WorldWideScience

Sample records for respiration lr measurements

  1. Interpreting, measuring, and modeling soil respiration

    Michael G. Ryan; Beverly E. Law

    2005-01-01

    This paper reviews the role of soil respiration in determining ecosystem carbon balance, and the conceptual basis for measuring and modeling soil respiration. We developed it to provide background and context for this special issue on soil respiration and to synthesize the presentations and discussions at the workshop. Soil respiration is the largest component of...

  2. Perturbation measurements in reactor LR-0 and their evaluation

    Rypar, W.; Faehrmann, K.H.

    1988-07-01

    To investigate space-dependent kinetic effects in reactors of the WWER-1000 type, two central and one eccentric perturbation measurements were performed in the zero power reactor LR-0 of the UJV Rez (CSSR) by trapeze-form movements of an absorber cluster. The measurements were based ona computer aided CAMAC system for the simultaneous data acquisition of 20 spatially distributed neutron detectors and for cluster movement control. The measurements were followed by a detailed evaluation in the ZfK Rossendorf (GDR) with respect to the calculation results of flux response obtained by nodal code HEXDYN3D, the aim of which was to demostrate the limits of the point reactor model and to account for space-dependent effects by approximative methods. A sensitive check of the calculation methods was made possible especially by the eccentric perturbation where the space dependent effects,due to a larger distance of cluster movement, were most significant. (author). 17 figs., 9 refs

  3. The calibration of the solid state nuclear track detector LR 115 for radon measurements

    Gericke, C; Jönsson, G; Freyer, K; Treutler, H C; Enge, W

    1999-01-01

    An experimental calibration of indoor room and outdoor soil detector devices which are based on LR 115 as sensitive element has taken place at the Swedish Radiation Protection Institute in Stockholm (Sweden) in 1994 and 1996, at the Physikalisch-Technischen Bundesanstalt in Braunschweig (Germany) in 1997 and at the Umweltforschungszentrum Leipzig-Halle (Germany) in 1997. Special properties of the used solid state nuclear track detector (SSNTD) material LR 115 have been measured to define the application of the experimental calibration.

  4. Improving respiration measurements with gas exchange analyzers.

    Montero, R; Ribas-Carbó, M; Del Saz, N F; El Aou-Ouad, H; Berry, J A; Flexas, J; Bota, J

    2016-12-01

    Dark respiration measurements with open-flow gas exchange analyzers are often questioned for their low accuracy as their low values often reach the precision limit of the instrument. Respiration was measured in five species, two hypostomatous (Vitis Vinifera L. and Acanthus mollis) and three amphistomatous, one with similar amount of stomata in both sides (Eucalyptus citriodora) and two with different stomata density (Brassica oleracea and Vicia faba). CO 2 differential (ΔCO 2 ) increased two-fold with no change in apparent R d , when the two leaves with higher stomatal density faced outside. These results showed a clear effect of the position of stomata on ΔCO 2 . Therefore, it can be concluded that leaf position is important to guarantee the improvement of respiration measurements increasing ΔCO 2 without affecting the respiration results by leaf or mass units. This method will help to increase the accuracy of leaf respiration measurements using gas exchange analyzers. Copyright © 2016 Elsevier GmbH. All rights reserved.

  5. Quality assurance for environmental radon measurements by LR115 nuclear track detectors

    Gomaa, M A [National Network of Radiation Physics, Atomic Energy Authority, Cairo (Egypt); Hafez, A F [Physics Department, Faculty of Science, Alexandria Univercity, Alexandria (Egypt); Hussein, A S [Radiation Protection Department, Nuclear Power Plants Authority, Cairo (Egypt)

    2007-06-15

    Passive radon dosimeters based on LR115 nuclear track detectors are very attractive for assessment of radon exposure. For developing countries wishing to undertake national radon survey the most appropriate techniques are those making use of LR115 detectors. These detectors are small, cheap, simple, and non-hazardous and provide an entirely adequate tool for large scale use in assessing levels of radon over several months because of the short - term fluctuations in radon concentrations. In this paper, the principles and philosophy in order to improve the quality and reliability of radon exposure under a quality assurance (QA) program are presented . Also examples of how a QA program of radon measurements by LR115 detectors using the can-techniques are well defined and applied.

  6. Quality assurance for environmental radon measurements by LR115 nuclear track detectors

    Gomaa, M.A.; Hafez, A.F.; Hussein, A.S.

    2007-01-01

    Passive radon dosimeters based on LR115 nuclear track detectors are very attractive for assessment of radon exposure. For developing countries wishing to undertake national radon survey the most appropriate techniques are those making use of LR115 detectors. These detectors are small, cheap, simple, and non-hazardous and provide an entirely adequate tool for large scale use in assessing levels of radon over several months because of the short - term fluctuations in radon concentrations. In this paper, the principles and philosophy in order to improve the quality and reliability of radon exposure under a quality assurance (QA) program are presented . Also examples of how a QA program of radon measurements by LR115 detectors using the can-techniques are well defined and applied

  7. Development of measuring system with self-powered neutron detectors for the LR-0 reactor

    Erben, O.; Horinek, K.; Szasz, Z.

    1989-01-01

    A measuring channel with self-powered detectors was developed for measuring neutron fluxs density in the reactor core. The measuring channel consists of a measuring probe with standard self-powered detectors of Soviet make, a signal pathway, a current/voltage converter and a measuring and recording unit. Neutron flux density in the LR-0 reactor core reaches a maximum of 10 13 m -2 s -1 . Experiments using the channel were carried out both in steady-state operation and after emergency shutdown of the reactor, this from power levels of 2,096 W and 1,830 W. The results of the experiments are tabulated and briefly analyzed. (Z.M.). 4 figs., 3 tabs., 5 refs

  8. Parameters of calibration of the measurement system of 222 Rn based in LR-115

    Garcia, M.L.; Mireles, F.; Quirino, L.; Davila, I.; Lugo, F.; Pinedo, J.L.; Chavez, A.

    2003-01-01

    Since the SSNTD technique (Solid State Nuclear Track Detection) it was discovered it has been used as passive method for the detection of subnuclear particles in great variety of fields of the science. The use of the technique in measurements of 222 Rn in air have already been established implying better methodologies in the exhibition to the environment until their engraving and reading processes. The SSNTD technique is since a method by comparison since the material it can be used a single time, therefore it requires of calibration in one controlled radon atmosphere, using gauged standards. The objective of this work is to show the calibration of the devices used as radon monitors based on SSNTD. The material used as SSNTD is LR-115 Il. The standardization of the parameters used in the exhibition to radon in air, engraving and reading process, its are based on the response of the LR-115 Il, the one arrangement of the device, engraving speed and mainly the calibration factor. They are considered two types of monitors: Open camera and Closed camera, the difference among the calibration factors of both cameras is the percentage of the descendants of radon in the open camera. The standardized parameters are operation voltage of the counting system; temperature, time and concentration of the engraving solution; and thickness. (Author)

  9. Respirable dust measured downwind during rock dust application.

    Harris, M L; Organiscak, J; Klima, S; Perera, I E

    2017-05-01

    The Pittsburgh Mining Research Division of the U.S. National Institute for Occupational Safety and Health (NIOSH) conducted underground evaluations in an attempt to quantify respirable rock dust generation when using untreated rock dust and rock dust treated with an anticaking additive. Using personal dust monitors, these evaluations measured respirable rock dust levels arising from a flinger-type application of rock dust on rib and roof surfaces. Rock dust with a majority of the respirable component removed was also applied in NIOSH's Bruceton Experimental Mine using a bantam duster. The respirable dust measurements obtained downwind from both of these tests are presented and discussed. This testing did not measure miners' exposure to respirable coal mine dust under acceptable mining practices, but indicates the need for effective continuous administrative controls to be exercised when rock dusting to minimize the measured amount of rock dust in the sampling device.

  10. Some investigations and use of LR-115 track detectors for radon measurements

    Amrani, D

    2001-01-01

    Closed passive integrating radon dosimeters based on the use of cellulose nitrate (LR-115 type II) have been developed for assessment of long term radon exposure. This paper presents and comments the results of investigations, of registration efficiency, calibration factors, linearity tests and lower limit of detection for LR-115 detectors from different batches.

  11. Carbon dioxide titration method for soil respiration measurements

    Martín Rubio, Luis

    2017-01-01

    This thesis was commissioned by Tampere University of Applied Sciences, which was interested in studying and developing a titration measurement method for soil respiration and biodegradability. Some experiments were carried out measuring soil respiration for testing the method and others adding some biodegradable material like polylactic acid compressed material and 100% biodegradable plastic bags to test its biodegradability and the possibility to measure it via titration. The thesi...

  12. Can we distinguish autotrophic respiration from heterotrophic respiration in a field site using high temporal resolution CO2 flux measurements?

    Biro, Beatrice; Berger, Sina; Praetzel, Leandra; Blodau, Christian

    2016-04-01

    The processes behind C-cycling in peatlands are important to understand for assessing the vulnerability of peatlands as carbon sinks under changing climate conditions. Especially boreal peatlands are likely to underlie strong alterations in the future. It is expected that C-pools that are directly influenced by vegetation and water table fluctuations can be easily destabilized. The CO2 efflux through respiration underlies autotrophic and heterotrophic processes that show different feedbacks on changing environmental conditions. In order to understand the respiration fluxes better for more accurate modelling and prognoses, the determination of the relative importance of different respiration sources is necessary. Earlier studies used e.g. exfoliation experiments, incubation experiments or modelling approaches to estimate the different respiration sources for the total ecosystem respiration (Reco). To further the understanding in this topic, I want to distinguish autotrophic and heterotrophic respiration using high temporal resolution measurements. The study site was selected along a hydrological gradient in a peatland in southern Ontario (Canada) and measurements were conducted from May to September 2015 once per month. Environmental controls (water table, soil temperature and soil moisture) that effect the respiration sources were recorded. In my study I used a Li-COR 6400XT and a Los Gatos greenhouse gas analyzer (GGA). Reco was determined by chamber flux measurements with the GGA, while simultaneously CO2 respiration measurements on different vegetation compartments like roots, leaves and mosses were conducted using the Li-COR 6400XT. The difference between Reco and autotrophic respiration equals heterotrophic respiration. After the measurements, the vegetation plots were harvested and separated for all compartments (leaves, roots, mosses, soil organic matter), dried and weighed. The weighted respiration rates from all vegetation compartments sum up to

  13. Measurement of lung tumor motion using respiration-correlated CT

    Mageras, Gig S.; Pevsner, Alex; Yorke, Ellen D.; Rosenzweig, Kenneth E.; Ford, Eric C.; Hertanto, Agung; Larson, Steven M.; Lovelock, D. Michael; Erdi, Yusuf E.; Nehmeh, Sadek A.; Humm, John L.; Ling, C. Clifton

    2004-01-01

    Purpose: We investigate the characteristics of lung tumor motion measured with respiration-correlated computed tomography (RCCT) and examine the method's applicability to radiotherapy planning and treatment. Methods and materials: Six patients treated for non-small-cell lung carcinoma received a helical single-slice computed tomography (CT) scan with a slow couch movement (1 mm/s), while simultaneously respiration is recorded with an external position-sensitive monitor. Another 6 patients receive a 4-slice CT scan in a cine mode, in which sequential images are acquired for a complete respiratory cycle at each couch position while respiration is recorded. The images are retrospectively resorted into different respiration phases as measured with the external monitor (4-slice data) or patient surface displacement observed in the images (single-slice data). The gross tumor volume (GTV) in lung is delineated at one phase and serves as a visual guide for delineation at other phases. Interfractional GTV variation is estimated by scaling diaphragm position variations measured in gated radiographs at treatment with the ratio of GTV:diaphragm displacement observed in the RCCT data. Results: Seven out of 12 patients show GTV displacement with respiration of more than 1 cm, primarily in the superior-inferior (SI) direction; 2 patients show anterior-posterior displacement of more than 1 cm. In all cases, extremes in GTV position in the SI direction are consistent with externally measured extremes in respiration. Three patients show evidence of hysteresis in GTV motion, in which the tumor trajectory is displaced 0.2 to 0.5 cm anteriorly during expiration relative to inspiration. Significant (>1 cm) expansion of the GTV in the SI direction with respiration is observed in 1 patient. Estimated intrafractional GTV motion for gated treatment at end expiration is 0.6 cm or less in all cases; however; interfraction variation estimates (systematic plus random) are more than 1 cm in 3

  14. Track counting and thickness measurement of LR115 radon detectors using a commercial image scanner

    De Cicco, F.; Pugliese, M.; Roca, V.; Sabbarese, C.

    2014-01-01

    An original optical method for track counting and film thickness determination of etched LR115 radon detectors was developed. The method offers several advantages compared with standard techniques. In particular, it is non-destructive, very simple and rather inexpensive, since it uses a commercial scanner and a free software. The complete analysis and the calibration procedure carried out for the determination of radon specific activity are reported. A comparison with the results of spark counting defines the accuracy and the precision of the new technique. (authors)

  15. Aquatic respiration rate measurements at low oxygen concentrations.

    Moritz Holtappels

    Full Text Available Despite its huge ecological importance, microbial oxygen respiration in pelagic waters is little studied, primarily due to methodological difficulties. Respiration measurements are challenging because of the required high resolution of oxygen concentration measurements. Recent improvements in oxygen sensing techniques bear great potential to overcome these limitations. Here we compare 3 different methods to measure oxygen consumption rates at low oxygen concentrations, utilizing amperometric Clark type sensors (STOX, optical sensors (optodes, and mass spectrometry in combination with (18-18O2 labeling. Oxygen concentrations and consumption rates agreed well between the different methods when applied in the same experimental setting. Oxygen consumption rates between 30 and 400 nmol L(-1 h(-1 were measured with high precision and relative standard errors of less than 3%. Rate detection limits in the range of 1 nmol L(-1 h(-1 were suitable for rate determinations in open ocean water and were lowest at the lowest applied O2 concentration.

  16. Gravimetric Measurements of Filtering Facepiece Respirators Challenged With Diesel Exhaust.

    Satish, Swathi; Swanson, Jacob J; Xiao, Kai; Viner, Andrew S; Kittelson, David B; Pui, David Y H

    2017-07-01

    Elevated concentrations of diesel exhaust have been linked to adverse health effects. Filtering facepiece respirators (FFRs) are widely used as a form of respiratory protection against diesel particulate matter (DPM) in occupational settings. Previous results (Penconek A, Drążyk P, Moskal A. (2013) Penetration of diesel exhaust particles through commercially available dust half masks. Ann Occup Hyg; 57: 360-73.) have suggested that common FFRs are less efficient than would be expected for this purpose based on their certification approvals. The objective of this study was to measure the penetration of DPM through NIOSH-certified R95 and P95 electret respirators to verify this result. Gravimetric-based penetration measurements conducted using polytetrafluoroethylene (PTFE) and polypropylene (PP) filters were compared with penetration measurements made with a Scanning Mobility Particle Sizer (SMPS, TSI Inc.), which measures the particle size distribution. Gravimetric measurements using PP filters were variable compared to SMPS measurements and biased high due to adsorption of gas phase organic material. Relatively inert PTFE filters adsorbed less gas phase organic material resulting in measurements that were more accurate. To attempt to correct for artifacts associated with adsorption of gas phase organic material, primary and secondary filters were used in series upstream and downstream of the FFR. Correcting for adsorption by subtracting the secondary mass from the primary mass improved the result for both PTFE and PP filters but this correction is subject to 'equilibrium' conditions that depend on sampling time and the concentration of particles and gas phase hydrocarbons. Overall, the results demonstrate that the use of filters to determine filtration efficiency of FFRs challenged with diesel exhaust produces erroneous results due to the presence of gas phase hydrocarbons in diesel exhaust and the tendency of filters to adsorb organic material. Published by

  17. Radon measurement by Solid States Nuclear Tracks Detectors (SSNTD/LR-115) in the city of Cocody (Abidjan)

    Agba, Dabo Salif Ignace

    2011-02-01

    Radon as natural gas is permanently present in our environment. It is the main natural radiological exposure source for human beings. So, the study of the concentration of this rare gas is essential in order to evaluate the risks incured by the population and the environment. The results of different studies will guide as to take the appropriate protection decisions as recommended by the World Health Organization (WHO). The present work consists in measuring the concentration of radon (Rn 222 isotope) in seven (7) pre-selected sites in the city of Cocody (Abidjan) using SSNTD/LR-115 (photographic film detectors). Our measurements showed some variations in the concentration of radon according to seasons and the influence of main factors such as the porosity, humidity and the diameter of the specks of soil. We noticed that our measured values remain very low compared to international standards. This work is the first step for more important measurements throughout the whole ivorian territory. The aim is to draw a national cartography of radon in Cote d'Ivoire. [fr

  18. Parameters of calibration of the measurement system of {sup 222} Rn based in LR-115; Parametros de calibracion del sistema de medicion de {sup 222} Rn basado en LR-115

    Garcia, M.L.; Mireles, F.; Quirino, L.; Davila, I.; Lugo, F.; Pinedo, J.L. [CREN-UAZ, 98068 Zacatecas (Mexico); Chavez, A. [ININ, 52045 Ocoyoacac, Estado de Mexico (Mexico)]. e-mail: mluisagb@hotmail.com

    2003-07-01

    Since the SSNTD technique (Solid State Nuclear Track Detection) it was discovered it has been used as passive method for the detection of subnuclear particles in great variety of fields of the science. The use of the technique in measurements of {sup 222} Rn in air have already been established implying better methodologies in the exhibition to the environment until their engraving and reading processes. The SSNTD technique is since a method by comparison since the material it can be used a single time, therefore it requires of calibration in one controlled radon atmosphere, using gauged standards. The objective of this work is to show the calibration of the devices used as radon monitors based on SSNTD. The material used as SSNTD is LR-115 Il. The standardization of the parameters used in the exhibition to radon in air, engraving and reading process, its are based on the response of the LR-115 Il, the one arrangement of the device, engraving speed and mainly the calibration factor. They are considered two types of monitors: Open camera and Closed camera, the difference among the calibration factors of both cameras is the percentage of the descendants of radon in the open camera. The standardized parameters are operation voltage of the counting system; temperature, time and concentration of the engraving solution; and thickness. (Author)

  19. Measurement of 89Y(n,2n) spectral averaged cross section in LR-0 special core reactor spectrum

    Košťál, Michal; Losa, Evžen; Baroň, Petr; Šolc, Jaroslav; Švadlenková, Marie; Koleška, Michal; Mareček, Martin; Uhlíř, Jan

    2017-12-01

    The present paper describes reaction rate measurement of 89Y(n,2n)88Y in a well-defined reactor spectrum of a special core assembled in the LR-0 reactor and compares this value with results of simulation. The reaction rate is derived from the measurement of activity of 88Y using gamma-ray spectrometry of irradiated Y2O3 sample. The resulting cross section value averaged in spectrum is 43.9 ± 1.5 μb, averaged in the 235U spectrum is 0.172 ± 0.006 mb. This cross-section is important as it is used as high energy neutron monitor and is therefore included in the International Reactor Dosimetry and Fusion File. Calculations of reaction rates were performed with the MCNP6 code using ENDF/B-VII.0, JEFF-3.1, JEFF-3.2, JENDL-3.3, JENDL-4, ROSFOND-2010, CENDL-3.1 and IRDFF nuclear data libraries. The agreement with uranium description by CIELO library is very good, while in ENDF/B-VII.0 description of uranium, underprediction about 10% in average can be observed.

  20. Measuring oxygen uptake in fishes with bimodal respiration.

    Lefevre, S; Bayley, M; McKenzie, D J

    2016-01-01

    Respirometry is a robust method for measurement of oxygen uptake as a proxy for metabolic rate in fishes, and how species with bimodal respiration might meet their demands from water v. air has interested researchers for over a century. The challenges of measuring oxygen uptake from both water and air, preferably simultaneously, have been addressed in a variety of ways, which are briefly reviewed. These methods are not well-suited for the long-term measurements necessary to be certain of obtaining undisturbed patterns of respiratory partitioning, for example, to estimate traits such as standard metabolic rate. Such measurements require automated intermittent-closed respirometry that, for bimodal fishes, has only recently been developed. This paper describes two approaches in enough detail to be replicated by the interested researcher. These methods are for static respirometry. Measuring oxygen uptake by bimodal fishes during exercise poses specific challenges, which are described to aid the reader in designing experiments. The respiratory physiology and behaviour of air-breathing fishes is very complex and can easily be influenced by experimental conditions, and some general considerations are listed to facilitate the design of experiments. Air breathing is believed to have evolved in response to aquatic hypoxia and, probably, associated hypercapnia. The review ends by considering what realistic hypercapnia is, how hypercapnic tropical waters can become and how this might influence bimodal animals' gas exchange. © 2015 The Fisheries Society of the British Isles.

  1. Calibrating soil respiration measures with a dynamic flux apparatus using artificial soil media of varying porosity

    John R. Butnor; Kurt H. Johnsen

    2004-01-01

    Measurement of soil respiration to quantify ecosystem carbon cyclingrequires absolute, not relative, estimates of soil CO2 efflux. We describe a novel, automated efflux apparatus that can be used to test the accuracy of chamber-based soil respiration measurements by generating known CO2 fluxes. Artificial soil is supported...

  2. Determination of microcystin-LR in drinking water using UPLC tandem mass spectrometry-matrix effects and measurement.

    Li, Wei; Duan, Jinming; Niu, Chaoying; Qiang, Naichen; Mulcahy, Dennis

    2011-10-01

    A simple detection method using ultra-performance liquid chromatography electrospray ionisation tandem mass spectrometry (UPLC-ESI-MS-MS) coupled with the sample dilution method for determining trace microcystin-LR (MC-LR) in drinking water is presented. The limit of detection (LOD) was 0.04 µg/L and the limit of quantitation (LOQ) was 0.1 µg/L. Water matrix effects of ionic strength, dissolved organic carbon (DOC) and pH were examined. The results indicate that signal detection intensity for MC-LR was significantly suppressed as the ionic strength increased from ultrapure water condition, whereas it increased slightly with solution pH and DOC at low concentrations. However, addition of methanol (MeOH) into the sample was able to counter the signal suppression effects. In this study, dilution of the tap water sample by adding 4% MeOH (v/v) was observed to be adequate to compensate for the signal suppression. The recoveries of the samples fortified with MC-LR (0.2, 1, and 10 µg/L) for three different tap water samples ranged from 84.4% to 112.9%.

  3. Indoor radon measurements in the dwellings of Kangra District of Himachal Pradesh, India, using LR-115 nuclear track detectors

    Dhiman, M. [Punjab Technical University (India); Mehra, R. [Department of Physics, Dr. B.R. Ambedkar National Institute of Technology (India); Tyagi, A.K. [Department of Applied Sciences, Shaheed Bhagat Singh College of Engineering and Technology (India)

    2014-07-01

    Study of indoor radon was carried out in the domestic environment of 15 villages of Kangra district of Himachal Pradesh, India. Time integrated track etch technique has been used for the measurement of indoor radon levels. Bare cellulose nitrate LR-115 type II films have been used as detectors in the survey of indoor radon for four seasons of three months each covering a period of one year from March 2012 to March 2013. The houses were chosen randomly in such a way that the dwellings constructed with different types of building materials such as soil, bricks, cement, marble, concrete, wood in different localities of the village are covered. It has been found that indoor radon concentration depends upon the type of house, ventilation condition etc. The calibration constant of 1 track cm{sup -2} day{sup -1} which is equal to 50 Bqm{sup -3} has been used to express radon concentration in Bqm{sup -3}. The conversion factors have been used to calculate the exposure (an exposure of an individual to radon progeny of 1 WLM is equivalent to 3.54 mJ h m{sup -3}), the annual effective dose (1 WLM=3.88 mSv) and the lifetime fatality risk (3 x 10{sup -4} WLM). Indoor radon concentrations were found to vary from 132.25 Bqm{sup -3} to 449.75 Bqm{sup -3} with an average value of 261.40 Bqm{sup -3}. Annual effective dose in these dwellings were found to vary form 2.78 mSv to 7.68 mSv with an average value of 4.5 mSv. The average radon concentration in dwellings in most of the villages falls in the action level (200-600 Bqm{sup -3}) recommended by International Commission on Radiological Protection. Document available in abstract form only. (authors)

  4. Oxygen respiration rates of benthic foraminifera as measured with oxygen microsensors

    Geslin, E.; Risgaard-Petersen, N.; Lombard, Fabien

    2011-01-01

    of the foraminiferal specimens. The results show a wide range of oxygen respiration rates for the different species (from 0.09 to 5.27 nl cell−1 h−1) and a clear correlation with foraminiferal biovolume showed by the power law relationship: R = 3.98 10−3 BioVol0.88 where the oxygen respiration rate (R) is expressed......Oxygen respiration rates of benthic foraminifera are still badly known, mainly because they are difficult to measure. Oxygen respiration rates of seventeen species of benthic foraminifera were measured using microelectrodes and calculated on the basis of the oxygen fluxes measured in the vicinity...... groups (nematodes, copepods, ostracods, ciliates and flagellates) suggests that benthic foraminifera have a lower oxygen respiration rates per unit biovolume. The total contribution of benthic foraminifera to the aerobic mineralisation of organic matter is estimated for the studied areas. The results...

  5. Effect of test exercises and mask donning on measured respirator fit.

    Crutchfield, C D; Fairbank, E O; Greenstein, S L

    1999-12-01

    Quantitative respirator fit test protocols are typically defined by a series of fit test exercises. A rationale for the protocols that have been developed is generally not available. There also is little information available that describes the effect or effectiveness of the fit test exercises currently specified in respiratory protection standards. This study was designed to assess the relative impact of fit test exercises and mask donning on respirator fit as measured by a controlled negative pressure and an ambient aerosol fit test system. Multiple donnings of two different sizes of identical respirator models by each of 14 test subjects showed that donning affects respirator fit to a greater degree than fit test exercises. Currently specified fit test protocols emphasize test exercises, and the determination of fit is based on a single mask donning. A rationale for a modified fit test protocol based on fewer, more targeted test exercises and multiple mask donnings is presented. The modified protocol identified inadequately fitting respirators as effectively as the currently specified Occupational Safety and Health Administration (OSHA) quantitative fit test protocol. The controlled negative pressure system measured significantly (p < 0.0001) more respirator leakage than the ambient aerosol fit test system. The bend over fit test exercise was found to be predictive of poor respirator fit by both fit test systems. For the better fitting respirators, only the talking exercise generated aerosol fit factors that were significantly lower (p < 0.0001) than corresponding donning fit factors.

  6. Long-term measurements of respirable sulfates and particulates inside and outside homes

    Spengler, J D; Dockery, D W; Turner, W A; Wolfson, J M; Ferris, B G

    1981-01-01

    To better understand the health effects of air pollution, the results of extensive indoor and outdoor measurements of mass respirable particulates and water-soluble respirable particulates are analyzed. The measurements were taken in six U.S. citiesPortage, Wis./ Topeka, Kans./ Kingston/Harriman, Tenn./ Watertown, Mass./ St. Louis, Mo./ and Steubenville, Ohio. Results indicated that the major source of indoor air pollution is cigarette smoke, which contributes about 20

  7. Respiration rate of stream insects measured in situ along a large altitude range

    Rostgaard, S.; Jacobsen, D.

    2005-01-01

    Field studies of respiration in stream insects are few in comparison with laboratory studies. To evaluate the influence of temperature and oxygen along altitudinal gradients we measured the respiration rate of fully acclimatized larval Trichoptera, Plecoptera and Ephemeroptera under similar field...... at 100 and 50% oxygen saturation indicated that highland animals reduced their oxygen uptake more than their counterparts in the lowland when oxygen availability decreased. The temperature response of respiration calculated between the insect assemblages at different altitudes showed a mean assemblage Q...

  8. A combined electrochemical and optical trapping platform for measuring single cell respiration rates at electrode interfaces

    Gross, Benjamin J.; El-Naggar, Mohamed Y.

    2015-01-01

    Metal-reducing bacteria gain energy by extracellular electron transfer to external solids, such as naturally abundant minerals, which substitute for oxygen or the other common soluble electron acceptors of respiration. This process is one of the earliest forms of respiration on earth and has significant environmental and technological implications. By performing electron transfer to electrodes instead of minerals, these microbes can be used as biocatalysts for conversion of diverse chemical fuels to electricity. Understanding such a complex biotic-abiotic interaction necessitates the development of tools capable of probing extracellular electron transfer down to the level of single cells. Here, we describe an experimental platform for single cell respiration measurements. The design integrates an infrared optical trap, perfusion chamber, and lithographically fabricated electrochemical chips containing potentiostatically controlled transparent indium tin oxide microelectrodes. Individual bacteria are manipulated using the optical trap and placed on the microelectrodes, which are biased at a suitable oxidizing potential in the absence of any chemical electron acceptor. The potentiostat is used to detect the respiration current correlated with cell-electrode contact. We demonstrate the system with single cell measurements of the dissimilatory-metal reducing bacterium Shewanella oneidensis MR-1, which resulted in respiration currents ranging from 15 fA to 100 fA per cell under our measurement conditions. Mutants lacking the outer-membrane cytochromes necessary for extracellular respiration did not result in any measurable current output upon contact. In addition to the application for extracellular electron transfer studies, the ability to electronically measure cell-specific respiration rates may provide answers for a variety of fundamental microbial physiology questions

  9. A combined electrochemical and optical trapping platform for measuring single cell respiration rates at electrode interfaces.

    Gross, Benjamin J; El-Naggar, Mohamed Y

    2015-06-01

    Metal-reducing bacteria gain energy by extracellular electron transfer to external solids, such as naturally abundant minerals, which substitute for oxygen or the other common soluble electron acceptors of respiration. This process is one of the earliest forms of respiration on earth and has significant environmental and technological implications. By performing electron transfer to electrodes instead of minerals, these microbes can be used as biocatalysts for conversion of diverse chemical fuels to electricity. Understanding such a complex biotic-abiotic interaction necessitates the development of tools capable of probing extracellular electron transfer down to the level of single cells. Here, we describe an experimental platform for single cell respiration measurements. The design integrates an infrared optical trap, perfusion chamber, and lithographically fabricated electrochemical chips containing potentiostatically controlled transparent indium tin oxide microelectrodes. Individual bacteria are manipulated using the optical trap and placed on the microelectrodes, which are biased at a suitable oxidizing potential in the absence of any chemical electron acceptor. The potentiostat is used to detect the respiration current correlated with cell-electrode contact. We demonstrate the system with single cell measurements of the dissimilatory-metal reducing bacterium Shewanella oneidensis MR-1, which resulted in respiration currents ranging from 15 fA to 100 fA per cell under our measurement conditions. Mutants lacking the outer-membrane cytochromes necessary for extracellular respiration did not result in any measurable current output upon contact. In addition to the application for extracellular electron transfer studies, the ability to electronically measure cell-specific respiration rates may provide answers for a variety of fundamental microbial physiology questions.

  10. A combined electrochemical and optical trapping platform for measuring single cell respiration rates at electrode interfaces

    Gross, Benjamin J. [Department of Physics and Astronomy, University of Southern California, 920 Bloom Walk, Los Angeles, California 90089-0484 (United States); El-Naggar, Mohamed Y., E-mail: mnaggar@usc.edu [Department of Physics and Astronomy, University of Southern California, 920 Bloom Walk, Los Angeles, California 90089-0484 (United States); Molecular and Computational Biology Section, Department of Biological Sciences, University of Southern California, Los Angeles, California 90089-0484 (United States); Department of Chemistry, University of Southern California, Los Angeles, California 90089-0484 (United States)

    2015-06-15

    Metal-reducing bacteria gain energy by extracellular electron transfer to external solids, such as naturally abundant minerals, which substitute for oxygen or the other common soluble electron acceptors of respiration. This process is one of the earliest forms of respiration on earth and has significant environmental and technological implications. By performing electron transfer to electrodes instead of minerals, these microbes can be used as biocatalysts for conversion of diverse chemical fuels to electricity. Understanding such a complex biotic-abiotic interaction necessitates the development of tools capable of probing extracellular electron transfer down to the level of single cells. Here, we describe an experimental platform for single cell respiration measurements. The design integrates an infrared optical trap, perfusion chamber, and lithographically fabricated electrochemical chips containing potentiostatically controlled transparent indium tin oxide microelectrodes. Individual bacteria are manipulated using the optical trap and placed on the microelectrodes, which are biased at a suitable oxidizing potential in the absence of any chemical electron acceptor. The potentiostat is used to detect the respiration current correlated with cell-electrode contact. We demonstrate the system with single cell measurements of the dissimilatory-metal reducing bacterium Shewanella oneidensis MR-1, which resulted in respiration currents ranging from 15 fA to 100 fA per cell under our measurement conditions. Mutants lacking the outer-membrane cytochromes necessary for extracellular respiration did not result in any measurable current output upon contact. In addition to the application for extracellular electron transfer studies, the ability to electronically measure cell-specific respiration rates may provide answers for a variety of fundamental microbial physiology questions.

  11. Temperature dependence of bulk respiration of crop stands. Measurement and model fitting

    Tani, Takashi; Arai, Ryuji; Tako, Yasuhiro

    2007-01-01

    The objective of the present study was to examine whether the temperature dependence of respiration at a crop-stand scale could be directly represented by an Arrhenius function that was widely used for representing the temperature dependence of leaf respiration. We determined temperature dependences of bulk respiration of monospecific stands of rice and soybean within a range of the air temperature from 15 to 30degC using large closed chambers. Measured responses of respiration rates of the two stands were well fitted by the Arrhenius function (R 2 =0.99). In the existing model to assess the local radiological impact of the anthropogenic carbon-14, effects of the physical environmental factors on photosynthesis and respiration of crop stands are not taken into account for the calculation of the net amount of carbon per cultivation area in crops at harvest which is the crucial parameter for the estimation of the activity concentration of carbon-14 in crops. Our result indicates that the Arrhenius function is useful for incorporating the effect of the temperature on respiration of crop stands into the model which is expected to contribute to a more realistic estimate of the activity concentration of carbon-14 in crops. (author)

  12. A Medical Cloud-Based Platform for Respiration Rate Measurement and Hierarchical Classification of Breath Disorders

    Atena Roshan Fekr

    2014-06-01

    Full Text Available The measurement of human respiratory signals is crucial in cyberbiological systems. A disordered breathing pattern can be the first symptom of different physiological, mechanical, or psychological dysfunctions. Therefore, a real-time monitoring of the respiration patterns, as well as respiration rate is a critical need in medical applications. There are several methods for respiration rate measurement. However, despite their accuracy, these methods are expensive and could not be integrated in a body sensor network. In this work, we present a real-time cloud-based platform for both monitoring the respiration rate and breath pattern classification, remotely. The proposed system is designed particularly for patients with breathing problems (e.g., respiratory complications after surgery or sleep disorders. Our system includes calibrated accelerometer sensor, Bluetooth Low Energy (BLE and cloud-computing model. We also suggest a procedure to improve the accuracy of respiration rate for patients at rest positions. The overall error in the respiration rate calculation is obtained 0.53% considering SPR-BTA spirometer as the reference. Five types of respiration disorders, Bradapnea, Tachypnea, Cheyn-stokes, Kaussmal, and Biot’s breathing are classified based on hierarchical Support Vector Machine (SVM with seven different features. We have evaluated the performance of the proposed classification while it is individualized to every subject (case 1 as well as considering all subjects (case 2. Since the selection of kernel function is a key factor to decide SVM’s performance, in this paper three different kernel functions are evaluated. The experiments are conducted with 11 subjects and the average accuracy of 94.52% for case 1 and the accuracy of 81.29% for case 2 are achieved based on Radial Basis Function (RBF. Finally, a performance evaluation has been done for normal and impaired subjects considering sensitivity, specificity and G-mean parameters

  13. Soil respiration from four aggrading forested watersheds measured over a quarter century

    David C. Coleman; Mark D. Hunter; John Hutton; Steven Pomeroy; Lloyd Swift

    2002-01-01

    Soil respiration was measured in four aggrading, forested second-growth watersheds in the southern Appalachians using an identical method (alkali absorption) at intervals 23 and 24 years apart. Seasonal trends were similar, with mid-summer maxima and winter minima. Amounts of carbon dioxide evolved were higher in the recent measurements (1995) compared to the earlier...

  14. Microchambers with Solid-State Phosphorescent Sensor for Measuring Single Mitochondrial Respiration.

    Pham, Ted D; Wallace, Douglas C; Burke, Peter J

    2016-07-09

    It is now well established that, even within a single cell, multiple copies of the mitochondrial genome may be present (genetic heteroplasmy). It would be interesting to develop techniques to determine if and to what extent this genetic variation results in functional variation from one mitochondrion to the next (functional heteroplasmy). Measuring mitochondrial respiration can reveal the organelles' functional capacity for Adenosine triphosphate (ATP) production and determine mitochondrial damage that may arise from genetic or age related defects. However, available technologies require significant quantities of mitochondria. Here, we develop a technology to assay the respiration of a single mitochondrion. Our "micro-respirometer" consists of micron sized chambers etched out of borofloat glass substrates and coated with an oxygen sensitive phosphorescent dye Pt(II) meso-tetra(pentafluorophenyl)porphine (PtTFPP) mixed with polystyrene. The chambers are sealed with a polydimethylsiloxane layer coated with oxygen impermeable Viton rubber to prevent diffusion of oxygen from the environment. As the mitochondria consume oxygen in the chamber, the phosphorescence signal increases, allowing direct determination of the respiration rate. Experiments with coupled vs. uncoupled mitochondria showed a substantial difference in respiration, confirming the validity of the microchambers as single mitochondrial respirometers. This demonstration could enable future high-throughput assays of mitochondrial respiration and benefit the study of mitochondrial functional heterogeneity, and its role in health and disease.

  15. Investigation of Mitochondrial Dysfunction by Sequential Microplate-Based Respiration Measurements from Intact and Permeabilized Neurons

    Clerc, Pascaline; Polster, Brian M.

    2012-01-01

    Mitochondrial dysfunction is a component of many neurodegenerative conditions. Measurement of oxygen consumption from intact neurons enables evaluation of mitochondrial bioenergetics under conditions that are more physiologically realistic compared to isolated mitochondria. However, mechanistic analysis of mitochondrial function in cells is complicated by changing energy demands and lack of substrate control. Here we describe a technique for sequentially measuring respiration from intact and saponin-permeabilized cortical neurons on single microplates. This technique allows control of substrates to individual electron transport chain complexes following permeabilization, as well as side-by-side comparisons to intact cells. To illustrate the utility of the technique, we demonstrate that inhibition of respiration by the drug KB-R7943 in intact neurons is relieved by delivery of the complex II substrate succinate, but not by complex I substrates, via acute saponin permeabilization. In contrast, methyl succinate, a putative cell permeable complex II substrate, failed to rescue respiration in intact neurons and was a poor complex II substrate in permeabilized cells. Sequential measurements of intact and permeabilized cell respiration should be particularly useful for evaluating indirect mitochondrial toxicity due to drugs or cellular signaling events which cannot be readily studied using isolated mitochondria. PMID:22496810

  16. Respiration and Heartbeat Measurement for Sleep Monitoring Using a Flexible AlN Piezoelectric Film Sensor

    Nan BU

    2009-11-01

    Full Text Available Respiratory and heartbeat monitoring during sleep provides basic physiological information for diagnosis of sleep disorders. This paper proposes a new method for non-invasive and unconstrained measurement of respiration and heartbeat during sleep. A flexible piezoelectric film sensor made of aluminum nitride (AlN material is used for signal acquisition. The total thickness of this sensor is less than 40 μm; the thin thickness makes it imperceptible when integrated into a bed. In addition, the AlN film sensor has good sensitivity, so that pressure fluctuation due to respiration and heartbeat can be measured when a subject is lying on this sensor. The pressure fluctuation measured can be further separated into signals corresponding to respiration and heartbeat, respectively. In the proposed method, the signal separation is achieved using an algorithm based on empirical mode decomposition (EMD. From the experimental results, it was found that respiration and heartbeat signals can be successfully obtained with the proposed method.

  17. Comparing ecosystem and soil respiration: Review and key challenges of tower-based and soil measurements

    Barba, Josep; Cueva, Alejandro; Bahn, Michael; Barron-Gafford, Greg A.; Bond-Lamberty, Benjamin; Hanson, Paul J.; Jaimes, Aline; Kulmala, Liisa; Pumpanen, Jukka; Scott, Russell L.; Wohlfahrt, Georg; Vargas, Rodrigo

    2018-02-01

    The net ecosystem exchange (NEE) is the difference between ecosystem CO2 assimilation and CO2 losses to the atmosphere. Ecosystem respiration (Reco), the efflux of CO2 from the ecosystem to the atmosphere, includes the soil-to-atmosphere carbon flux (i.e., soil respiration; Rsoil) and aboveground plant respiration. Therefore, Rsoil is a fraction of Reco and by definition has to be smaller than Reco at annual, seasonal and daily scales. However, several studies estimating Reco with the eddy covariance technique and measuring Rsoil within the footprint of the tower have reported higher Rsoil than Reco at different time scales. Here, we compare four different and contrasting ecosystems (from forest to grasslands, and from boreal to semiarid) to study whether, and under what conditions, measurements of Reco are lower than Rsoil. In general, both fluxes showed similar temporal patterns, but Reco was not consistently higher than Rsoil from daily to annual scales across sites. We identified several issues that apply for measuring NEE and measuring/upscaling Rsoil that could result in an underestimation of Reco and/or an overestimation of Rsoil. These issues are discussed based on (a) nighttime measurements of NEE, (b) Rsoil measurements, and (c) the interpretation of the functional relationships of these fluxes with temperature (i.e., Q10). We highlight that there is still a need for better integration of Rsoil with eddy covariance measurements to address challenges related to spatial and temporal variability of Reco and Rsoil.

  18. Calculations of fission rate distribution in the core of WWER-1000 mock-up on the LR-0 reactor using alternative methods and comparison with results of measurements

    Zaritskiy, S.; Kovalishin, A.; Tsvetkov, T.; Rypar, V.; Svadlenkova, M.

    2011-01-01

    General review of experimental and calculation researches on WWER-440 and WWER-1000 mock-ups on the reactor LR-0 was introduced on the twentieth Symposium AER. The experimental core fission rate distribution was obtained by means of gamma-scanning of the fuel pins - 140La single peak (1596 keV) measurements and wide energy range (approximately 600-900 keV) measurements. Altogether from 260 to 500 fuel pins were scanned in different experiments. The measurements were arranged in the middle of the fuel (the active part of pin). Pin-to-pin calculations of the WWER-1000 mock-up core fission rate distribution were performed with several codes: Monte Carlo codes MCU-REA/2 and MCNPX with different nuclear data libraries, diffusion code RADAR (63 energy groups library) and code SVL based on Surface Harmonics Method (69 energy groups). Calculated data are compared with experimental ones. The obtained results allow developing the benchmark for core calculations methodologies, evaluating and validating source reliability for the out-of-core (inside and outside pressure vessel) neutron transport calculations. (Authors)

  19. Unifying LL and LR parsing

    W.H.L.M. Pijls (Wim)

    1993-01-01

    textabstractIn parsing theory, LL parsing and LR parsing are regarded to be two distinct methods. In this paper the relation between these methods is clarified.As shown in literature on parsing theory, for every context-free grammar, a so-called non-deterministic LR(0) automaton can be constructed.

  20. Comparison of the three optical platforms for measurement of cellular respiration.

    Kondrashina, Alina V; Ogurtsov, Vladimir I; Papkovsky, Dmitri B

    2015-01-01

    We compared three optical platforms for measurement of cellular respiration: absolute oxygen consumption rates (OCRs) in hermetically sealed microcuvettes, relative OCRs measured in a 96-well plate with oil seal, and steady-state oxygenation of cells in an open 96-well plate. Using mouse embryonic fibroblasts cell line, the phosphorescent intracellular O2 probe MitoXpress-Intra, and time-resolved fluorescence reader, we determined algorithms for conversion of relative OCRs and cell oxygenation into absolute OCRs, thereby allowing simple high-throughput measurement of absolute OCR values. Copyright © 2014 Elsevier Inc. All rights reserved.

  1. Measuring priming using 14C of respired CO2: effects on respiration source pools and interactions with warming

    Hopkins, F. M.; Trumbore, S.

    2011-12-01

    The role of substrate availability on soil carbon turnover is a critical unknown in predicting future soil carbon stocks. Substrate composition and availability can be altered by land cover change, warming, and nitrogen deposition, which can in turn affect soil carbon stocks through the priming effect. In particular, little is understood about the interaction between warming and changing substrate concentration. We examined the interactions between global change factors and the priming effect using sucrose addition to incubations of soils from two forest Free Air CO2 Enrichment (FACE) sites (Duke and Aspen). In addition to the in situ global change manipulations conducted at these sites, the CO2 fertilization procedure over the decade-long experiment labeled soil carbon pools with fossil-derived carbon (depleted in 14C relative to the background isotope content of soil carbon), allowing us to determine the effect of priming on respiration of soil carbon substrates of different ages. Thus, we used the carbon-13 signature of sucrose-derived CO2 to account for losses of substrate C, and the carbon-14 signature to partition fluxes of soil-derived CO2 between pre-FACE (> 10 y) and FACE derived (stocks, differences in the source of the priming effect between the two sites may be due to inherent differences in the relative role of stabilization factors within the soil carbon stock.

  2. Respirator field performance factors

    Skaggs, B.J.; DeField, J.D.; Strandberg, S.W.; Sutcliffe, C.R.

    1985-01-01

    The Industrial Hygiene Group assisted OSHA and the NRC in measurements of respirator performance under field conditions. They reviewed problems associated with sampling aerosols within the respirator in order to determine fit factors (FFs) or field performance factor (FPF). In addition, they designed an environmental chamber study to determine the effects of temperature and humidity on a respirator wearer

  3. Measurement of gross photosynthesis, respiration in the light, and mesophyll conductance using H218O labeling.

    Gauthier, Paul Pg; Battle, Mark O; Griffin, Kevin L; Bender, Michael L

    2018-03-27

    A fundamental challenge in plant physiology is independently determining the rates of gross O2 production by photosynthesis and O2 consumption by respiration, photorespiration, and other processes. Previous studies on isolated chloroplasts or leaves have separately constrained net and gross O2 production (NOP and GOP, respectively) by labeling ambient O2 with 18O while leaf water was unlabeled. Here, we describe a method to accurately measure GOP and NOP of whole detached leaves in a cuvette as a routine gas exchange measurement. The petiole is immersed in water enriched to a δ18O of ~9,000‰, and leaf water is labeled through the transpiration stream. Photosynthesis transfers 18O from H2O to O2. GOP is calculated from the increase in δ18O of O2 as air passes through the cuvette. NOP is determined from the increase in O2/N2. Both terms are measured by isotope ratio mass spectrometry. CO2 assimilation and other standard gas exchange parameters are also measured. Reproducible measurements are made on a single leaf for more than 15 hours. We used this method to measure the light response curve of NOP and GOP in Phaseolus vulgaris at 21% and 2% O2. We then used these data to examine the O2/CO2 ratio of net photosynthesis, the light response curve of mesophyll conductance, and the apparent inhibition of respiration in the light (Kok effect) at both oxygen levels. The results are discussed in the context of evaluating the technique as a tool to study and understand leaf physiological traits. {copyright, serif} 2018 American Society of Plant Biologists. All rights reserved.

  4. The value of soil respiration measurements for interpreting and modeling terrestrial carbon cycling

    Phillips, Claire L.; Bond-Lamberty, Ben; Desai, Ankur R.; Lavoie, Martin; Risk, Dave; Tang, Jianwu; Todd-Brown, Katherine; Vargas, Rodrigo

    2016-11-16

    A recent acceleration of model-data synthesis activities has leveraged many terrestrial carbon (C) datasets, but utilization of soil respiration (RS) data has not kept pace with other types such as eddy covariance (EC) fluxes and soil C stocks. Here we argue that RS data, including non-continuous measurements from survey sampling campaigns, have unrealized value and should be utilized more extensively and creatively in data synthesis and modeling activities. We identify three major challenges in interpreting RS data, and discuss opportunities to address them. The first challenge is that when RS is compared to ecosystem respiration (RECO) measured from EC towers, it is not uncommon to find substantial mismatch, indicating one or both flux methodologies are unreliable. We argue the most likely cause of mismatch is unreliable EC data, and there is an unrecognized opportunity to utilize RS for EC quality control. The second challenge is that RS integrates belowground heterotrophic (RH) and autotrophic (RA) activity, whereas modelers generally prefer partitioned fluxes, and few models include an explicit RS output. Opportunities exist to use the total RS flux for data assimilation and model benchmarking methods rather than less-certain partitioned fluxes. Pushing for more experiments that not only partition RS but also monitor the age of RA and RH, as well as for the development of belowground RA components in models, would allow for more direct comparison between measured and modeled values. The third challenge is that soil respiration is generally measured at a very different resolution than that needed for comparison to EC or ecosystem- to global-scale models. Measuring soil fluxes with finer spatial resolution and more extensive coverage, and downscaling EC fluxes to match the scale of RS, will improve chamber and tower comparisons. Opportunities also exist to estimate RH at regional scales by implementing decomposition functional types, akin to plant functional

  5. Measuring temperature dependence of soil respiration: importance of incubation time, soil type, moisture content and model fits

    Schipper, L. A.; Robinson, J.; O'Neill, T.; Ryburn, J.; Arcus, V. L.

    2015-12-01

    Developing robust models of the temperature response and sensitivity of soil respiration is critical for determining changes carbon cycling in response to climate change and at daily to annual time scales. Currently, approaches for measuring temperature dependence of soil respiration generally use long incubation times (days to weeks and months) at a limited number of incubation temperatures. Long incubation times likely allow thermal adaptation by the microbial population so that results are poorly representative of in situ soil responses. Additionally, too few incubation temperatures allows for the fit and justification of many different predictive equations, which can lead to inaccuracies when used for carbon budgeting purposes. We have developed a method to rapidly determine the response of soil respiration rate to wide range of temperatures. An aluminium block with 44 sample slots is heated at one end and cooled at the other to give a temperature gradient from 0 to 55°C at about one degree increments. Soil respiration is measured within 5 hours to minimise the possibility of thermal adaptation. We have used this method to demonstrate the similarity of temperature sensitivity of respiration for different soils from the same location across seasons. We are currently testing whether long-term (weeks to months) incubation alter temperature response and sensitivity that occurs in situ responses. This method is also well suited for determining the most appropriate models of temperature dependence and sensitivity of soil respiration (including macromolecular rate theory MMRT). With additional testing, this method is expected to be a more reliable method of measuring soil respiration rate for soil quality and modelling of soil carbon processes.

  6. An instrument design and sample strategy for measuring soil respiration in the coastal temperate rain forest

    Nay, S. M.; D'Amore, D. V.

    2009-12-01

    The coastal temperate rainforest (CTR) along the northwest coast of North America is a large and complex mosaic of forests and wetlands located on an undulating terrain ranging from sea level to thousands of meters in elevation. This biome stores a dynamic portion of the total carbon stock of North America. The fate of the terrestrial carbon stock is of concern due to the potential for mobilization and export of this store to both the atmosphere as carbon respiration flux and ocean as dissolved organic and inorganic carbon flux. Soil respiration is the largest export vector in the system and must be accurately measured to gain any comprehensive understanding of how carbon moves though this system. Suitable monitoring tools capable of measuring carbon fluxes at small spatial scales are essential for our understanding of carbon dynamics at larger spatial scales within this complex assemblage of ecosystems. We have adapted instrumentation and developed a sampling strategy for optimizing replication of soil respiration measurements to quantify differences among spatially complex landscape units of the CTR. We start with the design of the instrument to ease the technological, ergonomic and financial barriers that technicians encounter in monitoring the efflux of CO2 from the soil. Our sampling strategy optimizes the physical efforts of the field work and manages for the high variation of flux measurements encountered in this difficult environment of rough terrain, dense vegetation and wet climate. Our soil respirometer incorporates an infra-red gas analyzer (LiCor Inc. LI-820) and an 8300 cm3 soil respiration chamber; the device is durable, lightweight, easy to operate and can be built for under $5000 per unit. The modest unit price allows for a multiple unit fleet to be deployed and operated in an intensive field monitoring campaign. We use a large 346 cm2 collar to accommodate as much micro spatial variation as feasible and to facilitate repeated measures for tracking

  7. Applied use of cardiac and respiration measures: practical considerations and precautions.

    Wilson, G F

    1992-11-01

    Cardiac and respiratory measures can be successfully applied to "real world" environments and these measures have certain advantages over both performance and subjective measures that are typically used to monitor operator state and workload. However, because of large differences between laboratory and "real world" environments one must utilize caution in directly applying laboratory data and theories to the day-to-day world environment. While most workers are highly over-trained in their jobs, laboratory subjects are often under-trained in the cognitive tasks that are used to study cognitive activity. It is possible that a substantial portion of experimental effects reported in laboratory studies is due to learning effects. In addition, relatively small changes in cardiac and respiration measures are reported to experimental manipulations in the laboratory while a much larger range of changes are reported in "real world" environments. These differences highlight questions about laboratory/real world similarities and the need to develop a database of actual work environment data. A third area of concern is the relative lack of control over the experimental situation that is the case with most applied research. The possible confounding of changes due to cognitive and physical activity levels is a major concern and strategies for overcoming these problems are suggested. The potential for valuable contributions by cardiac and respiratory measures to applied research make overcoming these difficulties worthwhile.

  8. Forest Ecosystem respiration estimated from eddy covariance and chamber measurements under high turbulence and substantial tree mortality from bark beetles

    Speckman, Heather N.; Frank, John M.; Bradford, John B.; Miles, Brianna L.; Massman, William J.; Parton, William J.; Ryan, Michael G.

    2015-01-01

    Eddy covariance nighttime fluxes are uncertain due to potential measurement biases. Many studies report eddy covariance nighttime flux lower than flux from extrapolated chamber measurements, despite corrections for low turbulence. We compared eddy covariance and chamber estimates of ecosystem respiration at the GLEES Ameriflux site over seven growing seasons under high turbulence (summer night mean friction velocity (u*) = 0.7 m s−1), during which bark beetles killed or infested 85% of the aboveground respiring biomass. Chamber-based estimates of ecosystem respiration during the growth season, developed from foliage, wood and soil CO2 efflux measurements, declined 35% after 85% of the forest basal area had been killed or impaired by bark beetles (from 7.1 ±0.22 μmol m−2 s−1 in 2005 to 4.6 ±0.16 μmol m−2 s−1 in 2011). Soil efflux remained at ~3.3 μmol m−2 s−1 throughout the mortality, while the loss of live wood and foliage and their respiration drove the decline of the chamber estimate. Eddy covariance estimates of fluxes at night remained constant over the same period, ~3.0 μmol m−2 s−1 for both 2005 (intact forest) and 2011 (85% basal area killed or impaired). Eddy covariance fluxes were lower than chamber estimates of ecosystem respiration (60% lower in 2005, and 32% in 2011), but the mean night estimates from the two techniques were correlated within a year (r2 from 0.18-0.60). The difference between the two techniques was not the result of inadequate turbulence, because the results were robust to a u* filter of > 0.7 m s−1. The decline in the average seasonal difference between the two techniques was strongly correlated with overstory leaf area (r2=0.92). The discrepancy between methods of respiration estimation should be resolved to have confidence in ecosystem carbon flux estimates.

  9. Stress level in wild harbour porpoises (Phocoena phocoena) during satellite tagging measured by respiration, heart rate and cortisol

    Eskesen, Ida Grønborg; Teilmann, J.; Geertsen, B. M.

    2009-01-01

    During satellite tagging of harbour porpoises (Phocoena phocoena), heart rate, respiration rate and cortisol value were measured to evaluate stress effects during handling and tagging. Respiration rates were obtained using video recordings, heart rates were recorded and serum cortisol levels were...... between cortisol and month of year, sex and body length. As high individual variations occurred in response to tagging of harbour porpoises, it is not possible to give general advice based oil the factors investigated, on how to reduce stress during handling. However, pouring water over the animal...

  10. Comparison of Respirable Mass Concentrations Measured by a Personal Dust Monitor and a Personal DataRAM to Gravimetric Measurements.

    Halterman, Andrew; Sousan, Sinan; Peters, Thomas M

    2017-12-15

    In 2016, the Mine Safety and Health Administration required the use of continuous monitors to measure respirable dust in mines and better protect miner health. The Personal Dust Monitor, PDM3700, has met stringent performance criteria for this purpose. In a laboratory study, respirable mass concentrations measured with the PDM3700 and a photometer (personal DataRam, pDR-1500) were compared to those measured gravimetrically for five aerosols of varying refractive index and density (diesel exhaust fume, welding fume, coal dust, Arizona road dust (ARD), and salt [NaCl] aerosol) at target concentrations of 0.38, 0.75, and 1.5 mg m-3. For all aerosols except coal dust, strong, near-one-to-one, linear relationships were observed between mass concentrations measured with the PDM3700 and gravimetrically (diesel fume, slope = 0.99, R2 = 0.99; ARD, slope = 0.98, R2 = 0.99; and NaCl, slope = 0.95, R2 = 0.99). The slope deviated substantially from unity for coal dust (slope = 0.55; R2 = 0.99). Linear relationships were also observed between mass concentrations measured with the pDR-1500 and gravimetrically, but one-to-one behavior was not exhibited (diesel fume, slope = 0.23, R2 = 0.76; coal dust, slope = 0.54, R2 = 0.99; ARD, slope = 0.61, R2 = 0.99; NaCl, slope = 1.14, R2 = 0.98). Unlike the pDR-1500, mass concentrations measured with the PDM3700 appear independent of refractive index and density, suggesting that it could have applications in a variety of occupational settings. © The Author(s) 2017. Published by Oxford University Press on behalf of the British Occupational Hygiene Society.

  11. Measurement and Modeling of Respiration Rate of Tomato (Cultivar Roma) for Modified Atmosphere Storage.

    Kandasamy, Palani; Moitra, Ranabir; Mukherjee, Souti

    2015-01-01

    Experiments were conducted to determine the respiration rate of tomato at 10, 20 and 30 °C using closed respiration system. Oxygen depletion and carbon dioxide accumulation in the system containing tomato was monitored. Respiration rate was found to decrease with increasing CO2 and decreasing O2 concentration. Michaelis-Menten type model based on enzyme kinetics was evaluated using experimental data generated for predicting the respiration rate. The model parameters that obtained from the respiration rate at different O2 and CO2 concentration levels were used to fit the model against the storage temperatures. The fitting was fair (R2 = 0.923 to 0.970) when the respiration rate was expressed as O2 concentation. Since inhibition constant for CO2 concentration tended towards negetive, the model was modified as a function of O2 concentration only. The modified model was fitted to the experimental data and showed good agreement (R2 = 0.998) with experimentally estimated respiration rate.

  12. Measurements of soil respiration and simple models dependent on moisture and temperature for an Amazonian southwest tropical forest

    Zanchi, F.B.; Rocha, Da H.R.; Freitas, De H.C.; Kruijt, B.; Waterloo, M.J.; Manzi, A.O.

    2009-01-01

    Soil respiration plays a significant role in the carbon cycle of Amazonian tropical forests, although in situ measurements have only been poorly reported and the dependence of soil moisture and soil temperature also weakly understood. This work investigates the temporal variability of soil

  13. Carbon fluxes of surfaces vs. ecosystems. Advantages of measuring eddy covariance and soil respiration simultaneously in dry grassland ecosystems

    Nagy, Z.; Pintér, K.; Pavelka, Marian; Dařenová, Eva; Balogh, J.

    2011-01-01

    Roč. 8, č. 9 (2011), s. 2523-2534 ISSN 1726-4170 R&D Projects: GA MŠk(CZ) ED1.1.00/02.0073 Institutional research plan: CEZ:AV0Z60870520 Keywords : carbon fluxes * ecosystems * grassland ecoystems * measuring eddy covariance * soil respiration Subject RIV: EH - Ecology, Behaviour Impact factor: 3.859, year: 2011

  14. Biosignal PI, an Affordable Open-Source ECG and Respiration Measurement System

    Farhad Abtahi

    2014-12-01

    Full Text Available Bioimedical pilot projects e.g., telemedicine, homecare, animal and human trials usually involve several physiological measurements. Technical development of these projects is time consuming and in particular costly. A versatile but affordable biosignal measurement platform can help to reduce time and risk while keeping the focus on the important goal and making an efficient use of resources. In this work, an affordable and open source platform for development of physiological signals is proposed. As a first step an 8–12 leads electrocardiogram (ECG and respiration monitoring system is developed. Chips based on iCoupler technology have been used to achieve electrical isolation as required by IEC 60601 for patient safety. The result shows the potential of this platform as a base for prototyping compact, affordable, and medically safe measurement systems. Further work involves both hardware and software development to develop modules. These modules may require development of front-ends for other biosignals or just collect data wirelessly from different devices e.g., blood pressure, weight, bioimpedance spectrum, blood glucose, e.g., through Bluetooth. All design and development documents, files and source codes will be available for non-commercial use through project website, BiosignalPI.org.

  15. Measurement of Lung Cancer Tumor Markers in a Glass Wool Company Workers Exposed to Respirable Synthetic Vitreous Fiber and Dust

    Shabnam Abtahi

    2018-01-01

    Full Text Available Background: Occupational exposures to respirable synthetic vitreous fiber (SVF and dust are associated with many lung diseases including lung cancer. Low-dose computed tomography is used for screening patients who are highly suspicious of having lung carcinoma. However, it seems not to be cost-effective. Serum biomarkers could be a useful tool for the surveillance of occupational exposure, by providing the possibility of diagnosing lung cancer in its early stages. Objective: To determine if serum carcinoembryonic antigen (CEA and cytokeratin fragment (CYFRA 21-1 levels in workers exposed more than normal population to respirable SVF and dust may be used as indicators of progression towards lung cancer. Methods: An analytic cross-sectional study, including 145 personnel of a glass wool company, along with 25 age-matched healthy individuals, was conducted to investigate the relationship between occupational exposure to respirable SVFs and dust and serum levels of two lung/pleura serum tumor markers, CEA and CYFRA 21-1, measured by ELISA. Results: Individuals exposed to higher than the recommended levels of respirable SVF had higher serum concentrations of CEA and CYFRA 21-1, compared to controls (p=0.008 and 0.040, respectively, as well as in comparison to those exposed to lower than recommended OSHA levels (p=0.046 and 0.033, respectively. Workers with >9 years work experience, had significantly (p=0.045 higher levels of serum CYFRA 21-1 than those with ≤9 years of experience. Conclusion: It seems that working for >9 years in sites with detectable levels of respirable SVF and dust would increase the levels of known lung cancer serum tumor markers. Transferring these workers to sites with respirable SVF concentrations lower than the limit of detection in the air is recommended.

  16. A method for measuring losses of soil carbon by heterotrophic respiration from peat soils under oil palms

    Farmer, Jenny; Manning, Frances; Smith, Jo; Arn Teh, Yit

    2017-04-01

    The effects of drainage and deforestation of South East Asian peat swamp forests for the development of oil palm plantations has received considerable attention in both mainstream media and academia, and is the source of significant discussion and debate. However, data on the long-term carbon losses from these peat soils as a result of this land use change is still limited and the methods with which to collect this data are still developing. Here we present the ongoing evolution and implementation of a method for separating autotrophic and heterotrophic respiration by sampling carbon dioxide emissions at increasing distance from palm trees. We present the limitations of the method, modelling approaches and results from our studies. In 2011 we trialled this method in Sumatra, Indonesia and collected rate measurements over a six day period in three ages of oil palm. In the four year oil palm site there were thirteen collars that had no roots present and from these the peat based carbon losses were recorded to be 0.44 g CO2 m2 hr-1 [0.34; 0.57] (equivalent to 39 t CO2 ha-1 yr-1 [30; 50]) with a mean water table depth of 0.40 m, or 63% of the measured total respiration across the plot. In the two older palm sites of six and seven years, only one collar out of 100 had no roots present, and thus a linear random effects model was developed to calculate heterotrophic emissions for different distances from the palm tree. This model suggested that heterotrophic respiration was between 37 - 59% of total respiration in the six year old plantation and 39 - 56% in the seven year old plantation. We applied this method in 2014 to a seven year old plantation, in Sarawak, Malaysia, modifying the method to include the heterotrophic contribution from beneath frond piles and weed covered areas. These results indicated peat based carbon losses to be 0.42 g CO2 m2 hr-1 [0.27;0.59] (equivalent to 37 t CO2 ha-1 yr-1 [24; 52]) at an average water table depth of 0.35 m, 47% of the measured

  17. [Second-hand smoke exposure in hospitality venues in Barcelona: measurement of respirable particles].

    Villarroel, Nazmy; López, María José; Sánchez-Martínez, Francesca; Fernández, Esteve; Nebot, Manel

    2011-01-01

    To quantify the concentration of respirable particles equal to or smaller than 2.5μm (PM(2.5)) as a marker of second-hand smoke (SHS) exposure in a sample of hospitality venues in Barcelona 2 years after the Spanish smoking law came into effect. We performed a cross-sectional descriptive study from October to December 2007. The study population consisted of 40 hospitality venues in Barcelona selected by a random route sampling, with representation of the different types of smoking regulation included in the law (smoking allowed, smoking ban and venues with smoking areas). SHS levels were quantified by measuring PM(2.5) concentrations, which were measured using a laser photometer (Side Pack AM 510 Personal Aerosol Monitor). The measurements were carried out for 5 minutes outside the venue and for 30 minutes inside the venue. In addition, observational variables related to the characteristics of the venue and signs of tobacco consumption were recorded. The concentration of PM(2.5) in venues where smoking was still allowed was five times higher than that in venues where smoking was banned (182μg/m(3) and 34μg/m(3), respectively) and exceeded the concentration established by the US Environmental Protection Agency (EPA) as harmful (35μg/m(3)). However, in venues where smoking was banned, the concentration was lower than the EPA standard and there were no significant differences with the outdoor PM(2.5) concentration. Two years after the introduction of the Spanish smoking law, SHS exposure in venues where smoking was allowed was q still very high, representing a significant health risk for hospitality workers. Copyright © 2010 SESPAS. Published by Elsevier Espana. All rights reserved.

  18. Characterizing the impact of diffusive and advective soil gas transport on the measurement and interpretation of the isotopic signal of soil respiration

    Zachary E. Kayler; Elizabeth W. Sulzman; William D. Rugh; Alan C. Mix; Barbara J. Bond

    2010-01-01

    By measuring the isotopic signature of soil respiration, we seek to learn the isotopic composition of the carbon respired in the soil (δ13CR-S) so that we may draw inferences about ecosystem processes. Requisite to this goal is the need to understand how (δ13CR-S) is affected by...

  19. Forest ecosystem respiration estimated from eddy covariance and chamber measurements under high turbulence and substantial tree mortality from bark beetles.

    Speckman, Heather N; Frank, John M; Bradford, John B; Miles, Brianna L; Massman, William J; Parton, William J; Ryan, Michael G

    2015-02-01

    Eddy covariance nighttime fluxes are uncertain due to potential measurement biases. Many studies report eddy covariance nighttime flux lower than flux from extrapolated chamber measurements, despite corrections for low turbulence. We compared eddy covariance and chamber estimates of ecosystem respiration at the GLEES Ameriflux site over seven growing seasons under high turbulence [summer night mean friction velocity (u*) = 0.7 m s(-1)], during which bark beetles killed or infested 85% of the aboveground respiring biomass. Chamber-based estimates of ecosystem respiration during the growth season, developed from foliage, wood, and soil CO2 efflux measurements, declined 35% after 85% of the forest basal area had been killed or impaired by bark beetles (from 7.1 ± 0.22 μmol m(-2) s(-1) in 2005 to 4.6 ± 0.16 μmol m(-2) s(-1) in 2011). Soil efflux remained at ~3.3 μmol m(-2) s(-1) throughout the mortality, while the loss of live wood and foliage and their respiration drove the decline of the chamber estimate. Eddy covariance estimates of fluxes at night remained constant over the same period, ~3.0 μmol m(-2) s(-1) for both 2005 (intact forest) and 2011 (85% basal area killed or impaired). Eddy covariance fluxes were lower than chamber estimates of ecosystem respiration (60% lower in 2005, and 32% in 2011), but the mean night estimates from the two techniques were correlated within a year (r(2) from 0.18 to 0.60). The difference between the two techniques was not the result of inadequate turbulence, because the results were robust to a u* filter of >0.7 m s(-1). The decline in the average seasonal difference between the two techniques was strongly correlated with overstory leaf area (r(2) = 0.92). The discrepancy between methods of respiration estimation should be resolved to have confidence in ecosystem carbon flux estimates. © 2014 John Wiley & Sons Ltd.

  20. Diet induced thermogenesis measured over 24h in a respiration chamber: effect of diet composition.

    Westerterp, K.R.; Wilson, S.A.; Rolland, V.

    1999-01-01

    Department of Human Biology, Maastricht University, The Netherlands. OBJECTIVE: To study the effect of diet composition on diet-induced thermogenesis (DIT) over 24h in a respiration chamber. SUBJECTS: Eight healthy female volunteers (age 27 +/- 3 y; body mass index, BMI 23 +/- 3 kg/m2). DIETS: A

  1. The hydration enthalpies of Md3+ and Lr3+

    Bruechle, W.; Schaedel, M.; Scherer, U.W.; Kratz, J.V.

    1987-10-01

    Lawrencium (3-min 260 Lr) and lighter actinides were produced in the bombardement of a 249 Bk target with 18 O ions and loaded onto a cation exchange column in 0.05 M α-hydroxy-isobutyrate solution at pH = 4.85 together with the radioactive lanthanide tracers 166 Ho, 171 Er, and 171 Tm. In elutions with 0.12 M α-hydroxy-isobutyrate solution (pH = 4.85) trivalent Lr was eluted exactly together with the Er tracer and Md close to Ho. Lr elutes much later than expected based on the known elution positions of the lighter actinides and the expected analogy to the elution positions of the homologous lanthanides. From the measured elution positions, ionic radii were calculated for Lr 3+ and Md 3+ . Semiempirical models allow the calculation of the heat of hydration from the ionic radii, resulting in ΔH hyd ≅ - 3654 kJ/mol for Md 3+ and ΔH hyd ≅ - 3689 kJ/mol for Lr 3+ . (orig.)

  2. Lessons from simultaneous measurements of soil respiration and net ecosystem exchange of CO2 in temperate forests

    Renchon, A.; Pendall, E.

    2017-12-01

    Land-surface exchanges of CO2 play a key role in ameliorating or exacerbating climate change. The eddy-covariance method allows direct measurement of net ecosystem-atmosphere exchange of CO2 (NEE), but partitioning daytime NEE into its components - gross primary productivity (GPP) and ecosystem respiration (RE) - remains challenging. Continuous measurements of soil respiration (RS), along with flux towers, have the potential to better constrain data and models of RE and GPP. We use simultaneous half-hourly NEE and RS data to: (1) compare the short-term (fortnightly) apparent temperature sensitivity (Q10) of nighttime RS and RE; (2) assess whether daytime RS can be estimated using nighttime response functions; and (3) compare the long-term (annual) responses of nighttime RS and nighttime RE to interacting soil moisture and soil temperature. We found that nighttime RS has a lower short-term Q10 than nighttime RE. This suggests that the Q10 of nighttime RE is strongly influenced by the Q10 of nighttime above-ground respiration, or possibly by a bias in RE measurements. The short-term Q10 of RS and RE decreased with increasing temperature. In general, daytime RS could be estimated using nighttime RS temperature and soil moisture (r2 = 0.9). However, this results from little to no diurnal variation in RS, and estimating daytime RS as the average of nighttime RS gave similar results (r2 = 0.9). Furthermore, we observed a day-night hysteresis of RS response to temperature, especially when using air temperature and sometimes when using soil temperature at 5cm depth. In fact, during some months, soil respiration observations were lower during daytime compared to nighttime, despite higher temperature in daytime. Therefore, daytime RS modelled from nighttime RS temperature response was overestimated during these periods. RS and RE responses to the combination of soil moisture and soil temperature were similar, and consistent with the DAMM model of soil-C decomposition. These

  3. Impact of two particle measurement techniques on the determination of N95 class respirator filtration performance against ultrafine particles

    Mostofi, Reza; Noël, Alexandra; Haghighat, Fariborz; Bahloul, Ali; Lara, Jaime; Cloutier, Yves

    2012-01-01

    Highlights: ► Performance evaluation of respirator using two different measurement techniques. ► Impaction and electrical mobility were used to characterize ultrafine particle. ► The experiment was done using ultrafine-sized poly-dispersed aerosols. ► Both techniques show that MPPS would occur at a similar size range. - Abstract: The purpose of this experimental study was to compare two different particle measurement devices; an Electrical Low Pressure Impactor (ELPI) and a Scanning Mobility Particle Sizer (SMPS), to measure the number concentration and the size distribution of NaCl salt aerosols to determine the collection efficiency of filtering respirators against poly disperse aerosols. Tests were performed on NIOSH approved N95 filtering face-piece respirators (FFR), sealed on a manikin head. Ultrafine particles found in the aerosols were also collected and observed by transmission electron microscopy (TEM). According to the results, there is a systematic difference for the particle size distribution measured by the SMPS and the ELPI. It is largely attributed to the difference in the measurement techniques. However, in spite of these discrepancies, reasonably similar trends were found for the number concentration with both measuring instruments. The particle penetration, calculated based on mobility and aerodynamic diameters, never exceeded 5% for any size range measured at constant flow rate of 85 L/min. Also, the most penetrating particle size (MPPS), with the lowest filtration efficiency, would occur at a similar ultrafine size range <100 nm. With the ELPI, the MPPS was at 70 nm aerodynamic diameter, whereas it occurred at 40 nm mobility diameter with the SMPS.

  4. Relationships between Personal Measurements of 'Total' Dust, Respirable, Thoracic, and Inhalable Aerosol Fractions in the Cement Production Industry.

    Notø, Hilde P; Nordby, Karl-Christian; Eduard, Wijnand

    2016-05-01

    The aims of this study were to examine the relationships and establish conversion factors between 'total' dust, respirable, thoracic, and inhalable aerosol fractions measured by parallel personal sampling on workers from the production departments of cement plants. 'Total' dust in this study refers to aerosol sampled by the closed face 37-mm Millipore filter cassette. Side-by-side personal measurements of 'total' dust and respirable, thoracic, and inhalable aerosol fractions were performed on workers in 17 European and Turkish cement plants. Simple linear and mixed model regressions were used to model the associations between the samplers. The total number of personal samples collected on 141 workers was 512. Of these 8.4% were excluded leaving 469 for statistical analysis. The different aerosol fractions contained from 90 to 130 measurements and-side-by side measurements of all four aerosol fractions were collected on 72 workers.The median ratios between observed results of the respirable, 'total' dust, and inhalable fractions relative to the thoracic aerosol fractions were 0.51, 2.4, and 5.9 respectively. The ratios between the samplers were not constant over the measured concentration range and were best described by regression models. Job type, position of samplers on left or right shoulder and plant had no substantial effect on the ratios. The ratios between aerosol fractions changed with different air concentrations. Conversion models for estimation of the fractions were established. These models explained a high proportion of the variance (74-91%) indicating that they are useful for the estimation of concentrations based on measurements of a different aerosol fraction. The calculated uncertainties at most observed concentrations were below 30% which is acceptable for comparison with limit values (EN 482, 2012). The cement industry will therefore be able to predict the health related aerosol fractions from their former or future measurements of one of the

  5. WWER safety investigations on LR-0 reactor

    Mikus, J.

    2001-01-01

    A set of the measurement needed for the WWER-440 and WWER-1000 reactor lifetime assessment, verification of the methods, codes and input cross section libraries for the WWER reactor pressure vessel exposure evaluation has been performed on the LR-0 experimental reactor. The WWER Mock-ups (engineering benchmarks) has been carried out on the reactor, with the aim to investigate differential neutron spectra for reactor dosimetry purposes. Critical experiments have also been performed to determine the perturbation of the fission density distribution caused by the WWER-440 control assembly. Such assembly, partially inserted in the core, has significant influence on the space power distribution. A wide research program for sub-criticality investigations of the spent nuclear fuel storage has been realized on the LR-0 reactor. A benchmark experiment is realized on the reactor in corresponding geometry for CASTOR 440/84 container for storage and transportation of spent fuel. Critical experiments with new fuel assemblies including various burnable absorbers and different enrichments are performed. A set of critical experiments is performed using the fuel assemblies with 3,6% and 4,4% enrichment, arranged in the WWER-440 type cores with various lattice pitch. The critical high of the moderator level and the moderator level coefficient of reactivity are measured and the effect of the fuel assembly, placed in a hexagonal tube of stainless steel containing boron absorber (ATABOR - STANDARD) is investigated. The obtained results are used for the validation of the codes (MCNP, KENO and SCALE) in the frame of the contract 'Burn-up credit implementation for the storage and transport containers of the spent fuel'. Combined neutron-gamma spectra measurements in the WWER-1000 Mock-up are carried out during 2001

  6. Solving LR Conflicts Through Context Aware Scanning

    Leon, C. Rodriguez; Forte, L. Garcia

    2011-09-01

    This paper presents a new algorithm to compute the exact list of tokens expected by any LR syntax analyzer at any point of the scanning process. The lexer can, at any time, compute the exact list of valid tokens to return only tokens in this set. In the case than more than one matching token is in the valid set, the lexer can resort to a nested LR parser to disambiguate. Allowing nested LR parsing requires some slight modifications when building the LR parsing tables. We also show how LR parsers can parse conflictive and inherently ambiguous languages using a combination of nested parsing and context aware scanning. These expanded lexical analyzers can be generated from high level specifications.

  7. Unexpected results in Chernozem soil respiration while measuring the effect of a bio-fertilizer on soil microbial activity.

    Bautista, Gabriela; Mátyás, Bence; Carpio, Isabel; Vilches, Richard; Pazmino, Karina

    2017-01-01

    The number of studies investigating the effect of bio-fertilizers is increasing because of their importance in sustainable agriculture and environmental quality. In our experiments, we measured the effect of different fertilizers on soil respiration. In the present study, we were looking for the cause of unexpected changes in CO2 values while examining Chernozem soil samples. We concluded that CO2 oxidizing microbes or methanotrophs may be present in the soil that periodically consume CO2 . This is unusual for a sample taken from the upper layer of well-ventilated Chernozem soil with optimal moisture content.

  8. Respiration-correlated spiral CT: A method of measuring respiratory-induced anatomic motion for radiation treatment planning

    Ford, E.C.; Mageras, G.S.; Yorke, E.; Ling, C.C.

    2003-01-01

    We describe a method for generating CT images at multiple respiratory phases with a single spiral CT scan, referred to as respiratory-correlated spiral CT (RCCT). RCCT relies on a respiration wave form supplied by an external patient monitor. During acquisition this wave form is recorded along with the initiation time of the CT scan, so as to 'time stamp' each reconstructed slice with the phase of the respiratory cycle. By selecting the appropriate slices, a full CT image set is generated at several phases, typically 7-11 per cycle. The CT parameters are chosen to optimize the temporal resolution while minimizing the spatial gap between slices at successive respiratory cycles. Using a pitch of 0.5, a gantry rotation period of 1.5 s, and a 180 degree sign reconstruction algorithm results in ∼5 mm slice spacing at a given phase for typical respiration periods, and a respiratory motion within each slice that is acceptably small, particularly near end expiration or end inspiration where gated radiotherapy is to occur. We have performed validation measurements on a phantom with a moving sphere designed to simulate respiration-induced tumor motion. RCCT scans of the phantom at respiratory periods of 4, 5, and 6 s show good agreement of the sphere's motion with that observed under fluoroscopic imaging. The positional deviations in the sphere's centroid between RCCT and fluoroscopy are 1.1±0.9 mm in the transaxial direction (average over all scans at all phases ±1 s.d.) and 1.2±1.0 mm in the longitudinal direction. Reconstructed volumes match those expected on the basis of stationary-phantom scans to within 5% in all cases. The surface distortions of the reconstructed sphere, as quantified by deviations from a mathematical reference sphere, are similar to those from a stationary phantom scan and are correlated with the speed of the phantom. A RCCT scan of the phantom undergoing irregular motion, demonstrates that successful reconstruction can be achieved even with

  9. LRSYS, PASCAL LR(1) Parser Generator System

    O'Hair, K.

    1991-01-01

    Description of program or function: LRSYS is a complete LR(1) parser generator system written entirely in a portable subset of Pascal. The system, LRSYS, includes a grammar analyzer program (LR) which reads a context-free (BNF) grammar as input and produces LR(1) parsing tables as output, a lexical analyzer generator (LEX) which reads regular expressions created by the REG process as input and produces lexical tables as output, and various parser skeletons that get merged with the tables to produce complete parsers (SMAKE). Current parser skeletons include Pascal, FORTRAN 77, and C. In addition, the CRAY1, DEC VAX11 version contains LRLTRAN and CFT- FORTRAN 77 skeletons. Other language skeletons can easily be added to the system. LRSYS is based on the LR program (NESC Abstract 822)

  10. LR: Compact connectivity representation for triangle meshes

    Gurung, T; Luffel, M; Lindstrom, P; Rossignac, J

    2011-01-28

    We propose LR (Laced Ring) - a simple data structure for representing the connectivity of manifold triangle meshes. LR provides the option to store on average either 1.08 references per triangle or 26.2 bits per triangle. Its construction, from an input mesh that supports constant-time adjacency queries, has linear space and time complexity, and involves ordering most vertices along a nearly-Hamiltonian cycle. LR is best suited for applications that process meshes with fixed connectivity, as any changes to the connectivity require the data structure to be rebuilt. We provide an implementation of the set of standard random-access, constant-time operators for traversing a mesh, and show that LR often saves both space and traversal time over competing representations.

  11. Modeling Soil Organic Carbon Turnover in Four Temperate Forests Based on Radiocarbon Measurements of Heterotrophic Respiration and Soil Organic Carbon

    Ahrens, B.; Borken, W.; Muhr, J.; Schrumpf, M.; Savage, K. E.; Wutzler, T.; Trumbore, S.; Reichstein, M.

    2011-12-01

    Soils of temperate forests store significant amounts of soil organic matter and are considered to be net sinks of atmospheric CO2. Soil organic carbon (SOC) dynamics have been studied using the Δ14C signature of bulk SOC or different SOC fractions as observational constraints in SOC models. Further, the Δ14C signature of CO2 evolved during the incubation of soil and roots has been widely used together with Δ14C of total soil respiration to partition soil respiration into heterotrophic respiration (Rh) and root respiration. However, these data have rarely been used together as observational constraints to determine SOC turnover times. Here, we present a multiple constraints approach, where we used SOC stock and its Δ14C signature, and heterotrophic respiration and its Δ14C signature to estimate SOC turnover times of a simple serial two-pool model via Bayesian optimization. We used data from four temperate forest ecosystems in Germany and the USA with different disturbance and management histories from selective logging to afforestation in the late 19th and early 20th century. The Δ14C signature of the atmosphere with its prominent bomb peak was used as a proxy for the Δ14C signature of aboveground and belowground litterfall. The Δ14C signature of litterfall was lagged behind the atmospheric signal to account for the period between photosynthetic fixation of carbon and its addition to SOC pools. We showed that the combined use of Δ14C measurements of Rh and SOC stocks helped to better constrain turnover times of the fast pool (primarily by Δ14C of Rh) and the slow pool (primarily by Δ14C of SOC). In particular, by introducing two additional parameters that describe the deviation from steady state of the fast and slow cycling pool for both SOC and SO14C, we were able to demonstrate that we cannot maintain the often used steady-state assumption of SOC models in general. Furthermore, a new transport version of our model, including SOC transport via

  12. Accident dynamics of LR-0 reactor

    Vorisek, M.; Tinka, I.

    1981-01-01

    The results are given of calculating the accident dynamics of the LR-0 light water experimental zero power reactor. Calculations of the time dependence of power, the total released energy, the temperature of fuel and its cladding were made using program FATRAP for different values of the total inserted reactivity. Using the results, an analysis is made of hypothetic accident states of the LR-0 reactor. The results are shown graphically. (J.B.)

  13. Microcystin-LR Induced Immunotoxicity in Mammals

    Yaqoob Lone

    2016-01-01

    Full Text Available Microcystins are toxic molecules produced by cyanobacterial blooms due to water eutrophication. Exposure to microcystins is a global health problem because of its association with various other pathological effects and people all over the world are exposed to microcystins on a regular basis. Evidence shows that microcystin-LR (MC-LR may adversely affect the immune system, but its specific effects on immune functions are lacking. In the present review, immunotoxicological effects associated with MC-LR in animals, humans, and in vitro models have been reported. Overall, the data shows that chronic exposure to MC-LR has the potential to impair vital immune responses which could lead to increased risk of various diseases including cancers. Studies in animal and in vitro models have provided some pivotal understanding into the potential mechanisms of MC-LR related immunotoxicity suggesting that further investigation, particularly in humans, is required to better understand the relationship between development of disease and the MC-LR exposure.

  14. Measurements of CO2 exchange with an automated chamber system throughout the year: challenges in measuring night-time respiration on porous peat soil

    M. Koskinen

    2014-01-01

    Full Text Available We built an automatic chamber system to measure greenhouse gas (GHG exchange in forested peatland ecosystems. We aimed to build a system robust enough which would work throughout the year and could measure through a changing snowpack in addition to producing annual GHG fluxes by integrating the measurements without the need of using models. The system worked rather well throughout the year, but it was not service free. Gap filling of data was still necessary. We observed problems in carbon dioxide (CO2 respiration flux estimation during calm summer nights, when a CO2 concentration gradient from soil/moss system to atmosphere builds up. Chambers greatly overestimated the night-time respiration. This was due to the disturbance caused by the chamber to the soil-moss CO2 gradient and consequent initial pulse of CO2 to the chamber headspace. We tested different flux calculation and measurement methods to solve this problem. The estimated flux was strongly dependent on (1 the starting point of the fit after closing the chamber, (2 the length of the fit, (3 the type of the fit (linear and polynomial, (4 the speed of the fan mixing the air inside the chamber, and (5 atmospheric turbulence (friction velocity, u*. The best fitting method (the most robust, least random variation for respiration measurements on our sites was linear fitting with the period of 120–240 s after chamber closure. Furthermore, the fan should be adjusted to spin at minimum speed to avoid the pulse-effect, but it should be kept on to ensure mixing. If night-time problems cannot be solved, emissions can be estimated using daytime data from opaque chambers.

  15. Measurements of CO2 exchange with an automated chamber system throughout the year: challenges in measuring night-time respiration on porous peat soil

    Koskinen, M.; Minkkinen, K.; Ojanen, P.; Kämäräinen, M.; Laurila, T.; Lohila, A.

    2014-01-01

    We built an automatic chamber system to measure greenhouse gas (GHG) exchange in forested peatland ecosystems. We aimed to build a system robust enough which would work throughout the year and could measure through a changing snowpack in addition to producing annual GHG fluxes by integrating the measurements without the need of using models. The system worked rather well throughout the year, but it was not service free. Gap filling of data was still necessary. We observed problems in carbon dioxide (CO2) respiration flux estimation during calm summer nights, when a CO2 concentration gradient from soil/moss system to atmosphere builds up. Chambers greatly overestimated the night-time respiration. This was due to the disturbance caused by the chamber to the soil-moss CO2 gradient and consequent initial pulse of CO2 to the chamber headspace. We tested different flux calculation and measurement methods to solve this problem. The estimated flux was strongly dependent on (1) the starting point of the fit after closing the chamber, (2) the length of the fit, (3) the type of the fit (linear and polynomial), (4) the speed of the fan mixing the air inside the chamber, and (5) atmospheric turbulence (friction velocity, u*). The best fitting method (the most robust, least random variation) for respiration measurements on our sites was linear fitting with the period of 120-240 s after chamber closure. Furthermore, the fan should be adjusted to spin at minimum speed to avoid the pulse-effect, but it should be kept on to ensure mixing. If night-time problems cannot be solved, emissions can be estimated using daytime data from opaque chambers.

  16. Evaluating a new method to estimate the rate of leaf respiration in the light by analysis of combined gas exchange and chlorophyll fluorescence measurements

    Yin, X.; Sun, Z.; Struik, P.C.; Gu, J.

    2011-01-01

    Day respiration (R(d)) is an important parameter in leaf ecophysiology. It is difficult to measure directly and is indirectly estimated from gas exchange (GE) measurements of the net photosynthetic rate (A), commonly using the Laisk method or the Kok method. Recently a new method was proposed to

  17. Absolute Transition Rates in {sup 188}lr

    Malmskog, S G; Berg, V

    1969-09-15

    Half-lives of several excited levels in {sup 188}lr have been measured using an electron-electron delayed coincidence spectrometer. Active {sup 188}Pt sources were prepared from spallation products using the ISOLDE on-line mass separator facility at CERN. The following half-lives were obtained: T{sub 1/2} (54.8 keV level) = (1.93 {+-} 0.10) nsec; T{sub 1/2} (96.7 keV level) = (0.59 {+-} 0.12) nsec; T{sub 1/2} (187.6 keV level) = (0.056 {+-} 0.013) nsec; T{sub 1/2} (195.1 keV level) = (0.051 {+-} 0.010) nsec; T{sub 1/2} (478. 3 keV level) {<=} 0.15 nsec The 54.8 keV transition was found to have an enhanced E2 transition probability indicating a collective character for this transition.

  18. Respirable dust and respirable silica exposure in Ontario gold mines.

    Verma, Dave K; Rajhans, Gyan S; Malik, Om P; des Tombe, Karen

    2014-01-01

    A comprehensive survey of respirable dust and respirable silica in Ontario gold mines was conducted by the Ontario Ministry of Labor during 1978-1979. The aim was to assess the feasibility of introducing gravimetric sampling to replace the assessment method which used konimeters, a device which gave results in terms of number of particles per cubic centimeter (ppcc) of air. The study involved both laboratory and field assessments. The field assessment involved measurement of airborne respirable dust and respirable silica at all eight operating gold mines of the time. This article describes the details of the field assessment. A total of 288 long-term (7-8 hr) personal respirable dust air samples were collected from seven occupational categories in eight gold mines. The respirable silica (α-quartz) was determined by x-ray diffraction method. The results show that during 1978-1979, the industry wide mean respirable dust was about 1 mg/m(3), and the mean respirable silica was 0.08 mg/m(3.)The mean% silica in respirable dust was 7.5%. The data set would be useful in future epidemiological and health studies, as well as in assessment of workers' compensation claims for occupational diseases such as silicosis, chronic obstructive pulmonary disease (COPD), and autoimmune diseases such as renal disease and rheumatoid arthritis.

  19. Contribution of Root Respiration to Soil Respiration in Sugarcane Plantation in Thailand

    Wilaiwan Sornpoon; Sebastien Bonnet; Poonpipope Kasemsap; Savitri Garivait

    2013-01-01

    The understanding on the contribution of root respiration to total soil respiration is still very limited, especially for sugarcane. In this study, trenching experiments in sugarcane plantations were conducted to separate and investigate soil respiration for this crop. The measurements were performed for the whole growing period of 344 days to quantify root respiration. The obtained monitoring data showed that the respiration rate is increasing with the age of the plant, accounting for up to ...

  20. Facepiece leakage and fitting of respirators

    White, J.M.

    1978-05-01

    The ways in which airborne contaminants can penetrate respirators and the factors which affect the fit of respirators are discussed. The fit of the respirator to the face is shown to be the most critical factor affecting the protection achieved by the user. Qualitative and quantitative fit testing techniques are described and their application to industrial respirator programs is examined. Quantitative measurement of the leakage of a respirator while worn can be used to numerically indicate the protection achieved. These numbers, often referred to as protection factors, are sometimes used as the basis for selecting suitable respirators and this practice is reviewed. (author)

  1. Transfer of bacteriophage MS2 and fluorescein from N95 filtering facepiece respirators to hands: Measuring fomite potential

    Brady, Tyler M.; Strauch, Amanda L.; Almaguer, Claudia M.; Niezgoda, George; Shafer, Ronald E.; Yorio, Patrick L.; Fisher, Edward M.

    2017-01-01

    Contact transmission of pathogens from personal protective equipment is a concern within the healthcare industry. During public health emergency outbreaks, resources become constrained and the reuse of personal protective equipment, such as N95 filtering facepiece respirators, may be needed. This study was designed to characterize the transfer of bacteriophage MS2 and fluorescein between filtering facepiece respirators and the wearer’s hands during three simulated use scenarios. Filtering facepiece respirators were contaminated with MS2 and fluorescein in droplets or droplet nuclei. Thirteen test subjects performed filtering facepiece respirator use scenarios including improper doffing, proper doffing and reuse, and improper doffing and reuse. Fluorescein and MS2 contamination transfer were quantified. The average MS2 transfer from filtering facepiece respirators to the subjects’ hands ranged from 7.6–15.4% and 2.2–2.7% for droplet and droplet nuclei derived contamination, respectively. Handling filtering facepiece respirators contaminated with droplets resulted in higher levels of MS2 transfer compared to droplet nuclei for all use scenarios (p = 0.007). MS2 transfer from droplet contaminated filtering facepiece respirators during improper doffing and reuse was greater than transfer during improper doffing (p = 0.008) and proper doffing and reuse (p = 0.042). Droplet contamination resulted in higher levels of fluorescein transfer compared to droplet nuclei contaminated filtering facepiece respirators for all use scenarios (p = 0.009). Fluorescein transfer was greater for improper doffing and reuse (p = 0.007) from droplet contaminated masks compared to droplet nuclei contaminated filtering facepiece respirators and for improper doffing and reuse when compared improper doffing (p = 0.017) and proper doffing and reuse (p = 0.018) for droplet contaminated filtering facepiece respirators. For droplet nuclei contaminated filtering facepiece respirators, the

  2. Cattle respiration facility

    Hellwing, Anne Louise Frydendahl; Lund, Peter; Weisbjerg, Martin Riis

    2012-01-01

    In Denmark, the emission rate of methane from dairy cows has been calculated using the IPCC standard values for dairy cows in Western countries, due to the lack of national data. Therefore, four respiration chambers for dairy cows were built with the main purpose of measuring methane, but also...

  3. Microcystin-LR in surface water of Ponjavica river

    Natić Dejan

    2012-01-01

    Full Text Available Background/Aim. Cyanobacterial toxins befall a group of various compounds according to chemical structure and health effects on people and animals. The most significant in this large group of compounds are microcystins. Their presence in water used for human consumption causes serious health problems, liver beeing the target organ. Microcystins are spread all over the world. Waterblooms of cyanobacterias and their cyanotoxins are also common in the majority of surface waters in Serbia. The aim of this study was to propose HPLC method for determination of mikrocystin-LR, to validate the method and to use it for determination of microcystin-LR in the surface water of the river Ponjavica. The Ponjavica is very eutrophic water and has ideal conditions for the cyanobacterial growth. Methods. Sample of water form the Ponjavica river were collected during the summer 2008. Coupled columns (HLB, Sep-Pak, were used for sample preparation and HPLC/PDA method was used for quantification of microcystin- LR. Results. Parameters of validation show that the proposed method is simple, fast, sensitive (0.1 mg/L and selective with the yield of 89%-92%. The measuring uncertainty of

  4. Measurement of cell respiration and oxygenation in standard multichannel biochips using phosphorescent O2-sensitive probes.

    Kondrashina, Alina V; Papkovsky, Dmitri B; Dmitriev, Ruslan I

    2013-09-07

    Measurement of cell oxygenation and oxygen consumption is useful for studies of cell bioenergetics, metabolism, mitochondrial function, drug toxicity and common pathophysiological conditions. Here we present a new platform for such applications which uses commercial multichannel biochips (μ-slides, Ibidi) and phosphorescent O2 sensitive probes. This platform was evaluated with both extracellular and intracellular O2 probes, several different cell types and treatments including mitochondrial uncoupling and inhibition, depletion of extracellular Ca(2+) and inhibition of V-ATPase and histone deacetylases. The results show that compared to the standard microwell plates currently used, the μ-slide platform provides facile O2 measurements with both suspension and adherent cells, higher sensitivity and reproducibility, and faster measurement time. It also allows re-perfusion and multiple treatments of cells and multi-parametric analyses in conjunction with other probes. Optical measurements are conducted on standard fluorescence readers and microscopes.

  5. WWER-440 control assembly local power peaking investigation on LR-0 reactor

    Mikus, J.

    2002-01-01

    This paper presents information concerning the local power peaking problem induced by the WWER-440 control assembly and the investigation possibilities on the light water, zero power reactor LR-0 at the Nuclear Research Institute (NRI) Rez plc. A brief description is given about the disposable control assembly model, experimental arrangement and conditions on the LR-0 reactor with regard to the earlier performed investigations as well as to the relevant measurements to be realized in the near future.(abstract)

  6. The Study Of Metalworking Fluids Biodegradability By Indirect Measurement Of Bacterial Inoculum Respiration

    Gerulová Kristína

    2015-06-01

    Full Text Available An apparatus for measuring biodegradability of metalworking fluids (MWFs was constructed according to (1, based on the Zahn-Wellens test which enables a continuous determination of CO2 production by the change in conductivity of absorption solution. Results obtained from the testing of 8 different MWFs by this modified method were compared to those obtained in standardized OECD 302 B. The comparison showed better description of bacterial inoculum activity in tested solution; lag phase was easy to indicate. Tested emulsion achieved the level of primary degradability 39.7 – 40.8 %, and semi-synthetics 19.1 – 43.5%. The samples of synthetics where the degradation level reached 43.9 - 58.6 % were identified as the most degradable metalworking fluids.

  7. New method of measuring lichen respiration: response of selected species to temperature, pH and sulphur dioxide

    Baddeley, M S; Ferry, B W; Finegan, E J

    1971-01-01

    The respiration of selected lichens and their response to temperature, pH and sulphur dioxide concentration were investigated in aqueous solution using an oxygen electrode. Respiration rates increased to a maximum at 40/sup 0/ C although some individual species showed variations from this general pattern. The optimal pH for respiration was found to be 4.2 except in Hypogymnia physodes (3.2) and Ramalina fastigiata (5.2). Sulfur dioxide at concentrations similar to those likely to be encountered in heavily polluted areas in nature had marked inhibitory effects of the respiration rate of all species investigated but as these variations did not entirely correspond to the tolerances of the species in the field some other factors must also be involved in the sensitivity of lichens to sulphur dioxide pollution. The advantages of using an oxygen electrode rather than manometric or other techniques in studies on the respiration rate of lichens are discussed. 29 references, 3 figures, 2 tables.

  8. LR-90 prevents methylglyoxal-induced oxidative stress and apoptosis in human endothelial cells

    Figarola, James L.; Singhal, Jyotsana; Rahbar, Samuel; Awasthi, Sanjay

    2014-01-01

    Methylglyoxal (MGO) is a highly reactive dicarbonyl compound known to induce cellular injury and cytoxicity, including apoptosis in vascular cells. Vascular endothelial cell apoptosis has been implicated in the pathophysiology and progression of atherosclerosis. We investigated whether the advanced glycation end-product inhibitor LR-90 could prevent MGO-induced apoptosis in human umbilical vascular endothelial cells (HUVECs). HUVECs were pre-treated with LR-90 and then stimulated with MGO. Cell morphology, cytotoxicity and apoptosis were evaluated by light microscopy, MTT assay, and Annexin V-FITC and propidium iodide double staining, respectively. Levels of Bax, Bcl-2, cytochrome c, mitogen-activated protein kinases (MAPKs) and caspase activities were assessed by Western blotting. Reactive oxygen species (ROS) generation and mitochondrial membrane potential (MMP) were measured with fluorescent probes. LR-90 dose-dependently prevented MGO-associated HUVEC cytotoxicity and apoptotic biochemical changes such as loss of MMP, increased Bax/Bcl-2 protein ratio, mitochondrial cytochrome c release and activation of caspase-3 and 9. Additionally, LR-90 blocked intracellular ROS formation and MAPK (p44/p42, p38, JNK) activation, though the latter seem to be not directly involved in MGO-induced HUVEC apoptosis. LR-90 prevents MGO-induced HUVEC apoptosis by inhibiting ROS and associated mitochondrial-dependent apoptotic signaling cascades, suggesting that LR-90 possess cytoprotective ability which could be beneficial in prevention of diabetic related-atherosclerosis. PMID:24615331

  9. Main: 1LR5 [RPSD[Archive

    Full Text Available Aux311; Zea Mays Molecule: Auxin Binding Protein 1; Chain: A, B, C, D; Engineered: Yes; Mutation: Yes Protei...-.|EMBL; L08425; AAA33430.1; -.|PIR; S16262; S16262.|PDB; 1LR5; X-ray; A/B/C/D=39-201.|PDB; 1LRH; X-ray; A/B/C/D=39-201.|Mai

  10. Mitochondrial Respiration and Oxygen Tension.

    Shaw, Daniel S; Meitha, Karlia; Considine, Michael J; Foyer, Christine H

    2017-01-01

    Measurements of respiration and oxygen tension in plant organs allow a precise understanding of mitochondrial capacity and function within the context of cellular oxygen metabolism. Here we describe methods that can be routinely used for the isolation of intact mitochondria, and the determination of respiratory electron transport, together with techniques for in vivo determination of oxygen tension and measurement of respiration by both CO 2 production and O 2 consumption that enables calculation of the respiratory quotient [CO 2 ]/[O 2 ].

  11. L-R asymmetry in gut's

    Karadayi, H.R.

    1982-01-01

    An idea of L-R asymmetry is proposed for the grand unification schemes. The idea provides an intrinsic mechanism to obtain standard model charges of fermions in the case of more than one weak gauge boson. It is elaborated within a scheme based on the partial symmetry SU(4)sub(C)xSU(2)sub(L)xSU(2)sub(R) where the coupling constants gsub(L) and gsub(R) corresponding to the chiral SU(2) factors are assumed to be different from each other. Then, the embedding of this structure within the simple symmetry SO(10) is shown. In both cases, a consistent description of vector particle masses is given. These two schemes are considered as primary models to realize the L-R asymmetry idea due to the lack of family unification. However, in a subsequent work, we will show that the SO(14) unification of the three families can be obtained within the framework of L-R asymmetry. All formulations are carried out with the aid of a mathematical method that we recently proposed for the Lie algebra representations of classical groups. (author)

  12. Production, oxygen respiration rates, and sinking velocity of copepod fecal pellets: Direct measurements of ballasting by opal and calcite

    Ploug, H.; Iversen, M.H.; Koski, Marja

    2008-01-01

    sp., T. weissflogii, and E. huxleyi, respectively. The average carbon-specific respiration rate was 0.15 d(-1) independent on diet (range: 0.08-0.21 d(-1)). Because of ballasting of opal and calcite, sinking velocities were significantly higher for pellets produced on T. weissflogii (322 +/- 169 m d...

  13. Main: 1LR4 [RPSD[Archive

    Full Text Available 1LR4 トウモロコシ Corn Zea mays L. Casein Kinase Ii, Alpha Chain Name=Ack2; Zea Mays Mole...cule: Protein Kinase Ck2; Chain: A; Synonym: Casein Kinase Ii, Alpha Chain; Engineered: Yes Transferase 2.7....ray; A=2-326.|PDB; 1M2Q; X-ray; A=2-328.|PDB; 1M2R; X-ray; A=2-328.|PDB; 1OM1; X-ray; A=1-332.|Mai

  14. Antilisterial activity of a broad-spectrum bacteriocin, enterocin LR/6 from Enterococcus faecium LR/6.

    Kumar, Manoj; Srivastava, Sheela

    2010-10-01

    Enterocin LR/6, a purified bacteriocin, exhibited broad inhibitory spectrum both against related as well as some food-borne pathogens such as Listeria monocytogenes, Yersinia enterocolitica, Aeromonas sp., Shigella sp., and Bacillus licheniformis. In this investigation, we have focused on L. monocytogenes as the target organism, as it is not only an important pathogen but can also survive over a wide range of environmental conditions such as refrigeration temperature, low pH, and high-salt concentration. This allows the pathogen to overcome many food preservation and safety barriers and poses a potential risk to human health. The enterocin LR/6 showed a bactericidal action against L. monocytogenes and completely inhibited the growth on agar plates, supplemented with 200 AU/ml of enterocin LR/6. The effectiveness of enterocin LR/6 in completely killing a population of acid-adapted (pH 5.2, 2 h) L. monocytogenes exposed to different temperatures (4-37 degrees C), pH (2.5-8.0), and osmotic (up to 30% NaCl) stress is reported here. This paper focuses on the key issue of killing of the acid-adapted L. monocytogenes cells under adverse environmental conditions.

  15. Measurements of CO2 exchange with an automated chamber system throughout the year: challenges in measuring nighttime respiration on porous peat soil

    Koskinen, M.; Minkkinen, K.; Ojanen, P.; Kämäräinen, M.; Laurila, T.; Lohila, A.

    2013-08-01

    We built an automatic chamber system to measure greehouse gas (GHG) exchange in forested peatland ecosystems. We aimed to build a system robust enough which would work throughout the year and could measure through a changing snowpackin addition to producing annual GHG fluxes by integrating the measurements without the need of using models. The system worked rather well throughout the year, but it was not service free. Gap filling of data was still necessary. We observed problems in carbon dioxide (CO2) flux estimation during calm summer nights, when a CO2 concentration gradient from soil/moss system to atmosphere builds up. Chambers greatly overestimated the nighttime respiration. This was due to the disturbance caused by the chamber to the soil-moss CO2 gradient and consequent initial pulse of CO2 to the chamber headspace. We tested different flux calculation and measurement methods to solve this problem. The estimated flux was strongly dependent on (1) the type of the fit (linear and polynomial), (2) the starting point of the fit after closing the chamber, (3) the length of the fit, (4) the speed of the fan mixing the air inside the chamber, and (5) atmospheric turbulence (friction velocity, u*). The best fitting method (the most robust, least random variation) was linear fitting with the period of 120-240 s after chamber closure. Furthermore, the fan should be adjusted to spin at minimum speed to avoid the pulse-effect, but it should be kept on to ensure mixing. If nighttime problems cannot be solved, emissions can be estimated using daytime data from opaque chambers.

  16. Dynamics of Total Microcystin LR Concentration in Three Subtropical Hydroelectric Generation Reservoirs in Uruguay, South America.

    González-Piana, Mauricio; Fabián, Daniel; Piccardo, Andrea; Chalar, Guillermo

    2017-10-01

    This study analyzed the temporal dynamics of total microcystin LR concentrations between the years of 2012 and 2015 in the Bonete, Baygorria and Palmar hydroelectric generation reservoirs in the central region of the Negro River, Uruguay. The three reservoirs showed differents total microcystin LR concentration, with no significant differences among them. Over 20 sampling dates, the three reservoirs exhibited total microcystin LR concentrations on eight occasions that corresponded to a slight to moderate human health risk according to WHO guideline values for recreational waters. By determining the concentration of microcystin LR in cyanobacterial biomass, we identified cyanobacterial populations that occurred over time with varying degrees of toxin production (maximal 85.4 µg/mm 3 ). The microcystin LR concentration in Bonete was positively correlated with temperature (r = 0.587) and cyanobacterial biomass (r = 0.736), in Baygorria with cyanobacterial biomass (r = 0.521), and in Palmar with temperature (r = 0.500) and negatively correlated with ammonia (r = -0.492). Action is needed to reduce the presence of toxic cyanobacteria in these systems. A decrease in the use of agrochemicals and management changes in the reservoir basins could be successful long-term measures.

  17. [Effects of Tillage on Soil Respiration and Root Respiration Under Rain-Fed Summer Corn Field].

    Lu, Xing-li; Liao, Yun-cheng

    2015-06-01

    To explore the effects of different tillage systems on soil respiration and root respiration under rain-fed condition. Based on a short-term experiment, this paper investigated soil respiration in summer corn growth season under four tillage treatments including subsoiling tillage (ST), no tillage (NT), rotary tillage (RT) and moldboard plow tillage (CT). The contribution of root respiration using root exclusion method was also discussed. The results showed that soil respiration rate presented a single peak trend under four tillage methods during the summer corn growing season, and the maximum value was recorded at the heading stage. The trends of soil respiration were as follows: heading stage > flowering stage > grain filling stage > maturity stage > jointing stage > seedling stage. The trends of soil respiration under different tillage systems were as follows: CT > ST > RT > NT. There was a significant correlation between soil respiration rate and soil temperatures (P soil respiration using exponential function equation. However, there was no significant correlation between soil respiration rate and soil moisture. Root respiration accounted for 45.13%-56.86% of the proportion of soil respiratio n with the mean value 51.72% during the summer corn growing season under different tillage systems. Therefore, root exclusion method could be used to study the contribution of crop growth to carbon emission, to compare effects of different tillage systems on the contribution of root respiration provides the bases for selecting the measures to slow down the decomposition of soil carbon.

  18. Unexpected results in Chernozem soil respiration while measuring the effect of a bio-fertilizer on soil microbial activity [version 2; referees: 2 approved

    Gabriela Bautista

    2017-12-01

    Full Text Available The number of studies investigating the effect of bio-fertilizers is increasing because of their importance in sustainable agriculture and environmental quality. In our experiments, we measured the effect of different fertilizers on soil respiration. In the present study, we were looking for the cause of unexpected changes in CO2 values while examining Chernozem soil samples. We concluded that CO2 oxidizing microbes or methanotrophs may be present in the soil that periodically consume CO2 . This is unusual for a sample taken from the upper layer of well-ventilated Chernozem soil with optimal moisture content.

  19. The uptake kinetics and immunotoxic effects of microcystin-LR in human and chicken peripheral blood lymphocytes in vitro

    Lankoff, Anna; Carmichael, Wayne W.; Grasman, Keith A.; Yuan, Moucun

    2004-01-01

    Microcystin-LR is a cyanobacterial heptapeptide that presents acute and chronic hazards to animal and human health. We investigated the influence of this toxin on human and chicken immune system modulation in vitro. Peripheral blood lymphocytes were treated with microcystin-LR at environmentally relevant doses of 1, 10 and 25 μg/ml for 12, 24, 48, 72 h (for proliferation assay cells were treated for 72 h). T-cell and B-cell proliferation as well as apoptosis and necrosis were determined in human and chicken samples. IL-2 and IL-6 production by human lymphocytes also was measured. In addition, uptake kinetics of microcystin-LR into human and chicken peripheral blood lymphocytes were calculated by Liquid Chromatography (LS) /Mass Spectrometry (MS) analysis. At the highest dose microcystin-LR decreased T-cell proliferation and all doses of microcystin-LR inhibited B-cell proliferation. The frequency of apoptotic and necrotic cells increased in a dose and time-dependent manner. Human lymphocytes responded to stimulation with microcystin-LR by increased production of IL-6 and decreased production of IL-2. Human lymphocytes were able to uptake from 0.014 to 1.663 μg/ml and chicken lymphocytes from 0.035 to 1.733 μg/ml of the microcystin-LR added to the cultures, depending on the treatment time and dose. In conclusion, microcystin-LR acted as an immunomodulator in cytokine production and down-regulated lymphocyte functions by induction of apoptosis and necrosis. However, further studies dealing with the influence of microcystin-LR on expression cytokine genes and transcription factors are necessary to confirm these hypotheses

  20. Long term carbon dioxide exchange above a mixed forest in the Belgian Ardennes: evaluation of different approaches to deduce total ecosystem respiration from Eddy covariance measurements

    Jérôme, Elisabeth; Aubinet, Marc; Heinesch, Bernard

    2010-05-01

    The general aim of this research is to analyze inter annual variability of carbon dioxide (CO2) fluxes exchanged by a mixed forest located at the Vielsalm experimental site in Belgium. At this site, CO2 flux measurements started in 1996 and are still going on. Thirteen complete years of measurements are thus available. Net Ecosystem Exchange (NEE) inter annual variability may be driven by gross primary productivity (GPP) or Total Ecosystem Respiration (TER), which should thus be both quantified. Using flux partitioning methods, TER is deduced from NEE measurements. GPP is then obtained by subtracting TER from NEE. Initially, a robust estimation of TER is required. This work seeks to compare two independent approaches to assess TER in order to quantify the implications on inter-annual variability. The comparison was performed on twelve complete years. TER estimates can be deduced by extrapolating to the whole day NEE measurements taken during selected night or day periods. In both case, the extrapolation is performed by using a respiration response to temperature. The first approach, referred as the night-time approach, consisted in calculating TER using a temperature response function derived from night-time data sets (Reichstein et al., 2005). The second approach, referred as the daytime approach, consisted in assessing TER from the intercept of the NEE/Photosynthetically Photon Flux Density (PPFD) response (Wohlfahrt et al., 2005). For each approach, different modalities were compared: the use of long term (annual) or short term (15 days) data sets for the night-time approach and the use of different types of regression for the daytime approach. In addition, the impact of the temperature choice was studied for each of the approaches. For the night-time approach, main results showed that air temperature sensitivity of ecosystem respiration derived from annual data did not reflect the short-term air temperature sensitivity. Vielsalm is a summer active ecosystem

  1. Associations among methane emission traits measured in the feedlot and in respiration chambers in Angus cattle bred to vary in feed efficiency.

    Herd, R M; Velazco, J I; Arthur, P F; Hegarty, R F

    2016-11-01

    The objective of the study was to evaluate associations among animal performance and methane emission traits under feedlot conditions and in respiration chambers in Angus cattle bred to vary in residual feed intake (RFI), which is a measure of feed efficiency. Fifty-nine cattle were tested for feedlot RFI, of which 41 had methane production recorded on an ad libitum grain-based ration in the feedlot, 59 on a restricted grain-based ration in respiration chambers, and 57 on a restricted roughage ration in respiration chambers. The cattle became older and heavier as they went through the different phases of the experiment, but their feed intake (expressed as DMI) and daily emission of enteric methane (methane production rate; MPR) did not increase proportionally, as feed offered was restricted in the respiration chamber tests. Methane emissions by individual animals relative to their DMI were calculated as methane yield (MY; MPR/DMI) and as 2 measures of residual methane production (RMP and RMP), which were calculated as the difference between measured MPR and that predicted from feed intake by 2 different equations. Within each test regime, MPR was positively correlated ( = 0.28 to 0.61) with DMI. Phenotypic correlations for MY, RMP, and RMP between the feedlot test and the restricted grain test ( = 0.40 to 0.43) and between the restricted grain test and the restricted roughage test were moderate ( = 0.36 to 0.41) and moderate to strong between the feedlot test and the restricted roughage test ( = 0.54 to 0.58). These results indicate that the rankings of animals for methane production relative to feed consumed are relatively stable over the 3 test phases. Feedlot feed conversion ratio and RFI were not correlated with MPR in the feedlot test and grain-based chamber test but were negatively correlated with MPR in the chamber roughage test ( = -0.31 and -0.37). Both were negatively correlated with MY and RMP in the feedlot test ( = -0.42 to -0.54) and subsequent

  2. Effects of respirator use on worker performance

    Cardarelli, R. [Yankee Atomic Electric Co., Bolton, MA (United States)

    1995-03-01

    In 1993, EPRI funded Yankee Atomic Electric Company to examine the effects of respirator use on worker efficiency. Phase I of Yankee`s effort was to develop a study design to determine respirator effects. Given success in Phase I, a larger population will be tested to determine if a stasitically significant respirator effect on performance can be measured. This paper summarizes the 1993 EPRI/Yankee Respirator Effects of Pilot Study, and describes the study design for the 1994 EPRI/Yankee Respirator Study to be conducted at the Oyster Creek Nuclear Power Plant. Also described is a summary of respirator effect studies that have been conducted during the last ten (10) years.

  3. Monitoring of microcystin-LR in Luvuvhu River catchment ...

    The main aim of this study is to assess the levels of microcystin-LR in Luvuvhu River catchment and to assess the physicochemical parameters that may promote the growth of cyanobacteria. The level of microcystin-LR in some of the sampling sites was <0.18 ìg/l except for one site (Luvuvhu River just before the confluence ...

  4. Microcystin-LR equivalent concentrations in fish tissue during a ...

    The effects of a decomposing cyanobacteria bloom on water quality and the accumulation of microcystin-LR equivalent toxin in fish at Loskop Dam were studied in May 2012. Enzyme-linked immunosorbent assay [ELISA] was used to confirm the presence of microcystin-LR equivalent in the water and to determine the ...

  5. Antioxidant Effect of Curcumin Against Microcystin- LR-Induced ...

    Purpose: To investigate the effect of curcumin on microcystin-LR (MC-LR)- induced renal oxidative damage in Balb/c mice. Methods: 40 male Balb/c mice were assigned randomly to 4 groups each having 10 mice. One group served as normal (saline treated) while another group was used as curcumin control. The third ...

  6. Assessment of co-seismic landslide susceptibility using LR and ...

    Suchita Shrestha

    2018-03-28

    Mar 28, 2018 ... statistical methods, namely Logistic Regression. (LR) and Analysis ... The LR method has been applied by various researchers ... many bivariate models need that the independent variables be .... through a point (per unit contour length), and tan β is the ..... by multivariate statistical techniques; Nat. Hazards ...

  7. alpha-particle radioactivity from LR 115 by two methods of analysis

    Azkour, K; Adloff, J C; Pape, A

    1999-01-01

    LR115 track detectors were exposed to samples of Moroccan phosphate and phosphogypsum to measure their alpha-particle radioactivity. Then two formalisms were used for the dosimetry: simulation by a Monte Carlo method and determination of concentrations from a numerically integrated track registration equation. The results were compared with those deduced gamma-ray spectrometry.

  8. IRT-LR-DIF with Estimation of the Focal-Group Density as an Empirical Histogram

    Woods, Carol M.

    2008-01-01

    Item response theory-likelihood ratio-differential item functioning (IRT-LR-DIF) is used to evaluate the degree to which items on a test or questionnaire have different measurement properties for one group of people versus another, irrespective of group-mean differences on the construct. Usually, the latent distribution is presumed normal for both…

  9. Measurement of respirable superabsorbent polyacrylate (SAP) dust by ethanol derivatization using gas chromatography-mass spectrometry (GC-MS) detection.

    McCormack, Paul; Lemmo, John S; Macomber, Margaret; Holcomb, Mark L; Lieckfield, Robert

    2011-04-01

    Superabsorbent polyacrylate (SAP) is an important industrial chemical manufactured primarily as sodium polyacrylate but occasionally as potassium salt. It has many applications owing to its intrinsic physical property of very high water absorption, which can be more than 100 times it own weight. SAP is commonly used in disposable diapers and feminine hygiene products and is known by a number of synonyms-sodium polyacrylate, superabsorbent polyacrylate (SAP), polyacrylate absorbent (PA), and superabsorbent material (SAM). Germany and The Netherlands have adopted a nonbinding scientific guideline value 0.05 mg/m³ (8-hr time-weighted average, TWA) as the maximum allowable workplace concentration for the respirable dust of SAP (acrylate was developed and validated for the analysis of respirable superabsorbent polyacrylate dust collected on filter cassettes in the workplace environment. This method is an alternative to the commonly used sodium-based method, which is limited owing to potential interference by other sources of sodium from the workplace and laboratory environments. The alcohol derivatization method effectively eliminates sodium interference from several classes of sodium compounds, as shown by their purposeful introduction at two and six times the equivalent amount of SAP present in reference samples. The accuracy of the method, as determined by comparison with sodium analysis of known reference samples, was greater than 80% over the study range of 5-50 μg of SAP dust. The lower reporting limit of the method is 3.0 μg of SAP per sample, which is equivalent to 3 (μg/m³) for an 8-hr sampling period at the recommended flow rate of 2.2 L/min.

  10. Dynamics of organic matters in the root-rhizoplane-soil system of maize [Zea mays], 1: A simple and rapid method for measuring root respiration

    Okada, K. [Tokyo Univ., Tokyo (Japan); Kumura, A.

    1990-03-15

    In the analysis of dynamics of organic matter in the root-rhizoplane-soil system, it is essential to estimate various kinds of carbon flows in the system separately. Since a simple and rapid method for measuring root respiration was needed for this purpose, the authors developed the following method. A plastic syringe is used as the chamber. Sample roots are put into a syringe, in which the air is replaced with air of known CO{sub 2} concentration and the syringe is kept at a constant temperature for a certain time. A volume of the air in the syringe is injected into the flow of N{sub 2} gas in the tube which is connected to an infrared gas analyzer. The CO{sub 2} concentration in the syringe is directly related to the reading of the analyzer. From the difference of the CO{sub 2} concentration in the syringe before and after the incubation, the respiration rate of the roots is calculated. The details of the procedure were determined by the results of experiments regarding the effects of factors concerned. (author)

  11. Integrating est.of ecosystem respiration from eddy covariance towers with automated measures of soil respiration: Exam. the dvlpt. and influence of hysteresis in soil respiratory fluxes along a woody plant gradient 2026

    The physiognomic shift in ecosystem structure from a grassland to a woodland may alter the sensitivity of CO2 exchange to variations in growing-season temperatures and precipitation inputs. One large component of ecosystem flux is the efflux of CO2 from the soil (soil respiration, Rsoil), which is ...

  12. Intraperitoneal exposure of whitefish to microcystin-LR induces rapid liver injury followed by regeneration and resilience to subsequent exposures

    Woźny, Maciej; Lewczuk, Bogdan; Ziółkowska, Natalia; Gomułka, Piotr; Dobosz, Stefan; Łakomiak, Alicja; Florczyk, Maciej; Brzuzan, Paweł

    2016-01-01

    To date, there has been no systematic approach comprehensively describing the sequence of pathological changes in fish during prolonged exposure to microcystin-LR (MC-LR). Towards this aim, juvenile whitefish individuals received an intraperitoneal injection with pure MC-LR, and the injection was repeated every week to maintain continuous exposure for 28 days. During the exposure period, growth and condition of the fish were assessed based on biometric measurements. Additionally, selected biochemical markers were analysed in the fishes' blood, and their livers were carefully examined for morphological, ultrastructural, and molecular changes. The higher dose of MC-LR (100 μg·kg −1 ) caused severe liver injury at the beginning of the exposure period, whereas the lower dose (10 μg·kg −1 ) caused less, probably reversible injury, and its effects began to be observed later in the exposure period. These marked changes were accompanied by substantial MC-LR uptake by the liver. However, starting on the 7th day of exposure, cell debris began to be removed by phagocytes, then by 14th day, proliferation of liver cells had markedly increased, which led to reconstruction of the liver parenchyma at the end of the treatment. Surprisingly, despite weekly-repeated intraperitoneal injections, MC-LR did not accumulate over time of exposure which suggests its limited uptake in the later phase of exposure. In support, mRNA expression of the membrane transport protein oatp1d was decreased at the same time as the regenerative processes were observed. Our study shows that closing of active membrane transport may serve as one defence mechanism against further MC-LR intoxication. - Highlights: • The study presents pathological changes in whitefish during prolonged MC-LR exposure. • After early, severe injury, the damaged liver parenchyma of the fish regenerated. • Endoplasmic reticulum, cytoskeleton, and chromatin were the main targets for MC-LR. • MC-LR did not

  13. Intraperitoneal exposure of whitefish to microcystin-LR induces rapid liver injury followed by regeneration and resilience to subsequent exposures

    Woźny, Maciej, E-mail: maciej.wozny@uwm.edu.pl [Department of Environmental Biotechnology, Faculty of Environmental Sciences, University of Warmia and Mazury in Olsztyn, ul. Słoneczna 45G, 10-709 Olsztyn (Poland); Lewczuk, Bogdan; Ziółkowska, Natalia [Department of Histology and Embryology, Faculty of Veterinary Medicine, University of Warmia and Mazury in Olsztyn, ul. M. Oczapowskiego 13, 10-713 Olsztyn (Poland); Gomułka, Piotr [Department of Ichthyology, Faculty of Environmental Sciences, University of Warmia and Mazury in Olsztyn, ul. M. Oczapowskiego 5, 10-719 Olsztyn (Poland); Dobosz, Stefan [Department of the Salmonid Research in Rutki, Inland Fisheries Institute in Olsztyn, Rutki, 83-330 Żukowo (Poland); Łakomiak, Alicja; Florczyk, Maciej; Brzuzan, Paweł [Department of Environmental Biotechnology, Faculty of Environmental Sciences, University of Warmia and Mazury in Olsztyn, ul. Słoneczna 45G, 10-709 Olsztyn (Poland)

    2016-12-15

    To date, there has been no systematic approach comprehensively describing the sequence of pathological changes in fish during prolonged exposure to microcystin-LR (MC-LR). Towards this aim, juvenile whitefish individuals received an intraperitoneal injection with pure MC-LR, and the injection was repeated every week to maintain continuous exposure for 28 days. During the exposure period, growth and condition of the fish were assessed based on biometric measurements. Additionally, selected biochemical markers were analysed in the fishes' blood, and their livers were carefully examined for morphological, ultrastructural, and molecular changes. The higher dose of MC-LR (100 μg·kg{sup −1}) caused severe liver injury at the beginning of the exposure period, whereas the lower dose (10 μg·kg{sup −1}) caused less, probably reversible injury, and its effects began to be observed later in the exposure period. These marked changes were accompanied by substantial MC-LR uptake by the liver. However, starting on the 7th day of exposure, cell debris began to be removed by phagocytes, then by 14th day, proliferation of liver cells had markedly increased, which led to reconstruction of the liver parenchyma at the end of the treatment. Surprisingly, despite weekly-repeated intraperitoneal injections, MC-LR did not accumulate over time of exposure which suggests its limited uptake in the later phase of exposure. In support, mRNA expression of the membrane transport protein oatp1d was decreased at the same time as the regenerative processes were observed. Our study shows that closing of active membrane transport may serve as one defence mechanism against further MC-LR intoxication. - Highlights: • The study presents pathological changes in whitefish during prolonged MC-LR exposure. • After early, severe injury, the damaged liver parenchyma of the fish regenerated. • Endoplasmic reticulum, cytoskeleton, and chromatin were the main targets for MC-LR. • MC-LR did not

  14. A further study of the (CR-LR) difference technique for retrospective radon exposure assessment

    Nikezic, D.; Yip, C.W.Y.; Leung, S.Y.Y.; Leung, J.K.C.; Yu, K.N.

    2006-01-01

    The (CR-LR) difference technique, based on the CR-39 and LR 115 detectors, for the determination of implanted 210 Po in glass after deposition of short-lived radon progeny, was analyzed in details in this paper. The sensitivities of both detectors were calculated using the Monte Carlo method with V functions particularly derived in our previous works for the detectors used in the present experiments. The dependency of the sensitivity ratio on the removed layer of both detectors was determined and verified experimentally. The simulated sensitivity ratios correlate well with the experimental ones. A major finding of the present work is that the sensitivity ratio between the CR-39 and LR 115 detectors depends only weakly on the ratio between the 238 U and 232 Th concentrations in the glass samples. This is crucial for the application of the (CR-LR) difference technique for retrospective radon exposure assessments, since measurements of the 238 U and 232 Th concentrations in the relatively small real-life glass samples will make the retrospective radon exposure assessments impractical

  15. Nutrients and temperature additively increase stream microbial respiration

    David W. P. Manning; Amy D. Rosemond; Vladislav Gulis; Jonathan P. Benstead; John S. Kominoski

    2017-01-01

    Rising temperatures and nutrient enrichment are co‐occurring global‐change drivers that stimulate microbial respiration of detrital carbon, but nutrient effects on the temperature dependence of respiration in aquatic ecosystems remain uncertain. We measured respiration rates associated with leaf litter, wood, and fine benthic organic matter (FBOM) across...

  16. Inhibition of Microcystis aeruginosa and microcystin- LR with one ...

    Yomi

    2State Key Laboratory of Urban Water Resource and Environment, Harbin Institute of Technology, Harbin 150001,. China. ... industrial wastewater and domestic sewage. One of the .... LR detected by high performance liquid chromatography.

  17. Approximate Solution of LR Fuzzy Sylvester Matrix Equations

    Xiaobin Guo

    2013-01-01

    Full Text Available The fuzzy Sylvester matrix equation AX~+X~B=C~ in which A,B are m×m and n×n crisp matrices, respectively, and C~ is an m×n LR fuzzy numbers matrix is investigated. Based on the Kronecker product of matrices, we convert the fuzzy Sylvester matrix equation into an LR fuzzy linear system. Then we extend the fuzzy linear system into two systems of linear equations according to the arithmetic operations of LR fuzzy numbers. The fuzzy approximate solution of the original fuzzy matrix equation is obtained by solving the crisp linear systems. The existence condition of the LR fuzzy solution is also discussed. Some examples are given to illustrate the proposed method.

  18. Choosing the right respirator

    Bidwell, J.

    1997-01-01

    Selecting respirators to help protect workers from airborne contaminants can be a confusing process. The consequences of selecting the incorrect respirator can be intimidating, and worker safety and health may be dramatically and irreparably affected if an inappropriate respirator is chosen. When used in the workplace, a formal respiratory protection program must be established covering the basic requirements outlined in the OSHA Respiratory Protection Standard (29 CFR 1910.134). Education and training must be properly emphasized and conducted periodically. Maintenance, cleaning, and storage programs must be established and routinely followed for reusable respirators. The process of establishing a respiratory protection program can be broken down into four basic steps: Identify respiratory hazards and concentrations; understand the contaminants effects on workers' health; select appropriate respiratory protection; and train in proper respirator use and maintenance. These four steps are the foundation for establishing a basic respirator protection program. Be sure to consult state and federal OSHA requirements to ensure that the program complies. Leading industrial respirator manufacturers should be able to assist with on-site training and education in this four-step process, in addition to helping employers train their workers and conduct respirator fit testing

  19. Separating rhizosphere respiration from total soil respiration in two larch plantations in northeastern China.

    Jiang, Lifen; Shi, Fuchen; Li, Bo; Luo, Yiqi; Chen, Jiquan; Chen, Jiakuan

    2005-09-01

    The potential capacity of soil to sequester carbon in response to global warming is strongly regulated by the ratio of rhizosphere respiration to respiration by soil microbial decomposers, because of their different temperature sensitivities. To quantify relative contributions of rhizosphere respiration to total soil respiration as influenced by forest stand development, we conducted a trenching study in two larch (Larix gmelini (Rupr.) Rupr.) plantations, aged 17 and 31 years, in northeastern China. Four plots in each plantation were randomly selected and trenched in early May 2001. Soil surface CO2 effluxes both inside and outside the plots were measured from May 2001 to August 2002. Soil respiration (i.e., the CO2 effluxes outside the trenched plots) varied similarly in the two plantations from 0.8 micromol m(-2) s(-1) in winter to 6.0 micromol m(-2) s(-1) in summer. Rhizosphere respiration (i.e., CO2 efflux outside the trenched plots minus that inside the plots) varied from 0.2 to 2.0 micromol m(-2) s(-1) in the old forest and from 0.3 to 4.0 micromol m(-2) s(-1) in the young forest over the seasons. Rhizosphere respiration, on average, accounted for 25% of soil respiration in the old forest and 65% in the young forest. Rhizosphere and soil respiration were significantly correlated with soil temperature but not with soil water content. We conclude that the role forests play in regulating climate change may depend on their age.

  20. Effects of different algaecides on the photosynthetic capacity, cell integrity and microcystin-LR release of Microcystis aeruginosa

    Zhou, Shiqing; Shao, Yisheng; Gao, Naiyun; Deng, Yang; Qiao, Junlian; Ou, Huase; Deng, Jing

    2013-01-01

    Bench scale tests were conducted to study the effects of four common algaecides, including copper sulfate, hydrogen peroxide, diuron and ethyl 2-methylacetoacetate (EMA) on the photosynthetic capacity, cell integrity and microcystin-LR (MC-LR) release of Microcystis aeruginosa. The release of potassium (K + ) from cell membrane during algaecide exposure was also analyzed. The three typical photosynthetic parameters, including the effective quantum yield (φ e ), photosynthetic efficiency (α) and maximal electron transport rate (rETR max ), were measured by a pulse amplitude modulated (PAM) fluorometry. Results showed that the photosynthetic capacity was all inhibited by the four algaecides, to different degrees, by limiting the energy capture in photosynthesis, and blocking the electron transfer chain in primary reaction. For example, at high diuron concentration (7.5 mg L −1 ), φ e , α and rETR max decreased from 0.46 to 0.19 (p −2 s −1 /μmol photons m −2 s −1 , and from 160.7 to 0.1 (p −2 s −1 compared with the control group after 96 h of exposure, respectively. Furthermore, the increase of algaecide dose could lead to the cell lysis, as well as release of intracellular MC-LR that enhanced the accumulation of extracellular MC-LR. The order of MC-LR release potential for the four algaecides was CuSO 4 > H 2 O 2 > diuron > EMA. Highlights: • PAM was used to investigate the effects of algaecides on Microcystis aeruginosa. • We estimate the release of potassium (K + ) from cell membrane for cell lysis. • The risk of microcystin-LR release was evaluated after algaecides exposure. • The order of MC-LR release potential was copper sulfate > hydrogen peroxide > diuron > ethyl 2-methylacetoacetate

  1. Soil Respiration And Respiration Partitioning In An Oak-Savannah With A History Of Fertilization

    Morris, K. A.; Nair, R.; Schrumpf, M.; Migliavacca, M.

    2017-12-01

    Soil respiration is a combination of autotrophic and heterotrophic components. These components have different controls and structurally complex ecosystems such as oak-savannahs offer an opportunity to study strongly contrasting conditions (ie., soil from under trees versus open areas) in an environment with similar soil mineralogy and climatic patterns. To measure respiration coming from plant roots, fungal hyphae, and free-living microbes we established stations of soil cores comprised of three selectively permeable meshes under tree canopies and in open grassy areas of a Holm Oak (Quercus ilex) savannah in Extremadura, Spain. Large plots of this ecosystem had previously been fertilized as part of a stoichiometeric imbalance study (in 2015). Stations were installed in Dec. 2016 within four plots; control, N added, P added, and N+P added. Respiration from cores was measured in campaigns at key phenological stages with a portable Li-Cor 8100A unit. Six months after installation > 50% of soil respiration was attributable to free-living microbes. There is a persistent effect of the prior fertilization, resulting in increased soil respiration in open areas regardless of fertilizer type, while respiration from under tree canopies had a varied response. Soil under tree canopies showed distinct sensitivity to stoichiometric imbalance, meaning that addition of N or P alone either did not change respiration or decreased it slightly, while N+P stimulated respiration. We determined that respiration from free-living microbes is a major component of soil respiration even in the most active plant growing season. However, because of the lag between the time of fertilization and the time of measurement, it not possible to say whether treatment responses are due solely to nutrient status of the soil or whether changes in plant biomass and species composition also play a role. Additional work planned at the site will shed light on this uncertainty as well as the contribution of

  2. BOREAS TE-5 Soil Respiration Data

    Hall, Forrest G. (Editor); Curd, Shelaine (Editor); Ehleriinger, Jim; Brooks, J. Renee; Flanagan, Larry

    2000-01-01

    The BOREAS TE-5 team collected measurements in the NSA and SSA on gas exchange, gas composition, and tree growth. Soil respiration data were collected from 26-May-94 to 07-Sep-94 in the BOREAS NSA and SSA to compare the soil respiration rates in different forest sites using a LI-COR 6200 soil respiration chamber (model 6299). The data are stored in tabular ASCII files. The data files are available on a CD-ROM (see document number 20010000884), or from the Oak Ridge National Laboratory (ORNL) Distrobuted Activity Archive Center (DAAC).

  3. Direct determination of bulk etching rate for LR-115-II solid state ...

    The thickness of the removed layer of the LR-115-II solid state nuclear track detector during etching is measured directly with a rather precise instrument. Dependence of bulk etching rate on temperature of the etching solution is investigated. It has been found that the bulk etching rate is 3.2 m/h at 60°C in 2.5 N NaOH of ...

  4. Seasonal Oxygen Dynamics in a Warm Temperate Estuary: Effects of Hydrologic Variability on Measurements of Primary Production, Respiration, and Net Metabolism

    Seasonal responses in estuarine metabolism (primary production, respiration, and net metabolism) were examined using two complementary approaches. Total ecosystem metabolism rates were calculated from dissolved oxygen time series using Odum’s open water method. Water column rates...

  5. Partitioning net ecosystem carbon exchange into net assimilation and respiration using 13CO2 measurements: A cost-effective sampling strategy

    OgéE, J.; Peylin, P.; Ciais, P.; Bariac, T.; Brunet, Y.; Berbigier, P.; Roche, C.; Richard, P.; Bardoux, G.; Bonnefond, J.-M.

    2003-06-01

    The current emphasis on global climate studies has led the scientific community to set up a number of sites for measuring the long-term biosphere-atmosphere net CO2 exchange (net ecosystem exchange, NEE). Partitioning this flux into its elementary components, net assimilation (FA), and respiration (FR), remains necessary in order to get a better understanding of biosphere functioning and design better surface exchange models. Noting that FR and FA have different isotopic signatures, we evaluate the potential of isotopic 13CO2 measurements in the air (combined with CO2 flux and concentration measurements) to partition NEE into FR and FA on a routine basis. The study is conducted at a temperate coniferous forest where intensive isotopic measurements in air, soil, and biomass were performed in summer 1997. The multilayer soil-vegetation-atmosphere transfer model MuSICA is adapted to compute 13CO2 flux and concentration profiles. Using MuSICA as a "perfect" simulator and taking advantage of the very dense spatiotemporal resolution of the isotopic data set (341 flasks over a 24-hour period) enable us to test each hypothesis and estimate the performance of the method. The partitioning works better in midafternoon when isotopic disequilibrium is strong. With only 15 flasks, i.e., two 13CO2 nighttime profiles (to estimate the isotopic signature of FR) and five daytime measurements (to perform the partitioning) we get mean daily estimates of FR and FA that agree with the model within 15-20%. However, knowledge of the mesophyll conductance seems crucial and may be a limitation to the method.

  6. Electrochemical Aptatoxisensor Responses on Nanocomposites Containing Electro-Deposited Silver Nanoparticles on Poly(Propyleneimine Dendrimer for the Detection of Microcystin-LR in Freshwater

    Mawethu P. Bilibana

    2016-11-01

    Full Text Available A sensitive and reagentless electrochemical aptatoxisensor was developed on cobalt (II salicylaldiimine metallodendrimer (SDD–Co(II doped with electro-synthesized silver nanoparticles (AgNPs for microcystin-LR (L, l-leucine; R, l-arginine, or MC-LR, detection in the nanomolar range. The GCE|SDD–Co(II|AgNPs aptatoxisensor was fabricated with 5’ thiolated aptamer through self-assembly on the modified surface of the glassy carbon electrode (GCE and the electronic response was measured using cyclic voltammetry (CV. Specific binding of MC-LR with the aptamer on GCE|SDD–Co(II|AgNPs aptatoxisensor caused the formation of a complex that resulted in steric hindrance and electrostatic repulsion culminating in variation of the corresponding peak current of the electrochemical probe. The aptatoxisensor showed a linear response for MC-LR between 0.1 and 1.1 µg·L−1 and the calculated limit of detection (LOD was 0.04 µg·L−1. In the detection of MC-LR in water samples, the aptatoxisensor proved to be highly sensitive and stable, performed well in the presence of interfering analog and was comparable to the conventional analytical techniques. The results demonstrate that the constructed MC-LR aptatoxisensor is a suitable device for routine quantification of MC-LR in freshwater and environmental samples.

  7. Effect of Acupuncture at LR3 on Cerebral Glucose Metabolism in a Rat Model of Hypertension: A 18F-FDG-PET Study

    Jing Li

    2018-01-01

    Full Text Available Our objective was to investigate the effect of acupuncture at LR3 on cerebral glucose metabolism in spontaneously hypertensive rats (SHRs. We used 18F-2-fluoro-deoxy-D-glucose positron emission tomography (18F-FDG-PET to examine the effects of acupuncture at LR3 on cerebral glucose metabolism in SHRs. SHRs were randomly allocated to receive no treatment (SHR group, needling at LR3 (SHR + LR3 group, or sham needling (SHR + sham group. Rats received 10 min acupuncture once per day for 7 days and were compared to normotensive Wistar Kyoto (WKY rats. Blood pressure (BP measurement and PET were performed after the first needling and the 7-day treatment period. BP was lower in the SHR + LR3 group compared to the other SHR groups between 30 and 60 min after the first needling and at 24 and 48 h after the 7-day treatment period. Glucose metabolism in the motor, sensory, and visual cortices was decreased in SHR group compared to WKY group. Needling at LR3 was associated with decreased glucose metabolism in the dorsal thalamus, thalamus, and hypothalamus and with increased metabolism in the cerebellar anterior and posterior lobes, medulla oblongata, and sensory cortex compared to the SHR group. These findings suggest that LR3 acupuncture improves hypertension through a mechanism involving altered brain activation in SHRs.

  8. Respiration in Aquatic Insects.

    MacFarland, John

    1985-01-01

    This article: (1) explains the respiratory patterns of several freshwater insects; (2) describes the differences and mechanisms of spiracular cutaneous, and gill respiration; and (3) discusses behavioral aspects of selected aquatic insects. (ML)

  9. Partitioning of ecosystem respiration in a beech forest

    Brændholt, Andreas; Ibrom, Andreas; Larsen, Klaus Steenberg

    2018-01-01

    Terrestrial ecosystem respiration (Reco) represents a major component of the global carbon cycle. It consists of many sub-components, such as aboveground plant respiration and belowground root and microbial respiration, each of which may respond differently to abiotic factors, and thus to global...... of Reco in a temperate beech forest at diel, seasonal and annual time scales. Reco was measured by eddy covariance while respiration rates from soil, tree stems and isolated coarse tree roots were measured bi-hourly by an automated closed-chamber system. Soil respiration (Rsoil) was measured in intact...... plots, and heterotrophic Rsoil was measured in trenched plots. Tree stem (Rstem) and coarse root (Rroot) respiration were measured by custom made closed-chambers. We found that the contribution of Rstem to total Reco varied across the year, by only accounting for 6% of Reco during winter and 16% during...

  10. Low-priced, time-saving, reliable and stable LR-115 counting system

    Tchorz-Trzeciakiewicz, D.E.

    2015-01-01

    Nuclear alpha particles leave etches (tracks) when they hit the surface of a LR-115 detector. The density of these tracks is used to measure radon concentration. Counting these tracks by human sense is tedious and time-consuming procedure and may introduce counting error, whereas most available automatic and semiautomatic counting systems are expensive or complex. An uncomplicated, robust, reliable and stable counting system using freely available on the Internet software as Digimizer™ and PhotoScape was developed and proposed. The effectiveness of the proposed procedure was evaluated by comparing the amount of tracks counted by software with the amount of tracks counted manually for 223 detectors. The percentage error for each analysed detector was obtained as a difference between automatic and manual counts divided by manual count. For more than 97% of detectors, the percentage errors oscillated between −3% and 3%. - Highlights: • Semiautomatic, uncomplicated procedure was proposed to count the amount of alpha tracks. • Freely available software on the Internet used as alpha tracks counting system for LR-115. • LR-115 detectors used to measure radon concentration and radon exhalation rate

  11. Digging up your dirt. High school students combine small-scale respiration and soil carbon measurements with satellite imagery in hands-on inquiry activities.

    Kemper, K.; Throop, H.

    2015-12-01

    One of the greatest impacts on the global carbon cycle is changes in land use. Making this concept relevant and inquiry-based for high school students is challenging. Many are familiar with reconstructing paleo-climate from ice core data, but few have a connection to current climate research. Many students ask questions like 'What will our area be like in 20 years?' or 'How much does planting trees help?' while few have the scientific language to engage in a discussion to answer these questions. Our work connects students to climate change research in several ways: first, teacher Keska Kemper engaged in field research with Dr. Heather Throop creating a 'teacher in the field' perspective for students in the classroom. Dr. Throop met with Keska Kemper's students several times to develop an inquiry-based field study. Students predicted and then measured rates of respiration between different soil types in an urban park close to their school. Students then could compare their results from Portland, Oregon to Throop's work across a rain gradient in Australia. Discussions about percent tree cover and soil carbon helped students see connections between land use changes and changes in carbon cycling. Last, students examined satellite imagery to determine percent tree cover and numberss of trees to compare to soil carbon in the same region. Students were able to examine imagery over the last 30 years to visualize land use changes in the greater Portland area.

  12. Effect of calcium and magnesium on the antimicrobial action of enterocin LR/6 produced by Enterococcus faecium LR/6.

    Kumar, Manoj; Srivastava, Sheela

    2011-06-01

    Enterococci are well-known producers of antimicrobial peptides (enterocins) that possess potential as biopreservatives in food. In this study, divalent cations and release of intracellular potassium were used to assess the mechanism of interaction and killing of enterocin LR/6 produced by Enterococcus faecium LR/6 on three target Gram-positive and Gram-negative bacteria, namely Micrococcus luteus, Enterococcus sp. strain LR/3 and Escherichia coli K-12. Whilst treatment with enterocin LR/6 in all cases led to a significant loss of viability, suggesting a bactericidal mode of action, E. coli K-12 showed better tolerance than the other two strains. Bacteriocins have generally been reported to create pores in the membrane of sensitive cells and this function is diminished by divalent cations. In this study it was shown that Ca(2+) and Mg(2+) markedly improved the viability of enterocin LR/6-treated cells in a concentration-dependent manner. K(+) release as a sign of membrane leakiness was higher in M. luteus compared with the other two test strains. In agreement with the viability response, pre-exposure to Ca(2+) and Mg(2+) substantially reduced the amount of K(+) leakage by M. luteus and Enterococcus sp.; in the case of E. coli K-12, no leakage of K(+) was recorded. These results suggest that enterocin LR/6, which possesses good antibacterial potential, may not be very effective as a preservative in foods containing high concentrations of calcium and magnesium. Copyright © 2011 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

  13. Enteric methane emissions from low- and high-residual feed intake beef heifers measured using GreenFeed and respiration chamber techniques.

    Alemu, A W; Vyas, D; Manafiazar, G; Basarab, J A; Beauchemin, K A

    2017-08-01

    The objectives of this study were to evaluate the relationship between residual feed intake (RFI; g/d) and enteric methane (CH) production (g/kg DM) and to compare CH and carbon dioxide (CO) emissions measured using respiration chambers (RC) and the GreenFeed emission monitoring (GEM) system (C-Lock Inc., Rapid City, SD). A total of 98 crossbred replacement heifers were group housed in 2 pens and fed barley silage ad libitum and their individual feed intakes were recorded by 16 automated feeding bunks (GrowSafe, Airdrie, AB, Canada) for a period of 72 d to determine their phenotypic RFI. Heifers were ranked on the basis of phenotypic RFI, and 16 heifers (8 with low RFI and 8 with high RFI) were randomly selected for enteric CH and CO emissions measurement. Enteric CH and CO emissions of individual animals were measured over two 25-d periods using RC (2 d/period) and GEM systems (all days when not in chambers). During gas measurements metabolic BW tended to be greater ( ≤ 0.09) for high-RFI heifers but ADG tended ( = 0.09) to be greater for low-RFI heifers. As expected, high-RFI heifers consumed 6.9% more feed ( = 0.03) compared to their more efficient counterparts (7.1 vs. 6.6 kg DM/d). Average CH emissions were 202 and 222 g/d ( = 0.02) with the GEM system and 156 and 164 g/d ( = 0.40) with RC for the low- and high-RFI heifers, respectively. When adjusted for feed intake, CH yield (g/kg DMI) was similar for high- and low-RFI heifers (GEM: 27.7 and 28.5, = 0.25; RC: 26.5 and 26.5, = 0.99). However, CH yield differed between the 2 measurement techniques only for the high-RFI group ( = 0.01). Estimates of CO yield (g/kg DMI) also differed between the 2 techniques ( ≤ 0.03). Our study found that high- and low-efficiency cattle produce similar CH yield but different daily CH emissions. The 2 measurement techniques differ in estimating CH and CO emissions, partially because of differences in conditions (lower feed intakes of cattle while in chambers, fewer days

  14. [The development of a respiration and temperature monitor].

    Du, X; Wu, B; Liu, Y; He, Q; Xiao, J

    2001-12-01

    This paper introduces the design of a monitoring system to measure the respiration and temperature of a body with an 8Xc196 single-chip microcomputer. This system can measure and display the respiration wave, respiration frequency and the body temperature in real-time with a liquid crystal display (LCD) and give an alarm when the parameters are beyond the normal scope. In addition, this device can provide a 24 hours trend graph of the respiration frequency and the body temperature parameters measured. Data can also be exchanged through serial communication interfaces (RS232) between the PC and the monitor.

  15. LALR(1) : LL(1) = LR(0) : LL(0)

    Kruseman Aretz, F.E.J.; Emde Boas, van P.; Hemker, P.W.; Hoffman, W.; Houwen, van der P.J.; Pfluger, P.R.

    1992-01-01

    It is shown that LL(l) and LALR(l) acceptors can be obtained by restricting the action tables of the corresponding LL(O) and LR(O) acceptors to those entries that are accessed in at least one accepting sequence (of a sentence from the language). It follows that a number of properties that are easily

  16. Experimental study on the aging process of the LR 115 cellulose nitrate radon detector

    Siems, M.; Freyer, K.; Treutler, H.-C.; Joensson, G.; Enge, W.

    2001-01-01

    An experimental determination of the aging process of cellulose nitrate detector material was based on the examination of special properties of the LR 115 solid state nuclear track detectors (SSNTDs) of various ages up to 18 years. The examined relevant parameters are the bulk etching rate v b and the track etching rate v t . These parameters are responsible for the appearance, the size and the registration efficiency of tracks of α-particles from radon gas in the detector. To find a correlation between these material parameters and the detector sensitivity an experimental calibration of indoor room and outdoor soil detector devices based on LR 115 took place at the Umweltforschungszentrum Leipzig-Halle (Germany). To avoid routine calibration work in external radon exposure facilities a correction of the age dependent calibration factors with the material parameters measured in one's own laboratory was targeted. In this study a general age dependence, however, was not found. The following statements for practical applications can be made. (i) the bulk etching rate v b for detectors of the same batch has a depth dependence and this dependence is constant over 2 years (LR 115 September 1994). (ii) detectors of different batches older than 5 years and stored at room temperature show an odd v b behaviour when v b is used for describing track shapes. (iii) the calibration factor of detectors of different batches that were stored at about +4 deg. C is constant over 5 years (LR 115 September 1994 and February 1999, Table 2). The conclusion is that LR 115 detectors not older than 5 years and stored in a refrigerator at about +4 deg. C should be preferred for radon measurements. Furthermore these detectors should be recalibrated every year and the microscope work of this calibrations should be performed by the same person who performs the measurements. In addition, a phenomenon related to fundamental track formation mechanisms was found, that the time straggling of the

  17. Microcystin-LR exposure induces developmental neurotoxicity in zebrafish embryo

    Wu, Qin; Yan, Wei; Liu, Chunsheng; Li, Li; Yu, Liqin; Zhao, Sujuan; Li, Guangyu

    2016-01-01

    Microcystin-LR (MCLR) is a commonly acting potent hepatotoxin and has been pointed out of potentially causing developmental neurotoxicity, but the exact mechanism is little known. In this study, zebrafish embryos were exposed to 0, 0.8, 1.6 or 3.2 mg/L MCLR for 120 h. MCLR exposure through submersion caused serious hatching delay and body length decrease. The content of MCLR in zebrafish larvae was analyzed and the results demonstrated that MCLR can accumulate in zebrafish larvae. The locomotor speed of zebrafish larvae was decreased. Furthermore, the dopamine and acetylcholine (ACh) content were detected to be significantly decreased in MCLR exposure groups. And the acetylcholinesterase (AChE) activity was significantly increased after exposure to 1.6 and 3.2 mg/L MCLR. The transcription pattern of manf, chrnα7 and ache gene was consistent with the change of the dopamine content, ACh content and AChE activity. Gene expression involved in the development of neurons was also measured. α1-tubulin and shha gene expression were down-regulated, whereas mbp and gap43 gene expression were observed to be significantly up-regulated upon exposure to MCLR. The above results indicated that MCLR-induced developmental toxicity might attribute to the disorder of cholinergic system, dopaminergic signaling, and the development of neurons. - Highlights: • MCLR accumulation induces developmental neurotoxicity in zebrafish embryo. • The decrease of dopamine levels might be associated with the MCLR-induced developmental neurotoxicity in zebrafish larvae. • The alternation of cholinergic system might contribute to the change of neurobehavior in zebrafish larvae exposure with MCLR. - MCLR accumulation induces developmental neurotoxicity by affecting cholinergic system, dopaminergic signaling, and the development of neurons in zebrafish embryo.

  18. Simplified pressure method for respirator fit testing.

    Han, D; Xu, M; Foo, S; Pilacinski, W; Willeke, K

    1991-08-01

    A simplified pressure method has been developed for fit testing air-purifying respirators. In this method, the air-purifying cartridges are replaced by a pressure-sensing attachment and a valve. While wearers hold their breath, a small pump extracts air from the respirator cavity until a steady-state pressure is reached in 1 to 2 sec. The flow rate through the face seal leak is a unique function of this pressure, which is determined once for all respirators, regardless of the respirator's cavity volume or deformation because of pliability. The contaminant concentration inside the respirator depends on the degree of dilution by the flow through the cartridges. The cartridge flow varies among different brands and is measured once for each brand. The ratio of cartridge to leakflow is a measure of fit. This flow ratio has been measured on human subjects and has been compared to fit factors determined on the same subjects by means of photometric and particle count tests. The aerosol tests gave higher values of fit.

  19. Radon concentrations in some Egyptian dwellings using LR 115 detectors

    Hussein, A S [Radiation Protection Department, Nuclear Power Plants Authority, Cairo (Egypt)

    2007-06-15

    Radon, a well-established risk factor for human lung cancer, is present at low concentrations in most homes. Consequently, many countries have established national guidelines for residential radon concentrations. This survey provides additional information about indoor radon concentrations in Egypt. Indoor radon survey of a total of 15 randomly selected houses in Qena city, Upper Egypt was carried out. LR 115 detectors were exposed for one year, covering all the seasons. The estimated indoor radon levels varied from 19 to 59 Bq m{sup 3} with an average of 40 Bq m{sup 3}. Using the bare and filtered LR 115 detectors, the average equilibrium factor F was assessed as 0.30 indoors. An average annual effective dose of 0.40 mSv has been estimated and was found to be lower than the ICRP-65.

  20. Radon concentrations in some Egyptian dwellings using LR 115 detectors

    Hussein, A.S.

    2007-01-01

    Radon, a well-established risk factor for human lung cancer, is present at low concentrations in most homes. Consequently, many countries have established national guidelines for residential radon concentrations. This survey provides additional information about indoor radon concentrations in Egypt. Indoor radon survey of a total of 15 randomly selected houses in Qena city, Upper Egypt was carried out. LR 115 detectors were exposed for one year, covering all the seasons. The estimated indoor radon levels varied from 19 to 59 Bq m 3 with an average of 40 Bq m 3 . Using the bare and filtered LR 115 detectors, the average equilibrium factor F was assessed as 0.30 indoors. An average annual effective dose of 0.40 mSv has been estimated and was found to be lower than the ICRP-65

  1. Cell density dependence of Microcystis aeruginosa responses to copper algaecide concentrations: Implications for microcystin-LR release.

    Kinley, Ciera M; Iwinski, Kyla J; Hendrikse, Maas; Geer, Tyler D; Rodgers, John H

    2017-11-01

    Along with mechanistic models, predictions of exposure-response relationships for copper are often derived from laboratory toxicity experiments with standardized experimental exposures and conditions. For predictions of copper toxicity to algae, cell density is a critical factor often overlooked. For pulse exposures of copper-based algaecides in aquatic systems, cell density can significantly influence copper sorbed by the algal population, and consequent responses. A cyanobacterium, Microcystis aeruginosa, was exposed to a copper-based algaecide over a range of cell densities to model the density-dependence of exposures, and effects on microcystin-LR (MC-LR) release. Copper exposure concentrations were arrayed to result in a gradient of MC-LR release, and masses of copper sorbed to algal populations were measured following exposures. While copper exposure concentrations eliciting comparable MC-LR release ranged an order of magnitude (24-h EC50s 0.03-0.3mg Cu/L) among cell densities of 10 6 through 10 7 cells/mL, copper doses (mg Cu/mg algae) were similar (24-h EC50s 0.005-0.006mg Cu/mg algae). Comparisons of MC-LR release as a function of copper exposure concentrations and doses provided a metric of the density dependence of algal responses in the context of copper-based algaecide applications. Combined with estimates of other site-specific factors (e.g. water characteristics) and fate processes (e.g. dilution and dispersion, sorption to organic matter and sediments), measuring exposure-response relationships for specific cell densities can refine predictions for in situ exposures and algal responses. These measurements can in turn decrease the likelihood of amending unnecessary copper concentrations to aquatic systems, and minimize risks for non-target aquatic organisms. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Short communication: Emergence of a new race of leaf rust with combined virulence to Lr14a and Lr72 genes on durum wheat

    Soleiman, N.H; Solis, I.; Soliman, M.H.; Sillero, J.C.; Villegas, D.; Alvaro, F.; Royo, C.; Serra, J.; Ammar, K.; Martínez-Moreno, F.

    2016-11-01

    Leaf rust is a foliar disease caused by the fungus Puccinia triticina that may severely reduce durum wheat yield. Resistance to this pathogen is common in modern durum germplasm but is frequently based on Lr72 and Lr14a. After accounts of races with virulence to Lr14a gene in France in 2000, the present study reports the detection in 2013 for the first time of a new race with virulence to Lr14a and Lr72. The aim of this work was to characterize the virulence pattern of four Spanish isolates with virulence to Lr14a, and to discuss the consequences of this presence. Rusted leaves from cultivars ‘Don Jaime’ (Lr14a) and ‘Gallareta’ (Lr72) were collected in 2013 in the field at two Spanish sites, one in the south (near Cadiz) and another in the north (near Girona). Spores from single pustule for each cultivar and site were multiplied on susceptible cultivar ‘Don Rafael’. Then, the four isolates were inoculated on a set of 19 isogenic lines Thatcher to characterize their virulence spectrum. All isolates presented the same virulence pattern. They were virulent on both Lr14a and Lr72 and the race was named DBB/BS. This race was very similar to those reported in 2009-11, but with added virulence to Lr14a. The resistance based on Lr14a has therefore been overcome in Spain, by a new race that has likely emerged via stepwise mutation from the local predominating races. This information is important to guide breeders in their breeding programmes and gene deployment strategies. (Author)

  3. Bulk etch rate of LR-115 cellulose nitrate film

    Harris, M.J.; Schlenker, R.A.

    1977-01-01

    Bulk etch rate (V/sub b/) of Kodak LR-115 cellulose nitrate film has been studied, and values for the parameter are presented. An interesting variability of V/sub b/ has been found which has implications for microdosimetry using this type of integrating nuclear track detector. Short-term and longer-term thickness changes have been observed which may increase the uncertainty in estimations of dose using this type of detector

  4. Effects of Manipulated Above- and Belowground Organic Matter Input on Soil Respiration in a Chinese Pine Plantation

    Zhao, Bo; Wu, Lianhai; Zhang, Chunyu; Zhao, Xiuhai; Gadow, Klaus v.

    2015-01-01

    Alteration in the amount of soil organic matter input can have profound effect on carbon dynamics in forest soils. The objective of our research was to determine the response in soil respiration to above- and belowground organic matter manipulation in a Chinese pine (Pinus tabulaeformis) plantation. Five organic matter treatments were applied during a 2-year experiment: both litter removal and root trenching (LRRT), only litter removal (LR), control (CK), only root trenching (RT) and litter addition (LA). We found that either aboveground litter removal or root trenching decreased soil respiration. On average, soil respiration rate was significantly decreased in the LRRT treatment, by about 38.93% ± 2.01% compared to the control. Soil respiration rate in the LR treatment was 30.65% ± 1.87% and in the RT treatment 17.65% ± 1.95% lower than in the control. Litter addition significantly increased soil respiration rate by about 25.82% ± 2.44% compared to the control. Soil temperature and soil moisture were the main factors affecting seasonal variation in soil respiration. Up to the 59.7% to 82.9% seasonal variation in soil respiration is explained by integrating soil temperature and soil moisture within each of the various organic matter treatments. The temperature sensitivity parameter, Q 10, was higher in the RT (2.72) and LA (3.19) treatments relative to the control (2.51), but lower in the LRRT (1.52) and LR treatments (1.36). Our data suggest that manipulation of soil organic matter input can not only alter soil CO2 efflux, but also have profound effect on the temperature sensitivity of organic carbon decomposition in a temperate pine forest. PMID:25970791

  5. A prospective validation of the IOTA logistic regression models (LR1 and LR2) in comparison to subjective pattern recognition for the diagnosis of ovarian cancer.

    Nunes, Natalie; Ambler, Gareth; Hoo, Wee-Liak; Naftalin, Joel; Foo, Xulin; Widschwendter, Martin; Jurkovic, Davor

    2013-11-01

    This study aimed to assess the accuracy of the International Ovarian Tumour Analysis (IOTA) logistic regression models (LR1 and LR2) and that of subjective pattern recognition (PR) for the diagnosis of ovarian cancer. This was a prospective single-center study in a general gynecology unit of a tertiary hospital during 33 months. There were 292 consecutive women who underwent surgery after an ultrasound diagnosis of an adnexal tumor. All examinations were by a single level 2 ultrasound operator, according to the IOTA guidelines. The malignancy likelihood was calculated using the IOTA LR1 and LR2. The women were then examined separately by an expert operator using subjective PR. These were compared to operative findings and histology. The sensitivity, specificity, area under the curve (AUC), and accuracy of the 3 methods were calculated and compared. The AUCs for LR1 and LR2 were 0.94 [95% confidence interval (CI), 0.92-0.97] and 0.93 (95% CI, 0.90-0.96), respectively. Subjective PR gave a positive likelihood ratio (LR+ve) of 13.9 (95% CI, 7.84-24.6) and a LR-ve of 0.049 (95% CI, 0.022-0.107). The corresponding LR+ve and LR-ve for LR1 were 3.33 (95% CI, 2.85-3.55) and 0.03 (95% CI, 0.01-0.10), and for LR2 were 3.58 (95% CI, 2.77-4.63) and 0.052 (95% CI, 0.022-0.123). The accuracy of PR was 0.942 (95% CI, 0.908-0.966), which was significantly higher when compared with 0.829 (95% CI, 0.781-0.870) for LR1 and 0.836 (95% CI, 0.788-0.872) for LR2 (P IOTA LR1 and LR2 were similar in nonexpert's hands when compared to the original and validation IOTA studies. The PR method was the more accurate test to diagnose ovarian cancer than either of the IOTA models.

  6. Comparative Studies on the pH Dependence of DOW of Microcystin-RR and -LR Using LC-MS

    Gaodao Liang

    2011-01-01

    Full Text Available Microcystins (MCs are well known worldwide as hepatotoxins produced by cyanobacteria, but little is known about the physicochemical properties of these compounds. The dependence of the n-octanol/water distribution ratio (DOW of MC-RR and -LR to pH was measured by high-performance liquid chromatography combined with mass spectrometry (LC-MS. There was a remarkable difference in such relationships between MC-RR and -LR. The log DOW of MC-LR decreased from 1.63 at pH 1.0 to -1.26 at pH 6.5, and stabilized between -1.04 and -1.56 at a pH of 6.5~12.0; log DOW of MC-RR varied between -1.24 and -0.67 at a pH of 1.00~4.00, and stabilized between -1.20 and -1.54 at a pH of 4.00~12.00. The difference of hydrophobicity in acidic condition between MC-RR and -LR is important, not only for the analytical method of both toxins, but perhaps also for understanding the difference of toxicity to animals between the two toxins.

  7. Plant Respiration and Climate Change Effects

    Bruhn, D.

    2002-04-01

    Plant respiration is one of the key processes in terms of an understanding of plant growth and functioning in a future climate. Short- and long-term effects of temperature and CO 2 on plant respiration were investigated in a number of plant species. The experiments tested effects of either temperature and/or CO 2 from the level of individual respiratory enzymes, isolated mitochondria, whole-tissue, and up to the whole canopy level. The short-term effects of elevated atmospheric CO 2 on plant respiration appeared to be less than suggested so far in the literature. This was true both at the tissue level and for intact mitochondria. Respiratory enzymes can, however, be affected already at low CO 2 . These effects did not manifest itself at the tissue level, though, due to low degrees of control on the whole respiratory process exerted by the particular enzymes. Plant respiration on the other hand was affected by long-term growth at elevated atmospheric CO 2 . The findings of the reduced plant respiration at the leaf level were consistent with the literature and potential causes are discussed. Short-term effects of temperature on plant respiration were demonstrated to be dependent on the actual measurement temperature. Further, it is shown that mitochondrial leaf respiration in darkness and light differ substantially in the temperature sensitivity with the former being the far most sensitive. This has implications for modelling CO 2 exchange between vegetation and atmosphere as demonstrated here, since this has so far been neglected. Long-term effects of temperature resulted in respiratory acclimation in a number of species. Respiratory acclimation appeared not to occur to any one single type of growth temperature. The implications of this finding in combination with the timing of acclimation are discussed for modelling respiratory CO 2 release. (au)

  8. Plant Respiration and Climate Change Effects

    Bruhn, D

    2002-04-01

    Plant respiration is one of the key processes in terms of an understanding of plant growth and functioning in a future climate. Short- and long-term effects of temperature and CO{sub 2} on plant respiration were investigated in a number of plant species. The experiments tested effects of either temperature and/or CO{sub 2} from the level of individual respiratory enzymes, isolated mitochondria, whole-tissue, and up to the whole canopy level. The short-term effects of elevated atmospheric CO{sub 2} on plant respiration appeared to be less than suggested so far in the literature. This was true both at the tissue level and for intact mitochondria. Respiratory enzymes can, however, be affected already at low CO{sub 2}. These effects did not manifest itself at the tissue level, though, due to low degrees of control on the whole respiratory process exerted by the particular enzymes. Plant respiration on the other hand was affected by long-term growth at elevated atmospheric CO{sub 2}. The findings of the reduced plant respiration at the leaf level were consistent with the literature and potential causes are discussed. Short-term effects of temperature on plant respiration were demonstrated to be dependent on the actual measurement temperature. Further, it is shown that mitochondrial leaf respiration in darkness and light differ substantially in the temperature sensitivity with the former being the far most sensitive. This has implications for modelling CO{sub 2} exchange between vegetation and atmosphere as demonstrated here, since this has so far been neglected. Long-term effects of temperature resulted in respiratory acclimation in a number of species. Respiratory acclimation appeared not to occur to any one single type of growth temperature. The implications of this finding in combination with the timing of acclimation are discussed for modelling respiratory CO{sub 2} release. (au)

  9. Evaluation of activation detectors for the SPHINX project at the LR-0 experimental reactor

    Lahodova, Zdena; Viererbl, Ladislav; Novak, Evzen; Svadlenkova, Marie; Rypar, Vojtech

    2008-01-01

    This article summarizes the measurements of neutron fluence distributions carried out at the LR-0 research reactor (Czech Republic) in the frame of the SPHINX project. The influence of fluoride-salts or graphite filling in the SR-0 modules on neutron spectrum was studied using activation detectors. The activation detectors (Mn, Ni, In and Au) were evaluated to determine the changes in neutron field. The In and Au detectors were also irradiated with a cadmium cover. Five different configurations of reactor core (EROS) were realized. (authors)

  10. Evaluation of activation detectors for the SPHINX project at the LR-0 experimental reactor

    Lahodova, Zdena; Viererbl, Ladislav [Research Center Rez Ltd (Czech Republic); Novak, Evzen; Svadlenkova, Marie; Rypar, Vojtech [Nuclear Power and Safety Division, Nuclear Research Institute Rez plc (Czech Republic)

    2008-07-01

    This article summarizes the measurements of neutron fluence distributions carried out at the LR-0 research reactor (Czech Republic) in the frame of the SPHINX project. The influence of fluoride-salts or graphite filling in the SR-0 modules on neutron spectrum was studied using activation detectors. The activation detectors (Mn, Ni, In and Au) were evaluated to determine the changes in neutron field. The In and Au detectors were also irradiated with a cadmium cover. Five different configurations of reactor core (EROS) were realized. (authors)

  11. Rod drop in the LR-0 reactor core comprising 55 fuel assemblies

    Hadek, J.; Grundmann, U.

    1989-09-01

    Data from the third stage of kinetic measurements on the LR-0 reactor, performed in 1988, were employed for additional calculations using the 3-dimensional neutron kinetics code HEXDYN3D. The reactor consists of subassemblies similar to those in the WWER-1000 (PWR) reactor. The theoretical and experimental results are compared for the time behavior of the neutron flux caused by drop of the control rod cluster in various subassemblies of the reactor. The results demonstrate that the HEXDYN3D code is well suited to the treatment of the space-time behavior of the neutron flux. (author). 21 figs., 2 tabs., 16 refs

  12. SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

    Mehmet AYBEKE

    2015-12-01

    Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

  13. Respirators. Does your face fit

    Caro, N M; Else, D

    1981-04-01

    The authors carried out a survey of face sizes of men and women of four different ethnic origins and carried out face-seal leakage trials on four corresponding test panels. No single respirator design is likely to fit all members of the workforce, and it may be necessary to stock respirators from more than one manufacturers.Three or four different respirators or size of respirator may be needed. However, the use of lossely-fitting respirators such as Airsteam helmets could remove the necessity for exhaustive fitting procedures.

  14. Adaptive local surface refinement based on LR NURBS and its application to contact

    Zimmermann, Christopher; Sauer, Roger A.

    2017-12-01

    A novel adaptive local surface refinement technique based on Locally Refined Non-Uniform Rational B-Splines (LR NURBS) is presented. LR NURBS can model complex geometries exactly and are the rational extension of LR B-splines. The local representation of the parameter space overcomes the drawback of non-existent local refinement in standard NURBS-based isogeometric analysis. For a convenient embedding into general finite element codes, the Bézier extraction operator for LR NURBS is formulated. An automatic remeshing technique is presented that allows adaptive local refinement and coarsening of LR NURBS. In this work, LR NURBS are applied to contact computations of 3D solids and membranes. For solids, LR NURBS-enriched finite elements are used to discretize the contact surfaces with LR NURBS finite elements, while the rest of the body is discretized by linear Lagrange finite elements. For membranes, the entire surface is discretized by LR NURBS. Various numerical examples are shown, and they demonstrate the benefit of using LR NURBS: Compared to uniform refinement, LR NURBS can achieve high accuracy at lower computational cost.

  15. Dynamics of microcystins-LR and -RR in the phytoplanktivorous silver carp in a sub-chronic toxicity experiment

    Xie Liqiang; Xie Ping; Ozawa, Kazuhiko; Honma, Takamitsu; Yokoyama, Atsushi; Park, Ho-Dong

    2004-01-01

    A sub-chronic toxicity experiment was conducted to examine tissue distribution and depuration of two microcystins (microcystin-LR and microcystin -RR) in the phytoplanktivorous filter-feeding silver carp during a course of 80 days. Two large tanks (A, B) were used, and in Tank A, the fish were fed naturally with fresh Microcystis viridis cells (collected from a eutrophic pond) throughout the experiment, while in Tank B, the food of the fish were M. viridis cells for the first 40 days and then changed to artificial carp feed. High Performance Liquid Chromatography (HPLC) was used to measure MC-LR and MC-RR in the M. viridis cells, the seston, and the intestine, blood, liver and muscle tissue of silver carp at an interval of 20 days. MC-RR and MC-LR in the collected Microcystis cells varied between 268-580 and 110-292 μg g -1 DW, respectively. In Tank A, MC-RR and MC-LR varied between 41.5-99.5 and 6.9-15.8 μg g -1 DW in the seston, respectively. The maximum MC-RR in the blood, liver and muscle of the fish was 49.7, 17.8 and 1.77 μg g -1 DW, respectively. No MC-LR was detectable in the muscle and blood samples of the silver carp in spite of the abundant presence of this toxin in the intestines (for the liver, there was only one case when a relatively minor quantity was detected). These findings contrast with previous experimental results on rainbow trout. Perhaps silver carp has a mechanism to degrade MC-LR actively and to inhibit MC-LR transportation across the intestines. The depuration of MC-RR concentrations occurred slowly than uptakes in blood, liver and muscle, and the depuration rate was in the order of blood>liver>muscle. The grazing ability of silver carp on toxic cyanobacteria suggests an applicability of using phytoplanktivorous fish to counteract cyanotoxin contamination in eutrophic waters. - Silver carp are tolerant of cyanobacterial toxins, and might be used to control toxic algal blooms in highly eutrophic lakes

  16. Effects of different algaecides on the photosynthetic capacity, cell integrity and microcystin-LR release of Microcystis aeruginosa

    Zhou, Shiqing [State Key Laboratory of Pollution Control and Resource Reuse, Tongji University, Shanghai 200092 (China); Shao, Yisheng, E-mail: yishengshao@163.com [State Key Laboratory of Pollution Control and Resource Reuse, Tongji University, Shanghai 200092 (China); China Academy of Urban Planning and Design, Beijing 100037 (China); Gao, Naiyun [State Key Laboratory of Pollution Control and Resource Reuse, Tongji University, Shanghai 200092 (China); Deng, Yang [Department of Earth and Environmental Studies, Montclair State University, Montclair NJ 07043 (United States); Qiao, Junlian; Ou, Huase; Deng, Jing [State Key Laboratory of Pollution Control and Resource Reuse, Tongji University, Shanghai 200092 (China)

    2013-10-01

    Bench scale tests were conducted to study the effects of four common algaecides, including copper sulfate, hydrogen peroxide, diuron and ethyl 2-methylacetoacetate (EMA) on the photosynthetic capacity, cell integrity and microcystin-LR (MC-LR) release of Microcystis aeruginosa. The release of potassium (K{sup +}) from cell membrane during algaecide exposure was also analyzed. The three typical photosynthetic parameters, including the effective quantum yield (φ{sub e}), photosynthetic efficiency (α) and maximal electron transport rate (rETR{sub max}), were measured by a pulse amplitude modulated (PAM) fluorometry. Results showed that the photosynthetic capacity was all inhibited by the four algaecides, to different degrees, by limiting the energy capture in photosynthesis, and blocking the electron transfer chain in primary reaction. For example, at high diuron concentration (7.5 mg L{sup −1}), φ{sub e}, α and rETR{sub max} decreased from 0.46 to 0.19 (p < 0.01), from 0.20 to 0.01 (p < 0.01) μmol electrons m{sup −2} s{sup −1}/μmol photons m{sup −2} s{sup −1}, and from 160.7 to 0.1 (p < 0.001) μmol m{sup −2} s{sup −1} compared with the control group after 96 h of exposure, respectively. Furthermore, the increase of algaecide dose could lead to the cell lysis, as well as release of intracellular MC-LR that enhanced the accumulation of extracellular MC-LR. The order of MC-LR release potential for the four algaecides was CuSO{sub 4} > H{sub 2}O{sub 2} > diuron > EMA. Highlights: • PAM was used to investigate the effects of algaecides on Microcystis aeruginosa. • We estimate the release of potassium (K{sup +}) from cell membrane for cell lysis. • The risk of microcystin-LR release was evaluated after algaecides exposure. • The order of MC-LR release potential was copper sulfate > hydrogen peroxide > diuron > ethyl 2-methylacetoacetate.

  17. Effects of microcystin-LR, cylindrospermopsin and a microcystin-LR/cylindrospermopsin mixture on growth, oxidative stress and mineral content in lettuce plants (Lactuca sativa L.).

    Freitas, Marisa; Azevedo, Joana; Pinto, Edgar; Neves, Joana; Campos, Alexandre; Vasconcelos, Vitor

    2015-06-01

    Toxic cyanobacterial blooms are documented worldwide as an emerging environmental concern. Recent studies support the hypothesis that microcystin-LR (MC-LR) and cylindrospermopsin (CYN) produce toxic effects in crop plants. Lettuce (Lactuca sativa L.) is an important commercial leafy vegetable that supplies essential elements for human nutrition; thus, the study of its sensitivity to MC-LR, CYN and a MC-LR/CYN mixture is of major relevance. This study aimed to assess the effects of environmentally relevant concentrations (1, 10 and 100 µg/L) of MC-LR, CYN and a MC-LR/CYN mixture on growth, antioxidant defense system and mineral content in lettuce plants. In almost all treatments, an increase in root fresh weight was obtained; however, the fresh weight of leaves was significantly decreased in plants exposed to 100 µg/L concentrations of each toxin and the toxin mixture. Overall, GST activity was significantly increased in roots, contrary to GPx activity, which decreased in roots and leaves. The mineral content in lettuce leaves changed due to its exposure to cyanotoxins; in general, the mineral content decreased with MC-LR and increased with CYN, and apparently these effects are time and concentration-dependent. The effects of the MC-LR/CYN mixture were almost always similar to the single cyanotoxins, although MC-LR seems to be more toxic than CYN. Our results suggest that lettuce plants in non-early stages of development are able to cope with lower concentrations of MC-LR, CYN and the MC-LR/CYN mixture; however, higher concentrations (100 µg/L) can affect both lettuce yield and nutritional quality. Copyright © 2015 Elsevier Inc. All rights reserved.

  18. Soil Respiration under Different Land Uses in Eastern China

    Fan, Li-Chao; Yang, Ming-Zhen; Han, Wen-Yan

    2015-01-01

    Land-use change has a crucial influence on soil respiration, which further affects soil nutrient availability and carbon stock. We monitored soil respiration rates under different land-use types (tea gardens with three production levels, adjacent woodland, and a vegetable field) in Eastern China at weekly intervals over a year using the dynamic closed chamber method. The relationship between soil respiration and environmental factors was also evaluated. The soil respiration rate exhibited a remarkable single peak that was highest in July/August and lowest in January. The annual cumulative respiration flux increased by 25.6% and 20.9% in the tea garden with high production (HP) and the vegetable field (VF), respectively, relative to woodland (WL). However, no significant differences were observed between tea gardens with medium production (MP), low production (LP), WL, and VF. Soil respiration rates were significantly and positively correlated with organic carbon, total nitrogen, and available phosphorous content. Each site displayed a significant exponential relationship between soil respiration and soil temperature measured at 5 cm depth, which explained 84–98% of the variation in soil respiration. The model with a combination of soil temperature and moisture was better at predicting the temporal variation of soil respiration rate than the single temperature model for all sites. Q10 was 2.40, 2.00, and 1.86–1.98 for VF, WL, and tea gardens, respectively, indicating that converting WL to VF increased and converting to tea gardens decreased the sensitivity of soil respiration to temperature. The equation of the multiple linear regression showed that identical factors, including soil organic carbon (SOC), soil water content (SWC), pH, and water soluble aluminum (WSAl), drove the changes in soil respiration and Q10 after conversion of land use. Temporal variations of soil respiration were mainly controlled by soil temperature, whereas spatial variations were

  19. [Temperature sensitivity of wheat plant respiration and soil respiration influenced by increased UV-B radiation from elongation to flowering periods].

    Chen, Shu-Tao; Hu, Zheng-Hua; Li, Han-Mao; Ji, Yu-Hong; Yang, Yan-Ping

    2009-05-15

    Field experiment was carried out in the spring of 2008 in order to investigate the effects of increased UV-B radiation on the temperature sensitivity of wheat plant respiration and soil respiration from elongation to flowering periods. Static chamber-gas chromatography method was used to measure ecosystem respiration and soil respiration under 20% UV-B radiation increase and control. Environmental factors such as temperature and moisture were also measured. Results indicated that supplemental UV-B radiation inhibited the ecosystem respiration and soil respiration from wheat elongation to flowering periods, and the inhibition effect was more obvious for soil respiration than for ecosystem respiration. Ecosystem respiration rates, on daily average, were 9%, 9%, 3%, 16% and 30% higher for control than for UV-B treatment forthe five measurement days, while soil respiration rates were 99%, 93%, 106%, 38% and 10% higher for control than for UV-B treatment. The Q10s (temperature sensitivity coefficients) for plant respiration under control and UV-B treatments were 1.79 and 1.59, respectively, while the Q10s for soil respiration were 1.38 and 1.76, respectively. The Q10s for ecosystem respiration were 1.65 and 1.63 under CK and UV-B treatments, respectively. Supplemental UV-B radiation caused a lower Q10 for plant respiration and a higher Q10 for soil respiration, although no significant effect of supplemental UV-B radiation on the Q10 for ecosystem respiration was found.

  20. Interpreting diel hysteresis between soil respiration and temperature

    C. Phillips; N. Nickerson; D. Risk; B.J. Bond

    2011-01-01

    Increasing use of automated soil respiration chambers in recent years has demonstrated complex diel relationships between soil respiration and temperature that are not apparent from less frequent measurements. Soil surface flux is often lagged from soil temperature by several hours, which results in semielliptical hysteresis loops when surface flux is plotted as a...

  1. Soil Respiration and Student Inquiry: A Perfect Match

    Hoyt, Catherine Marie; Wallenstein, Matthew David

    2011-01-01

    This activity explores the cycling of carbon between the atmosphere (primarily as CO[subscript 2]) and biomass in plants, animals, and microscopic organisms. Students design soil respiration experiments using a protocol that resembles current practice in soil ecology. Three methods for measuring soil respiration are presented. Student-derived…

  2. Synthesis of visible light sensitized S, N and C co-doped polymorphic TiO2 for Microcystin-LR MC-LR removal

    Microcystin-LR (MC-LR) is considered as one of the most widespread and toxic cyanotoxins, which had been discovered to be hepatotoxic, cytotoxic and neurotoxic. It is the only cyanotoxin that has been proposed by Word Health Organization (WHO) for a provisional guideline (1 ppb) ...

  3. Overestimation of soil CO2 fluxes from closed chamber measurements at low atmospheric turbulence biases the diurnal pattern and the annual soil respiration budget

    Brændholt, Andreas; Larsen, Klaus Steenberg; Ibrom, Andreas

    2016-01-01

    Abstract Precise quantification of the diurnal and seasonal variation of soil respiration (Rs) is crucial to correctly estimate annual soil carbon fluxes as well as to correctly interpret the response of Rs to biotic and abiotic factors on different time scale. In this study we found a systematic...... day time, i.e. following the course of soil temperatures. This effect on the diurnal pattern was due to low turbulence primarily occurring during night time. We calculated different annual Rs budgets by filtering out fluxes for different levels of u⋆. The highest annual Rs budget was found when...

  4. LR1: a candidate RNA virus of Leishmania.

    Tarr, P I; Aline, R F; Smiley, B L; Scholler, J; Keithly, J; Stuart, K

    1988-01-01

    Although viruses are important biological agents and useful molecular tools, little is known about the viruses of parasites. We report here the discovery of a candidate for an RNA virus in a kinetoplastid parasite. This potential virus, which we term LR1, is present in the promastigote form of the human pathogen Leishmania braziliensis guyanensis CUMC1-1A but not in 11 other stocks of Leishmania that were examined nor in Trypanosoma brucei. The candidate viral RNA has a size of approximately ...

  5. Abnormal mitochondrial respiration in failed human myocardium.

    Sharov, V G; Todor, A V; Silverman, N; Goldstein, S; Sabbah, H N

    2000-12-01

    Chronic heart failure (HF) is associated with morphologic abnormalities of cardiac mitochondria including hyperplasia, reduced organelle size and compromised structural integrity. In this study, we examined whether functional abnormalities of mitochondrial respiration are also present in myocardium of patients with advanced HF. Mitochondrial respiration was examined using a Clark electrode in an oxygraph cell containing saponin-skinned muscle bundles obtained from myocardium of failed explanted human hearts due to ischemic (ICM, n=9) or idiopathic dilated (IDC, n=9) cardiomyopathy. Myocardial specimens from five normal donor hearts served as controls (CON). Basal respiratory rate, respiratory rate after addition of the substrates glutamate and malate (V(SUB)), state 3 respiration (after addition of ADP, V(ADP)) and respiration after the addition of atractyloside (V(AT)) were measured in scar-free muscle bundles obtained from the subendocardial (ENDO) and subepicardial (EPI) thirds of the left ventricular (LV) free wall, interventricular septum and right ventricular (RV) free wall. There were no differences in basal and substrate-supported respiration between CON and HF regardless of etiology. V(ADP)was significantly depressed both in ICM and IDC compared to CON in all the regions studied. The respiratory control ratio, V(ADP)/V(AT), was also significantly decreased in HF compared to CON. In both ICM and IDC, V(ADP)was significantly lower in ENDO compared to EPI. The results indicate that mitochondrial respiration is abnormal in the failing human heart. The findings support the concept of low myocardial energy production in HF via oxidative phosphorylation, an abnormality with a potentially impact on global cardiac performance. Copyright 2000 Academic Press.

  6. Modeling respiration from snags and coarse woody debris before and after an invasive gypsy moth disturbance

    Heidi J. Renninger; Nicholas Carlo; Kenneth L. Clark; Karina V.R. Schäfer

    2014-01-01

    Although snags and coarse woody debris are a small component of ecosystem respiration, disturbances can significantly increase the mass and respiration from these carbon (C) pools. The objectives of this study were to (1) measure respiration rates of snags and coarse woody debris throughout the year in a forest previously defoliated by gypsy moths, (2) develop models...

  7. Foliar and ecosystem respiration in an old-growth tropical rain forest

    Molly A. Cavaleri; Steven F. Oberbauer; Michael G. Ryan

    2008-01-01

    Foliar respiration is a major component of ecosystem respiration, yet extrapolations are often uncertain in tropical forests because of indirect estimates of leaf area index (LAI).A portable tower was used to directly measure LAI and night-time foliar respiration from 52 vertical transects throughout an old-growth tropical rain forest in Costa Rica. In this study, we (...

  8. The wheat resistance gene Lr34 results in the constitutive induction of multiple defense pathways in transgenic barley.

    Chauhan, Harsh; Boni, Rainer; Bucher, Rahel; Kuhn, Benjamin; Buchmann, Gabriele; Sucher, Justine; Selter, Liselotte L; Hensel, Goetz; Kumlehn, Jochen; Bigler, Laurent; Glauser, Gaëtan; Wicker, Thomas; Krattinger, Simon G; Keller, Beat

    2015-10-01

    The wheat gene Lr34 encodes an ABCG-type transporter which provides durable resistance against multiple pathogens. Lr34 is functional as a transgene in barley, but its mode of action has remained largely unknown both in wheat and barley. Here we studied gene expression in uninfected barley lines transgenic for Lr34. Genes from multiple defense pathways contributing to basal and inducible disease resistance were constitutively active in seedlings and mature leaves. In addition, the hormones jasmonic acid and salicylic acid were induced to high levels, and increased levels of lignin as well as hordatines were observed. These results demonstrate a strong, constitutive re-programming of metabolism by Lr34. The resistant Lr34 allele (Lr34res) encodes a protein that differs by two amino acid polymorphisms from the susceptible Lr34sus allele. The deletion of a single phenylalanine residue in Lr34sus was sufficient to induce the characteristic Lr34-based responses. Combination of Lr34res and Lr34sus in the same plant resulted in a reduction of Lr34res expression by 8- to 20-fold when the low-expressing Lr34res line BG8 was used as a parent. Crosses with the high-expressing Lr34res line BG9 resulted in an increase of Lr34sus expression by 13- to 16-fold in progenies that inherited both alleles. These results indicate an interaction of the two Lr34 alleles on the transcriptional level. Reduction of Lr34res expression in BG8 crosses reduced the negative pleiotropic effects of Lr34res on barley growth and vigor without compromising disease resistance, suggesting that transgenic combination of Lr34res and Lr34sus can result in agronomically useful resistance. © 2015 The Authors The Plant Journal © 2015 John Wiley & Sons Ltd.

  9. High performance sulfur, nitrogen and carbon doped mesoporous anatase–brookite TiO2 photocatalyst for the removal of microcystin-LR under visible light irradiation

    El-Sheikh, Said M.; Zhang, Geshan; El-Hosainy, Hamza M.; Ismail, Adel A.; O'Shea, Kevin E.; Falaras, Polycarpos; Kontos, Athanassios G.; Dionysiou, Dionysios D.

    2014-01-01

    Graphical abstract: - Highlights: • Synthesis of tailor-designed C, N and S doped titania anatase–brookite nano-heterojunction photocatalyst. • Microcystin-LR was completely removed in the presence of doped sample under visible light. • The MC-LR degradation rate achieved by the doped sample was much better than that of un-doped sample under visible light. - Abstract: Carbon, nitrogen and sulfur (C, N and S) doped mesoporous anatase–brookite nano-heterojunction titania photocatalysts have been synthesized through a simple sol–gel method in the presence of triblock copolymer Pluronic P123. XRD and Raman spectra revealed the formation of anatase and brookite mixed phases. XPS spectra indicated the presence of C, N and S dopants. The TEM images demonstrated the formation of almost monodisperse titania nanoparticles with particle sizes of approximately 10 nm. N 2 isotherm measurements confirmed that both doped and undoped titania anatase–brookite materials have mesoporous structure. The photocatalytic degradation of the cyanotoxin microcystin-LR (MC-LR) has been investigated using these novel nanomaterials under visible light illumination. The photocatalytic efficiency of the mesoporous titania anatase–brookite photocatalyst dramatically increased with the addition of the C, N and S non-metal, achieving complete degradation (∼100%) of MC-LR. The results demonstrate the advantages of the synthetic approach and the great potential of the visible light activated C, N, and S doped titania photocatalysts for the treatment of organic micropollutants in contaminated waters under visible light

  10. Laboratory studies of dissolved radiolabelled microcystin-LR in lake water

    Hyenstrand, Per; Rohrlack, Thomas; Beattie, Kenneth A

    2003-01-01

    The fate of dissolved microcystin-LR was studied in laboratory experiments using surface water taken from a eutrophic lake. Based on initial range finding, a concentration of 50 microg l(-1) dissolved 14C-microcystin-LR was selected for subsequent time-course experiments. The first was performed ...... fractions. The study demonstrated that biodegradation of dissolved microcystin-LR occurred in water collected at a lake surface with carbon dioxide as a major end-product....

  11. Comprehensive insights into microcystin-LR effects on hepatic lipid metabolism using cross-omics technologies

    Zhang, Zongyao; Zhang, Xu-Xiang; Wu, Bing; Yin, Jinbao; Yu, Yunjiang; Yang, Liuyan

    2016-01-01

    Highlights: • Use of cross-omics technologies to evaluate toxic effects of microcystin-LR. • Disturbance of hepatic lipid metabolism by oral exposure to microcystin-LR. • Crucial roles of gut microbial community shift in the metabolic disturbance induced by microcystin-LR. - Abstract: Microcystin-LR (MC-LR) can induce hepatic tissue damages and molecular toxicities, but its effects on lipid metabolism remain unknown. This study investigated the effects of MC-LR exposure on mice lipid metabolism and uncovered the underlying mechanism through metabonomic, transcriptomic and metagenomic analyses after administration of mice with MC-LR by gavage for 28 d. Increased liver weight and abdominal fat weight, and evident hepatic lipid vacuoles accumulation were observed in the mice fed with 0.2 mg/kg/d MC-LR. Serum nuclear magnetic resonance analysis showed that MC-LR treatment altered the levels of serum metabolites including triglyceride, unsaturated fatty acid (UFA) and very low density lipoprotein. Digital Gene Expression technology was used to reveal differential expression of hepatic transcriptomes, demonstrating that MC-LR treatment disturbed hepatic UFA biosynthesis and activated peroxisome proliferator-activated receptor (PPAR) signaling pathways via Pparγ, Fabp1 and Fabp2 over-expression. Metagenomic analyses of gut microbiota revealed that MC-LR exposure also increased abundant ratio of Firmicutes vs. Bacteroidetes in gut and altered biosynthetic pathways of various microbial metabolic and pro-inflammatory molecules. In conclusion, oral MC-LR exposure can induce hepatic lipid metabolism disorder mediated by UFA biosynthesis and PPAR activation, and gut microbial community shift may play an important role in the metabolic disturbance.

  12. Comprehensive insights into microcystin-LR effects on hepatic lipid metabolism using cross-omics technologies

    Zhang, Zongyao [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023 (China); Center for Environmental Health Research, South China Institute of Environmental Sciences, The Ministry of Environmental Protection of PRC, Guangzhou 510655 (China); Zhang, Xu-Xiang, E-mail: zhangxx@nju.edu.cn [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023 (China); Wu, Bing; Yin, Jinbao [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023 (China); Yu, Yunjiang [Center for Environmental Health Research, South China Institute of Environmental Sciences, The Ministry of Environmental Protection of PRC, Guangzhou 510655 (China); Yang, Liuyan, E-mail: yangly@nju.edu.cn [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023 (China)

    2016-09-05

    Highlights: • Use of cross-omics technologies to evaluate toxic effects of microcystin-LR. • Disturbance of hepatic lipid metabolism by oral exposure to microcystin-LR. • Crucial roles of gut microbial community shift in the metabolic disturbance induced by microcystin-LR. - Abstract: Microcystin-LR (MC-LR) can induce hepatic tissue damages and molecular toxicities, but its effects on lipid metabolism remain unknown. This study investigated the effects of MC-LR exposure on mice lipid metabolism and uncovered the underlying mechanism through metabonomic, transcriptomic and metagenomic analyses after administration of mice with MC-LR by gavage for 28 d. Increased liver weight and abdominal fat weight, and evident hepatic lipid vacuoles accumulation were observed in the mice fed with 0.2 mg/kg/d MC-LR. Serum nuclear magnetic resonance analysis showed that MC-LR treatment altered the levels of serum metabolites including triglyceride, unsaturated fatty acid (UFA) and very low density lipoprotein. Digital Gene Expression technology was used to reveal differential expression of hepatic transcriptomes, demonstrating that MC-LR treatment disturbed hepatic UFA biosynthesis and activated peroxisome proliferator-activated receptor (PPAR) signaling pathways via Pparγ, Fabp1 and Fabp2 over-expression. Metagenomic analyses of gut microbiota revealed that MC-LR exposure also increased abundant ratio of Firmicutes vs. Bacteroidetes in gut and altered biosynthetic pathways of various microbial metabolic and pro-inflammatory molecules. In conclusion, oral MC-LR exposure can induce hepatic lipid metabolism disorder mediated by UFA biosynthesis and PPAR activation, and gut microbial community shift may play an important role in the metabolic disturbance.

  13. Photocatalytic Cellulosic Electrospun Fibers for the Degradation of Potent Cyanobacteria Toxin Microcystin-LR

    2012-01-01

    visible light activated or UV light activated), the surface area of the fiber mat, and loading solution pH all have an effect on the distribution of...photocatalysis with nanoparticles (such as titania, TiO2 ) show tremendous promise as a simple and energy efficient tech- nology for water purification and...LR (MC-LR). MC- LR is one of the most commonly found cyanobacteria toxins generated by the more frequently occurring cyanobacteria algae blooms in

  14. Using eddy covariance of CO2, 13CO2 and CH4, continuous soil respiration measurements, and PhenoCams to constrain a process-based biogeochemical model for carbon market-funded wetland restoration

    Oikawa, P. Y.; Baldocchi, D. D.; Knox, S. H.; Sturtevant, C. S.; Verfaillie, J. G.; Dronova, I.; Jenerette, D.; Poindexter, C.; Huang, Y. W.

    2015-12-01

    We use multiple data streams in a model-data fusion approach to reduce uncertainty in predicting CO2 and CH4 exchange in drained and flooded peatlands. Drained peatlands in the Sacramento-San Joaquin River Delta, California are a strong source of CO2 to the atmosphere and flooded peatlands or wetlands are a strong CO2 sink. However, wetlands are also large sources of CH4 that can offset the greenhouse gas mitigation potential of wetland restoration. Reducing uncertainty in model predictions of annual CO2 and CH4 budgets is critical for including wetland restoration in Cap-and-Trade programs. We have developed and parameterized the Peatland Ecosystem Photosynthesis, Respiration, and Methane Transport model (PEPRMT) in a drained agricultural peatland and a restored wetland. Both ecosystem respiration (Reco) and CH4 production are a function of 2 soil carbon (C) pools (i.e. recently-fixed C and soil organic C), temperature, and water table height. Photosynthesis is predicted using a light use efficiency model. To estimate parameters we use a Markov Chain Monte Carlo approach with an adaptive Metropolis-Hastings algorithm. Multiple data streams are used to constrain model parameters including eddy covariance of CO2, 13CO2 and CH4, continuous soil respiration measurements and digital photography. Digital photography is used to estimate leaf area index, an important input variable for the photosynthesis model. Soil respiration and 13CO2 fluxes allow partitioning of eddy covariance data between Reco and photosynthesis. Partitioned fluxes of CO2 with associated uncertainty are used to parametrize the Reco and photosynthesis models within PEPRMT. Overall, PEPRMT model performance is high. For example, we observe high data-model agreement between modeled and observed partitioned Reco (r2 = 0.68; slope = 1; RMSE = 0.59 g C-CO2 m-2 d-1). Model validation demonstrated the model's ability to accurately predict annual budgets of CO2 and CH4 in a wetland system (within 14% and 1

  15. Geochemical importance of isotopic fractionation during respiration

    Schleser, G.; Foerstel, H.

    1975-01-01

    In 1935 it was found that atmospheric oxygen contained a relatively greater abundance of the 18 O isotope than did the oxygen bound in water (Dole effect). A major contribution to the fractionation of the stable oxygen isotopes should result from the respiration of microorganisms. In this respect our interest centers on the soil because nearly all organic material produced on land is decomposed within the soil. The oceans are less important because the primary productivity on land is twice the value for the oceans. In a first approach we measured the oxygen isotope fractionation during the respiration of E. coli K12 for different respiration rates. These results, accomplished with a chemostat, indicate that the fractionation factor α of the oxygen isotopes increases with the increasing respiratory activity, measured as Q/sub O 2 /. At low dilution rates or growth rates respectively of about 0.05 h -1 , the fractionation factor amounts to 1.006 increasing to 1.017 at dilution rates of about 1.0 h -1 . The results are interpreted as a kinetic mass fractionation due to the slightly different diffusion coefficients of 16 O 2 and 18 O 16 O. The respiration rates in conjunction with the corresponding fractionation data are compared with the respiration rates of typical soil microorganisms such as Azotobacter, in order to deduce fractionation data for these organisms. This is necessary to calculate a mean global fractionation factor. Understanding the Dole effect with these fractionation processes should finally give us the opportunity to calculate gas-exchange rates between the atmosphere and the oceans, on the basis of the behavior of the stable oxygen isotopes

  16. Jumping spark evaluation of α-radiograms taken on strippable LR-115 film

    Somogyi, G.; Hunyadi, I.; Varga, Zs.

    1978-01-01

    Jumping spark counting was used for the automatic measurement of α-ray tracks on Kodak Pathe LR-115 type special cellulose nitrate films. The effect of temperature and interruptions on the etching rate was observed during the etching of the α track detectors. The recommended parameters for the etching are the following: 10% NaOH solution, 60 +- 0.1 deg C, 1.5 h etching time, 20 rotations/min. The final thickness is 6-7 μm. The counting efficiency of the jumping spark evaluation in the function of the track density and the α energy was carefully studied. The angular distribution of the α particles from the Al(p, α) 24 Mg reaction was determined. This method can be effectively used for the measurement of environmental α activity as for 222 Rn release from 226 Ra. (V.N.)

  17. [Effects of management regime on soil respiration from agroecosystems].

    Chen, Shu-tao; Zhu, Da-wei; Niu, Chuan-po; Zou, Jian-wen; Wang, Chao; Sun, Wen-juan

    2009-10-15

    In order to examine the effects of management regime, such as nitrogen application and plowing method, on soil respiration from farmland, the static opaque chamber-gas chromatograph method was used to measure soil CO2 fluxes in situ. The field measurement was carried out for 5 growing seasons, which were the 2002-2003 wheat, 2003 maize and soybean, 2003-2004 wheat, 2004 maize and 2004-2005 wheat seasons. Our results showed that soil respiration increased in fertilizer-applied treatments compared with no fertilizer treatment after 3 times of fertilizer application on 9 November 2002, 14 February and 26 March 2003. And the most obvious increase appeared following the third fertilizer application. No significant difference in soil respiration was found among several fertilizer application treatments. The effect of plowing depth on soil respiration was contingent on preceding cropping practice. Over the 2003-2004 wheat-growing seasons (its preceding cropping practice was rice paddy), mean soil respiration rates were not significant different (p > 0.05) between no plowing treatment and shallow plowing treatment. The shallow plowing treatment CT2 led to higher soil CO2 losses compared with no plowing treatment of NT2 in the 2004 maize-growing season, however, the significant higher (p soil respiration rates occurred with no plowing treatment of NT3 in the following 2004-2005 wheat-growing season. Intensive plowing (25 cm depth), compared with no plowing practice (NT4), increased soil respiration significantly during the 2004-2005 wheat-growing season. Regression analysis showed that the exponential function could be employed to fit the relationship between soil respiration and temperature. The exponential relationship yielded the Q10 values which were varied from 1.26 to 3.60, with a mean value of 2.08. To evaluate the effect of temperature on soil respiration, the CO2 emission fluxes were normalized for each treatment and each crop growing season. Plotting the

  18. Occupational Exposure to Respirable Dust, Respirable Crystalline Silica and Diesel Engine Exhaust Emissions in the London Tunnelling Environment.

    Galea, Karen S; Mair, Craig; Alexander, Carla; de Vocht, Frank; van Tongeren, Martie

    2016-03-01

    Personal 8-h shift exposure to respirable dust, diesel engine exhaust emissions (DEEE) (as respirable elemental carbon), and respirable crystalline silica of workers involved in constructing an underground metro railway tunnel was assessed. Black carbon (BC) concentrations were also assessed using a MicroAeth AE51. During sprayed concrete lining (SCL) activities in the tunnel, the geometric mean (GM) respirable dust exposure level was 0.91mg m(-3), with the highest exposure measured on a back-up sprayer (3.20mg m(-3)). The GM respirable crystalline silica concentration for SCL workers was 0.03mg m(-3), with the highest measurement also for the back-up sprayer (0.24mg m(-3)). During tunnel boring machine (TBM) activities, the GM respirable dust concentration was 0.54mg m(-3). The GM respirable elemental carbon concentration for all the TBM operators was 18 µg m(-3); with the highest concentration measured on a segment lifter. The BC concentrations were higher in the SCL environment in comparison to the TBM environment (daily GM 18-54 µg m(-3) versus 3-6 µg m(-3)). This small-scale monitoring campaign provides additional personal data on exposures experienced by underground tunnel construction workers. © The Author 2015. Published by Oxford University Press on behalf of the British Occupational Hygiene Society.

  19. [Special artificial respiration procedures and intracranial pressure. Animal experiment studies, development and use of a new pressure measuring technic, clinical aspects].

    Schedl, R

    1985-01-01

    We investigated the influence of Forced Diffusion Ventilation (FDV), a special form of High Frequency Ventilation (HFV), on elevated intracranial pressure (ICP) in 5 dogs. Elevation of ICP was standardized by inflation of an epidural balloon. A typical finding with FDV is a reduced intrapleural pressure and therefore one could expect a better cerebrovenous drainage influencing ICP. Nevertheless, we found no changes in mean ICP under conditions of FDV compared with IPPV. Respirator-synchronous fluctuations of ICP, cisternal cerebrospinal fluid pressure and intrapleural pressure were drastically reduced with FDV. This phenomenon has been already reported by other groups as a typical effect of HFV with rates of 100/min. One can speculate, that this immediate impact of HFV on ICP-curves might be of some advantage in patients with critically reduced intracranial compliance requiring long-term artificial ventilation, because peaks and amplitudes of ICP are reduced. Our clinical experience with High Frequency Pulsation (HFP) includes 11 patients with severe brain trauma. In clinical routine this method of HFV is more facile to applicate than FDV, because there is no need of a special endotracheal tube and sufficient CO2-elimination is not strongly dependent on precise position of the tube. But HFP, as FDV, includes all advantages of respiratory systems, that are open against atmosphere (coughing and simultaneous breathing, without drastically increasing airway pressure, suction during respiration, etc.). However, we could find no special advantages or disadvantages in ICP-course during long-term application of HFP (up to 10 days). Because application of HFV is dependent on special technical equipment, we investigated in 6 patients the influence of respiratory frequency, tidal volume and inspiratory flow on ICP-fluctuations using conventional ventilators. ICP was recorded by a new, self constructed pneumatic epidural pressure sensor. Ventilator-related ICP

  20. The wheat Lr34 multipathogen resistance gene confers resistance to anthracnose and rust in sorghum.

    Schnippenkoetter, Wendelin; Lo, Clive; Liu, Guoquan; Dibley, Katherine; Chan, Wai Lung; White, Jodie; Milne, Ricky; Zwart, Alexander; Kwong, Eunjung; Keller, Beat; Godwin, Ian; Krattinger, Simon G; Lagudah, Evans

    2017-11-01

    The ability of the wheat Lr34 multipathogen resistance gene (Lr34res) to function across a wide taxonomic boundary was investigated in transgenic Sorghum bicolor. Increased resistance to sorghum rust and anthracnose disease symptoms following infection with the biotrophic pathogen Puccinia purpurea and the hemibiotroph Colletotrichum sublineolum, respectively, occurred in transgenic plants expressing the Lr34res ABC transporter. Transgenic sorghum lines that highly expressed the wheat Lr34res gene exhibited immunity to sorghum rust compared to the low-expressing single copy Lr34res genotype that conferred partial resistance. Pathogen-induced pigmentation mediated by flavonoid phytoalexins was evident on transgenic sorghum leaves following P. purpurea infection within 24-72 h, which paralleled Lr34res gene expression. Elevated expression of flavone synthase II, flavanone 4-reductase and dihydroflavonol reductase genes which control the biosynthesis of flavonoid phytoalexins characterized the highly expressing Lr34res transgenic lines 24-h post-inoculation with P. purpurea. Metabolite analysis of mesocotyls infected with C. sublineolum showed increased levels of 3-deoxyanthocyanidin metabolites were associated with Lr34res expression, concomitant with reduced symptoms of anthracnose. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  1. Roles of miRNAs in microcystin-LR-induced Sertoli cell toxicity

    Zhou, Yuan [Immunology and Reproduction Biology Laboratory & State Key Laboratory of Analytical Chemistry for Life Science, Medical School, Nanjing University, Nanjing, Jiangsu 210093 (China); Jiangsu Key Laboratory of Molecular Medicine, Nanjing University, Nanjing, Jiangsu 210093 (China); Wang, Hui [The Centre for Individualized Medication, Linköping University Hospital, Linköping University, Linköping SE-58185 (Sweden); Wang, Cong [Immunology and Reproduction Biology Laboratory & State Key Laboratory of Analytical Chemistry for Life Science, Medical School, Nanjing University, Nanjing, Jiangsu 210093 (China); Jiangsu Key Laboratory of Molecular Medicine, Nanjing University, Nanjing, Jiangsu 210093 (China); Qiu, Xuefeng [Department of Urology, Affiliated Drum Tower Hospital, School of Medicine, Nanjing University, Nanjing 210008 (China); Benson, Mikael [The Centre for Individualized Medication, Linköping University Hospital, Linköping University, Linköping SE-58185 (Sweden); Yin, Xiaoqin [Immunology and Reproduction Biology Laboratory & State Key Laboratory of Analytical Chemistry for Life Science, Medical School, Nanjing University, Nanjing, Jiangsu 210093 (China); Jiangsu Key Laboratory of Molecular Medicine, Nanjing University, Nanjing, Jiangsu 210093 (China); Xiang, Zou [Department of Microbiology and Immunology, Mucosal Immunobiology and Vaccine Research Center, Institute of Biomedicine, University of Gothenburg, Gothenburg (Sweden); Li, Dongmei, E-mail: lidm@nju.edu.cn [Immunology and Reproduction Biology Laboratory & State Key Laboratory of Analytical Chemistry for Life Science, Medical School, Nanjing University, Nanjing, Jiangsu 210093 (China); Jiangsu Key Laboratory of Molecular Medicine, Nanjing University, Nanjing, Jiangsu 210093 (China); and others

    2015-08-15

    Microcystin (MC)-LR, a cyclic heptapeptide, is a potent reproductive system toxin. To understand the molecular mechanisms of MC-induced reproductive system cytotoxicity, we evaluated global changes of miRNA and mRNA expression in mouse Sertoli cells following MC-LR treatment. Our results revealed that the exposure to MC-LR resulted in an altered miRNA expression profile that might be responsible for the modulation of mRNA expression. Bio-functional analysis indicated that the altered genes were involved in specific cellular processes, including cell death and proliferation. Target gene analysis suggested that junction injury in Sertoli cells exposed to MC-LR might be mediated by miRNAs through the regulation of the Sertoli cell-Sertoli cell pathway. Collectively, these findings may enhance our understanding on the modes of action of MC-LR on mouse Sertoli cells as well as the molecular mechanisms underlying the toxicity of MC-LR on the male reproductive system. - Highlights: • miRNAs were altered in Sertoli cells exposed to MC-LR. • Alerted genes were involved in different cell functions including the cell morphology. • MC-LR adversely affected Sertoli cell junction formation through the regulating miRNAs.

  2. A MEMS turbine prototype for respiration harvesting

    Goreke, U.; Habibiabad, S.; Azgin, K.; Beyaz, M. I.

    2015-12-01

    The design, manufacturing, and performance characterization of a MEMS-scale turbine prototype is reported. The turbine is designed for integration into a respiration harvester that can convert normal human breathing into electrical power through electromagnetic induction. The device measures 10 mm in radius, and employs 12 blades located around the turbine periphery along with ball bearings around the center. Finite element simulations showed that an average torque of 3.07 μNm is induced at 12 lpm airflow rate, which lies in normal breathing levels. The turbine and a test package were manufactured using CNC milling on PMMA. Tests were performed at respiration flow rates between 5-25 lpm. The highest rotational speed was measured to be 9.84 krpm at 25 lpm, resulting in 8.96 mbar pressure drop across the device and 370 mW actuation power.

  3. Validity of the MMPI-2-RF (Restructured Form) L-r and K-r Scales in Detecting Underreporting in Clinical and Nonclinical Samples

    Sellbom, Martin; Bagby, R. Michael

    2008-01-01

    In the current investigation, the authors examined the validity of the L-r and K-r scales on the recently developed Minnesota Multiphasic Personality Inventory-2-Restructured Form (MMPI-2-RF; Y. S. Ben-Porath & A. Tellegen, in press) in measuring underreported response bias. Three archival samples previously collected for examining MMPI-2…

  4. Two Proximal Skin Electrodes — A Respiration Rate Body Sensor

    Viktor Avbelj

    2012-10-01

    Full Text Available We propose a new body sensor for extracting the respiration rate based on the amplitude changes in the body surface potential differences between two proximal body electrodes. The sensor could be designed as a plaster-like reusable unit that can be easily fixed onto the surface of the body. It could be equipped either with a sufficiently large memory for storing the measured data or with a low-power radio system that can transmit the measured data to a gateway for further processing. We explore the influence of the sensor’s position on the quality of the extracted results using multi-channel ECG measurements and considering all the pairs of two neighboring electrodes as potential respiration-rate sensors. The analysis of the clinical measurements, which also include reference thermistor-based respiration signals, shows that the proposed approach is a viable option for monitoring the respiration frequency and for a rough classification of breathing types. The obtained results were evaluated on a wireless prototype of a respiration body sensor. We indicate the best positions for the respiration body sensor and prove that a single sensor for body surface potential difference on proximal skin electrodes can be used for combined measurements of respiratory and cardiac activities.

  5. Root Zone Respiration on Hydroponically Grown Wheat Plant Systems

    Soler-Crespo, R. A.; Monje, O. A.

    2010-01-01

    Root respiration is a biological phenomenon that controls plant growth and physiological development during a plant's lifespan. This process is dependent on the availability of oxygen in the system where the plant is located. In hydroponic systems, where plants are submerged in a solution containing vital nutrients but no type of soil, the availability of oxygen arises from the dissolved oxygen concentration in the solution. This oxygen concentration is dependent on the , gas-liquid interface formed on the upper surface of the liquid, as given by Henry's Law, depending on pressure and temperature conditions. Respiration rates of the plants rise as biomass and root zone increase with age. The respiration rate of Apogee wheat plants (Triticum aestivum) was measured as a function of light intensity (catalytic for photosynthesis) and CO2 concentration to determine their effect on respiration rates. To determine their effects on respiration rate and plant growth microbial communities were introduced into the system, by Innoculum. Surfactants were introduced, simulating gray-water usage in space, as another factor to determine their effect on chemical oxygen demand of microbials and on respiration rates of the plants. It is expected to see small effects from changes in CO2 concentration or light levels, and to see root respiration decrease in an exponential manner with plant age and microbial activity.

  6. Respiration in spiders (Araneae).

    Schmitz, Anke

    2016-05-01

    Spiders (Araneae) are unique regarding their respiratory system: they are the only animal group that breathe simultaneously with lungs and tracheae. Looking at the physiology of respiration the existence of tracheae plays an important role in spiders with a well-developed tracheal system. Other factors as sex, life time, type of prey capture and the high ability to gain energy anaerobically influence the resting and the active metabolic rate intensely. Most spiders have metabolic rates that are much lower than expected from body mass; but especially those with two pairs of lungs. Males normally have higher resting rates than females; spiders that are less evolved and possess a cribellum have lower metabolic rates than higher evolved species. Freely hunting spiders show a higher energy turnover than spiders hunting with a web. Spiders that live longer than 1 year will have lower metabolic rates than those species that die after 1 year in which development and reproduction must be completed. Lower temperatures and starvation, which most spiders can cope with, will decrease the metabolic rate as well.

  7. Global spatiotemporal distribution of soil respiration modeled using a global database

    Hashimoto, S.; Carvalhais, N.; Ito, A.; Migliavacca, M.; Nishina, K.; Reichstein, M.

    2015-07-01

    The flux of carbon dioxide from the soil to the atmosphere (soil respiration) is one of the major fluxes in the global carbon cycle. At present, the accumulated field observation data cover a wide range of geographical locations and climate conditions. However, there are still large uncertainties in the magnitude and spatiotemporal variation of global soil respiration. Using a global soil respiration data set, we developed a climate-driven model of soil respiration by modifying and updating Raich's model, and the global spatiotemporal distribution of soil respiration was examined using this model. The model was applied at a spatial resolution of 0.5°and a monthly time step. Soil respiration was divided into the heterotrophic and autotrophic components of respiration using an empirical model. The estimated mean annual global soil respiration was 91 Pg C yr-1 (between 1965 and 2012; Monte Carlo 95 % confidence interval: 87-95 Pg C yr-1) and increased at the rate of 0.09 Pg C yr-2. The contribution of soil respiration from boreal regions to the total increase in global soil respiration was on the same order of magnitude as that of tropical and temperate regions, despite a lower absolute magnitude of soil respiration in boreal regions. The estimated annual global heterotrophic respiration and global autotrophic respiration were 51 and 40 Pg C yr-1, respectively. The global soil respiration responded to the increase in air temperature at the rate of 3.3 Pg C yr-1 °C-1, and Q10 = 1.4. Our study scaled up observed soil respiration values from field measurements to estimate global soil respiration and provide a data-oriented estimate of global soil respiration. The estimates are based on a semi-empirical model parameterized with over one thousand data points. Our analysis indicates that the climate controls on soil respiration may translate into an increasing trend in global soil respiration and our analysis emphasizes the relevance of the soil carbon flux from soil to

  8. Soil respiration is stimulated by elevated CO2 and reduced by summer drought: three years of measurements in a multifactor ecosystem manipulation experiment in a temperate heathland (CLIMAITE)

    Selsted, Merete Bang; van der Linden, Leon; Ibrom, Andreas

    2012-01-01

    This study investigated the impact of predicted future climatic and atmospheric conditions on soil respiration (RS) in a Danish Calluna‐Deschampsia‐heathland. A fully factorial in situ experiment with treatments of elevated atmospheric CO2 (+130 ppm), raised soil temperature (+0.4 °C) and extended...... summer drought (5–8% precipitation exclusion) was established in 2005. The average RS, observed in the control over 3 years of measurements (1.7 μmol CO2 m−2 sec−1), increased 38% under elevated CO2, irrespective of combination with the drought or temperature treatments. In contrast, extended summer...... due to reduced plant growth or changes in soil water holding capacity. An empirical model that predicts RS from soil temperature, soil moisture and plant biomass was developed and accounted for 55% of the observed variability in RS. The model predicted annual sums of RS in 2006 and 2007...

  9. Controls on Ecosystem and Root Respiration in an Alaskan Peatland

    McConnell, N. A.; McGuire, A. D.; Harden, J. W.; Kane, E. S.; Turetsky, M. R.

    2010-12-01

    Boreal ecosystems cover 14% of the vegetated surface on earth and account for 25-30% of the world’s soil carbon (C), mainly due to large carbon stocks in deep peat and frozen soil layers. While peatlands have served as historical sinks of carbon, global climate change may trigger re-release of C to the atmosphere and may turn these ecosystems into net C sources. Rates of C release from a peatland are determined by regional climate and local biotic and abiotic factors such as vegetation cover, thaw depth, and peat thickness. Soil CO2 fluxes are driven by both autotrophic (plant) respiration and heterotrophic (microbial) respiration. Thus, changes in plant and microbial activity in the soil will impact CO2 emissions from peatlands. In this study, we explored environmental and vegetation controls on ecosystem respiration and root respiration in a variety of wetland sites. The study was conducted at the Alaskan Peatland Experiment (APEX; www.uoguelph.ca/APEX) sites in the Bonanza Creek Experimental Forest located 35 km southwest of Fairbanks Alaska. We measured ecosystem respiration, root respiration, and monitored a suite of environmental variables along a vegetation and soil moisture gradient including a black spruce stand with permafrost, a shrubby site with permafrost, a tussock grass site, and a herbaceous open rich fen. Within the rich fen, we have been conducting water table manipulations including a control, lowered, and raised water table treatment. In each of our sites, we measured total ecosystem respiration using static chambers and root respiration by harvesting roots from the uppermost 20 cm and placing them in a root cuvette to obtain a root flux. Ecosystem respiration (ER) on a μmol/m2/sec basis varied across sites. Water table was a significant predictor of ER at the lowered manipulation site and temperature was a strong predictor at the control site in the rich fen. Water table and temperature were both significant predictors of ER at the raised

  10. Respirable versus inhalable dust sampling

    Hondros, J.

    1987-01-01

    The ICRP uses a total inhalable dust figure as the basis of calculations on employee lung dose. This paper was written to look at one aspect of the Olympic Dam dust situation, namely, the inhalable versus respirable fraction of the dust cloud. The results of this study will determine whether it is possible to use respirable dust figures, as obtained during routine monitoring to help in the calculations of employee exposure to internal radioactive contaminants

  11. Temperature response of soil respiration largely unaltered with experimental warming

    Carey, Joanna C.; Tang, Jianwu; Templer, Pamela H.; Kroeger, Kevin D.; Crowther, Thomas W.; Burton, Andrew J.; Dukes, Jeffrey S.; Emmett, Bridget; Frey, Serita D.; Heskel, Mary A.; Jiang, Lifen; Machmuller, Megan B.; Mohan, Jacqueline; Panetta, Anne Marie; Reich, Peter B.; Reinsch, Sabine; Wang, Xin; Allison, Steven D.; Bamminger, Chris; Bridgham, Scott; Collins, Scott L.; de Dato, Giovanbattista; Eddy, William C.; Enquist, Brian J.; Estiarte, Marc; Harte, John; Henderson, Amanda; Johnson, Bart R.; Steenberg Larsen, Klaus; Luo, Yiqi; Marhan, Sven; Melillo, Jerry M.; Penuelas, Josep; Pfeifer-Meister, Laurel; Poll, Christian; Rastetter, Edward B.; Reinmann, Andrew B.; Reynolds, Lorien L.; Schmidt, Inger K.; Shaver, Gaius R.; Strong, Aaron L.; Suseela, Vidya; Tietema, Albert

    2016-01-01

    The respiratory release of carbon dioxide (CO2) from soil is a major yet poorly understood flux in the global carbon cycle. Climatic warming is hypothesized to increase rates of soil respiration, potentially fueling further increases in global temperatures. However, despite considerable scientific attention in recent decades, the overall response of soil respiration to anticipated climatic warming remains unclear. We synthesize the largest global dataset to date of soil respiration, moisture, and temperature measurements, totaling >3,800 observations representing 27 temperature manipulation studies, spanning nine biomes and over 2 decades of warming. Our analysis reveals no significant differences in the temperature sensitivity of soil respiration between control and warmed plots in all biomes, with the exception of deserts and boreal forests. Thus, our data provide limited evidence of acclimation of soil respiration to experimental warming in several major biome types, contrary to the results from multiple single-site studies. Moreover, across all nondesert biomes, respiration rates with and without experimental warming follow a Gaussian response, increasing with soil temperature up to a threshold of ∼25 °C, above which respiration rates decrease with further increases in temperature. This consistent decrease in temperature sensitivity at higher temperatures demonstrates that rising global temperatures may result in regionally variable responses in soil respiration, with colder climates being considerably more responsive to increased ambient temperatures compared with warmer regions. Our analysis adds a unique cross-biome perspective on the temperature response of soil respiration, information critical to improving our mechanistic understanding of how soil carbon dynamics change with climatic warming.

  12. Changes in mitochondrial respiration in the human placenta over gestation.

    Holland, Olivia J; Hickey, Anthony J R; Alvsaker, Anna; Moran, Stephanie; Hedges, Christopher; Chamley, Lawrence W; Perkins, Anthony V

    2017-09-01

    Placental mitochondria are subjected to micro-environmental changes throughout gestation, in particular large variations in oxygen. How placental mitochondrial respiration adapts to changing oxygen concentrations remains unexplored. Additionally, placental tissue is often studied in culture; however, the effect of culture on placental mitochondria is unclear. Placental tissue was obtained from first trimester and term (laboured and non-laboured) pregnancies, and selectively permeabilized to access mitochondria. Respirometry was used to compare respiration states and substrate use in mitochondria. Additionally, explants of placental tissue were cultured for four, 12, 24, 48, or 96 h and respiration measured. Mitochondrial respiration decreased at 11 weeks compared to earlier gestations (p = 0.05-0.001), and mitochondrial content increased at 12-13 weeks compared to 7-10 weeks (p = 0.042). In term placentae, oxidative phosphorylation (OXPHOS) through mitochondrial complex IV (p Respiration was increased (p ≤ 0.006-0.001) in laboured compared to non-laboured placenta. After four hours of culture, respiration was depressed compared to fresh tissue from the same placenta and continued to decline with time in culture. Markers of apoptosis were increased, while markers of autophagy, mitochondrial biogenesis, and mitochondrial membrane potential were decreased after four hours of culture. Respiration and mitochondrial content alter over gestation/with labour. Decreased respiration at 11 weeks and increased mitochondrial content at 12-13 weeks may relate to onset of maternal blood flow, and increased respiration as a result of labour may be an adaptation to ischaemia-reperfusion. At term, mitochondria were more susceptible to changes in respiratory function relative to first trimester when cultured in vitro, perhaps reflecting changes in metabolic demands as gestation progresses. Metabolic plasticity of placental mitochondria has relevance to placenta

  13. Investigations into the biodegradation of microcystin-LR in wastewaters

    Ho, Lionel; Hoefel, Daniel; Palazot, Sebastien; Sawade, Emma; Newcombe, Gayle; Saint, Christopher P.; Brookes, Justin D.

    2010-01-01

    Microcystins are potent hepatotoxins that can be produced by cyanobacteria. These organisms can proliferate in wastewaters due to a number of factors including high concentrations of nutrients for growth. As treated wastewaters are now being considered as supplementary drinking water sources, in addition to their frequent use for irrigated agriculture, it is imperative that these wastewaters are free of toxins such as microcystins. This study investigated the potential for biodegradation of microcystin-LR (MCLR) in wastewaters through a biological sand filtration experiment and in static batch reactor experiments. MCLR was effectively removed at a range of concentrations and at various temperatures, with degradation attributed to the action of microorganisms indigenous to the wastewaters. No hepatotoxic by-products were detected following the degradation of MCLR as determined by a protein phosphatase inhibition assay. Using TaqMan polymerase chain reaction, the first gene involved in bacterial degradation of MCLR (mlrA) was detected and the responsible bacteria shown to increase with the amount of MCLR being degraded. This finding suggested that the degradation of MCLR was dependent upon the abundance of MCLR-degrading organisms present within the wastewater, and that MCLR may provide bacteria with a significant carbon source for proliferation; in turn increasing MCLR removal.

  14. Effects of bioirrigation of non-biting midges (Diptera: Chironomidae) on lake sediment respiration

    Baranov, Viktor; Lewandowski, Jörg; Romeijn, Paul; Singer, Gabriel; Krause, Stefan

    2016-06-01

    Bioirrigation or the transport of fluids into the sediment matrix due to the activities of organisms such as bloodworms (larvae of Diptera, Chironomidae), has substantial impacts on sediment respiration in lakes. However, previous quantifications of bioirrigation impacts of Chironomidae have been limited by technical challenges such as the difficulty to separate faunal and bacterial respiration. This paper describes a novel method based on the bioreactive tracer resazurin for measuring respiration in-situ in non-sealed systems with constant oxygen supply. Applying this new method in microcosm experiments revealed that bioirrigation enhanced sediment respiration by up to 2.5 times. The new method is yielding lower oxygen consumption than previously reported, as it is only sensitive to aerobic heterotrophous respiration and not to other processes causing oxygen decrease. Hence it decouples the quantification of respiration of animals and inorganic oxygen consumption from microbe respiration in sediment.

  15. Quantitative evaluation of the protective effect of respirators

    Murata, Mikio

    1983-01-01

    The present status and related problems of the quantitative evaluation method for respirator efficiency are generally reviewed. As the introduction, the special features of various types of respirators are summarized, and the basic concept of leakage and the protection factor are explained. As for the quantitative measurement of the protective efficiency, the features of various existing man-test methods such as NaCl aerosol man-test, DOP (dioctyl phthalate) man-test, and SF 6 gas man-test are reviewed and discussed. As the important problems associated with those man-tests, the following aspects are discussed. The measurement of the aerosol concentration within masks; the calculation method for the protection factor; the effect of beards. The examples of measuring the protection factor are also explained for the following respirator systems: half mask respirator with a high efficiency filter; full face mask respirator with a high efficiency filter; demand mode and pressure-demand mode respirators; and mound suit with suspenders. Finally, the outline of the manual of respiratory protection published by NRC in 1976 is briefly reviewed. (Aoki, K.)

  16. Respirator use and its impact on particulate matter exposure in aluminum manufacturing facilities.

    Liu, Sa; Noth, Elizabeth; Eisen, Ellen; Cullen, Mark R; Hammond, Katharine

    2018-05-31

    Objectives As part of a large epidemiologic study of particulate health effect, this study aimed to report respirator use among total particulate matter (TPM) samples collected in a major aluminum manufacturing company from 1966‒2013 and evaluate the impact of respirator-use adjustment on exposure estimation. Methods Descriptive analyses were performed to evaluate respirator use across facilities and by facility type and job. Protection factors were applied to TPM measurements for recorded respirator use. Estimated TPM exposure for each job ‒ before and after respirator-use adjustment ‒ were compared to assess the impact of adjustment on exposure estimation. Results Respirator use was noted for 37% of 12 402 full-shift personal TPM samples. Measured TPM concentration ranged from less than detectable to 8220 mg/m3, with arithmetic mean, median and standard deviation being 10.6, 0.87 and 130 mg/m 3 , respectively. Respirators were used more often in smelting facilities (52% of TPM measurements) than in fabricating (17%) or refinery facilities (28%) (Pfacilities were subject to respirator-use adjustment, whereas it was 20% and 70% in fabricating and refinery facilities, respectively. Applying protection factors to TPM measurements significantly reduced estimated job mean TPM exposures and changed exposure categories in these facilities, with larger impact in smelting than fabricating facilities. Conclusions Respirator use varied by time, facility and job. Adjusting respirator use resulted in differential impact in smelting and fabricating facilities, which will need to be incorporated into ongoing epidemiologic studies accordingly.

  17. A mechanical breathing simulator for respirator test

    Murata, Mikio; Ikezawa, Yoshio; Yoshida, Yoshikazu

    1976-01-01

    A mechanical breathing simulator has been developed to produce the human respiration for use in respirator test. The respirations were produced through the strokes of piston controlled by a rockerarm with adjustable fulcrum. The respiration rate was governed by motor-speed control, independent of the tidal volume achieved by adjustment of the piston stroke. By the breather, the simulated respirations for work rate 0, 208, 415, 622 and 830 kg-m/min could be produced through the typical dummy head. (auth.)

  18. Kinetic and mechanistic study of microcystin-LR degradation by nitrous acid under ultraviolet irradiation.

    Ma, Qingwei; Ren, Jing; Huang, Honghui; Wang, Shoubing; Wang, Xiangrong; Fan, Zhengqiu

    2012-05-15

    Degradation of microcystin-LR (MC-LR) in the presence of nitrous acid (HNO(2)) under irradiation of 365nm ultraviolet (UV) was studied for the first time. The influence of initial conditions including pH value, NaNO(2) concentration, MC-LR concentration and UV intensity were studied. MC-LR was degraded in the presence of HNO(2); enhanced degradation of MC-LR was observed with 365nm UV irradiation, caused by the generation of hydroxyl radicals through the photolysis of HNO(2). The degradation processes of MC-LR could well fit the pseudo-first-order kinetics. Mass spectrometry was applied for identification of the byproducts and the analysis of degradation mechanisms. Major degradation pathways were proposed according to the results of LC-MS analysis. The degradation of MC-LR was initiated via three major pathways: attack of hydroxyl radicals on the conjugated carbon double bonds of Adda, attack of hydroxyl radicals on the benzene ring of Adda, and attack of nitrosonium ion on the benzene ring of Adda. Copyright © 2012 Elsevier B.V. All rights reserved.

  19. Temperature response of soil respiration largely unaltered with experimental warming

    Carey, Joanna C; Tang, Jianwu; Templer, Pamela H

    2016-01-01

    The respiratory release of carbon dioxide (CO2) from soil is a major yet poorly understood flux in the global carbon cycle. Climatic warming is hypothesized to increase rates of soil respiration, potentially fueling further increases in global temperatures. However, despite considerable scientific...... attention in recent decades, the overall response of soil respiration to anticipated climatic warming remains unclear. We synthesize the largest global dataset to date of soil respiration, moisture, and temperature measurements, totaling >3,800 observations representing 27 temperature manipulation studies......, spanning nine biomes and over 2 decades of warming. Our analysis reveals no significant differences in the temperature sensitivity of soil respiration between control and warmed plots in all biomes, with the exception of deserts and boreal forests. Thus, our data provide limited evidence of acclimation...

  20. Kinetic and mechanistic study of microcystin-LR degradation by nitrous acid under ultraviolet irradiation

    Ma, Qingwei; Ren, Jing; Huang, Honghui; Wang, Shoubing; Wang, Xiangrong; Fan, Zhengqiu

    2012-01-01

    Highlights: ► For the first time, degradation of MC-LR by nitrous acid under UV 365 nm was discovered. ► The effects of factors on MC-LR degradation were analyzed based on kinetic study. ► Mass spectrometry was applied for identification of intermediates and products. ► Special intermediates involved in this study were identified. ► Degradation mechanisms were proposed according to the results of LC–MS analysis. - Abstract: Degradation of microcystin-LR (MC-LR) in the presence of nitrous acid (HNO 2 ) under irradiation of 365 nm ultraviolet (UV) was studied for the first time. The influence of initial conditions including pH value, NaNO 2 concentration, MC-LR concentration and UV intensity were studied. MC-LR was degraded in the presence of HNO 2 ; enhanced degradation of MC-LR was observed with 365 nm UV irradiation, caused by the generation of hydroxyl radicals through the photolysis of HNO 2 . The degradation processes of MC-LR could well fit the pseudo-first-order kinetics. Mass spectrometry was applied for identification of the byproducts and the analysis of degradation mechanisms. Major degradation pathways were proposed according to the results of LC–MS analysis. The degradation of MC-LR was initiated via three major pathways: attack of hydroxyl radicals on the conjugated carbon double bonds of Adda, attack of hydroxyl radicals on the benzene ring of Adda, and attack of nitrosonium ion on the benzene ring of Adda.

  1. Kinetic and mechanistic study of microcystin-LR degradation by nitrous acid under ultraviolet irradiation

    Ma, Qingwei; Ren, Jing [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China); Huang, Honghui [Key Laboratory of Fisheries Ecology Environment, Ministry of Agriculture, Guangzhou 510300 (China); Wang, Shoubing [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China); Wang, Xiangrong, E-mail: xrxrwang@vip.sina.com [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China); Fan, Zhengqiu, E-mail: zhqfan@fudan.edu.cn [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China)

    2012-05-15

    Highlights: Black-Right-Pointing-Pointer For the first time, degradation of MC-LR by nitrous acid under UV 365 nm was discovered. Black-Right-Pointing-Pointer The effects of factors on MC-LR degradation were analyzed based on kinetic study. Black-Right-Pointing-Pointer Mass spectrometry was applied for identification of intermediates and products. Black-Right-Pointing-Pointer Special intermediates involved in this study were identified. Black-Right-Pointing-Pointer Degradation mechanisms were proposed according to the results of LC-MS analysis. - Abstract: Degradation of microcystin-LR (MC-LR) in the presence of nitrous acid (HNO{sub 2}) under irradiation of 365 nm ultraviolet (UV) was studied for the first time. The influence of initial conditions including pH value, NaNO{sub 2} concentration, MC-LR concentration and UV intensity were studied. MC-LR was degraded in the presence of HNO{sub 2}; enhanced degradation of MC-LR was observed with 365 nm UV irradiation, caused by the generation of hydroxyl radicals through the photolysis of HNO{sub 2}. The degradation processes of MC-LR could well fit the pseudo-first-order kinetics. Mass spectrometry was applied for identification of the byproducts and the analysis of degradation mechanisms. Major degradation pathways were proposed according to the results of LC-MS analysis. The degradation of MC-LR was initiated via three major pathways: attack of hydroxyl radicals on the conjugated carbon double bonds of Adda, attack of hydroxyl radicals on the benzene ring of Adda, and attack of nitrosonium ion on the benzene ring of Adda.

  2. 76 FR 60937 - Draft License Renewal Interim Staff Guidance LR-ISG-2011-02; Aging Management Program for Steam...

    2011-09-30

    ...-2011-02; Aging Management Program for Steam Generators AGENCY: Nuclear Regulatory Commission. ACTION... License Renewal Interim Staff Guidance (LR-ISG), LR-ISG-2011-02, ``Aging Management Program for Steam... using Revision 3 of NEI 97-06 to manage steam generator aging. The Draft LR-ISG revises the NRC staff's...

  3. Biophysical controls on soil respiration in the dominant patch types of an old-growth, mixed-conifer forest

    Siyan Ma; Jiquan Chen; John R. Butnor; Malcolm North; Eugénie S. Euskirchen; Brian Oakley

    2005-01-01

    Little is known about biophysical controls on soil respiration in California's Sierra Nevada old-growth, mixed-conifer forests. Using portable and automated soil respiration sampling units, we measured soil respiration rate (SRR) in three dominant patch types: closed canopy (CC), ceanothus-dominated patches (CECO), and open canopy (OC). SRR varied significantly...

  4. Effects of simulated warming on soil respiration to XiaoPo lake

    Zhao, Shuangkai; Chen, Kelong; Wu, Chengyong; Mao, Yahui

    2018-02-01

    The main flux of carbon cycling in terrestrial and atmospheric ecosystems is soil respiration, and soil respiration is one of the main ways of soil carbon output. This is of great significance to explore the dynamic changes of soil respiration rate and its effect on temperature rise, and the correlation between environmental factors and soil respiration. In this study, we used the open soil carbon flux measurement system (LI-8100, LI-COR, NE) in the experimental area of the XiaoPo Lake wetland in the Qinghai Lake Basin, and the Kobresia (Rs) were measured, and the soil respiration was simulated by simulated temperature (OTC) and natural state. The results showed that the temperature of 5 cm soil was 1.37 °C higher than that of the control during the experiment, and the effect of warming was obvious. The respiration rate of soil under warming and natural conditions showed obvious diurnal variation and monthly variation. The effect of warming on soil respiration rate was promoted and the effect of precipitation on soil respiration rate was inhibited. Further studies have shown that the relationship between soil respiration and 5 cm soil temperature under the control and warming treatments can be described by the exponential equation, and the correlation analysis between the two plots shows a very significant exponential relationship (p main influencing factor of soil respiration in this region.

  5. Adsorption of microcystin-LR on mesoporous carbons and its potential use in drinking water source.

    Park, Jeong-Ann; Jung, Sung-Mok; Yi, In-Geol; Choi, Jae-Woo; Kim, Song-Bae; Lee, Sang-Hyup

    2017-06-01

    Microcystin-LR (MC-LR) is a common toxin derived from cyanobacterial blooms an effective, rapid and non-toxic method needs to be developed for its removal from drinking water treatment plants (DWTP). For an adsorption-based method, mesoporous carbon can be a promising supplemental adsorbent. The effect of mesoporous carbon (MC1, MC2, and MC3) properties and water quality parameters on the adsorption of MC-LR were investigated and the results were analyzed by kinetic, isotherm, thermodynamic, Derjaguin-Landau-Verwey-Overbeek (DLVO), and intraparticle diffusion models. MC1 was the most appropriate type for the removal of MC-LR with a maximum adsorption capacity of 35,670.49 μg/g. Adsorption of MC-LR is a spontaneous reaction dominated by van der Waals interactions. Pore sizes of 8.5-14 nm enhance the pore diffusion of MC-LR from the surface to the mesopores of MC1. The adsorption capacity was not sensitive to changes in the pH (3.2-8.0) and the existence of organic matter (2-5 mg/L). Furthermore, the final concentration of MC-LR was below the WHO guideline level after a 10-min reaction with 20 mg/L of MC1 in the Nak-Dong River, a drinking water source. The MC-LR adsorption mainly competed with humic substances (500-1000 g/mole); however, they did not have a great effect on adsorption. Copyright © 2017. Published by Elsevier Ltd.

  6. Development of an ELISA and Immunochromatographic Strip for Highly Sensitive Detection of Microcystin-LR

    Liqiang Liu

    2014-08-01

    Full Text Available A monoclonal antibody for microcystin–leucine–arginine (MC-LR was produced by cell fusion. The immunogen was synthesized in two steps. First, ovalbumin/ bovine serum albumin was conjugated with 6-acetylthiohexanoic acid using a carbodiimide EDC (1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride/ NHS (N-hydroxysulfosuccinimide reaction. After dialysis, the protein was reacted with MC-LR based on a free radical reaction under basic solution conditions. The protein conjugate was used for immunization based on low volume. The antibodies were identified by indirect competitive (icELISA and were subjected to tap water and lake water analysis. The concentration causing 50% inhibition of binding of MC-LR (IC50 by the competitive indirect ELISA was 0.27 ng/mL. Cross-reactivity to the MC-RR, MC-YR and MC-WR was good. The tap water and lake water matrices had no effect on the detection limit. The analytical recovery of MC-LR in the water samples in the icELISA was 94%–110%. Based on this antibody, an immunochromatographic biosensor was developed with a cut-off value of 1 ng/mL, which could satisfy the requirement of the World Health Organization for MC-LR detection in drinking water. This biosensor could be therefore be used as a fast screening tool in the field detection of MC-LR.

  7. WWER-440 local power peaking experiment with/without Hf inserts in the LR-0 reactor

    Josek, R.; Hudec, F.; Rypar, V.

    2006-01-01

    One of the known issues of the WWER-440 reactors is the control rod coupler induced power peaking in the neighbouring fuel assemblies. The effect has been discovered some years ago and is believed to be the cause of several fuel failures during operation in WWER-440 reactors. The effect itself is due to over-moderation and small absorption in the region of control rod coupler, leading to increase in thermal neutron flux and hence to power flare-up in the neighbouring fuel pins. The fuel vendor tackled the problem by attaching hafnium inserts on the inside of the control assembly box. The experiment performed in the LR-0 reactor was focused on the axial and radial power profiles in the vicinity of the control assembly with and without the hafnium inserts. The results of measurements with zero boron concentration are presented. The hafnium insert causes a decrease in peaking factor of about 30% in selected pins close to the control assembly. The measurements are compared with calculations performed with the MCNP-4C code. The compared variables are: the axial fission density distributions; peking factors and peaking factor decrease due to Hf insert. The MCNP results are accurate with respect to the experimental results. A series of benchmarks is being prepared on the basis of these measurements

  8. Study of graphite reactivity worth on well-defined cores assembled on LR-0 reactor

    Košťál, Michal; Rypar, Vojtěch; Milčák, Ján; Juříček, Vlastimil; Losa, Evžen; Forget, Benoit; Harper, Sterling

    2016-01-01

    Highlights: • A light water critical facility for graphite reactivity worth measurements. • Comparison of calculated and measured k eff . • Effect of graphite description on k eff . - Abstract: Graphite is an often-used moderating material on the basis of its good moderating power and very low absorption cross section. This small absorption cross section permits the use of natural or low-enriched uranium in graphite moderated reactors. Graphite is now being considered as the moderator for Fluoride-salt-cooled High Temperature Reactors (FHR). The critical moderator level was measured for various graphite block configurations in an experimental dry assembly of the LR-0 reactor. Comparisons with experiments were performed between Monte Carlo simulation tools for which satisfactory agreement was obtained with the exception of some systematic discrepancies. The larger discrepancies were observed when using the ENDF/B-VII.0 library. To decrease the uncertainties, based on conservative assumptions, relative comparisons were done. The results provided by the different nuclear data libraries are within 3 sigma interval of experimental uncertainties. It has been determined that differences between the results of calculations are caused by variations in the (n,n), (n,n′), (n,g) reactions and also by various angular distributions, while the (n,g) cross section variations play only a minor role for these configurations.

  9. Combination of On-line pH and Oxygen Transfer Rate Measurement in Shake Flasks by Fiber Optical Technique and Respiration Activity MOnitoring System (RAMOS

    Jochen Büchs

    2007-12-01

    Full Text Available Shake flasks are commonly used for process development in biotechnologyindustry. For this purpose a lot of information is required from the growth conditions duringthe fermentation experiments. Therefore, Anderlei et al. developed the RAMOS technology[1, 2], which proviedes on-line oxygen and carbondioxide transfer rates in shake flasks.Besides oxygen consumption, the pH in the medium also plays an important role for thesuccessful cultivation of micro-organisms and for process development. For online pHmeasurement fiber optical methods based on fluorophores are available. Here a combinationof the on-line Oxygen Transfer Rate (OTR measurements in the RAMOS device with anon-line, fiber optical pH measurement is presented. To demonstrate the application of thecombined measurement techniques, Escherichia coli cultivations were performed and on-line pH measurements were compared with off-line samples. The combination of on-lineOTR and pH measurements gives a lot of information about the cultivation and, therefore, itis a powerful technique for monitoring shake flask experiments as well as for processdevelopment.

  10. General Instructions for Disposable Respirators

    2009-04-09

    This podcast, intended for the general public, demonstrates how to put on and take off disposable respirators that are to be used in areas affected by the influenza outbreak.  Created: 4/9/2009 by CDC, National Institute for Occupational Safety and Health (NIOSH).   Date Released: 4/29/2009.

  11. Use of Facemasks and Respirators

    2007-05-15

    This program demonstrates the differences of facemasks and respirators that are to be used in public settings during an influenza pandemic.  Created: 5/15/2007 by CDC, National Institute for Occupational Safety and Health (NIOSH).   Date Released: 5/25/2007.

  12. Forest thinning and soil respiration in a ponderosa pine plantation in the Sierra Nevada.

    Tang, Jianwu; Qi, Ye; Xu, Ming; Misson, Laurent; Goldstein, Allen H

    2005-01-01

    Soil respiration is controlled by soil temperature, soil water, fine roots, microbial activity, and soil physical and chemical properties. Forest thinning changes soil temperature, soil water content, and root density and activity, and thus changes soil respiration. We measured soil respiration monthly and soil temperature and volumetric soil water continuously in a young ponderosa pine (Pinus ponderosa Dougl. ex P. Laws. & C. Laws.) plantation in the Sierra Nevada Mountains in California from June 1998 to May 2000 (before a thinning that removed 30% of the biomass), and from May to December 2001 (after thinning). Thinning increased the spatial homogeneity of soil temperature and respiration. We conducted a multivariate analysis with two independent variables of soil temperature and water and a categorical variable representing the thinning event to simulate soil respiration and assess the effect of thinning. Thinning did not change the sensitivity of soil respiration to temperature or to water, but decreased total soil respiration by 13% at a given temperature and water content. This decrease in soil respiration was likely associated with the decrease in root density after thinning. With a model driven by continuous soil temperature and water time series, we estimated that total soil respiration was 948, 949 and 831 g C m(-2) year(-1) in the years 1999, 2000 and 2001, respectively. Although thinning reduced soil respiration at a given temperature and water content, because of natural climate variability and the thinning effect on soil temperature and water, actual cumulative soil respiration showed no clear trend following thinning. We conclude that the effect of forest thinning on soil respiration is the combined result of a decrease in root respiration, an increase in soil organic matter, and changes in soil temperature and water due to both thinning and interannual climate variability.

  13. Seasonality of temperate forest photosynthesis and daytime respiration.

    Wehr, R; Munger, J W; McManus, J B; Nelson, D D; Zahniser, M S; Davidson, E A; Wofsy, S C; Saleska, S R

    2016-06-30

    Terrestrial ecosystems currently offset one-quarter of anthropogenic carbon dioxide (CO2) emissions because of a slight imbalance between global terrestrial photosynthesis and respiration. Understanding what controls these two biological fluxes is therefore crucial to predicting climate change. Yet there is no way of directly measuring the photosynthesis or daytime respiration of a whole ecosystem of interacting organisms; instead, these fluxes are generally inferred from measurements of net ecosystem-atmosphere CO2 exchange (NEE), in a way that is based on assumed ecosystem-scale responses to the environment. The consequent view of temperate deciduous forests (an important CO2 sink) is that, first, ecosystem respiration is greater during the day than at night; and second, ecosystem photosynthetic light-use efficiency peaks after leaf expansion in spring and then declines, presumably because of leaf ageing or water stress. This view has underlain the development of terrestrial biosphere models used in climate prediction and of remote sensing indices of global biosphere productivity. Here, we use new isotopic instrumentation to determine ecosystem photosynthesis and daytime respiration in a temperate deciduous forest over a three-year period. We find that ecosystem respiration is lower during the day than at night-the first robust evidence of the inhibition of leaf respiration by light at the ecosystem scale. Because they do not capture this effect, standard approaches overestimate ecosystem photosynthesis and daytime respiration in the first half of the growing season at our site, and inaccurately portray ecosystem photosynthetic light-use efficiency. These findings revise our understanding of forest-atmosphere carbon exchange, and provide a basis for investigating how leaf-level physiological dynamics manifest at the canopy scale in other ecosystems.

  14. Determination of power density in VVER-1000 Mock-Up in LR-0 reactor

    Košál Michal

    2017-01-01

    Full Text Available The pin power density is an important quantity which has to be monitored during the reactor operation, for two main reasons. Firstly, it is part of the limits and conditions of safe operation and, secondly, it is source term in neutron transport calculations used for the adequate assessing of the state of core structures and pressure vessel material. It is often calculated using deterministic codes which may have problems with an adequate definition of boundary conditions in subcritical regions. This may lead to overestimation of real situation, and therefore the validation of the utility codes contributes not only to better fuel utilization, but also to more precise description of radiation situation in structural components of core. Current paper presents methods developed at LR-0 reactor, as well as selected results for pin power density measurement in peripheral regions of VVER-1000 mock-up. The presented data show that the results of a utility diffusion code at core boundary overestimate the measurement. This situation, however satisfactory safe, may lead to unduly conservative approach in the determination of radiation damage of core structures.

  15. 78 FR 18535 - Respirator Certification Fees

    2013-03-27

    ... facepiece respirators. The North American respiratory protection market generated revenues around $1,830 million in 2007, the most recent data available.\\4\\ A summary of market segmentation, by respirator type... management. Of the U.S. respirator market of products approved by NIOSH, approximately 35 percent of approval...

  16. A simple highly sensitive and selective aptamer-based colorimetric sensor for environmental toxins microcystin-LR in water samples.

    Li, Xiuyan; Cheng, Ruojie; Shi, Huijie; Tang, Bo; Xiao, Hanshuang; Zhao, Guohua

    2016-03-05

    A simple and highly sensitive aptamer-based colorimetric sensor was developed for selective detection of Microcystin-LR (MC-LR). The aptamer (ABA) was employed as recognition element which could bind MC-LR with high-affinity, while gold nanoparticles (AuNPs) worked as sensing materials whose plasma resonance absorption peaks red shifted upon binding of the targets at a high concentration of sodium chloride. With the addition of MC-LR, the random coil aptamer adsorbed on Au NPs altered into regulated structure to form MC-LR-aptamer complexes and broke away from the surface of Au NPs, leading to the aggregation of AuNPs, and the color converted from red to blue due to the interparticle plasmon coupling. Results showed that our aptamer-based colorimetric sensor exhibited rapid and sensitive detection performance for MC-LR with linear range from 0.5 nM to 7.5 μM and the detection limit reached 0.37 nM. Meanwhile, the pollutants usually coexisting with MC-LR in pollutant water samples had not demonstrated disturbance for detecting of MC-LR. The mechanism was also proposed suggesting that high affinity interaction between aptamer and MC-LR significantly enhanced the sensitivity and selectivity for MC-LR detection. Besides, the established method was utilized in analyzing real water samples and splendid sensitivity and selectivity were obtained as well. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. Lr67/Yr46 confers adult plant resistance to stem rust and powdery mildew in wheat.

    Herrera-Foessel, Sybil A; Singh, Ravi P; Lillemo, Morten; Huerta-Espino, Julio; Bhavani, Sridhar; Singh, Sukhwinder; Lan, Caixia; Calvo-Salazar, Violeta; Lagudah, Evans S

    2014-04-01

    We demonstrate that Lr67/Yr46 has pleiotropic effect on stem rust and powdery mildew resistance and is associated with leaf tip necrosis. Genes are designated as Sr55, Pm46 and Ltn3 , respectively. Wheat (Triticum aestivum) accession RL6077, known to carry the pleiotropic slow rusting leaf and yellow rust resistance genes Lr67/Yr46 in Thatcher background, displayed significantly lower stem rust (P. graminis tritici; Pgt) and powdery mildew (Blumeria graminis tritici; Bgt) severities in Kenya and in Norway, respectively, compared to its recurrent parent Thatcher. We investigated the resistance of RL6077 to stem rust and powdery mildew using Avocet × RL6077 F6 recombinant inbred lines (RILs) derived from two photoperiod-insensitive F3 families segregating for Lr67/Yr46. Greenhouse seedling tests were conducted with Mexican Pgt race RTR. Field evaluations were conducted under artificially initiated stem rust epidemics with Pgt races RTR and TTKST (Ug99 + Sr24) at Ciudad Obregon (Mexico) and Njoro (Kenya) during 2010-2011; and under natural powdery mildew epiphytotic in Norway at Ås and Hamar during 2011 and 2012. In Mexico, a mean reduction of 41 % on stem rust severity was obtained for RILs carrying Lr67/Yr46, compared to RILs that lacked the gene, whereas in Kenya the difference was smaller (16 %) but significant. In Norway, leaf tip necrosis was associated with Lr67/Yr46 and RILs carrying Lr67/Yr46 showed a 20 % reduction in mean powdery mildew severity at both sites across the 2 years of evaluation. Our study demonstrates that Lr67/Yr46 confers partial resistance to stem rust and powdery mildew and is associated with leaf tip necrosis. The corresponding pleiotropic, or tightly linked, genes, designated as Sr55, Pm46, and Ltn3, can be utilized to provide broad-spectrum durable disease resistance in wheat.

  18. Molecular and analysis of a phenylalanine ammonia-lyase gene (LrPAL2) from Lycoris radiata.

    Jiang, Yumei; Xia, Bing; Liang, Lijian; Li, Xiaodan; Xu, Sheng; Peng, Feng; Wang, Ren

    2013-03-01

    Phenylalanine ammonia-lyase (PAL), the first enzyme of phenylpropanoid biosynthesis, participates in the biosynthesis of flavonoids, lignins, stilbenes and many other compounds. In this study, we cloned a 2,326 bp full-length PAL2 gene from Lycoris radiata by using degenerate oligonucleotide primer PCR (DOP-PCR) and the rapid amplification of cDNA ends method. The cDNA contains a 2,124 bp coding region encoding 707 amino acids. The LrPAL2 shares about 77.0 % nucleic acid identity and 83 % amino acid identity with LrPAL1. Furthermore, genome sequence analysis demonstrated that LrPAL2 gene contains one intron and two exons. The 5' flanking sequence of LrPAL2 was also cloned by self-formed adaptor PCR (SEFA-PCR), and a group of putative cis-acting elements such as TATA box, CAAT box, G box, TC-rich repeats, CGTCA motif and TCA-element were identified. The LrPAL2 was detected in all tissues examined, with high abundance in bulbs at leaf sprouting stage and in petals at blooming stage. Besides, LrPAL2 drastically responded to MJ, SNP and UV, moderately responded to GA and SA, and a little increased under wounding. Comparison of LrPAL2 expression and LrPAL1 expression demonstrated that LrPAL2 can be more significantly induced than LrPAL1 under the above treatments, and LrPAL2 transcripts accumulated prominently at blooming stage, especially in petals, while LrPAL1 transcripts did not accumulated significantly at blooming stage. All these results suggested that LrPAL2 might play distinct roles in different branches of the phenylpropanoid pathway.

  19. Exposure to inhalable, respirable, and ultrafine particles in welding fume.

    Lehnert, Martin; Pesch, Beate; Lotz, Anne; Pelzer, Johannes; Kendzia, Benjamin; Gawrych, Katarzyna; Heinze, Evelyn; Van Gelder, Rainer; Punkenburg, Ewald; Weiss, Tobias; Mattenklott, Markus; Hahn, Jens-Uwe; Möhlmann, Carsten; Berges, Markus; Hartwig, Andrea; Brüning, Thomas

    2012-07-01

    This investigation aims to explore determinants of exposure to particle size-specific welding fume. Area sampling of ultrafine particles (UFP) was performed at 33 worksites in parallel with the collection of respirable particles. Personal sampling of respirable and inhalable particles was carried out in the breathing zone of 241 welders. Median mass concentrations were 2.48 mg m(-3) for inhalable and 1.29 mg m(-3) for respirable particles when excluding 26 users of powered air-purifying respirators (PAPRs). Mass concentrations were highest when flux-cored arc welding (FCAW) with gas was applied (median of inhalable particles: 11.6 mg m(-3)). Measurements of particles were frequently below the limit of detection (LOD), especially inside PAPRs or during tungsten inert gas welding (TIG). However, TIG generated a high number of small particles, including UFP. We imputed measurements welding fume. Concentrations were mainly predicted by the welding process and were significantly higher when local exhaust ventilation (LEV) was inefficient or when welding was performed in confined spaces. Substitution of high-emission techniques like FCAW, efficient LEV, and using PAPRs where applicable can reduce exposure to welding fume. However, harmonizing the different exposure metrics for UFP (as particle counts) and for the respirable or inhalable fraction of the welding fume (expressed as their mass) remains challenging.

  20. Fast Neutron Transport in the Biological Shielding Model and Other Regions of the VVER-1000 Mock-Up on the LR-0 Research Reactor

    Košťál Michal

    2016-01-01

    Full Text Available A set of benchmark experiments was carried out in the full scale VVER-1000 mock-up on the reactor LR-0 in order to validate neutron transport calculation methodologies and to perform the optimization of the shape and locations of neutron flux operation monitors channels inside the shielding of the new VVER-1000 type reactors. Compared with previous experiments on the VVER-1000 mock-up on the reactor LR-0, the fast neutron spectra were measured in the extended neutron energy interval (0.1–10 MeV and new calculations were carried out with the MCNPX code using various nuclear data libraries (ENDF/B VII.0, JEFF 3.1, JENDL 3.3, JENDL 4, ROSFOND 2009, and CENDL 3.1. Measurements and calculations were carried out at different points in the mock-up. The calculation and experimental data are compared.

  1. Creating the Chemistry in Cellular Respiration Concept Inventory (CCRCI)

    Forshee, Jay Lance, II

    Students at our institution report cellular respiration to be the most difficult concept they encounter in undergraduate biology, but why students find this difficult is unknown. Students may find cellular respiration difficult because there is a large amount of steps, or because there are persistent, long-lasting misconceptions and misunderstandings surrounding their knowledge of chemistry, which affect their performance on cellular respiration assessments. Most studies of cellular respiration focus on student macro understanding of the process related to breathing, and matter and energy. To date, no studies identify which chemistry concepts are most relevant to students' development of an understanding of the process of cellular respiration or have developed an assessment to measure student understanding of them. Following the Delphi method, the researchers conducted expert interviews with faculty members from four-year, masters-, and PhD-granting institutions who teach undergraduate general biology, and are experts in their respective fields of biology. From these interviews, researchers identified twelve chemistry concepts important to understanding cellular respiration and using surveys, these twelve concepts were refined into five (electron transfer, energy transfer, thermodynamics (law/conservation), chemical reactions, and gradients). The researchers then interviewed undergraduate introductory biology students at a large Midwestern university to identify their knowledge and misconceptions of the chemistry concepts that the faculty had identified previously as important. The CCRCI was developed using the five important chemistry concepts underlying cellular respiration. The final version of the CCRCI was administered to n=160 introductory biology students during the spring 2017 semester. Reliability of the CCRCI was evaluated using Cronbach's alpha (=.7) and split-half reliability (=.769), and validity of the instrument was assessed through content validity

  2. Opposite effects of pioglitazone and rosiglitazone on mitochondrial respiration in skeletal muscle of patients with type 2 diabetes

    Rabøl, R; Boushel, R; Almdal, T

    2010-01-01

    mitochondrial respiration per milligram muscle was measured in saponin-treated skinned muscle fibres using high-resolution respirometry. RESULTS: Mitochondrial respiration per milligram muscle was lower in T2DM compared to controls at baseline and decreased during ROSI treatment but increased during PIO...... of ROSI and PIO on mitochondrial respiration, and also show that insulin sensitivity can be improved independently of changes in mitochondrial respiration. We confirm that mitochondrial respiration is reduced in T2DM compared to age- and BMI-matched control subjects....

  3. Radon survey related to construction materials and soils in Zacatecas, Mexico using LR-115

    Mireles, F.; Garcia, M.L.; Quirino, L.L.; Davila, J.I.; Pinedo, J.L.; Rios, C.; Montero, M.E.; Colmenero, L.; Villalba, L.

    2007-01-01

    Indoor radon gas ( 222 Rn), present in the air inside buildings, is one of the most important sources of radiation exposure to the population. This gas originates in the 238 U radioactive decay chain, which is contained in rock and solid soil particles. Radon accumulation in confined spaces, inside buildings, depends on several factors such as the type of soils, type of constructions, building materials, and ventilation. The aim of this work is to present indoor and outdoor radon concentrations for 202 dwellings and indoor concentrations for 148 public clinics; and the radon concentrations relate to the type of predominant soils, the construction years; and building materials used in the ceilings, walls and floors, for cities and towns of the 57 municipalities in the State of Zacatecas, Mexico. The 222 Rn concentrations were measured with a passive-type radon monitor, with LR-115 as detector material; and the radon survey was made during four stages of three months each throughout Zacatecas from 2001 to 2002. The indoor and outdoor radon concentration averages in dwellings were 55.6±4.9Bqm -3 and 46.5±5.3Bqm -3 , respectively. The indoor radon concentration average in public clinics was 57.8±5.4Bqm -3 . These values were lower than the US EPA action limit of 148Bqm -3

  4. Application of DNA RFLP procedures in interspecific gene transfer: The Lr19 translocation of wheat

    Prins, R.; Marais, G.F.; Marais, A.S.; Pretorius, Z.A.; Janse, B.J.H.

    1998-01-01

    Twenty-nine lines with deletions in the Lr19 ('Indis') translocated chromosome segment were used to physically map Thinopyrum Restriction Fragment Length Polymorphism (RFLP) loci as well as the Sr25 and Sdl loci. The relative distances between marker loci on the translocation were then calculated. The information was then used as an aid to characterize several recombined forms of the translocation. The data confirmed the reported homoeology between the Lr19 segment and chromosome arm 7DL of wheat. Also, it seems that the Lr19 translocation in 'Indis' is very similar to the Lr19 segment in the T4 source and that the former may not derive from Thinopyrum distichum. Near-isogenic lines of the recombined segments were derived and used to study their expression of leaf rust resistance. It became evident that only one potentially useful recombinant was obtained in an earlier attempt to induce allosyndetic pairing between the Lr19 translocation and 7DL of wheat. (author)

  5. Crystallization and preliminary crystallographic analysis of human LR11 Vps10p domain

    Nakata, Zenzaburo; Nagae, Masamichi; Yasui, Norihisa; Bujo, Hideaki; Nogi, Terukazu; Takagi, Junichi

    2010-01-01

    LR11/sorLA contains in its extracellular region a large (∼700-residue) Vps10p domain that is implicated in its intracellular protein-trafficking function. Here, the expression, purification, crystallization and preliminary crystallographic characterization of this domain are described. Low-density lipoprotein receptor (LDLR) relative with 11 binding repeats (LR11; also known as sorLA) is genetically associated with late-onset Alzheimer’s disease and is thought to be involved in neurodegenerative processes. LR11 contains a vacuolar protein-sorting 10 protein (Vps10p) domain. As this domain has been implicated in protein–protein interaction in other receptors, its structure and function are of great biological interest. Human LR11 Vps10p domain was expressed in mammalian cells and the purified protein was crystallized using the hanging-drop vapour-diffusion method. Enzymatic deglycosylation of the sample was critical to obtaining diffraction-quality crystals. Deglycosylated LR11 Vps10p-domain crystals belonged to the hexagonal space group P6 1 22. A diffraction data set was collected to 2.4 Å resolution and a clear molecular-replacement solution was obtained

  6. Status Report on Scoping Reactor Physics and Sensitivity/Uncertainty Analysis of LR-0 Reactor Molten Salt Experiments

    Brown, Nicholas R.; Mueller, Donald E.; Patton, Bruce W.; Powers, Jeffrey J.

    2016-01-01

    Experiments are being planned at Research Centre Rež (RC Rež) to use the FLiBe (2 "7LiF-BeF_2) salt from the Molten Salt Reactor Experiment (MSRE) to perform reactor physics measurements in the LR-0 low power nuclear reactor. These experiments are intended to inform on neutron spectral effects and nuclear data uncertainties for advanced reactor systems utilizing FLiBe salt in a thermal neutron energy spectrum. Oak Ridge National Laboratory (ORNL) is performing sensitivity/uncertainty (S/U) analysis of these planned experiments as part of the ongoing collaboration between the United States and the Czech Republic on civilian nuclear energy research and development. The objective of these analyses is to produce the sensitivity of neutron multiplication to cross section data on an energy-dependent basis for specific nuclides. This report provides a status update on the S/U analyses of critical experiments at the LR-0 Reactor relevant to fluoride salt-cooled high temperature reactor (FHR) and liquid-fueled molten salt reactor (MSR) concepts. The S/U analyses will be used to inform design of FLiBe-based experiments using the salt from MSRE.

  7. Status Report on Scoping Reactor Physics and Sensitivity/Uncertainty Analysis of LR-0 Reactor Molten Salt Experiments

    Brown, Nicholas R. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Reactor and Nuclear Systems Division; Mueller, Donald E. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Reactor and Nuclear Systems Division; Patton, Bruce W. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Reactor and Nuclear Systems Division; Powers, Jeffrey J. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Reactor and Nuclear Systems Division

    2016-08-31

    Experiments are being planned at Research Centre Rež (RC Rež) to use the FLiBe (2 7LiF-BeF2) salt from the Molten Salt Reactor Experiment (MSRE) to perform reactor physics measurements in the LR-0 low power nuclear reactor. These experiments are intended to inform on neutron spectral effects and nuclear data uncertainties for advanced reactor systems utilizing FLiBe salt in a thermal neutron energy spectrum. Oak Ridge National Laboratory (ORNL) is performing sensitivity/uncertainty (S/U) analysis of these planned experiments as part of the ongoing collaboration between the United States and the Czech Republic on civilian nuclear energy research and development. The objective of these analyses is to produce the sensitivity of neutron multiplication to cross section data on an energy-dependent basis for specific nuclides. This report provides a status update on the S/U analyses of critical experiments at the LR-0 Reactor relevant to fluoride salt-cooled high temperature reactor (FHR) and liquid-fueled molten salt reactor (MSR) concepts. The S/U analyses will be used to inform design of FLiBe-based experiments using the salt from MSRE.

  8. Exposición al humo ambiental de tabaco en locales de hostelería de Barcelona: medición de partículas respirables Second-hand smoke exposure in hospitality venues in Barcelona: measurement of respirable particles

    Nazmy Villarroel

    2011-06-01

    Full Text Available Objetivo: Medir la concentración de partículas respirables de tamaño igual o menor que 2,5µm (PM2,5 como marcador del humo ambiental de tabaco (HAT en locales de hostelería de Barcelona 2 años después de la entrada en vigor de la Ley 28/2005. Métodos: Se trata de un estudio descriptivo transversal. La población de estudio fueron 40 locales de la ciudad de Barcelona seleccionados por muestreo de ruta aleatoria con representación de los distintos tipos de regulación existentes tras la aplicación de la Ley (permitido fumar, prohibido fumar y locales con zonas para fumadores y no fumadores. El trabajo de campo se realizó entre octubre y diciembre de 2007. El HAT se cuantificó determinando las PM2,5 con un monitor con fotómetro láser (Side Pack AM 510 Personal Aerosol Monitor. Se realizaron mediciones iniciales de 5 minutos en el exterior del local y de 30 minutos en el interior. Además, se recogieron variables de tipo observacional relacionadas con las características del local y los signos de consumo tabaco. Resultados: La concentración de PM2,5 en los locales donde se permite fumar es cinco veces más alta que en los que se ha prohibido (182 µg/m³ y 34 µg/m³, respectivamente, y supera la concentración establecida como perjudicial por la Environmental Protection Agency: de Estados Unidos (35 µg/m³. En aquellos locales en que se ha prohibido fumar, la concentración de PM2,5 no supera este estándar ni muestra diferencias significativas con la concentración en el exterior del local. Conclusiones: Dos años después de la entrada en vigor de la Ley de medidas sanitarias frente al tabaquismo, la exposición al HAT en los locales de hostelería donde se permitía fumar seguía siendo muy alta. Esto suponía un importante riesgo para la salud de los trabajadores de este sector.Objectives: To quantify the concentration of respirable particles equal to or smaller than 2.5 µm (PM2.5 as a marker of second-hand smoke (SHS exposure

  9. Insulin resistance in HIV-infected youth is associated with decreased mitochondrial respiration.

    Takemoto, Jody K; Miller, Tracie L; Wang, Jiajia; Jacobson, Denise L; Geffner, Mitchell E; Van Dyke, Russell B; Gerschenson, Mariana

    2017-01-02

    To identify relationships between insulin resistance (IR) and mitochondrial respiration in perinatally HIV-infected youth. Case-control study. Mitochondrial respiration was assessed in perinatally HIV-infected youth in Tanner stages 2-5, 25 youth with IR (IR+) and 50 without IR (IR-) who were enrolled in the Pediatric HIV/AIDS Cohort Study. IR was defined as a homeostatic model of assessment for IR value at least 4.0. A novel, high-throughput oximetry method was used to evaluate cellular respiration in peripheral blood mononuclear cells. Unadjusted and adjusted differences in mitochondrial respiration markers between IR+ and IR- were evaluated, as were correlations between mitochondrial respiration markers and biochemical measurements. IR+ and IR- youth were similar on age, sex, and race/ethnicity. Mean age was 16.5 and 15.6 years in IR+ and IR-, respectively. The IR+ group had significantly higher mean BMI and metabolic analytes (fasting glucose, insulin, cholesterol, triglycerides, and venous lactate and pyruvate) compared with the IR-. Mitochondrial respiration markers were, on average, lower in the IR+ compared with IR-, including basal respiration (417.5 vs. 597.5 pmol, P = 0.074), ATP production (11 513 vs. 15 202 pmol, P = 0.078), proton leak (584.6 vs. 790.0 pmol, P = 0.033), maximal respiration (1815 vs. 2399 pmol, P = 0.025), and spare respiration capacity (1162 vs. 2017 pmol, P = 0.032). Nonmitochondrial respiration did not differ by IR status. The results did not change when adjusted for age. HIV-infected youth with IR have lower mitochondrial respiration markers when compared to youth without IR. Disordered mitochondrial respiration may be a potential mechanism for IR in this population.

  10. Glycolysis-respiration relationships in a neuroblastoma cell line.

    Swerdlow, Russell H; E, Lezi; Aires, Daniel; Lu, Jianghua

    2013-04-01

    Although some reciprocal glycolysis-respiration relationships are well recognized, the relationship between reduced glycolysis flux and mitochondrial respiration has not been critically characterized. We concomitantly measured the extracellular acidification rate (ECAR) and oxygen consumption rate (OCR) of SH-SY5Y neuroblastoma cells under free and restricted glycolysis flux conditions. Under conditions of fixed energy demand ECAR and OCR values showed a reciprocal relationship. In addition to observing an expected Crabtree effect in which increasing glucose availability raised the ECAR and reduced the OCR, a novel reciprocal relationship was documented in which reducing the ECAR via glucose deprivation or glycolysis inhibition increased the OCR. Substituting galactose for glucose, which reduces net glycolysis ATP yield without blocking glycolysis flux, similarly reduced the ECAR and increased the OCR. We further determined how reduced ECAR conditions affect proteins that associate with energy sensing and energy response pathways. ERK phosphorylation, SIRT1, and HIF1a decreased while AKT, p38, and AMPK phosphorylation increased. These data document a novel intracellular glycolysis-respiration effect in which restricting glycolysis flux increases mitochondrial respiration. Since this effect can be used to manipulate cell bioenergetic infrastructures, this particular glycolysis-respiration effect can practically inform the development of new mitochondrial medicine approaches. Copyright © 2012 Elsevier B.V. All rights reserved.

  11. Video-based respiration monitoring with automatic region of interest detection

    Janssen, R.J.M.; Wang, Wenjin; Moço, A.; de Haan, G.

    2016-01-01

    Vital signs monitoring is ubiquitous in clinical environments and emerging in home-based healthcare applications. Still, since current monitoring methods require uncomfortable sensors, respiration rate remains the least measured vital sign. In this paper, we propose a video-based respiration

  12. Design of climate respiration chambers, adjustable to the metabolic mass of subjects

    Heetkamp, M.J.W.; Alferink, S.J.J.; Zandstra, T.; Hendriks, P.; Brand, van den H.; Gerrits, W.J.J.

    2015-01-01

    Open-circuit respiration chambers can be used to measure gas exchange and to calculate heat production (Q) of humans and animals. When studying short-term changes in Q, the size of the respiration chamber in relation to the subject of study is a point of concern. The washout time of a chamber,

  13. Contribution of bacterial respiration to plankton respiration from 50°N to 44°S in the Atlantic Ocean

    García-Martín, E. E.; Aranguren-Gassis, M.; Hartmann, M.; Zubkov, M. V.; Serret, P.

    2017-11-01

    Marine bacteria play an important role in the global cycling of carbon and therefore in climate regulation. However, the paucity of direct measurements means that our understanding of the magnitude and variability of bacterial respiration in the ocean is poor. Estimations of respiration in the 0.2-0.8 μm size-fraction (considered as bacterial respiration), total plankton community respiration, and the contribution of bacterial respiration to total plankton community respiration were made along two latitudinal transects in the Atlantic Ocean (ca. 50°N-44°S) during 2010 and 2011. Two different methodologies were used: determination of changes in dissolved O2 concentration after standard 24 h dark bottle incubations, and measurements of in vivo reduction of 2-(ρ-iodophenyl)-3-(ρ-nitrophenyl)-5phenyl tetrazolium salt (INT). There was an overall significant correlation (r = 0.44, p community respiration estimated by both methods. Depth-integrated community respiration varied as much as threefold between regions. Maximum rates occurred in waters of the western European shelf and Patagonian shelf, and minimum rates in the North and South oligotrophic gyres. Depth-integrated bacterial respiration followed the same pattern as community respiration. There was a significantly higher cell-specific bacterial respiration in the northern subtropical gyre than in the southern subtropical gyre which suggests that bacterial carbon turnover is faster in the northern gyre. The relationships between plankton respiration and physicochemical and biological variables were different in different years. In general, INTT was correlated to both chlorophyll-a and bacterial abundance, while INT0.2-0.8 was only correlated with bacterial abundance. However, in 2010 INTT and INT0.2-0.8 were also correlated with temperature and primary production while in 2011 they were correlated with nitrate + nitrite concentration. The bacterial contribution to depth integrated community respiration was

  14. Tillage Effects on Soil Properties & Respiration

    Rusu, Teodor; Bogdan, Ileana; Moraru, Paula; Pop, Adrian; Duda, Bogdan; Cacovean, Horea; Coste, Camelia

    2015-04-01

    Soil tillage systems can be able to influence soil compaction, water dynamics, soil temperature and soil structural condition. These processes can be expressed as changes of soil microbiological activity, soil respiration and sustainability of agriculture. Objectives of this study were: 1) to assess the effects of tillage systems (Conventional System-CS, Minimum Tillage-MT, No-Tillage-NT) on soil compaction, soil temperature, soil moisture and soil respiration and 2) to establish the relationship that exists in changing soil properties. Three treatments were installed: CS-plough + disc; MT-paraplow + rotary grape; NT-direct sowing. The study was conducted on an Argic-Stagnic Faeoziom. The MT and NT applications reduce or completely eliminate the soil mobilization, due to this, soil is compacted in the first year of application. The degree of compaction is directly related to soil type and its state of degradation. The state of soil compaction diminished over time, tending toward a specific type of soil density. Soil moisture was higher in NT and MT at the time of sowing and in the early stages of vegetation and differences diminished over time. Moisture determinations showed statistically significant differences. The MT and NT applications reduced the thermal amplitude in the first 15 cm of soil depth and increased the soil temperature by 0.5-2.20C. The determinations confirm the effect of soil tillage system on soil respiration; the daily average was lower at NT (315-1914 mmoli m-2s-1) and followed by MT (318-2395 mmoli m-2s-1) and is higher in the CS (321-2480 mmol m-2s-1). Comparing with CS, all the two conservation tillage measures decreased soil respiration, with the best effects of no-tillage. An exceeding amount of CO2 produced in the soil and released into the atmosphere, resulting from aerobic processes of mineralization of organic matter (excessive loosening) is considered to be not only a way of increasing the CO2 in the atmosphere, but also a loss of

  15. SR and LR Union Suture for the Treatment of Myopic Strabismus Fixus: Is Scleral Fixation Necessary?

    Carol P. S. Lam

    2015-01-01

    Full Text Available Purpose. To evaluate and compare the effectiveness of scleral fixation SR and LR union suture and nonscleral fixation union suture for the treatment of myopic strabismus fixus. Methods. Retrospective review of 32 eyes of 22 patients with myopic strabismus fixus who had undergone union suture of superior rectus (SR and lateral rectus (LR with or without scleral fixation, and follow-up longer than 6 months at Hong Kong Eye Hospital from 2006 to 2013. Surgical techniques and outcomes in terms of ocular alignment are analyzed. Results. There is significant overall improvement both in postoperative angle of esodeviation (P0.05. Conclusions. Union suture of SR and LR is an effective procedure in correcting myopic strabismus fixus. Fixation of the union suture to the sclera does not improve surgical outcome.

  16. Pitavastatin attenuates the PDGF-induced LR11/uPA receptor-mediated migration of smooth muscle cells

    Jiang, Meizi; Bujo, Hideaki; Zhu, Yanjuan; Yamazaki, Hiroyuki; Hirayama, Satoshi; Kanaki, Tatsuro; Shibasaki, Manabu; Takahashi, Kazuo; Schneider, Wolfgang J.; Saito, Yasushi

    2006-01-01

    Statins, inhibitors of HMG-CoA reductase, elicit various actions on vascular cells including the modulation of proliferation and migration of smooth muscle cells (SMCs). Here, we have elucidated the mechanism by which statins, in particular pitavastatin, attenuate the migration activity of SMCs. The expression of LR11, a member of the LDL receptor family and an enhancer of cell surface localization of urokinase-type plasminogen activator receptor (uPAR), is increased in cultured SMCs by treatment with PDGF-BB. Pitavastatin attenuates the PDGF-BB -induced surface expression of LR11 and uPAR. The increased migration of SMCs observed both upon overexpression of LR11 and via stimulation of secretion of soluble LR11 is not reversed by pitavastatin. In vivo studies showed that the SMCs expressing LR11 in plaques are almost congruent with intimal cells expressing nonmuscle myosin heavy chain (SMemb). Pitavastatin reduced the expression of LR11 and SMemb, and the levels of LR11, uPAR, and SMemb in cultured intimal SMCs were reduced to those seen in medial SMCs. We propose that this statin reduces PDGF-induced migration through the attenuation of the LR11/uPAR system in SMCs. Modulation of the LR11/uPAR system with statins suggests a novel treatment strategy for atherogenesis based on suppression of intimal SMC migration

  17. Microcystin-LR induces anoikis resistance to the hepatocyte uptake transporter OATP1B3-expressing cell lines

    Takano, Hiroyuki; Takumi, Shota; Ikema, Satoshi; Mizoue, Nozomi; Hotta, Yuki; Shiozaki, Kazuhiro; Sugiyama, Yasumasa; Furukawa, Tatsuhiko; Komatsu, Masaharu

    2014-01-01

    Microcystin-LR is a cyclic peptide released by several bloom-forming cyanobacteria. Understanding the mechanism of microcystin-LR toxicity is important, because of the both potencies of its acute cytotoxicity and tumor-promoting activity in hepatocytes of animals and humans. Recently, we have reported that the expression of human hepatocyte uptake transporter OATP1B3 was critical for the selective uptake of microcystin-LR into hepatocytes and for induction of its fatal cytotoxicity. In this study, we demonstrated a novel function of microcystin-LR which induced bipotential changes including anoikis resistance and cytoskeleton reorganization to OATP1B3-transfected HEK293 cells (HEK293-OATP1B3). After exposure to microcystin-LR, HEK293-OATP1B3 cells were divided to the floating cells and remaining adherent cells. After collection and reseeding the floating cells into a fresh flask, cells were confluently proliferated (HEK293-OATP1B3-FL) under the microcystin-LR-free condition. Both the proliferated HEK293-OATP1B3-FL and remaining adherent HEK293-OATP1B3-AD cells changed the character with down- and up-regulation of E-cadherin, respectively. Additionally, these cells acquired resistance to microcystin-LR. These results suggest that microcystin-LR could be associated with not only tumor promotion, but also epithelial–mesenchymal transition-mediated cancer metastasis. Furthermore, microcystin-LR might induce the cytoskeleton reorganization be accompanied epithelial–mesenchymal transition

  18. Combined toxicity of microcystin-LR and copper on lettuce (Lactuca sativa L.).

    Cao, Qing; Steinman, Alan D; Wan, Xiang; Xie, Liqiang

    2018-05-10

    Microcystins and copper commonly co-exist in the natural environment, but their combined toxicity remains unclear, especially in terrestrial plants. The present study investigated the toxicity effects of microcystin-LR (0, 5, 50, 500, 1000 μg L -1 ) and copper (0, 50, 500, 1000, 2000 μg L -1 ), both individually and in mixture, on the germination, growth and oxidative response of lettuce. The bioaccumulation of microcystin-LR and copper was also evaluated. Results showed that the decrease in lettuce germination induced by copper alone was not significantly different from that induced by the mixture, and the combined toxicity assessment showed a simple additive effect. Lettuce growth was not significantly reduced by microcystin-LR alone, whereas it was significantly reduced by copper alone and the mixture when copper concentration was higher than 500 μg L -1 . High concentrations of microcystin-LR (1000 μg L -1 ) and copper (≥50 μg L -1 ),as well as their mixture (≥50 + 500 μg L -1 ), induced oxidative stress in lettuce. A synergistic effect on the growth and antioxidative system of lettuce was observed when exposed to low concentrations of the mixture (≤50 + 500 μg L -1 ), whereas an antagonistic effect was observed at high concentrations (≥1000 + 2000 μg L -1 ). Moreover, the interaction of microcystin-LR and copper can increase their accumulation in lettuce. Our results suggest that the toxicity effects of microcystin-LR and copper are exacerbated when they co-exist in the natural environment at low concentrations, which not only negatively affects plant growth but also poses a potential risk to human health via the food chain. Copyright © 2018. Published by Elsevier Ltd.

  19. Estimation of microbial respiration rates in groundwater by geochemical modeling constrained with stable isotopes

    Murphy, E.M.

    1998-01-01

    Changes in geochemistry and stable isotopes along a well-established groundwater flow path were used to estimate in situ microbial respiration rates in the Middendorf aquifer in the southeastern United States. Respiration rates were determined for individual terminal electron acceptors including O 2 , MnO 2 , Fe 3+ , and SO 4 2- . The extent of biotic reactions were constrained by the fractionation of stable isotopes of carbon and sulfur. Sulfur isotopes and the presence of sulfur-oxidizing microorganisms indicated that sulfate is produced through the oxidation of reduced sulfur species in the aquifer and not by the dissolution of gypsum, as previously reported. The respiration rates varied along the flow path as the groundwater transitioned between primarily oxic to anoxic conditions. Iron-reducing microorganisms were the largest contributors to the oxidation of organic matter along the portion of the groundwater flow path investigated in this study. The transition zone between oxic and anoxic groundwater contained a wide range of terminal electron acceptors and showed the greatest diversity and numbers of culturable microorganisms and the highest respiration rates. A comparison of respiration rates measured from core samples and pumped groundwater suggests that variability in respiration rates may often reflect the measurement scales, both in the sample volume and the time-frame over which the respiration measurement is averaged. Chemical heterogeneity may create a wide range of respiration rates when the scale of the observation is below the scale of the heterogeneity

  20. Diagnostics on LALR(k) conflicts based on a method for LR(k) testing

    Kristensen, Bent Bruun; Madsen, Ole Lehrmann

    1981-01-01

    A user of an LALR(k) parser generator system may have difficulties in understanding how a given LALR(k) conflict is generated. This is especially difficult if the conflict does not correspond to an LR(k) conflict. A practical method for giving informative diagnostics on LALR(k) conflicts is prese......A user of an LALR(k) parser generator system may have difficulties in understanding how a given LALR(k) conflict is generated. This is especially difficult if the conflict does not correspond to an LR(k) conflict. A practical method for giving informative diagnostics on LALR(k) conflicts...

  1. Detoxification of microcystin-LR in water by Portulaca oleracea cv.

    Isobe, Takatoshi; Okuhata, Hiroshi; Miyasaka, Hitoshi; Jeon, Bong-Seok; Park, Ho-Dong

    2014-03-01

    Microcystin-LR (0.02 μg/ml) in the hydroculture medium of Portulaca oleracea cv., became below the detection level (<0.0001 μg/ml) by HPLC analysis after 7 days. The toxicity of microcystin estimated with protein phosphatase inhibition assay, however, remained at 37% of the initial level, indicating that microcystin-LR was transformed by P. oleracea cv. into unknown compound(s) of lower toxicity. Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  2. 75 FR 29699 - Total Inward Leakage Requirements for Respirators

    2010-05-27

    ... or other half-mask respirator inward leakage measurement, and offer any additional comments on the..., facsimile (412) 386-4089, e-mail [email protected] . SUPPLEMENTARY INFORMATION: I. Background The Department of... order to conduct tests and prepare responses. On April 20, 2010, NIOSH responded by reopening the docket...

  3. 30 CFR 71.100 - Respirable dust standard.

    2010-07-01

    ... concentration of respirable dust in the mine atmosphere during each shift to which each miner in the active... shall be measured with an approved sampling device and expressed in terms of an equivalent concentration determined in accordance with § 71.206 (Approved sampling devices; equivalent concentrations). ...

  4. Gap filling strategies and error in estimating annual soil respiration

    Soil respiration (Rsoil) is one of the largest CO2 fluxes in the global carbon (C) cycle. Estimation of annual Rsoil requires extrapolation of survey measurements or gap-filling of automated records to produce a complete time series. While many gap-filling methodologies have been employed, there is ...

  5. Dependence of Soil Respiration on Soil Temperature and Soil Moisture in Successional Forests in Southern China

    Xu-Li Tang; Guo-Yi Zhou; Shu-Guang Liu; De-Qiang Zhang; Shi-Zhong Liu; Jiong Li; Cun-Yu Zhou

    2006-01-01

    The spatial and temporal variations in soil respiration and its relationship with biophysical factors in forests near the Tropic of Cancer remain highly uncertain. To contribute towards an improvement of actual estimates, soil respiration rates, soil temperature, and soil moisture were measured in three successional subtropical forests at the Dinghushan Nature Reserve (DNR) in southern China from March 2003 to February 2005. The overall objective of the present study was to analyze the temporal variations of soil respiration and its biophysical dependence in these forests. The relationships between biophysical factors and soil respiration rates were compared in successional forests to test the hypothesis that these forests responded similarly to biophysical factors. The seasonality of soil respiration coincided with the seasonal climate pattern, with high respiration rates in the hot humid season (April-September) and with low rates in the cool dry season (October-March). Soil respiration measured at these forests showed a clear increasing trend with the progressive succession. Annual mean (± SD) soil respiration rate in the DNR forests was (9.0±4.6) Mg CO2-C/hm2 per year, ranging from (6.1±3.2) Mg CO2-C/hm2 per year in early successional forests to (10.7±4.9) Mg CO2-C/hm2 per year in advanced successional forests. Soil respiration was correlated with both soil temperature and moisture. The T/M model, where the two biophysical variables are driving factors, accounted for 74%-82% of soil respiration variation in DNR forests. Temperature sensitivity decreased along progressive succession stages, suggesting that advanced-successional forests have a good ability to adjust to temperature. In contrast, moisture increased with progressive succession processes. This increase is caused, in part, by abundant respirators in advanced-successional forest, where more soil moisture is needed to maintain their activities.

  6. Dependence of soil respiration on soil temperature and soil moisture in successional forests in Southern China

    Tang, X.-L.; Zhou, G.-Y.; Liu, S.-G.; Zhang, D.-Q.; Liu, S.-Z.; Li, Ji; Zhou, C.-Y.

    2006-01-01

    The spatial and temporal variations in soil respiration and its relationship with biophysical factors in forests near the Tropic of Cancer remain highly uncertain. To contribute towards an improvement of actual estimates, soil respiration rates, soil temperature, and soil moisture were measured in three successional subtropical forests at the Dinghushan Nature Reserve (DNR) in southern China from March 2003 to February 2005. The overall objective of the present study was to analyze the temporal variations of soil respiration and its biophysical dependence in these forests. The relationships between biophysical factors and soil respiration rates were compared in successional forests to test the hypothesis that these forests responded similarly to biophysical factors. The seasonality of soil respiration coincided with the seasonal climate pattern, with high respiration rates in the hot humid season (April-September) and with low rates in the cool dry season (October-March). Soil respiration measured at these forests showed a clear increasing trend with the progressive succession. Annual mean (±SD) soil respiration rate in the DNR forests was (9.0 ± 4.6) Mg CO2-C/hm2per year, ranging from (6.1 ± 3.2) Mg CO2-C/hm2per year in early successional forests to (10.7 ± 4.9) Mg CO2-C/hm2 per year in advanced successional forests. Soil respiration was correlated with both soil temperature and moisture. The T/M model, where the two biophysical variables are driving factors, accounted for 74%-82% of soil respiration variation in DNR forests. Temperature sensitivity decreased along progressive succession stages, suggesting that advanced-successional forests have a good ability to adjust to temperature. In contrast, moisture increased with progressive succession processes. This increase is caused, in part, by abundant respirators in advanced-successional forest, where more soil moisture is needed to maintain their activities.

  7. Soil and Root Respiration Under Elevated CO2 Concentrations During Seedling Growth of Pinus sylvestris var. sylvestriformis

    2007-01-01

    The objectives of this study were to investigate the effect of higher CO2 concentrations (500 and 700 μmol mol-1) in atmosphere on total soil respiration and the contribution of root respiration to total soil respiration during seedling growth of Pinus sylvestris var. sylvestriformis. During the four growing seasons (May-October) from 1999 to 2003, the seedlings were exposed to elevated concentrations of CO2 in open-top chambers. The total soil respiration and contribution of root respiration were measured using an LI-6400-09 soil CO2 flux chamber on June 15 and October 8, 2003. To separate root respiration from total soil respiration, three PVC cylinders were inserted approximately 30 cm deep into the soil in each chamber. There were marked diurnal changes in air and soil temperatures on June 15. Both the total soil respiration and the soil respiration without roots showed a strong diurnal pattern, increasing from before sunrise to about 14:00in the afternoon and then decreasing before the next sunrise. No increase in the mean total soil respiration and mean soil respiration with roots severed was observed under the elevated CO2 treatments on June 15, 2003, as compared to the open field and control chamber with ambient CO2. However, on October 8, 2003, the total soil respiration and soil respiration with roots severed in the open field were lower than those in the control and elevated CO2 chambers. The mean contribution of root respiration measured on June 15, 2003, ranged from 8.3% to 30.5% and on October 8, 2003,from 20.6% to 48.6%.

  8. Prospective evaluation of IOTA logistic regression models LR1 and LR2 in comparison with subjective pattern recognition for diagnosis of ovarian cancer in an outpatient setting.

    Nunes, N; Ambler, G; Foo, X; Widschwendter, M; Jurkovic, D

    2018-06-01

    To determine whether International Ovarian Tumor Analysis (IOTA) logistic regression models LR1 and LR2 developed for the preoperative diagnosis of ovarian cancer could also be used to differentiate between benign and malignant adnexal tumors in the population of women attending gynecology outpatient clinics. This was a single-center prospective observational study of consecutive women attending our gynecological diagnostic outpatient unit, recruited between May 2009 and January 2012. All the women were first examined by a Level-II ultrasound operator. In those diagnosed with adnexal tumors, the IOTA-LR1/2 protocol was used to evaluate the masses. The LR1 and LR2 models were then used to assess the risk of malignancy. Subsequently, the women were also examined by a Level-III examiner, who used pattern recognition to differentiate between benign and malignant tumors. Women with an ultrasound diagnosis of malignancy were offered surgery, while asymptomatic women with presumed benign lesions were offered conservative management with a minimum follow-up of 12 months. The initial diagnosis was compared with two reference standards: histological findings and/or a comparative assessment of tumor morphology on follow-up ultrasound scans. All women for whom the tumor classification on follow-up changed from benign to malignant were offered surgery. In the final analysis, 489 women who had either or both of the reference standards were included. Their mean age was 50 years (range, 16-91 years) and 45% were postmenopausal. Of the included women, 342/489 (69.9%) had surgery and 147/489 (30.1%) were managed conservatively. The malignancy rate was 137/489 (28.0%). Overall, sensitivities of LR1 and LR2 for the diagnosis of malignancy were 97.1% (95% CI, 92.7-99.2%) and 94.9% (95% CI, 89.8-97.9%) and specificities were 77.3% (95% CI, 72.5-81.5%) and 76.7% (95% CI, 71.9-81.0%), respectively (P > 0.05). In comparison with pattern recognition (sensitivity 94.2% (95% CI, 88

  9. A novel photocatalytic material for removing microcystin-LR under visible light irradiation: degradation characteristics and mechanisms.

    Xin Sui

    Full Text Available Microcystin-LR (MC-LR, a common toxic species in contaminated aquatic systems, persists for long periods because of its cyclic structure. Ag3PO4 is an environment-friendly photocatalyst with relatively good degradation capacity for hazardous organic pollutants. This study aimed to investigate the degradation capacity of Ag3PO4 for MC-LR under visible light.An Ag3PO4 photocatalyst was synthesized by the ion-exchange method and characterized by X-ray diffraction, field-emission scanning electron microscope, and UV-Vis spectrophotometer. MC-LR was quantified in each sample through high-performance liquid chromatograph. The degradation efficiency of MC-LR was affected by initial pH, initial Ag3PO4 concentration, initial MC-LR concentration, and recycle experiments. The degradation intermediates of MC-LR were examined by liquid chromatography-mass spectrometry (LC/MS.The degradation process can be well fitted with the pseudo-first-order kinetic model. The maximum MC-LR degradation rate of 99.98% can be obtained within 5 h under the following optimum conditions: pH of 5.01, Ag3PO4 concentration of 26.67 g/L, and MC-LR concentration of 9.06 mg/L. Nine intermediates were detected and analyzed by LC/MS. Three main degradation pathways were proposed based on the molecular weight of the intermediates and the reaction mechanism: (1 hydroxylation on the aromatic ring of Adda, (2 hydroxylation on the diene bonds of Adda, and (3 internal interactions on the cyclic structure of MC-LR.Ag3PO4 is a highly efficient catalyst for MC-LR degradation in aqueous solutions.

  10. Management effects on European cropland respiration

    Eugster, Werner; Moffat, Antje M.; Ceschia, Eric

    2010-01-01

    Increases in respiration rates following management activities in croplands are considered a relevant anthropogenic source of CO2. In this paper, we quantify the impact of management events on cropland respiration fluxes of CO2 as they occur under current climate and management conditions. Our....... This allowed us to address the question of how management activities influence ecosystem respiration. This was done by comparing respiration fluxes during 7, 14, and 28 days after the management with those observed during the matching time period before management. Median increases in respiration ranged from...... than management alone are also important at a given site. Temperature is the climatic factor that showed best correlation with site-specific respiration fluxes. Therefore, the effect of temperature changes between the time periods before and after management were taken into account for a subset of 13...

  11. Prediction of the transition energies of atomic No and Lr by the intermediate Hamiltonian coupled cluster method

    Borschevsky, A.; Eliav, E.; Kaldor, U.; Vilkas, M.J.; Ishikawa, Y.

    2007-01-01

    Complete text of publication follows: Measurements of the spectroscopic properties of the superheavy elements present a serious challenge to the experimentalist. Their short lifetimes and the low quantities of their production necessitate reliable prediction of transition energies to avoid the need for broad wavelength scans and to assist in identifying the lines. Thus, reliable high-accuracy calculations are necessary prior and parallel to experimental research. Nobelium and Lawrencium are at present the two most likely candidates for spectroscopic measurements, with the first experiments planned at GSI, Darmstadt. The intermediate Hamiltonian (IH) coupled cluster method is applied to the ionization potentials, electron affinities, and excitation energies of atomic nobelium and lawrencium. Large basis sets are used (37s31p26d21f16g11h6i). All levels of a particular atom are obtained simultaneously by diagonalizing the IH matrix. The matrix elements correspond to all excitations from correlated occupied orbitals to virtual orbitals in a large P space, and are 'dressed' by folding in excitations to higher virtual orbitals (Q space) at the coupled cluster singles-and-doubles level. Lamb-shift corrections are included. The same approach was applied to the lighter homologues of Lr and No, lutetium and ytterbium, for which many transition energies are experimentally known, in order to assess the accuracy of the calculation. The average absolute error of 20 excitation energies of Lu is 423 cm -1 , and the error limits for Lr are therefore put at 700 cm -1 . Predicted Lr excitations with large transition moments in the prime range for the planned experiment, 20,000-30,000 cm -1 , are 7p → 8s at 20,100 cm -1 and 7p →p 7d at 28,100 cm -1 . In case of Yb, the calculated ionization potential was within 20 cm -1 of the experiment, and the average error of the 20 lowest calculated excitations was about 300 cm -1 . Hence, the error limits of nobelium are set to 800 cm -1

  12. Respirators: Supervisors Self-Study #43442

    Chochoms, Michael [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2016-04-20

    This course, Respirators: Supervisors Self-Study (#43442), addresses training requirements for supervisors of respirator wearers as specified by the American National Standard Institute (ANSI) Standard for Respiratory Protection, ANSI Z88.2, and as incorporated by reference in the Department of Energy (DOE) Worker Health and Safety Rule, 10 Code of Federal Regulations (CFR) 851. This course also presents the responsibilities of supervisors of respirator wearers at Los Alamos National Laboratory (LANL).

  13. Dynamic characteristics of soil respiration in Yellow River Delta wetlands, China

    Wang, Xiao; Luo, Xianxiang; Jia, Hongli; Zheng, Hao

    2018-02-01

    The stable soil carbon (C) pool in coastal wetlands, referred to as "blue C", which has been extensively damaged by climate change and soil degradation, is of importance to maintain global C cycle. Therefore, to investigate the dynamic characteristics of soil respiration rate and evaluate C budgets in coastal wetlands are urgently. In this study, the diurnal and seasonal variation of soil respiration rate in the reed wetland land (RL) and the bare wetland land (BL) was measured in situ with the dynamic gas-infrared CO2 method in four seasons, and the factors impacted on the dynamic characteristics of soil respiration were investigated. The results showed that the diurnal variation of soil respiration rate consistently presented a "U" curve pattern in April, July, and September, with the maximum values at 12:00 a.m. and the minimum values at 6:00 a.m. In the same season, the diurnal soil respiration rate in RL was significantly greater than those in BL (P respiration rate was 0.14, 0.42, and 0.39 μmol m-2 s-1 in RL, 0.05, 0.22, 0.13, and 0.01 μmol m-2 s-1 in BL, respectively. Soil surface temperature was the primary factor that influenced soil respiration, which was confirmed by the exponential positive correlation between the soil respiration rate and soil surface temperature in BL and RL (P respiration, confirming by the significantly negative correlation between soil respiration rate and the content of soluble salt. These results will be useful for understanding the mechanisms underlying soil respiration and elevating C sequestration potential in the coastal wetlands.

  14. Diel hysteresis between soil respiration and soil temperature in a biological soil crust covered desert ecosystem.

    Guan, Chao; Li, Xinrong; Zhang, Peng; Chen, Yongle

    2018-01-01

    Soil respiration induced by biological soil crusts (BSCs) is an important process in the carbon (C) cycle in arid and semi-arid ecosystems, where vascular plants are restricted by the harsh environment, particularly the limited soil moisture. However, the interaction between temperature and soil respiration remains uncertain because of the number of factors that control soil respiration, including temperature and soil moisture, especially in BSC-dominated areas. In this study, the soil respiration in moss-dominated crusts and lichen-dominated crusts was continuously measured using an automated soil respiration system over a one-year period from November 2015 to October 2016 in the Shapotou region of the Tengger Desert, northern China. The results indicated that over daily cycles, the half-hourly soil respiration rates in both types of BSC-covered areas were commonly related to the soil temperature. The observed diel hysteresis between the half-hourly soil respiration rates and soil temperature in the BSC-covered areas was limited by nonlinearity loops with semielliptical shapes, and soil temperature often peaked later than the half-hourly soil respiration rates in the BSC-covered areas. The average lag times between the half-hourly soil respiration rates and soil temperature for both types of BSC-covered areas were two hours over the diel cycles, and they were negatively and linearly related to the volumetric soil water content. Our results highlight the diel hysteresis phenomenon that occurs between soil respiration rates and soil temperatures in BSC-covered areas and the negative response of this phenomenon to soil moisture, which may influence total C budget evaluations. Therefore, the interactive effects of soil temperature and moisture on soil respiration in BSC-covered areas should be considered in global carbon cycle models of desert ecosystems.

  15. Inactivation Kinetics of the Cyanobacterial Toxin Microcystin-LR by Free Chlorine

    Worldwide, the increasing occurrence of toxins produced by cyanobacteria in water bodies used as source waters for drinking water has become an important public health issue. Microcystin-LR is one of the most commonly found cyanotoxins. A detailed evaluation of the free chlorine ...

  16. Bond scission cross sections for alpha-particles in cellulose nitrate (LR115)

    Barillon, R; Chambaudet, A; Katz, R; Stoquert, J P; Pape, A

    1999-01-01

    Chemical damage created by alpha-particles in cellulose nitrate (LR115) have been studied by infrared spectroscopy. This technique enables identifying the sensitive bonds and giving an order of magnitude of their scission cross sections for given alpha-particle energies. The high cross sections observed suggest a new description of the track etch velocity in this material.

  17. Identification of leaf rust resistant gene Lr10 in Pakistani wheat ...

    Leaf (brown) rust is the major disease of wheat in Pakistan and other countries. The disease is more effectively controlled when several rust resistance genes are pyramided into a single line. Molecular survey was conducted to screen 25 Pakistan wheat germplasm for the presence of leaf rust resistance gene Lr10 using ...

  18. Identification of rust resistance genes Lr10 and Sr9a in Pakistani ...

    Identification of rust resistance genes Lr10 and Sr9a in Pakistani wheat germplasm using PCR based molecular markers. M Babar, AF Mashhadi, A Mehvish, AN Zahra, R Waheed, A Hasnain, S ur-Rahman, N Hussain, M Ali, I Khaliq, A Aziz ...

  19. Cardiac, Skeletal, and smooth muscle mitochondrial respiration

    Park, Song-Young; Gifford, Jayson R; Andtbacka, Robert H I

    2014-01-01

    , skeletal, and smooth muscle was harvested from a total of 22 subjects (53±6 yrs) and mitochondrial respiration assessed in permeabilized fibers. Complex I+II, state 3 respiration, an index of oxidative phosphorylation capacity, fell progressively from cardiac, skeletal, to smooth muscle (54±1; 39±4; 15......±1 pmol•s(-1)•mg (-1), prespiration rates were normalized by CS (respiration...... per mitochondrial content), oxidative phosphorylation capacity was no longer different between the three muscle types. Interestingly, Complex I state 2 normalized for CS activity, an index of non-phosphorylating respiration per mitochondrial content, increased progressively from cardiac, skeletal...

  20. Effect of nitrogen on the seasonal course of growth and maintenance respiration in stems of Norway spruce trees.

    Stockfors, Jan; Linder, Sune

    1998-03-01

    To determine effects of stem nitrogen concentration ([N]) on the seasonal course of respiration, rates of stem respiration of ten control and ten irrigated-fertilized (IL), 30-year-old Norway spruce trees (Picea abies (L.) Karst.), growing in northern Sweden, were measured on seven occasions from June 1993 to April 1994. To explore sources of seasonal variation and mechanisms of fertilization effects on respiration, we separated total respiration into growth and maintenance respiration for both xylem and phloem bark. Stem respiration increased in response to the IL treatment and was positively correlated with growth rate, volume of living cells and stem nitrogen content. However, no significant effect of IL treatment or [N] in the living cells was found for respiration per unit volume of live cells. Total stem respiration during the growing season (June to September) was estimated to be 16.7 and 29.7 mol CO(2) m(-2) for control and IL-treated trees, respectively. Respiration during the growing season accounted for approximately 64% of total annual respiration. Depending on the method, estimated growth respiration varied between 40 and 60% of total respiration during the growing season. Between 75 and 80% of the live cell volume in the stems was in the phloem, and phloem maintenance accounted for about 70% of maintenance respiration. Because most of the living cells were found in the phloem, and the living xylem cells were concentrated in the outer growth rings, we concluded that the best base for expressing rates of stem growth and maintenance respiration in young Norway spruce trees is stem surface area.

  1. Oxidation of microcystin-LR by the Fenton process : Kinetics, degradation intermediates, water quality and toxicity assessment

    Park, Jeong-Ann; Yang, Boram; Park, Chanhyuk; Choi, Jae-Woo; van Genuchten, Case M.|info:eu-repo/dai/nl/413489647; Lee, Sang-Hyup

    2017-01-01

    The Fenton process was assessed as a cost-effective technology for the removal of Microcystin-LR (MC-LR) among UV, UV/H2O2, and Fenton process according to efficiency and electrical energy per order (EE/O). The determined practical concentrations of the Fenton reagents were 5 mg/L Fe(II) and 5 mg/L

  2. Influence of the datasets size on the stability of the LR in the lower region of the within source distribution

    Haraksim, Rudolf; Meuwly, Didier

    2013-01-01

    This article focuses on the statistical evaluation of the fingermark evidence using the likelihood ratio (LR) approach. It studies the influence of the quantity of data used to model the within (WS) and between (BS) source variability. The LR system built for the experiment uses an Automated

  3. A Multi-Walled Carbon Nanotube-based Biosensor for Monitoring Microcystin-LR in Sources of Drinking Water Supplies

    A multi-walled carbon nanotube-based electrochemical biosensor is developed for monitoring microcystin-LR (MC-LR), a toxic cyanobacterial toxin, in sources of drinking water supplies. The biosensor electrodes are fabricated using dense, mm-long multi-walled CNT (MWCNT) arrays gro...

  4. Solar photo-Fenton treatment of microcystin-LR in aqueous environment: Transformation products and toxicity in different water matrices

    Transformation products and toxicity patterns of microcystin-LR (MC-LR), a common cyanotoxin in freshwaters, during degradation by solar photo-Fenton process were studied in the absence and presence of two major water components, namely fulvic acid and alkalinity. The transformat...

  5. Lymphocyte respiration in children with Trisomy 21

    Aburawi Elhadi H

    2012-12-01

    Full Text Available Abstract Background This study measured lymphocyte mitochondrial O2 consumption (cellular respiration in children with trisomy 21. Methods Peripheral blood mononuclear cells were isolated from whole blood of trisomy 21 and control children and these cells were immediately used to measure cellular respiration rate. [O2] was determined as a function of time from the phosphorescence decay rates (1/τ of Pd (II-meso-tetra-(4-sulfonatophenyl-tetrabenzoporphyrin. In sealed vials containing lymphocytes and glucose as a respiratory substrate, [O2] declined linearly with time, confirming the zero-order kinetics of O2 conversion to H2O by cytochrome oxidase. The rate of respiration (k, in μM O2 min-1, thus, was the negative of the slope of [O2] vs. time. Cyanide inhibited O2 consumption, confirming that oxidation occurred in the mitochondrial respiratory chain. Results For control children (age = 8.8 ± 5.6 years, n = 26, the mean (± SD value of kc (in μM O2 per min per 107 cells was 1.36 ± 0.79 (coefficient of variation, Cv = 58%; median = 1.17; range = 0.60 to 3.12; -2SD = 0.61. For children with trisomy 21 (age = 7.2 ± 4.6 years, n = 26, the values of kc were 0.82 ± 0.62 (Cv = 76%; median = 0.60; range = 0.20 to 2.80, pp6.1 mU/L. Fourteen of 26 (54% children with trisomy 21 had kc values of 0.20 to 0.60 (i.e., kc positively correlated with body-mass index (BMI, R >0.302, serum creatinine (R >0.507, blood urea nitrogen (BUN, R >0.535 and albumin (R >0.446. Conclusions Children with trisomy 21 in this study have reduced lymphocyte bioenergetics. The clinical importance of this finding requires further studies.

  6. [Effects of Warming and Straw Application on Soil Respiration and Enzyme Activity in a Winter Wheat Cropland].

    Chen, Shu-tao; Sang, Lin; Zhang, Xu; Hu, Zheng-hua

    2016-02-15

    In order to investigate the effects of warming and straw application on soil respiration and enzyme activity, a field experiment was performed from November 2014 to May 2015. Four treatments, which were control (CK), warming, straw application, and warming and straw application, were arranged in field. Seasonal variability in soil respiration, soil temperature and soil moisture for different treatments were measured. Urease, invertase, and catalase activities for different treatments were measured at the elongation, booting, and anthesis stages. The results showed that soil respiration in different treatments had similar seasonal variation patterns. Seasonal mean soil respiration rates for the CK, warming, straw application, and warming and straw application treatments were 1.46, 1.96, 1.92, and 2.45 micromol x (m2 x s)(-1), respectively. ANOVA indicated that both warming and straw applications significantly (P soil respiration compared to the control treatment. The relationship between soil respiration and soil temperature in different treatments fitted with the exponential regression function. The exponential regression functions explained 34.3%, 28.1%, 24.6%, and 32.0% variations of soil respiration for CK, warming, straw application, and warming and straw application treatments, respectively. Warming and straw applications significantly (P soil respiration and urease activity fitted with a linear regression function, with the P value of 0.061. The relationship between soil respiration and invertase (P = 0.013), and between soil respiration and catalase activity (P = 0.002) fitted well with linear regression functions.

  7. Tissue distribution, excretion and hepatic biotransformation of microcystin-LR in mice

    Robinson, N.A.; Pace, J.G.; Matson, C.F.; Miura, G.A.; Lawrence, W.B.

    1991-01-01

    The distribution, excretion and hepatic metabolism of [3H]microcystin-LR (sublethal i.v.) were measured in mice. Plasma elimination was biexponential with alpha- and beta-phase half-lives of 0.8 and 6.9 min, respectively. At 60 min, liver contained 67 +/- 4% of dose. Through the 6-day study the amount of hepatic radioactivity did not change whereas 23.7 +/- 1.7% of the dose was excreted; 9.2 +/- 1.0% in urine and 14.5 +/- 1.1% in feces. Approximately 60% of the urine and fecal radiolabel 6 and 12 hr postinjection was the parent toxin. Hepatic cytosol, which contained 70 +/- 2% of the hepatic radiolabel (1 hr through 6 days), was prepared for high-performance liquid chromatography analysis by heat denaturation, pronase digestion and C18 Sep Pak extraction. At 1 hr, 35 +/- 2% of the radiolabel was insoluble or C18 Sep Pak-bound; 43 +/- 3% was associated with a peak of retention time (rt) 6.6 min, and 16 +/- 3% with the parent toxin (rt 9.4 min). After 6 days, 8 +/- 1% was C18 Sep Pak-bound or insoluble; 5 +/- 0% occurred at rt 6.6 min, 17 +/- 1% with parent and 60 +/- 2% was associated with rt 8.1 min. Two other peaks, rt 4.9 and 5.6 min, appeared transiently. Analysis of hepatic cytosol by desalting chromatography under nondenaturing and denaturing conditions revealed that all of the radiolabel was associated with cytosolic components, and 83 +/- 5% was bound covalently through 1 day. By day 6 the amount of covalently bound isotope decreased to 42 +/- 11%. This is the first study to describe the long-term hepatic retention of microcystin toxin and documents putative detoxication products

  8. The Effect of Restoration on Soil Respiration in an Urban Tidal Wetland in the Meadowlands, New Jersey

    Schafer, K. V.; Kurepa, S.; Duman, T.; Scott, M.; Pechmann, I.; Vanderklein, D. W.

    2017-12-01

    The effect of wetland restoration on soil respiration in tidal brackish marshes has not been comprehensively studied. In New Jersey, common mitigation efforts come in the form of the removal of an invasive haplotype of Phragmites australis and replanting of native species, resulting in significant habitat disturbance. This study investigated the differences in soil respiration within and between areas covered with P. australis, Spartina alterniflora, and Spartina patens. We performed static chamber measurements of soil respiration using an infrared gas analyzer to measure CO2 fluxes in a natural site and a mitigated site in the Meadowlands of New Jersey. Daytime measurements were performed in 10 random locations in areas populated with each of the vegetation types, to represent the spatial heterogeneity of the wetland area, during summer 2017. Due to the nature of the wetland, vegetation had to be removed to uncover the soil. Prior to measuring exposed soil respiration, we therefore measured CO2 flux including the vegetation within the chamber, which allowed us to additionally calculate the respiration including the vegetation. Furthermore, we assessed direct respiration of green leaves with leaf gas exchange measurements. Combining these different methodologies and scales allow us to estimate the function of different components that contribute to total respiration from the wetland, and how they change spatially and temporally. Initial results showed that soil respiration in P. australis patches was much higher than in both Spartina species, however average vegetation respiration per unit mass was similar across all three. Vegetation respiration and soil respiration are of the same order of magnitude in all three species as well. Also, when respiration with and without vegetation was combined, P. australis showed a considerably higher flux.

  9. Soil respiration in Mexico: Advances and future directions

    Alejandro Cueva

    2016-07-01

    Full Text Available Soil respiration (RS is a CO2 efflux from the soil to the atmosphere defined as the sum of autotrophic (respiration by roots and mycorrhizae, and heterotrophic (respiration of microorganisms that decompose fractions of organic matter and of soil fauna respiration. Globally, RS is considered to be the second largest flux of C to the atmosphere. From published literature it is clear that its main controls are soil temperature, soil moisture, photosynthesis, organic matter inputs and soil biota composition. Despite its relevance in C cycle science, there have been only twenty eight studies in Mexico in the last decade where direct measurement of gas exchange was conducted in the field. These studies were held mostly in agricultural and forest ecosystems, in Central and Southern Mexico where mild subtropical conditions prevail. However, arid, semi-arid, tropical and wetland ecosystems may have an important role in Mexico’s CO2 emissions because of their extent and extensive land use changes. From the twenty eight studies, only two provided continuous measurements of RS with high temporal resolution, highlighting the need for long-term studies to evaluate the complex biophysical controls of this flux and associated processes over different ecological succession stages. We conclude that Mexico represents an important opportunity to understand its complex dynamics, in national and global context, as ecosystems in the country cover a wide range of climatic conditions. This is particularly important because deforestation and degradation of Mexican ecosystems is rapidly increasing along with expected changes in climate.

  10. ECG-derived respiration methods: adapted ICA and PCA.

    Tiinanen, Suvi; Noponen, Kai; Tulppo, Mikko; Kiviniemi, Antti; Seppänen, Tapio

    2015-05-01

    Respiration is an important signal in early diagnostics, prediction, and treatment of several diseases. Moreover, a growing trend toward ambulatory measurements outside laboratory environments encourages developing indirect measurement methods such as ECG derived respiration (EDR). Recently, decomposition techniques like principal component analysis (PCA), and its nonlinear version, kernel PCA (KPCA), have been used to derive a surrogate respiration signal from single-channel ECG. In this paper, we propose an adapted independent component analysis (AICA) algorithm to obtain EDR signal, and extend the normal linear PCA technique based on the best principal component (PC) selection (APCA, adapted PCA) to improve its performance further. We also demonstrate that the usage of smoothing spline resampling and bandpass-filtering improve the performance of all EDR methods. Compared with other recent EDR methods using correlation coefficient and magnitude squared coherence, the proposed AICA and APCA yield a statistically significant improvement with correlations 0.84, 0.82, 0.76 and coherences 0.90, 0.91, 0.85 between reference respiration and AICA, APCA and KPCA, respectively. Copyright © 2015 IPEM. Published by Elsevier Ltd. All rights reserved.

  11. The Lr34 adult plant rust resistance gene provides seedling resistance in durum wheat without senescence.

    Rinaldo, Amy; Gilbert, Brian; Boni, Rainer; Krattinger, Simon G; Singh, Davinder; Park, Robert F; Lagudah, Evans; Ayliffe, Michael

    2017-07-01

    The hexaploid wheat (Triticum aestivum) adult plant resistance gene, Lr34/Yr18/Sr57/Pm38/Ltn1, provides broad-spectrum resistance to wheat leaf rust (Lr34), stripe rust (Yr18), stem rust (Sr57) and powdery mildew (Pm38) pathogens, and has remained effective in wheat crops for many decades. The partial resistance provided by this gene is only apparent in adult plants and not effective in field-grown seedlings. Lr34 also causes leaf tip necrosis (Ltn1) in mature adult plant leaves when grown under field conditions. This D genome-encoded bread wheat gene was transferred to tetraploid durum wheat (T. turgidum) cultivar Stewart by transformation. Transgenic durum lines were produced with elevated gene expression levels when compared with the endogenous hexaploid gene. Unlike nontransgenic hexaploid and durum control lines, these transgenic plants showed robust seedling resistance to pathogens causing wheat leaf rust, stripe rust and powdery mildew disease. The effectiveness of seedling resistance against each pathogen correlated with the level of transgene expression. No evidence of accelerated leaf necrosis or up-regulation of senescence gene markers was apparent in these seedlings, suggesting senescence is not required for Lr34 resistance, although leaf tip necrosis occurred in mature plant flag leaves. Several abiotic stress-response genes were up-regulated in these seedlings in the absence of rust infection as previously observed in adult plant flag leaves of hexaploid wheat. Increasing day length significantly increased Lr34 seedling resistance. These data demonstrate that expression of a highly durable, broad-spectrum adult plant resistance gene can be modified to provide seedling resistance in durum wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  12. Influence of forced respiration on nonlinear dynamics in heart rate variability

    Kanters, J K; Højgaard, M V; Agner, E

    1997-01-01

    Although it is doubtful whether the normal sinus rhythm can be described as low-dimensional chaos, there is evidence for inherent nonlinear dynamics and determinism in time series of consecutive R-R intervals. However, the physiological origin for these nonlinearities is unknown. The aim...... with a metronome set to 12 min(-1). Nonlinear dynamics were measured as the correlation dimension and the nonlinear prediction error. Complexity expressed as correlation dimension was unchanged from normal respiration, 9.1 +/- 0.5, compared with forced respiration, 9.3 +/- 0.6. Also, nonlinear determinism...... expressed as the nonlinear prediction error did not differ between spontaneous respiration, 32.3 +/- 3.4 ms, and forced respiration, 31.9 +/- 5.7. It is concluded that the origin of the nonlinear dynamics in heart rate variability is not a nonlinear input from the respiration into the cardiovascular...

  13. The Low Energy Level Structure of {sup 191}lr

    Malmskog, S G; Berg, V [AB Atomenergi, Nykoeping (Sweden); [Inst. of Physics, U niv. of Stockholm (Sweden); Baecklin, A; Hedin, G [Inst. of Physics, Univ. of Upp sala (Sweden)

    1970-02-15

    The decay of {sup 191}Pt to {sup 191}Ir has been investigated using Ge(Li)-detectors and a double focusing beta spectrometer. 35 transitions were observed and most of them were placed in a level scheme. Special attention was given to the low energy level band structure. Several multipolarity mixing ratios were determined from L-subshell ratio measurements. Using the delayed coincidence technique the half-life of the 179.05 keV level was measured to 40 {+-} 12 psec. The low level decay properties are discussed in terms of the Nilsson model with the inclusion of Coriolis coupling.

  14. Evaluation of 14C abundance in soil respiration using accelerator mass spectrometry

    Koarashi, Jun; Iida, Takao; Moriizumi, Jun; Asano, Tomohiro

    2004-01-01

    To clarify the behavior of 14 C in terrestrial ecosystems, 14 C abundance in soil respiration was evaluated in an urban forest with a new method involving a closed chamber technique and 14 C measurement by accelerator mass spectrometry (AMS). Soil respiration had a higher Δ 14 C than the contemporary atmosphere. This indicates that a significant portion of soil respiration is derived from the decomposition of soil organic matter enriched in 14 C by atmospheric nuclear weapons tests, with a notable time lag between atmospheric 14 C addition and re-emission from soil. On the other hand, δ 14 C in soil respiration demonstrated that 14 C abundance ratio itself in soil-respired CO 2 is not always high compared with that in atmospheric CO 2 because of the isotope fractionation during plant photosynthesis and microbial decomposition of soil organic matter. The Δ 14 C in soil respiration was slightly lower in August than in March, suggesting a relatively high contribution of plant root respiration and decomposition of newly accumulated and/or 14 C-depleted soil organic matter to the total soil respiration in August

  15. Microcystin-LR Induces Apoptosis via NF-κB /iNOS Pathway in INS-1 Cells

    Kai Shen

    2011-07-01

    Full Text Available Cyanobacterial toxins, especially the microcystins, are found in eutrophied waters throughout the world, and their potential to impact on human and animal health is a cause for concern. Microcystin-LR (MC-LR is one of the common toxic microcystin congeners and occurs frequently in diverse water systems. Recent work suggested that apoptosis plays a major role in the toxic effects induced by MC-LR in hepatocytes. However, the roles of MC-LR in pancreatic beta cells have not been fully established. The aim of the present study was to assess possible in vitro effects of MC-LR on cell apoptosis in the rat insulinoma cell line, INS-1. Our results demonstrated that MC-LR promoted selectively activation of NF-κB (increasing nuclear p50/p65 translocation and increased the mRNA and protein levels of induced nitric oxide synthase (iNOS. The chronic treatment with MC-LR stimulated nitric oxide (NO production derived from iNOS and induced apoptosis in a dose dependent manner in INS-1 cells. Meanwhile, this effect was inhibited by the NF-κB inhibitor PDTC, which reversed the apoptosis induced by MC-LR. Our observations indicate that MC-LR induced cell apoptosis via an iNOS-dependent pathway. A well-known nuclear transcription factor, NF-κB, is activated and mediates intracellular nitric oxide synthesis. We suggest that the apoptosis induced by chronic MC-LR in vivo presents a possible cause of β-cell dysfunction, as a key environmental factor in the development of diabetes mellitus.

  16. Chronic exposure to microcystin-LR affected mitochondrial DNA maintenance and caused pathological changes of lung tissue in mice

    Li, Xinxiu; Xu, Lizhi; Zhou, Wei; Zhao, Qingya; Wang, Yaping

    2016-01-01

    Microcystin-LR (MC-LR), an important variant of cyanotoxin family, was frequently encountered in the contaminated aquatic environment and taken as a potent hepatotoxin. However, a little was known on the association between the long-term MC-LR exposure and lung damage. In this study, we investigated the changes of the pulmonary histopathology, mitochondrial DNA (mtDNA) integrity and the expression of mtDNA encoded genes in the mice with chronic exposed to MC-LR at different concentrations (1, 5, 10, 20 and 40 μg/L) for 12 months. Our results showed that the long-term and persistent exposure to MC-LR disturbed the balance of redox system, influenced mtDNA stability, changed the expression of mitochondrial genes in the lung cells. Notably, MC-LR exposure influenced the level of inflammatory cytokines and resulted in thickening of the alveolar septa. In conclusion, chronic exposure to MC-LR affected mtDNA maintenance, and caused lung impairment in mice. - Highlights: • A simulated natural exposure to MC-LR caused the lung pathological changes. • The chronic exposure disturbed the redox system balance of lung tissue cells. • The chronic exposure impaired the mtDNA stability and mitochondria function. • The lung was one of the vulnerable organs to MC-LR exposure in mice. - Long-term exposure to MC-LR in drinking water disturbed the balance of redox system, affected mitochondrial DNA maintenance and caused lung impairment in mice.

  17. Boreal and temperate trees show strong acclimation of respiration to warming.

    Reich, Peter B; Sendall, Kerrie M; Stefanski, Artur; Wei, Xiaorong; Rich, Roy L; Montgomery, Rebecca A

    2016-03-31

    Plant respiration results in an annual flux of carbon dioxide (CO2) to the atmosphere that is six times as large as that due to the emissions from fossil fuel burning, so changes in either will impact future climate. As plant respiration responds positively to temperature, a warming world may result in additional respiratory CO2 release, and hence further atmospheric warming. Plant respiration can acclimate to altered temperatures, however, weakening the positive feedback of plant respiration to rising global air temperature, but a lack of evidence on long-term (weeks to years) acclimation to climate warming in field settings currently hinders realistic predictions of respiratory release of CO2 under future climatic conditions. Here we demonstrate strong acclimation of leaf respiration to both experimental warming and seasonal temperature variation for juveniles of ten North American tree species growing for several years in forest conditions. Plants grown and measured at 3.4 °C above ambient temperature increased leaf respiration by an average of 5% compared to plants grown and measured at ambient temperature; without acclimation, these increases would have been 23%. Thus, acclimation eliminated 80% of the expected increase in leaf respiration of non-acclimated plants. Acclimation of leaf respiration per degree temperature change was similar for experimental warming and seasonal temperature variation. Moreover, the observed increase in leaf respiration per degree increase in temperature was less than half as large as the average reported for previous studies, which were conducted largely over shorter time scales in laboratory settings. If such dampening effects of leaf thermal acclimation occur generally, the increase in respiration rates of terrestrial plants in response to climate warming may be less than predicted, and thus may not raise atmospheric CO2 concentrations as much as anticipated.

  18. Influence of temperature and organic matter content on soil respiration in a deciduous oak forest

    Zsolt Kotroczó

    2014-12-01

    Full Text Available The increasing temperature enhances soil respiration differently depend on different conditions (soil moisture, soil organic matter, the activity of soil microbes. It is an essential factor to predicting the effect of climate change on soil respiration. In a temperate deciduous forest (North-Hungary we added or removal aboveground and belowground litter to determine total soil respiration. We investigated the relationship between total soil CO2 efflux, soil moisture and soil temperature. Soil CO2 efflux was measured at each plot using chamber based soil respiration measurements. We determined the temperature sensitivity of soil respiration. The effect of doubled litter was less than the effect of removal. We found that temperature was more influential in the control of soil respiration than soil moisture in litter removal treatments, particularly in the wetter root exclusion treatments (NR and NI (R2: 0.49-0.61. Soil moisture (R2: 0.18-0.24 and temperature (R2: 0.18-0.20 influenced soil respiration similarly in treatments, where soil was drier (Control, Double Litter, Double Wood. A significantly greater increase in temperature induced higher soil respiration were significantly higher (2-2.5-fold in root exclusion treatments, where soil was wetter throughout the year, than in control and litter addition treatments. The highest bacterial and fungal count was at the DL treatment but the differences is not significant compared to the Control. The bacterial number at the No Litter, No Root, No Input treatment was significantly lower at the Control. Similar phenomenon can be observed at the fungal too, but the differences are not significant. The results of soil respiration suggest that the soil aridity can reduce soil respiration increases with the temperature increase. Soil bacterial and fungal count results show the higher organic matter content and soil surface cover litter favors the activity.

  19. Untangling metabolic and spatial interactions of stress tolerance in plants. 2. Accelerated method for measuring and predicting stress tolerance. Can we unravel the mysteries of the interactions between photosynthesis and respiration?

    Biel, Karl Y; Nishio, John N

    2010-09-01

    A simple method using the O(2) electrode that allows examination of the response of respiration and photosynthesis in leaf slices or algae to anoxia and high light under different temperatures useful for the examination of the interactions among photosynthesis, photorespiration, and respiration is described. The method provides a quantifiable assessment of stress tolerance that also permits us to examine fundamental biochemically and genetically related responses involved in stress tolerance and the cooperation among organelles. Additionally, we demonstrated a role for compounds, such as NO(-)(3) and oxaloacetate, as protective agents against photoinhibition, and we examined the role of dark adaptation in the activation of photosynthesis and NO(-)(3)-dependent O(2) oxygen evolution. A physiological and ecological role of a dark period (night) in stress tolerance is presented. Utilizing the method to follow changes in such metabolic activities as protein synthesis, protein conformation states, enzymes activity, carbon metabolism, and gene expression at different points during the treatments will be educational.

  20. Mitochondrial respiration is sensitive to cytoarchitectural breakdown.

    Kandel, Judith; Angelin, Alessia A; Wallace, Douglas C; Eckmann, David M

    2016-11-07

    An abundance of research suggests that cellular mitochondrial and cytoskeletal disruption are related, but few studies have directly investigated causative connections between the two. We previously demonstrated that inhibiting microtubule and microfilament polymerization affects mitochondrial motility on the whole-cell level in fibroblasts. Since mitochondrial motility can be indicative of mitochondrial function, we now further characterize the effects of these cytoskeletal inhibitors on mitochondrial potential, morphology and respiration. We found that although they did not reduce mitochondrial inner membrane potential, cytoskeletal toxins induced significant decreases in basal mitochondrial respiration. In some cases, basal respiration was only affected after cells were pretreated with the calcium ionophore A23187 in order to stress mitochondrial function. In most cases, mitochondrial morphology remained unaffected, but extreme microfilament depolymerization or combined intermediate doses of microtubule and microfilament toxins resulted in decreased mitochondrial lengths. Interestingly, these two particular exposures did not affect mitochondrial respiration in cells not sensitized with A23187, indicating an interplay between mitochondrial morphology and respiration. In all cases, inducing maximal respiration diminished differences between control and experimental groups, suggesting that reduced basal respiration originates as a largely elective rather than pathological symptom of cytoskeletal impairment. However, viability experiments suggest that even this type of respiration decrease may be associated with cell death.

  1. Elemental Concentration of Inhalable and Respirable Particulate ...

    20537 and respirable foam for I.O.M sampler. The elemental composition (Co, Ni, Zn, Cu, Fe, Pb, Cr, Mn and Cd) were analyzed by using Atomic Absorption Spectrophotometric (AAS). The data generated were subjected to descriptive analysis. In inhalable fraction,the enrichment factor ranged from 1-73.3 while in respirable ...

  2. Respirators: APR Issuer Self Study 33461

    Chochoms, Michael [Los Alamos National Laboratory

    2016-07-13

    Respirators: APR Issuer Self-Study (course 33461) is designed to introduce and familiarize employees selected as air-purifying respirator (APR) issuers at Los Alamos National Laboratory (LANL) with the responsibilities, limitations, procedures, and resources for issuing APRs at LANL. The goal is to enable these issuers to consistently provide proper, functioning APRs to authorized users

  3. Quantitative change of EEG and respiration signals during mindfulness meditation

    2014-01-01

    Background This study investigates measures of mindfulness meditation (MM) as a mental practice, in which a resting but alert state of mind is maintained. A population of older people with high stress level participated in this study, while electroencephalographic (EEG) and respiration signals were recorded during a MM intervention. The physiological signals during meditation and control conditions were analyzed with signal processing. Methods EEG and respiration data were collected and analyzed on 34 novice meditators after a 6-week meditation intervention. Collected data were analyzed with spectral analysis, phase analysis and classification to evaluate an objective marker for meditation. Results Different frequency bands showed differences in meditation and control conditions. Furthermore, we established a classifier using EEG and respiration signals with a higher accuracy (85%) at discriminating between meditation and control conditions than a classifier using the EEG signal only (78%). Conclusion Support vector machine (SVM) classifier with EEG and respiration feature vector is a viable objective marker for meditation ability. This classifier should be able to quantify different levels of meditation depth and meditation experience in future studies. PMID:24939519

  4. Analysis of WRKY transcription factors and characterization of two Botrytis cinerea-responsive LrWRKY genes from Lilium regale.

    Cui, Qi; Yan, Xiao; Gao, Xue; Zhang, Dong-Mei; He, Heng-Bin; Jia, Gui-Xia

    2018-06-01

    A major constraint in producing lilies is gray mold caused by Botrytis elliptica and B. cinerea. WRKY transcription factors play important roles in plant immune responses. However, limited information is available about the WRKY gene family in lily plants. In this study, 23 LrWRKY genes with complete WRKY domains were identified from the Botrytis-resistant species Lilium regale. The putative WRKY genes were divided into seven subgroups (Group I, IIa-e, and III) according to their structural features. Sequence alignment revealed that LrWRKY proteins have a highly conserved WRKYGQK domain and a variant, the WRKYGKK domain, and these proteins generally contained similar motif compositions throughout the same subgroup. Functional annotation predicted they might be involved in biological processes related to abiotic and biotic stresses. A qRT-PCR analysis confirmed that expression of six LrWRKY genes in L. regale or the susceptible Asian hybrid 'Yale' was induced by B. cinerea infection. Among these genes, LrWRKY4, LrWRKY8 and LrWRKY10 were expressed at a higher level in L. regale than 'Yale', while the expression of LrWRKY6 and LrWRKY12 was lower in L. regale. Furthermore, LrWRKY4 and LrWRKY12 genes, which also respond to salicylic acid (SA) and methyl jasmonate (MeJA) treatments, were isolated from L. regale. Subcellular localization analysis determined that they were targeted to the nucleus. Constitutive expression of LrWRKY4 and LrWRKY12 in Arabidopsis resulted in plants that were more resistant to B. cinerea than wild-type plants. This resistance was coupled with the transcriptional changes of SA and JA-responsive genes. Overall, our study provides valuable information about the structural and functional characterization of LrWRKY genes that will not only deepen our understanding of the molecular mechanisms underlying the defense of lily against B. cinerea but also offer potential targets for cultivar improvement via biotechnology. Copyright © 2018 Elsevier Masson

  5. Estimating noctural ecosystem respiration from the vertical turbulent flux and change in storange of CO2

    Gorsel, van E.; Delpierre, N.; Leuning, R.; Black, A.; Munger, J.W.; Wofsy, S.; Aubinet, M.; Feigenwinter, C.; Beringer, J.; Bonal, D.; Chen, B.; Chen, J.; Clement, R.; Davis, K.J.; Desai, A.R.; Dragoni, D.; Etzold, S.; Grünwald, T.; Gu, L.; Heinesch, B.; Hutyra, L.R.; Jans, W.W.P.; Kutsch, W.; Law, B.E.; Leclerc, Y.; Mammarella, I.; Montagnani, L.; Noormets, A.; Rebmann, C.; Wharton, S.

    2009-01-01

    Micrometeorological measurements of nighttime ecosystem respiration can be systematically biased when stable atmospheric conditions lead to drainage flows associated with decoupling of air flow above and within plant canopies. The associated horizontal and vertical advective fluxes cannot be

  6. Studies on photosynthesis and respiration in some marine macroalgae of the Goa coast

    Dhargalkar, V.K.

    Primary production and respiration rates were measured in 14 marine macroalgal species from the Goa coast. The highest production rate was observed in Hypnea musciformis and the lowest in Laurencia papillosa. Net production rates in these 14 species...

  7. Annual ecosystem respiration budget for a Pinus sylvestris stand in central Siberia

    Shibistova, O.; Zrazhevskaya, G.; Astrakhantceva, N.; Shijneva, I.; Lloyd, J.; Arneth, A.; Kolle, J.; Knohl, A.; Schmerler, J.

    2002-01-01

    Using a ground-based and an above-canopy eddy covariance system in addition to stem respiration measurements, the annual respiratory fluxes attributable to soil, stems and foliage were determined for a Scots pine (Pinus sylvestris L.) forest growing in central Siberia. Night-time foliar respiration was estimated on the basis of the difference between fluxes measured below and above the canopy and the stem respiration measurements. Comparison of the effects of night-time turbulence on measured CO 2 fluxes showed flux loss above the canopy at low wind speeds, but no such effect was observed for the ground-based eddy system. This suggests that problems with flow homogeneity or flux divergence (both of which would be expected to be greater above the canopy than below) were responsible for above-canopy losses under these conditions. After correcting for this, a strong seasonality in foliar respiration was observed. This was not solely attributable to temperature variations, with intrinsic foliar respiratory capacities being much greater in spring and autumn. The opposite pattern was observed for stem respiration, with the intrinsic respiratory capacity being lower from autumn through early spring. Maximum respiratory activity was observed in early summer. This was not simply associated with a response to higher temperatures but seemed closely linked with cambial activity and the development of new xylem elements. Soil respiration rates exhibited an apparent high sensitivity to temperature, with seasonal data implying a Q 10 of about 7. We interpret this as reflecting covarying changes in soil microbial activity and soil temperatures throughout the snow-free season. Averaged over the two study years (1999 and 2000), the annual respiratory flux was estimated at 38.3 mol C/m 2 /a. Of this 0.61 was attributable to soil respiration, with stem respiration accounting for 0.21 and foliar respiration 0.18

  8. Similar uptake profiles of microcystin-LR and -RR in an in vitro human intestinal model

    Zeller, P.; Clement, M.; Fessard, V.

    2011-01-01

    Highlights: → First description of in vitro cellular uptake of MCs into intestinal cells. → OATP 3A1 and OATP 4A1 are expressed in Caco-2 cell membranes. → MC-LR and MC-RR show similar uptake in Caco-2 cells. → MCs are probably excreted from Caco-2 cells by an active mechanism. -- Abstract: Microcystins (MCs) are cyclic hepatotoxins produced by various species of cyanobacteria. Their structure includes two variable amino acids (AA) leading to more than 80 MC variants. In this study, we focused on the most common variant, microcystin-LR (MC-LR), and microcystin-RR (MC-RR), a variant differing by only one AA. Despite their structural similarity, MC-LR elicits higher liver toxicity than MC-RR partly due to a discrepancy in their uptake by hepatic organic anion transporters (OATP 1B1 and 1B3). However, even though ingestion is the major pathway of human exposure to MCs, intestinal absorption of MCs has been poorly addressed. Consequently, we investigated the cellular uptake of the two MC variants in the human intestinal cell line Caco-2 by immunolocalization using an anti-MC antibody. Caco-2 cells were treated for 30 min to 24 h with several concentrations (1-50 μM) of both variants. We first confirmed the localization of OATP 3A1 and 4A1 at the cell membrane of Caco-2 cells. Our study also revealed a rapid uptake of both variants in less than 1 h. The uptake profiles of the two variants did not differ in our immunostaining study neither with respect to concentration nor the time of exposure. Furthermore, we have demonstrated for the first time the nuclear localization of MC-RR and confirmed that of MC-LR. Finally, our results suggest a facilitated uptake and an active excretion of MC-LR and MC-RR in Caco-2 cells. Further investigation on the role of OATP 3A1 and 4A1 in MC uptake should be useful to clarify the mechanism of intestinal absorption of MCs and contribute in risk assessment of cyanotoxin exposure.

  9. Pore-scale investigation on the response of heterotrophic respiration to moisture conditions in heterogeneous soils

    Yan, Zhifeng; Liu, Chongxuan; Todd-Brown, Katherine E.; Liu, Yuanyuan; Bond-Lamberty, Ben; Bailey, Vanessa L.

    2016-11-15

    The relationship between microbial respiration rate and soil moisture content is an important property for understanding and predicting soil organic carbon degradation, CO2 production and emission, and their subsequent effects on climate change. This paper reports a pore-scale modeling study to investigate the response of heterotrophic respiration to moisture conditions in soils and to evaluate various factors that affect this response. X-ray computed tomography was used to derive soil pore structures, which were then used for pore-scale model investigation. The pore-scale results were then averaged to calculate the effective respiration rates as a function of water content in soils. The calculated effective respiration rate first increases and then decreases with increasing soil water content, showing a maximum respiration rate at water saturation degree of 0.75 that is consistent with field and laboratory observations. The relationship between the respiration rate and moisture content is affected by various factors, including pore-scale organic carbon bioavailability, the rate of oxygen delivery, soil pore structure and physical heterogeneity, soil clay content, and microbial drought resistivity. Simulations also illustrates that a larger fraction of CO2 produced from microbial respiration can be accumulated inside soil cores under higher saturation conditions, implying that CO2 flux measured on the top of soil cores may underestimate or overestimate true soil respiration rates under dynamic moisture conditions. Overall, this study provides mechanistic insights into the soil respiration response to the change in moisture conditions, and reveals a complex relationship between heterotrophic microbial respiration rate and moisture content in soils that is affected by various hydrological, geochemical, and biophysical factors.

  10. The role of p38 in mitochondrial respiration in male and female mice.

    Ju, Xiaohua; Wen, Yi; Metzger, Daniel; Jung, Marianna

    2013-06-07

    p38 is a mitogen-activated protein kinase and mediates cell growth, cell differentiation, and synaptic plasticity. The aim of this study is to determine the extent to which p38 plays a role in maintaining mitochondrial respiration in male and female mice under a normal condition. To achieve this aim, we have generated transgenic mice that lack p38 in cerebellar Purkinje neurons by crossing Pcp2 (Purkinje cell protein 2)-Cre mice with p38(loxP/loxP) mice. Mitochondria from cerebellum were then isolated from the transgenic and wild-type mice to measure mitochondrial respiration using XF24 respirometer. The mRNA and protein expression of cytochrome c oxidase (COX) in cerebellum were also measured using RT-PCR and immunoblot methods. Separately, HT22 cells were used to determine the involvement of 17β-estradiol (E2) and COX in mitochondrial respiration. The genetic knockout of p38 in Purkinje neurons suppressed the mitochondrial respiration only in male mice and increased COX expression only in female mice. The inhibition of COX by sodium azide (SA) sharply suppressed mitochondrial respiration of HT22 cells in a manner that was protected by E2. These data suggest that p38 is required for the mitochondrial respiration of male mice. When p38 is below a normal level, females may maintain mitochondrial respiration through COX up-regulation. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  11. Homogeneous time-resolved fluoroimmunoassay of microcystin-LR using layered WS2 nanosheets as a transducer

    Qin, Xiaodan; Wang, Yuanxiu; Song, Bo; Wang, Xin; Ma, Hua; Yuan, Jingli

    2017-06-01

    A homogeneous time-resolved fluoroimmunoassay method for rapid and sensitive detection of microcystin-LR (MC-LR) in water samples was developed based on the interaction between water-soluble WS2 nanosheets and the conjugate of MC-LR with a luminescent Eu3+ complex BHHBCB-Eu3+ (BHHBCB: 1,2-bis[4‧-(1″,1″,1″,2″,2″,3″,3″-heptafluoro-4″,6″-hexanedion-6″-yl)- benzyl]-4-chlorosulfobenzene). The large lateral dimensions and high surface areas of two-dimensional layered WS2 nanosheets enable easy adsorption of the MC-LR-BHHBCB-Eu3+ conjugate, that lead to efficient quenching of the luminescence of Eu3+ complex via energy transfer or electron transfer process. However, the addition of monoclonal anti-MC-LR antibody can induce the formation of MC-LR-BHHBCB-Eu3+/antibody immune complex, which prevents the interaction between WS2 nanosheets and MC-LR-BHHBCB-Eu3+ to result in the restoration of Eu3+ luminescence. This signal transduction mechanism made it possible for analysis of the target MC-LR in a homogeneous system. The present method has advantages of rapidity and simplicity since the B/F (bound reagent/free reagent) separation steps, the solid-phase carrier and antibody labeling or modification process are not necessary. The proposed immunosensing system displayed a wide linear range, good precision and accuracy, and comparable sensitivity with a detection limit of 0.3 μg l-1, which satisfied the World Health Organization (WHO) provisional guideline limit of 1.0 μg l-1 for MC-LR in drinking water.

  12. The interactive effects of microcystin-LR and cylindrospermopsin on the growth rate of the freshwater algae Chlorella vulgaris.

    Pinheiro, Carlos; Azevedo, Joana; Campos, Alexandre; Vasconcelos, Vítor; Loureiro, Susana

    2016-05-01

    Microcystin-LR (MC-LR) and cylindrospermopsin (CYN) are the most representative cyanobacterial cyanotoxins. They have been simultaneously detected in aquatic systems, but their combined ecotoxicological effects to aquatic organisms, especially microalgae, is unknown. In this study, we examined the effects of these cyanotoxins individually and as a binary mixture on the growth rate of the freshwater algae Chlorella vulgaris. Using the MIXTOX tool, the reference model concentration addition (CA) was selected to evaluate the combined effects of MC-LR and CYN on the growth of the freshwater green algae due to its conservative prediction of mixture effect for putative similar or dissimilar acting chemicals. Deviations from the CA model such as synergism/antagonism, dose-ratio and dose-level dependency were also assessed. In single exposures, our results demonstrated that MC-LR and CYN had different impacts on the growth rates of C. vulgaris at the highest tested concentrations, being CYN the most toxic. In the mixture exposure trial, MC-LR and CYN showed a synergistic deviation from the conceptual model CA as the best descriptive model. MC-LR individually was not toxic even at high concentrations (37 mg L(-1)); however, the presence of MC-LR at much lower concentrations (0.4-16.7 mg L(-1)) increased the CYN toxicity. From these results, the combined exposure of MC-LR and CYN should be considered for risk assessment of mixtures as the toxicity may be underestimated when looking only at the single cyanotoxins and not their combination. This study also represents an important step to understand the interactions among MC-LR and CYN detected previously in aquatic systems.

  13. First successful ionization of Lr (Z = 103) by a surface-ionization technique

    Sato, Tetsuya K., E-mail: sato.tetsuya@jaea.go.jp; Sato, Nozomi; Asai, Masato; Tsukada, Kazuaki; Toyoshima, Atsushi; Ooe, Kazuhiro; Miyashita, Sunao; Schädel, Matthias [Advanced Science Research Center, Japan Atomic Energy Agency (JAEA), 2-4 Shirakata-shirane, Tokai-mura, Ibaraki 319-1195 (Japan); Kaneya, Yusuke; Nagame, Yuichiro [Advanced Science Research Center, Japan Atomic Energy Agency (JAEA), 2-4 Shirakata-shirane, Tokai-mura, Ibaraki 319-1195 (Japan); Graduate School of Science and Engineering, Ibaraki University, 2-1-1, Bunkyo, Mito, Ibaraki 310-8512 (Japan); Osa, Akihiko [Department of Research Reactor and Tandem Accelerator, Japan Atomic Energy Agency (JAEA), 2-4 Shirakata shirane, Tokai-mura, Ibaraki 319-1195 (Japan); Ichikawa, Shin-ichi [Advanced Science Research Center, Japan Atomic Energy Agency (JAEA), 2-4 Shirakata-shirane, Tokai-mura, Ibaraki 319-1195 (Japan); Nishina Center for Accelerator-Based Science, RIKEN, 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan); Stora, Thierry [ISOLDE, CERN, CH-1211 Geneva 23 (Switzerland); Kratz, Jens Volker [Institut für Kernchemie, Universität Mainz, D-55099 Mainz (Germany)

    2013-02-15

    We have developed a surface ionization ion-source as part of the JAEA-ISOL (Isotope Separator On-Line) setup, which is coupled to a He/CdI{sub 2} gas-jet transport system to determine the first ionization potential of the heaviest actinide lawrencium (Lr, Z = 103). The new ion-source is an improved version of the previous source that provided good ionization efficiencies for lanthanides. An additional filament was newly installed to give better control over its operation. We report, here, on the development of the new gas-jet coupled surface ion-source and on the first successful ionization and mass separation of 27-s {sup 256}Lr produced in the {sup 249}Cf + {sup 11}B reaction.

  14. Bioleaching of Primary Nickel Ore Using Acidithiobacillus ferrooxidans LR Cells Immobilized in Glass Beads

    Ellen Cristine Giese

    2015-06-01

    Full Text Available Sulphide minerals are one of the most important sources of value metals. For several years, a large number of hydrometallurgical and biotechnological processes have been developed to leach low-grade sulphide ores and the conditions are well established. However, the management of microorganisms in the bioleaching process is not easy to handle. In this paper, the use of immobilized cells of Acidithiobacillus ferrooxidans LR in glass beads in bioleaching of primary nickel ore was evaluated. The column experiments inoculated with immobilized cells of A. ferrooxidans LR showed the same efficiency than the conventional method using free cells and is promising for application on a larger scale as it ensuring integrity and activity of biomining microorganisms and reduce process costs. DOI: http://dx.doi.org/10.17807/orbital.v7i2.698 

  15. Evaluation of respiration-correlated digital tomosynthesis in lung.

    Santoro, Joseph; Kriminski, Sergey; Lovelock, D Michael; Rosenzweig, Kenneth; Mostafavi, Hassan; Amols, Howard I; Mageras, Gig S

    2010-03-01

    Digital tomosynthesis (DTS) with a linear accelerator-mounted imaging system provides a means of reconstructing tomographic images from radiographic projections over a limited gantry arc, thus requiring only a few seconds to acquire. Its application in the thorax, however, often results in blurred images from respiration-induced motion. This work evaluates the feasibility of respiration-correlated (RC) DTS for soft-tissue visualization and patient positioning. Image data acquired with a gantry-mounted kilovoltage imaging system while recording respiration were retrospectively analyzed from patients receiving radiotherapy for non-small-cell lung carcinoma. Projection images spanning an approximately 30 degrees gantry arc were sorted into four respiration phase bins prior to DTS reconstruction, which uses a backprojection, followed by a procedure to suppress structures above and below the reconstruction plane of interest. The DTS images were reconstructed in planes at different depths through the patient and normal to a user-selected angle close to the center of the arc. The localization accuracy of RC-DTS was assessed via a comparison with CBCT. Evaluation of RC-DTS in eight tumors shows visible reduction in image blur caused by the respiratory motion. It also allows the visualization of tumor motion extent. The best image quality is achieved at the end-exhalation phase of the respiratory motion. Comparison of RC-DTS with respiration-correlated cone-beam CT in determining tumor position, motion extent and displacement between treatment sessions shows agreement in most cases within 2-3 mm, comparable in magnitude to the intraobserver repeatability of the measurement. These results suggest the method's applicability for soft-tissue image guidance in lung, but must be confirmed with further studies in larger numbers of patients.

  16. Lr-Lp Stability of the Incompressible Flows with Nonzero Far-Field Velocity

    Jaiok Roh

    2011-01-01

    Full Text Available We consider the stability of stationary solutions w for the exterior Navier-Stokes flows with a nonzero constant velocity u∞ at infinity. For u∞=0 with nonzero stationary solution w, Chen (1993, Kozono and Ogawa (1994, and Borchers and Miyakawa (1995 have studied the temporal stability in Lp spaces for 11 and obtain Lr-Lp stability as Kozono and Ogawa and Borchers and Miyakawa obtained for u∞=0.

  17. Driver-response relationships between frontal EEG and respiration during affective audiovisual stimuli.

    Kroupi, Eleni; Vesin, Jean-Marc; Ebrahimi, Touradj

    2013-01-01

    The complementary nature and the coordinative tendencies of brain and body are essential to the way humans function. Although static features from brain and body signals have been shown to reflect emotions, the dynamic interrelation of the two systems during emotional processes is still in its infancy. This study aims at investigating the way brain signals captured by Electroencephalography (EEG) and bodily responses reflected in respiration interact when watching music clips. A non-linear measure is applied to frontal EEG and respiration to determine the driver/driven relationship between these two modalities. The results reveal a unidirectional dependence from respiration to EEG which adds evidence to the bodily-feedback theory.

  18. Thermal effects on growth and respiration rates of the mayfly, Dolania americana (ephemeroptera)

    Harvey, R.S.

    1975-01-01

    The mayfly Dolania Americana, common in the sand of Upper Three Runs Creek, Savannah River Plant, was studied to determine the effects of seasonal changes in temperature on population growth rates and to determine the effects of slight elevations in water temperature on respiration rates of this benthic species. Growth of the population increased with stream temperature until peak emergence of adults in June and July. There was a strong inverse correlation between body weight and respiration rates of immature nymphs. Respiration rates at 2.5, 5, and 10 0 C above ambient creekwater temperatures were not significantly higher than those measured at ambient creekwater temperatures. (auth)

  19. Theoretical spectroscopic study of the conjugate microcystin-LR-europium cryptate

    Santos, Julio G.; Dutra, Jose Diogo L.; Costa Junior, Nivan B. da; Freire, Ricardo O., E-mail: rfreire@ufs.br [Universidade Federal de Sergipe (UFS), Sao Cristovao, SE (Brazil). Departamento de Quimica; Alves Junior, Severino; Sa, Gilberto F. de [Universidade Federal de Pernambuco (UFPE), Recife, PE (Brazil). Departamento de Quimica Fundamental

    2013-02-15

    In this work, theoretical tools were used to study spectroscopic properties of the conjugate microcystin-LR-europium cryptate. The Sparkle/AM1 model was applied to predict the geometry of the system and the INDO/S-CIS model was used to calculate the excited state energies. Based on the Judd-Ofelt theory, the intensity parameters were predicted and a theoretical model based on the theory of the 4f-4f transitions was applied to calculate energy transfer and backtransfer rates, radiative and non-radiative decay rates, quantum efficiency and quantum yield. A detailed study of the luminescent properties of the conjugate Microcystin-LR-europium cryptate was carried out. The results show that the theoretical quantum yield of luminescence of 23% is in good agreement with the experimental value published. This fact suggests that this theoretical protocol can be used to design new systems in order to improve their luminescence properties. The results suggest that this luminescent system may be a good conjugate for using in assay ELISA for detection by luminescence of the Microcystin-LR in water. (author)

  20. Soil respiration fluxes in a temperate mixed forest: seasonality and temperature sensitivities differ among microbial and root-rhizosphere respiration.

    Ruehr, Nadine K; Buchmann, Nina

    2010-02-01

    Although soil respiration, a major CO(2) flux in terrestrial ecosystems, is known to be highly variable with time, the response of its component fluxes to temperature and phenology is less clear. Therefore, we partitioned soil respiration (SR) into microbial (MR) and root-rhizosphere respiration (RR) using small root exclusion treatments in a mixed mountain forest in Switzerland. In addition, fine root respiration (FRR) was determined with measurements of excised roots. RR and FRR were strongly related to each other (R(2) = 0.92, n = 7), with RR contributing about 46% and FRR about 32% to total SR. RR rates increased more strongly with temperature (Q(10) = 3.2) than MR rates (Q(10) = 2.3). Since the contribution of RR to SR was found to be higher during growing (50%) than during dormant periods (40%), we separated the 2-year data set into phenophases. During the growing period of 2007, the temperature sensitivity of RR (Q(10) = 2.5, R(2) = 0.62) was similar to that of MR (Q(10) = 2.2, R(2) = 0.57). However, during the dormant period of 2006/2007, RR was not related to soil temperature (R(2) = 0.44, n.s.), in contrast to MR (Q(10) = 7.2; R(2) = 0.92). To better understand the influence of plant activity on root respiration, we related RR and FRR rates to photosynthetic active radiation (both R(2) = 0.67, n = 7, P = 0.025), suggesting increased root respiration rates during times with high photosynthesis. During foliage green-up in spring 2008, i.e., from bud break to full leaf expansion, RR increased by a factor of 5, while soil temperature increased only by about 5 degrees C, leading to an extraordinary high Q(10) of 10.6; meanwhile, the contribution of RR to SR increased from 29 to 47%. This clearly shows that root respiration and its apparent temperature sensitivity highly depend on plant phenology and thus on canopy assimilation and carbon allocation belowground.

  1. The Contribution of Old Carbon to Respiration from Alaskan Tundra Following Permafrost Thaw

    Schuur, E. A.; Vogel, J. G.; Crummer, K. G.; Lee, H.; Sickman, J. O.; Dutta, K.

    2007-12-01

    More than 450 Pg of soil carbon (C) has accumulated in high latitude ecosystems after the retreat of the last major ice sheets. Recent studies suggest that, due to climate warming, these ecosystems may no longer be accumulating C, and in some cases may be losing stored C to the atmosphere. We used radiocarbon measurements of carbon dioxide to detect the age of C respired from tussock tundra near Denali National Park, Alaska. At this tundra site, permafrost has been observed to warm and thaw over the past several decades, causing the ground surface to subside as ice volume in the soil decreased. We established three sites within this area that differed in vegetation and surface topography; both characteristics varied in relation to the degree of permafrost thaw. We made radiocarbon measurements of ecosystem respiration, incubations of soil organic matter, and incubations of above and belowground plant biomass to determine the age and isotopic value of C respired from these sites. Over the study period from 2004 to 2006, ecosystem respiration radiocarbon values averaged from +35‰ to +95‰ in different months across sites. For soil incubations, surface soil radiocarbon was elevated relative both to ecosystem respiration and the current atmospheric radiocarbon value, demonstrating the significant contribution from C fixed over the past years to several decades. The deeper soil, in contrast, had respiration isotope values that averaged below zero, reflecting the significant effect of radioactive decay on the isotope content of deeper soil layers. The plant and soil incubations were combined in a multi- source mixing model to determine probable contributions from these different sources to ecosystem respiration. Deep soil respiration generally averaged between 5-15% of total ecosystem respiration, but reached as high as 40% in some months. When aggregated across the growing season, the two sites undergoing more disturbance from permafrost thaw had on average 2-3 times

  2. Soil Respiration of Three Mangrove Forests on Sanibel Island, Florida

    Cartwright, F.; Bovard, B. D.

    2011-12-01

    Carbon cycling studies conducted in mangrove forests have typically focused on aboveground processes. Our understanding of carbon storage in these systems is therefore limited by the lack information on belowground processes such as fine root production and soil respiration. To our knowledge there exist no studies investigating temporal patterns in and environmental controls on soil respiration in multiple types of mangrove ecosystems concurrently. This study is part of a larger study on carbon storage in three mangrove forests on Sanibel Island, Florida. Here we report on eight months of soil respiration data within these forests that will ultimately be incorporated into an annual carbon budget for each habitat type. Soil respiration was monitored in the following three mangrove habitat types: a fringe mangrove forest dominated by Rhizophora mangle, a basin mangrove forest dominated by Avicennia germinans, and a higher elevation forest comprised of a mix of Avicennia germinans and Laguncularia racemosa, and non-woody salt marsh species. Beginning in June of 2010, we measured soil emissions of carbon dioxide at 5 random locations within three-100 m2 plots within each habitat type. Sampling was performed at monthly intervals and conducted over the course of three days. For each day, one plot from each habitat type was measured. In addition to soil respiration, soil temperature, salinity and gravimetric moisture content were also measured. Our data indicate the Black mangrove forest, dominated by Avicennia germinans, experiences the highest rates of soil respiration with a mean rate of 4.61 ± 0.60 μmol CO2 m-2 s-1. The mixed mangrove and salt marsh habitat has the lowest soil carbon emission rates with a mean of 2.78 ± 0.40 μmol CO2 m-2 s-1. Soil carbon effluxes appear to peak in the early part of the wet season around May to June and are lower and relatively constant the remainder of the year. Our data also suggest there are important but brief periods where

  3. Contributions of ectomycorrhizal fungal mats to forest soil respiration

    C. Phillips; L.A. Kluber; J.P. Martin; B.A. Caldwell; B.J. Bond

    2012-01-01

    Distinct aggregations of fungal hyphae and rhizomorphs, or “mats”, formed by some genera of ectomycorrhizal (EcM) fungi are common features of soils in coniferous forests of the Pacific Northwest. We measured in situ respiration rates of Piloderma mats and neighboring non-mat soils in an old-growth Douglas-fir forest in western Oregon to investigate whether there was...

  4. Oxygen dependence of respiration in rat spinotrapezius muscle in situ

    Golub, Aleksander S.; Pittman, Roland N.

    2012-01-01

    The oxygen dependence of respiration in striated muscle in situ was studied by measuring the rate of decrease of interstitial Po2 [oxygen disappearance curve (ODC)] following rapid arrest of blood flow by pneumatic tissue compression, which ejected red blood cells from the muscle vessels and made the ODC independent from oxygen bound to hemoglobin. After the contribution of photo-consumption of oxygen by the method was evaluated and accounted for, the corrected ODCs were converted into the Po...

  5. Identificação de microcistina LR ao nível molecular empregando microscopia de força atômica

    Augusto Etchegaray

    2010-01-01

    Full Text Available Microcystins are non-ribosomal peptides that must be detected for its health concern. Here, microcystin LR and its specific antibody were respectively tethered to the substrate and to the tip of an atomic force microscope, after surface functionalization using 3-aminopropyltriethoxysilane and glutaraldehyde. Functionalization was confirmed comparing topographic images taken on bare and modified tips. Force versus distance curves were successfully used to measure the specific antibody-antigen interactions comparing with a control in which microcystin was initially blocked by incubation with free antibodies. The results showed unequivocally the specific recognition of MLR, suggesting that this method could be useful for biosensor development.

  6. Convergence in the temperature response of leaf respiration across biomes and plant functional types.

    Heskel, Mary A; O'Sullivan, Odhran S; Reich, Peter B; Tjoelker, Mark G; Weerasinghe, Lasantha K; Penillard, Aurore; Egerton, John J G; Creek, Danielle; Bloomfield, Keith J; Xiang, Jen; Sinca, Felipe; Stangl, Zsofia R; Martinez-de la Torre, Alberto; Griffin, Kevin L; Huntingford, Chris; Hurry, Vaughan; Meir, Patrick; Turnbull, Matthew H; Atkin, Owen K

    2016-04-05

    Plant respiration constitutes a massive carbon flux to the atmosphere, and a major control on the evolution of the global carbon cycle. It therefore has the potential to modulate levels of climate change due to the human burning of fossil fuels. Neither current physiological nor terrestrial biosphere models adequately describe its short-term temperature response, and even minor differences in the shape of the response curve can significantly impact estimates of ecosystem carbon release and/or storage. Given this, it is critical to establish whether there are predictable patterns in the shape of the respiration-temperature response curve, and thus in the intrinsic temperature sensitivity of respiration across the globe. Analyzing measurements in a comprehensive database for 231 species spanning 7 biomes, we demonstrate that temperature-dependent increases in leaf respiration do not follow a commonly used exponential function. Instead, we find a decelerating function as leaves warm, reflecting a declining sensitivity to higher temperatures that is remarkably uniform across all biomes and plant functional types. Such convergence in the temperature sensitivity of leaf respiration suggests that there are universally applicable controls on the temperature response of plant energy metabolism, such that a single new function can predict the temperature dependence of leaf respiration for global vegetation. This simple function enables straightforward description of plant respiration in the land-surface components of coupled earth system models. Our cross-biome analyses shows significant implications for such fluxes in cold climates, generally projecting lower values compared with previous estimates.

  7. Arbuscular mycorrhizal fungi regulate soil respiration and its response to precipitation change in a semiarid steppe.

    Zhang, Bingwei; Li, Shan; Chen, Shiping; Ren, Tingting; Yang, Zhiqiang; Zhao, Hanlin; Liang, Yu; Han, Xingguo

    2016-01-28

    Arbuscular mycorrhizal fungi (AMF) are critical links in plant-soil continuum and play a critical role in soil carbon cycles. Soil respiration, one of the largest carbon fluxes in global carbon cycle, is sensitive to precipitation change in semiarid ecosystems. In this study, a field experiment with fungicide application and water addition was conducted during 2010-2013 in a semiarid steppe in Inner Mongolia, China, and soil respiration was continuously measured to investigate the influences of AMF on soil respiration under different precipitation regimes. Results showed that soil respiration was promoted by water addition treatment especially during drought seasons, which induced a nonlinear response of soil respiration to precipitation change. Fungicide application suppressed AMF root colonization without impacts on soil microbes. AMF suppression treatment accelerated soil respiration with 2.7, 28.5 and 37.6 g C m(-2) across three seasons, which were mainly caused by the enhanced heterotrophic component. A steeper response of soil respiration rate to precipitation was found under fungicide application treatments, suggesting a greater dampening effect of AMF on soil carbon release as water availability increased. Our study highlighted the importance of AMF on soil carbon stabilization and sequestration in semiarid steppe ecosystems especially during wet seasons.

  8. Acclimation and soil moisture constrain sugar maple root respiration in experimentally warmed soil.

    Jarvi, Mickey P; Burton, Andrew J

    2013-09-01

    The response of root respiration to warmer soil can affect ecosystem carbon (C) allocation and the strength of positive feedbacks between climatic warming and soil CO2 efflux. This study sought to determine whether fine-root (maple (Acer saccharum Marsh.)-dominated northern hardwood forest would adjust to experimentally warmed soil, reducing C return to the atmosphere at the ecosystem scale to levels lower than that would be expected using an exponential temperature response function. Infrared heating lamps were used to warm the soil (+4 to +5 °C) in a mature sugar maple forest in a fully factorial design, including water additions used to offset the effects of warming-induced dry soil. Fine-root-specific respiration rates, root biomass, root nitrogen (N) concentration, soil temperature and soil moisture were measured from 2009 to 2011, with experimental treatments conducted from late 2010 to 2011. Partial acclimation of fine-root respiration to soil warming occurred, with soil moisture deficit further constraining specific respiration rates in heated plots. Fine-root biomass and N concentration remained unchanged. Over the 2011 growing season, ecosystem root respiration was not significantly greater in warmed soil. This result would not be predicted by models that allow respiration to increase exponentially with temperature and do not directly reduce root respiration in drier soil.

  9. Arbuscular mycorrhizal fungi regulate soil respiration and its response to precipitation change in a semiarid steppe

    Zhang, Bingwei; Li, Shan; Chen, Shiping; Ren, Tingting; Yang, Zhiqiang; Zhao, Hanlin; Liang, Yu; Han, Xingguo

    2016-01-01

    Arbuscular mycorrhizal fungi (AMF) are critical links in plant-soil continuum and play a critical role in soil carbon cycles. Soil respiration, one of the largest carbon fluxes in global carbon cycle, is sensitive to precipitation change in semiarid ecosystems. In this study, a field experiment with fungicide application and water addition was conducted during 2010-2013 in a semiarid steppe in Inner Mongolia, China, and soil respiration was continuously measured to investigate the influences of AMF on soil respiration under different precipitation regimes. Results showed that soil respiration was promoted by water addition treatment especially during drought seasons, which induced a nonlinear response of soil respiration to precipitation change. Fungicide application suppressed AMF root colonization without impacts on soil microbes. AMF suppression treatment accelerated soil respiration with 2.7, 28.5 and 37.6 g C m-2 across three seasons, which were mainly caused by the enhanced heterotrophic component. A steeper response of soil respiration rate to precipitation was found under fungicide application treatments, suggesting a greater dampening effect of AMF on soil carbon release as water availability increased. Our study highlighted the importance of AMF on soil carbon stabilization and sequestration in semiarid steppe ecosystems especially during wet seasons.

  10. Soil respiration in relation to photosynthesis of Quercus mongolica trees at elevated CO2.

    Zhou, Yumei; Li, Mai-He; Cheng, Xu-Bing; Wang, Cun-Guo; Fan, A-Nan; Shi, Lian-Xuan; Wang, Xiu-Xiu; Han, Shijie

    2010-12-06

    Knowledge of soil respiration and photosynthesis under elevated CO(2) is crucial for exactly understanding and predicting the carbon balance in forest ecosystems in a rapid CO(2)-enriched world. Quercus mongolica Fischer ex Ledebour seedlings were planted in open-top chambers exposed to elevated CO(2) (EC = 500 µmol mol(-1)) and ambient CO(2) (AC = 370 µmol mol(-1)) from 2005 to 2008. Daily, seasonal and inter-annual variations in soil respiration and photosynthetic assimilation were measured during 2007 and 2008 growing seasons. EC significantly stimulated the daytime soil respiration by 24.5% (322.4 at EC vs. 259.0 mg CO(2) m(-2) hr(-1) at AC) in 2007 and 21.0% (281.2 at EC vs. 232.6 mg CO(2) m(-2) hr(-1) at AC) in 2008, and increased the daytime CO(2) assimilation by 28.8% (624.1 at EC vs. 484.6 mg CO(2) m(-2) hr(-1) at AC) across the two growing seasons. The temporal variation in soil respiration was positively correlated with the aboveground photosynthesis, soil temperature, and soil water content at both EC and AC. EC did not affect the temperature sensitivity of soil respiration. The increased daytime soil respiration at EC resulted mainly from the increased aboveground photosynthesis. The present study indicates that increases in CO(2) fixation of plants in a CO(2)-rich world will rapidly return to the atmosphere by increased soil respiration.

  11. Diurnal variation in soil respiration under different land uses on Taihang Mountain, North China

    Liu, Xiuping; Zhang, Wanjun; Zhang, Bin; Yang, Qihong; Chang, Jianguo; Hou, Ke

    2016-01-01

    The aim of this paper is to evaluate the diurnal variation in soil respiration under different land use types on Taihang Mountain, North China, and to understand its response to environmental factors (e.g., soil temperature and moisture) and forest management. Diurnal variations in soil respiration from plantations (Robinia pseudoacacia, Punica granatum, and Ziziphus jujuba), naturally regenerated forests (Vitex negundo var. heterophylla), grasslands (Bothriochloa ischaemum), and farmlands (winter wheat/summer maize) were measured using an LI-8100 automated soil CO2 flux system from May 2012 to April 2013. The results indicated that land use type had a significant effect on the diurnal variation of soil respiration. The diurnal soil respiration from farmlands was highest, followed by Ziziphus jujube, R. pseudoacacia, P. granatum, the lower soil CO2 efflux was found from B. ischaemum and V. negundo var. heterophylla. The diurnal soil respiration across different land use types was significantly affected by soil temperature and moisture, and their interaction. Precipitation-stimulated soil respiration increased more in soil with low water content and less in soil with high water content. The lower diurnal soil respiration from naturally regenerated forests suggests that naturally regenerated vegetation is the optimal vegetation type for reducing global warming.

  12. Heterotrophic components of soil respiration in pastures and forests in southwestern Amazonia, Acre, Brazil

    Eric Atlas Davidson

    2008-12-01

    Full Text Available In this paper we present data on soil microbial biomass and heterotrophic respiration in pastures, mature and secondary forests, in order to elucidate their contribution to total CO2 flux from soil to atmosphere. The research was conducted in Southwestern Amazonia, Acre State, Brazil. Microbial biomass was estimated using a variation of the traditional fumigation-extraction method and heterotrophic respiration was measured using respirometry flasks attached to an infrared gas analyzer. Soil microbial biomass and heterotrophic respiration did not differ statistically among pastures, mature and secondary forests. These laboratory results indicate that higher CO2 fluxes from pasture soils measured in situ are probably due to higher root respiration by pasture grasses.

  13. Significance of cold-season respiration and photosynthesis in a subarctic heath ecosystem in Northern Sweden

    Larsen, Klaus Steenberg; Ibrom, Andreas; Jonasson, S.

    2007-01-01

    While substantial cold-season respiration has been documented in most arctic and alpine ecosystems in recent years, the significance of cold-season photosynthesis in these biomes is still believed to be small. In a mesic, subartic heath during both the cold and warm season, we measured in situ...... ecosystem respiration and photosynthesis with a chamber technique at ambient conditions and at artificially, increased frequency of freeze-thaw (FT) cycles during fall and spring. We fitted the measured ecosystem exchange rates to respiration and photosynthesis models with R-2-values ranging from 0.81 to 0.......85. As expected, estimated cold-season (October, November, April and May) respiration was significant and accounted for at least 22% of the annual respiratory CO2 flux. More surprisingly, estimated photosynthesis during this period accounted for up to 19% of the annual gross CO2 uptake, suggesting that cold...

  14. The NACA Exceptional Service Medal presented at the NACA High Speed Flight Station. L-R: Hugh Dryden

    1956-01-01

    The NASA exceptional Service Medal presented at the NACA High Speed Flight Station. L-R: Hugh Dryden, Joe Walker (X-1A research pilot), Stan Butchart (pilot of the B-29 mothership), Richard Payne (X-1A crew chief).

  15. Operations of the LR56 radioactive liquid cask transport system at U.S. Department of Energy sites

    Davidson, J.S.; Hornstra, D.J.; Sazawal, V.K.; Clement, G.

    1996-01-01

    The LR56 cask system is licensed for use in France under Certificate of Compliance F/309/B(U)F for transport of 4,000-liter volumes of radioactive liquids. Three LR56 cask systems (with modifications for use at Department of Energy (DOE) sites) have been purchased for delivery at the Hanford Site, Oak Ridge National Laboratory (ORNL), and Savannah River Site (SRS). The LR56 cask systems will be used for on-site transfers of Type B quantities of radioactive liquid waste. The ORNL unit will also be used as a Type A packaging for transfers of radioactive liquids between DOE sites. This paper discusses LR56 operating features and the use of the cask system at the three DOE sites

  16. Vegetation types alter soil respiration and its temperature sensitivity at the field scale in an estuary wetland.

    Guangxuan Han

    Full Text Available Vegetation type plays an important role in regulating the temporal and spatial variation of soil respiration. Therefore, vegetation patchiness may cause high uncertainties in the estimates of soil respiration for scaling field measurements to ecosystem level. Few studies provide insights regarding the influence of vegetation types on soil respiration and its temperature sensitivity in an estuary wetland. In order to enhance the understanding of this issue, we focused on the growing season and investigated how the soil respiration and its temperature sensitivity are affected by the different vegetation (Phragmites australis, Suaeda salsa and bare soil in the Yellow River Estuary. During the growing season, there were significant linear relationships between soil respiration rates and shoot and root biomass, respectively. On the diurnal timescale, daytime soil respiration was more dependent on net photosynthesis. A positive correlation between soil respiration and net photosynthesis at the Phragmites australis site was found. There were exponential correlations between soil respiration and soil temperature, and the fitted Q10 values varied among different vegetation types (1.81, 2.15 and 3.43 for Phragmites australis, Suaeda salsa and bare soil sites, respectively. During the growing season, the mean soil respiration was consistently higher at the Phragmites australis site (1.11 µmol CO2 m(-2 s(-1, followed by the Suaeda salsa site (0.77 µmol CO2 m(-2 s(-1 and the bare soil site (0.41 µmol CO2 m(-2 s(-1. The mean monthly soil respiration was positively correlated with shoot and root biomass, total C, and total N among the three vegetation patches. Our results suggest that vegetation patchiness at a field scale might have a large impact on ecosystem-scale soil respiration. Therefore, it is necessary to consider the differences in vegetation types when using models to evaluate soil respiration in an estuary wetland.

  17. Vegetation Types Alter Soil Respiration and Its Temperature Sensitivity at the Field Scale in an Estuary Wetland

    Han, Guangxuan; Xing, Qinghui; Luo, Yiqi; Rafique, Rashad; Yu, Junbao; Mikle, Nate

    2014-01-01

    Vegetation type plays an important role in regulating the temporal and spatial variation of soil respiration. Therefore, vegetation patchiness may cause high uncertainties in the estimates of soil respiration for scaling field measurements to ecosystem level. Few studies provide insights regarding the influence of vegetation types on soil respiration and its temperature sensitivity in an estuary wetland. In order to enhance the understanding of this issue, we focused on the growing season and investigated how the soil respiration and its temperature sensitivity are affected by the different vegetation (Phragmites australis, Suaeda salsa and bare soil) in the Yellow River Estuary. During the growing season, there were significant linear relationships between soil respiration rates and shoot and root biomass, respectively. On the diurnal timescale, daytime soil respiration was more dependent on net photosynthesis. A positive correlation between soil respiration and net photosynthesis at the Phragmites australis site was found. There were exponential correlations between soil respiration and soil temperature, and the fitted Q 10 values varied among different vegetation types (1.81, 2.15 and 3.43 for Phragmites australis, Suaeda salsa and bare soil sites, respectively). During the growing season, the mean soil respiration was consistently higher at the Phragmites australis site (1.11 µmol CO2 m−2 s−1), followed by the Suaeda salsa site (0.77 µmol CO2 m−2 s−1) and the bare soil site (0.41 µmol CO2 m−2 s−1). The mean monthly soil respiration was positively correlated with shoot and root biomass, total C, and total N among the three vegetation patches. Our results suggest that vegetation patchiness at a field scale might have a large impact on ecosystem-scale soil respiration. Therefore, it is necessary to consider the differences in vegetation types when using models to evaluate soil respiration in an estuary wetland. PMID:24608636

  18. Allelopathic effects of microcystin-LR on the germination, growth and metabolism of five charophyte species and a submerged angiosperm.

    Rojo, Carmen; Segura, Matilde; Cortés, Francisco; Rodrigo, María A

    2013-11-15

    Microcystins (MCs) are produced by cyanobacteria in aquatic environments and adversely affect macrophytes at very high concentrations. However, the effects of MC on macrophytes at concentrations of environmental relevance are largely unknown. The main objective of this study was to analyze the allelopathic effects of MC-LR at natural concentrations (1, 8 and 16 μg MC-LR/L) on five charophyte species (Chara aspera, C. baltica, C. hispida, C. vulgaris and Nitella hyalina) and the angiosperm Myriophyllum spicatum. Macrophyte specimens were obtained from a restored area located in Albufera de València Natural Park, a protected coastal Mediterranean wetland. Two different experiments were conducted involving (i) the addition of MC-LR to natural sediment to evaluate its effects on seed germination and (ii) the addition of MC-LR to water cultures of macrophytes to evaluate its effects on growth and metabolic functions. In water, the MC-LR concentration decreased by 84% in two weeks; the loss was not significant in sediment. The first seedlings (all C. hispida) emerged from the wetland sediment following a delay of a few days in the presence of MC-LR. The germination rates in 8 and 16 μg MC-LR/L treatments were 44% and 11% of that occurring in the absence of MC, but these differences disappeared over time. The final density was 6-7 germlings/dm(3). Final germling length was unaffected by MC-LR. Rotifers (Lecane spp.) emerging from the natural sediment during the experiment were favored by MC-LR; the opposite pattern was observed in the cladoceran Daphnia magna. The growth rates of C. vulgaris, C. baltica and N. hyalina were unaffected by MC exposure, whereas those of C. hispida and C. aspera were reduced in the MC treatments relative to the control treatment. The concentration of chlorophyll-a and the in vivo net photosynthetic rate were lower in the presence of MC-LR, even at the lowest concentration, for all of the characeans tested. M. spicatum was sensitive to the

  19. How much work is expended for respiration?

    Johnson, A T

    1993-01-01

    The rate of work expended to move air in the respiratory system has been determined for five different airflow waveshapes, a non-linear respiratory model and five exercise levels. As expected, the rectangular waveshape was the most efficient. Model conditions were then changed one a time: (i) starting lung volume was allowed to vary, (ii) exhalation flow limitation was added, (iii) respiration was considered to be a metabolic burden determining part of the ventilation requirement and (iv) a respirator mask was added. Although there is no direct work advantage to varying initial lung volume, such volume changes appear to be dictated by the asymmetry of lung recoil pressure about the lung relaxation volume; allowing the work of respiration to become a metabolic burden clearly shows why respiratory waveforms change from rest to exercise; and, adding a respirator imposes a severe respiratory burden on the wearer engaging in moderate, heavy and very heavy exercise.

  20. Species identities, not functional groups, explain the effects of earthworms on litter carbon-derived soil respiration

    Soil respiration is frequently measured as a surrogate for biological activities and is important in soil carbon cycling. The heterotrophic component of soil respiration is primarily driven by microbial decomposition of leaf litter and soil organic matter, and is partially controlled by resource ava...

  1. Respiration of midges (Diptera; Chironomidae) in British Columbian lakes: oxy-regulation, temperature and their role as palaeo-indicators

    Brodersen, Klaus Peter; Pedersen, Ole; Walker, Ian R.

    2008-01-01

    1. The specific respiration rate of 13 chironomid taxa and Chaoborus were measured to test the hypothesis of the relation between a species' ability to regulate their oxygen uptake and their distributional patterns among nine study lakes in British Columbia, Canada. 2. Respiration patterns of ind...

  2. [Soil Microbial Respiration Under Different Soil Temperature Conditions and Its Relationship to Soil Dissolved Organic Carbon and Invertase].

    Wu, Jing; Chen, Shu-tao; Hu, Zheng-hua; Zhang, Xu

    2015-04-01

    In order to investigate the soil microbial respiration under different temperature conditions and its relationship to soil dissolved organic carbon ( DOC) and invertase, an indoor incubation experiment was performed. The soil samples used for the experiment were taken from Laoshan, Zijinshan, and Baohuashan. The responses of soil microbial respiration to the increasing temperature were studied. The soil DOC content and invertase activity were also measured at the end of incubation. Results showed that relationships between cumulative microbial respiration of different soils and soil temperature could be explained by exponential functions, which had P values lower than 0.001. The coefficient of temperature sensitivity (Q10 value) varied from 1.762 to 1.895. The Q10 value of cumulative microbial respiration decreased with the increase of soil temperature for all soils. The Q10 value of microbial respiration on 27 days after incubation was close to that of 1 day after incubation, indicating that the temperature sensitivity of recalcitrant organic carbon may be similar to that of labile organic carbon. For all soils, a highly significant ( P = 0.003 ) linear relationship between cumulative soil microbial respiration and soil DOC content could be observed. Soil DOC content could explain 31.6% variances of cumulative soil microbial respiration. For the individual soil and all soils, the relationship between cumulative soil microbial respiration and invertase activity could be explained by a highly significant (P soil microbial respiration.

  3. Partitioning autotrophic and heterotrophic respiration at Howland Forest

    Carbone, Mariah; Hollinger, Dave; Davidson, Eric; Savage, Kathleen; Hughes, Holly

    2015-04-01

    Terrestrial ecosystem respiration is the combined flux of CO2 to the atmosphere from above- and below-ground, plant (autotrophic) and microbial (heterotrophic) sources. Flux measurements alone (e.g., from eddy covariance towers or soil chambers) cannot distinguish the contributions from these sources, which may change seasonally and respond differently to temperature and moisture. The development of improved process-based models that can predict how plants and microbes respond to changing environmental conditions (on seasonal, interannual, or decadal timescales) requires data from field observations and experiments to distinguish among these respiration sources. We tested the viability of partitioning of soil and ecosystem respiration into autotrophic and heterotrophic components with different approaches at the Howland Forest in central Maine, USA. These include an experimental manipulation using the classic root trenching approach and targeted ∆14CO2 measurements. For the isotopic measurements, we used a two-end member mass balance approach to determine the fraction of soil respiration from autotrophic and heterotrophic sources. When summed over the course of the growing season, the trenched chamber flux (heterotrophic) accounted for 53 ± 2% of the total control chamber flux. Over the four different 14C sampling periods, the heterotrophic component ranged from 35-55% and the autotrophic component ranges 45-65% of the total flux. Next steps will include assessing the value of the flux partitioning for constraining a simple ecosystem model using a model-data fusion approach to reduce uncertainties in estimates of NPP and simulation of future soil C stocks and fluxes.

  4. Life-cycle exposure to microcystin-LR interferes with the reproductive endocrine system of male zebrafish.

    Su, Yujing; Li, Li; Hou, Jie; Wu, Ning; Lin, Wang; Li, Guangyu

    2016-06-01

    Recently, MC-LR reproductive toxicity drew great attention. Limited information was available on endocrine-disrupting effects of MC-LR on the reproduction system in fish. In the present study, zebrafish hatchlings (5 d post-fertilization) were exposed to 0, 0.3, 3 and 30μg/L MC-LR for 90 d until they reached sexual maturity. Male zebrafish were selected, and changes in growth and developmental parameters, testicular histological structure as well as the levels of gonadal steroid hormones were studied along with the related-gene transcriptional responses in the hypothalamic-pituitary-gonadal axis (HPG-axis). The results, for the first time, show a life cycle exposure to MC-LR causes growth inhibition, testicular damage and delayed sperm maturation. A significant decrease in T/E2 ratio indicated that MC-LR disrupted sex steroid hormones balance. The changes in transcriptional responses of HPG-axis related genes revealed that MC-LR promoted the conversion of T to E2 in circulating blood. It was also noted that vtg1 mRNA expression in the liver was up-regulated, which implied that MC-LR could induce estrogenic-like effects at environmentally relevant concentrations and long-term exposure. Our findings indicated that a life cycle exposure to MC-LR causes endocrine disruption with organic and functional damage of the testis, which might compromise the quality of life for the survivors and pose a potent threat on fish reproduction and thus population dynamics in MCs-contaminated aquatic environments. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Effects of environmental factors and soil properties on topographic variations of soil respiration

    Tamai, K.

    2010-01-01

    Soil respiration rates were measured along different parts of a slope in (a) an evergreen forest with common brown forest soil and (b) a deciduous forest with immature soil. The effects of soil temperature, soil moisture and soil properties were estimated individually, and the magnitudes of these effects in the deciduous and evergreen forests were compared. In the evergreen forest with common brown forest soil, soil properties had the greatest effect on soil respiration rates, followed by soi...

  6. Landscape Influences on Potential Soil Respiration Rates in a Forested Watershed of Southeastern Kentucky

    Amanda C. Abnee; James A. Thompson; Randall K. Kolka; Elisa M. D' Angelo; Mark S. Coyne

    2004-01-01

    Soil respiration measurements conducted in the laboratory have been shown to be related to temperature and moisture, with maximum rates at soil temperatures between 25 and 40°C and soil moisture between -0.01 and -0.10 MPa. A preliminary study using forest soils from eastern Kentucky supported the previous research with soil respiration rates greater at 25°C than at 15...

  7. Impact of environmental factors and biological soil crust types on soil respiration in a desert ecosystem.

    Feng, Wei; Zhang, Yuqing; Jia, Xin; Wu, Bin; Zha, Tianshan; Qin, Shugao; Wang, Ben; Shao, Chenxi; Liu, Jiabin; Fa, Keyu

    2014-01-01

    The responses of soil respiration to environmental conditions have been studied extensively in various ecosystems. However, little is known about the impacts of temperature and moisture on soils respiration under biological soil crusts. In this study, CO2 efflux from biologically-crusted soils was measured continuously with an automated chamber system in Ningxia, northwest China, from June to October 2012. The highest soil respiration was observed in lichen-crusted soil (0.93 ± 0.43 µmol m-2 s-1) and the lowest values in algae-crusted soil (0.73 ± 0.31 µmol m-2 s-1). Over the diurnal scale, soil respiration was highest in the morning whereas soil temperature was highest in the midday, which resulted in diurnal hysteresis between the two variables. In addition, the lag time between soil respiration and soil temperature was negatively correlated with the soil volumetric water content and was reduced as soil water content increased. Over the seasonal scale, daily mean nighttime soil respiration was positively correlated with soil temperature when moisture exceeded 0.075 and 0.085 m3 m-3 in lichen- and moss-crusted soil, respectively. However, moisture did not affect on soil respiration in algae-crusted soil during the study period. Daily mean nighttime soil respiration normalized by soil temperature increased with water content in lichen- and moss-crusted soil. Our results indicated that different types of biological soil crusts could affect response of soil respiration to environmental factors. There is a need to consider the spatial distribution of different types of biological soil crusts and their relative contributions to the total C budgets at the ecosystem or landscape level.

  8. Soil respiration in the cold desert environment of the Colorado Plateau (USA): Abiotic regulators and thresholds

    Fernandez, D.P.; Neff, J.C.; Belnap, J.; Reynolds, R.L.

    2006-01-01

    Decomposition is central to understanding ecosystem carbon exchange and nutrient-release processes. Unlike mesic ecosystems, which have been extensively studied, xeric landscapes have received little attention; as a result, abiotic soil-respiration regulatory processes are poorly understood in xeric environments. To provide a more complete and quantitative understanding about how abiotic factors influence soil respiration in xeric ecosystems, we conducted soil- respiration and decomposition-cloth measurements in the cold desert of southeast Utah. Our study evaluated when and to what extent soil texture, moisture, temperature, organic carbon, and nitrogen influence soil respiration and examined whether the inverse-texture hypothesis applies to decomposition. Within our study site, the effect of texture on moisture, as described by the inverse texture hypothesis, was evident, but its effect on decomposition was not. Our results show temperature and moisture to be the dominant abiotic controls of soil respiration. Specifically, temporal offsets in temperature and moisture conditions appear to have a strong control on soil respiration, with the highest fluxes occurring in spring when temperature and moisture were favorable. These temporal offsets resulted in decomposition rates that were controlled by soil moisture and temperature thresholds. The highest fluxes of CO2 occurred when soil temperature was between 10 and 16??C and volumetric soil moisture was greater than 10%. Decomposition-cloth results, which integrate decomposition processes across several months, support the soil-respiration results and further illustrate the seasonal patterns of high respiration rates during spring and low rates during summer and fall. Results from this study suggest that the parameters used to predict soil respiration in mesic ecosystems likely do not apply in cold-desert environments. ?? Springer 2006.

  9. Impact of Environmental Factors and Biological Soil Crust Types on Soil Respiration in a Desert Ecosystem

    Feng, Wei; Zhang, Yuqing; Jia, Xin; Wu, Bin; Zha, Tianshan; Qin, Shugao; Wang, Ben; Shao, Chenxi; Liu, Jiabin; Fa, Keyu

    2014-01-01

    The responses of soil respiration to environmental conditions have been studied extensively in various ecosystems. However, little is known about the impacts of temperature and moisture on soils respiration under biological soil crusts. In this study, CO2 efflux from biologically-crusted soils was measured continuously with an automated chamber system in Ningxia, northwest China, from June to October 2012. The highest soil respiration was observed in lichen-crusted soil (0.93±0.43 µmol m−2 s−1) and the lowest values in algae-crusted soil (0.73±0.31 µmol m−2 s−1). Over the diurnal scale, soil respiration was highest in the morning whereas soil temperature was highest in the midday, which resulted in diurnal hysteresis between the two variables. In addition, the lag time between soil respiration and soil temperature was negatively correlated with the soil volumetric water content and was reduced as soil water content increased. Over the seasonal scale, daily mean nighttime soil respiration was positively correlated with soil temperature when moisture exceeded 0.075 and 0.085 m3 m−3 in lichen- and moss-crusted soil, respectively. However, moisture did not affect on soil respiration in algae-crusted soil during the study period. Daily mean nighttime soil respiration normalized by soil temperature increased with water content in lichen- and moss-crusted soil. Our results indicated that different types of biological soil crusts could affect response of soil respiration to environmental factors. There is a need to consider the spatial distribution of different types of biological soil crusts and their relative contributions to the total C budgets at the ecosystem or landscape level. PMID:25050837

  10. 42 CFR 84.134 - Respirator containers; minimum requirements.

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Respirator containers; minimum requirements. 84.134... Respirators § 84.134 Respirator containers; minimum requirements. Supplied-air respirators shall be equipped with a substantial, durable container bearing markings which show the applicant's name, the type and...

  11. 42 CFR 84.197 - Respirator containers; minimum requirements.

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Respirator containers; minimum requirements. 84.197... Cartridge Respirators § 84.197 Respirator containers; minimum requirements. Respirators shall be equipped with a substantial, durable container bearing markings which show the applicant's name, the type and...

  12. 42 CFR 84.174 - Respirator containers; minimum requirements.

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Respirator containers; minimum requirements. 84.174... Air-Purifying Particulate Respirators § 84.174 Respirator containers; minimum requirements. (a) Except..., durable container bearing markings which show the applicant's name, the type of respirator it contains...

  13. Respiration of Nitrate and Nitrite.

    Cole, Jeffrey A; Richardson, David J

    2008-09-01

    Nitrate reduction to ammonia via nitrite occurs widely as an anabolic process through which bacteria, archaea, and plants can assimilate nitrate into cellular biomass. Escherichia coli and related enteric bacteria can couple the eight-electron reduction of nitrate to ammonium to growth by coupling the nitrate and nitrite reductases involved to energy-conserving respiratory electron transport systems. In global terms, the respiratory reduction of nitrate to ammonium dominates nitrate and nitrite reduction in many electron-rich environments such as anoxic marine sediments and sulfide-rich thermal vents, the human gastrointestinal tract, and the bodies of warm-blooded animals. This review reviews the regulation and enzymology of this process in E. coli and, where relevant detail is available, also in Salmonella and draws comparisons with and implications for the process in other bacteria where it is pertinent to do so. Fatty acids may be present in high levels in many of the natural environments of E. coli and Salmonella in which oxygen is limited but nitrate is available to support respiration. In E. coli, nitrate reduction in the periplasm involves the products of two seven-gene operons, napFDAGHBC, encoding the periplasmic nitrate reductase, and nrfABCDEFG, encoding the periplasmic nitrite reductase. No bacterium has yet been shown to couple a periplasmic nitrate reductase solely to the cytoplasmic nitrite reductase NirB. The cytoplasmic pathway for nitrate reduction to ammonia is restricted almost exclusively to a few groups of facultative anaerobic bacteria that encounter high concentrations of environmental nitrate.

  14. Forest harvesting effects on soil temperature, moisture, and respiration in a bottomland hardwood forest

    Londo, A.J.; Messina, M.G.; Schoenholtz, S.H.

    1999-01-01

    The effect of forest disturbance on C cycling has become an issue, given concerns about escalating atmospheric C content. The authors examined the effects of harvest intensity on in situ and laboratory mineral soil respiration in an East Texas bottomland hardwood forest between 6 and 22 mo after harvesting. Treatments included a clearcut, a partial cut wherein approximately 58% of the basal area was removed, and an unharvested control. The soda-lime absorption technique was used for in situ respiration (CO 2 efflux) and the wet alkali method (NaOH) was used for laboratory mineral soil respiration. Soil temperature and moisture content were also measured. Harvesting significantly increased in situ respiration during most sampling periods. This effect was attributed to an increase in live root and microflora activity associated with postharvesting revegetation. In situ respiration increased exponentially (Q 10 relationship) as treatment soil temperatures increased, but followed a parabolic-type pattern through the range of soil moisture measured (mean range 10.4--31.5%). Mean rates of laboratory mineral soil respiration measured during the study were unaffected by cutting treatment for most sampling sessions. Overall, the mean rate of CO 2 efflux in the clearcuts was significantly higher than that in the partial cuts, which in turn was significantly higher than that in the controls. Mass balance estimates indicate that these treatment differences will have little or no long-term effect on C sequestration of these managed forests

  15. Influence of vestibular activation on respiration in humans

    Monahan, Kevin D.; Sharpe, Melissa K.; Drury, Daniel; Ertl, Andrew C.; Ray, Chester A.

    2002-01-01

    The purpose of this study was to determine the effects of the semicircular canals and otolith organs on respiration in humans. On the basis of animal studies, we hypothesized that vestibular activation would elicit a vestibulorespiratory reflex. To test this hypothesis, respiratory measures, arterial blood pressure, and heart rate were measured during engagement of semicircular canals and/or otolith organs. Dynamic upright pitch and roll (15 cycles/min), which activate the otolith organs and semicircular canals, increased respiratory rate (Delta2 +/- 1 and Delta3 +/- 1 breaths/min, respectively; P < 0.05). Dynamic yaw and lateral pitch (15 cycles/min), which activate the semicircular canals, increased respiration similarly (Delta3 +/- 1 and Delta2 +/- 1, respectively; P < 0.05). Dynamic chair rotation (15 cycles/min), which mimics dynamic yaw but eliminates neck muscle afferent, increased respiration (Delta3 +/- 1; P < 0.05) comparable to dynamic yaw (15 cycles/min). Increases in respiratory rate were graded as greater responses occurred during upright (Delta5 +/- 2 breaths/min) and lateral pitch (Delta4 +/- 1) and roll (Delta5 +/- 1) performed at 30 cycles/min. Increases in breathing frequency resulted in increases in minute ventilation during most interventions. Static head-down rotation, which activates otolith organs, did not alter respiratory rate (Delta1 +/- 1 breaths/min). Collectively, these data indicate that semicircular canals, but not otolith organs or neck muscle afferents, mediate increased ventilation in humans and support the concept that vestibular activation alters respiration in humans.

  16. Soil respiration in northern forests exposed to elevated atmospheric carbon dioxide and ozone.

    Pregitzer, Kurt; Loya, Wendy; Kubiske, Mark; Zak, Donald

    2006-06-01

    The aspen free-air CO2 and O3 enrichment (FACTS II-FACE) study in Rhinelander, Wisconsin, USA, is designed to understand the mechanisms by which young northern deciduous forest ecosystems respond to elevated atmospheric carbon dioxide (CO2) and elevated tropospheric ozone (O3) in a replicated, factorial, field experiment. Soil respiration is the second largest flux of carbon (C) in these ecosystems, and the objective of this study was to understand how soil respiration responded to the experimental treatments as these fast-growing stands of pure aspen and birch + aspen approached maximum leaf area. Rates of soil respiration were typically lowest in the elevated O3 treatment. Elevated CO2 significantly stimulated soil respiration (8-26%) compared to the control treatment in both community types over all three growing seasons. In years 6-7 of the experiment, the greatest rates of soil respiration occurred in the interaction treatment (CO2 + O3), and rates of soil respiration were 15-25% greater in this treatment than in the elevated CO2 treatment, depending on year and community type. Two of the treatments, elevated CO2 and elevated CO2 + O3, were fumigated with 13C-depleted CO2, and in these two treatments we used standard isotope mixing models to understand the proportions of new and old C in soil respiration. During the peak of the growing season, C fixed since the initiation of the experiment in 1998 (new C) accounted for 60-80% of total soil respiration. The isotope measurements independently confirmed that more new C was respired from the interaction treatment compared to the elevated CO2 treatment. A period of low soil moisture late in the 2003 growing season resulted in soil respiration with an isotopic signature 4-6 per thousand enriched in 13C compared to sample dates when the percentage soil moisture was higher. In 2004, an extended period of low soil moisture during August and early September, punctuated by a significant rainfall event, resulted in soil

  17. Soil respiration in typical plant communities in the wetland surrounding the high-salinity Ebinur Lake

    Li, Yanhong; Zhao, Mingliang; Li, Fadong

    2018-03-01

    Soil respiration in wetlands surrounding lakes is a vital component of the soil carbon cycle in arid regions. However, information remains limited on the soil respiration around highly saline lakes during the plant growing season. Here, we aimed to evaluate diurnal and seasonal variation in soil respiration to elucidate the controlling factors in the wetland of Ebinur Lake, Xinjiang Uygur Autonomous Region, western China. We used a soil carbon flux automatic analyzer (LI-840A) to measure soil respiration rates during the growing season (April to November) in two fields covered by reeds and tamarisk and one field with no vegetation (bare soil) from 2015 to 2016. The results showed a single peak in the diurnal pattern of soil respiration from 11:00 to 17:00 for plots covered in reeds, tamarisk, and bare soil, with minimum values being detected from 03:00 to 07:00. During the growing season, the soil respiration of reeds and tamarisk peaked during the thriving period (4.16 and 3.75 mmol•m-2•s-1, respectively), while that of bare soil peaked during the intermediate growth period (0.74 mmol•m-2•s-1). The soil respiration in all three plots was lowest during the wintering period (0.08, 0.09, and-0.87 mmol•m-2•s-1, respectively). Air temperature and relative humidity significantly influenced soil respiration. A significant linear relationship was detected between soil respiration and soil temperature for reeds, tamarisk, and bare soil. The average Q10 of reeds and tamarisk were larger than that of bare soil. However, soil moisture content was not the main factor controlling soil respiration. Soil respiration was negatively correlated with soil pH and soil salinity in all three plot types. In contrast, soil respiration was positively correlated with organic carbon. Overall, CO2 emissions and greenhouse gases had a relatively weak effect on the wetlands surrounding the highly saline Ebinur Lake.

  18. [Research progress on photosynthesis regulating and controlling soil respiration].

    Jing, Yan-Li; Guan, De-Xin; Wu, Jia-Bing; Wang, An-Zhi; Yuan, Feng-Hui

    2013-01-01

    To understand the mechanisms of soil respiration and accurately estimate its magnitude are the crucial basis of evaluating global carbon balance. However, the previously built soil respiration forecast models usually neglect the physiological processes that photosynthesis supplies substrates for rhizospheric respiration, leading to the defect in evaluating the mechanisms of soil respiration. This paper summarized the research progress on the mechanisms of photosynthetic regulation and control of soil respiration, introduced the related main research methods, and discussed the existing problems and research hotspots.

  19. The Evaluation of Basal Respiration for Various Soil Textures in Ecologically Sensitive Area

    Huličová, P.; Kotorová, D.; Fazekašová, D.; Hynšt, J.

    2017-10-01

    The present contribution was focused on monitoring changes in the soil basal respiration in different textures of soil in the dry polder Beša. The research was conducted between 2012 and 2014 on soil type Fluvisol locations on three soil textures: clay - loam soil, clayey soil and clay soil in three soil depths. The basal respiration (BR) has been determine by soil CO2 production measuring from incubated soil samples in serum bottles in laboratory condition. Release Co2 has been analysed by gas chromatography. Content of clay particles were in the range 52.18 % to 81.31%, indicating the high difference between the minimum and maximum content. By using of multiple LSD-test we recorded statistically significant impact of clay on basal respiration. Results confirm the values of basal respiration with the depth of the soil profile decreased.

  20. Comparing organic versus conventional soil management on soil respiration [version 1; referees: 2 approved

    Bence Mátyás

    2018-03-01

    Full Text Available Soil management has great potential to affect soil respiration. In this study, we investigated the effects of organic versus conventional soil management on soil respiration.  We measured the main soil physical-chemical properties from conventional and organic managed soil in Ecuador. Soil respiration was determined using alkaline absorption according to Witkamp.  Soil properties such as organic matter, nitrogen, and humidity, were comparable between conventional and organic soils in the present study, and in a further analysis there was no statically significant correlation with soil respiration. Therefore, even though organic farmers tend to apply more organic material to their fields, but this did not result in a significantly higher CO2 production in their soils in the present study.

  1. Experimental warming does not enhance soil respiration in a semiarid temperate forest-steppe ecosystem

    Lellei-Kovacs, E.; Kovacs-Lang, E.; Kalapos, T.

    2008-01-01

    are still limited. Soil respiration rate-measured monthly between April and November from 2003 to 2006-remained very low (0.09 - 1.53 mu mol CO2 m(-2) s(-1))in accordance with the moderate biological activity and low humus content of the nutrient poor, coarse sandy soil. Specific soil respiration rate...... ( calculated for unit soil organic matter content), however, was relatively high (0.36 - 7.92 mu mol CO g(-1) C(org)h(-1)) suggesting substrate limitation for soil biological activity. During the day, soil respiration rate was significantly lower at dawn than at midday, while seasonally clear temperature......The influence of simulated climate change on soil respiration was studied in a field experiment on 4 m x 5 m plots in the semiarid temperate Pannonian sand forest-steppe. This ecosystem type has low productivity and soil organic matter content, and covers large areas, yet data on soil carbon fluxes...

  2. Internal respiration of Amazon tree stems greatly exceeds external CO2 efflux

    J. Q. Chambers

    2012-12-01

    Full Text Available Respiration in tree stems is an important component of forest carbon balance. The rate of CO2 efflux from the stem has often been assumed to be a measure of stem respiration. However, recent work in temperate forests has demonstrated that stem CO2 efflux can either overestimate or underestimate respiration rate because of emission or removal of CO2 by transport in xylem water. Here, we studied gas exchange from stems of tropical forest trees using a new approach to better understand respiration in an ecosystem that plays a key role in the global carbon cycle. Our main questions were (1 is internal CO2 transport important in tropical trees, and, if so, (2 does this transport result in net release of CO2 respired in the roots at the stem, or does it cause the opposite effect of net removal of stem-respired CO2? To answer these questions, we measured the ratio of stem CO2 efflux to O2 influx. This ratio, defined here as apparent respiratory quotient (ARQ, is expected to equal 1.0 if carbohydrates are the substrate for respiration, and the net transport of CO2 in the xylem water is negligible. Using a stem chamber approach to quantifying ARQ, we found values of 0.66 ± 0.18. These low ARQ values indicate that a large portion of respired CO2 (~ 35% is not emitted locally, and is probably transported upward in the stem. ARQ values of 0.21 ± 0.10 were found for the steady-state gas concentration within the stem, sampled by in-stem equilibration probes. These lower values may result from the proximity to the xylem water stream. In contrast, we found ARQ values of 1.00 ± 0.13 for soil respiration. Our results indicate the existence of a considerable internal flux of CO2 in the stems of tropical trees. If the transported CO2 is used in the canopy as a substrate for photosynthesis, it could account for up to 10% of the C fixed by the tree, and perhaps serve as a mechanism that buffers the response of the tree to changing CO2 levels. Our results also

  3. Stand-scale soil respiration estimates based on chamber methods in a Bornean tropical rainforest

    Kume, T.; Katayama, A.; Komatsu, H.; Ohashi, M.; Nakagawa, M.; Yamashita, M.; Otsuki, K.; Suzuki, M.; Kumagai, T.

    2009-12-01

    This study was undertaken to estimate stand-scale soil respiration in an aseasonal tropical rainforest on Borneo Island. To this aim, we identified critical and practical factors explaining spatial variations in soil respiration based on the soil respiration measurements conducted at 25 points in a 40 × 40 m subplot of a 4 ha study plot for five years in relation to soil, root, and forest structural factors. Consequently, we found significant positive correlation between the soil respiration and forest structural parameters. The most important factor was the mean DBH within 6 m of the measurement points, which had a significant linear relationship with soil respiration. Using the derived linear regression and an inventory dataset, we estimated the 4 ha-scale soil respiration. The 4 ha-scale estimation (6.0 μmol m-2 s-1) was nearly identical to the subplot scale measurements (5.7 μmol m-2 s-1), which were roughly comparable to the nocturnal CO2 fluxes calculated using the eddy covariance technique. To confirm the spatial representativeness of soil respiration estimates in the subplot, we performed variogram analysis. Semivariance of DBH(6) in the 4 ha plot showed that there was autocorrelation within the separation distance of about 20 m, and that the spatial dependence was unclear at a separation distance of greater than 20 m. This ascertained that the 40 × 40 m subplot could represent the whole forest structure in the 4 ha plot. In addition, we discuss characteristics of the stand-scale soil respiration at this site by comparing with those of other forests reported in previous literature in terms of the soil C balance. Soil respiration at our site was noticeably greater, relative to the incident litterfall amount, than soil respiration in other tropical and temperate forests probably owing to the larger total belowground C allocation by emergent trees. Overall, this study suggests the arrangement of emergent trees and their bellow ground C allocation could be

  4. Microcystis aeruginos strain [D-Leu1] Mcyst-LR producer, from Buenos Aires province, Argentina

    Lorena Rosso

    2014-04-01

    Full Text Available Objective: To show the toxicological and phylogenetic characterization of a native Microcystis aeruginosa (M. aeruginosa strain (named CAAT 2005-3 isolated from a water body of Buenos Aires province, Argentine. Methods: A M. aeruginosa strain was isolated from the drainage canal of the sewage treatment in the town of Pila, Buenos Aires province, Argentina and acclimated to laboratory conditions. The amplification of cpcBA-IGS Phcocyanin (PC, intergenic spacer and flanking regions was carried out in order to build a phylogenetic tree. An exactive/orbitrap mass spectrometer equipped with an electrospray ionization source (Thermo Fisher Scientific, Bremen, Germany was used for the LC/ESI-HRMS microcystins analysis. The number of cell/mL and [D-Leu1] Mcyst-LR production obtained as a function of time was modelled using the Gompertz equation. Results: The phylogenetic analysis showed that the sequence clustered with others M. aeruginosa sequences obtained from NCBI. The first Argentinian strain of M. aeruginosa (CAAT 2005-3 growing under culture conditions maintains the typical colonial architecture of M. aeruginosa with profuse mucilage. M. aeruginosa CAAT 2005-3 expresses a toxin variant, that was identified by LC-HRMS/Orbitrapas as [D-Leu1] microcystin-LR ([M+H]+=1 037.8 m/z. Conclusions: [D-Leu1] microcystin-LR has been also detected in M. aeruginosa samples from Canada, Brazil and Argentina. This work provides the basis for technological development and production of analytical standards of toxins present in our region.

  5. Determining the axial power profile of partly flooded fuel in a compact core assembled in reactor LR-0

    Košťál, Michal; Švadlenková, Marie; Baroň, Petr; Rypar, Vojtěch; Milčák, Ján

    2016-01-01

    Highlights: • Fission density in partly flooded compact core. • Calculation of fission density axial profile. • Significant calculational under prediction of experimental axial profile. - Abstract: Measurement and calculation of the axial power profile near the boundary of a moderated and non-moderated core is used to analyze the suitability of the neutron-physical process description, mainly the angular cross-section of a water-moderated uranium system. This is also an important issue because it affects the radiation situation above the partly flooded core of a water-moderated reactor. Axial power profiles of various fuel pins irradiated on reactor LR-0 were measured and the results were compared with MCNP6 code calculations using the ENDF/B-VII.0 nuclear data library. The calculated power profile in positions above the moderator level significantly underestimates experimental results. This might be caused by an improper description of the angular distribution of scattered neutrons in a water-moderated uranium system.

  6. Olfactory Bulb Field Potentials and Respiration in Sleep-Wake States of Mice.

    Jessberger, Jakob; Zhong, Weiwei; Brankačk, Jurij; Draguhn, Andreas

    2016-01-01

    It is well established that local field potentials (LFP) in the rodent olfactory bulb (OB) follow respiration. This respiration-related rhythm (RR) in OB depends on nasal air flow, indicating that it is conveyed by sensory inputs from the nasal epithelium. Recently RR was found outside the olfactory system, suggesting that it plays a role in organizing distributed network activity. It is therefore important to measure RR and to delineate it from endogenous electrical rhythms like theta which cover similar frequency bands in small rodents. In order to validate such measurements in freely behaving mice, we compared rhythmic LFP in the OB with two respiration-related biophysical parameters: whole-body plethysmography (PG) and nasal temperature (thermocouple; TC). During waking, all three signals reflected respiration with similar reliability. Peak power of RR in OB decreased with increasing respiration rate whereas power of PG increased. During NREM sleep, respiration-related TC signals disappeared and large amplitude slow waves frequently concealed RR in OB. In this situation, PG provided a reliable signal while breathing-related rhythms in TC and OB returned only during microarousals. In summary, local field potentials in the olfactory bulb do reliably reflect respiratory rhythm during wakefulness and REM sleep but not during NREM sleep.

  7. Olfactory Bulb Field Potentials and Respiration in Sleep-Wake States of Mice

    Jakob Jessberger

    2016-01-01

    Full Text Available It is well established that local field potentials (LFP in the rodent olfactory bulb (OB follow respiration. This respiration-related rhythm (RR in OB depends on nasal air flow, indicating that it is conveyed by sensory inputs from the nasal epithelium. Recently RR was found outside the olfactory system, suggesting that it plays a role in organizing distributed network activity. It is therefore important to measure RR and to delineate it from endogenous electrical rhythms like theta which cover similar frequency bands in small rodents. In order to validate such measurements in freely behaving mice, we compared rhythmic LFP in the OB with two respiration-related biophysical parameters: whole-body plethysmography (PG and nasal temperature (thermocouple; TC. During waking, all three signals reflected respiration with similar reliability. Peak power of RR in OB decreased with increasing respiration rate whereas power of PG increased. During NREM sleep, respiration-related TC signals disappeared and large amplitude slow waves frequently concealed RR in OB. In this situation, PG provided a reliable signal while breathing-related rhythms in TC and OB returned only during microarousals. In summary, local field potentials in the olfactory bulb do reliably reflect respiratory rhythm during wakefulness and REM sleep but not during NREM sleep.

  8. Evaluation of LR-115 cellulose nitrate film for use in bone autoradiography

    Harris, M.J.; Schlenker, R.A.

    1977-01-01

    An evaluation of Kodak LR-115 cellulose nitrate (CN) film for alpha autoradiography of radium-burdened bone was undertaken. Comparison of the registration efficiency between a plaster of Paris radiator and bone samples on NTA nuclear track emulsion and on the CN film is presented. CN film was observed to record as etched-through holes 11 percent and as tracks only 32 percent of the events detected by NTA emulsion. Potential advantages and disadvantages of using CN film in microdosimetry and for adapting it to automated analysis are discussed

  9. Application of the LR-56 at DOE Facilities in the United States

    Smith, A.C.

    1998-05-01

    The ability to ship Type B liquid packages will be necessary for the nuclear industry to meet the energy production requirements of the next century. There are no packages licensed in the United States for transportation of large quantities of such liquids at present. Packages designed for transporting liquids must address technical challenges and incorporate features which are not common to packages designed for solid contents. These issues and the methods of addressing them are illustrated by the safety analysis performed for utilization of the LR-56 Liquid Package at US DOE facilities

  10. The review of the reactor physics experiments carried out on the LR-0 research reactor NRI Rez plc for reactors of the VVER type

    Hudec, Frantisek; Jansky, Bohumil; Juricek, Vlastimil; Mikus, Jan; Novak, Evzen; Osmera, Bohumil; Posta, Severin; Rypar, Vojtech; Svadlenkova, Marie

    2010-01-01

    LR-0 is an experimental zero power reactor mainly used for the determination of the neutron-physical characteristics of WWER and PWR type reactor lattices and shielding with UO2 or MOX fuel. Its major assets include capability to design and operate multizone cores, i.e. substituted cores, with an inner inserted part in hexagonal or square geometry (driven by LR-0 standard assemblies); Standard and special supporting plates for mock-up experiments; special supporting plates, which enables the triangular symmetrical assembly arrangement with an arbitrary pitch; Modeling neutron field parameters of power reactors; Wide range benchmarking possibilities, with high reproducibility of the benchmark design parameters; Wide range of measurement techniques including equipment and experienced personal; Flexible rearrangements of the core. The main experiments included: Pin wise flux distribution measurements; VVER-440 and VVER-1000 mock-ups; compact spent fuel storage; space kinetics experiment; core parameters experimental determination; experiment with new design fuel assembly; WWER-440 control assembly influence; and burnable absorber study. International research projects are also described. (P.A.)

  11. Annual ecosystem respiration variability of alpine peatland on the eastern Qinghai-Tibet Plateau and its controlling factors.

    Peng, Haijun; Hong, Bing; Hong, Yetang; Zhu, Yongxuan; Cai, Chen; Yuan, Lingui; Wang, Yu

    2015-09-01

    Peatlands are widely developed in the eastern Qinghai-Tibet Plateau, but little is known about carbon budgets for these alpine peatland ecosystems. In this study, we used an automatic chamber system to measure ecosystem respiration in the Hongyuan peatland, which is located in the eastern Qinghai-Tibet Plateau. Annual ecosystem respiration measurements showed a typical seasonal pattern, with the peak appearing in June. The highest respiration was 10.43 μmol CO2/m(2)/s, and the lowest was 0.20 μmol CO2/m(2)/s. The annual average ecosystem respiration was 2.06 μmol CO2/m(2)/s. The total annual respiration was 599.98 g C/m(2), and respiration during the growing season (from May to September) accounted for 78 % of the annual sum. Nonlinear regression revealed that ecosystem respiration has a significant exponential correlation with soil temperature at 10-cm depth (R (2) = 0.98). The Q 10 value was 3.90, which is far higher than the average Q 10 value of terrestrial ecosystems. Ecosystem respiration had an apparent diurnal variation pattern in growing season, with peaks and valleys appearing at approximately 14:00 and 10:00, respectively, which could be explained by soil temperature and soil water content variation at 10-cm depth.

  12. Pulmo uterinus: a history of ideas on fetal respiration.

    Obladen, Michael

    2017-05-24

    Theories about fetal respiration began in antiquity. Aristotle characterized pneuma as warm air, but also as the enabler of vital functions and instrument of the soul. In Galen's system of physiology, the vital spirit was carried by the umbilical arteries, the nutrients by the umbilical vein from the placenta to the fetus. In 1569 Aranzio postulated that the maternal and fetal vasculatures are distinct. From 1670 to 1690, a century before the discovery of oxygen, researchers understood that during respiration some form of exchange with the air must occur, naming the substance biolychnium, phlogiston, sal-nitro, or nitro-aerial particles. An analogy of placental and pulmonary gas exchange was described in 1674 by Mayow. In 1779, Lavoisier understood the discovery of oxygen, discarded the phlogiston theory, and based respiration physiology on gas exchange. With the invention of the spectroscope, it became possible to measure hemoglobin oxygenation, and in 1876 Zweifel proved fetal oxygen uptake. Major progress in understanding fetal gas exchange was achieved in the 20th century by the physiologists Barcroft in Cambridge and Dawes in Oxford.

  13. Microcystin-LR induced reactive oxygen species mediate cytoskeletal disruption and apoptosis of hepatocytes in Cyprinus carpio L.

    Jinlin Jiang

    Full Text Available Microcystins (MCs are a group of cyclic hepatotoxic peptides produced by cyanobacteria. Microcystin-LR (MC-LR contains Leucine (L and Arginine (R in the variable positions, and is one of the most common and potently toxic peptides. MC-LR can inhibit protein phosphatase type 1 and type 2A (PP1 and PP2A activities and induce excessive production of reactive oxygen species (ROS. The underlying mechanism of the inhibition of PP1 and PP2A has been extensively studied. The over-production of ROS is considered to be another main mechanism behind MC-LR toxicity; however, the detailed toxicological mechanism involved in over-production of ROS in carp (Cyprinus carpio L. remains largely unclear. In our present study, the hydroxyl radical (•OH was significantly induced in the liver of carp after a relatively short-term exposure to MC-LR. The elevated reactive oxygen species (ROS production may play an important role in the disruption of microtubule structure. Pre-injection of the antioxidant N-acetyl-cysteine (NAC provided significant protection to the cytoskeleton, however buthionine sulfoximine (BSO exacerbated cytoskeletal destruction. In addition, the elevated ROS formation induced the expression of apoptosis-related genes, including p38, JNKa, and bcl-2. A significant increase in apoptotic cells was observed at 12-48 hours. Our study further supports evidence that ROS are involved in MC-LR induced damage to liver cells in carp, and indicates the need for further study of the molecular mechanisms behind MC-LR toxicity.

  14. Microcystin-LR Induced Reactive Oxygen Species Mediate Cytoskeletal Disruption and Apoptosis of Hepatocytes in Cyprinus carpio L.

    Jiang, Jinlin; Shan, Zhengjun; Xu, Weili; Wang, Xiaorong; Zhou, Junying; Kong, Deyang; Xu, Jing

    2013-01-01

    Microcystins (MCs) are a group of cyclic hepatotoxic peptides produced by cyanobacteria. Microcystin-LR (MC-LR) contains Leucine (L) and Arginine (R) in the variable positions, and is one of the most common and potently toxic peptides. MC-LR can inhibit protein phosphatase type 1 and type 2A (PP1 and PP2A) activities and induce excessive production of reactive oxygen species (ROS). The underlying mechanism of the inhibition of PP1 and PP2A has been extensively studied. The over-production of ROS is considered to be another main mechanism behind MC-LR toxicity; however, the detailed toxicological mechanism involved in over-production of ROS in carp (Cyprinus carpio L.) remains largely unclear. In our present study, the hydroxyl radical (•OH) was significantly induced in the liver of carp after a relatively short-term exposure to MC-LR. The elevated reactive oxygen species (ROS) production may play an important role in the disruption of microtubule structure. Pre-injection of the antioxidant N-acetyl-cysteine (NAC) provided significant protection to the cytoskeleton, however buthionine sulfoximine (BSO) exacerbated cytoskeletal destruction. In addition, the elevated ROS formation induced the expression of apoptosis-related genes, including p38, JNKa, and bcl-2. A significant increase in apoptotic cells was observed at 12 - 48 hours. Our study further supports evidence that ROS are involved in MC-LR induced damage to liver cells in carp, and indicates the need for further study of the molecular mechanisms behind MC-LR toxicity. PMID:24376844

  15. On the relative roles of hydrology, salinity, temperature, and root productivity in controlling soil respiration from coastal swamps (freshwater)

    Krauss, Ken W.; Whitbeck, Julie L.; Howard, Rebecca J.

    2012-01-01

    Background and aims Soil CO2 emissions can dominate gaseous carbon losses from forested wetlands (swamps), especially those positioned in coastal environments. Understanding the varied roles of hydroperiod, salinity, temperature, and root productivity on soil respiration is important in discerning how carbon balances may shift as freshwater swamps retreat inland with sea-level rise and salinity incursion, and convert to mixed communities with marsh plants. Methods We exposed soil mesocosms to combinations of permanent flooding, tide, and salinity, and tracked soil respiration over 2 1/2 growing seasons. We also related these measurements to rates from field sites along the lower Savannah River, Georgia, USA. Soil temperature and root productivity were assessed simultaneously for both experiments. Results Soil respiration from mesocosms (22.7-1678.2 mg CO2 m-2 h-1) differed significantly among treatments during four of the seven sampling intervals, where permanently flooded treatments contributed to low rates of soil respiration and tidally flooded treatments sometimes contributed to higher rates. Permanent flooding reduced the overall capacity for soil respiration as soils warmed. Salinity did reduce soil respiration at times in tidal treatments, indicating that salinity may affect the amount of CO2 respired with tide more strongly than under permanent flooding. However, soil respiration related greatest to root biomass (mesocosm) and standing root length (field); any stress reducing root productivity (incl. salinity and permanent flooding) therefore reduces soil respiration. Conclusions Overall, we hypothesized a stronger, direct role for salinity on soil respiration, and found that salinity effects were being masked by varied capacities for increases in respiration with soil warming as dictated by hydrology, and the indirect influence that salinity can have on plant productivity.

  16. Can we relate respiration rates of bark and wood with tissue nitrogen concentrations and branch-level CO2 fluxes across woody species?

    Eller, A. S.; Wright, I.; Cernusak, L. A.

    2013-12-01

    Respiration from above-ground woody tissue is generally responsible for 5-15% of ecosystem respiration (~ 30% of total above-ground respiration). The CO2 respired by branches comes from both the sapwood and the living layers within the bark, but because there is considerable movement of respired CO2 within woody tissues (e.g. in the transpiration stream), and because the bark can present a considerable barrier to CO2 diffusion, it can be difficult to interpret measured CO2 efflux from intact branches in relation to the respiration rates of the component tissues, and to relative mass allocation to each. In this study we investigated these issues in 15 evergreen tree and shrub species native to the Sydney area in eastern Australia. We measured CO2 efflux and light-dependent refixation of respired CO2 in photosynthetic bark from the exterior surfaces of branches (0.5-1.5 cm in diameter), and measured the tissue-specific respiration rates of the bark and wood from those same branches. We also measured the nitrogen content and tissue density of the wood and bark to determine: 1) Among species, what is the relationship between %N and tissue respiration? 2) How is photosynthetic refixation of CO2 related to respiration and %N in the bark and underlying wood? and 3) What is the relationship between branch CO2 efflux and the respiration rates of the underlying wood and bark that make up the branch? Across the 15 species %N was a better predictor of respiration in wood than in bark. CO2 efflux measured from the exterior of the stem in the dark was positively correlated with photosynthetic refixation and explained ~40% of the variation in rates of refixation. Refixation rates were not strongly related to bark or wood %N. Differences among species in CO2 efflux rates were not well explained by differences in bark or wood %N and there was a stronger relationship between bark respiration and CO2 efflux than between wood respiration and CO2 efflux. These results suggest that the

  17. Neutron flux characterization using Lr-115 NTD and binary glass metal as converter

    Alvarado, R.; Palacios, D.; Sajo B, L.; Greaves, E.; Barros, H.; Nemeth, P.; Goncalves, I. F.

    2010-01-01

    The installed neutron irradiation cell at the Simon Bolivar University Laboratory is employed frequently for applications where the neutron field should be monitored. The ratio of epithermal and thermal neutron flux were determined by the cadmium difference method in three different irradiation locations of a graphite thermalized 252 Cf source. Monte Carlo simulation provided the expected thermal neutron field inside the irradiation cell and the nuclear trace detectors sensitivity. The passive device is a Kodak-Pathe Lr-115 externally coated with a thin (0,1 mm) binary glass metal strip Fe 75 B 25 where the 10 B(n,α) 7 Li reaction converts free neutrons into alpha particles that are registered as etched tracks. The results allow to determine the neutron flux in an easy, reproducible and effective way, with the advantage of a low self-absorption effect due to the converter material. Improved etching process of the Lr-115 nuclear track detectors and the software parameters for track analysis are included. (Author)

  18. Two weeks of metformin treatment enhances mitochondrial respiration in skeletal muscle of AMPK kinase dead but not wild type mice

    Kristensen, Jonas Møller; Larsen, Steen; Helge, Jørn Wulff

    2013-01-01

    signaling. We investigated this by two weeks of oral metformin treatment of muscle specific kinase dead a(2) (KD) AMPK mice and wild type (WT) littermates. We measured mitochondrial respiration and protein activity and expressions of key enzymes involved in mitochondrial carbohydrate and fat metabolism...... and oxidative phosphorylation. Mitochondrial respiration, HAD and CS activity, PDH and complex I-V and cytochrome c protein expression were all reduced in AMPK KD compared to WT tibialis anterior muscles. Surprisingly, metformin treatment only enhanced respiration in AMPK KD mice and thereby rescued...... the respiration defect compared to the WT mice. Metformin did not influence protein activities or expressions in either WT or AMPK KD mice.We conclude that two weeks of in vivo metformin treatment enhances mitochondrial respiration in the mitochondrial deficient AMPK KD but not WT mice. The improvement seems...

  19. Soil respiration and organic carbon dynamics with grassland conversions to woodlands in temperate china.

    Wei Wang

    Full Text Available Soils are the largest terrestrial carbon store and soil respiration is the second-largest flux in ecosystem carbon cycling. Across China's temperate region, climatic changes and human activities have frequently caused the transformation of grasslands to woodlands. However, the effect of this transition on soil respiration and soil organic carbon (SOC dynamics remains uncertain in this area. In this study, we measured in situ soil respiration and SOC storage over a two-year period (Jan. 2007-Dec. 2008 from five characteristic vegetation types in a forest-steppe ecotone of temperate China, including grassland (GR, shrubland (SH, as well as in evergreen coniferous (EC, deciduous coniferous (DC and deciduous broadleaved forest (DB, to evaluate the changes of soil respiration and SOC storage with grassland conversions to diverse types of woodlands. Annual soil respiration increased by 3%, 6%, 14%, and 22% after the conversion from GR to EC, SH, DC, and DB, respectively. The variation in soil respiration among different vegetation types could be well explained by SOC and soil total nitrogen content. Despite higher soil respiration in woodlands, SOC storage and residence time increased in the upper 20 cm of soil. Our results suggest that the differences in soil environmental conditions, especially soil substrate availability, influenced the level of annual soil respiration produced by different vegetation types. Moreover, shifts from grassland to woody plant dominance resulted in increased SOC storage. Given the widespread increase in woody plant abundance caused by climate change and large-scale afforestation programs, the soils are expected to accumulate and store increased amounts of organic carbon in temperate areas of China.

  20. Ecosystem warming does not affect photosynthesis or aboveground autotrophic respiration for boreal black spruce

    Bronson, D.R. [Wyoming Univ., Laramie, WY (United States). Dept. of Renewable Resources; Gower, S.T. [Wisconsin Univ., Madison, WI (United States). Dept. of Forest Ecology and Management

    2010-04-15

    Substantial increases in climatic temperatures may cause boreal forests to become a carbon source. An improved understanding of the effect of climatic warming on photosynthesis and autotrophic respiration is needed in order to determine the impact of temperature increases on net carbon balances. This study measured the light-saturated photosynthesis foliage respiration and stem respiration of black spruce in heated and control plots during a 3-year period at a site located in Thompson, Manitoba. Greenhouses and soil-heating cables were used to maintain air and soil temperatures at 5 degrees C above ambient air and soil temperatures. Studies were conducted to determine the influence of soil and air warming; soil-only warming; and greenhouses maintained at ambient temperatures. The study showed that treatment differences for photosynthesis, foliage respiration, and stem respiration were not significant over the 3-year period. Results suggested that black spruce may not have significant changes in photosynthesis or respiration rates in warmer climates. 38 refs., 3 tabs., 4 figs.

  1. Microbial properties explain temporal variation in soil respiration in a grassland subjected to nitrogen addition

    Li, Yue; Liu, Yinghui; Wu, Shanmei; Niu, Lei; Tian, Yuqiang

    2015-01-01

    The role of soil microbial variables in shaping the temporal variability of soil respiration has been well acknowledged but is poorly understood, particularly under elevated nitrogen (N) deposition conditions. We measured soil respiration along with soil microbial properties during the early, middle, and late growing seasons in temperate grassland plots that had been treated with N additions of 0, 2, 4, 8, 16, or 32 g N m−2 yr−1 for 10 years. Representing the averages over three observation periods, total (Rs) and heterotrophic (Rh) respiration were highest with 4 g N m−2 yr−1, but autotrophic respiration (Ra) was highest with 8 to 16 g N m−2 yr−1. Also, the responses of Rh and Ra were unsynchronized considering the periods separately. N addition had no significant impact on the temperature sensitivity (Q10) for Rs but inhibited the Q10 for Rh. Significant interactions between observation period and N level occurred in soil respiration components, and the temporal variations in soil respiration components were mostly associated with changes in microbial biomass carbon (MBC) and phospholipid fatty acids (PLFAs). Further observation on soil organic carbon and root biomass is needed to reveal the long-term effect of N deposition on soil C sequestration. PMID:26678303

  2. Seasonal and episodic moisture controls on plant and microbial contributions to soil respiration.

    Carbone, Mariah S; Still, Christopher J; Ambrose, Anthony R; Dawson, Todd E; Williams, A Park; Boot, Claudia M; Schaeffer, Sean M; Schimel, Joshua P

    2011-09-01

    Moisture inputs drive soil respiration (SR) dynamics in semi-arid and arid ecosystems. However, determining the contributions of root and microbial respiration to SR, and their separate temporal responses to periodic drought and water pulses, remains poorly understood. This study was conducted in a pine forest ecosystem with a Mediterranean-type climate that receives seasonally varying precipitation inputs from both rainfall (in the winter) and fog-drip (primarily in the summer). We used automated SR measurements, radiocarbon SR source partitioning, and a water addition experiment to understand how SR, and its separate root and microbial sources, respond to seasonal and episodic changes in moisture. Seasonal changes in SR were driven by surface soil water content and large changes in root respiration contributions. Superimposed on these seasonal patterns were episodic pulses of precipitation that determined the short-term SR patterns. Warm season precipitation pulses derived from fog-drip, and rainfall following extended dry periods, stimulated the largest SR responses. Microbial respiration dominated these SR responses, increasing within hours, whereas root respiration responded more slowly over days. We conclude that root and microbial respiration sources respond differently in timing and magnitude to both seasonal and episodic moisture inputs. These findings have important implications for the mechanistic representation of SR in models and the response of dry ecosystems to changes in precipitation patterns.

  3. Effect of typhoon disturbance on soil respiration dynamic in a tropical broadleaves plantation in southern Taiwan

    Chiang, Po-Neng; Yu, Jui-Chu; Lai, Yen-Jen

    2017-04-01

    Global forests contain 69% of total carbon stored in forest soil and litter. But the carbon storage ability and release rate of warming gases of forest soil also affect global climate change. Reforestation is one of the best solutions to mitigate warming gases release and to store in soil. Typhoon is one of the most hazards to disturb forest ecosystem and change carbon cycle. Typhoon disturbance is also affect soil carbon cycle such as soil respiration, carbon storage. Therefore, the objective of this study is to clarify the effect of typhoon disturbance on soil respiration dynamic in a tropical broadleaves plantation in southern Taiwan. Fourteen broadleaved tree species were planted in 2002-2005. Twelves continuous soil respiration chambers was divided two treatments (trench and non-trench) and observed since 2011 to 2014. The soil belongs to Entisol with over 60% of sandstone. The soil pH is 5.5 with low base cations because of high sand percentage. Forest biometric such as tree high, DBH, litterfall was measured in 2011-2014. Data showed that the accumulation amount of litterfall was highest in December to February and lowest in June. Soil respiration was related with season variation in research site. Soil temperature showed significantly exponential related with soil respiration in research site (p<0.001).However, soil respiration showed significantly negative relationship with total amount of litterfall (p<0.001), suggesting that the tree was still young and did not reach crown closure.

  4. No diurnal variation in rate or carbon isotope composition of soil respiration in a boreal forest

    Betson, N.R.; Gottlicher, S.G.; Hogberg, P.; Hall, M.; Wallin, G.; Richter, A.

    2007-01-01

    This study evaluated the diurnal variability in the rate and stable carbon isotope ratio ((delta) 13 C) of soil respiration in a northern boreal forest, measured with opaque chambers after the removal of understory vegetation. The experiment was conducted in June and August 2004 at the Picea abies L. Karst-dominated Flakaliden Research Forest in northern Sweden, using unfertilized girdled-tree plots and unfertilized non-girdled tree plots. Soil respiration and (delta) 13 C of soil-respired carbon dioxide (CO 2 ) were measured every 4 hours on 6 plots, with a total of 11 sampling times over each 48 hour period. The purpose was to clarify an earlier study regarding the origin of diurnal patterns of soil CO 2 flux. This study explored whether the diurnal patterns were the result of photosynthetic CO 2 uptake during the day by the understory or whether there were underlying trends in soil respiration driven by plant root allocation. The sampling campaigns undertaken in this study investigated whether diurnal variations in soil respiration rate and (delta) 13 C exist in this ecosystem when no understory vegetation is present. Shoot photosynthesis and environmental parameters were measured simultaneously. Despite significant variations in climatic conditions and shoot photosynthetic rates in non-girdled trees, no diurnal patterns in soil respiration rates and (delta) 13 C were noted in either treatment. The lack of detectable diurnal changes in both treatments indicates that modeling of daily boreal forest carbon balances based on single instantaneous measurements are unlikely to be misconstrued by substantial diurnal trends. However, it was suggested that spatial variable should be accounted for, given the large standard errors. The impact of tree girdling on soil respiration rates also emphasized the significance of canopy photosynthesis in driving soil processes. 37 refs., 2 figs

  5. Detection of trace microcystin-LR on a 20 MHz QCM sensor coated with in situ self-assembled MIPs.

    He, Hao; Zhou, Lianqun; Wang, Yi; Li, Chuanyu; Yao, Jia; Zhang, Wei; Zhang, Qingwen; Li, Mingyu; Li, Haiwen; Dong, Wen-fei

    2015-01-01

    A 20 MHz quartz crystal microbalance (QCM) sensor coated with in situ self-assembled molecularly imprinted polymers (MIPs) was presented for the detection of trace microcystin-LR (MC-LR) in drinking water. The sensor performance obtained using the in situ self-assembled MIPs was compared with traditionally synthesized MIPs on 20 MHz and normal 10 MHz QCM chip. The results show that the response increases by more than 60% when using the in situ self-assembly method compared using the traditionally method while the 20 MHz QCM chip provides four-fold higher response than the 10 MHz one. Therefore, the in situ self-assembled MIPs coated on a high frequency QCM chip was used in the sensor performance test to detect MC-LR in tap water. It showed a limit of detection (LOD) of 0.04 nM which is lower than the safety guideline level (1 nM MC-LR) of drinking water in China. The low sensor response to other analogs indicated the high specificity of the sensor to MC-LR. The sensor showed high stability and low signal variation less than 2.58% after regeneration. The lake water sample analysis shows the sensor is possible for practical use. The combination of the higher frequency QCM with the in situ self-assembled MIPs provides a good candidate for the detection of other small molecules. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. [Soil respiration characteristics in winter wheat field in North China Plain].

    Chen, Shuyue; Li, Jun; Lu, Peiling; Wang, Yinghong; Yu, Qiang

    2004-09-01

    Experiments were conducted at the Yucheng Comprehensive Experimental Station of the Chinese Academy of Sciences during 2002-2003 to investigate the respiration of a pulverous sandstone soil under cultivation of winter wheat over a growth season. The effluent CO2 was collected and analyzed by the static-chamber/gas chromatography (GC) method at a frequency of once a week in spring and autumn, once two weeks in winter, twice a week for straw manure treatment, once a week for no straw manure treatment and nitrogen fertilization treatment in summer. The results indicated that diurnal variation of soil respiration rate showed a single peak in typical winter wheat farmlands in the North China Plain, and reached the highest at about 13 o'clock, and the lowest at about 4 o'clock in the early morning. In winter wheat growth season, the soil respiration rate was 31.23-606.85 mg x m(-2) x h(-1) under straw manure, 28.99-549.66 x m(-2) x h(-1) under no straw manure, 10.46-590.86 mg x m(-2) x h(-1) in N0, 16.11-349.88 mg x m(-2) x h(-1) in N100, 12.25-415.00 mg x m(-2) x h(-1) in N200, and 23.01-410.58 mg x m(-2) x h(-1) in N300, showing a similar seasonal variation tendency with soil temperature. Among all treatments, the straw manure had the most distinct soil respiration, though the soil respiration also increased slightly with increasing nitrogen fertilization. Soil respiration increased exponentially with increasing soil temperature, and the correlation of soil temperature at the depth of 5 cm was the best. This relationship was usually described with the Q10 model, which represented the sensitivity of soil respiration to temperature. Q10 was not a fixed value, which varied with the depth at which the temperature was measured and the depth of the active soil layer and soil temperature. At same time, the Q10 value decreased with increasing soil temperature. Soil water content was another important factor affecting soil respiration rate, but in this region, the relationship

  7. [Soil respiration dynamics and its controlling factors of typical vegetation communities on meadow steppes in the western Songnen Plain].

    Wang, Ming; Liu, Xing-Tu; Li, Xiu-Jun; Zhang, Ji-Tao; Wang, Guo-Dong; Lu, Xin-Rui; Li, Xiao-Yu

    2014-01-01

    In order to accurately explore the soil respiration dynamics and its controlling factors of typical vegetation types in the western Songnen Plain, soil respiration rates of Chloris virgata, Puccinellia distans, Phragmites australis and Leymus chinensis communities were measured. The results showed that the diurnal curves of soil respiration rates of the four vegetation communities had simple peak values, which appeared at 11:00-15:00, and the valley values occurred at 21:00-1:00 or 3:00-5:00. The seasonal dynamic patterns of their soil respiration rates were similar, with the maximum (3.21-4.84 micromol CO2 x m(-2) x s(-1)) occurring in July and August and the minimum (0.46-1.51 micromol CO2 x m(-2) x s(-1)) in October. The soil respiration rates of the four vegetation communities had significant exponential correlations with ambient air temperature and soil temperature. Soil moisture, however, only played an important role in affecting the soil respiration rate of C. virgata community while air humidity near the soil surface was significantly correlated with the soil respiration rates of P. australis and L. chinensis communities. The soil salt contents seriously constrained the CO2 dioxide emission, and the soil pH, electrical conductivity (EC), exchangeable sodium percentage (ESP) could explain 87%-91% spatial variations of the soil respiration rate.

  8. Reductions in the variations of respiration signals for respiratory-gated radiotherapy when using the video-coaching respiration guiding system

    Lee, Hyun Jeong; Yea, Ji Woon; Oh, Se An

    2015-07-01

    Respiratory-gated radiation therapy (RGRT) has been used to minimize the dose to normal tissue in lung-cancer radiotherapy. The present research aims to improve the regularity of respiration in RGRT by using a video-coached respiration guiding system. In the study, 16 patients with lung cancer were evaluated. The respiration signals of the patients were measured by using a realtime position management (RPM) respiratory gating system (Varian, USA), and the patients were trained using the video-coaching respiration guiding system. The patients performed free breathing and guided breathing, and the respiratory cycles were acquired for ~5 min. Then, Microsoft Excel 2010 software was used to calculate the mean and the standard deviation for each phase. The standard deviation was computed in order to analyze the improvement in the respiratory regularity with respect to the period and the displacement. The standard deviation of the guided breathing decreased to 48.8% in the inhale peak and 24.2% in the exhale peak compared with the values for the free breathing of patient 6. The standard deviation of the respiratory cycle was found to be decreased when using the respiratory guiding system. The respiratory regularity was significantly improved when using the video-coaching respiration guiding system. Therefore, the system is useful for improving the accuracy and the efficiency of RGRT.

  9. Comparison of fast neutron spectra in graphite and FLINA salt inserted in well-defined core assembled in LR-0 reactor

    Košťál, Michal; Veškrna, Martin; Cvachovec, František; Jánský, Bohumil; Novák, Evžen; Rypar, Vojtěch; Milčák, Ján; Losa, Evžen; Mravec, Filip; Matěj, Zdeněk; Rejchrt, Jiří; Forget, Benoit; Harper, Sterling

    2015-01-01

    Highlights: • Neutron spectra measured in graphite and LiF + NaF. • Comparison of calculated and measured neutron spectra. • Effect of 19F on variation between various library calculated spectra. - Abstract: The present paper aims to compare the calculated and measured spectra after insertion of candidate materials for the Molten salt reactor/Fluoride cooled high temperature reactor system concept into the LR-0 reactor. The calculation is realized with MCNP6 code using ENDF/B-VII.0, JEFF-3.1, JENDL-3.3, JENDL-4, ROSFOND-2010 and CENDL-3.1 nuclear data libraries. Additionally, comparisons between the slowing down power of each media were performed. The slowing down properties are important parameters affecting the thickness of moderator media in a reactor

  10. Ecological risk assessment of microcystin-LR in the upstream section of the Haihe River based on a species sensitivity distribution model.

    Niu, Zhiguang; Du, Lei; Li, Jiafu; Zhang, Ying; Lv, Zhiwei

    2018-02-01

    The eutrophication of surface water has been the main problem of water quality management in recent decades, and the ecological risk of microcystin-LR (MC-LR), which is the by-product of eutrophication, has drawn more attention worldwide. The aims of our study were to determine the predicted no effect concentration (PNEC) of MC-LR and to assess the ecological risk of MC-LR in the upstream section of the Haihe River. HC 5 (hazardous concentration for 5% of biological species) and PNEC were obtained from a species sensitivity distribution (SSD) model, which was constructed with the acute toxicity data of MC-LR on aquatic organisms. The concentrations of MC-LR in the upstream section of the Haihe River from April to August of 2015 were analysed, and the ecological risk characteristics of MC-LR were evaluated based on the SSD model. The results showed that the HC 5 of MC-LR in freshwater was 17.18 μg/L and PNEC was 5.73 μg/L. The concentrations of MC-LR ranged from 0.68 μg/L to 32.21 μg/L and were obviously higher in summer than in spring. The values of the risk quotient (RQ) ranged from 0.12 to 5.62, suggesting that the risk of MC-LR for aquatic organisms in the river was at a medium or high level during the study period. Compared with other waterbodies in the world, the pollution level of MC-LR in the Haihe River was at a moderate level. This research could promote the study of the ecological risk of MC-LR at the ecosystem level. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Omega-3 fatty acid docosahexaenoic acid increases SorLA/LR11, a sorting protein with reduced expression in sporadic Alzheimer's disease (AD): relevance to AD prevention.

    Ma, Qiu-Lan; Teter, Bruce; Ubeda, Oliver J; Morihara, Takashi; Dhoot, Dilsher; Nyby, Michael D; Tuck, Michael L; Frautschy, Sally A; Cole, Greg M

    2007-12-26

    Environmental and genetic factors, notably ApoE4, contribute to the etiology of late-onset Alzheimer's disease (LOAD). Reduced mRNA and protein for an apolipoprotein E (ApoE) receptor family member, SorLA (LR11) has been found in LOAD but not early-onset AD, suggesting that LR11 loss is not secondary to pathology. LR11 is a neuronal sorting protein that reduces amyloid precursor protein (APP) trafficking to secretases that generate beta-amyloid (Abeta). Genetic polymorphisms that reduce LR11 expression are associated with increased AD risk. However these polymorphisms account for only a fraction of cases with LR11 deficits, suggesting involvement of environmental factors. Because lipoprotein receptors are typically lipid-regulated, we postulated that LR11 is regulated by docosahexaenoic acid (DHA), an essential omega-3 fatty acid related to reduced AD risk and reduced Abeta accumulation. In this study, we report that DHA significantly increases LR11 in multiple systems, including primary rat neurons, aged non-Tg mice and an aged DHA-depleted APPsw AD mouse model. DHA also increased LR11 in a human neuronal line. In vivo elevation of LR11 was also observed with dietary fish oil in young rats with insulin resistance, a model for type II diabetes, another AD risk factor. These data argue that DHA induction of LR11 does not require DHA-depleting diets and is not age dependent. Because reduced LR11 is known to increase Abeta production and may be a significant genetic cause of LOAD, our results indicate that DHA increases in SorLA/LR11 levels may play an important role in preventing LOAD.

  12. Organic fuels for respiration in tropical river systems

    Ward, N.; Keil, R. G.; Richey, J. E.; Krusche, A. V.; Medeiros, P. M.

    2011-12-01

    Watershed-derived organic matter is thought to provide anywhere from 30-90% of the organic matter in rivers (e.g. Hernes et al 2008; Spencer et al 2010). The most abundant biochemicals on land are cellulose, hemicelluloses, and lignin. Combined, they represent as much as 80% of the biomass in a typical forest and as much as 60% of the biomass in a typical field (natural or crop)(Bose et al 2009; Bridgeman et al., 2007; Hu and Zu 2006; Martens et al 2004). They are often assumed to be refractory and hard to degrade, but this assumption is at odds with virtually all observations: soils and marine sediments are not accumulating vast amounts of these compounds (Hedges and Oades, 1997), and degradation experiments suggest that cellulose, hemicelluloses and lignin are reactive and likely to be important fuels for respiration (Benner, 1991; Haddad et al, 1992; Dittmar et al, 2001; Otto and Simpson, 2006). During several trips to the lower Amazon River, incubation experiments were performed in which the biological degradation of lignin phenols was observed in order to assess the contribution of microbial respiration of terrestrially-derived macromolecules to gross respiration and CO2 gas evasion rates. Both particulate and dissolved lignin concentrations decreased by ~40% after being incubated in the dark for 5-7 days, indicating a turnover time of the entire lignin pool of 12-18 days. These results shift the paradigm that lignocellulose derived OM is highly recalcitrant, and indicate that microbial respiration of lignocellulose may play a larger role in total respiration rates/CO2 outgassing than previously thought. A simple mass balance calculation was done to test whether microbial degradation alone could explain the lignin data observed in the field. First, a theoretical particulate lignin concentration for Macapa was calculated based on the observed data at Obidos. The measured rate of particulate lignin degradation was multiplied by the transit time of water from

  13. Evolution of the LR56 radioactive liquid waste transportation system for use at Hanford, Oak Ridge, and Savannah River Sites

    Clement, G.; Delvecchio, D.J.; Sazawal, V.

    1997-01-01

    The LR56 system is a radioactive liquid transportation cask licensed for use in France for on-site road transfer of Type B bulk quantities of radioactive liquids. Three LR56 systems (with adaptations for use at the Department of Energy (DOE) sites in the US) have been recently purchased for use at the Hanford site, the Oak Ridge National laboratory site and the Savannah River Site. The paper discussed the main features of the LR56 system and presents the evolution of the design. Particular attention is given to the last version developed for the Savannah River Site to be used for the transfer of highly concentrated alpha bearing liquids. For this application a special enhancement of the secondary vessel has been implemented which provides the system with a double leak tight confinement

  14. Plankton community respiration, net ecosystem metabolism, and oxygen dynamics on the Louisiana continental shelf: implications for hypoxia

    We conducted a multi-year study of the Louisiana continental shelf (LCS) to better understand the linkages between water column metabolism and the formation of hypoxia (dissolved oxygen respiration rates (WR) were measured on 10 cr...

  15. Estimating Canopy Dark Respiration for Crop Models

    Monje Mejia, Oscar Alberto

    2014-01-01

    Crop production is obtained from accurate estimates of daily carbon gain.Canopy gross photosynthesis (Pgross) can be estimated from biochemical models of photosynthesis using sun and shaded leaf portions and the amount of intercepted photosyntheticallyactive radiation (PAR).In turn, canopy daily net carbon gain can be estimated from canopy daily gross photosynthesis when canopy dark respiration (Rd) is known.

  16. LIMITATION OF SOIL RESPIRATION DURING DRY PERIOD

    Pavelka, Marian; Janouš, Dalibor; Acosta, Manuel

    2003-01-01

    Roč. 16, - (2003), s. 47-52. ISBN 80-7157-297-7 R&D Projects: GA MŠk LN00A141; GA AV ČR IBS6087005 Institutional research plan: CEZ:AV0Z6087904 Keywords : moisture * Norway spruce * precipitation * respiration * soil CO2 efflux Subject RIV: EH - Ecology, Behaviour

  17. Internal current generation in respiration chambers

    Saborowski, R.; Buchholz, F.

    1998-06-01

    A technical device generating a constant and directed current within a sealed respiration chamber is described. It does not involve any external pumps or tubing. This system is easy to handle, and improved the maintenance of rheotactic pelagic species like the Northern krill ( Meganyctiphanes norvegica, Crustacea) or small fishes ( Gasterosteus aculeatus) under experimental conditions.

  18. 42 CFR 84.1130 - Respirators; description.

    2010-10-01

    ...; Pesticide; Paint Spray; Powered Air-Purifying High Efficiency Respirators and Combination Gas Masks § 84...., dust clouds produced in mining, quarrying, and tunneling, and in dusts produced during industrial... respective vapors, or from the chemical reaction between their respective vapors and gases. (3) Air-purifying...

  19. Development of conformal respirator monitoring technology

    Shonka, J.J.; Weismann, J.J.; Logan, R.J.

    1997-04-01

    This report summarizes the results of a Small Business Innovative Research Phase II project to develop a modular, surface conforming respirator monitor to improve upon the manual survey techniques presently used by the nuclear industry. Research was performed with plastic scintillator and gas proportional modules in an effort to find the most conducive geometry for a surface conformal, position sensitive monitor. The respirator monitor prototype developed is a computer controlled, position-sensitive detection system employing 56 modular proportional counters mounted in molds conforming to the inner and outer surfaces of a commonly used respirator (Scott Model 801450-40). The molds are housed in separate enclosures and hinged to create a open-quotes waffle-ironclose quotes effect so that the closed monitor will simultaneously survey both surfaces of the respirator. The proportional counter prototype was also designed to incorporate Shonka Research Associates previously developed charge-division electronics. This research provided valuable experience into pixellated position sensitive detection systems. The technology developed can be adapted to other monitoring applications where there is a need for deployment of many traditional radiation detectors

  20. Assessment of human respiration patterns via noncontact sensing using Doppler multi-radar system.

    Gu, Changzhan; Li, Changzhi

    2015-03-16

    Human respiratory patterns at chest and abdomen are associated with both physical and emotional states. Accurate measurement of the respiratory patterns provides an approach to assess and analyze the physical and emotional states of the subject persons. Not many research efforts have been made to wirelessly assess different respiration patterns, largely due to the inaccuracy of the conventional continuous-wave radar sensor to track the original signal pattern of slow respiratory movements. This paper presents the accurate assessment of different respiratory patterns based on noncontact Doppler radar sensing. This paper evaluates the feasibility of accurately monitoring different human respiration patterns via noncontact radar sensing. A 2.4 GHz DC coupled multi-radar system was used for accurate measurement of the complete respiration patterns without any signal distortion. Experiments were carried out in the lab environment to measure the different respiration patterns when the subject person performed natural breathing, chest breathing and diaphragmatic breathing. The experimental results showed that accurate assessment of different respiration patterns is feasible using the proposed noncontact radar sensing technique.

  1. Microcystin-LR nanobody screening from an alpaca phage display nanobody library and its expression and application.

    Xu, Chongxin; Yang, Ying; Liu, Liwen; Li, Jianhong; Liu, Xiaoqin; Zhang, Xiao; Liu, Yuan; Zhang, Cunzheng; Liu, Xianjin

    2018-04-30

    Microcystin-LR (MC-LR) is a type of biotoxin that pollutes the ecological environment and food. The study aimed to obtain new nanobodies from phage nanobody library for determination of MC-LR. The toxin was conjugated to keyhole limpet haemocyanin (KLH) and bovine serum albumin (BSA), respectively, then the conjugates were used as coated antigens for enrichment (coated MC-LR-KLH) and screening (coated MC-LR-BSA) of MC-LR phage nanobodies from an alpaca phage display nanobody library. The antigen-specific phage particles were enriched effectively with four rounds of biopanning. At the last round of enrichment, total 20 positive monoclonal phage nanobodies were obtained from the library, which were analyzed after monoclonal phage enzyme linked immunosorbent assay (ELISA), colony PCR and DNA sequencing. The most three positive nanobody genes, ANAb12, ANAb9 and ANAb7 were cloned into pET26b vector, then the nanobodies were expressed in Escherichia coli BL21 respectively. After being purified, the molecular weight (M.W.) of all nanobodies were approximate 15kDa with sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The purified nanobodies, ANAb12, ANAb9 and ANAb7 were used to establish the indirect competitive ELISA (IC-ELISA) for MC-LR, and their half-maximum inhibition concentrations (IC 50 ) were 0.87, 1.17 and 1.47μg/L, their detection limits (IC 10 ) were 0.06, 0.08 and 0.12μg/L, respectively. All of them showed strong cross-reactivity (CRs) of 82.7-116.9% for MC-RR, MC-YR and MC-WR, and weak CRs of less than 4.56% for MC-LW, less than 0.1% for MC-LY and MC-LF. It was found that all the IC-ELISAs for MC-LR spiked in tap water samples detection were with good accuracy, stability and repeatability, their recoveries were 84.0-106.5%, coefficient of variations (CVs) were 3.4-10.6%. These results showed that IC-ELISA based on the nanobodies from the alpaca phage display antibody library were promising for high sensitive determination of multiple

  2. Soil respiration sensitivities to water and temperature in a revegetated desert

    Zhang, Zhi-Shan; Dong, Xue-Jun; Xu, Bing-Xin; Chen, Yong-Le; Zhao, Yang; Gao, Yan-Hong; Hu, Yi-Gang; Huang, Lei

    2015-04-01

    Soil respiration in water-limited ecosystems is affected intricately by soil water content (SWC), temperature, and soil properties. Eight sites on sand-fixed dunes that revegetated in different years since 1950s, with several topographical positions and various biological soil crusts (BSCs) and soil properties, were selected, as well as a moving sand dune (MSD) and a reference steppe in the Tengger Desert of China. Intact soil samples of 20 cm in depth were taken and incubated randomly at 12 levels of SWC (0 to 0.4 m3 m-3) and at 9 levels of temperature (5 to 45°C) in a growth chamber; additionally, cryptogamic and microbial respirations (RM) were measured. Total soil respiration (RT, including cryptogamic, microbial, and root respiration) was measured for 2 years at the MSD and five sites of sand-fixed dunes. The relationship between RM and SWC under the optimal SWC condition (0.25 m3 m-3) is linear, as is the entire range of RT and SWC. The slope of linear function describes sensitivity of soil respiration to water (SRW) and reflects to soil water availability, which is related significantly to soil physical properties, BSCs, and soil chemical properties, in decreasing importance. Inversely, Q10 for RM is related significantly to abovementioned factors in increasing importance. However, Q10 for RT and respiration rate at 20°C are related significantly to soil texture and depth of BSCs and subsoil only. In conclusion, through affecting SRW, soil physical properties produce significant influences on soil respiration, especially for RT. This indicates that a definition of the biophysical meaning of SRW is necessary, considering the water-limited and coarse-textured soil in most desert ecosystems.

  3. Mitochondrial Respiration in Insulin-Producing β-Cells: General Characteristics and Adaptive Effects of Hypoxia.

    Hals, Ingrid K; Bruerberg, Simon Gustafson; Ma, Zuheng; Scholz, Hanne; Björklund, Anneli; Grill, Valdemar

    2015-01-01

    To provide novel insights on mitochondrial respiration in β-cells and the adaptive effects of hypoxia. Insulin-producing INS-1 832/13 cells were exposed to 18 hours of hypoxia followed by 20-22 hours re-oxygenation. Mitochondrial respiration was measured by high-resolution respirometry in both intact and permeabilized cells, in the latter after establishing three functional substrate-uncoupler-inhibitor titration (SUIT) protocols. Concomitant measurements included proteins of mitochondrial complexes (Western blotting), ATP and insulin secretion. Intact cells exhibited a high degree of intrinsic uncoupling, comprising about 50% of oxygen consumption in the basal respiratory state. Hypoxia followed by re-oxygenation increased maximal overall respiration. Exploratory experiments in peremabilized cells could not show induction of respiration by malate or pyruvate as reducing substrates, thus glutamate and succinate were used as mitochondrial substrates in SUIT protocols. Permeabilized cells displayed a high capacity for oxidative phosphorylation for both complex I- and II-linked substrates in relation to maximum capacity of electron transfer. Previous hypoxia decreased phosphorylation control of complex I-linked respiration, but not in complex II-linked respiration. Coupling control ratios showed increased coupling efficiency for both complex I- and II-linked substrates in hypoxia-exposed cells. Respiratory rates overall were increased. Also previous hypoxia increased proteins of mitochondrial complexes I and II (Western blotting) in INS-1 cells as well as in rat and human islets. Mitochondrial effects were accompanied by unchanged levels of ATP, increased basal and preserved glucose-induced insulin secretion. Exposure of INS-1 832/13 cells to hypoxia, followed by a re-oxygenation period increases substrate-stimulated respiratory capacity and coupling efficiency. Such effects are accompanied by up-regulation of mitochondrial complexes also in pancreatic islets

  4. Workplace performance of a loose-fitting powered air purifying respirator during nanoparticle synthesis

    Koivisto, Antti J.; Aromaa, Mikko; Koponen, Ismo K.; Fransman, Wouter; Jensen, Keld A.; Mäkelä, Jyrki M.; Hämeri, Kaarle J.

    2015-01-01

    Nanoparticle (particles with diameter ≤100 nm) exposure is recognized as a potentially harmful size fraction for pulmonary particle exposure. During nanoparticle synthesis, the number concentrations in the process room may exceed 10 × 10 6 cm −3 . During such conditions, it is essential that the occupants in the room wear highly reliable high-performance respirators to prevent inhalation exposure. Here we have studied the in-use program protection factor (PPF) of loose-fitting powered air purifying respirators, while workers were coating components with TiO 2 or Cu x O y nanoparticles under a hood using a liquid flame spray process. The PPF was measured using condensation particle counters, an electrical low pressure impactor, and diffusion chargers. The room particle concentrations varied from 4 × 10 6 to 40 × 10 6 cm −3 , and the count median aerodynamic diameter ranged from 32 to 180 nm. Concentrations inside the respirator varied from 0.7 to 7.2 cm −3 . However, on average, tidal breathing was assumed to increase the respirator concentration by 2.3 cm −3 . The derived PPF exceeded 1.1 × 10 6 , which is more than 40 × 10 3 times the respirator assigned protection factor. We were unable to measure clear differences in the PPF of respirators with old and new filters, among two male and one female user, or assess most penetrating particle size. This study shows that the loose-fitting powered air purifying respirator provides very efficient protection against nanoparticle inhalation exposure if used properly

  5. Workplace performance of a loose-fitting powered air purifying respirator during nanoparticle synthesis

    Koivisto, Antti J., E-mail: jok@nrcwe.dk [National Research Centre for the Working Environment (Denmark); Aromaa, Mikko [Tampere University of Technology, Department of Physics (Finland); Koponen, Ismo K. [National Research Centre for the Working Environment (Denmark); Fransman, Wouter [TNO (Netherlands); Jensen, Keld A. [National Research Centre for the Working Environment (Denmark); Mäkelä, Jyrki M. [Tampere University of Technology, Department of Physics (Finland); Hämeri, Kaarle J. [University of Helsinki, Department of Physics (Finland)

    2015-04-15

    Nanoparticle (particles with diameter ≤100 nm) exposure is recognized as a potentially harmful size fraction for pulmonary particle exposure. During nanoparticle synthesis, the number concentrations in the process room may exceed 10 × 10{sup 6} cm{sup −3}. During such conditions, it is essential that the occupants in the room wear highly reliable high-performance respirators to prevent inhalation exposure. Here we have studied the in-use program protection factor (PPF) of loose-fitting powered air purifying respirators, while workers were coating components with TiO{sub 2} or Cu{sub x}O{sub y} nanoparticles under a hood using a liquid flame spray process. The PPF was measured using condensation particle counters, an electrical low pressure impactor, and diffusion chargers. The room particle concentrations varied from 4 × 10{sup 6} to 40 × 10{sup 6} cm{sup −3}, and the count median aerodynamic diameter ranged from 32 to 180 nm. Concentrations inside the respirator varied from 0.7 to 7.2 cm{sup −3}. However, on average, tidal breathing was assumed to increase the respirator concentration by 2.3 cm{sup −3}. The derived PPF exceeded 1.1 × 10{sup 6}, which is more than 40 × 10{sup 3} times the respirator assigned protection factor. We were unable to measure clear differences in the PPF of respirators with old and new filters, among two male and one female user, or assess most penetrating particle size. This study shows that the loose-fitting powered air purifying respirator provides very efficient protection against nanoparticle inhalation exposure if used properly.

  6. Acceptable respiratory protection program and LASL respirator research

    Skaggs, B.J.

    1979-01-01

    A short history is presented on the LASL Respiratory Protection Training Programs. Then a discussion is given on the major points of an acceptable respiratory protection program utilizing the points required by the Occupational, Safety, and Health Administration (OSHA) Regulation 29 CFR 1910.134. Contributions to respirator research are reviewed. Discussion is presented under the following section headings: program administration; respirator selection; respirator use; fitting and training; respirator maintenance; medical clearance and surveillance; special problems; program evaluation; and documentation

  7. Contribution of root to soil respiration and carbon balance in ...

    Soil respiration varied from 2.5 to 11.9 g CO2 m-2 d-1 and from 1.5 to 9.3 g CO2 m-2 d-1, and the contribution of root respiration to total soil respiration from 38% to 76% and from 25% to 72% in Communities 1 and 2, respectively. During the growing season (May–September), soil respiration, shoot biomass, live root ...

  8. Blind void filling in LR-EPONs: How efficient it can be?

    Elrasad, Amr; Shihada, Basem

    2015-01-01

    This work proposes a novel blind void (idle periods) filling in Long-Reach Ethernet Passive Optical Networks (LR-EPONs) namely Size Controlled Batch Void Filling (SCBVF). We emphasize on reducing grant delays and hence reducing the average packet delay. SCBVF delay reduction is achieved by early flushing data during the idle time periods (voids) between allocated grants. The proposed approach can be integrated with almost all of the previously reported dynamic bandwidth allocation schemes. SCBVF is less sensitive to differential distance between ONUs and can work well in case of small differential distances compared to previously reported void filling schemes. We support our work by extensive simulation study considering bursty traffic with long range dependency. Numerical results show a delay reduction up to 35% compared to non-void filling scheme outperforming its main competitors that can achieve up to 7% delay reduction.

  9. Optimum Design of LLC Resonant Converter using Inductance Ratio (Lm/Lr)

    Palle, Kowstubha; Krishnaveni, K.; Ramesh Reddy, Kolli

    2017-06-01

    The main benefits of LLC resonant dc/dc converter over conventional series and parallel resonant converters are its light load regulation, less circulating currents, larger bandwidth for zero voltage switching, and less tuning of switching frequency for controlled output. An unique analytical tool, called fundamental harmonic approximation with peak gain adjustment is used for designing the converter. In this paper, an optimum design of the converter is proposed by considering three different design criterions with different values of inductance ratio (Lm/Lr) to achieve good efficiency at high input voltage. The optimum design includes the analysis in operating range, switching frequency range, primary side losses of a switch and stability. The analysis is carried out with simulation using the software tools like MATLAB and PSIM. The performance of the optimized design is demonstrated for a design specification of 12 V, 5 A output operating with an input voltage range of 300-400 V using FSFR 2100 IC of Texas instruments.

  10. Intrinsic efficiency of LR-115 in alpha particles detection: simulations and experiments

    Aharmim, B.; Sabir, A.; Marah, H.

    2002-01-01

    A numerical simulation is developed to characterize the response of the cellulose nitrate detector ''LR-115 type II'' to alpha particles of different incidence angles and energies. It permits to know whether an alpha particle at a given energy and direction is able to produce a visible etched track or not. For this purpose, a V t -variable track etch rate model is used. We have considered that the track etch rate is a function of the ionization rate and the defect created by delta rays along the alpha particle trajectory. Validation of the model is presented in the form of comparisons between theoretically computed values of the sensitive energy range and the track diameters and experimentally determined ones

  11. Etched-hole formation in LR-115 cellulose nitrate detector irradiated with fast neutrons

    Sawamura, Teruko; Yamazaki, Hatsuo

    1988-01-01

    This paper deals with the neutron detection sensitivity of LR-115 cellulose nitrate by counting the etched holes of α-tracks produced by the (n,α) reactions of the constituent nuclei of the cellulose nitrate. A formula for the etched-hole formation efficiency is derived, and applied to obtain the efficiency for each of the (n,α) reactions of 14 N, 16 O and 12 C by using an experimental expression relating the track-to-bulk etch-rate ratio to the residual range of the α-particle. From the efficiencies obtained, and the reaction cross sections, the neutron detection sensitivity is evaluated against neutron energy up to 11 MeV, and compared with the experimental values in the energy region between 2.2 and 5 MeV; the agreement is fairly good in the region. (author)

  12. Feasibility studies of colorless LR 115 SSNTD for alpha-particle radiobiological experiments

    Chan, K.F.; Tse, A.K.W.; Fong, W.F.; Yu, K.N.

    2006-01-01

    The feasibility of using the active layer of the colorless LR 115 SSNTD for alpha-particle radiobiological experiments was studied. The track revelation time on the bottom side (the side attached to the polyester base) was much longer than that on the top side (the side not attached to the polyester base) of the active layer so track formation on the top side was more desirable. In relation to this, culture of HeLa cells on the bottom side of the active layer was found feasible although the cultured cell number was relatively smaller. The feasibility of using this SSNTD for alpha-particle radiobiological experiments was demonstrated by culturing cells on the bottom side while performing alpha-particle irradiation and chemical etching on the top side, and by taking photographs of the cells and alpha-particle tracks together under the optical microscope

  13. Blind void filling in LR-EPONs: How efficient it can be?

    Elrasad, Amr

    2015-07-01

    This work proposes a novel blind void (idle periods) filling in Long-Reach Ethernet Passive Optical Networks (LR-EPONs) namely Size Controlled Batch Void Filling (SCBVF). We emphasize on reducing grant delays and hence reducing the average packet delay. SCBVF delay reduction is achieved by early flushing data during the idle time periods (voids) between allocated grants. The proposed approach can be integrated with almost all of the previously reported dynamic bandwidth allocation schemes. SCBVF is less sensitive to differential distance between ONUs and can work well in case of small differential distances compared to previously reported void filling schemes. We support our work by extensive simulation study considering bursty traffic with long range dependency. Numerical results show a delay reduction up to 35% compared to non-void filling scheme outperforming its main competitors that can achieve up to 7% delay reduction.

  14. On asymptotic behavior of anisotropic branes with induced gravity inspired by L(R) term

    Heydari-Fard, Malihe

    2010-01-01

    The DGP brane-world scenario provides the accelerated expansion of the universe at late-time by large-distance modification of general relativity without any need for dark energy. Using the method in reference [33], we investigate the asymptotic behavior of homogeneous and anisotropic cosmologies on a generalization of DGP scenario where the effective theory of gravity induced on the brane is given by a L(R) term. We show that for a constant induced curvature term on the brane all Bianchi models except type IX isotropize, like general relativity, if the effective energy density and E ab term satisfy some energy conditions. Finally, we compare the result of the model with the result of anisotropic DGP branes and general relativity

  15. Type B liquid package technical issues -- Experience with LR-56 safety analysis

    Smith, A.C.; Alstine, M.N. van; Gromada, R.J.; Hensel, S.J.; Gupta, N.K.

    1997-01-01

    In the course of the development of nuclear industry in France, shipment of Type B quantities (i.e., quantities having significant radiological consequences) of radioactive liquids between different, sites became necessary. Based on the experience acquired at the Commissariat a l'Energie Atomique (CEA) nuclear centers, a series of tanker trailers has been developed to meet this need. Similarly, as part of the ongoing program to process wastes to stable end forms, a need exists to move radioactive liquids at several DOE sites. The LR-56, developed by CEA to transport liquids of medium to high activity, was selected for these US applications, based on its design features and successful operating experience in France. No comparable Type B liquid packages are certified in the US Packages employed in transport of Type B quantities of liquids are either only suitable for small volumes, or are used within site boundaries with extensive administrative controls employed to insure that an adequate level of safety is maintained. The requirement is to provide safety equivalent to the level established by federal regulations in 10 CFR 71. Type B radioactive materials packages (RAM packages) are typically simple, rugged containers which are designed and fabricated in accordance with the ASME Boiler and Pressure Vessel Code to provide containment under the normal conditions of transport (NCT) and hypothetical accident conditions (HAC) established by the regulations. Packages designed for liquid contents must address a number of technical issues which are not common to packages for solid contents. This paper reviews the technical issues associated with Type B liquid packages from the perspective of the experience gained from the evaluation of the LR-56 for use at DOE sites

  16. Thermal adaptation of heterotrophic soil respiration in laboratory microcosms.

    Mark A. Bradford; Brian W. Watts; Christian A. Davies

    2010-01-01

    Respiration of heterotrophic microorganisms decomposing soil organic carbon releases carbon dioxide from soils to the atmosphere. In the short term, soil microbial respiration is strongly dependent on temperature. In the long term, the response of heterotrophic soil respiration to temperature is uncertain. However, following established evolutionary tradeoffs, mass-...

  17. 42 CFR 84.1134 - Respirator containers; minimum requirements.

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Respirator containers; minimum requirements. 84... Combination Gas Masks § 84.1134 Respirator containers; minimum requirements. (a) Except as provided in paragraph (b) of this section each respirator shall be equipped with a substantial, durable container...

  18. 21 CFR 892.1970 - Radiographic ECG/respirator synchronizer.

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Radiographic ECG/respirator synchronizer. 892.1970... (CONTINUED) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1970 Radiographic ECG/respirator synchronizer. (a) Identification. A radiographic ECG/respirator synchronizer is a device intended to be used to...

  19. What controls respiration rate in stored sugarbeet roots

    Although respiration is estimated to be responsible for 60 to 80% of the sucrose lost during storage, the mechanisms by which sugarbeet roots regulate their respiration rate are unknown. In plants, respiration rate is regulated by (1) available respiratory capacity, (2) cellular energy status, (3) ...

  20. Redefinition and global estimation of basal ecosystem respiration rate

    Yuan, Wenping; Luo, Yiqi; Li, Xianglan

    2011-01-01

    Basal ecosystem respiration rate (BR), the ecosystem respiration rate at a given temperature, is a common and important parameter in empirical models for quantifying ecosystem respiration (ER) globally. Numerous studies have indicated that BR varies in space. However, many empirical ER models sti...

  1. Quantifying soil respiration at landscape scales. Chapter 11

    John B. Bradford; Michael G. Ryan

    2008-01-01

    Soil CO2, efflux, or soil respiration, represents a substantial component of carbon cycling in terrestrial ecosystems. Consequently, quantifying soil respiration over large areas and long time periods is an increasingly important goal. However, soil respiration rates vary dramatically in space and time in response to both environmental conditions...

  2. Induction by ethylene of cyanide-resistant respiration

    Solomos, T.; Laties, G.G.

    1976-05-17

    Ethylene and cyanide induce an increase in respiration in a variety of plant tissues, whereas ethylene has no effect on tissues whose respiration is strongly inhibited by cyanide. It is suggested that the existence of a cyanide-insensitive electron transport path is a prerequisite for stimulation of respiration by ethylene.

  3. Temperature acclimation of growth, photosynthesis and respiration in two mesophilic phytoplankton species

    Stæhr, P. A.; Birkeland, M. J.

    2006-01-01

    grown as nutrient-replete semicontinuous cultures for 2 weeks at 5, 15 and 25°C, during which growth rate was determined from changes in Chl a. Gross photosynthesis (GP) was measured as 14C assimilation at saturating light and respiration (R) was measured as O2 uptake along a temperature gradient from 0...

  4. Reproduction impairment and endocrine disruption in female zebrafish after long-term exposure to MC-LR: A life cycle assessment

    Hou, Jie; Li, Li; Wu, Ning; Su, Yujing; Lin, Wang; Li, Guangyu; Gu, Zemao

    2016-01-01

    Microcystin-LR (MC-LR) has been found to cause reproductive and developmental impairments as well as to disrupt sex hormone homeostasis of fish during acute and sub-chronic toxic experiments. However, fish in natural environments are continuously exposed to MC-LR throughout their entire life cycle as opposed to short-term exposure. Here, we tested the hypothesis that the mechanism by which MC-LR harms female fish reproduction and development within natural water bodies is through interference of the reproductive endocrine system. In the present study, zebrafish hatchlings (5 d post-fertilization) were exposed to 0, 0.3, 3 and 30 μg/L MC-LR for 90 d until reaching sexual maturity. Female zebrafish were selected, and the changes in growth and developmental indicators, ovarian ultrastructure as well as the levels of gonadal steroid hormones and vitellogenin (VTG) were examined along with the transcription of related genes in the hypothalamic–pituitary–gonadal–liver axis (HPGL-axis). The results showed for the first time, a life cycle exposure to MC-LR caused growth inhibition, decreased ovary weight and ovarian ultra-pathological lesions. Decreased ovarian testosterone levels indicated that MC-LR disrupted sex steroid hormone balance. Significantly up-regulated transcription of brain FSHβ and LHβ along with ovarian ERα, FSHR and LHR suggested positive feedback regulation in the HPGL-axis was induced as a compensatory mechanism for MC-LR damage. It was also noted that ovarian VTG content and hepatic ERα and VTG1 expression were all down-regulated, which might be responsible for reduced vitellus storage noted in our histological observations. Our findings indicate that a life cycle exposure to MC-LR impairs the development and reproduction of female zebrafish by disrupting the transcription of related HPGL-axis genes, suggesting that MC-LR has potential adverse effects on fish reproduction and thus population dynamics in MCs-contaminated aquatic

  5. Soil respiration and photosynthetic uptake of carbon dioxide by ground-cover plants in four ages of jack pine forest

    Striegl, Robert G.; Wickland, K.P.

    2001-01-01

    Soil carbon dioxide (CO2) emission (soil respiration), net CO2 exchange after photosynthetic uptake by ground-cover plants, and soil CO2 concentration versus depth below land surface were measured at four ages of jack pine (Pinus banksiana Lamb.) forest in central Saskatchewan. Soil respiration was smallest at a clear-cut site, largest in an 8-year-old stand, and decreased with stand age in 20-year-old and mature (60-75 years old) stands during May-September 1994 (12.1, 34.6, 31.5, and 24.9 mol C??m-2, respectively). Simulations of soil respiration at each stand based on continuously recorded soil temperature were within one standard deviation of measured flux for 48 of 52 measurement periods, but were 10%-30% less than linear interpolations of measured flux for the season. This was probably due to decreased soil respiration at night modeled by the temperature-flux relationships, but not documented by daytime chamber measurements. CO2 uptake by ground-cover plants ranged from 0 at the clear-cut site to 29, 25, and 9% of total growing season soil respiration at the 8-year, 20-year, and mature stands. CO2 concentrations were as great as 7150 ppmv in the upper 1 m of unsaturated zone and were proportional to measured soil respiration.

  6. Respiration climacteric in tomato fruits elucidated by constraint-based modelling.

    Colombié, Sophie; Beauvoit, Bertrand; Nazaret, Christine; Bénard, Camille; Vercambre, Gilles; Le Gall, Sophie; Biais, Benoit; Cabasson, Cécile; Maucourt, Mickaël; Bernillon, Stéphane; Moing, Annick; Dieuaide-Noubhani, Martine; Mazat, Jean-Pierre; Gibon, Yves

    2017-03-01

    Tomato is a model organism to study the development of fleshy fruit including ripening initiation. Unfortunately, few studies deal with the brief phase of accelerated ripening associated with the respiration climacteric because of practical problems involved in measuring fruit respiration. Because constraint-based modelling allows predicting accurate metabolic fluxes, we investigated the respiration and energy dissipation of fruit pericarp at the breaker stage using a detailed stoichiometric model of the respiratory pathway, including alternative oxidase and uncoupling proteins. Assuming steady-state, a metabolic dataset was transformed into constraints to solve the model on a daily basis throughout tomato fruit development. We detected a peak of CO 2 released and an excess of energy dissipated at 40 d post anthesis (DPA) just before the onset of ripening coinciding with the respiration climacteric. We demonstrated the unbalanced carbon allocation with the sharp slowdown of accumulation (for syntheses and storage) and the beginning of the degradation of starch and cell wall polysaccharides. Experiments with fruits harvested from plants cultivated under stress conditions confirmed the concept. We conclude that modelling with an accurate metabolic dataset is an efficient tool to bypass the difficulty of measuring fruit respiration and to elucidate the underlying mechanisms of ripening. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

  7. Global convergence in leaf respiration from estimates of thermal acclimation across time and space.

    Vanderwel, Mark C; Slot, Martijn; Lichstein, Jeremy W; Reich, Peter B; Kattge, Jens; Atkin, Owen K; Bloomfield, Keith J; Tjoelker, Mark G; Kitajima, Kaoru

    2015-09-01

    Recent compilations of experimental and observational data have documented global temperature-dependent patterns of variation in leaf dark respiration (R), but it remains unclear whether local adjustments in respiration over time (through thermal acclimation) are consistent with the patterns in R found across geographical temperature gradients. We integrated results from two global empirical syntheses into a simple temperature-dependent respiration framework to compare the measured effects of respiration acclimation-over-time and variation-across-space to one another, and to a null model in which acclimation is ignored. Using these models, we projected the influence of thermal acclimation on: seasonal variation in R; spatial variation in mean annual R across a global temperature gradient; and future increases in R under climate change. The measured strength of acclimation-over-time produces differences in annual R across spatial temperature gradients that agree well with global variation-across-space. Our models further project that acclimation effects could potentially halve increases in R (compared with the null model) as the climate warms over the 21st Century. Convergence in global temperature-dependent patterns of R indicates that physiological adjustments arising from thermal acclimation are capable of explaining observed variation in leaf respiration at ambient growth temperatures across the globe. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  8. Evaluation of the transfer and the accumulation of microcystins in tomato (Solanum lycopersicum cultivar MicroTom) tissues using a cyanobacterial extract containing microcystins and the radiolabeled microcystin-LR ("1"4C-MC-LR)

    Corbel, Sylvain; Mougin, Christian; Nélieu, Sylvie; Delarue, Ghislaine; Bouaïcha, Noureddine

    2016-01-01

    Microcystins are the most common cyanotoxins and may be expected wherever blooms of cyanobacteria occur in surface waters. Their persistence both in the irrigation water and in the soil can lead to their transfer and bioaccumulation into agricultural plants. The aim of this work was to investigate microcystin accumulation in Solanum lycopersicum cultivar MicroTom. The plant was exposed to either Microcystis aeruginosa crude extracts containing up to 100 μg eq. MC-LR L"−"1 in a soil–plant system for 90 days or pure radiolabeled "1"4C-MC-LR in a hydroponic condition for 48 h. Toxin bioaccumulation in the soil and different plant tissues was assessed both by the PP2A inhibition assay and by liquid chromatography-mass spectrometry (LC/MS/MS). After 90 days of exposure, microcystins persisted in the soil and their free extractable concentrations accumulated were very low varying between 1.6 and 3.9 μg eq. MC-LR kg"−"1 DW. Free MC-LR was detected only in roots and leaves with concentrations varying between 4.5 and 8.1 μg kg"−"1 DW and between 0.29 and 0.55 μg kg"−"1 DW, respectively. By using radioactivity ("1"4C-MC-LR), the results have reported a growing accumulation of toxins within the organs roots > leaves > stems and allowed them to confirm the absence of MC-LR in fruits after 48 h of exposure. The bioconcentration factor (BCF) was 13.6 in roots, 4.5 in leaves, and 1.4 in stems. On the other hand, the results highlight the presence of two radioactive fractions in different plant tissues. The non-extractable fraction of radioactivity, corresponding to the covalently bound MC-LR, was higher than that of the extractable fraction only in roots and leaves reaching 56% and 71% of the total accumulated toxin, respectively. Therefore, results raise that monitoring programs must monitor the presence of MCs in the irrigation water to avoid the transfer and accumulation of these toxins in crops. - Graphical abstract: Bioconcentration factors in organs of the

  9. Evaluation of the transfer and the accumulation of microcystins in tomato (Solanum lycopersicum cultivar MicroTom) tissues using a cyanobacterial extract containing microcystins and the radiolabeled microcystin-LR ({sup 14}C-MC-LR)

    Corbel, Sylvain [INRA, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); AgroParisTech, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); Laboratoire Ecologie, Systématique et Evolution, UMR8079, Univ. Paris-Sud/CNRS/AgroParisTech, Université Paris-Sud, F-91405 Orsay (France); Mougin, Christian; Nélieu, Sylvie; Delarue, Ghislaine [INRA, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); AgroParisTech, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); Bouaïcha, Noureddine, E-mail: noureddine.bouaicha@u-psud.fr [Laboratoire Ecologie, Systématique et Evolution, UMR8079, Univ. Paris-Sud/CNRS/AgroParisTech, Université Paris-Sud, F-91405 Orsay (France)

    2016-01-15

    Microcystins are the most common cyanotoxins and may be expected wherever blooms of cyanobacteria occur in surface waters. Their persistence both in the irrigation water and in the soil can lead to their transfer and bioaccumulation into agricultural plants. The aim of this work was to investigate microcystin accumulation in Solanum lycopersicum cultivar MicroTom. The plant was exposed to either Microcystis aeruginosa crude extracts containing up to 100 μg eq. MC-LR L{sup −1} in a soil–plant system for 90 days or pure radiolabeled {sup 14}C-MC-LR in a hydroponic condition for 48 h. Toxin bioaccumulation in the soil and different plant tissues was assessed both by the PP2A inhibition assay and by liquid chromatography-mass spectrometry (LC/MS/MS). After 90 days of exposure, microcystins persisted in the soil and their free extractable concentrations accumulated were very low varying between 1.6 and 3.9 μg eq. MC-LR kg{sup −1} DW. Free MC-LR was detected only in roots and leaves with concentrations varying between 4.5 and 8.1 μg kg{sup −1} DW and between 0.29 and 0.55 μg kg{sup −1} DW, respectively. By using radioactivity ({sup 14}C-MC-LR), the results have reported a growing accumulation of toxins within the organs roots > leaves > stems and allowed them to confirm the absence of MC-LR in fruits after 48 h of exposure. The bioconcentration factor (BCF) was 13.6 in roots, 4.5 in leaves, and 1.4 in stems. On the other hand, the results highlight the presence of two radioactive fractions in different plant tissues. The non-extractable fraction of radioactivity, corresponding to the covalently bound MC-LR, was higher than that of the extractable fraction only in roots and leaves reaching 56% and 71% of the total accumulated toxin, respectively. Therefore, results raise that monitoring programs must monitor the presence of MCs in the irrigation water to avoid the transfer and accumulation of these toxins in crops. - Graphical abstract: Bioconcentration

  10. Estimation of ecosystem respiration and its components by means of stable isotopes and improved closed-chamber methods

    Brændholt, Andreas

    Ecosystem respiration (Reco) is the second largest flux of CO2 between the biosphere and the atmosphere. It consists of several components, such as plant respiration and soil respiration (Rsoil), each of which may respond differently to abiotic factors, and thus to global climate change. Rsoil...... and abiotic factors, and before estimating Rsoil fluxes over longer time scales. The work also shows that artificial turbulent air mixing may provide a method to overcome the issue with overestimated fluxes, allowing for measurements even at low atmospheric turbulence. Furthermore, the results show...

  11. Gastrocnemius mitochondrial respiration: are there any differences between men and women?

    Thompson, Jonathan R; Swanson, Stanley A; Casale, George P; Johanning, Jason M; Papoutsi, Evlampia; Koutakis, Panagiotis; Miserlis, Dimitrios; Zhu, Zhen; Pipinos, Iraklis I

    2013-11-01

    Work on human and mouse skeletal muscle by our group and others has demonstrated that aging and age-related degenerative diseases are associated with mitochondrial dysfunction, which may be more prevalent in males. There have been, however, no studies that specifically examine the influence of male or female sex on human skeletal muscle mitochondrial respiration. The purpose of this study was to compare mitochondrial respiration in the gastrocnemius of adult men and women. Gastrocnemius muscle was obtained from male (n = 19) and female (n = 11) human subjects with healthy lower-extremity musculoskeletal and arterial systems and normal ambulatory function. All patients were undergoing operations for the treatment of varicose veins in their legs. Mitochondrial respiration was determined with a Clark electrode in an oxygraph cell containing saponin-skinned muscle bundles. Complex I-, II-, III-, and IV-dependent respiration was measured individually and normalized to muscle weight, total protein content, and citrate synthase (CS, index of mitochondrial content). Male and female patients had no evidence of musculoskeletal or arterial disease and did not differ with regard to age, race, body mass index, or other clinical characteristics. Complex I-, II-, III-, and IV-dependent respiration normalized to muscle weight, total protein content, and CS did not statistically differ for males compared with females. Our study evaluates, for the first time, gastrocnemius mitochondrial respiration of adult men and women who have healthy musculoskeletal and arterial systems and normal ambulatory function. Our data demonstrate there are no differences in the respiration of gastrocnemius mitochondria between men and women. Copyright © 2013 Elsevier Inc. All rights reserved.

  12. A distinct seasonal pattern of the ratio of soil respiration to total ecosystem respiration in a spruce-dominated forest

    E.A. Davidson; A.D. Richardson; K.E. Savage; D.Y. Hollinger

    2006-01-01

    Annual budgets and fitted temperature response curves for soil respiration and ecosystem respiration provide useful information for partitioning annual carbon budgets of ecosystems, but they may not adequately reveal seasonal variation in the ratios of these two fluxes. Soil respiration (Rs) typically contributes 30-80% of...

  13. Using RNA-sequencing and in silico subtraction to identify resistance gene analog markers for Lr16 in wheat

    Leaf rust, caused by Puccinia triticina Eriks., is one of the most widespread diseases of wheat worldwide and breeding for resistance is one of the most effective methods of control. Lr16 is a wheat leaf rust resistance gene that provides resistance at both the seedling and adult stages. Simple s...

  14. Microcystin-LR equivalent concentrations in fish tissue during a postbloom Microcystis exposure in Loskop Dam, South Africa

    Nchabeleng, T

    2014-12-01

    Full Text Available The effects of a decomposing cyanobacteria bloom on water quality and the accumulation of microcystin-LR equivalent toxin in fish at Loskop Dam were studied in May 2012. Enzyme-linked immunosorbent assay [ELISA] was used to confirm the presence...

  15. Experimental demonstration of CMOS-compatible long-range dielectric-loaded surface plasmon-polariton waveguides (LR-DLSPPWs)

    Zektzer, Roy; Desiatov, Boris; Mazurski, Noa

    2015-01-01

    We demonstrate the design, fabrication and experimental characterization of long-range dielectric-loaded surface plasmon-polariton waveguides (LR-DLSPPWs) that are compatible with complementary metal-oxide semiconductor (CMOS) technology. The demonstrated waveguides feature good mode confinement...

  16. Explicit Determinants of the RFPrLrR Circulant and RLPrFrL Circulant Matrices Involving Some Famous Numbers

    Tingting Xu

    2014-01-01

    Full Text Available Circulant matrices may play a crucial role in solving various differential equations. In this paper, the techniques used herein are based on the inverse factorization of polynomial. We give the explicit determinants of the RFPrLrR circulant matrices and RLPrFrL circulant matrices involving Fibonacci, Lucas, Pell, and Pell-Lucas number, respectively.

  17. Oxygen dependence of respiration in rat spinotrapezius muscle in situ

    Pittman, Roland N.

    2012-01-01

    The oxygen dependence of respiration in striated muscle in situ was studied by measuring the rate of decrease of interstitial Po2 [oxygen disappearance curve (ODC)] following rapid arrest of blood flow by pneumatic tissue compression, which ejected red blood cells from the muscle vessels and made the ODC independent from oxygen bound to hemoglobin. After the contribution of photo-consumption of oxygen by the method was evaluated and accounted for, the corrected ODCs were converted into the Po2 dependence of oxygen consumption, V̇o2, proportional to the rate of Po2 decrease. Fitting equations obtained from a model of heterogeneous intracellular Po2 were applied to recover the parameters describing respiration in muscle fibers, with a predicted sigmoidal shape for the dependence of V̇o2 on Po2. This curve consists of two regions connected by the point for critical Po2 of the cell (i.e., Po2 at the sarcolemma when the center of the cell becomes anoxic). The critical Po2 was below the Po2 for half-maximal respiratory rate (P50) for the cells. In six muscles at rest, the rate of oxygen consumption was 139 ± 6 nl O2/cm3·s and mitochondrial P50 was k = 10.5 ± 0.8 mmHg. The range of Po2 values inside the muscle fibers was found to be 4–5 mmHg at the critical Po2. The oxygen dependence of respiration can be studied in thin muscles under different experimental conditions. In resting muscle, the critical Po2 was substantially lower than the interstitial Po2 of 53 ± 2 mmHg, a finding that indicates that V̇o2 under this circumstance is independent of oxygen supply and is discordant with the conventional hypothesis of metabolic regulation of the oxygen supply to tissue. PMID:22523254

  18. Cost-effectiveness analysis of N95 respirators and medical masks to protect healthcare workers in China from respiratory infections.

    Mukerji, Shohini; MacIntyre, C Raina; Seale, Holly; Wang, Quanyi; Yang, Peng; Wang, Xiaoli; Newall, Anthony T

    2017-07-03

    There are substantial differences between the costs of medical masks and N95 respirators. Cost-effectiveness analysis is required to assist decision-makers evaluating alternative healthcare worker (HCW) mask/respirator strategies. This study aims to compare the cost-effectiveness of N95 respirators and medical masks for protecting HCWs in Beijing, China. We developed a cost-effectiveness analysis model utilising efficacy and resource use data from two cluster randomised clinical trials assessing various mask/respirator strategies conducted in HCWs in Level 2 and 3 Beijing hospitals for the 2008-09 and 2009-10 influenza seasons. The main outcome measure was the incremental cost-effectiveness ratio (ICER) per clinical respiratory illness (CRI) case prevented. We used a societal perspective which included intervention costs, the healthcare costs of CRI in HCWs and absenteeism costs. The incremental cost to prevent a CRI case with continuous use of N95 respirators when compared to medical masks ranged from US $490-$1230 (approx. 3000-7600 RMB). One-way sensitivity analysis indicated that the CRI attack rate and intervention effectiveness had the greatest impact on cost-effectiveness. The determination of cost-effectiveness for mask/respirator strategies will depend on the willingness to pay to prevent a CRI case in a HCW, which will vary between countries. In the case of a highly pathogenic pandemic, respirator use in HCWs would likely be a cost-effective intervention.

  19. Soil Respiration Changes after Prescribed Fires in Spanish Black Pine (Pinus nigra Arn. ssp. salzmannii Monospecific and Mixed Forest Stands

    Pedro Antonio Plaza-Álvarez

    2017-07-01

    Full Text Available Soil respiration is a major carbon pathway sensitive to environmental changes. Using prescribed burnings to reduce fuel accumulation and lower risks of large-scale wildfires has recently become more important. Prescribed burning can significantly alter the soil environment, but its effect in practice on soil respiration is not sufficiently understood. We evaluated the effects of prescribed burning on soil respiration before and after burning (May–July 2016. Prescribed burning was conducted in two natural pine areas by comparing a mixed stand of Pinus nigra Arn. ssp. salzmannii with Pinus pinaster Ait. to a pure stand of Pinus nigra Arn. ssp. salzmannii in the central Iberian Peninsula. Soil respiration was measured by an EGM-4 (Environmental Gas Monitor infrared gas analyser in both burned and unburned (control plots. Burnings were low-intensity, and slightly more energetic in the pure stand given its larger litter volume. Post-burning soil respiration followed a similar evolution to that in the control plots, but was greater in the pure stand burned zone and slightly lower in the burned plots in the mixed stand. No significant differences were found in any stand. Soil respiration significantly changed in temporal evolution due to increasing temperatures when summer began. We conclude that prescribed fire induces no changes in SR immediately after fire. This study helps understand how prescribed burnings can affect soil respiration in pure and mixed Spanish black pine forest stands.

  20. Estimation of fractional contribution of root respiration to a forest-floor CO2 flux using carbon isotopes

    Hachiya, Masashi; Moriizumi, Jun; Yamazawa, Hiromi

    2010-01-01

    Efflux of soil respired carbon dioxide(CO 2 ) is very important component for the global carbon cycle and dynamics of 14 C in environment, and to predict the global climate changes caused by increasing CO 2 concentrations in the atmosphere. There are two components that generate CO 2 in soil, soil organic matter decomposition and root respiration. Although the former is relatively well understood, the root-derived CO 2 efflux has not been evaluated sufficiently. The objective of our research is to estimate depth profile of the root respiration rate. Thus we developed a box model which calculates the depth profile. In this paper, we discussed about (1) the adequacy of calculated result by comparing it to the to observed soil respired CO 2 flux with trenching method and (2) sensitivity of the box model to uncertainty in the input data. The result showed that the depth profile of root respiration rate decreased with soil depth. This is attributed to the distribution of fine roots which dominate root respiration. The model results reasonable agreed with the measurement results and characteristics of root respiration. The output of the model was robust to the variation of the input data. (author)

  1. Assessment of respirable dust exposures in an opencast coal mine.

    Onder, M; Yigit, E

    2009-05-01

    All major opencast mining activities produce dust. The major operations that produce dust are drilling, blasting, loading, unloading, and transporting. Dust not only deteriorates the environmental air quality in and around the mining site but also creates serious health hazards. Therefore, assessment of dust levels that arise from various opencast mining operations is required to prevent and minimize the health risks. To achieve this objective, an opencast coal mining area was selected to generate site-specific emission data and collect respirable dust measurement samples. The study covered various mining activities in different locations including overburden loading, stock yard, coal loading, drilling, and coal handling plant. The dust levels were examined to assess miners' exposure to respirable dust in each of the opencast mining areas from 1994 to 2005. The data obtained from the dust measurement studies were evaluated by using analysis of variance (ANOVA) and the Tukey-Kramer procedure. The analyses were performed by using Minitab 14 statistical software. It was concluded that, drilling operations produce higher dust concentration levels and thus, drill operators may have higher incidence of respiratory disorders related to exposure to dust in their work environment.

  2. A new method for studying the transport of radon and thoron in various building materials using CR-39 and LR-115 solid state nuclear track detectors

    Misdaq, M.A.; Ktata, A.; Bakhchi, A.

    2000-01-01

    Radon ( 222 Rn) and thoron ( 220 Rn) α-activities per unit volume were measured inside and outside different building materials by using two types of solid state nuclear track detectors (SSNTD) (CR-39 and LR-115 type II). In addition, the radon and thoron emanation coefficients of the studied materials were evaluated. Based on these data, the transport of radon and thoron across parallelepipedic blocks of the building materials could be investigated and radon and thoron global α-activities per unit volume outside different building material blocks were determined. Moreover, the diffusion length and the effective diffusion coefficient of radon in the building materials were evaluated and the total alpha activity due to radon in the atmospheres of different rooms consisting of different building materials was studied

  3. Frost Induces Respiration and Accelerates Carbon Depletion in Trees.

    Or Sperling

    Full Text Available Cellular respiration depletes stored carbohydrates during extended periods of limited photosynthesis, e.g. winter dormancy or drought. As respiration rate is largely a function of temperature, the thermal conditions during such periods may affect non-structural carbohydrate (NSC availability and, ultimately, recovery. Here, we surveyed stem responses to temperature changes in 15 woody species. For two species with divergent respirational response to frost, P. integerrima and P. trichocarpa, we also examined corresponding changes in NSC levels. Finally, we simulated respiration-induced NSC depletion using historical temperature data for the western US. We report a novel finding that tree stems significantly increase respiration in response to near freezing temperatures. We observed this excess respiration in 13 of 15 species, deviating 10% to 170% over values predicted by the Arrhenius equation. Excess respiration persisted at temperatures above 0 °C during warming and reoccurred over multiple frost-warming cycles. A large adjustment of NSCs accompanied excess respiration in P. integerrima, whereas P. trichocarpa neither excessively respired nor adjusted NSCs. Over the course of the years included in our model, frost-induced respiration accelerated stem NSC consumption by 8.4 mg (glucose eq. cm(-3 yr(-1 on average in the western US, a level of depletion that may continue to significantly affect spring NSC availability. This novel finding revises the current paradigm of low temperature respiration kinetics.

  4. Frost Induces Respiration and Accelerates Carbon Depletion in Trees.

    Sperling, Or; Earles, J Mason; Secchi, Francesca; Godfrey, Jessie; Zwieniecki, Maciej A

    2015-01-01

    Cellular respiration depletes stored carbohydrates during extended periods of limited photosynthesis, e.g. winter dormancy or drought. As respiration rate is largely a function of temperature, the thermal conditions during such periods may affect non-structural carbohydrate (NSC) availability and, ultimately, recovery. Here, we surveyed stem responses to temperature changes in 15 woody species. For two species with divergent respirational response to frost, P. integerrima and P. trichocarpa, we also examined corresponding changes in NSC levels. Finally, we simulated respiration-induced NSC depletion using historical temperature data for the western US. We report a novel finding that tree stems significantly increase respiration in response to near freezing temperatures. We observed this excess respiration in 13 of 15 species, deviating 10% to 170% over values predicted by the Arrhenius equation. Excess respiration persisted at temperatures above 0 °C during warming and reoccurred over multiple frost-warming cycles. A large adjustment of NSCs accompanied excess respiration in P. integerrima, whereas P. trichocarpa neither excessively respired nor adjusted NSCs. Over the course of the years included in our model, frost-induced respiration accelerated stem NSC consumption by 8.4 mg (glucose eq.) cm(-3) yr(-1) on average in the western US, a level of depletion that may continue to significantly affect spring NSC availability. This novel finding revises the current paradigm of low temperature respiration kinetics.

  5. Study of the weekly irrigation cycle of a cultivated field in a semi-arid area (Marrakech region, Morocco) by using CR-39 and LR-115 II track detectors and radon as a natural tracer

    Misdaq, M.A.; Essaouif, Z.

    2007-01-01

    Uranium ( 238 U) and thorium ( 232 Th) concentrations were measured in the soil of a cultivated field situated in a semi-arid area (Marrakech, Morocco) by using CR-39 and LR-115 type II solid state nuclear track detectors (SSNTDs). The same track detectors were used for measuring alpha- and beta-activities due to radon and thoron gases emanating from the soil of the studied irrigated agricultural field. The influence of the humidity (soil water content), soil depth and climate conditions on the weekly irrigation cycle of the studied cultivated field was investigated by exploiting radon measurements

  6. Did Respiration or Photosynthesis Come First

    Broda, E.

    1979-01-01

    The similarity of the mechanisms in photosynthetic and in oxidative phosphorylation suggests a common origin ( convers ion hypothesis). It is proposed that an early form of electron flow with oxidative phosphorylation ("prerespiration"), to terminal electron acceptors available in a reducing biosphere, was supplemented by a photocatalyst capable of a redox reaction. In this way, cyclic photophosphorylation arose. Further stages in evolution were reverse electron flow powered by ATP, to make NADH as a reductant for CO2 , and subsequently noncyclic electron flow. These processes concomitantly provided the oxidants indispensable for full development of oxidative phosphorylation, i.e. for normal respiration: sulphate, O2 and with participation of the nitrificants, nitrite and nitrate. Thus, prerespiration preceded photosynthesis, and this preceded respiration. It is also suggested that nonredox photoprocesses of the Halobacterium type are not part of the mainstream of bioenergetic evolution. They do not lead to photoprocesses with electron flow. (author)

  7. Exaggerated root respiration accounts for growth retardation in a starchless mutant of Arabidopsis thaliana.

    Brauner, Katrin; Hörmiller, Imke; Nägele, Thomas; Heyer, Arnd G

    2014-07-01

    The knock-out mutation of plastidial phosphoglucomutase (pgm) causes a starchless phenotype in Arabidopsis thaliana, and results in a severe growth reduction of plants cultivated under diurnal conditions. It has been speculated that high soluble sugar levels accumulating during the light phase in leaf mesophyll might cause a reduction of photosynthetic activity or that shortage of reduced carbon during the night is the reason for the slow biomass gain of pgm. Separate simultaneous measurements of leaf net photosynthesis and root respiration demonstrate that photosynthetic activity per unit fresh weight is not reduced in pgm, whereas root respiration is strongly elevated. Comparison with a mutant defective in the dominating vacuolar invertase (AtβFruct4) revealed that high sucrose concentration in the cytosol, but not in the vacuole, of leaf cells is responsible for elevated assimilate transport to the root. Increased sugar supply to the root, as observed in pgm mutants, forces substantial respiratory losses. Because root respiration accounts for 80% of total plant respiration under long-day conditions, this gives rise to retarded biomass formation. In contrast, reduced vacuolar invertase activity leads to reduced net photosynthesis in the shoot and lowered root respiration, and affords an increased root/shoot ratio. The results demonstrate that roots have very limited capacity for carbon storage but exert rigid control of supply for their maintenance metabolism. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.

  8. Sustained stimulation of soil respiration after 10 years of experimental warming

    Reth, S; Graf, W; Reichstein, M; Munch, J C

    2009-01-01

    A number of forest and grassland studies indicated that stimulation of the soil respiration by soil warming ceases after a couple of years (Luo et al 2001 Nature 413 622-5). Here we present results from a long-term soil warming lysimeter experiment in southern Germany showing sustained stimulation of soil respiration after 10 years. Moreover, both warmed and control treatments exhibited a similar temperature response of soil respiration, indicating that adaptation in terms of temperature sensitivity was absent. Carbon dioxide concentration measurements within the profiles are supporting these findings. The increased soil respiration occurred although vegetation productivity in the warmed treatment was not higher than in the control plots. These findings strongly contrast with current soil carbon modeling concepts, where carbon pools decay according to first-order kinetics, and thus a depletion of labile soil carbon pools leads to an apparent down-regulation of microbial respiration (Knorr et al 2005 Nature 433 298-301). Consequently, the potential for positive climate carbon cycle feedback may be larger than represented in current models of soil carbon turnover.

  9. Towards an HIV-1 cure: measuring the latent reservoir.

    Bruner, Katherine M; Hosmane, Nina N; Siliciano, Robert F

    2015-04-01

    The latent reservoir (LR) of HIV-1 in resting memory CD4(+) T cells serves as a major barrier to curing HIV-1 infection. While many PCR- and culture-based assays have been used to measure the size of the LR, correlation between results of different assays is poor and recent studies indicate that no available assay provides an accurate measurement of reservoir size. The discrepancies between assays are a hurdle to clinical trials that aim to measure the efficacy of HIV-1 eradication strategies. Here we describe the advantages and disadvantages of various approaches to measuring the LR. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. Effects of fire disturbance on soil respiration in the non-growing season in a Larix gmelinii forest in the Daxing'an Mountains, China.

    Tongxin Hu

    Full Text Available In boreal forests, fire is an important part of the ecosystem that greatly influences soil respiration, which in turn affects the carbon balance. Wildfire can have a significant effect on soil respiration and it depends on the fire severity and environmental factors (soil temperature and snow water equivalent after fire disturbance. In this study, we quantified post-fire soil respiration during the non-growing season (from November to April in a Larix gmelinii forest in Daxing'an Mountains of China. Soil respiration was measured in the snow-covered and snow-free conditions with varying degrees of natural burn severity forests. We found that soil respiration decreases as burn severity increases. The estimated annual C efflux also decreased with increased burn severity. Soil respiration during the non-growing season approximately accounted for 4%-5% of the annual C efflux in all site types. Soil temperature (at 5 cm depth was the predominant determinant of non-growing season soil respiration change in this area. Soil temperature and snow water equivalent could explain 73%-79% of the soil respiration variability in winter snow-covering period (November to March. Mean spring freeze-thaw cycle (FTC period (April soil respiration contributed 63% of the non-growing season C efflux. Our finding is key for understanding and predicting the potential change in the response of boreal forest ecosystems to fire disturbance under future climate change.

  11. Effects of fire disturbance on soil respiration in the non-growing season in a Larix gmelinii forest in the Daxing'an Mountains, China.

    Hu, Tongxin; Sun, Long; Hu, Haiqing; Guo, Futao

    2017-01-01

    In boreal forests, fire is an important part of the ecosystem that greatly influences soil respiration, which in turn affects the carbon balance. Wildfire can have a significant effect on soil respiration and it depends on the fire severity and environmental factors (soil temperature and snow water equivalent) after fire disturbance. In this study, we quantified post-fire soil respiration during the non-growing season (from November to April) in a Larix gmelinii forest in Daxing'an Mountains of China. Soil respiration was measured in the snow-covered and snow-free conditions with varying degrees of natural burn severity forests. We found that soil respiration decreases as burn severity increases. The estimated annual C efflux also decreased with increased burn severity. Soil respiration during the non-growing season approximately accounted for 4%-5% of the annual C efflux in all site types. Soil temperature (at 5 cm depth) was the predominant determinant of non-growing season soil respiration change in this area. Soil temperature and snow water equivalent could explain 73%-79% of the soil respiration variability in winter snow-covering period (November to March). Mean spring freeze-thaw cycle (FTC) period (April) soil respiration contributed 63% of the non-growing season C efflux. Our finding is key for understanding and predicting the potential change in the response of boreal forest ecosystems to fire disturbance under future climate change.

  12. Correlation consistent basis sets for actinides. II. The atoms Ac and Np-Lr.

    Feng, Rulin; Peterson, Kirk A

    2017-08-28

    New correlation consistent basis sets optimized using the all-electron third-order Douglas-Kroll-Hess (DKH3) scalar relativistic Hamiltonian are reported for the actinide elements Ac and Np through Lr. These complete the series of sets reported previously for Th-U [K. A. Peterson, J. Chem. Phys. 142, 074105 (2015); M. Vasiliu et al., J. Phys. Chem. A 119, 11422 (2015)]. The new sets range in size from double- to quadruple-zeta and encompass both those optimized for valence (6s6p5f7s6d) and outer-core electron correlations (valence + 5s5p5d). The final sets have been contracted for both the DKH3 and eXact 2-component (X2C) Hamiltonians, yielding cc-pVnZ-DK3/cc-pVnZ-X2C sets for valence correlation and cc-pwCVnZ-DK3/cc-pwCVnZ-X2C sets for outer-core correlation (n = D, T, Q in each case). In order to test the effectiveness of the new basis sets, both atomic and molecular benchmark calculations have been carried out. In the first case, the first three atomic ionization potentials (IPs) of all the actinide elements Ac-Lr have been calculated using the Feller-Peterson-Dixon (FPD) composite approach, primarily with the multireference configuration interaction (MRCI) method. Excellent convergence towards the respective complete basis set (CBS) limits is achieved with the new sets, leading to good agreement with experiment, where these exist, after accurately accounting for spin-orbit effects using the 4-component Dirac-Hartree-Fock method. For a molecular test, the IP and atomization energy (AE) of PuO 2 have been calculated also using the FPD method but using a coupled cluster approach with spin-orbit coupling accounted for using the 4-component MRCI. The present calculations yield an IP 0 for PuO 2 of 159.8 kcal/mol, which is in excellent agreement with the experimental electron transfer bracketing value of 162 ± 3 kcal/mol. Likewise, the calculated 0 K AE of 305.6 kcal/mol is in very good agreement with the currently accepted experimental value of 303.1 ± 5 kcal

  13. Thresholds and interactive effects of soil moisture on the temperature response of soil respiration

    Lellei-Kovács, Eszter; Kovács-Láng, Edit; Botta-Dukát, Zoltán

    2011-01-01

    efflux is soil temperature, while soil moisture has less, although significant effect on soil respiration. Clear thresholds for moisture effects on temperature sensitivity were identified at 0.6, 4.0 and 7.0vol% by almost each model, which relate well to other known limits for biological activity......Ecosystem carbon exchange is poorly understood in low-productivity, semiarid habitats. Here we studied the controls of soil temperature and moisture on soil respiration in climate change field experiment in a sandy forest-steppe. Soil CO2 efflux was measured monthly from April to November in 2003......–2008 on plots receiving either rain exclusion or nocturnal warming, or serving as ambient control. Based on this dataset, we developed and compared empirical models of temperature and moisture effects on soil respiration. Results suggest that in this semiarid ecosystem the main controlling factor for soil CO2...

  14. The moisture response of soil heterotrophic respiration: interaction with soil properties

    Moyano, F E; Vasilyeva, N; Bouckaert, L

    2012-01-01

    the heterotrophic respiration response to moisture have limited empirical support and introduce an uncertainty of at least 4% in global soil carbon stock predictions by 2100. The necessity of improving the representation of this relationship in models has been highlighted in recent studies. Here we present a data......Soil moisture is of primary importance for predicting the evolution of soil carbon stocks and fluxes, both because it strongly controls organic matter decomposition and because it is predicted to change at global scales in the following decades. However, the soil functions used to model......-driven analysis of soil moisture-respiration relations based on 90 soils. With the use of linear models we show how the relationship between soil heterotrophic respiration and different measures of soil moisture is consistently affected by soil properties. The empirical models derived include main effects...

  15. Continuous daylight in the high-Arctic summer supports high plankton respiration rates compared to those supported in the dark

    Mesa, Elena

    2017-04-21

    Plankton respiration rate is a major component of global CO2 production and is forecasted to increase rapidly in the Arctic with warming. Yet, existing assessments in the Arctic evaluated plankton respiration in the dark. Evidence that plankton respiration may be stimulated in the light is particularly relevant for the high Arctic where plankton communities experience continuous daylight in spring and summer. Here we demonstrate that plankton community respiration evaluated under the continuous daylight conditions present in situ, tends to be higher than that evaluated in the dark. The ratio between community respiration measured in the light (Rlight) and in the dark (Rdark) increased as the 2/3 power of Rlight so that the Rlight:Rdark ratio increased from an average value of 1.37 at the median Rlight measured here (3.62 µmol O2 L-1 d-1) to an average value of 17.56 at the highest Rlight measured here (15.8 µmol O2 L-1 d-1). The role of respiratory processes as a source of CO2 in the Arctic has, therefore, been underestimated and is far more important than previously believed, particularly in the late spring, with 24 h photoperiods, when community respiration rates are highest.

  16. Spinal cord motion. Influence of respiration and cardiac cycle

    Winklhofer, S. [RWTH Aachen University Hospital (Germany). Dept. of Neuroradiology; University Hospital Zurich (Switzerland). Inst. of Diagnostic and Interventional Radiology; Schoth, F. [RWTH Aachen University Hospital (Germany). Dept. of Diagnostic Radiology; Stolzmann, P. [University Hospital Zurich (Switzerland). Inst. of Diagnostic and Interventional Radiology; Krings, T. [Toronto Western Hospital, ON (Canada). Div. of Neuroradiology; Mull, M.; Wiesmann, M. [RWTH Aachen University Hospital (Germany). Dept. of Neuroradiology; Stracke, C.P. [RWTH Aachen University Hospital (Germany). Dept. of Neuroradiology; Alfried-Krupp-Hospital, Essen (Germany). Dept. of Neuroradiology

    2014-11-15

    To assess physiological spinal cord motion during the cardiac cycle compared with the influence of respiration based on magnetic resonance imaging (MRI) measurements. Anterior-posterior spinal cord motion within the spinal canal was assessed in 16 healthy volunteers (median age, 25 years) by cardiac-triggered and cardiac-gated gradient echo pulse sequence MRI. Image acquisition was performed during breath-holding, normal breathing, and forced breathing. Normal spinal cord motion values were computed using descriptive statistics. Breathing-dependent differences were assessed using the Wilcoxon signed-rank test and compared with the cardiac-based cord motion. A normal value table was set up for the spinal cord motion of each vertebral cervico-thoracic-lumbar segment. Significant differences in cord motion were found between cardiac-based motion while breath-holding and the two breathing modalities (P < 0.01 each). Spinal cord motion was found to be highest during forced breathing, with a maximum in the lower cervical spinal segments (C5; mean, 2.1 mm ± 1.17). Image acquisition during breath-holding revealed the lowest motion. MRI permits the demonstration and evaluation of cardiac and respiration-dependent spinal cord motion within the spinal canal from the cervical to lumbar segments. Breathing conditions have a considerably greater impact than cardiac activity on spinal cord motion.

  17. Exposure to respirable crystalline silica in South African farm workers

    Swanepoel, Andrew; Rees, David; Renton, Kevin; Kromhout, Hans

    2009-01-01

    Although listed in some publications as an activity associated with silica (quartz) exposure, agriculture is not widely recognized as an industry with a potential for silica associated diseases. Because so many people work in agriculture; and because silica exposure and silicosis are associated with serious diseases such as tuberculosis (TB), particular in those immunological compromised by the Human immunodeficiency virus (HIV), silica exposure in agriculture is potentially very important. But in South Africa (SA) very little is known about silica exposure in this industry. The objectives of this project are: (a) to measure inhalable and respirable dust and its quartz content on two typical sandy soil farms in the Free State province of SA for all major tasks done on the farms; and (b) to characterise the mineralogy soil type of these farms. Two typical farms in the sandy soil region of the Free State province were studied. The potential health effects faced by these farm workers from exposure to respirable crystalline silica are discussed.

  18. Respirable quartz hazard associated with coal mine roof bolter dust

    Joy, G.J.; Beck, T.W.; Listak, J.M.

    2010-01-01

    Pneumoconiosis has been reported to be increasing among underground coal miners in the Southern Appalachian Region. The National Institute for Occupational Safety and Health conducted a study to examine the particle size distribution and quartz content of dust generated by the installation of roof bolts in mines. Forty-six bulk samples of roof bolting machine pre-cleaner cyclone dump dust and collector box dust were collected from 26 underground coal mines. Real-time and integrated airborne respirable dust concentrations were measured on 3 mining sections in 2 mines. The real-time airborne dust concentrations profiles were examined to identify any concentration changes that might be associated with pre-cleaner cyclone dust discharge events. The study showed that bolter dust is a potential inhalation hazard due to the fraction of dust less than 10 μm in size, and the quartz content of the dust. The pre-cleaner cyclone dust was significantly larger than the collector box dust, indicating that the pre-cleaner functioned properly in removing the larger dust size fraction from the airstream. However, the pre-cleaner dust still contained a substantial amount of respirable dust. It was concluded that in order to maintain the effectiveness of a roof bolter dust collector, periodic removal of dust is required. Appropriate work procedures and equipment are necessary to minimize exposure during this cleaning task. 13 refs., 3 tabs., 2 figs.

  19. Spinal cord motion. Influence of respiration and cardiac cycle

    Winklhofer, S.; University Hospital Zurich; Schoth, F.; Stolzmann, P.; Krings, T.; Mull, M.; Wiesmann, M.; Stracke, C.P.; Alfried-Krupp-Hospital, Essen

    2014-01-01

    To assess physiological spinal cord motion during the cardiac cycle compared with the influence of respiration based on magnetic resonance imaging (MRI) measurements. Anterior-posterior spinal cord motion within the spinal canal was assessed in 16 healthy volunteers (median age, 25 years) by cardiac-triggered and cardiac-gated gradient echo pulse sequence MRI. Image acquisition was performed during breath-holding, normal breathing, and forced breathing. Normal spinal cord motion values were computed using descriptive statistics. Breathing-dependent differences were assessed using the Wilcoxon signed-rank test and compared with the cardiac-based cord motion. A normal value table was set up for the spinal cord motion of each vertebral cervico-thoracic-lumbar segment. Significant differences in cord motion were found between cardiac-based motion while breath-holding and the two breathing modalities (P < 0.01 each). Spinal cord motion was found to be highest during forced breathing, with a maximum in the lower cervical spinal segments (C5; mean, 2.1 mm ± 1.17). Image acquisition during breath-holding revealed the lowest motion. MRI permits the demonstration and evaluation of cardiac and respiration-dependent spinal cord motion within the spinal canal from the cervical to lumbar segments. Breathing conditions have a considerably greater impact than cardiac activity on spinal cord motion.

  20. Plant species richness regulates soil respiration through changes in productivity.

    Dias, André Tavares Corrêa; van Ruijven, Jasper; Berendse, Frank

    2010-07-01

    Soil respiration is an important pathway of the C cycle. However, it is still poorly understood how changes in plant community diversity can affect this ecosystem process. Here we used a long-term experiment consisting of a gradient of grassland plant species richness to test for effects of diversity on soil respiration. We hypothesized that plant diversity could affect soil respiration in two ways. On the one hand, more diverse plant communities have been shown to promote plant productivity, which could increase soil respiration. On the other hand, the nutrient concentration in the biomass produced has been shown to decrease with diversity, which could counteract the production-induced increase in soil respiration. Our results clearly show that soil respiration increased with species richness. Detailed analysis revealed that this effect was not due to differences in species composition. In general, soil respiration in mixtures was higher than would be expected from the monocultures. Path analysis revealed that species richness predominantly regulates soil respiration through changes in productivity. No evidence supporting the hypothesized negative effect of lower N concentration on soil respiration was found. We conclude that shifts in productivity are the main mechanism by which changes in plant diversity may affect soil respiration.

  1. Mitochondrial respiration in subcutaneous and visceral adipose tissue from patients with morbid obesity

    Kraunsøe, Regitze; Boushel, Robert Christopher; Hansen, Christina Neigaard

    2010-01-01

    were permeabilized and respirometric measurements were performed in duplicate at 37 degrees C. Substrates (glutamate (G) + malate (M) + octanoyl carnitine (O) + succinate (S)) were added sequentially to provide electrons to complex I + II. ADP ((D)) for state 3 respiration was added after GM. Uncoupled...

  2. Fourteen Annually Repeated Droughts Suppressed Autotrophic Soil Respiration and Resulted in an Ecosystem Change

    Kopittke, G.R.; Tietema, A.; van Loon, E.; Asscheman, D.

    2014-01-01

    Predictions of future climate over the next 100 years show that the frequency of long periods of droughts in summer will increase in the Netherlands. This study investigated the effect of 14 annually repeated droughts on soil respiration at a Dutch heathland. Field measurements of total soil

  3. MICROBIAL COLONIZATION, RESPIRATION, AND BREAKDOWN OF MAPLE LEAVES ALONG A STREAM-MARSH CONTINUUM

    Breakdown rates, macroinvertebrate and bacterial colonization, and microbial respiration were measured on decaying maple (Acer saccharum) leaves at three sites along a stream-marsh continuum. Breakdown rates (-k+-SE) were 0.0284+-0.0045 d-1 for leaves in a high-gradient, non-tida...

  4. 30 CFR 71.101 - Respirable dust standard when quartz is present.

    2010-07-01

    ... during each shift to which each miner is exposed at or below a concentration of respirable dust computed... per cubic meter of air as measured with an approved sampling device and in terms of an equivalent concentration determined in accordance with § 71.206 (Approved sampling devices; equivalent concentrations...

  5. 30 CFR 70.101 - Respirable dust standard when quartz is present.

    2010-07-01

    ... concentration of respirable dust in the mine atmosphere during each shift to which each miner in the active... of air as measured with an approved sampling device and in terms of an equivalent concentration determined in accordance with § 70.206 (Approved sampling devices; equivalent concentrations), computed by...

  6. Soil respiration response to prescribed burning and thinning in mixed-conifer and hardwood forests

    Amy Concilio; Siyan Ma; Qinglin Li; James LeMoine; Jiquan Chen; Malcolm North; Daryl Moorhead; Randy Jensen

    2005-01-01

    The effects of management on soil carbon efflux in different ecosystems are still largely unknown yet crucial to both our understanding and management of global carbon flux. To compare the effects of common forest management practices on soil carbon cycling, we measured soil respiration rate (SRR) in a mixed-conifer and hardwood forest that had undergone various...

  7. Root respiration in North American forests: Effects of nitrogen concentration and temperature across biomes

    A.J. Burton; K.S. Pregitzer; R.W. Ruess; R.L. Hendrick; Mike F. Allen

    2002-01-01

    Root respiration rates have been shown to be correlated with temperature and root N concentration in studies of individual forest types or species, but it is not known how universal these relationships are across forest species adapted to widely different climatic and edaphic conditions. In order to test for broad, cross-species relationships, we measured fine root...

  8. Litter Decomposition and Soil Respiration Responses to Fuel-Reduction Treatments in Piedmond Loblolly Pine Forests

    Mac A. Callaham; Peter H. Anderson; Thomas A. Waldrop; Darren J. Lione; Victor B. Shelburne

    2004-01-01

    As part of the National Fire and Fire Surrogate Study, we measured the short-term effects of different fuel-management practices on leaf litter decomposition and soil respiration in loblolly pine stands on the upper Piedmont of South Carolina. These stands had been subjected to a factorial arrangement of experimental fuel-management treatments that included prescribed...

  9. Seasonal and interannual patterns in primary production, respiration and net ecosystem metabolism in three estuaries in the northeast Gulf of Mexico

    Measurements of primary production and respiration provide fundamental information about the trophic status of aquatic ecosystems, yet such measurements are logistically difficult and expensive to sustain as part of long-term monitoring programs. However, ecosystem metabolism par...

  10. Investigating the impact of temporal and spatial variation in spring snow melt on summer soil respiration

    John, G. P.; Papuga, S. A.; Wright, C. L.; Nelson, K.; Barron-Gafford, G. A.

    2010-12-01

    While soil respiration - the flux of carbon dioxide from the soil surface to the atmosphere - is the second largest terrestrial carbon flux, it is the least well constrained component of the terrestrial carbon cycle. This is in part because of its high variability in space and time that can become amplified under certain environmental conditions. Under current climate change scenarios, both summer and winter precipitation are expected to be altered in terrestrial ecosystems of the southwestern US. Precipitation magnitude and intensity influence soil moisture, which is a key control on ecosystem-scale respiration rates. Therefore understanding how changes in snow and rainfall translate to changes in soil moisture is critical to understanding climate change impacts on soil respiration processes. Our study took place within the footprint of a semiarid mixed-conifer flux measurement system on Mount Bigelow just north of Tucson, AZ. We analyzed images from three understory phenology cameras (pheno-cams) to identify areas that represented early and late snowmelt. Within the field of view of each of the three pheno-cams we established three early-melt and three late-melt soil respiration measurement “sites”. To understand the persistence of snowmelt conditions on summer soil respiration, we measured soil respiration, soil moisture, and soil temperature at all six sites on four days representing different summer periods (i.e. pre-monsoon, early monsoon, mid-monsoon, and late monsoon). Throughout the entire study period, at both early- and late-melt sites soil respiration was strongly correlated with amount of soil moisture, and was less responsive to temperature. Soil respiration generally increased throughout the rainy season, peaking by mid-monsoon at both early- and late-melt sites. Interestingly, early-melt sites were wetter than late-melt sites following rainfall occurring in the pre- and early monsoon. However, following rainfall occurring in the mid- to late

  11. Microcystin-LR and Cylindrospermopsin Induced Alterations in Chromatin Organization of Plant Cells

    Máthé, Csaba; M-Hamvas, Márta; Vasas, Gábor

    2013-01-01

    Cyanobacteria produce metabolites with diverse bioactivities, structures and pharmacological properties. The effects of microcystins (MCYs), a family of peptide type protein-phosphatase inhibitors and cylindrospermopsin (CYN), an alkaloid type of protein synthesis blocker will be discussed in this review. We are focusing mainly on cyanotoxin-induced changes of chromatin organization and their possible cellular mechanisms. The particularities of plant cells explain the importance of such studies. Preprophase bands (PPBs) are premitotic cytoskeletal structures important in the determination of plant cell division plane. Phragmoplasts are cytoskeletal structures involved in plant cytokinesis. Both cyanotoxins induce the formation of multipolar spindles and disrupted phragmoplasts, leading to abnormal sister chromatid segregation during mitosis. Thus, MCY and CYN are probably inducing alterations of chromosome number. MCY induces programmed cell death: chromatin condensation, nucleus fragmentation, necrosis, alterations of nuclease and protease enzyme activities and patterns. The above effects may be related to elevated reactive oxygen species (ROS) and/or disfunctioning of microtubule associated proteins. Specific effects: MCY-LR induces histone H3 hyperphosphorylation leading to incomplete chromatid segregation and the formation of micronuclei. CYN induces the formation of split or double PPB directly related to protein synthesis inhibition. Cyanotoxins are powerful tools in the study of plant cell organization. PMID:24084787

  12. Microcystin-LR and Cylindrospermopsin Induced Alterations in Chromatin Organization of Plant Cells

    Gábor Vasas

    2013-09-01

    Full Text Available Cyanobacteria produce metabolites with diverse bioactivities, structures and pharmacological properties. The effects of microcystins (MCYs, a family of peptide type protein-phosphatase inhibitors and cylindrospermopsin (CYN, an alkaloid type of protein synthesis blocker will be discussed in this review. We are focusing mainly on cyanotoxin-induced changes of chromatin organization and their possible cellular mechanisms. The particularities of plant cells explain the importance of such studies. Preprophase bands (PPBs are premitotic cytoskeletal structures important in the determination of plant cell division plane. Phragmoplasts are cytoskeletal structures involved in plant cytokinesis. Both cyanotoxins induce the formation of multipolar spindles and disrupted phragmoplasts, leading to abnormal sister chromatid segregation during mitosis. Thus, MCY and CYN are probably inducing alterations of chromosome number. MCY induces programmed cell death: chromatin condensation, nucleus fragmentation, necrosis, alterations of nuclease and protease enzyme activities and patterns. The above effects may be related to elevated reactive oxygen species (ROS and/or disfunctioning of microtubule associated proteins. Specific effects: MCY-LR induces histone H3 hyperphosphorylation leading to incomplete chromatid segregation and the formation of micronuclei. CYN induces the formation of split or double PPB directly related to protein synthesis inhibition. Cyanotoxins are powerful tools in the study of plant cell organization.

  13. Development of Blueberry and Carrot Juice Blend Fermented by Lactobacillus reuteri LR92

    Carolina Saori Ishii Mauro

    2016-12-01

    Full Text Available This study aimed to evaluate the blueberry and carrot juice blend as a fermentable substrate for Lactobacillus reuteri LR92, in order to develop a fermented non-dairy functional beverage. Analysis of cell viability, pH, and acidity were performed during the fermentation process. The resistance of the microorganism in the blend, under simulated gastrointestinal conditions and in storage at 4 °C for 28 days, was evaluated at the same time as the antioxidant potential of the fermented juice. After 40 h of fermentation, the L. reuteri population presented a logarithmic growth of three cycles, reaching count records of 10.26 ± 0.23 log CFU/mL and after 28 days of storage at 4 °C, the bacterial population maintained elevated numbers of viable cell (8.96 ± 0.08 log CFU/mL, with increase in the antioxidant capacity of the fermented blend. However, in the test of gastric simulation, the L. reuteri population had a logarithmic reduction of five cycles. In the presence of bile salts, the viability was maintained even after 150 min of incubation. This way, the results suggested that the blueberry and carrot blend juice can be considered as a good medium for the growth of L. reuteri, providing microbiological stability during refrigerated storage with elevated antioxidant capacity, which allows for the development of a non-dairy probiotic beverage.

  14. Leaf respiration at different canopy positions in sweetgum (Liquidambar styraciflua) grown in ambient and elevated concentrations of carbon dioxide in the field

    Tissue, D. T.; Lewis, J. D.; Wullschleger, S. D.; Amthro, J. S.; Griffin, K. L.; Anderson, O. R.

    2002-01-01

    The effects of elevated carbon dioxide and canopy position on leaf respiration in sweetgum trees in a closed canopy forest were measured in an effort to determine if, and why, enriched atmospheric carbon dioxide might affect leaf respiration in sweetgum. To account for the dark respiratory response to growth in elevated carbon dioxide, cell ultrastructure and cytochrome c oxidase activity in leaves were measured at different seasonal growth periods. Leaf respiration under light conditions was also estimated to determine whether elevated carbon dioxide affected daytime respiration. Results showed that long-term exposure to elevated carbon dioxide did not effect night-time or day- time respiration in trees grown in a plantation in the field. Canopy position affected night-time respiration partially, through the effects on leaf soluble sugar, starch, nitrogen and leaf mass per unit area. In carbon dioxide partial pressure the effects of canopy position were insignificant. It was concluded that elevated carbon dioxide does not directly impact leaf respiration in sweetgum and assuming no changes in leaf nitrogen or leaf chemical composition, the long-term effects on respiration in this species will be minimal. 50 refs., 4 tabs., 3 figs

  15. Characterization of small-to-medium head-and-face dimensions for developing respirator fit test panels and evaluating fit of filtering facepiece respirators with different faceseal design

    Lin, Yi-Chun

    2017-01-01

    A respirator fit test panel (RFTP) with facial size distribution representative of intended users is essential to the evaluation of respirator fit for new models of respirators. In this study an anthropometric survey was conducted among youths representing respirator users in mid-Taiwan to characterize head-and-face dimensions key to RFTPs for application to small-to-medium facial features. The participants were fit-tested for three N95 masks of different facepiece design and the results compared to facial size distribution specified in the RFTPs of bivariate and principal component analysis design developed in this study to realize the influence of facial characteristics to respirator fit in relation to facepiece design. Nineteen dimensions were measured for 206 participants. In fit testing the qualitative fit test (QLFT) procedures prescribed by the U.S. Occupational Safety and Health Administration were adopted. As the results show, the bizygomatic breadth of the male and female participants were 90.1 and 90.8% of their counterparts reported for the U.S. youths (P < 0.001), respectively. Compared to the bivariate distribution, the PCA design better accommodated variation in facial contours among different respirator user groups or populations, with the RFTPs reported in this study and from literature consistently covering over 92% of the participants. Overall, the facial fit of filtering facepieces increased with increasing facial dimensions. The total percentages of the tests wherein the final maneuver being completed was “Moving head up-and-down”, “Talking” or “Bending over” in bivariate and PCA RFTPs were 13.3–61.9% and 22.9–52.8%, respectively. The respirators with a three-panel flat fold structured in the facepiece provided greater fit, particularly when the users moved heads. When the facial size distribution in a bivariate RFTP did not sufficiently represent petite facial size, the fit testing was inclined to overestimate the general fit

  16. A 3D graphene-based biosensor as an early microcystin-LR screening tool in sources of drinking water supply

    Zhang, Wei; Han, Changseok; Jia, Baoping; Saint, Christopher; Nadagouda, Mallikarjuna; Falaras, Polycarpos; Sygellou, Labrini; Vogiazi, Vasileia; Dionysiou, Dionysios D.

    2017-01-01

    Highlights: • 3D graphene-based biosensors can detect MC-LR with remarkable sensitivity. • Good linear correlation between electron-transfer resistance and MC-LR concentration. • A detection limit of 0.04 μg/L MC-LR was accomplished. - Abstract: Recent advances in graphene synthesis and understanding of properties have led to enormous applications in a variety of areas. Graphene and its unique electrical properties can favor electrochemical biosensor applications for aqueous toxin monitoring. Graphene-based biosensors can be used as an alternative to time-consuming, expensive and non-portable conventional methods of analysis involved in water quality monitoring and assessment. In this work, we showcased a three-dimensional (3D) graphene-based biosensor for microcystin-LR (MC-LR) detection and quantification. We report the efficient functionalization and immobilization of microcystin-LR and its antibodies on the facile synthesized CVD 3D graphene. The modified graphene electrodes were characterized by X-ray photoelectron spectroscopy and micro-Raman spectroscopy. Cyclic voltammetry and electrochemical impedance spectroscopy were used to electrochemically characterize the biochemical events on the electrodes. Specifically, as-prepared 3D graphene-based biosensors can detect MC-LR with remarkable sensitivity due to its macro-porous structure and large surface area, and high conductivity. A very good linear correlation of the electron-transfer resistance (R"2 = 0.93) was achieved over 0.05 and 20 μg/L MC-LR concentration range. Also, a detection limit of 0.05 μg/L was accomplished, which is much lower than the World Health Organization (WHO) provisional guideline limit of MC-LR concentration (i.e. 1 μg/L) in drinking water.

  17. Process optimization for microcystin-LR degradation by Response Surface Methodology and mechanism analysis in gas-liquid hybrid discharge system.

    Zhang, Yi; Wei, Hanyu; Xin, Qing; Wang, Mingang; Wang, Qi; Wang, Qiang; Cong, Yanqing

    2016-12-01

    A gas-liquid hybrid discharge system was applied to microcystin-LR (MC-LR) degradation. MC-LR degradation was completed after 1 min under a pulsed high voltage of 16 kV, gas-liquid interface gap of 10 mm and oxygen flow rate of 160 L/h. The Box-Behnken Design was proposed in Response Surface Methodology to evaluate the influence of pulsed high voltage, electrode distance and oxygen flow rate on MC-LR removal efficiency. Multiple regression analysis, focused on multivariable factors, was employed and a reduced cubic model was developed. The ANOVA analysis shows that the model is significant and the model prediction on MC-LR removal was also validated with experimental data. The optimum conditions for the process are obtained at pulsed voltage of 16 kV, gas-liquid interface gap of 10 mm and oxygen flow rate of 120 L/h with ta removal efficiency of MC-LR of 96.6%. The addition of catalysts (TiO 2 or Fe 2+ ) in the gas-liquid hybrid discharge system was found to enhance the removal of MC-LR. The intermediates of MC-LR degradation were analyzed by liquid chromatography/mass spectrometry. The degradation pathway proposed envisaged the oxidation of hydroxyl radicals and ozone, and attack of high-energy electrons on the unsaturated double bonds of Adda and Mdha, with MC-LR finally decomposing into small molecular products. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. Response of soil respiration to acid rain in forests of different maturity in southern China.

    Guohua Liang

    Full Text Available The response of soil respiration to acid rain in forests, especially in forests of different maturity, is poorly understood in southern China despite the fact that acid rain has become a serious environmental threat in this region in recent years. Here, we investigated this issue in three subtropical forests of different maturity [i.e. a young pine forest (PF, a transitional mixed conifer and broadleaf forest (MF and an old-growth broadleaved forest (BF] in southern China. Soil respiration was measured over two years under four simulated acid rain (SAR treatments (CK, the local lake water, pH 4.5; T1, water pH 4.0; T2, water pH 3.5; and T3, water pH 3.0. Results indicated that SAR did not significantly affect soil respiration in the PF, whereas it significantly reduced soil respiration in the MF and the BF. The depressed effects on both forests occurred mostly in the warm-wet seasons and were correlated with a decrease in soil microbial activity and in fine root biomass caused by soil acidification under SAR. The sensitivity of the response of soil respiration to SAR showed an increasing trend with the progressive maturity of the three forests, which may result from their differences in acid buffering ability in soil and in litter layer. These results indicated that the depressed effect of acid rain on soil respiration in southern China may be more pronounced in the future in light of the projected change in forest maturity. However, due to the nature of this field study with chronosequence design and the related pseudoreplication for forest types, this inference should be read with caution. Further studies are needed to draw rigorous conclusions regarding the response differences among forests of different maturity using replicated forest types.

  19. Dose Response of Endotoxin on Hepatocyte and Muscle Mitochondrial Respiration In Vitro

    Brandt, Sebastian; Porta, Francesca; Jakob, Stephan M.; Takala, Jukka; Djafarzadeh, Siamak

    2015-01-01

    Introduction. Results on mitochondrial dysfunction in sepsis are controversial. We aimed to assess effects of LPS at wide dose and time ranges on hepatocytes and isolated skeletal muscle mitochondria. Methods. Human hepatocellular carcinoma cells (HepG2) were exposed to placebo or LPS (0.1, 1, and 10 μg/mL) for 4, 8, 16, and 24 hours and primary human hepatocytes to 1 μg/mL LPS or placebo (4, 8, and 16 hours). Mitochondria from porcine skeletal muscle samples were exposed to increasing doses of LPS (0.1–100 μg/mg) for 2 and 4 hours. Respiration rates of intact and permeabilized cells and isolated mitochondria were measured by high-resolution respirometry. Results. In HepG2 cells, LPS reduced mitochondrial membrane potential and cellular ATP content but did not modify basal respiration. Stimulated complex II respiration was reduced time-dependently using 1 μg/mL LPS. In primary human hepatocytes, stimulated mitochondrial complex II respiration was reduced time-dependently using 1 μg/mL LPS. In isolated porcine skeletal muscle mitochondria, stimulated respiration decreased at high doses (50 and 100 μg/mL LPS). Conclusion. LPS reduced cellular ATP content of HepG2 cells, most likely as a result of the induced decrease in membrane potential. LPS decreased cellular and isolated mitochondrial respiration in a time-dependent, dose-dependent and complex-dependent manner. PMID:25649304

  20. Effects of elevated CO2 leaf diets on gypsy moth (Lepidoptera: Lymantriidae) respiration rates.

    Foss, Anita R; Mattson, William J; Trier, Terry M

    2013-06-01

    Elevated levels of CO2 affect plant growth and leaf chemistry, which in turn can alter host plant suitability for insect herbivores. We examined the suitability of foliage from trees grown from seedlings since 1997 at Aspen FACE as diet for the gypsy moth (Lymantria dispar L.) Lepidoptera: Lymantriidae: paper birch (Betula papyrifera Marshall) in 2004-2005, and trembling aspen (Populus tremuloides Michaux) in 2006-2007, and measured consequent effects on larval respiration. Leaves were collected for diet and leaf chemistry (nutritional and secondary compound proxies) from trees grown under ambient (average 380 ppm) and elevated CO2 (average 560 ppm) conditions. Elevated CO2 did not significantly alter birch or aspen leaf chemistry compared with ambient levels with the exception that birch percent carbon in 2004 and aspen moisture content in 2006 were significantly lowered. Respiration rates were significantly higher (15-59%) for larvae reared on birch grown under elevated CO2 compared with ambient conditions, but were not different on two aspen clones, until larvae reached the fifth instar, when those consuming elevated CO2 leaves on clone 271 had lower (26%) respiration rates, and those consuming elevated CO2 leaves on clone 216 had higher (36%) respiration rates. However, elevated CO2 had no apparent effect on the respiration rates of pupae derived from larvae fed either birch or aspen leaves. Higher respiration rates for larvae fed diets grown under ambient or elevated CO2 demonstrates their lower efficiency of converting chemical energy of digested food stuffs extracted from such leaves into their biosynthetic processes.

  1. Response of soil respiration to acid rain in forests of different maturity in southern China.

    Liang, Guohua; Liu, Xingzhao; Chen, Xiaomei; Qiu, Qingyan; Zhang, Deqiang; Chu, Guowei; Liu, Juxiu; Liu, Shizhong; Zhou, Guoyi

    2013-01-01

    The response of soil respiration to acid rain in forests, especially in forests of different maturity, is poorly understood in southern China despite the fact that acid rain has become a serious environmental threat in this region in recent years. Here, we investigated this issue in three subtropical forests of different maturity [i.e. a young pine forest (PF), a transitional mixed conifer and broadleaf forest (MF) and an old-growth broadleaved forest (BF)] in southern China. Soil respiration was measured over two years under four simulated acid rain (SAR) treatments (CK, the local lake water, pH 4.5; T1, water pH 4.0; T2, water pH 3.5; and T3, water pH 3.0). Results indicated that SAR did not significantly affect soil respiration in the PF, whereas it significantly reduced soil respiration in the MF and the BF. The depressed effects on both forests occurred mostly in the warm-wet seasons and were correlated with a decrease in soil microbial activity and in fine root biomass caused by soil acidification under SAR. The sensitivity of the response of soil respiration to SAR showed an increasing trend with the progressive maturity of the three forests, which may result from their differences in acid buffering ability in soil and in litter layer. These results indicated that the depressed effect of acid rain on soil respiration in southern China may be more pronounced in the future in light of the projected change in forest maturity. However, due to the nature of this field study with chronosequence design and the related pseudoreplication for forest types, this inference should be read with caution. Further studies are needed to draw rigorous conclusions regarding the response differences among forests of different maturity using replicated forest types.

  2. Temperature response of respiration across heterogeneous microtopography in the Arctic tundra, Utqiaġvik, Alaska

    Wilkman, E.; Zona, D.; Tang, Y.; Gioli, B.; Lipson, D.; Oechel, W. C.

    2017-12-01

    The response of ecosystem respiration to warming in the Arctic is not well constrained, partly due to the presence of ice-wedge polygons in continuous permafrost areas. These formations lead to substantial variation in vegetation, soil moisture, water table, and active layer depth over the meter scale that can drive respiratory carbon loss. Accurate calculations of in-situ temperature sensitivities (Q10) are vital for the prediction of future Arctic emissions, and while the eddy covariance technique has commonly been used to determine the diurnal and season patterns of net ecosystem exchange (NEE) of CO2, the lack of suitable dark periods in the Arctic summer has limited our ability to estimate and interpret ecosystem respiration. To therefore improve our understanding of and define controls on ecosystem respiration, we directly compared CO2 fluxes measured from automated chambers across the main local polygonised landscape forms (high and low centers, polygon rims, and polygon troughs) to estimates from an adjacent eddy covariance tower. Low-centered polygons and polygon troughs had the greatest cumulative respiration rates, and ecosystem type appeared to be the most important explanatory variable for these rates. Despite the difference in absolute respiration rates, Q10 was surprisingly similar across all microtopographic features, despite contrasting water levels and vegetation types. Conversely, Q10 varied temporally, with higher values during the early and late summer and lower values during the peak growing season. Finally, good agreement was found between chamber and tower based Q10 estimates during the peak growing season. Overall, this study suggests that it is possible to simplify estimates of the temperature sensitivity of respiration across heterogeneous landscapes, but that seasonal changes in Q10 should be incorporated into current and future model simulations.

  3. Review of economic evaluations of mask and respirator use for protection against respiratory infection transmission.

    Mukerji, Shohini; MacIntyre, C Raina; Newall, Anthony T

    2015-10-13

    There has been increasing debate surrounding mask and respirator interventions to control respiratory infection transmission in both healthcare and community settings. As decision makers are considering the recommendations they should evaluate how to provide the most efficient protection strategies with minimum costs. The aim of this review is to identify and evaluate the existing economic evaluation literature in this area and to offer advice on how future evaluations on this topic should be conducted. We searched the Scopus database for all literature on economic evaluation of mask or respirator use to control respiratory infection transmission. Reference lists from the identified studies were also manually searched. Seven studies met our inclusion criteria from the initial 806 studies identified by the search strategy and our manual search. Five studies considered interventions for seasonal and/or pandemic influenza, with one also considering SARS (Severe Acute Respiratory Syndrome). The other two studies focussed on tuberculosis transmission control interventions. The settings and methodologies of the studies varied greatly. No low-middle income settings were identified. Only one of the reviewed studies cited clinical evidence to inform their mask/respirator intervention effectiveness parameters. Mask and respirator interventions were generally reported by the study authors to be cost saving or cost-effective when compared to no intervention or other control measures, however the evaluations had important limitations. Given the large cost differential between masks and respirators, there is a need for more comprehensive economic evaluations to compare the relative costs and benefits of these interventions in situations and settings where alternative options are potentially applicable. There are at present insufficient well conducted cost-effectiveness studies to inform decision-makers on the value for money of alternative mask/respirator options.

  4. Maintenance, endogeneous, respiration, lysis, decay and predation

    loosdrecht, Marc C. M. Van; Henze, Mogens

    1999-01-01

    mechanism is microbiologically correct. The lysis/decay model mechanism is a strongly simplified representation of reality. This paper tries to review the processes grouped under endogenous respiration in activated sludge models. Mechanisms and processes such as maintenance, lysis, internal and external...... decay, predation and death-regeneration are discussed. From recent microbial research it has become evident that cells do not die by themselves. Bacteria are however subject to predation by protozoa. Bacteria store reserve polymers that in absence of external substrate are used for growth...

  5. Removal of microcystin-LR from drinking water using a bamboo-based charcoal adsorbent modified with chitosan.

    Zhang, Hangjun; Zhu, Guoying; Jia, Xiuying; Ding, Ying; Zhang, Mi; Gao, Qing; Hu, Ciming; Xu, Shuying

    2011-01-01

    A new kind of low-cost syntactic adsorbent from bamboo charcoal and chitosan was developed for the removal of microcystin-LR from drinking water. Removal efficiency was higher for the syntactic adsorbent when the amount of bamboo charcoal was increased. The optimum dose ratio of bamboo charcoal to chitosan was 6:4, and the optimum amount was 15 mg/L; equilibrium time was 6 hr. The adsorption isotherm was non-linear and could be simulated by the Freundlich model (R2 = 0.9337). Adsorption efficiency was strongly affected by pH and natural organic matter (NOM). Removal efficiency was 16% higher at pH 3 than at pH 9. Efficiency rate was reduced by 15% with 25 mg/L NOM (UV254 = 0.089 cm(-1)) in drinking water. This study demonstrated that the bamboo charcoal modified with chitosan can effectively remove microcystin-LR from drinking water.

  6. Development of an Advanced Respirator Fit Test Headform (Postprint)

    2012-11-01

    N95 filtering facepiece respirators (FFRs) for pro - tection studies against viable airborne particles. A Static (i.e., non-moving, non-speaking...requiredto wear respirators to reduce their exposure to air- borne hazards.(1) The U.S. Occupational Safety and Health Administration ( OSHA ) Respiratory...13 workplace protection factors.(9,10). Inward leakage (IL) of con - taminants into a respirator facepiece has been described as a combination of

  7. Measurements of equilibrium factor between radon and its progeny by using of SSNTD and quality assurance

    Nikezic, D.

    2009-01-01

    In this paper, a critical survey of existing methods for equilibrium factor determination by using SSNTD is given. An original method, developed by Nikezic and Yu [11,12], that is based on application of LR115 detector is presented. New introduced quantity, so called, proxy factor, that is measurable with LR115 detector, is well correlated with equilibrium factor. (author) [sr

  8. Contribution of root respiration to soil respiration in a C3/C4 mixed ...

    Unknown

    The linear regression relationship between soil respiration and root biomass was used to determine the .... 10 days, sieved 50 g soil samples were placed in a 100 ml beaker and a 250 ..... Comparatively, the method can take multi-samples by ...

  9. ESTIMATING ROOT RESPIRATION IN SPRUCE AND BEECH: DECREASES IN SOIL RESPIRATION FOLLOWING GIRDLING

    A study was undertaken to follow seasonal fluxes of CO2 from soil and to estimate the contribution of autotrophic (root + mycorrhizal) to total soil respiration (SR) in a mixed stand of European beech (Fagus sylvatica) and Norway spruce (Picea abies) near Freising, Germany. Matu...

  10. Decadal prediction skill in the ocean with surface nudging in the IPSL-CM5A-LR climate model

    Mignot , Juliette; García-Serrano , Javier; Swingedouw , Didier; Germe , Agathe; Nguyen , Sébastien; Ortega , Pablo; Guilyardi , Éric; Ray , Sulagna

    2016-01-01

    International audience; Two decadal prediction ensembles, based on the same climate model (IPSL-CM5A-LR) and the same surface nudging initialization strategy are analyzed and compared with a focus on upper-ocean variables in different regions of the globe. One ensemble consists of 3-member hindcasts launched every year since 1961 while the other ensemble benefits from 9 members but with start dates only every 5 years. Analysis includes anomaly correlation coefficients and root mean square err...

  11. Metabolic interactions between methanogenic consortia and anaerobic respiring bacteria

    Stams, A.J.; Oude Elferink, S.J.; Westermann, Peter

    2003-01-01

    Most types of anaerobic respiration are able to outcompete methanogenic consortia for common substrates if the respective electron acceptors are present in sufficient amounts. Furthermore, several products or intermediate compounds formed by anaerobic respiring bacteria are toxic to methanogenic...... consortia. Despite the potentially adverse effects, only few inorganic electron acceptors potentially utilizable for anaerobic respiration have been investigated with respect to negative interactions in anaerobic digesters. In this chapter we review competitive and inhibitory interactions between anaerobic...... respiring populations and methanogenic consortia in bioreactors. Due to the few studies in anaerobic digesters, many of our discussions are based upon studies of defined cultures or natural ecosystems...

  12. Oxidação de microcistinas-LR em águas pelo íon ferrato(VI Aqueous oxidation of microcystin-LR by ferrate(VI

    Sérgio João de Luca

    2010-03-01

    Full Text Available Toxinas de cianobactérias têm se tornado um grave problema na produção segura de água para consumo humano e animal. Técnicas convencionais de tratamento falham em atingir padrões de potabilidade. O ferrato(VI de potássio, um composto oxidante e coagulante, mostra potencialidade no tratamento de águas contaminadas. Neste trabalho, são apresentados resultados da oxidação pelo ferrato(VI de uma toxina gerada por cianobactérias, a microcistina-LR. Ensaios de cinética de oxidação e de teste de jarros mostram um valor médio de 0,012 min-1 para a constante de taxa de reação de pseudoprimeira ordem, para concentrações de MC-LR de 100 a 200 µg.L-1 na água bruta. Dosagens de 1,6 a 5,0 mg.L-1 de ferrato(VI sugerem o atendimento ao padrão de potabilidade para microcistinas, mostrando que o oxidante poderá ser empregado como coadjuvante no tratamento de água.Algae toxins are becoming a severe problem in the water treatment industry, especially for human and animal consumption. Traditional treatment processes have failed in complying with water supply standards. Potassium ferrate(VI is a powerful oxidant, disinfectant and, also, a coagulant. In this paper, the results of microcystin-LR oxidation by ferrate(VI ion are presented. Kinetic and jar tests showed a average value of 0,012 min-1 for the pseudo first order reaction rate constant, for 100 and 200 µg.L-1 concentration of MC-LR. Ferrate(VI dosages between 1.6 and 5.0 mg.L-1 suggest that water supply standards for MC-LR can be reached, which means that the oxidant may be employed as coadjuvant in water treatment.

  13. Sex-dependent effects of microcystin-LR on hypothalamic-pituitary-gonad axis and gametogenesis of adult zebrafish

    Liu, Wanjing; Chen, Chuanyue; Chen, Liang; Wang, Li; Li, Jian; Chen, Yuanyuan; Jin, Jienan; Kawan, Atufa; Zhang, Xuezhen

    2016-03-01

    While microcystins (MCs) have been reported to exert reproductive toxicity on fish with a sex-dependent effect, the underlying mechanism has been rarely investigated. In the present study, zebrafish were exposed to 1, 5 and 20 μg/L MC-LR for 30 d. The gonad-somatic index declined in all treated males. 17β-estradiol (E2), testosterone (T), 11-keto testosterone (11-KT) and follicle-stimulating hormone (FSH) levels increased in serum from all treated females, while T, FSH and luteinizing hormone (LH) levels changed in all treated males. Histomorphological observation showed that MC-LR exposure evidently retarded oogenesis and spermatogenesis. Transcriptional changes of 22 genes of the hypothalamic-pituitary-gonad (HPG) axis exhibited sex-specific responses, and the relationship between gene transcriptions and gametogenesis was evaluated by principle component analysis (PCA). Major contributors to PC1 (gnrh2, gnrhr3, ar, lhr, hmgra, hmgrb and cyp19a) were positively correlated with the number of post-vitellogenic oocytes, while PC1 (gnrh2, lhβ, erβ, fshr, cyp11a and 17βhsd) were positively correlated with the number of spermatozoa. The protein levels of 17βHSD and CYP19a were affected in both females and males. In conclusion, this study first investigated the sex-dependent effects of microcystins on fish reproduction and revealed some important molecular biomarkers related to gametogenesis in zebrafish suffered from MC-LR.

  14. Respirator studies for the ERDA Division of Safety, Standards, and Compliance. Progress report, July 1, 1974--June 30, 1975

    Douglas, D.D.; Hack, A.L.; Davis, T.O.; Shafer, C.; Moore, T.O.; Richards, C.P.; Revoir, W.H.

    1976-08-01

    Major accomplishments during FY 1975 were the initiation of a respirator research program to investigate the physiological effects of wearing a respirator under stress, assisting ERDA contractors by providing information and training concerning respirator programs, quality assurance of respirators, and respirator applications. A newsletter of respirator developments for ERDA contractor personnel was published, and a Respirator Symposium was conducted

  15. Development of everlasting flowers (Comanthera elegans (Bong. L.R. Parra & Giul. in three cultivation systems

    Fernanda da Conceição Moreira

    2017-06-01

    Full Text Available Marketing the inflorescences of Comanthera elegans (Bong. L.R. Parra & Giul. represents a source of income to many families from extractives communities in the portion of the Espinhaço Range located in the state of Minas Gerais, Brazil. Cultivating this species stands out by allying income generation with conservation since the species is currently endangered. This study aimed to assess aspects of the development of C. elegans in three cultivation systems: beds, rows, and whole area. Sowing took place in January 2009 and the inflorescences were harvested in May 2010, which characterized the experimental period. Emergence; plant density; rates of flowering, mortality, resprouting, and recruiting of new individuals; and production of inflorescences per plant and per area were assessed. Emergence began approximately 50 days after sowing. Plant density ranged from 130 to 350 plants.m-2 among the three cultivation systems. The highest mortality rate (18% was observed at the peak of the dry season (August and the overall mortality rate over one reproductive cycle was 49%. Of the plants that lost the aerial part, 36% resprouted. Sprouting and seed germination accounted for 30 and 3% of the recruiting of new individuals, respectively. C. elegans had two bloom (AprilMay 2009 and April-May 2010: 5.4% of the plants bloomed in the first season and 78%, in the second. Each plant produced between three and 178 inflorescences and the highest inflorescence production in terms of weight (232 g.m-2 and number (2,910 inflorescences.m-2 was observed in the cultivation in beds at 1,624 kg.ha-1.

  16. Penetration of asbestos fibers in respirator filters

    Cheng, Yung-Sung; Pearson, S.D.; Rohrbacher, K.D.; Yeh, Hsu-Chi.

    1994-01-01

    Currently, the health risks associated with asbestos have restricted its use and created a growing asbestos abatement industry with a need for respirator filters that are effective for worker protection. The main purpose of this project is to determine the influence of fiber size, electrostatic charge, and flow rate on the penetration of asbestos fibers in respirator filter cartridges. The study includes four types of filters each tested at two flow rates: the AO-R57A, a dual cartridge HEPA filter tested at 16 and 42.5 L/min; the MSA-S, a dust and mist filter tested at 16 and 42.5 L/min; the MSA-A power filter tested at 32 and 85 L/min; and the 3M-8710, a low-efficiency disposable face mask filter tested at 32 and 85 L/min. The three types of asbestos fibers used (amosite, crocidolite, and chrysotile) ranged in length from 0.04-0.5 μm and in aspect ratio (ratio of length to diameter) from 3 to 60. The fibers were used in both charged and neutralized forms. The results from amosite fibers are reported here

  17. The mTOR inhibitor sirolimus suppresses renal, hepatic, and cardiac tissue cellular respiration.

    Albawardi, Alia; Almarzooqi, Saeeda; Saraswathiamma, Dhanya; Abdul-Kader, Hidaya Mohammed; Souid, Abdul-Kader; Alfazari, Ali S

    2015-01-01

    The purpose of this in vitro study was to develop a useful biomarker (e.g., cellular respiration, or mitochondrial O2 consumption) for measuring activities of mTOR inhibitors. It measured the effects of commonly used immunosuppressants (sirolimus-rapamycin, tacrolimus, and cyclosporine) on cellular respiration in target tissues (kidney, liver, and heart) from C57BL/6 mice. The mammalian target of rapamycin (mTOR), a serine/ threonine kinase that supports nutrient-dependent cell growth and survival, is known to control energy conversion processes within the mitochondria. Consistently, inhibitors of mTOR (e.g., rapamycin, also known as sirolimus or Rapamune®) have been shown to impair mitochondrial function. Inhibitors of the calcium-dependent serine/threonine phosphatase calcineurin (e.g., tacrolimus and cyclosporine), on the other hand, strictly prevent lymphokine production leading to a reduced T-cell function. Sirolimus (10 μM) inhibited renal (22%, P=0.002), hepatic (39%, Prespiration. Tacrolimus and cyclosporine had no or minimum effects on cellular respiration in these tissues. Thus, these results clearly demonstrate that impaired cellular respiration (bioenergetics) is a sensitive biomarker of the immunosuppressants that target mTOR.

  18. Separating the effect of respiration from the heart rate variability for cases of constant harmonic breathing

    Kircher Michael

    2015-09-01

    Full Text Available Heart Rate Variability studies are a known measure for the autonomous control of the heart rate. In special situations, its interpretation can be ambiguous, since the respiration has a major influence on the heart rate variability. For this reason it has often been proposed to measure Heart Rate Variability, while the subjects are breathing at a constant respiration rate. That way the spectral influence of the respiration is known. In this work we propose to remove this constant respiratory influence from the heart rate and the Heart Rate Variability parameters to gain respiration free autonomous controlled heart rate signal. The spectral respiratory component in the heart rate signal is detected and characterized. Subsequently the respiratory effect on Heart Rate Variability is removed using spectral filtering approaches, such as the Notch filter or the Raised Cosine filter. As a result new decoupled Heart Variability parameters are gained, which could lead to new additional interpretations of the autonomous control of the heart rate.

  19. Stem respiration of Populus species in the third year of free-air CO2 enrichment.

    Gielen, Birgit; Scarascia-Mugnozza, Giuseppe; Ceulemans, Reinhart

    2003-04-01

    Carbon cycling in ecosystems, and especially in forests, is intensively studied to predict the effects of global climate change, and the role which forests may play in 'changing climate change'. One of the questions is whether the carbon balance of forests will be affected by increasing atmospheric CO2 concentrations. Regarding this question, effects of elevated [CO2] on woody-tissue respiration have frequently been neglected. Stem respiration of three Populus species (P. alba L. (Clone 2AS-11), P. nigra L. (Clone Jean Pourtet), and P. x euramericana (Clone I-214)) was measured in a managed, high-density forest plantation exposed to free-air CO2 enrichment (POPFACE). During the period of measurements, in May of the third year, stem respiration rates were not affected by the FACE treatment. Moreover, FACE did not influence the relationships between respiration rate and both stem temperature and relative growth rate. The results were supported by the reported absence of a FACE-effect on growth and stem wood density.

  20. Analyses of Heart Rate, Respiration and Cardiorespiratory Coupling in Patients with Schizophrenia

    Steffen Schulz

    2015-01-01

    Full Text Available Schizophrenia is a severe mental disorder associated with a significantly increased cardiovascular mortality rate. However, the underlying mechanisms leading to this cardiovascular disease (CVD are not fully known. Therefore, the objective of this study was to characterize the cardiorespiratory influence by investigating heart rate, respiration and the causal strength and direction of cardiorespiratory coupling (CRC, based mainly on entropy measures. We investigated 23 non-medicated patients with schizophrenia (SZ, comparing them to 23 age- and gender-matched healthy controls (CO. A significantly reduced complexity was found for the heart rate and a significantly increased complexity in respiration and CRC in SZ patients when compared to corresponding measurements from CO (p < 0.001. CRC analyses revealed a clear coupling, with a driver-responder relationship from respiration to heart rate in SZ patients. Moreover, a slight driver-responder relationship from heart rate to respiration could be recognized. These findings lead to the assumption that SZ should be considered to be a high-risk group for CVD. We hypothesize that the varying cardiorespiratory regulation contributes to the increased risk for cardiac mortality. Therefore, regular monitoring of the cardiorespiratory status of SZ is suggested to identify autonomic regulation impairment at an early stage—to develop timely and effective treatment and intervention strategies.

  1. A dynamic soil chamber system coupled with a tunable diode laser for online measurements of delta-13C, delta-18O, and efflux rate of soil respired CO2

    Powers, Heath H [Los Alamos National Laboratory; Mcdowell, Nate [Los Alamos National Laboratory; Hanson, David [UNM; Hunt, John [LANDCARE RESEARCH

    2009-01-01

    High frequency observations of the stable isotopic composition of CO(2) effluxes from soil have been sparse due in part to measurement challenges. We have developed an open-system method that utilizes a flow-through chamber coupled to a tunable diode laser (TDL) to quantify the rate of soil CO(2) efflux and its delta(13)C and delta(18)O values (delta(13)C(R) and delta(18)O(R), respectively). We tested the method first in the laboratory using an artificial soil test column and then in a semi-arid woodland. We found that the CO(2) efflux rates of 1.2 to 7.3 micromol m(-2) s(-1) measured by the chamber-TDL system were similar to measurements made using the chamber and an infrared gas analyzer (IRGA) (R(2) = 0.99) and compared well with efflux rates generated from the soil test column (R(2) = 0.94). Measured delta(13)C and delta(18)O values of CO(2) efflux using the chamber-TDL system at 2 min intervals were not significantly different from source air values across all efflux rates after accounting for diffusive enrichment. Field measurements during drought demonstrated a strong dependency of CO(2) efflux and isotopic composition on soil water content. Addition of water to the soil beneath the chamber resulted in average changes of +6.9 micromol m(-2) s(-1), -5.0 per thousand, and -55.0 per thousand for soil CO(2) efflux, delta(13)C(R) and delta(18)O(R), respectively. All three variables initiated responses within 2 min of water addition, with peak responses observed within 10 min for isotopes and 20 min for efflux. The observed delta(18)O(R) was more enriched than predicted from temperature-dependent H(2)O-CO(2) equilibration theory, similar to other recent observations of delta(18)O(R) from dry soils (Wingate L, Seibt U, Maseyk K, Ogee J, Almeida P, Yakir D, Pereira JS, Mencuccini M. Global Change Biol. 2008; 14: 2178). The soil chamber coupled with the TDL was found to be an effective method for capturing soil CO(2) efflux and its stable isotope composition at high

  2. Photosynthesis, respiration, and carbon turnover in sinking marine snow from surface waters of Southern California Bight: implications for the carbon cycle in the ocean

    Ploug, Helle; Grossart, Hans-Peter; Azam, F.

    1999-01-01

    Photosynthesis and respiration were measured in 1 to 6 mm large aggregates (marine snow) collected in the Southern Californian Eight, USA. The aggregates were freely sinking in a vertical flow system with an upward flow velocity which opposed the sinking velocity of individual aggregates during...... techniques. Both the respiration rate per aggregate volume and the bacterial densities decreased with increasing aggregate size. The respiration rates normalized to the number of bacteria in single aggregates were 7.4 to 70 fmol C cell(-1) d(-1). The aggregate community respired 433 to 984 ng C d(-1) per...... aggregate in darkness, which yielded a turnover time of 8 to 9 d for the total organic carbon in aggregates. Thus, marine snow is not only a vehicle for vertical flux of organic matter; the aggregates are also hotspots of microbial respiration which cause a fast and efficient respiratory turnover...

  3. Mitochondrial Respiration after One Session of Calf Raise Exercise in Patients with Peripheral Vascular Disease and Healthy Older Adults.

    van Schaardenburgh, Michel; Wohlwend, Martin; Rognmo, Øivind; Mattsson, Erney J R

    2016-01-01

    Mitochondria are essential for energy production in the muscle cell and for this they are dependent upon a sufficient supply of oxygen by the circulation. Exercise training has shown to be a potent stimulus for physiological adaptations and mitochondria play a central role. Whether changes in mitochondrial respiration are seen after exercise in patients with a reduced circulation is unknown. The aim of the study was to evaluate the time course and whether one session of calf raise exercise stimulates mitochondrial respiration in the calf muscle of patients with peripheral vascular disease. One group of patients with peripheral vascular disease (n = 11) and one group of healthy older adults (n = 11) were included. Patients performed one session of continuous calf raises followed by 5 extra repetitions after initiation of pain. Healthy older adults performed 100 continuous calf raises. Gastrocnemius muscle biopsies were collected at baseline and 15 minutes, one hour, three hours and 24 hours after one session of calf raise exercise. A multi substrate (octanoylcarnitine, malate, adp, glutamate, succinate, FCCP, rotenone) approach was used to analyze mitochondrial respiration in permeabilized fibers. Mixed-linear model for repeated measures was used for statistical analyses. Patients with peripheral vascular disease have a lower baseline respiration supported by complex I and they increase respiration supported by complex II at one hour post-exercise. Healthy older adults increase respiration supported by electron transfer flavoprotein and complex I at one hour and 24 hours post-exercise. Our results indicate a shift towards mitochondrial respiration supported by complex II as being a pathophysiological component of peripheral vascular disease. Furthermore exercise stimulates mitochondrial respiration already after one session of calf raise exercise in patients with peripheral vascular disease and healthy older adults. ClinicalTrials.gov NCT01842412.

  4. Partitioning of ecosystem respiration in a paludified shallow-peat spruce forest in the southern taiga of European Russia

    Kurbatova, J; Tatarinov, F; Varlagin, A; Avilov, V; Molchanov, A; Kozlov, D; Ivanov, D; Valentini, R

    2013-01-01

    Soil, tree stems, and ecosystem carbon dioxide fluxes were measured by chambers and eddy covariance methods in a paludified shallow-peat spruce forest in the southern taiga of European Russia (Tver region, 56° N 33° E) during the growing seasons of 2002–2012. The site was established in 1998 as part of the EUROSIBERIAN CARBONFLUX project, an international field experiment examining atmosphere–biosphere interaction in Siberia and European Russia. In all years the observed annual cumulative net ecosystem flux was positive (the forest was a source of carbon to the atmosphere). Soil and tree stem respiration was a significant part of the total ecosystem respiration (ER) in this paludified shallow-peat spruce forest. On average, 49% of the ER came from soil respiration. We found that the soil fluxes exhibited high seasonal variability, ranging from 0.7 to 10 μmol m −2  s −1 . Generally, the soil respiration depended on the soil temperature and ground water level. In drought conditions, the soil respiration was low and did not depend on temperature. The stem respiration of spruces grew intensively in May, had permanently high values from June to the end of September, and in October it dramatically decreased. The tree stem respiration in midsummer was about 3–5 μmol m −2  s −1 for dominant trees and about 1–2 μmol m −2  s −1 for subdominant trees. The respiration of living tree stems was about 10–20% of the ER. (letter)

  5. [Analysis of soil respiration and influence factors in wheat farmland under conservation tillage in southwest hilly region].

    Zhang, Sai; Zhang, Xiao-Yu; Wang, Long-Chang; Luo, Hai-Xiu; Zhou, Hang-Fei; Ma, Zhong-Lian; Zhang, Cui-Wei

    2013-07-01

    In order to investigate the effect of conservation tillage on soil respiration in dry cropping farmland in southwest purple hilly region, the LI6400-09 respiratory chamber was adopted in the experiment conducted in the experimental field in Southwest University in Beibei, Chongqing. The respiration and the hydrothermal and biotic factors of soil were measured and analyzed during the growth period of wheat in the triple intercropping system of wheat/maize/soybean. There were four treatments including T (traditional tillage), R (ridge tillage), TS (traditional tillage + straw mulching) and RS (ridge tillage + straw mulching), which were all in triplicates. The results indicated that the soil respiration rate changed in the range of 1.100-2.508 micromol x (m2 x s)(-1) during the reproductive growth stage of wheat. There were significant differences in soil respiration rate among different treatments, which could be ranked as RS > R > TS > T. The soil temperature in the 10cm layer was ranked as T > R > TS > RS. The relationship between soil respiration and soil temperature fitted well with an exponential function, in which the Q10 values were 1.25, 1.20, 1.31 and 1.26, respectively. The soil moisture in the 5cm layer was ranked as TS > RS > T > R. The best fitting model between soil moisture and soil respiration was a parabolic curve, indicating the presence of soil moisture with the strongest soil respiration. The response threshold of wheat to soil moisture was 14.80%-17.47% during the reproductive stage. The dominant groups of soil animals were Collembola and Acarina, which were correlated with soil respiration to some extent. The correlation was high in the treatments T and R, ranged from 0.669-0.921, whereas there was no remarkable correlation in the other treatments.

  6. State of the art in monitoring respirable mine aerosols

    Volkwein, J.C.; Mischler, S.E.; Thimons, E.D.; Timko, R.J.; Kissell, F.N.

    2005-07-01

    The Centers for Disease Control and Prevention (CDC), National Institute for Occupational Safety and Health (NIOSH) has been developing several new tools to help miners monitor respirable coal dust, silica, and diesel particulate matter. This paper discusses three main topics. First, the latest results of the person wearable dust monitor (PDM), developed by Rupprecht and Patashnick under CDC contract. The PDM was tested side by side with conventional samplers at a number of US coal mines and results indicated that the PDM was comparable to conventional samplers. Second, improvements to the Dust Dosimeter monitoring technique that includes a new pump with built in pressure transducer and algorithm to convert differential pressure to dust concentration have shown good precision. Third, advances in the use of the detector tube technique to monitor tailpipe diesel emissions and ambient diesel particulate matter show that strong correlations exist between differential pressure measurement and elemental carbon in the samplers. 3 figs.

  7. Decadal prediction skill in the ocean with surface nudging in the IPSL-CM5A-LR climate model

    Mignot, Juliette; García-Serrano, Javier; Swingedouw, Didier; Germe, Agathe; Nguyen, Sébastien; Ortega, Pablo; Guilyardi, Eric; Ray, Sulagna

    2016-08-01

    Two decadal prediction ensembles, based on the same climate model (IPSL-CM5A-LR) and the same surface nudging initialization strategy are analyzed and compared with a focus on upper-ocean variables in different regions of the globe. One ensemble consists of 3-member hindcasts launched every year since 1961 while the other ensemble benefits from 9 members but with start dates only every 5 years. Analysis includes anomaly correlation coefficients and root mean square errors computed against several reanalysis and gridded observational fields, as well as against the nudged simulation used to produce the hindcasts initial conditions. The last skill measure gives an upper limit of the predictability horizon one can expect in the forecast system, while the comparison with different datasets highlights uncertainty when assessing the actual skill. Results provide a potential prediction skill (verification against the nudged simulation) beyond the linear trend of the order of 10 years ahead at the global scale, but essentially associated with non-linear radiative forcings, in particular from volcanoes. At regional scale, we obtain 1 year in the tropical band, 10 years at midlatitudes in the North Atlantic and North Pacific, and 5 years at tropical latitudes in the North Atlantic, for both sea surface temperature (SST) and upper-ocean heat content. Actual prediction skill (verified against observational or reanalysis data) is overall more limited and less robust. Even so, large actual skill is found in the extratropical North Atlantic for SST and in the tropical to subtropical North Pacific for upper-ocean heat content. Results are analyzed with respect to the specific dynamics of the model and the way it is influenced by the nudging. The interplay between initialization and internal modes of variability is also analyzed for sea surface salinity. The study illustrates the importance of two key ingredients both necessary for the success of future coordinated decadal

  8. Changes in soil respiration after thinning activities in dense Aleppo pine forests

    Llovet, Joan; Alonso, Macià; Cerdà, Artemi

    2015-04-01

    Forest fires are a widespread perturbation in Mediterranean areas, and they have tended to increase during the last decades (Pausas, 2004; Moreno et al, 1998). Aleppo pine (Pinus halepensis Mill) is dominant specie in some forest landscapes of western Mediterranean Basin, due to its capacity to colonize abandoned fields, and also due to afforestation practices mainly performed during the 20th century (Ruiz Navarro et al., 2009). Aleppo pine tends to die as consequence of forest fires, although it is able to disperse a high quantity of seeds which easily germinates. These dispersion and germination can result in dense forests with high inter and intra-specific competition, low diversity, low growth, and high fuel accumulation, increasing the risk of new forest fires. These forests of high density present ecological problems and management difficulties that require preventive treatments. Thinning treatments are common in these types of communities, but the management has to be oriented towards strengthening their functions. In the context of global change, better understandings of the implications of forest management practices in the carbon cycle are necessary. The objective of this study was to examine the evolution of seasonal soil respiration after treatment of selective thinning in dense Aleppo pine forests. The study area covers three localities placed in the Valencian Community (E Spain) affected by a forest fire in 1994. Thinning activities were done 16 years after the fire, reducing pine density from around 100,000 individuals per hectare to around 900 individuals per hectare. Soil respiration was measured in situ with a portable soil respiration instrument (LI-6400, LiCor, Lincoln, NB, USA) fitted with a soil respiration chamber (6400-09, LiCor, Lincoln, NB, USA). We installed 12 plots per treatment (control and thinned) and locality, being a total of 72 plots. We carried out 13 measurements covering a period of one year. We also estimated other related

  9. The role of alternative cyanide-insensitive respiration in plants. Final report

    Raskin, Ilya

    1997-09-29

    This DOE funded research concentrated on the investigation of the role of respiration and oxidative stress in plant biology. Initially the authors concentrated on the possible role of cyanide-insensitive respiration in counteracting the deleterious effects of chilling stress. Although plants are considered to be poikilotherms, there are a few examples of thermogenesis, in which the tissue temperature increases well above ambient. They suggested that differences between thermogenic and non-thermogenic plants may be quantitative rather than qualitative, and that heat from increased respiration may have a local protective effect on the mitochondria, slowing or reducing the effects of chilling. They proposed that this is accomplished by a large increase in respiration, predominantly via the alternative pathway. They measured the increases in respiration, particularly via the alternative pathway, in response to chilling. They have also quantified the associated increases in heat evolution in response to chilling in a number of plant species using a microcalorimeter. For example, after 8 h exposure to 8 C, heat evolution in chilling-sensitive species increased 47--98%, compared to 7--22% for the chilling-resistant species. No increase in heat evolution was observed in the extremely chilling-sensitive ornamental Episcka cupreata (Hook). Increases in heat evolution were observed when plants were chilled in constant light or in the dark, but not when plants were chilled at high humidity. Heat evolution by mitochondria isolated from potato tuber slices were also measured. These values, together with measurements of the heat capacity of isolated mitochondria and counting of the mitochondria by flow cytometry, allow calculation of theoretical maximal rates of heating and the heat produced per mitochondrion. The obtained data was consistent with the protective role of respiratory heat production in cold-stressed plants.

  10. Response of Respiration of Soybean Leaves Grown at Ambient and Elevated Carbon Dioxide Concentrations to Day-to-day Variation in Light and Temperature under Field Conditions

    BUNCE, JAMES A.

    2005-01-01

    • Background and Aims Respiration is an important component of plant carbon balance, but it remains uncertain how respiration will respond to increases in atmospheric carbon dioxide concentration, and there are few measurements of respiration for crop plants grown at elevated [CO2] under field conditions. The hypothesis that respiration of leaves of soybeans grown at elevated [CO2] is increased is tested; and the effects of photosynthesis and acclimation to temperature examined. • Methods Net rates of carbon dioxide exchange were recorded every 10 min, 24 h per day for mature upper canopy leaves of soybeans grown in field plots at the current ambient [CO2] and at ambient plus 350 µmol mol−1 [CO2] in open top chambers. Measurements were made on pairs of leaves from both [CO2] treatments on a total of 16 d during the middle of the growing seasons of two years. • Key Results Elevated [CO2] increased daytime net carbon dioxide fixation rates per unit of leaf area by an average of 48 %, but had no effect on night-time respiration expressed per unit of area, which averaged 53 mmol m−2 d−1 (1·4 µmol m−2 s−1) for both the ambient and elevated [CO2] treatments. Leaf dry mass per unit of area was increased on average by 23 % by elevated [CO2], and respiration per unit of mass was significantly lower at elevated [CO2]. Respiration increased by a factor of 2·5 between 18 and 26 °C average night temperature, for both [CO2] treatments. • Conclusions These results do not support predictions that elevated [CO2] would increase respiration per unit of area by increasing photosynthesis or by increasing leaf mass per unit of area, nor the idea that acclimation of respiration to temperature would be rapid enough to make dark respiration insensitive to variation in temperature between nights. PMID:15781437

  11. Photocatalytic degradation and mineralization of microcystin-LR under UV-A, solar and visible light using nanostructured nitrogen doped TiO2

    Triantis, T.M.; Fotiou, T.; Kaloudis, T.; Kontos, A.G.; Falaras, P.; Dionysiou, D.D.; Pelaez, M.; Hiskia, A.

    2012-01-01

    Highlights: ► N-TiO 2 exhibited effective degradation of MC-LR under UV-A, solar and visible light. ► Complete photocatalytic mineralization of MC-LR was achieved under UV-A and solar light. ► The organic nitrogen is mainly released as ammonium and nitrate ions. - Abstract: In an attempt to face serious environmental hazards, the degradation of microcystin-LR (MC-LR), one of the most common and more toxic water soluble cyanotoxin compounds released by cyanobacteria blooms, was investigated using nitrogen doped TiO 2 (N-TiO 2 ) photocatalyst, under UV-A, solar and visible light. Commercial Degussa P25 TiO 2 , Kronos and reference TiO 2 nanopowders were used for comparison. It was found that under UV-A irradiation, all photocatalysts were effective in toxin elimination. The higher MC-LR degradation (99%) was observed with Degussa P25 TiO 2 followed by N-TiO 2 with 96% toxin destruction after 20 min of illumination. Under solar light illumination, N-TiO 2 nanocatalyst exhibits similar photocatalytic activity with that of commercially available materials such as Degussa P25 and Kronos TiO 2 for the destruction of MC-LR. Upon irradiation with visible light Degussa P25 practically did not show any response, while the N-TiO 2 displayed remarkable photocatalytic efficiency. In addition, it has been shown that photodegradation products did not present any significant protein phosphatase inhibition activity, proving that toxicity is proportional only to the remaining MC-LR in solution. Finally, total organic carbon (TOC) and inorganic ions (NO 2 − , NO 3 − and NH 4 + ) determinations confirmed that complete photocatalytic mineralization of MC-LR was achieved under both UV-A and solar light.

  12. Ultrasound-based logistic regression model LR2 versus magnetic resonance imaging for discriminating between benign and malignant adnexal masses: a prospective study.

    Shimada, Kanane; Matsumoto, Koji; Mimura, Takashi; Ishikawa, Tetsuya; Munechika, Jiro; Ohgiya, Yoshimitsu; Kushima, Miki; Hirose, Yusuke; Asami, Yuka; Iitsuka, Chiaki; Miyamoto, Shingo; Onuki, Mamiko; Tsunoda, Hajime; Matsuoka, Ryu; Ichizuka, Kiyotake; Sekizawa, Akihiko

    2018-06-01

    The diagnostic performances of the International Ovarian Tumor Analysis (IOTA) ultrasound-based logistic regression model (LR2) and magnetic resonance imaging (MRI) in discriminating between benign and malignant adnexal masses have not been directly compared in a single study. Using the IOTA LR2 model and subjective interpretation of MRI findings by experienced radiologists, 265 consecutive patients with adnexal masses were preoperatively evaluated in two hospitals between February 2014 and December 2015. Definitive histological diagnosis of excised tissues was used as a gold standard. From the 265 study subjects, 54 (20.4%) tumors were histologically diagnosed as malignant (including 11 borderline and 3 metastatic tumors). Preoperative diagnoses of malignant tumors showed 91.7% total agreement between IOTA LR2 and MRI, with a kappa value of 0.77 [95% confidence interval (CI), 0.68-0.86]. Sensitivity of IOTA LR2 (0.94, 95% CI, 0.85-0.98) for predicting malignant tumors was similar to that of MRI (0.96, 95% CI, 0.87-0.99; P = 0.99), whereas specificity of IOTA LR2 (0.98, 95% CI, 0.95-0.99) was significantly higher than that of MRI (0.91, 95% CI, 0.87-0.95; P = 0.002). Combined IOTA LR2 and MRI results gave the greatest sensitivity (1.00, 95% CI, 0.93-1.00) and had similar specificity (0.91, 95% CI, 0.86-0.94) to MRI. The IOTA LR2 model had a similar sensitivity to MRI for discriminating between benign and malignant tumors and a higher specificity compared with MRI. Our findings suggest that the IOTA LR2 model, either alone or in conjunction with MRI, should be included in preoperative evaluation of adnexal masses.

  13. Roles of piRNAs in microcystin-leucine-arginine (MC-LR) induced reproductive toxicity in testis on male offspring.

    Zhang, Ling; Zhang, Hui; Zhang, Huan; Benson, Mikael; Han, Xiaodong; Li, Dongmei

    2017-07-01

    In the present study, we evaluated the toxic effects on the testis of the male offspring of MC-LR exposure during fetal and lactational periods. Pregnant females were distributed into two experimental groups: control group and MC-LR group which were exposed to 0 and 10 μg/L of MC-LR, respectively, through drinking water separately during fetal and lactational periods. At the age of 30 days after birth, the male offspring were euthanized. The body weight, testis index, and histomorphology change were observed and the global changes of piwi-interacting RNA (piRNA) expression were evaluated. The results revealed that MC-LR was found in the testis of male offspring, body weight and testis index decreased significantly, and testicular tissue structure was damaged in the MC-LR group. In addition, the exposure to MC-LR resulted in an altered piRNA expression profile and an increase of the cell apoptosis and a decrease of the cell proliferation in the testis of the male offspring. It was reasonable to speculate that the toxic effects on reproductive system of the male offspring in MC-LR group might be mediated by piRNAs through the regulation of the target genes. As far as we are aware, this is the first report showing that MC-LR could play a role in disorder of proliferative and cell apoptosis in the testis of the male offspring by the maternal transmission effect of toxicity. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. IMAGING OF BRAIN FUNCTION BASED ON THE ANALYSIS OF FUNCTIONAL CONNECTIVITY - IMAGING ANALYSIS OF BRAIN FUNCTION BY FMRI AFTER ACUPUNCTURE AT LR3 IN HEALTHY INDIVIDUALS

    Zheng, Yu; Wang, Yuying; Lan, Yujun; Qu, Xiaodong; Lin, Kelin; Zhang, Jiping; Qu, Shanshan; Wang, Yanjie; Tang, Chunzhi; Huang, Yong

    2016-01-01

    Objective: This Study observed the relevant brain areas activated by acupuncture at the Taichong acupoint (LR3) and analyzed the functional connectivity among brain areas using resting state functional magnetic resonance imaging (fMRI) to explore the acupoint specificity of the Taichong acupoint. Methods: A total of 45 healthy subjects were randomly divided into the Taichong (LR3) group, sham acupuncture group and sham acupoint group. Subjects received resting state fMRI before acupuncture, a...

  15. Modeling temporal and large-scale spatial variability of soil respiration from soil water availability, temperature and vegetation productivity indices

    Reichstein, Markus; Rey, Ana; Freibauer, Annette; Tenhunen, John; Valentini, Riccardo; Banza, Joao; Casals, Pere; Cheng, Yufu; Grünzweig, Jose M.; Irvine, James; Joffre, Richard; Law, Beverly E.; Loustau, Denis; Miglietta, Franco; Oechel, Walter; Ourcival, Jean-Marc; Pereira, Joao S.; Peressotti, Alessandro; Ponti, Francesca; Qi, Ye; Rambal, Serge; Rayment, Mark; Romanya, Joan; Rossi, Federica; Tedeschi, Vanessa; Tirone, Giampiero; Xu, Ming; Yakir, Dan

    2003-12-01

    Field-chamber measurements of soil respiration from 17 different forest and shrubland sites in Europe and North America were summarized and analyzed with the goal to develop a model describing seasonal, interannual and spatial variability of soil respiration as affected by water availability, temperature, and site properties. The analysis was performed at a daily and at a monthly time step. With the daily time step, the relative soil water content in the upper soil layer expressed as a fraction of field capacity was a good predictor of soil respiration at all sites. Among the site variables tested, those related to site productivity (e.g., leaf area index) correlated significantly with soil respiration, while carbon pool variables like standing biomass or the litter and soil carbon stocks did not show a clear relationship with soil respiration. Furthermore, it was evidenced that the effect of precipitation on soil respiration stretched beyond its direct effect via soil moisture. A general statistical nonlinear regression model was developed to describe soil respiration as dependent on soil temperature, soil water content, and site-specific maximum leaf area index. The model explained nearly two thirds of the temporal and intersite variability of soil respiration with a mean absolute error of 0.82 μmol m-2 s-1. The parameterized model exhibits the following principal properties: (1) At a relative amount of upper-layer soil water of 16% of field capacity, half-maximal soil respiration rates are reached. (2) The apparent temperature sensitivity of soil respiration measured as Q10 varies between 1 and 5 depending on soil temperature and water content. (3) Soil respiration under reference moisture and temperature conditions is linearly related to maximum site leaf area index. At a monthly timescale, we employed the approach by [2002] that used monthly precipitation and air temperature to globally predict soil respiration (T&P model). While this model was able to

  16. Modelling temporal and large-scale spatial variability of soil respiration from soil water availability, temperature and vegetation productivity indices

    Reichstein, M.; Rey, A.; Freibauer, A.; Tenhunen, J.; Valentini, R.; Soil Respiration Synthesis Team

    2003-04-01

    Field-chamber measurements of soil respiration from 17 different forest and shrubland sites in Europe and North America were summarized and analyzed with the goal to develop a model describing seasonal, inter-annual and spatial variability of soil respiration as affected by water availability, temperature and site properties. The analysis was performed at a daily and at a monthly time step. With the daily time step, the relative soil water content in the upper soil layer expressed as a fraction of field capacity was a good predictor of soil respiration at all sites. Among the site variables tested, those related to site productivity (e.g. leaf area index) correlated significantly with soil respiration, while carbon pool variables like standing biomass or the litter and soil carbon stocks did not show a clear relationship with soil respiration. Furthermore, it was evidenced that the effect of precipitation on soil respiration stretched beyond its direct effect via soil moisture. A general statistical non-linear regression model was developed to describe soil respiration as dependent on soil temperature, soil water content and site-specific maximum leaf area index. The model explained nearly two thirds of the temporal and inter-site variability of soil respiration with a mean absolute error of 0.82 µmol m-2 s-1. The parameterised model exhibits the following principal properties: 1) At a relative amount of upper-layer soil water of 16% of field capacity half-maximal soil respiration rates are reached. 2) The apparent temperature sensitivity of soil respiration measured as Q10 varies between 1 and 5 depending on soil temperature and water content. 3) Soil respiration under reference moisture and temperature conditions is linearly related to maximum site leaf area index. At a monthly time-scale we employed the approach by Raich et al. (2002, Global Change Biol. 8, 800-812) that used monthly precipitation and air temperature to globally predict soil respiration (T

  17. Simulation of Human Respiration with Breathing Thermal Manikin

    Bjørn, Erik

    The human respiration contains carbon dioxide, bioeffluents, and perhaps virus or bacteria. People may also indulge in activities that produce contaminants, as for example tobacco smoking. For these reasons, the human respiration remains one of the main contributors to contamination of the indoor...

  18. Differential soil respiration responses to changing hydrologic regimes

    Vincent J. Pacific; Brian L. McGlynn; Diego A. Riveros-Iregui; Howard E. Epstein; Daniel L. Welsch

    2009-01-01

    Soil respiration is tightly coupled to the hydrologic cycle (i.e., snowmelt and precipitation timing and magnitude). We examined riparian and hillslope soil respiration across a wet (2005) and a dry (2006) growing season in a subalpine catchment. When comparing the riparian zones, cumulative CO2 efflux was 33% higher, and peak efflux occurred 17 days earlier during the...

  19. Automatic patient respiration failure detection system with wireless transmission

    Dimeff, J.; Pope, J. M.

    1968-01-01

    Automatic respiration failure detection system detects respiration failure in patients with a surgically implanted tracheostomy tube, and actuates an audible and/or visual alarm. The system incorporates a miniature radio transmitter so that the patient is unencumbered by wires yet can be monitored from a remote location.

  20. Soil respiration response to experimental disturbances over 3 years

    Amy Concilio; Siyan Ma; Soung-Ryoul Ryu; Malcolm North; Jiquan Chen

    2006-01-01

    Soil respiration is a major pathway for carbon cycling in terrestrial ecosystems yet little is known about its response to natural and anthropogenic disturbances. This study examined soil respiration response to prescribed burning and thinning treatments in an old-growth, mixed-conifer forest on the western slope of the Sierra Nevada Mountains. Experimental treatments...