WorldWideScience

Sample records for response element ggccgataacaaactccggcc

  1. The finite element response matrix method

    International Nuclear Information System (INIS)

    Nakata, H.; Martin, W.R.

    1983-02-01

    A new technique is developed with an alternative formulation of the response matrix method implemented with the finite element scheme. Two types of response matrices are generated from the Galerkin solution to the weak form of the diffusion equation subject to an arbitrary current and source. The piecewise polynomials are defined in two levels, the first for the local (assembly) calculations and the second for the global (core) response matrix calculations. This finite element response matrix technique was tested in two 2-dimensional test problems, 2D-IAEA benchmark problem and Biblis benchmark problem, with satisfatory results. The computational time, whereas the current code is not extensively optimized, is of the same order of the well estabilished coarse mesh codes. Furthermore, the application of the finite element technique in an alternative formulation of response matrix method permits the method to easily incorporate additional capabilities such as treatment of spatially dependent cross-sections, arbitrary geometrical configurations, and high heterogeneous assemblies. (Author) [pt

  2. Nuclear responses in INTOR plasma stabilization elements

    International Nuclear Information System (INIS)

    Gohar, Y.; Gilligan, J.; Jung, J.; Mattas, R.F.; Miley, G.H.; Wiffen, F.W.; Yang, S.

    1985-01-01

    Nuclear responses in the plasma stabilization elements were studied in a parametric fashion as a part of the transient electromagnetics critical issue C of ETR/INTOR activity. The main responses are neutron fluence and radiation dose in the insulator material, induced resistivity and atomic displacement in the conductor material, nuclear heating and life analysis for the elements. Copper and aluminum conductors with either MgAl 2 O 4 or MgO insulating material were investigated. Radiation damage and life analysis for these elements were also discussed

  3. The finite element response Matrix method

    International Nuclear Information System (INIS)

    Nakata, H.; Martin, W.R.

    1983-01-01

    A new method for global reactor core calculations is described. This method is based on a unique formulation of the response matrix method, implemented with a higher order finite element method. The unique aspects of this approach are twofold. First, there are two levels to the overall calculational scheme: the local or assembly level and the global or core level. Second, the response matrix scheme, which is formulated at both levels, consists of two separate response matrices rather than one response matrix as is generally the case. These separate response matrices are seen to be quite beneficial for the criticality eigenvalue calculation, because they are independent of k /SUB eff/. The response matrices are generated from a Galerkin finite element solution to the weak form of the diffusion equation, subject to an arbitrary incoming current and an arbitrary distributed source. Calculational results are reported for two test problems, the two-dimensional International Atomic Energy Agency benchmark problem and a two-dimensional pressurized water reactor test problem (Biblis reactor), and they compare well with standard coarse mesh methods with respect to accuracy and efficiency. Moreover, the accuracy (and capability) is comparable to fine mesh for a fraction of the computational cost. Extension of the method to treat heterogeneous assemblies and spatial depletion effects is discussed

  4. Organization of cis-acting regulatory elements in osmotic- and cold-stress-responsive promoters.

    Science.gov (United States)

    Yamaguchi-Shinozaki, Kazuko; Shinozaki, Kazuo

    2005-02-01

    cis-Acting regulatory elements are important molecular switches involved in the transcriptional regulation of a dynamic network of gene activities controlling various biological processes, including abiotic stress responses, hormone responses and developmental processes. In particular, understanding regulatory gene networks in stress response cascades depends on successful functional analyses of cis-acting elements. The ever-improving accuracy of transcriptome expression profiling has led to the identification of various combinations of cis-acting elements in the promoter regions of stress-inducible genes involved in stress and hormone responses. Here we discuss major cis-acting elements, such as the ABA-responsive element (ABRE) and the dehydration-responsive element/C-repeat (DRE/CRT), that are a vital part of ABA-dependent and ABA-independent gene expression in osmotic and cold stress responses.

  5. ACGT-containing abscisic acid response element (ABRE) and coupling element 3 (CE3) are functionally equivalent.

    Science.gov (United States)

    Hobo, T; Asada, M; Kowyama, Y; Hattori, T

    1999-09-01

    ACGT-containing ABA response elements (ABREs) have been functionally identified in the promoters of various genes. In addition, single copies of ABRE have been found to require a cis-acting, coupling element to achieve ABA induction. A coupling element 3 (CE3) sequence, originally identified as such in the barley HVA1 promoter, is found approximately 30 bp downstream of motif A (ACGT-containing ABRE) in the promoter of the Osem gene. The relationship between these two elements was further defined by linker-scan analyses of a 55 bp fragment of the Osem promoter, which is sufficient for ABA-responsiveness and VP1 activation. The analyses revealed that both motif A and CE3 sequence were required not only for ABA-responsiveness but also for VP1 activation. Since the sequences of motif A and CE3 were found to be similar, motif-exchange experiments were carried out. The experiments demonstrated that motif A and CE3 were interchangeable by each other with respect to both ABA and VP1 regulation. In addition, both sequences were shown to be recognized by a VP1-interacting, ABA-responsive bZIP factor TRAB1. These results indicate that ACGT-containing ABREs and CE3 are functionally equivalent cis-acting elements. Furthermore, TRAB1 was shown to bind two other non-ACGT ABREs. Based on these results, all these ABREs including CE3 are proposed to be categorized into a single class of cis-acting elements.

  6. Integrating Responsive Building Elements in Buildings

    DEFF Research Database (Denmark)

    Haase, Matthias; Amato, Alex; Heiselberg, Per

    2006-01-01

    energy strategies to develop guidelines and procedures for estimation of environmental performance of responsive building elements and integrated building concepts This paper introduces the ideas of this collaborative work and discusses its usefulness for Hong Kong and China. Special focus was put...

  7. Characteristic and analysis of structural elements of corporate social responsibility

    Directory of Open Access Journals (Sweden)

    J. S. Bilonog

    2015-04-01

    Full Text Available In this article attention is focused on social responsibility of business and on necessity to estimate its condition in Ukraine. Materials regarding elements and the principles of corporate social responsibility are structured. On this basis unification of quantitative elements of business social responsibility is offered according to which it is possible to carry out the analysis of the non­financial reporting. It is proposed to use not only quantitative techniques of data analysis but also refer to the qualitative ones. As a result of this, the analysis of social reports will be more productive and would minimize subjectivity of the researcher or representatives of the company which are responsible for presenting the information to the general public. The basic principles by which the companies can realize the strategy of corporate social responsibility are considered. Due to the empirical analysis of corporate reports expediency to use specified elements is proved. Reports of the companies in producing and non­productive sector are analyzed in more detail; features of displaying information on corporate social responsibility are defined. The attention to need of carrying out monitoring researches in the sphere of the corporate social reporting is updated.

  8. State-of-the-art Review : Vol. 2A. Responsive Building Elements

    DEFF Research Database (Denmark)

    Blümel, Ernst; Haghighat, Fariborz; Li, Yuguo

    This report resumes and presents the activity done in Subtask A of IEA-ECBCS Annex 44 “Integrating Environmentally Responsive Elements in Buildings” concerning the state of the art review of Responsive Building Elements. It is based on the contributions from the participating countries...... at researchers in the field and gives an overview of how these elements work together with available performance data. It is hoped, that this report will be helpful for researchers in their search for new solutions to the problem of designing and constructing sustainable buildings....

  9. Specificity determinants for the abscisic acid response element ?

    OpenAIRE

    Sarkar, Aditya Kumar; Lahiri, Ansuman

    2013-01-01

    Abscisic acid (ABA) response elements (ABREs) are a group of cis-acting DNA elements that have been identified from promoter analysis of many ABA-regulated genes in plants. We are interested in understanding the mechanism of binding specificity between ABREs and a class of bZIP transcription factors known as ABRE binding factors (ABFs). In this work, we have modeled the homodimeric structure of the bZIP domain of ABRE binding factor 1 from Arabidopsis thaliana (AtABF1) and studied its interac...

  10. 3-dimensional earthquake response analysis of embedded reactor building using hybrid model of boundary elements and finite elements

    International Nuclear Information System (INIS)

    Muto, K.; Motosaka, M.; Kamata, M.; Masuda, K.; Urao, K.; Mameda, T.

    1985-01-01

    In order to investigate the 3-dimensional earthquake response characteristics of an embedded structure with consideration for soil-structure interaction, the authors have developed an analytical method using 3-dimensional hybrid model of boundary elements (BEM) and finite elements (FEM) and have conducted a dynamic analysis of an actual nuclear reactor building. This paper describes a comparative study between two different embedment depths in soil as elastic half-space. As the results, it was found that the earthquake response intensity decreases with the increase of the embedment depth and that this method was confirmed to be effective for investigating the 3-D response characteristics of embedded structures such as deflection pattern of each floor level, floor response spectra in high frequency range. (orig.)

  11. Prediction of transcriptional regulatory elements for plant hormone responses based on microarray data

    Directory of Open Access Journals (Sweden)

    Yamaguchi-Shinozaki Kazuko

    2011-02-01

    Full Text Available Abstract Background Phytohormones organize plant development and environmental adaptation through cell-to-cell signal transduction, and their action involves transcriptional activation. Recent international efforts to establish and maintain public databases of Arabidopsis microarray data have enabled the utilization of this data in the analysis of various phytohormone responses, providing genome-wide identification of promoters targeted by phytohormones. Results We utilized such microarray data for prediction of cis-regulatory elements with an octamer-based approach. Our test prediction of a drought-responsive RD29A promoter with the aid of microarray data for response to drought, ABA and overexpression of DREB1A, a key regulator of cold and drought response, provided reasonable results that fit with the experimentally identified regulatory elements. With this succession, we expanded the prediction to various phytohormone responses, including those for abscisic acid, auxin, cytokinin, ethylene, brassinosteroid, jasmonic acid, and salicylic acid, as well as for hydrogen peroxide, drought and DREB1A overexpression. Totally 622 promoters that are activated by phytohormones were subjected to the prediction. In addition, we have assigned putative functions to 53 octamers of the Regulatory Element Group (REG that have been extracted as position-dependent cis-regulatory elements with the aid of their feature of preferential appearance in the promoter region. Conclusions Our prediction of Arabidopsis cis-regulatory elements for phytohormone responses provides guidance for experimental analysis of promoters to reveal the basis of the transcriptional network of phytohormone responses.

  12. A retinoic acid response element that overlaps an estrogen response element mediates multihormonal sensitivity in transcriptional activation of the lactoferrin gene.

    Science.gov (United States)

    Lee, M O; Liu, Y; Zhang, X K

    1995-08-01

    The lactoferrin gene is highly expressed in many different tissues, and its expression is controlled by different regulators. In this report, we have defined a retinoic acid response element (RARE) in the 5'-flanking region of the lactoferrin gene promoter. The lactoferrin-RARE is composed of two AGGTCA-like motifs arranged as a direct repeat with 1-bp spacing (DR-1). A gel retardation assay demonstrated that it bound strongly with retinoid X receptor (RXR) homodimers and RXR-retinoic acid receptor (RAR) heterodimers as well as chicken ovalbumin upstream promoter transcription factor (COUP-TF) orphan receptor. In CV-1 cells, the lactoferrin-RARE linked with a heterologous thymidine kinase promoter was strongly activated by RXR homodimers in response to 9-cis-retinoic acid (9-cis-RA) but not to all-trans-RA. When the COUP-TF orphan receptor was cotransfected, the 9-cis-RA-induced RXR homodimer activity was strongly repressed. A unique feature of the lactoferrin-RARE is that it has an AGGTCA-like motif in common with an estrogen-responsive element (ERE). The composite RARE/ERE contributes to the functional interaction between retinoid receptors and the estrogen receptor (ER) and their ligands. In CV-1 cells, cotransfection of the retinoid and estrogen receptors led to mutual inhibition of the other's activity, while an RA-dependent inhibition of ER activity was observed in breast cancer cells. Furthermore, the lactoferrin-RARE/ERE showed differential transactivation activity in different cell types. RAs could activate the lactoferrin-RARE/ERE in human leukemia HL-60 cells and U937 cells but not in human breast cancer cells. By gel retardation analyses, we demonstrated that strong binding of the endogenous COUP-TF in breast cancer cells to the composite element contributed to diminished RA response in these cells. Thus, the lactoferrin-RARE/ERE functions as a signaling switch module that mediates multihormonal responsiveness in the regulation of lactoferrin gene

  13. Spectral response of multi-element silicon detectors

    Energy Technology Data Exchange (ETDEWEB)

    Ludewigt, B.A.; Rossington, C.S.; Chapman, K. [Univ. of California, Berkeley, CA (United States)

    1997-04-01

    Multi-element silicon strip detectors, in conjunction with integrated circuit pulse-processing electronics, offer an attractive alternative to conventional lithium-drifted silicon Si(Li) and high purity germanium detectors (HPGe) for high count rate, low noise synchrotron x-ray fluorescence applications. One of the major differences between the segmented Si detectors and the commercially available single-element Si(Li) or HPGe detectors is that hundreds of elements can be fabricated on a single Si substrate using standard silicon processing technologies. The segmentation of the detector substrate into many small elements results in very low noise performance at or near, room temperature, and the count rate of the detector is increased many-fold due to the multiplication in the total number of detectors. Traditionally, a single channel of detector with electronics can handle {approximately}100 kHz count rates while maintaining good energy resolution; the segmented detectors can operate at greater than MHz count rates merely due to the multiplication in the number of channels. One of the most critical aspects in the development of the segmented detectors is characterizing the charge sharing and charge loss that occur between the individual detector strips, and determining how these affect the spectral response of the detectors.

  14. Elements of a national emergency response system for nuclear accidents

    International Nuclear Information System (INIS)

    Dickerson, M.H.

    1987-01-01

    The purpose of this paper is to suggest elements for a general emergency response system, employed at a national level, to detect, evaluate and assess the consequences of a radiological atmospheric release occurring within or outside of national boundaries. These elements are focused on the total aspect of emergency response ranging from providing an initial alarm to a total assessment of the environmental and health effects. Elements of the emergency response system are described in such a way that existing resources can be directly applied if appropriate; if not, newly developed or an expansion of existing resources can be employed. The major thrust of this paper is toward a philosophical discussion and general description of resources that would be required to implementation. If the major features of this proposal system are judged desirable for implementation, then the next level of detail can be added. The philosophy underlying this paper is preparedness - preparedness through planning, awareness and the application of technology. More specifically, it is establishment of reasonable guidelines including the definition of reference and protective action levels for public exposure to accidents involving nuclear material; education of the public, government officials and the news media; and the application of models and measurements coupled to computer systems to address a series of questions related to emergency planning, response and assessment. It is the role of a proven national emergency response system to provide reliable, quality-controlled information to decision makers for the management of environmental crises

  15. ABFs, a family of ABA-responsive element binding factors.

    Science.gov (United States)

    Choi, H; Hong, J; Ha, J; Kang, J; Kim, S Y

    2000-01-21

    Abscisic acid (ABA) plays an important role in environmental stress responses of higher plants during vegetative growth. One of the ABA-mediated responses is the induced expression of a large number of genes, which is mediated by cis-regulatory elements known as abscisic acid-responsive elements (ABREs). Although a number of ABRE binding transcription factors have been known, they are not specifically from vegetative tissues under induced conditions. Considering the tissue specificity of ABA signaling pathways, factors mediating ABA-dependent stress responses during vegetative growth phase may thus have been unidentified so far. Here, we report a family of ABRE binding factors isolated from young Arabidopsis plants under stress conditions. The factors, isolated by a yeast one-hybrid system using a prototypical ABRE and named as ABFs (ABRE binding factors) belong to a distinct subfamily of bZIP proteins. Binding site selection assay performed with one ABF showed that its preferred binding site is the strong ABRE, CACGTGGC. ABFs can transactivate an ABRE-containing reporter gene in yeast. Expression of ABFs is induced by ABA and various stress treatments, whereas their induction patterns are different from one another. Thus, a new family of ABRE binding factors indeed exists that have the potential to activate a large number of ABA/stress-responsive genes in Arabidopsis.

  16. Effect of Large Negative Phase of Blast Loading on Structural Response of RC Elements

    Directory of Open Access Journals (Sweden)

    Syed Zubair Iman

    2016-01-01

    Full Text Available Structural response of reinforced concrete (RC elements for analysis and design are often obtained using the positive phase of the blast pressure curve disregarding the negative phase assuming insignificant contribution from the negative phase of the loading. Although, some insight on the effect of negative phase of blast pressure based on elastic single-degree-of-freedom (SDOF analysis was presented before, the influence of negative phase on different types of resistance functions of SDOF models and on realistic finite element analysis has not been explored. In this study, the effects of inclusion of pulse negative phase on structural response of RC elements from SDOF analysis and from more detailed finite element analysis have been investigated. Investigation of SDOF part has been conducted using MATLAB code that utilizes non-linear resistance functions of SDOF model. Detailed numerical investigation using finite element code DIANA was conducted on the significance of the negative phase on structural response. In the FE model, different support stiffness was used to explore the effect of support stiffness on the structural response due to blast negative phase. Results from SDOF and FE analyses present specific situations where the effect of large negative phase was found to be significant on the structural response of RC elements.

  17. 33 CFR Appendix C to Part 155 - Training Elements for Oil Spill Response Plans

    Science.gov (United States)

    2010-07-01

    .... 155, App. C Appendix C to Part 155—Training Elements for Oil Spill Response Plans 1. General 1.1The portion of the plan dealing with training is one of the key elements of a response plan. This concept is... included training as one of the sections required in a vessel or facility response plan. In reviewing...

  18. Assessment of hypoxia and TNF-alpha response by a vector with HRE and NF-kappaB response elements.

    Science.gov (United States)

    Chen, Zhilin; Eadie, Ashley L; Hall, Sean R; Ballantyne, Laurel; Ademidun, David; Tse, M Yat; Pang, Stephen C; Melo, Luis G; Ward, Christopher A; Brunt, Keith R

    2017-01-01

    Hypoxia and inflammatory cytokine activation (H&I) are common processes in many acute and chronic diseases. Thus, a single vector that responds to both hypoxia and inflammatory cytokines, such as TNF-alpha, is useful for assesing the severity of such diseases. Adaptation to hypoxia is regulated primarily by hypoxia inducible transcription factor (HIF alpha) nuclear proteins that engage genes containing a hypoxia response element (HRE). Inflammation activates a multitude of cytokines, including TNF-alpha, that invariably modulate activation of the nuclear factor kappa B (NF-kB) transcription factor. We constructed a vector that encompassed both a hypoxia response element (HRE), and a NF-kappaB responsive element. We show that this vector was functionally responsive to both hypoxia and TNF-alpha, in vitro and in vivo . Thus, this vector might be suitable for the detection and assessment of hypoxia or TNF-alpha.

  19. Hormone response element binding proteins: novel regulators of vitamin D and estrogen signaling.

    Science.gov (United States)

    Lisse, Thomas S; Hewison, Martin; Adams, John S

    2011-03-01

    Insights from vitamin D-resistant New World primates and their human homologues as models of natural and pathological insensitivity to sterol/steroid action have uncovered a family of novel intracellular vitamin D and estrogen regulatory proteins involved in hormone action. The proteins, known as "vitamin D or estrogen response element-binding proteins", behave as potent cis-acting, transdominant regulators to inhibit steroid receptor binding to DNA response elements and is responsible for vitamin D and estrogen resistances. This set of interactors belongs to the heterogeneous nuclear ribonucleoprotein (hnRNP) family of previously known pre-mRNA-interacting proteins. This review provides new insights into the mechanism by which these novel regulators of signaling and metabolism can act to regulate responses to vitamin D and estrogen. In addition the review also describes other molecules that are known to influence nuclear receptor signaling through interaction with hormone response elements. Copyright © 2011 Elsevier Inc. All rights reserved.

  20. Functional analysis of the stress response element and its role in the multistress response of Saccharomyces cerevisiae.

    Science.gov (United States)

    Treger, J M; Magee, T R; McEntee, K

    1998-02-04

    The DDR2 gene of Saccharomyces cerevisiae is a multistress response gene whose transcription is rapidly and strongly induced by a diverse array of xenobiotic agents, and environmental and physiological conditions. The multistress response of this gene requires the pentanucleotide, 5' CCCCT, (C4T;STRE (STress Response Element)) and the zinc-finger transcription factors, Msn2p and Msn4p. A 51bp oligonucleotide (oligo 31/32) containing two STREs from the DDR2 promoter region was previously shown to direct heat shock activation of a lacZ reporter gene. In this work we demonstrate that the same element conferred a complete multistress response to an E. coli galK reporter gene introduced into yeast cells. A variant oligonucleotide in which both the STRE spacing and neighboring sequences were altered responded to the same spectrum of stresses, while substitution of nucleotides within the pentanucleotide completely abolished the multistress response. These results directly demonstrate that STREs are not only necessary but are sufficient for mediating a transcriptional response to a surprisingly diverse set of environmental and physiological conditions.

  1. 33 CFR Appendix D to Part 154 - Training Elements for Oil Spill Response Plans

    Science.gov (United States)

    2010-07-01

    ... Appendix D to Part 154—Training Elements for Oil Spill Response Plans 1. General 1.1The portion of the plan dealing with training is one of the key elements of a response plan. This concept is clearly expressed by... that the plans often do not provide sufficient information in the training section of the plan for...

  2. Antioxidant response elements: Discovery, classes, regulation and potential applications

    Directory of Open Access Journals (Sweden)

    Azhwar Raghunath

    2018-07-01

    Full Text Available Exposure to antioxidants and xenobiotics triggers the expression of a myriad of genes encoding antioxidant proteins, detoxifying enzymes, and xenobiotic transporters to offer protection against oxidative stress. This articulated universal mechanism is regulated through the cis-acting elements in an array of Nrf2 target genes called antioxidant response elements (AREs, which play a critical role in redox homeostasis. Though the Keap1/Nrf2/ARE system involves many players, AREs hold the key in transcriptional regulation of cytoprotective genes. ARE-mediated reporter constructs have been widely used, including xenobiotics profiling and Nrf2 activator screening. The complexity of AREs is brought by the presence of other regulatory elements within the AREs. The diversity in the ARE sequences not only bring regulatory selectivity of diverse transcription factors, but also confer functional complexity in the Keap1/Nrf2/ARE pathway. The different transcription factors either homodimerize or heterodimerize to bind the AREs. Depending on the nature of partners, they may activate or suppress the transcription. Attention is required for deeper mechanistic understanding of ARE-mediated gene regulation. The computational methods of identification and analysis of AREs are still in their infancy. Investigations are required to know whether epigenetics mechanism plays a role in the regulation of genes mediated through AREs. The polymorphisms in the AREs leading to oxidative stress related diseases are warranted. A thorough understanding of AREs will pave the way for the development of therapeutic agents against cancer, neurodegenerative, cardiovascular, metabolic and other diseases with oxidative stress. Keywords: Antioxidant response elements, Antioxidant genes, ARE-reporter constructs, ARE SNPs, Keap1/Nrf2/ARE pathway, Oxidative stress

  3. Molecular analysis of UAS(E), a cis element containing stress response elements responsible for ethanol induction of the KlADH4 gene of Kluyveromyces lactis.

    Science.gov (United States)

    Mazzoni, C; Santori, F; Saliola, M; Falcone, C

    2000-01-01

    KlADH4 is a gene of Kluyveromyces lactis encoding a mitochondrial alcohol dehydrogenase activity, which is specifically induced by ethanol and insensitive to glucose repression. In this work, we report the molecular analysis of UAS(E), an element of the KlADH4 promoter which is essential for the induction of KlADH4 in the presence of ethanol. UAS(E) contains five stress response elements (STREs), which have been found in many genes of Saccharomyces cerevisiae involved in the response of cells to conditions of stress. Whereas KlADH4 is not responsive to stress conditions, the STREs present in UAS(E) seem to play a key role in the induction of the gene by ethanol, a situation that has not been observed in the related yeast S. cerevisiae. Gel retardation experiments showed that STREs in the KlADH4 promoter can bind factor(s) under non-inducing conditions. Moreover, we observed that the RAP1 binding site present in UAS(E) binds KlRap1p.

  4. Finite element simulation of impact response of wire mesh screens

    Directory of Open Access Journals (Sweden)

    Wang Caizheng

    2015-01-01

    Full Text Available In this paper, the response of wire mesh screens to low velocity impact with blunt objects is investigated using finite element (FE simulation. The woven wire mesh is modelled with homogeneous shell elements with equivalent smeared mechanical properties. The mechanical behaviour of the woven wire mesh was determined experimentally with tensile tests on steel wire mesh coupons to generate the data for the smeared shell material used in the FE. The effects of impacts with a low mass (4 kg and a large mass (40 kg providing the same impact energy are studied. The joint between the wire mesh screen and the aluminium frame surrounding it is modelled using contact elements with friction between the corresponding elements. Damage to the screen of different types compromising its structural integrity, such as mesh separation and pulling out from the surrounding frame is modelled. The FE simulation is validated with results of impact tests conducted on woven steel wire screen meshes.

  5. Altered response hierarchy and increased T-cell breadth upon HIV-1 conserved element DNA vaccination in macaques.

    Directory of Open Access Journals (Sweden)

    Viraj Kulkarni

    Full Text Available HIV sequence diversity and potential decoy epitopes are hurdles in the development of an effective AIDS vaccine. A DNA vaccine candidate comprising of highly conserved p24(gag elements (CE induced robust immunity in all 10 vaccinated macaques, whereas full-length gag DNA vaccination elicited responses to these conserved elements in only 5 of 11 animals, targeting fewer CE per animal. Importantly, boosting CE-primed macaques with DNA expressing full-length p55(gag increased both magnitude of CE responses and breadth of Gag immunity, demonstrating alteration of the hierarchy of epitope recognition in the presence of pre-existing CE-specific responses. Inclusion of a conserved element immunogen provides a novel and effective strategy to broaden responses against highly diverse pathogens by avoiding decoy epitopes, while focusing responses to critical viral elements for which few escape pathways exist.

  6. Regulatory elements in vivo in the promoter of the abscisic acid responsive gene rab17 from maize.

    Science.gov (United States)

    Busk, P K; Jensen, A B; Pagès, M

    1997-06-01

    The rab17 gene from maize is transcribed in late embryonic development and is responsive to abscisic acid and water stress in embryo and vegetative tissues. In vivo footprinting and transient transformation of rab17 were performed in embryos and vegetative tissues to characterize the cis-elements involved in regulation of the gene. By in vivo footprinting, protein binding was observed to nine elements in the promoter, which correspond to five putative ABREs (abscisic acid responsive elements) and four other sequences. The footprints indicated that distinct proteins interact with these elements in the two developmental stages. In transient transformation, six of the elements were important for high level expression of the rab17 promoter in embryos, whereas only three elements were important in leaves. The cis-acting sequences can be divided in embryo-specific, ABA-specific and leaf-specific elements on the basis of protein binding and the ability to confer expression of rab17. We found one positive, new element, called GRA, with the sequence CACTGGCCGCCC. This element was important for transcription in leaves but not in embryos. Two other non-ABRE elements that stimulated transcription from the rab17 promoter resemble previously described abscisic acid and drought-inducible elements. There were differences in protein binding and function of the five ABREs in the rab17 promoter. The possible reasons for these differences are discussed. The in vivo data obtained suggest that an embryo-specific pathway regulates transcription of the rab genes during development, whereas another pathway is responsible for induction in response to ABA and drought in vegetative tissues.

  7. A retinoic acid response element that overlaps an estrogen response element mediates multihormonal sensitivity in transcriptional activation of the lactoferrin gene.

    OpenAIRE

    Lee, M O; Liu, Y; Zhang, X K

    1995-01-01

    The lactoferrin gene is highly expressed in many different tissues, and its expression is controlled by different regulators. In this report, we have defined a retinoic acid response element (RARE) in the 5'-flanking region of the lactoferrin gene promoter. The lactoferrin-RARE is composed of two AGGTCA-like motifs arranged as a direct repeat with 1-bp spacing (DR-1). A gel retardation assay demonstrated that it bound strongly with retinoid X receptor (RXR) homodimers and RXR-retinoic acid re...

  8. Specificity determinants for the abscisic acid response element.

    Science.gov (United States)

    Sarkar, Aditya Kumar; Lahiri, Ansuman

    2013-01-01

    Abscisic acid (ABA) response elements (ABREs) are a group of cis-acting DNA elements that have been identified from promoter analysis of many ABA-regulated genes in plants. We are interested in understanding the mechanism of binding specificity between ABREs and a class of bZIP transcription factors known as ABRE binding factors (ABFs). In this work, we have modeled the homodimeric structure of the bZIP domain of ABRE binding factor 1 from Arabidopsis thaliana (AtABF1) and studied its interaction with ACGT core motif-containing ABRE sequences. We have also examined the variation in the stability of the protein-DNA complex upon mutating ABRE sequences using the protein design algorithm FoldX. The high throughput free energy calculations successfully predicted the ability of ABF1 to bind to alternative core motifs like GCGT or AAGT and also rationalized the role of the flanking sequences in determining the specificity of the protein-DNA interaction.

  9. 1ST-ORDER NONADIABATIC COUPLING MATRIX-ELEMENTS FROM MULTICONFIGURATIONAL SELF-CONSISTENT-FIELD RESPONSE THEORY

    DEFF Research Database (Denmark)

    Bak, Keld L.; Jørgensen, Poul; Jensen, H.J.A.

    1992-01-01

    A new scheme for obtaining first-order nonadiabatic coupling matrix elements (FO-NACME) for multiconfigurational self-consistent-field (MCSCF) wave functions is presented. The FO-NACME are evaluated from residues of linear response functions. The residues involve the geometrical response of a ref......A new scheme for obtaining first-order nonadiabatic coupling matrix elements (FO-NACME) for multiconfigurational self-consistent-field (MCSCF) wave functions is presented. The FO-NACME are evaluated from residues of linear response functions. The residues involve the geometrical response...... to the full configuration interaction limit. Comparisons are made with state-averaged MCSCF results for MgH2 and finite-difference configuration interaction by perturbation with multiconfigurational zeroth-order wave function reflected by interactive process (CIPSI) results for BH....

  10. Seismic response of three-dimensional rockfill dams using the Indirect Boundary Element Method

    International Nuclear Information System (INIS)

    Sanchez-Sesma, Francisco J; Arellano-Guzman, Mauricio; Perez-Gavilan, Juan J; Suarez, Martha; Marengo-Mogollon, Humberto; Chaillat, Stephanie; Jaramillo, Juan Diego; Gomez, Juan; Iturraran-Viveros, Ursula; Rodriguez-Castellanos, Alejandro

    2010-01-01

    The Indirect Boundary Element Method (IBEM) is used to compute the seismic response of a three-dimensional rockfill dam model. The IBEM is based on a single layer integral representation of elastic fields in terms of the full-space Green function, or fundamental solution of the equations of dynamic elasticity, and the associated force densities along the boundaries. The method has been applied to simulate the ground motion in several configurations of surface geology. Moreover, the IBEM has been used as benchmark to test other procedures. We compute the seismic response of a three-dimensional rockfill dam model placed within a canyon that constitutes an irregularity on the surface of an elastic half-space. The rockfill is also assumed elastic with hysteretic damping to account for energy dissipation. Various types of incident waves are considered to analyze the physical characteristics of the response: symmetries, amplifications, impulse response and the like. Computations are performed in the frequency domain and lead to time response using Fourier analysis. In the present implementation a symmetrical model is used to test symmetries. The boundaries of each region are discretized into boundary elements whose size depends on the shortest wavelength, typically, six boundary segments per wavelength. Usually, the seismic response of rockfill dams is simulated using either finite elements (FEM) or finite differences (FDM). In most applications, commercial tools that combine features of these methods are used to assess the seismic response of the system for a given motion at the base of model. However, in order to consider realistic excitation of seismic waves with different incidence angles and azimuth we explore the IBEM.

  11. An approach to unfold the response of a multi-element system using an artificial neural network

    International Nuclear Information System (INIS)

    Cordes, E.; Fehrenbacher, G.; Schuetz, R.; Sprunck, M.; Hahn, K.; Hofmann, R.; Wahl, W.

    1998-01-01

    An unfolding procedure is proposed which aims at obtaining spectral information of a neutron radiation field by the analysis of the response of a multi-element system consisting of converter type semiconductors. For the unfolding procedure an artificial neural network (feed forward network), trained by the back-propagation method, was used. The response functions of the single elements to neutron radiation were calculated by application of a computational model for an energy range from 10 -2 eV to 10 MeV. The training of the artificial neural network was based on the computation of responses of a six-element system for a set of 300 neutron spectra and the application of the back-propagation method. The validation was performed by the unfolding of 100 computed responses. Two unfolding examples were pointed out for the determination of the neutron spectra. The spectra resulting from the unfolding procedure agree well with the original spectra used for the response computation

  12. Transcriptomic analysis of rice aleurone cells identified a novel abscisic acid response element.

    Science.gov (United States)

    Watanabe, Kenneth A; Homayouni, Arielle; Gu, Lingkun; Huang, Kuan-Ying; Ho, Tuan-Hua David; Shen, Qingxi J

    2017-09-01

    Seeds serve as a great model to study plant responses to drought stress, which is largely mediated by abscisic acid (ABA). The ABA responsive element (ABRE) is a key cis-regulatory element in ABA signalling. However, its consensus sequence (ACGTG(G/T)C) is present in the promoters of only about 40% of ABA-induced genes in rice aleurone cells, suggesting other ABREs may exist. To identify novel ABREs, RNA sequencing was performed on aleurone cells of rice seeds treated with 20 μM ABA. Gibbs sampling was used to identify enriched elements, and particle bombardment-mediated transient expression studies were performed to verify the function. Gene ontology analysis was performed to predict the roles of genes containing the novel ABREs. This study revealed 2443 ABA-inducible genes and a novel ABRE, designated as ABREN, which was experimentally verified to mediate ABA signalling in rice aleurone cells. Many of the ABREN-containing genes are predicted to be involved in stress responses and transcription. Analysis of other species suggests that the ABREN may be monocot specific. This study also revealed interesting expression patterns of genes involved in ABA metabolism and signalling. Collectively, this study advanced our understanding of diverse cis-regulatory sequences and the transcriptomes underlying ABA responses in rice aleurone cells. © 2017 John Wiley & Sons Ltd.

  13. Integrating Environmentally Responsive Elements in Buildings

    DEFF Research Database (Denmark)

    Heiselberg, Per

    2006-01-01

    Significant improvement have been achieved on efficiency improvements of specific building elements like the building envelope and building equipment and services and whilst most building elements still offer opportunities for efficiency improvements, the greatest future potential lie with techno......Significant improvement have been achieved on efficiency improvements of specific building elements like the building envelope and building equipment and services and whilst most building elements still offer opportunities for efficiency improvements, the greatest future potential lie...

  14. DNA demethylases target promoter transposable elements to positively regulate stress responsive genes in Arabidopsis.

    Science.gov (United States)

    Le, Tuan-Ngoc; Schumann, Ulrike; Smith, Neil A; Tiwari, Sameer; Au, Phil Chi Khang; Zhu, Qian-Hao; Taylor, Jennifer M; Kazan, Kemal; Llewellyn, Danny J; Zhang, Ren; Dennis, Elizabeth S; Wang, Ming-Bo

    2014-09-17

    DNA demethylases regulate DNA methylation levels in eukaryotes. Arabidopsis encodes four DNA demethylases, DEMETER (DME), REPRESSOR OF SILENCING 1 (ROS1), DEMETER-LIKE 2 (DML2), and DML3. While DME is involved in maternal specific gene expression during seed development, the biological function of the remaining DNA demethylases remains unclear. We show that ROS1, DML2, and DML3 play a role in fungal disease resistance in Arabidopsis. A triple DNA demethylase mutant, rdd (ros1 dml2 dml3), shows increased susceptibility to the fungal pathogen Fusarium oxysporum. We identify 348 genes differentially expressed in rdd relative to wild type, and a significant proportion of these genes are downregulated in rdd and have functions in stress response, suggesting that DNA demethylases maintain or positively regulate the expression of stress response genes required for F. oxysporum resistance. The rdd-downregulated stress response genes are enriched for short transposable element sequences in their promoters. Many of these transposable elements and their surrounding sequences show localized DNA methylation changes in rdd, and a general reduction in CHH methylation, suggesting that RNA-directed DNA methylation (RdDM), responsible for CHH methylation, may participate in DNA demethylase-mediated regulation of stress response genes. Many of the rdd-downregulated stress response genes are downregulated in the RdDM mutants nrpd1 and nrpe1, and the RdDM mutants nrpe1 and ago4 show enhanced susceptibility to F. oxysporum infection. Our results suggest that a primary function of DNA demethylases in plants is to regulate the expression of stress response genes by targeting promoter transposable element sequences.

  15. The effect of loading time on flexible pavement dynamic response: a finite element analysis

    Science.gov (United States)

    Yin, Hao; Solaimanian, Mansour; Kumar, Tanmay; Stoffels, Shelley

    2007-12-01

    Dynamic response of asphalt concrete (AC) pavements under moving load is a key component for accurate prediction of flexible pavement performance. The time and temperature dependency of AC materials calls for utilizing advanced material characterization and mechanistic theories, such as viscoelasticity and stress/strain analysis. In layered elastic analysis, as implemented in the new Mechanistic-Empirical Pavement Design Guide (MEPDG), the time dependency is accounted for by calculating the loading times at different AC layer depths. In this study, the time effect on pavement response was evaluated by means of the concept of “pseudo temperature.” With the pavement temperature measured from instrumented thermocouples, the time and temperature dependency of AC materials was integrated into one single factor, termed “effective temperature.” Via this effective temperature, pavement responses under a transient load were predicted through finite element analysis. In the finite element model, viscoelastic behavior of AC materials was characterized through relaxation moduli, while the layers with unbound granular material were assumed to be in an elastic mode. The analysis was conducted for two different AC mixtures in a simplified flexible pavement structure at two different seasons. Finite element analysis results reveal that the loading time has a more pronounced impact on pavement response in the summer for both asphalt types. The results indicate that for reasonable prediction of dynamic response in flexible pavements, the effect of the depth-dependent loading time on pavement temperature should be considered.

  16. Identification of a peroxisome proliferator responsive element (PPRE)-like cis-element in mouse plasminogen activator inhibitor-1 gene promoter

    International Nuclear Information System (INIS)

    Chen Jiegen; Li Xi; Huang Haiyan; Liu Honglei; Liu Deguo; Song Tanjing; Ma Chungu; Ma Duan; Song Houyan; Tang Qiqun

    2006-01-01

    PAI-1 is expressed and secreted by adipose tissue which may mediate the pathogenesis of obesity-associated cardiovascular complications. Evidence is presented in this report that PAI-1 is not expressed by preadipocyte, but significantly induced during 3T3-L1 adipocyte differentiation and the PAI-1 expression correlates with the induction of peroxisome proliferator-activated receptor γ (PPARγ). A peroxisome proliferator responsive element (PPRE)-like cis-element (-206TCCCCCATGCCCT-194) is identified in the mouse PAI-1 gene promoter by electrophoretic mobility shift assay (EMSA) combined with transient transfection experiments; the PPRE-like cis-element forms a specific DNA-protein complex only with adipocyte nuclear extracts, not with preadipocyte nuclear extracts; the DNA-protein complex can be totally competed away by non-labeled consensus PPRE, and can be supershifted with PPARγ antibody. Mutation of this PPRE-like cis-element can abolish the transactivation of mouse PAI-1 promoter mediated by PPARγ. Specific PPARγ ligand Pioglitazone can significantly induce the PAI-1 expression, and stimulate the secretion of PAI-1 into medium

  17. Analysis of Resonance Response Performance of C-Band Antenna Using Parasitic Element

    Science.gov (United States)

    Islam, M. T.; Misran, N.; Mandeep, J. S.

    2014-01-01

    Analysis of the resonance response improvement of a planar C-band (4–8 GHz) antenna is proposed using parasitic element method. This parasitic element based method is validated for change in the active and parasitic antenna elements. A novel dual-band antenna for C-band application covering 5.7 GHz and 7.6 GHz is designed and fabricated. The antenna is composed of circular parasitic element with unequal microstrip lines at both sides and a rectangular partial ground plane. A fractional bandwidth of 13.5% has been achieved from 5.5 GHz to 6.3 GHz (WLAN band) for the lower band. The upper band covers from 7.1 GHz to 8 GHz with a fractional bandwidth of 12%. A gain of 6.4 dBi is achieved at the lower frequency and 4 dBi is achieved at the upper frequency. The VSWR of the antenna is less than 2 at the resonance frequency. PMID:24895643

  18. Application of ADINA fluid element for transient response analysis of fluid-structure system

    International Nuclear Information System (INIS)

    Sakurai, Y.; Kodama, T.; Shiraishi, T.

    1985-01-01

    Pressure propagation and Fluid-Structure Interaction (FSI) in 3D space were simulated by general purpose finite element program ADINA using the displacement-based fluid element which presumes inviscid and compressible fluid with no net flow. Numerical transient solution was compared with the measured data of an FSI experiment and was found to fairly agree with the measured. In the next step, post analysis was conducted for a blowdown experiment performed with a 1/7 scaled reactor pressure vessel and a flexible core barrel and the code performance was found to be satisfactory. It is concluded that the transient response of the core internal structure of a PWR during the initial stage of LOCA can be analyzed by the displacement-based finite fluid element and the structural element. (orig.)

  19. Development of a Rapidly Deployed Department of Energy Emergency Response Element

    International Nuclear Information System (INIS)

    Riland, C.A.; Hopkins, R.C.; Tighe, R.J.

    1999-01-01

    The Federal Radiological Emergency Response Plan (FRERP) directs the Department of Energy (DOE) to maintain a viable, timely, and fully documented response option capable of supporting the responsible Lead Federal Agency in the event of a radiological emergency impacting any state or US territory (e.g., CONUS). In addition, the DOE maintains a response option to support radiological emergencies outside the continental US (OCONUS). While the OCUNUS mission is not governed by the FREP, this response is operationally similar to that assigned to the DOE by the FREP. The DOE is prepared to alert, activate, and deploy radiological response teams to augment the Radiological Assistance Program and/or local responders. The Radiological Monitoring and Assessment Center (RMAC) is a phased response that integrates with the Federal Radiological Monitoring and Assessment Center (FRMAC) in CONUS environments and represents a stand-alone DOE response for OCONUS environments. The FRMAC/RMAC Phase I was formally ''stood up'' as an operational element in April 1999. The FRMAC/RMAC Phase II proposed ''stand-up'' date is midyear 2000

  20. Frequency response analysis of cylindrical shells conveying fluid using finite element method

    International Nuclear Information System (INIS)

    Seo, Young Soo; Jeong, Weui Bong; Yoo, Wan Suk; Jeong, Ho Kyeong

    2005-01-01

    A finite element vibration analysis of thin-walled cylindrical shells conveying fluid with uniform velocity is presented. The dynamic behavior of thin-walled shell is based on the Sanders' theory and the fluid in cylindrical shell is considered as inviscid and incompressible so that it satisfies the Laplace's equation. A beam-like shell element is used to reduce the number of degree-of-freedom by restricting to the circumferential modes of cylindrical shell. An estimation of frequency response function of the pipe considering of the coupled effects of the internal fluid is presented. A dynamic coupling condition of the interface between the fluid and the structure is used. The effective thickness of fluid according to circumferential modes is also discussed. The influence of fluid velocity on the frequency response function is illustrated and discussed. The results by this method are compared with published results and those by commercial tools

  1. Prediction of elastic-plastic response of structural elements subjected to cyclic loading

    International Nuclear Information System (INIS)

    El Haddad, M.H.; Samaan, S.

    1985-01-01

    A simplified elastic-plastic analysis is developed to predict stress strain and force deformation response of structural metallic elements subjected to irregular cyclic loadings. In this analysis a simple elastic-plastic method for predicting the skeleton force deformation curve is developed. In this method, elastic and fully plastic solutions are first obtained for unknown quantities, such as deflection or local strains. Elastic and fully plastic contributions are then combined to obtain an elastic-plastic solution. The skeleton curve is doubled to establish the shape of the hysteresis loop. The complete force deformation response can therefore be simulated through reversal by reversal in accordance with hysteresis looping and material memory. Several examples of structural elements with various cross sections made from various materials and subjected to irregular cyclic loadings, are analysed. A close agreement is obtained between experimental results found in the literature and present predictions. (orig.)

  2. Characterization of an estrogen-responsive element implicated in regulation of the rainbow trout estrogen receptor gene.

    Science.gov (United States)

    Le Dréan, Y; Lazennec, G; Kern, L; Saligaut, D; Pakdel, F; Valotaire, Y

    1995-08-01

    We previously reported that the expression of the rainbow trout estrogen receptor (rtER) gene is markedly increased by estradiol (E2). In this paper, we have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyl transferase (CAT), linked to 5' flanking regions of the rtER gene promoter, to identify cis-elements responsible for E2 inducibility. Deletion analysis localized an estrogen-responsive element (ERE), at position +242, with one mutation on the first base compared with the consensus sequence. This element confers estrogen responsiveness to CAT reporter linked to both the herpes simplex virus thymidine kinase promoter and the homologous rtER promoter. Moreover, using a 0.2 kb fragment of the rtER promoter encompassing the ERE and the rtER DNA binding domain obtained from a bacterial expression system, DNase I footprinting experiments demonstrated a specific protection covering 20 bp (+240/+260) containing the ERE sequence. Based on these studies, we believe that this ERE sequence, identified in the rtER gene promoter, may be a major cis-acting element involved in the regulation of the gene by estrogen.

  3. Effects of segregation of primary alloying elements on the creep response in magnesium alloys

    DEFF Research Database (Denmark)

    Huang, Y.D.; Dieringa, H.; Hort, N.

    2008-01-01

    The segregation of primary alloying elements deteriorates the high temperature creep resistance of magnesium alloys. Annealing at high temperatures alleviating their segregations can improve the creep resistance. Present investigation on the effect of segregation of primary alloying elements...... on the creep response may provide some useful information about how to improve the creep resistance of magnesium alloys in the future. (c) 2008 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved....

  4. Revisiting the Relationship between Transposable Elements and the Eukaryotic Stress Response.

    Science.gov (United States)

    Horváth, Vivien; Merenciano, Miriam; González, Josefa

    2017-11-01

    A relationship between transposable elements (TEs) and the eukaryotic stress response was suggested in the first publications describing TEs. Since then, it has often been assumed that TEs are activated by stress, and that this activation is often beneficial for the organism. In recent years, the availability of new high-throughput experimental techniques has allowed further interrogation of the relationship between TEs and stress. By reviewing the recent literature, we conclude that although there is evidence for a beneficial effect of TE activation under stress conditions, the relationship between TEs and the eukaryotic stress response is quite complex. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Meta-analysis of the effect of overexpression of C-repeat/dehydration-responsive element binding family genes on temperature stress tolerance and related responses

    Science.gov (United States)

    C-repeat/dehydration-responsive element binding proteins are transcription factors that play a critical role in plant response to temperature stress. Over-expression of CBF/DREB genes has been demonstrated to enhance temperature stress tolerance. A series of physiological and biochemical modificat...

  6. Implementation of structural response sensitivity calculations in a large-scale finite-element analysis system

    Science.gov (United States)

    Giles, G. L.; Rogers, J. L., Jr.

    1982-01-01

    The implementation includes a generalized method for specifying element cross-sectional dimensions as design variables that can be used in analytically calculating derivatives of output quantities from static stress, vibration, and buckling analyses for both membrane and bending elements. Limited sample results for static displacements and stresses are presented to indicate the advantages of analytically calclating response derivatives compared to finite difference methods. Continuing developments to implement these procedures into an enhanced version of the system are also discussed.

  7. Antioxidant response elements: Discovery, classes, regulation and potential applications.

    Science.gov (United States)

    Raghunath, Azhwar; Sundarraj, Kiruthika; Nagarajan, Raju; Arfuso, Frank; Bian, Jinsong; Kumar, Alan P; Sethi, Gautam; Perumal, Ekambaram

    2018-07-01

    Exposure to antioxidants and xenobiotics triggers the expression of a myriad of genes encoding antioxidant proteins, detoxifying enzymes, and xenobiotic transporters to offer protection against oxidative stress. This articulated universal mechanism is regulated through the cis-acting elements in an array of Nrf2 target genes called antioxidant response elements (AREs), which play a critical role in redox homeostasis. Though the Keap1/Nrf2/ARE system involves many players, AREs hold the key in transcriptional regulation of cytoprotective genes. ARE-mediated reporter constructs have been widely used, including xenobiotics profiling and Nrf2 activator screening. The complexity of AREs is brought by the presence of other regulatory elements within the AREs. The diversity in the ARE sequences not only bring regulatory selectivity of diverse transcription factors, but also confer functional complexity in the Keap1/Nrf2/ARE pathway. The different transcription factors either homodimerize or heterodimerize to bind the AREs. Depending on the nature of partners, they may activate or suppress the transcription. Attention is required for deeper mechanistic understanding of ARE-mediated gene regulation. The computational methods of identification and analysis of AREs are still in their infancy. Investigations are required to know whether epigenetics mechanism plays a role in the regulation of genes mediated through AREs. The polymorphisms in the AREs leading to oxidative stress related diseases are warranted. A thorough understanding of AREs will pave the way for the development of therapeutic agents against cancer, neurodegenerative, cardiovascular, metabolic and other diseases with oxidative stress. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  8. Paired hormone response elements predict caveolin-1 as a glucocorticoid target gene.

    Directory of Open Access Journals (Sweden)

    Marinus F van Batenburg

    2010-01-01

    Full Text Available Glucocorticoids act in part via glucocorticoid receptor binding to hormone response elements (HREs, but their direct target genes in vivo are still largely unknown. We developed the criterion that genomic occurrence of paired HREs at an inter-HRE distance less than 200 bp predicts hormone responsiveness, based on synergy of multiple HREs, and HRE information from known target genes. This criterion predicts a substantial number of novel responsive genes, when applied to genomic regions 10 kb upstream of genes. Multiple-tissue in situ hybridization showed that mRNA expression of 6 out of 10 selected genes was induced in a tissue-specific manner in mice treated with a single dose of corticosterone, with the spleen being the most responsive organ. Caveolin-1 was strongly responsive in several organs, and the HRE pair in its upstream region showed increased occupancy by glucocorticoid receptor in response to corticosterone. Our approach allowed for discovery of novel tissue specific glucocorticoid target genes, which may exemplify responses underlying the permissive actions of glucocorticoids.

  9. Verification of Advective Bar Elements Implemented in the Aria Thermal Response Code.

    Energy Technology Data Exchange (ETDEWEB)

    Mills, Brantley [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2016-01-01

    A verification effort was undertaken to evaluate the implementation of the new advective bar capability in the Aria thermal response code. Several approaches to the verification process were taken : a mesh refinement study to demonstrate solution convergence in the fluid and the solid, visually examining the mapping of the advective bar element nodes to the surrounding surfaces, and a comparison of solutions produced using the advective bars for simple geometries with solutions from commercial CFD software . The mesh refinement study has shown solution convergence for simple pipe flow in both temperature and velocity . Guidelines were provided to achieve appropriate meshes between the advective bar elements and the surrounding volume. Simulations of pipe flow using advective bars elements in Aria have been compared to simulations using the commercial CFD software ANSYS Fluent (r) and provided comparable solutions in temperature and velocity supporting proper implementation of the new capability. Verification of Advective Bar Elements iv Acknowledgements A special thanks goes to Dean Dobranich for his guidance and expertise through all stages of this effort . His advice and feedback was instrumental to its completion. Thanks also goes to Sam Subia and Tolu Okusanya for helping to plan many of the verification activities performed in this document. Thank you to Sam, Justin Lamb and Victor Brunini for their assistance in resolving issues encountered with running the advective bar element model. Finally, thanks goes to Dean, Sam, and Adam Hetzler for reviewing the document and providing very valuable comments.

  10. Identification of an estrogen response element in the 3'-flanking region of the murine c-fos protooncogene.

    Science.gov (United States)

    Hyder, S M; Stancel, G M; Nawaz, Z; McDonnell, D P; Loose-Mitchell, D S

    1992-09-05

    We have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyltransferase, linked to regions of mouse c-fos, to identify a specific estrogen response element (ERE) in this protooncogene. This element is located in the untranslated 3'-flanking region of the c-fos gene, 5 kilobases (kb) downstream from the c-fos promoter and 1.5 kb downstream of the poly(A) signal. This element confers estrogen responsiveness to chloramphenicol acetyltransferase reporters linked to both the herpes simplex virus thymidine kinase promoter and the homologous c-fos promoter. Deletion analysis localized the response element to a 200-base pair fragment which contains the element GGTCACCACAGCC that resembles the consensus ERE sequence GGTCACAGTGACC originally identified in Xenopus vitellogenin A2 gene. A synthetic 36-base pair oligodeoxynucleotide containing this c-fos sequence conferred estrogen inducibility to the thymidine kinase promoter. The corresponding sequence also induced reporter activity when present in the c-fos gene fragment 3 kb from the thymidine kinase promoter. Gel-shift experiments demonstrated that synthetic oligonucleotides containing either the consensus ERE or the c-fos element bind human estrogen receptor obtained from a yeast expression system. However, the mobility of the shifted band is faster for the fos-ERE-complex than the consensus ERE complex suggesting that the three-dimensional structure of the protein-DNA complexes is different or that other factors are differentially involved in the two reactions. When the 5'-GGTCA sequence present in the c-fos ERE is mutated to 5'-TTTCA, transcriptional activation and receptor binding activities are both lost. Mutation of the CAGCC-3' element corresponding to the second half-site of the c-fos sequence also led to the loss of receptor binding activity, suggesting that both half-sites of this element are involved in this function. The estrogen induction mediated by either the c-fos or

  11. Ultraviolet B (UVB) induction of the c-fos promoter is mediated by phospho-cAMP response element binding protein (CREB) binding to CRE and c-fos activator protein 1 site (FAP1) cis elements.

    Science.gov (United States)

    Gonzales, Melissa; Bowden, G Tim

    2002-06-26

    The ultraviolet B (UVB) portion (280-320 nm) of the ultraviolet spectrum has been shown to contribute to the development of non-melanoma skin cancer in humans. Research in the human keratinocyte cell line, HaCaT, revealed that UVB irradiation caused the upregulation of the transcription factor activator protein-1 (AP-1). The AP-1 complex formed in UVB-irradiated HaCaT cells is specifically composed of c-fos and Jun D. c-Fos expression was induced in a manner that correlated with the UVB-induced activation of AP-1. To investigate how c-fos expression is regulated by UVB irradiation, the role of each of four cis elements within the c-fos promoter was evaluated. Clustered point mutations at the sis inducible element (SIE), serum response element (SRE), c-fos AP-1 site (FAP1), or cyclic AMP response elements (CRE) significantly inhibited UVB induction of the c-fos promoter. This indicated that all four cis elements are required for maximum promoter activity. The CRE and FAP1 elements were the two most active cis elements that mediate the UVB transactivation of c-fos. Homodimers of phosphorylated cAMP response element binding protein (CREB) were induced by UVB irradiation to bind to each of these elements. Therefore, CREB may function as an important regulatory protein in the UVB-induced expression of c-fos.

  12. Enrichment of conserved synaptic activity-responsive element in neuronal genes predicts a coordinated response of MEF2, CREB and SRF.

    Directory of Open Access Journals (Sweden)

    Fernanda M Rodríguez-Tornos

    Full Text Available A unique synaptic activity-responsive element (SARE sequence, composed of the consensus binding sites for SRF, MEF2 and CREB, is necessary for control of transcriptional upregulation of the Arc gene in response to synaptic activity. We hypothesize that this sequence is a broad mechanism that regulates gene expression in response to synaptic activation and during plasticity; and that analysis of SARE-containing genes could identify molecular mechanisms involved in brain disorders. To search for conserved SARE sequences in the mammalian genome, we used the SynoR in silico tool, and found the SARE cluster predominantly in the regulatory regions of genes expressed specifically in the nervous system; most were related to neural development and homeostatic maintenance. Two of these SARE sequences were tested in luciferase assays and proved to promote transcription in response to neuronal activation. Supporting the predictive capacity of our candidate list, up-regulation of several SARE containing genes in response to neuronal activity was validated using external data and also experimentally using primary cortical neurons and quantitative real time RT-PCR. The list of SARE-containing genes includes several linked to mental retardation and cognitive disorders, and is significantly enriched in genes that encode mRNA targeted by FMRP (fragile X mental retardation protein. Our study thus supports the idea that SARE sequences are relevant transcriptional regulatory elements that participate in plasticity. In addition, it offers a comprehensive view of how activity-responsive transcription factors coordinate their actions and increase the selectivity of their targets. Our data suggest that analysis of SARE-containing genes will reveal yet-undescribed pathways of synaptic plasticity and additional candidate genes disrupted in mental disease.

  13. The Specificity of Innate Immune Responses Is Enforced by Repression of Interferon Response Elements by NF-κB p50

    Science.gov (United States)

    Cheng, Christine S.; Feldman, Kristyn E.; Lee, James; Verma, Shilpi; Huang, De-Bin; Huynh, Kim; Chang, Mikyoung; Ponomarenko, Julia V.; Sun, Shao-Cong; Benedict, Chris A.; Ghosh, Gourisankar; Hoffmann, Alexander

    2011-01-01

    The specific binding of transcription factors to cognate sequence elements is thought to be critical for the generation of specific gene expression programs. Members of the nuclear factor κB (NF-κB) and interferon (IFN) regulatory factor (IRF) transcription factor families bind to the κB site and the IFN response element (IRE), respectively, of target genes, and they are activated in macrophages after exposure to pathogens. However, how these factors produce pathogen-specific inflammatory and immune responses remains poorly understood. Combining top-down and bottom-up systems biology approaches, we have identified the NF-κB p50 homodimer as a regulator of IRF responses. Unbiased genome-wide expression and biochemical and structural analyses revealed that the p50 homodimer repressed a subset of IFN-inducible genes through a previously uncharacterized subclass of guanine-rich IRE (G-IRE) sequences. Mathematical modeling predicted that the p50 homodimer might enforce the stimulus specificity of composite promoters. Indeed, the production of the antiviral regulator IFN-β was rendered stimulus-specific by the binding of the p50 homodimer to the G-IRE–containing IFNβ enhancer to suppress cytotoxic IFN signaling. Specifically, a deficiency in p50 resulted in the inappropriate production of IFN-β in response to bacterial DNA sensed by Toll-like receptor 9. This role for the NF-κB p50 homodimer in enforcing the specificity of the cellular response to pathogens by binding to a subset of IRE sequences alters our understanding of how the NF-κB and IRF signaling systems cooperate to regulate antimicrobial immunity. PMID:21343618

  14. Finite element modelling to assess the effect of surface mounted piezoelectric patch size on vibration response of a hybrid beam

    Science.gov (United States)

    Rahman, N.; Alam, M. N.

    2018-02-01

    Vibration response analysis of a hybrid beam with surface mounted patch piezoelectric layer is presented in this work. A one dimensional finite element (1D-FE) model based on efficient layerwise (zigzag) theory is used for the analysis. The beam element has eight mechanical and a variable number of electrical degrees of freedom. The beams are also modelled in 2D-FE (ABAQUS) using a plane stress piezoelectric quadrilateral element for piezo layers and a plane stress quadrilateral element for the elastic layers of hybrid beams. Results are presented to assess the effect of size of piezoelectric patch layer on the free and forced vibration responses of thin and moderately thick beams under clamped-free and clamped-clamped configurations. The beams are subjected to unit step loading and harmonic loading to obtain the forced vibration responses. The vibration control using in phase actuation potential on piezoelectric patches is also studied. The 1D-FE results are compared with the 2D-FE results.

  15. Development of Finite Element Response Model for Mechanistic - Empirical Design of Flexible Pavement

    Directory of Open Access Journals (Sweden)

    Mujtaba A. AHMED

    2012-08-01

    Full Text Available The focus of this work is to present a finite element method (FEM-based program of the M-E design on MATLAB protocol. The response output generated at critical locations are presented. The results were then compared with those from a locally available program called ‘NEMPADS’ and a reasonable comparison were achieved.

  16. HPV-16 L1 genes with inactivated negative RNA elements induce potent immune responses

    International Nuclear Information System (INIS)

    Rollman, Erik; Arnheim, Lisen; Collier, Brian; Oeberg, Daniel; Hall, Haakan; Klingstroem, Jonas; Dillner, Joakim; Pastrana, Diana V.; Buck, Chris B.; Hinkula, Jorma; Wahren, Britta; Schwartz, Stefan

    2004-01-01

    Introduction of point mutations in the 5' end of the human papillomavirus type 16 (HPV-16) L1 gene specifically inactivates negative regulatory RNA processing elements. DNA vaccination of C57Bl/6 mice with the mutated L1 gene resulted in improved immunogenicity for both neutralizing antibodies as well as for broad cellular immune responses. Previous reports on the activation of L1 by codon optimization may be explained by inactivation of the regulatory RNA elements. The modified HPV-16 L1 DNA that induced anti-HPV-16 immunity may be seen as a complementary approach to protein subunit immunization against papillomavirus

  17. HIV-1 p24(gag derived conserved element DNA vaccine increases the breadth of immune response in mice.

    Directory of Open Access Journals (Sweden)

    Viraj Kulkarni

    Full Text Available Viral diversity is considered a major impediment to the development of an effective HIV-1 vaccine. Despite this diversity, certain protein segments are nearly invariant across the known HIV-1 Group M sequences. We developed immunogens based on the highly conserved elements from the p24(gag region according to two principles: the immunogen must (i include strictly conserved elements of the virus that cannot mutate readily, and (ii exclude both HIV regions capable of mutating without limiting virus viability, and also immunodominant epitopes located in variable regions. We engineered two HIV-1 p24(gag DNA immunogens that express 7 highly Conserved Elements (CE of 12-24 amino acids in length and differ by only 1 amino acid in each CE ('toggle site', together covering >99% of the HIV-1 Group M sequences. Altering intracellular trafficking of the immunogens changed protein localization, stability, and also the nature of elicited immune responses. Immunization of C57BL/6 mice with p55(gag DNA induced poor, CD4(+ mediated cellular responses, to only 2 of the 7 CE; in contrast, vaccination with p24CE DNA induced cross-clade reactive, robust T cell responses to 4 of the 7 CE. The responses were multifunctional and composed of both CD4(+ and CD8(+ T cells with mature cytotoxic phenotype. These findings provide a method to increase immune response to universally conserved Gag epitopes, using the p24CE immunogen. p24CE DNA vaccination induced humoral immune responses similar in magnitude to those induced by p55(gag, which recognize the virus encoded p24(gag protein. The inclusion of DNA immunogens composed of conserved elements is a promising vaccine strategy to induce broader immunity by CD4(+ and CD8(+ T cells to additional regions of Gag compared to vaccination with p55(gag DNA, achieving maximal cross-clade reactive cellular and humoral responses.

  18. Mean annual response of lichen Parmelia sulcata to environmental elemental availability

    International Nuclear Information System (INIS)

    Reis, M.A.; Alves, L.C.; Freitas, M.C.; Os, B. van; Wolterbeek, H.Th.

    2000-01-01

    Lichens collected in an area previously identified as unpolluted, were transplanted to six different places located in polluted areas near Power Plants (both fuel and coal powered). A total of 26 lichen transplants were made for each place, each transplant weighing about 2g. Two were analysed as zero or reference and the remain 24 were hanged in nylon net bags in order to be able to collect two transplants each month, out of every station during a one year period. Besides the 24 lichen samples, each station was provided with two total deposition collection 10 litter buckets (with 25 cm diameter funnels) and an aerosol sampler. Concentration in both lichens and aerosols were measured by PIXE and INAA at ITN. Total deposition residues were analysed by ICP-MS at the The Netherlands Geological Survey. On this work we present the results obtained by looking for correlation between lichens elemental concentrations and annual averages of elemental availability variables such as concentration in suspension in the atmosphere and concentration in total deposition samples, for a total of 40 elements. In order to access both the limitations and the reliability of the results a discussion on the details of handling this data set is presented. A mathematical function which tentatively represents the lichen up-take response to water availability is also proposed. (author)

  19. Cis-regulatory element based targeted gene finding: genome-wide identification of abscisic acid- and abiotic stress-responsive genes in Arabidopsis thaliana.

    Science.gov (United States)

    Zhang, Weixiong; Ruan, Jianhua; Ho, Tuan-Hua David; You, Youngsook; Yu, Taotao; Quatrano, Ralph S

    2005-07-15

    A fundamental problem of computational genomics is identifying the genes that respond to certain endogenous cues and environmental stimuli. This problem can be referred to as targeted gene finding. Since gene regulation is mainly determined by the binding of transcription factors and cis-regulatory DNA sequences, most existing gene annotation methods, which exploit the conservation of open reading frames, are not effective in finding target genes. A viable approach to targeted gene finding is to exploit the cis-regulatory elements that are known to be responsible for the transcription of target genes. Given such cis-elements, putative target genes whose promoters contain the elements can be identified. As a case study, we apply the above approach to predict the genes in model plant Arabidopsis thaliana which are inducible by a phytohormone, abscisic acid (ABA), and abiotic stress, such as drought, cold and salinity. We first construct and analyze two ABA specific cis-elements, ABA-responsive element (ABRE) and its coupling element (CE), in A.thaliana, based on their conservation in rice and other cereal plants. We then use the ABRE-CE module to identify putative ABA-responsive genes in A.thaliana. Based on RT-PCR verification and the results from literature, this method has an accuracy rate of 67.5% for the top 40 predictions. The cis-element based targeted gene finding approach is expected to be widely applicable since a large number of cis-elements in many species are available.

  20. Finite Element Based Response Surface Methodology to Optimize Segmental Tunnel Lining

    Directory of Open Access Journals (Sweden)

    A. Rastbood

    2017-04-01

    Full Text Available The main objective of this paper is to optimize the geometrical and engineering characteristics of concrete segments of tunnel lining using Finite Element (FE based Response Surface Methodology (RSM. Input data for RSM statistical analysis were obtained using FEM. In RSM analysis, thickness (t and elasticity modulus of concrete segments (E, tunnel height (H, horizontal to vertical stress ratio (K and position of key segment in tunnel lining ring (θ were considered as input independent variables. Maximum values of Mises and Tresca stresses and tunnel ring displacement (UMAX were set as responses. Analysis of variance (ANOVA was carried out to investigate the influence of each input variable on the responses. Second-order polynomial equations in terms of influencing input variables were obtained for each response. It was found that elasticity modulus and key segment position variables were not included in yield stresses and ring displacement equations, and only tunnel height and stress ratio variables were included in ring displacement equation. Finally optimization analysis of tunnel lining ring was performed. Due to absence of elasticity modulus and key segment position variables in equations, their values were kept to average level and other variables were floated in related ranges. Response parameters were set to minimum. It was concluded that to obtain optimum values for responses, ring thickness and tunnel height must be near to their maximum and minimum values, respectively and ground state must be similar to hydrostatic conditions.

  1. Finite element modelling of Plantar Fascia response during running on different surface types

    Science.gov (United States)

    Razak, A. H. A.; Basaruddin, K. S.; Salleh, A. F.; Rusli, W. M. R.; Hashim, M. S. M.; Daud, R.

    2017-10-01

    Plantar fascia is a ligament found in human foot structure located beneath the skin of human foot that functioning to stabilize longitudinal arch of human foot during standing and normal gait. To perform direct experiment on plantar fascia seems very difficult since the structure located underneath the soft tissue. The aim of this study is to develop a finite element (FE) model of foot with plantar fascia and investigate the effect of the surface hardness on biomechanical response of plantar fascia during running. The plantar fascia model was developed using Solidworks 2015 according to the bone structure of foot model that was obtained from Turbosquid database. Boundary conditions were set out based on the data obtained from experiment of ground reaction force response during running on different surface hardness. The finite element analysis was performed using Ansys 14. The results found that the peak of stress and strain distribution were occur on the insertion of plantar fascia to bone especially on calcaneal area. Plantar fascia became stiffer with increment of Young’s modulus value and was able to resist more loads. Strain of plantar fascia was decreased when Young’s modulus increased with the same amount of loading.

  2. Biomechanical Analysis of Human Abdominal Impact Responses and Injuries through Finite Element Simulations of a Full Human Body Model.

    Science.gov (United States)

    Ruan, Jesse S; El-Jawahri, Raed; Barbat, Saeed; Prasad, Priya

    2005-11-01

    Human abdominal response and injury in blunt impacts was investigated through finite element simulations of cadaver tests using a full human body model of an average-sized adult male. The model was validated at various impact speeds by comparing model responses with available experimental cadaver test data in pendulum side impacts and frontal rigid bar impacts from various sources. Results of various abdominal impact simulations are presented in this paper. Model-predicted abdominal dynamic responses such as force-time and force-deflection characteristics, and injury severities, measured by organ pressures, for the simulated impact conditions are presented. Quantitative results such as impact forces, abdominal deflections, internal organ stresses have shown that the abdomen responded differently to left and right side impacts, especially in low speed impact. Results also indicated that the model exhibited speed sensitive response characteristics and the compressibility of the abdomen significantly influenced the overall impact response in the simulated impact conditions. This study demonstrates that the development of a validated finite element human body model can be useful for abdominal injury assessment. Internal organ injuries, which are difficult to detect in experimental studies with human cadavers due to the difficulty of instrumentation, may be more easily identified with a validated finite element model through stress-strain analysis.

  3. Simultaneous shifts in elemental stoichiometry and fatty acids of Emiliania huxleyi in response to environmental changes

    Science.gov (United States)

    Bi, Rong; Ismar, Stefanie M. H.; Sommer, Ulrich; Zhao, Meixun

    2018-02-01

    Climate-driven changes in environmental conditions have significant and complex effects on marine ecosystems. Variability in phytoplankton elements and biochemicals can be important for global ocean biogeochemistry and ecological functions, while there is currently limited understanding on how elements and biochemicals respond to the changing environments in key coccolithophore species such as Emiliania huxleyi. We investigated responses of elemental stoichiometry and fatty acids (FAs) in a strain of E. huxleyi under three temperatures (12, 18 and 24 °C), three N : P supply ratios (molar ratios 10:1, 24:1 and 63:1) and two pCO2 levels (560 and 2400 µatm). Overall, C : N : P stoichiometry showed the most pronounced response to N : P supply ratios, with high ratios of particulate organic carbon vs. particulate organic nitrogen (POC : PON) and low ratios of PON vs. particulate organic phosphorus (PON : POP) in low-N media, and high POC : POP and PON : POP in low-P media. The ratio of particulate inorganic carbon vs. POC (PIC : POC) and polyunsaturated fatty acid proportions strongly responded to temperature and pCO2, both being lower under high pCO2 and higher with warming. We observed synergistic interactions between warming and nutrient deficiency (and high pCO2) on elemental cellular contents and docosahexaenoic acid (DHA) proportion in most cases, indicating the enhanced effect of warming under nutrient deficiency (and high pCO2). Our results suggest differential sensitivity of elements and FAs to the changes in temperature, nutrient availability and pCO2 in E. huxleyi, which is to some extent unique compared to non-calcifying algal classes. Thus, simultaneous changes of elements and FAs should be considered when predicting future roles of E. huxleyi in the biotic-mediated connection between biogeochemical cycles, ecological functions and climate change.

  4. Geological occurrence response to trace elemental migration in coal liquefaction based on SPSS: take no. 11 coalbed in Antaibao mine for example

    Science.gov (United States)

    Xia, Xiaohong; Qin, Yong; Yang, Weifeng

    2013-03-01

    Coal liquefaction is an adoptable method to transfer the solid fossil energy into liquid oil in large scale, but the dirty material in which will migrate to different step of liquefaction. The migration rule of some trace elements is response to the react activity of macerals in coal and the geological occurrence of the element nature of itself. In this paper, from the SPSS data correlation analysis and hierarchical clustering dendrogram about the trace elements with macerals respond to coal liquefaction yield, it shows the trace elements in No.11 Antaibao coal seam originated from some of lithophile and sulphophle elements. Correlation coefficient between liquefaction yield of three organic macerals and migration of the elements in liquefaction residue indicated that the lithophile are easy to transfer to residue, while sulphophle are apt to in the liquid products. The activated macerals are response to sulphophle trace elements. The conclusion is useful to the coal blending and environmental effects on coal direct liquefaction.

  5. Contributions of individual domains to function of the HIV-1 Rev response element.

    Science.gov (United States)

    O'Carroll, Ina P; Thappeta, Yashna; Fan, Lixin; Ramirez-Valdez, Edric A; Smith, Sean; Wang, Yun-Xing; Rein, Alan

    2017-08-16

    The HIV-1 Rev response element (RRE) is a 351-base element in unspliced and partially spliced viral RNA; binding of the RRE by the viral Rev protein induces nuclear export of RRE-containing RNAs, as required for virus replication. It contains one long, imperfect double helix (domain I), one branched domain (domain II) containing a high-affinity Rev-binding site, and two or three additional domains. We previously reported that the RRE assumes an "A" shape in solution and suggested that the location of the Rev binding sites in domains I and II, opposite each other on the two legs of the A, is optimal for Rev binding and explains Rev's specificity for RRE-containing RNAs. Using SAXS and a quantitative functional assay, we have now analyzed a panel of RRE mutants. All the results support the essential role of the A shape for RRE function. Moreover, they suggest that the distal portion of domain I and the three crowning domains all contribute to the maintenance of the A shape. Domains I and II are necessary and sufficient for substantial RRE function, provided they are joined by a flexible linker that allows the two domains to face each other. IMPORTANCE Retroviral replication requires that some of the viral RNAs transcribed in the cell nucleus be exported to the cytoplasm without being spliced. To achieve this, HIV-1 encodes a protein, Rev, which binds to a complex, highly structured element within viral RNA, the Rev Response Element (RRE), and escorts RRE-containing RNAs from the nucleus. We previously reported that the RRE is "A"-shaped and suggested that this architecture, with the 2 legs opposite one another, can explain the specificity of Rev for the RRE. We have analyzed the functional contributions of individual RRE domains, and now report that several domains contribute, with some redundancy, to maintenance of the overall RRE shape. The data strongly support the hypothesis that the opposed placement of the 2 legs is essential for RRE function. Copyright © 2017

  6. The Dynamic Response of an Euler-Bernoulli Beam on an Elastic Foundation by Finite Element Analysis using the Exact Stiffness Matrix

    International Nuclear Information System (INIS)

    Kim, Jeong Soo; Kim, Moon Kyum

    2012-01-01

    In this study, finite element analysis of beam on elastic foundation, which received great attention of researchers due to its wide applications in engineering, is performed for estimating dynamic responses of shallow foundation using exact stiffness matrix. First, element stiffness matrix based on the closed solution of beam on elastic foundation is derived. Then, we performed static finite element analysis included exact stiffness matrix numerically, comparing results from the analysis with some exact analysis solutions well known for verification. Finally, dynamic finite element analysis is performed for a shallow foundation structure under rectangular pulse loading using trapezoidal method. The dynamic analysis results exist in the reasonable range comparing solution of single degree of freedom problem under a similar condition. The results show that finite element analysis using exact stiffness matrix is evaluated as a good tool of estimating the dynamic response of structures on elastic foundation.

  7. Genome-wide analysis of ABA-responsive elements ABRE and CE3 reveals divergent patterns in Arabidopsis and rice

    Directory of Open Access Journals (Sweden)

    Riaño-Pachón Diego

    2007-08-01

    Full Text Available Abstract Background In plants, complex regulatory mechanisms are at the core of physiological and developmental processes. The phytohormone abscisic acid (ABA is involved in the regulation of various such processes, including stomatal closure, seed and bud dormancy, and physiological responses to cold, drought and salinity stress. The underlying tissue or plant-wide control circuits often include combinatorial gene regulatory mechanisms and networks that we are only beginning to unravel with the help of new molecular tools. The increasing availability of genomic sequences and gene expression data enables us to dissect ABA regulatory mechanisms at the individual gene expression level. In this paper we used an in-silico-based approach directed towards genome-wide prediction and identification of specific features of ABA-responsive elements. In particular we analysed the genome-wide occurrence and positional arrangements of two well-described ABA-responsive cis-regulatory elements (CREs, ABRE and CE3, in thale cress (Arabidopsis thaliana and rice (Oryza sativa. Results Our results show that Arabidopsis and rice use the ABA-responsive elements ABRE and CE3 distinctively. Earlier reports for various monocots have identified CE3 as a coupling element (CE associated with ABRE. Surprisingly, we found that while ABRE is equally abundant in both species, CE3 is practically absent in Arabidopsis. ABRE-ABRE pairs are common in both genomes, suggesting that these can form functional ABA-responsive complexes (ABRCs in Arabidopsis and rice. Furthermore, we detected distinct combinations, orientation patterns and DNA strand preferences of ABRE and CE3 motifs in rice gene promoters. Conclusion Our computational analyses revealed distinct recruitment patterns of ABA-responsive CREs in upstream sequences of Arabidopsis and rice. The apparent absence of CE3s in Arabidopsis suggests that another CE pairs with ABRE to establish a functional ABRC capable of

  8. Genome-wide analysis of ABA-responsive elements ABRE and CE3 reveals divergent patterns in Arabidopsis and rice.

    Science.gov (United States)

    Gómez-Porras, Judith L; Riaño-Pachón, Diego Mauricio; Dreyer, Ingo; Mayer, Jorge E; Mueller-Roeber, Bernd

    2007-08-01

    In plants, complex regulatory mechanisms are at the core of physiological and developmental processes. The phytohormone abscisic acid (ABA) is involved in the regulation of various such processes, including stomatal closure, seed and bud dormancy, and physiological responses to cold, drought and salinity stress. The underlying tissue or plant-wide control circuits often include combinatorial gene regulatory mechanisms and networks that we are only beginning to unravel with the help of new molecular tools. The increasing availability of genomic sequences and gene expression data enables us to dissect ABA regulatory mechanisms at the individual gene expression level. In this paper we used an in-silico-based approach directed towards genome-wide prediction and identification of specific features of ABA-responsive elements. In particular we analysed the genome-wide occurrence and positional arrangements of two well-described ABA-responsive cis-regulatory elements (CREs), ABRE and CE3, in thale cress (Arabidopsis thaliana) and rice (Oryza sativa). Our results show that Arabidopsis and rice use the ABA-responsive elements ABRE and CE3 distinctively. Earlier reports for various monocots have identified CE3 as a coupling element (CE) associated with ABRE. Surprisingly, we found that while ABRE is equally abundant in both species, CE3 is practically absent in Arabidopsis. ABRE-ABRE pairs are common in both genomes, suggesting that these can form functional ABA-responsive complexes (ABRCs) in Arabidopsis and rice. Furthermore, we detected distinct combinations, orientation patterns and DNA strand preferences of ABRE and CE3 motifs in rice gene promoters. Our computational analyses revealed distinct recruitment patterns of ABA-responsive CREs in upstream sequences of Arabidopsis and rice. The apparent absence of CE3s in Arabidopsis suggests that another CE pairs with ABRE to establish a functional ABRC capable of interacting with transcription factors. Further studies will be

  9. A novel radiation responsive cis-acting element regulates gene induction and mediates tissue injury

    International Nuclear Information System (INIS)

    Hallahan, Dennis E.; Virudachalam, Subbulakshmi; Kuchibahtla, Jaya

    1997-01-01

    containing binding domains for the transcription factors AP-1 and Ets. This DNA sequence (TGCCTCAGTTTCCC) is similar to antioxidant responsive element. X-ray- mediated transcriptional activation of the 5' regulatory region of ICAM-1 required the antioxidant responsive element (ARE). Electrophoretic mobility shift analysis of nuclear proteins from irradiated endothelial cells incubated with the ARE binding domain (5'-GCTGCTGCCTCAGTTTCCC-3') showed increased protein-DNA complexes at 60 and 120 minutes after irradiation. Conclusions: 1) ICAM induction in irradiated tissue occurs in the microvascular endothelium. 2) ICAM expression contributes to the pathogenesis of radiation-mediated tissue injury and the ICAM knockout serves as a model for the study of the pathogenesis of tissue injury. 3) ICAM expression is regulated by a novel radiation-inducible cis-acting element that has homology to previously identified antioxidant responsive elements

  10. Creating diversified response profiles from a single quenchometric sensor element by using phase-resolved luminescence.

    Science.gov (United States)

    Tehan, Elizabeth C; Bukowski, Rachel M; Chodavarapu, Vamsy P; Titus, Albert H; Cartwright, Alexander N; Bright, Frank V

    2015-01-05

    We report a new strategy for generating a continuum of response profiles from a single luminescence-based sensor element by using phase-resolved detection. This strategy yields reliable responses that depend in a predictable manner on changes in the luminescent reporter lifetime in the presence of the target analyte, the excitation modulation frequency, and the detector (lock-in amplifier) phase angle. In the traditional steady-state mode, the sensor that we evaluate exhibits a linear, positive going response to changes in the target analyte concentration. Under phase-resolved conditions the analyte-dependent response profiles: (i) can become highly non-linear; (ii) yield negative going responses; (iii) can be biphasic; and (iv) can exhibit super sensitivity (e.g., sensitivities up to 300 fold greater in comparison to steady-state conditions).

  11. Improvement of dynamic response in an impact absorber by frictional elements

    International Nuclear Information System (INIS)

    Bedolla, Jorge; Szwedowicz, Dariusz; Cortes, Claudia; Gutierrezwing, Enrique S.; Jimenez, Juan; Majewski, Tadeusz

    2014-01-01

    A novel device that uses friction between one or more pairs of elastic conical rings to dissipate the energy from an impacting body is presented. The device consists of one moving and one stationary cylinders coupled to each other using two pairs of conical rings and a spring. The spring is used to restore the system to its original configuration after the impact. The dynamic response of the system to the impact forces during impact events is analysed numerically and experimentally. The effects of several governing parameters, such as the mass ratio between the cylinders, the duration of the transient response of the device, the magnitude of the rest zone of the moving element and the peak impact force are investigated. The proposed system is applicable in sequential impact scenarios, in which remarkable improvements were observed over traditional solid-rod impact absorbers. The present study may serve as a guide for the design of improved damping devices for impact applications.

  12. Characterization of a hypoxia-response element in the Epo locus of the pufferfish, Takifugu rubripes.

    Science.gov (United States)

    Kulkarni, Rashmi P; Tohari, Sumanty; Ho, Adrian; Brenner, Sydney; Venkatesh, Byrappa

    2010-06-01

    Animals respond to hypoxia by increasing synthesis of the glycoprotein hormone erythropoietin (Epo) which in turn stimulates the production of red blood cells. The gene encoding Epo has been recently cloned in teleost fishes such as the pufferfish Takifugu rubripes (fugu) and zebrafish (Danio rerio). It has been shown that the transcription levels of Epo in teleost fishes increase in response to anemia or hypoxia in a manner similar to its human ortholog. However, the cis-regulatory element(s) mediating the hypoxia response of Epo gene in fishes has not been identified. In the present study, using the human hepatoma cell line (Hep3B), we have identified and characterized a hypoxia response element (HRE) in the fugu Epo locus. The sequence of the fugu HRE (ACGTGCTG) is identical to that of the HRE in the human EPO locus. However, unlike the HRE in the mammalian Epo locus, which is located in the 3' region of the gene, the fugu HRE is located in the 5' flanking region and on the opposite strand of DNA. This HRE is conserved in other teleosts such as Tetraodon and zebrafish in a similar location. A 365-bp fragment containing the fugu HRE was able to drive GFP expression in the liver of transgenic zebrafish. However, we could not ascertain if the expression of transgene is induced by hypoxia in vivo due to the low and variable levels of GFP expression in transgenic zebrafish. Our investigations also revealed that the Epo locus has experienced extensive rearrangements during vertebrate evolution. Copyright © 2010 Elsevier B.V. All rights reserved.

  13. Dynamic Response of a Planetary Gear System Using a Finite Element/Contact Mechanics Model

    Science.gov (United States)

    Parker, Robert G.; Agashe, Vinayak; Vijayakar, Sandeep M.

    2000-01-01

    The dynamic response of a helicopter planetary gear system is examined over a wide range of operating speeds and torques. The analysis tool is a unique, semianalytical finite element formulation that admits precise representation of the tooth geometry and contact forces that are crucial in gear dynamics. Importantly, no a priori specification of static transmission error excitation or mesh frequency variation is required; the dynamic contact forces are evaluated internally at each time step. The calculated response shows classical resonances when a harmonic of mesh frequency coincides with a natural frequency. However, peculiar behavior occurs where resonances expected to be excited at a given speed are absent. This absence of particular modes is explained by analytical relationships that depend on the planetary configuration and mesh frequency harmonic. The torque sensitivity of the dynamic response is examined and compared to static analyses. Rotation mode response is shown to be more sensitive to input torque than translational mode response.

  14. MYC cis-Elements in PsMPT Promoter Is Involved in Chilling Response of Paeonia suffruticosa.

    Directory of Open Access Journals (Sweden)

    Yuxi Zhang

    Full Text Available The MPT transports Pi to synthesize ATP. PsMPT, a chilling-induced gene, was previously reported to promote energy metabolism during bud dormancy release in tree peony. In this study, the regulatory elements of PsMPT promoter involved in chilling response were further analyzed. The PsMPT transcript was detected in different tree peony tissues and was highly expressed in the flower organs, including petal, stigma and stamen. An 1174 bp of the PsMPT promoter was isolated by TAIL-PCR, and the PsMPT promoter::GUS transgenic Arabidopsis was generated and analyzed. GUS staining and qPCR showed that the promoter was active in mainly the flower stigma and stamen. Moreover, it was found that the promoter activity was enhanced by chilling, NaCl, GA, ACC and NAA, but inhibited by ABA, mannitol and PEG. In transgenic plants harboring 421 bp of the PsMPT promoter, the GUS gene expression and the activity were significantly increased by chilling treatment. When the fragment from -421 to -408 containing a MYC cis-element was deleted, the chilling response could not be observed. Further mutation analysis confirmed that the MYC element was one of the key motifs responding to chilling in the PsMPT promoter. The present study provides useful information for further investigation of the regulatory mechanism of PsMPT during the endo-dormancy release.

  15. The yeast genome may harbor hypoxia response elements (HRE).

    Science.gov (United States)

    Ferreira, Túlio César; Hertzberg, Libi; Gassmann, Max; Campos, Elida Geralda

    2007-01-01

    The hypoxia-inducible factor-1 (HIF-1) is a heterodimeric transcription factor activated when cells are submitted to hypoxia. The heterodimer is composed of two subunits, HIF-1alpha and the constitutively expressed HIF-1beta. During normoxia, HIF-1alpha is degraded by the 26S proteasome, but hypoxia causes HIF-1alpha to be stabilized, enter the nucleus and bind to HIF-1beta, thus forming the active complex. The complex then binds to the regulatory sequences of various genes involved in physiological and pathological processes. The specific regulatory sequence recognized by HIF-1 is the hypoxia response element (HRE) that has the consensus sequence 5'BRCGTGVBBB3'. Although the basic transcriptional regulation machinery is conserved between yeast and mammals, Saccharomyces cerevisiae does not express HIF-1 subunits. However, we hypothesized that baker's yeast has a protein analogous to HIF-1 which participates in the response to changes in oxygen levels by binding to HRE sequences. In this study we screened the yeast genome for HREs using probabilistic motif search tools. We described 24 yeast genes containing motifs with high probability of being HREs (p-value<0.1) and classified them according to biological function. Our results show that S. cerevisiae may harbor HREs and indicate that a transcription factor analogous to HIF-1 may exist in this organism.

  16. Element uptake and physiological responses of Lactuca sativa upon co-exposures to tourmaline and dissolved humic acids.

    Science.gov (United States)

    Jia, Weili; Wang, Cuiping; Ma, Chuanxin; Wang, Jicheng; Sun, Hongwen

    2018-03-27

    Element migration and physiological response in Lactuca sativa upon co-exposure to tourmaline (T) and dissolved humic acids (DHAs) were investigated. Different fractions of DHA 1 and DHA 4 and three different doses of T were introduced into Hoagland's solution. The results indicated that T enhanced the contents of elements such as N and C, Si and Al in the roots and shoots. The correlation between TF values of Si and Al (R 2  = 0.7387) was higher than that of Si and Mn (R 2  = 0.4961) without the presence of DHAs. However, both DHA 1 and DHA 4 increased the correlation between Si and Mn, but decreased the one between Si and Al. CAT activities in T treatments were positively correlated to the contents of N and Al in the shoots, whose R 2 was 0.9994 and 0.9897, respectively. In the co-exposure of DHAs and tourmaline, DHA 4 exhibited more impacts on element uptake, CAT activities, as well as ABA contents in comparison with the presence of DHA 1 , regardless of the T exposure doses. These results suggested that DHAs have effects on mineral element behaviors and physiological response in Lactuca sativa upon exposure to tourmaline for the first time, which had great use in guiding soil remediation.

  17. Simultaneous shifts in elemental stoichiometry and fatty acids of Emiliania huxleyi in response to environmental changes

    Directory of Open Access Journals (Sweden)

    R. Bi

    2018-02-01

    Full Text Available Climate-driven changes in environmental conditions have significant and complex effects on marine ecosystems. Variability in phytoplankton elements and biochemicals can be important for global ocean biogeochemistry and ecological functions, while there is currently limited understanding on how elements and biochemicals respond to the changing environments in key coccolithophore species such as Emiliania huxleyi. We investigated responses of elemental stoichiometry and fatty acids (FAs in a strain of E. huxleyi under three temperatures (12, 18 and 24 °C, three N : P supply ratios (molar ratios 10:1, 24:1 and 63:1 and two pCO2 levels (560 and 2400 µatm. Overall, C : N : P stoichiometry showed the most pronounced response to N : P supply ratios, with high ratios of particulate organic carbon vs. particulate organic nitrogen (POC : PON and low ratios of PON vs. particulate organic phosphorus (PON : POP in low-N media, and high POC : POP and PON : POP in low-P media. The ratio of particulate inorganic carbon vs. POC (PIC : POC and polyunsaturated fatty acid proportions strongly responded to temperature and pCO2, both being lower under high pCO2 and higher with warming. We observed synergistic interactions between warming and nutrient deficiency (and high pCO2 on elemental cellular contents and docosahexaenoic acid (DHA proportion in most cases, indicating the enhanced effect of warming under nutrient deficiency (and high pCO2. Our results suggest differential sensitivity of elements and FAs to the changes in temperature, nutrient availability and pCO2 in E. huxleyi, which is to some extent unique compared to non-calcifying algal classes. Thus, simultaneous changes of elements and FAs should be considered when predicting future roles of E. huxleyi in the biotic-mediated connection between biogeochemical cycles, ecological functions and climate change.

  18. Integration of growth factor signals at the c-fos serum response element.

    Science.gov (United States)

    Price, M A; Hill, C; Treisman, R

    1996-04-29

    A transcription factor ternary complex composed of serum response factor (SRF) and a second factor, ternary complex factor (TCF), mediates the response of the c-fos Serum Response Element to growth factors and mitogens. In NIH3T3 fibroblasts, TCF binding is required for transcriptional activation by the SRE in response to activation of the Ras-Raf-ERK pathway. We compared the properties of three members of the TCF family, Elk-1, SAP-1 and SAP-2 (ERP/NET). Although all the proteins contain sequences required for ternary complex formation with SRF, only Elk-1 and SAP-1 appear to interact with the c-fos SRE efficiently in vivo. Each TCF contains a C-terminal activation domain capable of transcriptional activation in response to activation of the Ras-Raf-ERK pathway, and this is dependent on the integrity of S/T-P motifs conserved between all the TCF family members. In contrast, activation of the SRE by whole serum and the mitogenic phospholipid LPA requires SRF binding alone. Constitutively activated members of the Rho subfamily of Ras-like GTPases are also capable of inducing activation of the SRE in the absence of TCF; unlike activated Ras itself, these proteins do not activate the TCFs in NIH3T3 cells. At the SRE, SRF- and TCF-linked signalling pathways act synergistically to potentiate transcription.

  19. SANTOS - a two-dimensional finite element program for the quasistatic, large deformation, inelastic response of solids

    Energy Technology Data Exchange (ETDEWEB)

    Stone, C.M.

    1997-07-01

    SANTOS is a finite element program designed to compute the quasistatic, large deformation, inelastic response of two-dimensional planar or axisymmetric solids. The code is derived from the transient dynamic code PRONTO 2D. The solution strategy used to compute the equilibrium states is based on a self-adaptive dynamic relaxation solution scheme, which is based on explicit central difference pseudo-time integration and artificial mass proportional damping. The element used in SANTOS is a uniform strain 4-node quadrilateral element with an hourglass control scheme to control the spurious deformation modes. Finite strain constitutive models for many common engineering materials are included. A robust master-slave contact algorithm for modeling sliding contact is implemented. An interface for coupling to an external code is also provided. 43 refs., 22 figs.

  20. Signaling cross-talk between peroxisome proliferator-activated receptor/retinoid X receptor and estrogen receptor through estrogen response elements.

    Science.gov (United States)

    Keller, H; Givel, F; Perroud, M; Wahli, W

    1995-07-01

    Peroxisome proliferator-activated receptors (PPARs) and retinoid X receptors (RXRs) are nuclear hormone receptors that are activated by fatty acids and 9-cis-retinoic acid, respectively. PPARs and RXRs form heterodimers that activate transcription by binding to PPAR response elements (PPREs) in the promoter of target genes. The PPREs described thus far consist of a direct tandem repeat of the AGGTCA core element with one intervening nucleotide. We show here that the vitellogenin A2 estrogen response element (ERE) can also function as a PPRE and is bound by a PPAR/RXR heterodimer. Although this heterodimer can bind to several other ERE-related palindromic response elements containing AGGTCA half-sites, only the ERE is able to confer transactivation of test reporter plasmids, when the ERE is placed either close to or at a distance from the transcription initiation site. Examination of natural ERE-containing promoters, including the pS2, very-low-density apolipoprotein II and vitellogenin A2 genes, revealed considerable differences in the binding of PPAR/RXR heterodimers to these EREs. In their natural promoter context, these EREs did not allow transcriptional activation by PPARs/RXRs. Analysis of this lack of stimulation of the vitellogenin A2 promoter demonstrated that PPARs/RXRs bind to the ERE but cannot transactivate due to a nonpermissive promoter structure. As a consequence, PPARs/RXRs inhibit transactivation by the estrogen receptor through competition for ERE binding. This is the first example of signaling cross-talk between PPAR/RXR and estrogen receptor.

  1. Regulation of Cancer Cell Responsiveness to Ionizing Radiation Treatment by Cyclic AMP Response Element Binding Nuclear Transcription Factor

    Directory of Open Access Journals (Sweden)

    Francesca D’Auria

    2017-05-01

    Full Text Available Cyclic AMP response element binding (CREB protein is a member of the CREB/activating transcription factor (ATF family of transcription factors that play an important role in the cell response to different environmental stimuli leading to proliferation, differentiation, apoptosis, and survival. A number of studies highlight the involvement of CREB in the resistance to ionizing radiation (IR therapy, demonstrating a relationship between IR-induced CREB family members’ activation and cell survival. Consistent with these observations, we have recently demonstrated that CREB and ATF-1 are expressed in leukemia cell lines and that low-dose radiation treatment can trigger CREB activation, leading to survival of erythro-leukemia cells (K562. On the other hand, a number of evidences highlight a proapoptotic role of CREB following IR treatment of cancer cells. Since the development of multiple mechanisms of resistance is one key problem of most malignancies, including those of hematological origin, it is highly desirable to identify biological markers of responsiveness/unresponsiveness useful to follow-up the individual response and to adjust anticancer treatments. Taking into account all these considerations, this mini-review will be focused on the involvement of CREB/ATF family members in response to IR therapy, to deepen our knowledge of this topic, and to pave the way to translation into a therapeutic context.

  2. Hepatic overexpression of cAMP-responsive element modulator α induces a regulatory T-cell response in a murine model of chronic liver disease

    NARCIS (Netherlands)

    Kuttkat, Nadine; Mohs, Antje; Ohl, Kim; Hooiveld, Guido; Longerich, Thomas; Tenbrock, Klaus; Cubero, Francisco Javier; Trautwein, Christian

    2016-01-01


    Objective Th17 cells are a subset of CD4+ T-helper cells characterised by interleukin 17 (IL-17) production, a cytokine that plays a crucial role in inflammation-associated diseases. The cyclic AMP-responsive element modulator-α (CREMα) is a central mediator of T-cell pathogenesis, which

  3. A Multi-Element Approach to Location Inference of Twitter: A Case for Emergency Response

    Directory of Open Access Journals (Sweden)

    Farhad Laylavi

    2016-04-01

    Full Text Available Since its inception, Twitter has played a major role in real-world events—especially in the aftermath of disasters and catastrophic incidents, and has been increasingly becoming the first point of contact for users wishing to provide or seek information about such situations. The use of Twitter in emergency response and disaster management opens up avenues of research concerning different aspects of Twitter data quality, usefulness and credibility. A real challenge that has attracted substantial attention in the Twitter research community exists in the location inference of twitter data. Considering that less than 2% of tweets are geotagged, finding location inference methods that can go beyond the geotagging capability is undoubtedly the priority research area. This is especially true in terms of emergency response, where spatial aspects of information play an important role. This paper introduces a multi-elemental location inference method that puts the geotagging aside and tries to predict the location of tweets by exploiting the other inherently attached data elements. In this regard, textual content, users’ profile location and place labelling, as the main location-related elements, are taken into account. Location-name classes in three granularity levels are defined and employed to look up the location references from the location-associated elements. The inferred location of the finest granular level is assigned to a tweet, based on a novel location assignment rule. The location assigned by the location inference process is considered to be the inferred location of a tweet, and is compared with the geotagged coordinates as the ground truth of the study. The results show that this method is able to successfully infer the location of 87% of the tweets at the average distance error of 12.2 km and the median distance error of 4.5 km, which is a significant improvement compared with that of the current methods that can predict the location

  4. Effects of rare earth elements and REE-binding proteins on physiological responses in plants.

    Science.gov (United States)

    Liu, Dongwu; Wang, Xue; Chen, Zhiwei

    2012-02-01

    Rare earth elements (REEs), which include 17 elements in the periodic table, share chemical properties related to a similar external electronic configuration. REEs enriched fertilizers have been used in China since the 1980s. REEs could enter the cell and cell organelles, influence plant growth, and mainly be bound with the biological macromolecules. REE-binding proteins have been found in some plants. In addition, the chlorophyll activities and photosynthetic rate can be regulated by REEs. REEs could promote the protective function of cell membrane and enhance the plant resistance capability to stress produced by environmental factors, and affect the plant physiological mechanism by regulating the Ca²⁺ level in the plant cells. The focus of present review is to describe how REEs and REE-binding proteins participate in the physiological responses in plants.

  5. A role for neuronal cAMP responsive-element binding (CREB)-1 in brain responses to calorie restriction

    Science.gov (United States)

    Fusco, Salvatore; Ripoli, Cristian; Podda, Maria Vittoria; Ranieri, Sofia Chiatamone; Leone, Lucia; Toietta, Gabriele; McBurney, Michael W.; Schütz, Günther; Riccio, Antonella; Grassi, Claudio; Galeotti, Tommaso; Pani, Giovambattista

    2012-01-01

    Calorie restriction delays brain senescence and prevents neurodegeneration, but critical regulators of these beneficial responses other than the NAD+-dependent histone deacetylase Sirtuin-1 (Sirt-1) are unknown. We report that effects of calorie restriction on neuronal plasticity, memory and social behavior are abolished in mice lacking cAMP responsive-element binding (CREB)-1 in the forebrain. Moreover, CREB deficiency drastically reduces the expression of Sirt-1 and the induction of genes relevant to neuronal metabolism and survival in the cortex and hippocampus of dietary-restricted animals. Biochemical studies reveal a complex interplay between CREB and Sirt-1: CREB directly regulates the transcription of the sirtuin in neuronal cells by binding to Sirt-1 chromatin; Sirt-1, in turn, is recruited by CREB to DNA and promotes CREB-dependent expression of target gene peroxisome proliferator-activated receptor-γ coactivator-1α and neuronal NO Synthase. Accordingly, expression of these CREB targets is markedly reduced in the brain of Sirt KO mice that are, like CREB-deficient mice, poorly responsive to calorie restriction. Thus, the above circuitry, modulated by nutrient availability, links energy metabolism with neurotrophin signaling, participates in brain adaptation to nutrient restriction, and is potentially relevant to accelerated brain aging by overnutrition and diabetes. PMID:22190495

  6. Probabilistic finite elements

    Science.gov (United States)

    Belytschko, Ted; Wing, Kam Liu

    1987-01-01

    In the Probabilistic Finite Element Method (PFEM), finite element methods have been efficiently combined with second-order perturbation techniques to provide an effective method for informing the designer of the range of response which is likely in a given problem. The designer must provide as input the statistical character of the input variables, such as yield strength, load magnitude, and Young's modulus, by specifying their mean values and their variances. The output then consists of the mean response and the variance in the response. Thus the designer is given a much broader picture of the predicted performance than with simply a single response curve. These methods are applicable to a wide class of problems, provided that the scale of randomness is not too large and the probabilistic density functions possess decaying tails. By incorporating the computational techniques we have developed in the past 3 years for efficiency, the probabilistic finite element methods are capable of handling large systems with many sources of uncertainties. Sample results for an elastic-plastic ten-bar structure and an elastic-plastic plane continuum with a circular hole subject to cyclic loadings with the yield stress on the random field are given.

  7. Non-linear finite element analysis for prediction of seismic response of buildings considering soil-structure interaction

    Directory of Open Access Journals (Sweden)

    E. Çelebi

    2012-11-01

    Full Text Available The objective of this paper focuses primarily on the numerical approach based on two-dimensional (2-D finite element method for analysis of the seismic response of infinite soil-structure interaction (SSI system. This study is performed by a series of different scenarios that involved comprehensive parametric analyses including the effects of realistic material properties of the underlying soil on the structural response quantities. Viscous artificial boundaries, simulating the process of wave transmission along the truncated interface of the semi-infinite space, are adopted in the non-linear finite element formulation in the time domain along with Newmark's integration. The slenderness ratio of the superstructure and the local soil conditions as well as the characteristics of input excitations are important parameters for the numerical simulation in this research. The mechanical behavior of the underlying soil medium considered in this prediction model is simulated by an undrained elasto-plastic Mohr-Coulomb model under plane-strain conditions. To emphasize the important findings of this type of problems to civil engineers, systematic calculations with different controlling parameters are accomplished to evaluate directly the structural response of the vibrating soil-structure system. When the underlying soil becomes stiffer, the frequency content of the seismic motion has a major role in altering the seismic response. The sudden increase of the dynamic response is more pronounced for resonance case, when the frequency content of the seismic ground motion is close to that of the SSI system. The SSI effects under different seismic inputs are different for all considered soil conditions and structural types.

  8. ETHYLENE RESPONSE FACTOR 96 positively regulates Arabidopsis resistance to necrotrophic pathogens by direct binding to GCC elements of jasmonate - and ethylene-responsive defence genes.

    Science.gov (United States)

    Catinot, Jérémy; Huang, Jing-Bo; Huang, Pin-Yao; Tseng, Min-Yuan; Chen, Ying-Lan; Gu, Shin-Yuan; Lo, Wan-Sheng; Wang, Long-Chi; Chen, Yet-Ran; Zimmerli, Laurent

    2015-12-01

    The ERF (ethylene responsive factor) family is composed of transcription factors (TFs) that are critical for appropriate Arabidopsis thaliana responses to biotic and abiotic stresses. Here we identified and characterized a member of the ERF TF group IX, namely ERF96, that when overexpressed enhances Arabidopsis resistance to necrotrophic pathogens such as the fungus Botrytis cinerea and the bacterium Pectobacterium carotovorum. ERF96 is jasmonate (JA) and ethylene (ET) responsive and ERF96 transcripts accumulation was abolished in JA-insensitive coi1-16 and in ET-insensitive ein2-1 mutants. Protoplast transactivation and electrophoresis mobility shift analyses revealed that ERF96 is an activator of transcription that binds to GCC elements. In addition, ERF96 mainly localized to the nucleus. Microarray analysis coupled to chromatin immunoprecipitation-PCR of Arabidopsis overexpressing ERF96 revealed that ERF96 enhances the expression of the JA/ET defence genes PDF1.2a, PR-3 and PR-4 as well as the TF ORA59 by direct binding to GCC elements present in their promoters. While ERF96-RNAi plants demonstrated wild-type resistance to necrotrophic pathogens, basal PDF1.2 expression levels were reduced in ERF96-silenced plants. This work revealed ERF96 as a key player of the ERF network that positively regulates the Arabidopsis resistance response to necrotrophic pathogens. © 2015 John Wiley & Sons Ltd.

  9. Isolation of an X-ray-responsive element in the promoter region of tissue-type plasminogen activator: Potential uses of X-ray-responsive elements for gene therapy

    International Nuclear Information System (INIS)

    Boothman, D.A.; Lee, I.W.; Sahijdak, W.M.

    1994-01-01

    Tissue-type plasminogen activator (t-PA) was induced over 50-fold after X irradiation in radioresistant human melanoma cells. Activities of t-PA were induced 14-fold in ataxia telangiectasia, 9-fold in Bloom's syndrome and 6-fold in Fanconi's anemia cells, compared to normal human fibroblasts. X-ray-inducible synthesis of the protease, t-PA, may play a role(s) in damage-inducible repair processes in mammalian cells, similar to the SOS repair systems in lower eukaryotes and prokaryotes. DNA band shift and DNase I footprinting assays were used to determine binding if transcription factors to a previously unknown X-ray-responsive element (XRE) in the t-PA promoter. The major goals of our research with XREs are to understand (a) which transcription factor(s) regulates to-PA induction after X-rays, and (b) the role(s) of t-PA in DNA repair, apoptosis or other responses to X rays. The purpose of this paper is to discuss the potential use of an XRE, such as the one in the t-PA promoter, for gene radiotherapy. Several gene therapy strategies are proposed. 22 refs., 3 figs

  10. Soil solution chemistry and element fluxes in three European heathlands and their responses to warming and drought

    DEFF Research Database (Denmark)

    Schmidt, I.K.; Tietema, A.; Williams, D.

    2004-01-01

    Soil water chemistry and element budgets were studied at three northwestern European Calluna vulgaris heathland sites in Denmark (DK), The Netherlands (NL), and Wales (UK). Responses to experimental nighttime warming and early summer drought were followed during a two-year period. Soil solution...

  11. Development of electrochemical reporter assay using HeLa cells transfected with vector plasmids encoding various responsive elements

    Energy Technology Data Exchange (ETDEWEB)

    Shiku, Hitoshi, E-mail: shiku@bioinfo.che.tohoku.ac.jp [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan); Takeda, Michiaki; Murata, Tatsuya [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan); Akiba, Uichi; Hamada, Fumio [Graduate School of Engineering and Resource Science, Akita University, 1-1 Tegata gakuen-machi, Akita 010-8502 (Japan); Matsue, Tomokazu, E-mail: matsue@bioinfo.che.tohoku.ac.jp [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan)

    2009-04-27

    Electrochemical assay using HeLa cell lines transfected with various plasmid vectors encoding SEAP (secreted alkaline phosphatase) as the reporter has been performed by using SECM (scanning electrochemical microscopy). The plasmid vector contains different responsive elements that include GRE (glucocorticoid response elements), CRE (cAMP responsive elements), or {kappa}B (binding site for NF{kappa}B (nuclear factor kappa B)) upstream of the SEAP sequence. The transfected HeLa cells were patterned on a culture dish in a 4 x 4 array of circles of diameter 300 {mu}m by using the PDMS (poly(dimethylsiloxane)) stencil technique. The cellular array was first exposed to 100 ng mL{sup -1} dexamethasone, 10 ng mL{sup -1} forskolin, or 100 ng mL{sup -1} TNF-{alpha} (tumor necrosis factor {alpha}) after which it was further cultured in an RPMI culture medium for 6 h. After incubation, the cellular array was soaked in a measuring solution containing 4.7 mM PAPP (p-aminophenylphosphate) at pH 9.5, following which electrochemical measurements were performed immediately within 40 min. The SECM method allows parallel evaluation of different cell lines transfected with pGRE-SEAP, pCRE-SEAP, and pNF{kappa}B-SEAP patterned on the same solid support for detection of the oxidation current of PAP (p-aminophenol) flux produced from only 300 HeLa cells in each stencil pattern. The results of the SECM method were highly sensitive as compared to those obtained from the conventional CL (chemiluminescence) protocol with at least 5 x 10{sup 4} cells per well.

  12. Effect of randomness on multi-frequency aeroelastic responses resolved by Unsteady Adaptive Stochastic Finite Elements

    International Nuclear Information System (INIS)

    Witteveen, Jeroen A.S.; Bijl, Hester

    2009-01-01

    The Unsteady Adaptive Stochastic Finite Elements (UASFE) method resolves the effect of randomness in numerical simulations of single-mode aeroelastic responses with a constant accuracy in time for a constant number of samples. In this paper, the UASFE framework is extended to multi-frequency responses and continuous structures by employing a wavelet decomposition pre-processing step to decompose the sampled multi-frequency signals into single-frequency components. The effect of the randomness on the multi-frequency response is then obtained by summing the results of the UASFE interpolation at constant phase for the different frequency components. Results for multi-frequency responses and continuous structures show a three orders of magnitude reduction of computational costs compared to crude Monte Carlo simulations in a harmonically forced oscillator, a flutter panel problem, and the three-dimensional transonic AGARD 445.6 wing aeroelastic benchmark subject to random fields and random parameters with various probability distributions.

  13. An ethylene-responsive enhancer element is involved in the senescence-related expression of the carnation glutathione-S-transferase (GST1) gene.

    Science.gov (United States)

    Itzhaki, H; Maxson, J M; Woodson, W R

    1994-09-13

    The increased production of ethylene during carnation petal senescence regulates the transcription of the GST1 gene encoding a subunit of glutathione-S-transferase. We have investigated the molecular basis for this ethylene-responsive transcription by examining the cis elements and trans-acting factors involved in the expression of the GST1 gene. Transient expression assays following delivery of GST1 5' flanking DNA fused to a beta-glucuronidase receptor gene were used to functionally define sequences responsible for ethylene-responsive expression. Deletion analysis of the 5' flanking sequences of GST1 identified a single positive regulatory element of 197 bp between -667 and -470 necessary for ethylene-responsive expression. The sequences within this ethylene-responsive region were further localized to 126 bp between -596 and -470. The ethylene-responsive element (ERE) within this region conferred ethylene-regulated expression upon a minimal cauliflower mosaic virus-35S TATA-box promoter in an orientation-independent manner. Gel electrophoresis mobility-shift assays and DNase I footprinting were used to identify proteins that bind to sequences within the ERE. Nuclear proteins from carnation petals were shown to specifically interact with the 126-bp ERE and the presence and binding of these proteins were independent of ethylene or petal senescence. DNase I footprinting defined DNA sequences between -510 and -488 within the ERE specifically protected by bound protein. An 8-bp sequence (ATTTCAAA) within the protected region shares significant homology with promoter sequences required for ethylene responsiveness from the tomato fruit-ripening E4 gene.

  14. Third-generation Ah receptor-responsive luciferase reporter plasmids: amplification of dioxin-responsive elements dramatically increases CALUX bioassay sensitivity and responsiveness.

    Science.gov (United States)

    He, Guochun; Tsutsumi, Tomoaki; Zhao, Bin; Baston, David S; Zhao, Jing; Heath-Pagliuso, Sharon; Denison, Michael S

    2011-10-01

    2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD, dioxin) and related dioxin-like chemicals are widespread and persistent environmental contaminants that produce diverse toxic and biological effects through their ability to bind to and activate the Ah receptor (AhR) and AhR-dependent gene expression. The chemically activated luciferase expression (CALUX) system is an AhR-responsive recombinant luciferase reporter gene-based cell bioassay that has been used in combination with chemical extraction and cleanup methods for the relatively rapid and inexpensive detection and relative quantitation of dioxin and dioxin-like chemicals in a wide variety of sample matrices. Although the CALUX bioassay has been validated and used extensively for screening purposes, it has some limitations when screening samples with very low levels of dioxin-like chemicals or when there is only a small amount of sample matrix for analysis. Here, we describe the development of third-generation (G3) CALUX plasmids with increased numbers of dioxin-responsive elements, and stable transfection of these new plasmids into mouse hepatoma (Hepa1c1c7) cells has produced novel amplified G3 CALUX cell bioassays that respond to TCDD with a dramatically increased magnitude of luciferase induction and significantly lower minimal detection limit than existing CALUX-type cell lines. The new G3 CALUX cell lines provide a highly responsive and sensitive bioassay system for the detection and relative quantitation of very low levels of dioxin-like chemicals in sample extracts.

  15. Third-Generation Ah Receptor–Responsive Luciferase Reporter Plasmids: Amplification of Dioxin-Responsive Elements Dramatically Increases CALUX Bioassay Sensitivity and Responsiveness

    Science.gov (United States)

    He, Guochun; Tsutsumi, Tomoaki; Zhao, Bin; Baston, David S.; Zhao, Jing; Heath-Pagliuso, Sharon; Denison, Michael S.

    2011-01-01

    2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD, dioxin) and related dioxin-like chemicals are widespread and persistent environmental contaminants that produce diverse toxic and biological effects through their ability to bind to and activate the Ah receptor (AhR) and AhR-dependent gene expression. The chemically activated luciferase expression (CALUX) system is an AhR-responsive recombinant luciferase reporter gene–based cell bioassay that has been used in combination with chemical extraction and cleanup methods for the relatively rapid and inexpensive detection and relative quantitation of dioxin and dioxin-like chemicals in a wide variety of sample matrices. Although the CALUX bioassay has been validated and used extensively for screening purposes, it has some limitations when screening samples with very low levels of dioxin-like chemicals or when there is only a small amount of sample matrix for analysis. Here, we describe the development of third-generation (G3) CALUX plasmids with increased numbers of dioxin-responsive elements, and stable transfection of these new plasmids into mouse hepatoma (Hepa1c1c7) cells has produced novel amplified G3 CALUX cell bioassays that respond to TCDD with a dramatically increased magnitude of luciferase induction and significantly lower minimal detection limit than existing CALUX-type cell lines. The new G3 CALUX cell lines provide a highly responsive and sensitive bioassay system for the detection and relative quantitation of very low levels of dioxin-like chemicals in sample extracts. PMID:21775728

  16. Functional cooperativity between two TPA responsive elements in undifferentiated F9 embryonic stem cells.

    OpenAIRE

    Okuda, A; Imagawa, M; Sakai, M; Muramatsu, M

    1990-01-01

    We have recently identified an enhancer, termed GPEI, in the 5'-flanking region of the rat glutathione transferase P gene, that is composed of two imperfect TPA (phorbol 12-O-tetradecanoate 13-acetate) responsive elements (TREs). Unlike other TRE-containing enhancers, GPEI exhibits a strong transcriptional enhancing activity in F9 embryonic stem cells. Mutational analyses have revealed that the high activity of GPEI is mediated by two imperfect TREs. Each TRE-like sequence has no activity by ...

  17. Reactor calculation in coarse mesh by finite element method applied to matrix response method

    International Nuclear Information System (INIS)

    Nakata, H.

    1982-01-01

    The finite element method is applied to the solution of the modified formulation of the matrix-response method aiming to do reactor calculations in coarse mesh. Good results are obtained with a short running time. The method is applicable to problems where the heterogeneity is predominant and to problems of evolution in coarse meshes where the burnup is variable in one same coarse mesh, making the cross section vary spatially with the evolution. (E.G.) [pt

  18. Cloning the uteroglobin gene promoter from the relic volcano rabbit (Romerolagus diazi) reveals an ancient estrogen-response element.

    Science.gov (United States)

    Acosta-MontesdeOca, Adriana; Zariñán, Teresa; Macías, Héctor; Pérez-Solís, Marco A; Ulloa-Aguirre, Alfredo; Gutiérrez-Sagal, Rubén

    2012-05-01

    To gain further insight on the estrogen-dependent transcriptional regulation of the uteroglobin (UG) gene, we cloned the 5'-flanking region of the UG gene from the phylogenetically ancient volcano rabbit (Romerolagus diazi; Rd). The cloned region spans 812 base pairs (bp; -812/-1) and contains a noncanonical TATA box (TACA). The translation start site is 48 bp downstream from the putative transcription initiation site (AGA), and is preceded by a consensus Kozak box. Comparison of the Rd-UG gene with that previously isolated from rabbits (Oryctolagus cuniculus) showed 93% in sequence identity as well as a number of conserved cis-acting elements, including the estrogen-response element (ERE; -265/-251), which differs from the consensus by two nucleotides. In MCF-7 cells, 17β-estradiol (E(2)) induced transcription of a luciferase reporter driven by the Rd-UG promoter in a similar manner as in an equivalent rabbit UG reporter; the Rd-UG promoter was 30% more responsive to E(2) than the rabbit promoter. Mutagenesis studies on the Rd-ERE confirmed this cis-element as a target of E(2) as two luciferase mutant reporters of the Rd-promoter, one with the rabbit and the other with the consensus ERE, were more responsive to the hormone than the wild-type reporter. Gel shift and super-shift assays showed that estrogen receptor-α indeed binds to the imperfect palindromic sequence of the Rd-ERE. Copyright © 2012 Wiley Periodicals, Inc.

  19. Activation of the carbohydrate response element binding protein (ChREBP) in response to anoxia in the turtle Trachemys scripta elegans.

    Science.gov (United States)

    Krivoruchko, Anastasia; Storey, Kenneth B

    2014-10-01

    ChREBP (carbohydrate response element binding protein) is a glucose-responsive transcription factor that is known to be an important regulator of glycolytic and lipogenic genes in response to glucose. We hypothesized that activation of ChREBP could be relevant to anoxia survival by the anoxia-tolerant turtle, Trachemys scripta elegans. Expression of ChREBP in response to 5 and 20h of anoxia was examined using RT-PCR and Western immunoblotting. In addition, subcellular localization and DNA-binding activity of ChREBP protein were assessed and transcript levels of liver pyruvate kinase (LPK), a downstream gene under ChREBP control were quantified using RT-PCR. ChREBP was anoxia-responsive in kidney and liver, with transcript levels increasing by 1.2-1.8 fold in response to anoxia and protein levels increasing by 1.8-1.9 fold. Enhanced nuclear presence under anoxia was also observed in both tissues by 2.2-2.8 fold. A 4.2 fold increase in DNA binding activity of ChREBP was also observed in liver in response to 5h of anoxia. In addition, transcript levels of LPK increased by 2.1 fold in response to 5h of anoxia in the liver. The results suggest that activation of ChREBP in response to anoxia might be a crucial factor for anoxia survival in turtle liver by contributing to elevated glycolytic flux in the initial phases of oxygen limitation. This study provides the first demonstration of activation of ChREBP in response to anoxia in a natural model of anoxia tolerance, further improving our understanding of the molecular nature of anoxia tolerance. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. Functional consequences of inducible genetic elements from the p53 SOS response in a mammalian organ system.

    Science.gov (United States)

    Guthrie, O'neil W

    2017-10-01

    In response to DNA damage from ultraviolet (UV) radiation, bacteria deploy the SOS response in order to limit cell death. This bacterial SOS response is characterized by an increase in the recA gene that transactivates expression of multiple DNA repair genes. The current series of experiments demonstrate that a mammalian organ system (the cochlea) that is not evolutionarily conditioned to UV radiation can elicit SOS responses that are reminiscent of that of bacteria. This mammalian SOS response is characterized by an increase in the p53 gene with activation of multiple DNA repair genes that harbor p53 response elements in their promoters. Furthermore, the experimental results provide support for the notion of a convergent trigger paradox, where independent SOS triggers facilitate disparate physiologic sequelae (loss vs. recovery of function). Therefore, it is proposed that the mammalian SOS response is multifunctional and manipulation of this endogenous response could be exploited in future biomedical interventions. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. A chromatin insulator driving three-dimensional Polycomb response element (PRE) contacts and Polycomb association with the chromatin fiber

    DEFF Research Database (Denmark)

    Comet, Itys; Schuettengruber, Bernd; Sexton, Tom

    2011-01-01

    to insulate genes from regulatory elements or to take part in long-distance interactions. Using a high-resolution chromatin conformation capture (H3C) method, we show that the Drosophila gypsy insulator behaves as a conformational chromatin border that is able to prohibit contacts between a Polycomb response...... element (PRE) and a distal promoter. On the other hand, two spaced gypsy elements form a chromatin loop that is able to bring an upstream PRE in contact with a downstream gene to mediate its repression. Chromatin immunoprecipitation (ChIP) profiles of the Polycomb protein and its associated H3K27me3...... histone mark reflect this insulator-dependent chromatin conformation, suggesting that Polycomb action at a distance can be organized by local chromatin topology....

  2. Essential role for cyclic-AMP responsive element binding protein 1 (CREB) in the survival of acute lymphoblastic leukemia

    NARCIS (Netherlands)

    van der Sligte, Naomi E.; Kampen, Kim R.; ter Elst, Arja; Scherpen, Frank J. G.; Meeuwsen-de Boer, Tiny G. J.; Guryev, Victor; van Leeuwen, Frank N.; Kornblau, Steven M.; de Bont, Eveline S. J. M.

    2015-01-01

    Acute lymphoblastic leukemia (ALL) relapse remains a leading cause of cancer related death in children, therefore, new therapeutic options are needed. Recently, we showed that a peptide derived from Cyclic-AMP Responsive Element Binding Protein (CREB) was highly phosphorylated in pediatric

  3. Calculation of foundation response to spatially varying ground motion by finite element method

    International Nuclear Information System (INIS)

    Wang, F.; Gantenbein, F.

    1995-01-01

    This paper presents a general method to compute the response of a rigid foundation of arbitrary shape resting on a homogeneous or multilayered elastic soil when subjected to a spatially varying ground motion. The foundation response is calculated from the free-field ground motion and the contact tractions between the foundation and the soil. The spatial variation of ground motion in this study is introduced by a coherence function and the contact tractions are obtained numerically using the Finite Element Method in the process of calculating the dynamic compliance of the foundation. Applications of this method to a massless rigid disc supported on an elastic half space and to that founded on an elastic medium consisting of a layer of constant thickness supported on an elastic half space are described. The numerical results obtained are in very good agreement with analytical solutions published in the literature. (authors). 5 refs., 8 figs

  4. A 20 bp cis-acting element is both necessary and sufficient to mediate elicitor response of a maize PRms gene.

    Science.gov (United States)

    Raventós, D; Jensen, A B; Rask, M B; Casacuberta, J M; Mundy, J; San Segundo, B

    1995-01-01

    Transient gene expression assays in barley aleurone protoplasts were used to identify a cis-regulatory element involved in the elicitor-responsive expression of the maize PRms gene. Analysis of transcriptional fusions between PRms 5' upstream sequences and a chloramphenicol acetyltransferase reporter gene, as well as chimeric promoters containing PRms promoter fragments or repeated oligonucleotides fused to a minimal promoter, delineated a 20 bp sequence which functioned as an elicitor-response element (ERE). This sequence contains a motif (-246 AATTGACC) similar to sequences found in promoters of other pathogen-responsive genes. The analysis also indicated that an enhancing sequence(s) between -397 and -296 is required for full PRms activation by elicitors. The protein kinase inhibitor staurosporine was found to completely block the transcriptional activation induced by elicitors. These data indicate that protein phosphorylation is involved in the signal transduction pathway leading to PRms expression.

  5. Dissection of cis-regulatory element architecture of the rice oleosin gene promoters to assess abscisic acid responsiveness in suspension-cultured rice cells.

    Science.gov (United States)

    Kim, Sol; Lee, Soo-Bin; Han, Chae-Seong; Lim, Mi-Na; Lee, Sung-Eun; Yoon, In Sun; Hwang, Yong-Sic

    2017-08-01

    Oleosins are the most abundant proteins in the monolipid layer surrounding neutral storage lipids that form oil bodies in plants. Several lines of evidence indicate that they are physiologically important for the maintenance of oil body structure and for mobilization of the lipids stored inside. Rice has six oleosin genes in its genome, the expression of all of which was found to be responsive to abscisic acid (ABA) in our examination of mature embryo and aleurone tissues. The 5'-flanking region of OsOle5 was initially characterized for its responsiveness to ABA through a transient expression assay system using the protoplasts from suspension-cultured rice cells. A series of successive deletions and site-directed mutations identified five regions critical for the hormonal induction of its promoter activity. A search for cis-acting elements in these regions deposited in a public database revealed that they contain various promoter elements previously reported to be involved in the ABA response of various genes. A gain-of-function experiment indicated that multiple copies of all five regions were sufficient to provide the minimal promoter with a distinct ABA responsiveness. Comparative sequence analysis of the short, but still ABA-responsive, promoters of OsOle genes revealed no common modular architecture shared by them, indicating that various distinct promoter elements and independent trans-acting factors are involved in the ABA responsiveness of rice oleosin multigenes. Copyright © 2017 Elsevier GmbH. All rights reserved.

  6. Blast response of curved carbon/epoxy composite panels: Experimental study and finite-element analysis

    International Nuclear Information System (INIS)

    Phadnis, V A; Roy, A; Silberschmidt, V V; Kumar, P; Shukla, A

    2013-01-01

    Experimental and numerical studies were conducted to understand the effect of plate curvature on blast response of carbon/epoxy composite panels. A shock-tube system was utilized to impart controlled shock loading to quasi-isotropic composite panels with differing range of radii of curvatures. A 3D Digital Image Correlation (DIC) technique coupled with high-speed photography was used to obtain out-of-plane deflection and velocity, as well as in-plane strain on the back face of the panels. Macroscopic post-mortem analysis was performed to compare yielding and deformation in these panels. A dynamic computational simulation that integrates fluid-structure interaction was conducted to evaluate the panel response in general purpose finite-element software ABAQUS/Explicit. The obtained numerical results were compared to the experimental data and showed a good correlation

  7. An efficient finite element solution for gear dynamics

    International Nuclear Information System (INIS)

    Cooley, C G; Parker, R G; Vijayakar, S M

    2010-01-01

    A finite element formulation for the dynamic response of gear pairs is proposed. Following an established approach in lumped parameter gear dynamic models, the static solution is used as the excitation in a frequency domain solution of the finite element vibration model. The nonlinear finite element/contact mechanics formulation provides accurate calculation of the static solution and average mesh stiffness that are used in the dynamic simulation. The frequency domain finite element calculation of dynamic response compares well with numerically integrated (time domain) finite element dynamic results and previously published experimental results. Simulation time with the proposed formulation is two orders of magnitude lower than numerically integrated dynamic results. This formulation admits system level dynamic gearbox response, which may include multiple gear meshes, flexible shafts, rolling element bearings, housing structures, and other deformable components.

  8. First-principles study on the effect of alloying elements on the elastic deformation response in β-titanium alloys

    International Nuclear Information System (INIS)

    Gouda, Mohammed K.; Gepreel, Mohamed A. H.; Nakamura, Koichi

    2015-01-01

    Theoretical deformation response of hypothetical β-titanium alloys was investigated using first-principles calculation technique under periodic boundary conditions. Simulation was carried out on hypothetical 54-atom supercell of Ti–X (X = Cr, Mn, Fe, Zr, Nb, Mo, Al, and Sn) binary alloys. The results showed that the strength of Ti increases by alloying, except for Cr. The most effective alloying elements are Nb, Zr, and Mo in the current simulation. The mechanism of bond breaking was revealed by studying the local structure around the alloying element atom with respect to volume change. Moreover, the effect of alloying elements on bulk modulus and admissible strain was investigated. It was found that Zr, Nb, and Mo have a significant effect to enhance the admissible strain of Ti without change in bulk modulus

  9. Aeroelastic Response from Indicial Functions with a Finite Element Model of a Suspension Bridge

    Science.gov (United States)

    Mikkelsen, O.; Jakobsen, J. B.

    2017-12-01

    The present paper describes a comprehensive analysis of the aeroelastic bridge response in time-domain, with a finite element model of the structure. The main focus is on the analysis of flutter instability, accounting for the wind forces generated by the bridge motion, including twisting as well as vertical and horizontal translation, i.e. all three global degrees of freedom. The solution is obtained by direct integration of the equations of motion for the bridge-wind system, with motion-dependent forces approximated from flutter derivatives in terms of rational functions. For the streamlined bridge box-girder investigated, the motion dependent wind forces related to the along-wind response are found to have a limited influence on the flutter velocity. The flutter mode shapes in the time-domain and the frequency domain are consistent, and composed of the three lowest symmetrical vertical modes coupled with the first torsional symmetric mode. The method applied in this study provides detailed response estimates and contributes to an increased understanding of the complex aeroelastic behaviour of long-span bridges.

  10. Finite Element Modelling for Static and Free Vibration Response of Functionally Graded Beam

    Directory of Open Access Journals (Sweden)

    Ateeb Ahmad Khan

    Full Text Available Abstract A 1D Finite Element model for static response and free vibration analysis of functionally graded material (FGM beam is presented in this work. The FE model is based on efficient zig-zag theory (ZIGT with two noded beam element having four degrees of freedom at each node. Linear interpolation is used for the axial displacement and cubic hermite interpolation is used for the deflection. Out of a large variety of FGM systems available, Al/SiC and Ni/Al2O3 metal/ceramic FGM system has been chosen. Modified rule of mixture (MROM is used to calculate the young's modulus and rule of mixture (ROM is used to calculate density and poisson's ratio of FGM beam at any point. The MATLAB code based on 1D FE zigzag theory for FGM elastic beams is developed. A 2D FE model for the same elastic FGM beam has been developed using ABAQUS software. An 8-node biquadratic plane stress quadrilateral type element is used for modeling in ABAQUS. Three different end conditions namely simply-supported, cantilever and clamped- clamped are considered. The deflection, normal stress and shear stress has been reported for various models used. Eigen Value problem using subspace iteration method is solved to obtain un-damped natural frequencies and the corresponding mode shapes. The results predicted by the 1D FE model have been compared with the 2D FE results and the results present in open literature. This proves the correctness of the model. Finally, mode shapes have also been plotted for various FGM systems.

  11. cAMP response element binding protein (CREB activates transcription via two distinct genetic elements of the human glucose-6-phosphatase gene

    Directory of Open Access Journals (Sweden)

    Stefano Luisa

    2005-01-01

    Full Text Available Abstract Background The enzyme glucose-6-phosphatase catalyzes the dephosphorylation of glucose-6-phosphatase to glucose, the final step in the gluconeogenic and glycogenolytic pathways. Expression of the glucose-6-phosphatase gene is induced by glucocorticoids and elevated levels of intracellular cAMP. The effect of cAMP in regulating glucose-6-phosphatase gene transcription was corroborated by the identification of two genetic motifs CRE1 and CRE2 in the human and murine glucose-6-phosphatase gene promoter that resemble cAMP response elements (CRE. Results The cAMP response element is a point of convergence for many extracellular and intracellular signals, including cAMP, calcium, and neurotrophins. The major CRE binding protein CREB, a member of the basic region leucine zipper (bZIP family of transcription factors, requires phosphorylation to become a biologically active transcriptional activator. Since unphosphorylated CREB is transcriptionally silent simple overexpression studies cannot be performed to test the biological role of CRE-like sequences of the glucose-6-phosphatase gene. The use of a constitutively active CREB2/CREB fusion protein allowed us to uncouple the investigation of target genes of CREB from the variety of signaling pathways that lead to an activation of CREB. Here, we show that this constitutively active CREB2/CREB fusion protein strikingly enhanced reporter gene transcription mediated by either CRE1 or CRE2 derived from the glucose-6-phosphatase gene. Likewise, reporter gene transcription was enhanced following expression of the catalytic subunit of cAMP-dependent protein kinase (PKA in the nucleus of transfected cells. In contrast, activating transcription factor 2 (ATF2, known to compete with CREB for binding to the canonical CRE sequence 5'-TGACGTCA-3', did not transactivate reporter genes containing CRE1, CRE2, or both CREs derived from the glucose-6-phosphatase gene. Conclusions Using a constitutively active CREB2

  12. Quality assessment of structure and language elements of written responses given by seven Scandinavian drug information centres

    DEFF Research Database (Denmark)

    Reppe, Linda Amundstuen; Spigset, Olav; Kampmann, Jens Peter

    2017-01-01

    PURPOSE: The aim of this study was to identify structure and language elements affecting the quality of responses from Scandinavian drug information centres (DICs). METHODS: Six different fictitious drug-related queries were sent to each of seven Scandinavian DICs. The centres were blinded for wh...... on drug-related queries with respect to language and text structure. Giving specific advice and precise conclusions and avoiding too compressed language and non-standard abbreviations may aid to reach this goal....... of responses was generally judged as satisfactory to good. Presenting specific advice and conclusions were considered to improve the quality of the responses. However, small nuances in language formulations could affect the individual judgments of the experts, e.g. on whether or not advice was given. Some...... and explaining pharmacological terms to ensure that enquirers understand the response as intended. In addition, more use of active voice and less compressed text structure would be desirable. CONCLUSIONS: This evaluation of responses to DIC queries may give some indications on how to improve written responses...

  13. Growth and Tissue Elemental Composition Response of Butterhead Lettuce (Lactuca sativa, cv. Flandria to Hydroponic and Aquaponic Conditions

    Directory of Open Access Journals (Sweden)

    Tyler S. Anderson

    2017-07-01

    Full Text Available The primary objective of this research was to compare lettuce performance under conventional hydroponics at pH 5.8 (referred to as H5, hydroponics at pH 7.0 (referred to as H7, and recirculated aquaponic water at pH 7.0 (referred to as A7. Aquaponic nutrients were supplied by continuously recirculating water between a fish rearing system (recirculating aquaculture system or RAS and the lettuce growing system (with the sole addition being chelated iron. This paper builds upon our previous research where we found that H7 produced 26% less shoot fresh weight (FW growth than H5 and an 18% reduction in dry weight (DW. In this research, we also evaluated the inorganic hydroponics nutrient solution at pH 7.0 (H7 to provide continuity between experiments and to isolate the pH effect. The A7 plant biomass responses were not different from H5 in all biomass response categories. H7 was different from H5 in shoot FW, DW, and DW/FW, as well as root FW and DW. H7 was different from the A7 in shoot FW, DW/FW, and root DW. There were no tissue elemental differences between H5 and H7 except Cu. The Ca and Na contents differed between H5 and A7, while the microelements Mn, Mo, and Zn differed. Generally, the elemental tissue differences between treatments were proportional to the differences for the same elements in the nutrient solutions. Aquaponic systems are often viewed to be more complicated and more risky because two complex systems are being joined (hydroponics plus RAS. However, the aquaponics system proved to be surprisingly simple to manage in daily operations. Our data suggested that the aquaponics system (A7, which was operated at a higher pH 7.0, was able to offset any negative biomass and elemental effects that occurred in the inorganic hydroponic pH 7.0 treatment (H7 from its increased pH and less optimized nutrient solution elemental concentrations.

  14. Modeling 3D PCMI using the Extended Finite Element Method with higher order elements

    Energy Technology Data Exchange (ETDEWEB)

    Jiang, W. [Idaho National Lab. (INL), Idaho Falls, ID (United States); Spencer, Benjamin W. [Idaho National Lab. (INL), Idaho Falls, ID (United States)

    2017-03-31

    This report documents the recent development to enable XFEM to work with higher order elements. It also demonstrates the application of higher order (quadratic) elements to both 2D and 3D models of PCMI problems, where discrete fractures in the fuel are represented using XFEM. The modeling results demonstrate the ability of the higher order XFEM to accurately capture the effects of a crack on the response in the vicinity of the intersecting surfaces of cracked fuel and cladding, as well as represent smooth responses in the regions away from the crack.

  15. Effects of gamma irradiation on the DNA-protein complex between the estrogen response element and the estrogen receptor

    Czech Academy of Sciences Publication Activity Database

    Štísová, Viktorie; Goffinont, S.; Maurizot, M. S.; Davídková, Marie

    2010-01-01

    Roč. 79, č. 8 (2010), s. 880-889 ISSN 0969-806X R&D Projects: GA MŠk 1P05OC085; GA MŠk OC09012 Institutional research plan: CEZ:AV0Z10480505 Keywords : DNA-protein complex * estrogen response element * estrogen receptor * ionizing radiation Subject RIV: BO - Biophysics Impact factor: 1.132, year: 2010

  16. ZAP-70 and p72syk are signaling response elements through MHC class II molecules

    DEFF Research Database (Denmark)

    Kanner, S B; Grosmaire, L S; Blake, J

    1995-01-01

    Ligation of major histocompatibility complex (MHC) class II antigens expressed on antigen-activated human CD4+ T-lymphocytes induces early signal transduction events including the activation of tyrosine kinases, the tyrosine phosphorylation of phospholipase-C gamma 1 and the mobilization...... of intracellular calcium. Similar responses have been observed in B-cells following stimulation of MHC class II molecules, including the increased production of intracellular cAMP. In this report, we demonstrate that the ZAP-70 tyrosine kinase is a responsive signaling element following cross-linking of HLA...... by herbimycin A. MHC class II ligation on B-lymphocytes resulted in cell death, which was both qualitatively distinct from Fas-induced apoptosis and partially protected by herbimycin A pretreatment. Thus, ligation of MHC class II molecules expressed on human lymphocytes stimulates the ZAP-70/p72syk family...

  17. The Use of Sparse Direct Solver in Vector Finite Element Modeling for Calculating Two Dimensional (2-D) Magnetotelluric Responses in Transverse Electric (TE) Mode

    Science.gov (United States)

    Yihaa Roodhiyah, Lisa’; Tjong, Tiffany; Nurhasan; Sutarno, D.

    2018-04-01

    The late research, linear matrices of vector finite element in two dimensional(2-D) magnetotelluric (MT) responses modeling was solved by non-sparse direct solver in TE mode. Nevertheless, there is some weakness which have to be improved especially accuracy in the low frequency (10-3 Hz-10-5 Hz) which is not achieved yet and high cost computation in dense mesh. In this work, the solver which is used is sparse direct solver instead of non-sparse direct solverto overcome the weaknesses of solving linear matrices of vector finite element metod using non-sparse direct solver. Sparse direct solver will be advantageous in solving linear matrices of vector finite element method because of the matrix properties which is symmetrical and sparse. The validation of sparse direct solver in solving linear matrices of vector finite element has been done for a homogen half-space model and vertical contact model by analytical solution. Thevalidation result of sparse direct solver in solving linear matrices of vector finite element shows that sparse direct solver is more stable than non-sparse direct solver in computing linear problem of vector finite element method especially in low frequency. In the end, the accuracy of 2D MT responses modelling in low frequency (10-3 Hz-10-5 Hz) has been reached out under the efficient allocation memory of array and less computational time consuming.

  18. Two estrogen response element sequences near the PCNA gene are not responsible for its estrogen-enhanced expression in MCF7 cells.

    Science.gov (United States)

    Wang, Cheng; Yu, Jie; Kallen, Caleb B

    2008-01-01

    The proliferating cell nuclear antigen (PCNA) is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE) sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2) enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2. Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays. We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.

  19. New advances in the forced response computation of periodic structures using the wave finite element (WFE) method

    OpenAIRE

    Mencik , Jean-Mathieu

    2014-01-01

    International audience; The wave finite element (WFE) method is investigated to describe the harmonic forced response of onedimensional periodic structures like those composed of complex substructures and encountered in engineering applications. The dynamic behavior of these periodic structures is analyzed over wide frequency bands where complex spatial dynamics, inside the substructures, are likely to occur.Within theWFE framework, the dynamic behavior of periodic structures is described in ...

  20. Degradation by radiation of the response of a thermocouple of a fuel element

    International Nuclear Information System (INIS)

    Rodriguez V, A.

    1994-01-01

    In the TRIGA Mark III Reactor of the National Institute of Nuclear Research, is necessary to use an instrumented fuel element for measurement the fuel temperature during pulses of power. This fuel element is exposed to daily temperature gradient of order to 390 Centigrade degrees in normal condition of reactor operation at 1 MW. The experience which this instrumented fuel elements is that useful life of the thermocouples is less then the fuel, because they show important changes in their chemistry composition and electrical specifications, until the point they don't give any response. So is necessary to know the factors that influenced in the shortening of the thermocouples life. The change in composition affects the thermocouple calibration depends on where the changes take place relative to the temperature gradient. The change will be dependent on the neutron flux and so the value of the neutron flux may be used as a measure or the composition change. If there is no neutron flux within the temperature gradient, there will be no composition change, and so the thermocouple calibration will no change. If the neutron flux varies within the region in which a temperature gradients exists, the composition of the thermocouple will vary and the calibration will change. But the maximum change in calibration will occur if the neutron flux is high and constant within the region of the temperature gradient. In this case, a composition change takes place which is uniform throughout the gradient and so the emf output can be expected to change. In this reactor, the thermocouples are in the second case. Then, the relative position of the thermal and neutron flux gradients are the most important factor that explain the composition change after or 2,500 times of exposing the thermocouples to the temperature gradients of order to 390 Centigrade degrees. (Author)

  1. Regulation of CYP3A4 by pregnane X receptor: The role of nuclear receptors competing for response element binding

    Energy Technology Data Exchange (ETDEWEB)

    Istrate, Monica A., E-mail: monicai@scripps.edu [Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, Stuttgart, Germany, and University of Tuebingen, Auerbachstr. 112, D-70376 Stuttgart (Germany); Nussler, Andreas K., E-mail: nuessler@uchir.me.tum.de [Department of Traumatology, Technical University Munich, Ismaningerstr. 22, 81675 Munich (Germany); Eichelbaum, Michel, E-mail: michel.eichelbaum@ikp-stuttgart.de [Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, Stuttgart, Germany, and University of Tuebingen, Auerbachstr. 112, D-70376 Stuttgart (Germany); Burk, Oliver, E-mail: oliver.burk@ikp-stuttgart.de [Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, Stuttgart, Germany, and University of Tuebingen, Auerbachstr. 112, D-70376 Stuttgart (Germany)

    2010-03-19

    Induction of the major drug metabolizing enzyme CYP3A4 by xenobiotics contributes to the pronounced interindividual variability of its expression and often results in clinically relevant drug-drug interactions. It is mainly mediated by PXR, which regulates CYP3A4 expression by binding to several specific elements in the 5' upstream regulatory region of the gene. Induction itself shows a marked interindividual variability, whose underlying determinants are only partly understood. In this study, we investigated the role of nuclear receptor binding to PXR response elements in CYP3A4, as a potential non-genetic mechanism contributing to interindividual variability of induction. By in vitro DNA binding experiments, we showed that several nuclear receptors bind efficiently to the proximal promoter ER6 and distal xenobiotic-responsive enhancer module DR3 motifs. TR{alpha}1, TR{beta}1, COUP-TFI, and COUP-TFII further demonstrated dose-dependent repression of PXR-mediated CYP3A4 enhancer/promoter reporter activity in transient transfection in the presence and absence of the PXR inducer rifampin, while VDR showed this effect only in the absence of treatment. By combining functional in vitro characterization with hepatic expression analysis, we predict that TR{alpha}1, TR{beta}1, COUP-TFI, and COUP-TFII show a strong potential for the repression of PXR-mediated activation of CYP3A4 in vivo. In summary, our results demonstrate that nuclear receptor binding to PXR response elements interferes with PXR-mediated expression and induction of CYP3A4 and thereby contributes to the interindividual variability of induction.

  2. Interaction between two cis-acting elements, ABRE and DRE, in ABA-dependent expression of Arabidopsis rd29A gene in response to dehydration and high-salinity stresses.

    Science.gov (United States)

    Narusaka, Yoshihiro; Nakashima, Kazuo; Shinwari, Zabta K; Sakuma, Yoh; Furihata, Takashi; Abe, Hiroshi; Narusaka, Mari; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko

    2003-04-01

    Many abiotic stress-inducible genes contain two cis-acting elements, namely a dehydration-responsive element (DRE; TACCGACAT) and an ABA-responsive element (ABRE; ACGTGG/TC), in their promoter regions. We precisely analyzed the 120 bp promoter region (-174 to -55) of the Arabidopsis rd29A gene whose expression is induced by dehydration, high-salinity, low-temperature, and abscisic acid (ABA) treatments and whose 120 bp promoter region contains the DRE, DRE/CRT-core motif (A/GCCGAC), and ABRE sequences. Deletion and base substitution analyses of this region showed that the DRE-core motif functions as DRE and that the DRE/DRE-core motif could be a coupling element of ABRE. Gel mobility shift assays revealed that DRE-binding proteins (DREB1s/CBFs and DREB2s) bind to both DRE and the DRE-core motif and that ABRE-binding proteins (AREBs/ABFs) bind to ABRE in the 120 bp promoter region. In addition, transactivation experiments using Arabidopsis leaf protoplasts showed that DREBs and AREBs cumulatively transactivate the expression of a GUS reporter gene fused to the 120 bp promoter region of rd29A. These results indicate that DRE and ABRE are interdependent in the ABA-responsive expression of the rd29A gene in response to ABA in Arabidopsis.

  3. An IFNG SNP with an estrogen-like response element selectively enhances promoter expression in peripheral but not lamina propria T cells.

    Science.gov (United States)

    Gonsky, R; Deem, R L; Bream, J H; Young, H A; Targan, S R

    2006-07-01

    This study examines mucosa-specific regulatory pathways involved in modulation of interferon-gamma (IFN-gamma) in lamina propria T cells. Previous studies identified mucosa-specific CD2 cis-elements within the -204 to -108 bp IFNG promoter. Within this region, a single-site nucleotide polymorphism, -179G/T, imparts tumor necrosis factor-alpha stimulation of IFNG in peripheral blood lymphocytes, and is linked with accelerated AIDS progression. We discovered a putative estrogen response element (ERE) introduced by the -179T, which displays selective activation in peripheral blood mononuclear cells (PBMC) vs lamina propria mononuclear cells (LPMC). Transfection of PBMC with constructs containing the -179G or -179T site revealed CD2-mediated enhancement of the -179T compared to -179G allele, although, in LPMC, a similar level of expression was detected. Electrophoretic mobility shift assay (EMSA) analysis demonstrated CD2-mediated nucleoprotein binding to the -179T but not the -179G in PBMC. In LPMC, binding is constitutive to both -179G and -179T regions. Sequence and EMSA analysis suggests that the -179T allele creates an ERE-like binding site capable of binding recombinant estrogen receptor. Estrogen response element transactivation is enhanced by CD2 signaling, but inhibited by estrogen in PBMC but not in LPMC, although expression of estrogen receptor was similar. This is the first report to describe a potential molecular mechanism responsible for selectively controlling IFN-gamma production in LPMC.

  4. Finite element analysis of structural response of superconducting magnet for a fusion reactor

    International Nuclear Information System (INIS)

    Reich, M.; Powell, J.; Bezler, P.; Chang, T.Y.; Prachuktam, S.

    1975-01-01

    In the proposal Tokamak fusion reactor, the superconducting unit consists of an assembly of D-shaped magnets standing vertically and arranged in a toroidal configuration. Each magnet is a composite structure comprised of Nb-22%Ti and Nb-48%Ti, and stabilizing metals such as copper and aluminum or stainless steel held together by reinforced epoxies which also serve as insulators and spacers. The magnets are quite large, typically 15-20 meters in diameter with rectangular cross sections around 0.93x2m. Under static loading condition, the magnet is subjected to dead weight and large magnetic field forces, which may induce high stresses in the structure. Furthermore, additional stresses due to earthquake must also be considered for the design of the component. Both static and dynamic analyses of a typical field magnet have been performed by use of the finite element method. The magnet was assumed to be linearly elastic with equivalent homogeneous material properties. Various finite element models have been considered in order to better represent the structure for a particular loading case. For earthquake analysis, the magnet was assumed to be subjected to 50% of the El Centro 1940 earthquake and the dynamic response was obtained by the displacement spectrum analysis procedure. In the paper, numerical results are presented and the structure behavior of the magnet under static and dynamic loading conditions is discussed

  5. Transcriptional activation of rat creatine kinase B by 17beta-estradiol in MCF-7 cells involves an estrogen responsive element and GC-rich sites.

    Science.gov (United States)

    Wang, F; Samudio, I; Safe, S

    2001-01-01

    The rat creatine kinase B (CKB) gene is induced by estrogen in the uterus, and constructs containing rat CKB gene promoter inserts are highly estrogen-responsive in cell culture. Analysis of the upstream -568 to -523 region of the promoter in HeLa cells has identified an imperfect palindromic estrogen response element (ERE) that is required for hormone inducibility. Analysis of the CKB gene promoter in MCF-7 breast cancer cells confirmed that pCKB7 (containing the -568 to -523 promoter insert) was estrogen-responsive in transient transfection studies. However, mutation and deletion analysis of this region of the promoter showed that two GC-rich sites and the concensus ERE were functional cis-elements that bound estrogen receptor alpha (ERalpha)/Sp1 and ERalpha proteins, respectively. The role of these elements was confirmed in gel mobility shift and chromatin immunoprecipitation assays and transfection studies in MDA-MB-231 and Schneider Drosophila SL-2 cells. These results show that transcriptional activation of CKB by estrogen is dependent, in part, on ERalpha/Sp1 action which is cell context-dependent. Copyright 2001 Wiley-Liss, Inc.

  6. The role of the glucose-sensing transcription factor carbohydrate-responsive element-binding protein pathway in termite queen fertility

    Czech Academy of Sciences Publication Activity Database

    Sillam-Dusses, D.; Hanus, Robert; Poulsen, M.; Roy, V.; Favier, M.; Vasseur-Cognet, M.

    2016-01-01

    Roč. 6, č. 5 (2016), č. článku 160080. ISSN 2046-2441 R&D Projects: GA ČR(CZ) GA14-12774S Institutional support: RVO:61388963 Keywords : reproduction * phenotypic plasticity * carbohydrate-responsive element-binding protein * transcription factor * social insects * lipogenesis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.481, year: 2016 http://rsob.royalsocietypublishing.org/content/6/5/160080

  7. Two estrogen response element sequences near the PCNA gene are not responsible for its estrogen-enhanced expression in MCF7 cells.

    Directory of Open Access Journals (Sweden)

    Cheng Wang

    Full Text Available The proliferating cell nuclear antigen (PCNA is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2 enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2.Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays.We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.

  8. Lichen Parmelia sulcata time response model to environmental elemental availability

    International Nuclear Information System (INIS)

    Reis, M.A.; Alves, L.C.; Freitas, M.C.; Os, B. van; Wolterbeek, H.Th.

    2000-01-01

    Transplants of lichen Parmelia sulcata collected in an area previously identified as non polluted, were placed at six stations, five of which were near Power Plants and the other in an area expected to be a remote station. Together with the lichen transplants, two total deposition collection buckets and an aerosol sampler were installed. Lichens were recollected two every month from each station. At the same time the water collection buckets were replaced by new ones. The aerosol sampler filter was replaced every week, collection being effective only for 10 minutes out of every two hours; in the remote station aerosol filters were replaced only once a month, the collection rate being kept. Each station was run for a period of one year. Both lichens and aerosol filters were analysed by PIXE and INAA at ITN. Total deposition samples were dried under an infrared lamp, and afterwards acid digested and analysed by ICP-MS at the National Geological Survey of The Netherlands. Data for the three types of samples were then produced for a total of 16 elements. In this work we used the data set thus obtained to test a model for the time response of lichen Parmelia sulcata to a new environment. (author)

  9. A distal ABA responsive element in AtNCED3 promoter is required for positive feedback regulation of ABA biosynthesis in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Yan-Zhuo Yang

    Full Text Available The plant hormone abscisic acid (ABA plays a crucial role in plant development and responses to abiotic stresses. Recent studies indicate that a positive feedback regulation by ABA exists in ABA biosynthesis in plants under dehydration stress. To understand the molecular basis of this regulation, we analyzed the cis-elements of the AtNCED3 promoter in Arabidopsis. AtNCED3 encodes the first committed and highly regulated dioxygenase in the ABA biosynthetic pathway. Through delineated and mutagenesis analyses in stable-transformed Arabidopsis, we revealed that a distal ABA responsive element (ABRE: GGCACGTG, -2372 to -2364 bp is required for ABA-induced AtNCED3 expression. By analyzing the AtNCED3 expression in ABRE binding protein ABF3 over-expression transgenic plants and knock-out mutants, we provide evidence that the ABA feedback regulation of AtNCED3 expression is not mediated by ABF3.

  10. A distal ABA responsive element in AtNCED3 promoter is required for positive feedback regulation of ABA biosynthesis in Arabidopsis.

    Science.gov (United States)

    Yang, Yan-Zhuo; Tan, Bao-Cai

    2014-01-01

    The plant hormone abscisic acid (ABA) plays a crucial role in plant development and responses to abiotic stresses. Recent studies indicate that a positive feedback regulation by ABA exists in ABA biosynthesis in plants under dehydration stress. To understand the molecular basis of this regulation, we analyzed the cis-elements of the AtNCED3 promoter in Arabidopsis. AtNCED3 encodes the first committed and highly regulated dioxygenase in the ABA biosynthetic pathway. Through delineated and mutagenesis analyses in stable-transformed Arabidopsis, we revealed that a distal ABA responsive element (ABRE: GGCACGTG, -2372 to -2364 bp) is required for ABA-induced AtNCED3 expression. By analyzing the AtNCED3 expression in ABRE binding protein ABF3 over-expression transgenic plants and knock-out mutants, we provide evidence that the ABA feedback regulation of AtNCED3 expression is not mediated by ABF3.

  11. Transposable elements in cancer.

    Science.gov (United States)

    Burns, Kathleen H

    2017-07-01

    Transposable elements give rise to interspersed repeats, sequences that comprise most of our genomes. These mobile DNAs have been historically underappreciated - both because they have been presumed to be unimportant, and because their high copy number and variability pose unique technical challenges. Neither impediment now seems steadfast. Interest in the human mobilome has never been greater, and methods enabling its study are maturing at a fast pace. This Review describes the activity of transposable elements in human cancers, particularly long interspersed element-1 (LINE-1). LINE-1 sequences are self-propagating, protein-coding retrotransposons, and their activity results in somatically acquired insertions in cancer genomes. Altered expression of transposable elements and animation of genomic LINE-1 sequences appear to be hallmarks of cancer, and can be responsible for driving mutations in tumorigenesis.

  12. Spatially dependent burnup implementation into the nodal program based on the finite element response matrix method

    International Nuclear Information System (INIS)

    Yoriyaz, H.

    1986-01-01

    In this work a spatial burnup scheme and feedback effects has been implemented into the FERM ( 'Finite Element Response Matrix' )program. The spatially dependent neutronic parameters have been considered in three levels: zonewise calculation, assembly wise calculation and pointwise calculation. Flux and power distributions and the multiplication factor were calculated and compared with the results obtained by CITATIOn program. These comparisons showed that processing time in the Ferm code has been hundred of times shorter and no significant difference has been observed in the assembly average power distribution. (Author) [pt

  13. Capacity for cooperative binding of thyroid hormone (T3) receptor dimers defines wild type T3 response elements.

    Science.gov (United States)

    Brent, G A; Williams, G R; Harney, J W; Forman, B M; Samuels, H H; Moore, D D; Larsen, P R

    1992-04-01

    Thyroid hormone response elements (T3REs) have been identified in a variety of promoters including those directing expression of rat GH (rGH), alpha-myosin heavy chain (rMHC), and malic enzyme (rME). A detailed biochemical and genetic analysis of the rGH element has shown that it consists of three hexamers related to the consensus [(A/G)GGT(C/A)A]. We have extended this analysis to the rMHC and rME elements. Binding of highly purified thyroid hormone receptor (T3R) to T3REs was determined using the gel shift assay, and thyroid hormone (T3) induction was measured in transient tranfections. We show that the wild type version of each of the three elements binds T3R dimers cooperatively. Mutational analysis of the rMHC and rME elements identified domains important for binding T3R dimers and allowed a direct determination of the relationship between T3R binding and function. In each element two hexamers are required for dimer binding, and mutations that interfere with dimer formation significantly reduce T3 induction. Similar to the rGH element, the rMHC T3RE contains three hexameric domains arranged as a direct repeat followed by an inverted copy, although the third domain is weaker than in rGH. All three are required for full function and T3R binding. The rME T3RE is a two-hexamer direct repeat T3RE, which also binds T3R monomer and dimer. Across a series of mutant elements, there was a strong correlation between dimer binding in vitro and function in vivo for rMHC (r = 0.99, P less than 0.01) and rME (r = 0.67, P less than 0.05) T3REs. Our results demonstrate a similar pattern of T3R dimer binding to a diverse array of hexameric sequences and arrangements in three wild type T3REs. Addition of nuclear protein enhanced T3R binding but did not alter the specificity of binding to wild type or mutant elements. Binding of purified T3R to T3REs was highly correlated with function, both with and without the addition of nuclear protein. T3R dimer formation is the common

  14. Identification of the G13 (cAMP-response-element-binding protein-related protein) gene product related to activating transcription factor 6 as a transcriptional activator of the mammalian unfolded protein response.

    Science.gov (United States)

    Haze, K; Okada, T; Yoshida, H; Yanagi, H; Yura, T; Negishi, M; Mori, K

    2001-04-01

    Eukaryotic cells control the levels of molecular chaperones and folding enzymes in the endoplasmic reticulum (ER) by a transcriptional induction process termed the unfolded protein response (UPR). The mammalian UPR is mediated by the cis-acting ER stress response element consisting of 19 nt (CCAATN(9)CCACG), the CCACG part of which is considered to provide specificity. We recently identified the basic leucine zipper (bZIP) protein ATF6 as a mammalian UPR-specific transcription factor; ATF6 is activated by ER stress-induced proteolysis and binds directly to CCACG. Here we report that eukaryotic cells express another bZIP protein closely related to ATF6 in both structure and function. This protein encoded by the G13 (cAMP response element binding protein-related protein) gene is constitutively synthesized as a type II transmembrane glycoprotein anchored in the ER membrane and processed into a soluble form upon ER stress as occurs with ATF6. The proteolytic processing of ATF6 and the G13 gene product is accompanied by their relocation from the ER to the nucleus; their basic regions seem to function as a nuclear localization signal. Overexpression of the soluble form of the G13 product constitutively activates the UPR, whereas overexpression of a mutant lacking the activation domain exhibits a strong dominant-negative effect. Furthermore, the soluble forms of ATF6 and the G13 gene product are unable to bind to several point mutants of the cis-acting ER stress response element in vitro that hardly respond to ER stress in vivo. We thus concluded that the two related bZIP proteins are crucial transcriptional regulators of the mammalian UPR, and propose calling the ATF6 gene product ATF6alpha and the G13 gene product ATF6beta.

  15. Coherence of reactor design and fuel element design

    International Nuclear Information System (INIS)

    Vom Scheidt, S.

    1995-01-01

    Its background of more than 25 years of experience makes Framatome the world's leading company in the design and sales of fuel elements for pressurized water reactors (PWR). In 1994, the fuel fabrication units were incorporated as subsidiaries, which further strengthens the company's position. The activities in the fuel sector comprise fuel element design, selection and sourcing of materials, fuel element fabrication, and the services associated with nuclear fuel. Design responsibility lies with the Design and sales Management, which closely cooperates with the engineers of the reactor plant for which the fuel elements are being designed, for fuel elements are inseparable parts of the respective reactors. The Design and Sales Management also has developed a complete line of services associated with fuel element inspection and repair. As far as fuel element sales are concerned, Framatome delivers the first core in order to be able to assume full responsibility vis-a-vis the customer for the performance of the nuclear steam supply system. Reloads are sold through the Fragema Association established by Framatome and Cogema. (orig.) [de

  16. The transient response for different types of erodable surface thermocouples using finite element analysis

    Directory of Open Access Journals (Sweden)

    Mohammed Hussein

    2007-01-01

    Full Text Available The transient response of erodable surface thermocouples has been numerically assessed by using a two dimensional finite element analysis. Four types of base metal erodable surface thermocouples have been examined in this study, included type-K (alumel-chromel, type-E (chromel-constantan, type-T (copper-constantan, and type-J (iron-constantan with 50 mm thick- ness for each. The practical importance of these types of thermocouples is to be used in internal combustion engine studies and aerodynamics experiments. The step heat flux was applied at the surface of the thermocouple model. The heat flux from the measurements of the surface temperature can be commonly identified by assuming that the heat transfer within these devices is one-dimensional. The surface temperature histories at different positions along the thermocouple are presented. The normalized surface temperature histories at the center of the thermocouple for different types at different response time are also depicted. The thermocouple response to different heat flux variations were considered by using a square heat flux with 2 ms width, a sinusoidal surface heat flux variation width 10 ms period and repeated heat flux variation with 2 ms width. The present results demonstrate that the two dimensional transient heat conduction effects have a significant influence on the surface temperature history measurements made with these devices. It was observed that the surface temperature history and the transient response for thermocouple type-E are higher than that for other types due to the thermal properties of this thermocouple. It was concluded that the thermal properties of the surrounding material do have an impact, but the properties of the thermocouple and the insulation materials also make an important contribution to the net response.

  17. Adaptive response of arbuscular mycorrhizal symbiosis to accumulation of elements and translocation in Phragmites australis affected by cadmium stress.

    Science.gov (United States)

    Huang, Xiaochen; Ho, Shih-Hsin; Zhu, Shishu; Ma, Fang; Wu, Jieting; Yang, Jixian; Wang, Li

    2017-07-15

    Arbuscular mycorrhizal (AM) fungi have been reported to play a central role in improving plant tolerance to cadmium (Cd)-contaminated sites. This is achieved by enhancing both the growth of host plants and the nutritive elements in plants. This study assessed potential regulatory effects of AM symbiosis with regard to nutrient uptake and transport, and revealed different response strategies to various Cd concentrations. Phragmites australis was inoculated with Rhizophagus irregularis in the greenhouse cultivation system, where it was treated with 0-20 mg L -1 of Cd for 21days to investigate growth parameters, as well as Cd and nutritive element distribution in response to AM fungus inoculation. Mycorrhizal plants showed a higher tolerance, particularly under high Cd-level stress in the substrate. Moreover, our results determined the roots as dominant Cd reservoirs in plants. The AM fungus improved Cd accumulation and saturated concentration in the roots, thus inhibiting Cd uptake to shoots. The observed distributions of nutritive elements and the interactions among these indicated the highest microelement contribution to roots, Ca contributed maximally in leaves, and K and P contributed similarly under Cd stress. In addition, AM fungus inoculation effectively impacted Mn and P uptake and accumulation while coping with Cd toxicity. This study also demonstrated translocation factor from metal concentration (TF) could be a good parameter to evaluate different transportation strategies induced by various Cd stresses in contrast to the bioconcentration factor (BCF) and translocation factor from metal accumulation (TF'). Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Distinctly different dynamics and kinetics of two steroid receptors at the same response elements in living cells.

    Directory of Open Access Journals (Sweden)

    Hatice Z Nenseth

    Full Text Available Closely related transcription factors (TFs can bind to the same response elements (REs with similar affinities and activate transcription. However, it is unknown whether transcription is similarly orchestrated by different TFs bound at the same RE. Here we have compared the recovery half time (t1/2, binding site occupancy and the resulting temporal changes in transcription upon binding of two closely related steroid receptors, the androgen and glucocorticoid receptors (AR and GR, to their common hormone REs (HREs. We show that there are significant differences at all of these levels between AR and GR at the MMTV HRE when activated by their ligands. These data show that two TFs bound at the same RE can have significantly different modes of action that can affect their responses to environmental cues.

  19. Hermitian Mindlin Plate Wavelet Finite Element Method for Load Identification

    Directory of Open Access Journals (Sweden)

    Xiaofeng Xue

    2016-01-01

    Full Text Available A new Hermitian Mindlin plate wavelet element is proposed. The two-dimensional Hermitian cubic spline interpolation wavelet is substituted into finite element functions to construct frequency response function (FRF. It uses a system’s FRF and response spectrums to calculate load spectrums and then derives loads in the time domain via the inverse fast Fourier transform. By simulating different excitation cases, Hermitian cubic spline wavelets on the interval (HCSWI finite elements are used to reverse load identification in the Mindlin plate. The singular value decomposition (SVD method is adopted to solve the ill-posed inverse problem. Compared with ANSYS results, HCSWI Mindlin plate element can accurately identify the applied load. Numerical results show that the algorithm of HCSWI Mindlin plate element is effective. The accuracy of HCSWI can be verified by comparing the FRF of HCSWI and ANSYS elements with the experiment data. The experiment proves that the load identification of HCSWI Mindlin plate is effective and precise by using the FRF and response spectrums to calculate the loads.

  20. Nuclear toxicology file: cell response to the steady or radioactive chemical elements exposure; Dossier toxicologie nucleaire: reponse cellulaire a l'exposition aux elements chimiques stables ou radioactifs

    Energy Technology Data Exchange (ETDEWEB)

    Lopez, B.S.; Saintigny, Y. [Centre National de la Recherche Scientifique (CNRS), Sciences du Vivant, UMR 217, 92 - Fontenay aux Roses (France); CEA Fontenay aux Roses, IRCM, UMR 217, 92 (France); Adam, Ch. [Institut de Radioprotection et de Surete Nucleaire (IRSN:DEI/SECRE), Lab. de Radioecologie et d' Ecotoxicologie, 13 - Saint-Paul-lez-Durance (France)

    2008-09-15

    The cellular response to an exposure in a toxic element is made at different levels. The first level is the agent detoxication by its elimination or its neutralization. The second level is the repair of the damages caused by this agent (for example the DNA repair). The third level is the control of the cellular death programmed to eliminate the irreparably damaged cells.Finally, the hurt cell can inform the nearby cells by producing molecular effectors inducing an abscopal or bystander effect. (N.C.)

  1. Quantitative analysis of polycomb response elements (PREs at identical genomic locations distinguishes contributions of PRE sequence and genomic environment

    Directory of Open Access Journals (Sweden)

    Okulski Helena

    2011-03-01

    Full Text Available Abstract Background Polycomb/Trithorax response elements (PREs are cis-regulatory elements essential for the regulation of several hundred developmentally important genes. However, the precise sequence requirements for PRE function are not fully understood, and it is also unclear whether these elements all function in a similar manner. Drosophila PRE reporter assays typically rely on random integration by P-element insertion, but PREs are extremely sensitive to genomic position. Results We adapted the ΦC31 site-specific integration tool to enable systematic quantitative comparison of PREs and sequence variants at identical genomic locations. In this adaptation, a miniwhite (mw reporter in combination with eye-pigment analysis gives a quantitative readout of PRE function. We compared the Hox PRE Frontabdominal-7 (Fab-7 with a PRE from the vestigial (vg gene at four landing sites. The analysis revealed that the Fab-7 and vg PREs have fundamentally different properties, both in terms of their interaction with the genomic environment at each site and their inherent silencing abilities. Furthermore, we used the ΦC31 tool to examine the effect of deletions and mutations in the vg PRE, identifying a 106 bp region containing a previously predicted motif (GTGT that is essential for silencing. Conclusions This analysis showed that different PREs have quantifiably different properties, and that changes in as few as four base pairs have profound effects on PRE function, thus illustrating the power and sensitivity of ΦC31 site-specific integration as a tool for the rapid and quantitative dissection of elements of PRE design.

  2. Plant-soil distribution of potentially toxic elements in response to elevated atmospheric CO2.

    Science.gov (United States)

    Duval, Benjamin D; Dijkstra, Paul; Natali, Susan M; Megonigal, J Patrick; Ketterer, Michael E; Drake, Bert G; Lerdau, Manuel T; Gordon, Gwyneth; Anbar, Ariel D; Hungate, Bruce A

    2011-04-01

    The distribution of contaminant elements within ecosystems is an environmental concern because of these elements' potential toxicity to animals and plants and their ability to hinder microbial ecosystem services. As with nutrients, contaminants are cycled within and through ecosystems. Elevated atmospheric CO2 generally increases plant productivity and alters nutrient element cycling, but whether CO2 causes similar effects on the cycling of contaminant elements is unknown. Here we show that 11 years of experimental CO2 enrichment in a sandy soil with low organic matter content causes plants to accumulate contaminants in plant biomass, with declines in the extractable contaminant element pools in surface soils. These results indicate that CO2 alters the distribution of contaminant elements in ecosystems, with plant element accumulation and declining soil availability both likely explained by the CO2 stimulation of plant biomass. Our results highlight the interdependence of element cycles and the importance of taking a broad view of the periodic table when the effects of global environmental change on ecosystem biogeochemistry are considered.

  3. Mechanism Profiling of Hepatotoxicity Caused by Oxidative Stress Using Antioxidant Response Element Reporter Gene Assay Models and Big Data.

    Science.gov (United States)

    Kim, Marlene Thai; Huang, Ruili; Sedykh, Alexander; Wang, Wenyi; Xia, Menghang; Zhu, Hao

    2016-05-01

    Hepatotoxicity accounts for a substantial number of drugs being withdrawn from the market. Using traditional animal models to detect hepatotoxicity is expensive and time-consuming. Alternative in vitro methods, in particular cell-based high-throughput screening (HTS) studies, have provided the research community with a large amount of data from toxicity assays. Among the various assays used to screen potential toxicants is the antioxidant response element beta lactamase reporter gene assay (ARE-bla), which identifies chemicals that have the potential to induce oxidative stress and was used to test > 10,000 compounds from the Tox21 program. The ARE-bla computational model and HTS data from a big data source (PubChem) were used to profile environmental and pharmaceutical compounds with hepatotoxicity data. Quantitative structure-activity relationship (QSAR) models were developed based on ARE-bla data. The models predicted the potential oxidative stress response for known liver toxicants when no ARE-bla data were available. Liver toxicants were used as probe compounds to search PubChem Bioassay and generate a response profile, which contained thousands of bioassays (> 10 million data points). By ranking the in vitro-in vivo correlations (IVIVCs), the most relevant bioassay(s) related to hepatotoxicity were identified. The liver toxicants profile contained the ARE-bla and relevant PubChem assays. Potential toxicophores for well-known toxicants were created by identifying chemical features that existed only in compounds with high IVIVCs. Profiling chemical IVIVCs created an opportunity to fully explore the source-to-outcome continuum of modern experimental toxicology using cheminformatics approaches and big data sources. Kim MT, Huang R, Sedykh A, Wang W, Xia M, Zhu H. 2016. Mechanism profiling of hepatotoxicity caused by oxidative stress using antioxidant response element reporter gene assay models and big data. Environ Health Perspect 124:634-641;

  4. The cis-regulatory element CCACGTGG is involved in ABA and water-stress responses of the maize gene rab28.

    Science.gov (United States)

    Pla, M; Vilardell, J; Guiltinan, M J; Marcotte, W R; Niogret, M F; Quatrano, R S; Pagès, M

    1993-01-01

    The maize gene rab28 has been identified as ABA-inducible in embryos and vegetative tissues. It is also induced by water stress in young leaves. The proximal promoter region contains the conserved cis-acting element CCACGTGG (ABRE) reported for ABA induction in other plant genes. Transient expression assays in rice protoplasts indicate that a 134 bp fragment (-194 to -60 containing the ABRE) fused to a truncated cauliflower mosaic virus promoter (35S) is sufficient to confer ABA-responsiveness upon the GUS reporter gene. Gel retardation experiments indicate that nuclear proteins from tissues in which the rab28 gene is expressed can interact specifically with this 134 bp DNA fragment. Nuclear protein extracts from embryo and water-stressed leaves generate specific complexes of different electrophoretic mobility which are stable in the presence of detergent and high salt. However, by DMS footprinting the same guanine-specific contacts with the ABRE in both the embryo and leaf binding activities were detected. These results indicate that the rab28 promoter sequence CCACGTGG is a functional ABA-responsive element, and suggest that distinct regulatory factors with apparent similar affinity for the ABRE sequence may be involved in the hormone action during embryo development and in vegetative tissues subjected to osmotic stress.

  5. Dis3- and exosome subunit-responsive 3′ mRNA instability elements

    International Nuclear Information System (INIS)

    Kiss, Daniel L.; Hou, Dezhi; Gross, Robert H.; Andrulis, Erik D.

    2012-01-01

    Highlights: ► Successful use of a novel RNA-specific bioinformatic tool, RNA SCOPE. ► Identified novel 3′ UTR cis-acting element that destabilizes a reporter mRNA. ► Show exosome subunits are required for cis-acting element-mediated mRNA instability. ► Define precise sequence requirements of novel cis-acting element. ► Show that microarray-defined exosome subunit-regulated mRNAs have novel element. -- Abstract: Eukaryotic RNA turnover is regulated in part by the exosome, a nuclear and cytoplasmic complex of ribonucleases (RNases) and RNA-binding proteins. The major RNase of the complex is thought to be Dis3, a multi-functional 3′–5′ exoribonuclease and endoribonuclease. Although it is known that Dis3 and core exosome subunits are recruited to transcriptionally active genes and to messenger RNA (mRNA) substrates, this recruitment is thought to occur indirectly. We sought to discover cis-acting elements that recruit Dis3 or other exosome subunits. Using a bioinformatic tool called RNA SCOPE to screen the 3′ untranslated regions of up-regulated transcripts from our published Dis3 depletion-derived transcriptomic data set, we identified several motifs as candidate instability elements. Secondary screening using a luciferase reporter system revealed that one cassette—harboring four elements—destabilized the reporter transcript. RNAi-based depletion of Dis3, Rrp6, Rrp4, Rrp40, or Rrp46 diminished the efficacy of cassette-mediated destabilization. Truncation analysis of the cassette showed that two exosome subunit-sensitive elements (ESSEs) destabilized the reporter. Point-directed mutagenesis of ESSE abrogated the destabilization effect. An examination of the transcriptomic data from exosome subunit depletion-based microarrays revealed that mRNAs with ESSEs are found in every up-regulated mRNA data set but are underrepresented or missing from the down-regulated data sets. Taken together, our findings imply a potentially novel mechanism of m

  6. Differential regulation of the human progesterone receptor gene through an estrogen response element half site and Sp1 sites.

    Science.gov (United States)

    Petz, Larry N; Ziegler, Yvonne S; Schultz, Jennifer R; Kim, Hwajin; Kemper, J Kim; Nardulli, Ann M

    2004-02-01

    The progesterone receptor (PR) gene is regulated by estrogen in normal reproductive tissues and in MCF-7 human breast cancer cells. Although it is generally thought that estrogen responsiveness is mediated by interaction of the ligand-occupied estrogen receptor (ER) with estrogen response elements (EREs) in target genes, the human progesterone receptor (PR) gene lacks a palindromic ERE. Promoter A of the PR gene does, however, contain an ERE half site upstream of two adjacent Sp1 sites from +571 to +595, the +571 ERE/Sp1 site. We have examined the individual contributions of the ERE half site and the two Sp1 sites in regulating estrogen responsiveness. Transient transfection assays demonstrated that both Sp1 sites were critical for estrogen-mediated activation of the PR gene. Interestingly, rather than decreasing transcription, mutations in the ERE half site increased transcription substantially suggesting that this site plays a role in limiting transcription. Chromatin immunoprecipitation assays demonstrated that Sp1 was associated with the +571 ERE/Sp1 site in the endogenous PR gene in the absence and in the presence of estrogen, but that ERalpha was only associated with this region of the PR gene after MCF-7 cells had been treated with estrogen. Our studies provide evidence that effective regulation of transcription through the +571 ERE/Sp1 site requires the binding of ERalpha and Sp1 to their respective cis elements and the appropriate interaction of ERalpha and Sp1 with other coregulatory proteins and transcription factors.

  7. Domain- and nucleotide-specific Rev response element regulation of feline immunodeficiency virus production

    Science.gov (United States)

    Na, Hong; Huisman, Willem; Ellestad, Kristofor K.; Phillips, Tom R.; Power, Christopher

    2010-01-01

    Computational analysis of feline immunodeficiency virus (FIV) RNA sequences indicated that common FIV strains contain a rev response element (RRE) defined by a long unbranched hairpin with 6 stem-loop sub-domains, termed stem-loop A (SLA). To examine the role of the RNA secondary structure of the RRE, mutational analyses were performed in both an infectious FIV molecular clone and a FIV CAT-RRE reporter system. These studies disclosed that the stems within SLA (SA1, 2, 3, 4, and 5) of the RRE were critical but SA6 was not essential for FIV replication and CAT expression. These studies also revealed that the secondary structure rather than an antisense protein (ASP) mediates virus expression and replication in vitro. In addition, a single synonymous mutation within the FIV-RRE, SA3/45, reduced viral reverse transcriptase activity and p24 expression after transfection but in addition also showed a marked reduction in viral expression and production following infection. PMID:20570310

  8. Newly constructed stable reporter cell lines for mechanistic studies on electrophile-responsive element-mediated gene expression reveal a role for flavonoid planarity.

    NARCIS (Netherlands)

    Boerboom, A.M.A.; Vermeulen, M.; Woude, H. van der; Bremer, B.I.; Lee-Hilz, Y.Y.; Kampman, E.; Bladeren, P.J. van; Rietjens, I.M.C.M.; Aarts, J.

    2006-01-01

    The electrophile-responsive element (EpRE) is a transcriptional enhancer involved in cancer-chemoprotective gene expression modulation by certain food components. Two stably transfected luciferase reporter cell lines were developed, EpRE(hNQO1)-LUX and EpRE(mGST-Ya)-LUX, based on EpRE sequences from

  9. Newly constructed stable reporter cell lines for mechanistic studies on electrophile-responsive element-mediated gene expression reveal a role for flavonoid planarity

    NARCIS (Netherlands)

    Boerboom, A.M.J.F.; Vermeulen, M.; Woude, H. van der; Bremer, B.I.; Lee-Hilz, Y.Y.; Kampman, E.; Bladeren, P.J. van; Rietjens, I.M.C.M.; Aarts, J.M.M.J.G.

    2006-01-01

    The electrophile-responsive element (EpRE) is a transcriptional enhancer involved in cancer-chemoprotective gene expression modulation by certain food components. Two stably transfected luciferase reporter cell lines were developed, EpRE(hNQO1)-LUX and EpRE(mGST-Ya)-LUX, based on EpRE sequences from

  10. v-src induction of the TIS10/PGS2 prostaglandin synthase gene is mediated by an ATF/CRE transcription response element.

    Science.gov (United States)

    Xie, W; Fletcher, B S; Andersen, R D; Herschman, H R

    1994-10-01

    We recently reported the cloning of a mitogen-inducible prostaglandin synthase gene, TIS10/PGS2. In addition to growth factors and tumor promoters, the v-src oncogene induces TIS10/PGS2 expression in 3T3 cells. Deletion analysis, using luciferase reporters, identifies a region between -80 and -40 nucleotides 5' of the TIS10/PGS2 transcription start site that mediates pp60v-src induction in 3T3 cells. This region contains the sequence CGTCACGTG, which includes overlapping ATF/CRE (CGTCA) and E-box (CACGTG) sequences. Gel shift-oligonucleotide competition experiments with nuclear extracts from cells stably transfected with a temperature-sensitive v-src gene demonstrate that the CGTCACGTG sequence can bind proteins at both the ATF/CRE and E-box sequences. Dominant-negative CREB and Myc proteins that bind DNA, but do not transactivate, block v-src induction of a luciferase reporter driven by the first 80 nucleotides of the TIS10/PGS2 promoter. Mutational analysis distinguishes which TIS10/PGS2 cis-acting element mediates pp60v-src induction. E-box mutation has no effect on the fold induction in response to pp60v-src. In contrast, ATF/CRE mutation attenuates the pp60v-src response. Antibody supershift and methylation interference experiments demonstrate that CREB and at least one other ATF transcription factor in these extracts bind to the TIS10/PGS2 ATF/CRE element. Expression of a dominant-negative ras gene also blocks TIS10/PGS2 induction by v-src. Our data suggest that Ras mediates pp60v-src activation of an ATF transcription factor, leading to induced TIS10/PGS2 expression via the ATF/CRE element of the TIS10/PGS2 promoter. This is the first description of v-src activation of gene expression via an ATF/CRE element.

  11. Inhibition of cyclic AMP response element-directed transcription by decoy oligonucleotides enhances tumor-specific radiosensitivity

    Energy Technology Data Exchange (ETDEWEB)

    Park, Serk In, E-mail: serkin@korea.edu [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); The BK21 Plus Program for Biomedical Sciences, Korea University College of Medicine, Seoul (Korea, Republic of); Department of Medicine and Center for Bone Biology, Vanderbilt University School of Medicine, Nashville, TN (United States); Park, Sung-Jun [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); Laboratory of Obesity and Aging Research, National Heart, Lung and Blood Institute, National Institutes of Health, Bethesda, MD (United States); Lee, Junghan; Kim, Hye Eun; Park, Su Jin; Sohn, Jeong-Won [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); Park, Yun Gyu, E-mail: parkyg@korea.ac.kr [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of)

    2016-01-15

    The radiation stress induces cytotoxic responses of cell death as well as cytoprotective responses of cell survival. Understanding exact cellular mechanism and signal transduction pathways is important in improving cancer radiotherapy. Increasing evidence suggests that cyclic AMP response element binding protein (CREB)/activating transcription factor (ATF) family proteins act as a survival factor and a signaling molecule in response to stress. We postulated that CREB inhibition via CRE decoy oligonucleotide increases tumor cell sensitization to γ-irradiation-induced cytotoxic stress. In the present study, we demonstrate that CREB phosphorylation and CREB DNA-protein complex formation increased in time- and radiation dose-dependent manners, while there was no significant change in total protein level of CREB. In addition, CREB was phosphorylated in response to γ-irradiation through p38 MAPK pathway. Further investigation revealed that CREB blockade by decoy oligonucleotides functionally inhibited transactivation of CREB, and significantly increased radiosensitivity of multiple human cancer cell lines including TP53- and/or RB-mutated cells with minimal effects on normal cells. We also demonstrate that tumor cells ectopically expressing dominant negative mutant CREB (KCREB) and the cells treated with p38 MAPK inhibitors were more sensitive to γ-irradiation than wild type parental cells or control-treated cells. Taken together, we conclude that CREB protects tumor cells from γ-irradiation, and combination of CREB inhibition plus ionizing radiation will be a promising radiotherapeutic approach. - Highlights: • γ-Irradiation induced CREB phosphorylation and CRE-directed transcription in tumor. • γ-Irradiation-induced transcriptional activation of CREB was via p38 MAPK pathway. • CRE blockade increased radiosensitivity of tumor cells but not of normal cells. • CRE decoy oligonucleotides or p38 MAPK inhibitors can be used as radiosensitizers.

  12. Inhibition of cyclic AMP response element-directed transcription by decoy oligonucleotides enhances tumor-specific radiosensitivity

    International Nuclear Information System (INIS)

    Park, Serk In; Park, Sung-Jun; Lee, Junghan; Kim, Hye Eun; Park, Su Jin; Sohn, Jeong-Won; Park, Yun Gyu

    2016-01-01

    The radiation stress induces cytotoxic responses of cell death as well as cytoprotective responses of cell survival. Understanding exact cellular mechanism and signal transduction pathways is important in improving cancer radiotherapy. Increasing evidence suggests that cyclic AMP response element binding protein (CREB)/activating transcription factor (ATF) family proteins act as a survival factor and a signaling molecule in response to stress. We postulated that CREB inhibition via CRE decoy oligonucleotide increases tumor cell sensitization to γ-irradiation-induced cytotoxic stress. In the present study, we demonstrate that CREB phosphorylation and CREB DNA-protein complex formation increased in time- and radiation dose-dependent manners, while there was no significant change in total protein level of CREB. In addition, CREB was phosphorylated in response to γ-irradiation through p38 MAPK pathway. Further investigation revealed that CREB blockade by decoy oligonucleotides functionally inhibited transactivation of CREB, and significantly increased radiosensitivity of multiple human cancer cell lines including TP53- and/or RB-mutated cells with minimal effects on normal cells. We also demonstrate that tumor cells ectopically expressing dominant negative mutant CREB (KCREB) and the cells treated with p38 MAPK inhibitors were more sensitive to γ-irradiation than wild type parental cells or control-treated cells. Taken together, we conclude that CREB protects tumor cells from γ-irradiation, and combination of CREB inhibition plus ionizing radiation will be a promising radiotherapeutic approach. - Highlights: • γ-Irradiation induced CREB phosphorylation and CRE-directed transcription in tumor. • γ-Irradiation-induced transcriptional activation of CREB was via p38 MAPK pathway. • CRE blockade increased radiosensitivity of tumor cells but not of normal cells. • CRE decoy oligonucleotides or p38 MAPK inhibitors can be used as radiosensitizers.

  13. Trace elements in the sea surface microlayer: rapid responses to changes in aerosol deposition

    Directory of Open Access Journals (Sweden)

    Alina M. Ebling

    2017-08-01

    Full Text Available Natural and anthropogenic aerosols are a significant source of trace elements to oligotrophic ocean surface waters, where they provide episodic pulses of limiting micronutrients for the microbial community. However, little is known about the fate of trace elements at the air-sea interface, i.e. the sea surface microlayer. In this study, samples of aerosols, sea surface microlayer, and underlying water column were collected in the Florida Keys during a dusty season (July 2014 and non-dusty season (May 2015 and analyzed for the dissolved and particulate elements Al, Fe, Ni, Cu, Zn, and Pb. Microlayer samples were collected using a cylinder of ultra-pure SiO2 (quartz glass, a novel adaptation of the glass plate technique. A significant dust deposition event occurred during the 2014 sampling period which resulted in elevated concentrations of trace elements in the microlayer. Residence times in the microlayer from this event ranged from 12 to 94 minutes for dissolved trace elements and from 1.3 to 3.4 minutes for particulate trace elements. These residence times are potentially long enough for the atmospherically derived trace elements to undergo chemical and biological alterations within the microlayer. Characterizing the trace element distributions within the three regimes is an important step towards our overall goals of understanding the rates and mechanisms of the solubilization of trace elements following aeolian dust deposition and how this might affect microorganisms in surface waters.

  14. Participation of Water in the Binding of Estrogen Receptor with Estrogen Responsive Element in vitro.

    Science.gov (United States)

    Zhu, Guo-Zhang; Tang, Guo-Qing; Ruan, Kang-Cheng; Gong, Yue-Ting; Zhang, Yong-Lian

    1998-01-01

    Many reports have showed that bound water was involved in the interaction between/among the macromolecules. However, it has not been reported whether bound water is also involved in the binding of trans-factors and cis-elements in the regulation of the eukaryotic gene trans-cription or not. Preliminary studies have been made on the effect of bound water on the binding of estrogen receptor with estrogen responsive element in vitro. In the gel retardation assay using the cytosol extract of rat uterus as the supplier of estrogen receptor and 32 bp oligonucleotide containing a concensus vitellogenin A(2) ERE as the probe, various cosolvents, such as glycerol, sucrose, N-dimethylformamide and dimethylsulfoxide, were added respectively to the reaction mixture in varying concentrations to regulate the osmotic pressure. The results indicated that the binding of ER-ERE was enhanced with the increase in the final concentration of these individual cosolvents. On the other hand, when the reaction was carried out under an increasing hydrostatic pressure, the ER-ERE binding was decreased sharply. After decompression the binding of ER-ERE was gradually restored to the normal level with the lapse of time. These results suggested that bound water was directly involved in the binding of ER-ERE and may play an important role in the regulation of the eukaryotic gene transcription.

  15. Transcriptional activation of transforming growth factor alpha by estradiol: requirement for both a GC-rich site and an estrogen response element half-site.

    Science.gov (United States)

    Vyhlidal, C; Samudio, I; Kladde, M P; Safe, S

    2000-06-01

    17beta-Estradiol (E2) induces transforming growth factor alpha (TGFalpha) gene expression in MCF-7 cells and previous studies have identified a 53 bp (-252 to -200) sequence containing two imperfect estrogen responsive elements (EREs) that contribute to E2 responsiveness. Deletion analysis of the TGFalpha gene promoter in this study identified a second upstream region of the promoter (-623 to -549) that is also E2 responsive. This sequence contains three GC-rich sites and an imperfect ERE half-site, and the specific cis-elements and trans-acting factors were determined by promoter analysis in transient transfection experiments, gel mobility shift assays and in vitro DNA footprinting. The results are consistent with an estrogen receptor alpha (ERalpha)/Sp1 complex interacting with an Sp1(N)(30) ERE half-site ((1/2)) motif in which both ERalpha and Sp1 bind promoter DNA. The ER/Sp1-DNA complex is formed using nuclear extracts from MCF-7 cells but not with recombinant human ERalpha or Sp1 proteins, suggesting that other nuclear factor(s) are required for complex stabilization. The E2-responsive Sp1(N)(x)ERE(1/2) motif identified in the TGFalpha gene promoter has also been characterized in the cathepsin D and heat shock protein 27 gene promoters; however, in the latter two promoters the numbers of intervening nucleotides are 23 and 10 respectively.

  16. In vitro selection of DNA elements highly responsive to the human T-cell lymphotropic virus type I transcriptional activator, Tax.

    Science.gov (United States)

    Paca-Uccaralertkun, S; Zhao, L J; Adya, N; Cross, J V; Cullen, B R; Boros, I M; Giam, C Z

    1994-01-01

    The human T-cell lymphotropic virus type I (HTLV-I) transactivator, Tax, the ubiquitous transcriptional factor cyclic AMP (cAMP) response element-binding protein (CREB protein), and the 21-bp repeats in the HTLV-I transcriptional enhancer form a ternary nucleoprotein complex (L. J. Zhao and C. Z. Giam, Proc. Natl. Acad. Sci. USA 89:7070-7074, 1992). Using an antibody directed against the COOH-terminal region of Tax along with purified Tax and CREB proteins, we selected DNA elements bound specifically by the Tax-CREB complex in vitro. Two distinct but related groups of sequences containing the cAMP response element (CRE) flanked by long runs of G and C residues in the 5' and 3' regions, respectively, were preferentially recognized by Tax-CREB. In contrast, CREB alone binds only to CRE motifs (GNTGACG[T/C]) without neighboring G- or C-rich sequences. The Tax-CREB-selected sequences bear a striking resemblance to the 5' or 3' two-thirds of the HTLV-I 21-bp repeats and are highly inducible by Tax. Gel electrophoretic mobility shift assays, DNA transfection, and DNase I footprinting analyses indicated that the G- and C-rich sequences flanking the CRE motif are crucial for Tax-CREB-DNA ternary complex assembly and Tax transactivation but are not in direct contact with the Tax-CREB complex. These data show that Tax recruits CREB to form a multiprotein complex that specifically recognizes the viral 21-bp repeats. The expanded DNA binding specificity of Tax-CREB and the obligatory role the ternary Tax-CREB-DNA complex plays in transactivation reveal a novel mechanism for regulating the transcriptional activity of leucine zipper proteins like CREB.

  17. Fluid element in SAP IV

    International Nuclear Information System (INIS)

    Yilmaz, C.; Akkas, N.

    1979-01-01

    In previous studies a fluid element is incorporated in the widely used general purpose finite element program SAPIV. This type of problem is of interest in the design of nuclear components involving geometric complexities and nonlinearities. The elasticity matrix of a general-purpose finite element program is modified in such a way that it becomes possible to idealize fluid as a structural finite element with zero shear modulus and a given bulk modules. Using the modified version of SAPIV, several solid-fluid interactions problems are solved. The numerical solutions are compared with the available analytical solutions. They are shown to be in reasonable aggrement. It is also shown that by solving an exterior-fluid interaction problem, the pressure wave propagation in the acoustic medium can be solved with the same approach. In this study, two of the problem not studied in the previous work will be presented. These problems are namely the effects of the link elements used at solid-fluid interfaces and of the concentrated loads on the response of the fluid medium. Truss elements are used as the link elements. After these investigations, it is decided that general purpose finite element programs with slight modifications can be used in the safety analysis of nuclear reactor plants. By this procedure it is possible to handle two-dimensional plane strain and tridimensional axisymmetric problems of this type. (orig.)

  18. Functional cooperativity between two TPA responsive elements in undifferentiated F9 embryonic stem cells.

    Science.gov (United States)

    Okuda, A; Imagawa, M; Sakai, M; Muramatsu, M

    1990-01-01

    We have recently identified an enhancer, termed GPEI, in the 5'-flanking region of the rat glutathione transferase P gene, that is composed of two imperfect TPA (phorbol 12-O-tetradecanoate 13-acetate) responsive elements (TREs). Unlike other TRE-containing enhancers, GPEI exhibits a strong transcriptional enhancing activity in F9 embryonic stem cells. Mutational analyses have revealed that the high activity of GPEI is mediated by two imperfect TREs. Each TRE-like sequence has no activity by itself but acts synergistically to form a strong enhancer which is active even in the very low level of AP-1 activity in F9 cells. Furthermore, we show that synthetic DNAs containing two perfect TREs in certain arrangements have strong transcriptional enhancing activities in F9 cells and the activity is greatly influenced by the relative orientation and the distance of two TREs. Images Fig. 1. Fig. 2. Fig. 3. PMID:2323334

  19. Numerical Simulation of the Ground Response to the Tire Load Using Finite Element Method

    Science.gov (United States)

    Valaskova, Veronika; Vlcek, Jozef

    2017-10-01

    Response of the pavement to the excitation caused by the moving vehicle is one of the actual problems of the civil engineering practice. The load from the vehicle is transferred to the pavement structure through contact area of the tires. Experimental studies show nonuniform distribution of the pressure in the area. This non-uniformity is caused by the flexible nature and the shape of the tire and is influenced by the tire inflation. Several tire load patterns, including uniform distribution and point load, were involved in the numerical modelling using finite element method. Applied tire loads were based on the tire contact forces of the lorry Tatra 815. There were selected two procedures for the calculations. The first one was based on the simplification of the vehicle to the half-part model. The characteristics of the vehicle model were verified by the experiment and by the numerical model in the software ADINA, when vehicle behaviour during the ride was investigated. Second step involved application of the calculated contact forces for the front axle as the load on the multi-layered half space representing the pavement structure. This procedure was realized in the software Plaxis and considered various stress patterns for the load. The response of the ground to the vehicle load was then analyzed. Axisymmetric model was established for this procedure. The paper presents the results of the investigation of the contact pressure distribution and corresponding reaction of the pavement to various load distribution patterns. The results show differences in some calculated quantities for different load patterns, which need to be verified by the experimental way when also ground response should be observed.

  20. Identification of two novel functional p53 responsive elements in the herpes simplex virus-1 genome.

    Science.gov (United States)

    Hsieh, Jui-Cheng; Kuta, Ryan; Armour, Courtney R; Boehmer, Paul E

    2014-07-01

    Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency. Copyright © 2014 Elsevier Inc. All rights reserved.

  1. Four-terminal circuit element with photonic core

    Science.gov (United States)

    Sampayan, Stephen

    2017-08-29

    A four-terminal circuit element is described that includes a photonic core inside of the circuit element that uses a wide bandgap semiconductor material that exhibits photoconductivity and allows current flow through the material in response to the light that is incident on the wide bandgap material. The four-terminal circuit element can be configured based on various hardware structures using a single piece or multiple pieces or layers of a wide bandgap semiconductor material to achieve various designed electrical properties such as high switching voltages by using the photoconductive feature beyond the breakdown voltages of semiconductor devices or circuits operated based on electrical bias or control designs. The photonic core aspect of the four-terminal circuit element provides unique features that enable versatile circuit applications to either replace the semiconductor transistor-based circuit elements or semiconductor diode-based circuit elements.

  2. Prediction and analysis of human thoracic impact responses and injuries in cadaver impacts using a full human body finite element model.

    Science.gov (United States)

    Ruan, Jesse; El-Jawahri, Raed; Chai, Li; Barbat, Saeed; Prasad, Priya

    2003-10-01

    Human thoracic dynamic responses and injuries associated with frontal impact, side impact, and belt loading were investigated and predicted using a complete human body finite element model for an average adult male. The human body model was developed to study the impact biomechanics of a vehicular occupant. Its geometry was based on the Visible Human Project (National Library of Medicine) and the topographies from human body anatomical texts. The data was then scaled to an average adult male according to available biomechanical data from the literature. The model includes details of the head, neck, ribcage, abdomen, thoracic and lumbar spine, internal organs of the chest and abdomen, pelvis, and the upper and lower extremities. The present study is focused on the dynamic response and injuries of the thorax. The model was validated at various impact speeds by comparing predicted responses with available experimental cadaver data in frontal and side pendulum impacts, as well as belt loading. Model responses were compared with similar individual cadaver tests instead of using cadaver corridors because the large differences between the upper and lower bounds of the corridors may confound the model validation. The validated model was then used to study thorax dynamic responses and injuries in various simulated impact conditions. Parameters that could induce injuries such as force, deflection, and stress were computed from model simulations and were compared with previously proposed thoracic injury criteria to assess injury potential for the thorax. It has been shown that the model exhibited speed sensitive impact characteristics, and the compressibility of the internal organs significantly influenced the overall impact response in the simulated impact conditions. This study demonstrates that the development of a validated FE human body model could be useful for injury assessment in various cadaveric impacts reported in the literature. Internal organ injuries, which are

  3. The French national inventory of radioactive waste. Elements of openness and responsibility

    International Nuclear Information System (INIS)

    Faussat, A.; Fernique, J.C.

    1995-01-01

    Article 13 of the Waste Act of 30 December 1991 calls for the Agence nationale pour la gestion des dechets radioactifs (ANDRA) ''to register the condition and location of all radioactive waste on national territory''. The establishment of a national inventory of radioactive waste and the broad distribution of inventory report to ensure that it becomes a matter of public record constitute a new approach to public information and an effective means of fulfilling the responsibility of the present generation vis-a-vis posterity. The National Waste Register goes beyond the low level radioactive waste disposal facilities to encompass 'all' waste, wherever it may be, including waste in storage at sites where waste is produced. As a result, the Register is multi-faceted, containing information on a variety of elements, from highly radioactive waste to hospital waste collected by ANDRA and to repositories with very low level radioactive material. Information must be provided about all of these widely divergent components. ANDRA has already published two inventories, which demonstrates the durability of its new mission. The Register now contains the inventory of radioactive waste generated by some activities connected with the defence programme. Data collection for the Register involves contacting the generators of waste and working with these entities, whether they are nuclear industry companies, defence organizations, non-nuclear industries, or the 25 Regional Directorates of Industry, Research and Environment, the control institutions or the environmental protection organizations. The yearly exchange of information among all partners involved in radioactive waste management is one of the basic tools of ANDRA, allowing it to be recognized as open and responsible, and to be more credible, fulfilling in this way one of the essential criteria for acceptability. (author). 4 refs

  4. v-src Induction of the TIS10/PGS2 prostaglandin synthase gene is mediated by an ATF/CRE transcription response element

    Energy Technology Data Exchange (ETDEWEB)

    Xie, W.; Fletcher, B.S.; Andersen, R.D.; Herschman, H.R. [Univ. of California, Los Angeles, CA (United States)

    1994-10-01

    The authors recently reported the cloning of a mitogen-inducible prostaglandin synthase gene, TIS10/PGS2. In addition to growth factor and tumor promoters, the v-src oncogene induces TIS10/PGS2 expression in 3T3 cells. Deletion analysis, using luciferase reporters, identifies a region between -80 and -40 nucleotides 5{prime} of the TIS10/PGS2 transcription start site that mediates pp60{sup v-src} induction in 3T3 cells. This region contains the sequence CGTCACGTG, which includes overlapping ATF/CRE (CGTCA) and E-box (CACGTG) sequences. Gel shift-oligonucleotide competition experiments with nuclear extracts from cells stably transfected with a temperature-sensitive v-src gene demonstrate that the CGTCACGTG sequence can bind proteins at both the AFT/CRE and E-box sequences. Dominant-negative CREB and Myc proteins that bind DNA, but do not transactivate, block v-src induction of a luciferase reporter driven by the first 80 nucleotides of the TIS10/PGS2 promoter. Mutational analysis distinguishes which TIS10/PGS2 cis-acting element mediates pp60{sup v-src} induction. E-box mutation has no effect on the fold induction in response to pp60{sup v-src}. In contrast, ATF/CRE mutation attenuates the pp{sup v-src} response. Antibody supershift and methylation interference experiments demonstrate that CREB and at least one other ATF transcription factor in these extracts bind to the TIS10/PGS2 ATF/CRE element. Expression of a dominant-negative ras gene also blocks TIS10/PGS2 induction by v-src. The data suggest that Ras mediates pp60{sup v-src} activation of an ATF transcription factor, leading to induced TIS10/PGS2 expression via the ATF/CRE element of the TIS10/PGS2 promoter. This is the first description of v-src activation of gene expression via an ATF/CRE element. 64 refs., 8 figs.

  5. Structural response analysis of very large floating structures in waves using one-dimensional finite element model; Ichijigen yugen yoso model ni yoru choogata futai no harochu kozo oto kaiseki

    Energy Technology Data Exchange (ETDEWEB)

    Fujikubo, M.; Yao, T.; Oida, H. [Hiroshima University, Hiroshima (Japan). Faculty of Engineering

    1996-12-31

    Formulation was made on a one-dimensional beam finite element which is effective in analyzing structural response of very large floating structures by modeling them on beams on an elastic foundation. This element allows strict solution of vibration response in the beams on the elastic foundation to be calculated efficiently for a case where mass and rigidity change in the longitudinal direction. This analysis method was used to analyze structural response of a large pontoon-type floating structure to investigate mass in the end part for the structural response and the effect of decay while passing the structure. With a pontoon-type floating structure, reduction in bends and bending stress in the end part of the floating structure is important in designing the structure. Reducing the mass in the end part is effective as a means to avoid resonance in these responses and reduce the responses. Increase in rigidity of a floating structure shifts the peak in quasi-static response to lower frequency side, and reduces response in resonance, hence it is advantageous for improving the response. Since incident waves decay while passing through the floating structure, response in the lower wave side decreases. The peak frequency in the quasi-static response also decreases at the end part of the structure in the upper wave side due to decay in wave force. 7 refs., 11 figs., 1 tab.

  6. Structural response analysis of very large floating structures in waves using one-dimensional finite element model; Ichijigen yugen yoso model ni yoru choogata futai no harochu kozo oto kaiseki

    Energy Technology Data Exchange (ETDEWEB)

    Fujikubo, M; Yao, T; Oida, H [Hiroshima University, Hiroshima (Japan). Faculty of Engineering

    1997-12-31

    Formulation was made on a one-dimensional beam finite element which is effective in analyzing structural response of very large floating structures by modeling them on beams on an elastic foundation. This element allows strict solution of vibration response in the beams on the elastic foundation to be calculated efficiently for a case where mass and rigidity change in the longitudinal direction. This analysis method was used to analyze structural response of a large pontoon-type floating structure to investigate mass in the end part for the structural response and the effect of decay while passing the structure. With a pontoon-type floating structure, reduction in bends and bending stress in the end part of the floating structure is important in designing the structure. Reducing the mass in the end part is effective as a means to avoid resonance in these responses and reduce the responses. Increase in rigidity of a floating structure shifts the peak in quasi-static response to lower frequency side, and reduces response in resonance, hence it is advantageous for improving the response. Since incident waves decay while passing through the floating structure, response in the lower wave side decreases. The peak frequency in the quasi-static response also decreases at the end part of the structure in the upper wave side due to decay in wave force. 7 refs., 11 figs., 1 tab.

  7. Environmental mineralogy - Understanding element behavior in ecosystems; Mineralogie environnementale: comprendre le comportement des elements dans les ecosystemes

    Energy Technology Data Exchange (ETDEWEB)

    Brown Jr, G.E. [Department of Geological and Environmental Sciences, Stanford University, Stanford, CA 94305-2115 (United States); Department of Photon Science and Stanford Synchrotron Radiation Lightsource, SLAC National Accelerator Laboratory, Menlo Park, CA 94025 (United States); Calas, G. [Institut de mineralogie et de physique des milieux condenses (IMPMC), universite Paris-6 - universite Paris-7, IPGP, CNRS, case 115, 75252 Paris (France)

    2011-02-15

    Environmental Mineralogy has developed over the past decade in response to the recognition that minerals are linked in many important ways with the global ecosystem. Minerals are the main repositories of the chemical elements in Earth's crust and thus are the main sources of elements needed for the development of civilization, contaminant and pollutant elements that impact global and local ecosystems, and elements that are essential plant nutrients. These elements are released from minerals through natural processes, such as chemical weathering, and anthropogenic activities, such as mining and energy production, agriculture and industrial activities, and careless waste disposal. Minerals also play key roles in the biogeochemical cycling of the elements, sequestering elements and releasing them as the primary minerals in crustal rocks undergo various structural and compositional transformations in response to physical, chemical, and biological processes that produce secondary minerals and soils. These processes have resulted in the release of toxic elements such as arsenic in groundwater aquifers, which is having a major impact on the health of millions of people in South and Southeast Asia. The interfaces between mineral surfaces and aqueous solutions are the locations of most chemical reactions that control the composition of the natural environment, including the composition of natural waters. The nuclear fuel cycle, from uranium mining to the disposition of high-level nuclear waste, is also intimately related to minerals. A fundamental understanding of these processes requires molecular-scale information about minerals, their bulk structures and properties such as solubility, their surfaces, and their interactions with aqueous solutions, atmospheric and soil gases, natural organic matter, and biological organisms. Gaining this understanding is further complicated by the presence of natural, incidental, and manufactured nano-particles in the environment

  8. Predicting the response of high damping rubber bearings using simplified models and finite element analysis

    International Nuclear Information System (INIS)

    Fuller, K.N.G.; Gough, J.; Ahmadi, H.R.

    1993-01-01

    The International Atomic Energy Agency has initiated a co-ordinated research programme on implementation of base-isolation for nuclear structures. This paper discusses two areas relevant to modelling elastomeric base-isolators. These are the use of simplified models to predict the response of isolated structures to earthquake inputs and finite element analysis for calculating the stress distributions within the isolators. In the former, a curvilinear hysteretic model of the high damping natural rubber able to accommodate the stiffening of the rubber at large shear deflections is presented. Its predictions of structural accelerations and bearing displacement produced by design earthquakes and those above the design level are compared with those using a linear spring and dashpot model. A comparison has been made between two finite element analyses using MARC and ABAQUS of the force-deformation behaviour of a single disc of rubber bonded on both sides. The disc was loaded both in compression and shear. Two forms of strain energy functions were used namely Mooney-RivIin and Ogden. The agreement between MARC and ABAQUS for the Mooney-Rivlin model for the material was very good. This was not however the case for the Ogden model and a difference of 25% in the maximum vertical deflection of the disc under 200kN load was observed. The need for a 'benchmark' problem is identified. This could be used to establish the accuracy of the finite element solvers. A problem based on the work of Rivlin on the force-deformation behaviour of cylinder of rubber under torsion is nominated. An appraisal of strain energy functions based on Mooney-RivIin formulations is carried out. It is shown that even for a five term series the strain energy function is incapable of catering for the rapid change of modulus at small strains both for simple and pure shear modes of deformation. This function models tension/compression data much better. The work identifies the need for evaluating other forms

  9. Lichens (Parmelia sulcata) time response model to environmental elemental availability

    NARCIS (Netherlands)

    Reis, M.A.; Alves, L.C.; Freitas, M.C.; Os, B. van; Wolterbeek, H.T.

    1999-01-01

    Parmelia sulcata transplants, collected in a non-polluted area, were exposed to new atmospheric conditions at six stations, of which five were located near power plants and one at an unpolluted area. Data were collected for a 1-year period, on rainfall, airborne particulates, elemental deposition

  10. Radiographic element

    International Nuclear Information System (INIS)

    Abbott, T.I.; Jones, C.G.

    1984-01-01

    Radiographic elements are disclosed comprised of first and second silver halide emulsion layers separated by an interposed support capable of transmitting radiation to which the second image portion is responsive. At least the first imaging portion contains a silver halide emulsion in which thin tubular silver halide grains of intermediate aspect ratios (from 5:1 to 8:1) are present. Spectral sensitizing dye is adsorbed to the surface of the tubular grains. Increased photographic speeds can be realized at comparable levels of crossover. (author)

  11. Cyclic adenosine 3',5'-monophosphate (cAMP) enhances cAMP-responsive element binding (CREB) protein phosphorylation and phospho-CREB interaction with the mouse steroidogenic acute regulatory protein gene promoter.

    Science.gov (United States)

    Clem, Brian F; Hudson, Elizabeth A; Clark, Barbara J

    2005-03-01

    Steroidogenic acute regulatory protein (StAR) transcription is regulated through cAMP-protein kinase A-dependent mechanisms that involve multiple transcription factors including the cAMP-responsive element binding protein (CREB) family members. Classically, binding of phosphorylated CREB to cis-acting cAMP-responsive elements (5'-TGACGTCA-3') within target gene promoters leads to recruitment of the coactivator CREB binding protein (CBP). Herein we examined the extent of CREB family member phosphorylation on protein-DNA interactions and CBP recruitment with the StAR promoter. Immunoblot analysis revealed that CREB, cAMP-responsive element modulator (CREM), and activating transcription factor (ATF)-1 are expressed in MA-10 mouse Leydig tumor cells, yet only CREB and ATF-1 are phosphorylated. (Bu)2cAMP treatment of MA-10 cells increased CREB phosphorylation approximately 2.3-fold within 30 min but did not change total nuclear CREB expression levels. Using DNA-affinity chromatography, we now show that CREB and ATF-1, but not CREM, interact with the StAR promoter, and this interaction is dependent on the activator protein-1 (AP-1) cis-acting element within the cAMP-responsive region. In addition, (Bu)2cAMP-treatment increased phosphorylated CREB (P-CREB) association with the StAR promoter but did not influence total CREB interaction. In vivo chromatin immunoprecipitation assays demonstrated CREB binding to the StAR proximal promoter is independent of (Bu)2cAMP-treatment, confirming our in vitro analysis. However, (Bu)2cAMP-treatment increased P-CREB and CBP interaction with the StAR promoter, demonstrating for the first time the physical role of P-CREB:DNA interactions in CBP recruitment to the StAR proximal promoter.

  12. Hypoxia-response element (HRE)-directed transcriptional regulation of the rat lysyl oxidase gene in response to cobalt and cadmium.

    Science.gov (United States)

    Gao, Song; Zhou, Jing; Zhao, Yinzhi; Toselli, Paul; Li, Wande

    2013-04-01

    Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5'-ACGTG-3') exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10-100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)-treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at -387/-383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation.

  13. Finite element analysis of an inflatable torus considering air mass structural element

    Science.gov (United States)

    Gajbhiye, S. C.; Upadhyay, S. H.; Harsha, S. P.

    2014-01-01

    Inflatable structures, also known as gossamer structures, are at high boom in the current space technology due to their low mass and compact size comparing to the traditional spacecraft designing. Internal pressure becomes the major source of strength and rigidity, essentially stiffen the structure. However, inflatable space based membrane structure are at high risk to the vibration disturbance due to their low structural stiffness and material damping. Hence, the vibration modes of the structure should be known to a high degree of accuracy in order to provide better control authority. In the past, most of the studies conducted on the vibration analysis of gossamer structures used inaccurate or approximate theories in modeling the internal pressure. The toroidal shaped structure is one of the important key element in space application, helps to support the reflector in space application. This paper discusses the finite-element analysis of an inflated torus. The eigen-frequencies are obtained via three-dimensional small-strain elasticity theory, based on extremum energy principle. The two finite-element model (model-1 and model-2) have cases have been generated using a commercial finite-element package. The structure model-1 with shell element and model-2 with the combination of the mass of enclosed fluid (air) added to the shell elements have been taken for the study. The model-1 is computed with present analytical approach to understand the convergence rate and the accuracy. The convergence study is made available for the symmetric modes and anti-symmetric modes about the centroidal-axis plane, meeting the eigen-frequencies of an inflatable torus with the circular cross section. The structural model-2 is introduced with air mass element and analyzed its eigen-frequency with different aspect ratio and mode shape response using in-plane and out-plane loading condition are studied.

  14. Identification of Smad Response Elements in the Promoter of Goldfish FSHβ Gene and Evidence for Their Mediation of Activin and GnRH Stimulation of FSHβ Expression

    Directory of Open Access Journals (Sweden)

    Man-Tat eLau

    2012-03-01

    Full Text Available As an essential hormone regulating gonads in vertebrates, the biosynthesis and secretion of follicle-stimulating hormone (FSH is controlled by a variety of endocrine and paracrine factors in both mammalian and non-mammalian vertebrates. Activin was initially discovered in the ovary for its specific stimulation of FSH secretion by the pituitary cells. Our earlier studies in fish have shown that activin stimulates FSHβ but suppresses LHβ expression in both the goldfish and zebrafish. Further experiments showed that the regulation of FSHβ in fish occurred at the promoter level involving Smads, in particular Smad3. To further understand the mechanisms by which activin/Smad regulates FSHβ transcription, the present study was undertaken to analyze the promoter of goldfish FSHβ gene (fshb with the aim to identify potential cis-regulatory elements responsible for activin/Smad stimulation. Both serial deletion and site-directed mutagenesis were used, and the promoter activity was tested in the LβT2 cells, a murine gonadotroph cell line. The reporter constructs of goldfish FSHβ promoter-SEAP (secreted alkaline phosphatase were co-transfected with an expression plasmid for Smads (2 or 3 followed by measurement of SEAP activity in the medium. Two putative Smad responsive elements (SRE were identified in the promoter at distal and proximal regions, respectively. The distal site contained a consensus Smad binding element (SBE; AGAC, -1675/-1672 whereas the proximal site (GACCTTGA, -212/-205 was identical to an SF-1 binding site reported in humans, which was preceded by a sequence (AACACTGA highly conserved between fish and mammals. The proximal site also seemed to be involved in mediating stimulation of FSHβ expression by gonadotropin-releasing hormone (GnRH and its potential interaction with activin. In conclusion, we have identified two potential cis-regulatory elements in the promoter of goldfish FSHβ that are responsible for activin

  15. Tooth Fracture Detection in Spiral Bevel Gears System by Harmonic Response Based on Finite Element Method

    Directory of Open Access Journals (Sweden)

    Yuan Chen

    2017-01-01

    Full Text Available Spiral bevel gears occupy several advantages such as high contact ratio, strong carrying capacity, and smooth operation, which become one of the most widely used components in high-speed stage of the aeronautical transmission system. Its dynamic characteristics are addressed by many scholars. However, spiral bevel gears, especially tooth fracture occurrence and monitoring, are not to be investigated, according to the limited published issues. Therefore, this paper establishes a three-dimensional model and finite element model of the Gleason spiral bevel gear pair. The model considers the effect of tooth root fracture on the system due to fatigue. Finite element method is used to compute the mesh generation, set the boundary condition, and carry out the dynamic load. The harmonic response spectra of the base under tooth fracture are calculated and the influence of main parameters on monitoring failure is investigated as well. The results show that the change of torque affects insignificantly the determination of whether or not the system has tooth fracture. The intermediate frequency interval (200 Hz–1000 Hz is the best interval to judge tooth fracture occurrence. The best fault test region is located in the working area where the system is going through meshing. The simulation calculation provides a theoretical reference for spiral bevel gear system test and fault diagnosis.

  16. Thyroid Hormone Receptor β (TRβ) and Liver X Receptor (LXR) Regulate Carbohydrate-response Element-binding Protein (ChREBP) Expression in a Tissue-selective Manner*

    Science.gov (United States)

    Gauthier, Karine; Billon, Cyrielle; Bissler, Marie; Beylot, Michel; Lobaccaro, Jean-Marc; Vanacker, Jean-Marc; Samarut, Jacques

    2010-01-01

    Thyroid hormone (TR) and liver X (LXR) receptors are transcription factors involved in lipogenesis. Both receptors recognize the same consensus DNA-response element in vitro. It was previously shown that their signaling pathways interact in the control of cholesterol elimination in the liver. In the present study, carbohydrate-response element-binding protein (ChREBP), a major transcription factor controlling the activation of glucose-induced lipogenesis in liver, is characterized as a direct target of thyroid hormones (TH) in liver and white adipose tissue (WAT), the two main lipogenic tissues in mice. Using genetic and molecular approaches, ChREBP is shown to be specifically regulated by TRβ but not by TRα in vivo, even in WAT where both TR isoforms are expressed. However, this isotype specificity is not found in vitro. This TRβ specific regulation correlates with the loss of TH-induced lipogenesis in TRβ−/− mice. Fasting/refeeding experiments show that TRβ is not required for the activation of ChREBP expression particularly marked in WAT following refeeding. However, TH can stimulate ChREBP expression in WAT even under fasting conditions, suggesting completely independent pathways. Because ChREBP has been described as an LXR target, the interaction of LXR and TRβ in ChREBP regulation was assayed both in vitro and in vivo. Each receptor recognizes a different response element on the ChREBP promoter, located only 8 bp apart. There is a cross-talk between LXR and TRβ signaling on the ChREBP promoter in liver but not in WAT where LXR does not regulate ChREBP expression. The molecular basis for this cross-talk has been determined in in vitro systems. PMID:20615868

  17. Low-temperature-induced expression of rice ureidoglycolate amidohydrolase is mediated by a C-repeat/dehydration-responsive element that specifically interacts with rice C-repeat-binding factor 3

    Directory of Open Access Journals (Sweden)

    Juan eLi

    2015-11-01

    Full Text Available Nitrogen recycling and redistribution are important for the environmental stress response of plants. In non nitrogen-fixing plants, ureide metabolism is crucial to nitrogen recycling from organic sources. Various studies have suggested that the rate-limiting components of ureide metabolism respond to environmental stresses. However, the underlying regulation mechanism is not well understood. In this report, rice ureidoglycolate amidohydrolase (OsUAH, which is a recently identified enzyme catalyzing the final step of ureide degradation, was identified as low-temperature- (LT but not abscisic acid- (ABA regulated. To elucidate the LT regulatory mechanism at the transcriptional level, we isolated and characterized the promoter region of OsUAH (POsUAH. Series deletions revealed that a minimal region between -522 and -420 relative to the transcriptional start site was sufficient for the cold induction of POsUAH. Detailed analyses of this 103-bp fragment indicated that a C-repeat/dehydration-responsive (CRT/DRE element localized at position -434 was essential for LT-responsive expression. A rice C-repeat-binding factors/DRE-binding proteins 1 (CBFs/DREB1s subfamily member, OsCBF3, was screened to specifically bind to the CRT/DRE element in the minimal region both in yeast one-hybrid assays and in in vitro gel-shift analysis. Moreover, the promoter could be exclusively trans-activated by the interaction between the CRT/DRE element and OsCBF3 in vivo. These findings may help to elucidate the regulation mechanism of stress-responsive ureide metabolism genes and provide an example of the member-specific manipulation of the CBF/DREB1 subfamily.

  18. Elements to diminish radioactive accidents

    International Nuclear Information System (INIS)

    Cortes I, M.E.; Ramirez G, F.P.

    1998-01-01

    In this work it is presented an application of the cause-effect diagram method or Ichikawa method identifying the elements that allow to diminish accidents when the radioactive materials are transported. It is considered the transport of hazardous materials which include radioactive materials in the period: December 1996 until March 1997. Among the identified elements by this method it is possible to mention: the road type, the radioactive source protection, the grade driver responsibility and the preparation that the OEP has in the radioactive material management. It is showed the differences found between the country inner roads and the Mexico City area. (Author)

  19. Surveying DNA Elements within Functional Genes of Heterocyst-Forming Cyanobacteria.

    Directory of Open Access Journals (Sweden)

    Jason A Hilton

    Full Text Available Some cyanobacteria are capable of differentiating a variety of cell types in response to environmental factors. For instance, in low nitrogen conditions, some cyanobacteria form heterocysts, which are specialized for N2 fixation. Many heterocyst-forming cyanobacteria have DNA elements interrupting key N2 fixation genes, elements that are excised during heterocyst differentiation. While the mechanism for the excision of the element has been well-studied, many questions remain regarding the introduction of the elements into the cyanobacterial lineage and whether they have been retained ever since or have been lost and reintroduced. To examine the evolutionary relationships and possible function of DNA sequences that interrupt genes of heterocyst-forming cyanobacteria, we identified and compared 101 interruption element sequences within genes from 38 heterocyst-forming cyanobacterial genomes. The interruption element lengths ranged from about 1 kb (the minimum able to encode the recombinase responsible for element excision, up to nearly 1 Mb. The recombinase gene sequences served as genetic markers that were common across the interruption elements and were used to track element evolution. Elements were found that interrupted 22 different orthologs, only five of which had been previously observed to be interrupted by an element. Most of the newly identified interrupted orthologs encode proteins that have been shown to have heterocyst-specific activity. However, the presence of interruption elements within genes with no known role in N2 fixation, as well as in three non-heterocyst-forming cyanobacteria, indicates that the processes that trigger the excision of elements may not be limited to heterocyst development or that the elements move randomly within genomes. This comprehensive analysis provides the framework to study the history and behavior of these unique sequences, and offers new insight regarding the frequency and persistence of interruption

  20. Surveying DNA Elements within Functional Genes of Heterocyst-Forming Cyanobacteria.

    Science.gov (United States)

    Hilton, Jason A; Meeks, John C; Zehr, Jonathan P

    2016-01-01

    Some cyanobacteria are capable of differentiating a variety of cell types in response to environmental factors. For instance, in low nitrogen conditions, some cyanobacteria form heterocysts, which are specialized for N2 fixation. Many heterocyst-forming cyanobacteria have DNA elements interrupting key N2 fixation genes, elements that are excised during heterocyst differentiation. While the mechanism for the excision of the element has been well-studied, many questions remain regarding the introduction of the elements into the cyanobacterial lineage and whether they have been retained ever since or have been lost and reintroduced. To examine the evolutionary relationships and possible function of DNA sequences that interrupt genes of heterocyst-forming cyanobacteria, we identified and compared 101 interruption element sequences within genes from 38 heterocyst-forming cyanobacterial genomes. The interruption element lengths ranged from about 1 kb (the minimum able to encode the recombinase responsible for element excision), up to nearly 1 Mb. The recombinase gene sequences served as genetic markers that were common across the interruption elements and were used to track element evolution. Elements were found that interrupted 22 different orthologs, only five of which had been previously observed to be interrupted by an element. Most of the newly identified interrupted orthologs encode proteins that have been shown to have heterocyst-specific activity. However, the presence of interruption elements within genes with no known role in N2 fixation, as well as in three non-heterocyst-forming cyanobacteria, indicates that the processes that trigger the excision of elements may not be limited to heterocyst development or that the elements move randomly within genomes. This comprehensive analysis provides the framework to study the history and behavior of these unique sequences, and offers new insight regarding the frequency and persistence of interruption elements in

  1. Gene expression and stress response mediated by the epigenetic regulation of a transposable element small RNA.

    Directory of Open Access Journals (Sweden)

    Andrea D McCue

    2012-02-01

    Full Text Available The epigenetic activity of transposable elements (TEs can influence the regulation of genes; though, this regulation is confined to the genes, promoters, and enhancers that neighbor the TE. This local cis regulation of genes therefore limits the influence of the TE's epigenetic regulation on the genome. TE activity is suppressed by small RNAs, which also inhibit viruses and regulate the expression of genes. The production of TE heterochromatin-associated endogenous small interfering RNAs (siRNAs in the reference plant Arabidopsis thaliana is mechanistically distinct from gene-regulating small RNAs, such as microRNAs or trans-acting siRNAs (tasiRNAs. Previous research identified a TE small RNA that potentially regulates the UBP1b mRNA, which encodes an RNA-binding protein involved in stress granule formation. We demonstrate that this siRNA, siRNA854, is under the same trans-generational epigenetic control as the Athila family LTR retrotransposons from which it is produced. The epigenetic activation of Athila elements results in a shift in small RNA processing pathways, and new 21-22 nucleotide versions of Athila siRNAs are produced by protein components normally not responsible for processing TE siRNAs. This processing results in siRNA854's incorporation into ARGONAUTE1 protein complexes in a similar fashion to gene-regulating tasiRNAs. We have used reporter transgenes to demonstrate that the UPB1b 3' untranslated region directly responds to the epigenetic status of Athila TEs and the accumulation of siRNA854. The regulation of the UPB1b 3' untranslated region occurs both on the post-transcriptional and translational levels when Athila TEs are epigenetically activated, and this regulation results in the phenocopy of the ubp1b mutant stress-sensitive phenotype. This demonstrates that a TE's epigenetic activity can modulate the host organism's stress response. In addition, the ability of this TE siRNA to regulate a gene's expression in trans blurs

  2. Representation of individual elements of a complex call sequence in primary auditory cortex

    Directory of Open Access Journals (Sweden)

    Mark Nelson Wallace

    2013-10-01

    Full Text Available Conspecific communication calls can be rhythmic or contain extended, discontinuous series of either constant or frequency modulated harmonic tones and noise bursts separated by brief periods of silence. In the guinea pig, rhythmic calls can produce isomorphic responses within the primary auditory cortex (AI where single units respond to every call element. Other calls such as the chutter comprise a series of short irregular syllables that vary in their spectral content and are more like human speech. These calls can also evoke isomorphic responses, but may only do so in fields in the auditory belt and not in AI. Here we present evidence that cells in AI treat the individual elements within a syllable as separate auditory objects and respond selectively to one or a subset of them. We used a single chutter exemplar to compare single/multi-unit responses in the low-frequency portion of AI - AI(LF and the low-frequency part of the thalamic medial geniculate body - MGB(LF in urethane anaesthetised guinea pigs. Both thalamic and cortical cells responded with brief increases in firing rate to one, or more, of the 8 main elements present in the chutter call. Almost none of the units responded to all 8 elements. While there were many different combinations of responses to between one and five of the elements, MBG(LF and AI(LF neurons exhibited the same specific types of response combinations. Nearby units in the upper layers of the cortex tended to respond to similar combinations of elements while the deep layers were less responsive. Thus the responses from a number of AI units would need to be combined in order to represent the entire chutter call. Our results don’t rule out the possibility of constructive convergence but there was no evidence that a convergence of inputs within AI led to a complete representation of all eight elements.

  3. Emotional response towards food packaging

    DEFF Research Database (Denmark)

    Liao, Lewis Xinwei; Corsi, Armando M.; Chrysochou, Polymeros

    2015-01-01

    In this paper we investigate consumers’ emotional responses to food packaging. More specifically, we use self-report and physiological measures to jointly assess emotional responses to three typical food packaging elements: colours (lowwavelength vs. high-wavelength), images (positive vs. negative...... response that can only be measured by self-report measures. We propose that a joint application of selfreport and physiological measures can lead to richer information and wider interpretation of consumer emotional responses to food packaging elements than using either measure alone....

  4. Global and Local Mechanical Responses for Necking of Rectangular Bars Using Updated and Total Lagrangian Finite Element Formulations

    Directory of Open Access Journals (Sweden)

    Claudio A. Careglio

    2016-01-01

    Full Text Available In simulations of forged and stamping processes using the finite element method, load displacement paths and three-dimensional stress and strains states should be well and reliably represented. The simple tension test is a suitable and economical tool to calibrate constitutive equations with finite strains and plasticity for those simulations. A complex three-dimensional stress and strain states are developed when this test is done on rectangular bars and the necking phenomenon appears. In this work, global and local numerical results of the mechanical response of rectangular bars subjected to simple tension test obtained from two different finite element formulations are compared and discussed. To this end, Updated and Total Lagrangian formulations are used in order to get the three-dimensional stress and strain states. Geometric changes together with strain and stress distributions at the cross section where necking occurs are assessed. In particular, a detailed analysis of the effective plastic strain, stress components in axial and transverse directions and pressure, and deviatoric stress components is presented. Specific numerical results are also validated with experimental measurements comparing, in turn, the performance of the two numerical approaches used in this study.

  5. Expression of MUC17 is regulated by HIF1α-mediated hypoxic responses and requires a methylation-free hypoxia responsible element in pancreatic cancer.

    Directory of Open Access Journals (Sweden)

    Sho Kitamoto

    Full Text Available MUC17 is a type 1 membrane-bound glycoprotein that is mainly expressed in the digestive tract. Recent studies have demonstrated that the aberrant overexpression of MUC17 is correlated with the malignant potential of pancreatic ductal adenocarcinomas (PDACs; however, the exact regulatory mechanism of MUC17 expression has yet to be identified. Here, we provide the first report of the MUC17 regulatory mechanism under hypoxia, an essential feature of the tumor microenvironment and a driving force of cancer progression. Our data revealed that MUC17 was significantly induced by hypoxic stimulation through a hypoxia-inducible factor 1α (HIF1α-dependent pathway in some pancreatic cancer cells (e.g., AsPC1, whereas other pancreatic cancer cells (e.g., BxPC3 exhibited little response to hypoxia. Interestingly, these low-responsive cells have highly methylated CpG motifs within the hypoxia responsive element (HRE, 5'-RCGTG-3', a binding site for HIF1α. Thus, we investigated the demethylation effects of CpG at HRE on the hypoxic induction of MUC17. Treatment of low-responsive cells with 5-aza-2'-deoxycytidine followed by additional hypoxic incubation resulted in the restoration of hypoxic MUC17 induction. Furthermore, DNA methylation of HRE in pancreatic tissues from patients with PDACs showed higher hypomethylation status as compared to those from non-cancerous tissues, and hypomethylation was also correlated with MUC17 mRNA expression. Taken together, these findings suggested that the HIF1α-mediated hypoxic signal pathway contributes to MUC17 expression, and DNA methylation of HRE could be a determinant of the hypoxic inducibility of MUC17 in pancreatic cancer cells.

  6. The human tartrate-resistant acid phosphatase (TRAP): involvement of the hemin responsive elements (HRE) in transcriptional regulation.

    Science.gov (United States)

    Fleckenstein, E C; Dirks, W G; Drexler, H G

    2000-02-01

    The biochemical properties and protein structure of the tartrate-resistant acid phosphatase (TRAP), an iron-containing lysosomal glycoprotein in cells of the mononuclear phagocyte system, are well known. In contrast, little is known about the physiology and genic structure of this unique enzyme. In some diseases, like hairy cell leukemia, Gaucher's disease and osteoclastoma, cytochemically detected TRAP expression is used as a disease-associated marker. In order to begin to elucidate the regulation of this gene we generated different deletion constructs of the TRAP 5'-flanking region, placed them upstream of the luciferase reporter gene and assayed them for their ability to direct luciferase expression in human 293 cells. Treatment of these cells with the iron-modulating reagents transferrin and hemin causes opposite effects on the TRAP promoter activity. Two regulatory GAGGC tandem repeat sequences (the hemin responsive elements, HRE) within the 5'-flanking region of the human TRAP gene were identified. Studies with specific HRE-deletion constructs of the human TRAP 5'-flanking region upstream of the luciferase reporter gene document the functionality of these HRE-sequences which are apparently responsible for mediating transcriptional inhibition upon exposure to hemin. In addition to the previously published functional characterization of the murine TRAP HRE motifs, these results provide the first description of a new iron/hemin-responsive transcriptional regulation in the human TRAP gene.

  7. District element modelling of the rock mass response to glaciation at Finnsjoen, central Sweden

    International Nuclear Information System (INIS)

    Rosengren, L.; Stephansson, O.

    1990-12-01

    Six rock mechanics models of a cross section of the Finnsjoen test site have been simulated by means of distinct element analysis and the computer code UDEC. The rock mass response to glaciation, deglaciation, isostatic movements and water pressure from an ice lake have been simulated. Four of the models use a boundary condition with boundary elements at the bottom and sides of the model. This gives a state of stress inside the model which agrees well with the analytical solution where the horizontal and vertical stresses are almost similar. Roller boundaries were applied to two models. This boundary condition cause zero lateral displacement at the model boundaries and the horizontal stress are always less than the vertical stress. Isostatic movements were simulated in one model. Two different geometries of fracture Zone 2 were simulated. Results from modelling the two different geometries show minor changes in stresses, displacements and failure of fracture zones. Under normal pore pressure conditions in the rock mass the weight of the ice load increases the vertical stresses in the models differ depending on the boundary condition. An ice thickness of 3 km and 1 km and an ice wedge of 1 km thickness covering half the top surface of the model have been simulated. For each loading sequence of the six models a complete set of data about normal stress, stress profiles along selected sections, displacements and failure of fracture zones are presented. Based on the results of this study a protection zone of about 100 m width from the outer boundary of stress discontinuity to the repository location is suggested. This value is based on the result that the stress disturbance diminishes at this distance from the outer boundary of the discontinuity. (25 refs.) (authors)

  8. Phosphorylated cAMP response element-binding protein as a molecular marker of memory processing in rat hippocampus: effect of novelty

    OpenAIRE

    Viola, Haydée Ana María; Furman, Melina; Izquierdo, Luciana Adriana; Alonso, Mariana; Barros, Daniela Martí; Souza, Márcia Maria de; Izquierdo, Ivan Antônio; Medina, Jorge Horacio

    2000-01-01

    From mollusks to mammals the activation of cAMP response element-binding protein (CREB) appears to be an important step in the formation of long-term memory (LTM). Here we show that a 5 min exposure to a novel environment (open field) 1 hr after acquisition of a one-trial inhibitory avoidance training hinders both the formation of LTM for the avoidance task and the increase in the phosphorylation state of hippocampal Ser 133 CREB [phosphorylated CREB (pCREB)] associated with the avoidance tra...

  9. An ethylene-responsive enhancer element is involved in the senescence-related expression of the carnation glutathione-S-transferase (GST1) gene.

    OpenAIRE

    Itzhaki, H; Maxson, J M; Woodson, W R

    1994-01-01

    The increased production of ethylene during carnation petal senescence regulates the transcription of the GST1 gene encoding a subunit of glutathione-S-transferase. We have investigated the molecular basis for this ethylene-responsive transcription by examining the cis elements and trans-acting factors involved in the expression of the GST1 gene. Transient expression assays following delivery of GST1 5' flanking DNA fused to a beta-glucuronidase receptor gene were used to functionally define ...

  10. Environmental mineralogy - Understanding element behavior in ecosystems

    International Nuclear Information System (INIS)

    Brown Jr, G.E.; Calas, G.

    2011-01-01

    Environmental Mineralogy has developed over the past decade in response to the recognition that minerals are linked in many important ways with the global ecosystem. Minerals are the main repositories of the chemical elements in Earth's crust and thus are the main sources of elements needed for the development of civilization, contaminant and pollutant elements that impact global and local ecosystems, and elements that are essential plant nutrients. These elements are released from minerals through natural processes, such as chemical weathering, and anthropogenic activities, such as mining and energy production, agriculture and industrial activities, and careless waste disposal. Minerals also play key roles in the biogeochemical cycling of the elements, sequestering elements and releasing them as the primary minerals in crustal rocks undergo various structural and compositional transformations in response to physical, chemical, and biological processes that produce secondary minerals and soils. These processes have resulted in the release of toxic elements such as arsenic in groundwater aquifers, which is having a major impact on the health of millions of people in South and Southeast Asia. The interfaces between mineral surfaces and aqueous solutions are the locations of most chemical reactions that control the composition of the natural environment, including the composition of natural waters. The nuclear fuel cycle, from uranium mining to the disposition of high-level nuclear waste, is also intimately related to minerals. A fundamental understanding of these processes requires molecular-scale information about minerals, their bulk structures and properties such as solubility, their surfaces, and their interactions with aqueous solutions, atmospheric and soil gases, natural organic matter, and biological organisms. Gaining this understanding is further complicated by the presence of natural, incidental, and manufactured nano-particles in the environment, which

  11. The key elements for genetic response in Finnish dairy cattle breeding

    Directory of Open Access Journals (Sweden)

    Jarmo Juga

    1998-01-01

    Full Text Available This paper reviews some key elements of Finnish animal breeding research contributing to the Finnish dairy cattle breeding programme and discusses the possibilities and problems in collecting data for genetic evaluation, prediction of breeding values both within and across countries, estimation of the economic value of important traits, and selection of bulls and cows. Economic values are calculated for fertility, udder health and production traits when one genetic standard deviation unit (gen. sd. is changed in each trait independently and the financial returns from selection response in the Finnish dairy cattle breeding programme are estimated. The following components were used to calculate the economic value of mastitis treatments: 1 cost of mastitis including discarded milk and treatment costs, 2 reduction in milk price due to higher somatic cell count, 3 replacement costs and 4 lower production level of the herd due to involuntary culling of cows because of udder problems. A high somatic cell count lowers the price of milk and eventually leads to involuntary culling. For treatments for fertility disorders the following costs were included: 1 treatment costs 2 higher replacement costs and 3 decreased milk production in the herd. Days open included the following costs: 1 extra insemination, 2 reduced annual milk yield and 3 fewer calves born. Animal breeding was found to be a very cost effective investment, yielding returns of FIM 876.9 per cow from one round of selection when the gene flow was followed for over 25 years in the Finnish dairy cattle breeding programme.

  12. Fast finite elements for surgery simulation

    DEFF Research Database (Denmark)

    Bro-Nielsen, Morten

    1997-01-01

    This paper discusses volumetric deformable models for modeling human body parts and organs in surgery simulation systems. These models are built using finite element models for linear elastic materials. To achieve real-time response condensation has been applied to the system stiffness matrix...

  13. Application of a nonlinear spring element to analysis of circumferentially cracked pipe under dynamic loading

    International Nuclear Information System (INIS)

    Olson, R.; Scott, P.; Wilkowski, G.M.

    1992-01-01

    As part of the US NRC's Degraded Piping Program, the concept of using a nonlinear spring element to simulate the response of cracked pipe in dynamic finite element pipe evaluations was initially proposed. The nonlinear spring element is used to represent the moment versus rotation response of the cracked pipe section. The moment-rotation relationship for the crack size and material of interest is determined from either J-estimation scheme analyses or experimental data. In this paper, a number of possible approaches for modeling the nonlinear stiffness of the cracked pipe section are introduced. One approach, modeling the cracked section moment rotation response with a series of spring-slider elements, is discussed in detail. As part of this discussion, results from a series of finite element predictions using the spring-slider nonlinear spring element are compared with the results from a series of dynamic cracked pipe system experiments from the International Piping Integrity Research Group (IPIRG) program

  14. Response of a multi-element dosimeter to calibrated beta sources with E/sub max/ from 0.23 to 3.5 MeV

    International Nuclear Information System (INIS)

    Endres, G.W.R.; Scherpelz, R.I.; Roberson, P.L.

    1982-06-01

    The responses of several different dosimeter absorber systems were studied to determine their usefulness in beta radiation fields. Exposures to several different beta emitters were conducted at the PNL Calibrations Laboratory. The sources used are: 147 Pm, 85 Kr, U(nat), 90 Sr- 90 Y, and 106 Ru- 106 Rh. The maximum energy of these beta emitters varies from 0.23 to 3.5 MeV. The beta sources are calibrated for absorbed dose to tissue at a depth of 0.007 cm. Measurements of response for 4, 5, and 7 element versions of the dosimeter were made. All data reported were obtained from sets of three TLDs exposed under each absorber and for each of the radiation sources

  15. A Bifunctional Intronic Element Regulates the Expression of the Arginine/Lysine Transporter Cat-1 via Mechanisms Involving the Purine-rich Element Binding Protein A (Purα)*

    Science.gov (United States)

    Huang, Charlie C.; Chiribau, Calin-Bogdan; Majumder, Mithu; Chiang, Cheng-Ming; Wek, Ronald C.; Kelm, Robert J.; Khalili, Kamel; Snider, Martin D.; Hatzoglou, Maria

    2009-01-01

    Expression of the arginine/lysine transporter Cat-1 is highly induced in proliferating and stressed cells via mechanisms that include transcriptional activation. A bifunctional INE (intronic element) within the first intron of the Cat-1 gene was identified and characterized in this study. The INE had high sequence homology to an amino acid response element and was shown to act as a transcriptional enhancer in unstressed cells by binding the transcription factor, purine-rich element binding protein A (Purα). During endoplasmic reticulum stress, binding of Purα to the INE decreased; the element acted as a positive regulator in early stress by binding of the transcription factor ATF4 and as a negative regulator in prolonged stress by binding the stress-induced C/EBP family member, CHOP. We conclude that transcriptional control of the Cat-1 gene is tightly controlled by multiple cis-DNA elements, contributing to regulation of cationic amino acid transport for cell growth and proliferation. In addition, we propose that genes may use stress-response elements such as the INE to support basal expression in the absence of stress. PMID:19720825

  16. The cis decoy against the estrogen response element suppresses breast cancer cells via target disrupting c-fos not mitogen-activated protein kinase activity.

    Science.gov (United States)

    Wang, Li Hua; Yang, Xiao Yi; Zhang, Xiaohu; Mihalic, Kelly; Xiao, Weihua; Farrar, William L

    2003-05-01

    Breast cancer, the most common malignancy in women, has been demonstrated to be associated with the steroid hormone estrogen and its receptor (ER), a ligand-activated transcription factor. Therefore, we developed a phosphorothiolate cis-element decoy against the estrogen response element (ERE decoy) to target disruption of ER DNA binding and transcriptional activity. Here, we showed that the ERE decoy potently ablated the 17beta-estrogen-inducible cell proliferation and induced apoptosis of human breast carcinoma cells by functionally affecting expression of c-fos gene and AP-1 luciferase gene reporter activity. Specificity of the decoy was demonstrated by its ability to directly block ER binding to a cis-element probe and transactivation. Moreover, the decoy failed to inhibit ER-mediated mitogen-activated protein kinase signaling pathways and cell growth of ER-negative breast cancer cells. Taken together, these data suggest that estrogen-mediated cell growth of breast cancer cells can be preferentially restricted via targeted disruption of ER at the level of DNA binding by a novel and specific decoy strategy applied to steroid nuclear receptors.

  17. Identification of cis-acting regulatory elements in the human oxytocin gene promoter.

    Science.gov (United States)

    Richard, S; Zingg, H H

    1991-12-01

    The expression of hormone-inducible genes is determined by the interaction of trans-acting factors with hormone-inducible elements and elements mediating basal and cell-specific expression. We have shown earlier that the gene encoding the hypothalamic nonapeptide oxytocin (OT) is under the control of an estrogen response element (ERE). The present study was aimed at identifying cis-acting elements mediating basal expression of the OT gene. A construct containing sequences -381 to +36 of the human OT gene was linked to a reporter gene and transiently transfected into a series of neuronal and nonneuronal cell lines. Expression of this construct was cell specific: it was highest in the neuroblastoma-derived cell line, Neuro-2a, and lowest in NIH 3T3 and JEG-3 cells. By 5' deletion analysis, we determined that a segment from -49 to +36 was capable of mediating cells-pecific promoter activity. Within this segment, we identified three proximal promoter elements (PPE-1, PPE-2, and PPE-3) that are each required for promoter activity. Most notably, mutation of a conserved purine-rich element (GAGAGA) contained within PPE-2 leads to a 10-fold decrease in promoter strength. Gel mobility shift analysis with three different double-stranded oligonucleotides demonstrated that each proximal promoter element binds distinct nuclear factors. In each case, only the homologous oligonucleotide, but neither of the oligonucleotides corresponding to adjacent elements, was able to act as a competitor. Thus, a different set of factors appears to bind independently to each element. By reinserting the homologous ERE or a heterologous glucocorticoid response element upstream of intact or altered proximal promoter segments we determined that removal or mutation of proximal promoter elements decreases basal expression, but does not abrogate the hormone responsiveness of the promoter. In conclusion, these results indicate that an important component of the transcriptional activity of the OT

  18. Dynamic characterization of the CAREM fuel element prototype

    International Nuclear Information System (INIS)

    Ghiselli, Alberto M.; Fiori, Jose M.; Ibanez, Luis A.

    2004-01-01

    As a previous step to make a complete test plan to evaluate the hydrodynamic behavior of the present configuration of the CAREM type fuel element, a dynamic characterization analysis is required, without the dynamic response induced by the flowing fluid. This paper presents the tests made, the methods and instrumentation used, and the results obtained in order to obtain a complete dynamic characterization of the CAREM type fuel element. (author)

  19. Design Process for Integrated Concepts with Responsive Building Elements

    DEFF Research Database (Denmark)

    Aa, Van der A.; Heiselberg, Per

    2008-01-01

    An integrated building concept is a prerequisite to come to an energy efficient building with a good and healthy IAQ indoor comfort. A design process that defines the targets and boundary conditions in the very first stage of the design and guarantees them until the building is finished and used...... is needed. The hard question is however: how to make the right choice of the combination of individual measures from building components and building services elements. Within the framework of IEA-ECBCS Annex 44 research has been conducted about the design process for integrated building concepts...

  20. Killing of Brain Tumor Cells by Hypoxia-Responsive Element Mediated Expression of BAX

    Directory of Open Access Journals (Sweden)

    Hangjun Ruan

    1999-11-01

    Full Text Available The presence of radioresistant hypoxic cells in human brain tumors limits the overall effectiveness of conventional fractionated radiation therapy. Tumor-specific therapies that target hypoxic cells are clearly needed. We have investigated the expression of suicide genes under hypoxia by a hypoxia-responsive element (HRE, which can be activated through hypoxia-inducible factor-1 (HIF-1. We transfected plasmids containing multiple copies of HIRE into U-87 MG and U-251 MG-NCI human brain tumor cells and tested their ability to induce LacZ gene expression under anoxia. Gene expression under anoxia versus oxia was increased about 12-fold for U-87 MG cells and about fourfold for U-251 MG-NCI cells. At intermediate hypoxic conditions, increased LacZ gene expression in U-87 MG cells was induced by the plasmid that contained three HREs, but not by the plasmid with two HREs. Lastly, when we placed a suicide gene BAX under the control of HREs, cells transfected with the BAX plasmids were preferentially killed through apoptosis under anoxia. Our studies demonstrate that HRE-regulated gene expression is active in brain tumor cells, and that the amount of increased gene expression obtained is dependent on the cell line, the HIRE copy number, and the degree of hypoxia.

  1. The role of hypoxia response element in TGFβ-induced carbonic anhydrase IX expression in Hep3B human hepatoma cells

    Directory of Open Access Journals (Sweden)

    Yildirim Hatice

    2017-01-01

    Full Text Available Carbonic anhydrase IX (CAIX is a hypoxia-regulated gene. It is over expressed in a variety of cancers, including hepatocellular cancer. Transforming growth factor β (TGFβ is considered to have an impact on cancer biology due to its important roles in cell proliferation and differentiation. The effect of the TGFβ on CAIX expression under hypoxia and the mechanism underlying the role of the hypoxia response element (HRE on this expression are unknown. In this study, we demonstrate that TGFβ upregulates CAIX expression under hypoxic conditions in the Hep3B hepatoma cell line, indicating that the mitogen-activated protein kinase (MAPK- and phosphatidylinositol-4,5-bisphosphate 3-kinase (PI3K-signaling pathways might be responsible for this response. Site-directed mutagenesis of the HRE region in CAIX promoter reduced the TGFβ-induced CAIX promoter activity, pointing to the significance of HRE for this response. Up regulation of TGFβ-stimulated CAIX expression was consistent with the up regulation of promoter activity of five different truncated constructs of the CAIX promoter under hypoxia. Our findings show that the HRE region is critical for TGFβ-induced CAIX expression, which is mainly controlled by MAPK and PI3K pathways.

  2. Abscisic acid-activated SNRK2 protein kinases function in the gene-regulation pathway of ABA signal transduction by phosphorylating ABA response element-binding factors.

    Science.gov (United States)

    Kobayashi, Yuhko; Murata, Michiharu; Minami, Hideyuki; Yamamoto, Shuhei; Kagaya, Yasuaki; Hobo, Tokunori; Yamamoto, Akiko; Hattori, Tsukaho

    2005-12-01

    The plant hormone abscisic acid (ABA) induces gene expression via the ABA-response element (ABRE) present in the promoters of ABA-regulated genes. A group of bZIP proteins have been identified as ABRE-binding factors (ABFs) that activate transcription through this cis element. A rice ABF, TRAB1, has been shown to be activated via ABA-dependent phosphorylation. While a large number of signalling factors have been identified that are involved in stomatal regulation by ABA, relatively less is known about the ABA-signalling pathway that leads to gene expression. We have shown recently that three members of the rice SnRK2 protein kinase family, SAPK8, SAPK9 and SAPK10, are activated by ABA signal as well as by hyperosmotic stress. Here we show that transient overexpression in cultured cell protoplasts of these ABA-activated SnRK2 protein kinases leads to the activation of an ABRE-regulated promoter, suggesting that these kinases are involved in the gene-regulation pathway of ABA signalling. We further show several lines of evidence that these ABA-activated SnRK2 protein kinases directly phosphorylate TRAB1 in response to ABA. Kinetic analysis of SAPK10 activation and TRAB1 phosphorylation indicated that the latter immediately followed the former. TRAB1 was found to be phosphorylated not only in response to ABA, but also in response to hyperosmotic stress, which was interpreted as the consequence of phosphorylation of TRAB1 by hyperosmotically activated SAPKs. Physical interaction between TRAB1 and SAPK10 in vivo was demonstrated by a co-immunoprecipitation experiment. Finally, TRAB1 was phosphorylated in vitro by the ABA-activated SnRK2 protein kinases at Ser102, which is phosphorylated in vivo in response to ABA and is critical for the activation function.

  3. Four New Acylated Iridoid Glycosides from the Aerial Part of Veronicastrum sibiricum and Their Antioxidant Response Element-Inducing Activity.

    Science.gov (United States)

    Kim, Myeong Il; Kim, Chul Young

    2018-01-01

    Four new (1 - 4) and one known (5) acylated iridoid glycosides were isolated from the aerial parts of Veronicastrum sibiricum (L.) Pennell. The chemical structures of the isolated compounds were determined to be 3″,4″-dicinnamoyl-6-O-rhamnopyranosyl-10-O-bergaptol-5,7-bisdeoxycynanchoside (1), 3″,4″-dicinnamoyl-6-O-rhamnopyranosylpaulownioside (2), 2″,4″-dicinnamoyl-6-O-rhamnopyranosylcatalpol (3), 3″,4″-dicinnamoyl-6-O-rhamnopyranosylaucubin (4), and 3″,4″-dicinnamoyl-6-O-rhamnopyranosylcatalpol (5) using spectroscopic techniques. Among these compounds, compound 5 increased antioxidant response element (ARE) luciferase activity. © 2018 Wiley-VHCA AG, Zurich, Switzerland.

  4. A comparative study of finite element methodologies for the prediction of torsional response of bladed rotors

    International Nuclear Information System (INIS)

    Scheepers, R.; Heyns, P. S.

    2016-01-01

    The prevention of torsional vibration-induced fatigue damage to turbo-generators requires determining natural frequencies by either field testing or mathematical modelling. Torsional excitation methods, measurement techniques and mathematical modelling are active fields of research. However, these aspects are mostly considered in isolation and often without experimental verification. The objective of this work is to compare one dimensional (1D), full three dimensional (3D) and 3D cyclic symmetric (3DCS) Finite element (FE) methodologies for torsional vibration response. Results are compared to experimental results for a small-scale test rotor. It is concluded that 3D approaches are feasible given the current computing technology and require less simplification with potentially increased accuracy. Accuracy of 1D models may be reduced due to simplifications but faster solution times are obtained. For high levels of accuracy model updating using field test results is recommended

  5. Hypoxia-Response Element (HRE)–Directed Transcriptional Regulation of the Rat Lysyl Oxidase Gene in Response to Cobalt and Cadmium

    Science.gov (United States)

    Li, Wande

    2013-01-01

    Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5′-ACGTG-3′) exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10–100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)–treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at −387/−383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation. PMID:23161664

  6. Alcohol dysregulates corticotropin-releasing-hormone (CRH promoter activity by interfering with the negative glucocorticoid response element (nGRE.

    Directory of Open Access Journals (Sweden)

    Magdalena M Przybycien-Szymanska

    Full Text Available EtOH exposure in male rats increases corticotropin-releasing hormone (CRH mRNA in the paraventricular nucleus of the hypothalamus (PVN, a brain region responsible for coordinating stress and anxiety responses. In this study we identified the molecular mechanisms involved in mediating these effects by examining the direct effects of EtOH on CRH promoter activity in a neuronal cell line derived from the PVN (IVB. In addition, we investigated the potential interactions of EtOH and glucocorticoids on the CRH promoter by concomitantly treating cells with EtOH and the glucocorticoid receptor (GR antagonist RU486, and by sequentially deleting GR binding sites within glucocorticoid response element (GRE on the CRH promoter. Cells were transiently transfected with a firefly luciferase reporter construct containing 2.5 kb of the rat wild type (WT or mutated CRH promoter. Our results showed that EtOH treatment induced a biphasic response in CRH promoter activity. EtOH exposure for 0.5 h significantly decreased promoter activity compared to vehicle treated controls, whereas promoter activity was significantly increased after 2.0 h of EtOH exposure. Treatment with RU486, or deletion of the GR binding sites 1 and 2 within the GRE, abolished the EtOH-induced increase in the promoter activity, however did not affect EtOH-induced decrease in CRH promoter activity at an earlier time point. Overall, our data suggest that alcohol exposure directly regulates CRH promoter activity by interfering with the normal feedback mechanisms of glucocorticoids mediated by GR signaling at the GRE site of the CRH promoter.

  7. Limitations of commonly used thick-element personal dosimeters

    International Nuclear Information System (INIS)

    Gupta, V.P.

    1983-01-01

    In the ANSI Standard N13.11, accepted in June 1982, radiation dose depths of 1.0 cm and 0.007 cm in tissue for protection dosimetry have been adopted for deep and shallow dose equivalent estimations respectively. This standard is presently used for a mandatory personnel dosimetry performance testing program in the United States. Estimation of shallow-dose equivalent using a two-element dosimeter is described under the guidelines of this standard and the dosimetry practices followed by most dosimeter processors. A mathematical formulation, correlating a dosimeter response and shallow-dose equivalent factors at different energies, is presented. Also, the performance of a two-element thermoluminescent dosimeter is examined and the shallow-dose equivalent response results, both for the beta particles and photons, are discussed

  8. Implicit three-dimensional finite-element formulation for the nonlinear structural response of reactor components

    International Nuclear Information System (INIS)

    Kulak, R.F.; Belytschko, T.B.

    1975-09-01

    The formulation of a finite-element procedure for the implicit transient and static analysis of plate/shell type structures in three-dimensional space is described. The triangular plate/shell element can sustain both membrane and bending stresses. Both geometric and material nonlinearities can be treated, and an elastic-plastic material law has been incorporated. The formulation permits the element to undergo arbitrarily large rotations and translations; but, in its present form it is restricted to small strains. The discretized equations of motion are obtained by a stiffness method. An implicit integration algorithm based on trapezoidal integration formulas is used to integrate the discretized equations of motion in time. To ensure numerical stability, an iterative solution procedure with equilibrium checks is used

  9. The Seismic Response of High-Speed Railway Bridges Subjected to Near-Fault Forward Directivity Ground Motions Using a Vehicle-Track-Bridge Element

    Directory of Open Access Journals (Sweden)

    Chen Ling-kun

    2014-01-01

    Full Text Available Based on the Next Generation Attenuation (NGA project ground motion library, the finite element model of the high-speed railway vehicle-bridge system is established. The model was specifically developed for such system that is subjected to near-fault ground motions. In addition, it accounted for the influence of the rail irregularities. The vehicle-track-bridge (VTB element is presented to simulate the interaction between train and bridge, in which a train can be modeled as a series of sprung masses concentrated at the axle positions. For the short period railway bridge, the results from the case study demonstrate that directivity pulse effect tends to increase the seismic responses of the bridge compared with far-fault ground motions or nonpulse-like motions and the directivity pulse effect and high values of the vertical acceleration component can notably influence the hysteretic behaviour of piers.

  10. An ABA-responsive element in the AtSUC1 promoter is involved in the regulation of AtSUC1 expression.

    Science.gov (United States)

    Hoth, Stefan; Niedermeier, Matthias; Feuerstein, Andrea; Hornig, Julia; Sauer, Norbert

    2010-09-01

    Abscisic acid (ABA) and sugars regulate many aspects of plant growth and development, and we are only just beginning to understand the complex interactions between ABA and sugar signaling networks. Here, we show that ABA-dependent transcription factors bind to the promoter of the Arabidopsis thaliana AtSUC1 (At1g71880) sucrose transporter gene in vitro. We present the characterization of a cis-regulatory element by truncation of the AtSUC1 promoter and by electrophoretic mobility shift assays that is identical to a previously characterized ABA-responsive element (ABRE). In yeast 1-hybrid analyses we identified ABI5 (AtbZIP39; At2g36270) and AREB3 (AtbZIP66; At3g56850) as potential interactors. Analyses of plants expressing the beta-glucuronidase reporter gene under the control of ABI5 or AREB3 promoter sequences demonstrated that both transcription factor genes are co-expressed with AtSUC1 in pollen and seedlings, the primary sites of AtSUC1 action. Mutational analyses of the identified cis-regulatory element verified its importance for AtSUC1 expression in young seedlings. In abi5-4 seedlings, we observed an increase of sucrose-dependent anthocyanin accumulation and AtSUC1 mRNA levels. This suggests that ABI5 prevents an overshoot of sucrose-induced AtSUC1 expression and confirmed a novel cross-link between sugar and ABA signaling.

  11. Transactivation of a cellular promoter by the NS1 protein of the parvovirus minute virus of mice through a putative hormone-responsive element.

    Science.gov (United States)

    Vanacker, J M; Corbau, R; Adelmant, G; Perros, M; Laudet, V; Rommelaere, J

    1996-01-01

    The promoter of the thyroid hormone receptor alpha gene (c-erbA-1) is activated by the nonstructural protein 1 (NS1) of parvovirus minute virus of mice (prototype strain [MVMp]) in ras-transformed FREJ4 cells that are permissive for lytic MVMp replication. This stimulation may be related to the sensitivity of host cells to MVMp, as it does not take place in parental FR3T3 cells, which are resistant to the parvovirus killing effect. The analysis of a series of deletion and point mutants of the c-erbA-1 promoter led to the identification of an upstream region that is necessary for NS1-driven transactivation. This sequence harbors a putative hormone-responsive element and is sufficient to render a minimal promoter NS1 inducible in FREJ4 but not in FR3T3 cells, and it is involved in distinct interactions with proteins from the respective cell lines. The NS1-responsive element of the c-erbA-1 promoter bears no homology with sequences that were previously reported to be necessary for NS1 DNA binding and transactivation. Altogether, our data point to a novel, cell-specific mechanism of promoter activation by NS1. PMID:8642664

  12. Rev and Rex proteins of human complex retroviruses function with the MMTV Rem-responsive element

    Directory of Open Access Journals (Sweden)

    Dudley Jaquelin P

    2009-02-01

    Full Text Available Abstract Background Mouse mammary tumor virus (MMTV encodes the Rem protein, an HIV Rev-like protein that enhances nuclear export of unspliced viral RNA in rodent cells. We have shown that Rem is expressed from a doubly spliced RNA, typical of complex retroviruses. Several recent reports indicate that MMTV can infect human cells, suggesting that MMTV might interact with human retroviruses, such as human immunodeficiency virus (HIV, human T-cell leukemia virus (HTLV, and human endogenous retrovirus type K (HERV-K. In this report, we test whether the export/regulatory proteins of human complex retroviruses will increase expression from vectors containing the Rem-responsive element (RmRE. Results MMTV Rem, HIV Rev, and HTLV Rex proteins, but not HERV-K Rec, enhanced expression from an MMTV-based reporter plasmid in human T cells, and this activity was dependent on the RmRE. No RmRE-dependent reporter gene expression was detectable using Rev, Rex, or Rec in HC11 mouse mammary cells. Cell fractionation and RNA quantitation experiments suggested that the regulatory proteins did not affect RNA stability or nuclear export in the MMTV reporter system. Rem had no demonstrable activity on export elements from HIV, HTLV, or HERV-K. Similar to the Rem-specific activity in rodent cells, the RmRE-dependent functions of Rem, Rev, or Rex in human cells were inhibited by a dominant-negative truncated nucleoporin that acts in the Crm1 pathway of RNA and protein export. Conclusion These data argue that many retroviral regulatory proteins recognize similar complex RNA structures, which may depend on the presence of cell-type specific proteins. Retroviral protein activity on the RmRE appears to affect a post-export function of the reporter RNA. Our results provide additional evidence that MMTV is a complex retrovirus with the potential for viral interactions in human cells.

  13. Transport of rare earth element-tagged soil particles in response to thunderstorm runoff.

    Science.gov (United States)

    Matisoff, G; Ketterer, M E; Wilson, C G; Layman, R; Whiting, P J

    2001-08-15

    The downslope transport of rare earth element-tagged soil particles remobilized during a spring thunderstorm was studied on both a natural prairie and an agricultural field in southwestern Iowa (U.S.A.). A technique was developed for tagging natural soils with the rare earth elements Eu, Tb, and Ho to approximately 1,000 ppm via coprecipitation with MnO2. Tagged material was replaced in target locations; surficial soil samples were collected following precipitation and runoff; and rare earth element concentrations were determined by inductively coupled plasma mass spectrometry. Diffusion and exponential models were applied to the concentration-distance data to determine particle transport distances. The results indicate that the concentration-distance data are well described by the diffusion model, butthe exponential model does not simulate the rapid drop-off in concentrations near the tagged source. Using the diffusion model, calculated particle transport distances at all hillside locations and at both the cultivated and natural prairie sites were short, ranging from 3 to 73 cm during this single runoff event. This study successfully demonstrates a new tool for studying soil erosion.

  14. Hybrid finite element method for describing the electrical response of biological cells to applied fields.

    Science.gov (United States)

    Ying, Wenjun; Henriquez, Craig S

    2007-04-01

    A novel hybrid finite element method (FEM) for modeling the response of passive and active biological membranes to external stimuli is presented. The method is based on the differential equations that describe the conservation of electric flux and membrane currents. By introducing the electric flux through the cell membrane as an additional variable, the algorithm decouples the linear partial differential equation part from the nonlinear ordinary differential equation part that defines the membrane dynamics of interest. This conveniently results in two subproblems: a linear interface problem and a nonlinear initial value problem. The linear interface problem is solved with a hybrid FEM. The initial value problem is integrated by a standard ordinary differential equation solver such as the Euler and Runge-Kutta methods. During time integration, these two subproblems are solved alternatively. The algorithm can be used to model the interaction of stimuli with multiple cells of almost arbitrary geometries and complex ion-channel gating at the plasma membrane. Numerical experiments are presented demonstrating the uses of the method for modeling field stimulation and action potential propagation.

  15. An upstream activation element exerting differential transcriptional activation on an archaeal promoter

    DEFF Research Database (Denmark)

    Peng, Nan; Xia, Qiu; Chen, Zhengjun

    2009-01-01

    S gene encoding an arabinose binding protein was characterized using an Sulfolobus islandicus reporter gene system. The minimal active araS promoter (P(araS)) was found to be 59 nucleotides long and harboured four promoter elements: an ara-box, an upstream transcription factor B-responsive element (BRE......), a TATA-box and a proximal promoter element, each of which contained important nucleotides that either greatly decreased or completely abolished promoter activity upon mutagenesis. The basal araS promoter was virtually inactive due to intrinsically weak BRE element, and the upstream activating sequence...... (UAS) ara-box activated the basal promoter by recruiting transcription factor B to its BRE. While this UAS ensured a general expression from an inactive or weak basal promoter in the presence of other tested carbon resources, it exhibited a strong arabinose-responsive transcriptional activation. To our...

  16. The Ubx Polycomb response element bypasses an unpaired Fab-8 insulator via cis transvection in Drosophila.

    Science.gov (United States)

    Lu, Danfeng; Li, Zhuoran; Li, Lingling; Yang, Liping; Chen, Guijun; Yang, Deying; Zhang, Yue; Singh, Vikrant; Smith, Sheryl; Xiao, Yu; Wang, Erlin; Ye, Yunshuang; Zhang, Wei; Zhou, Lei; Rong, Yikang; Zhou, Jumin

    2018-01-01

    Chromatin insulators or boundary elements protect genes from regulatory activities from neighboring genes or chromatin domains. In the Drosophila Abdominal-B (Abd-B) locus, the deletion of such elements, such as Frontabdominal-7 (Fab-7) or Fab-8 led to dominant gain of function phenotypes, presumably due to the loss of chromatin barriers. Homologous chromosomes are paired in Drosophila, creating a number of pairing dependent phenomena including transvection, and whether transvection may affect the function of Polycomb response elements (PREs) and thus contribute to the phenotypes are not known. Here, we studied the chromatin barrier activity of Fab-8 and how it is affected by the zygosity of the transgene, and found that Fab-8 is able to block the silencing effect of the Ubx PRE on the DsRed reporter gene in a CTCF binding sites dependent manner. However, the blocking also depends on the zygosity of the transgene in that the barrier activity is present when the transgene is homozygous, but absent when the transgene is heterozygous. To analyze this effect, we performed chromatin immunoprecipitation and quantitative PCR (ChIP-qPCR) experiments on homozygous transgenic embryos, and found that H3K27me3 and H3K9me3 marks are restricted by Fab-8, but they spread beyond Fab-8 into the DsRed gene when the two CTCF binding sites within Fab-8 were mutated. Consistent with this, the mutation reduced H3K4me3 and RNA Pol II binding to the DsRed gene, and consequently, DsRed expression. Importantly, in heterozygous embryos, Fab-8 is unable to prevent the spread of H3K27me3 and H3K9me3 marks from crossing Fab-8 into DsRed, suggesting an insulator bypass. These results suggest that in the Abd-B locus, deletion of the insulator in one copy of the chromosome could lead to the loss of insulator activity on the homologous chromosome, and in other loci where chromosomal deletion created hemizygous regions of the genome, the chromatin barrier could be compromised. This study highlights

  17. Analysis of a cis-Acting Element Involved in Regulation by Estrogen of Human Angiotensinogen Gene Expression.

    Science.gov (United States)

    Zhao, Yan-Yan; Sun, Kai-Lai; Ashok, Kumar

    1998-01-01

    The work was aimed to identify the estrogen responsive element in the human angiotensinogen gene. The nucleotide sequence between the transcription initiation site and TATA box in angiotensinogen gene promoter was found to be strongly homologous with the consensus estrogen responsive element. This sequence was confirmed as the estrogen responsive element (HAG ERE) by electrophoretic mobility shift assay. The recombinant expression vectors were constructed in which chloramphenicol acetyltransferase (CAT) reporter gene was driven by angiotensinogen core promoter with HAG ERE of by TK core promoter with multiplied HAG ERE, and were used in cotransfection with the human estrogen receptor expression vector into HepG(2) cells; CAT assays showed an increase of the CAT activity on 17beta-estradiol treatment in those transfectants. These results suggest that the human angiotensinogen gene is transcriptionally up-regulated by estrogen through the estrogen responsive element near TATA box of the promoter.

  18. Hydroponics: A Versatile System to Study Nutrient Allocation and Plant Responses to Nutrient Availability and Exposure to Toxic Elements.

    Science.gov (United States)

    Nguyen, Nga T; McInturf, Samuel A; Mendoza-Cózatl, David G

    2016-07-13

    Hydroponic systems have been utilized as one of the standard methods for plant biology research and are also used in commercial production for several crops, including lettuce and tomato. Within the plant research community, numerous hydroponic systems have been designed to study plant responses to biotic and abiotic stresses. Here we present a hydroponic protocol that can be easily implemented in laboratories interested in pursuing studies on plant mineral nutrition. This protocol describes the hydroponic system set up in detail and the preparation of plant material for successful experiments. Most of the materials described in this protocol can be found outside scientific supply companies, making the set up for hydroponic experiments less expensive and convenient. The use of a hydroponic growth system is most advantageous in situations where the nutrient media need to be well controlled and when intact roots need to be harvested for downstream applications. We also demonstrate how nutrient concentrations can be modified to induce plant responses to both essential nutrients and toxic non-essential elements.

  19. Isoniazid suppresses antioxidant response element activities and impairs adipogenesis in mouse and human preadipocytes

    International Nuclear Information System (INIS)

    Chen, Yanyan; Xue, Peng; Hou, Yongyong; Zhang, Hao; Zheng, Hongzhi; Zhou, Tong; Qu, Weidong; Teng, Weiping; Zhang, Qiang; Andersen, Melvin E.; Pi, Jingbo

    2013-01-01

    Transcriptional signaling through the antioxidant response element (ARE), orchestrated by the Nuclear factor E2-related factor 2 (Nrf2), is a major cellular defense mechanism against oxidative or electrophilic stress. Here, we reported that isoniazid (INH), a widely used antitubercular drug, displays a substantial inhibitory property against ARE activities in diverse mouse and human cells. In 3T3-L1 preadipocytes, INH concentration-dependently suppressed the ARE-luciferase reporter activity and mRNA expression of various ARE-dependent antioxidant genes under basal and oxidative stressed conditions. In keeping with our previous findings that Nrf2-ARE plays a critical role in adipogenesis by regulating expression of CCAAT/enhancer-binding protein β (C/EBPβ) and peroxisome proliferator-activated receptor γ (PPARγ), suppression of ARE signaling by INH hampered adipogenic differentiation of 3T3-L1 cells and human adipose-derived stem cells (ADSCs). Following adipogenesis induced by hormonal cocktails, INH-treated 3T3-L1 cells and ADSCs displayed significantly reduced levels of lipid accumulation and attenuated expression of C/EBPα and PPARγ. Time-course studies in 3T3-L1 cells revealed that inhibition of adipogenesis by INH occurred in the early stage of terminal adipogenic differentiation, where reduced expression of C/EBPβ and C/EBPδ was observed. To our knowledge, the present study is the first to demonstrate that INH suppresses ARE signaling and interrupts with the transcriptional network of adipogenesis, leading to impaired adipogenic differentiation. The inhibition of ARE signaling may be a potential underlying mechanism by which INH attenuates cellular antioxidant response contributing to various complications. - Highlights: • Isoniazid suppresses ARE-mediated transcriptional activity. • Isoniazid inhibits adipogenesis in preadipocytes. • Isoniazid suppresses adipogenic gene expression during adipogenesis

  20. Semianalytic Design Sensitivity Analysis of Nonlinear Structures With a Commercial Finite Element Package

    International Nuclear Information System (INIS)

    Lee, Tae Hee; Yoo, Jung Hun; Choi, Hyeong Cheol

    2002-01-01

    A finite element package is often used as a daily design tool for engineering designers in order to analyze and improve the design. The finite element analysis can provide the responses of a system for given design variables. Although finite element analysis can quite well provide the structural behaviors for given design variables, it cannot provide enough information to improve the design such as design sensitivity coefficients. Design sensitivity analysis is an essential step to predict the change in responses due to a change in design variables and to optimize a system with the aid of the gradient-based optimization techniques. To develop a numerical method of design sensitivity analysis, analytical derivatives that are based on analytical differentiation of the continuous or discrete finite element equations are effective but analytical derivatives are difficult because of the lack of internal information of the commercial finite element package such as shape functions. Therefore, design sensitivity analysis outside of the finite element package is necessary for practical application in an industrial setting. In this paper, the semi-analytic method for design sensitivity analysis is used for the development of the design sensitivity module outside of a commercial finite element package of ANSYS. The direct differentiation method is employed to compute the design derivatives of the response and the pseudo-load for design sensitivity analysis is effectively evaluated by using the design variation of the related internal nodal forces. Especially, we suggest an effective method for stress and nonlinear design sensitivity analyses that is independent of the commercial finite element package is also discussed. Numerical examples are illustrated to show the accuracy and efficiency of the developed method and to provide insights for implementation of the suggested method into other commercial finite element packages

  1. Characterization and localization of metal-responsive-element-binding transcription factors from tilapia

    Energy Technology Data Exchange (ETDEWEB)

    Cheung, Andrew Pok-Lap; Au, Candy Yee-Man; Chan, William Wai-Lun [Department of Biochemistry, Chinese University of Hong Kong, Sha Tin, N.T., Hong Kong (Hong Kong); Chan, King Ming, E-mail: kingchan@cuhk.edu.hk [Department of Biochemistry, Chinese University of Hong Kong, Sha Tin, N.T., Hong Kong (Hong Kong)

    2010-08-01

    Two isoforms of MTF-1, MTF-1L (long form) and MTF-1S (short form), were cloned in tilapia (Ti) and characterized in a tilapia liver cell line, Hepa-T1. The cloned tiMTF-1L has the characteristics of all of the tiMTF-1S identified so far with the zinc finger domain having six fingers, the acidic-rich, proline-rich, and serine/threonine-rich domains; however, the short form encodes for the zinc finger domain with five zinc fingers only and no other domains. The transient transfection of tiMTF-1L into human HepG2 cells showed both constitutive and zinc-induced metal-responsive-element (MRE)-driven reporter gene expression. However, the transfection of tiMTF-1S (which lacks all three transactivation domains) into a human cell line showed reduced transcriptional activities compared with an endogenous control in both basal- and Zn{sup 2+}-induced conditions. The tiMTF-1 isoforms were tagged with GFP and transfected into Hepa-T1 cells (tilapia hepatocytes). The nuclear translocation of tiMTF-1L was observed when the cells were exposed to a sufficient concentration of metals for 6 h. However, tiMTF-1S, was localized in the nucleus with or without metal treatment. Electrophoretic mobility shift assay (EMSA) confirmed that both of the isoforms were able to bind to the MRE specifically in vitro. Tissue distribution studies showed that tiMTF-1L was more abundant than tiMTF-1S in all of the tissues tested.

  2. Characterization and localization of metal-responsive-element-binding transcription factors from tilapia

    International Nuclear Information System (INIS)

    Cheung, Andrew Pok-Lap; Au, Candy Yee-Man; Chan, William Wai-Lun; Chan, King Ming

    2010-01-01

    Two isoforms of MTF-1, MTF-1L (long form) and MTF-1S (short form), were cloned in tilapia (Ti) and characterized in a tilapia liver cell line, Hepa-T1. The cloned tiMTF-1L has the characteristics of all of the tiMTF-1S identified so far with the zinc finger domain having six fingers, the acidic-rich, proline-rich, and serine/threonine-rich domains; however, the short form encodes for the zinc finger domain with five zinc fingers only and no other domains. The transient transfection of tiMTF-1L into human HepG2 cells showed both constitutive and zinc-induced metal-responsive-element (MRE)-driven reporter gene expression. However, the transfection of tiMTF-1S (which lacks all three transactivation domains) into a human cell line showed reduced transcriptional activities compared with an endogenous control in both basal- and Zn 2+ -induced conditions. The tiMTF-1 isoforms were tagged with GFP and transfected into Hepa-T1 cells (tilapia hepatocytes). The nuclear translocation of tiMTF-1L was observed when the cells were exposed to a sufficient concentration of metals for 6 h. However, tiMTF-1S, was localized in the nucleus with or without metal treatment. Electrophoretic mobility shift assay (EMSA) confirmed that both of the isoforms were able to bind to the MRE specifically in vitro. Tissue distribution studies showed that tiMTF-1L was more abundant than tiMTF-1S in all of the tissues tested.

  3. Modeling and assessment of the response of super-light elements to fire

    DEFF Research Database (Denmark)

    Hertz, Kristian Dahl; Campeanu, B.M.; Giraudo, M.

    2013-01-01

    Due to the significant weight of the elements, which raise the construction and transportation costs and the CO2 production, concrete buildings may not meet the requirements for sustainable constructions. Furthermore, concrete is quite vulnerable to fire, as it undergoes a permanent degradation...... of its mechanical properties at temperatures commonly reached by structural elements during a fire in a building. As a consequence, several multi-story concrete buildings have collapsed or suffered major structural damages because of fire, and caused injuries and casualties among the occupants. Even...... in those cases, where a safe evacuation of the building is ensured, the high costs associated with the downtime and reparation of the building can be very high and not acceptable in the view of a safe and sustainable design of structures. In this respect, the newly patented building technology...

  4. Heavy metals and related trace elements

    International Nuclear Information System (INIS)

    Leland, H.V.; Luoma, S.N.; Wilkes, D.J.

    1977-01-01

    A review is given of heavy metals and related trace elements in the aquatic environment. Other reviews and bibliographies are cited, dealing with the metabolism and transport of metal ions and with the toxic effects of stable and radioactive trace metals on aquatic organisms. The sources of trace elements in natural waters are discussed. It is suggested that atmospheric inputs of several trace metals comprise sizable fractions of total inputs to the Great Lakes and continental shelf waters. Information on stack emissions of trace elements from a coal-fired steam plant was used to estimate the likely range of air concentrations and inputs to a forested watershed in Tennessee. Some basic concepts of cycling of elements through aquatic communities were examined, such as the Pb, Mn and Zn concentrations in sediment and estuarine plants and animals colonizing dredge-spoil disposal areas. The use of plants as biological indicators of trace element contamination was outlined, as well as bioaccumulation in aquatic fauna. The effects of environmental factors on the kinetics of element exchange were noted, for example the influx rates of Cs 137 in tubificid worms, and Co 60 and Zn 65 in shrimp were shown to be temperature dependent. The toxicity of heavy metals on aquatic fauna was discussed, such as the histopathological lesions in the kidney and liver of fishes caused by heavy metals, and the effects of Hg and Cu on the olfactory response of rainbow trout

  5. Hypotonicity-induced reduction of aquaporin-2 transcription in mpkCCD cells is independent of the tonicity responsive element, vasopressin, and cAMP.

    Science.gov (United States)

    Kortenoeven, Marleen L A; van den Brand, Michiel; Wetzels, Jack F M; Deen, Peter M T

    2011-04-15

    The syndrome of inappropriate antidiuretic hormone secretion is characterized by excessive water uptake and hyponatremia. The extent of hyponatremia, however, is less than anticipated, which is ascribed to a defense mechanism, the vasopressin-escape, and is suggested to involve a tonicity-determined down-regulation of the water channel aquaporin-2 (AQP2). The underlying mechanism, however, is poorly understood. To study this, we used the mouse cortical collecting duct (mpkCCD) cell line. MpkCCD cells, transfected with an AQP2-promoter luciferase construct showed a reduced and increased AQP2 abundance and transcription following culture in hypotonic and hypertonic medium, respectively. This depended on tonicity rather than osmolality and occurred independently of the vasopressin analog dDAVP, cAMP levels, or protein kinase A activity. Although prostaglandins and nitric oxide reduced AQP2 abundance, inhibition of their synthesis did not influence tonicity-induced AQP2 transcription. Also, cells in which the cAMP or tonicity-responsive element (CRE/TonE) in the AQP2-promoter were mutated showed a similar response to hypotonicity. Instead, the tonicity-responsive elements were pin-pointed to nucleotides -283 to -252 and -157 to -126 bp. In conclusion, our data indicate that hypotonicity reduces AQP2 abundance and transcription, which occurs independently of vasopressin, cAMP, and the known TonE and CRE in the AQP2-promoter. Increased prostaglandin and nitric oxide, as found in vivo, may contribute to reduced AQP2 in vasopressin-escape, but do not mediate the effect of hypotonicity on AQP2 transcription. Our data suggest that two novel segments (-283 to -252 and -157 to -126 bp) in the AQP2-promoter mediate the hypotonicity-induced AQP2 down-regulation during vasopressin-escape.

  6. Densely ionizing radiation affects DNA methylation of selective LINE-1 elements

    Energy Technology Data Exchange (ETDEWEB)

    Prior, Sara; Miousse, Isabelle R. [Department of Environmental and Occupational Health, Fay W. Boozman College of Public Health, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Nzabarushimana, Etienne [Department of Environmental and Occupational Health, Fay W. Boozman College of Public Health, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Department of Bioinformatics, School of Informatics and Computing, Indiana University, Bloomington, IN 47405 (United States); Pathak, Rupak [Division of Radiation Health, Department of Pharmaceutical Sciences, College of Pharmacy, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Skinner, Charles; Kutanzi, Kristy R. [Department of Environmental and Occupational Health, Fay W. Boozman College of Public Health, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Allen, Antiño R. [Division of Radiation Health, Department of Pharmaceutical Sciences, College of Pharmacy, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Raber, Jacob [Departments of Behavioral Neuroscience, Neurology, and Radiation Medicine, Division of Neuroscience, ONPRC, Oregon Health & Science University, Portland, OR 97239 (United States); Tackett, Alan J. [Department of Biochemistry, College of Medicine, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Hauer-Jensen, Martin [Division of Radiation Health, Department of Pharmaceutical Sciences, College of Pharmacy, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Nelson, Gregory A. [Department of Basic Sciences, Division of Radiation Research, Loma Linda University, Loma Linda, CA 92350 (United States); and others

    2016-10-15

    Long Interspersed Nucleotide Element 1 (LINE-1) retrotransposons are heavily methylated and are the most abundant transposable elements in mammalian genomes. Here, we investigated the differential DNA methylation within the LINE-1 under normal conditions and in response to environmentally relevant doses of sparsely and densely ionizing radiation. We demonstrate that DNA methylation of LINE-1 elements in the lungs of C57BL6 mice is dependent on their evolutionary age, where the elder age of the element is associated with the lower extent of DNA methylation. Exposure to 5-aza-2′-deoxycytidine and methionine-deficient diet affected DNA methylation of selective LINE-1 elements in an age- and promoter type-dependent manner. Exposure to densely IR, but not sparsely IR, resulted in DNA hypermethylation of older LINE-1 elements, while the DNA methylation of evolutionary younger elements remained mostly unchanged. We also demonstrate that exposure to densely IR increased mRNA and protein levels of LINE-1 via the loss of the histone H3K9 dimethylation and an increase in the H3K4 trimethylation at the LINE-1 5′-untranslated region, independently of DNA methylation. Our findings suggest that DNA methylation is important for regulation of LINE-1 expression under normal conditions, but histone modifications may dictate the transcriptional activity of LINE-1 in response to exposure to densely IR. - Highlights: • DNA methylation of LINE-1 elements is dependent on their evolutionary age. • Densely ionizing radiation affects DNA methylation of selective LINE-1 elements. • Radiation-induced reactivation of LINE-1 is DNA methylation-independent. • Histone modifications dictate the transcriptional activity of LINE-1.

  7. Densely ionizing radiation affects DNA methylation of selective LINE-1 elements

    International Nuclear Information System (INIS)

    Prior, Sara; Miousse, Isabelle R.; Nzabarushimana, Etienne; Pathak, Rupak; Skinner, Charles; Kutanzi, Kristy R.; Allen, Antiño R.; Raber, Jacob; Tackett, Alan J.; Hauer-Jensen, Martin; Nelson, Gregory A.

    2016-01-01

    Long Interspersed Nucleotide Element 1 (LINE-1) retrotransposons are heavily methylated and are the most abundant transposable elements in mammalian genomes. Here, we investigated the differential DNA methylation within the LINE-1 under normal conditions and in response to environmentally relevant doses of sparsely and densely ionizing radiation. We demonstrate that DNA methylation of LINE-1 elements in the lungs of C57BL6 mice is dependent on their evolutionary age, where the elder age of the element is associated with the lower extent of DNA methylation. Exposure to 5-aza-2′-deoxycytidine and methionine-deficient diet affected DNA methylation of selective LINE-1 elements in an age- and promoter type-dependent manner. Exposure to densely IR, but not sparsely IR, resulted in DNA hypermethylation of older LINE-1 elements, while the DNA methylation of evolutionary younger elements remained mostly unchanged. We also demonstrate that exposure to densely IR increased mRNA and protein levels of LINE-1 via the loss of the histone H3K9 dimethylation and an increase in the H3K4 trimethylation at the LINE-1 5′-untranslated region, independently of DNA methylation. Our findings suggest that DNA methylation is important for regulation of LINE-1 expression under normal conditions, but histone modifications may dictate the transcriptional activity of LINE-1 in response to exposure to densely IR. - Highlights: • DNA methylation of LINE-1 elements is dependent on their evolutionary age. • Densely ionizing radiation affects DNA methylation of selective LINE-1 elements. • Radiation-induced reactivation of LINE-1 is DNA methylation-independent. • Histone modifications dictate the transcriptional activity of LINE-1.

  8. Elemental cycling response of an Adirondack subalpine spruce-fir forest to atmospheric and environmental change

    Science.gov (United States)

    Andrew J. Friedland; Eric K. Miller

    1996-01-01

    Patterns and trends in forest elemental cycling can become more apparent in the presence of atmospheric perturbations. High-elevation forests of the northeastern United States have received large amounts of atmospheric deposition of pollutants, which have altered natural elemental cycling and retention rates in a variety of ways. This study examined atmospheric...

  9. Legal questions concerning the termination of spent fuel element reprocessing

    International Nuclear Information System (INIS)

    John, Michele

    2005-01-01

    The thesis on legal aspects of the terminated spent fuel reprocessing in Germany is based on the legislation, jurisdiction and literature until January 2004. The five chapters cover the following topics: description of the problem; reprocessing of spent fuel elements in foreign countries - practical and legal aspects; operators' responsibilities according to the atomic law with respect to the reprocessing of Geman spent fuel elements in foreign countries; compatibility of the prohibition of Geman spent fuel element reprocessing in foreign countries with international law, European law and German constitutional law; results of the evaluation

  10. Unconscious emotional effects of packaging design elements

    DEFF Research Database (Denmark)

    Liao, Lewis; Corsi, Armando; Lockshin, Larry

    on a convenience sample of 120 participants. The results suggest that image is the only element able to generate a significant effect on consumers’ unconscious emotional response. In addition, the results also suggest the interaction between image and colour has a significant effect on consumers’ unconscious...

  11. The Role of Carbohydrate Response Element Binding Protein in Intestinal and Hepatic Fructose Metabolism

    Directory of Open Access Journals (Sweden)

    Katsumi Iizuka

    2017-02-01

    Full Text Available Many articles have discussed the relationship between fructose consumption and the incidence of obesity and related diseases. Fructose is absorbed in the intestine and metabolized in the liver to glucose, lactate, glycogen, and, to a lesser extent, lipids. Unabsorbed fructose causes bacterial fermentation, resulting in irritable bowl syndrome. Therefore, understanding the mechanisms underlying intestinal and hepatic fructose metabolism is important for the treatment of metabolic syndrome and fructose malabsorption. Carbohydrate response element binding protein (ChREBP is a glucose-activated transcription factor that controls approximately 50% of de novo lipogenesis in the liver. ChREBP target genes are involved in glycolysis (Glut2, liver pyruvate kinase, fructolysis (Glut5, ketohexokinase, and lipogenesis (acetyl CoA carboxylase, fatty acid synthase. ChREBP gene deletion protects against high sucrose diet-induced and leptin-deficient obesity, because Chrebp−/− mice cannot consume fructose or sucrose. Moreover, ChREBP contributes to some of the physiological effects of fructose on sweet taste preference and glucose production through regulation of ChREBP target genes, such as fibroblast growth factor-21 and glucose-6-phosphatase catalytic subunits. Thus, ChREBP might play roles in fructose metabolism. Restriction of excess fructose intake will be beneficial for preventing not only metabolic syndrome but also irritable bowl syndrome.

  12. Load responsive hydrodynamic bearing

    Science.gov (United States)

    Kalsi, Manmohan S.; Somogyi, Dezso; Dietle, Lannie L.

    2002-01-01

    A load responsive hydrodynamic bearing is provided in the form of a thrust bearing or journal bearing for supporting, guiding and lubricating a relatively rotatable member to minimize wear thereof responsive to relative rotation under severe load. In the space between spaced relatively rotatable members and in the presence of a liquid or grease lubricant, one or more continuous ring shaped integral generally circular bearing bodies each define at least one dynamic surface and a plurality of support regions. Each of the support regions defines a static surface which is oriented in generally opposed relation with the dynamic surface for contact with one of the relatively rotatable members. A plurality of flexing regions are defined by the generally circular body of the bearing and are integral with and located between adjacent support regions. Each of the flexing regions has a first beam-like element being connected by an integral flexible hinge with one of the support regions and a second beam-like element having an integral flexible hinge connection with an adjacent support region. A least one local weakening geometry of the flexing region is located intermediate the first and second beam-like elements. In response to application of load from one of the relatively rotatable elements to the bearing, the beam-like elements and the local weakening geometry become flexed, causing the dynamic surface to deform and establish a hydrodynamic geometry for wedging lubricant into the dynamic interface.

  13. Design of responsive materials using topologically interlocked elements

    International Nuclear Information System (INIS)

    Molotnikov, A; Gerbrand, R; Qi, Y; Simon, G P; Estrin, Y

    2015-01-01

    In this work we present a novel approach to designing responsive structures by segmentation of monolithic plates into an assembly of topologically interlocked building blocks. The particular example considered is an assembly of interlocking osteomorphic blocks. The results of this study demonstrate that the constraining force, which is required to hold the blocks together, can be viewed as a design parameter that governs the bending stiffness and the load bearing capacity of the segmented structure. In the case where the constraining forces are provided laterally using an external frame, the maximum load the assembly can sustain and its stiffness increase linearly with the magnitude of the lateral load applied. Furthermore, we show that the segmented plate with integrated shape memory wires employed as tensioning cables can act as a smart structure that changes its flexural stiffness and load bearing capacity in response to external stimuli, such as heat generated by the switching on and off an electric current. (paper)

  14. Finite-element analysis of flawed and unflawed pipe tests

    International Nuclear Information System (INIS)

    James, R.J.; Nickell, R.E.; Sullaway, M.F.

    1989-12-01

    Contemporary versions of the general purpose, nonlinear finite element program ABAQUS have been used in structural response verification exercises on flawed and unflawed austenitic stainless steel and ferritic steel piping. Among the topics examined, through comparison between ABAQUS calculations and test results, were: (1) the effect of using variations in the stress-strain relationship from the test article material on the calculated response; (2) the convergence properties of various finite element representations of the pipe geometry, using shell, beam and continuum models; (3) the effect of test system compliance; and (4) the validity of ABAQUS J-integral routines for flawed pipe evaluations. The study was culminated by the development and demonstration of a ''macroelement'' representation for the flawed pipe section. The macroelement can be inserted into an existing piping system model, in order to accurately treat the crack-opening and crack-closing static and dynamic response. 11 refs., 20 figs., 1 tab

  15. Plasmids encoding PKI(1-31), a specific inhibitor of cAMP-stimulated gene expression, inhibit the basal transcriptional activity of some but not all cAMP-regulated DNA response elements in JEG-3 cells.

    Science.gov (United States)

    Grove, J R; Deutsch, P J; Price, D J; Habener, J F; Avruch, J

    1989-11-25

    Plasmids that encode a bioactive amino-terminal fragment of the heat-stable inhibitor of the cAMP-dependent protein kinase, PKI(1-31), were employed to characterize the role of this protein kinase in the control of transcriptional activity mediated by three DNA regulatory elements in the JEG-3 human placental cell line. The 5'-flanking sequence of the human collagenase gene contains the heptameric sequence, 5'-TGAGTCA-3', previously identified as a "phorbol ester" response element. Reporter genes containing either the intact 1.2-kilobase 5'-flanking sequence from the human collagenase gene or just the 7-base pair (bp) response element, when coupled to an enhancerless promoter, each exhibit both cAMP and phorbol ester-stimulated expression in JEG-3 cells. Cotransfection of either construct with plasmids encoding PKI(1-31) inhibits cAMP-stimulated but not basal- or phorbol ester-stimulated expression. Pretreatment of cells with phorbol ester for 1 or 2 days abrogates completely the response to rechallenge with phorbol ester but does not alter the basal expression of either construct; cAMP-stimulated expression, while modestly inhibited, remains vigorous. The 5'-flanking sequence of the human chorionic gonadotropin-alpha subunit (HCG alpha) gene has two copies of the sequence, 5'-TGACGTCA-3', contained in directly adjacent identical 18-bp segments, previously identified as a cAMP-response element. Reporter genes containing either the intact 1.5 kilobase of 5'-flanking sequence from the HCG alpha gene, or just the 36-bp tandem repeat cAMP response element, when coupled to an enhancerless promoter, both exhibit a vigorous cAMP stimulation of expression but no response to phorbol ester in JEG-3 cells. Cotransfection with plasmids encoding PKI(1-31) inhibits both basal and cAMP-stimulated expression in a parallel fashion. The 5'-flanking sequence of the human enkephalin gene mediates cAMP-stimulated expression of reporter genes in both JEG-3 and CV-1 cells. Plasmids

  16. Summary compilation of shell element performance versus formulation.

    Energy Technology Data Exchange (ETDEWEB)

    Heinstein, Martin Wilhelm; Hales, Jason Dean (Idaho National Laboratory, Idaho Falls, ID); Breivik, Nicole L.; Key, Samuel W. (FMA Development, LLC, Great Falls, MT)

    2011-07-01

    This document compares the finite element shell formulations in the Sierra Solid Mechanics code. These are finite elements either currently in the Sierra simulation codes Presto and Adagio, or expected to be added to them in time. The list of elements are divided into traditional two-dimensional, plane stress shell finite elements, and three-dimensional solid finite elements that contain either modifications or additional terms designed to represent the bending stiffness expected to be found in shell formulations. These particular finite elements are formulated for finite deformation and inelastic material response, and, as such, are not based on some of the elegant formulations that can be found in an elastic, infinitesimal finite element setting. Each shell element is subjected to a series of 12 verification and validation test problems. The underlying purpose of the tests here is to identify the quality of both the spatially discrete finite element gradient operator and the spatially discrete finite element divergence operator. If the derivation of the finite element is proper, the discrete divergence operator is the transpose of the discrete gradient operator. An overall summary is provided from which one can rank, at least in an average sense, how well the individual formulations can be expected to perform in applications encountered year in and year out. A letter grade has been assigned albeit sometimes subjectively for each shell element and each test problem result. The number of A's, B's, C's, et cetera assigned have been totaled, and a grade point average (GPA) has been computed, based on a 4.0-system. These grades, combined with a comparison between the test problems and the application problem, can be used to guide an analyst to select the element with the best shell formulation.

  17. Metabolite Regulation of Nuclear Localization of Carbohydrate-response Element-binding Protein (ChREBP): ROLE OF AMP AS AN ALLOSTERIC INHIBITOR.

    Science.gov (United States)

    Sato, Shogo; Jung, Hunmin; Nakagawa, Tsutomu; Pawlosky, Robert; Takeshima, Tomomi; Lee, Wan-Ru; Sakiyama, Haruhiko; Laxman, Sunil; Wynn, R Max; Tu, Benjamin P; MacMillan, John B; De Brabander, Jef K; Veech, Richard L; Uyeda, Kosaku

    2016-05-13

    The carbohydrate-response element-binding protein (ChREBP) is a glucose-responsive transcription factor that plays an essential role in converting excess carbohydrate to fat storage in the liver. In response to glucose levels, ChREBP is regulated by nuclear/cytosol trafficking via interaction with 14-3-3 proteins, CRM-1 (exportin-1 or XPO-1), or importins. Nuclear localization of ChREBP was rapidly inhibited when incubated in branched-chain α-ketoacids, saturated and unsaturated fatty acids, or 5-aminoimidazole-4-carboxamide ribonucleotide. Here, we discovered that protein-free extracts of high fat-fed livers contained, in addition to ketone bodies, a new metabolite, identified as AMP, which specifically activates the interaction between ChREBP and 14-3-3. The crystal structure showed that AMP binds directly to the N terminus of ChREBP-α2 helix. Our results suggest that AMP inhibits the nuclear localization of ChREBP through an allosteric activation of ChREBP/14-3-3 interactions and not by activation of AMPK. AMP and ketone bodies together can therefore inhibit lipogenesis by restricting localization of ChREBP to the cytoplasm during periods of ketosis. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  18. Regulation of insulin-like growth factor I transcription by cyclic adenosine 3',5'-monophosphate (cAMP) in fetal rat bone cells through an element within exon 1: protein kinase A-dependent control without a consensus AMP response element

    Science.gov (United States)

    McCarthy, T. L.; Thomas, M. J.; Centrella, M.; Rotwein, P.

    1995-01-01

    Insulin-like growth factor I (IGF-I) is a locally synthesized anabolic growth factor for bone. IGF-I synthesis by primary fetal rat osteoblasts (Ob) is stimulated by agents that increase the intracellular cAMP concentration, including prostaglandin E2 (PGE2). Previous studies with Ob cultures demonstrated that PGE2 enhanced IGF-I transcription through selective use of IGF-I promoter 1, with little effect on IGF-I messenger RNA half-life. Transient transfection of Ob cultures with an array of promoter 1-luciferase reporter fusion constructs has now allowed localization of a potential cis-acting promoter element(s) responsible for cAMP-stimulated gene expression to the 5'-untranslated region (5'-UTR) of IGF-I exon 1, within a segment lacking a consensus cAMP response element. Our evidence derives from three principal observations: 1) a transfection construct containing only 122 nucleotides (nt) of promoter 1 and 328 nt of the 5'-UTR retained full PGE2-stimulated reporter expression; 2) maximal PGE2-driven reporter expression required the presence of nt 196 to 328 of exon 1 when tested within the context of IGF-I promoter 1; 3) cotransfection of IGF-I promoter-luciferase-reporter constructs with a plasmid encoding the alpha-isoform of the catalytic subunit of murine cAMP-dependent protein kinase (PKA) produced results comparable to those seen with PGE2 treatment, whereas cotransfection with a plasmid encoding a mutant regulatory subunit of PKA that cannot bind cAMP blocked PGE2-induced reporter expression. Deoxyribonuclease I footprinting of the 5'-UTR of exon 1 demonstrated protected sequences at HS3A, HS3B, and HS3D, three of six DNA-protein binding sites previously characterized with rat liver nuclear extracts. Of these three regions, only the HS3D binding site is located within the functionally identified hormonally responsive segment of IGF-I exon 1. These results directly implicate PKA in the control of IGF-I gene transcription by PGE2 and identify a segment of

  19. Finite element elastic-plastic analysis of LMFBR components

    International Nuclear Information System (INIS)

    Levy, A.; Pifko, A.; Armen, H. Jr.

    1978-01-01

    The present effort involves the development of computationally efficient finite element methods for accurately predicting the isothermal elastic-plastic three-dimensional response of thick and thin shell structures subjected to mechanical and thermal loads. This work will be used as the basis for further development of analytical tools to be used to verify the structural integrity of liquid metal fast breeder reactor (LMFBR) components. The methods presented here have been implemented into the three-dimensional solid element module (HEX) of the Grumman PLANS finite element program. These methods include the use of optimal stress points as well as a variable number of stress points within an element. This allows monitoring the stress history at many points within an element and hence provides an accurate representation of the elastic-plastic boundary using a minimum number of degrees of freedom. Also included is an improved thermal stress analysis capability in which the temperature variation and corresponding thermal strain variation are represented by the same functional form as the displacement variation. Various problems are used to demonstrate these improved capabilities. (Auth.)

  20. New functionalities in abundant element oxides: ubiquitous element strategy

    International Nuclear Information System (INIS)

    Hosono, Hideo; Hayashi, Katsuro; Kamiya, Toshio; Atou, Toshiyuki; Susaki, Tomofumi

    2011-01-01

    While most ceramics are composed of ubiquitous elements (the ten most abundant elements within the Earth's crust), many advanced materials are based on rare elements. A 'rare-element crisis' is approaching owing to the imbalance between the limited supply of rare elements and the increasing demand. Therefore, we propose a 'ubiquitous element strategy' for materials research, which aims to apply abundant elements in a variety of innovative applications. Creation of innovative oxide materials and devices based on conventional ceramics is one specific challenge. This review describes the concept of ubiquitous element strategy and gives some highlights of our recent research on the synthesis of electronic, thermionic and structural materials using ubiquitous elements. (topical review)

  1. Finite Element Modeling and Analysis of Nonlinear Impact and Frictional Motion Responses Including Fluid—Structure Coupling Effects

    Directory of Open Access Journals (Sweden)

    Yong Zhao

    1997-01-01

    Full Text Available A nonlinear three dimensional (3D single rack model and a nonlinear 3D whole pool multi-rack model are developed for the spent fuel storage racks of a nuclear power plant (NPP to determine impacts and frictional motion responses when subjected to 3D excitations from the supporting building floor. The submerged free standing rack system and surrounding water are coupled due to hydrodynamic fluid-structure interaction (FSI using potential theory. The models developed have features that allow consideration of geometric and material nonlinearities including (1 the impacts of fuel assemblies to rack cells, a rack to adjacent racks or pool walls, and rack support legs to the pool floor; (2 the hydrodynamic coupling of fuel assemblies with their storing racks, and of a rack with adjacent racks, pool walls, and the pool floor; and (3 the dynamic motion behavior of rocking, twisting, and frictional sliding of rack modules. Using these models 3D nonlinear time history dynamic analyses are performed per the U.S. Nuclear Regulatory Commission (USNRC criteria. Since few such modeling, analyses, and results using both the 3D single and whole pool multiple rack models are available in the literature, this paper emphasizes description of modeling and analysis techniques using the SOLVIA general purpose nonlinear finite element code. Typical response results with different Coulomb friction coefficients are presented and discussed.

  2. Growth responses of selected freshwater algae to trace elements and scrubber ash slurry generated by coal-fired power plants

    Energy Technology Data Exchange (ETDEWEB)

    Vocke, R.W.

    1979-01-01

    The development and implementation of standard toxicity tests is a necessity if consistent and reliable data are to be obtained for water quality criteria. The adapted EPA AAPBT is an ideal static algal toxicity test system. The algal test medium has a chemical composition similar to natural unpolluted waters of low ionic strength. It is appropriate to use MATC water quality criteria when assessing the potential impact of pollutants generated by coal-fired power stations because these energy-generated pollutants typically enter aquatic systems in small quantities over long periods. The MATC water quality criteria are estimates of trace element and SASE levels, based on the most sensitive alga investigated, that will not cause significant changes in naturally-functioning algal populations. These levels are 0.016f mg L/sup -1/ As(V), 0.001 mg L/sup -1/ Cd(II), 0.004 mg L/sup -1/ Hg(II), 0.006 mg L/sup -1/ Se(VI), and 0.344% SASE. To provide viable working water quality criteria, an extrapolation from the laboratory to the natural environment must be made. Therefore, those oxidation states of the trace elements were selected which are the dominant states occurring in natural, unpolluted, slightly alkaline freshwaters. It must be pointed out that these MATC values are based on algal responses to single toxicants and no allowance is made for synergistic, additive, or antagonistic relationships which could occur in natural aquatic systems. Additionally, natural chelation may influence toxicity. The highly toxic nature of potential pollutants from coal-fired generating plants emphasizes the need for minimizing stack effluent pollutants and retaining scrubber ash slurry for proper disposal in an effort to maintain trace elements in concentration ranges compatible with naturally-functioning ecosystems.

  3. Stimulation of interleukin-13 expression by human T-cell leukemia virus type 1 oncoprotein Tax via a dually active promoter element responsive to NF-kappaB and NFAT.

    Science.gov (United States)

    Silbermann, Katrin; Schneider, Grit; Grassmann, Ralph

    2008-11-01

    The human T-cell leukemia virus type 1 (HTLV-1) Tax oncoprotein transforms human lymphocytes and is critical for the pathogenesis of HTLV-1-induced adult T-cell leukaemia. In HTLV-transformed cells, Tax upregulates interleukin (IL)-13, a cytokine with proliferative and anti-apoptotic functions that is linked to leukaemogenesis. Tax-stimulated IL-13 is thought to result in autocrine stimulation of HTLV-infected cells and thus may be relevant to their growth. The causal transactivation of the IL-13 promoter by Tax is predominantly dependent on a nuclear factor of activated T cells (NFAT)-binding P element. Here, it was shown that the isolated IL-13 Tax-responsive element (IL13TaxRE) was sufficient to mediate IL-13 transactivation by Tax and NFAT1. However, cyclosporin A, a specific NFAT inhibitor, revealed that Tax transactivation of IL13TaxRE or wild-type IL-13 promoter was independent of NFAT and that NFAT did not contribute to IL-13 upregulation in HTLV-transformed cells. By contrast, Tax stimulation was repressible by an efficient nuclear factor (NF)-kappaB inhibitor (IkBaDN), indicating the requirement for NF-kappaB. The capacity of NF-kappaB to stimulate IL13TaxRE was demonstrated by a strong response to NF-kappaB in reporter assays and by direct binding of NF-kappaB to IL13TaxRE. Thus, IL13TaxRE in the IL-13 promoter represents a dually active promoter element responsive to NF-kappaB and NFAT. Together, these results indicate that Tax causes IL-13 upregulation in HTLV-1-infected cells via NF-kappaB.

  4. Platinum-group element mineralization

    International Nuclear Information System (INIS)

    Gruenewaldt, G.

    1985-01-01

    The purpose of this investigation is to determine the geological processes responsible for the abnormal enrichment of the platinum-group elements (PGE) in the mineralized layers of the Bushveld Complex. Questions asked are: what processes caused enrichment of the Bushveld magma in the PGE ; by what processes were these PGE concentrated in the mineralized layers ; was contamination of the Bushveld magma from external sources important in the formation of the PGE enriched layers ; what are the effects of fractional crystallization on the PGE ratios

  5. Molecular cloning and preliminary function study of iron responsive element binding protein 1 gene from cypermethrin-resistant Culex pipiens pallens

    Directory of Open Access Journals (Sweden)

    Tan Wenbin

    2011-11-01

    Full Text Available Abstract Background Insecticide resistance jeopardizes the control of mosquito populations and mosquito-borne disease control, which creates a major public health concern. Two-dimensional electrophoresis identified one protein segment with high sequence homology to part of Aedes aegypti iron-responsive element binding protein (IRE-BP. Method RT-PCR and RACE (rapid amplification of cDNA end were used to clone a cDNA encoding full length IRE-BP 1. Real-time quantitative RT-PCR was used to evaluate the transcriptional level changes in the Cr-IRE strain Aedes aegypti compared to the susceptible strain of Cx. pipiens pallens. The expression profile of the gene was established in the mosquito life cycle. Methyl tritiated thymidine (3H-TdR was used to observe the cypermethrin resistance changes in C6/36 cells containing the stably transfected IRE-BP 1 gene of Cx. pipiens pallens. Results The complete sequence of iron responsive element binding protein 1 (IRE-BP 1 has been cloned from the cypermethrin-resistant strain of Culex pipiens pallens (Cr-IRE strain. Quantitative RT-PCR analysis indicated that the IRE-BP 1 transcription level was 6.7 times higher in the Cr-IRE strain than in the susceptible strain of 4th instar larvae. The IRE-BP 1 expression was also found to be consistently higher throughout the life cycle of the Cr-IRE strain. A protein of predicted size 109.4 kDa has been detected by Western blotting in IRE-BP 1-transfected mosquito C6/36 cells. These IRE-BP 1-transfected cells also showed enhanced cypermethrin resistance compared to null-transfected or plasmid vector-transfected cells as determined by 3H-TdR incorporation. Conclusion IRE-BP 1 is expressed at higher levels in the Cr-IRE strain, and may confer some insecticide resistance in Cx. pipiens pallens.

  6. Microstructure Optimization of Dual-Phase Steels Using a Representative Volume Element and a Response Surface Method: Parametric Study

    Science.gov (United States)

    Belgasam, Tarek M.; Zbib, Hussein M.

    2017-12-01

    Dual-phase (DP) steels have received widespread attention for their low density and high strength. This low density is of value to the automotive industry for the weight reduction it offers and the attendant fuel savings and emission reductions. Recent studies on developing DP steels showed that the combination of strength/ductility could be significantly improved when changing the volume fraction and grain size of phases in the microstructure depending on microstructure properties. Consequently, DP steel manufacturers are interested in predicting microstructure properties and in optimizing microstructure design. In this work, a microstructure-based approach using representative volume elements (RVEs) was developed. The approach examined the flow behavior of DP steels using virtual tension tests with an RVE to identify specific mechanical properties. Microstructures with varied martensite and ferrite grain sizes, martensite volume fractions, carbon content, and morphologies were studied in 3D RVE approaches. The effect of these microstructure parameters on a combination of strength/ductility of DP steels was examined numerically using the finite element method by implementing a dislocation density-based elastic-plastic constitutive model, and a Response surface methodology to determine the optimum conditions for a required combination of strength/ductility. The results from the numerical simulations are compared with experimental results found in the literature. The developed methodology proves to be a powerful tool for studying the effect and interaction of key microstructural parameters on strength and ductility and thus can be used to identify optimum microstructural conditions.

  7. Predicting Job Stress Based on Elements of Coping Styles in Nurses

    Directory of Open Access Journals (Sweden)

    Mansoureh Nezari Sedeh

    2016-07-01

    Full Text Available Using coping methods can help to dominate on physical, mental, and social relationships, individual contradiction problems, and can be considered as one of effective factors in general and mental health of nurses. The objective of the present research is predicting job stress based on elements of coping styles in nurses. By correlative methodology for this research, 120 female20-45 years old nurses in Tehran city were selected by simple random sampling method based on Cochran formula. The research instrument includes job stress questionnaire and coping style questionnaire of Lazzarus & Folkman; the Pearson correlation coefficient test, and linear regression were used to test hypotheses and generalize the obtained information from tests. Findings showed that participants’ scores were near normal range and Cronbach’s alpha coefficient was 0.58 which indicated scores internal consistency. The obtained results showed that coping elements in 0.05 significant level with f-value of 12.403 significantly predicted job stress. In addition, regression coefficient among support, responsibility, and managerial solution elements was negative and positive with two other relationships including job stress and escape-avoidance. Therefore, it can be concluded that elements of support, responsibility, escape-avoidance, and managerial solution significantly predict nurses’ job stress among coping elements.

  8. Activation of estrogen response elements is mediated both via estrogen and muscle contractions in rat skeletal muscle myotubes

    DEFF Research Database (Denmark)

    Wiik, A.; Hellsten, Ylva; Berthelson, P.

    2009-01-01

    is ER independent. The muscle contraction-induced transactivation of ERE and increase in ERbeta mRNA were instead found to be MAP kinase (MAPK) dependent. This study demonstrates for the first time that muscle contractions have a similar functional effect as estrogen in skeletal muscle myotubes, causing......The aim of the present study was to investigate the activation of estrogen response elements (EREs) by estrogen and muscle contractions in rat myotubes in culture and to assess whether the activation is dependent on the estrogen receptors (ERs). In addition, the effect of estrogen and contraction...... on the mRNA levels of ERalpha and ERbeta was studied to determine the functional consequence of the transactivation. Myoblasts were isolated from rat skeletal muscle and transfected with a vector consisting of sequences of EREs coupled to the gene for luciferase. The transfected myoblasts were...

  9. Metals and trace elements in feathers: A geochemical approach to avoid misinterpretation of analytical responses.

    Science.gov (United States)

    Borghesi, Fabrizio; Migani, Francesca; Andreotti, Alessandro; Baccetti, Nicola; Bianchi, Nicola; Birke, Manfred; Dinelli, Enrico

    2016-02-15

    Assessing trace metal pollution using feathers has long attracted the attention of ecotoxicologists as a cost-effective and non-invasive biomonitoring method. In order to interpret the concentrations in feathers considering the external contamination due to lithic residue particles, we adopted a novel geochemical approach. We analysed 58 element concentrations in feathers of wild Eurasian Greater Flamingo Phoenicopterus roseus fledglings, from 4 colonies in Western Europe (Spain, France, Sardinia, and North-eastern Italy) and one group of adults from zoo. In addition, 53 elements were assessed in soil collected close to the nesting islets. This enabled to compare a wide selection of metals among the colonies, highlighting environmental anomalies and tackling possible causes of misinterpretation of feather results. Most trace elements in feathers (Al, Ce, Co, Cs, Fe, Ga, Li, Mn, Nb, Pb, Rb, Ti, V, Zr, and REEs) were of external origin. Some elements could be constitutive (Cu, Zn) or significantly bioaccumulated (Hg, Se) in flamingos. For As, Cr, and to a lesser extent Pb, it seems that bioaccumulation potentially could be revealed by highly exposed birds, provided feathers are well cleaned. This comprehensive study provides a new dataset and confirms that Hg has been accumulated in feathers in all sites to some extent, with particular concern for the Sardinian colony, which should be studied further including Cr. The Spanish colony appears critical for As pollution and should be urgently investigated in depth. Feathers collected from North-eastern Italy were the hardest to clean, but our methods allowed biological interpretation of Cr and Pb. Our study highlights the importance of external contamination when analysing trace elements in feathers and advances methodological recommendations in order to reduce the presence of residual particles carrying elements of external origin. Geochemical data, when available, can represent a valuable tool for a correct

  10. Identification of unique cis-element pattern on simulated microgravity treated Arabidopsis by in silico and gene expression

    Science.gov (United States)

    Soh, Hyuncheol; Choi, Yongsang; Lee, Taek-Kyun; Yeo, Up-Dong; Han, Kyeongsik; Auh, Chungkyun; Lee, Sukchan

    2012-08-01

    Arabidopsis gene expression microarray (44 K) was used to detect genes highly induced under simulated microgravity stress (SMS). Ten SMS-inducible genes were selected from the microarray data and these 10 genes were found to be abundantly expressed in 3-week-old plants. Nine out of the 10 SMS-inducible genes were also expressed in response to the three abiotic stresses of drought, touch, and wounding in 3-week-old Arabidopsis plants respectively. However, WRKY46 was elevated only in response to SMS. Six other WRKY genes did not respond to SMS. To clarify the characteristics of the genes expressed at high levels in response to SMS, 20 cis-elements in the promoters of the 40 selected genes including the 10 SMS-inducible genes, the 6 WRKY genes, and abiotic stress-inducible genes were analyzed and their spatial positions on each promoter were determined. Four cis-elements (M/T-G-T-P from MYB1AT or TATABOX5, GT1CONSENSUS, TATABOX5, and POLASIG1) showed a unique spatial arrangement in most SMS-inducible genes including WRKY46. Therefore the M/T-G-T-P cis-element patterns identified in the promoter of WRKY46 may play important roles in regulating gene expression in response to SMS. The presences of the cis-element patterns suggest that the order or spatial positioning of certain groups of cis-elements is more important than the existence or numbers of specific cis-elements. Taken together, our data indicate that WRKY46 is a novel SMS inducible transcription factor and the unique spatial arrangement of cis-elements shown in WRKY46 promoter may play an important role for its response to SMS.

  11. On the residual stress modeling of shot-peened AISI 4340 steel: finite element and response surface methods

    Science.gov (United States)

    Asgari, Ali; Dehestani, Pouya; Poruraminaie, Iman

    2018-02-01

    Shot peening is a well-known process in applying the residual stress on the surface of industrial parts. The induced residual stress improves fatigue life. In this study, the effects of shot peening parameters such as shot diameter, shot speed, friction coefficient, and the number of impacts on the applied residual stress will be evaluated. To assess these parameters effect, firstly the shot peening process has been simulated by finite element method. Then, effects of the process parameters on the residual stress have been evaluated by response surface method as a statistical approach. Finally, a strong model is presented to predict the maximum residual stress induced by shot peening process in AISI 4340 steel. Also, the optimum parameters for the maximum residual stress are achieved. The results indicate that effect of shot diameter on the induced residual stress is increased by increasing the shot speed. Also, enhancing the friction coefficient magnitude always cannot lead to increase in the residual stress.

  12. Finite element modelling of aluminum alloy 2024-T3 under transverse impact loading

    Science.gov (United States)

    Abdullah, Ahmad Sufian; Kuntjoro, Wahyu; Yamin, A. F. M.

    2017-12-01

    Fiber metal laminate named GLARE is a new aerospace material which has great potential to be widely used in future lightweight aircraft. It consists of aluminum alloy 2024-T3 and glass-fiber reinforced laminate. In order to produce reliable finite element model of impact response or crashworthiness of structure made of GLARE, one can initially model and validate the finite element model of the impact response of its constituents separately. The objective of this study was to develop a reliable finite element model of aluminum alloy 2024-T3 under low velocity transverse impact loading using commercial software ABAQUS. Johnson-Cook plasticity and damage models were used to predict the alloy's material properties and impact behavior. The results of the finite element analysis were compared to the experiment that has similar material and impact conditions. Results showed good correlations in terms of impact forces, deformation and failure progressions which concluded that the finite element model of 2024-T3 aluminum alloy under low velocity transverse impact condition using Johnson-Cook plastic and damage models was reliable.

  13. Production of porous filter elements from PEUAPM nanocomposites and silver nanoparticles

    International Nuclear Information System (INIS)

    Bizzo, M.A.; Hui, W.S.

    2014-01-01

    The production of filter elements for water based in polymers is widespread in the market, but has an undesirable characteristic: they are not efficient and able to retain or eliminate microorganisms at all times. This paper proposes to produce nanocomposite filters with biocidal properties composed of ultra-high molecular weight polyethylene(UHMWPE) and silver nanoparticles, the UHMWPE is responsible for the uniform porous structure of the filters and the silver nanoparticles incorporated on the polymer are responsible for the biocide action. Particulate polymer that presents a different particle size curve was used for sintering the filters. Samples of filter elements obtained in this work were characterized by the techniques of X-ray diffraction, scanning electron microscopy and EDS microanalysis. The results indicated a porosity of approximately 49% in the filter, and the formation of the nanocomposite. key-words: nanocomposites, silver, UHMWPE, filter elements. (author)

  14. Memristors: Memory elements in potato tubers.

    Science.gov (United States)

    Volkov, Alexander G; Nyasani, Eunice K; Blockmon, Avery L; Volkova, Maya I

    2015-01-01

    A memristor is a nonlinear element because its current-voltage characteristic is similar to that of a Lissajous pattern for nonlinear systems. This element was postulated recently and researchers are looking for it in different biosystems. We investigated electrical circuitry of red Irish potato tubers (Solanum tuberosum L.). The goal was to discover if potato tubers might have a new electrical component - a resistor with memory. The analysis was based on a cyclic current-voltage characteristic where the resistor with memory should manifest itself. We found that the electrostimulation by bipolar sinusoidal or triangle periodic waves induces electrical responses in the potato tubers with fingerprints of memristors. Tetraethylammonium chloride, an inhibitor of voltage gated K(+) channels, transforms a memristor to a resistor in potato tubers. Our results demonstrate that a voltage gated K(+) channel in the excitable tissue of potato tubers has properties of a memristor. Uncoupler carbonylcyanide-4-trifluoromethoxy-phenyl hydrazone decreases the amplitude of electrical responses at low and high frequencies of bipolar periodic sinusoidal or triangle electrostimulating waves. The discovery of memristors in plants creates a new direction in the understanding of electrical phenomena in plants.

  15. Modeling grain boundaries in polycrystals using cohesive elements: Qualitative and quantitative analysis

    Energy Technology Data Exchange (ETDEWEB)

    El Shawish, Samir, E-mail: Samir.ElShawish@ijs.si [Jožef Stefan Institute, Jamova cesta 39, SI-1000 Ljubljana (Slovenia); Cizelj, Leon [Jožef Stefan Institute, Jamova cesta 39, SI-1000 Ljubljana (Slovenia); Simonovski, Igor [European Commission, DG-JRC, Institute for Energy and Transport, P.O. Box 2, NL-1755 ZG Petten (Netherlands)

    2013-08-15

    Highlights: ► We estimate the performance of cohesive elements for modeling grain boundaries. ► We compare the computed stresses in ABAQUS finite element solver. ► Tests are performed in analytical and realistic models of polycrystals. ► Most severe issue is found within the plastic grain response. ► Other identified issues are related to topological constraints in modeling space. -- Abstract: We propose and demonstrate several tests to estimate the performance of the cohesive elements in ABAQUS for modeling grain boundaries in complex spatial structures such as polycrystalline aggregates. The performance of the cohesive elements is checked by comparing the computed stresses with the theoretically predicted values for a homogeneous material under uniaxial tensile loading. Statistical analyses are performed under different loading conditions for two elasto-plastic models of the grains: isotropic elasticity with isotropic hardening plasticity and anisotropic elasticity with crystal plasticity. Tests are conducted on an analytical finite element model generated from Voronoi tessellation as well as on a realistic finite element model of a stainless steel wire. The results of the analyses highlight several issues related to the computation of normal and shear stresses. The most severe issue is found within the plastic grain response where the computed normal stresses on a particularly oriented cohesive elements are significantly underestimated. Other issues are found to be related to topological constraints in the modeling space and result in the increased scatter of the computed stresses.

  16. Dielectric response of arbitrary-shaped clusters studied by the finite element method

    Czech Academy of Sciences Publication Activity Database

    Rychetský, Ivan; Klíč, Antonín

    2012-01-01

    Roč. 427, č. 1 (2012), s. 143-147 ISSN 0015-0193 R&D Projects: GA ČR GA202/09/0430 Institutional research plan: CEZ:AV0Z10100520 Keywords : effective permittivity * two-component composite * integral representation * finite element analysis Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 0.415, year: 2012

  17. An Evolutionary Conserved Epigenetic Mark of Polycomb Response Elements Implemented by Trx/MLL/COMPASS.

    Science.gov (United States)

    Rickels, Ryan; Hu, Deqing; Collings, Clayton K; Woodfin, Ashley R; Piunti, Andrea; Mohan, Man; Herz, Hans-Martin; Kvon, Evgeny; Shilatifard, Ali

    2016-07-21

    Polycomb response elements (PREs) are specific DNA sequences that stably maintain the developmental pattern of gene expression. Drosophila PREs are well characterized, whereas the existence of PREs in mammals remains debated. Accumulating evidence supports a model in which CpG islands recruit Polycomb group (PcG) complexes; however, which subset of CGIs is selected to serve as PREs is unclear. Trithorax (Trx) positively regulates gene expression in Drosophila and co-occupies PREs to antagonize Polycomb-dependent silencing. Here we demonstrate that Trx-dependent H3K4 dimethylation (H3K4me2) marks Drosophila PREs and maintains the developmental expression pattern of nearby genes. Similarly, the mammalian Trx homolog, MLL1, deposits H3K4me2 at CpG-dense regions that could serve as PREs. In the absence of MLL1 and H3K4me2, H3K27me3 levels, a mark of Polycomb repressive complex 2 (PRC2), increase at these loci. By inhibiting PRC2-dependent H3K27me3 in the absence of MLL1, we can rescue expression of these loci, demonstrating a functional balance between MLL1 and PRC2 activities at these sites. Thus, our study provides rules for identifying cell-type-specific functional mammalian PREs within the human genome. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. Implementation of the utilization program for the fuel elements of the Atucha I nuclear power plant

    International Nuclear Information System (INIS)

    Martin, H.R.; Serra, O.H.; Parker, Alejandro

    1981-01-01

    The programming operation for the use of the fuel elements in the Atucha-1 nuclear power plant was initially under the responsibility of the KWU Company, as part of the services rendered due for the manufacturing of said elements. This job was done with the help of the TRISIC program, developed in the early seventies by CNEA and SIEMENS staff. From april 21, 1979 on, CNEA took over the responsibility and strategy of the interchange of fuel elements. The several stages carried out for the implementation of this service are detailed. (M.E.L.) [es

  19. Variational approach to probabilistic finite elements

    Science.gov (United States)

    Belytschko, T.; Liu, W. K.; Mani, A.; Besterfield, G.

    1991-08-01

    Probabilistic finite element methods (PFEM), synthesizing the power of finite element methods with second-moment techniques, are formulated for various classes of problems in structural and solid mechanics. Time-invariant random materials, geometric properties and loads are incorporated in terms of their fundamental statistics viz. second-moments. Analogous to the discretization of the displacement field in finite element methods, the random fields are also discretized. Preserving the conceptual simplicity, the response moments are calculated with minimal computations. By incorporating certain computational techniques, these methods are shown to be capable of handling large systems with many sources of uncertainties. By construction, these methods are applicable when the scale of randomness is not very large and when the probabilistic density functions have decaying tails. The accuracy and efficiency of these methods, along with their limitations, are demonstrated by various applications. Results obtained are compared with those of Monte Carlo simulation and it is shown that good accuracy can be obtained for both linear and nonlinear problems. The methods are amenable to implementation in deterministic FEM based computer codes.

  20. Responsive web design workflow

    OpenAIRE

    LAAK, TIMO

    2013-01-01

    Responsive Web Design Workflow is a literature review about Responsive Web Design, a web standards based modern web design paradigm. The goals of this research were to define what responsive web design is, determine its importance in building modern websites and describe a workflow for responsive web design projects. Responsive web design is a paradigm to create adaptive websites, which respond to the properties of the media that is used to render them. The three key elements of responsi...

  1. Enhanced phosphorylation of cyclic AMP response element binding protein in Brain of mice following repetitive hypoxic exposure

    International Nuclear Information System (INIS)

    Gao Yanan; Gao Ge; Long Caixia; Han Song; Zu Pengyu; Fang Li; Li Junfa

    2006-01-01

    Cerebral ischemic/hypoxic preconditioning (I/HPC) is a phenomenon of endogenous protection that renders Brain tolerant to sustained ischemia/hypoxia. This profound protection induced by I/HPC makes it an attractive target for developing potential clinical therapeutic approaches. However, the molecular mechanism of I/HPC is unclear. Cyclic AMP (cAMP) response element binding protein (CREB), a selective nuclear transcriptional factor, plays a key role in the neuronal functions. Phosphorylation of CREB on Ser-133 may facilitate its transcriptional activity in response to various stresses. In the current study, we observed the changes in CREB phosphorylation (Ser-133) and protein expression in Brain of auto-hypoxia-induced HPC mice by using Western blot analysis. We found that the levels of phosphorylated CREB (Ser-133), but not protein expression of CREB, increased significantly (p < 0.05) in the hippocampus and the frontal cortex of mice after repetitive hypoxic exposure (H2-H4, n = 6 for each group), when compared to that of the normoxic (H0, n = 6) or hypoxic exposure once group (H1, n = 6). In addition, a significant enhancement (p < 0.05) of CREB phosphorylation (Ser-133) could also be found in the nuclear extracts from the whole hippocampus of hypoxic preconditioned mice (H2-H4, n = 6 for each group). These results suggest that the phosphorylation of CREB might be involved in the development of cerebral hypoxic preconditioning

  2. Numerical modeling of the dynamic behavior of structures under impact with a discrete elements / finite elements coupling

    International Nuclear Information System (INIS)

    Rousseau, J.

    2009-07-01

    That study focuses on concrete structures submitted to impact loading and is aimed at predicting local damage in the vicinity of an impact zone as well as the global response of the structure. The Discrete Element Method (DEM) seems particularly well suited in this context for modeling fractures. An identification process of DEM material parameters from macroscopic data (Young's modulus, compressive and tensile strength, fracture energy, etc.) will first be presented for the purpose of enhancing reproducibility and reliability of the simulation results with DE samples of various sizes. Then, a particular interaction, between concrete and steel elements, was developed for the simulation of reinforced concrete. The discrete elements method was validated on quasi-static and dynamic tests carried out on small samples of concrete and reinforced concrete. Finally, discrete elements were used to simulate impacts on reinforced concrete slabs in order to confront the results with experimental tests. The modeling of a large structure by means of DEM may lead to prohibitive computation times. A refined discretization becomes required in the vicinity of the impact, while the structure may be modeled using a coarse FE mesh further from the impact area, where the material behaves elastically. A coupled discrete-finite element approach is thus proposed: the impact zone is modeled by means of DE and elastic FE are used on the rest of the structure. An existing method for 3D finite elements was extended to shells. This new method was then validated on many quasi-static and dynamic tests. The proposed approach is then applied to an impact on a concrete structure in order to validate the coupled method and compare computation times. (author)

  3. Element by element review of their atomic weights

    International Nuclear Information System (INIS)

    Peiser, H.S.; Holden, N.E.; Bievre, P. de

    1984-01-01

    The IUPAC 'standard' atomic weights of the terrestrially occurring chemical elements are individually reviewed tracing changes during the past 25 years. Emphasized is the relevant published scientific evidence which in each case constitutes the basis for the expert judgment by the responsible IUPAC Commission. It biennially reports on, recommends, and tabulates the best values of these atomic weights with an implied judgment of their individual reliability. In the introductory part of this Review the history of atomic-weight determinations is sketched. The IUPAC leadership in this data-evaluation project is described as it benefits science, technology, and trade. The remaining experimental uncertainties and natural variabilities are discussed. The treatment of abnormal materials is explained. The principal techniques for determining atomic weights are outlined. The effects of naturally occurring radioactive nuclides are characterized in their essentials. (author)

  4. Modelling optimization involving different types of elements in finite element analysis

    International Nuclear Information System (INIS)

    Wai, C M; Rivai, Ahmad; Bapokutty, Omar

    2013-01-01

    Finite elements are used to express the mechanical behaviour of a structure in finite element analysis. Therefore, the selection of the elements determines the quality of the analysis. The aim of this paper is to compare and contrast 1D element, 2D element, and 3D element used in finite element analysis. A simple case study was carried out on a standard W460x74 I-beam. The I-beam was modelled and analyzed statically with 1D elements, 2D elements and 3D elements. The results for the three separate finite element models were compared in terms of stresses, deformation and displacement of the I-beam. All three finite element models yield satisfactory results with acceptable errors. The advantages and limitations of these elements are discussed. 1D elements offer simplicity although lacking in their ability to model complicated geometry. 2D elements and 3D elements provide more detail yet sophisticated results which require more time and computer memory in the modelling process. It is also found that the choice of element in finite element analysis is influence by a few factors such as the geometry of the structure, desired analysis results, and the capability of the computer

  5. Transposable elements in cancer as a by-product of stress-induced evolvability

    DEFF Research Database (Denmark)

    Mourier, Tobias; Nielsen, Lars P.; Hansen, Anders Johannes

    2014-01-01

    Transposable elements (TEs) are ubiquitous in eukaryotic genomes. Barbara McClintock's famous notion of TEs acting as controlling elements modifying the genetic response of an organism upon exposure to stressful environments has since been solidly supported in a series of model organisms. This re...... as an evolutionary by-product of organisms' abilities to genetically adapt to environmental stress....

  6. Element-topology-independent preconditioners for parallel finite element computations

    Science.gov (United States)

    Park, K. C.; Alexander, Scott

    1992-01-01

    A family of preconditioners for the solution of finite element equations are presented, which are element-topology independent and thus can be applicable to element order-free parallel computations. A key feature of the present preconditioners is the repeated use of element connectivity matrices and their left and right inverses. The properties and performance of the present preconditioners are demonstrated via beam and two-dimensional finite element matrices for implicit time integration computations.

  7. Trace element deficiency and its diagnosis by radioisotope injection

    International Nuclear Information System (INIS)

    Kirchgessner, M.; Schwarz, F.J.

    1976-01-01

    The metabolism of trace elements is subject to certain mechanisms of homeostatic regulation. The supply status of the trace elements, iron, copper, zinc and manganese has definite effects on their respective extent of intestinal absorption, retention and intestinal excretion. Experimental studies show that there is an increase in intestinal absorption and retention, and a decrease in turnover rate and endogenous excretion of these trace elements in response to deficient dietary intake. On the basis of these results, three models are discussed for the use of radioisotopes in the diagnosis of situations of trace element deficiency: (1) Determination of the intestinal absorption of an orally administered radioisotope dose by measuring the activity of blood; (2) Determination of the retention of a parenterally administered dose in blood or plasma; and (3) Determination of the endogenous faecal excretion of a parenterally administered dose. The advantages and disadvantages of these models are discussed. Determination of the endogenous secretion of the trace element after intravenous injection of its radioisotope may be considered as the simplest and most informative method. (author)

  8. A HLA class I cis-regulatory element whose activity can be modulated by hormones.

    Science.gov (United States)

    Sim, B C; Hui, K M

    1994-12-01

    To elucidate the basis of the down-regulation in major histocompatibility complex (MHC) class I gene expression and to identify possible DNA-binding regulatory elements that have the potential to interact with class I MHC genes, we have studied the transcriptional regulation of class I HLA genes in human breast carcinoma cells. A 9 base pair (bp) negative cis-regulatory element (NRE) has been identified using band-shift assays employing DNA sequences derived from the 5'-flanking region of HLA class I genes. This 9-bp element, GTCATGGCG, located within exon I of the HLA class I gene, can potently inhibit the expression of a heterologous thymidine kinase (TK) gene promoter and the HLA enhancer element. Furthermore, this regulatory element can exert its suppressive function in either the sense or anti-sense orientation. More interestingly, NRE can suppress dexamethasone-mediated gene activation in the context of the reported glucocorticoid-responsive element (GRE) in MCF-7 cells but has no influence on the estrogen-mediated transcriptional activation of MCF-7 cells in the context of the reported estrogen-responsive element (ERE). Furthermore, the presence of such a regulatory element within the HLA class I gene whose activity can be modulated by hormones correlates well with our observation that the level of HLA class I gene expression can be down-regulated by hormones in human breast carcinoma cells. Such interactions between negative regulatory elements and specific hormone trans-activators are novel and suggest a versatile form of transcriptional control.

  9. Complex finite element sensitivity method for creep analysis

    International Nuclear Information System (INIS)

    Gomez-Farias, Armando; Montoya, Arturo; Millwater, Harry

    2015-01-01

    The complex finite element method (ZFEM) has been extended to perform sensitivity analysis for mechanical and structural systems undergoing creep deformation. ZFEM uses a complex finite element formulation to provide shape, material, and loading derivatives of the system response, providing an insight into the essential factors which control the behavior of the system as a function of time. A complex variable-based quadrilateral user element (UEL) subroutine implementing the power law creep constitutive formulation was incorporated within the Abaqus commercial finite element software. The results of the complex finite element computations were verified by comparing them to the reference solution for the steady-state creep problem of a thick-walled cylinder in the power law creep range. A practical application of the ZFEM implementation to creep deformation analysis is the calculation of the skeletal point of a notched bar test from a single ZFEM run. In contrast, the standard finite element procedure requires multiple runs. The value of the skeletal point is that it identifies the location where the stress state is accurate, regardless of the certainty of the creep material properties. - Highlights: • A novel finite element sensitivity method (ZFEM) for creep was introduced. • ZFEM has the capability to calculate accurate partial derivatives. • ZFEM can be used for identification of the skeletal point of creep structures. • ZFEM can be easily implemented in a commercial software, e.g. Abaqus. • ZFEM results were shown to be in excellent agreement with analytical solutions

  10. Seismic response of uplifting concrete gravity dams

    International Nuclear Information System (INIS)

    Leger, P.; Sauve, G.; Bhattacharjee, S.

    1992-01-01

    The foundation interaction effects on the seismic response of dam-foundation systems have generally been studied using the linear elastic finite element models. In reality, the foundation can not develop effective tensile stresses to a significant degree along the interface. A two-dimensional finite element model, in which nonlinear gap elements are used at the dam-foundation interface to determine the uplift response of concrete gravity dams subjected to seismic loads, is presented. Time domain analyses were performed for a wide range of modelling assumptions such as dam height, interface uplift pressure, interface mesh density, and earthquake input motions, that were systematically varied to find their influence on the seismic response. The nonlinear interface behavior generally reduces the seismic response of dam-foundation systems acting as a seismic isolation mechanism, and may increase the safety against sliding by reducing the base shear transmitted to the foundation. 4 refs., 5 figs., 6 tabs

  11. Maize DRE-binding proteins DBF1 and DBF2 are involved in rab17 regulation through the drought-responsive element in an ABA-dependent pathway.

    Science.gov (United States)

    Kizis, Dimosthenis; Pagès, Montserrat

    2002-06-01

    The abscisic acid-responsive gene rab17 of maize is expressed during late embryogenesis, and is induced by ABA and desiccation in embryo and vegetative tissues. ABRE and DRE cis-elements are involved in regulation of the gene by ABA and drought. Using yeast one-hybrid screening, we isolated two cDNAs encoding two new DRE-binding proteins, designated DBF1 and DBF2, that are members of the AP2/EREBP transcription factor family. Analysis of mRNA accumulation profiles showed that DBF1 is induced during maize embryogenesis and after desiccation, NaCl and ABA treatments in plant seedlings, whereas the DBF2 mRNA is not induced. DNA-binding preferences of DBFs were analysed by electrophoretic mobility shift assays, and showed that both DBF1 and DBF2 bound to the wild-type DRE2 element, but not to the DRE2 mutant or to the DRE1 element which differs only in a single nucleotide. Transactivation activity using particle bombardment showed that DBF1 functioned as activator of DRE2-dependent transcription of rab17 promoter by ABA, whereas DBF2 overexpression had a repression action downregulating not only the basal promoter activity, but also the ABA effect. These results show that ABA plays a role in the regulation of DBF activity, and suggests the existence of an ABA-dependent pathway for the regulation of genes through the C-repeat/DRE element.

  12. Regulation of Cox-2 by Cyclic AMP Response Element Binding Protein in Prostate Cancer: Potential Role for Nexrutine

    Directory of Open Access Journals (Sweden)

    Rita Ghosh

    2007-11-01

    Full Text Available We recently showed that NexrutineR, a Phellodendron amurense bark extract, suppresses proliferation of prostate cancer cell lines and tumor development in the transgenic adenocarcinoma of mouse prostate (TRAMP model. Our data also indicate that the antiproliferative effects of NexrutineR are mediated in part by Akt and Cyclic AMP response element binding protein (CREB. Cyclooxygenase (Cox-2, a pro-inflammatory mediator, is a CREB target that induces prostaglandin E2 (PGE2 and suppresses apoptosis. Treatment of LNCaP cells with NexrutineR reduced tumor necrosis factor α-induced enzymatic as well as promoter activities of Cox-2. NexrutineR also reduced the expression and promoter activity of Cox-2 in PC-3 cells that express high constitutive levels of Cox-2. Deletion analysis coupled with mutational analysis of the Cox-2 promoter identified CRE as being sufficient for mediating NexrutineR response. Immunohistochemical analysis of human prostate tumors show increased expression of CREB and DNA binding activity in high-grade tumors (three-fold higher in human prostate tumors compared to normal prostate; P = .01. We have identified CREB-mediated activation of Cox-2 as a potential signaling pathway in prostate cancer which can be blocked with a nontoxic, cost-effective dietary supplement like NexrutineR, demonstrating a prospective for development of NexrutineR for prostate cancer management.

  13. PIXE analysis of trace elements in relation to chlorophyll concentration in Plantago ovata Forsk

    International Nuclear Information System (INIS)

    Saha, Priyanka; Sen Raychaudhuri, Sarmistha; Chakraborty, Anindita; Sudarshan, Mathummal

    2010-01-01

    Plantago ovata Forsk - an economically important medicinal plant - was analyzed for trace elements and chlorophyll in a study of the effects of gamma radiation on physiological responses of the seedlings. Proton-induced X-ray emission (PIXE) technique was used to quantify trace elements in unirradiated and gamma-irradiated plants at the seedling stage. The experiments revealed radiation-induced changes in the trace element and chlorophyll concentrations.

  14. Straightened cervical lordosis causes stress concentration: a finite element model study

    Energy Technology Data Exchange (ETDEWEB)

    Wei, Wei; Shi, Shiyuan; Fei, Jun; Wang, Yifan; Chen, Chunyue [Hangzhou Red Cross Hospital, Hangzhou, Zhejiang, (China); Liao, Shenhui [School of Information Science and Engineering, Central South University, Changsha, Hunan (China)

    2013-03-15

    In this study, we propose a finite element analysis of the complete cervical spine with straightened and normal physiological curvature by using a specially designed modelling system. An accurate finite element model is established to recommend plausible approaches to treatment of cervical spondylosis through the finite element analysis results. There are few reports of biomechanics influence of the straightened cervical curve. It is difficult to measure internal responses of cervical spine directly. However, the finite element method has been reported to have the capability to quantify both external and internal responses to mechanical loading, such as the strain and stress distribution of spinal components. We choose a subject with a straightened cervical spine from whom to collect the CT scan data, which formed the basis of the finite element analysis. By using a specially designed modelling system, a high quality finite element model of the complete cervical spine with straightened curvature was generated, which was then mapped to reconstruct a normal physiological curvature model by a volumetric mesh deformation method based on discrete differential properties. Then, the same boundary conditions were applied to do a comparison. The result demonstrated that the active movement range of straightened cervical spine decreased by 24–33 %, but the stress increased by 5–95 %. The stress was concentrated at the facet joint cartilage, uncovertebral joint and the disk. The results suggest that cervical lordosis may have a direct impact on cervical spondylosis treatment. These results may be useful for clinical treatment of cervical spondylosis with straightened curvature.

  15. Straightened cervical lordosis causes stress concentration: a finite element model study

    International Nuclear Information System (INIS)

    Wei, Wei; Shi, Shiyuan; Fei, Jun; Wang, Yifan; Chen, Chunyue; Liao, Shenhui

    2013-01-01

    In this study, we propose a finite element analysis of the complete cervical spine with straightened and normal physiological curvature by using a specially designed modelling system. An accurate finite element model is established to recommend plausible approaches to treatment of cervical spondylosis through the finite element analysis results. There are few reports of biomechanics influence of the straightened cervical curve. It is difficult to measure internal responses of cervical spine directly. However, the finite element method has been reported to have the capability to quantify both external and internal responses to mechanical loading, such as the strain and stress distribution of spinal components. We choose a subject with a straightened cervical spine from whom to collect the CT scan data, which formed the basis of the finite element analysis. By using a specially designed modelling system, a high quality finite element model of the complete cervical spine with straightened curvature was generated, which was then mapped to reconstruct a normal physiological curvature model by a volumetric mesh deformation method based on discrete differential properties. Then, the same boundary conditions were applied to do a comparison. The result demonstrated that the active movement range of straightened cervical spine decreased by 24–33 %, but the stress increased by 5–95 %. The stress was concentrated at the facet joint cartilage, uncovertebral joint and the disk. The results suggest that cervical lordosis may have a direct impact on cervical spondylosis treatment. These results may be useful for clinical treatment of cervical spondylosis with straightened curvature.

  16. Seismic analysis of the APR1400 nuclear reactor system using a verified beam element model

    Energy Technology Data Exchange (ETDEWEB)

    Park, Jong-beom [Department of Mechanical Engineering, Yonsei University, 50 Yonsei-ro, Seodaemun-gu, Seoul 03722 (Korea, Republic of); Park, No-Cheol, E-mail: pnch@yonsei.ac.kr [Department of Mechanical Engineering, Yonsei University, 50 Yonsei-ro, Seodaemun-gu, Seoul 03722 (Korea, Republic of); Lee, Sang-Jeong; Park, Young-Pil [Department of Mechanical Engineering, Yonsei University, 50 Yonsei-ro, Seodaemun-gu, Seoul 03722 (Korea, Republic of); Choi, Youngin [Korea Institute of Nuclear Safety, 62 Gwahak-ro, Yuseong-gu, Daejeon 34142 (Korea, Republic of)

    2017-03-15

    Highlights: • A simplified beam element model is constructed based on the real dynamic characteristics of the APR1400. • Time history analysis is performed to calculate the seismic responses of the structures. • Large deformations can be observed at the in-phase mode of reactor vessel and core support barrel. - Abstract: Structural integrity is the first priority in the design of nuclear reactor internal structures. In particular, nuclear reactor internals should be designed to endure external forces, such as those due to earthquakes. Many researchers have performed finite element analyses to meet these design requirements. Generally, a seismic analysis model should reflect the dynamic characteristics of the target system. However, seismic analysis based on the finite element method requires long computation times as well as huge storage space. In this research, a beam element model was developed and confirmed based on the real dynamic characteristics of an advanced pressurized water nuclear reactor 1400 (APR1400) system. That verification process enhances the accuracy of the finite element analysis using the beam elements, remarkably. Also, the beam element model reduces seismic analysis costs. Therefore, the beam element model was used to perform the seismic analysis. Then, the safety of the APR1400 was assessed based on a seismic analysis of the time history responses of its structures. Thus, efficient, accurate seismic analysis was demonstrated using the proposed beam element model.

  17. Seismic analysis of the APR1400 nuclear reactor system using a verified beam element model

    International Nuclear Information System (INIS)

    Park, Jong-beom; Park, No-Cheol; Lee, Sang-Jeong; Park, Young-Pil; Choi, Youngin

    2017-01-01

    Highlights: • A simplified beam element model is constructed based on the real dynamic characteristics of the APR1400. • Time history analysis is performed to calculate the seismic responses of the structures. • Large deformations can be observed at the in-phase mode of reactor vessel and core support barrel. - Abstract: Structural integrity is the first priority in the design of nuclear reactor internal structures. In particular, nuclear reactor internals should be designed to endure external forces, such as those due to earthquakes. Many researchers have performed finite element analyses to meet these design requirements. Generally, a seismic analysis model should reflect the dynamic characteristics of the target system. However, seismic analysis based on the finite element method requires long computation times as well as huge storage space. In this research, a beam element model was developed and confirmed based on the real dynamic characteristics of an advanced pressurized water nuclear reactor 1400 (APR1400) system. That verification process enhances the accuracy of the finite element analysis using the beam elements, remarkably. Also, the beam element model reduces seismic analysis costs. Therefore, the beam element model was used to perform the seismic analysis. Then, the safety of the APR1400 was assessed based on a seismic analysis of the time history responses of its structures. Thus, efficient, accurate seismic analysis was demonstrated using the proposed beam element model.

  18. Autoshaping with common and distinctive stimulus elements, compact and dispersed arrays.

    Science.gov (United States)

    Sperling, S E; Perkins, M E

    1979-05-01

    Four groups of pigeons were trained with a standard autoshaping procedure in which a brief fixed-duration interval always followed by a grain delivery alternated with a longer variable-duration interval never associated with grain delivery. One of two stimuli was always presented during each interval. One of them contained three black dots and a black star on a green background; the other contained four black dots on a green background. The four elements of each stimulus were arranged in a more compact array for two groups and in a more dispersed array for the other two groups. Which of the two stimuli preceded grain delivery was counterbalanced within each pair of groups. The speed of occurrence of the first autoshaped peck was not affected by whether the stimulus containing the distinctive star element preceded grain delivery, but autoshaping was faster when the stimulus arrays were compact than when they were dispersed. During 560 response-independent training trials that followed the first autoshaped peck, this pattern reversed; both discriminative control over responding and the relative frequency of pecking the stimulus that preceded grain delivery were greater for the two groups where this stimulus contained the discriminative element than for the two groups where it contained only common elements. During subsequent testing with stimuli containing only a single element each, the distinctive feature was responded to proportionately more often by the two groups for which it had been an element of the stimulus preceding grain delivery than by the two groups for which it had been an element of the stimulus complex that never was associated with grain delivery. These data add further support to the hypothesis that the initial occurrence of autoshaped responding and its subsequent maintenance are not affected by the same variables. They also suggest that automaintenance is as sensitive as response-dependent training to the presence or absence of a distinctive

  19. Dynamics of unsymmetric piecewise-linear/non-linear systems using finite elements in time

    Science.gov (United States)

    Wang, Yu

    1995-08-01

    The dynamic response and stability of a single-degree-of-freedom system with unsymmetric piecewise-linear/non-linear stiffness are analyzed using the finite element method in the time domain. Based on a Hamilton's weak principle, this method provides a simple and efficient approach for predicting all possible fundamental and sub-periodic responses. The stability of the steady state response is determined by using Floquet's theory without any special effort for calculating transition matrices. This method is applied to a number of examples, demonstrating its effectiveness even for a strongly non-linear problem involving both clearance and continuous stiffness non-linearities. Close agreement is found between available published findings and the predictions of the finite element in time approach, which appears to be an efficient and reliable alternative technique for non-linear dynamic response and stability analysis of periodic systems.

  20. A Polymorphic Antioxidant Response Element Links NRF2/sMAF Binding to Enhanced MAPT Expression and Reduced Risk of Parkinsonian Disorders

    Directory of Open Access Journals (Sweden)

    Xuting Wang

    2016-04-01

    Full Text Available The NRF2/sMAF protein complex regulates the oxidative stress response by occupying cis-acting enhancers containing an antioxidant response element (ARE. Integrating genome-wide maps of NRF2/sMAF occupancy with disease-susceptibility loci, we discovered eight polymorphic AREs linked to 14 highly ranked disease-risk SNPs in individuals of European ancestry. Among these SNPs was rs242561, located within a regulatory region of the MAPT gene (encoding microtubule-associated protein Tau. It was consistently occupied by NRF2/sMAF in multiple experiments and its strong-binding allele associated with higher mRNA levels in cell lines and human brain tissue. Induction of MAPT transcription by NRF2 was confirmed using a human neuroblastoma cell line and a Nrf2-deficient mouse model. Most importantly, rs242561 displayed complete linkage disequilibrium with a highly protective allele identified in multiple GWASs of progressive supranuclear palsy, Parkinson’s disease, and corticobasal degeneration. These observations suggest a potential role for NRF2/sMAF in tauopathies and a possible role for NRF2 pathway activators in disease prevention.

  1. Brain response to primary blast wave using validated finite element models of human head and advanced combat helmet

    Directory of Open Access Journals (Sweden)

    Liying eZhang

    2013-08-01

    Full Text Available Blast-induced traumatic brain injury has emerged as a signature injury in combat casualty care. Present combat helmets are designed primarily to protect against ballistic and blunt impacts, but the current issue with helmets is protection concerning blasts. In order to delineate the blast wave attenuating capability of the Advanced Combat Helmet (ACH, a finite element (FE study was undertaken to evaluate the head response against blast loadings with and without helmet using a partially validated FE model of the human head and ACH. Four levels of overpressures (0.27-0.66 MPa from the Bowen’s lung iso-damage threshold curves were used to simulate blast insults. Effectiveness of the helmet with respect to head orientation was also investigated. The resulting biomechanical responses of the brain to blast threats were compared for human head with and without the helmet. For all Bowen’s cases, the peak intracranial pressures (ICP in the head ranged from 0.68-1.8 MPa in the coup cortical region. ACH was found to mitigate ICP in the head by 10-35%. Helmeted head resulted in 30% lower average peak brain strains and product of strain and strain rate. Among three blast loading directions with ACH, highest reduction in peak ICP (44% was due to backward blasts whereas the lowest reduction in peak ICP and brain strains was due to forward blast (27%. The biomechanical responses of a human head to primary blast insult exhibited directional sensitivity owing to the different geometry contours and coverage of the helmet construction and asymmetric anatomy of the head. Thus, direction-specific tolerances are needed in helmet design in order to offer omni-directional protection for the human head. The blasts of varying peak overpressures and durations that are believed to produce the same level of lung injury produce different levels of mechanical responses in the brain, and hence "iso-damage" curves for brain injury are likely different than the Bowen curves

  2. Mixed Element Formulation for the Finite Element-Boundary Integral Method

    National Research Council Canada - National Science Library

    Meese, J; Kempel, L. C; Schneider, S. W

    2006-01-01

    A mixed element approach using right hexahedral elements and right prism elements for the finite element-boundary integral method is presented and discussed for the study of planar cavity-backed antennas...

  3. Discrete Element Modeling

    Energy Technology Data Exchange (ETDEWEB)

    Morris, J; Johnson, S

    2007-12-03

    The Distinct Element Method (also frequently referred to as the Discrete Element Method) (DEM) is a Lagrangian numerical technique where the computational domain consists of discrete solid elements which interact via compliant contacts. This can be contrasted with Finite Element Methods where the computational domain is assumed to represent a continuum (although many modern implementations of the FEM can accommodate some Distinct Element capabilities). Often the terms Discrete Element Method and Distinct Element Method are used interchangeably in the literature, although Cundall and Hart (1992) suggested that Discrete Element Methods should be a more inclusive term covering Distinct Element Methods, Displacement Discontinuity Analysis and Modal Methods. In this work, DEM specifically refers to the Distinct Element Method, where the discrete elements interact via compliant contacts, in contrast with Displacement Discontinuity Analysis where the contacts are rigid and all compliance is taken up by the adjacent intact material.

  4. The Indirect Boundary Element Method (IBEM) for Seismic Response of Topographical Irregularities in Layered Media

    Science.gov (United States)

    Contreras Zazueta, M. A.; Perton, M.; Sanchez-Sesma, F. J.; Sánchez-Alvaro, E.

    2013-12-01

    The seismic hazard assessment of extended developments, such as a dam, a bridge or a pipeline, needs the strong ground motion simulation taking into account the effects of surface geology. In many cases the incoming wave field can be obtained from attenuation relations or simulations for layered media using Discrete Wave Number (DWN). Sometimes there is a need to include in simulations the seismic source as well. A number of methods to solve these problems have been developed. Among them the Finite Element and Finite Difference Methods (FEM and FDM) are generally preferred because of the facility of use. Nevertheless, the analysis of realistic dynamic loading induced by earthquakes requires a thinner mesh of the entire domain to consider high frequencies. Consequently this may imply a high computational cost. The Indirect Boundary Element Method (IBEM) can also be employed. Here it is used to study the response of a site to historical seismic activity. This method is particularly suited to model wave propagation through wide areas as it requires only the meshing of boundaries. Moreover, it is well suited to represent finely the diffraction that can occur on a fault. However, the IBEM has been applied mainly to simple geometrical configurations. In this communication significant refinements of the formulation are presented. Using IBEM we can simulate wave propagation in complex geometrical configurations such as a stratified medium crossed by thin faults or having a complex topography. Two main developments are here described; one integrates the DWN method inside the IBEM in order to represent the Green's functions of stratified media with relatively low computational cost but assuming unbounded parallel flat layers, and the other is the extension of IBEM to deal with multi-regions in contact which allows more versatility with a higher computational cost compared to the first one but still minor to an equivalent FEM formulation. The two approaches are fully

  5. A 'Swinging Cradle' model for in vitro classification of different types of response elements of a nuclear receptor

    International Nuclear Information System (INIS)

    Malo, Madhu S.; Pushpakaran, Premraj; Hodin, Richard A.

    2005-01-01

    Nuclear receptors are hormone-activated transcription factors that bind to specific target sequences termed hormone-response element (HRE). A HRE usually consists of two half-sites (5'-AGGTCA-3' consensus sequence) arranged as a direct, everted or inverted repeat with variable spacer region. Assignment of a HRE as a direct, everted or inverted repeat is based on its homology to the consensus half-site, but minor variations can make such an assignment confusing. We hypothesize a 'Swinging Cradle' model for HRE classification, whereby the core HRE functions as the 'sitting platform' for the NR, and the extra nucleotides at either end act as the 'sling' of the Cradle. We show that in vitro binding of the thyroid hormone receptor and 9-cis retinoic acid receptor heterodimer to an everted repeat TRE follows the 'Swinging Cradle' model, whereas the other TREs do not. We also show that among these TREs, the everted repeat mediates the highest biological activity

  6. Glycogen Synthase Kinase-3 regulates IGFBP-1 gene transcription through the Thymine-rich Insulin Response Element

    Directory of Open Access Journals (Sweden)

    Marquez Rodolfo

    2004-09-01

    Full Text Available Abstract Background Hepatic expression of several gene products involved in glucose metabolism, including phosphoenolpyruvate carboxykinase (PEPCK, glucose-6-phosphatase (G6Pase and insulin-like growth factor binding protein-1 (IGFBP-1, is rapidly and completely inhibited by insulin. This inhibition is mediated through the regulation of a DNA element present in each of these gene promoters, that we call the Thymine-rich Insulin Response Element (TIRE. The insulin signalling pathway that results in the inhibition of these gene promoters requires the activation of phosphatidylinositol 3-kinase (PI 3-kinase. However, the molecules that connect PI 3-kinase to these gene promoters are not yet fully defined. Glycogen Synthase Kinase 3 (GSK-3 is inhibited following activation of PI 3-kinase. We have shown previously that inhibitors of GSK-3 reduce the activity of two TIRE-containing gene promoters (PEPCK and G6Pase, whose products are required for gluconeogenesis. Results In this report we demonstrate that in H4IIE-C3 cells, four distinct classes of GSK-3 inhibitor mimic the effect of insulin on a third TIRE-containing gene, IGFBP-1. We identify the TIRE as the minimum requirement for inhibition by these agents, and demonstrate that the target of GSK-3 is unlikely to be the postulated TIRE-binding protein FOXO-1. Importantly, overexpression of GSK-3 in cells reduces the insulin regulation of TIRE activity as well as endogenous IGFBP-1 expression. Conclusions These results implicate GSK-3 as an intermediate in the pathway from the insulin receptor to the TIRE. Indeed, this is the first demonstration of an absolute requirement for GSK-3 inhibition in insulin regulation of gene transcription. These data support the potential use of GSK-3 inhibitors in the treatment of insulin resistant states such as Type 2 diabetes mellitus, but suggest that it will be important to identify all TIRE-containing genes to assess potential side effects of these agents.

  7. Elemental markers in elasmobranchs: effects of environmental history and growth on vertebral chemistry.

    Science.gov (United States)

    Smith, Wade D; Miller, Jessica A; Heppell, Selina S

    2013-01-01

    Differences in the chemical composition of calcified skeletal structures (e.g. shells, otoliths) have proven useful for reconstructing the environmental history of many marine species. However, the extent to which ambient environmental conditions can be inferred from the elemental signatures within the vertebrae of elasmobranchs (sharks, skates, rays) has not been evaluated. To assess the relationship between water and vertebral elemental composition, we conducted two laboratory studies using round stingrays, Urobatis halleri, as a model species. First, we examined the effects of temperature (16°, 18°, 24°C) on vertebral elemental incorporation (Li/Ca, Mg/Ca, Mn/Ca, Zn/Ca, Sr/Ca, Ba/Ca). Second, we tested the relationship between water and subsequent vertebral elemental composition by manipulating dissolved barium concentrations (1x, 3x, 6x). We also evaluated the influence of natural variation in growth rate on elemental incorporation for both experiments. Finally, we examined the accuracy of classifying individuals to known environmental histories (temperature and barium treatments) using vertebral elemental composition. Temperature had strong, negative effects on the uptake of magnesium (DMg) and barium (DBa) and positively influenced manganese (DMn) incorporation. Temperature-dependent responses were not observed for lithium and strontium. Vertebral Ba/Ca was positively correlated with ambient Ba/Ca. Partition coefficients (DBa) revealed increased discrimination of barium in response to increased dissolved barium concentrations. There were no significant relationships between elemental incorporation and somatic growth or vertebral precipitation rates for any elements except Zn. Relationships between somatic growth rate and DZn were, however, inconsistent and inconclusive. Variation in the vertebral elemental signatures of U. halleri reliably distinguished individual rays from each treatment based on temperature (85%) and Ba exposure (96%) history. These

  8. Transportation of irradiated fuel elements

    International Nuclear Information System (INIS)

    Preece, A.H.

    1980-01-01

    The report falls under the headings: introduction (explaining the special interest of the London Borough of Brent, as forming part of the route for transportation of irradiated fuel elements); nuclear power (with special reference to transport of spent fuel and radioactive wastes); the flask aspect (design, safety regulations, criticisms, tests, etc.); the accident aspect (working manual for rail staff, train formation, responsibility, postulated accident situations); the emergency arrangements aspect; the monitoring aspect (health and safety reports); legislation; contingency plans; radiation - relevant background information. (U.K.)

  9. Four regulatory elements in the human c-fos promoter mediate transactivation by HTLV-1 Tax protein.

    Science.gov (United States)

    Alexandre, C; Verrier, B

    1991-04-01

    Expression of the human c-fos proto-oncogene is activated in trans by the Tax protein encoded by human T-cell leukemia virus type-1 (HTLV-1). Indeed, we show here that a HeLa clone stably transfected by Tax expresses Fos at a high level. We also show that multiple elements of the human c-fos promoter, i.e. the v-sis conditioned medium inducible element (SIE), the dyad symmetry element (DSE) necessary for growth factor induction, the octanucleotide direct repeat element (DR), and the cyclic AMP response element (CRE) centred at -60, can all mediate Tax transactivation. In the DSE, the 10bp central core that binds the serum response factor (SRF) is, by itself, sufficient to mediate Tax transactivation. Moreover, a CRE-binding protein is involved in Tax activation through the CRE-60 element. Since Fos is a transregulator of cellular genes, our results suggest that the oncoprotein plays a crucial role in T-cell transformation by HTLV-1 in conjunction with other Tax-inducible genes.

  10. Influence of easily ionised elements on the delayed responses of the emission intensities of an analyte in a power modulated U-shaped argon stabilised DC arc plasma with an aerosol supply

    Directory of Open Access Journals (Sweden)

    MIROSLAV KUZMANOVIC

    2005-09-01

    Full Text Available The current of a U-shaped argon stabilised DC arc was square modulated with a 40 Hz repetition frequency between 6 and 3 A. The delayed line intensity responses to the modulation of the arc current were investigated using calcium as a representative analyte. The intensities of both the atomic and ionic lines were monitored at different distances from the arc axis in the presence of various concentrations of the easily ionised element. Temporal evolutions were monitored on a millisecond time scale. It was found that the responses of the line intesity to the arc current change strongly depended on the observed radial position, especially in the vicinity of the arc axis. The obtained results showed a significant influence of even small amounts of the easily ionised element on the excitation and transport of the analyte and indicated a way of possibly improving the analytical capabilities of the excitation source.

  11. Probalistic Finite Elements (PFEM) structural dynamics and fracture mechanics

    Science.gov (United States)

    Liu, Wing-Kam; Belytschko, Ted; Mani, A.; Besterfield, G.

    1989-01-01

    The purpose of this work is to develop computationally efficient methodologies for assessing the effects of randomness in loads, material properties, and other aspects of a problem by a finite element analysis. The resulting group of methods is called probabilistic finite elements (PFEM). The overall objective of this work is to develop methodologies whereby the lifetime of a component can be predicted, accounting for the variability in the material and geometry of the component, the loads, and other aspects of the environment; and the range of response expected in a particular scenario can be presented to the analyst in addition to the response itself. Emphasis has been placed on methods which are not statistical in character; that is, they do not involve Monte Carlo simulations. The reason for this choice of direction is that Monte Carlo simulations of complex nonlinear response require a tremendous amount of computation. The focus of efforts so far has been on nonlinear structural dynamics. However, in the continuation of this project, emphasis will be shifted to probabilistic fracture mechanics so that the effect of randomness in crack geometry and material properties can be studied interactively with the effect of random load and environment.

  12. Application of Dynamic Analysis in Semi-Analytical Finite Element Method.

    Science.gov (United States)

    Liu, Pengfei; Xing, Qinyan; Wang, Dawei; Oeser, Markus

    2017-08-30

    Analyses of dynamic responses are significantly important for the design, maintenance and rehabilitation of asphalt pavement. In order to evaluate the dynamic responses of asphalt pavement under moving loads, a specific computational program, SAFEM, was developed based on a semi-analytical finite element method. This method is three-dimensional and only requires a two-dimensional FE discretization by incorporating Fourier series in the third dimension. In this paper, the algorithm to apply the dynamic analysis to SAFEM was introduced in detail. Asphalt pavement models under moving loads were built in the SAFEM and commercial finite element software ABAQUS to verify the accuracy and efficiency of the SAFEM. The verification shows that the computational accuracy of SAFEM is high enough and its computational time is much shorter than ABAQUS. Moreover, experimental verification was carried out and the prediction derived from SAFEM is consistent with the measurement. Therefore, the SAFEM is feasible to reliably predict the dynamic response of asphalt pavement under moving loads, thus proving beneficial to road administration in assessing the pavement's state.

  13. The transuranium elements: From neptunium and plutonium to element 112

    International Nuclear Information System (INIS)

    Hoffman, D.C.

    1996-01-01

    Beginning in the 1930's, both chemists and physicists became interested in synthesizing new artificial elements. The first transuranium element, Np, was synthesized in 1940. Over the past six decades, 20 transuranium elements have been produced. A review of the synthesis is given. The procedure of naming the heavy elements is also discussed. It appears feasible to produce elements 113 and 114. With the Berkeley Gas-filled Separator, it should be possible to reach the superheavy elements in the region of the spherical Z=114 shell, but with fewer neutrons than the N=184 spherical shell. 57 refs, 6 figs

  14. General Stress Responses in the Honey Bee

    Directory of Open Access Journals (Sweden)

    Naïla Even

    2012-12-01

    Full Text Available The biological concept of stress originated in mammals, where a “General Adaptation Syndrome” describes a set of common integrated physiological responses to diverse noxious agents. Physiological mechanisms of stress in mammals have been extensively investigated through diverse behavioral and physiological studies. One of the main elements of the stress response pathway is the endocrine hypothalamo-pituitary-adrenal (HPA axis, which underlies the “fight-or-flight” response via a hormonal cascade of catecholamines and corticoid hormones. Physiological responses to stress have been studied more recently in insects: they involve biogenic amines (octopamine, dopamine, neuropeptides (allatostatin, corazonin and metabolic hormones (adipokinetic hormone, diuretic hormone. Here, we review elements of the physiological stress response that are or may be specific to honey bees, given the economical and ecological impact of this species. This review proposes a hypothetical integrated honey bee stress pathway somewhat analogous to the mammalian HPA, involving the brain and, particularly, the neurohemal organ corpora cardiaca and peripheral targets, including energy storage organs (fat body and crop. We discuss how this system can organize rapid coordinated changes in metabolic activity and arousal, in response to adverse environmental stimuli. We highlight physiological elements of the general stress responses that are specific to honey bees, and the areas in which we lack information to stimulate more research into how this fascinating and vital insect responds to stress.

  15. A role for circadian evening elements in cold-regulated gene expression in Arabidopsis.

    Science.gov (United States)

    Mikkelsen, Michael D; Thomashow, Michael F

    2009-10-01

    The plant transcriptome is dramatically altered in response to low temperature. The cis-acting DNA regulatory elements and trans-acting factors that regulate the majority of cold-regulated genes are unknown. Previous bioinformatic analysis has indicated that the promoters of cold-induced genes are enriched in the Evening Element (EE), AAAATATCT, a DNA regulatory element that has a role in circadian-regulated gene expression. Here we tested the role of EE and EE-like (EEL) elements in cold-induced expression of two Arabidopsis genes, CONSTANS-like 1 (COL1; At5g54470) and a gene encoding a 27-kDa protein of unknown function that we designated COLD-REGULATED GENE 27 (COR27; At5g42900). Mutational analysis indicated that the EE/EEL elements were required for cold induction of COL1 and COR27, and that their action was amplified through coupling with ABA response element (ABRE)-like (ABREL) motifs. An artificial promoter consisting solely of four EE motifs interspersed with three ABREL motifs was sufficient to impart cold-induced gene expression. Both COL1 and COR27 were found to be regulated by the circadian clock at warm growth temperatures and cold-induction of COR27 was gated by the clock. These results suggest that cold- and clock-regulated gene expression are integrated through regulatory proteins that bind to EE and EEL elements supported by transcription factors acting at ABREL sequences. Bioinformatic analysis indicated that the coupling of EE and EEL motifs with ABREL motifs is highly enriched in cold-induced genes and thus may constitute a DNA regulatory element pair with a significant role in configuring the low-temperature transcriptome.

  16. Atrium and HTP fuel elements for the U.S. market

    International Nuclear Information System (INIS)

    Morgan, J.N.; Krebs, W.D.

    1994-01-01

    The international acitivities of Siemens in the nuclear fuel sector are the responsibility of the Nuclear Fuel Cycle Unit of the Power Generation Division (KWU) in Germany, the Nuclear Dividion of Siemens Power Corporation (SPC) in the Unites States, and the German Siemens subsidiaries, ANF GmbH (fuel element fabrication) in Lingen and NRG - Nuklearrohr Gesellschaft mbH (cladding tube production) in Duisburg. The requirements of the U.S. market for light water reactor fuel elements are met by products from the European market. (orig.) [de

  17. Stabilization of numerical interchange in spectral-element magnetohydrodynamics

    Science.gov (United States)

    Sovinec, C. R.

    2016-08-01

    Auxiliary numerical projections of the divergence of flow velocity and vorticity parallel to magnetic field are developed and tested for the purpose of suppressing unphysical interchange instability in magnetohydrodynamic simulations. The numerical instability arises with equal-order C0 finite- and spectral-element expansions of the flow velocity, magnetic field, and pressure and is sensitive to behavior at the limit of resolution. The auxiliary projections are motivated by physical field-line bending, and coercive responses to the projections are added to the flow-velocity equation. Their incomplete expansions are limited to the highest-order orthogonal polynomial in at least one coordinate of the spectral elements. Cylindrical eigenmode computations show that the projections induce convergence from the stable side with first-order ideal-MHD equations during h-refinement and p-refinement. Hyperbolic and parabolic projections and responses are compared, together with different methods for avoiding magnetic divergence error. The projections are also shown to be effective in linear and nonlinear time-dependent computations with the NIMROD code Sovinec et al. [17], provided that the projections introduce numerical dissipation.

  18. Limitless Analytic Elements

    Science.gov (United States)

    Strack, O. D. L.

    2018-02-01

    We present equations for new limitless analytic line elements. These elements possess a virtually unlimited number of degrees of freedom. We apply these new limitless analytic elements to head-specified boundaries and to problems with inhomogeneities in hydraulic conductivity. Applications of these new analytic elements to practical problems involving head-specified boundaries require the solution of a very large number of equations. To make the new elements useful in practice, an efficient iterative scheme is required. We present an improved version of the scheme presented by Bandilla et al. (2007), based on the application of Cauchy integrals. The limitless analytic elements are useful when modeling strings of elements, rivers for example, where local conditions are difficult to model, e.g., when a well is close to a river. The solution of such problems is facilitated by increasing the order of the elements to obtain a good solution. This makes it unnecessary to resort to dividing the element in question into many smaller elements to obtain a satisfactory solution.

  19. Discrete element modeling of microstructure of nacre

    Science.gov (United States)

    Chandler, Mei Qiang; Cheng, Jing-Ru C.

    2018-04-01

    The microstructure of nacre consists of polygon-shaped aragonite mineral tablets bonded by very thin layers of organic materials and is organized in a brick-mortar morphology. In this research, the discrete element method was utilized to model this structure. The aragonite mineral tablets were modeled with three-dimensional polygon particles generated by the Voronoi tessellation method to represent the Voronoi-like patterns of mineral tablets assembly observed in experiments. The organic matrix was modeled with a group of spring elements. The constitutive relations of the spring elements were inspired from the experimental results of organic molecules from the literature. The mineral bridges were modeled with simple elastic bonds with the parameters based on experimental data from the literature. The bulk stress-strain responses from the models agreed well with experimental results. The model results show that the mineral bridges play important roles in providing the stiffness and yield strength for the nacre, while the organic matrix in providing the ductility for the nacre. This work demonstrated the suitability of particle methods for modeling microstructures of nacre.

  20. Seismic response of LMFBR tanks with imperfections

    International Nuclear Information System (INIS)

    Gvildys, J.; Ma, D.C.; Chang, Y.W.

    1985-01-01

    This paper deals with seismic responses of imperfect circular tanks. Physical imperfection due to manufacturing tolerances and numerical imperfection due to finite element spatial discretization are described. Numerical imperfections produced by 4-node and 9-node Lagrangian shell elements are examined. A convergence study is performed in which the number of the shell elements required to capture the dominant ''out-of-roundness'' modes under seismic excitations is determined. The response of a shell with a cos4theta imperfection due to manufacturing tolerances is compared with that of a perfect circular shell to demonstrate the effects of imperfection on the axial stresses of the shell under seismic conditions. 3 refs., 4 figs., 2 tabs

  1. Autoshaping with common and distinctive stimulus elements, compact and dispersed arrays1

    Science.gov (United States)

    Sperling, Sally E.; Perkins, Mark E.

    1979-01-01

    Four groups of pigeons were trained with a standard autoshaping procedure in which a brief fixed-duration interval always followed by a grain delivery alternated with a longer variable-duration interval never associated with grain delivery. One of two stimuli was always presented during each interval. One of them contained three black dots and a black star on a green background; the other contained four black dots on a green background. The four elements of each stimulus were arranged in a more compact array for two groups and in a more dispersed array for the other two groups. Which of the two stimuli preceded grain delivery was counterbalanced within each pair of groups. The speed of occurrence of the first autoshaped peck was not affected by whether the stimulus containing the distinctive star element preceded grain delivery, but autoshaping was faster when the stimulus arrays were compact than when they were dispersed. During 560 response-independent training trials that followed the first autoshaped peck, this pattern reversed; both discriminative control over responding and the relative frequency of pecking the stimulus that preceded grain delivery were greater for the two groups where this stimulus contained the discriminative element than for the two groups where it contained only common elements. During subsequent testing with stimuli containing only a single element each, the distinctive feature was responded to proportionately more often by the two groups for which it had been an element of the stimulus preceding grain delivery than by the two groups for which it had been an element of the stimulus complex that never was associated with grain delivery. These data add further support to the hypothesis that the initial occurrence of autoshaped responding and its subsequent maintenance are not affected by the same variables. They also suggest that automaintenance is as sensitive as response-dependent training to the presence or absence of a distinctive

  2. Gender and international crisis response

    DEFF Research Database (Denmark)

    Eklund, Lisa; Tellier, Siri

    2012-01-01

    For more than a decade the humanitarian community has been mandated to mainstream gender in its response to crises. One element of this mandate is a repeated call for sex-disaggregated data to help guide the response. This study examines available analyses, assessments and academic literature to ...

  3. Regulatory elements in the promoter region of the rat gene encoding the acyl-CoA-binding protein

    DEFF Research Database (Denmark)

    Elholm, M; Bjerking, G; Knudsen, J

    1996-01-01

    for the ACBP DR-1 element. Addition of peroxisome proliferators (PP) to H4IIEC3 rat hepatoma cells led to an increase in the ACBP mRNA level, indicating that the DR-1 element could be a functional peroxisome proliferator responsive element (PPRE). Analysis of the ACBP promoter by transient transfection showed...

  4. Efficient Analysis of Structures with Rotatable Elements Using Model Order Reduction

    Directory of Open Access Journals (Sweden)

    G. Fotyga

    2016-04-01

    Full Text Available This paper presents a novel full-wave technique which allows for a fast 3D finite element analysis of waveguide structures containing rotatable tuning elements of arbitrary shapes. Rotation of these elements changes the resonant frequencies of the structure, which can be used in the tuning process to obtain the S-characteristics desired for the device. For fast commutations of the response as the tuning elements are rotated, the 3D finite element method is supported by multilevel model-order reduction, orthogonal projection at the boundaries of macromodels and the operation called macromodels cloning. All the time-consuming steps are performed only once in the preparatory stage. In the tuning stage, only small parts of the domain are updated, by means of a special meshing technique. In effect, the tuning process is performed extremely rapidly. The results of the numerical experiments confirm the efficiency and validity of the proposed method.

  5. Finite element model updating of concrete structures based on imprecise probability

    Science.gov (United States)

    Biswal, S.; Ramaswamy, A.

    2017-09-01

    Imprecise probability based methods are developed in this study for the parameter estimation, in finite element model updating for concrete structures, when the measurements are imprecisely defined. Bayesian analysis using Metropolis Hastings algorithm for parameter estimation is generalized to incorporate the imprecision present in the prior distribution, in the likelihood function, and in the measured responses. Three different cases are considered (i) imprecision is present in the prior distribution and in the measurements only, (ii) imprecision is present in the parameters of the finite element model and in the measurement only, and (iii) imprecision is present in the prior distribution, in the parameters of the finite element model, and in the measurements. Procedures are also developed for integrating the imprecision in the parameters of the finite element model, in the finite element software Abaqus. The proposed methods are then verified against reinforced concrete beams and prestressed concrete beams tested in our laboratory as part of this study.

  6. ATTRIBUTION OF CONDUCT TO A STATE-THE SUBJECTIVE ELEMENT OF THE INTERNATIONAL RESPONSIBILITY OT THE STATE FOR INTERNATIONALLY WRONGFUL ACTS

    Directory of Open Access Journals (Sweden)

    FELICIA MAXIM

    2012-05-01

    Full Text Available In order to establish responsibility of states for internationally wrongful act, two elements are identified. First, the conduct in question must be attributable to the State under international law. Secondly, for responsibility to attach to the act of the State, the conduct must constitute a breach of an international legal obligation in force for that State at that time. For particular conduct to be characterized as an internationally wrongful act, it must first be attributable to the State. The State is a real organized entity, a legal person with full authority to act under international law. But to recognize this is not to deny the elementary fact that the State cannot act of itself. States can act only by and through their agents and representatives. In determining what constitutes an organ of a State for the purposes of responsibility, the internal law and practice of each State are of prime importance. The structure of the State and the functions of its organs are not, in general, governed by international law. It is a matter for each State to decide how its administration is to be structured and which functions are to be assumed by government. But while the State remains free to determine its internal structure and functions through its own law and practice, international law has a distinct role. Conduct is thereby attributed to the State as a subject of international law and not as a subject of internal law. The State as a subject of international law is held responsible for the conduct of all the organs, instrumentalities and officials which form part of its organization and act in that capacity, whether or not they have separate legal personality under its internal law.

  7. A fluid-solid finite element method for the analysis of reactor safety problems

    International Nuclear Information System (INIS)

    Mitra, Santanu; Kumar, Ashutosh; Sinhamahapatra, K.P.

    2006-01-01

    The work presented herein can broadly be categorized as a fluid-structure interaction problem. The response of a circular cylindrical structure subjected to cross flow is examined using the finite element method for both the liquid and the structure domains. The cylindrical tube is mounted elastically at the ends and is free to move under the action of the unsteady flow-induced forces. The fluid is considered to be acoustic compressible and viscous. A Galerkin finite element method implemented on a triangular mesh is used to solve the time-dependent Navier-Stokes equations. The cylinder motion is modeled using a five-degrees of freedom generalized shell element structural dynamics model. The numerical simulations of the response of the calandria tubes/pressure tubes, adjustor rod and shut-off rod of a nuclear reactor are presented. A few typical results are presented to assess the accuracy and applicability of the developed modules

  8. Effects of trace elements and mono- and dithiols on mitochondrial monoamine oxidase of rats

    Energy Technology Data Exchange (ETDEWEB)

    Revis, N.; Horton, C.

    1978-01-01

    The effects of several trace elements on mitochondrial monoamine oxidase (MAO) were studied. Elements were studied at a concentration of 1 mM; only mercury, cadmium, and copper were significantly effective in reducing the activity of this enzyme. Of several thiols tested, only dithiothreitol could reverse the inhibition of MAO by these elements. Evidence is also presented in this report to show that cysteine, homocysteine, and reduced glutathione inhibit this MAO, whereas dithiothreitol or dithioerythritol evoke stimulatory responses.

  9. Macro-Elements and Trace Elements in Cereal Grains Cultivated in Latvia

    Directory of Open Access Journals (Sweden)

    Jākobsone Ida

    2015-09-01

    Full Text Available Cereal-based foods have great importance in the compensation of micro- and trace element deficiency, because 50% of the foods produced worldwide are made up of cereal grains. The aim of the research was to determine the concentration of macro-elements and trace elements in different cereals cultivated in Latvia. Various cereals were used in the research: rye (n = 45, barley (n = 54, spring wheat (n = 27, winter wheat (n = 53, triticale (n = 45 and oats (n = 42. Thirteen macro- and trace elements (Cd, Pb, Ni, Cr, Al, Cu, K, Na, Mn, Fe, Zn, Mg, Ca were determined in cereal grain samples (n = 266. Macro-elements and trace elements varied significantly (p < 0.01 or p < 0.001. The highest concentrations of macro- and trace elements were found in oats and the lowest in rye. The obtained data will expand the opportunity for food and nutrition scientists to evaluate content of the examined elements in grain products, and dietary consumption (bioavailability of the examined macro-elements and trace elements.

  10. H-2RIIBP, a member of the nuclear hormone receptor superfamily that binds to both the regulatory element of major histocompatibility class I genes and the estrogen response element.

    Science.gov (United States)

    Hamada, K; Gleason, S L; Levi, B Z; Hirschfeld, S; Appella, E; Ozato, K

    1989-11-01

    Transcription of major histocompatibility complex (MHC) class I genes is regulated by the conserved MHC class I regulatory element (CRE). The CRE has two factor-binding sites, region I and region II, both of which elicit enhancer function. By screening a mouse lambda gt 11 library with the CRE as a probe, we isolated a cDNA clone that encodes a protein capable of binding to region II of the CRE. This protein, H-2RIIBP (H-2 region II binding protein), bound to the native region II sequence, but not to other MHC cis-acting sequences or to mutant region II sequences, similar to the naturally occurring region II factor in mouse cells. The deduced amino acid sequence of H-2RIIBP revealed two putative zinc fingers homologous to the DNA-binding domain of steroid/thyroid hormone receptors. Although sequence similarity in other regions was minimal, H-2RIIBP has apparent modular domains characteristic of the nuclear hormone receptors. Further analyses showed that both H-2RIIBP and the natural region II factor bind to the estrogen response element (ERE) of the vitellogenin A2 gene. The ERE is composed of a palindrome, and half of this palindrome resembles the region II binding site of the MHC CRE. These results indicate that H-2RIIBP (i) is a member of the superfamily of nuclear hormone receptors and (ii) may regulate not only MHC class I genes but also genes containing the ERE and related sequences. Sequences homologous to the H-2RIIBP gene are widely conserved in the animal kingdom. H-2RIIBP mRNA is expressed in many mouse tissues, in agreement with the distribution of the natural region II factor.

  11. Finite element model updating in structural dynamics using design sensitivity and optimisation

    OpenAIRE

    Calvi, Adriano

    1998-01-01

    Model updating is an important issue in engineering. In fact a well-correlated model provides for accurate evaluation of the structure loads and responses. The main objectives of the study were to exploit available optimisation programs to create an error localisation and updating procedure of nite element models that minimises the "error" between experimental and analytical modal data, addressing in particular the updating of large scale nite element models with se...

  12. Amino Acid Change in the Carbohydrate Response Element Binding Protein is associated with lower triglycerides and myocardial infarction incidence depending on level of adherence to the Mediterranean diet in the PREDIMED trial

    Science.gov (United States)

    A variant (rs3812316, C771G, and Gln241His) in the MLXIPL (Max-like protein X interacting protein-like) gene encoding the carbohydrate response element binding protein has been associated with lower triglycerides. However, its association with cardiovascular diseases and gene-diet interactions modul...

  13. Phase reduction and synchronization of a network of coupled dynamical elements exhibiting collective oscillations

    Science.gov (United States)

    Nakao, Hiroya; Yasui, Sho; Ota, Masashi; Arai, Kensuke; Kawamura, Yoji

    2018-04-01

    A general phase reduction method for a network of coupled dynamical elements exhibiting collective oscillations, which is applicable to arbitrary networks of heterogeneous dynamical elements, is developed. A set of coupled adjoint equations for phase sensitivity functions, which characterize the phase response of the collective oscillation to small perturbations applied to individual elements, is derived. Using the phase sensitivity functions, collective oscillation of the network under weak perturbation can be described approximately by a one-dimensional phase equation. As an example, mutual synchronization between a pair of collectively oscillating networks of excitable and oscillatory FitzHugh-Nagumo elements with random coupling is studied.

  14. Towards improved modeling of steel-concrete composite wall elements

    International Nuclear Information System (INIS)

    Vecchio, Frank J.; McQuade, Ian

    2011-01-01

    Highlights: → Improved analysis of double skinned steel concrete composite containment walls. → Smeared rotating crack concept applied in formulation of new analytical model. → Model implemented into finite element program; numerically stable and robust. → Models behavior of shear-critical elements with greater ease and improved accuracy. → Accurate assessments of strength, deformation and failure mode of test specimens. - Abstract: The Disturbed Stress Field Model, a smeared rotating crack model for reinforced concrete based on the Modified Compression Field Theory, is adapted to the analysis of double-skin steel-concrete wall elements. The computational model is then incorporated into a two-dimensional nonlinear finite element analysis algorithm. Verification studies are undertaken by modeling various test specimens, including panel elements subject to uniaxial compression, panel elements subjected to in-plane shear, and wall specimens subjected to reversed cyclic lateral displacements. In all cases, the analysis model is found to provide accurate calculations of structural load capacities, pre- and post-peak displacement responses, post-peak ductility, chronology of damage, and ultimate failure mode. Minor deficiencies are found in regards to the accurate portrayal of faceplate buckling and the effects of interfacial slip between the faceplates and the concrete. Other aspects of the modeling procedure that are in need of further research and development are also identified and discussed.

  15. Theoretical models to predict the transient heat transfer performance of HIFAR fuel elements under non-forced convective conditions

    International Nuclear Information System (INIS)

    Green, W.J.

    1987-04-01

    Simple theoretical models have been developed which are suitable for predicting the thermal responses of irradiated research fuel elements of markedly different geometries when they are subjected to loss-of-coolant accident conditions. These models have been used to calculate temperature responses corresponding to various non-forced convective conditions. Comparisons between experimentally observed temperatures and calculated values have shown that a suitable value for surface thermal emissivity is 0.35; modelling of the fuel element beyond the region of the fuel plate needs to be included since these areas account for approximately 25 per cent of the thermal power dissipated; general agreement between calculated and experimental temperatures for both transient and steady-state conditions is good - the maximum discrepancy between calculated and experimental temperatures for a HIFAR Mark IV/V fuel element is ∼ 70 deg C, and for an Oak Ridge Reactor (ORR) box-type fuel element ∼ 30 deg C; and axial power distribution does not significantly affect thermal responses for the conditions investigated. Overall, the comparisons have shown that the models evolved can reproduce experimental data to a level of accuracy that provides confidence in the modelling technique and the postulated heat dissipation mechanisms, and that these models can be used to predict thermal responses of fuel elements in accident conditions that are not easily investigated experimentally

  16. cis- and trans-acting elements of the estrogen-regulated vitellogenin gene B1 of Xenopus laevis.

    Science.gov (United States)

    Wahli, W; Martinez, E; Corthésy, B; Cardinaux, J R

    1989-01-01

    Vitellogenin genes are expressed under strict estrogen control in the liver of female oviparous vertebrates. Gene transfer experiments using estrogen-responsive cells have shown that the 13 bp perfect palindromic element GGTCACTGTGACC found upstream of the Xenopus laevis vitellogenin gene A2 promoter mediates hormonal stimulation and thus, was called the estrogen-responsive element (ERE). In the Xenopus vitellogenin genes B1 and B2 there are two closely adjacent EREs with one or more base substitutions when compared to the consensus ERE GGTCANNNTGACC. On their own, these degenerated elements have only a low or no regulatory capacity at all but act together synergistically to form an estrogen-responsive unit (ERU) with the same strength as the perfect palindromic 13 bp element. Analysis of estrogen receptor binding to the gene B1 ERU revealed a cooperative interaction of receptor dimers to the two adjacent imperfect EREs which most likely explains the synergistic stimulation observed in vivo. Furthermore, a promoter activator element located between positions --113 and --42 of the gene B1 and functional in the human MCF-7 and the Xenopus B3.2 cells has been identified and shown to be involved in the high level of induced transcription activity when the ERE is placed at a distance from the promoter. Finally, a hormone-controlled in vitro transcription system derived from Xenopus liver nuclear extracts was exploited to characterize two additional novel cis-acting elements within the vitellogenin gene B1 promoter. One of them, a negative regulatory element (NRE), is responsible for repression of promoter activity in the absence of hormone. The second is related to the NF-I binding site and is required, together with the ERE, to mediate hormonal induction. Moreover, we detected three trans-acting activities in Xenopus liver nuclear extracts that interact with these regions and demonstrated that they participate in the regulation of the expression of the vitellogenin

  17. Development of polygon elements based on the scaled boundary finite element method

    International Nuclear Information System (INIS)

    Chiong, Irene; Song Chongmin

    2010-01-01

    We aim to extend the scaled boundary finite element method to construct conforming polygon elements. The development of the polygonal finite element is highly anticipated in computational mechanics as greater flexibility and accuracy can be achieved using these elements. The scaled boundary polygonal finite element will enable new developments in mesh generation, better accuracy from a higher order approximation and better transition elements in finite element meshes. Polygon elements of arbitrary number of edges and order have been developed successfully. The edges of an element are discretised with line elements. The displacement solution of the scaled boundary finite element method is used in the development of shape functions. They are shown to be smooth and continuous within the element, and satisfy compatibility and completeness requirements. Furthermore, eigenvalue decomposition has been used to depict element modes and outcomes indicate the ability of the scaled boundary polygonal element to express rigid body and constant strain modes. Numerical tests are presented; the patch test is passed and constant strain modes verified. Accuracy and convergence of the method are also presented and the performance of the scaled boundary polygonal finite element is verified on Cook's swept panel problem. Results show that the scaled boundary polygonal finite element method outperforms a traditional mesh and accuracy and convergence are achieved from fewer nodes. The proposed method is also shown to be truly flexible, and applies to arbitrary n-gons formed of irregular and non-convex polygons.

  18. P53 family members modulate the expression of PRODH, but not PRODH2, via intronic p53 response elements.

    Directory of Open Access Journals (Sweden)

    Ivan Raimondi

    Full Text Available The tumor suppressor p53 was previously shown to markedly up-regulate the expression of the PRODH gene, encoding the proline dehydrogenase (PRODH enzyme, which catalyzes the first step in proline degradation. Also PRODH2, which degrades 4-hydroxy-L-proline, a product of protein (e.g. collagen catabolism, was recently described as a p53 target. Here, we confirmed p53-dependent induction of endogenous PRODH in response to genotoxic damage in cell lines of different histological origin. We established that over-expression of TAp73β or TAp63β is sufficient to induce PRODH expression in p53-null cells and that PRODH expression parallels the modulation of endogenous p73 by genotoxic drugs in several cell lines. The p53, p63, and p73-dependent transcriptional activation was linked to specific intronic response elements (REs, among those predicted by bioinformatics tools and experimentally validated by a yeast-based transactivation assay. p53 occupancy measurements were validated in HCT116 and MCF7 human cell lines. Conversely, PRODH2 was not responsive to p63 nor p73 and, at best, could be considered a weak p53 target. In fact, minimal levels of PRODH2 transcript induction by genotoxic stress was observed exclusively in one of four p53 wild-type cell lines tested. Consistently, all predicted p53 REs in PRODH2 were poor matches to the p53 RE consensus and showed very weak responsiveness, only to p53, in the functional assay. Taken together, our results highlight that PRODH, but not PRODH2, expression is under the control of p53 family members, specifically p53 and p73. This supports a deeper link between proteins of the p53-family and metabolic pathways, as PRODH modulates the balance of proline and glutamate levels and those of their derivative alpha-keto-glutarate (α-KG under normal and pathological (tumor conditions.

  19. Dynamic response of a multielement HTGR core

    International Nuclear Information System (INIS)

    Reich, M.; Bezler, P.; Koplik, B.; Curreri, J.; Goradia, H.; Lasker, L.

    1977-01-01

    One of the primary factors in determining the structural integrity and consequently the safety of a High Temperature Gas-Cooled Reactor (HTGR) is the dynamic response of the core when subjected to a seismic excitation. The HTGR core under consideration consists of several thousands of hexagonal elements arranged in vertical stacks containing about eight elements per stack. There are clearance gaps between adjacent elements, which can change substantially due to radiation effects produced during their active lifetime. Surrounding the outer periphery of the core are reflector blocks and restraining spring-pack arrangements which bear against the reactor vessel structure (PCRV). Earthquake input motions to this type of core arrangement will result in multiple impacts between adjacent elements as well as between the reflector blocks and the restraining spring packs. The highly complex nonlinear response associated with the multiple collisions across the clearance gaps and with the spring packs is the subject matter of this paper. Of particular importance is the ability to analyze a complex nonlinear system with gaps by employing a model with a reduced number of masses. This is necessary in order to obtain solutions in a time-frame and at a cost which is not too expensive. In addition the effect of variations in total clearance as well as the initial distribution of clearances between adjacent elements is of primary concern. Both of these aspects of the problem are treated in the present analysis. Finally, by constraining the motion of the reflector blocks, a more realistic description of the dynamic response of the multi-element HTGR core is obtained

  20. Responsibility and Reliability | Williams | Philosophical Papers

    African Journals Online (AJOL)

    'Responsibilist\\' approaches to epistemology link knowledge and justification with epistemically responsible belief management, where responsible management is understood to involve an essential element of guidance by recognized epistemic norms. By contrast, reliabilist approaches stress the de facto reliability of ...

  1. Gene targeting by the vitamin D response element binding protein reveals a role for vitamin D in osteoblast mTOR signaling.

    Science.gov (United States)

    Lisse, Thomas S; Liu, Ting; Irmler, Martin; Beckers, Johannes; Chen, Hong; Adams, John S; Hewison, Martin

    2011-03-01

    Transcriptional regulation by hormonal 1,25-dihydroxyvitamin D(3) [1,25(OH)(2)D(3)] involves occupancy of vitamin D response elements (VDREs) by the VDRE binding protein (VDRE-BP) or 1,25(OH)(2)D(3)-bound vitamin D receptor (VDR). This relationship is disrupted by elevated VDRE-BP, causing a form of hereditary vitamin D-resistant rickets (HVDRR). DNA array analysis showed that of 114 genes regulated by 1,25(OH)(2)D(3) in control cells, almost all (113) were rendered insensitive to the hormone in VDRE-BP-overexpressing HVDRR cells. Among these was the gene for DNA-damage-inducible transcript 4 (DDIT4), an inhibitor of mammalian target of rapamycin (mTOR) signaling. Chromatin immunoprecipitation PCR using 1,25(OH)(2)D(3)-treated osteoblasts confirmed that VDR and VDRE-BP compete for binding to the DDIT4 gene promoter. Expression of DDIT4 mRNA in these cells was induced (1.6-6 fold) by 1,25(OH)(2)D(3) (10-100 nM), and Western blot and flow cytometry analysis showed that this response involved suppression of phosphorylated S6K1(T389) (a downstream target of mTOR) similar to rapamycin treatment. siRNA knockdown of DDIT4 completely abrogated antiproliferative responses to 1,25(OH)(2)D(3), whereas overexpression of VDRE-BP exerted a dominant-negative effect on transcription of 1,25(OH)(2)D(3)-target genes. DDIT4, an inhibitor of mTOR signaling, is a direct target for 1,25(OH)(2)D(3) and VDRE-BP, and functions to suppress cell proliferation in response to vitamin D.

  2. Experimental Study of Elements Promoting Mixing in Fuel Elements

    International Nuclear Information System (INIS)

    Silin, Nicolas; Juanico, Luis; Delmastro, Dario

    2003-01-01

    In the present work a thermal tracing technique is used to measure the increase of the mixing between subchannels in the presence of different mixing elements.As representative elements a spacer, a spacer with mixing vanes and turbulence promoter buttons were considered.The performance of these elements was evaluated by studying the behavior of a thermal trace in each case.Also the pressure drop for each case is presented.The results present a qualitative and quantitative guide for the application of each one of these appendages in future nuclear elements

  3. Implementation of a Unified Constitutive Model into the ABAQUS Finite Element Package

    National Research Council Canada - National Science Library

    Wescott, R

    1999-01-01

    Unified constitutive models have previously been developed at AMRL and implemented into the PAFEC and ABAQUS Finite Element packages to predict the stress-strain response of structures that undergo...

  4. A novel microbial fuel cell sensor with biocathode sensing element.

    Science.gov (United States)

    Jiang, Yong; Liang, Peng; Liu, Panpan; Wang, Donglin; Miao, Bo; Huang, Xia

    2017-08-15

    The traditional microbial fuel cell (MFC) sensor with bioanode as sensing element delivers limited sensitivity to toxicity monitoring, restricted application to only anaerobic and organic rich water body, and increased potential fault warning to the combined shock of organic matter/toxicity. In this study, the biocathode for oxygen reduction reaction was employed for the first time as the sensing element in MFC sensor for toxicity monitoring. The results shown that the sensitivity of MFC sensor with biocathode sensing element (7.4±2.0 to 67.5±4.0mA% -1 cm -2 ) was much greater than that showed by bioanode sensing element (3.4±1.5 to 5.5±0.7mA% -1 cm -2 ). The biocathode sensing element achieved the lowest detection limit reported to date using MFC sensor for formaldehyde detection (0.0005%), while the bioanode was more applicable for higher concentration (>0.0025%). There was a quicker response of biocathode sensing element with the increase of conductivity and dissolved oxygen (DO). The biocathode sensing element made the MFC sensor directly applied to clean water body monitoring, e.g., drinking water and reclaimed water, without the amending of background organic matter, and it also decreased the warning failure when challenged by a combined shock of organic matter/toxicity. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Elemental misinterpretation in automated analysis of LIBS spectra.

    Science.gov (United States)

    Hübert, Waldemar; Ankerhold, Georg

    2011-07-01

    In this work, the Stark effect is shown to be mainly responsible for wrong elemental allocation by automated laser-induced breakdown spectroscopy (LIBS) software solutions. Due to broadening and shift of an elemental emission line affected by the Stark effect, its measured spectral position might interfere with the line position of several other elements. The micro-plasma is generated by focusing a frequency-doubled 200 mJ pulsed Nd/YAG laser on an aluminum target and furthermore on a brass sample in air at atmospheric pressure. After laser pulse excitation, we have measured the temporal evolution of the Al(II) ion line at 281.6 nm (4s(1)S-3p(1)P) during the decay of the laser-induced plasma. Depending on laser pulse power, the center of the measured line is red-shifted by 130 pm (490 GHz) with respect to the exact line position. In this case, the well-known spectral line positions of two moderate and strong lines of other elements coincide with the actual shifted position of the Al(II) line. Consequently, a time-resolving software analysis can lead to an elemental misinterpretation. To avoid a wrong interpretation of LIBS spectra in automated analysis software for a given LIBS system, we recommend using larger gate delays incorporating Stark broadening parameters and using a range of tolerance, which is non-symmetric around the measured line center. These suggestions may help to improve time-resolving LIBS software promising a smaller probability of wrong elemental identification and making LIBS more attractive for industrial applications.

  6. Elements beyond uranium

    International Nuclear Information System (INIS)

    Seaborg, G.T.; Loveland, W.D.

    1990-01-01

    This book is the 12th volume in a series on transuranium elements. Varied techniques for production of these elements, the methods used in the identification, and the exquisitely refined microchemical techniques required to deal wth samples sometimes involving only a few atoms are described in detail. The chapter on synthesis of the new elements is liberally laced with reminiscences of the proud progenitors as well as the criteria for the discovery of a new chemical element. The authors lament that the superheavy elements (elements in the region of atomic number 114) still elude detection even though their creation should be possible, and some, at least, should survive long enough to be detected. One chapter in the book is devoted to practical applictions of uranium, and the transuranic elements

  7. Response and binding elements for ligand-dependent positive transcription factors integrate positive and negative regulation of gene expression

    International Nuclear Information System (INIS)

    Rosenfeld, M.G.; Glass, C.K.; Adler, S.; Crenshaw, E.B. III; He, X.; Lira, S.A.; Elsholtz, H.P.; Mangalam, H.J.; Holloway, J.M.; Nelson, C.; Albert, V.R.; Ingraham, H.A.

    1988-01-01

    Accurate, regulated initiation of mRNA transcription by RNA polymerase II is dependent on the actions of a variety of positive and negative trans-acting factors that bind cis-acting promoter and enhancer elements. These transcription factors may exert their actions in a tissue-specific manner or function under control of plasma membrane or intracellular ligand-dependent receptors. A major goal in the authors' laboratory has been to identify the molecular mechanisms responsible for the serial activation of hormone-encoding genes in the pituitary during development and the positive and negative regulation of their transcription. The anterior pituitary gland contains phenotypically distinct cell types, each of which expresses unique trophic hormones: adrenocorticotropic hormone, thyroid-stimulating hormone, prolactin, growth hormone, and follicle-stimulating hormone/luteinizing hormone. The structurally related prolactin and growth hormone genes are expressed in lactotrophs and somatotrophs, respectively, with their expression virtually limited to the pituitary gland. The reported transient coexpression of these two structurally related neuroendocrine genes raises the possibility that the prolactin and growth hormone genes are developmentally controlled by a common factor(s)

  8. Finite Element Analysis of Circular Plate using SolidWorks

    International Nuclear Information System (INIS)

    Kang, Yeo Jin; Jhung, Myung Jo

    2011-01-01

    Circular plates are used extensively in mechanical engineering for nuclear reactor internal components. The examples in the reactor vessel internals are upper guide structure support plate, fuel alignment plate, lower support plate etc. To verify the structural integrity of these plates, the finite element analyses are performed, which require the development of the finite element model. Sometimes it is very costly and time consuming to make the model especially for the beginners who start their engineering job for the structural analysis, necessitating a simple method to develop the finite element model for the pursuing structural analysis. Therefore in this study, the input decks are generated for the finite element analysis of a circular plate as shown in Fig. 1, which can be used for the structural analysis such as modal analysis, response spectrum analysis, stress analysis, etc using the commercial program Solid Works. The example problems are solved and the results are included for analysts to perform easily the finite element analysis of the mechanical plate components due to various loadings. The various results presented in this study would be helpful not only for the benchmark calculations and results comparisons but also as a part of the knowledge management for the future generation of young designers, scientists and computer analysts

  9. The transcriptional regulatory network in the drought response and its crosstalk in abiotic stress responses including drought, cold and heat

    Directory of Open Access Journals (Sweden)

    Kazuo eNakashima

    2014-05-01

    Full Text Available Drought negatively impacts plant growth and the productivity of crops around the world. Understanding the molecular mechanisms in the drought response is important for improvement of drought tolerance using molecular techniques. In plants, abscisic acid (ABA is accumulated under osmotic stress conditions caused by drought, and has a key role in stress responses and tolerance. Comprehensive molecular analyses have shown that ABA regulates the expression of many genes under osmotic stress conditions, and the ABA-responsive element (ABRE is the major cis-element for ABA-responsive gene expression. Transcription factors (TFs are master regulators of gene expression. ABRE-binding protein (AREB and ABRE-binding factor (ABF TFs control gene expression in an ABA-dependent manner. SNF1-related protein kinases 2, group A 2C-type protein phosphatases, and ABA receptors were shown to control the ABA signaling pathway. ABA-independent signaling pathways such as dehydration-responsive element-binding protein (DREB TFs and NAC TFs are also involved in stress responses including drought, heat and cold. Recent studies have suggested that there are interactions between the major ABA signaling pathway and other signaling factors in stress responses. The important roles of these transcription factors in crosstalk among abiotic stress responses will be discussed. Control of ABA or stress signaling factor expression can improve tolerance to environmental stresses. Recent studies using crops have shown that stress-specific overexpression of TFs improves drought tolerance and grain yield compared with controls in the field.

  10. The transcriptional regulatory network in the drought response and its crosstalk in abiotic stress responses including drought, cold, and heat.

    Science.gov (United States)

    Nakashima, Kazuo; Yamaguchi-Shinozaki, Kazuko; Shinozaki, Kazuo

    2014-01-01

    Drought negatively impacts plant growth and the productivity of crops around the world. Understanding the molecular mechanisms in the drought response is important for improvement of drought tolerance using molecular techniques. In plants, abscisic acid (ABA) is accumulated under osmotic stress conditions caused by drought, and has a key role in stress responses and tolerance. Comprehensive molecular analyses have shown that ABA regulates the expression of many genes under osmotic stress conditions, and the ABA-responsive element (ABRE) is the major cis-element for ABA-responsive gene expression. Transcription factors (TFs) are master regulators of gene expression. ABRE-binding protein and ABRE-binding factor TFs control gene expression in an ABA-dependent manner. SNF1-related protein kinases 2, group A 2C-type protein phosphatases, and ABA receptors were shown to control the ABA signaling pathway. ABA-independent signaling pathways such as dehydration-responsive element-binding protein TFs and NAC TFs are also involved in stress responses including drought, heat, and cold. Recent studies have suggested that there are interactions between the major ABA signaling pathway and other signaling factors in stress responses. The important roles of these TFs in crosstalk among abiotic stress responses will be discussed. Control of ABA or stress signaling factor expression can improve tolerance to environmental stresses. Recent studies using crops have shown that stress-specific overexpression of TFs improves drought tolerance and grain yield compared with controls in the field.

  11. Two-Dimensional Nonlinear Finite Element Analysis of CMC Microstructures

    Science.gov (United States)

    Mital, Subodh K.; Goldberg, Robert K.; Bonacuse, Peter J.

    2012-01-01

    A research program has been developed to quantify the effects of the microstructure of a woven ceramic matrix composite and its variability on the effective properties and response of the material. In order to characterize and quantify the variations in the microstructure of a five harness satin weave, chemical vapor infiltrated (CVI) SiC/SiC composite material, specimens were serially sectioned and polished to capture images that detailed the fiber tows, matrix, and porosity. Open source quantitative image analysis tools were then used to isolate the constituents, from which two dimensional finite element models were generated which approximated the actual specimen section geometry. A simplified elastic-plastic model, wherein all stress above yield is redistributed to lower stress regions, is used to approximate the progressive damage behavior for each of the composite constituents. Finite element analyses under in-plane tensile loading were performed to examine how the variability in the local microstructure affected the macroscopic stress-strain response of the material as well as the local initiation and progression of damage. The macroscopic stress-strain response appeared to be minimally affected by the variation in local microstructure, but the locations where damage initiated and propagated appeared to be linked to specific aspects of the local microstructure.

  12. Hydraulic and hydrodynamic tests for design evaluation of research reactors fuel elements

    International Nuclear Information System (INIS)

    Kulichevsky, R.; Martin Ghiselli, A.; Fiori, J.; Yedros, P.

    2002-01-01

    During the design steps of research reactors fuel elements some tests are usually necessary to verify its design, i.e.: its hydraulic characteristics, dynamical response and structural integrity. The hydraulic tests are developed in order to know the pressure drops characteristics of different parts or elements of the prototype and of the whole fuel element. Also, some tests are carried out to obtain the velocity distribution of the coolant water across different prototype's sections. The hydrodynamic tests scopes are the assessment of the dynamical characteristics of the fuel elements and their components and its dynamical response considering the forces generated by the coolant flowing water at different flow rate conditions. Endurance tests are also necessary to qualify the structural design of the FE prototypes and their corresponding clamp tools, verifying the whole system structural integrity and wear processes influences. To carry out these tests a special test facility is needed to obtain a proper representation of the hydraulic and geometric boundary conditions of the fuel element. In some cases changes on the fuel element prototype or dummy are necessary to assure that the data results are representative of the case under study. Different kind of sensors are mounted on the test section and also on the fuel element itself when necessary. Some examples of the instrumentation used are strain gauges, displacement transducers, absolute and differential pressure transducers, pitot tubes, etc. The obtained data are, for example, plates' vibration amplitudes and frequencies, whole bundle displacement characterization, pressure drops and flow velocity measurements. The Experimental Low Pressure Loop is a hydraulic loop located at CNEA's Constituyentes Atomic Center and is the test facility where different kind of tests are performed in order to support and evaluate the design of research reactor fuel elements. A brief description of the facility, and examples of

  13. Intraoperative tumor detection: Relative performance of single-element, dual-element, and imaging probes with various collimators

    International Nuclear Information System (INIS)

    Hartsough, N.E.; Barrett, H.H.; Barber, H.B.; Woolfenden, J.M.

    1995-01-01

    Accurate tumor staging depends on finding all tumor sites, and curative surgery requires the removal of all cancerous tissue from those sites. One technique for locating tumors is to inject patients before surgery with a radiotracer that is preferentially taken up by cancerous tissue. Then, an intraoperative gamma-sensitive probe is used to locate the tumors. Small (< 1-cm diameter) tumors, often undetectable by external imaging and by the standard surgical inspection with sight and touch, can be found with probes. Simple calculations and measurements with radioactive tumor models show that small tumors should be detected by single-element probes, but often such probes fail to detect these small tumors in practice. This discrepancy is often caused by the use of a uniform background to predict probe performance. Real backgrounds are nonuniform and can decrease probe performance dramatically. Dual-element, coincidence, or imaging probes may solve the background problem. The authors devised a method to predict probe performance in a realistic background which includes variations in normal organ uptakes. They predict the relative performance of both existing probes and those in the design stage so that optimal detector and collimator configurations can be determined. The procedure includes a Monte-Carlo-calculated point-response function, a numerical torso phantom, and measured biodistribution of a monoclonal antibody. The Hotelling Trace Value, a measure of tumor-detection performance, is computed from the probe responses in simulated studies

  14. Automotive IC reliability: Elements of the battle towards zero defects

    NARCIS (Netherlands)

    Kuper, F.G.

    2008-01-01

    The battle towards zero defects consists of fast response to PPM signals, prevention of incidents and continuous improvement. In this paper elements of all three branches are treated. A PPM analysis tool called quality crawl charts is introduced that enables prediction of customer complaint levels

  15. A petunia ethylene-responsive element binding factor, PhERF2, plays an important role in antiviral RNA silencing.

    Science.gov (United States)

    Sun, Daoyang; Nandety, Raja Sekhar; Zhang, Yanlong; Reid, Michael S; Niu, Lixin; Jiang, Cai-Zhong

    2016-05-01

    Virus-induced RNA silencing is involved in plant antiviral defense and requires key enzyme components, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonaute proteins (AGOs). However, the transcriptional regulation of these critical components is largely unknown. In petunia (Petunia hybrida), an ethylene-responsive element binding factor, PhERF2, is induced by Tobacco rattle virus (TRV) infection. Inclusion of a PhERF2 fragment in a TRV silencing construct containing reporter fragments of phytoene desaturase (PDS) or chalcone synthase (CHS) substantially impaired silencing efficiency of both the PDS and CHS reporters. Silencing was also impaired in PhERF2- RNAi lines, where TRV-PhPDS infection did not show the expected silencing phenotype (photobleaching). In contrast, photobleaching in response to infiltration with the TRV-PhPDS construct was enhanced in plants overexpressing PhERF2 Transcript abundance of the RNA silencing-related genes RDR2, RDR6, DCL2, and AGO2 was lower in PhERF2-silenced plants but higher in PhERF2-overexpressing plants. Moreover, PhERF2-silenced lines showed higher susceptibility to Cucumber mosaic virus (CMV) than wild-type (WT) plants, while plants overexpressing PhERF2 exhibited increased resistance. Interestingly, growth and development of PhERF2-RNAi lines were substantially slower, whereas the overexpressing lines were more vigorous than the controls. Taken together, our results indicate that PhERF2 functions as a positive regulator in antiviral RNA silencing. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  16. Studies of biaxial mechanical properties and nonlinear finite element modeling of skin.

    Science.gov (United States)

    Shang, Xituan; Yen, Michael R T; Gaber, M Waleed

    2010-06-01

    The objective of this research is to conduct mechanical property studies of skin from two individual but potentially connected aspects. One is to determine the mechanical properties of the skin experimentally by biaxial tests, and the other is to use the finite element method to model the skin properties. Dynamic biaxial tests were performed on 16 pieces of abdominal skin specimen from rats. Typical biaxial stress-strain responses show that skin possesses anisotropy, nonlinearity and hysteresis. To describe the stress-strain relationship in forms of strain energy function, the material constants of each specimen were obtained and the results show a high correlation between theory and experiments. Based on the experimental results, a finite element model of skin was built to model the skin's special properties including anisotropy and nonlinearity. This model was based on Arruda and Boyce's eight-chain model and Bischoff et al.'s finite element model of skin. The simulation results show that the isotropic, nonlinear eight-chain model could predict the skin's anisotropic and nonlinear responses to biaxial loading by the presence of an anisotropic prestress state.

  17. A self-adaptive finite element approach for simulation of mixed-mode delamination using cohesive zone models

    NARCIS (Netherlands)

    Samimi, M.; Dommelen, van J.A.W.; Geers, M.G.D.

    2011-01-01

    Oscillations observed in the load–displacement response of brittle interfaces modeled by cohesive zone elements in a quasi-static finite element framework are artifacts of the discretization. The typical limit points in this oscillatory path can be traced by application of path-following techniques,

  18. Identification of hookworm DAF-16/FOXO response elements and direct gene targets.

    Directory of Open Access Journals (Sweden)

    Xin Gao

    2010-08-01

    Full Text Available The infective stage of the parasitic nematode hookworm is developmentally arrested in the environment and needs to infect a specific host to complete its life cycle. The canine hookworm (Ancylostoma caninum is an excellent model for investigating human hookworm infections. The transcription factor of A. caninum, Ac-DAF-16, which has a characteristic fork head or "winged helix" DNA binding domain (DBD, has been implicated in the resumption of hookworm development in the host. However, the precise roles of Ac-DAF-16 in hookworm parasitism and its downstream targets are unknown. In the present study, we combined molecular techniques and bioinformatics to identify a group of Ac-DAF-16 binding sites and target genes.The DNA binding domain of Ac-DAF-16 was used to select genomic fragments by in vitro genomic selection. Twenty four bound genomic fragments were analyzed for the presence of the DAF-16 family binding element (DBE and possible alternative Ac-DAF-16 bind motifs. The 22 genes linked to these genomic fragments were identified using bioinformatics tools and defined as candidate direct gene targets of Ac-DAF-16. Their developmental stage-specific expression patterns were examined. Also, a new putative DAF-16 binding element was identified.Our results show that Ac-DAF-16 is involved in diverse biological processes throughout hookworm development. Further investigation of these target genes will provide insights into the molecular basis by which Ac-DAF-16 regulates its downstream gene network in hookworm infection.

  19. Platelet-released growth factors can accelerate tenocyte proliferation and activate the anti-oxidant response element.

    Science.gov (United States)

    Tohidnezhad, M; Varoga, D; Wruck, C J; Brandenburg, L O; Seekamp, A; Shakibaei, M; Sönmez, T T; Pufe, Thomas; Lippross, S

    2011-05-01

    Little is know about the pathophysiology of acute and degenerative tendon injuries. Although most lesions are uncomplicated, treatment is long and unsatisfactory in a considerable number of cases. Besides the common growth factors that were shown to be relevant for tendon integrity more recently protection against oxidative stress was shown to promote tendon healing. To improve tendon regeneration, many have advocated the use of platelet-rich plasma (PRP), a thrombocyte concentrate that can serve as an autologous source of growth factors. In this study, we investigated the effect of platelet-released growth factors (PRGF) on tenocytes. Tenocytes were isolated from the Achilles tendon of postnatal rats. Tenocyte cell cultures were stimulated with PRGF. We used a CyQuant assay and WST assay to analyse tendon cell growth and viability in different concentrations of PRGF. Migration and proliferation of cells grown in PRGF were assessed by a scratch test. A dual-luciferase assay was used to demonstrate the activation of the anti-oxidant response element (ARE) in tenocytes. A positive effect of PRGF could be shown on tendon cell growth and migratory capacity. PRGF activated the Nrf2-ARE pathway in a dose-dependent manner. Here, we provide evidence of a biological effect of PRGF on tenocytes by the promotion of tenocyte growth and activation of the Nrf2-ARE pathway. This is a novel aspect of the action of platelet concentrates on tendon growth.

  20. cAMP-response-element-binding protein positively regulates breast cancer metastasis and subsequent bone destruction

    Energy Technology Data Exchange (ETDEWEB)

    Son, Jieun; Lee, Jong-Ho; Kim, Ha-Neui; Ha, Hyunil, E-mail: hyunil74@hotmail.com; Lee, Zang Hee, E-mail: zang1959@snu.ac.kr

    2010-07-23

    Research highlights: {yields} CREB is highly expressed in advanced breast cancer cells. {yields} Tumor-related factors such as TGF-{beta} further elevate CREB expression. {yields} CREB upregulation stimulates metastatic potential of breast cancer cells. {yields} CREB signaling is required for breast cancer-induced bone destruction. -- Abstract: cAMP-response-element-binding protein (CREB) signaling has been reported to be associated with cancer development and poor clinical outcome in various types of cancer. However, it remains to be elucidated whether CREB is involved in breast cancer development and osteotropism. Here, we found that metastatic MDA-MB-231 breast cancer cells exhibited higher CREB expression than did non-metastatic MCF-7 cells and that CREB expression was further increased by several soluble factors linked to cancer progression, such as IL-1, IGF-1, and TGF-{beta}. Using wild-type CREB and a dominant-negative form (K-CREB), we found that CREB signaling positively regulated the proliferation, migration, and invasion of MDA-MB-231 cells. In addition, K-CREB prevented MDA-MB-231 cell-induced osteolytic lesions in a mouse model of cancer metastasis. Furthermore, CREB signaling in cancer cells regulated the gene expression of PTHrP, MMPs, and OPG, which are closely involved in cancer metastasis and bone destruction. These results indicate that breast cancer cells acquire CREB overexpression during their development and that this CREB upregulation plays an important role in multiple steps of breast cancer bone metastasis.

  1. Coupled porohyperelastic mass transport (PHEXPT) finite element models for soft tissues using ABAQUS.

    Science.gov (United States)

    Vande Geest, Jonathan P; Simon, B R; Rigby, Paul H; Newberg, Tyler P

    2011-04-01

    Finite element models (FEMs) including characteristic large deformations in highly nonlinear materials (hyperelasticity and coupled diffusive/convective transport of neutral mobile species) will allow quantitative study of in vivo tissues. Such FEMs will provide basic understanding of normal and pathological tissue responses and lead to optimization of local drug delivery strategies. We present a coupled porohyperelastic mass transport (PHEXPT) finite element approach developed using a commercially available ABAQUS finite element software. The PHEXPT transient simulations are based on sequential solution of the porohyperelastic (PHE) and mass transport (XPT) problems where an Eulerian PHE FEM is coupled to a Lagrangian XPT FEM using a custom-written FORTRAN program. The PHEXPT theoretical background is derived in the context of porous media transport theory and extended to ABAQUS finite element formulations. The essential assumptions needed in order to use ABAQUS are clearly identified in the derivation. Representative benchmark finite element simulations are provided along with analytical solutions (when appropriate). These simulations demonstrate the differences in transient and steady state responses including finite deformations, total stress, fluid pressure, relative fluid, and mobile species flux. A detailed description of important model considerations (e.g., material property functions and jump discontinuities at material interfaces) is also presented in the context of finite deformations. The ABAQUS-based PHEXPT approach enables the use of the available ABAQUS capabilities (interactive FEM mesh generation, finite element libraries, nonlinear material laws, pre- and postprocessing, etc.). PHEXPT FEMs can be used to simulate the transport of a relatively large neutral species (negligible osmotic fluid flux) in highly deformable hydrated soft tissues and tissue-engineered materials.

  2. Development of a Finite Element Model of the Human Shoulder to Investigate the Mechanical Responses and Injuries in Side Impact

    Science.gov (United States)

    Iwamoto, Masami; Miki, Kazuo; Yang, King H.

    Previous studies in both fields of automotive safety and orthopedic surgery have hypothesized that immobilization of the shoulder caused by the shoulder injury could be related to multiple rib fractures, which are frequently life threatening. Therefore, for more effective occupant protection, it is important to understand the relationship between shoulder injury and multiple rib fractures in side impact. The purpose of this study is to develop a finite element model of the human shoulder in order to understand this relationship. The shoulder model included three bones (the humerus, scapula and clavicle) and major ligaments and muscles around the shoulder. The model also included approaches to represent bone fractures and joint dislocations. The relationships between shoulder injury and immobilization of the shoulder are discussed using model responses for lateral shoulder impact. It is also discussed how the injury can be related to multiple rib fractures.

  3. Generalized finite elements

    International Nuclear Information System (INIS)

    Wachspress, E.

    2009-01-01

    Triangles and rectangles are the ubiquitous elements in finite element studies. Only these elements admit polynomial basis functions. Rational functions provide a basis for elements having any number of straight and curved sides. Numerical complexities initially associated with rational bases precluded extensive use. Recent analysis has reduced these difficulties and programs have been written to illustrate effectiveness. Although incorporation in major finite element software requires considerable effort, there are advantages in some applications which warrant implementation. An outline of the basic theory and of recent innovations is presented here. (authors)

  4. The role of high-energy synchrotron radiation in biomedical trace element research

    International Nuclear Information System (INIS)

    Pounds, J.G.; Long, G.J.; Kwiatek, W.M.; Jones, K.W.; Gordon, B.M.; Hanson, A.L.

    1987-01-01

    This paper will present the results of an investigation of the distribution of essential elements in the normal hepatic lobule. the liver is the organ responsible for metabolism and storage of most trace elements. Although parenchymal hepatocytes are rather uniform histologically, morphometry, histochemistry, immunohistochemistry, and microdissection with microchemical investigations have revealed marked heterogeneity on a functional and biochemical level. Hepatocytes from the periportal and perivenous zones of the liver parrenchyma differ in oxidative energy metabolism, glucose uptake and output, unreagenesis, biotransformation, bile acid secretion, and palsma protein synthesis and secretion. Although trace elements are intimately involved in the regulation and maintenance of these functions, little is known regarding the heterogeneity of trace element localization of the liver parenchyma. Histochemical techniques for trace elements generally give high spatial resolution, but lack specificity and stoichiometry. Microdissection has been of marginal usefulness for trace element analyses due to the very small size of the dissected parenchyma. The characteristics of the high-energy x-ray microscope provide an effective approach for elucidating the trace element content of these small biological structures or regions. 5 refs., 1 fig., 1 tab

  5. Elements to diminish radioactive accidents; Elementos para disminuir accidentes radiactivos

    Energy Technology Data Exchange (ETDEWEB)

    Cortes I, M.E.; Ramirez G, F.P. [Instituto Mexicano del Petroleo, Eje Central Lazaro Cardenas 152, C.P. 07730 Mexico D.F. (Mexico)

    1998-12-31

    In this work it is presented an application of the cause-effect diagram method or Ichikawa method identifying the elements that allow to diminish accidents when the radioactive materials are transported. It is considered the transport of hazardous materials which include radioactive materials in the period: December 1996 until March 1997. Among the identified elements by this method it is possible to mention: the road type, the radioactive source protection, the grade driver responsibility and the preparation that the OEP has in the radioactive material management. It is showed the differences found between the country inner roads and the Mexico City area. (Author)

  6. From Response to Responsibility: A Study of the Other and Language in the Ethical Structure of Responsibility in the Writings of Bonhoetrer and Levinas

    OpenAIRE

    Liu, Yinya

    2010-01-01

    This thesis explores the emergence of the concept of ethical responsibility in the writings of Dietrich Bonhoeffer (1906-1945) and Emmanuel Levinas (1906-1995). It argues that 'the other' and 'language' are both indispensable and correlative elements in the analysis of ethical responsibility presented by these two authors. Chapter one outlines the main theories of responsibility that have unfolded down in the history of philosophy to the twentieth century, noting the need to re...

  7. Trace elements in agroecosystems and impacts on the environment.

    Science.gov (United States)

    He, Zhenli L; Yang, Xiaoe E; Stoffella, Peter J

    2005-01-01

    Trace elements mean elements present at low concentrations (mg kg-1 or less) in agroecosystems. Some trace elements, including copper (Cu), zinc (Zn), manganese (Mn), iron (Fe), molybdenum (Mo), and boron (B) are essential to plant growth and are called micronutrients. Except for B, these elements are also heavy metals, and are toxic to plants at high concentrations. Some trace elements, such as cobalt (Co) and selenium (Se), are not essential to plant growth but are required by animals and human beings. Other trace elements such as cadmium (Cd), lead (Pb), chromium (Cr), nickel (Ni), mercury (Hg), and arsenic (As) have toxic effects on living organisms and are often considered as contaminants. Trace elements in an agroecosystem are either inherited from soil parent materials or inputs through human activities. Soil contamination with heavy metals and toxic elements due to parent materials or point sources often occurs in a limited area and is easy to identify. Repeated use of metal-enriched chemicals, fertilizers, and organic amendments such as sewage sludge as well as wastewater may cause contamination at a large scale. A good example is the increased concentration of Cu and Zn in soils under long-term production of citrus and other fruit crops. Many chemical processes are involved in the transformation of trace elements in soils, but precipitation-dissolution, adsorption-desorption, and complexation are the most important processes controlling bioavailability and mobility of trace elements in soils. Both deficiency and toxicity of trace elements occur in agroecosystems. Application of trace elements in fertilizers is effective in correcting micronutrient deficiencies for crop production, whereas remediation of soils contaminated with metals is still costly and difficult although phytoremediation appears promising as a cost-effective approach. Soil microorganisms are the first living organisms subjected to the impacts of metal contamination. Being responsive and

  8. Elimination of active tad elements during the sexual phase of the Neurospora crassa life cycle.

    Science.gov (United States)

    Anderson, C; Tang, Q; Kinsey, J A

    2001-06-01

    Tad is an active LINE-like retrotransposon isolated from the Adiopodoumé strain of Neurospora crassa. Extensive analysis of other Neurospora strains has revealed no other strain with active Tad, but all strains tested have multiple copies of defective Tad elements. We have examined the ability of Tad to survive during the sexual cycle of Neurospora and find that active Tad is rapidly eliminated. The characteristics of this elimination suggest that the repeat-induced point mutation (RIP) mechanism was responsible. By the use of transformation to switch the mating type of the Adiopodoumé strain we concluded that this strain is not defective in the RIP process. Analysis of defective Tad elements isolated from a variety of strains indicates that the major difference between these elements and active Tad is due to the presence of a large number of G-C to A-T transition mutations. This would be expected if the changes were due primarily to the RIP process. Mapping of a selection of defective Tad elements reveals that they are present on all of the chromosomes; however, many of the elements are not widely shared among strains. This suggests that repeated introduction and elimination of Tad elements has occurred. Mechanisms that might be responsible for this repeated introduction are discussed. Copyright 2001 Academic Press.

  9. Detailed assessment of gene activation levels by multiple hypoxia-responsive elements under various hypoxic conditions.

    Science.gov (United States)

    Takeuchi, Yasuto; Inubushi, Masayuki; Jin, Yong-Nan; Murai, Chika; Tsuji, Atsushi B; Hata, Hironobu; Kitagawa, Yoshimasa; Saga, Tsuneo

    2014-12-01

    HIF-1/HRE pathway is a promising target for the imaging and the treatment of intractable malignancy (HIF-1; hypoxia-inducible factor 1, HRE; hypoxia-responsive element). The purposes of our study are: (1) to assess the gene activation levels resulting from various numbers of HREs under various hypoxic conditions, (2) to evaluate the bidirectional activity of multiple HREs, and (3) to confirm whether multiple HREs can induce gene expression in vivo. Human colon carcinoma HCT116 cells were transiently transfected by the constructs containing a firefly luciferase reporter gene and various numbers (2, 4, 6, 8, 10, and 12) of HREs (nHRE+, nHRE-). The relative luciferase activities were measured under various durations of hypoxia (6, 12, 18, and 24 h), O2 concentrations (1, 2, 4, 8, and 16 %), and various concentrations of deferoxamine mesylate (20, 40, 80, 160, and 320 µg/mL growth medium). The bidirectional gene activation levels by HREs were examined in the constructs (dual-luc-nHREs) containing firefly and Renilla luciferase reporter genes at each side of nHREs. Finally, to test whether the construct containing 12HRE and the NIS reporter gene (12HRE-NIS) can induce gene expression in vivo, SPECT imaging was performed in a mouse xenograft model. (1) gene activation levels by HREs tended to increase with increasing HRE copy number, but a saturation effect was observed in constructs with more than 6 or 8 copies of an HRE, (2) gene activation levels by HREs increased remarkably during 6-12 h of hypoxia, but not beyond 12 h, (3) gene activation levels by HREs decreased with increasing O2 concentrations, but could be detected even under mild hypoxia at 16 % O2, (4) the bidirectionally proportional activity of the HRE was confirmed regardless of the hypoxic severity, and (5) NIS expression driven by 12 tandem copies of an HRE in response to hypoxia could be visualized on in vivo SPECT imaging. The results of this study will help in the understanding and assessment of

  10. Phytoremediation of soils contaminated with toxic elements and radionuclides

    International Nuclear Information System (INIS)

    Cornish, J.E.; Goldberg, W.C.; Levine, R.S.; Benemann, J.R.

    1995-01-01

    At many US Department of Energy (US DOE) facilities and other sites, surface soils over relatively large areas are contaminated with heavy metals, radionuclides, and other toxic elements, often at only a relatively small factor above regulatory action levels. Cleanup of such sites presents major challenges, because currently available soil remediation technologies can be very expensive. In response, the US DOE's Office of Technology Development, through the Western Environmental Technology Office, is sponsoring research in the area of phytoremediation. Phytoremediation is an emerging technology that uses higher plants to transfer toxic elements and radionuclides from surface soils into aboveground biomass. Some plants, termed hyperaccumulators, take up toxic elements in substantial amounts, resulting in concentrations in aboveground biomass over 100 times those observed with conventional plants. After growth, the plant biomass is harvested, and the toxic elements are concentrated and reclaimed or disposed of. As growing, harvesting, and processing plant biomass is relatively inexpensive, phytoremediation can be a low-cost technology for remediation of extensive areas having lightly to moderately contaminated soils. This paper reviews the potential of hyper- and moderate accumulator plants in soil remediation, provides some comparative cost estimates, and outlines ongoing work initiated by the US DOE

  11. Natural fracking and the genesis of five-element veins

    Science.gov (United States)

    Markl, Gregor; Burisch, Mathias; Neumann, Udo

    2016-08-01

    Hydrothermal Ag-Co-Ni-Bi-As (five-element vein type) ore deposits show very conspicuous textures of the native elements silver, bismuth, and arsenic indicating formation from a rapid, far-from-equilibrium process. Such textures include up to dm-large tree- and wire-like aggregates overgrown by Co-Ni-Fe arsenides and mostly carbonates. Despite the historical and contemporary importance of five-element vein type deposits as sources of silver, bismuth, and cobalt, and despite of spectacular museum specimens, their process of formation is not yet understood and has been a matter of debate since centuries. We propose, based on observations from a number of classical European five-element vein deposits and carbon isotope analyses, that "natural fracking," i.e., liberation of hydrocarbons or hydrocarbon-bearing fluids during break up of rocks in the vicinity of an active hydrothermal system and mixing between these hydrocarbons (e.g., methane and/or methane-bearing fluids) and a metal-rich hydrothermal fluid is responsible for ore precipitation and the formation of the unusual ore textures and assemblages. Thermodynamic and isotope mixing calculations show that the textural, chemical, and isotopic features of the investigated deposits can entirely be explained by this mechanism.

  12. APOBEC3G inhibits HIV-1 RNA elongation by inactivating the viral trans-activation response element.

    Science.gov (United States)

    Nowarski, Roni; Prabhu, Ponnandy; Kenig, Edan; Smith, Yoav; Britan-Rosich, Elena; Kotler, Moshe

    2014-07-29

    Deamination of cytidine residues in viral DNA is a major mechanism by which APOBEC3G (A3G) inhibits vif-deficient human immunodeficiency virus type 1 (HIV-1) replication. dC-to-dU transition following RNase-H activity leads to viral cDNA degradation, production of non-functional proteins, formation of undesired stop codons and decreased viral protein synthesis. Here, we demonstrate that A3G provides an additional layer of defense against HIV-1 infection dependent on inhibition of proviral transcription. HIV-1 transcription elongation is regulated by the trans-activation response (TAR) element, a short stem-loop RNA structure required for elongation factors binding. Vif-deficient HIV-1-infected cells accumulate short viral transcripts and produce lower amounts of full-length HIV-1 transcripts due to A3G deamination of the TAR apical loop cytidine, highlighting the requirement for TAR loop integrity in HIV-1 transcription. We further show that free single-stranded DNA (ssDNA) termini are not essential for A3G activity and a gap of CCC motif blocked with juxtaposed DNA or RNA on either or 3'+5' ends is sufficient for A3G deamination. These results identify A3G as an efficient mutator and that deamination of (-)SSDNA results in an early block of HIV-1 transcription. Copyright © 2014 Elsevier Ltd. All rights reserved.

  13. Zinc: a multipurpose trace element

    Energy Technology Data Exchange (ETDEWEB)

    Stefanidou, M.; Maravelias, C.; Dona, A.; Spiliopoulou, C. [University of Athens, Department of Forensic Medicine and Toxicology, Athens (Greece)

    2006-01-01

    Zinc (Zn) is one of the most important trace elements in the body and it is essential as a catalytic, structural and regulatory ion. It is involved in homeostasis, in immune responses, in oxidative stress, in apoptosis and in ageing. Zinc-binding proteins (metallothioneins, MTs), are protective in situations of stress and in situations of exposure to toxic metals, infections and low Zn nutrition. Metallothioneins play a key role in Zn-related cell homeostasis due to their high affinity for Zn, which is in turn relevant against oxidative stress and immune responses, including natural killer (NK) cell activity and ageing, since NK activity and Zn ion bioavailability decrease in ageing. Physiological supplementation of Zn in ageing and in age-related degenerative diseases corrects immune defects, reduces infection relapse and prevents ageing. Zinc is not stored in the body and excess intakes result in reduced absorption and increased excretion. Nevertheless, there are cases of acute and chronic Zn poisoning. (orig.)

  14. Trace element deficiency and its diagnosis by biochemical criteria

    International Nuclear Information System (INIS)

    Kirchgessner, M.; Grassmann, E.; Roth, H.P.; Spoerl, R.; Schnegg, A.

    1976-01-01

    The effect of trace element deficiency on growth of rats and dairy cows is demonstrated using zinc and nickel. The effect of copper deficiency on reproductive performance is shown to be associated with increased death rates of pregnant animals and their foetuses. For the diagnosis of suboptimum states of trace element supply, biochemical criteria are needed. The mere analysis of the trace element content of various body tissues may lead to falase diagnoses because of the often slow response to varying intake and because of interactions with other dietary ingredients affecting absorption and metabolic efficiency of utilization. Thus copper deficiency is associated with a decrease in the serum level of both copper and iron, despite adequate iron intake, and simultaneously with an accumulation of iron in the liver of the animal. Enzymes and hormones containing the essential trace element as an integral constituent may serve as biochemical criteria. A sensitive response to zinc intake is exhibited by the activity of the alkaline phosphatase of serum or bones, and by the activity of the pancreatic carboxypeptidase A, all of which show a significant reaction to deficient intake within two to four days, and perhaps by the biopotency of insulin. Ceruloplasmin responds to the supply of copper. Its biosynthesis in the liver is possible only from copper available for this purpose. Thus, the determination of ceruloplasmin may take account of at least part of the copper available to the body for metabolic functions. Among various criteria, the catalase activity in blood may provide additional information on the state of iron supply. Malate dehydrogenase and glucose-6-phosphate dehydrogenase respond to nickel-deficient intake. Nickel deficiency also involves anaemia due to disorders in iron absorption

  15. Solution of Fokker–Planck equation by finite element and finite ...

    Indian Academy of Sciences (India)

    The response of a structural system to white noise excitation (delta-correlated) constitutes a Markov vector process whose transitional probability density function (TPDF) is governed by both the forward Fokker–Planck and backward Kolmogorov equations. Numerical solution of these equations by finite element and finite ...

  16. Gap junctional communication modulates gene transcription by altering the recruitment of Sp1 and Sp3 to connexin-response elements in osteoblast promoters

    Science.gov (United States)

    Stains, Joseph P.; Lecanda, Fernando; Screen, Joanne; Towler, Dwight A.; Civitelli, Roberto

    2003-01-01

    Loss-of-function mutations of gap junction proteins, connexins, represent a mechanism of disease in a variety of tissues. We have shown that recessive (gene deletion) or dominant (connexin45 overexpression) disruption of connexin43 function results in osteoblast dysfunction and abnormal expression of osteoblast genes, including down-regulation of osteocalcin transcription. To elucidate the molecular mechanisms of gap junction-sensitive transcriptional regulation, we systematically analyzed the rat osteocalcin promoter for sensitivity to gap junctional intercellular communication. We identified an Sp1/Sp3 containing complex that assembles on a minimal element in the -70 to -57 region of the osteocalcin promoter in a gap junction-dependent manner. This CT-rich connexin-response element is necessary and sufficient to confer gap junction sensitivity to the osteocalcin proximal promoter. Repression of osteocalcin transcription occurs as a result of displacement of the stimulatory Sp1 by the inhibitory Sp3 on the promoter when gap junctional communication is perturbed. Modulation of Sp1/Sp3 recruitment also occurs on the collagen Ialpha1 promoter and translates into gap junction-sensitive transcriptional control of collagen Ialpha1 gene expression. Thus, regulation of Sp1/Sp3 recruitment to the promoter may represent a potential general mechanism for transcriptional control of target genes by signals passing through gap junctions.

  17. Identification of germline transcriptional regulatory elements in Aedes aegypti

    Science.gov (United States)

    Akbari, Omar S.; Papathanos, Philippos A.; Sandler, Jeremy E.; Kennedy, Katie; Hay, Bruce A.

    2014-02-01

    The mosquito Aedes aegypti is the principal vector for the yellow fever and dengue viruses, and is also responsible for recent outbreaks of the alphavirus chikungunya. Vector control strategies utilizing engineered gene drive systems are being developed as a means of replacing wild, pathogen transmitting mosquitoes with individuals refractory to disease transmission, or bringing about population suppression. Several of these systems, including Medea, UDMEL, and site-specific nucleases, which can be used to drive genes into populations or bring about population suppression, utilize transcriptional regulatory elements that drive germline-specific expression. Here we report the identification of multiple regulatory elements able to drive gene expression specifically in the female germline, or in the male and female germline, in the mosquito Aedes aegypti. These elements can also be used as tools with which to probe the roles of specific genes in germline function and in the early embryo, through overexpression or RNA interference.

  18. Immunoglobulin gene usage in the human anti-pathogen response.

    Science.gov (United States)

    Newkirk, M M; Rioux, J D

    1995-09-01

    The human antibody response to foreign pathogens is generated to a relatively small number of target surface proteins and carbohydrates that nonetheless have an extensive array of epitopes. The study of human monoclonal antibodies to different pathogens shows that there are a diversity of mechanisms used to generate a sufficient repertoire of antibodies to combat the invading pathogens. Although many different immunoglobulin gene elements are used to construct the anti-pathogen response, some elements are used more often than would be expected if all elements were used randomly. For example, the immune response to Haemophilus influenzae polysaccharide appears to be quite narrow, being restricted primarily to a specific heavy-chain gene, 3-15, and a lambda light-chain family II member, 4A. In contrast, for the immune response to cytomegalovirus proteins, a wider group of gene elements is needed. It is also surprising that despite an investigator bias for IgG- rather than IgM-secreting immortal B cells (because of their high affinity and neutralizing abilities), 26% of light chains and 13% of heavy chains showed a very low level of somatic mutation, equivalent to an IgM molecule that has not undergone affinity maturation. Although some highly mutated IgG molecules are present in the anti-pathogen response, most of the monoclonal antibodies specific for viruses or bacteria have a level of somatic hypermutation similar to that of the adult IgM repertoire. A number of studies have shown that there are similarities in the antibody responses to pathogens and to self (autoantibodies).(ABSTRACT TRUNCATED AT 250 WORDS)

  19. Finite element analysis of inelastic structural behavior

    International Nuclear Information System (INIS)

    Argyris, J.H.; Szimmat, J.; Willam, K.J.

    1977-01-01

    The paper describes recent achievements in the finite element analysis of inelastic material behavior. The main purpose is to examine the interaction of three disciplines; (i) the finite element formulation of large deformation problems in the light of a systematic linearization, (ii) the constitutive modelling of inelastic processes in the rate-dependent and rate-independent response regime and (iii) the numerical solution of nonlinear rate problems via incremental iteration techniques. In the first part, alternative finite element models are developed for the idealization of large deformation problems. A systematic approach is presented to linearize the field equations locally by an incremental procedure. The finite element formulation is then examined for the description of inelastic material processes. In the second part, nonlinear and inelastic material phenomena are classified and illustrated with representative examples of concrete and metal components. In particular, rate-dependent and rate-independent material behavior is examined and representative constitutive models are assessed for their mathematical characterization. Hypoelastic, elastoplastic and endochronic models are compared for the description rate-independent material phenomena. In the third part, the numerial solution of inelastic structural behavior is discussed. In this context, several incremental techniques are developed and compared for tracing the evolution of the inelastic process. The numerical procedures are examined with regard to stability and accuracy to assess the overall efficiency. The 'optimal' incremental technique is then contrasted with the computer storage requirements to retain the data for the 'memory-characteristics' of the constitutive model

  20. Resveratrol stimulates c-Fos gene transcription via activation of ERK1/2 involving multiple genetic elements.

    Science.gov (United States)

    Thiel, Gerald; Rössler, Oliver G

    2018-06-05

    The polyphenol resveratrol is found in many plant and fruits and is a constituent of our diet. Resveratrol has been proposed to have chemopreventive and anti-inflammatory activities. On the cellular level, resveratrol activates stimulus-regulated transcription factors. To identify resveratrol-responsive elements within a natural gene promoter, the molecular pathway leading to c-Fos gene expression by resveratrol was dissected. The c-Fos gene encodes a basic region leucine zipper transcription factor and is a prototype of an immediate-early gene that is regulated by a wide range of signaling molecules. We analyzed chromatin-integrated c-Fos promoter-luciferase reporter genes where transcription factor binding sites were destroyed by point mutations or deletion mutagenesis. The results show that mutation of the binding sites for serum response factor (SRF), activator protein-1 (AP-1) and cAMP response element binding protein (CREB) significantly reduced reporter gene transcription following stimulation of the cells with resveratrol. Inactivation of the binding sites for signal transducer and activator of transcription (STAT) or ternary complex factors did not influence resveratrol-regulated c-Fos promoter activity. Thus, the c-Fos promoter contains three resveratrol-responsive elements, the cAMP response element (CRE), and the binding sites for SRF and AP-1. Moreover, we show that the transcriptional activation potential of the c-Fos protein is increased in resveratrol-stimulated cells, indicating that the biological activity of c-Fos is elevated by resveratrol stimulation. Pharmacological and genetic experiments revealed that the protein kinase ERK1/2 is the signal transducer that connects resveratrol treatment with the c-Fos gene. Copyright © 2018 Elsevier B.V. All rights reserved.

  1. The synthetic elements

    Energy Technology Data Exchange (ETDEWEB)

    Hoffman, D.C.

    1990-05-01

    Prior to 1940, the heaviest element known was uranium, discovered in 1789. Since that time the elements 93 through 109 have been synthesized and identified and the elements 43, 61, 85, and 87 which were missing form the periodic tables of the 1930's have been discovered. The techniques and problems involved in these discoveries and the placement of the transuranium elements in the periodic table will be discussed. The production and positive identification of elements heavier than Md (Z=101), which have very short half-lives and can only be produced an atom-at-a-time, are very difficult and there have been controversies concerning their discovery. Some of the new methods which have been developed and used in these studies will be described. The prospects for production of still heavier elements will be considered.

  2. The synthetic elements

    International Nuclear Information System (INIS)

    Hoffman, D.C.

    1990-05-01

    Prior to 1940, the heaviest element known was uranium, discovered in 1789. Since that time the elements 93 through 109 have been synthesized and identified and the elements 43, 61, 85, and 87 which were missing form the periodic tables of the 1930's have been discovered. The techniques and problems involved in these discoveries and the placement of the transuranium elements in the periodic table will be discussed. The production and positive identification of elements heavier than Md (Z=101), which have very short half-lives and can only be produced an atom-at-a-time, are very difficult and there have been controversies concerning their discovery. Some of the new methods which have been developed and used in these studies will be described. The prospects for production of still heavier elements will be considered

  3. Performance Characteristics of PTC Elements for an Electric Vehicle Heating System

    Directory of Open Access Journals (Sweden)

    Yoon Hyuk Shin

    2016-10-01

    Full Text Available A high-voltage positive temperature coefficient (PTC heater has a simple structure and a swift response. Therefore, for cabin heating in electric vehicles (EVs, such heaters are used either on their own or with a heat pump system. In this study, the sintering process in the manufacturing of PTC elements for an EV heating system was improved to enhance surface uniformity. The electrode production process entailing thin-film sputtering deposition was applied to ensure the high heating performance of PTC elements and reduce the electrode thickness. The allowable voltage and surface heat temperature of the high-voltage PTC elements with thin-film electrodes were 800 V and 172 °C, respectively. The electrode layer thickness was uniform at approximately 3.8 μm or less, approximately 69% less electrode materials were required compared to that before process improvement. Furthermore, a heater for the EV heating system was manufactured using the developed high-voltage PTC elements to verify performance and reliability.

  4. Service elements influencing the emotions of visitors to an international airport

    Directory of Open Access Journals (Sweden)

    L du Plessis

    2014-01-01

    Full Text Available Emotions constitute a crucial element in understanding a service experience. When a service experience is evaluated by airport visitors, their evaluation is influenced by their emotional reactions. Furthermore, since emotions represent a primary source of human motivation, positive emotions are likely to lead to positive responses, increased satisfaction and favourable behaviour. These introductory statements give rise to the aim of this article, which is to explore those service elements influencing visitors' emotions and, consequently, also their experiences at an international airport. In order to achieve the aim, a questionnaire survey (N=490 was conducted at an international airport in South Africa after which a factor analysis was performed to identify the primary elements of the airport service environment that influence the emotions of visitors. Structural equation modelling was then employed to test the significance of the relationship between the service elements and the emotions of visitors. Five distinct service elements were identified, namely Physical comfort, Amenities, Visitor facilities, Passenger services and Accessibility. These elements further showed significant correlations with the emotions of visitors. This research was the first of its kind conducted at an international airport in South Africa and contributes significantly to management practices regarding specific elements of an international airport environment, i.e. the emotions, experiences and behaviour of international airport visitors.

  5. Hypoxia-induced oxidative base modifications in the VEGF hypoxia-response element are associated with transcriptionally active nucleosomes.

    Science.gov (United States)

    Ruchko, Mykhaylo V; Gorodnya, Olena M; Pastukh, Viktor M; Swiger, Brad M; Middleton, Natavia S; Wilson, Glenn L; Gillespie, Mark N

    2009-02-01

    Reactive oxygen species (ROS) generated in hypoxic pulmonary artery endothelial cells cause transient oxidative base modifications in the hypoxia-response element (HRE) of the VEGF gene that bear a conspicuous relationship to induction of VEGF mRNA expression (K.A. Ziel et al., FASEB J. 19, 387-394, 2005). If such base modifications are indeed linked to transcriptional regulation, then they should be detected in HRE sequences associated with transcriptionally active nucleosomes. Southern blot analysis of the VEGF HRE associated with nucleosome fractions prepared by micrococcal nuclease digestion indicated that hypoxia redistributed some HRE sequences from multinucleosomes to transcriptionally active mono- and dinucleosome fractions. A simple PCR method revealed that VEGF HRE sequences harboring oxidative base modifications were found exclusively in mononucleosomes. Inhibition of hypoxia-induced ROS generation with myxathiozol prevented formation of oxidative base modifications but not the redistribution of HRE sequences into mono- and dinucleosome fractions. The histone deacetylase inhibitor trichostatin A caused retention of HRE sequences in compacted nucleosome fractions and prevented formation of oxidative base modifications. These findings suggest that the hypoxia-induced oxidant stress directed at the VEGF HRE requires the sequence to be repositioned into mononucleosomes and support the prospect that oxidative modifications in this sequence are an important step in transcriptional activation.

  6. Preparation and Launch of the JEM ISS Elements - A NASA Mission Manager's Perspective

    Science.gov (United States)

    Higginbotham, Scott A.

    2016-01-01

    The pre-flight launch site preparations and launch of the Japanese Experiment Module (JEM) elements of the International Space Station required an intense multi-year, international collaborative effort between US and Japanese personnel at the Kennedy Space Center (KSC). This presentation will provide a brief overview of KSC, a brief overview of the ISS, and a summary of authors experience managing the NASA team responsible that supported and conducted the JEM element operations.

  7. Characterizing high-temperature deformation of internally heated nuclear fuel element simulators

    Energy Technology Data Exchange (ETDEWEB)

    Belov, A.I.; Fong, R.W.L.; Leitch, B.W.; Nitheanandan, T.; Williams, A., E-mail: alexander.belov@cnl.ca [Canadian Nuclear Laboratories, Chalk River, Ontario (Canada)

    2016-06-15

    The sag behaviour of a simulated nuclear fuel element during high-temperature transients has been investigated in an experiment utilizing an internal indirect heating method. The major motivation of the experiment was to improve understanding of the dominant mechanisms underlying the element thermo-mechanical response under loss-of-coolant accident conditions and to obtain accurate experimental data to support development of 3-D computational fuel element models. The experiment was conducted using an electrically heated CANDU fuel element simulator. Three consecutive thermal cycles with peak temperatures up to ≈1000 {sup o}C were applied to the element. The element sag deflections and sheath temperatures were measured. On heating up to 600 {sup o}C, only minor lateral deflections of the element were observed. Further heating to above 700 {sup o}C resulted in an element multi-rate creep and significant permanent bow. Post-test visual and X-ray examinations revealed a pronounced necking of the sheath at the pellet-to-pellet interface locations. A wall thickness reduction was detected in the necked region that is interpreted as a sheath longitudinal strain localization effect. The sheath cross-sectioning showed signs of a 'hard' pellet-cladding interaction due to the applied cycles. A 3-D model of the experiment was generated using the ANSYS finite element code. As a fully coupled thermal mechanical simulation is computationally expensive, it was deemed sufficient to use the measured sheath temperatures as a boundary condition, and thus an uncoupled mechanical simulation only was conducted. The ANSYS simulation results match the experiment sag observations well up to the point at which the fuel element started cooling down. (author)

  8. Open-water and under-ice seasonal variations in trace element content and physicochemical associations in fluvial bed sediment.

    Science.gov (United States)

    Doig, Lorne E; Carr, Meghan K; Meissner, Anna G N; Jardine, Tim D; Jones, Paul D; Bharadwaj, Lalita; Lindenschmidt, Karl-Erich

    2017-11-01

    Across the circumpolar world, intensive anthropogenic activities in the southern reaches of many large, northward-flowing rivers can cause sediment contamination in the downstream depositional environment. The influence of ice cover on concentrations of inorganic contaminants in bed sediment (i.e., sediment quality) is unknown in these rivers, where winter is the dominant season. A geomorphic response unit approach was used to select hydraulically diverse sampling sites across a northern test-case system, the Slave River and delta (Northwest Territories, Canada). Surface sediment samples (top 1 cm) were collected from 6 predefined geomorphic response units (12 sites) to assess the relationships between bed sediment physicochemistry (particle size distribution and total organic carbon content) and trace element content (mercury and 18 other trace elements) during open-water conditions. A subset of sites was resampled under-ice to assess the influence of season on these relationships and on total trace element content. Concentrations of the majority of trace elements were strongly correlated with percent fines and proxies for grain size (aluminum and iron), with similar trace element grain size/grain size proxy relationships between seasons. However, finer materials were deposited under ice with associated increases in sediment total organic carbon content and the concentrations of most trace elements investigated. The geomorphic response unit approach was effective at identifying diverse hydrological environments for sampling prior to field operations. Our data demonstrate the need for under-ice sampling to confirm year-round consistency in trace element-geochemical relationships in fluvial systems and to define the upper extremes of these relationships. Whether contaminated or not, under-ice bed sediment can represent a "worst-case" scenario in terms of trace element concentrations and exposure for sediment-associated organisms in northern fluvial systems

  9. Interactions between the cytomegalovirus promoter and the estrogen response element: implications for design of estrogen-responsive reporter plasmids.

    Science.gov (United States)

    Derecka, K; Wang, C K; Flint, A P F

    2006-07-01

    We aimed to produce an estrogen-responsive reporter plasmid that would permit monitoring of estrogen receptor function in the uterus in vivo. The plasmid pBL-tk-CAT(+)ERE was induced by estrogen in bovine endometrial stromal cells. When the CAT gene was replaced by the secreted alkaline phosphatase SeAP, the resulting construct pBL-tk-SeAP(+)ERE remained estrogen responsive. However when the tk promoter was replaced by the cytomegalovirus (cmv) promoter, the resulting plasmid (pBL-cmv-SeAP(+)ERE) was not estrogen responsive. Inhibition of ERE function was not due to an effect in trans or due to lack of estrogen receptor. It was not due to an interaction between the cmv promoter and the SeAP gene. cmv promoter function was dependent on NF-kappaB, and mutagenesis in the NF-kappaB sites reduced basal reporter expression without imparting responsiveness to estrogen. A mutation in the TATA box also failed to impart estrogen responsiveness. Modeling of DNA accessibility indicated the ERE was inserted at a site accessible to transcription factors. We conclude that the cmv promoter inhibits ERE function in cis when the two sequences are located in the same construct, and that this effect does not involve an interaction between cmv and reporter gene, NF-kappaB sites or the TATA box, or DNA inaccessibility.

  10. The solar element

    DEFF Research Database (Denmark)

    Kragh, Helge

    2009-01-01

    of the nineteenth century. In the modest form of a yellow spectral line known as D3, 'helium' was sometimes supposed to exist in the Sun's atmosphere, an idea which is traditionally ascribed to J. Norman Lockyer. Did Lockyer discover helium as a solar element? How was the suggestion received by chemists, physicists...... and astronomers in the period until the spring of 1895, when William Ramsay serendipitously found the gas in uranium minerals? The hypothetical element helium was fairly well known, yet Ramsay's discovery owed little or nothing to Lockyer's solar element. Indeed, for a brief while it was thought that the two...... elements might be different. The complex story of how helium became established as both a solar and terrestrial element involves precise observations as well as airy speculations. It is a story that is unique among the discovery histories of the chemical elements....

  11. Investigations on Actuator Dynamics through Theoretical and Finite Element Approach

    Directory of Open Access Journals (Sweden)

    Somashekhar S. Hiremath

    2010-01-01

    Full Text Available This paper gives a new approach for modeling the fluid-structure interaction of servovalve component-actuator. The analyzed valve is a precision flow control valve-jet pipe electrohydraulic servovalve. The positioning of an actuator depends upon the flow rate from control ports, in turn depends on the spool position. Theoretical investigation is made for No-load condition and Load condition for an actuator. These are used in finite element modeling of an actuator. The fluid-structure-interaction (FSI is established between the piston and the fluid cavities at the piston end. The fluid cavities were modeled with special purpose hydrostatic fluid elements while the piston is modeled with brick elements. The finite element method is used to simulate the variation of cavity pressure, cavity volume, mass flow rate, and the actuator velocity. The finite element analysis is extended to study the system's linearized response to harmonic excitation using direct solution steady-state dynamics. It was observed from the analysis that the natural frequency of the actuator depends upon the position of the piston in the cylinder. This is a close match with theoretical and simulation results. The effect of bulk modulus is also presented in the paper.

  12. Root anatomy and element distribution vary between two Salix caprea isolates with different Cd accumulation capacities

    International Nuclear Information System (INIS)

    Vaculík, Marek; Konlechner, Cornelia; Langer, Ingrid; Adlassnig, Wolfram; Puschenreiter, Markus; Lux, Alexander; Hauser, Marie-Theres

    2012-01-01

    The understanding of the influence of toxic elements on root anatomy and element distribution is still limited. This study describes anatomical responses, metal accumulation and element distribution of rooted cuttings of Salix caprea after exposure to Cd and/or Zn. Differences in the development of apoplastic barriers and tissue organization in roots between two distinct S. caprea isolates with divergent Cd uptake and accumulation capacities in leaves might reflect an adaptive predisposition based on different natural origins. Energy-dispersive X-ray spectroscopy (EDX) revealed that Cd and Zn interfered with the distribution of elements in a tissue- and isolate-specific manner. Zinc, Ca, Mg, Na and Si were enriched in the peripheral bark, K and S in the phloem and Cd in both vascular tissues. Si levels were lower in the superior Cd translocator. Since the cuttings originated from stocks isolated from polluted and unpolluted sites we probably uncovered different strategies against toxic elements. - Highlights: ► We describe responses in roots of S. caprea exposed to Cd and Zn. ► Apoplastic barrier development varied among isolates from differently polluted sites. ► EDX analyses revealed variations of element distributions in root tissues. ► Si weight% was lower in the isolate with a higher Cd translocation capacity. ► S. caprea isolates possessed different strategies to respond to Cd and Zn. - S. caprea altered element distribution and translocation, apoplastic barrier development and root anatomy upon Cd and/or Zn exposure.

  13. Optically Controlled Reconfigurable Antenna Array Based on E-Shaped Elements

    Directory of Open Access Journals (Sweden)

    Arismar Cerqueira Sodré Junior

    2014-01-01

    Full Text Available This work presents the development of optically controlled reconfigurable antenna arrays. They are based on two patch elements with E-shaped slots, a printed probe, and a photoconductive switch made from an intrinsic silicon die. Numerical simulations and experiments have been shown to be in agreement, and both demonstrate that the frequency response of the antenna arrays can be efficiently reconfigured over two different frequency ISM bands, namely, 2.4 and 5 GHz. A measured gain of 12.5 dBi has been obtained through the use of two radiating elements printed in a low-cost substrate and a dihedral corner reflector.

  14. Nuclear fuel element

    International Nuclear Information System (INIS)

    Penrose, R.T.; Thompson, J.R.

    1976-01-01

    A method of protecting the cladding of a nuclear fuel element from internal attack and a nuclear fuel element for use in the core of a nuclear reactor are disclosed. The nuclear fuel element has disposed therein an additive of a barium-containing material and the barium-containing material collects reactive gases through chemical reaction or adsorption at temperatures ranging from room temperature up to fuel element plenum temperatures. The additive is located in the plenum of the fuel element and preferably in the form of particles in a hollow container having a multiplicity of gas permeable openings in one portion of the container with the openings being of a size smaller than the size of the particles. The openings permit gases and liquids entering the plenum to contact the particles. The additive is comprised of elemental barium or a barium alloy containing one or more metals in addition to barium such as aluminum, zirconium, nickel, titanium and combinations thereof. 6 claims, 3 drawing figures

  15. Use of response envelopes for seismic margin assessment of reinforced concrete walls and slabs

    Energy Technology Data Exchange (ETDEWEB)

    Ile, Nicolas; Frau, Alberto, E-mail: alberto.frau@cea.fr

    2017-04-01

    Highlights: • Proposal of a method for application of the elliptical envelope to RC shell elements. • Proposal of new algorithms for the seismic margin evaluation for RC shell elements. • Verification of a RC wall 3D structure, using the proposed assessment approach. - Abstract: Seismic safety evaluations of existing nuclear facilities are usually based on the assumption of structural linearity. For the design basis earthquake (DBE), it is reasonable to apply a conventional evaluation of the seismic safety of building structures and carry out a linear elastic analysis to assess the load effects on structural elements. Estimating the seismic capacity of a structural element requires an estimation of the critical combination of responses acting in this structural element and compare this combination with the capacity of the element. By exploiting the response-spectrum-based procedure for predicting the response envelopes in linear structures formulated by Menun and Der Kiureghian (2000a), algorithms are developed for the seismic margin assessment of reinforced concrete shell finite elements. These algorithms facilitate the comparison of the response-spectrum-based envelopes to prescribed capacity surfaces for the purpose of assessing the safety margin of this kind of structures. The practical application of elliptical response envelopes in case of shell finite elements is based on the use of layer models such as those developed by Marti (1990), which transfer the generalized stress field to three layers under the assumption that the two outer layers carry membrane forces and the internal layer carries only the out-of-plane shears. The utility of the assessment approach is discussed with reference to a case study of a 3D structure made of reinforced concrete walls.

  16. Use of response envelopes for seismic margin assessment of reinforced concrete walls and slabs

    International Nuclear Information System (INIS)

    Ile, Nicolas; Frau, Alberto

    2017-01-01

    Highlights: • Proposal of a method for application of the elliptical envelope to RC shell elements. • Proposal of new algorithms for the seismic margin evaluation for RC shell elements. • Verification of a RC wall 3D structure, using the proposed assessment approach. - Abstract: Seismic safety evaluations of existing nuclear facilities are usually based on the assumption of structural linearity. For the design basis earthquake (DBE), it is reasonable to apply a conventional evaluation of the seismic safety of building structures and carry out a linear elastic analysis to assess the load effects on structural elements. Estimating the seismic capacity of a structural element requires an estimation of the critical combination of responses acting in this structural element and compare this combination with the capacity of the element. By exploiting the response-spectrum-based procedure for predicting the response envelopes in linear structures formulated by Menun and Der Kiureghian (2000a), algorithms are developed for the seismic margin assessment of reinforced concrete shell finite elements. These algorithms facilitate the comparison of the response-spectrum-based envelopes to prescribed capacity surfaces for the purpose of assessing the safety margin of this kind of structures. The practical application of elliptical response envelopes in case of shell finite elements is based on the use of layer models such as those developed by Marti (1990), which transfer the generalized stress field to three layers under the assumption that the two outer layers carry membrane forces and the internal layer carries only the out-of-plane shears. The utility of the assessment approach is discussed with reference to a case study of a 3D structure made of reinforced concrete walls.

  17. Predicted HIFAR fuel element temperatures for postulated loss-of-coolant accidents

    International Nuclear Information System (INIS)

    Green, W.J.

    1987-04-01

    A two-dimensional theoretical heat transfer model of a HIFAR Mark IV/Va fuel element has been developed and validated by comparing predicted thermal performances with experimental temperature responses obtained from irradiated fuel elements during simulated accident conditions. Full details of the model's development and its verification have been reported elsewhere. In this report, the model has been further used to ascertain acceptable limits of fuel element decay power for the start of two specific LOCAs which have been identified by the Regulatory Bureau of the AAEC. For a single fuel element which is positioned within a fuel load/unload flask and is not subjected to any forced convective air cooling, the model indicates that fission product decay powers must not exceed 1.86 kW if fuel surface temperatures are not to exceed 450 deg C. In the case of a HIFAR core LOCA in which the complete inventory of heavy water is lost, it is calculated that the maximum fission product decay power of a central element must not exceed 1.1 kW if fuel surface temperatures are not to exceed 450 deg C anywhere in the core

  18. Deciphering RNA Regulatory Elements Involved in the Developmental and Environmental Gene Regulation of Trypanosoma brucei.

    Science.gov (United States)

    Gazestani, Vahid H; Salavati, Reza

    2015-01-01

    Trypanosoma brucei is a vector-borne parasite with intricate life cycle that can cause serious diseases in humans and animals. This pathogen relies on fine regulation of gene expression to respond and adapt to variable environments, with implications in transmission and infectivity. However, the involved regulatory elements and their mechanisms of actions are largely unknown. Here, benefiting from a new graph-based approach for finding functional regulatory elements in RNA (GRAFFER), we have predicted 88 new RNA regulatory elements that are potentially involved in the gene regulatory network of T. brucei. We show that many of these newly predicted elements are responsive to both transcriptomic and proteomic changes during the life cycle of the parasite. Moreover, we found that 11 of predicted elements strikingly resemble previously identified regulatory elements for the parasite. Additionally, comparison with previously predicted motifs on T. brucei suggested the superior performance of our approach based on the current limited knowledge of regulatory elements in T. brucei.

  19. HLArestrictor-a tool for patient-specific predictions of HLA restriction elements and optimal epitopes within peptides

    DEFF Research Database (Denmark)

    Larsen, Malene Erup; Kloverpris, H.; Stryhn, A.

    2011-01-01

    ://www.cbs.dtu.dk/services/HLArestrictor ), which is based on the highly versatile and accurate NetMHCpan predictor, which here has been optimized for the identification of both the MHC restriction element and the corresponding minimal epitope of a T cell response in a given individual. As input, it requires high-resolution (i.e., 4-digit) HLA...... HLA restrictions and minimal epitopes for about 90% of the positive peptide/patient pairs while rejecting more than 95% of the negative peptide-HLA pairs. Furthermore, for 18 peptide/HLA tetramer validated responses, HLArestrictor in all cases predicted both the HLA restriction element and minimal...

  20. The Evolving Dynamic Response of a Four Storey Reinforced Concrete Structure during Construction

    Directory of Open Access Journals (Sweden)

    A. Devin

    2012-01-01

    Full Text Available Structures include elements designated as load bearing and non-load bearing. While non-load bearing elements, such as facades and internal partitions, are acknowledged to add mass to the system, the structural stiffness and strength is generally attributed to load bearing elements only. This paper investigates the contribution of non-load bearing elements to the dynamic response of a new structure, the Charles Institute, in the grounds of University College Dublin (UCD Ireland. The vertical vibration response of the first floor and the lateral response at each floor level were recorded at different construction stages. The evolution of the structural response as well as the generation of a finite element (FE model is discussed. It was found that the addition of the non-load bearing facades increased the first floor natural frequency from 10.7 Hz to 11.4?Hz, a change of approximately +6.5%. Similarly these external facades resulted in the first sway mode having its frequency increased by 6%. The subsequent addition of internal partitions, mechanical services and furnishings resulted in the floor natural frequency reducing to 9.2 Hz. It is concluded that external facades have the net effect of adding stiffness and the effect of internal partitions and furnishings is to add mass. In the context of finite element modelling of structures there is a significant challenge to represent these non-structural elements correctly so as to enable the generation of truly predictive FE models.

  1. When radionuclides take the place of vital elements

    International Nuclear Information System (INIS)

    Rouffignac, Ch. de; Poncy, J.L.; Martin, M.

    2003-01-01

    The radiosensitivity of the kidneys is a major factor restricting the applications of chemoradiotherapy. However, improved knowledge of the mechanisms involved has allowed new treatments to be developed that attenuate the effects of the irradiation or delay its consequences. Certain radioactive elements can behave in the body like calcium, and so exhibit a special affinity for bone structures. The skin is the first tissue that is damaged by external exposure to ionising radiation. The early and late responses to irradiation in this complex organ are still poorly understood. Thanks to DNA micro-arrays, the response of skin cells to irradiation, and in particular that of epidermal stem cells, can now be studied globally. (authors)

  2. Chemistry of superheavy elements

    International Nuclear Information System (INIS)

    Schaedel, M.

    2012-01-01

    The chemistry of superheavy elements - or transactinides from their position in the Periodic Table - is summarized. After giving an overview over historical developments, nuclear aspects about synthesis of neutron-rich isotopes of these elements, produced in hot-fusion reactions, and their nuclear decay properties are briefly mentioned. Specific requirements to cope with the one-atom-at-a-time situation in automated chemical separations and recent developments in aqueous-phase and gas-phase chemistry are presented. Exciting, current developments, first applications, and future prospects of chemical separations behind physical recoil separators ('pre-separator') are discussed in detail. The status of our current knowledge about the chemistry of rutherfordium (Rf, element 104), dubnium (Db, element 105), seaborgium (Sg, element 106), bohrium (Bh, element 107), hassium (Hs, element 108), copernicium (Cn, element 112), and element 114 is discussed from an experimental point of view. Recent results are emphasized and compared with empirical extrapolations and with fully-relativistic theoretical calculations, especially also under the aspect of the architecture of the Periodic Table. (orig.)

  3. A fractional model with parallel fractional Maxwell elements for amorphous thermoplastics

    Science.gov (United States)

    Lei, Dong; Liang, Yingjie; Xiao, Rui

    2018-01-01

    We develop a fractional model to describe the thermomechanical behavior of amorphous thermoplastics. The fractional model is composed of two parallel fractional Maxwell elements. The first fractional Maxwell model is used to describe the glass transition, while the second component is aimed at describing the viscous flow. We further derive the analytical solutions for the stress relaxation modulus and complex modulus through Laplace transform. We then demonstrate the model is able to describe the master curves of the stress relaxation modulus, storage modulus and loss modulus, which all show two distinct transition regions. The obtained parameters show that the modulus of the two fractional Maxwell elements differs in 2-3 orders of magnitude, while the relaxation time differs in 7-9 orders of magnitude. Finally, we apply the model to describe the stress response of constant strain rate tests. The model, together with the parameters obtained from fitting the master curve of stress relaxation modulus, can accurately predict the temperature and strain rate dependent stress response.

  4. Finite element modeling of trolling-mode AFM.

    Science.gov (United States)

    Sajjadi, Mohammadreza; Pishkenari, Hossein Nejat; Vossoughi, Gholamreza

    2018-06-01

    Trolling mode atomic force microscopy (TR-AFM) has overcome many imaging problems in liquid environments by considerably reducing the liquid-resonator interaction forces. The finite element model of the TR-AFM resonator considering the effects of fluid and nanoneedle flexibility is presented in this research, for the first time. The model is verified by ABAQUS software. The effect of installation angle of the microbeam relative to the horizon and the effect of fluid on the system behavior are investigated. Using the finite element model, frequency response curve of the system is obtained and validated around the frequency of the operating mode by the available experimental results, in air and liquid. The changes in the natural frequencies in the presence of liquid are studied. The effects of tip-sample interaction on the excitation of higher order modes of the system are also investigated in air and liquid environments. Copyright © 2018 Elsevier B.V. All rights reserved.

  5. Modular arrangement of regulatory RNA elements.

    Science.gov (United States)

    Roßmanith, Johanna; Narberhaus, Franz

    2017-03-04

    Due to their simple architecture and control mechanism, regulatory RNA modules are attractive building blocks in synthetic biology. This is especially true for riboswitches, which are natural ligand-binding regulators of gene expression. The discovery of various tandem riboswitches inspired the design of combined RNA modules with activities not yet found in nature. Riboswitches were placed in tandem or in combination with a ribozyme or temperature-responsive RNA thermometer resulting in new functionalities. Here, we compare natural examples of tandem riboswitches with recently designed artificial RNA regulators suggesting substantial modularity of regulatory RNA elements. Challenges associated with modular RNA design are discussed.

  6. The genomic view of genes responsive to the antagonistic phytohormones, abscisic acid, and gibberellin.

    Science.gov (United States)

    Yazaki, Junshi; Kikuchi, Shoshi

    2005-01-01

    We now have the various genomics tools for monocot (Oryza sativa) and a dicot (Arabidopsis thaliana) plant. Plant is not only a very important agricultural resource but also a model organism for biological research. It is important that the interaction between ABA and GA is investigated for controlling the transition from embryogenesis to germination in seeds using genomics tools. These studies have investigated the relationship between dormancy and germination using genomics tools. Genomics tools identified genes that had never before been annotated as ABA- or GA-responsive genes in plant, detected new interactions between genes responsive to the two hormones, comprehensively characterized cis-elements of hormone-responsive genes, and characterized cis-elements of rice and Arabidopsis. In these research, ABA- and GA-regulated genes have been classified as functional proteins (proteins that probably function in stress or PR tolerance) and regulatory proteins (protein factors involved in further regulation of signal transduction). Comparison between ABA and/or GA-responsive genes in rice and those in Arabidopsis has shown that the cis-element has specificity in each species. cis-Elements for the dehydration-stress response have been specified in Arabidopsis but not in rice. cis-Elements for protein storage are remarkably richer in the upstream regions of the rice gene than in those of Arabidopsis.

  7. Phylogeny based discovery of regulatory elements

    Directory of Open Access Journals (Sweden)

    Cohen Barak A

    2006-05-01

    Full Text Available Abstract Background Algorithms that locate evolutionarily conserved sequences have become powerful tools for finding functional DNA elements, including transcription factor binding sites; however, most methods do not take advantage of an explicit model for the constrained evolution of functional DNA sequences. Results We developed a probabilistic framework that combines an HKY85 model, which assigns probabilities to different base substitutions between species, and weight matrix models of transcription factor binding sites, which describe the probabilities of observing particular nucleotides at specific positions in the binding site. The method incorporates the phylogenies of the species under consideration and takes into account the position specific variation of transcription factor binding sites. Using our framework we assessed the suitability of alignments of genomic sequences from commonly used species as substrates for comparative genomic approaches to regulatory motif finding. We then applied this technique to Saccharomyces cerevisiae and related species by examining all possible six base pair DNA sequences (hexamers and identifying sequences that are conserved in a significant number of promoters. By combining similar conserved hexamers we reconstructed known cis-regulatory motifs and made predictions of previously unidentified motifs. We tested one prediction experimentally, finding it to be a regulatory element involved in the transcriptional response to glucose. Conclusion The experimental validation of a regulatory element prediction missed by other large-scale motif finding studies demonstrates that our approach is a useful addition to the current suite of tools for finding regulatory motifs.

  8. The interaction between the iron-responsive element binding protein and its cognate RNA is highly dependent upon both RNA sequence and structure.

    Science.gov (United States)

    Jaffrey, S R; Haile, D J; Klausner, R D; Harford, J B

    1993-09-25

    To assess the influence of RNA sequence/structure on the interaction RNAs with the iron-responsive element binding protein (IRE-BP), twenty eight altered RNAs were tested as competitors for an RNA corresponding to the ferritin H chain IRE. All changes in the loop of the predicted IRE hairpin and in the unpaired cytosine residue characteristically found in IRE stems significantly decreased the apparent affinity of the RNA for the IRE-BP. Similarly, alteration in the spacing and/or orientation of the loop and the unpaired cytosine of the stem by either increasing or decreasing the number of base pairs separating them significantly reduced efficacy as a competitor. It is inferred that the IRE-BP forms multiple contacts with its cognate RNA, and that these contacts, acting in concert, provide the basis for the high affinity of this interaction.

  9. Chemistry of the elements

    International Nuclear Information System (INIS)

    Greenwood, N.N.; Earnshaw, A.

    1984-01-01

    This textbook presents an account of the chemistry of the elements for both undergraduate and postgraduate students. It covers not only the 'inorganic' chemistry of the elements, but also analytical, theoretical, industrial, organometallic;, bio-inorganic and other areas of chemistry which apply. The following elements of special nuclear interest are included: Rb, Cs, Fr, Sr, Ba, Ra, Po, At, Rn, Sc, Y, Zr, Hf, V, Nb, Ta, Mo, Tc, Ru, the Lanthanide Elements, the Actinide Elements. (U.K.)

  10. [Research Progress and Prospect of Applications of Finite Element Method in Lumbar Spine Biomechanics].

    Science.gov (United States)

    Zhang, Zhenjun; Li, Yang; Liao, Zhenhua; Liu, Weiqiang

    2016-12-01

    Based on the application of finite element analysis in spine biomechanics,the research progress of finite element method applied in lumbar spine mechanics is reviewed and the prospect is forecasted.The related works,including lumbar ontology modeling,clinical application research,and occupational injury and protection,are summarized.The main research areas of finite element method are as follows:new accurate modeling process,the optimized simulation method,diversified clinical effect evaluation,and the clinical application of artificial lumbar disc.According to the recent research progress,the application prospects of finite element method,such as automation and individuation of modeling process,evaluation and analysis of new operation methods and simulation of mechanical damage and dynamic response,are discussed.The purpose of this paper is to provide the theoretical reference and practical guidance for the clinical lumbar problems by reviewing the application of finite element method in the field of the lumbar spine biomechanics.

  11. Implementing Responsibility Centre Budgeting

    Science.gov (United States)

    Vonasek, Joseph

    2011-01-01

    Recently, institutes of higher education (universities) have shown a renewed interest in organisational structures and operating methodologies that generate productivity and innovation; responsibility centre budgeting (RCB) is one such process. This paper describes the underlying principles constituting RCB, its origin and structural elements, and…

  12. Toxic Elements

    DEFF Research Database (Denmark)

    Hajeb, Parvaneh; Shakibazadeh, Shahram; Sloth, Jens Jørgen

    2016-01-01

    Food is considered the main source of toxic element (arsenic, cadmium, lead, and mercury) exposure to humans, and they can cause major public health effects. In this chapter, we discuss the most important sources for toxic element in food and the foodstuffs which are significant contributors to h...

  13. A STUDY ON THE HIERARCHY OF MANAGEMENT ELEMENTS

    Science.gov (United States)

    Suzuki, Nobuyuki; Watanabe, Tadashi

    Compared to the late 20th century, the Japanese construction industry has drastically changed its business methodology, outlook and approach in response to global issues and the incredible advances in technology. Such influences, non-exhaustively include the; WTO Government procurement agreement, updating conditions of tendering and contracting, client demands for cost reduction and the rapid penetration of ICT (Information and Communication Technology) into modern society. These days, the significance of controlling Quality, Cost and Time (the so-called QCT) has been recognized as an eternal-triangle by almost all countries, Government organizations and the private sector. However, as the construction industry is exposed to , and influenced by, more and more internal and external dynamic factors, continued reliance on managing and controlling QCT elements on their own is no longer adequate in meeting the growing demands and expectations, and as such control of additional management elements is now essential to avoid problems, or minimize their potential impacts should they occur. This paper utilizes the results of a survey carried out amongst construction managers and consultants in Japan and overseas to develop a spatial network that defines the interaction of management factors as a weighted graphical model. The calculated closeness centrality index of the developed management network model is adopted to identify the initialelement hierarchy, which is then further analyzed using the minimum distance of independent relationships of management elements (Warshall-Floyd algorism methodology), to identify the optimum potential hierarchy for effective construction management. A key result of the analysis is the significance of "Human Resource" in the construction industry management element hierarchy alongside the traditional QCT elements.

  14. A new periodic imperfect quasi axisymmetric shell element

    International Nuclear Information System (INIS)

    Combescure, A.; Garuti, G.

    1983-08-01

    The object of this paper is to give the formulation and the validation of a ''quasi axisymmetric'' shell element: the main idea is to develop the theory of an imperfect quasi axisymmetric shell element. The imperfection is a variation of the circumferential radius of curvature rsub(theta). The equations are obtained by transporting the equilibrium equations from the actual geometry onto the theoretical axisymmetric (rsub(theta)=r 0 geometry. It is shown that the main hypothesis convenient to perform simply this transformation is that the membrane strains associated with that variation of geometry are less than 1% (that is always the case if you suppose that the imperfect structure is obtained from the perfect one by an inextensional displacement field). The formulation of the element is given in the general case. The rigidity matrices, are given in the particular case in which the imperfection has a component on a single Fourier harmonic. The comparison of theoretical and computed, 3D and quasi axisymmetric, solution or a very simple case shows the influence of the number of the Fourier harmonics chosen on the response of the structure. The influence of the initial imperfections on the natural frequency are studied with element and compared with 3D calculations. Comparison of 3D, quasi axisymmetric, and analytical buckling loads are given and explained. This element gives a very efficient tool for the calculation of thin shells of revolution (which are always imperfect) and especially unables easy parametric study of the variation of the buckling load and eigen frequencies with the amplitude and shapes of non axisymmetric imperfections

  15. Seismic response of three-dimensional topographies using a time-domain boundary element method

    Science.gov (United States)

    Janod, François; Coutant, Olivier

    2000-08-01

    We present a time-domain implementation for a boundary element method (BEM) to compute the diffraction of seismic waves by 3-D topographies overlying a homogeneous half-space. This implementation is chosen to overcome the memory limitations arising when solving the boundary conditions with a frequency-domain approach. This formulation is flexible because it allows one to make an adaptive use of the Green's function time translation properties: the boundary conditions solving scheme can be chosen as a trade-off between memory and cpu requirements. We explore here an explicit method of solution that requires little memory but a high cpu cost in order to run on a workstation computer. We obtain good results with four points per minimum wavelength discretization for various topographies and plane wave excitations. This implementation can be used for two different aims: the time-domain approach allows an easier implementation of the BEM in hybrid methods (e.g. coupling with finite differences), and it also allows one to run simple BEM models with reasonable computer requirements. In order to keep reasonable computation times, we do not introduce any interface and we only consider homogeneous models. Results are shown for different configurations: an explosion near a flat free surface, a plane wave vertically incident on a Gaussian hill and on a hemispherical cavity, and an explosion point below the surface of a Gaussian hill. Comparison is made with other numerical methods, such as finite difference methods (FDMs) and spectral elements.

  16. Systematic Dissection of Sequence Elements Controlling σ70 Promoters Using a Genomically-Encoded Multiplexed Reporter Assay in E. coli.

    Science.gov (United States)

    Urtecho, Guillaume; Tripp, Arielle D; Insigne, Kimberly; Kim, Hwangbeom; Kosuri, Sriram

    2018-02-01

    Promoters are the key drivers of gene expression and are largely responsible for the regulation of cellular responses to time and environment. In E. coli , decades of studies have revealed most, if not all, of the sequence elements necessary to encode promoter function. Despite our knowledge of these motifs, it is still not possible to predict the strength and regulation of a promoter from primary sequence alone. Here we develop a novel multiplexed assay to study promoter function in E. coli by building a site-specific genomic recombination-mediated cassette exchange (RMCE) system that allows for the facile construction and testing of large libraries of genetic designs integrated into precise genomic locations. We build and test a library of 10,898 σ70 promoter variants consisting of all combinations of a set of eight -35 elements, eight -10 elements, three UP elements, eight spacers, and eight backgrounds. We find that the -35 and -10 sequence elements can explain approximately 74% of the variance in promoter strength within our dataset using a simple log-linear statistical model. Neural network models can explain greater than 95% of the variance in our dataset, and show the increased power is due to nonlinear interactions of other elements such as the spacer, background, and UP elements.

  17. OpenSeesPy: Python library for the OpenSees finite element framework

    Science.gov (United States)

    Zhu, Minjie; McKenna, Frank; Scott, Michael H.

    2018-01-01

    OpenSees, an open source finite element software framework, has been used broadly in the earthquake engineering community for simulating the seismic response of structural and geotechnical systems. The framework allows users to perform finite element analysis with a scripting language and for developers to create both serial and parallel finite element computer applications as interpreters. For the last 15 years, Tcl has been the primary scripting language to which the model building and analysis modules of OpenSees are linked. To provide users with different scripting language options, particularly Python, the OpenSees interpreter interface was refactored to provide multi-interpreter capabilities. This refactoring, resulting in the creation of OpenSeesPy as a Python module, is accomplished through an abstract interface for interpreter calls with concrete implementations for different scripting languages. Through this approach, users are able to develop applications that utilize the unique features of several scripting languages while taking advantage of advanced finite element analysis models and algorithms.

  18. Widespread Chromatin Accessibility at Repetitive Elements Links Stem Cells with Human Cancer

    Directory of Open Access Journals (Sweden)

    Nicholas C. Gomez

    2016-11-01

    Full Text Available Chromatin regulation is critical for differentiation and disease. However, features linking the chromatin environment of stem cells with disease remain largely unknown. We explored chromatin accessibility in embryonic and multipotent stem cells and unexpectedly identified widespread chromatin accessibility at repetitive elements. Integrating genomic and biochemical approaches, we demonstrate that these sites of increased accessibility are associated with well-positioned nucleosomes marked by distinct histone modifications. Differentiation is accompanied by chromatin remodeling at repetitive elements associated with altered expression of genes in relevant developmental pathways. Remarkably, we found that the chromatin environment of Ewing sarcoma, a mesenchymally derived tumor, is shared with primary mesenchymal stem cells (MSCs. Accessibility at repetitive elements in MSCs offers a permissive environment that is exploited by the critical oncogene responsible for this cancer. Our data demonstrate that stem cells harbor a unique chromatin landscape characterized by accessibility at repetitive elements, a feature associated with differentiation and oncogenesis.

  19. PELTIER ELEMENTS

    CERN Document Server

    Tani, Laurits

    2015-01-01

    To control Peltier elements, temperature controller was used. I used TEC-1091 that was manufactured my Meerstetter Engineering. To gain control with the temperature controller, software had to be intalled on a controlling PC. There were different modes to control the Peltier: Tempererature controller to control temperature, Static current/voltage to control voltage and current and LIVE ON/OFF to auto-tune the controller respectively to the system. Also, since near the collision pipe there is much radiation, radiation-proof Peltier elements have to be used. To gain the best results, I had to find the most efficient Peltier elements and try to get their cold side to -40 degrees Celsius.

  20. The hydrogen epoch of reionization array dish III: measuring chromaticity of prototype element with reflectometry

    Science.gov (United States)

    Patra, Nipanjana; Parsons, Aaron R.; DeBoer, David R.; Thyagarajan, Nithyanandan; Ewall-Wice, Aaron; Hsyu, Gilbert; Leung, Tsz Kuk; Day, Cherie K.; de Lera Acedo, Eloy; Aguirre, James E.; Alexander, Paul; Ali, Zaki S.; Beardsley, Adam P.; Bowman, Judd D.; Bradley, Richard F.; Carilli, Chris L.; Cheng, Carina; Dillon, Joshua S.; Fadana, Gcobisa; Fagnoni, Nicolas; Fritz, Randall; Furlanetto, Steve R.; Glendenning, Brian; Greig, Bradley; Grobbelaar, Jasper; Hazelton, Bryna J.; Jacobs, Daniel C.; Julius, Austin; Kariseb, MacCalvin; Kohn, Saul A.; Lebedeva, Anna; Lekalake, Telalo; Liu, Adrian; Loots, Anita; MacMahon, David; Malan, Lourence; Malgas, Cresshim; Maree, Matthys; Martinot, Zachary; Mathison, Nathan; Matsetela, Eunice; Mesinger, Andrei; Morales, Miguel F.; Neben, Abraham R.; Pieterse, Samantha; Pober, Jonathan C.; Razavi-Ghods, Nima; Ringuette, Jon; Robnett, James; Rosie, Kathryn; Sell, Raddwine; Smith, Craig; Syce, Angelo; Tegmark, Max; Williams, Peter K. G.; Zheng, Haoxuan

    2018-04-01

    Spectral structures due to the instrument response is the current limiting factor for the experiments attempting to detect the redshifted 21 cm signal from the Epoch of Reionization (EoR). Recent advances in the delay spectrum methodology for measuring the redshifted 21 cm EoR power spectrum brought new attention to the impact of an antenna's frequency response on the viability of making this challenging measurement. The delay spectrum methodology provides a somewhat straightforward relationship between the time-domain response of an instrument that can be directly measured and the power spectrum modes accessible to a 21 cm EoR experiment. In this paper, we derive the explicit relationship between antenna reflection coefficient ( S 11) measurements made by a Vector Network Analyzer (VNA) and the extent of additional foreground contaminations in delay space. In the light of this mathematical framework, we examine the chromaticity of a prototype antenna element that will constitute the Hydrogen Epoch of Reionization Array (HERA) between 100 and 200 MHz. These reflectometry measurements exhibit additional structures relative to electromagnetic simulations, but we find that even without any further design improvement, such an antenna element will support measuring spatial k modes with line-of-sight components of k ∥ > 0.2 h Mpc- 1. We also find that when combined with the powerful inverse covariance weighting method used in optimal quadratic estimation of redshifted 21 cm power spectra the HERA prototype elements can successfully measure the power spectrum at spatial modes as low as k ∥ > 0.1 h Mpc- 1. This work represents a major step toward understanding the HERA antenna element and highlights a straightforward method for characterizing instrument response for future experiments designed to detect the 21 cm EoR power spectrum.

  1. A 2.5D finite element and boundary element model for the ground vibration from trains in tunnels and validation using measurement data

    Science.gov (United States)

    Jin, Qiyun; Thompson, David J.; Lurcock, Daniel E. J.; Toward, Martin G. R.; Ntotsios, Evangelos

    2018-05-01

    A numerical model is presented for the ground-borne vibration produced by trains running in tunnels. The model makes use of the assumption that the geometry and material properties are invariant in the axial direction. It is based on the so-called two-and-a-half dimensional (2.5D) coupled Finite Element and Boundary Element methodology, in which a two-dimensional cross-section is discretised into finite elements and boundary elements and the third dimension is represented by a Fourier transform over wavenumbers. The model is applied to a particular case of a metro line built with a cast-iron tunnel lining. An equivalent continuous model of the tunnel is developed to allow it to be readily implemented in the 2.5D framework. The tunnel structure and the track are modelled using solid and beam finite elements while the ground is modelled using boundary elements. The 2.5D track-tunnel-ground model is coupled with a train consisting of several vehicles, which are represented by multi-body models. The response caused by the passage of a train is calculated as the sum of the dynamic component, excited by the combined rail and wheel roughness, and the quasi-static component, induced by the constant moving axle loads. Field measurements have been carried out to provide experimental validation of the model. These include measurements of the vibration of the rail, the tunnel invert and the tunnel wall. In addition, simultaneous measurements were made on the ground surface above the tunnel. Rail roughness and track characterisation measurements were also made. The prediction results are compared with measured vibration obtained during train passages, with good agreement.

  2. Dynamic transient analysis of rupture disks by the finite-element method

    International Nuclear Information System (INIS)

    Hsieh, B.J.

    1975-02-01

    A finite element method utilizing the principle of virtual work in convected coordinates is used to analyze the axisymmetric dynamic transient response of rupture disks. This method can treat non-linearities arising both from inelastic material properties and large displacements/rotations provided that the convected strains are small. This report contains extensive calculations using a variety of rupture disk geometries and attempts to relate the static buckling of such disks to their dynamic response characteristics. A majority of the calculations treat the response of 18 inch disks typical of those currently considered for use in the Clinch River Breeder Reactor intermediate heat transport system

  3. Fabrication of Porous Silicon Based Humidity Sensing Elements on Paper

    Directory of Open Access Journals (Sweden)

    Tero Jalkanen

    2015-01-01

    Full Text Available A roll-to-roll compatible fabrication process of porous silicon (pSi based sensing elements for a real-time humidity monitoring is described. The sensing elements, consisting of printed interdigitated silver electrodes and a spray-coated pSi layer, were fabricated on a coated paper substrate by a two-step process. Capacitive and resistive responses of the sensing elements were examined under different concentrations of humidity. More than a three orders of magnitude reproducible decrease in resistance was measured when the relative humidity (RH was increased from 0% to 90%. A relatively fast recovery without the need of any refreshing methods was observed with a change in RH. Humidity background signal and hysteresis arising from the paper substrate were dependent on the thickness of sensing pSi layer. Hysteresis in most optimal sensing element setup (a thick pSi layer was still noticeable but not detrimental for the sensing. In addition to electrical characterization of sensing elements, thermal degradation and moisture adsorption properties of the paper substrate were examined in connection to the fabrication process of the silver electrodes and the moisture sensitivity of the paper. The results pave the way towards the development of low-cost humidity sensors which could be utilized, for example, in smart packaging applications or in smart cities to monitor the environment.

  4. Bridges for Pedestrians with Random Parameters using the Stochastic Finite Elements Analysis

    Science.gov (United States)

    Szafran, J.; Kamiński, M.

    2017-02-01

    The main aim of this paper is to present a Stochastic Finite Element Method analysis with reference to principal design parameters of bridges for pedestrians: eigenfrequency and deflection of bridge span. They are considered with respect to random thickness of plates in boxed-section bridge platform, Young modulus of structural steel and static load resulting from crowd of pedestrians. The influence of the quality of the numerical model in the context of traditional FEM is shown also on the example of a simple steel shield. Steel structures with random parameters are discretized in exactly the same way as for the needs of traditional Finite Element Method. Its probabilistic version is provided thanks to the Response Function Method, where several numerical tests with random parameter values varying around its mean value enable the determination of the structural response and, thanks to the Least Squares Method, its final probabilistic moments.

  5. Bridges for Pedestrians with Random Parameters using the Stochastic Finite Elements Analysis

    Directory of Open Access Journals (Sweden)

    Szafran J.

    2017-02-01

    Full Text Available The main aim of this paper is to present a Stochastic Finite Element Method analysis with reference to principal design parameters of bridges for pedestrians: eigenfrequency and deflection of bridge span. They are considered with respect to random thickness of plates in boxed-section bridge platform, Young modulus of structural steel and static load resulting from crowd of pedestrians. The influence of the quality of the numerical model in the context of traditional FEM is shown also on the example of a simple steel shield. Steel structures with random parameters are discretized in exactly the same way as for the needs of traditional Finite Element Method. Its probabilistic version is provided thanks to the Response Function Method, where several numerical tests with random parameter values varying around its mean value enable the determination of the structural response and, thanks to the Least Squares Method, its final probabilistic moments.

  6. Dynamic instability analysis of axisymmetric shells by finite element method with convected coordinates

    International Nuclear Information System (INIS)

    Hsieh, B.J.

    1977-01-01

    A rectilinear shell element formulated in the convected (co-rotational) coordinates is used to investigate the effects of edge conditions on the behaviors of thin shells of revolution under suddenly applied uniform loading. The equivalent generalized nodal forces under uniform loading are computed to the third order of the length of each element. A dynamic buckling load is defined as the load at which a great change in the response is observed for a small change in the loading. The problem studied is a shallow spherical cap. The cap is discretized into a finite number of elements. This discretization introduces some initial imperfections into the shell model. Nonetheless, the effect of this artificial imperfection is isolated from the effect of the edge conditions provided the same number of elements is used in all the cases. Four different edge conditions for the cap are used. These boundary conditions are fixed edge, hinged edge, roller edge and free edge. The apex displacement of the cap is taken as the measure for the response of the cap, and the dynamic buckling load is obtained by examining the response of the cap under different levels of loadings. Dynamic buckling loads can be found for all cases but for the free edge case. They are 0.28q for both fixed and hinged cases and 0.13 q for the roller case, where q is the classic static buckling load of a complete spherical shell with the same geometric dimensions and material properties. In the case of free edge, the motions of the cap are composed of mostly rigid body motion and small vibrations. The vibration of the cap is stable up to 1 q loading. The cap does snap through at higher loading. However, no loading can be clearly identified as buckling load

  7. Challenges and progress in predicting biological responses to incorporated radioactivity

    International Nuclear Information System (INIS)

    Howell, R. W.; Neti, P. V. S. V.; Pinto, M.; Gerashchenko, B. I.; Narra, V. R.; Azzam, E. I.

    2006-01-01

    Prediction of risks and therapeutic outcome in nuclear medicine largely rely on calculation of the absorbed dose. Absorbed dose specification is complex due to the wide variety of radiations emitted, non-uniform activity distribution, biokinetics, etc. Conventional organ absorbed dose estimates assumed that radioactivity is distributed uniformly throughout the organ. However, there have been dramatic improvements in dosimetry models that reflect the substructure of organs as well as tissue elements within them. These models rely on improved nuclear medicine imaging capabilities that facilitate determination of activity within voxels that represent tissue elements of ∼0.2-1 cm 3 . However, even these improved approaches assume that all cells within the tissue element receive the same dose. The tissue element may be comprised of a variety of cells having different radiosensitivities and different incorporated radioactivity. Furthermore, the extent to which non-uniform distributions of radioactivity within a small tissue element impact the absorbed dose distribution is strongly dependent on the number, type, and energy of the radiations emitted by the radionuclide. It is also necessary to know whether the dose to a given cell arises from radioactive decays within itself (self-dose) or decays in surrounding cells (cross-dose). Cellular response to self-dose can be considerably different than its response to cross-dose from the same radiopharmaceutical. Bystander effects can also play a role in the response. Evidence shows that even under conditions of 'uniform' distribution of radioactivity, a combination of organ dosimetry, voxel dosimetry and dosimetry at the cellular and multicellular levels can be required to predict response. (authors)

  8. Response Mixture Modeling: Accounting for Heterogeneity in Item Characteristics across Response Times.

    Science.gov (United States)

    Molenaar, Dylan; de Boeck, Paul

    2018-06-01

    In item response theory modeling of responses and response times, it is commonly assumed that the item responses have the same characteristics across the response times. However, heterogeneity might arise in the data if subjects resort to different response processes when solving the test items. These differences may be within-subject effects, that is, a subject might use a certain process on some of the items and a different process with different item characteristics on the other items. If the probability of using one process over the other process depends on the subject's response time, within-subject heterogeneity of the item characteristics across the response times arises. In this paper, the method of response mixture modeling is presented to account for such heterogeneity. Contrary to traditional mixture modeling where the full response vectors are classified, response mixture modeling involves classification of the individual elements in the response vector. In a simulation study, the response mixture model is shown to be viable in terms of parameter recovery. In addition, the response mixture model is applied to a real dataset to illustrate its use in investigating within-subject heterogeneity in the item characteristics across response times.

  9. Dynamic analysis of an axially moving beam subject to inner pressure using finite element method

    Energy Technology Data Exchange (ETDEWEB)

    Hua, Hongliang; Qiu, Ming; Liao, Zhenqiang [Nanjing University of Science and Technology, Nanjing (China)

    2017-06-15

    A dynamic model of an axially moving flexible beam subject to an inner pressure is present. The coupling principle between a flexible beam and inner pressure is analyzed first, and the potential energy of the inner pressure due to the beam bending is derived using the principle of virtual work. A 1D hollow beam element contain inner pressure is established. The finite element method and Lagrange’s equation are used to derive the motion equations of the axially moving system. The dynamic responses are analyzed by Newmark-β time integration method. Based on the computed dynamic responses, the effects of inner pressure on beam dynamics are discussed. Some interesting phenomenon is observed.

  10. Evaluation of radiation damping using 3-D finite element models

    International Nuclear Information System (INIS)

    Vaughan, D.K.; Isenberg, J.

    1983-01-01

    The paper presents an analytic approach which is being used to quantify the contribution of radiation damping to overall system damping. The approach uses three-dimensional finite element techniques and can easily include details of site geology, foundation shape, and embedment depth. The approach involves performing free vibration response analyses for each soil-structure interaction (SSI) mode of interest. The structural model is specified without damping and, consequently, amplitude decay of the structure's free vibration response is a measure of the radiation damping characteristics of the soil-structure system for the particular deformational mode being investigated. The computational approach developed is highly efficient in order to minimize the impact of including three-dimensional geometry within the model. A new finite element code, FLEX, has been developed to represent the soil continuum. FLEX uses a highly optimized explicit time integration algorithm which takes advantage of parallel processing on vector machines, such as the CRAY 1 computer. A modal representation of the superstructure is used in combination with a substructuring approach to solve for the coupled response of the soil-structure system. This requires solving for numerical Green's functions for each degree-of-freedom of the foundation (assumed rigid). Once computed for a particular site and foundation, these Green's functions may be used within a convolution integral to represent the continuum forces on the foundation for any free vibration SSI response computation of any superstructure model. This analytic approach is applied to an investigation of the radiation damping coefficients for the first two fundamental SSI modes of the HDR containment structure. (orig./HP)

  11. Environmental controls on the elemental composition of a Southern Hemisphere strain of the coccolithophore Emiliania huxleyi

    Science.gov (United States)

    Feng, Yuanyuan; Roleda, Michael Y.; Armstrong, Evelyn; Law, Cliff S.; Boyd, Philip W.; Hurd, Catriona L.

    2018-01-01

    A series of semi-continuous incubation experiments were conducted with the coccolithophore Emiliania huxleyi strain NIWA1108 (Southern Ocean isolate) to examine the effects of five environmental drivers (nitrate and phosphate concentrations, irradiance, temperature, and partial pressure of CO2 (pCO2)) on both the physiological rates and elemental composition of the coccolithophore. Here, we report the alteration of the elemental composition of E. huxleyi in response to the changes in these environmental drivers. A series of dose-response curves for the cellular elemental composition of E. huxleyi were fitted for each of the five drivers across an environmentally representative gradient. The importance of each driver in regulating the elemental composition of E. huxleyi was ranked using a semi-quantitative approach. The percentage variations in elemental composition arising from the change in each driver between present-day and model-projected conditions for the year 2100 were calculated. Temperature was the most important driver controlling both cellular particulate organic and inorganic carbon content, whereas nutrient concentrations were the most important regulator of cellular particulate nitrogen and phosphorus of E. huxleyi. In contrast, elevated pCO2 had the greatest influence on cellular particulate inorganic carbon to organic carbon ratio, resulting in a decrease in the ratio. Our results indicate that the different environmental drivers play specific roles in regulating the elemental composition of E. huxleyi with wide-reaching implications for coccolithophore-related marine biogeochemical cycles, as a consequence of the regulation of E. huxleyi physiological processes.

  12. Finite element model for nonlinear shells of revolution

    International Nuclear Information System (INIS)

    Cook, W.A.

    1979-01-01

    Nuclear material shipping containers have shells of revolution as basic structural components. Analytically modeling the response of these containers to severe accident impact conditions requires a nonlinear shell-of-revolution model that accounts for both geometric and material nonlinearities. Existing models are limited to large displacements, small rotations, and nonlinear materials. The paper presents a finite element model for a nonlinear shell of revolution that will account for large displacements, large strains, large rotations, and nonlinear materials

  13. Study of the Internal Mechanical response of an asphalt mixture by 3-D Discrete Element Modeling

    DEFF Research Database (Denmark)

    Feng, Huan; Pettinari, Matteo; Hofko, Bernhard

    2015-01-01

    and the reliability of which have been validated. The dynamic modulus of asphalt mixtures were predicted by conducting Discrete Element simulation under dynamic strain control loading. In order to reduce the calculation time, a method based on frequency–temperature superposition principle has been implemented......In this paper the viscoelastic behavior of asphalt mixture was investigated by employing a three-dimensional Discrete Element Method (DEM). The cylinder model was filled with cubic array of spheres with a specified radius, and was considered as a whole mixture with uniform contact properties....... The ball density effect on the internal stress distribution of the asphalt mixture model has been studied when using this method. Furthermore, the internal stresses under dynamic loading have been studied. The agreement between the predicted and the laboratory test results of the complex modulus shows...

  14. Dynamics Modeling and Analysis of Local Fault of Rolling Element Bearing

    Directory of Open Access Journals (Sweden)

    Lingli Cui

    2015-01-01

    Full Text Available This paper presents a nonlinear vibration model of rolling element bearings with 5 degrees of freedom based on Hertz contact theory and relevant bearing knowledge of kinematics and dynamics. The slipping of ball, oil film stiffness, and the nonlinear time-varying stiffness of the bearing are taken into consideration in the model proposed here. The single-point local fault model of rolling element bearing is introduced into the nonlinear model with 5 degrees of freedom according to the loss of the contact deformation of ball when it rolls into and out of the local fault location. The functions of spall depth corresponding to defects of different shapes are discussed separately in this paper. Then the ode solver in Matlab is adopted to perform a numerical solution on the nonlinear vibration model to simulate the vibration response of the rolling elements bearings with local fault. The simulation signals analysis results show a similar behavior and pattern to that observed in the processed experimental signals of rolling element bearings in both time domain and frequency domain which validated the nonlinear vibration model proposed here to generate typical rolling element bearings local fault signals for possible and effective fault diagnostic algorithms research.

  15. Effects of gamma irradiation on the DNA-protein complex between the estrogen response element and the estrogen receptor

    Energy Technology Data Exchange (ETDEWEB)

    Stisova, Viktorie [Department of Radiation Dosimetry, Nuclear Physics Institute AS CR, Na Truhlarce 39/64, 18086 Praha 8 (Czech Republic); Goffinont, Stephane; Spotheim-Maurizot, Melanie [Centre de Biophysique Moleculaire CNRS, rue Charles Sadron, 45071 Orleans Cedex 2 (France); Davidkova, Marie, E-mail: davidkova@ujf.cas.c [Department of Radiation Dosimetry, Nuclear Physics Institute AS CR, Na Truhlarce 39/64, 18086 Praha 8 (Czech Republic)

    2010-08-15

    Signaling by estrogens, risk factors in breast cancer, is mediated through their binding to the estrogen receptor protein (ER), followed by the formation of a complex between ER and a DNA sequence, called estrogen response element (ERE). Anti-estrogens act as competitive inhibitors by blocking the signal transduction. We have studied in vitro the radiosensitivity of the complex between ERalpha, a subtype of this receptor, and a DNA fragment bearing ERE, as well as the influence of an estrogen (estradiol) or an anti-estrogen (tamoxifen) on this radiosensitivity. We observe that the complex is destabilized upon irradiation with gamma rays in aerated aqueous solution. The analysis of the decrease of binding abilities of the two partners shows that destabilization is mainly due to the damage to the protein. The destabilization is reduced when irradiating in presence of tamoxifen and is increased in presence of estradiol. These effects are due to opposite influences of the ligands on the loss of binding ability of ER. The mechanism that can account for our results is: binding of estradiol or tamoxifen induces distinct structural changes of the ER ligand-binding domain that can trigger (by allostery) distinct structural changes of the ER DNA-binding domains and thus, can differently affect ER-ERE interaction.

  16. Climate-responsive design : A framework for an energy concept design-decision support tool for architects using principles of climate-responsive design

    NARCIS (Netherlands)

    Looman, R.H.J.

    2017-01-01

    In climate-responsive design the building becomes an intermediary in its own energy housekeeping, forming a link between the harvest of climate resources and low-energy provision of comfort. Essential here is the employment of climate-responsive building elements; structural and architectural

  17. Integration of finite element analysis and design of experiments to analyse the geometrical factors in bi-layered tube hydroforming

    International Nuclear Information System (INIS)

    Alaswad, A.; Olabi, A.G.; Benyounis, K.Y.

    2011-01-01

    Tube hydroforming (THF) is a type of unconventional metal forming process in which high fluid pressure and axial feed are used to deform a tube blank in the desired shape. Bi-layered tube hydroforming is suitable to produce bi-layered joints to be used in special applications such as aerospace, oil production and nuclear power plants. In this work, a finite element study along with response surface methodology (RSM) for design of experiment (DOE) has been used to construct models for three responses namely: bulge height, thickness reduction, and wrinkle height as a function of geometrical factors for X shape bi-layered tube hydroforming. A finite element model was built and experimentally validated. The models developed using finite element analysis (FEA) and RSM was found to be educated. The factors effect and their interactions on the three responses were determined and discussed. Such integration was proved to be a successful technique that can be used to predict the geometry of the hydroformed part.

  18. Interactions Between the Cytomegalovirus Promoter and the Estrogen Response Element: Implications for Design of Estrogen-Responsive Reporter Plasmids

    OpenAIRE

    Derecka, K.; Wang, C.K.; Flint, A.P.F.

    2006-01-01

    We aimed to produce an estrogen-responsive reporter plasmid that would permit monitoring of estrogen receptor function in the uterus in vivo. The plasmid pBL-tk-CAT(+)ERE was induced by estrogen in bovine endometrial stromal cells. When the CAT gene was replaced by the secreted alkaline phosphatase SeAP, the resulting construct pBL-tk-SeAP(+)ERE remained estrogen responsive. However when the tk promoter was replaced by the cytomegalovirus (cmv) promoter, the resulting plasmid (pBL-cmv-SeAP(+)...

  19. Flexible Connection Elastomeric Rubber as a Pounding Resisting Element between Two Adjacent Buildings

    Directory of Open Access Journals (Sweden)

    Yuskar Lase

    2013-03-01

    Full Text Available To solve pounding problem of two adjacent buildings, structural designer usually employs a dilatation between the structures or make the two structures as a monolith structure. Other alternative is by using an elastomeric rubber as a pounding resisting element between the two structures. Effectiveness in applying elastomeric rubber component as flexible connection of two adjacent structures is the main focus of this paper. Various simulations such as structure models, earthquake excitations and openings in gap element are studied. Observation of maximum structural responses will be performed for structure model with elastomeric rubber in comparison with (1 monolith structure model and (2 structure model with rigid element (steel element. Simulation results show that application of elastomeric rubber component to prevent structures from pounding problem provides advantages especially in reducing internal forces in the shorter building. However, it slightly increases displacement of both structures.

  20. Creating conditions for cooperative learning: Basic elements

    Directory of Open Access Journals (Sweden)

    Ševkušić-Mandić Slavica G.

    2003-01-01

    Full Text Available Although a large number of research evidence speak out in favor of cooperative learning, its effectiveness in teaching does not depend only on teacher’s and students’ enthusiasm and willingness to work in such a manner. Creating cooperative situations in learning demands a serious preparation and engagement on the part of teacher who is structuring various aspects of work in the classroom. Although there exist a large number of models and techniques of cooperative learning, which vary in the way in which students work together, in the structure of learning tasks as well as in the degree to which cooperative efforts of students are coupled with competition among groups, some elements should be present in the structure of conditions irrespective of the type of group work in question. Potential effects of cooperation are not likely to emerge unless teachers apply five basic elements of cooperative structure: 1. structuring of the learning task and students’ positive interdependence, 2. individual responsibility, 3. upgrading of "face to face" interaction, 4. training of students’ social skills, and 5. evaluation of group processes. The paper discusses various strategies for establishing the mentioned elements and concrete examples for teaching practice are provided, which should be of assistance to teachers for as much successful cooperative learning application as possible in work with children.

  1. E2-mediated cathepsin D (CTSD) activation involves looping of distal enhancer elements.

    Science.gov (United States)

    Bretschneider, Nancy; Kangaspeska, Sara; Seifert, Martin; Reid, George; Gannon, Frank; Denger, Stefanie

    2008-08-01

    Estrogen receptor alpha (ERalpha) is a ligand dependent transcription factor that regulates the expression of target genes through interacting with cis-acting estrogen response elements (EREs). However, only a minority of ERalpha binding sites are located within the proximal promoter regions of responsive genes. Here we report the characterization of an ERE located 9kbp upstream of the TSS of the cathepsin D gene (CTSD) that up-regulates CTSD expression upon estrogen stimulation in MCF-7 cells. Using ChIP, we show recruitment of ERalpha and phosphorylated PolII at the CTSD distal enhancer region. Moreover, we determine the kinetics of transient CpG methylation on the promoter region of CTSD and for the first time, at a distal enhancer element. We show that ERalpha is crucial for long-distance regulation of CTSD expression involving a looping mechanism.

  2. The Important Elements of a Science Video

    Science.gov (United States)

    Harned, D. A.; Moorman, M.; McMahon, G.

    2012-12-01

    New technologies have revolutionized use of video as a means of communication. Films have become easier to create and to distribute. Video is omnipresent in our culture and supplements or even replaces writing in many applications. How can scientists and educators best use video to communicate scientific results? Video podcasts are being used in addition to journal, print, and online publications to communicate the relevance of scientific findings of the U.S. Geological Survey's (USGS) National Water-Quality Assessment (NAWQA) program to general audiences such as resource managers, educational groups, public officials, and the general public. In an effort to improve the production of science videos a survey was developed to provide insight into effective science communication with video. Viewers of USGS podcast videos were surveyed using Likert response- scaling to identify the important elements of science videos. The surveys were of 120 scientists and educators attending the 2010 and 2011 Fall Meetings of the American Geophysical Union and the 2012 meeting of the National Monitoring Council. The median age of the respondents was 44 years, with an education level of a Bachelor's Degree or higher. Respondents reported that their primary sources for watching science videos were YouTube and science websites. Video length was the single most important element associated with reaching the greatest number of viewers. The surveys indicated a median length of 5 minutes as appropriate for a web video, with 5-7 minutes the 25th-75th percentiles. An illustration of the effect of length: a 5-minute and a 20-minute version of a USGS film on the effect of urbanization on water-quality was made available on the same website. The short film has been downloaded 3 times more frequently than the longer film version. The survey showed that the most important elements to include in a science film are style elements including strong visuals, an engaging story, and a simple message, and

  3. Cannabinoid exposure during zebra finch sensorimotor vocal learning persistently alters expression of endocannabinoid signaling elements and acute agonist responsiveness

    Directory of Open Access Journals (Sweden)

    Lichtman Aron H

    2011-01-01

    Full Text Available Abstract Background Previously we have found that cannabinoid treatment of zebra finches during sensorimotor stages of vocal development alters song patterns produced in adulthood. Such persistently altered behavior must be attributable to changes in physiological substrates responsible for song. We are currently working to identify the nature of such physiological changes, and to understand how they contribute to altered vocal learning. One possibility is that developmental agonist exposure results in altered expression of elements of endocannabinoid signaling systems. To test this hypothesis we have studied effects of the potent cannabinoid receptor agonist WIN55212-2 (WIN on endocannabinoid levels and densities of CB1 immunostaining in zebra finch brain. Results We found that late postnatal WIN treatment caused a long-term global disregulation of both levels of the endocannabinoid, 2-arachidonyl glycerol (2-AG and densities of CB1 immunostaining across brain regions, while repeated cannabinoid treatment in adults produced few long-term changes in the endogenous cannabinoid system. Conclusions Our findings indicate that the zebra finch endocannabinoid system is particularly sensitive to exogenous agonist exposure during the critical period of song learning and provide insight into susceptible brain areas.

  4. Placental transfer of the actinides and related heavy elements

    International Nuclear Information System (INIS)

    Sikov, M.R.

    1987-01-01

    This manuscript presents a selective review of the literature dealing with prenatal exposure of experimental animals and humans to actinides and related heavy elements, and uses this information to consider comparative aspects of placental transfer and fetoplacental distribution. General patterns have been derived from typical quantitative values, and used to compare similarities and dissimilarities, and to examine factors responsible for observed differences. 37 refs.; 1 figure; 2 tabs

  5. Parameter Optimization of Multi-Element Synthetic Aperture Imaging Systems

    Directory of Open Access Journals (Sweden)

    Vera Behar

    2007-03-01

    Full Text Available In conventional ultrasound imaging systems with phased arrays, the further improvement of lateral resolution requires enlarging of the number of array elements that in turn increases both, the complexity and the cost, of imaging systems. Multi-element synthetic aperture focusing (MSAF systems are a very good alternative to conventional systems with phased arrays. The benefit of the synthetic aperture is in reduction of the system complexity, cost and acquisition time. In a MSAF system considered in the paper, a group of elements transmit and receive signals simultaneously, and the transmit beam is defocused to emulate a single element response. The echo received at each element of a receive sub-aperture is recorded in the computer memory. The process of transmission/reception is repeated for all positions of a transmit sub-aperture. All the data recordings associated with each corresponding pair "transmit-receive sub-aperture" are then focused synthetically producing a low-resolution image. The final high-resolution image is formed by summing of the all low-resolution images associated with transmit/receive sub-apertures. A problem of parameter optimization of a MSAF system is considered in this paper. The quality of imaging (lateral resolution and contrast is expressed in terms of the beam characteristics - beam width and side lobe level. The comparison between the MSAF system described in the paper and an equivalent conventional phased array system shows that the MSAF system acquires images of equivalent quality much faster using only a small part of the power per image.

  6. Dose determination algorithms for a nearly tissue equivalent multi-element thermoluminescent dosimeter

    International Nuclear Information System (INIS)

    Moscovitch, M.; Chamberlain, J.; Velbeck, K.J.

    1988-01-01

    In a continuing effort to develop dosimetric systems that will enable reliable interpretation of dosimeter readings in terms of the absorbed dose or dose-equivalent, a new multi-element TL dosimeter assembly for Beta and Gamma dose monitoring has been designed. The radiation-sensitive volumes are four LiF-TLD elements, each covered by its own unique filter. For media-matching, care has been taken to employ nearly tissue equivalent filters of thicknesses of 1000 mg/cm 2 and 300 mg/cm 2 for deep dose and dose to the lens-of-the-eye measurements respectively. Only one metal filter (Cu) is employed to provide low energy photon discrimination. A Thin TL element (0.09 mm thick) is located behind an open window designed to improve the energy under-response to low energy beta rays and to provide closer estimate of the shallow dose equivalent. The deep and shallow dose equivalents are derived from the correlation of the response of the various TL elements to the above quantities through computations based on previously defined relationships obtained from experimental results. The theoretical formalization for the dose calculation algorithms is described in detail, and provides a useful methodology which can be applied to different tissue-equivalent dosimeter assemblies. Experimental data has been obtained by performing irradiation according to the specifications established by DOELAP, using 27 types of pure and mixed radiation fields including Cs-137 gamma rays, low energy photons down to 20 keV, Sr/Y-90, Uranium, and Tl-204 beta particles

  7. The trace-elements of the atmospheric aerosol of the Amazon basin

    International Nuclear Information System (INIS)

    Orsini, C.M.Q.; Artaxo Netto, P.E.; Tabacniks, M.H.

    1981-05-01

    The distribution of the trace-elements AL, Si, P, S, CL, K, Ca, Ti, Fe and V in the atmospheric aerosol of the Amazon Basin was determined by means of samples collected between August 23 and September 2 of 1980, at a remote place located in the Amazon Forest, about 30 Km NE of the city of Manaus, Brazil. 33 samples were succesfully analyzed by the PIXE method (Particle Induced X-Ray Emission) by using α-particle beam of the Pelletron Accelerator of the University of Sao Paulo, and the results revealed that the trace-elements S and K have a large predominance, mainly as fine particle size relative to the others; this fact is consistent with the statement that the natural cycles of these two elements are critically involved in the biophysical processes responsible for the life of the tropical rain forest of the Amazon. (Author) [pt

  8. Enhancement of Immune Memory Responses to Respiratory Infection

    Science.gov (United States)

    2017-08-01

    AWARD NUMBER: W81XWH-16-1-0360 TITLE: Enhancement of Immune Memory Responses to Respiratory Infection PRINCIPAL INVESTIGATORs: Dr Min Chen PhD...5a. CONTRACT NUMBER Enhancement of Immune Memory Responses to Respiratory Infection 5b. GRANT NUMBER W81XWH-16-1-0360 5c. PROGRAM ELEMENT NUMBER...entitled “ENHANCEMENT OF IMMUNE MEMORY RESPONSES TO RESPIRATORY INFECTION: AUTOPHAGY IN MEMORY B-CELLS RESPONSE TO INFLUENZA VACCINE (AMBRIV

  9. Frequency response function (FRF) based updating of a laser spot welded structure

    Science.gov (United States)

    Zin, M. S. Mohd; Rani, M. N. Abdul; Yunus, M. A.; Sani, M. S. M.; Wan Iskandar Mirza, W. I. I.; Mat Isa, A. A.

    2018-04-01

    The objective of this paper is to present frequency response function (FRF) based updating as a method for matching the finite element (FE) model of a laser spot welded structure with a physical test structure. The FE model of the welded structure was developed using CQUAD4 and CWELD element connectors, and NASTRAN was used to calculate the natural frequencies, mode shapes and FRF. Minimization of the discrepancies between the finite element and experimental FRFs was carried out using the exceptional numerical capability of NASTRAN Sol 200. The experimental work was performed under free-free boundary conditions using LMS SCADAS. Avast improvement in the finite element FRF was achieved using the frequency response function (FRF) based updating with two different objective functions proposed.

  10. Artificial Neural Networks for Nonlinear Dynamic Response Simulation in Mechanical Systems

    DEFF Research Database (Denmark)

    Christiansen, Niels Hørbye; Høgsberg, Jan Becker; Winther, Ole

    2011-01-01

    It is shown how artificial neural networks can be trained to predict dynamic response of a simple nonlinear structure. Data generated using a nonlinear finite element model of a simplified wind turbine is used to train a one layer artificial neural network. When trained properly the network is ab...... to perform accurate response prediction much faster than the corresponding finite element model. Initial result indicate a reduction in cpu time by two orders of magnitude....

  11. Electromagnetic analysis of control element drive mechanism for KSNP

    International Nuclear Information System (INIS)

    Kim, H. M.; Kim, I. G.; Kim, I. Y.

    2002-01-01

    The magnetic jack type Control Element Drive Mechanism (CEDM) for Korean Standard Nuclear Power Plant (KSNP) is an electromechanical device which provides controlled linear motion to the Control Element Assembly (CEA) through the Extension Shaft Assembly (ESA) in response to operational signals received from the Control Element Drive Mechanism Control System (CEDMCS). The CEDM is operated by applying localized magnetic flux fields to movable latch and lift magnets, which are in the coolant pressure boundary. The CEDM design had been developed through electromechanical testing of the system including the magnetic force lifting the ESA. But it will be inefficient if parametric studies should be performed to improve the CEDM by test due to the consumption of high cost and long duration. So it becomes necessary to develop a computational model to simulate the electromagnetic characteristics of the CEDM to improve the CEDM design efficiently. In this paper, the electromagnetic analysis using a 2D finite element model has been carried out to simulate magnetic force of the lift magnet of the CEDM, to provide effective evaluation between leakage flux and lift force and to compare with test results. Analysis results show the lift force satisfied the test results and design requirement and the lift force depend on the shape of the components, leakage flux and B-H curve

  12. Estrogen-dependent downregulation of hairy and enhancer of split homolog-1 gene expression in breast cancer cells is mediated via a 3' distal element.

    Science.gov (United States)

    Müller, Patrick; Merrell, Kenneth W; Crofts, Justin D; Rönnlund, Caroline; Lin, Chin-Yo; Gustafsson, Jan-Ake; Ström, Anders

    2009-03-01

    Regulation of hairy and enhancer of split homologue-1 (HES-1) by estradiol and all-trans retinoic acid affects proliferation of human breast cancer cells. Here, we identify and characterize cis-regulatory elements involved in HES-1 regulation. In the distal 5' promoter of the HES-1 gene, we found a retinoic acid response element and in the distal 3' region, an estrogen receptor alpha(ER)alpha binding site. The ERalpha binding site, composed of an estrogen response element (ERE) and an ERE half-site, is important for both ERalpha binding and transcriptional regulation. Chromatin immunoprecipitation assays revealed that ERalpha is recruited to the ERE and associates with the HES-1 promoter. We also show recruitment of nuclear receptor co-regulators to the ERE in response to estradiol, followed by a decrease in histone acetylation and RNA polymerase II docking in the HES-1 promoter region. Our findings are consistent with a novel type of repressive estrogen response element in the distal 3' region of the HES-1 gene.

  13. Measurements of environmental gamma-ray spectra using a multi-element TL dosemeter

    International Nuclear Information System (INIS)

    Furuta, Sadaaki; Boetter-Jensen, L.; Nielsen, S.P.

    1986-12-01

    A method to estimate the energy distribution and dose of environmental gamma radiation was developed using a multielement TL dosemeter. Experimentally obtained energy responses from a multi-element TL dosemeter with different kinds of filters were used to calculate the energy distribution and related dose by the SAND-II computer code. The code was originally developed to estimate the neutron flux using a multiple foil activation method. Measurements were made at several locations with the multi-element TL dosemeter and comparisons were made with results from a NaI(Tl) scintillation detector and a high-pressure ionization chamber. (author)

  14. Environmental lichenology: Biomonitoring trace-element air pollution

    International Nuclear Information System (INIS)

    Sloof, J.E.

    1993-01-01

    Chapter 1 describes the possibilities to study trace-element air pollution in order to get insight in the character and element levels of such pollution. Chapter 2 describes two monitoring surveys using Parmelia sulcata Taylor on a national scale, in which spatial and temporal patterns of heavy metals were investigated. The surveys were carried out in 1982-1983 at 110 sampling sites and in 1986-1987 at 210 sampling sites. From these studies it was concluded that lichens are at least good qualitative biomonitors for atmospheric trace-element levels. Chapter 3 describes the response of lichens to the cesium-137 activity as a result of the Chernobyl accident, deposited by rainfall in the Netherlands. From this study it was concluded that lichens are good biomonitors for atmospheric cesium-137 activity too. Chapter 4 describes the application of factor analysis to a lichen data set from a monitoring survey on a national scale (1986-1987), for source apportionment. In Chapter 5 a field study is described on the contribution of a possible influence from the soil to element concentrations in Parmelia sulcata Taylor growing on trees in a an area with polluted soil. Chapter 6 describes a field study on the interchangeability of two tolerant lichen species (Parmelia sulcata Taylor and Lecanora conizaeoides Nyl.) in a polluted area. In Chapter 7 a field study is described in which the quantitative relationships between concentrations of cobalt, scandium and zinc in lichens and concentrations in air particulate matter and total deposition (wet and dry) were investigated. Chapter 8 describes a laboratory study on the kinetics of the uptake-and release of cadmium in a green algae species (Selenastrum capricornutum Printz), which is regarded to be representative for the algal symboint in the lichens used in this thesis. Chapter 9 presents the central conclusions of this thesis for the lichen species, elements and conditions under study. (orig./MG)

  15. Environmental lichenology: Biomonitoring trace-element air pollution

    Energy Technology Data Exchange (ETDEWEB)

    Sloof, J E

    1993-09-27

    Chapter 1 describes the possibilities to study trace-element air pollution in order to get insight in the character and element levels of such pollution. Chapter 2 describes two monitoring surveys using Parmelia sulcata Taylor on a national scale, in which spatial and temporal patterns of heavy metals were investigated. The surveys were carried out in 1982-1983 at 110 sampling sites and in 1986-1987 at 210 sampling sites. From these studies it was concluded that lichens are at least good qualitative biomonitors for atmospheric trace-element levels. Chapter 3 describes the response of lichens to the cesium-137 activity as a result of the Chernobyl accident, deposited by rainfall in the Netherlands. From this study it was concluded that lichens are good biomonitors for atmospheric cesium-137 activity too. Chapter 4 describes the application of factor analysis to a lichen data set from a monitoring survey on a national scale (1986-1987), for source apportionment. In Chapter 5 a field study is described on the contribution of a possible influence from the soil to element concentrations in Parmelia sulcata Taylor growing on trees in a an area with polluted soil. Chapter 6 describes a field study on the interchangeability of two tolerant lichen species (Parmelia sulcata Taylor and Lecanora conizaeoides Nyl.) in a polluted area. In Chapter 7 a field study is described in which the quantitative relationships between concentrations of cobalt, scandium and zinc in lichens and concentrations in air particulate matter and total deposition (wet and dry) were investigated. Chapter 8 describes a laboratory study on the kinetics of the uptake-and release of cadmium in a green algae species (Selenastrum capricornutum Printz), which is regarded to be representative for the algal symboint in the lichens used in this thesis. Chapter 9 presents the central conclusions of this thesis for the lichen species, elements and conditions under study. (orig./MG).

  16. Elastic-plastic and creep analyses by assumed stress finite elements

    International Nuclear Information System (INIS)

    Pian, T.H.H.; Spilker, R.L.; Lee, S.W.

    1975-01-01

    A formulation is presented of incremental finite element solutions for both initial stress and initial strain problems based on modified complementary energy principle with relaxed inter-element continuity requirement. The corresponding finite element model is the assumed stress hybrid model which has stress parameters in the interior of each element and displacements at the individual nodes as unknowns. The formulation includes an important consideration that the states of stress and strain and the beginning of each increment may not satisfy the equilibrium and compatibility equations. These imbalance and mismatch conditions all lead to correction terms for the equivalent nodal forces of the matrix equations. The initial stress method is applied to elastic-plastic analysis of structures. In this case the stress parameters for the individual elements can be eliminated resulting to a system of equations with only nodal displacements as unknowns. Two different complementary energy principles can be formulated, in one of which the equilibrium of the final state of stress is maintained while in the other the equilibrium of the stress increments is maintained. Each of these two different formulations can be combined with different iterative schemes to be used at each incremental steps of the elastic-plastic analysis. It is also indicated clearly that for the initial stress method the state of stress at the beginning of each increments is in general, not in equilibrium and an imbalance correction is needed. Results of a comprehensive evaluation of various solution procedures by the initial stress method using the assumed stress hybrid elements are presented. The example used is the static response of a thick wall cylinder of elastic-perfectly plastic material under internal pressure. Solid of revolution elements with rectangular cross sections are used

  17. Hotspots for Vitamin-Steroid-Thyroid Hormone Response Elements Within Switch Regions of Immunoglobulin Heavy Chain Loci Predict a Direct Influence of Vitamins and Hormones on B Cell Class Switch Recombination.

    Science.gov (United States)

    Hurwitz, Julia L; Penkert, Rhiannon R; Xu, Beisi; Fan, Yiping; Partridge, Janet F; Maul, Robert W; Gearhart, Patricia J

    2016-03-01

    Vitamin A deficiencies are common throughout the world and have a significant negative influence on immune protection against viral infections. Mouse models demonstrate that the production of IgA, a first line of defense against viruses at mucosal sites, is inhibited in the context of vitamin A deficiency. In vitro, the addition of vitamin A to activated B cells can enhance IgA expression, but downregulate IgE. Previous reports have demonstrated that vitamin A modifies cytokine patterns, and in so doing may influence antibody isotype expression by an indirect mechanism. However, we have now discovered hundreds of potential response elements among Sμ, Sɛ, and Sα switch sites within immunoglobulin heavy chain loci. These hotspots appear in both mouse and human loci and include targets for vitamin receptors and related proteins (e.g., estrogen receptors) in the nuclear receptor superfamily. Full response elements with direct repeats are relatively infrequent or absent in Sγ regions although half-sites are present. Based on these results, we pose a hypothesis that nuclear receptors have a direct effect on the immunoglobulin heavy chain class switch recombination event. We propose that vitamin A may alter S site accessibility to activation-induced deaminase and nonhomologous end-joining machinery, thereby influencing the isotype switch, antibody production, and protection against viral infections at mucosal sites.

  18. Deep-sea mud in the Pacific Ocean as a potential resource for rare-earth elements

    Science.gov (United States)

    Kato, Yasuhiro; Fujinaga, Koichiro; Nakamura, Kentaro; Takaya, Yutaro; Kitamura, Kenichi; Ohta, Junichiro; Toda, Ryuichi; Nakashima, Takuya; Iwamori, Hikaru

    2011-08-01

    World demand for rare-earth elements and the metal yttrium--which are crucial for novel electronic equipment and green-energy technologies--is increasing rapidly. Several types of seafloor sediment harbour high concentrations of these elements. However, seafloor sediments have not been regarded as a rare-earth element and yttrium resource, because data on the spatial distribution of these deposits are insufficient. Here, we report measurements of the elemental composition of over 2,000 seafloor sediments, sampled at depth intervals of around one metre, at 78 sites that cover a large part of the Pacific Ocean. We show that deep-sea mud contains high concentrations of rare-earth elements and yttrium at numerous sites throughout the eastern South and central North Pacific. We estimate that an area of just one square kilometre, surrounding one of the sampling sites, could provide one-fifth of the current annual world consumption of these elements. Uptake of rare-earth elements and yttrium by mineral phases such as hydrothermal iron-oxyhydroxides and phillipsite seems to be responsible for their high concentration. We show that rare-earth elements and yttrium are readily recovered from the mud by simple acid leaching, and suggest that deep-sea mud constitutes a highly promising huge resource for these elements.

  19. Development of efficient finite elements for structural integrity analysis of solid rocket motor propellant grains

    International Nuclear Information System (INIS)

    Marimuthu, R.; Nageswara Rao, B.

    2013-01-01

    Solid propellant rocket motors (SRM) are regularly used in the satellite launch vehicles which consist of mainly three different structural materials viz., solid propellant, liner, and casing materials. It is essential to assess the structural integrity of solid propellant grains under the specified gravity, thermal and pressure loading conditions. For this purpose finite elements developed following the Herrmann formulation are: twenty node brick element (BH20), eight node quadrilateral plane strain element (PH8) and, eight node axi-symmetric solid of revolution element (AH8). The time-dependent nature of the solid propellant grains is taken into account utilizing the direct inverse method of Schepary to specify the effective Young's modulus and Poisson's ratio. The developed elements are tested considering various problems prior to implementation in the in-house software package (viz., Finite Element Analysis of STructures, FEAST). Several SRM configurations are analyzed to assess the structural integrity under different loading conditions. Finite element analysis results are found to be in good agreement with those obtained earlier from MARC software. -- Highlights: • Developed efficient Herrmann elements. • Accuracy of finite elements demonstrated solving several known solution problems. • Time dependent structural response obtained using the direct inverse method of Schepary. • Performed structural analysis of grains under gravity, thermal and pressure loads

  20. Development and applications of a flat triangular element for thin laminated shells

    Science.gov (United States)

    Mohan, P.

    updated Lagrangian formulation of the flat shell element and have been validated using standard examples in the literature involving deformation-dependent pressure loads. The element can be used to obtain the nonlinear response of the tent structure under wind and snow loads. (Abstract shortened by UMI.)

  1. Transcriptional changes underlying elemental stoichiometry shifts in a marine heterotrophic bacterium

    Directory of Open Access Journals (Sweden)

    Leong-Keat eChan

    2012-05-01

    Full Text Available Marine bacteria drive the biogeochemical processing of oceanic dissolved organic carbon (DOC, a 750-Tg C reservoir that is a critical component of the global C cycle. Catabolism of DOC is thought to be regulated by the biomass composition of heterotrophic bacteria, as cells maintain a C:N:P ratio of ~50:10:1 during DOC processing. Yet a complicating factor in stoichiometry-based analyses is that bacteria can change the C:N:P ratio of their biomass in response to resource composition. We investigated the physiological mechanisms of resource-driven shifts in biomass stoichiometry in continuous cultures of the marine heterotrophic bacterium Ruegeria pomeroyi (a member of the Roseobacter clade under four element limitation regimes (C, N, P, and S. Microarray analysis indicated that the bacterium scavenged for alternate sources of the scarce element when cells were C-, N-, or P-limited; reworked the ratios of biomolecules when C- and P- limited; and exerted tighter control over import/export and cytoplasmic pools when N-limited. Under S-limitation, a scenario not existing naturally for surface ocean microbes, stress responses dominated transcriptional changes. Resource-driven changes in C:N ratios of up to 2.5-fold and in C:P ratios of up to 6-fold were measured in R. pomeroyi biomass. These changes were best explained if the C and P content of the cells was flexible in the face of shifting resources but N content was not, achieved through the net balance of different transcriptional strategies. The cellular-level metabolic trade-offs that govern biomass stoichiometery in R. pomeroyi may have implications for global carbon cycling. Strong homeostatic responses to N limitation by heterotrophic marine bacteria would intensify competition with autotrophs. Modification of cellular inventories in C- and P-limited heterotrophs would vary the elemental ratio of particulate organic matter sequestered in the deep ocean.

  2. Finite element modeling of piezoelectric elements with complex electrode configuration

    International Nuclear Information System (INIS)

    Paradies, R; Schläpfer, B

    2009-01-01

    It is well known that the material properties of piezoelectric materials strongly depend on the state of polarization of the individual element. While an unpolarized material exhibits mechanically isotropic material properties in the absence of global piezoelectric capabilities, the piezoelectric material properties become transversally isotropic with respect to the polarization direction after polarization. Therefore, for evaluating piezoelectric elements the material properties, including the coupling between the mechanical and the electromechanical behavior, should be addressed correctly. This is of special importance for the micromechanical description of piezoelectric elements with interdigitated electrodes (IDEs). The best known representatives of this group are active fiber composites (AFCs), macro fiber composites (MFCs) and the radial field diaphragm (RFD), respectively. While the material properties are available for a piezoelectric wafer with a homogeneous polarization perpendicular to its plane as postulated in the so-called uniform field model (UFM), the same information is missing for piezoelectric elements with more complex electrode configurations like the above-mentioned ones with IDEs. This is due to the inhomogeneous field distribution which does not automatically allow for the correct assignment of the material, i.e. orientation and property. A variation of the material orientation as well as the material properties can be accomplished by including the polarization process of the piezoelectric transducer in the finite element (FE) simulation prior to the actual load case to be investigated. A corresponding procedure is presented which automatically assigns the piezoelectric material properties, e.g. elasticity matrix, permittivity, and charge vector, for finite element models (FEMs) describing piezoelectric transducers according to the electric field distribution (field orientation and strength) in the structure. A corresponding code has been

  3. Rare (Earth Elements [score

    Directory of Open Access Journals (Sweden)

    Camilo Méndez

    2014-12-01

    Full Text Available Rare (Earth Elements is a cycle of works for solo piano. The cycle was inspired by James Dillon’s Book of Elements (Vol. I-V. The complete cycle will consist of 14 pieces; one for each selected rare (earth element. The chosen elements are Neodymium, Erbium, Tellurium, Hafnium, Tantalum, Technetium, Indium, Dysprosium, Lanthanium, Cerium, Europium, Terbium, Yttrium and Darmstadtium. These elements were selected due to their special atomic properties that in many cases make them extremely valuable for the development of new technologies, and also because of their scarcity. To date, only 4 works have been completed Yttrium, Technetium, Indium and Tellurium.

  4. Numerical techniques for the improved performance of a finite element approach to wind turbine aeroelastics

    Energy Technology Data Exchange (ETDEWEB)

    Anderson, M.B. [Renewable Energy Systems Ltd., Hemel Hempstead (United Kingdom)

    1996-09-01

    It is possible to compute the aeroelastic response of a horizontal axis wind turbine comprising; Structural: rotor substructure 144 dof, tower substructure 48 dof, induction, synchronous or variable speed, and gearbox. Aerodynamic: 3 blades (10 elements per blade), dynamic stall, and 6 different aerofoil types with combination of fixed or pitching elements. Control: stall or power regulation or speed control and shutdowns, wind shear, and tower shadow. Turbulence: 8 radial points, 32 circumferential, and 3 components. On a DEC Alpha Workstation the code will simulate the response inclose to real-time. As the code is presently formulated deflections from the initial starting point have to be small and therefore its ability to fully analyse very flexible structures is limited. (EG)

  5. Expression of phosphorylated cAMP response element binding protein (p-CREB) in bladder afferent pathways in VIP-/- mice with cyclophosphamide (CYP)-induced cystitis

    DEFF Research Database (Denmark)

    Jensen, Dorthe G; Studeny, Simon; May, Victor

    2008-01-01

    The expression of phosphorylated cAMP response element binding protein (p-CREB) in dorsal root ganglia (DRG) with and without cyclophosphamide (CYP)-induced cystitis (150 mg/kg, i.p; 48 h) was determined in VIP(-/-) and wild-type (WT) mice. p-CREB immunoreactivity (IR) was determined in bladder...... (Fast blue) afferent cells. Nerve growth factor (NGF) bladder content was determined by enzyme-linked immunosorbent assays. Basal expression of p-CREB-IR in DRG of VIP(-/-) mice was (p DRG compared to WT mice. CYP treatment in WT mice increased (p ...-CREB-IR in L1, L2, L5-S1 DRG. CYP treatment in VIP(-/-) mice (p DRG compared to WT with CYP. In WT mice, bladder afferent cells (20-38%) in DRG expressed p-CREB-IR under basal conditions. With CYP, p-CREB-IR increased in bladder afferent cells (60...

  6. Response of subassembly model with internals

    International Nuclear Information System (INIS)

    Kennedy, J.M.; Belytschko, T.

    1977-01-01

    For the purpose of predicting the structural response in such accident environments, a program STRAW has been developed. This is a finite element program which can treat the structure-fluid system consisting of the coolant and the subassembly walls. Both material nonlinearities due to elastic-plastic response and geometric nonlinearities due to large displacements can be treated. The energy source can be represented either by a pressure-time history or an equation of state. Because of the lack of any simplifying symmetry in the geometry of the subassembly the program uses a quasi-three dimensional model. The cross section of the accident hexcan and the adjacent hexcan are modelled by a two-dimensional finite element mesh which represents the hexcan walls by flexural element and the internals by two-dimensional continuum elements. This mesh is coupled to a series of one-dimensional elements which represent the axial flow of the coolant and the longitudinal stiffness of the fuel pins and hexcan. The latter is of importance in the adjacent hexcan, for its lateral displacement is resisted entirely by this flexural behavior and its inertia. The adequacy of such quasi-three dimensional models has been examined by comparing the STRAW results against almost complete three-dimensonal analysis performed with the REXCAT program. In this program, the accident hexcan is represented in a true three-dimensional sense by plate-shell elements, whereas the internals are represented as axisymmetric. These comparisons indicate that the quasi-three-dimensional approach employed in STRAW is valid for a large range of pressure time histories; the fidelity of this model suffers primarily when pressure reaches a peak over a very short time, such as 5-10 microseconds

  7. Extended spectrum β-lactamases, carbapenemases and mobile genetic elements responsible for antibiotics resistance in Gram-negative bacteria.

    Science.gov (United States)

    El Salabi, Allaaeddin; Walsh, Timothey R; Chouchani, Chedly

    2013-05-01

    Infectious diseases due to Gram-negative bacteria are a leading cause of morbidity and mortality worldwide. Antimicrobial agents represent one major therapeutic tools implicated to treat these infections. The misuse of antimicrobial agents has resulted in the emergence of resistant strains of Gram-negatives in particular Enterobacteriaceae and non-fermenters; they have an effect not only on a human but on the public health when bacteria use the resistance mechanisms to spread in the hospital environment and to the community outside the hospitals by means of mobile genetic elements. Gram-negative bacteria have become increasingly resistant to antimicrobial agents. They have developed several mechanisms by which they can withstand to antimicrobials, these mechanisms include the production of Extended-spectrum β-lactamases (ESBLs) and carbapenemases, furthermore, Gram-negative bacteria are now capable of spreading such resistance between members of the family Enterobacteriaceae and non-fermenters using mobile genetic elements as vehicles for such resistance mechanisms rendering antibiotics useless. Therefore, addressing the issue of mechanisms of antimicrobial resistance is considered one of most urgent priorities. This review will help to illustrate different resistance mechanisms; ESBLs, carbapenemases encoded by genes carried by mobile genetic elements, which are used by Gram-negative bacteria to escape antimicrobial effect.

  8. Estimation of trace elements in some anti-diabetic medicinal plants using PIXE technique

    International Nuclear Information System (INIS)

    Naga Raju, G.J.; Sarita, P.; Ramana Murty, G.A.V.; Ravi Kumar, M.; Seetharami Reddy, B.; John Charles, M.; Lakshminarayana, S.; Seshi Reddy, T.; Reddy, S. Bhuloka; Vijayan, V.

    2006-01-01

    Trace elemental analysis was carried out in various parts of some anti-diabetic medicinal plants using PIXE technique. A 3 MeV proton beam was used to excite the samples. The elements Cl, K, Ca, Ti, Cr, Mn, Fe, Ni, Cu, Zn, Br, Rb and Sr were identified and their concentrations were estimated. The results of the present study provide justification for the usage of these medicinal plants in the treatment of diabetes mellitus (DM) since they are found to contain appreciable amounts of the elements K, Ca, Cr, Mn, Cu, and Zn, which are responsible for potentiating insulin action. Our results show that the analyzed medicinal plants can be considered as potential sources for providing a reasonable amount of the required elements other than diet to the patients of DM. Moreover, these results can be used to set new standards for prescribing the dosage of the herbal drugs prepared from these plant materials

  9. Absence of respiratory inflammatory reaction of elemental sulfur using the California Pesticide Illness Database and a mouse model.

    Science.gov (United States)

    Lee, Kiyoung; Smith, Jodi L; Last, Jerold A

    2005-01-01

    Elemental sulfur, a natural substance, is used as a fungicide. Elemental sulfur is the most heavily used agricultural chemical in California. In 2003, annual sulfur usage in California was about 34% of the total weight of pesticide active ingredient used in production agriculture. Even though sulfur is mostly used in dust form, the respiratory health effects of elemental sulfur are not well documented. The purpose of this paper is to address the possible respiratory effect of elemental sulfur using the California Pesticide Illness Database and laboratory experiments with mice. We analyzed the California Pesticide Illness Database between 1991 and 2001. Among 127 reports of definite, probable, and possible illness involving sulfur, 21 cases (16%) were identified as respiratory related. A mouse model was used to examine whether there was an inflammatory or fibrotic response to elemental sulfur. Dust solutions were injected intratracheally into ovalbumin sensitized mice and lung damage was evaluated. Lung inflammatory response was analyzed via total lavage cell counts and differentials, and airway collagen content was analyzed histologically and biochemically. No significant differences from controls were seen in animals exposed to sulfur particles. The findings suggest that acute exposure of elemental sulfur itself may not cause an inflammatory reaction. However, further studies are needed to understand the possible health effects of chronic sulfur exposure and environmental weathering of sulfur dust.

  10. Effective operational oil spill response planning

    International Nuclear Information System (INIS)

    Meyers, R.J.

    1991-01-01

    An operational Contingency Plan is one of the single most important aspects of effective oil spill response operations. It is a spill control game plan. A thorough contingency plan provides a set of guidelines that can be used to help direct all phases of spill response activities. More than simple a compilation of lists and rosters, the contingency plan reflects strategic and philosophical elements of spill response that help to ensure a viable response to any spill incident. Facilities and oil carrying vessels should have well maintained contingency plans with these features. This paper describes the requirement for effective oil spill response pans and the training required to exercise them

  11. Environmental controls on the elemental composition of a Southern Hemisphere strain of the coccolithophore Emiliania huxleyi

    Directory of Open Access Journals (Sweden)

    Y. Feng

    2018-01-01

    Full Text Available A series of semi-continuous incubation experiments were conducted with the coccolithophore Emiliania huxleyi strain NIWA1108 (Southern Ocean isolate to examine the effects of five environmental drivers (nitrate and phosphate concentrations, irradiance, temperature, and partial pressure of CO2 (pCO2 on both the physiological rates and elemental composition of the coccolithophore. Here, we report the alteration of the elemental composition of E. huxleyi in response to the changes in these environmental drivers. A series of dose–response curves for the cellular elemental composition of E. huxleyi were fitted for each of the five drivers across an environmentally representative gradient. The importance of each driver in regulating the elemental composition of E. huxleyi was ranked using a semi-quantitative approach. The percentage variations in elemental composition arising from the change in each driver between present-day and model-projected conditions for the year 2100 were calculated. Temperature was the most important driver controlling both cellular particulate organic and inorganic carbon content, whereas nutrient concentrations were the most important regulator of cellular particulate nitrogen and phosphorus of E. huxleyi. In contrast, elevated pCO2 had the greatest influence on cellular particulate inorganic carbon to organic carbon ratio, resulting in a decrease in the ratio. Our results indicate that the different environmental drivers play specific roles in regulating the elemental composition of E. huxleyi with wide-reaching implications for coccolithophore-related marine biogeochemical cycles, as a consequence of the regulation of E. huxleyi physiological processes.

  12. CONDOR: neutronic code for fuel elements calculation with rods

    International Nuclear Information System (INIS)

    Villarino, E.A.

    1990-01-01

    CONDOR neutronic code is used for the calculation of fuel elements formed by fuel rods. The method employed to obtain the neutronic flux is that of collision probabilities in a multigroup scheme on two-dimensional geometry. This code utilizes new calculation algorithms and normalization of such collision probabilities. Burn-up calculations can be made before the alternative of applying variational methods for response flux calculations or those corresponding to collision normalization. (Author) [es

  13. The response to September 11: a disaster case study.

    Science.gov (United States)

    Crane, Michael A; Levy-Carrick, Nomi C; Crowley, Laura; Barnhart, Stephanie; Dudas, Melissa; Onuoha, Uchechukwu; Globina, Yelena; Haile, Winta; Shukla, Gauri; Ozbay, Fatih

    2014-01-01

    The response to 9/11 continues into its 14th year. The World Trade Center Health Program (WTCHP), a long-term monitoring and treatment program now funded by the Zadroga Act of 2010, includes >60,000 World Trade Center (WTC) disaster responders and community members ("survivors"). The aim of this review is to identify several elements that have had a critical impact on the evolution of the WTC response and, directly or indirectly, the health of the WTC-exposed population. It further explores post-disaster monitoring efforts, recent scientific findings from the WTCHP, and some implications of this experience for ongoing and future environmental disaster response. Transparency and responsiveness, site safety and worker training, assessment of acute and chronic exposure, and development of clinical expertise are interconnected elements determining efficacy of disaster response. Even in a relatively well-resourced environment, challenges regarding allocation of appropriate attention to vulnerable populations and integration of treatment response to significant medical and mental health comorbidities remain areas of ongoing programmatic development. Copyright © 2014 Icahn School of Medicine at Mount Sinai. All rights reserved.

  14. Nonlinear vibrations of thin arbitrarily laminated composite plates subjected to harmonic excitations using DKT elements

    Science.gov (United States)

    Chiang, C. K.; Xue, David Y.; Mei, Chuh

    1993-04-01

    A finite element formulation is presented for determining the large-amplitude free and steady-state forced vibration response of arbitrarily laminated anisotropic composite thin plates using the Discrete Kirchhoff Theory (DKT) triangular elements. The nonlinear stiffness and harmonic force matrices of an arbitrarily laminated composite triangular plate element are developed for nonlinear free and forced vibration analyses. The linearized updated-mode method with nonlinear time function approximation is employed for the solution of the system nonlinear eigenvalue equations. The amplitude-frequency relations for convergence with gridwork refinement, triangular plates, different boundary conditions, lamination angles, number of plies, and uniform versus concentrated loads are presented.

  15. Identification of a growth hormone-responsive STAT5-binding element in the rat insulin 1 gene

    DEFF Research Database (Denmark)

    Galsgaard, E D; Gouilleux, F; Groner, B

    1996-01-01

    promoter activity 2-fold, and this stimulation was abolished by introduction of a block mutation in a gamma-interferon-activated sequence (GAS)-like element (GLE) with the sequence 5'-TTCTGGGAA-3' located in the rat insulin 1 enhancer at position -330 to -322. This element, termed Ins-GLE, was able...... transfected with STAT5 and GH receptor cDNAs, it was found that expression of STAT5 was necessary for GH induction of these two DNA-binding complexes. These results suggest that GH stimulates insulin 1 promoter activity by inducing the binding of STAT5 to Ins-GLE.......GH and PRL stimulate both proliferation and insulin production in pancreatic beta-cells as well as in the rat insulinoma cell line RIN-5AH, We report here that human GH increases insulin mRNA levels in RIN-5AH cells via both somatogenic and lactogenic receptors. GH stimulated the rat insulin 1...

  16. Defective distal regulatory element at the 5' upstream of rat prolactin gene of steroid-nonresponsive GH-subclone.

    Science.gov (United States)

    Kumar, V; Wong, D T; Pasion, S G; Biswas, D K

    1987-12-08

    The prolactin-nonproducing (PRL-) GH cell strains (rat pituitary tumor cells in culture). GH12C1 and F1BGH12C1, do not respond to steroid hormones estradiol or hydrocortisone (HC). However, the stimulatory effect of estradiol and the inhibitory effect of hydrocortisone on prolactin synthesis can be demonstrated in the prolactin-producing GH cell strain, GH4C1. In this investigation we have examined the 5' end flanking region of rat prolactin (rat PRL) gene of steroid-responsive, GH4C1 cells to identify the positive and negative regulatory elements and to verify the status of these elements in steroid-nonresponsive F1BGH12C1 cells. Results presented in this report demonstrate that the basel level expression of the co-transferred Neo gene (neomycin phosphoribosyl transferase) is modulated by the distal upstream regulatory elements of rat PRL gene in response to steroid hormones. The expression of adjacent Neo gene is inhibited by dexamethasone and is stimulated by estradiol in transfectants carrying distal regulatory elements (SRE) of steroid-responsive cells. These responses are not observed in transfectants with the rat PRL upstream sequences derived from steroid-nonresponsive cells. The basal level expression of the host cell alpha-2 tubulin gene is not affected by dexamethasone. We report here the identification of the distal steroid regulatory element (SRE) located between 3.8 and 7.8 kb upstream of the transcription initiation site of rat PRL gene. Both the positive and the negative effects of steroid hormones can be identified within this upstream sequence. This distal SRE appears to be nonfunctional in steroid-nonresponsive cells. Though the proximal SRE is functional, the defect in the distal SRE makes the GH substrain nonresponsive to steroid hormones. These results suggest that both the proximal and the distal SREs are essential for the mediation of action of steroid hormones in GH cells.

  17. A two-dimensional, finite-element methods for calculating TF coil response to out-of-plane Lorentz forces

    International Nuclear Information System (INIS)

    Witt, R.J.

    1989-01-01

    Toroidal field (TF) coils in fusion systems are routinely operated at very high magnetic fields. While obtaining the response of the coil to in-plane loads is relatively straightforward, the same is not true for the out-of-plane loads. Previous treatments of the out-of-plane problem have involved large, three-dimensional finite element idealizations. A new treatment of the out-of-plane problem is presented here; the model is two-dimensional in nature, and consumes far less CPU-time than three-dimensional methods. The approach assumes there exists a region of torsional deformation in the inboard leg and a bending region in the outboard leg. It also assumes the outboard part of the coil is attached to a torque frame/cylinder, which experiences primarily torsional deformation. Three-dimensional transition regions exist between the inboard and outboard legs and between the outboard leg and the torque frame. By considering several idealized problems of cylindrical shells subjected to moment distributions, it is shown that the size of these three-dimensional regions is quite small, and that the interaction between the torsional and bending regions can be treated in an equivalent two-dimensional fashion. Equivalent stiffnesses are derived to model penetration into and twist along the cylinders. These stiffnesses are then used in a special substructuring analysis to couple the three regions together. Results from the new method are compared to results from a 3D continuum model. (orig.)

  18. Elements of a new climate agreement by 2015

    Energy Technology Data Exchange (ETDEWEB)

    Holm Olsen, K.; Fenhann, J.; Luetken, S.

    2013-06-15

    This year's Perspectives from UNEP and UNEP Risoe Centre in collaboration with the Global Green Growth Institute (GGGI) focuses on the elements of a new climate agreement by 2015 that will contribute to achieve the 2 deg. C limit for global warming. The first paper in this publication frames the global mitigation challenge based on the UNEP Emissions Gap Report 2012. The five other articles address key elements of a new climate agreement; emissions from international aviation, a vision for carbon markets up to 2020 and beyond, how green growth strategies can address the emissions gap, redesign of a REDD+ mechanism in response to the crisis of global deforestation and how NAMAs in Southern Africa can reconcile the gap between local and global objectives for development and climate change mitigation. The Perspectives series seeks to inspire policy- and decision makers by communicating the diverse insights and visions of leading actors in the arena of low carbon development in developing countries. (Author)

  19. Finite element modeling of micromachined MEMS photon devices

    Science.gov (United States)

    Evans, Boyd M., III; Schonberger, D. W.; Datskos, Panos G.

    1999-09-01

    The technology of microelectronics that has evolved over the past half century is one of great power and sophistication and can now be extended to many applications (MEMS and MOEMS) other than electronics. An interesting application of MEMS quantum devices is the detection of electromagnetic radiation. The operation principle of MEMS quantum devices is based on the photoinduced stress in semiconductors, and the photon detection results from the measurement of the photoinduced bending. These devices can be described as micromechanical photon detectors. In this work, we have developed a technique for simulating electronic stresses using finite element analysis. We have used our technique to model the response of micromechanical photon devices to external stimuli and compared these results with experimental data. Material properties, geometry, and bimaterial design play an important role in the performance of micromechanical photon detectors. We have modeled these effects using finite element analysis and included the effects of bimaterial thickness coating, effective length of the device, width, and thickness.

  20. Finite Element Modeling of Micromachined MEMS Photon Devices

    International Nuclear Information System (INIS)

    Datskos, P.G.; Evans, B.M.; Schonberger, D.

    1999-01-01

    The technology of microelectronics that has evolved over the past half century is one of great power and sophistication and can now be extended to many applications (MEMS and MOEMS) other than electronics. An interesting application of MEMS quantum devices is the detection of electromagnetic radiation. The operation principle of MEMS quantum devices is based on the photoinduced stress in semiconductors, and the photon detection results from the measurement of the photoinduced bending. These devices can be described as micromechanical photon detectors. In this work, we have developed a technique for simulating electronic stresses using finite element analysis. We have used our technique to model the response of micromechanical photon devices to external stimuli and compared these results with experimental data. Material properties, geometry, and bimaterial design play an important role in the performance of micromechanical photon detectors. We have modeled these effects using finite element analysis and included the effects of bimaterial thickness coating, effective length of the device, width, and thickness

  1. Basic Finite Element Method

    International Nuclear Information System (INIS)

    Lee, Byeong Hae

    1992-02-01

    This book gives descriptions of basic finite element method, which includes basic finite element method and data, black box, writing of data, definition of VECTOR, definition of matrix, matrix and multiplication of matrix, addition of matrix, and unit matrix, conception of hardness matrix like spring power and displacement, governed equation of an elastic body, finite element method, Fortran method and programming such as composition of computer, order of programming and data card and Fortran card, finite element program and application of nonelastic problem.

  2. Trace element emissions from coal

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2012-09-15

    Trace elements are emitted during coal combustion. The quantity, in general, depends on the physical and chemical properties of the element itself, the concentration of the element in the coal, the combustion conditions and the type of particulate control device used, and its collection efficiency as a function of particle size. Some trace elements become concentrated in certain particle streams following combustion such as bottom ash, fly ash, and flue gas particulate matter, while others do not. Various classification schemes have been developed to describe this partitioning behaviour. These classification schemes generally distinguish between: Class 1: elements that are approximately equally concentrated in the fly ash and bottom ash, or show little or no fine particle enrichment, examples include Mn, Be, Co and Cr; Class 2: elements that are enriched in the fly ash relative to bottom ash, or show increasing enrichment with decreasing particle size, examples include As, Cd, Pb and Sb; Class 3: elements which are emitted in the gas phase (primarily Hg (not discussed in this review), and in some cases, Se). Control of class 1 trace elements is directly related to control of total particulate matter emissions, while control of the class 2 elements depends on collection of fine particulates. Due to the variability in particulate control device efficiencies, emission rates of these elements can vary substantially. The volatility of class 3 elements means that particulate controls have only a limited impact on the emissions of these elements.

  3. Nuclear fuel element

    International Nuclear Information System (INIS)

    Grossman, L.N.; Levin, H.A.

    1975-01-01

    A nuclear fuel element has disposed therein an alloy having the essential components of nickel, titanium and zirconium, and the alloy reacts with water, water vapor and reactive gases at reactor ambient temperatures. The alloy is disposed in the plenum of the fuel element in the form of particles in a hollow gas permeable container having a multiplicity of openings of size smallr than the size of the particles. The container is preferably held in the spring in the plenum of the fuel element. (E.C.B.)

  4. Standard elements; Elements standards

    Energy Technology Data Exchange (ETDEWEB)

    Blanc, B [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

    1958-07-01

    Following his own experience the author recalls the various advantages, especially in the laboratory, of having pre-fabricated vacuum-line components at his disposal. (author) [French] A la suite de sa propre experience, l'auteur veut rappeler les divers avantages que presente, tout particulierement en laboratoire, le fait d'avoir a sa disposition des elements pre-fabriques de canalisations a vide. (auteur)

  5. Statistical Energy Analysis (SEA) and Energy Finite Element Analysis (EFEA) Predictions for a Floor-Equipped Composite Cylinder

    Science.gov (United States)

    Grosveld, Ferdinand W.; Schiller, Noah H.; Cabell, Randolph H.

    2011-01-01

    Comet Enflow is a commercially available, high frequency vibroacoustic analysis software founded on Energy Finite Element Analysis (EFEA) and Energy Boundary Element Analysis (EBEA). Energy Finite Element Analysis (EFEA) was validated on a floor-equipped composite cylinder by comparing EFEA vibroacoustic response predictions with Statistical Energy Analysis (SEA) and experimental results. Statistical Energy Analysis (SEA) predictions were made using the commercial software program VA One 2009 from ESI Group. The frequency region of interest for this study covers the one-third octave bands with center frequencies from 100 Hz to 4000 Hz.

  6. Transplutonium elements - a literature survey

    International Nuclear Information System (INIS)

    Sivaramakrishnan, C.K.; Jadhav, A.V.

    1974-01-01

    The report surveys reported work on the discovery of transplutonium elements and their production through various methods like bombardment of heavy elements with charged ions, successive neutron captures on heavy elements in reactors and multiple neutron captures by heavy elements during nuclear explosions. Estimated yields of transplutonium elements in special targets irradiated in reactors, and also as byproducts from spent power reactor fuels are quoted. Various chemical procedures adopted for recovery of these elements from irradiated target and also from power reactor fuel reprocessing streams are described. A brief survey of shielded facilities available at various centres for transplutonium programmes is also included. Major uses of some of these heavy elements are described. (author)

  7. Determination of acoustic vibration in watermelon by finite element modeling

    Science.gov (United States)

    Nourain, Jamal; Ying, Yibin B.; Wang, Jianping; Rao, Xiuqin

    2004-11-01

    The analysis of the vibration responses of a fruit is suggested to measure firmness non-destructively. A wooden ball excited the fruits and the response signals were captured using an accelerometer sensor. The method has been well studied and understood on ellipsoidal shaped fruit (watermelon). In this work, using the finite element simulations, the applicability of the method on watermelon was investigated. The firmness index is dependent on the mass, density, and natural frequency of the lowest spherical modes (under free boundary conditions). This developed index extends the firmness estimation for fruits or vegetables from a spherical to an ellipsoidal shape. The mode of Finite element analysis (FEA) of watermelon was generated based on measured geometry, and it can be served as a theoretical reference for predicting the modal characteristics as a function of design parameters such as material, geometrical, and physical properties. It was found that there were four types of mode shapes. The 1st one was first-type longitudinal mode, the 2nd one was the second-type longitudinal mode, the 3rd one was breathing mode or pure compression mode, and the fourth was flexural or torsional mode shape. As suggested in many references, the First-type spherical vibration mode or oblate-Prolate for watermelon is the lowest bending modes, it's most likely related to fruit firmness. Comparisons of finite element and experimental modal parameters show that both results were agreed in mode shape as well as natural frequencies. In order to measure the vibration signal of the mode, excitation and sensors should be placed on the watermelon surface far away from the nodal lines. The excitation and the response sensors should be in accordance with vibration directions. The correlations between the natural frequency and firmness was 0.856, natural frequency and Young's modulus was 0.800, and the natural frequency and stiffness factor (SF) was 0.862. The stiffness factor (SF) is adequate

  8. Location analysis for the estrogen receptor-? reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements

    OpenAIRE

    Mason, Christopher E.; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M.; Kallen, Roland G.; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B.

    2010-01-01

    Location analysis for estrogen receptor-? (ER?)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ER?-bound loci and quantify the incidence of ERE sequences under two stringencies of detection:

  9. Researches on modeling of nuclear power plants for dynamic response analysis

    International Nuclear Information System (INIS)

    Watabe, M.; Fukuzawa, R.; Chiba, O.; Toritani, T.

    1983-01-01

    The authors tried to establish the rational and economical model due to the vertical component considering the dynamic soil-structure interaction effects and the flexibility of the mat foundation. Three types of models were introduced. 1) Finite element model. Two cases of response analyses due to harmonic excitations with the finite element model were performed in which the mat foundation was treated rigid and elastic body. The dynamic soil-structure interaction effects were evaluated based on the condition that soil was semiinfinite elastic medium. 2) Sophisticated mass-spring-dashpot model. Two cases of response analyses due to harmonic excitations were performed to simulate the dynamic characteristics of the finite element models mentioned above using the sophisticated mass-spring-dashpot model, in which the dynamic soil-structure interaction effects were evaluated with the same procedure applied to the finite element model. 3) Simplified mass-spring-dashpot model. There were introduced three types of the simplified mass-spring-dashpot model in which the dynamic soil-structure interaction effects were simplified. Response analyses due to harmonic excitations and earthquake ground motions were performed in order to establish the rational and economical model. (orig./HP)

  10. Genomic Characterization of Metformin Hepatic Response.

    Directory of Open Access Journals (Sweden)

    Marcelo R Luizon

    2016-11-01

    Full Text Available Metformin is used as a first-line therapy for type 2 diabetes (T2D and prescribed for numerous other diseases. However, its mechanism of action in the liver has yet to be characterized in a systematic manner. To comprehensively identify genes and regulatory elements associated with metformin treatment, we carried out RNA-seq and ChIP-seq (H3K27ac, H3K27me3 on primary human hepatocytes from the same donor treated with vehicle control, metformin or metformin and compound C, an AMP-activated protein kinase (AMPK inhibitor (allowing to identify AMPK-independent pathways. We identified thousands of metformin responsive AMPK-dependent and AMPK-independent differentially expressed genes and regulatory elements. We functionally validated several elements for metformin-induced promoter and enhancer activity. These include an enhancer in an ataxia telangiectasia mutated (ATM intron that has SNPs in linkage disequilibrium with a metformin treatment response GWAS lead SNP (rs11212617 that showed increased enhancer activity for the associated haplotype. Expression quantitative trait locus (eQTL liver analysis and CRISPR activation suggest that this enhancer could be regulating ATM, which has a known role in AMPK activation, and potentially also EXPH5 and DDX10, its neighboring genes. Using ChIP-seq and siRNA knockdown, we further show that activating transcription factor 3 (ATF3, our top metformin upregulated AMPK-dependent gene, could have an important role in gluconeogenesis repression. Our findings provide a genome-wide representation of metformin hepatic response, highlight important sequences that could be associated with interindividual variability in glycemic response to metformin and identify novel T2D treatment candidates.

  11. Phytoremediation of Toxic Elemental and Organic Pollutants

    International Nuclear Information System (INIS)

    Meagher, Richard B.

    2000-01-01

    Phytoremediation is the use of plants to extract, sequester, and/or detoxify pollutants. Phytoremediation is widely viewed as the ecologically responsible alternative to the environmentally destructive physical remediation methods currently practiced. Plants have many endogenous genetic, biochemical, and physiological properties that make them ideal agents for soil and water remediation. Significant progress has been made in recent years in developing native or genetically modified plants for the remediation of environmental contaminants. Because elements are immutable, phytoremediation strategies for radionuclide and heavy metal pollutants focus on hyperaccumulation above-ground. In contrast, organic pollutants can potentially be completely mineralized by plants

  12. Chalcogenides formed by trivalent rare earth elements with d-elements

    International Nuclear Information System (INIS)

    Flao, Zh.; Laruehl', P.; Olitro, R.

    1981-01-01

    Data on ternary compounds formed by trivalent rare earth elements with 3d-, 4d- and 5d-elements of the Periodic system is presented. Compounds of 3d-elements both in bivalent and trivalent states are considered. The main attention is paid to the structure of the compounds. Description of a great number of new structural types of compounds is given. In certain cases the structure has not been deciphered and, besides, structural investigations with monocrystals are not numerous. Attention is drawn to the existence of nonstoichiometric compounds. References to the works on investigation of thermal (melting temperature), magnetic, optical and electric properties as well as Moessbauer effect are presented

  13. Role of an ER stress response element in regulating the bidirectional promoter of the mouse CRELD2 - ALG12 gene pair

    Directory of Open Access Journals (Sweden)

    Hirata Yoko

    2010-11-01

    Full Text Available Abstract Background Recently, we identified cysteine-rich with EGF-like domains 2 (CRELD2 as a novel endoplasmic reticulum (ER stress-inducible gene and characterized its transcriptional regulation by ATF6 under ER stress conditions. Interestingly, the CRELD2 and asparagine-linked glycosylation 12 homolog (ALG12 genes are arranged as a bidirectional (head-to-head gene pair and are separated by less than 400 bp. In this study, we characterized the transcriptional regulation of the mouse CRELD2 and ALG12 genes that is mediated by a common bidirectional promoter. Results This short intergenic region contains an ER stress response element (ERSE sequence and is well conserved among the human, rat and mouse genomes. Microarray analysis revealed that CRELD2 and ALG12 mRNAs were induced in Neuro2a cells by treatment with thapsigargin (Tg, an ER stress inducer, in a time-dependent manner. Other ER stress inducers, tunicamycin and brefeldin A, also increased the expression of these two mRNAs in Neuro2a cells. We then tested for the possible involvement of the ERSE motif and other regulatory sites of the intergenic region in the transcriptional regulation of the mouse CRELD2 and ALG12 genes by using variants of the bidirectional reporter construct. With regards to the promoter activities of the CRELD2-ALG12 gene pair, the entire intergenic region hardly responded to Tg, whereas the CRELD2 promoter constructs of the proximal region containing the ERSE motif showed a marked responsiveness to Tg. The same ERSE motif of ALG12 gene in the opposite direction was less responsive to Tg. The direction and the distance of this motif from each transcriptional start site, however, has no impact on the responsiveness of either gene to Tg treatment. Additionally, we found three putative sequences in the intergenic region that antagonize the ERSE-mediated transcriptional activation. Conclusions These results show that the mouse CRELD2 and ALG12 genes are arranged as a

  14. Element-by-element parallel spectral-element methods for 3-D teleseismic wave modeling

    KAUST Repository

    Liu, Shaolin

    2017-09-28

    The development of an efficient algorithm for teleseismic wave field modeling is valuable for calculating the gradients of the misfit function (termed misfit gradients) or Fréchet derivatives when the teleseismic waveform is used for adjoint tomography. Here, we introduce an element-by-element parallel spectral-element method (EBE-SEM) for the efficient modeling of teleseismic wave field propagation in a reduced geology model. Under the plane-wave assumption, the frequency-wavenumber (FK) technique is implemented to compute the boundary wave field used to construct the boundary condition of the teleseismic wave incidence. To reduce the memory required for the storage of the boundary wave field for the incidence boundary condition, a strategy is introduced to efficiently store the boundary wave field on the model boundary. The perfectly matched layers absorbing boundary condition (PML ABC) is formulated using the EBE-SEM to absorb the scattered wave field from the model interior. The misfit gradient can easily be constructed in each time step during the calculation of the adjoint wave field. Three synthetic examples demonstrate the validity of the EBE-SEM for use in teleseismic wave field modeling and the misfit gradient calculation.

  15. Radiolabelled cellular blood elements

    International Nuclear Information System (INIS)

    Sinzinger, H.

    1990-01-01

    This book reports on radiolabelled cellular blood elements, covering new advances made during the past several years, in particular the use of Tc-99 as a tracer for blood elements. Coverage extends to several radiolabelled monoclonal antibodies that are specific for blood components and may label blood elements in vivo

  16. Proceedings of transuranium elements

    International Nuclear Information System (INIS)

    Anon.

    1992-01-01

    The identification of the first synthetic elements was established by chemical evidence. Conclusive proof of the synthesis of the first artificial element, technetium, was published in 1937 by Perrier and Segre. An essential aspect of their achievement was the prediction of the chemical properties of element 43, which had been missing from the periodic table and which was expected to have properties similar to those of manganese and rhenium. The discovery of other artificial elements, astatine and francium, was facilitated in 1939-1940 by the prediction of their chemical properties. A little more than 50 years ago, in the spring of 1940, Edwin McMillan and Philip Abelson synthesized element 93, neptunium, and confirmed its uniqueness by chemical means. On August 30, 1940, Glenn Seaborg, Arthur Wahl, and the late Joseph Kennedy began their neutron irradiations of uranium nitrate hexahydrate. A few months later they synthesized element 94, later named plutonium, by observing the alpha particles emitted from uranium oxide targets that had been bombarded with deuterons. Shortly thereafter they proved that is was the second transuranium element by establishing its unique oxidation-reduction behavior. The symposium honored the scientists and engineers whose vision and dedication led to the discovery of the transuranium elements and to the understanding of the influence of 5f electrons on their electronic structure and bonding. This volume represents a record of papers presented at the symposium

  17. Floor Response Spectra of Nuclear Containment Building with Soil-Structure Interaction

    Energy Technology Data Exchange (ETDEWEB)

    Seo, Choon Gyo; Ryu, Jeong Soo [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2008-10-15

    This paper presents a seismic analysis technique for a 3D soil-structure interaction(SSI) system in frequency domain, based on the finite element formulation incorporating frequency-dependent dynamic infinite elements for the far field soil region. Earthquake input motions are regarded as traveling SV-wave which is vertically incident from a far-field soil region. In which, the equivalent earthquake forces in the frequency domain are calculated using the exterior rigid boundary method and the free field response analysis. For the application, floor response spectra analyses for nuclear containment building on a soil medium is carried out, the obtained results are compared with the free field response by other solution.

  18. Groundwater response under an electronuclear plant to a river flood wave analyzed by a nonlinear finite element model

    International Nuclear Information System (INIS)

    Gambolati, G.; Toffolo, F.; Uliana, F.

    1984-01-01

    A nonlinear finite element model based on the Dupuit-Boussinesq equation of flow in an unconfined aquifer has been developed and applied to simulate the water table fluctuation under the electronuclear plant of the test site of Trino Vercellese (northwestern Italy) in response to the flood event that occurred in the Po River from March 30 to April 4, 1981. The nonlinearity has been overcome by the aid of an efficient iterative linearization technique wherein the model equations are solved by symbolic factorization, numerical factorization, and backward-forward substitution after an optimal preliminary reordering. The model was run for uniform values of aquifer permeability and specific yield within the typical range evidenced for the Trino sands by the early data in our possession. The results show that the maximum water level elevation below the reactor is almost 3 m lower than the corresponding river flood peak even in the most unfavorable conditions, i.e., with the hydraulic conductivity in the upper range, and is rather insensitive to the specific yield values within the plausible interval. The model allowed for an easy evaluation of the effectiveness of the impermeable protection walls and of a possible secondary aquifer recharge from a minor channel. The modeling approach for the analysis of the water table behavior appears to be a very promising tool to help in the structural design of future electronuclear plants

  19. Use of the finite element displacement method to solve solid-fluid interaction vibration problems

    International Nuclear Information System (INIS)

    Brown, S.J.; Hsu, K.H.

    1978-01-01

    It is shown through comparison to experimental, theoretical, and other finite element formulations that the finite element displacement method can solve accurately and economically a certain class of solid-fluid eigenvalue problems. The problems considered are small displacements in the absence of viscous damping and are 2-D and 3-D in nature. In this study the advantages of the finite element method (in particular the displacement formulation) is apparent in that a large structure consisting of the cylinders, support flanges, fluid, and other experimental boundaries could be modeled to yield good correlation to experimental data. The ability to handle large problems with standard structural programs is the key advantage of the displacement fluid method. The greatest obstacle is the inability of the analyst to inhibit those rotational degrees of freedom that are unnecessary to his fluid-structure vibration problem. With judicious use of element formulation, boundary conditions and modeling, the displacement finite element method can be successfully used to predict solid-fluid response to vibration and seismic loading

  20. The transcriptional regulatory network mediated by banana (Musa acuminata) dehydration-responsive element binding (MaDREB) transcription factors in fruit ripening.

    Science.gov (United States)

    Kuang, Jian-Fei; Chen, Jian-Ye; Liu, Xun-Cheng; Han, Yan-Chao; Xiao, Yun-Yi; Shan, Wei; Tang, Yang; Wu, Ke-Qiang; He, Jun-Xian; Lu, Wang-Jin

    2017-04-01

    Fruit ripening is a complex, genetically programmed process involving the action of critical transcription factors (TFs). Despite the established significance of dehydration-responsive element binding (DREB) TFs in plant abiotic stress responses, the involvement of DREBs in fruit ripening is yet to be determined. Here, we identified four genes encoding ripening-regulated DREB TFs in banana (Musa acuminata), MaDREB1, MaDREB2, MaDREB3, and MaDREB4, and demonstrated that they play regulatory roles in fruit ripening. We showed that MaDREB1-MaDREB4 are nucleus-localized, induced by ethylene and encompass transcriptional activation activities. We performed a genome-wide chromatin immunoprecipitation and high-throughput sequencing (ChIP-Seq) experiment for MaDREB2 and identified 697 genomic regions as potential targets of MaDREB2. MaDREB2 binds to hundreds of loci with diverse functions and its binding sites are distributed in the promoter regions proximal to the transcriptional start site (TSS). Most of the MaDREB2-binding targets contain the conserved (A/G)CC(G/C)AC motif and MaDREB2 appears to directly regulate the expression of a number of genes involved in fruit ripening. In combination with transcriptome profiling (RNA sequencing) data, our results indicate that MaDREB2 may serve as both transcriptional activator and repressor during banana fruit ripening. In conclusion, our study suggests a hierarchical regulatory model of fruit ripening in banana and that the MaDREB TFs may act as transcriptional regulators in the regulatory network. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

  1. Chemical experiments with superheavy elements.

    Science.gov (United States)

    Türler, Andreas

    2010-01-01

    Unnoticed by many chemists, the Periodic Table of the Elements has been extended significantly in the last couple of years and the 7th period has very recently been completed with eka-Rn (element 118) currently being the heaviest element whose synthesis has been reported. These 'superheavy' elements (also called transactinides with atomic number > or = 104 (Rf)) have been artificially synthesized in fusion reactions at accelerators in minute quantities of a few single atoms. In addition, all isotopes of the transactinide elements are radioactive and decay with rather short half-lives. Nevertheless, it has been possible in some cases to investigate experimentally chemical properties of transactinide elements and even synthesize simple compounds. The experimental investigation of superheavy elements is especially intriguing, since theoretical calculations predict significant deviations from periodic trends due to the influence of strong relativistic effects. In this contribution first experiments with hassium (Hs, atomic number 108), copernicium (Cn, atomic number 112) and element 114 (eka-Pb) are reviewed.

  2. Causation and International State Responsibility

    NARCIS (Netherlands)

    Castellanos-Jankiewicz, L.

    2012-01-01

    This work studies causation in the law of international State responsibility. It is submitted that the absence of causation as an element of the internationally wrongful act owes more to the structure of international law, than to the inadequateness of causation as a conceptual and legal construct

  3. Improvement of range spatial resolution of medical ultrasound imaging by element-domain signal processing

    Science.gov (United States)

    Hasegawa, Hideyuki

    2017-07-01

    The range spatial resolution is an important factor determining the image quality in ultrasonic imaging. The range spatial resolution in ultrasonic imaging depends on the ultrasonic pulse length, which is determined by the mechanical response of the piezoelectric element in an ultrasonic probe. To improve the range spatial resolution without replacing the transducer element, in the present study, methods based on maximum likelihood (ML) estimation and multiple signal classification (MUSIC) were proposed. The proposed methods were applied to echo signals received by individual transducer elements in an ultrasonic probe. The basic experimental results showed that the axial half maximum of the echo from a string phantom was improved from 0.21 mm (conventional method) to 0.086 mm (ML) and 0.094 mm (MUSIC).

  4. Field-driven sense elements for chirality-dependent domain wall detection and storage

    Energy Technology Data Exchange (ETDEWEB)

    Bowden, S. R. [Center for Nanoscale Science and Technology, National Institute of Standards and Technology, Gaithersburg, Maryland 20899 (United States); Maryland Nanocenter, University of Maryland, College Park, Maryland 20742 (United States); Unguris, J. [Center for Nanoscale Science and Technology, National Institute of Standards and Technology, Gaithersburg, Maryland 20899 (United States)

    2013-12-14

    A method for locally sensing and storing data of transverse domain wall chirality in planar nanowire logic and memory systems is presented. Patterned elements, in close proximity to the nanowires, respond to the asymmetry in the stray field from the domain wall to produce a chirality-dependent response. When a bias field is applied, a stray field-assisted reversal of the element magnetization results in a reversed remanent state, measurable by scanning electron microscopy with polarization analysis (SEMPA). The elements are designed as triangles with tips pointing toward the nanowire, allowing the shape anisotropy to be dominated by the base but having a portion with lower volume and lower energy barrier closest to the domain wall. Micromagnetic modeling assists in the design of the nanowire-triangle systems and experiments using SEMPA confirm the importance of aspect ratio and spacing given a constant bias field magnitude.

  5. Program for responsible and safe disposal of spent fuel elements and radioactive wastes (National disposal program)

    International Nuclear Information System (INIS)

    2015-01-01

    The contribution covers the following topics: fundamentals of the disposal policy; amount of radioactive wastes and prognosis; disposal of radioactive wastes - spent fuel elements and wastes from waste processing, radioactive wastes with low heat production; legal framework of the nuclear waste disposal in Germany; public participation, cost and financing.

  6. The Importance of Packaging and Graphic Design to Communicate Corporate Social Responsibility

    Directory of Open Access Journals (Sweden)

    Listia Natadjaja

    2011-01-01

    Full Text Available Graphic design’s function develops through time. It does not only function to inform a product but also elements to communicate Corporate Social Responsibility. As happened in catastrophic areas in Indonesia like Aceh in 2004, Nias in 2005, Jogjakarta in 2007, Bekasi District in 2009, etc. many donated products had their contributor’s information, especially the ones from corporations. There are many ways a company could implement their social responsibility. Graphic design cannot stand alone, it needs an effective media for its placement, one of them is packaging design. By using a Biskiz Susu packaging design as a case study, I try to analyze the design elements, like color, shape, brand, illustration/character, typography, and layout and then connect them with aspects like: the visual perception impact of packaging design and the importance in communicating Corporate Social Responsibility. For input information, I also discuss some consideration aspects of placing the contributor’s identity on the packaging. Based on this study, the contributor’s information in the products gives many advantages. The result shows that graphic design could be the effective element for communicating Corporate Social Responsibility and packaging design can be one of the recommended media for graphic design placement. Hopefully, this analysis could help a corporation, organization or the government in organizing the graphic design elements and considering a packaging as a medium to communicate Corporate Social Responsibility (CSR.

  7. Deletion of an Endoplasmic Reticulum Stress Response Element in a ZmPP2C-A Gene Facilitates Drought Tolerance of Maize Seedlings.

    Science.gov (United States)

    Xiang, Yanli; Sun, Xiaopeng; Gao, Shan; Qin, Feng; Dai, Mingqiu

    2017-03-06

    Drought is a major abiotic stress that causes the yearly yield loss of maize, a crop cultured worldwide. Breeding drought-tolerant maize cultivars is a priority requirement of world agriculture. Clade A PP2C phosphatases (PP2C-A), which are conserved in most plant species, play important roles in abscisic acid (ABA) signaling and plant drought response. However, natural variations of PP2C-A genes that are directly associated with drought tolerance remain to be elucidated. Here, we conducted a candidate gene association analysis of the ZmPP2C-A gene family in a maize panel consisting of 368 varieties collected worldwide, and identified a drought responsive gene ZmPP2C-A10 that is tightly associated with drought tolerance. We found that the degree of drought tolerance of maize cultivars negatively correlates with the expression levels of ZmPP2C-A10. ZmPP2C-A10, like its Arabidopsis orthologs, interacts with ZmPYL ABA receptors and ZmSnRK2 kinases, suggesting that ZmPP2C-A10 is involved in mediating ABA signaling in maize. Transgenic studies in maize and Arabidopsis confirmed that ZmPP2C-A10 functions as a negative regulator of drought tolerance. Further, a causal natural variation, deletion allele-338, which bears a deletion of ERSE (endoplasmic reticulum stress response element) in the 5'-UTR region of ZmPP2C-A10, was detected. This deletion causes the loss of endoplasmic reticulum (ER) stress-induced expression of ZmPP2C-A10, leading to increased plant drought tolerance. Our study provides direct evidence linking ER stress signaling with drought tolerance and genetic resources that can be used directly in breeding drought-tolerant maize cultivars. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. Functional dissection of drought-responsive gene expression patterns in Cynodon dactylon L.

    Science.gov (United States)

    Kim, Changsoo; Lemke, Cornelia; Paterson, Andrew H

    2009-05-01

    Water deficit is one of the main abiotic factors that affect plant productivity in subtropical regions. To identify genes induced during the water stress response in Bermudagrass (Cynodon dactylon), cDNA macroarrays were used. The macroarray analysis identified 189 drought-responsive candidate genes from C. dactylon, of which 120 were up-regulated and 69 were down-regulated. The candidate genes were classified into seven groups by cluster analysis of expression levels across two intensities and three durations of imposed stress. Annotation using BLASTX suggested that up-regulated genes may be involved in proline biosynthesis, signal transduction pathways, protein repair systems, and removal of toxins, while down-regulated genes were mostly related to basic plant metabolism such as photosynthesis and glycolysis. The functional classification of gene ontology (GO) was consistent with the BLASTX results, also suggesting some crosstalk between abiotic and biotic stress. Comparative analysis of cis-regulatory elements from the candidate genes implicated specific elements in drought response in Bermudagrass. Although only a subset of genes was studied, Bermudagrass shared many drought-responsive genes and cis-regulatory elements with other botanical models, supporting a strategy of cross-taxon application of drought-responsive genes, regulatory cues, and physiological-genetic information.

  9. Theoretical and experimental investigation of the nonlinear structural dynamics of Fast Breeder Reactor fuel elements

    International Nuclear Information System (INIS)

    Liebe, R.

    1978-04-01

    This study describes theoretical and experimental investigations of the dynamic deformation behavior of single and clustered fuel elements under local fault conditions in a Fast Breeder Reactor core. In particular an energetic molten-fuel-coolant-interaction (FCI) is assumed in one subassembly with corresponding pressure pulses, which may rupture the wrapper and load the adjacent fuel elements impulsively. Associated coherent structural deformation may exceed tolerable and damage the control rods. To attack the outlined coupled fluid-structure-interaction problem it is assumed, that the loading at the structures is known in space and time, and that there is no feedback from the deformation response. Then current FCI-knowledge and experience from underwater core model explosion tests is utilized to estimate upper limits of relevant pulse characteristics. As a first step the static carrying capacity of the rigid-plastic hexagonal wrapper tube is calculated using the methods of limit analysis. Then for a general dynamic simulation of the complete elastoplastic subassembly response the concept of a discrete nonlinear hinge is introduced. A corresponding physical lumped parameter hinge model is presented, and general equations of motion are derived using D'Alembert's principle. Application to the static and dynamic analysis of a single complete fuel element includes the semiempirical modelling of the fuel-pin bundle by a homogeneous compressible medium. Most important conclusions are concerning the capability of the theoretical models, the failure modes and threshold load levels of single as well as clustered SNR-300 fuel elements and the safety relevant finding, that only limited deformations are found in the first row around the incident element. This shows in agreement with explosion test results that the structured and closely spaced fuel elements constitute an effective, inherent barrier against extreme dynamic loadings. (orig.) [de

  10. Transcript accumulation of putative drought responsive genes in ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-09-15

    Sep 15, 2009 ... tories where radioactive labelling is not available by using the silver staining ... ICCV2 were removed from the soil and roots were dipped for 5 h into water with or .... respective PCR product in control and drought-stressed samples will testify to the ..... responsive elements and the dehydration-responsive.

  11. Development of filter element from nanocomposites of ultra high molar mass polyethylene having silver nanoparticles

    International Nuclear Information System (INIS)

    Bizzo, Maurizio A.; Wang, S. Hui

    2015-01-01

    The production of polymer based filter elements for water is widespread in the market but has an undesirable characteristic, they are not always efficient and capable of retaining or eliminating microorganisms. This paper proposes the production of filters with biocidal activity, comprised by nanocomposites of ultra-high molar mass polyethylene (UHMMPE) containing silver nanoparticles. The polymer is responsible for the uniform porous structure of the filter element and the Ag nanoparticles for its biocidal action. The filter elements were produced from two kinds of UHMMPE particles with different particle size distributions, one in the range of 150 to 200μm and the other of 300 to 400μm. Samples were collected from the obtained filter elements and characterized by X-ray diffractometry, scanning electron microscopy and microanalysis. The results indicated the formation of nanocomposite containing silver nanoparticles. (author)

  12. Analysis of the jet pipe electro-hydraulic servo valve with finite element methods

    Directory of Open Access Journals (Sweden)

    Kaiyu Zhao

    2018-01-01

    Full Text Available The dynamic characteristics analysis about the jet pipe electro-hydraulic servo valve based on experience and mathematical derivation was difficult and not so precise. So we have analysed the armature feedback components, torque motor and jet pipe receiver in electrohydraulic servo valve by sophisticated finite element analysis tools respectively and have got physical meaning data on these parts. Then the data were fitted by Matlab and the mathematical relationships among them were calculated. We have done the dynamic multi-physical fields’ Simulink co-simulation using above mathematical relationship, and have got the input-output relationship of the overall valve, the frequency response and step response. This work can show the actual working condition accurately. At the same time, we have considered the materials and the impact of the critical design dimensions in the finite element analysis process. It provides some new ideas to the overall design of jet pipe electro-hydraulic servo valve.

  13. Chemistry of the superheavy elements.

    Science.gov (United States)

    Schädel, Matthias

    2015-03-13

    The quest for superheavy elements (SHEs) is driven by the desire to find and explore one of the extreme limits of existence of matter. These elements exist solely due to their nuclear shell stabilization. All 15 presently 'known' SHEs (11 are officially 'discovered' and named) up to element 118 are short-lived and are man-made atom-at-a-time in heavy ion induced nuclear reactions. They are identical to the transactinide elements located in the seventh period of the periodic table beginning with rutherfordium (element 104), dubnium (element 105) and seaborgium (element 106) in groups 4, 5 and 6, respectively. Their chemical properties are often surprising and unexpected from simple extrapolations. After hassium (element 108), chemistry has now reached copernicium (element 112) and flerovium (element 114). For the later ones, the focus is on questions of their metallic or possibly noble gas-like character originating from interplay of most pronounced relativistic effects and electron-shell effects. SHEs provide unique opportunities to get insights into the influence of strong relativistic effects on the atomic electrons and to probe 'relativistically' influenced chemical properties and the architecture of the periodic table at its farthest reach. In addition, they establish a test bench to challenge the validity and predictive power of modern fully relativistic quantum chemical models. © 2015 The Author(s) Published by the Royal Society. All rights reserved.

  14. The Diffraction Response Interpolation Method

    DEFF Research Database (Denmark)

    Jespersen, Søren Kragh; Wilhjelm, Jens Erik; Pedersen, Peder C.

    1998-01-01

    Computer modeling of the output voltage in a pulse-echo system is computationally very demanding, particularly whenconsidering reflector surfaces of arbitrary geometry. A new, efficient computational tool, the diffraction response interpolationmethod (DRIM), for modeling of reflectors in a fluid...... medium, is presented. The DRIM is based on the velocity potential impulseresponse method, adapted to pulse-echo applications by the use of acoustical reciprocity. Specifically, the DRIM operates bydividing the reflector surface into planar elements, finding the diffraction response at the corners...

  15. Analogs for transuranic elements

    International Nuclear Information System (INIS)

    Weimer, W.C.; Laul, J.C.; Kutt, J.C.

    1981-01-01

    A combined theoretical and experimental approach is being used to estimate the long-term environmental and biogeochemical behaviors of selected transuranic elements. The objective of this research is to estimate the effect that long-term (hundreds of years) environmental weathering has on the behavior of the transuranic elements americium and curium. This is achieved by investigating the actual behavior of naturally occurring rare earth elements, especially neodymium, that serve as transuranic analogs. Determination of the analog element behavior provides data that can be used to estimate the ultimate availability to man of transuranic materials released into the environment

  16. Computational contact and impact mechanics fundamentals of modeling interfacial phenomena in nonlinear finite element analysis

    CERN Document Server

    Laursen, Tod A

    2003-01-01

    This book comprehensively treats the formulation and finite element approximation of contact and impact problems in nonlinear mechanics. Intended for students, researchers and practitioners interested in numerical solid and structural analysis, as well as for engineers and scientists dealing with technologies in which tribological response must be characterized, the book includes an introductory but detailed overview of nonlinear finite element formulations before dealing with contact and impact specifically. Topics encompassed include the continuum mechanics, mathematical structure, variational framework, and finite element implementations associated with contact/impact interaction. Additionally, important and currently emerging research topics in computational contact mechanics are introduced, encompassing such topics as tribological complexity, conservative treatment of inelastic impact interaction, and novel spatial discretization strategies.

  17. The Chemistry of Superheavy Elements

    CERN Document Server

    Schädel, M

    2003-01-01

    The chemistry of transactinide or superheavy elements has reached element 108. Preparations are under way to leap to element 112 and beyond. The current status of this atom-at-a-time chemical research and its future perspectives are reviewed from an experimental point of view together with some of the interesting results from n -rich nuclides near and at the N=162 neutron shell. Experimental techniques and important results enlightening typical chemical properties of elements 104 through 108 are presented in an exemplary way. From the results of these experiments it is justified to place these elements in the Periodic Table of the Elements in to groups 4 through 8, respectively. However, mainly due to the influence of relativistic effects, it is no longer possible to deduce detailed chemical properties of these superheavy elements simply from this position.

  18. Use of analog elements to predict the equilibrium and behavior of transuranic elements in the environment

    International Nuclear Information System (INIS)

    Weimer, W.C.; Laul, J.C.; Kutt, J.C.

    1978-01-01

    Several naturally-occurring elements with chemical properties similar to those of selected transuranic elements have been chosen and are being examined as potential predictors of transuranic geochemical behaviors. This approach may allow the estimation of the long-term behaviors of transuranic elements in the environment by analyses of the steady-state behaviors of their analog elements. The elements receiving principal attention are the transuranics Am and Cm and their proposed lanthanide element analog Nd

  19. A study on human hair element content as monitor for trace elements pollution in Eg

    International Nuclear Information System (INIS)

    Tadros, N.; Metwally, E.

    2004-01-01

    Trace element content in human is a suitable indicator of exposure to trace element pollutants. Concentration levels of 12 trace elements in human head hair samples collected from more than 23 individuals have been determined. The collected hair samples were classified into four groups collected from workers at nuclear research center and others far away from the center. Neutron activation analysis technique was used in the preset study. The data reported for trace elements content in different hair samples were discussed. Significant differences were observed for several elements levels. comparative studies demonstrated that the concentration of some elements in hair of exposed workers, are greater than those corresponding to non exposed workers. Also, there was no clear significant correlation between the elements content of different hair samples and the age of the donors

  20. Pyrometallurgical partitioning of uranium and transuranic elements from rare earth elements by electrorefining and reductive extraction

    International Nuclear Information System (INIS)

    Uozumi, Koichi; Kinoshita, Kensuke; Inoue, Tadashi; Storvick, T.S.; Krueger, C.L.; Nabelek, C.R.

    2001-01-01

    High-level liquid waste generated from PUREX reprocessing contains a small amount of transuranic elements, such as Np, Pu, Am, and Cm, with long-lived radioactivities. A pyrometallurgical partitioning process is being developed to recover transuranic elements from such waste. Small amounts of U contained in the high-level liquid waste are also recovered in the process. A key issue for developing the process is effective separation of U and the transuranic elements from the rare-earth elements, because the two elemental groups are chemically analogous. A series of process tests were carried out in the present study to demonstrate that a combination of electrorefining and reductive extraction is useful for separating U and transuranic elements from the rare-earth elements. The results indicate that 99% of U and each transuranic elements is recovered by the combination process as a product, and that the quantity of rare-earth elements contained in the product is smaller than the transuranic elements by weight. The overall mass balance of U and transuranic elements in the system ranged within the experimental errors assigned to sampling and analysis. (author)