Long-term measurements of respirable sulfates and particulates inside and outside homes

Energy Technology Data Exchange (ETDEWEB)

Spengler, J D; Dockery, D W; Turner, W A; Wolfson, J M; Ferris, B G

1981-01-01

To better understand the health effects of air pollution, the results of extensive indoor and outdoor measurements of mass respirable particulates and water-soluble respirable particulates are analyzed. The measurements were taken in six U.S. citiesPortage, Wis./ Topeka, Kans./ Kingston/Harriman, Tenn./ Watertown, Mass./ St. Louis, Mo./ and Steubenville, Ohio. Results indicated that the major source of indoor air pollution is cigarette smoke, which contributes about 20

Determination of microcystin-LR in drinking water using UPLC tandem mass spectrometry-matrix effects and measurement.

Science.gov (United States)

Li, Wei; Duan, Jinming; Niu, Chaoying; Qiang, Naichen; Mulcahy, Dennis

2011-10-01

A simple detection method using ultra-performance liquid chromatography electrospray ionisation tandem mass spectrometry (UPLC-ESI-MS-MS) coupled with the sample dilution method for determining trace microcystin-LR (MC-LR) in drinking water is presented. The limit of detection (LOD) was 0.04 µg/L and the limit of quantitation (LOQ) was 0.1 µg/L. Water matrix effects of ionic strength, dissolved organic carbon (DOC) and pH were examined. The results indicate that signal detection intensity for MC-LR was significantly suppressed as the ionic strength increased from ultrapure water condition, whereas it increased slightly with solution pH and DOC at low concentrations. However, addition of methanol (MeOH) into the sample was able to counter the signal suppression effects. In this study, dilution of the tap water sample by adding 4% MeOH (v/v) was observed to be adequate to compensate for the signal suppression. The recoveries of the samples fortified with MC-LR (0.2, 1, and 10 µg/L) for three different tap water samples ranged from 84.4% to 112.9%.

Antilisterial activity of a broad-spectrum bacteriocin, enterocin LR/6 from Enterococcus faecium LR/6.

Science.gov (United States)

Kumar, Manoj; Srivastava, Sheela

2010-10-01

Enterocin LR/6, a purified bacteriocin, exhibited broad inhibitory spectrum both against related as well as some food-borne pathogens such as Listeria monocytogenes, Yersinia enterocolitica, Aeromonas sp., Shigella sp., and Bacillus licheniformis. In this investigation, we have focused on L. monocytogenes as the target organism, as it is not only an important pathogen but can also survive over a wide range of environmental conditions such as refrigeration temperature, low pH, and high-salt concentration. This allows the pathogen to overcome many food preservation and safety barriers and poses a potential risk to human health. The enterocin LR/6 showed a bactericidal action against L. monocytogenes and completely inhibited the growth on agar plates, supplemented with 200 AU/ml of enterocin LR/6. The effectiveness of enterocin LR/6 in completely killing a population of acid-adapted (pH 5.2, 2 h) L. monocytogenes exposed to different temperatures (4-37 degrees C), pH (2.5-8.0), and osmotic (up to 30% NaCl) stress is reported here. This paper focuses on the key issue of killing of the acid-adapted L. monocytogenes cells under adverse environmental conditions.

LR: Compact connectivity representation for triangle meshes

Energy Technology Data Exchange (ETDEWEB)

Gurung, T; Luffel, M; Lindstrom, P; Rossignac, J

2011-01-28

We propose LR (Laced Ring) - a simple data structure for representing the connectivity of manifold triangle meshes. LR provides the option to store on average either 1.08 references per triangle or 26.2 bits per triangle. Its construction, from an input mesh that supports constant-time adjacency queries, has linear space and time complexity, and involves ordering most vertices along a nearly-Hamiltonian cycle. LR is best suited for applications that process meshes with fixed connectivity, as any changes to the connectivity require the data structure to be rebuilt. We provide an implementation of the set of standard random-access, constant-time operators for traversing a mesh, and show that LR often saves both space and traversal time over competing representations.

Short communication: Emergence of a new race of leaf rust with combined virulence to Lr14a and Lr72 genes on durum wheat

Energy Technology Data Exchange (ETDEWEB)

Soleiman, N.H; Solis, I.; Soliman, M.H.; Sillero, J.C.; Villegas, D.; Alvaro, F.; Royo, C.; Serra, J.; Ammar, K.; Martínez-Moreno, F.

2016-11-01

Leaf rust is a foliar disease caused by the fungus Puccinia triticina that may severely reduce durum wheat yield. Resistance to this pathogen is common in modern durum germplasm but is frequently based on Lr72 and Lr14a. After accounts of races with virulence to Lr14a gene in France in 2000, the present study reports the detection in 2013 for the first time of a new race with virulence to Lr14a and Lr72. The aim of this work was to characterize the virulence pattern of four Spanish isolates with virulence to Lr14a, and to discuss the consequences of this presence. Rusted leaves from cultivars ‘Don Jaime’ (Lr14a) and ‘Gallareta’ (Lr72) were collected in 2013 in the field at two Spanish sites, one in the south (near Cadiz) and another in the north (near Girona). Spores from single pustule for each cultivar and site were multiplied on susceptible cultivar ‘Don Rafael’. Then, the four isolates were inoculated on a set of 19 isogenic lines Thatcher to characterize their virulence spectrum. All isolates presented the same virulence pattern. They were virulent on both Lr14a and Lr72 and the race was named DBB/BS. This race was very similar to those reported in 2009-11, but with added virulence to Lr14a. The resistance based on Lr14a has therefore been overcome in Spain, by a new race that has likely emerged via stepwise mutation from the local predominating races. This information is important to guide breeders in their breeding programmes and gene deployment strategies. (Author)

Respiration rate of stream insects measured in situ along a large altitude range

DEFF Research Database (Denmark)

Rostgaard, S.; Jacobsen, D.

2005-01-01

Field studies of respiration in stream insects are few in comparison with laboratory studies. To evaluate the influence of temperature and oxygen along altitudinal gradients we measured the respiration rate of fully acclimatized larval Trichoptera, Plecoptera and Ephemeroptera under similar field...... at 100 and 50% oxygen saturation indicated that highland animals reduced their oxygen uptake more than their counterparts in the lowland when oxygen availability decreased. The temperature response of respiration calculated between the insect assemblages at different altitudes showed a mean assemblage Q...

LRSYS, PASCAL LR(1) Parser Generator System

International Nuclear Information System (INIS)

O'Hair, K.

1991-01-01

Description of program or function: LRSYS is a complete LR(1) parser generator system written entirely in a portable subset of Pascal. The system, LRSYS, includes a grammar analyzer program (LR) which reads a context-free (BNF) grammar as input and produces LR(1) parsing tables as output, a lexical analyzer generator (LEX) which reads regular expressions created by the REG process as input and produces lexical tables as output, and various parser skeletons that get merged with the tables to produce complete parsers (SMAKE). Current parser skeletons include Pascal, FORTRAN 77, and C. In addition, the CRAY1, DEC VAX11 version contains LRLTRAN and CFT- FORTRAN 77 skeletons. Other language skeletons can easily be added to the system. LRSYS is based on the LR program (NESC Abstract 822)

Contribution of Root Respiration to Soil Respiration in Sugarcane Plantation in Thailand

OpenAIRE

Wilaiwan Sornpoon; Sebastien Bonnet; Poonpipope Kasemsap; Savitri Garivait

2013-01-01

The understanding on the contribution of root respiration to total soil respiration is still very limited, especially for sugarcane. In this study, trenching experiments in sugarcane plantations were conducted to separate and investigate soil respiration for this crop. The measurements were performed for the whole growing period of 344 days to quantify root respiration. The obtained monitoring data showed that the respiration rate is increasing with the age of the plant, accounting for up to ...

Temperature dependence of bulk respiration of crop stands. Measurement and model fitting

International Nuclear Information System (INIS)

Tani, Takashi; Arai, Ryuji; Tako, Yasuhiro

2007-01-01

The objective of the present study was to examine whether the temperature dependence of respiration at a crop-stand scale could be directly represented by an Arrhenius function that was widely used for representing the temperature dependence of leaf respiration. We determined temperature dependences of bulk respiration of monospecific stands of rice and soybean within a range of the air temperature from 15 to 30degC using large closed chambers. Measured responses of respiration rates of the two stands were well fitted by the Arrhenius function (R 2 =0.99). In the existing model to assess the local radiological impact of the anthropogenic carbon-14, effects of the physical environmental factors on photosynthesis and respiration of crop stands are not taken into account for the calculation of the net amount of carbon per cultivation area in crops at harvest which is the crucial parameter for the estimation of the activity concentration of carbon-14 in crops. Our result indicates that the Arrhenius function is useful for incorporating the effect of the temperature on respiration of crop stands into the model which is expected to contribute to a more realistic estimate of the activity concentration of carbon-14 in crops. (author)

A combined electrochemical and optical trapping platform for measuring single cell respiration rates at electrode interfaces

Energy Technology Data Exchange (ETDEWEB)

Gross, Benjamin J. [Department of Physics and Astronomy, University of Southern California, 920 Bloom Walk, Los Angeles, California 90089-0484 (United States); El-Naggar, Mohamed Y., E-mail: mnaggar@usc.edu [Department of Physics and Astronomy, University of Southern California, 920 Bloom Walk, Los Angeles, California 90089-0484 (United States); Molecular and Computational Biology Section, Department of Biological Sciences, University of Southern California, Los Angeles, California 90089-0484 (United States); Department of Chemistry, University of Southern California, Los Angeles, California 90089-0484 (United States)

2015-06-15

Metal-reducing bacteria gain energy by extracellular electron transfer to external solids, such as naturally abundant minerals, which substitute for oxygen or the other common soluble electron acceptors of respiration. This process is one of the earliest forms of respiration on earth and has significant environmental and technological implications. By performing electron transfer to electrodes instead of minerals, these microbes can be used as biocatalysts for conversion of diverse chemical fuels to electricity. Understanding such a complex biotic-abiotic interaction necessitates the development of tools capable of probing extracellular electron transfer down to the level of single cells. Here, we describe an experimental platform for single cell respiration measurements. The design integrates an infrared optical trap, perfusion chamber, and lithographically fabricated electrochemical chips containing potentiostatically controlled transparent indium tin oxide microelectrodes. Individual bacteria are manipulated using the optical trap and placed on the microelectrodes, which are biased at a suitable oxidizing potential in the absence of any chemical electron acceptor. The potentiostat is used to detect the respiration current correlated with cell-electrode contact. We demonstrate the system with single cell measurements of the dissimilatory-metal reducing bacterium Shewanella oneidensis MR-1, which resulted in respiration currents ranging from 15 fA to 100 fA per cell under our measurement conditions. Mutants lacking the outer-membrane cytochromes necessary for extracellular respiration did not result in any measurable current output upon contact. In addition to the application for extracellular electron transfer studies, the ability to electronically measure cell-specific respiration rates may provide answers for a variety of fundamental microbial physiology questions.

A combined electrochemical and optical trapping platform for measuring single cell respiration rates at electrode interfaces.

Science.gov (United States)

Gross, Benjamin J; El-Naggar, Mohamed Y

2015-06-01

Metal-reducing bacteria gain energy by extracellular electron transfer to external solids, such as naturally abundant minerals, which substitute for oxygen or the other common soluble electron acceptors of respiration. This process is one of the earliest forms of respiration on earth and has significant environmental and technological implications. By performing electron transfer to electrodes instead of minerals, these microbes can be used as biocatalysts for conversion of diverse chemical fuels to electricity. Understanding such a complex biotic-abiotic interaction necessitates the development of tools capable of probing extracellular electron transfer down to the level of single cells. Here, we describe an experimental platform for single cell respiration measurements. The design integrates an infrared optical trap, perfusion chamber, and lithographically fabricated electrochemical chips containing potentiostatically controlled transparent indium tin oxide microelectrodes. Individual bacteria are manipulated using the optical trap and placed on the microelectrodes, which are biased at a suitable oxidizing potential in the absence of any chemical electron acceptor. The potentiostat is used to detect the respiration current correlated with cell-electrode contact. We demonstrate the system with single cell measurements of the dissimilatory-metal reducing bacterium Shewanella oneidensis MR-1, which resulted in respiration currents ranging from 15 fA to 100 fA per cell under our measurement conditions. Mutants lacking the outer-membrane cytochromes necessary for extracellular respiration did not result in any measurable current output upon contact. In addition to the application for extracellular electron transfer studies, the ability to electronically measure cell-specific respiration rates may provide answers for a variety of fundamental microbial physiology questions.

A combined electrochemical and optical trapping platform for measuring single cell respiration rates at electrode interfaces

International Nuclear Information System (INIS)

Gross, Benjamin J.; El-Naggar, Mohamed Y.

2015-01-01

Metal-reducing bacteria gain energy by extracellular electron transfer to external solids, such as naturally abundant minerals, which substitute for oxygen or the other common soluble electron acceptors of respiration. This process is one of the earliest forms of respiration on earth and has significant environmental and technological implications. By performing electron transfer to electrodes instead of minerals, these microbes can be used as biocatalysts for conversion of diverse chemical fuels to electricity. Understanding such a complex biotic-abiotic interaction necessitates the development of tools capable of probing extracellular electron transfer down to the level of single cells. Here, we describe an experimental platform for single cell respiration measurements. The design integrates an infrared optical trap, perfusion chamber, and lithographically fabricated electrochemical chips containing potentiostatically controlled transparent indium tin oxide microelectrodes. Individual bacteria are manipulated using the optical trap and placed on the microelectrodes, which are biased at a suitable oxidizing potential in the absence of any chemical electron acceptor. The potentiostat is used to detect the respiration current correlated with cell-electrode contact. We demonstrate the system with single cell measurements of the dissimilatory-metal reducing bacterium Shewanella oneidensis MR-1, which resulted in respiration currents ranging from 15 fA to 100 fA per cell under our measurement conditions. Mutants lacking the outer-membrane cytochromes necessary for extracellular respiration did not result in any measurable current output upon contact. In addition to the application for extracellular electron transfer studies, the ability to electronically measure cell-specific respiration rates may provide answers for a variety of fundamental microbial physiology questions

A prospective validation of the IOTA logistic regression models (LR1 and LR2) in comparison to subjective pattern recognition for the diagnosis of ovarian cancer.

Science.gov (United States)

Nunes, Natalie; Ambler, Gareth; Hoo, Wee-Liak; Naftalin, Joel; Foo, Xulin; Widschwendter, Martin; Jurkovic, Davor

2013-11-01

This study aimed to assess the accuracy of the International Ovarian Tumour Analysis (IOTA) logistic regression models (LR1 and LR2) and that of subjective pattern recognition (PR) for the diagnosis of ovarian cancer. This was a prospective single-center study in a general gynecology unit of a tertiary hospital during 33 months. There were 292 consecutive women who underwent surgery after an ultrasound diagnosis of an adnexal tumor. All examinations were by a single level 2 ultrasound operator, according to the IOTA guidelines. The malignancy likelihood was calculated using the IOTA LR1 and LR2. The women were then examined separately by an expert operator using subjective PR. These were compared to operative findings and histology. The sensitivity, specificity, area under the curve (AUC), and accuracy of the 3 methods were calculated and compared. The AUCs for LR1 and LR2 were 0.94 [95% confidence interval (CI), 0.92-0.97] and 0.93 (95% CI, 0.90-0.96), respectively. Subjective PR gave a positive likelihood ratio (LR+ve) of 13.9 (95% CI, 7.84-24.6) and a LR-ve of 0.049 (95% CI, 0.022-0.107). The corresponding LR+ve and LR-ve for LR1 were 3.33 (95% CI, 2.85-3.55) and 0.03 (95% CI, 0.01-0.10), and for LR2 were 3.58 (95% CI, 2.77-4.63) and 0.052 (95% CI, 0.022-0.123). The accuracy of PR was 0.942 (95% CI, 0.908-0.966), which was significantly higher when compared with 0.829 (95% CI, 0.781-0.870) for LR1 and 0.836 (95% CI, 0.788-0.872) for LR2 (P IOTA LR1 and LR2 were similar in nonexpert's hands when compared to the original and validation IOTA studies. The PR method was the more accurate test to diagnose ovarian cancer than either of the IOTA models.

Effects of microcystin-LR, cylindrospermopsin and a microcystin-LR/cylindrospermopsin mixture on growth, oxidative stress and mineral content in lettuce plants (Lactuca sativa L.).

Science.gov (United States)

Freitas, Marisa; Azevedo, Joana; Pinto, Edgar; Neves, Joana; Campos, Alexandre; Vasconcelos, Vitor

2015-06-01

Toxic cyanobacterial blooms are documented worldwide as an emerging environmental concern. Recent studies support the hypothesis that microcystin-LR (MC-LR) and cylindrospermopsin (CYN) produce toxic effects in crop plants. Lettuce (Lactuca sativa L.) is an important commercial leafy vegetable that supplies essential elements for human nutrition; thus, the study of its sensitivity to MC-LR, CYN and a MC-LR/CYN mixture is of major relevance. This study aimed to assess the effects of environmentally relevant concentrations (1, 10 and 100 µg/L) of MC-LR, CYN and a MC-LR/CYN mixture on growth, antioxidant defense system and mineral content in lettuce plants. In almost all treatments, an increase in root fresh weight was obtained; however, the fresh weight of leaves was significantly decreased in plants exposed to 100 µg/L concentrations of each toxin and the toxin mixture. Overall, GST activity was significantly increased in roots, contrary to GPx activity, which decreased in roots and leaves. The mineral content in lettuce leaves changed due to its exposure to cyanotoxins; in general, the mineral content decreased with MC-LR and increased with CYN, and apparently these effects are time and concentration-dependent. The effects of the MC-LR/CYN mixture were almost always similar to the single cyanotoxins, although MC-LR seems to be more toxic than CYN. Our results suggest that lettuce plants in non-early stages of development are able to cope with lower concentrations of MC-LR, CYN and the MC-LR/CYN mixture; however, higher concentrations (100 µg/L) can affect both lettuce yield and nutritional quality. Copyright © 2015 Elsevier Inc. All rights reserved.

Parameters of calibration of the measurement system of 222 Rn based in LR-115

International Nuclear Information System (INIS)

Garcia, M.L.; Mireles, F.; Quirino, L.; Davila, I.; Lugo, F.; Pinedo, J.L.; Chavez, A.

2003-01-01

Since the SSNTD technique (Solid State Nuclear Track Detection) it was discovered it has been used as passive method for the detection of subnuclear particles in great variety of fields of the science. The use of the technique in measurements of 222 Rn in air have already been established implying better methodologies in the exhibition to the environment until their engraving and reading processes. The SSNTD technique is since a method by comparison since the material it can be used a single time, therefore it requires of calibration in one controlled radon atmosphere, using gauged standards. The objective of this work is to show the calibration of the devices used as radon monitors based on SSNTD. The material used as SSNTD is LR-115 Il. The standardization of the parameters used in the exhibition to radon in air, engraving and reading process, its are based on the response of the LR-115 Il, the one arrangement of the device, engraving speed and mainly the calibration factor. They are considered two types of monitors: Open camera and Closed camera, the difference among the calibration factors of both cameras is the percentage of the descendants of radon in the open camera. The standardized parameters are operation voltage of the counting system; temperature, time and concentration of the engraving solution; and thickness. (Author)

Microcystin-LR in surface water of Ponjavica river

Directory of Open Access Journals (Sweden)

Natić Dejan

2012-01-01

Full Text Available Background/Aim. Cyanobacterial toxins befall a group of various compounds according to chemical structure and health effects on people and animals. The most significant in this large group of compounds are microcystins. Their presence in water used for human consumption causes serious health problems, liver beeing the target organ. Microcystins are spread all over the world. Waterblooms of cyanobacterias and their cyanotoxins are also common in the majority of surface waters in Serbia. The aim of this study was to propose HPLC method for determination of mikrocystin-LR, to validate the method and to use it for determination of microcystin-LR in the surface water of the river Ponjavica. The Ponjavica is very eutrophic water and has ideal conditions for the cyanobacterial growth. Methods. Sample of water form the Ponjavica river were collected during the summer 2008. Coupled columns (HLB, Sep-Pak, were used for sample preparation and HPLC/PDA method was used for quantification of microcystin- LR. Results. Parameters of validation show that the proposed method is simple, fast, sensitive (0.1 mg/L and selective with the yield of 89%-92%. The measuring uncertainty of

Microchambers with Solid-State Phosphorescent Sensor for Measuring Single Mitochondrial Respiration.

Science.gov (United States)

Pham, Ted D; Wallace, Douglas C; Burke, Peter J

2016-07-09

It is now well established that, even within a single cell, multiple copies of the mitochondrial genome may be present (genetic heteroplasmy). It would be interesting to develop techniques to determine if and to what extent this genetic variation results in functional variation from one mitochondrion to the next (functional heteroplasmy). Measuring mitochondrial respiration can reveal the organelles' functional capacity for Adenosine triphosphate (ATP) production and determine mitochondrial damage that may arise from genetic or age related defects. However, available technologies require significant quantities of mitochondria. Here, we develop a technology to assay the respiration of a single mitochondrion. Our "micro-respirometer" consists of micron sized chambers etched out of borofloat glass substrates and coated with an oxygen sensitive phosphorescent dye Pt(II) meso-tetra(pentafluorophenyl)porphine (PtTFPP) mixed with polystyrene. The chambers are sealed with a polydimethylsiloxane layer coated with oxygen impermeable Viton rubber to prevent diffusion of oxygen from the environment. As the mitochondria consume oxygen in the chamber, the phosphorescence signal increases, allowing direct determination of the respiration rate. Experiments with coupled vs. uncoupled mitochondria showed a substantial difference in respiration, confirming the validity of the microchambers as single mitochondrial respirometers. This demonstration could enable future high-throughput assays of mitochondrial respiration and benefit the study of mitochondrial functional heterogeneity, and its role in health and disease.

Respiration and Heartbeat Measurement for Sleep Monitoring Using a Flexible AlN Piezoelectric Film Sensor

Directory of Open Access Journals (Sweden)

Nan BU

2009-11-01

Full Text Available Respiratory and heartbeat monitoring during sleep provides basic physiological information for diagnosis of sleep disorders. This paper proposes a new method for non-invasive and unconstrained measurement of respiration and heartbeat during sleep. A flexible piezoelectric film sensor made of aluminum nitride (AlN material is used for signal acquisition. The total thickness of this sensor is less than 40 μm; the thin thickness makes it imperceptible when integrated into a bed. In addition, the AlN film sensor has good sensitivity, so that pressure fluctuation due to respiration and heartbeat can be measured when a subject is lying on this sensor. The pressure fluctuation measured can be further separated into signals corresponding to respiration and heartbeat, respectively. In the proposed method, the signal separation is achieved using an algorithm based on empirical mode decomposition (EMD. From the experimental results, it was found that respiration and heartbeat signals can be successfully obtained with the proposed method.

Effect of calcium and magnesium on the antimicrobial action of enterocin LR/6 produced by Enterococcus faecium LR/6.

Science.gov (United States)

Kumar, Manoj; Srivastava, Sheela

2011-06-01

Enterococci are well-known producers of antimicrobial peptides (enterocins) that possess potential as biopreservatives in food. In this study, divalent cations and release of intracellular potassium were used to assess the mechanism of interaction and killing of enterocin LR/6 produced by Enterococcus faecium LR/6 on three target Gram-positive and Gram-negative bacteria, namely Micrococcus luteus, Enterococcus sp. strain LR/3 and Escherichia coli K-12. Whilst treatment with enterocin LR/6 in all cases led to a significant loss of viability, suggesting a bactericidal mode of action, E. coli K-12 showed better tolerance than the other two strains. Bacteriocins have generally been reported to create pores in the membrane of sensitive cells and this function is diminished by divalent cations. In this study it was shown that Ca(2+) and Mg(2+) markedly improved the viability of enterocin LR/6-treated cells in a concentration-dependent manner. K(+) release as a sign of membrane leakiness was higher in M. luteus compared with the other two test strains. In agreement with the viability response, pre-exposure to Ca(2+) and Mg(2+) substantially reduced the amount of K(+) leakage by M. luteus and Enterococcus sp.; in the case of E. coli K-12, no leakage of K(+) was recorded. These results suggest that enterocin LR/6, which possesses good antibacterial potential, may not be very effective as a preservative in foods containing high concentrations of calcium and magnesium. Copyright © 2011 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

Approximate Solution of LR Fuzzy Sylvester Matrix Equations

Directory of Open Access Journals (Sweden)

Xiaobin Guo

2013-01-01

Full Text Available The fuzzy Sylvester matrix equation AX~+X~B=C~ in which A,B are m×m and n×n crisp matrices, respectively, and C~ is an m×n LR fuzzy numbers matrix is investigated. Based on the Kronecker product of matrices, we convert the fuzzy Sylvester matrix equation into an LR fuzzy linear system. Then we extend the fuzzy linear system into two systems of linear equations according to the arithmetic operations of LR fuzzy numbers. The fuzzy approximate solution of the original fuzzy matrix equation is obtained by solving the crisp linear systems. The existence condition of the LR fuzzy solution is also discussed. Some examples are given to illustrate the proposed method.

Calibrating soil respiration measures with a dynamic flux apparatus using artificial soil media of varying porosity

Science.gov (United States)

John R. Butnor; Kurt H. Johnsen

2004-01-01

Measurement of soil respiration to quantify ecosystem carbon cyclingrequires absolute, not relative, estimates of soil CO2 efflux. We describe a novel, automated efflux apparatus that can be used to test the accuracy of chamber-based soil respiration measurements by generating known CO2 fluxes. Artificial soil is supported...

LR-90 prevents methylglyoxal-induced oxidative stress and apoptosis in human endothelial cells

Science.gov (United States)

Figarola, James L.; Singhal, Jyotsana; Rahbar, Samuel; Awasthi, Sanjay

2014-01-01

Methylglyoxal (MGO) is a highly reactive dicarbonyl compound known to induce cellular injury and cytoxicity, including apoptosis in vascular cells. Vascular endothelial cell apoptosis has been implicated in the pathophysiology and progression of atherosclerosis. We investigated whether the advanced glycation end-product inhibitor LR-90 could prevent MGO-induced apoptosis in human umbilical vascular endothelial cells (HUVECs). HUVECs were pre-treated with LR-90 and then stimulated with MGO. Cell morphology, cytotoxicity and apoptosis were evaluated by light microscopy, MTT assay, and Annexin V-FITC and propidium iodide double staining, respectively. Levels of Bax, Bcl-2, cytochrome c, mitogen-activated protein kinases (MAPKs) and caspase activities were assessed by Western blotting. Reactive oxygen species (ROS) generation and mitochondrial membrane potential (MMP) were measured with fluorescent probes. LR-90 dose-dependently prevented MGO-associated HUVEC cytotoxicity and apoptotic biochemical changes such as loss of MMP, increased Bax/Bcl-2 protein ratio, mitochondrial cytochrome c release and activation of caspase-3 and 9. Additionally, LR-90 blocked intracellular ROS formation and MAPK (p44/p42, p38, JNK) activation, though the latter seem to be not directly involved in MGO-induced HUVEC apoptosis. LR-90 prevents MGO-induced HUVEC apoptosis by inhibiting ROS and associated mitochondrial-dependent apoptotic signaling cascades, suggesting that LR-90 possess cytoprotective ability which could be beneficial in prevention of diabetic related-atherosclerosis. PMID:24615331

Accident dynamics of LR-0 reactor

International Nuclear Information System (INIS)

Vorisek, M.; Tinka, I.

1981-01-01

The results are given of calculating the accident dynamics of the LR-0 light water experimental zero power reactor. Calculations of the time dependence of power, the total released energy, the temperature of fuel and its cladding were made using program FATRAP for different values of the total inserted reactivity. Using the results, an analysis is made of hypothetic accident states of the LR-0 reactor. The results are shown graphically. (J.B.)

WWER-440 control assembly local power peaking investigation on LR-0 reactor

International Nuclear Information System (INIS)

Mikus, J.

2002-01-01

This paper presents information concerning the local power peaking problem induced by the WWER-440 control assembly and the investigation possibilities on the light water, zero power reactor LR-0 at the Nuclear Research Institute (NRI) Rez plc. A brief description is given about the disposable control assembly model, experimental arrangement and conditions on the LR-0 reactor with regard to the earlier performed investigations as well as to the relevant measurements to be realized in the near future.(abstract)

Low-priced, time-saving, reliable and stable LR-115 counting system

International Nuclear Information System (INIS)

Tchorz-Trzeciakiewicz, D.E.

2015-01-01

Nuclear alpha particles leave etches (tracks) when they hit the surface of a LR-115 detector. The density of these tracks is used to measure radon concentration. Counting these tracks by human sense is tedious and time-consuming procedure and may introduce counting error, whereas most available automatic and semiautomatic counting systems are expensive or complex. An uncomplicated, robust, reliable and stable counting system using freely available on the Internet software as Digimizer™ and PhotoScape was developed and proposed. The effectiveness of the proposed procedure was evaluated by comparing the amount of tracks counted by software with the amount of tracks counted manually for 223 detectors. The percentage error for each analysed detector was obtained as a difference between automatic and manual counts divided by manual count. For more than 97% of detectors, the percentage errors oscillated between −3% and 3%. - Highlights: • Semiautomatic, uncomplicated procedure was proposed to count the amount of alpha tracks. • Freely available software on the Internet used as alpha tracks counting system for LR-115. • LR-115 detectors used to measure radon concentration and radon exhalation rate

Respirable dust and respirable silica exposure in Ontario gold mines.

Science.gov (United States)

Verma, Dave K; Rajhans, Gyan S; Malik, Om P; des Tombe, Karen

2014-01-01

A comprehensive survey of respirable dust and respirable silica in Ontario gold mines was conducted by the Ontario Ministry of Labor during 1978-1979. The aim was to assess the feasibility of introducing gravimetric sampling to replace the assessment method which used konimeters, a device which gave results in terms of number of particles per cubic centimeter (ppcc) of air. The study involved both laboratory and field assessments. The field assessment involved measurement of airborne respirable dust and respirable silica at all eight operating gold mines of the time. This article describes the details of the field assessment. A total of 288 long-term (7-8 hr) personal respirable dust air samples were collected from seven occupational categories in eight gold mines. The respirable silica (α-quartz) was determined by x-ray diffraction method. The results show that during 1978-1979, the industry wide mean respirable dust was about 1 mg/m(3), and the mean respirable silica was 0.08 mg/m(3.)The mean% silica in respirable dust was 7.5%. The data set would be useful in future epidemiological and health studies, as well as in assessment of workers' compensation claims for occupational diseases such as silicosis, chronic obstructive pulmonary disease (COPD), and autoimmune diseases such as renal disease and rheumatoid arthritis.

L-R asymmetry in gut's

International Nuclear Information System (INIS)

Karadayi, H.R.

1982-01-01

An idea of L-R asymmetry is proposed for the grand unification schemes. The idea provides an intrinsic mechanism to obtain standard model charges of fermions in the case of more than one weak gauge boson. It is elaborated within a scheme based on the partial symmetry SU(4)sub(C)xSU(2)sub(L)xSU(2)sub(R) where the coupling constants gsub(L) and gsub(R) corresponding to the chiral SU(2) factors are assumed to be different from each other. Then, the embedding of this structure within the simple symmetry SO(10) is shown. In both cases, a consistent description of vector particle masses is given. These two schemes are considered as primary models to realize the L-R asymmetry idea due to the lack of family unification. However, in a subsequent work, we will show that the SO(14) unification of the three families can be obtained within the framework of L-R asymmetry. All formulations are carried out with the aid of a mathematical method that we recently proposed for the Lie algebra representations of classical groups. (author)

Roles of miRNAs in microcystin-LR-induced Sertoli cell toxicity

Energy Technology Data Exchange (ETDEWEB)

Zhou, Yuan [Immunology and Reproduction Biology Laboratory & State Key Laboratory of Analytical Chemistry for Life Science, Medical School, Nanjing University, Nanjing, Jiangsu 210093 (China); Jiangsu Key Laboratory of Molecular Medicine, Nanjing University, Nanjing, Jiangsu 210093 (China); Wang, Hui [The Centre for Individualized Medication, Linköping University Hospital, Linköping University, Linköping SE-58185 (Sweden); Wang, Cong [Immunology and Reproduction Biology Laboratory & State Key Laboratory of Analytical Chemistry for Life Science, Medical School, Nanjing University, Nanjing, Jiangsu 210093 (China); Jiangsu Key Laboratory of Molecular Medicine, Nanjing University, Nanjing, Jiangsu 210093 (China); Qiu, Xuefeng [Department of Urology, Affiliated Drum Tower Hospital, School of Medicine, Nanjing University, Nanjing 210008 (China); Benson, Mikael [The Centre for Individualized Medication, Linköping University Hospital, Linköping University, Linköping SE-58185 (Sweden); Yin, Xiaoqin [Immunology and Reproduction Biology Laboratory & State Key Laboratory of Analytical Chemistry for Life Science, Medical School, Nanjing University, Nanjing, Jiangsu 210093 (China); Jiangsu Key Laboratory of Molecular Medicine, Nanjing University, Nanjing, Jiangsu 210093 (China); Xiang, Zou [Department of Microbiology and Immunology, Mucosal Immunobiology and Vaccine Research Center, Institute of Biomedicine, University of Gothenburg, Gothenburg (Sweden); Li, Dongmei, E-mail: lidm@nju.edu.cn [Immunology and Reproduction Biology Laboratory & State Key Laboratory of Analytical Chemistry for Life Science, Medical School, Nanjing University, Nanjing, Jiangsu 210093 (China); Jiangsu Key Laboratory of Molecular Medicine, Nanjing University, Nanjing, Jiangsu 210093 (China); and others

2015-08-15

Microcystin (MC)-LR, a cyclic heptapeptide, is a potent reproductive system toxin. To understand the molecular mechanisms of MC-induced reproductive system cytotoxicity, we evaluated global changes of miRNA and mRNA expression in mouse Sertoli cells following MC-LR treatment. Our results revealed that the exposure to MC-LR resulted in an altered miRNA expression profile that might be responsible for the modulation of mRNA expression. Bio-functional analysis indicated that the altered genes were involved in specific cellular processes, including cell death and proliferation. Target gene analysis suggested that junction injury in Sertoli cells exposed to MC-LR might be mediated by miRNAs through the regulation of the Sertoli cell-Sertoli cell pathway. Collectively, these findings may enhance our understanding on the modes of action of MC-LR on mouse Sertoli cells as well as the molecular mechanisms underlying the toxicity of MC-LR on the male reproductive system. - Highlights: • miRNAs were altered in Sertoli cells exposed to MC-LR. • Alerted genes were involved in different cell functions including the cell morphology. • MC-LR adversely affected Sertoli cell junction formation through the regulating miRNAs.

Respirator field performance factors

International Nuclear Information System (INIS)

Skaggs, B.J.; DeField, J.D.; Strandberg, S.W.; Sutcliffe, C.R.

1985-01-01

The Industrial Hygiene Group assisted OSHA and the NRC in measurements of respirator performance under field conditions. They reviewed problems associated with sampling aerosols within the respirator in order to determine fit factors (FFs) or field performance factor (FPF). In addition, they designed an environmental chamber study to determine the effects of temperature and humidity on a respirator wearer

Investigation of Mitochondrial Dysfunction by Sequential Microplate-Based Respiration Measurements from Intact and Permeabilized Neurons

Science.gov (United States)

Clerc, Pascaline; Polster, Brian M.

2012-01-01

Mitochondrial dysfunction is a component of many neurodegenerative conditions. Measurement of oxygen consumption from intact neurons enables evaluation of mitochondrial bioenergetics under conditions that are more physiologically realistic compared to isolated mitochondria. However, mechanistic analysis of mitochondrial function in cells is complicated by changing energy demands and lack of substrate control. Here we describe a technique for sequentially measuring respiration from intact and saponin-permeabilized cortical neurons on single microplates. This technique allows control of substrates to individual electron transport chain complexes following permeabilization, as well as side-by-side comparisons to intact cells. To illustrate the utility of the technique, we demonstrate that inhibition of respiration by the drug KB-R7943 in intact neurons is relieved by delivery of the complex II substrate succinate, but not by complex I substrates, via acute saponin permeabilization. In contrast, methyl succinate, a putative cell permeable complex II substrate, failed to rescue respiration in intact neurons and was a poor complex II substrate in permeabilized cells. Sequential measurements of intact and permeabilized cell respiration should be particularly useful for evaluating indirect mitochondrial toxicity due to drugs or cellular signaling events which cannot be readily studied using isolated mitochondria. PMID:22496810

Adaptive local surface refinement based on LR NURBS and its application to contact

Science.gov (United States)

Zimmermann, Christopher; Sauer, Roger A.

2017-12-01

A novel adaptive local surface refinement technique based on Locally Refined Non-Uniform Rational B-Splines (LR NURBS) is presented. LR NURBS can model complex geometries exactly and are the rational extension of LR B-splines. The local representation of the parameter space overcomes the drawback of non-existent local refinement in standard NURBS-based isogeometric analysis. For a convenient embedding into general finite element codes, the Bézier extraction operator for LR NURBS is formulated. An automatic remeshing technique is presented that allows adaptive local refinement and coarsening of LR NURBS. In this work, LR NURBS are applied to contact computations of 3D solids and membranes. For solids, LR NURBS-enriched finite elements are used to discretize the contact surfaces with LR NURBS finite elements, while the rest of the body is discretized by linear Lagrange finite elements. For membranes, the entire surface is discretized by LR NURBS. Various numerical examples are shown, and they demonstrate the benefit of using LR NURBS: Compared to uniform refinement, LR NURBS can achieve high accuracy at lower computational cost.

Synthesis of visible light sensitized S, N and C co-doped polymorphic TiO2 for Microcystin-LR MC-LR removal

Science.gov (United States)

Microcystin-LR (MC-LR) is considered as one of the most widespread and toxic cyanotoxins, which had been discovered to be hepatotoxic, cytotoxic and neurotoxic. It is the only cyanotoxin that has been proposed by Word Health Organization (WHO) for a provisional guideline (1 ppb) ...

Soil Respiration And Respiration Partitioning In An Oak-Savannah With A History Of Fertilization

Science.gov (United States)

Morris, K. A.; Nair, R.; Schrumpf, M.; Migliavacca, M.

2017-12-01

Soil respiration is a combination of autotrophic and heterotrophic components. These components have different controls and structurally complex ecosystems such as oak-savannahs offer an opportunity to study strongly contrasting conditions (ie., soil from under trees versus open areas) in an environment with similar soil mineralogy and climatic patterns. To measure respiration coming from plant roots, fungal hyphae, and free-living microbes we established stations of soil cores comprised of three selectively permeable meshes under tree canopies and in open grassy areas of a Holm Oak (Quercus ilex) savannah in Extremadura, Spain. Large plots of this ecosystem had previously been fertilized as part of a stoichiometeric imbalance study (in 2015). Stations were installed in Dec. 2016 within four plots; control, N added, P added, and N+P added. Respiration from cores was measured in campaigns at key phenological stages with a portable Li-Cor 8100A unit. Six months after installation > 50% of soil respiration was attributable to free-living microbes. There is a persistent effect of the prior fertilization, resulting in increased soil respiration in open areas regardless of fertilizer type, while respiration from under tree canopies had a varied response. Soil under tree canopies showed distinct sensitivity to stoichiometric imbalance, meaning that addition of N or P alone either did not change respiration or decreased it slightly, while N+P stimulated respiration. We determined that respiration from free-living microbes is a major component of soil respiration even in the most active plant growing season. However, because of the lag between the time of fertilization and the time of measurement, it not possible to say whether treatment responses are due solely to nutrient status of the soil or whether changes in plant biomass and species composition also play a role. Additional work planned at the site will shed light on this uncertainty as well as the contribution of

[Temperature sensitivity of wheat plant respiration and soil respiration influenced by increased UV-B radiation from elongation to flowering periods].

Science.gov (United States)

Chen, Shu-Tao; Hu, Zheng-Hua; Li, Han-Mao; Ji, Yu-Hong; Yang, Yan-Ping

2009-05-15

Field experiment was carried out in the spring of 2008 in order to investigate the effects of increased UV-B radiation on the temperature sensitivity of wheat plant respiration and soil respiration from elongation to flowering periods. Static chamber-gas chromatography method was used to measure ecosystem respiration and soil respiration under 20% UV-B radiation increase and control. Environmental factors such as temperature and moisture were also measured. Results indicated that supplemental UV-B radiation inhibited the ecosystem respiration and soil respiration from wheat elongation to flowering periods, and the inhibition effect was more obvious for soil respiration than for ecosystem respiration. Ecosystem respiration rates, on daily average, were 9%, 9%, 3%, 16% and 30% higher for control than for UV-B treatment forthe five measurement days, while soil respiration rates were 99%, 93%, 106%, 38% and 10% higher for control than for UV-B treatment. The Q10s (temperature sensitivity coefficients) for plant respiration under control and UV-B treatments were 1.79 and 1.59, respectively, while the Q10s for soil respiration were 1.38 and 1.76, respectively. The Q10s for ecosystem respiration were 1.65 and 1.63 under CK and UV-B treatments, respectively. Supplemental UV-B radiation caused a lower Q10 for plant respiration and a higher Q10 for soil respiration, although no significant effect of supplemental UV-B radiation on the Q10 for ecosystem respiration was found.

A Medical Cloud-Based Platform for Respiration Rate Measurement and Hierarchical Classification of Breath Disorders

Directory of Open Access Journals (Sweden)

Atena Roshan Fekr

2014-06-01

Full Text Available The measurement of human respiratory signals is crucial in cyberbiological systems. A disordered breathing pattern can be the first symptom of different physiological, mechanical, or psychological dysfunctions. Therefore, a real-time monitoring of the respiration patterns, as well as respiration rate is a critical need in medical applications. There are several methods for respiration rate measurement. However, despite their accuracy, these methods are expensive and could not be integrated in a body sensor network. In this work, we present a real-time cloud-based platform for both monitoring the respiration rate and breath pattern classification, remotely. The proposed system is designed particularly for patients with breathing problems (e.g., respiratory complications after surgery or sleep disorders. Our system includes calibrated accelerometer sensor, Bluetooth Low Energy (BLE and cloud-computing model. We also suggest a procedure to improve the accuracy of respiration rate for patients at rest positions. The overall error in the respiration rate calculation is obtained 0.53% considering SPR-BTA spirometer as the reference. Five types of respiration disorders, Bradapnea, Tachypnea, Cheyn-stokes, Kaussmal, and Biot’s breathing are classified based on hierarchical Support Vector Machine (SVM with seven different features. We have evaluated the performance of the proposed classification while it is individualized to every subject (case 1 as well as considering all subjects (case 2. Since the selection of kernel function is a key factor to decide SVM’s performance, in this paper three different kernel functions are evaluated. The experiments are conducted with 11 subjects and the average accuracy of 94.52% for case 1 and the accuracy of 81.29% for case 2 are achieved based on Radial Basis Function (RBF. Finally, a performance evaluation has been done for normal and impaired subjects considering sensitivity, specificity and G-mean parameters

Measuring temperature dependence of soil respiration: importance of incubation time, soil type, moisture content and model fits

Science.gov (United States)

Schipper, L. A.; Robinson, J.; O'Neill, T.; Ryburn, J.; Arcus, V. L.

2015-12-01

Developing robust models of the temperature response and sensitivity of soil respiration is critical for determining changes carbon cycling in response to climate change and at daily to annual time scales. Currently, approaches for measuring temperature dependence of soil respiration generally use long incubation times (days to weeks and months) at a limited number of incubation temperatures. Long incubation times likely allow thermal adaptation by the microbial population so that results are poorly representative of in situ soil responses. Additionally, too few incubation temperatures allows for the fit and justification of many different predictive equations, which can lead to inaccuracies when used for carbon budgeting purposes. We have developed a method to rapidly determine the response of soil respiration rate to wide range of temperatures. An aluminium block with 44 sample slots is heated at one end and cooled at the other to give a temperature gradient from 0 to 55°C at about one degree increments. Soil respiration is measured within 5 hours to minimise the possibility of thermal adaptation. We have used this method to demonstrate the similarity of temperature sensitivity of respiration for different soils from the same location across seasons. We are currently testing whether long-term (weeks to months) incubation alter temperature response and sensitivity that occurs in situ responses. This method is also well suited for determining the most appropriate models of temperature dependence and sensitivity of soil respiration (including macromolecular rate theory MMRT). With additional testing, this method is expected to be a more reliable method of measuring soil respiration rate for soil quality and modelling of soil carbon processes.

Antioxidant Effect of Curcumin Against Microcystin- LR-Induced ...

African Journals Online (AJOL)

Purpose: To investigate the effect of curcumin on microcystin-LR (MC-LR)- induced renal oxidative damage in Balb/c mice. Methods: 40 male Balb/c mice were assigned randomly to 4 groups each having 10 mice. One group served as normal (saline treated) while another group was used as curcumin control. The third ...

Monitoring of microcystin-LR in Luvuvhu River catchment ...

African Journals Online (AJOL)

The main aim of this study is to assess the levels of microcystin-LR in Luvuvhu River catchment and to assess the physicochemical parameters that may promote the growth of cyanobacteria. The level of microcystin-LR in some of the sampling sites was <0.18 ìg/l except for one site (Luvuvhu River just before the confluence ...

Soil respiration from four aggrading forested watersheds measured over a quarter century

Science.gov (United States)

David C. Coleman; Mark D. Hunter; John Hutton; Steven Pomeroy; Lloyd Swift

2002-01-01

Soil respiration was measured in four aggrading, forested second-growth watersheds in the southern Appalachians using an identical method (alkali absorption) at intervals 23 and 24 years apart. Seasonal trends were similar, with mid-summer maxima and winter minima. Amounts of carbon dioxide evolved were higher in the recent measurements (1995) compared to the earlier...

Parameters of calibration of the measurement system of {sup 222} Rn based in LR-115; Parametros de calibracion del sistema de medicion de {sup 222} Rn basado en LR-115

Energy Technology Data Exchange (ETDEWEB)

Garcia, M.L.; Mireles, F.; Quirino, L.; Davila, I.; Lugo, F.; Pinedo, J.L. [CREN-UAZ, 98068 Zacatecas (Mexico); Chavez, A. [ININ, 52045 Ocoyoacac, Estado de Mexico (Mexico)]. e-mail: mluisagb@hotmail.com

2003-07-01

Since the SSNTD technique (Solid State Nuclear Track Detection) it was discovered it has been used as passive method for the detection of subnuclear particles in great variety of fields of the science. The use of the technique in measurements of {sup 222} Rn in air have already been established implying better methodologies in the exhibition to the environment until their engraving and reading processes. The SSNTD technique is since a method by comparison since the material it can be used a single time, therefore it requires of calibration in one controlled radon atmosphere, using gauged standards. The objective of this work is to show the calibration of the devices used as radon monitors based on SSNTD. The material used as SSNTD is LR-115 Il. The standardization of the parameters used in the exhibition to radon in air, engraving and reading process, its are based on the response of the LR-115 Il, the one arrangement of the device, engraving speed and mainly the calibration factor. They are considered two types of monitors: Open camera and Closed camera, the difference among the calibration factors of both cameras is the percentage of the descendants of radon in the open camera. The standardized parameters are operation voltage of the counting system; temperature, time and concentration of the engraving solution; and thickness. (Author)

Partitioning of ecosystem respiration in a beech forest

DEFF Research Database (Denmark)

Brændholt, Andreas; Ibrom, Andreas; Larsen, Klaus Steenberg

2018-01-01

Terrestrial ecosystem respiration (Reco) represents a major component of the global carbon cycle. It consists of many sub-components, such as aboveground plant respiration and belowground root and microbial respiration, each of which may respond differently to abiotic factors, and thus to global...... of Reco in a temperate beech forest at diel, seasonal and annual time scales. Reco was measured by eddy covariance while respiration rates from soil, tree stems and isolated coarse tree roots were measured bi-hourly by an automated closed-chamber system. Soil respiration (Rsoil) was measured in intact...... plots, and heterotrophic Rsoil was measured in trenched plots. Tree stem (Rstem) and coarse root (Rroot) respiration were measured by custom made closed-chambers. We found that the contribution of Rstem to total Reco varied across the year, by only accounting for 6% of Reco during winter and 16% during...

A further study of the (CR-LR) difference technique for retrospective radon exposure assessment

International Nuclear Information System (INIS)

Nikezic, D.; Yip, C.W.Y.; Leung, S.Y.Y.; Leung, J.K.C.; Yu, K.N.

2006-01-01

The (CR-LR) difference technique, based on the CR-39 and LR 115 detectors, for the determination of implanted 210 Po in glass after deposition of short-lived radon progeny, was analyzed in details in this paper. The sensitivities of both detectors were calculated using the Monte Carlo method with V functions particularly derived in our previous works for the detectors used in the present experiments. The dependency of the sensitivity ratio on the removed layer of both detectors was determined and verified experimentally. The simulated sensitivity ratios correlate well with the experimental ones. A major finding of the present work is that the sensitivity ratio between the CR-39 and LR 115 detectors depends only weakly on the ratio between the 238 U and 232 Th concentrations in the glass samples. This is crucial for the application of the (CR-LR) difference technique for retrospective radon exposure assessments, since measurements of the 238 U and 232 Th concentrations in the relatively small real-life glass samples will make the retrospective radon exposure assessments impractical

Laboratory studies of dissolved radiolabelled microcystin-LR in lake water

DEFF Research Database (Denmark)

Hyenstrand, Per; Rohrlack, Thomas; Beattie, Kenneth A

2003-01-01

The fate of dissolved microcystin-LR was studied in laboratory experiments using surface water taken from a eutrophic lake. Based on initial range finding, a concentration of 50 microg l(-1) dissolved 14C-microcystin-LR was selected for subsequent time-course experiments. The first was performed ...... fractions. The study demonstrated that biodegradation of dissolved microcystin-LR occurred in water collected at a lake surface with carbon dioxide as a major end-product....

Facepiece leakage and fitting of respirators

International Nuclear Information System (INIS)

White, J.M.

1978-05-01

The ways in which airborne contaminants can penetrate respirators and the factors which affect the fit of respirators are discussed. The fit of the respirator to the face is shown to be the most critical factor affecting the protection achieved by the user. Qualitative and quantitative fit testing techniques are described and their application to industrial respirator programs is examined. Quantitative measurement of the leakage of a respirator while worn can be used to numerically indicate the protection achieved. These numbers, often referred to as protection factors, are sometimes used as the basis for selecting suitable respirators and this practice is reviewed. (author)

Assessment of co-seismic landslide susceptibility using LR and ...

Indian Academy of Sciences (India)

Suchita Shrestha

2018-03-28

Mar 28, 2018 ... statistical methods, namely Logistic Regression. (LR) and Analysis ... The LR method has been applied by various researchers ... many bivariate models need that the independent variables be .... through a point (per unit contour length), and tan β is the ..... by multivariate statistical techniques; Nat. Hazards ...

SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

Directory of Open Access Journals (Sweden)

Mehmet AYBEKE

2015-12-01

Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

Dynamics of Total Microcystin LR Concentration in Three Subtropical Hydroelectric Generation Reservoirs in Uruguay, South America.

Science.gov (United States)

González-Piana, Mauricio; Fabián, Daniel; Piccardo, Andrea; Chalar, Guillermo

2017-10-01

This study analyzed the temporal dynamics of total microcystin LR concentrations between the years of 2012 and 2015 in the Bonete, Baygorria and Palmar hydroelectric generation reservoirs in the central region of the Negro River, Uruguay. The three reservoirs showed differents total microcystin LR concentration, with no significant differences among them. Over 20 sampling dates, the three reservoirs exhibited total microcystin LR concentrations on eight occasions that corresponded to a slight to moderate human health risk according to WHO guideline values for recreational waters. By determining the concentration of microcystin LR in cyanobacterial biomass, we identified cyanobacterial populations that occurred over time with varying degrees of toxin production (maximal 85.4 µg/mm 3 ). The microcystin LR concentration in Bonete was positively correlated with temperature (r = 0.587) and cyanobacterial biomass (r = 0.736), in Baygorria with cyanobacterial biomass (r = 0.521), and in Palmar with temperature (r = 0.500) and negatively correlated with ammonia (r = -0.492). Action is needed to reduce the presence of toxic cyanobacteria in these systems. A decrease in the use of agrochemicals and management changes in the reservoir basins could be successful long-term measures.

Microcystin-LR equivalent concentrations in fish tissue during a ...

African Journals Online (AJOL)

The effects of a decomposing cyanobacteria bloom on water quality and the accumulation of microcystin-LR equivalent toxin in fish at Loskop Dam were studied in May 2012. Enzyme-linked immunosorbent assay [ELISA] was used to confirm the presence of microcystin-LR equivalent in the water and to determine the ...

Comprehensive insights into microcystin-LR effects on hepatic lipid metabolism using cross-omics technologies

International Nuclear Information System (INIS)

Zhang, Zongyao; Zhang, Xu-Xiang; Wu, Bing; Yin, Jinbao; Yu, Yunjiang; Yang, Liuyan

2016-01-01

Highlights: • Use of cross-omics technologies to evaluate toxic effects of microcystin-LR. • Disturbance of hepatic lipid metabolism by oral exposure to microcystin-LR. • Crucial roles of gut microbial community shift in the metabolic disturbance induced by microcystin-LR. - Abstract: Microcystin-LR (MC-LR) can induce hepatic tissue damages and molecular toxicities, but its effects on lipid metabolism remain unknown. This study investigated the effects of MC-LR exposure on mice lipid metabolism and uncovered the underlying mechanism through metabonomic, transcriptomic and metagenomic analyses after administration of mice with MC-LR by gavage for 28 d. Increased liver weight and abdominal fat weight, and evident hepatic lipid vacuoles accumulation were observed in the mice fed with 0.2 mg/kg/d MC-LR. Serum nuclear magnetic resonance analysis showed that MC-LR treatment altered the levels of serum metabolites including triglyceride, unsaturated fatty acid (UFA) and very low density lipoprotein. Digital Gene Expression technology was used to reveal differential expression of hepatic transcriptomes, demonstrating that MC-LR treatment disturbed hepatic UFA biosynthesis and activated peroxisome proliferator-activated receptor (PPAR) signaling pathways via Pparγ, Fabp1 and Fabp2 over-expression. Metagenomic analyses of gut microbiota revealed that MC-LR exposure also increased abundant ratio of Firmicutes vs. Bacteroidetes in gut and altered biosynthetic pathways of various microbial metabolic and pro-inflammatory molecules. In conclusion, oral MC-LR exposure can induce hepatic lipid metabolism disorder mediated by UFA biosynthesis and PPAR activation, and gut microbial community shift may play an important role in the metabolic disturbance.

Comprehensive insights into microcystin-LR effects on hepatic lipid metabolism using cross-omics technologies

Energy Technology Data Exchange (ETDEWEB)

Zhang, Zongyao [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023 (China); Center for Environmental Health Research, South China Institute of Environmental Sciences, The Ministry of Environmental Protection of PRC, Guangzhou 510655 (China); Zhang, Xu-Xiang, E-mail: zhangxx@nju.edu.cn [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023 (China); Wu, Bing; Yin, Jinbao [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023 (China); Yu, Yunjiang [Center for Environmental Health Research, South China Institute of Environmental Sciences, The Ministry of Environmental Protection of PRC, Guangzhou 510655 (China); Yang, Liuyan, E-mail: yangly@nju.edu.cn [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023 (China)

2016-09-05

Highlights: • Use of cross-omics technologies to evaluate toxic effects of microcystin-LR. • Disturbance of hepatic lipid metabolism by oral exposure to microcystin-LR. • Crucial roles of gut microbial community shift in the metabolic disturbance induced by microcystin-LR. - Abstract: Microcystin-LR (MC-LR) can induce hepatic tissue damages and molecular toxicities, but its effects on lipid metabolism remain unknown. This study investigated the effects of MC-LR exposure on mice lipid metabolism and uncovered the underlying mechanism through metabonomic, transcriptomic and metagenomic analyses after administration of mice with MC-LR by gavage for 28 d. Increased liver weight and abdominal fat weight, and evident hepatic lipid vacuoles accumulation were observed in the mice fed with 0.2 mg/kg/d MC-LR. Serum nuclear magnetic resonance analysis showed that MC-LR treatment altered the levels of serum metabolites including triglyceride, unsaturated fatty acid (UFA) and very low density lipoprotein. Digital Gene Expression technology was used to reveal differential expression of hepatic transcriptomes, demonstrating that MC-LR treatment disturbed hepatic UFA biosynthesis and activated peroxisome proliferator-activated receptor (PPAR) signaling pathways via Pparγ, Fabp1 and Fabp2 over-expression. Metagenomic analyses of gut microbiota revealed that MC-LR exposure also increased abundant ratio of Firmicutes vs. Bacteroidetes in gut and altered biosynthetic pathways of various microbial metabolic and pro-inflammatory molecules. In conclusion, oral MC-LR exposure can induce hepatic lipid metabolism disorder mediated by UFA biosynthesis and PPAR activation, and gut microbial community shift may play an important role in the metabolic disturbance.

The uptake kinetics and immunotoxic effects of microcystin-LR in human and chicken peripheral blood lymphocytes in vitro

International Nuclear Information System (INIS)

Lankoff, Anna; Carmichael, Wayne W.; Grasman, Keith A.; Yuan, Moucun

2004-01-01

Microcystin-LR is a cyanobacterial heptapeptide that presents acute and chronic hazards to animal and human health. We investigated the influence of this toxin on human and chicken immune system modulation in vitro. Peripheral blood lymphocytes were treated with microcystin-LR at environmentally relevant doses of 1, 10 and 25 μg/ml for 12, 24, 48, 72 h (for proliferation assay cells were treated for 72 h). T-cell and B-cell proliferation as well as apoptosis and necrosis were determined in human and chicken samples. IL-2 and IL-6 production by human lymphocytes also was measured. In addition, uptake kinetics of microcystin-LR into human and chicken peripheral blood lymphocytes were calculated by Liquid Chromatography (LS) /Mass Spectrometry (MS) analysis. At the highest dose microcystin-LR decreased T-cell proliferation and all doses of microcystin-LR inhibited B-cell proliferation. The frequency of apoptotic and necrotic cells increased in a dose and time-dependent manner. Human lymphocytes responded to stimulation with microcystin-LR by increased production of IL-6 and decreased production of IL-2. Human lymphocytes were able to uptake from 0.014 to 1.663 μg/ml and chicken lymphocytes from 0.035 to 1.733 μg/ml of the microcystin-LR added to the cultures, depending on the treatment time and dose. In conclusion, microcystin-LR acted as an immunomodulator in cytokine production and down-regulated lymphocyte functions by induction of apoptosis and necrosis. However, further studies dealing with the influence of microcystin-LR on expression cytokine genes and transcription factors are necessary to confirm these hypotheses

Comparison of the three optical platforms for measurement of cellular respiration.

Science.gov (United States)

Kondrashina, Alina V; Ogurtsov, Vladimir I; Papkovsky, Dmitri B

2015-01-01

We compared three optical platforms for measurement of cellular respiration: absolute oxygen consumption rates (OCRs) in hermetically sealed microcuvettes, relative OCRs measured in a 96-well plate with oil seal, and steady-state oxygenation of cells in an open 96-well plate. Using mouse embryonic fibroblasts cell line, the phosphorescent intracellular O2 probe MitoXpress-Intra, and time-resolved fluorescence reader, we determined algorithms for conversion of relative OCRs and cell oxygenation into absolute OCRs, thereby allowing simple high-throughput measurement of absolute OCR values. Copyright © 2014 Elsevier Inc. All rights reserved.

Gravimetric Measurements of Filtering Facepiece Respirators Challenged With Diesel Exhaust.

Science.gov (United States)

Satish, Swathi; Swanson, Jacob J; Xiao, Kai; Viner, Andrew S; Kittelson, David B; Pui, David Y H

2017-07-01

Elevated concentrations of diesel exhaust have been linked to adverse health effects. Filtering facepiece respirators (FFRs) are widely used as a form of respiratory protection against diesel particulate matter (DPM) in occupational settings. Previous results (Penconek A, Drążyk P, Moskal A. (2013) Penetration of diesel exhaust particles through commercially available dust half masks. Ann Occup Hyg; 57: 360-73.) have suggested that common FFRs are less efficient than would be expected for this purpose based on their certification approvals. The objective of this study was to measure the penetration of DPM through NIOSH-certified R95 and P95 electret respirators to verify this result. Gravimetric-based penetration measurements conducted using polytetrafluoroethylene (PTFE) and polypropylene (PP) filters were compared with penetration measurements made with a Scanning Mobility Particle Sizer (SMPS, TSI Inc.), which measures the particle size distribution. Gravimetric measurements using PP filters were variable compared to SMPS measurements and biased high due to adsorption of gas phase organic material. Relatively inert PTFE filters adsorbed less gas phase organic material resulting in measurements that were more accurate. To attempt to correct for artifacts associated with adsorption of gas phase organic material, primary and secondary filters were used in series upstream and downstream of the FFR. Correcting for adsorption by subtracting the secondary mass from the primary mass improved the result for both PTFE and PP filters but this correction is subject to 'equilibrium' conditions that depend on sampling time and the concentration of particles and gas phase hydrocarbons. Overall, the results demonstrate that the use of filters to determine filtration efficiency of FFRs challenged with diesel exhaust produces erroneous results due to the presence of gas phase hydrocarbons in diesel exhaust and the tendency of filters to adsorb organic material. Published by

Cell density dependence of Microcystis aeruginosa responses to copper algaecide concentrations: Implications for microcystin-LR release.

Science.gov (United States)

Kinley, Ciera M; Iwinski, Kyla J; Hendrikse, Maas; Geer, Tyler D; Rodgers, John H

2017-11-01

Along with mechanistic models, predictions of exposure-response relationships for copper are often derived from laboratory toxicity experiments with standardized experimental exposures and conditions. For predictions of copper toxicity to algae, cell density is a critical factor often overlooked. For pulse exposures of copper-based algaecides in aquatic systems, cell density can significantly influence copper sorbed by the algal population, and consequent responses. A cyanobacterium, Microcystis aeruginosa, was exposed to a copper-based algaecide over a range of cell densities to model the density-dependence of exposures, and effects on microcystin-LR (MC-LR) release. Copper exposure concentrations were arrayed to result in a gradient of MC-LR release, and masses of copper sorbed to algal populations were measured following exposures. While copper exposure concentrations eliciting comparable MC-LR release ranged an order of magnitude (24-h EC50s 0.03-0.3mg Cu/L) among cell densities of 10 6 through 10 7 cells/mL, copper doses (mg Cu/mg algae) were similar (24-h EC50s 0.005-0.006mg Cu/mg algae). Comparisons of MC-LR release as a function of copper exposure concentrations and doses provided a metric of the density dependence of algal responses in the context of copper-based algaecide applications. Combined with estimates of other site-specific factors (e.g. water characteristics) and fate processes (e.g. dilution and dispersion, sorption to organic matter and sediments), measuring exposure-response relationships for specific cell densities can refine predictions for in situ exposures and algal responses. These measurements can in turn decrease the likelihood of amending unnecessary copper concentrations to aquatic systems, and minimize risks for non-target aquatic organisms. Copyright © 2017 Elsevier Inc. All rights reserved.

[Effects of Tillage on Soil Respiration and Root Respiration Under Rain-Fed Summer Corn Field].

Science.gov (United States)

Lu, Xing-li; Liao, Yun-cheng

2015-06-01

To explore the effects of different tillage systems on soil respiration and root respiration under rain-fed condition. Based on a short-term experiment, this paper investigated soil respiration in summer corn growth season under four tillage treatments including subsoiling tillage (ST), no tillage (NT), rotary tillage (RT) and moldboard plow tillage (CT). The contribution of root respiration using root exclusion method was also discussed. The results showed that soil respiration rate presented a single peak trend under four tillage methods during the summer corn growing season, and the maximum value was recorded at the heading stage. The trends of soil respiration were as follows: heading stage > flowering stage > grain filling stage > maturity stage > jointing stage > seedling stage. The trends of soil respiration under different tillage systems were as follows: CT > ST > RT > NT. There was a significant correlation between soil respiration rate and soil temperatures (P soil respiration using exponential function equation. However, there was no significant correlation between soil respiration rate and soil moisture. Root respiration accounted for 45.13%-56.86% of the proportion of soil respiratio n with the mean value 51.72% during the summer corn growing season under different tillage systems. Therefore, root exclusion method could be used to study the contribution of crop growth to carbon emission, to compare effects of different tillage systems on the contribution of root respiration provides the bases for selecting the measures to slow down the decomposition of soil carbon.

Comparing ecosystem and soil respiration: Review and key challenges of tower-based and soil measurements

Energy Technology Data Exchange (ETDEWEB)

Barba, Josep; Cueva, Alejandro; Bahn, Michael; Barron-Gafford, Greg A.; Bond-Lamberty, Benjamin; Hanson, Paul J.; Jaimes, Aline; Kulmala, Liisa; Pumpanen, Jukka; Scott, Russell L.; Wohlfahrt, Georg; Vargas, Rodrigo

2018-02-01

The net ecosystem exchange (NEE) is the difference between ecosystem CO2 assimilation and CO2 losses to the atmosphere. Ecosystem respiration (Reco), the efflux of CO2 from the ecosystem to the atmosphere, includes the soil-to-atmosphere carbon flux (i.e., soil respiration; Rsoil) and aboveground plant respiration. Therefore, Rsoil is a fraction of Reco and by definition has to be smaller than Reco at annual, seasonal and daily scales. However, several studies estimating Reco with the eddy covariance technique and measuring Rsoil within the footprint of the tower have reported higher Rsoil than Reco at different time scales. Here, we compare four different and contrasting ecosystems (from forest to grasslands, and from boreal to semiarid) to study whether, and under what conditions, measurements of Reco are lower than Rsoil. In general, both fluxes showed similar temporal patterns, but Reco was not consistently higher than Rsoil from daily to annual scales across sites. We identified several issues that apply for measuring NEE and measuring/upscaling Rsoil that could result in an underestimation of Reco and/or an overestimation of Rsoil. These issues are discussed based on (a) nighttime measurements of NEE, (b) Rsoil measurements, and (c) the interpretation of the functional relationships of these fluxes with temperature (i.e., Q10). We highlight that there is still a need for better integration of Rsoil with eddy covariance measurements to address challenges related to spatial and temporal variability of Reco and Rsoil.

Molecular and analysis of a phenylalanine ammonia-lyase gene (LrPAL2) from Lycoris radiata.

Science.gov (United States)

Jiang, Yumei; Xia, Bing; Liang, Lijian; Li, Xiaodan; Xu, Sheng; Peng, Feng; Wang, Ren

2013-03-01

Phenylalanine ammonia-lyase (PAL), the first enzyme of phenylpropanoid biosynthesis, participates in the biosynthesis of flavonoids, lignins, stilbenes and many other compounds. In this study, we cloned a 2,326 bp full-length PAL2 gene from Lycoris radiata by using degenerate oligonucleotide primer PCR (DOP-PCR) and the rapid amplification of cDNA ends method. The cDNA contains a 2,124 bp coding region encoding 707 amino acids. The LrPAL2 shares about 77.0 % nucleic acid identity and 83 % amino acid identity with LrPAL1. Furthermore, genome sequence analysis demonstrated that LrPAL2 gene contains one intron and two exons. The 5' flanking sequence of LrPAL2 was also cloned by self-formed adaptor PCR (SEFA-PCR), and a group of putative cis-acting elements such as TATA box, CAAT box, G box, TC-rich repeats, CGTCA motif and TCA-element were identified. The LrPAL2 was detected in all tissues examined, with high abundance in bulbs at leaf sprouting stage and in petals at blooming stage. Besides, LrPAL2 drastically responded to MJ, SNP and UV, moderately responded to GA and SA, and a little increased under wounding. Comparison of LrPAL2 expression and LrPAL1 expression demonstrated that LrPAL2 can be more significantly induced than LrPAL1 under the above treatments, and LrPAL2 transcripts accumulated prominently at blooming stage, especially in petals, while LrPAL1 transcripts did not accumulated significantly at blooming stage. All these results suggested that LrPAL2 might play distinct roles in different branches of the phenylpropanoid pathway.

[The development of a respiration and temperature monitor].

Science.gov (United States)

Du, X; Wu, B; Liu, Y; He, Q; Xiao, J

2001-12-01

This paper introduces the design of a monitoring system to measure the respiration and temperature of a body with an 8Xc196 single-chip microcomputer. This system can measure and display the respiration wave, respiration frequency and the body temperature in real-time with a liquid crystal display (LCD) and give an alarm when the parameters are beyond the normal scope. In addition, this device can provide a 24 hours trend graph of the respiration frequency and the body temperature parameters measured. Data can also be exchanged through serial communication interfaces (RS232) between the PC and the monitor.

Occupational Exposure to Respirable Dust, Respirable Crystalline Silica and Diesel Engine Exhaust Emissions in the London Tunnelling Environment.

Science.gov (United States)

Galea, Karen S; Mair, Craig; Alexander, Carla; de Vocht, Frank; van Tongeren, Martie

2016-03-01

Personal 8-h shift exposure to respirable dust, diesel engine exhaust emissions (DEEE) (as respirable elemental carbon), and respirable crystalline silica of workers involved in constructing an underground metro railway tunnel was assessed. Black carbon (BC) concentrations were also assessed using a MicroAeth AE51. During sprayed concrete lining (SCL) activities in the tunnel, the geometric mean (GM) respirable dust exposure level was 0.91mg m(-3), with the highest exposure measured on a back-up sprayer (3.20mg m(-3)). The GM respirable crystalline silica concentration for SCL workers was 0.03mg m(-3), with the highest measurement also for the back-up sprayer (0.24mg m(-3)). During tunnel boring machine (TBM) activities, the GM respirable dust concentration was 0.54mg m(-3). The GM respirable elemental carbon concentration for all the TBM operators was 18 µg m(-3); with the highest concentration measured on a segment lifter. The BC concentrations were higher in the SCL environment in comparison to the TBM environment (daily GM 18-54 µg m(-3) versus 3-6 µg m(-3)). This small-scale monitoring campaign provides additional personal data on exposures experienced by underground tunnel construction workers. © The Author 2015. Published by Oxford University Press on behalf of the British Occupational Hygiene Society.

Intraperitoneal exposure of whitefish to microcystin-LR induces rapid liver injury followed by regeneration and resilience to subsequent exposures

International Nuclear Information System (INIS)

Woźny, Maciej; Lewczuk, Bogdan; Ziółkowska, Natalia; Gomułka, Piotr; Dobosz, Stefan; Łakomiak, Alicja; Florczyk, Maciej; Brzuzan, Paweł

2016-01-01

To date, there has been no systematic approach comprehensively describing the sequence of pathological changes in fish during prolonged exposure to microcystin-LR (MC-LR). Towards this aim, juvenile whitefish individuals received an intraperitoneal injection with pure MC-LR, and the injection was repeated every week to maintain continuous exposure for 28 days. During the exposure period, growth and condition of the fish were assessed based on biometric measurements. Additionally, selected biochemical markers were analysed in the fishes' blood, and their livers were carefully examined for morphological, ultrastructural, and molecular changes. The higher dose of MC-LR (100 μg·kg −1 ) caused severe liver injury at the beginning of the exposure period, whereas the lower dose (10 μg·kg −1 ) caused less, probably reversible injury, and its effects began to be observed later in the exposure period. These marked changes were accompanied by substantial MC-LR uptake by the liver. However, starting on the 7th day of exposure, cell debris began to be removed by phagocytes, then by 14th day, proliferation of liver cells had markedly increased, which led to reconstruction of the liver parenchyma at the end of the treatment. Surprisingly, despite weekly-repeated intraperitoneal injections, MC-LR did not accumulate over time of exposure which suggests its limited uptake in the later phase of exposure. In support, mRNA expression of the membrane transport protein oatp1d was decreased at the same time as the regenerative processes were observed. Our study shows that closing of active membrane transport may serve as one defence mechanism against further MC-LR intoxication. - Highlights: • The study presents pathological changes in whitefish during prolonged MC-LR exposure. • After early, severe injury, the damaged liver parenchyma of the fish regenerated. • Endoplasmic reticulum, cytoskeleton, and chromatin were the main targets for MC-LR. • MC-LR did not

Experimental study on the aging process of the LR 115 cellulose nitrate radon detector

International Nuclear Information System (INIS)

Siems, M.; Freyer, K.; Treutler, H.-C.; Joensson, G.; Enge, W.

2001-01-01

An experimental determination of the aging process of cellulose nitrate detector material was based on the examination of special properties of the LR 115 solid state nuclear track detectors (SSNTDs) of various ages up to 18 years. The examined relevant parameters are the bulk etching rate v b and the track etching rate v t . These parameters are responsible for the appearance, the size and the registration efficiency of tracks of α-particles from radon gas in the detector. To find a correlation between these material parameters and the detector sensitivity an experimental calibration of indoor room and outdoor soil detector devices based on LR 115 took place at the Umweltforschungszentrum Leipzig-Halle (Germany). To avoid routine calibration work in external radon exposure facilities a correction of the age dependent calibration factors with the material parameters measured in one's own laboratory was targeted. In this study a general age dependence, however, was not found. The following statements for practical applications can be made. (i) the bulk etching rate v b for detectors of the same batch has a depth dependence and this dependence is constant over 2 years (LR 115 September 1994). (ii) detectors of different batches older than 5 years and stored at room temperature show an odd v b behaviour when v b is used for describing track shapes. (iii) the calibration factor of detectors of different batches that were stored at about +4 deg. C is constant over 5 years (LR 115 September 1994 and February 1999, Table 2). The conclusion is that LR 115 detectors not older than 5 years and stored in a refrigerator at about +4 deg. C should be preferred for radon measurements. Furthermore these detectors should be recalibrated every year and the microscope work of this calibrations should be performed by the same person who performs the measurements. In addition, a phenomenon related to fundamental track formation mechanisms was found, that the time straggling of the

Separating rhizosphere respiration from total soil respiration in two larch plantations in northeastern China.

Science.gov (United States)

Jiang, Lifen; Shi, Fuchen; Li, Bo; Luo, Yiqi; Chen, Jiquan; Chen, Jiakuan

2005-09-01

The potential capacity of soil to sequester carbon in response to global warming is strongly regulated by the ratio of rhizosphere respiration to respiration by soil microbial decomposers, because of their different temperature sensitivities. To quantify relative contributions of rhizosphere respiration to total soil respiration as influenced by forest stand development, we conducted a trenching study in two larch (Larix gmelini (Rupr.) Rupr.) plantations, aged 17 and 31 years, in northeastern China. Four plots in each plantation were randomly selected and trenched in early May 2001. Soil surface CO2 effluxes both inside and outside the plots were measured from May 2001 to August 2002. Soil respiration (i.e., the CO2 effluxes outside the trenched plots) varied similarly in the two plantations from 0.8 micromol m(-2) s(-1) in winter to 6.0 micromol m(-2) s(-1) in summer. Rhizosphere respiration (i.e., CO2 efflux outside the trenched plots minus that inside the plots) varied from 0.2 to 2.0 micromol m(-2) s(-1) in the old forest and from 0.3 to 4.0 micromol m(-2) s(-1) in the young forest over the seasons. Rhizosphere respiration, on average, accounted for 25% of soil respiration in the old forest and 65% in the young forest. Rhizosphere and soil respiration were significantly correlated with soil temperature but not with soil water content. We conclude that the role forests play in regulating climate change may depend on their age.

alpha-particle radioactivity from LR 115 by two methods of analysis

CERN Document Server

Azkour, K; Adloff, J C; Pape, A

1999-01-01

LR115 track detectors were exposed to samples of Moroccan phosphate and phosphogypsum to measure their alpha-particle radioactivity. Then two formalisms were used for the dosimetry: simulation by a Monte Carlo method and determination of concentrations from a numerically integrated track registration equation. The results were compared with those deduced gamma-ray spectrometry.

WWER safety investigations on LR-0 reactor

International Nuclear Information System (INIS)

Mikus, J.

2001-01-01

A set of the measurement needed for the WWER-440 and WWER-1000 reactor lifetime assessment, verification of the methods, codes and input cross section libraries for the WWER reactor pressure vessel exposure evaluation has been performed on the LR-0 experimental reactor. The WWER Mock-ups (engineering benchmarks) has been carried out on the reactor, with the aim to investigate differential neutron spectra for reactor dosimetry purposes. Critical experiments have also been performed to determine the perturbation of the fission density distribution caused by the WWER-440 control assembly. Such assembly, partially inserted in the core, has significant influence on the space power distribution. A wide research program for sub-criticality investigations of the spent nuclear fuel storage has been realized on the LR-0 reactor. A benchmark experiment is realized on the reactor in corresponding geometry for CASTOR 440/84 container for storage and transportation of spent fuel. Critical experiments with new fuel assemblies including various burnable absorbers and different enrichments are performed. A set of critical experiments is performed using the fuel assemblies with 3,6% and 4,4% enrichment, arranged in the WWER-440 type cores with various lattice pitch. The critical high of the moderator level and the moderator level coefficient of reactivity are measured and the effect of the fuel assembly, placed in a hexagonal tube of stainless steel containing boron absorber (ATABOR - STANDARD) is investigated. The obtained results are used for the validation of the codes (MCNP, KENO and SCALE) in the frame of the contract 'Burn-up credit implementation for the storage and transport containers of the spent fuel'. Combined neutron-gamma spectra measurements in the WWER-1000 Mock-up are carried out during 2001

Effects of respirator use on worker performance

Energy Technology Data Exchange (ETDEWEB)

Cardarelli, R. [Yankee Atomic Electric Co., Bolton, MA (United States)

1995-03-01

In 1993, EPRI funded Yankee Atomic Electric Company to examine the effects of respirator use on worker efficiency. Phase I of Yankee`s effort was to develop a study design to determine respirator effects. Given success in Phase I, a larger population will be tested to determine if a stasitically significant respirator effect on performance can be measured. This paper summarizes the 1993 EPRI/Yankee Respirator Effects of Pilot Study, and describes the study design for the 1994 EPRI/Yankee Respirator Study to be conducted at the Oyster Creek Nuclear Power Plant. Also described is a summary of respirator effect studies that have been conducted during the last ten (10) years.

Kinetic and mechanistic study of microcystin-LR degradation by nitrous acid under ultraviolet irradiation

International Nuclear Information System (INIS)

Ma, Qingwei; Ren, Jing; Huang, Honghui; Wang, Shoubing; Wang, Xiangrong; Fan, Zhengqiu

2012-01-01

Highlights: ► For the first time, degradation of MC-LR by nitrous acid under UV 365 nm was discovered. ► The effects of factors on MC-LR degradation were analyzed based on kinetic study. ► Mass spectrometry was applied for identification of intermediates and products. ► Special intermediates involved in this study were identified. ► Degradation mechanisms were proposed according to the results of LC–MS analysis. - Abstract: Degradation of microcystin-LR (MC-LR) in the presence of nitrous acid (HNO 2 ) under irradiation of 365 nm ultraviolet (UV) was studied for the first time. The influence of initial conditions including pH value, NaNO 2 concentration, MC-LR concentration and UV intensity were studied. MC-LR was degraded in the presence of HNO 2 ; enhanced degradation of MC-LR was observed with 365 nm UV irradiation, caused by the generation of hydroxyl radicals through the photolysis of HNO 2 . The degradation processes of MC-LR could well fit the pseudo-first-order kinetics. Mass spectrometry was applied for identification of the byproducts and the analysis of degradation mechanisms. Major degradation pathways were proposed according to the results of LC–MS analysis. The degradation of MC-LR was initiated via three major pathways: attack of hydroxyl radicals on the conjugated carbon double bonds of Adda, attack of hydroxyl radicals on the benzene ring of Adda, and attack of nitrosonium ion on the benzene ring of Adda.

Kinetic and mechanistic study of microcystin-LR degradation by nitrous acid under ultraviolet irradiation.

Science.gov (United States)

Ma, Qingwei; Ren, Jing; Huang, Honghui; Wang, Shoubing; Wang, Xiangrong; Fan, Zhengqiu

2012-05-15

Degradation of microcystin-LR (MC-LR) in the presence of nitrous acid (HNO(2)) under irradiation of 365nm ultraviolet (UV) was studied for the first time. The influence of initial conditions including pH value, NaNO(2) concentration, MC-LR concentration and UV intensity were studied. MC-LR was degraded in the presence of HNO(2); enhanced degradation of MC-LR was observed with 365nm UV irradiation, caused by the generation of hydroxyl radicals through the photolysis of HNO(2). The degradation processes of MC-LR could well fit the pseudo-first-order kinetics. Mass spectrometry was applied for identification of the byproducts and the analysis of degradation mechanisms. Major degradation pathways were proposed according to the results of LC-MS analysis. The degradation of MC-LR was initiated via three major pathways: attack of hydroxyl radicals on the conjugated carbon double bonds of Adda, attack of hydroxyl radicals on the benzene ring of Adda, and attack of nitrosonium ion on the benzene ring of Adda. Copyright © 2012 Elsevier B.V. All rights reserved.

Radon measurement by Solid States Nuclear Tracks Detectors (SSNTD/LR-115) in the city of Cocody (Abidjan)

International Nuclear Information System (INIS)

Agba, Dabo Salif Ignace

2011-02-01

Radon as natural gas is permanently present in our environment. It is the main natural radiological exposure source for human beings. So, the study of the concentration of this rare gas is essential in order to evaluate the risks incured by the population and the environment. The results of different studies will guide as to take the appropriate protection decisions as recommended by the World Health Organization (WHO). The present work consists in measuring the concentration of radon (Rn 222 isotope) in seven (7) pre-selected sites in the city of Cocody (Abidjan) using SSNTD/LR-115 (photographic film detectors). Our measurements showed some variations in the concentration of radon according to seasons and the influence of main factors such as the porosity, humidity and the diameter of the specks of soil. We noticed that our measured values remain very low compared to international standards. This work is the first step for more important measurements throughout the whole ivorian territory. The aim is to draw a national cartography of radon in Cote d'Ivoire. [fr

The wheat resistance gene Lr34 results in the constitutive induction of multiple defense pathways in transgenic barley.

Science.gov (United States)

Chauhan, Harsh; Boni, Rainer; Bucher, Rahel; Kuhn, Benjamin; Buchmann, Gabriele; Sucher, Justine; Selter, Liselotte L; Hensel, Goetz; Kumlehn, Jochen; Bigler, Laurent; Glauser, Gaëtan; Wicker, Thomas; Krattinger, Simon G; Keller, Beat

2015-10-01

The wheat gene Lr34 encodes an ABCG-type transporter which provides durable resistance against multiple pathogens. Lr34 is functional as a transgene in barley, but its mode of action has remained largely unknown both in wheat and barley. Here we studied gene expression in uninfected barley lines transgenic for Lr34. Genes from multiple defense pathways contributing to basal and inducible disease resistance were constitutively active in seedlings and mature leaves. In addition, the hormones jasmonic acid and salicylic acid were induced to high levels, and increased levels of lignin as well as hordatines were observed. These results demonstrate a strong, constitutive re-programming of metabolism by Lr34. The resistant Lr34 allele (Lr34res) encodes a protein that differs by two amino acid polymorphisms from the susceptible Lr34sus allele. The deletion of a single phenylalanine residue in Lr34sus was sufficient to induce the characteristic Lr34-based responses. Combination of Lr34res and Lr34sus in the same plant resulted in a reduction of Lr34res expression by 8- to 20-fold when the low-expressing Lr34res line BG8 was used as a parent. Crosses with the high-expressing Lr34res line BG9 resulted in an increase of Lr34sus expression by 13- to 16-fold in progenies that inherited both alleles. These results indicate an interaction of the two Lr34 alleles on the transcriptional level. Reduction of Lr34res expression in BG8 crosses reduced the negative pleiotropic effects of Lr34res on barley growth and vigor without compromising disease resistance, suggesting that transgenic combination of Lr34res and Lr34sus can result in agronomically useful resistance. © 2015 The Authors The Plant Journal © 2015 John Wiley & Sons Ltd.

Quantitative evaluation of the protective effect of respirators

International Nuclear Information System (INIS)

Murata, Mikio

1983-01-01

The present status and related problems of the quantitative evaluation method for respirator efficiency are generally reviewed. As the introduction, the special features of various types of respirators are summarized, and the basic concept of leakage and the protection factor are explained. As for the quantitative measurement of the protective efficiency, the features of various existing man-test methods such as NaCl aerosol man-test, DOP (dioctyl phthalate) man-test, and SF 6 gas man-test are reviewed and discussed. As the important problems associated with those man-tests, the following aspects are discussed. The measurement of the aerosol concentration within masks; the calculation method for the protection factor; the effect of beards. The examples of measuring the protection factor are also explained for the following respirator systems: half mask respirator with a high efficiency filter; full face mask respirator with a high efficiency filter; demand mode and pressure-demand mode respirators; and mound suit with suspenders. Finally, the outline of the manual of respiratory protection published by NRC in 1976 is briefly reviewed. (Aoki, K.)

Simplified pressure method for respirator fit testing.

Science.gov (United States)

Han, D; Xu, M; Foo, S; Pilacinski, W; Willeke, K

1991-08-01

A simplified pressure method has been developed for fit testing air-purifying respirators. In this method, the air-purifying cartridges are replaced by a pressure-sensing attachment and a valve. While wearers hold their breath, a small pump extracts air from the respirator cavity until a steady-state pressure is reached in 1 to 2 sec. The flow rate through the face seal leak is a unique function of this pressure, which is determined once for all respirators, regardless of the respirator's cavity volume or deformation because of pliability. The contaminant concentration inside the respirator depends on the degree of dilution by the flow through the cartridges. The cartridge flow varies among different brands and is measured once for each brand. The ratio of cartridge to leakflow is a measure of fit. This flow ratio has been measured on human subjects and has been compared to fit factors determined on the same subjects by means of photometric and particle count tests. The aerosol tests gave higher values of fit.

Intraperitoneal exposure of whitefish to microcystin-LR induces rapid liver injury followed by regeneration and resilience to subsequent exposures

Energy Technology Data Exchange (ETDEWEB)

Woźny, Maciej, E-mail: maciej.wozny@uwm.edu.pl [Department of Environmental Biotechnology, Faculty of Environmental Sciences, University of Warmia and Mazury in Olsztyn, ul. Słoneczna 45G, 10-709 Olsztyn (Poland); Lewczuk, Bogdan; Ziółkowska, Natalia [Department of Histology and Embryology, Faculty of Veterinary Medicine, University of Warmia and Mazury in Olsztyn, ul. M. Oczapowskiego 13, 10-713 Olsztyn (Poland); Gomułka, Piotr [Department of Ichthyology, Faculty of Environmental Sciences, University of Warmia and Mazury in Olsztyn, ul. M. Oczapowskiego 5, 10-719 Olsztyn (Poland); Dobosz, Stefan [Department of the Salmonid Research in Rutki, Inland Fisheries Institute in Olsztyn, Rutki, 83-330 Żukowo (Poland); Łakomiak, Alicja; Florczyk, Maciej; Brzuzan, Paweł [Department of Environmental Biotechnology, Faculty of Environmental Sciences, University of Warmia and Mazury in Olsztyn, ul. Słoneczna 45G, 10-709 Olsztyn (Poland)

2016-12-15

To date, there has been no systematic approach comprehensively describing the sequence of pathological changes in fish during prolonged exposure to microcystin-LR (MC-LR). Towards this aim, juvenile whitefish individuals received an intraperitoneal injection with pure MC-LR, and the injection was repeated every week to maintain continuous exposure for 28 days. During the exposure period, growth and condition of the fish were assessed based on biometric measurements. Additionally, selected biochemical markers were analysed in the fishes' blood, and their livers were carefully examined for morphological, ultrastructural, and molecular changes. The higher dose of MC-LR (100 μg·kg{sup −1}) caused severe liver injury at the beginning of the exposure period, whereas the lower dose (10 μg·kg{sup −1}) caused less, probably reversible injury, and its effects began to be observed later in the exposure period. These marked changes were accompanied by substantial MC-LR uptake by the liver. However, starting on the 7th day of exposure, cell debris began to be removed by phagocytes, then by 14th day, proliferation of liver cells had markedly increased, which led to reconstruction of the liver parenchyma at the end of the treatment. Surprisingly, despite weekly-repeated intraperitoneal injections, MC-LR did not accumulate over time of exposure which suggests its limited uptake in the later phase of exposure. In support, mRNA expression of the membrane transport protein oatp1d was decreased at the same time as the regenerative processes were observed. Our study shows that closing of active membrane transport may serve as one defence mechanism against further MC-LR intoxication. - Highlights: • The study presents pathological changes in whitefish during prolonged MC-LR exposure. • After early, severe injury, the damaged liver parenchyma of the fish regenerated. • Endoplasmic reticulum, cytoskeleton, and chromatin were the main targets for MC-LR. • MC-LR did not

Contribution of bacterial respiration to plankton respiration from 50°N to 44°S in the Atlantic Ocean

Science.gov (United States)

García-Martín, E. E.; Aranguren-Gassis, M.; Hartmann, M.; Zubkov, M. V.; Serret, P.

2017-11-01

Marine bacteria play an important role in the global cycling of carbon and therefore in climate regulation. However, the paucity of direct measurements means that our understanding of the magnitude and variability of bacterial respiration in the ocean is poor. Estimations of respiration in the 0.2-0.8 μm size-fraction (considered as bacterial respiration), total plankton community respiration, and the contribution of bacterial respiration to total plankton community respiration were made along two latitudinal transects in the Atlantic Ocean (ca. 50°N-44°S) during 2010 and 2011. Two different methodologies were used: determination of changes in dissolved O2 concentration after standard 24 h dark bottle incubations, and measurements of in vivo reduction of 2-(ρ-iodophenyl)-3-(ρ-nitrophenyl)-5phenyl tetrazolium salt (INT). There was an overall significant correlation (r = 0.44, p community respiration estimated by both methods. Depth-integrated community respiration varied as much as threefold between regions. Maximum rates occurred in waters of the western European shelf and Patagonian shelf, and minimum rates in the North and South oligotrophic gyres. Depth-integrated bacterial respiration followed the same pattern as community respiration. There was a significantly higher cell-specific bacterial respiration in the northern subtropical gyre than in the southern subtropical gyre which suggests that bacterial carbon turnover is faster in the northern gyre. The relationships between plankton respiration and physicochemical and biological variables were different in different years. In general, INTT was correlated to both chlorophyll-a and bacterial abundance, while INT0.2-0.8 was only correlated with bacterial abundance. However, in 2010 INTT and INT0.2-0.8 were also correlated with temperature and primary production while in 2011 they were correlated with nitrate + nitrite concentration. The bacterial contribution to depth integrated community respiration was

Kinetic and mechanistic study of microcystin-LR degradation by nitrous acid under ultraviolet irradiation

Energy Technology Data Exchange (ETDEWEB)

Ma, Qingwei; Ren, Jing [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China); Huang, Honghui [Key Laboratory of Fisheries Ecology Environment, Ministry of Agriculture, Guangzhou 510300 (China); Wang, Shoubing [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China); Wang, Xiangrong, E-mail: xrxrwang@vip.sina.com [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China); Fan, Zhengqiu, E-mail: zhqfan@fudan.edu.cn [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China)

2012-05-15

Highlights: Black-Right-Pointing-Pointer For the first time, degradation of MC-LR by nitrous acid under UV 365 nm was discovered. Black-Right-Pointing-Pointer The effects of factors on MC-LR degradation were analyzed based on kinetic study. Black-Right-Pointing-Pointer Mass spectrometry was applied for identification of intermediates and products. Black-Right-Pointing-Pointer Special intermediates involved in this study were identified. Black-Right-Pointing-Pointer Degradation mechanisms were proposed according to the results of LC-MS analysis. - Abstract: Degradation of microcystin-LR (MC-LR) in the presence of nitrous acid (HNO{sub 2}) under irradiation of 365 nm ultraviolet (UV) was studied for the first time. The influence of initial conditions including pH value, NaNO{sub 2} concentration, MC-LR concentration and UV intensity were studied. MC-LR was degraded in the presence of HNO{sub 2}; enhanced degradation of MC-LR was observed with 365 nm UV irradiation, caused by the generation of hydroxyl radicals through the photolysis of HNO{sub 2}. The degradation processes of MC-LR could well fit the pseudo-first-order kinetics. Mass spectrometry was applied for identification of the byproducts and the analysis of degradation mechanisms. Major degradation pathways were proposed according to the results of LC-MS analysis. The degradation of MC-LR was initiated via three major pathways: attack of hydroxyl radicals on the conjugated carbon double bonds of Adda, attack of hydroxyl radicals on the benzene ring of Adda, and attack of nitrosonium ion on the benzene ring of Adda.

Effects of different algaecides on the photosynthetic capacity, cell integrity and microcystin-LR release of Microcystis aeruginosa

International Nuclear Information System (INIS)

Zhou, Shiqing; Shao, Yisheng; Gao, Naiyun; Deng, Yang; Qiao, Junlian; Ou, Huase; Deng, Jing

2013-01-01

Bench scale tests were conducted to study the effects of four common algaecides, including copper sulfate, hydrogen peroxide, diuron and ethyl 2-methylacetoacetate (EMA) on the photosynthetic capacity, cell integrity and microcystin-LR (MC-LR) release of Microcystis aeruginosa. The release of potassium (K + ) from cell membrane during algaecide exposure was also analyzed. The three typical photosynthetic parameters, including the effective quantum yield (φ e ), photosynthetic efficiency (α) and maximal electron transport rate (rETR max ), were measured by a pulse amplitude modulated (PAM) fluorometry. Results showed that the photosynthetic capacity was all inhibited by the four algaecides, to different degrees, by limiting the energy capture in photosynthesis, and blocking the electron transfer chain in primary reaction. For example, at high diuron concentration (7.5 mg L −1 ), φ e , α and rETR max decreased from 0.46 to 0.19 (p −2 s −1 /μmol photons m −2 s −1 , and from 160.7 to 0.1 (p −2 s −1 compared with the control group after 96 h of exposure, respectively. Furthermore, the increase of algaecide dose could lead to the cell lysis, as well as release of intracellular MC-LR that enhanced the accumulation of extracellular MC-LR. The order of MC-LR release potential for the four algaecides was CuSO 4 > H 2 O 2 > diuron > EMA. Highlights: • PAM was used to investigate the effects of algaecides on Microcystis aeruginosa. • We estimate the release of potassium (K + ) from cell membrane for cell lysis. • The risk of microcystin-LR release was evaluated after algaecides exposure. • The order of MC-LR release potential was copper sulfate > hydrogen peroxide > diuron > ethyl 2-methylacetoacetate

The value of soil respiration measurements for interpreting and modeling terrestrial carbon cycling

Energy Technology Data Exchange (ETDEWEB)

Phillips, Claire L.; Bond-Lamberty, Ben; Desai, Ankur R.; Lavoie, Martin; Risk, Dave; Tang, Jianwu; Todd-Brown, Katherine; Vargas, Rodrigo

2016-11-16

A recent acceleration of model-data synthesis activities has leveraged many terrestrial carbon (C) datasets, but utilization of soil respiration (RS) data has not kept pace with other types such as eddy covariance (EC) fluxes and soil C stocks. Here we argue that RS data, including non-continuous measurements from survey sampling campaigns, have unrealized value and should be utilized more extensively and creatively in data synthesis and modeling activities. We identify three major challenges in interpreting RS data, and discuss opportunities to address them. The first challenge is that when RS is compared to ecosystem respiration (RECO) measured from EC towers, it is not uncommon to find substantial mismatch, indicating one or both flux methodologies are unreliable. We argue the most likely cause of mismatch is unreliable EC data, and there is an unrecognized opportunity to utilize RS for EC quality control. The second challenge is that RS integrates belowground heterotrophic (RH) and autotrophic (RA) activity, whereas modelers generally prefer partitioned fluxes, and few models include an explicit RS output. Opportunities exist to use the total RS flux for data assimilation and model benchmarking methods rather than less-certain partitioned fluxes. Pushing for more experiments that not only partition RS but also monitor the age of RA and RH, as well as for the development of belowground RA components in models, would allow for more direct comparison between measured and modeled values. The third challenge is that soil respiration is generally measured at a very different resolution than that needed for comparison to EC or ecosystem- to global-scale models. Measuring soil fluxes with finer spatial resolution and more extensive coverage, and downscaling EC fluxes to match the scale of RS, will improve chamber and tower comparisons. Opportunities also exist to estimate RH at regional scales by implementing decomposition functional types, akin to plant functional

Microcystin-LR Induces Apoptosis via NF-κB /iNOS Pathway in INS-1 Cells

Directory of Open Access Journals (Sweden)

Kai Shen

2011-07-01

Full Text Available Cyanobacterial toxins, especially the microcystins, are found in eutrophied waters throughout the world, and their potential to impact on human and animal health is a cause for concern. Microcystin-LR (MC-LR is one of the common toxic microcystin congeners and occurs frequently in diverse water systems. Recent work suggested that apoptosis plays a major role in the toxic effects induced by MC-LR in hepatocytes. However, the roles of MC-LR in pancreatic beta cells have not been fully established. The aim of the present study was to assess possible in vitro effects of MC-LR on cell apoptosis in the rat insulinoma cell line, INS-1. Our results demonstrated that MC-LR promoted selectively activation of NF-κB (increasing nuclear p50/p65 translocation and increased the mRNA and protein levels of induced nitric oxide synthase (iNOS. The chronic treatment with MC-LR stimulated nitric oxide (NO production derived from iNOS and induced apoptosis in a dose dependent manner in INS-1 cells. Meanwhile, this effect was inhibited by the NF-κB inhibitor PDTC, which reversed the apoptosis induced by MC-LR. Our observations indicate that MC-LR induced cell apoptosis via an iNOS-dependent pathway. A well-known nuclear transcription factor, NF-κB, is activated and mediates intracellular nitric oxide synthesis. We suggest that the apoptosis induced by chronic MC-LR in vivo presents a possible cause of β-cell dysfunction, as a key environmental factor in the development of diabetes mellitus.

A method for measuring losses of soil carbon by heterotrophic respiration from peat soils under oil palms

Science.gov (United States)

Farmer, Jenny; Manning, Frances; Smith, Jo; Arn Teh, Yit

2017-04-01

The effects of drainage and deforestation of South East Asian peat swamp forests for the development of oil palm plantations has received considerable attention in both mainstream media and academia, and is the source of significant discussion and debate. However, data on the long-term carbon losses from these peat soils as a result of this land use change is still limited and the methods with which to collect this data are still developing. Here we present the ongoing evolution and implementation of a method for separating autotrophic and heterotrophic respiration by sampling carbon dioxide emissions at increasing distance from palm trees. We present the limitations of the method, modelling approaches and results from our studies. In 2011 we trialled this method in Sumatra, Indonesia and collected rate measurements over a six day period in three ages of oil palm. In the four year oil palm site there were thirteen collars that had no roots present and from these the peat based carbon losses were recorded to be 0.44 g CO2 m2 hr-1 [0.34; 0.57] (equivalent to 39 t CO2 ha-1 yr-1 [30; 50]) with a mean water table depth of 0.40 m, or 63% of the measured total respiration across the plot. In the two older palm sites of six and seven years, only one collar out of 100 had no roots present, and thus a linear random effects model was developed to calculate heterotrophic emissions for different distances from the palm tree. This model suggested that heterotrophic respiration was between 37 - 59% of total respiration in the six year old plantation and 39 - 56% in the seven year old plantation. We applied this method in 2014 to a seven year old plantation, in Sarawak, Malaysia, modifying the method to include the heterotrophic contribution from beneath frond piles and weed covered areas. These results indicated peat based carbon losses to be 0.42 g CO2 m2 hr-1 [0.27;0.59] (equivalent to 37 t CO2 ha-1 yr-1 [24; 52]) at an average water table depth of 0.35 m, 47% of the measured

Mitochondrial Respiration and Oxygen Tension.

Science.gov (United States)

Shaw, Daniel S; Meitha, Karlia; Considine, Michael J; Foyer, Christine H

2017-01-01

Measurements of respiration and oxygen tension in plant organs allow a precise understanding of mitochondrial capacity and function within the context of cellular oxygen metabolism. Here we describe methods that can be routinely used for the isolation of intact mitochondria, and the determination of respiratory electron transport, together with techniques for in vivo determination of oxygen tension and measurement of respiration by both CO 2 production and O 2 consumption that enables calculation of the respiratory quotient [CO 2 ]/[O 2 ].

Oxidação de microcistinas-LR em águas pelo íon ferrato(VI Aqueous oxidation of microcystin-LR by ferrate(VI

Directory of Open Access Journals (Sweden)

Sérgio João de Luca

2010-03-01

Full Text Available Toxinas de cianobactérias têm se tornado um grave problema na produção segura de água para consumo humano e animal. Técnicas convencionais de tratamento falham em atingir padrões de potabilidade. O ferrato(VI de potássio, um composto oxidante e coagulante, mostra potencialidade no tratamento de águas contaminadas. Neste trabalho, são apresentados resultados da oxidação pelo ferrato(VI de uma toxina gerada por cianobactérias, a microcistina-LR. Ensaios de cinética de oxidação e de teste de jarros mostram um valor médio de 0,012 min-1 para a constante de taxa de reação de pseudoprimeira ordem, para concentrações de MC-LR de 100 a 200 µg.L-1 na água bruta. Dosagens de 1,6 a 5,0 mg.L-1 de ferrato(VI sugerem o atendimento ao padrão de potabilidade para microcistinas, mostrando que o oxidante poderá ser empregado como coadjuvante no tratamento de água.Algae toxins are becoming a severe problem in the water treatment industry, especially for human and animal consumption. Traditional treatment processes have failed in complying with water supply standards. Potassium ferrate(VI is a powerful oxidant, disinfectant and, also, a coagulant. In this paper, the results of microcystin-LR oxidation by ferrate(VI ion are presented. Kinetic and jar tests showed a average value of 0,012 min-1 for the pseudo first order reaction rate constant, for 100 and 200 µg.L-1 concentration of MC-LR. Ferrate(VI dosages between 1.6 and 5.0 mg.L-1 suggest that water supply standards for MC-LR can be reached, which means that the oxidant may be employed as coadjuvant in water treatment.

The wheat Lr34 multipathogen resistance gene confers resistance to anthracnose and rust in sorghum.

Science.gov (United States)

Schnippenkoetter, Wendelin; Lo, Clive; Liu, Guoquan; Dibley, Katherine; Chan, Wai Lung; White, Jodie; Milne, Ricky; Zwart, Alexander; Kwong, Eunjung; Keller, Beat; Godwin, Ian; Krattinger, Simon G; Lagudah, Evans

2017-11-01

The ability of the wheat Lr34 multipathogen resistance gene (Lr34res) to function across a wide taxonomic boundary was investigated in transgenic Sorghum bicolor. Increased resistance to sorghum rust and anthracnose disease symptoms following infection with the biotrophic pathogen Puccinia purpurea and the hemibiotroph Colletotrichum sublineolum, respectively, occurred in transgenic plants expressing the Lr34res ABC transporter. Transgenic sorghum lines that highly expressed the wheat Lr34res gene exhibited immunity to sorghum rust compared to the low-expressing single copy Lr34res genotype that conferred partial resistance. Pathogen-induced pigmentation mediated by flavonoid phytoalexins was evident on transgenic sorghum leaves following P. purpurea infection within 24-72 h, which paralleled Lr34res gene expression. Elevated expression of flavone synthase II, flavanone 4-reductase and dihydroflavonol reductase genes which control the biosynthesis of flavonoid phytoalexins characterized the highly expressing Lr34res transgenic lines 24-h post-inoculation with P. purpurea. Metabolite analysis of mesocotyls infected with C. sublineolum showed increased levels of 3-deoxyanthocyanidin metabolites were associated with Lr34res expression, concomitant with reduced symptoms of anthracnose. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Electrochemical Aptatoxisensor Responses on Nanocomposites Containing Electro-Deposited Silver Nanoparticles on Poly(Propyleneimine Dendrimer for the Detection of Microcystin-LR in Freshwater

Directory of Open Access Journals (Sweden)

Mawethu P. Bilibana

2016-11-01

Full Text Available A sensitive and reagentless electrochemical aptatoxisensor was developed on cobalt (II salicylaldiimine metallodendrimer (SDD–Co(II doped with electro-synthesized silver nanoparticles (AgNPs for microcystin-LR (L, l-leucine; R, l-arginine, or MC-LR, detection in the nanomolar range. The GCE|SDD–Co(II|AgNPs aptatoxisensor was fabricated with 5’ thiolated aptamer through self-assembly on the modified surface of the glassy carbon electrode (GCE and the electronic response was measured using cyclic voltammetry (CV. Specific binding of MC-LR with the aptamer on GCE|SDD–Co(II|AgNPs aptatoxisensor caused the formation of a complex that resulted in steric hindrance and electrostatic repulsion culminating in variation of the corresponding peak current of the electrochemical probe. The aptatoxisensor showed a linear response for MC-LR between 0.1 and 1.1 µg·L−1 and the calculated limit of detection (LOD was 0.04 µg·L−1. In the detection of MC-LR in water samples, the aptatoxisensor proved to be highly sensitive and stable, performed well in the presence of interfering analog and was comparable to the conventional analytical techniques. The results demonstrate that the constructed MC-LR aptatoxisensor is a suitable device for routine quantification of MC-LR in freshwater and environmental samples.

Measurement and Modeling of Respiration Rate of Tomato (Cultivar Roma) for Modified Atmosphere Storage.

Science.gov (United States)

Kandasamy, Palani; Moitra, Ranabir; Mukherjee, Souti

2015-01-01

Experiments were conducted to determine the respiration rate of tomato at 10, 20 and 30 °C using closed respiration system. Oxygen depletion and carbon dioxide accumulation in the system containing tomato was monitored. Respiration rate was found to decrease with increasing CO2 and decreasing O2 concentration. Michaelis-Menten type model based on enzyme kinetics was evaluated using experimental data generated for predicting the respiration rate. The model parameters that obtained from the respiration rate at different O2 and CO2 concentration levels were used to fit the model against the storage temperatures. The fitting was fair (R2 = 0.923 to 0.970) when the respiration rate was expressed as O2 concentation. Since inhibition constant for CO2 concentration tended towards negetive, the model was modified as a function of O2 concentration only. The modified model was fitted to the experimental data and showed good agreement (R2 = 0.998) with experimentally estimated respiration rate.

Photocatalytic Cellulosic Electrospun Fibers for the Degradation of Potent Cyanobacteria Toxin Microcystin-LR

Science.gov (United States)

2012-01-01

visible light activated or UV light activated), the surface area of the fiber mat, and loading solution pH all have an effect on the distribution of...photocatalysis with nanoparticles (such as titania, TiO2 ) show tremendous promise as a simple and energy efficient tech- nology for water purification and...LR (MC-LR). MC- LR is one of the most commonly found cyanobacteria toxins generated by the more frequently occurring cyanobacteria algae blooms in

A novel photocatalytic material for removing microcystin-LR under visible light irradiation: degradation characteristics and mechanisms.

Directory of Open Access Journals (Sweden)

Xin Sui

Full Text Available Microcystin-LR (MC-LR, a common toxic species in contaminated aquatic systems, persists for long periods because of its cyclic structure. Ag3PO4 is an environment-friendly photocatalyst with relatively good degradation capacity for hazardous organic pollutants. This study aimed to investigate the degradation capacity of Ag3PO4 for MC-LR under visible light.An Ag3PO4 photocatalyst was synthesized by the ion-exchange method and characterized by X-ray diffraction, field-emission scanning electron microscope, and UV-Vis spectrophotometer. MC-LR was quantified in each sample through high-performance liquid chromatograph. The degradation efficiency of MC-LR was affected by initial pH, initial Ag3PO4 concentration, initial MC-LR concentration, and recycle experiments. The degradation intermediates of MC-LR were examined by liquid chromatography-mass spectrometry (LC/MS.The degradation process can be well fitted with the pseudo-first-order kinetic model. The maximum MC-LR degradation rate of 99.98% can be obtained within 5 h under the following optimum conditions: pH of 5.01, Ag3PO4 concentration of 26.67 g/L, and MC-LR concentration of 9.06 mg/L. Nine intermediates were detected and analyzed by LC/MS. Three main degradation pathways were proposed based on the molecular weight of the intermediates and the reaction mechanism: (1 hydroxylation on the aromatic ring of Adda, (2 hydroxylation on the diene bonds of Adda, and (3 internal interactions on the cyclic structure of MC-LR.Ag3PO4 is a highly efficient catalyst for MC-LR degradation in aqueous solutions.

Comparative Studies on the pH Dependence of DOW of Microcystin-RR and -LR Using LC-MS

Directory of Open Access Journals (Sweden)

Gaodao Liang

2011-01-01

Full Text Available Microcystins (MCs are well known worldwide as hepatotoxins produced by cyanobacteria, but little is known about the physicochemical properties of these compounds. The dependence of the n-octanol/water distribution ratio (DOW of MC-RR and -LR to pH was measured by high-performance liquid chromatography combined with mass spectrometry (LC-MS. There was a remarkable difference in such relationships between MC-RR and -LR. The log DOW of MC-LR decreased from 1.63 at pH 1.0 to -1.26 at pH 6.5, and stabilized between -1.04 and -1.56 at a pH of 6.5~12.0; log DOW of MC-RR varied between -1.24 and -0.67 at a pH of 1.00~4.00, and stabilized between -1.20 and -1.54 at a pH of 4.00~12.00. The difference of hydrophobicity in acidic condition between MC-RR and -LR is important, not only for the analytical method of both toxins, but perhaps also for understanding the difference of toxicity to animals between the two toxins.

Pitavastatin attenuates the PDGF-induced LR11/uPA receptor-mediated migration of smooth muscle cells

International Nuclear Information System (INIS)

Jiang, Meizi; Bujo, Hideaki; Zhu, Yanjuan; Yamazaki, Hiroyuki; Hirayama, Satoshi; Kanaki, Tatsuro; Shibasaki, Manabu; Takahashi, Kazuo; Schneider, Wolfgang J.; Saito, Yasushi

2006-01-01

Statins, inhibitors of HMG-CoA reductase, elicit various actions on vascular cells including the modulation of proliferation and migration of smooth muscle cells (SMCs). Here, we have elucidated the mechanism by which statins, in particular pitavastatin, attenuate the migration activity of SMCs. The expression of LR11, a member of the LDL receptor family and an enhancer of cell surface localization of urokinase-type plasminogen activator receptor (uPAR), is increased in cultured SMCs by treatment with PDGF-BB. Pitavastatin attenuates the PDGF-BB -induced surface expression of LR11 and uPAR. The increased migration of SMCs observed both upon overexpression of LR11 and via stimulation of secretion of soluble LR11 is not reversed by pitavastatin. In vivo studies showed that the SMCs expressing LR11 in plaques are almost congruent with intimal cells expressing nonmuscle myosin heavy chain (SMemb). Pitavastatin reduced the expression of LR11 and SMemb, and the levels of LR11, uPAR, and SMemb in cultured intimal SMCs were reduced to those seen in medial SMCs. We propose that this statin reduces PDGF-induced migration through the attenuation of the LR11/uPAR system in SMCs. Modulation of the LR11/uPAR system with statins suggests a novel treatment strategy for atherogenesis based on suppression of intimal SMC migration

Nutrients and temperature additively increase stream microbial respiration

Science.gov (United States)

David W. P. Manning; Amy D. Rosemond; Vladislav Gulis; Jonathan P. Benstead; John S. Kominoski

2017-01-01

Rising temperatures and nutrient enrichment are co‐occurring global‐change drivers that stimulate microbial respiration of detrital carbon, but nutrient effects on the temperature dependence of respiration in aquatic ecosystems remain uncertain. We measured respiration rates associated with leaf litter, wood, and fine benthic organic matter (FBOM) across...

Effects of different algaecides on the photosynthetic capacity, cell integrity and microcystin-LR release of Microcystis aeruginosa

Energy Technology Data Exchange (ETDEWEB)

Zhou, Shiqing [State Key Laboratory of Pollution Control and Resource Reuse, Tongji University, Shanghai 200092 (China); Shao, Yisheng, E-mail: yishengshao@163.com [State Key Laboratory of Pollution Control and Resource Reuse, Tongji University, Shanghai 200092 (China); China Academy of Urban Planning and Design, Beijing 100037 (China); Gao, Naiyun [State Key Laboratory of Pollution Control and Resource Reuse, Tongji University, Shanghai 200092 (China); Deng, Yang [Department of Earth and Environmental Studies, Montclair State University, Montclair NJ 07043 (United States); Qiao, Junlian; Ou, Huase; Deng, Jing [State Key Laboratory of Pollution Control and Resource Reuse, Tongji University, Shanghai 200092 (China)

2013-10-01

Bench scale tests were conducted to study the effects of four common algaecides, including copper sulfate, hydrogen peroxide, diuron and ethyl 2-methylacetoacetate (EMA) on the photosynthetic capacity, cell integrity and microcystin-LR (MC-LR) release of Microcystis aeruginosa. The release of potassium (K{sup +}) from cell membrane during algaecide exposure was also analyzed. The three typical photosynthetic parameters, including the effective quantum yield (φ{sub e}), photosynthetic efficiency (α) and maximal electron transport rate (rETR{sub max}), were measured by a pulse amplitude modulated (PAM) fluorometry. Results showed that the photosynthetic capacity was all inhibited by the four algaecides, to different degrees, by limiting the energy capture in photosynthesis, and blocking the electron transfer chain in primary reaction. For example, at high diuron concentration (7.5 mg L{sup −1}), φ{sub e}, α and rETR{sub max} decreased from 0.46 to 0.19 (p < 0.01), from 0.20 to 0.01 (p < 0.01) μmol electrons m{sup −2} s{sup −1}/μmol photons m{sup −2} s{sup −1}, and from 160.7 to 0.1 (p < 0.001) μmol m{sup −2} s{sup −1} compared with the control group after 96 h of exposure, respectively. Furthermore, the increase of algaecide dose could lead to the cell lysis, as well as release of intracellular MC-LR that enhanced the accumulation of extracellular MC-LR. The order of MC-LR release potential for the four algaecides was CuSO{sub 4} > H{sub 2}O{sub 2} > diuron > EMA. Highlights: • PAM was used to investigate the effects of algaecides on Microcystis aeruginosa. • We estimate the release of potassium (K{sup +}) from cell membrane for cell lysis. • The risk of microcystin-LR release was evaluated after algaecides exposure. • The order of MC-LR release potential was copper sulfate > hydrogen peroxide > diuron > ethyl 2-methylacetoacetate.

Effect of Acupuncture at LR3 on Cerebral Glucose Metabolism in a Rat Model of Hypertension: A 18F-FDG-PET Study

Directory of Open Access Journals (Sweden)

Jing Li

2018-01-01

Full Text Available Our objective was to investigate the effect of acupuncture at LR3 on cerebral glucose metabolism in spontaneously hypertensive rats (SHRs. We used 18F-2-fluoro-deoxy-D-glucose positron emission tomography (18F-FDG-PET to examine the effects of acupuncture at LR3 on cerebral glucose metabolism in SHRs. SHRs were randomly allocated to receive no treatment (SHR group, needling at LR3 (SHR + LR3 group, or sham needling (SHR + sham group. Rats received 10 min acupuncture once per day for 7 days and were compared to normotensive Wistar Kyoto (WKY rats. Blood pressure (BP measurement and PET were performed after the first needling and the 7-day treatment period. BP was lower in the SHR + LR3 group compared to the other SHR groups between 30 and 60 min after the first needling and at 24 and 48 h after the 7-day treatment period. Glucose metabolism in the motor, sensory, and visual cortices was decreased in SHR group compared to WKY group. Needling at LR3 was associated with decreased glucose metabolism in the dorsal thalamus, thalamus, and hypothalamus and with increased metabolism in the cerebellar anterior and posterior lobes, medulla oblongata, and sensory cortex compared to the SHR group. These findings suggest that LR3 acupuncture improves hypertension through a mechanism involving altered brain activation in SHRs.

Homogeneous time-resolved fluoroimmunoassay of microcystin-LR using layered WS2 nanosheets as a transducer

Science.gov (United States)

Qin, Xiaodan; Wang, Yuanxiu; Song, Bo; Wang, Xin; Ma, Hua; Yuan, Jingli

2017-06-01

A homogeneous time-resolved fluoroimmunoassay method for rapid and sensitive detection of microcystin-LR (MC-LR) in water samples was developed based on the interaction between water-soluble WS2 nanosheets and the conjugate of MC-LR with a luminescent Eu3+ complex BHHBCB-Eu3+ (BHHBCB: 1,2-bis[4‧-(1″,1″,1″,2″,2″,3″,3″-heptafluoro-4″,6″-hexanedion-6″-yl)- benzyl]-4-chlorosulfobenzene). The large lateral dimensions and high surface areas of two-dimensional layered WS2 nanosheets enable easy adsorption of the MC-LR-BHHBCB-Eu3+ conjugate, that lead to efficient quenching of the luminescence of Eu3+ complex via energy transfer or electron transfer process. However, the addition of monoclonal anti-MC-LR antibody can induce the formation of MC-LR-BHHBCB-Eu3+/antibody immune complex, which prevents the interaction between WS2 nanosheets and MC-LR-BHHBCB-Eu3+ to result in the restoration of Eu3+ luminescence. This signal transduction mechanism made it possible for analysis of the target MC-LR in a homogeneous system. The present method has advantages of rapidity and simplicity since the B/F (bound reagent/free reagent) separation steps, the solid-phase carrier and antibody labeling or modification process are not necessary. The proposed immunosensing system displayed a wide linear range, good precision and accuracy, and comparable sensitivity with a detection limit of 0.3 μg l-1, which satisfied the World Health Organization (WHO) provisional guideline limit of 1.0 μg l-1 for MC-LR in drinking water.

Lessons from simultaneous measurements of soil respiration and net ecosystem exchange of CO2 in temperate forests

Science.gov (United States)

Renchon, A.; Pendall, E.

2017-12-01

Land-surface exchanges of CO2 play a key role in ameliorating or exacerbating climate change. The eddy-covariance method allows direct measurement of net ecosystem-atmosphere exchange of CO2 (NEE), but partitioning daytime NEE into its components - gross primary productivity (GPP) and ecosystem respiration (RE) - remains challenging. Continuous measurements of soil respiration (RS), along with flux towers, have the potential to better constrain data and models of RE and GPP. We use simultaneous half-hourly NEE and RS data to: (1) compare the short-term (fortnightly) apparent temperature sensitivity (Q10) of nighttime RS and RE; (2) assess whether daytime RS can be estimated using nighttime response functions; and (3) compare the long-term (annual) responses of nighttime RS and nighttime RE to interacting soil moisture and soil temperature. We found that nighttime RS has a lower short-term Q10 than nighttime RE. This suggests that the Q10 of nighttime RE is strongly influenced by the Q10 of nighttime above-ground respiration, or possibly by a bias in RE measurements. The short-term Q10 of RS and RE decreased with increasing temperature. In general, daytime RS could be estimated using nighttime RS temperature and soil moisture (r2 = 0.9). However, this results from little to no diurnal variation in RS, and estimating daytime RS as the average of nighttime RS gave similar results (r2 = 0.9). Furthermore, we observed a day-night hysteresis of RS response to temperature, especially when using air temperature and sometimes when using soil temperature at 5cm depth. In fact, during some months, soil respiration observations were lower during daytime compared to nighttime, despite higher temperature in daytime. Therefore, daytime RS modelled from nighttime RS temperature response was overestimated during these periods. RS and RE responses to the combination of soil moisture and soil temperature were similar, and consistent with the DAMM model of soil-C decomposition. These

BOREAS TE-5 Soil Respiration Data

Science.gov (United States)

Hall, Forrest G. (Editor); Curd, Shelaine (Editor); Ehleriinger, Jim; Brooks, J. Renee; Flanagan, Larry

2000-01-01

The BOREAS TE-5 team collected measurements in the NSA and SSA on gas exchange, gas composition, and tree growth. Soil respiration data were collected from 26-May-94 to 07-Sep-94 in the BOREAS NSA and SSA to compare the soil respiration rates in different forest sites using a LI-COR 6200 soil respiration chamber (model 6299). The data are stored in tabular ASCII files. The data files are available on a CD-ROM (see document number 20010000884), or from the Oak Ridge National Laboratory (ORNL) Distrobuted Activity Archive Center (DAAC).

Adsorption of microcystin-LR on mesoporous carbons and its potential use in drinking water source.

Science.gov (United States)

Park, Jeong-Ann; Jung, Sung-Mok; Yi, In-Geol; Choi, Jae-Woo; Kim, Song-Bae; Lee, Sang-Hyup

2017-06-01

Microcystin-LR (MC-LR) is a common toxin derived from cyanobacterial blooms an effective, rapid and non-toxic method needs to be developed for its removal from drinking water treatment plants (DWTP). For an adsorption-based method, mesoporous carbon can be a promising supplemental adsorbent. The effect of mesoporous carbon (MC1, MC2, and MC3) properties and water quality parameters on the adsorption of MC-LR were investigated and the results were analyzed by kinetic, isotherm, thermodynamic, Derjaguin-Landau-Verwey-Overbeek (DLVO), and intraparticle diffusion models. MC1 was the most appropriate type for the removal of MC-LR with a maximum adsorption capacity of 35,670.49 μg/g. Adsorption of MC-LR is a spontaneous reaction dominated by van der Waals interactions. Pore sizes of 8.5-14 nm enhance the pore diffusion of MC-LR from the surface to the mesopores of MC1. The adsorption capacity was not sensitive to changes in the pH (3.2-8.0) and the existence of organic matter (2-5 mg/L). Furthermore, the final concentration of MC-LR was below the WHO guideline level after a 10-min reaction with 20 mg/L of MC1 in the Nak-Dong River, a drinking water source. The MC-LR adsorption mainly competed with humic substances (500-1000 g/mole); however, they did not have a great effect on adsorption. Copyright © 2017. Published by Elsevier Ltd.

Crystallization and preliminary crystallographic analysis of human LR11 Vps10p domain

International Nuclear Information System (INIS)

Nakata, Zenzaburo; Nagae, Masamichi; Yasui, Norihisa; Bujo, Hideaki; Nogi, Terukazu; Takagi, Junichi

2010-01-01

LR11/sorLA contains in its extracellular region a large (∼700-residue) Vps10p domain that is implicated in its intracellular protein-trafficking function. Here, the expression, purification, crystallization and preliminary crystallographic characterization of this domain are described. Low-density lipoprotein receptor (LDLR) relative with 11 binding repeats (LR11; also known as sorLA) is genetically associated with late-onset Alzheimer’s disease and is thought to be involved in neurodegenerative processes. LR11 contains a vacuolar protein-sorting 10 protein (Vps10p) domain. As this domain has been implicated in protein–protein interaction in other receptors, its structure and function are of great biological interest. Human LR11 Vps10p domain was expressed in mammalian cells and the purified protein was crystallized using the hanging-drop vapour-diffusion method. Enzymatic deglycosylation of the sample was critical to obtaining diffraction-quality crystals. Deglycosylated LR11 Vps10p-domain crystals belonged to the hexagonal space group P6 1 22. A diffraction data set was collected to 2.4 Å resolution and a clear molecular-replacement solution was obtained

Measuring oxygen uptake in fishes with bimodal respiration.

Science.gov (United States)

Lefevre, S; Bayley, M; McKenzie, D J

2016-01-01

Respirometry is a robust method for measurement of oxygen uptake as a proxy for metabolic rate in fishes, and how species with bimodal respiration might meet their demands from water v. air has interested researchers for over a century. The challenges of measuring oxygen uptake from both water and air, preferably simultaneously, have been addressed in a variety of ways, which are briefly reviewed. These methods are not well-suited for the long-term measurements necessary to be certain of obtaining undisturbed patterns of respiratory partitioning, for example, to estimate traits such as standard metabolic rate. Such measurements require automated intermittent-closed respirometry that, for bimodal fishes, has only recently been developed. This paper describes two approaches in enough detail to be replicated by the interested researcher. These methods are for static respirometry. Measuring oxygen uptake by bimodal fishes during exercise poses specific challenges, which are described to aid the reader in designing experiments. The respiratory physiology and behaviour of air-breathing fishes is very complex and can easily be influenced by experimental conditions, and some general considerations are listed to facilitate the design of experiments. Air breathing is believed to have evolved in response to aquatic hypoxia and, probably, associated hypercapnia. The review ends by considering what realistic hypercapnia is, how hypercapnic tropical waters can become and how this might influence bimodal animals' gas exchange. © 2015 The Fisheries Society of the British Isles.

Life-cycle exposure to microcystin-LR interferes with the reproductive endocrine system of male zebrafish.

Science.gov (United States)

Su, Yujing; Li, Li; Hou, Jie; Wu, Ning; Lin, Wang; Li, Guangyu

2016-06-01

Recently, MC-LR reproductive toxicity drew great attention. Limited information was available on endocrine-disrupting effects of MC-LR on the reproduction system in fish. In the present study, zebrafish hatchlings (5 d post-fertilization) were exposed to 0, 0.3, 3 and 30μg/L MC-LR for 90 d until they reached sexual maturity. Male zebrafish were selected, and changes in growth and developmental parameters, testicular histological structure as well as the levels of gonadal steroid hormones were studied along with the related-gene transcriptional responses in the hypothalamic-pituitary-gonadal axis (HPG-axis). The results, for the first time, show a life cycle exposure to MC-LR causes growth inhibition, testicular damage and delayed sperm maturation. A significant decrease in T/E2 ratio indicated that MC-LR disrupted sex steroid hormones balance. The changes in transcriptional responses of HPG-axis related genes revealed that MC-LR promoted the conversion of T to E2 in circulating blood. It was also noted that vtg1 mRNA expression in the liver was up-regulated, which implied that MC-LR could induce estrogenic-like effects at environmentally relevant concentrations and long-term exposure. Our findings indicated that a life cycle exposure to MC-LR causes endocrine disruption with organic and functional damage of the testis, which might compromise the quality of life for the survivors and pose a potent threat on fish reproduction and thus population dynamics in MCs-contaminated aquatic environments. Copyright © 2016 Elsevier B.V. All rights reserved.

Detoxification of microcystin-LR in water by Portulaca oleracea cv.

Science.gov (United States)

Isobe, Takatoshi; Okuhata, Hiroshi; Miyasaka, Hitoshi; Jeon, Bong-Seok; Park, Ho-Dong

2014-03-01

Microcystin-LR (0.02 μg/ml) in the hydroculture medium of Portulaca oleracea cv., became below the detection level (<0.0001 μg/ml) by HPLC analysis after 7 days. The toxicity of microcystin estimated with protein phosphatase inhibition assay, however, remained at 37% of the initial level, indicating that microcystin-LR was transformed by P. oleracea cv. into unknown compound(s) of lower toxicity. Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Two Proximal Skin Electrodes — A Respiration Rate Body Sensor

Directory of Open Access Journals (Sweden)

Viktor Avbelj

2012-10-01

Full Text Available We propose a new body sensor for extracting the respiration rate based on the amplitude changes in the body surface potential differences between two proximal body electrodes. The sensor could be designed as a plaster-like reusable unit that can be easily fixed onto the surface of the body. It could be equipped either with a sufficiently large memory for storing the measured data or with a low-power radio system that can transmit the measured data to a gateway for further processing. We explore the influence of the sensor’s position on the quality of the extracted results using multi-channel ECG measurements and considering all the pairs of two neighboring electrodes as potential respiration-rate sensors. The analysis of the clinical measurements, which also include reference thermistor-based respiration signals, shows that the proposed approach is a viable option for monitoring the respiration frequency and for a rough classification of breathing types. The obtained results were evaluated on a wireless prototype of a respiration body sensor. We indicate the best positions for the respiration body sensor and prove that a single sensor for body surface potential difference on proximal skin electrodes can be used for combined measurements of respiratory and cardiac activities.

Direct determination of bulk etching rate for LR-115-II solid state ...

Indian Academy of Sciences (India)

The thickness of the removed layer of the LR-115-II solid state nuclear track detector during etching is measured directly with a rather precise instrument. Dependence of bulk etching rate on temperature of the etching solution is investigated. It has been found that the bulk etching rate is 3.2 m/h at 60°C in 2.5 N NaOH of ...

Main: 1LR5 [RPSD[Archive

Lifescience Database Archive (English)

Full Text Available Aux311; Zea Mays Molecule: Auxin Binding Protein 1; Chain: A, B, C, D; Engineered: Yes; Mutation: Yes Protei...-.|EMBL; L08425; AAA33430.1; -.|PIR; S16262; S16262.|PDB; 1LR5; X-ray; A/B/C/D=39-201.|PDB; 1LRH; X-ray; A/B/C/D=39-201.|Mai

A simple highly sensitive and selective aptamer-based colorimetric sensor for environmental toxins microcystin-LR in water samples.

Science.gov (United States)

Li, Xiuyan; Cheng, Ruojie; Shi, Huijie; Tang, Bo; Xiao, Hanshuang; Zhao, Guohua

2016-03-05

A simple and highly sensitive aptamer-based colorimetric sensor was developed for selective detection of Microcystin-LR (MC-LR). The aptamer (ABA) was employed as recognition element which could bind MC-LR with high-affinity, while gold nanoparticles (AuNPs) worked as sensing materials whose plasma resonance absorption peaks red shifted upon binding of the targets at a high concentration of sodium chloride. With the addition of MC-LR, the random coil aptamer adsorbed on Au NPs altered into regulated structure to form MC-LR-aptamer complexes and broke away from the surface of Au NPs, leading to the aggregation of AuNPs, and the color converted from red to blue due to the interparticle plasmon coupling. Results showed that our aptamer-based colorimetric sensor exhibited rapid and sensitive detection performance for MC-LR with linear range from 0.5 nM to 7.5 μM and the detection limit reached 0.37 nM. Meanwhile, the pollutants usually coexisting with MC-LR in pollutant water samples had not demonstrated disturbance for detecting of MC-LR. The mechanism was also proposed suggesting that high affinity interaction between aptamer and MC-LR significantly enhanced the sensitivity and selectivity for MC-LR detection. Besides, the established method was utilized in analyzing real water samples and splendid sensitivity and selectivity were obtained as well. Copyright © 2015 Elsevier B.V. All rights reserved.

Dynamics of microcystins-LR and -RR in the phytoplanktivorous silver carp in a sub-chronic toxicity experiment

International Nuclear Information System (INIS)

Xie Liqiang; Xie Ping; Ozawa, Kazuhiko; Honma, Takamitsu; Yokoyama, Atsushi; Park, Ho-Dong

2004-01-01

A sub-chronic toxicity experiment was conducted to examine tissue distribution and depuration of two microcystins (microcystin-LR and microcystin -RR) in the phytoplanktivorous filter-feeding silver carp during a course of 80 days. Two large tanks (A, B) were used, and in Tank A, the fish were fed naturally with fresh Microcystis viridis cells (collected from a eutrophic pond) throughout the experiment, while in Tank B, the food of the fish were M. viridis cells for the first 40 days and then changed to artificial carp feed. High Performance Liquid Chromatography (HPLC) was used to measure MC-LR and MC-RR in the M. viridis cells, the seston, and the intestine, blood, liver and muscle tissue of silver carp at an interval of 20 days. MC-RR and MC-LR in the collected Microcystis cells varied between 268-580 and 110-292 μg g -1 DW, respectively. In Tank A, MC-RR and MC-LR varied between 41.5-99.5 and 6.9-15.8 μg g -1 DW in the seston, respectively. The maximum MC-RR in the blood, liver and muscle of the fish was 49.7, 17.8 and 1.77 μg g -1 DW, respectively. No MC-LR was detectable in the muscle and blood samples of the silver carp in spite of the abundant presence of this toxin in the intestines (for the liver, there was only one case when a relatively minor quantity was detected). These findings contrast with previous experimental results on rainbow trout. Perhaps silver carp has a mechanism to degrade MC-LR actively and to inhibit MC-LR transportation across the intestines. The depuration of MC-RR concentrations occurred slowly than uptakes in blood, liver and muscle, and the depuration rate was in the order of blood>liver>muscle. The grazing ability of silver carp on toxic cyanobacteria suggests an applicability of using phytoplanktivorous fish to counteract cyanotoxin contamination in eutrophic waters. - Silver carp are tolerant of cyanobacterial toxins, and might be used to control toxic algal blooms in highly eutrophic lakes

Track counting and thickness measurement of LR115 radon detectors using a commercial image scanner

International Nuclear Information System (INIS)

De Cicco, F.; Pugliese, M.; Roca, V.; Sabbarese, C.

2014-01-01

An original optical method for track counting and film thickness determination of etched LR115 radon detectors was developed. The method offers several advantages compared with standard techniques. In particular, it is non-destructive, very simple and rather inexpensive, since it uses a commercial scanner and a free software. The complete analysis and the calibration procedure carried out for the determination of radon specific activity are reported. A comparison with the results of spark counting defines the accuracy and the precision of the new technique. (authors)

Development of an ELISA and Immunochromatographic Strip for Highly Sensitive Detection of Microcystin-LR

Directory of Open Access Journals (Sweden)

Liqiang Liu

2014-08-01

Full Text Available A monoclonal antibody for microcystin–leucine–arginine (MC-LR was produced by cell fusion. The immunogen was synthesized in two steps. First, ovalbumin/ bovine serum albumin was conjugated with 6-acetylthiohexanoic acid using a carbodiimide EDC (1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride/ NHS (N-hydroxysulfosuccinimide reaction. After dialysis, the protein was reacted with MC-LR based on a free radical reaction under basic solution conditions. The protein conjugate was used for immunization based on low volume. The antibodies were identified by indirect competitive (icELISA and were subjected to tap water and lake water analysis. The concentration causing 50% inhibition of binding of MC-LR (IC50 by the competitive indirect ELISA was 0.27 ng/mL. Cross-reactivity to the MC-RR, MC-YR and MC-WR was good. The tap water and lake water matrices had no effect on the detection limit. The analytical recovery of MC-LR in the water samples in the icELISA was 94%–110%. Based on this antibody, an immunochromatographic biosensor was developed with a cut-off value of 1 ng/mL, which could satisfy the requirement of the World Health Organization for MC-LR detection in drinking water. This biosensor could be therefore be used as a fast screening tool in the field detection of MC-LR.

Microcystin-LR induces anoikis resistance to the hepatocyte uptake transporter OATP1B3-expressing cell lines

International Nuclear Information System (INIS)

Takano, Hiroyuki; Takumi, Shota; Ikema, Satoshi; Mizoue, Nozomi; Hotta, Yuki; Shiozaki, Kazuhiro; Sugiyama, Yasumasa; Furukawa, Tatsuhiko; Komatsu, Masaharu

2014-01-01

Microcystin-LR is a cyclic peptide released by several bloom-forming cyanobacteria. Understanding the mechanism of microcystin-LR toxicity is important, because of the both potencies of its acute cytotoxicity and tumor-promoting activity in hepatocytes of animals and humans. Recently, we have reported that the expression of human hepatocyte uptake transporter OATP1B3 was critical for the selective uptake of microcystin-LR into hepatocytes and for induction of its fatal cytotoxicity. In this study, we demonstrated a novel function of microcystin-LR which induced bipotential changes including anoikis resistance and cytoskeleton reorganization to OATP1B3-transfected HEK293 cells (HEK293-OATP1B3). After exposure to microcystin-LR, HEK293-OATP1B3 cells were divided to the floating cells and remaining adherent cells. After collection and reseeding the floating cells into a fresh flask, cells were confluently proliferated (HEK293-OATP1B3-FL) under the microcystin-LR-free condition. Both the proliferated HEK293-OATP1B3-FL and remaining adherent HEK293-OATP1B3-AD cells changed the character with down- and up-regulation of E-cadherin, respectively. Additionally, these cells acquired resistance to microcystin-LR. These results suggest that microcystin-LR could be associated with not only tumor promotion, but also epithelial–mesenchymal transition-mediated cancer metastasis. Furthermore, microcystin-LR might induce the cytoskeleton reorganization be accompanied epithelial–mesenchymal transition

Analysis of WRKY transcription factors and characterization of two Botrytis cinerea-responsive LrWRKY genes from Lilium regale.

Science.gov (United States)

Cui, Qi; Yan, Xiao; Gao, Xue; Zhang, Dong-Mei; He, Heng-Bin; Jia, Gui-Xia

2018-06-01

A major constraint in producing lilies is gray mold caused by Botrytis elliptica and B. cinerea. WRKY transcription factors play important roles in plant immune responses. However, limited information is available about the WRKY gene family in lily plants. In this study, 23 LrWRKY genes with complete WRKY domains were identified from the Botrytis-resistant species Lilium regale. The putative WRKY genes were divided into seven subgroups (Group I, IIa-e, and III) according to their structural features. Sequence alignment revealed that LrWRKY proteins have a highly conserved WRKYGQK domain and a variant, the WRKYGKK domain, and these proteins generally contained similar motif compositions throughout the same subgroup. Functional annotation predicted they might be involved in biological processes related to abiotic and biotic stresses. A qRT-PCR analysis confirmed that expression of six LrWRKY genes in L. regale or the susceptible Asian hybrid 'Yale' was induced by B. cinerea infection. Among these genes, LrWRKY4, LrWRKY8 and LrWRKY10 were expressed at a higher level in L. regale than 'Yale', while the expression of LrWRKY6 and LrWRKY12 was lower in L. regale. Furthermore, LrWRKY4 and LrWRKY12 genes, which also respond to salicylic acid (SA) and methyl jasmonate (MeJA) treatments, were isolated from L. regale. Subcellular localization analysis determined that they were targeted to the nucleus. Constitutive expression of LrWRKY4 and LrWRKY12 in Arabidopsis resulted in plants that were more resistant to B. cinerea than wild-type plants. This resistance was coupled with the transcriptional changes of SA and JA-responsive genes. Overall, our study provides valuable information about the structural and functional characterization of LrWRKY genes that will not only deepen our understanding of the molecular mechanisms underlying the defense of lily against B. cinerea but also offer potential targets for cultivar improvement via biotechnology. Copyright © 2018 Elsevier Masson

IRT-LR-DIF with Estimation of the Focal-Group Density as an Empirical Histogram

Science.gov (United States)

Woods, Carol M.

2008-01-01

Item response theory-likelihood ratio-differential item functioning (IRT-LR-DIF) is used to evaluate the degree to which items on a test or questionnaire have different measurement properties for one group of people versus another, irrespective of group-mean differences on the construct. Usually, the latent distribution is presumed normal for both…

[Effects of management regime on soil respiration from agroecosystems].

Science.gov (United States)

Chen, Shu-tao; Zhu, Da-wei; Niu, Chuan-po; Zou, Jian-wen; Wang, Chao; Sun, Wen-juan

2009-10-15

In order to examine the effects of management regime, such as nitrogen application and plowing method, on soil respiration from farmland, the static opaque chamber-gas chromatograph method was used to measure soil CO2 fluxes in situ. The field measurement was carried out for 5 growing seasons, which were the 2002-2003 wheat, 2003 maize and soybean, 2003-2004 wheat, 2004 maize and 2004-2005 wheat seasons. Our results showed that soil respiration increased in fertilizer-applied treatments compared with no fertilizer treatment after 3 times of fertilizer application on 9 November 2002, 14 February and 26 March 2003. And the most obvious increase appeared following the third fertilizer application. No significant difference in soil respiration was found among several fertilizer application treatments. The effect of plowing depth on soil respiration was contingent on preceding cropping practice. Over the 2003-2004 wheat-growing seasons (its preceding cropping practice was rice paddy), mean soil respiration rates were not significant different (p > 0.05) between no plowing treatment and shallow plowing treatment. The shallow plowing treatment CT2 led to higher soil CO2 losses compared with no plowing treatment of NT2 in the 2004 maize-growing season, however, the significant higher (p soil respiration rates occurred with no plowing treatment of NT3 in the following 2004-2005 wheat-growing season. Intensive plowing (25 cm depth), compared with no plowing practice (NT4), increased soil respiration significantly during the 2004-2005 wheat-growing season. Regression analysis showed that the exponential function could be employed to fit the relationship between soil respiration and temperature. The exponential relationship yielded the Q10 values which were varied from 1.26 to 3.60, with a mean value of 2.08. To evaluate the effect of temperature on soil respiration, the CO2 emission fluxes were normalized for each treatment and each crop growing season. Plotting the

Chronic exposure to microcystin-LR affected mitochondrial DNA maintenance and caused pathological changes of lung tissue in mice

International Nuclear Information System (INIS)

Li, Xinxiu; Xu, Lizhi; Zhou, Wei; Zhao, Qingya; Wang, Yaping

2016-01-01

Microcystin-LR (MC-LR), an important variant of cyanotoxin family, was frequently encountered in the contaminated aquatic environment and taken as a potent hepatotoxin. However, a little was known on the association between the long-term MC-LR exposure and lung damage. In this study, we investigated the changes of the pulmonary histopathology, mitochondrial DNA (mtDNA) integrity and the expression of mtDNA encoded genes in the mice with chronic exposed to MC-LR at different concentrations (1, 5, 10, 20 and 40 μg/L) for 12 months. Our results showed that the long-term and persistent exposure to MC-LR disturbed the balance of redox system, influenced mtDNA stability, changed the expression of mitochondrial genes in the lung cells. Notably, MC-LR exposure influenced the level of inflammatory cytokines and resulted in thickening of the alveolar septa. In conclusion, chronic exposure to MC-LR affected mtDNA maintenance, and caused lung impairment in mice. - Highlights: • A simulated natural exposure to MC-LR caused the lung pathological changes. • The chronic exposure disturbed the redox system balance of lung tissue cells. • The chronic exposure impaired the mtDNA stability and mitochondria function. • The lung was one of the vulnerable organs to MC-LR exposure in mice. - Long-term exposure to MC-LR in drinking water disturbed the balance of redox system, affected mitochondrial DNA maintenance and caused lung impairment in mice.

Forest Ecosystem respiration estimated from eddy covariance and chamber measurements under high turbulence and substantial tree mortality from bark beetles

Science.gov (United States)

Speckman, Heather N.; Frank, John M.; Bradford, John B.; Miles, Brianna L.; Massman, William J.; Parton, William J.; Ryan, Michael G.

2015-01-01

Eddy covariance nighttime fluxes are uncertain due to potential measurement biases. Many studies report eddy covariance nighttime flux lower than flux from extrapolated chamber measurements, despite corrections for low turbulence. We compared eddy covariance and chamber estimates of ecosystem respiration at the GLEES Ameriflux site over seven growing seasons under high turbulence (summer night mean friction velocity (u*) = 0.7 m s−1), during which bark beetles killed or infested 85% of the aboveground respiring biomass. Chamber-based estimates of ecosystem respiration during the growth season, developed from foliage, wood and soil CO2 efflux measurements, declined 35% after 85% of the forest basal area had been killed or impaired by bark beetles (from 7.1 ±0.22 μmol m−2 s−1 in 2005 to 4.6 ±0.16 μmol m−2 s−1 in 2011). Soil efflux remained at ~3.3 μmol m−2 s−1 throughout the mortality, while the loss of live wood and foliage and their respiration drove the decline of the chamber estimate. Eddy covariance estimates of fluxes at night remained constant over the same period, ~3.0 μmol m−2 s−1 for both 2005 (intact forest) and 2011 (85% basal area killed or impaired). Eddy covariance fluxes were lower than chamber estimates of ecosystem respiration (60% lower in 2005, and 32% in 2011), but the mean night estimates from the two techniques were correlated within a year (r2 from 0.18-0.60). The difference between the two techniques was not the result of inadequate turbulence, because the results were robust to a u* filter of > 0.7 m s−1. The decline in the average seasonal difference between the two techniques was strongly correlated with overstory leaf area (r2=0.92). The discrepancy between methods of respiration estimation should be resolved to have confidence in ecosystem carbon flux estimates.

Forest ecosystem respiration estimated from eddy covariance and chamber measurements under high turbulence and substantial tree mortality from bark beetles.

Science.gov (United States)

Speckman, Heather N; Frank, John M; Bradford, John B; Miles, Brianna L; Massman, William J; Parton, William J; Ryan, Michael G

2015-02-01

Eddy covariance nighttime fluxes are uncertain due to potential measurement biases. Many studies report eddy covariance nighttime flux lower than flux from extrapolated chamber measurements, despite corrections for low turbulence. We compared eddy covariance and chamber estimates of ecosystem respiration at the GLEES Ameriflux site over seven growing seasons under high turbulence [summer night mean friction velocity (u*) = 0.7 m s(-1)], during which bark beetles killed or infested 85% of the aboveground respiring biomass. Chamber-based estimates of ecosystem respiration during the growth season, developed from foliage, wood, and soil CO2 efflux measurements, declined 35% after 85% of the forest basal area had been killed or impaired by bark beetles (from 7.1 ± 0.22 μmol m(-2) s(-1) in 2005 to 4.6 ± 0.16 μmol m(-2) s(-1) in 2011). Soil efflux remained at ~3.3 μmol m(-2) s(-1) throughout the mortality, while the loss of live wood and foliage and their respiration drove the decline of the chamber estimate. Eddy covariance estimates of fluxes at night remained constant over the same period, ~3.0 μmol m(-2) s(-1) for both 2005 (intact forest) and 2011 (85% basal area killed or impaired). Eddy covariance fluxes were lower than chamber estimates of ecosystem respiration (60% lower in 2005, and 32% in 2011), but the mean night estimates from the two techniques were correlated within a year (r(2) from 0.18 to 0.60). The difference between the two techniques was not the result of inadequate turbulence, because the results were robust to a u* filter of >0.7 m s(-1). The decline in the average seasonal difference between the two techniques was strongly correlated with overstory leaf area (r(2) = 0.92). The discrepancy between methods of respiration estimation should be resolved to have confidence in ecosystem carbon flux estimates. © 2014 John Wiley & Sons Ltd.

Application of DNA RFLP procedures in interspecific gene transfer: The Lr19 translocation of wheat

International Nuclear Information System (INIS)

Prins, R.; Marais, G.F.; Marais, A.S.; Pretorius, Z.A.; Janse, B.J.H.

1998-01-01

Twenty-nine lines with deletions in the Lr19 ('Indis') translocated chromosome segment were used to physically map Thinopyrum Restriction Fragment Length Polymorphism (RFLP) loci as well as the Sr25 and Sdl loci. The relative distances between marker loci on the translocation were then calculated. The information was then used as an aid to characterize several recombined forms of the translocation. The data confirmed the reported homoeology between the Lr19 segment and chromosome arm 7DL of wheat. Also, it seems that the Lr19 translocation in 'Indis' is very similar to the Lr19 segment in the T4 source and that the former may not derive from Thinopyrum distichum. Near-isogenic lines of the recombined segments were derived and used to study their expression of leaf rust resistance. It became evident that only one potentially useful recombinant was obtained in an earlier attempt to induce allosyndetic pairing between the Lr19 translocation and 7DL of wheat. (author)

Evaluation of the transfer and the accumulation of microcystins in tomato (Solanum lycopersicum cultivar MicroTom) tissues using a cyanobacterial extract containing microcystins and the radiolabeled microcystin-LR ("1"4C-MC-LR)

International Nuclear Information System (INIS)

Corbel, Sylvain; Mougin, Christian; Nélieu, Sylvie; Delarue, Ghislaine; Bouaïcha, Noureddine

2016-01-01

Microcystins are the most common cyanotoxins and may be expected wherever blooms of cyanobacteria occur in surface waters. Their persistence both in the irrigation water and in the soil can lead to their transfer and bioaccumulation into agricultural plants. The aim of this work was to investigate microcystin accumulation in Solanum lycopersicum cultivar MicroTom. The plant was exposed to either Microcystis aeruginosa crude extracts containing up to 100 μg eq. MC-LR L"−"1 in a soil–plant system for 90 days or pure radiolabeled "1"4C-MC-LR in a hydroponic condition for 48 h. Toxin bioaccumulation in the soil and different plant tissues was assessed both by the PP2A inhibition assay and by liquid chromatography-mass spectrometry (LC/MS/MS). After 90 days of exposure, microcystins persisted in the soil and their free extractable concentrations accumulated were very low varying between 1.6 and 3.9 μg eq. MC-LR kg"−"1 DW. Free MC-LR was detected only in roots and leaves with concentrations varying between 4.5 and 8.1 μg kg"−"1 DW and between 0.29 and 0.55 μg kg"−"1 DW, respectively. By using radioactivity ("1"4C-MC-LR), the results have reported a growing accumulation of toxins within the organs roots > leaves > stems and allowed them to confirm the absence of MC-LR in fruits after 48 h of exposure. The bioconcentration factor (BCF) was 13.6 in roots, 4.5 in leaves, and 1.4 in stems. On the other hand, the results highlight the presence of two radioactive fractions in different plant tissues. The non-extractable fraction of radioactivity, corresponding to the covalently bound MC-LR, was higher than that of the extractable fraction only in roots and leaves reaching 56% and 71% of the total accumulated toxin, respectively. Therefore, results raise that monitoring programs must monitor the presence of MCs in the irrigation water to avoid the transfer and accumulation of these toxins in crops. - Graphical abstract: Bioconcentration factors in organs of the

Evaluation of the transfer and the accumulation of microcystins in tomato (Solanum lycopersicum cultivar MicroTom) tissues using a cyanobacterial extract containing microcystins and the radiolabeled microcystin-LR ({sup 14}C-MC-LR)

Energy Technology Data Exchange (ETDEWEB)

Corbel, Sylvain [INRA, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); AgroParisTech, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); Laboratoire Ecologie, Systématique et Evolution, UMR8079, Univ. Paris-Sud/CNRS/AgroParisTech, Université Paris-Sud, F-91405 Orsay (France); Mougin, Christian; Nélieu, Sylvie; Delarue, Ghislaine [INRA, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); AgroParisTech, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); Bouaïcha, Noureddine, E-mail: noureddine.bouaicha@u-psud.fr [Laboratoire Ecologie, Systématique et Evolution, UMR8079, Univ. Paris-Sud/CNRS/AgroParisTech, Université Paris-Sud, F-91405 Orsay (France)

2016-01-15

Microcystins are the most common cyanotoxins and may be expected wherever blooms of cyanobacteria occur in surface waters. Their persistence both in the irrigation water and in the soil can lead to their transfer and bioaccumulation into agricultural plants. The aim of this work was to investigate microcystin accumulation in Solanum lycopersicum cultivar MicroTom. The plant was exposed to either Microcystis aeruginosa crude extracts containing up to 100 μg eq. MC-LR L{sup −1} in a soil–plant system for 90 days or pure radiolabeled {sup 14}C-MC-LR in a hydroponic condition for 48 h. Toxin bioaccumulation in the soil and different plant tissues was assessed both by the PP2A inhibition assay and by liquid chromatography-mass spectrometry (LC/MS/MS). After 90 days of exposure, microcystins persisted in the soil and their free extractable concentrations accumulated were very low varying between 1.6 and 3.9 μg eq. MC-LR kg{sup −1} DW. Free MC-LR was detected only in roots and leaves with concentrations varying between 4.5 and 8.1 μg kg{sup −1} DW and between 0.29 and 0.55 μg kg{sup −1} DW, respectively. By using radioactivity ({sup 14}C-MC-LR), the results have reported a growing accumulation of toxins within the organs roots > leaves > stems and allowed them to confirm the absence of MC-LR in fruits after 48 h of exposure. The bioconcentration factor (BCF) was 13.6 in roots, 4.5 in leaves, and 1.4 in stems. On the other hand, the results highlight the presence of two radioactive fractions in different plant tissues. The non-extractable fraction of radioactivity, corresponding to the covalently bound MC-LR, was higher than that of the extractable fraction only in roots and leaves reaching 56% and 71% of the total accumulated toxin, respectively. Therefore, results raise that monitoring programs must monitor the presence of MCs in the irrigation water to avoid the transfer and accumulation of these toxins in crops. - Graphical abstract: Bioconcentration

Theoretical spectroscopic study of the conjugate microcystin-LR-europium cryptate

Energy Technology Data Exchange (ETDEWEB)

Santos, Julio G.; Dutra, Jose Diogo L.; Costa Junior, Nivan B. da; Freire, Ricardo O., E-mail: rfreire@ufs.br [Universidade Federal de Sergipe (UFS), Sao Cristovao, SE (Brazil). Departamento de Quimica; Alves Junior, Severino; Sa, Gilberto F. de [Universidade Federal de Pernambuco (UFPE), Recife, PE (Brazil). Departamento de Quimica Fundamental

2013-02-15

In this work, theoretical tools were used to study spectroscopic properties of the conjugate microcystin-LR-europium cryptate. The Sparkle/AM1 model was applied to predict the geometry of the system and the INDO/S-CIS model was used to calculate the excited state energies. Based on the Judd-Ofelt theory, the intensity parameters were predicted and a theoretical model based on the theory of the 4f-4f transitions was applied to calculate energy transfer and backtransfer rates, radiative and non-radiative decay rates, quantum efficiency and quantum yield. A detailed study of the luminescent properties of the conjugate Microcystin-LR-europium cryptate was carried out. The results show that the theoretical quantum yield of luminescence of 23% is in good agreement with the experimental value published. This fact suggests that this theoretical protocol can be used to design new systems in order to improve their luminescence properties. The results suggest that this luminescent system may be a good conjugate for using in assay ELISA for detection by luminescence of the Microcystin-LR in water. (author)

Stress level in wild harbour porpoises (Phocoena phocoena) during satellite tagging measured by respiration, heart rate and cortisol

DEFF Research Database (Denmark)

Eskesen, Ida Grønborg; Teilmann, J.; Geertsen, B. M.

2009-01-01

During satellite tagging of harbour porpoises (Phocoena phocoena), heart rate, respiration rate and cortisol value were measured to evaluate stress effects during handling and tagging. Respiration rates were obtained using video recordings, heart rates were recorded and serum cortisol levels were...... between cortisol and month of year, sex and body length. As high individual variations occurred in response to tagging of harbour porpoises, it is not possible to give general advice based oil the factors investigated, on how to reduce stress during handling. However, pouring water over the animal...

Measurements of CO2 exchange with an automated chamber system throughout the year: challenges in measuring night-time respiration on porous peat soil

Directory of Open Access Journals (Sweden)

M. Koskinen

2014-01-01

Full Text Available We built an automatic chamber system to measure greenhouse gas (GHG exchange in forested peatland ecosystems. We aimed to build a system robust enough which would work throughout the year and could measure through a changing snowpack in addition to producing annual GHG fluxes by integrating the measurements without the need of using models. The system worked rather well throughout the year, but it was not service free. Gap filling of data was still necessary. We observed problems in carbon dioxide (CO2 respiration flux estimation during calm summer nights, when a CO2 concentration gradient from soil/moss system to atmosphere builds up. Chambers greatly overestimated the night-time respiration. This was due to the disturbance caused by the chamber to the soil-moss CO2 gradient and consequent initial pulse of CO2 to the chamber headspace. We tested different flux calculation and measurement methods to solve this problem. The estimated flux was strongly dependent on (1 the starting point of the fit after closing the chamber, (2 the length of the fit, (3 the type of the fit (linear and polynomial, (4 the speed of the fan mixing the air inside the chamber, and (5 atmospheric turbulence (friction velocity, u*. The best fitting method (the most robust, least random variation for respiration measurements on our sites was linear fitting with the period of 120–240 s after chamber closure. Furthermore, the fan should be adjusted to spin at minimum speed to avoid the pulse-effect, but it should be kept on to ensure mixing. If night-time problems cannot be solved, emissions can be estimated using daytime data from opaque chambers.

Measurements of CO2 exchange with an automated chamber system throughout the year: challenges in measuring night-time respiration on porous peat soil

Science.gov (United States)

Koskinen, M.; Minkkinen, K.; Ojanen, P.; Kämäräinen, M.; Laurila, T.; Lohila, A.

2014-01-01

We built an automatic chamber system to measure greenhouse gas (GHG) exchange in forested peatland ecosystems. We aimed to build a system robust enough which would work throughout the year and could measure through a changing snowpack in addition to producing annual GHG fluxes by integrating the measurements without the need of using models. The system worked rather well throughout the year, but it was not service free. Gap filling of data was still necessary. We observed problems in carbon dioxide (CO2) respiration flux estimation during calm summer nights, when a CO2 concentration gradient from soil/moss system to atmosphere builds up. Chambers greatly overestimated the night-time respiration. This was due to the disturbance caused by the chamber to the soil-moss CO2 gradient and consequent initial pulse of CO2 to the chamber headspace. We tested different flux calculation and measurement methods to solve this problem. The estimated flux was strongly dependent on (1) the starting point of the fit after closing the chamber, (2) the length of the fit, (3) the type of the fit (linear and polynomial), (4) the speed of the fan mixing the air inside the chamber, and (5) atmospheric turbulence (friction velocity, u*). The best fitting method (the most robust, least random variation) for respiration measurements on our sites was linear fitting with the period of 120-240 s after chamber closure. Furthermore, the fan should be adjusted to spin at minimum speed to avoid the pulse-effect, but it should be kept on to ensure mixing. If night-time problems cannot be solved, emissions can be estimated using daytime data from opaque chambers.

Cattle respiration facility

DEFF Research Database (Denmark)

Hellwing, Anne Louise Frydendahl; Lund, Peter; Weisbjerg, Martin Riis

2012-01-01

In Denmark, the emission rate of methane from dairy cows has been calculated using the IPCC standard values for dairy cows in Western countries, due to the lack of national data. Therefore, four respiration chambers for dairy cows were built with the main purpose of measuring methane, but also...

Measurement of 89Y(n,2n) spectral averaged cross section in LR-0 special core reactor spectrum

Science.gov (United States)

Košťál, Michal; Losa, Evžen; Baroň, Petr; Šolc, Jaroslav; Švadlenková, Marie; Koleška, Michal; Mareček, Martin; Uhlíř, Jan

2017-12-01

The present paper describes reaction rate measurement of 89Y(n,2n)88Y in a well-defined reactor spectrum of a special core assembled in the LR-0 reactor and compares this value with results of simulation. The reaction rate is derived from the measurement of activity of 88Y using gamma-ray spectrometry of irradiated Y2O3 sample. The resulting cross section value averaged in spectrum is 43.9 ± 1.5 μb, averaged in the 235U spectrum is 0.172 ± 0.006 mb. This cross-section is important as it is used as high energy neutron monitor and is therefore included in the International Reactor Dosimetry and Fusion File. Calculations of reaction rates were performed with the MCNP6 code using ENDF/B-VII.0, JEFF-3.1, JEFF-3.2, JENDL-3.3, JENDL-4, ROSFOND-2010, CENDL-3.1 and IRDFF nuclear data libraries. The agreement with uranium description by CIELO library is very good, while in ENDF/B-VII.0 description of uranium, underprediction about 10% in average can be observed.

Characterizing the impact of diffusive and advective soil gas transport on the measurement and interpretation of the isotopic signal of soil respiration

Science.gov (United States)

Zachary E. Kayler; Elizabeth W. Sulzman; William D. Rugh; Alan C. Mix; Barbara J. Bond

2010-01-01

By measuring the isotopic signature of soil respiration, we seek to learn the isotopic composition of the carbon respired in the soil (δ13CR-S) so that we may draw inferences about ecosystem processes. Requisite to this goal is the need to understand how (δ13CR-S) is affected by...

Respirator use and its impact on particulate matter exposure in aluminum manufacturing facilities.

Science.gov (United States)

Liu, Sa; Noth, Elizabeth; Eisen, Ellen; Cullen, Mark R; Hammond, Katharine

2018-05-31

Objectives As part of a large epidemiologic study of particulate health effect, this study aimed to report respirator use among total particulate matter (TPM) samples collected in a major aluminum manufacturing company from 1966‒2013 and evaluate the impact of respirator-use adjustment on exposure estimation. Methods Descriptive analyses were performed to evaluate respirator use across facilities and by facility type and job. Protection factors were applied to TPM measurements for recorded respirator use. Estimated TPM exposure for each job ‒ before and after respirator-use adjustment ‒ were compared to assess the impact of adjustment on exposure estimation. Results Respirator use was noted for 37% of 12 402 full-shift personal TPM samples. Measured TPM concentration ranged from less than detectable to 8220 mg/m3, with arithmetic mean, median and standard deviation being 10.6, 0.87 and 130 mg/m 3 , respectively. Respirators were used more often in smelting facilities (52% of TPM measurements) than in fabricating (17%) or refinery facilities (28%) (Pfacilities were subject to respirator-use adjustment, whereas it was 20% and 70% in fabricating and refinery facilities, respectively. Applying protection factors to TPM measurements significantly reduced estimated job mean TPM exposures and changed exposure categories in these facilities, with larger impact in smelting than fabricating facilities. Conclusions Respirator use varied by time, facility and job. Adjusting respirator use resulted in differential impact in smelting and fabricating facilities, which will need to be incorporated into ongoing epidemiologic studies accordingly.

Combined toxicity of microcystin-LR and copper on lettuce (Lactuca sativa L.).

Science.gov (United States)

Cao, Qing; Steinman, Alan D; Wan, Xiang; Xie, Liqiang

2018-05-10

Microcystins and copper commonly co-exist in the natural environment, but their combined toxicity remains unclear, especially in terrestrial plants. The present study investigated the toxicity effects of microcystin-LR (0, 5, 50, 500, 1000 μg L -1 ) and copper (0, 50, 500, 1000, 2000 μg L -1 ), both individually and in mixture, on the germination, growth and oxidative response of lettuce. The bioaccumulation of microcystin-LR and copper was also evaluated. Results showed that the decrease in lettuce germination induced by copper alone was not significantly different from that induced by the mixture, and the combined toxicity assessment showed a simple additive effect. Lettuce growth was not significantly reduced by microcystin-LR alone, whereas it was significantly reduced by copper alone and the mixture when copper concentration was higher than 500 μg L -1 . High concentrations of microcystin-LR (1000 μg L -1 ) and copper (≥50 μg L -1 ),as well as their mixture (≥50 + 500 μg L -1 ), induced oxidative stress in lettuce. A synergistic effect on the growth and antioxidative system of lettuce was observed when exposed to low concentrations of the mixture (≤50 + 500 μg L -1 ), whereas an antagonistic effect was observed at high concentrations (≥1000 + 2000 μg L -1 ). Moreover, the interaction of microcystin-LR and copper can increase their accumulation in lettuce. Our results suggest that the toxicity effects of microcystin-LR and copper are exacerbated when they co-exist in the natural environment at low concentrations, which not only negatively affects plant growth but also poses a potential risk to human health via the food chain. Copyright © 2018. Published by Elsevier Ltd.

Effects of simulated warming on soil respiration to XiaoPo lake

Science.gov (United States)

Zhao, Shuangkai; Chen, Kelong; Wu, Chengyong; Mao, Yahui

2018-02-01

The main flux of carbon cycling in terrestrial and atmospheric ecosystems is soil respiration, and soil respiration is one of the main ways of soil carbon output. This is of great significance to explore the dynamic changes of soil respiration rate and its effect on temperature rise, and the correlation between environmental factors and soil respiration. In this study, we used the open soil carbon flux measurement system (LI-8100, LI-COR, NE) in the experimental area of the XiaoPo Lake wetland in the Qinghai Lake Basin, and the Kobresia (Rs) were measured, and the soil respiration was simulated by simulated temperature (OTC) and natural state. The results showed that the temperature of 5 cm soil was 1.37 °C higher than that of the control during the experiment, and the effect of warming was obvious. The respiration rate of soil under warming and natural conditions showed obvious diurnal variation and monthly variation. The effect of warming on soil respiration rate was promoted and the effect of precipitation on soil respiration rate was inhibited. Further studies have shown that the relationship between soil respiration and 5 cm soil temperature under the control and warming treatments can be described by the exponential equation, and the correlation analysis between the two plots shows a very significant exponential relationship (p main influencing factor of soil respiration in this region.

Reproduction impairment and endocrine disruption in female zebrafish after long-term exposure to MC-LR: A life cycle assessment

International Nuclear Information System (INIS)

Hou, Jie; Li, Li; Wu, Ning; Su, Yujing; Lin, Wang; Li, Guangyu; Gu, Zemao

2016-01-01

Microcystin-LR (MC-LR) has been found to cause reproductive and developmental impairments as well as to disrupt sex hormone homeostasis of fish during acute and sub-chronic toxic experiments. However, fish in natural environments are continuously exposed to MC-LR throughout their entire life cycle as opposed to short-term exposure. Here, we tested the hypothesis that the mechanism by which MC-LR harms female fish reproduction and development within natural water bodies is through interference of the reproductive endocrine system. In the present study, zebrafish hatchlings (5 d post-fertilization) were exposed to 0, 0.3, 3 and 30 μg/L MC-LR for 90 d until reaching sexual maturity. Female zebrafish were selected, and the changes in growth and developmental indicators, ovarian ultrastructure as well as the levels of gonadal steroid hormones and vitellogenin (VTG) were examined along with the transcription of related genes in the hypothalamic–pituitary–gonadal–liver axis (HPGL-axis). The results showed for the first time, a life cycle exposure to MC-LR caused growth inhibition, decreased ovary weight and ovarian ultra-pathological lesions. Decreased ovarian testosterone levels indicated that MC-LR disrupted sex steroid hormone balance. Significantly up-regulated transcription of brain FSHβ and LHβ along with ovarian ERα, FSHR and LHR suggested positive feedback regulation in the HPGL-axis was induced as a compensatory mechanism for MC-LR damage. It was also noted that ovarian VTG content and hepatic ERα and VTG1 expression were all down-regulated, which might be responsible for reduced vitellus storage noted in our histological observations. Our findings indicate that a life cycle exposure to MC-LR impairs the development and reproduction of female zebrafish by disrupting the transcription of related HPGL-axis genes, suggesting that MC-LR has potential adverse effects on fish reproduction and thus population dynamics in MCs-contaminated aquatic

Impact of two particle measurement techniques on the determination of N95 class respirator filtration performance against ultrafine particles

International Nuclear Information System (INIS)

Mostofi, Reza; Noël, Alexandra; Haghighat, Fariborz; Bahloul, Ali; Lara, Jaime; Cloutier, Yves

2012-01-01

Highlights: ► Performance evaluation of respirator using two different measurement techniques. ► Impaction and electrical mobility were used to characterize ultrafine particle. ► The experiment was done using ultrafine-sized poly-dispersed aerosols. ► Both techniques show that MPPS would occur at a similar size range. - Abstract: The purpose of this experimental study was to compare two different particle measurement devices; an Electrical Low Pressure Impactor (ELPI) and a Scanning Mobility Particle Sizer (SMPS), to measure the number concentration and the size distribution of NaCl salt aerosols to determine the collection efficiency of filtering respirators against poly disperse aerosols. Tests were performed on NIOSH approved N95 filtering face-piece respirators (FFR), sealed on a manikin head. Ultrafine particles found in the aerosols were also collected and observed by transmission electron microscopy (TEM). According to the results, there is a systematic difference for the particle size distribution measured by the SMPS and the ELPI. It is largely attributed to the difference in the measurement techniques. However, in spite of these discrepancies, reasonably similar trends were found for the number concentration with both measuring instruments. The particle penetration, calculated based on mobility and aerodynamic diameters, never exceeded 5% for any size range measured at constant flow rate of 85 L/min. Also, the most penetrating particle size (MPPS), with the lowest filtration efficiency, would occur at a similar ultrafine size range <100 nm. With the ELPI, the MPPS was at 70 nm aerodynamic diameter, whereas it occurred at 40 nm mobility diameter with the SMPS.

Absolute Transition Rates in {sup 188}lr

Energy Technology Data Exchange (ETDEWEB)

Malmskog, S G; Berg, V

1969-09-15

Half-lives of several excited levels in {sup 188}lr have been measured using an electron-electron delayed coincidence spectrometer. Active {sup 188}Pt sources were prepared from spallation products using the ISOLDE on-line mass separator facility at CERN. The following half-lives were obtained: T{sub 1/2} (54.8 keV level) = (1.93 {+-} 0.10) nsec; T{sub 1/2} (96.7 keV level) = (0.59 {+-} 0.12) nsec; T{sub 1/2} (187.6 keV level) = (0.056 {+-} 0.013) nsec; T{sub 1/2} (195.1 keV level) = (0.051 {+-} 0.010) nsec; T{sub 1/2} (478. 3 keV level) {<=} 0.15 nsec The 54.8 keV transition was found to have an enhanced E2 transition probability indicating a collective character for this transition.

Soil Respiration and Student Inquiry: A Perfect Match

Science.gov (United States)

Hoyt, Catherine Marie; Wallenstein, Matthew David

2011-01-01

This activity explores the cycling of carbon between the atmosphere (primarily as CO[subscript 2]) and biomass in plants, animals, and microscopic organisms. Students design soil respiration experiments using a protocol that resembles current practice in soil ecology. Three methods for measuring soil respiration are presented. Student-derived…

Prospective evaluation of IOTA logistic regression models LR1 and LR2 in comparison with subjective pattern recognition for diagnosis of ovarian cancer in an outpatient setting.

Science.gov (United States)

Nunes, N; Ambler, G; Foo, X; Widschwendter, M; Jurkovic, D

2018-06-01

To determine whether International Ovarian Tumor Analysis (IOTA) logistic regression models LR1 and LR2 developed for the preoperative diagnosis of ovarian cancer could also be used to differentiate between benign and malignant adnexal tumors in the population of women attending gynecology outpatient clinics. This was a single-center prospective observational study of consecutive women attending our gynecological diagnostic outpatient unit, recruited between May 2009 and January 2012. All the women were first examined by a Level-II ultrasound operator. In those diagnosed with adnexal tumors, the IOTA-LR1/2 protocol was used to evaluate the masses. The LR1 and LR2 models were then used to assess the risk of malignancy. Subsequently, the women were also examined by a Level-III examiner, who used pattern recognition to differentiate between benign and malignant tumors. Women with an ultrasound diagnosis of malignancy were offered surgery, while asymptomatic women with presumed benign lesions were offered conservative management with a minimum follow-up of 12 months. The initial diagnosis was compared with two reference standards: histological findings and/or a comparative assessment of tumor morphology on follow-up ultrasound scans. All women for whom the tumor classification on follow-up changed from benign to malignant were offered surgery. In the final analysis, 489 women who had either or both of the reference standards were included. Their mean age was 50 years (range, 16-91 years) and 45% were postmenopausal. Of the included women, 342/489 (69.9%) had surgery and 147/489 (30.1%) were managed conservatively. The malignancy rate was 137/489 (28.0%). Overall, sensitivities of LR1 and LR2 for the diagnosis of malignancy were 97.1% (95% CI, 92.7-99.2%) and 94.9% (95% CI, 89.8-97.9%) and specificities were 77.3% (95% CI, 72.5-81.5%) and 76.7% (95% CI, 71.9-81.0%), respectively (P > 0.05). In comparison with pattern recognition (sensitivity 94.2% (95% CI, 88

Inhibition of Microcystis aeruginosa and microcystin- LR with one ...

African Journals Online (AJOL)

Yomi

2State Key Laboratory of Urban Water Resource and Environment, Harbin Institute of Technology, Harbin 150001,. China. ... industrial wastewater and domestic sewage. One of the .... LR detected by high performance liquid chromatography.

Seasonality of temperate forest photosynthesis and daytime respiration.

Science.gov (United States)

Wehr, R; Munger, J W; McManus, J B; Nelson, D D; Zahniser, M S; Davidson, E A; Wofsy, S C; Saleska, S R

2016-06-30

Terrestrial ecosystems currently offset one-quarter of anthropogenic carbon dioxide (CO2) emissions because of a slight imbalance between global terrestrial photosynthesis and respiration. Understanding what controls these two biological fluxes is therefore crucial to predicting climate change. Yet there is no way of directly measuring the photosynthesis or daytime respiration of a whole ecosystem of interacting organisms; instead, these fluxes are generally inferred from measurements of net ecosystem-atmosphere CO2 exchange (NEE), in a way that is based on assumed ecosystem-scale responses to the environment. The consequent view of temperate deciduous forests (an important CO2 sink) is that, first, ecosystem respiration is greater during the day than at night; and second, ecosystem photosynthetic light-use efficiency peaks after leaf expansion in spring and then declines, presumably because of leaf ageing or water stress. This view has underlain the development of terrestrial biosphere models used in climate prediction and of remote sensing indices of global biosphere productivity. Here, we use new isotopic instrumentation to determine ecosystem photosynthesis and daytime respiration in a temperate deciduous forest over a three-year period. We find that ecosystem respiration is lower during the day than at night-the first robust evidence of the inhibition of leaf respiration by light at the ecosystem scale. Because they do not capture this effect, standard approaches overestimate ecosystem photosynthesis and daytime respiration in the first half of the growing season at our site, and inaccurately portray ecosystem photosynthetic light-use efficiency. These findings revise our understanding of forest-atmosphere carbon exchange, and provide a basis for investigating how leaf-level physiological dynamics manifest at the canopy scale in other ecosystems.

Interpreting diel hysteresis between soil respiration and temperature

Science.gov (United States)

C. Phillips; N. Nickerson; D. Risk; B.J. Bond

2011-01-01

Increasing use of automated soil respiration chambers in recent years has demonstrated complex diel relationships between soil respiration and temperature that are not apparent from less frequent measurements. Soil surface flux is often lagged from soil temperature by several hours, which results in semielliptical hysteresis loops when surface flux is plotted as a...

76 FR 60937 - Draft License Renewal Interim Staff Guidance LR-ISG-2011-02; Aging Management Program for Steam...

Science.gov (United States)

2011-09-30

...-2011-02; Aging Management Program for Steam Generators AGENCY: Nuclear Regulatory Commission. ACTION... License Renewal Interim Staff Guidance (LR-ISG), LR-ISG-2011-02, ``Aging Management Program for Steam... using Revision 3 of NEI 97-06 to manage steam generator aging. The Draft LR-ISG revises the NRC staff's...

The interactive effects of microcystin-LR and cylindrospermopsin on the growth rate of the freshwater algae Chlorella vulgaris.

Science.gov (United States)

Pinheiro, Carlos; Azevedo, Joana; Campos, Alexandre; Vasconcelos, Vítor; Loureiro, Susana

2016-05-01

Microcystin-LR (MC-LR) and cylindrospermopsin (CYN) are the most representative cyanobacterial cyanotoxins. They have been simultaneously detected in aquatic systems, but their combined ecotoxicological effects to aquatic organisms, especially microalgae, is unknown. In this study, we examined the effects of these cyanotoxins individually and as a binary mixture on the growth rate of the freshwater algae Chlorella vulgaris. Using the MIXTOX tool, the reference model concentration addition (CA) was selected to evaluate the combined effects of MC-LR and CYN on the growth of the freshwater green algae due to its conservative prediction of mixture effect for putative similar or dissimilar acting chemicals. Deviations from the CA model such as synergism/antagonism, dose-ratio and dose-level dependency were also assessed. In single exposures, our results demonstrated that MC-LR and CYN had different impacts on the growth rates of C. vulgaris at the highest tested concentrations, being CYN the most toxic. In the mixture exposure trial, MC-LR and CYN showed a synergistic deviation from the conceptual model CA as the best descriptive model. MC-LR individually was not toxic even at high concentrations (37 mg L(-1)); however, the presence of MC-LR at much lower concentrations (0.4-16.7 mg L(-1)) increased the CYN toxicity. From these results, the combined exposure of MC-LR and CYN should be considered for risk assessment of mixtures as the toxicity may be underestimated when looking only at the single cyanotoxins and not their combination. This study also represents an important step to understand the interactions among MC-LR and CYN detected previously in aquatic systems.

Process optimization for microcystin-LR degradation by Response Surface Methodology and mechanism analysis in gas-liquid hybrid discharge system.

Science.gov (United States)

Zhang, Yi; Wei, Hanyu; Xin, Qing; Wang, Mingang; Wang, Qi; Wang, Qiang; Cong, Yanqing

2016-12-01

A gas-liquid hybrid discharge system was applied to microcystin-LR (MC-LR) degradation. MC-LR degradation was completed after 1 min under a pulsed high voltage of 16 kV, gas-liquid interface gap of 10 mm and oxygen flow rate of 160 L/h. The Box-Behnken Design was proposed in Response Surface Methodology to evaluate the influence of pulsed high voltage, electrode distance and oxygen flow rate on MC-LR removal efficiency. Multiple regression analysis, focused on multivariable factors, was employed and a reduced cubic model was developed. The ANOVA analysis shows that the model is significant and the model prediction on MC-LR removal was also validated with experimental data. The optimum conditions for the process are obtained at pulsed voltage of 16 kV, gas-liquid interface gap of 10 mm and oxygen flow rate of 120 L/h with ta removal efficiency of MC-LR of 96.6%. The addition of catalysts (TiO 2 or Fe 2+ ) in the gas-liquid hybrid discharge system was found to enhance the removal of MC-LR. The intermediates of MC-LR degradation were analyzed by liquid chromatography/mass spectrometry. The degradation pathway proposed envisaged the oxidation of hydroxyl radicals and ozone, and attack of high-energy electrons on the unsaturated double bonds of Adda and Mdha, with MC-LR finally decomposing into small molecular products. Copyright © 2016 Elsevier Ltd. All rights reserved.

Choosing the right respirator

International Nuclear Information System (INIS)

Bidwell, J.

1997-01-01

Selecting respirators to help protect workers from airborne contaminants can be a confusing process. The consequences of selecting the incorrect respirator can be intimidating, and worker safety and health may be dramatically and irreparably affected if an inappropriate respirator is chosen. When used in the workplace, a formal respiratory protection program must be established covering the basic requirements outlined in the OSHA Respiratory Protection Standard (29 CFR 1910.134). Education and training must be properly emphasized and conducted periodically. Maintenance, cleaning, and storage programs must be established and routinely followed for reusable respirators. The process of establishing a respiratory protection program can be broken down into four basic steps: Identify respiratory hazards and concentrations; understand the contaminants effects on workers' health; select appropriate respiratory protection; and train in proper respirator use and maintenance. These four steps are the foundation for establishing a basic respirator protection program. Be sure to consult state and federal OSHA requirements to ensure that the program complies. Leading industrial respirator manufacturers should be able to assist with on-site training and education in this four-step process, in addition to helping employers train their workers and conduct respirator fit testing

ECG-derived respiration methods: adapted ICA and PCA.

Science.gov (United States)

Tiinanen, Suvi; Noponen, Kai; Tulppo, Mikko; Kiviniemi, Antti; Seppänen, Tapio

2015-05-01

Respiration is an important signal in early diagnostics, prediction, and treatment of several diseases. Moreover, a growing trend toward ambulatory measurements outside laboratory environments encourages developing indirect measurement methods such as ECG derived respiration (EDR). Recently, decomposition techniques like principal component analysis (PCA), and its nonlinear version, kernel PCA (KPCA), have been used to derive a surrogate respiration signal from single-channel ECG. In this paper, we propose an adapted independent component analysis (AICA) algorithm to obtain EDR signal, and extend the normal linear PCA technique based on the best principal component (PC) selection (APCA, adapted PCA) to improve its performance further. We also demonstrate that the usage of smoothing spline resampling and bandpass-filtering improve the performance of all EDR methods. Compared with other recent EDR methods using correlation coefficient and magnitude squared coherence, the proposed AICA and APCA yield a statistically significant improvement with correlations 0.84, 0.82, 0.76 and coherences 0.90, 0.91, 0.85 between reference respiration and AICA, APCA and KPCA, respectively. Copyright © 2015 IPEM. Published by Elsevier Ltd. All rights reserved.

Comparison of Respirable Mass Concentrations Measured by a Personal Dust Monitor and a Personal DataRAM to Gravimetric Measurements.

Science.gov (United States)

Halterman, Andrew; Sousan, Sinan; Peters, Thomas M

2017-12-15

In 2016, the Mine Safety and Health Administration required the use of continuous monitors to measure respirable dust in mines and better protect miner health. The Personal Dust Monitor, PDM3700, has met stringent performance criteria for this purpose. In a laboratory study, respirable mass concentrations measured with the PDM3700 and a photometer (personal DataRam, pDR-1500) were compared to those measured gravimetrically for five aerosols of varying refractive index and density (diesel exhaust fume, welding fume, coal dust, Arizona road dust (ARD), and salt [NaCl] aerosol) at target concentrations of 0.38, 0.75, and 1.5 mg m-3. For all aerosols except coal dust, strong, near-one-to-one, linear relationships were observed between mass concentrations measured with the PDM3700 and gravimetrically (diesel fume, slope = 0.99, R2 = 0.99; ARD, slope = 0.98, R2 = 0.99; and NaCl, slope = 0.95, R2 = 0.99). The slope deviated substantially from unity for coal dust (slope = 0.55; R2 = 0.99). Linear relationships were also observed between mass concentrations measured with the pDR-1500 and gravimetrically, but one-to-one behavior was not exhibited (diesel fume, slope = 0.23, R2 = 0.76; coal dust, slope = 0.54, R2 = 0.99; ARD, slope = 0.61, R2 = 0.99; NaCl, slope = 1.14, R2 = 0.98). Unlike the pDR-1500, mass concentrations measured with the PDM3700 appear independent of refractive index and density, suggesting that it could have applications in a variety of occupational settings. © The Author(s) 2017. Published by Oxford University Press on behalf of the British Occupational Hygiene Society.

Main: 1LR4 [RPSD[Archive

Lifescience Database Archive (English)

Full Text Available 1LR4 トウモロコシ Corn Zea mays L. Casein Kinase Ii, Alpha Chain Name=Ack2; Zea Mays Mole...cule: Protein Kinase Ck2; Chain: A; Synonym: Casein Kinase Ii, Alpha Chain; Engineered: Yes Transferase 2.7....ray; A=2-326.|PDB; 1M2Q; X-ray; A=2-328.|PDB; 1M2R; X-ray; A=2-328.|PDB; 1OM1; X-ray; A=1-332.|Mai

Annual ecosystem respiration budget for a Pinus sylvestris stand in central Siberia

International Nuclear Information System (INIS)

Shibistova, O.; Zrazhevskaya, G.; Astrakhantceva, N.; Shijneva, I.; Lloyd, J.; Arneth, A.; Kolle, J.; Knohl, A.; Schmerler, J.

2002-01-01

Using a ground-based and an above-canopy eddy covariance system in addition to stem respiration measurements, the annual respiratory fluxes attributable to soil, stems and foliage were determined for a Scots pine (Pinus sylvestris L.) forest growing in central Siberia. Night-time foliar respiration was estimated on the basis of the difference between fluxes measured below and above the canopy and the stem respiration measurements. Comparison of the effects of night-time turbulence on measured CO 2 fluxes showed flux loss above the canopy at low wind speeds, but no such effect was observed for the ground-based eddy system. This suggests that problems with flow homogeneity or flux divergence (both of which would be expected to be greater above the canopy than below) were responsible for above-canopy losses under these conditions. After correcting for this, a strong seasonality in foliar respiration was observed. This was not solely attributable to temperature variations, with intrinsic foliar respiratory capacities being much greater in spring and autumn. The opposite pattern was observed for stem respiration, with the intrinsic respiratory capacity being lower from autumn through early spring. Maximum respiratory activity was observed in early summer. This was not simply associated with a response to higher temperatures but seemed closely linked with cambial activity and the development of new xylem elements. Soil respiration rates exhibited an apparent high sensitivity to temperature, with seasonal data implying a Q 10 of about 7. We interpret this as reflecting covarying changes in soil microbial activity and soil temperatures throughout the snow-free season. Averaged over the two study years (1999 and 2000), the annual respiratory flux was estimated at 38.3 mol C/m 2 /a. Of this 0.61 was attributable to soil respiration, with stem respiration accounting for 0.21 and foliar respiration 0.18

Plant Respiration and Climate Change Effects

International Nuclear Information System (INIS)

Bruhn, D.

2002-04-01

Plant respiration is one of the key processes in terms of an understanding of plant growth and functioning in a future climate. Short- and long-term effects of temperature and CO 2 on plant respiration were investigated in a number of plant species. The experiments tested effects of either temperature and/or CO 2 from the level of individual respiratory enzymes, isolated mitochondria, whole-tissue, and up to the whole canopy level. The short-term effects of elevated atmospheric CO 2 on plant respiration appeared to be less than suggested so far in the literature. This was true both at the tissue level and for intact mitochondria. Respiratory enzymes can, however, be affected already at low CO 2 . These effects did not manifest itself at the tissue level, though, due to low degrees of control on the whole respiratory process exerted by the particular enzymes. Plant respiration on the other hand was affected by long-term growth at elevated atmospheric CO 2 . The findings of the reduced plant respiration at the leaf level were consistent with the literature and potential causes are discussed. Short-term effects of temperature on plant respiration were demonstrated to be dependent on the actual measurement temperature. Further, it is shown that mitochondrial leaf respiration in darkness and light differ substantially in the temperature sensitivity with the former being the far most sensitive. This has implications for modelling CO 2 exchange between vegetation and atmosphere as demonstrated here, since this has so far been neglected. Long-term effects of temperature resulted in respiratory acclimation in a number of species. Respiratory acclimation appeared not to occur to any one single type of growth temperature. The implications of this finding in combination with the timing of acclimation are discussed for modelling respiratory CO 2 release. (au)

Plant Respiration and Climate Change Effects

Energy Technology Data Exchange (ETDEWEB)

Bruhn, D

2002-04-01

Plant respiration is one of the key processes in terms of an understanding of plant growth and functioning in a future climate. Short- and long-term effects of temperature and CO{sub 2} on plant respiration were investigated in a number of plant species. The experiments tested effects of either temperature and/or CO{sub 2} from the level of individual respiratory enzymes, isolated mitochondria, whole-tissue, and up to the whole canopy level. The short-term effects of elevated atmospheric CO{sub 2} on plant respiration appeared to be less than suggested so far in the literature. This was true both at the tissue level and for intact mitochondria. Respiratory enzymes can, however, be affected already at low CO{sub 2}. These effects did not manifest itself at the tissue level, though, due to low degrees of control on the whole respiratory process exerted by the particular enzymes. Plant respiration on the other hand was affected by long-term growth at elevated atmospheric CO{sub 2}. The findings of the reduced plant respiration at the leaf level were consistent with the literature and potential causes are discussed. Short-term effects of temperature on plant respiration were demonstrated to be dependent on the actual measurement temperature. Further, it is shown that mitochondrial leaf respiration in darkness and light differ substantially in the temperature sensitivity with the former being the far most sensitive. This has implications for modelling CO{sub 2} exchange between vegetation and atmosphere as demonstrated here, since this has so far been neglected. Long-term effects of temperature resulted in respiratory acclimation in a number of species. Respiratory acclimation appeared not to occur to any one single type of growth temperature. The implications of this finding in combination with the timing of acclimation are discussed for modelling respiratory CO{sub 2} release. (au)

Roles of piRNAs in microcystin-leucine-arginine (MC-LR) induced reproductive toxicity in testis on male offspring.

Science.gov (United States)

Zhang, Ling; Zhang, Hui; Zhang, Huan; Benson, Mikael; Han, Xiaodong; Li, Dongmei

2017-07-01

In the present study, we evaluated the toxic effects on the testis of the male offspring of MC-LR exposure during fetal and lactational periods. Pregnant females were distributed into two experimental groups: control group and MC-LR group which were exposed to 0 and 10 μg/L of MC-LR, respectively, through drinking water separately during fetal and lactational periods. At the age of 30 days after birth, the male offspring were euthanized. The body weight, testis index, and histomorphology change were observed and the global changes of piwi-interacting RNA (piRNA) expression were evaluated. The results revealed that MC-LR was found in the testis of male offspring, body weight and testis index decreased significantly, and testicular tissue structure was damaged in the MC-LR group. In addition, the exposure to MC-LR resulted in an altered piRNA expression profile and an increase of the cell apoptosis and a decrease of the cell proliferation in the testis of the male offspring. It was reasonable to speculate that the toxic effects on reproductive system of the male offspring in MC-LR group might be mediated by piRNAs through the regulation of the target genes. As far as we are aware, this is the first report showing that MC-LR could play a role in disorder of proliferative and cell apoptosis in the testis of the male offspring by the maternal transmission effect of toxicity. Copyright © 2017 Elsevier Ltd. All rights reserved.

Foliar and ecosystem respiration in an old-growth tropical rain forest

Science.gov (United States)

Molly A. Cavaleri; Steven F. Oberbauer; Michael G. Ryan

2008-01-01

Foliar respiration is a major component of ecosystem respiration, yet extrapolations are often uncertain in tropical forests because of indirect estimates of leaf area index (LAI).A portable tower was used to directly measure LAI and night-time foliar respiration from 52 vertical transects throughout an old-growth tropical rain forest in Costa Rica. In this study, we (...

Ecological risk assessment of microcystin-LR in the upstream section of the Haihe River based on a species sensitivity distribution model.

Science.gov (United States)

Niu, Zhiguang; Du, Lei; Li, Jiafu; Zhang, Ying; Lv, Zhiwei

2018-02-01

The eutrophication of surface water has been the main problem of water quality management in recent decades, and the ecological risk of microcystin-LR (MC-LR), which is the by-product of eutrophication, has drawn more attention worldwide. The aims of our study were to determine the predicted no effect concentration (PNEC) of MC-LR and to assess the ecological risk of MC-LR in the upstream section of the Haihe River. HC 5 (hazardous concentration for 5% of biological species) and PNEC were obtained from a species sensitivity distribution (SSD) model, which was constructed with the acute toxicity data of MC-LR on aquatic organisms. The concentrations of MC-LR in the upstream section of the Haihe River from April to August of 2015 were analysed, and the ecological risk characteristics of MC-LR were evaluated based on the SSD model. The results showed that the HC 5 of MC-LR in freshwater was 17.18 μg/L and PNEC was 5.73 μg/L. The concentrations of MC-LR ranged from 0.68 μg/L to 32.21 μg/L and were obviously higher in summer than in spring. The values of the risk quotient (RQ) ranged from 0.12 to 5.62, suggesting that the risk of MC-LR for aquatic organisms in the river was at a medium or high level during the study period. Compared with other waterbodies in the world, the pollution level of MC-LR in the Haihe River was at a moderate level. This research could promote the study of the ecological risk of MC-LR at the ecosystem level. Copyright © 2017 Elsevier Ltd. All rights reserved.

Measurements of soil respiration and simple models dependent on moisture and temperature for an Amazonian southwest tropical forest

NARCIS (Netherlands)

Zanchi, F.B.; Rocha, Da H.R.; Freitas, De H.C.; Kruijt, B.; Waterloo, M.J.; Manzi, A.O.

2009-01-01

Soil respiration plays a significant role in the carbon cycle of Amazonian tropical forests, although in situ measurements have only been poorly reported and the dependence of soil moisture and soil temperature also weakly understood. This work investigates the temporal variability of soil

Microcystin-LR induced reactive oxygen species mediate cytoskeletal disruption and apoptosis of hepatocytes in Cyprinus carpio L.

Directory of Open Access Journals (Sweden)

Jinlin Jiang

Full Text Available Microcystins (MCs are a group of cyclic hepatotoxic peptides produced by cyanobacteria. Microcystin-LR (MC-LR contains Leucine (L and Arginine (R in the variable positions, and is one of the most common and potently toxic peptides. MC-LR can inhibit protein phosphatase type 1 and type 2A (PP1 and PP2A activities and induce excessive production of reactive oxygen species (ROS. The underlying mechanism of the inhibition of PP1 and PP2A has been extensively studied. The over-production of ROS is considered to be another main mechanism behind MC-LR toxicity; however, the detailed toxicological mechanism involved in over-production of ROS in carp (Cyprinus carpio L. remains largely unclear. In our present study, the hydroxyl radical (•OH was significantly induced in the liver of carp after a relatively short-term exposure to MC-LR. The elevated reactive oxygen species (ROS production may play an important role in the disruption of microtubule structure. Pre-injection of the antioxidant N-acetyl-cysteine (NAC provided significant protection to the cytoskeleton, however buthionine sulfoximine (BSO exacerbated cytoskeletal destruction. In addition, the elevated ROS formation induced the expression of apoptosis-related genes, including p38, JNKa, and bcl-2. A significant increase in apoptotic cells was observed at 12-48 hours. Our study further supports evidence that ROS are involved in MC-LR induced damage to liver cells in carp, and indicates the need for further study of the molecular mechanisms behind MC-LR toxicity.

Microcystin-LR Induced Reactive Oxygen Species Mediate Cytoskeletal Disruption and Apoptosis of Hepatocytes in Cyprinus carpio L.

Science.gov (United States)

Jiang, Jinlin; Shan, Zhengjun; Xu, Weili; Wang, Xiaorong; Zhou, Junying; Kong, Deyang; Xu, Jing

2013-01-01

Microcystins (MCs) are a group of cyclic hepatotoxic peptides produced by cyanobacteria. Microcystin-LR (MC-LR) contains Leucine (L) and Arginine (R) in the variable positions, and is one of the most common and potently toxic peptides. MC-LR can inhibit protein phosphatase type 1 and type 2A (PP1 and PP2A) activities and induce excessive production of reactive oxygen species (ROS). The underlying mechanism of the inhibition of PP1 and PP2A has been extensively studied. The over-production of ROS is considered to be another main mechanism behind MC-LR toxicity; however, the detailed toxicological mechanism involved in over-production of ROS in carp (Cyprinus carpio L.) remains largely unclear. In our present study, the hydroxyl radical (•OH) was significantly induced in the liver of carp after a relatively short-term exposure to MC-LR. The elevated reactive oxygen species (ROS) production may play an important role in the disruption of microtubule structure. Pre-injection of the antioxidant N-acetyl-cysteine (NAC) provided significant protection to the cytoskeleton, however buthionine sulfoximine (BSO) exacerbated cytoskeletal destruction. In addition, the elevated ROS formation induced the expression of apoptosis-related genes, including p38, JNKa, and bcl-2. A significant increase in apoptotic cells was observed at 12 - 48 hours. Our study further supports evidence that ROS are involved in MC-LR induced damage to liver cells in carp, and indicates the need for further study of the molecular mechanisms behind MC-LR toxicity. PMID:24376844

A 3D graphene-based biosensor as an early microcystin-LR screening tool in sources of drinking water supply

International Nuclear Information System (INIS)

Zhang, Wei; Han, Changseok; Jia, Baoping; Saint, Christopher; Nadagouda, Mallikarjuna; Falaras, Polycarpos; Sygellou, Labrini; Vogiazi, Vasileia; Dionysiou, Dionysios D.

2017-01-01

Highlights: • 3D graphene-based biosensors can detect MC-LR with remarkable sensitivity. • Good linear correlation between electron-transfer resistance and MC-LR concentration. • A detection limit of 0.04 μg/L MC-LR was accomplished. - Abstract: Recent advances in graphene synthesis and understanding of properties have led to enormous applications in a variety of areas. Graphene and its unique electrical properties can favor electrochemical biosensor applications for aqueous toxin monitoring. Graphene-based biosensors can be used as an alternative to time-consuming, expensive and non-portable conventional methods of analysis involved in water quality monitoring and assessment. In this work, we showcased a three-dimensional (3D) graphene-based biosensor for microcystin-LR (MC-LR) detection and quantification. We report the efficient functionalization and immobilization of microcystin-LR and its antibodies on the facile synthesized CVD 3D graphene. The modified graphene electrodes were characterized by X-ray photoelectron spectroscopy and micro-Raman spectroscopy. Cyclic voltammetry and electrochemical impedance spectroscopy were used to electrochemically characterize the biochemical events on the electrodes. Specifically, as-prepared 3D graphene-based biosensors can detect MC-LR with remarkable sensitivity due to its macro-porous structure and large surface area, and high conductivity. A very good linear correlation of the electron-transfer resistance (R"2 = 0.93) was achieved over 0.05 and 20 μg/L MC-LR concentration range. Also, a detection limit of 0.05 μg/L was accomplished, which is much lower than the World Health Organization (WHO) provisional guideline limit of MC-LR concentration (i.e. 1 μg/L) in drinking water.

Video-based respiration monitoring with automatic region of interest detection

NARCIS (Netherlands)

Janssen, R.J.M.; Wang, Wenjin; Moço, A.; de Haan, G.

2016-01-01

Vital signs monitoring is ubiquitous in clinical environments and emerging in home-based healthcare applications. Still, since current monitoring methods require uncomfortable sensors, respiration rate remains the least measured vital sign. In this paper, we propose a video-based respiration

Operations of the LR56 radioactive liquid cask transport system at U.S. Department of Energy sites

International Nuclear Information System (INIS)

Davidson, J.S.; Hornstra, D.J.; Sazawal, V.K.; Clement, G.

1996-01-01

The LR56 cask system is licensed for use in France under Certificate of Compliance F/309/B(U)F for transport of 4,000-liter volumes of radioactive liquids. Three LR56 cask systems (with modifications for use at Department of Energy (DOE) sites) have been purchased for delivery at the Hanford Site, Oak Ridge National Laboratory (ORNL), and Savannah River Site (SRS). The LR56 cask systems will be used for on-site transfers of Type B quantities of radioactive liquid waste. The ORNL unit will also be used as a Type A packaging for transfers of radioactive liquids between DOE sites. This paper discusses LR56 operating features and the use of the cask system at the three DOE sites

Relationships between Personal Measurements of 'Total' Dust, Respirable, Thoracic, and Inhalable Aerosol Fractions in the Cement Production Industry.

Science.gov (United States)

Notø, Hilde P; Nordby, Karl-Christian; Eduard, Wijnand

2016-05-01

The aims of this study were to examine the relationships and establish conversion factors between 'total' dust, respirable, thoracic, and inhalable aerosol fractions measured by parallel personal sampling on workers from the production departments of cement plants. 'Total' dust in this study refers to aerosol sampled by the closed face 37-mm Millipore filter cassette. Side-by-side personal measurements of 'total' dust and respirable, thoracic, and inhalable aerosol fractions were performed on workers in 17 European and Turkish cement plants. Simple linear and mixed model regressions were used to model the associations between the samplers. The total number of personal samples collected on 141 workers was 512. Of these 8.4% were excluded leaving 469 for statistical analysis. The different aerosol fractions contained from 90 to 130 measurements and-side-by side measurements of all four aerosol fractions were collected on 72 workers.The median ratios between observed results of the respirable, 'total' dust, and inhalable fractions relative to the thoracic aerosol fractions were 0.51, 2.4, and 5.9 respectively. The ratios between the samplers were not constant over the measured concentration range and were best described by regression models. Job type, position of samplers on left or right shoulder and plant had no substantial effect on the ratios. The ratios between aerosol fractions changed with different air concentrations. Conversion models for estimation of the fractions were established. These models explained a high proportion of the variance (74-91%) indicating that they are useful for the estimation of concentrations based on measurements of a different aerosol fraction. The calculated uncertainties at most observed concentrations were below 30% which is acceptable for comparison with limit values (EN 482, 2012). The cement industry will therefore be able to predict the health related aerosol fractions from their former or future measurements of one of the

LALR(1) : LL(1) = LR(0) : LL(0)

NARCIS (Netherlands)

Kruseman Aretz, F.E.J.; Emde Boas, van P.; Hemker, P.W.; Hoffman, W.; Houwen, van der P.J.; Pfluger, P.R.

1992-01-01

It is shown that LL(l) and LALR(l) acceptors can be obtained by restricting the action tables of the corresponding LL(O) and LR(O) acceptors to those entries that are accessed in at least one accepting sequence (of a sentence from the language). It follows that a number of properties that are easily

Reproduction impairment and endocrine disruption in female zebrafish after long-term exposure to MC-LR: A life cycle assessment.

Science.gov (United States)

Hou, Jie; Li, Li; Wu, Ning; Su, Yujing; Lin, Wang; Li, Guangyu; Gu, Zemao

2016-01-01

Microcystin-LR (MC-LR) has been found to cause reproductive and developmental impairments as well as to disrupt sex hormone homeostasis of fish during acute and sub-chronic toxic experiments. However, fish in natural environments are continuously exposed to MC-LR throughout their entire life cycle as opposed to short-term exposure. Here, we tested the hypothesis that the mechanism by which MC-LR harms female fish reproduction and development within natural water bodies is through interference of the reproductive endocrine system. In the present study, zebrafish hatchlings (5 d post-fertilization) were exposed to 0, 0.3, 3 and 30 μg/L MC-LR for 90 d until reaching sexual maturity. Female zebrafish were selected, and the changes in growth and developmental indicators, ovarian ultrastructure as well as the levels of gonadal steroid hormones and vitellogenin (VTG) were examined along with the transcription of related genes in the hypothalamic-pituitary-gonadal-liver axis (HPGL-axis). The results showed for the first time, a life cycle exposure to MC-LR caused growth inhibition, decreased ovary weight and ovarian ultra-pathological lesions. Decreased ovarian testosterone levels indicated that MC-LR disrupted sex steroid hormone balance. Significantly up-regulated transcription of brain FSHβ and LHβ along with ovarian ERα, FSHR and LHR suggested positive feedback regulation in the HPGL-axis was induced as a compensatory mechanism for MC-LR damage. It was also noted that ovarian VTG content and hepatic ERα and VTG1 expression were all down-regulated, which might be responsible for reduced vitellus storage noted in our histological observations. Our findings indicate that a life cycle exposure to MC-LR impairs the development and reproduction of female zebrafish by disrupting the transcription of related HPGL-axis genes, suggesting that MC-LR has potential adverse effects on fish reproduction and thus population dynamics in MCs-contaminated aquatic environment

Microcystin-LR nanobody screening from an alpaca phage display nanobody library and its expression and application.

Science.gov (United States)

Xu, Chongxin; Yang, Ying; Liu, Liwen; Li, Jianhong; Liu, Xiaoqin; Zhang, Xiao; Liu, Yuan; Zhang, Cunzheng; Liu, Xianjin

2018-04-30

Microcystin-LR (MC-LR) is a type of biotoxin that pollutes the ecological environment and food. The study aimed to obtain new nanobodies from phage nanobody library for determination of MC-LR. The toxin was conjugated to keyhole limpet haemocyanin (KLH) and bovine serum albumin (BSA), respectively, then the conjugates were used as coated antigens for enrichment (coated MC-LR-KLH) and screening (coated MC-LR-BSA) of MC-LR phage nanobodies from an alpaca phage display nanobody library. The antigen-specific phage particles were enriched effectively with four rounds of biopanning. At the last round of enrichment, total 20 positive monoclonal phage nanobodies were obtained from the library, which were analyzed after monoclonal phage enzyme linked immunosorbent assay (ELISA), colony PCR and DNA sequencing. The most three positive nanobody genes, ANAb12, ANAb9 and ANAb7 were cloned into pET26b vector, then the nanobodies were expressed in Escherichia coli BL21 respectively. After being purified, the molecular weight (M.W.) of all nanobodies were approximate 15kDa with sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The purified nanobodies, ANAb12, ANAb9 and ANAb7 were used to establish the indirect competitive ELISA (IC-ELISA) for MC-LR, and their half-maximum inhibition concentrations (IC 50 ) were 0.87, 1.17 and 1.47μg/L, their detection limits (IC 10 ) were 0.06, 0.08 and 0.12μg/L, respectively. All of them showed strong cross-reactivity (CRs) of 82.7-116.9% for MC-RR, MC-YR and MC-WR, and weak CRs of less than 4.56% for MC-LW, less than 0.1% for MC-LY and MC-LF. It was found that all the IC-ELISAs for MC-LR spiked in tap water samples detection were with good accuracy, stability and repeatability, their recoveries were 84.0-106.5%, coefficient of variations (CVs) were 3.4-10.6%. These results showed that IC-ELISA based on the nanobodies from the alpaca phage display antibody library were promising for high sensitive determination of multiple

Boreal and temperate trees show strong acclimation of respiration to warming.

Science.gov (United States)

Reich, Peter B; Sendall, Kerrie M; Stefanski, Artur; Wei, Xiaorong; Rich, Roy L; Montgomery, Rebecca A

2016-03-31

Plant respiration results in an annual flux of carbon dioxide (CO2) to the atmosphere that is six times as large as that due to the emissions from fossil fuel burning, so changes in either will impact future climate. As plant respiration responds positively to temperature, a warming world may result in additional respiratory CO2 release, and hence further atmospheric warming. Plant respiration can acclimate to altered temperatures, however, weakening the positive feedback of plant respiration to rising global air temperature, but a lack of evidence on long-term (weeks to years) acclimation to climate warming in field settings currently hinders realistic predictions of respiratory release of CO2 under future climatic conditions. Here we demonstrate strong acclimation of leaf respiration to both experimental warming and seasonal temperature variation for juveniles of ten North American tree species growing for several years in forest conditions. Plants grown and measured at 3.4 °C above ambient temperature increased leaf respiration by an average of 5% compared to plants grown and measured at ambient temperature; without acclimation, these increases would have been 23%. Thus, acclimation eliminated 80% of the expected increase in leaf respiration of non-acclimated plants. Acclimation of leaf respiration per degree temperature change was similar for experimental warming and seasonal temperature variation. Moreover, the observed increase in leaf respiration per degree increase in temperature was less than half as large as the average reported for previous studies, which were conducted largely over shorter time scales in laboratory settings. If such dampening effects of leaf thermal acclimation occur generally, the increase in respiration rates of terrestrial plants in response to climate warming may be less than predicted, and thus may not raise atmospheric CO2 concentrations as much as anticipated.

Respirators. Does your face fit

Energy Technology Data Exchange (ETDEWEB)

Caro, N M; Else, D

1981-04-01

The authors carried out a survey of face sizes of men and women of four different ethnic origins and carried out face-seal leakage trials on four corresponding test panels. No single respirator design is likely to fit all members of the workforce, and it may be necessary to stock respirators from more than one manufacturers.Three or four different respirators or size of respirator may be needed. However, the use of lossely-fitting respirators such as Airsteam helmets could remove the necessity for exhaustive fitting procedures.

Geochemical importance of isotopic fractionation during respiration

International Nuclear Information System (INIS)

Schleser, G.; Foerstel, H.

1975-01-01

In 1935 it was found that atmospheric oxygen contained a relatively greater abundance of the 18 O isotope than did the oxygen bound in water (Dole effect). A major contribution to the fractionation of the stable oxygen isotopes should result from the respiration of microorganisms. In this respect our interest centers on the soil because nearly all organic material produced on land is decomposed within the soil. The oceans are less important because the primary productivity on land is twice the value for the oceans. In a first approach we measured the oxygen isotope fractionation during the respiration of E. coli K12 for different respiration rates. These results, accomplished with a chemostat, indicate that the fractionation factor α of the oxygen isotopes increases with the increasing respiratory activity, measured as Q/sub O 2 /. At low dilution rates or growth rates respectively of about 0.05 h -1 , the fractionation factor amounts to 1.006 increasing to 1.017 at dilution rates of about 1.0 h -1 . The results are interpreted as a kinetic mass fractionation due to the slightly different diffusion coefficients of 16 O 2 and 18 O 16 O. The respiration rates in conjunction with the corresponding fractionation data are compared with the respiration rates of typical soil microorganisms such as Azotobacter, in order to deduce fractionation data for these organisms. This is necessary to calculate a mean global fractionation factor. Understanding the Dole effect with these fractionation processes should finally give us the opportunity to calculate gas-exchange rates between the atmosphere and the oceans, on the basis of the behavior of the stable oxygen isotopes

Radon concentrations in some Egyptian dwellings using LR 115 detectors

International Nuclear Information System (INIS)

Hussein, A.S.

2007-01-01

Radon, a well-established risk factor for human lung cancer, is present at low concentrations in most homes. Consequently, many countries have established national guidelines for residential radon concentrations. This survey provides additional information about indoor radon concentrations in Egypt. Indoor radon survey of a total of 15 randomly selected houses in Qena city, Upper Egypt was carried out. LR 115 detectors were exposed for one year, covering all the seasons. The estimated indoor radon levels varied from 19 to 59 Bq m 3 with an average of 40 Bq m 3 . Using the bare and filtered LR 115 detectors, the average equilibrium factor F was assessed as 0.30 indoors. An average annual effective dose of 0.40 mSv has been estimated and was found to be lower than the ICRP-65

The Effect of Restoration on Soil Respiration in an Urban Tidal Wetland in the Meadowlands, New Jersey

Science.gov (United States)

Schafer, K. V.; Kurepa, S.; Duman, T.; Scott, M.; Pechmann, I.; Vanderklein, D. W.

2017-12-01

The effect of wetland restoration on soil respiration in tidal brackish marshes has not been comprehensively studied. In New Jersey, common mitigation efforts come in the form of the removal of an invasive haplotype of Phragmites australis and replanting of native species, resulting in significant habitat disturbance. This study investigated the differences in soil respiration within and between areas covered with P. australis, Spartina alterniflora, and Spartina patens. We performed static chamber measurements of soil respiration using an infrared gas analyzer to measure CO2 fluxes in a natural site and a mitigated site in the Meadowlands of New Jersey. Daytime measurements were performed in 10 random locations in areas populated with each of the vegetation types, to represent the spatial heterogeneity of the wetland area, during summer 2017. Due to the nature of the wetland, vegetation had to be removed to uncover the soil. Prior to measuring exposed soil respiration, we therefore measured CO2 flux including the vegetation within the chamber, which allowed us to additionally calculate the respiration including the vegetation. Furthermore, we assessed direct respiration of green leaves with leaf gas exchange measurements. Combining these different methodologies and scales allow us to estimate the function of different components that contribute to total respiration from the wetland, and how they change spatially and temporally. Initial results showed that soil respiration in P. australis patches was much higher than in both Spartina species, however average vegetation respiration per unit mass was similar across all three. Vegetation respiration and soil respiration are of the same order of magnitude in all three species as well. Also, when respiration with and without vegetation was combined, P. australis showed a considerably higher flux.

Soil Respiration under Different Land Uses in Eastern China

Science.gov (United States)

Fan, Li-Chao; Yang, Ming-Zhen; Han, Wen-Yan

2015-01-01

Land-use change has a crucial influence on soil respiration, which further affects soil nutrient availability and carbon stock. We monitored soil respiration rates under different land-use types (tea gardens with three production levels, adjacent woodland, and a vegetable field) in Eastern China at weekly intervals over a year using the dynamic closed chamber method. The relationship between soil respiration and environmental factors was also evaluated. The soil respiration rate exhibited a remarkable single peak that was highest in July/August and lowest in January. The annual cumulative respiration flux increased by 25.6% and 20.9% in the tea garden with high production (HP) and the vegetable field (VF), respectively, relative to woodland (WL). However, no significant differences were observed between tea gardens with medium production (MP), low production (LP), WL, and VF. Soil respiration rates were significantly and positively correlated with organic carbon, total nitrogen, and available phosphorous content. Each site displayed a significant exponential relationship between soil respiration and soil temperature measured at 5 cm depth, which explained 84–98% of the variation in soil respiration. The model with a combination of soil temperature and moisture was better at predicting the temporal variation of soil respiration rate than the single temperature model for all sites. Q10 was 2.40, 2.00, and 1.86–1.98 for VF, WL, and tea gardens, respectively, indicating that converting WL to VF increased and converting to tea gardens decreased the sensitivity of soil respiration to temperature. The equation of the multiple linear regression showed that identical factors, including soil organic carbon (SOC), soil water content (SWC), pH, and water soluble aluminum (WSAl), drove the changes in soil respiration and Q10 after conversion of land use. Temporal variations of soil respiration were mainly controlled by soil temperature, whereas spatial variations were

An instrument design and sample strategy for measuring soil respiration in the coastal temperate rain forest

Science.gov (United States)

Nay, S. M.; D'Amore, D. V.

2009-12-01

The coastal temperate rainforest (CTR) along the northwest coast of North America is a large and complex mosaic of forests and wetlands located on an undulating terrain ranging from sea level to thousands of meters in elevation. This biome stores a dynamic portion of the total carbon stock of North America. The fate of the terrestrial carbon stock is of concern due to the potential for mobilization and export of this store to both the atmosphere as carbon respiration flux and ocean as dissolved organic and inorganic carbon flux. Soil respiration is the largest export vector in the system and must be accurately measured to gain any comprehensive understanding of how carbon moves though this system. Suitable monitoring tools capable of measuring carbon fluxes at small spatial scales are essential for our understanding of carbon dynamics at larger spatial scales within this complex assemblage of ecosystems. We have adapted instrumentation and developed a sampling strategy for optimizing replication of soil respiration measurements to quantify differences among spatially complex landscape units of the CTR. We start with the design of the instrument to ease the technological, ergonomic and financial barriers that technicians encounter in monitoring the efflux of CO2 from the soil. Our sampling strategy optimizes the physical efforts of the field work and manages for the high variation of flux measurements encountered in this difficult environment of rough terrain, dense vegetation and wet climate. Our soil respirometer incorporates an infra-red gas analyzer (LiCor Inc. LI-820) and an 8300 cm3 soil respiration chamber; the device is durable, lightweight, easy to operate and can be built for under $5000 per unit. The modest unit price allows for a multiple unit fleet to be deployed and operated in an intensive field monitoring campaign. We use a large 346 cm2 collar to accommodate as much micro spatial variation as feasible and to facilitate repeated measures for tracking

Measurement of Lung Cancer Tumor Markers in a Glass Wool Company Workers Exposed to Respirable Synthetic Vitreous Fiber and Dust

Directory of Open Access Journals (Sweden)

Shabnam Abtahi

2018-01-01

Full Text Available Background: Occupational exposures to respirable synthetic vitreous fiber (SVF and dust are associated with many lung diseases including lung cancer. Low-dose computed tomography is used for screening patients who are highly suspicious of having lung carcinoma. However, it seems not to be cost-effective. Serum biomarkers could be a useful tool for the surveillance of occupational exposure, by providing the possibility of diagnosing lung cancer in its early stages. Objective: To determine if serum carcinoembryonic antigen (CEA and cytokeratin fragment (CYFRA 21-1 levels in workers exposed more than normal population to respirable SVF and dust may be used as indicators of progression towards lung cancer. Methods: An analytic cross-sectional study, including 145 personnel of a glass wool company, along with 25 age-matched healthy individuals, was conducted to investigate the relationship between occupational exposure to respirable SVFs and dust and serum levels of two lung/pleura serum tumor markers, CEA and CYFRA 21-1, measured by ELISA. Results: Individuals exposed to higher than the recommended levels of respirable SVF had higher serum concentrations of CEA and CYFRA 21-1, compared to controls (p=0.008 and 0.040, respectively, as well as in comparison to those exposed to lower than recommended OSHA levels (p=0.046 and 0.033, respectively. Workers with >9 years work experience, had significantly (p=0.045 higher levels of serum CYFRA 21-1 than those with ≤9 years of experience. Conclusion: It seems that working for >9 years in sites with detectable levels of respirable SVF and dust would increase the levels of known lung cancer serum tumor markers. Transferring these workers to sites with respirable SVF concentrations lower than the limit of detection in the air is recommended.

Lr67/Yr46 confers adult plant resistance to stem rust and powdery mildew in wheat.

Science.gov (United States)

Herrera-Foessel, Sybil A; Singh, Ravi P; Lillemo, Morten; Huerta-Espino, Julio; Bhavani, Sridhar; Singh, Sukhwinder; Lan, Caixia; Calvo-Salazar, Violeta; Lagudah, Evans S

2014-04-01

We demonstrate that Lr67/Yr46 has pleiotropic effect on stem rust and powdery mildew resistance and is associated with leaf tip necrosis. Genes are designated as Sr55, Pm46 and Ltn3 , respectively. Wheat (Triticum aestivum) accession RL6077, known to carry the pleiotropic slow rusting leaf and yellow rust resistance genes Lr67/Yr46 in Thatcher background, displayed significantly lower stem rust (P. graminis tritici; Pgt) and powdery mildew (Blumeria graminis tritici; Bgt) severities in Kenya and in Norway, respectively, compared to its recurrent parent Thatcher. We investigated the resistance of RL6077 to stem rust and powdery mildew using Avocet × RL6077 F6 recombinant inbred lines (RILs) derived from two photoperiod-insensitive F3 families segregating for Lr67/Yr46. Greenhouse seedling tests were conducted with Mexican Pgt race RTR. Field evaluations were conducted under artificially initiated stem rust epidemics with Pgt races RTR and TTKST (Ug99 + Sr24) at Ciudad Obregon (Mexico) and Njoro (Kenya) during 2010-2011; and under natural powdery mildew epiphytotic in Norway at Ås and Hamar during 2011 and 2012. In Mexico, a mean reduction of 41 % on stem rust severity was obtained for RILs carrying Lr67/Yr46, compared to RILs that lacked the gene, whereas in Kenya the difference was smaller (16 %) but significant. In Norway, leaf tip necrosis was associated with Lr67/Yr46 and RILs carrying Lr67/Yr46 showed a 20 % reduction in mean powdery mildew severity at both sites across the 2 years of evaluation. Our study demonstrates that Lr67/Yr46 confers partial resistance to stem rust and powdery mildew and is associated with leaf tip necrosis. The corresponding pleiotropic, or tightly linked, genes, designated as Sr55, Pm46, and Ltn3, can be utilized to provide broad-spectrum durable disease resistance in wheat.

Biosignal PI, an Affordable Open-Source ECG and Respiration Measurement System

Directory of Open Access Journals (Sweden)

Farhad Abtahi

2014-12-01

Full Text Available Bioimedical pilot projects e.g., telemedicine, homecare, animal and human trials usually involve several physiological measurements. Technical development of these projects is time consuming and in particular costly. A versatile but affordable biosignal measurement platform can help to reduce time and risk while keeping the focus on the important goal and making an efficient use of resources. In this work, an affordable and open source platform for development of physiological signals is proposed. As a first step an 8–12 leads electrocardiogram (ECG and respiration monitoring system is developed. Chips based on iCoupler technology have been used to achieve electrical isolation as required by IEC 60601 for patient safety. The result shows the potential of this platform as a base for prototyping compact, affordable, and medically safe measurement systems. Further work involves both hardware and software development to develop modules. These modules may require development of front-ends for other biosignals or just collect data wirelessly from different devices e.g., blood pressure, weight, bioimpedance spectrum, blood glucose, e.g., through Bluetooth. All design and development documents, files and source codes will be available for non-commercial use through project website, BiosignalPI.org.

Transfer of bacteriophage MS2 and fluorescein from N95 filtering facepiece respirators to hands: Measuring fomite potential

Science.gov (United States)

Brady, Tyler M.; Strauch, Amanda L.; Almaguer, Claudia M.; Niezgoda, George; Shafer, Ronald E.; Yorio, Patrick L.; Fisher, Edward M.

2017-01-01

Contact transmission of pathogens from personal protective equipment is a concern within the healthcare industry. During public health emergency outbreaks, resources become constrained and the reuse of personal protective equipment, such as N95 filtering facepiece respirators, may be needed. This study was designed to characterize the transfer of bacteriophage MS2 and fluorescein between filtering facepiece respirators and the wearer’s hands during three simulated use scenarios. Filtering facepiece respirators were contaminated with MS2 and fluorescein in droplets or droplet nuclei. Thirteen test subjects performed filtering facepiece respirator use scenarios including improper doffing, proper doffing and reuse, and improper doffing and reuse. Fluorescein and MS2 contamination transfer were quantified. The average MS2 transfer from filtering facepiece respirators to the subjects’ hands ranged from 7.6–15.4% and 2.2–2.7% for droplet and droplet nuclei derived contamination, respectively. Handling filtering facepiece respirators contaminated with droplets resulted in higher levels of MS2 transfer compared to droplet nuclei for all use scenarios (p = 0.007). MS2 transfer from droplet contaminated filtering facepiece respirators during improper doffing and reuse was greater than transfer during improper doffing (p = 0.008) and proper doffing and reuse (p = 0.042). Droplet contamination resulted in higher levels of fluorescein transfer compared to droplet nuclei contaminated filtering facepiece respirators for all use scenarios (p = 0.009). Fluorescein transfer was greater for improper doffing and reuse (p = 0.007) from droplet contaminated masks compared to droplet nuclei contaminated filtering facepiece respirators and for improper doffing and reuse when compared improper doffing (p = 0.017) and proper doffing and reuse (p = 0.018) for droplet contaminated filtering facepiece respirators. For droplet nuclei contaminated filtering facepiece respirators, the

A Multi-Walled Carbon Nanotube-based Biosensor for Monitoring Microcystin-LR in Sources of Drinking Water Supplies

Science.gov (United States)

A multi-walled carbon nanotube-based electrochemical biosensor is developed for monitoring microcystin-LR (MC-LR), a toxic cyanobacterial toxin, in sources of drinking water supplies. The biosensor electrodes are fabricated using dense, mm-long multi-walled CNT (MWCNT) arrays gro...

Radon concentrations in some Egyptian dwellings using LR 115 detectors

Energy Technology Data Exchange (ETDEWEB)

Hussein, A S [Radiation Protection Department, Nuclear Power Plants Authority, Cairo (Egypt)

2007-06-15

Radon, a well-established risk factor for human lung cancer, is present at low concentrations in most homes. Consequently, many countries have established national guidelines for residential radon concentrations. This survey provides additional information about indoor radon concentrations in Egypt. Indoor radon survey of a total of 15 randomly selected houses in Qena city, Upper Egypt was carried out. LR 115 detectors were exposed for one year, covering all the seasons. The estimated indoor radon levels varied from 19 to 59 Bq m{sup 3} with an average of 40 Bq m{sup 3}. Using the bare and filtered LR 115 detectors, the average equilibrium factor F was assessed as 0.30 indoors. An average annual effective dose of 0.40 mSv has been estimated and was found to be lower than the ICRP-65.

Root Zone Respiration on Hydroponically Grown Wheat Plant Systems

Science.gov (United States)

Soler-Crespo, R. A.; Monje, O. A.

2010-01-01

Root respiration is a biological phenomenon that controls plant growth and physiological development during a plant's lifespan. This process is dependent on the availability of oxygen in the system where the plant is located. In hydroponic systems, where plants are submerged in a solution containing vital nutrients but no type of soil, the availability of oxygen arises from the dissolved oxygen concentration in the solution. This oxygen concentration is dependent on the , gas-liquid interface formed on the upper surface of the liquid, as given by Henry's Law, depending on pressure and temperature conditions. Respiration rates of the plants rise as biomass and root zone increase with age. The respiration rate of Apogee wheat plants (Triticum aestivum) was measured as a function of light intensity (catalytic for photosynthesis) and CO2 concentration to determine their effect on respiration rates. To determine their effects on respiration rate and plant growth microbial communities were introduced into the system, by Innoculum. Surfactants were introduced, simulating gray-water usage in space, as another factor to determine their effect on chemical oxygen demand of microbials and on respiration rates of the plants. It is expected to see small effects from changes in CO2 concentration or light levels, and to see root respiration decrease in an exponential manner with plant age and microbial activity.

Applied use of cardiac and respiration measures: practical considerations and precautions.

Science.gov (United States)

Wilson, G F

1992-11-01

Cardiac and respiratory measures can be successfully applied to "real world" environments and these measures have certain advantages over both performance and subjective measures that are typically used to monitor operator state and workload. However, because of large differences between laboratory and "real world" environments one must utilize caution in directly applying laboratory data and theories to the day-to-day world environment. While most workers are highly over-trained in their jobs, laboratory subjects are often under-trained in the cognitive tasks that are used to study cognitive activity. It is possible that a substantial portion of experimental effects reported in laboratory studies is due to learning effects. In addition, relatively small changes in cardiac and respiration measures are reported to experimental manipulations in the laboratory while a much larger range of changes are reported in "real world" environments. These differences highlight questions about laboratory/real world similarities and the need to develop a database of actual work environment data. A third area of concern is the relative lack of control over the experimental situation that is the case with most applied research. The possible confounding of changes due to cognitive and physical activity levels is a major concern and strategies for overcoming these problems are suggested. The potential for valuable contributions by cardiac and respiratory measures to applied research make overcoming these difficulties worthwhile.

Measurement of gross photosynthesis, respiration in the light, and mesophyll conductance using H218O labeling.

Science.gov (United States)

Gauthier, Paul Pg; Battle, Mark O; Griffin, Kevin L; Bender, Michael L

2018-03-27

A fundamental challenge in plant physiology is independently determining the rates of gross O2 production by photosynthesis and O2 consumption by respiration, photorespiration, and other processes. Previous studies on isolated chloroplasts or leaves have separately constrained net and gross O2 production (NOP and GOP, respectively) by labeling ambient O2 with 18O while leaf water was unlabeled. Here, we describe a method to accurately measure GOP and NOP of whole detached leaves in a cuvette as a routine gas exchange measurement. The petiole is immersed in water enriched to a δ18O of ~9,000‰, and leaf water is labeled through the transpiration stream. Photosynthesis transfers 18O from H2O to O2. GOP is calculated from the increase in δ18O of O2 as air passes through the cuvette. NOP is determined from the increase in O2/N2. Both terms are measured by isotope ratio mass spectrometry. CO2 assimilation and other standard gas exchange parameters are also measured. Reproducible measurements are made on a single leaf for more than 15 hours. We used this method to measure the light response curve of NOP and GOP in Phaseolus vulgaris at 21% and 2% O2. We then used these data to examine the O2/CO2 ratio of net photosynthesis, the light response curve of mesophyll conductance, and the apparent inhibition of respiration in the light (Kok effect) at both oxygen levels. The results are discussed in the context of evaluating the technique as a tool to study and understand leaf physiological traits. {copyright, serif} 2018 American Society of Plant Biologists. All rights reserved.

New method of measuring lichen respiration: response of selected species to temperature, pH and sulphur dioxide

Energy Technology Data Exchange (ETDEWEB)

Baddeley, M S; Ferry, B W; Finegan, E J

1971-01-01

The respiration of selected lichens and their response to temperature, pH and sulphur dioxide concentration were investigated in aqueous solution using an oxygen electrode. Respiration rates increased to a maximum at 40/sup 0/ C although some individual species showed variations from this general pattern. The optimal pH for respiration was found to be 4.2 except in Hypogymnia physodes (3.2) and Ramalina fastigiata (5.2). Sulfur dioxide at concentrations similar to those likely to be encountered in heavily polluted areas in nature had marked inhibitory effects of the respiration rate of all species investigated but as these variations did not entirely correspond to the tolerances of the species in the field some other factors must also be involved in the sensitivity of lichens to sulphur dioxide pollution. The advantages of using an oxygen electrode rather than manometric or other techniques in studies on the respiration rate of lichens are discussed. 29 references, 3 figures, 2 tables.

Respiration climacteric in tomato fruits elucidated by constraint-based modelling.

Science.gov (United States)

Colombié, Sophie; Beauvoit, Bertrand; Nazaret, Christine; Bénard, Camille; Vercambre, Gilles; Le Gall, Sophie; Biais, Benoit; Cabasson, Cécile; Maucourt, Mickaël; Bernillon, Stéphane; Moing, Annick; Dieuaide-Noubhani, Martine; Mazat, Jean-Pierre; Gibon, Yves

2017-03-01

Tomato is a model organism to study the development of fleshy fruit including ripening initiation. Unfortunately, few studies deal with the brief phase of accelerated ripening associated with the respiration climacteric because of practical problems involved in measuring fruit respiration. Because constraint-based modelling allows predicting accurate metabolic fluxes, we investigated the respiration and energy dissipation of fruit pericarp at the breaker stage using a detailed stoichiometric model of the respiratory pathway, including alternative oxidase and uncoupling proteins. Assuming steady-state, a metabolic dataset was transformed into constraints to solve the model on a daily basis throughout tomato fruit development. We detected a peak of CO 2 released and an excess of energy dissipated at 40 d post anthesis (DPA) just before the onset of ripening coinciding with the respiration climacteric. We demonstrated the unbalanced carbon allocation with the sharp slowdown of accumulation (for syntheses and storage) and the beginning of the degradation of starch and cell wall polysaccharides. Experiments with fruits harvested from plants cultivated under stress conditions confirmed the concept. We conclude that modelling with an accurate metabolic dataset is an efficient tool to bypass the difficulty of measuring fruit respiration and to elucidate the underlying mechanisms of ripening. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

Exposure to inhalable, respirable, and ultrafine particles in welding fume.

Science.gov (United States)

Lehnert, Martin; Pesch, Beate; Lotz, Anne; Pelzer, Johannes; Kendzia, Benjamin; Gawrych, Katarzyna; Heinze, Evelyn; Van Gelder, Rainer; Punkenburg, Ewald; Weiss, Tobias; Mattenklott, Markus; Hahn, Jens-Uwe; Möhlmann, Carsten; Berges, Markus; Hartwig, Andrea; Brüning, Thomas

2012-07-01

This investigation aims to explore determinants of exposure to particle size-specific welding fume. Area sampling of ultrafine particles (UFP) was performed at 33 worksites in parallel with the collection of respirable particles. Personal sampling of respirable and inhalable particles was carried out in the breathing zone of 241 welders. Median mass concentrations were 2.48 mg m(-3) for inhalable and 1.29 mg m(-3) for respirable particles when excluding 26 users of powered air-purifying respirators (PAPRs). Mass concentrations were highest when flux-cored arc welding (FCAW) with gas was applied (median of inhalable particles: 11.6 mg m(-3)). Measurements of particles were frequently below the limit of detection (LOD), especially inside PAPRs or during tungsten inert gas welding (TIG). However, TIG generated a high number of small particles, including UFP. We imputed measurements welding fume. Concentrations were mainly predicted by the welding process and were significantly higher when local exhaust ventilation (LEV) was inefficient or when welding was performed in confined spaces. Substitution of high-emission techniques like FCAW, efficient LEV, and using PAPRs where applicable can reduce exposure to welding fume. However, harmonizing the different exposure metrics for UFP (as particle counts) and for the respirable or inhalable fraction of the welding fume (expressed as their mass) remains challenging.

Assessment of human respiration patterns via noncontact sensing using Doppler multi-radar system.

Science.gov (United States)

Gu, Changzhan; Li, Changzhi

2015-03-16

Human respiratory patterns at chest and abdomen are associated with both physical and emotional states. Accurate measurement of the respiratory patterns provides an approach to assess and analyze the physical and emotional states of the subject persons. Not many research efforts have been made to wirelessly assess different respiration patterns, largely due to the inaccuracy of the conventional continuous-wave radar sensor to track the original signal pattern of slow respiratory movements. This paper presents the accurate assessment of different respiratory patterns based on noncontact Doppler radar sensing. This paper evaluates the feasibility of accurately monitoring different human respiration patterns via noncontact radar sensing. A 2.4 GHz DC coupled multi-radar system was used for accurate measurement of the complete respiration patterns without any signal distortion. Experiments were carried out in the lab environment to measure the different respiration patterns when the subject person performed natural breathing, chest breathing and diaphragmatic breathing. The experimental results showed that accurate assessment of different respiration patterns is feasible using the proposed noncontact radar sensing technique.

Allelopathic effects of microcystin-LR on the germination, growth and metabolism of five charophyte species and a submerged angiosperm.

Science.gov (United States)

Rojo, Carmen; Segura, Matilde; Cortés, Francisco; Rodrigo, María A

2013-11-15

Microcystins (MCs) are produced by cyanobacteria in aquatic environments and adversely affect macrophytes at very high concentrations. However, the effects of MC on macrophytes at concentrations of environmental relevance are largely unknown. The main objective of this study was to analyze the allelopathic effects of MC-LR at natural concentrations (1, 8 and 16 μg MC-LR/L) on five charophyte species (Chara aspera, C. baltica, C. hispida, C. vulgaris and Nitella hyalina) and the angiosperm Myriophyllum spicatum. Macrophyte specimens were obtained from a restored area located in Albufera de València Natural Park, a protected coastal Mediterranean wetland. Two different experiments were conducted involving (i) the addition of MC-LR to natural sediment to evaluate its effects on seed germination and (ii) the addition of MC-LR to water cultures of macrophytes to evaluate its effects on growth and metabolic functions. In water, the MC-LR concentration decreased by 84% in two weeks; the loss was not significant in sediment. The first seedlings (all C. hispida) emerged from the wetland sediment following a delay of a few days in the presence of MC-LR. The germination rates in 8 and 16 μg MC-LR/L treatments were 44% and 11% of that occurring in the absence of MC, but these differences disappeared over time. The final density was 6-7 germlings/dm(3). Final germling length was unaffected by MC-LR. Rotifers (Lecane spp.) emerging from the natural sediment during the experiment were favored by MC-LR; the opposite pattern was observed in the cladoceran Daphnia magna. The growth rates of C. vulgaris, C. baltica and N. hyalina were unaffected by MC exposure, whereas those of C. hispida and C. aspera were reduced in the MC treatments relative to the control treatment. The concentration of chlorophyll-a and the in vivo net photosynthetic rate were lower in the presence of MC-LR, even at the lowest concentration, for all of the characeans tested. M. spicatum was sensitive to the

Reductions in the variations of respiration signals for respiratory-gated radiotherapy when using the video-coaching respiration guiding system

Science.gov (United States)

Lee, Hyun Jeong; Yea, Ji Woon; Oh, Se An

2015-07-01

Respiratory-gated radiation therapy (RGRT) has been used to minimize the dose to normal tissue in lung-cancer radiotherapy. The present research aims to improve the regularity of respiration in RGRT by using a video-coached respiration guiding system. In the study, 16 patients with lung cancer were evaluated. The respiration signals of the patients were measured by using a realtime position management (RPM) respiratory gating system (Varian, USA), and the patients were trained using the video-coaching respiration guiding system. The patients performed free breathing and guided breathing, and the respiratory cycles were acquired for ~5 min. Then, Microsoft Excel 2010 software was used to calculate the mean and the standard deviation for each phase. The standard deviation was computed in order to analyze the improvement in the respiratory regularity with respect to the period and the displacement. The standard deviation of the guided breathing decreased to 48.8% in the inhale peak and 24.2% in the exhale peak compared with the values for the free breathing of patient 6. The standard deviation of the respiratory cycle was found to be decreased when using the respiratory guiding system. The respiratory regularity was significantly improved when using the video-coaching respiration guiding system. Therefore, the system is useful for improving the accuracy and the efficiency of RGRT.

Global spatiotemporal distribution of soil respiration modeled using a global database

Science.gov (United States)

Hashimoto, S.; Carvalhais, N.; Ito, A.; Migliavacca, M.; Nishina, K.; Reichstein, M.

2015-07-01

The flux of carbon dioxide from the soil to the atmosphere (soil respiration) is one of the major fluxes in the global carbon cycle. At present, the accumulated field observation data cover a wide range of geographical locations and climate conditions. However, there are still large uncertainties in the magnitude and spatiotemporal variation of global soil respiration. Using a global soil respiration data set, we developed a climate-driven model of soil respiration by modifying and updating Raich's model, and the global spatiotemporal distribution of soil respiration was examined using this model. The model was applied at a spatial resolution of 0.5°and a monthly time step. Soil respiration was divided into the heterotrophic and autotrophic components of respiration using an empirical model. The estimated mean annual global soil respiration was 91 Pg C yr-1 (between 1965 and 2012; Monte Carlo 95 % confidence interval: 87-95 Pg C yr-1) and increased at the rate of 0.09 Pg C yr-2. The contribution of soil respiration from boreal regions to the total increase in global soil respiration was on the same order of magnitude as that of tropical and temperate regions, despite a lower absolute magnitude of soil respiration in boreal regions. The estimated annual global heterotrophic respiration and global autotrophic respiration were 51 and 40 Pg C yr-1, respectively. The global soil respiration responded to the increase in air temperature at the rate of 3.3 Pg C yr-1 °C-1, and Q10 = 1.4. Our study scaled up observed soil respiration values from field measurements to estimate global soil respiration and provide a data-oriented estimate of global soil respiration. The estimates are based on a semi-empirical model parameterized with over one thousand data points. Our analysis indicates that the climate controls on soil respiration may translate into an increasing trend in global soil respiration and our analysis emphasizes the relevance of the soil carbon flux from soil to

Estimation of microbial respiration rates in groundwater by geochemical modeling constrained with stable isotopes

International Nuclear Information System (INIS)

Murphy, E.M.

1998-01-01

Changes in geochemistry and stable isotopes along a well-established groundwater flow path were used to estimate in situ microbial respiration rates in the Middendorf aquifer in the southeastern United States. Respiration rates were determined for individual terminal electron acceptors including O 2 , MnO 2 , Fe 3+ , and SO 4 2- . The extent of biotic reactions were constrained by the fractionation of stable isotopes of carbon and sulfur. Sulfur isotopes and the presence of sulfur-oxidizing microorganisms indicated that sulfate is produced through the oxidation of reduced sulfur species in the aquifer and not by the dissolution of gypsum, as previously reported. The respiration rates varied along the flow path as the groundwater transitioned between primarily oxic to anoxic conditions. Iron-reducing microorganisms were the largest contributors to the oxidation of organic matter along the portion of the groundwater flow path investigated in this study. The transition zone between oxic and anoxic groundwater contained a wide range of terminal electron acceptors and showed the greatest diversity and numbers of culturable microorganisms and the highest respiration rates. A comparison of respiration rates measured from core samples and pumped groundwater suggests that variability in respiration rates may often reflect the measurement scales, both in the sample volume and the time-frame over which the respiration measurement is averaged. Chemical heterogeneity may create a wide range of respiration rates when the scale of the observation is below the scale of the heterogeneity

Controls on Ecosystem and Root Respiration in an Alaskan Peatland

Science.gov (United States)

McConnell, N. A.; McGuire, A. D.; Harden, J. W.; Kane, E. S.; Turetsky, M. R.

2010-12-01

Boreal ecosystems cover 14% of the vegetated surface on earth and account for 25-30% of the world’s soil carbon (C), mainly due to large carbon stocks in deep peat and frozen soil layers. While peatlands have served as historical sinks of carbon, global climate change may trigger re-release of C to the atmosphere and may turn these ecosystems into net C sources. Rates of C release from a peatland are determined by regional climate and local biotic and abiotic factors such as vegetation cover, thaw depth, and peat thickness. Soil CO2 fluxes are driven by both autotrophic (plant) respiration and heterotrophic (microbial) respiration. Thus, changes in plant and microbial activity in the soil will impact CO2 emissions from peatlands. In this study, we explored environmental and vegetation controls on ecosystem respiration and root respiration in a variety of wetland sites. The study was conducted at the Alaskan Peatland Experiment (APEX; www.uoguelph.ca/APEX) sites in the Bonanza Creek Experimental Forest located 35 km southwest of Fairbanks Alaska. We measured ecosystem respiration, root respiration, and monitored a suite of environmental variables along a vegetation and soil moisture gradient including a black spruce stand with permafrost, a shrubby site with permafrost, a tussock grass site, and a herbaceous open rich fen. Within the rich fen, we have been conducting water table manipulations including a control, lowered, and raised water table treatment. In each of our sites, we measured total ecosystem respiration using static chambers and root respiration by harvesting roots from the uppermost 20 cm and placing them in a root cuvette to obtain a root flux. Ecosystem respiration (ER) on a μmol/m2/sec basis varied across sites. Water table was a significant predictor of ER at the lowered manipulation site and temperature was a strong predictor at the control site in the rich fen. Water table and temperature were both significant predictors of ER at the raised

High performance sulfur, nitrogen and carbon doped mesoporous anatase–brookite TiO2 photocatalyst for the removal of microcystin-LR under visible light irradiation

International Nuclear Information System (INIS)

El-Sheikh, Said M.; Zhang, Geshan; El-Hosainy, Hamza M.; Ismail, Adel A.; O'Shea, Kevin E.; Falaras, Polycarpos; Kontos, Athanassios G.; Dionysiou, Dionysios D.

2014-01-01

Graphical abstract: - Highlights: • Synthesis of tailor-designed C, N and S doped titania anatase–brookite nano-heterojunction photocatalyst. • Microcystin-LR was completely removed in the presence of doped sample under visible light. • The MC-LR degradation rate achieved by the doped sample was much better than that of un-doped sample under visible light. - Abstract: Carbon, nitrogen and sulfur (C, N and S) doped mesoporous anatase–brookite nano-heterojunction titania photocatalysts have been synthesized through a simple sol–gel method in the presence of triblock copolymer Pluronic P123. XRD and Raman spectra revealed the formation of anatase and brookite mixed phases. XPS spectra indicated the presence of C, N and S dopants. The TEM images demonstrated the formation of almost monodisperse titania nanoparticles with particle sizes of approximately 10 nm. N 2 isotherm measurements confirmed that both doped and undoped titania anatase–brookite materials have mesoporous structure. The photocatalytic degradation of the cyanotoxin microcystin-LR (MC-LR) has been investigated using these novel nanomaterials under visible light illumination. The photocatalytic efficiency of the mesoporous titania anatase–brookite photocatalyst dramatically increased with the addition of the C, N and S non-metal, achieving complete degradation (∼100%) of MC-LR. The results demonstrate the advantages of the synthetic approach and the great potential of the visible light activated C, N, and S doped titania photocatalysts for the treatment of organic micropollutants in contaminated waters under visible light

Respiration-correlated spiral CT: A method of measuring respiratory-induced anatomic motion for radiation treatment planning

International Nuclear Information System (INIS)

Ford, E.C.; Mageras, G.S.; Yorke, E.; Ling, C.C.

2003-01-01

We describe a method for generating CT images at multiple respiratory phases with a single spiral CT scan, referred to as respiratory-correlated spiral CT (RCCT). RCCT relies on a respiration wave form supplied by an external patient monitor. During acquisition this wave form is recorded along with the initiation time of the CT scan, so as to 'time stamp' each reconstructed slice with the phase of the respiratory cycle. By selecting the appropriate slices, a full CT image set is generated at several phases, typically 7-11 per cycle. The CT parameters are chosen to optimize the temporal resolution while minimizing the spatial gap between slices at successive respiratory cycles. Using a pitch of 0.5, a gantry rotation period of 1.5 s, and a 180 degree sign reconstruction algorithm results in ∼5 mm slice spacing at a given phase for typical respiration periods, and a respiratory motion within each slice that is acceptably small, particularly near end expiration or end inspiration where gated radiotherapy is to occur. We have performed validation measurements on a phantom with a moving sphere designed to simulate respiration-induced tumor motion. RCCT scans of the phantom at respiratory periods of 4, 5, and 6 s show good agreement of the sphere's motion with that observed under fluoroscopic imaging. The positional deviations in the sphere's centroid between RCCT and fluoroscopy are 1.1±0.9 mm in the transaxial direction (average over all scans at all phases ±1 s.d.) and 1.2±1.0 mm in the longitudinal direction. Reconstructed volumes match those expected on the basis of stationary-phantom scans to within 5% in all cases. The surface distortions of the reconstructed sphere, as quantified by deviations from a mathematical reference sphere, are similar to those from a stationary phantom scan and are correlated with the speed of the phantom. A RCCT scan of the phantom undergoing irregular motion, demonstrates that successful reconstruction can be achieved even with

A pM leveled photoelectrochemical sensor for microcystin-LR based on surface molecularly imprinted TiO2@CNTs nanostructure.

Science.gov (United States)

Liu, Meichuan; Ding, Xue; Yang, Qiwei; Wang, Yu; Zhao, Guohua; Yang, Nianjun

2017-06-05

A simple and highly sensitive photoelectrochemical (PEC) sensor towards Microcystin-LR (MC-LR), a kind of typical cyanobacterial toxin in water samples, was developed on a surface molecular imprinted TiO 2 coated multiwalled carbon nanotubes (MI-TiO 2 @CNTs) hybrid nanostructure. It was synthesized using a feasible two-step sol-gel method combining with in situ surface molecular imprinting technique (MIT). With a controllable core-shell tube casing structure, the resultant MI-TiO 2 @CNTs are enhanced greatly in visible-light driven response capacity. In comparison with the traditional TiO 2 (P25) and non-imprinted (NI-)TiO 2 @CNTs, the MI-TiO 2 @CNTs based PEC sensor showed a much higher photoelectric oxidation capacity towards MC-LR. Using this sensor, the determination of MC-LR was doable in a wide linear range from 1.0pM to 3.0nM with a high photocurrent response sensitivity. An outstanding selectivity towards MC-LR was further achieved with this sensor, proven by simultaneously monitoring 100-fold potential co-existing interferences. The superiority of the obtained MC-LR sensor in sensitivity and selectivity is mainly attributed to the high specific surface area and excellent photoelectric activity of TiO 2 @CNTs heterojunction structure, as well as the abundant active recognition sites on its functionalized molecular imprinting surface. A promising PEC analysis platform with high sensitivity and selectivity for MC-LR has thus been provided. Copyright © 2017 Elsevier B.V. All rights reserved.

Oxidation of microcystin-LR by the Fenton process : Kinetics, degradation intermediates, water quality and toxicity assessment

NARCIS (Netherlands)

Park, Jeong-Ann; Yang, Boram; Park, Chanhyuk; Choi, Jae-Woo; van Genuchten, Case M.|info:eu-repo/dai/nl/413489647; Lee, Sang-Hyup

2017-01-01

The Fenton process was assessed as a cost-effective technology for the removal of Microcystin-LR (MC-LR) among UV, UV/H2O2, and Fenton process according to efficiency and electrical energy per order (EE/O). The determined practical concentrations of the Fenton reagents were 5 mg/L Fe(II) and 5 mg/L

Abnormal mitochondrial respiration in failed human myocardium.

Science.gov (United States)

Sharov, V G; Todor, A V; Silverman, N; Goldstein, S; Sabbah, H N

2000-12-01

Chronic heart failure (HF) is associated with morphologic abnormalities of cardiac mitochondria including hyperplasia, reduced organelle size and compromised structural integrity. In this study, we examined whether functional abnormalities of mitochondrial respiration are also present in myocardium of patients with advanced HF. Mitochondrial respiration was examined using a Clark electrode in an oxygraph cell containing saponin-skinned muscle bundles obtained from myocardium of failed explanted human hearts due to ischemic (ICM, n=9) or idiopathic dilated (IDC, n=9) cardiomyopathy. Myocardial specimens from five normal donor hearts served as controls (CON). Basal respiratory rate, respiratory rate after addition of the substrates glutamate and malate (V(SUB)), state 3 respiration (after addition of ADP, V(ADP)) and respiration after the addition of atractyloside (V(AT)) were measured in scar-free muscle bundles obtained from the subendocardial (ENDO) and subepicardial (EPI) thirds of the left ventricular (LV) free wall, interventricular septum and right ventricular (RV) free wall. There were no differences in basal and substrate-supported respiration between CON and HF regardless of etiology. V(ADP)was significantly depressed both in ICM and IDC compared to CON in all the regions studied. The respiratory control ratio, V(ADP)/V(AT), was also significantly decreased in HF compared to CON. In both ICM and IDC, V(ADP)was significantly lower in ENDO compared to EPI. The results indicate that mitochondrial respiration is abnormal in the failing human heart. The findings support the concept of low myocardial energy production in HF via oxidative phosphorylation, an abnormality with a potentially impact on global cardiac performance. Copyright 2000 Academic Press.

Partitioning autotrophic and heterotrophic respiration at Howland Forest

Science.gov (United States)

Carbone, Mariah; Hollinger, Dave; Davidson, Eric; Savage, Kathleen; Hughes, Holly

2015-04-01

Terrestrial ecosystem respiration is the combined flux of CO2 to the atmosphere from above- and below-ground, plant (autotrophic) and microbial (heterotrophic) sources. Flux measurements alone (e.g., from eddy covariance towers or soil chambers) cannot distinguish the contributions from these sources, which may change seasonally and respond differently to temperature and moisture. The development of improved process-based models that can predict how plants and microbes respond to changing environmental conditions (on seasonal, interannual, or decadal timescales) requires data from field observations and experiments to distinguish among these respiration sources. We tested the viability of partitioning of soil and ecosystem respiration into autotrophic and heterotrophic components with different approaches at the Howland Forest in central Maine, USA. These include an experimental manipulation using the classic root trenching approach and targeted ∆14CO2 measurements. For the isotopic measurements, we used a two-end member mass balance approach to determine the fraction of soil respiration from autotrophic and heterotrophic sources. When summed over the course of the growing season, the trenched chamber flux (heterotrophic) accounted for 53 ± 2% of the total control chamber flux. Over the four different 14C sampling periods, the heterotrophic component ranged from 35-55% and the autotrophic component ranges 45-65% of the total flux. Next steps will include assessing the value of the flux partitioning for constraining a simple ecosystem model using a model-data fusion approach to reduce uncertainties in estimates of NPP and simulation of future soil C stocks and fluxes.

Temperature response of soil respiration largely unaltered with experimental warming

Science.gov (United States)

Carey, Joanna C.; Tang, Jianwu; Templer, Pamela H.; Kroeger, Kevin D.; Crowther, Thomas W.; Burton, Andrew J.; Dukes, Jeffrey S.; Emmett, Bridget; Frey, Serita D.; Heskel, Mary A.; Jiang, Lifen; Machmuller, Megan B.; Mohan, Jacqueline; Panetta, Anne Marie; Reich, Peter B.; Reinsch, Sabine; Wang, Xin; Allison, Steven D.; Bamminger, Chris; Bridgham, Scott; Collins, Scott L.; de Dato, Giovanbattista; Eddy, William C.; Enquist, Brian J.; Estiarte, Marc; Harte, John; Henderson, Amanda; Johnson, Bart R.; Steenberg Larsen, Klaus; Luo, Yiqi; Marhan, Sven; Melillo, Jerry M.; Penuelas, Josep; Pfeifer-Meister, Laurel; Poll, Christian; Rastetter, Edward B.; Reinmann, Andrew B.; Reynolds, Lorien L.; Schmidt, Inger K.; Shaver, Gaius R.; Strong, Aaron L.; Suseela, Vidya; Tietema, Albert

2016-01-01

The respiratory release of carbon dioxide (CO2) from soil is a major yet poorly understood flux in the global carbon cycle. Climatic warming is hypothesized to increase rates of soil respiration, potentially fueling further increases in global temperatures. However, despite considerable scientific attention in recent decades, the overall response of soil respiration to anticipated climatic warming remains unclear. We synthesize the largest global dataset to date of soil respiration, moisture, and temperature measurements, totaling >3,800 observations representing 27 temperature manipulation studies, spanning nine biomes and over 2 decades of warming. Our analysis reveals no significant differences in the temperature sensitivity of soil respiration between control and warmed plots in all biomes, with the exception of deserts and boreal forests. Thus, our data provide limited evidence of acclimation of soil respiration to experimental warming in several major biome types, contrary to the results from multiple single-site studies. Moreover, across all nondesert biomes, respiration rates with and without experimental warming follow a Gaussian response, increasing with soil temperature up to a threshold of ∼25 °C, above which respiration rates decrease with further increases in temperature. This consistent decrease in temperature sensitivity at higher temperatures demonstrates that rising global temperatures may result in regionally variable responses in soil respiration, with colder climates being considerably more responsive to increased ambient temperatures compared with warmer regions. Our analysis adds a unique cross-biome perspective on the temperature response of soil respiration, information critical to improving our mechanistic understanding of how soil carbon dynamics change with climatic warming.

Glycolysis-respiration relationships in a neuroblastoma cell line.

Science.gov (United States)

Swerdlow, Russell H; E, Lezi; Aires, Daniel; Lu, Jianghua

2013-04-01

Although some reciprocal glycolysis-respiration relationships are well recognized, the relationship between reduced glycolysis flux and mitochondrial respiration has not been critically characterized. We concomitantly measured the extracellular acidification rate (ECAR) and oxygen consumption rate (OCR) of SH-SY5Y neuroblastoma cells under free and restricted glycolysis flux conditions. Under conditions of fixed energy demand ECAR and OCR values showed a reciprocal relationship. In addition to observing an expected Crabtree effect in which increasing glucose availability raised the ECAR and reduced the OCR, a novel reciprocal relationship was documented in which reducing the ECAR via glucose deprivation or glycolysis inhibition increased the OCR. Substituting galactose for glucose, which reduces net glycolysis ATP yield without blocking glycolysis flux, similarly reduced the ECAR and increased the OCR. We further determined how reduced ECAR conditions affect proteins that associate with energy sensing and energy response pathways. ERK phosphorylation, SIRT1, and HIF1a decreased while AKT, p38, and AMPK phosphorylation increased. These data document a novel intracellular glycolysis-respiration effect in which restricting glycolysis flux increases mitochondrial respiration. Since this effect can be used to manipulate cell bioenergetic infrastructures, this particular glycolysis-respiration effect can practically inform the development of new mitochondrial medicine approaches. Copyright © 2012 Elsevier B.V. All rights reserved.

Influence of forced respiration on nonlinear dynamics in heart rate variability

DEFF Research Database (Denmark)

Kanters, J K; Højgaard, M V; Agner, E

1997-01-01

Although it is doubtful whether the normal sinus rhythm can be described as low-dimensional chaos, there is evidence for inherent nonlinear dynamics and determinism in time series of consecutive R-R intervals. However, the physiological origin for these nonlinearities is unknown. The aim...... with a metronome set to 12 min(-1). Nonlinear dynamics were measured as the correlation dimension and the nonlinear prediction error. Complexity expressed as correlation dimension was unchanged from normal respiration, 9.1 +/- 0.5, compared with forced respiration, 9.3 +/- 0.6. Also, nonlinear determinism...... expressed as the nonlinear prediction error did not differ between spontaneous respiration, 32.3 +/- 3.4 ms, and forced respiration, 31.9 +/- 5.7. It is concluded that the origin of the nonlinear dynamics in heart rate variability is not a nonlinear input from the respiration into the cardiovascular...

Stand-scale soil respiration estimates based on chamber methods in a Bornean tropical rainforest

Science.gov (United States)

Kume, T.; Katayama, A.; Komatsu, H.; Ohashi, M.; Nakagawa, M.; Yamashita, M.; Otsuki, K.; Suzuki, M.; Kumagai, T.

2009-12-01

This study was undertaken to estimate stand-scale soil respiration in an aseasonal tropical rainforest on Borneo Island. To this aim, we identified critical and practical factors explaining spatial variations in soil respiration based on the soil respiration measurements conducted at 25 points in a 40 × 40 m subplot of a 4 ha study plot for five years in relation to soil, root, and forest structural factors. Consequently, we found significant positive correlation between the soil respiration and forest structural parameters. The most important factor was the mean DBH within 6 m of the measurement points, which had a significant linear relationship with soil respiration. Using the derived linear regression and an inventory dataset, we estimated the 4 ha-scale soil respiration. The 4 ha-scale estimation (6.0 μmol m-2 s-1) was nearly identical to the subplot scale measurements (5.7 μmol m-2 s-1), which were roughly comparable to the nocturnal CO2 fluxes calculated using the eddy covariance technique. To confirm the spatial representativeness of soil respiration estimates in the subplot, we performed variogram analysis. Semivariance of DBH(6) in the 4 ha plot showed that there was autocorrelation within the separation distance of about 20 m, and that the spatial dependence was unclear at a separation distance of greater than 20 m. This ascertained that the 40 × 40 m subplot could represent the whole forest structure in the 4 ha plot. In addition, we discuss characteristics of the stand-scale soil respiration at this site by comparing with those of other forests reported in previous literature in terms of the soil C balance. Soil respiration at our site was noticeably greater, relative to the incident litterfall amount, than soil respiration in other tropical and temperate forests probably owing to the larger total belowground C allocation by emergent trees. Overall, this study suggests the arrangement of emergent trees and their bellow ground C allocation could be

Diagnostics on LALR(k) conflicts based on a method for LR(k) testing

DEFF Research Database (Denmark)

Kristensen, Bent Bruun; Madsen, Ole Lehrmann

1981-01-01

A user of an LALR(k) parser generator system may have difficulties in understanding how a given LALR(k) conflict is generated. This is especially difficult if the conflict does not correspond to an LR(k) conflict. A practical method for giving informative diagnostics on LALR(k) conflicts is prese......A user of an LALR(k) parser generator system may have difficulties in understanding how a given LALR(k) conflict is generated. This is especially difficult if the conflict does not correspond to an LR(k) conflict. A practical method for giving informative diagnostics on LALR(k) conflicts...

Olfactory Bulb Field Potentials and Respiration in Sleep-Wake States of Mice.

Science.gov (United States)

Jessberger, Jakob; Zhong, Weiwei; Brankačk, Jurij; Draguhn, Andreas

2016-01-01

It is well established that local field potentials (LFP) in the rodent olfactory bulb (OB) follow respiration. This respiration-related rhythm (RR) in OB depends on nasal air flow, indicating that it is conveyed by sensory inputs from the nasal epithelium. Recently RR was found outside the olfactory system, suggesting that it plays a role in organizing distributed network activity. It is therefore important to measure RR and to delineate it from endogenous electrical rhythms like theta which cover similar frequency bands in small rodents. In order to validate such measurements in freely behaving mice, we compared rhythmic LFP in the OB with two respiration-related biophysical parameters: whole-body plethysmography (PG) and nasal temperature (thermocouple; TC). During waking, all three signals reflected respiration with similar reliability. Peak power of RR in OB decreased with increasing respiration rate whereas power of PG increased. During NREM sleep, respiration-related TC signals disappeared and large amplitude slow waves frequently concealed RR in OB. In this situation, PG provided a reliable signal while breathing-related rhythms in TC and OB returned only during microarousals. In summary, local field potentials in the olfactory bulb do reliably reflect respiratory rhythm during wakefulness and REM sleep but not during NREM sleep.

Olfactory Bulb Field Potentials and Respiration in Sleep-Wake States of Mice

Directory of Open Access Journals (Sweden)

Jakob Jessberger

2016-01-01

Full Text Available It is well established that local field potentials (LFP in the rodent olfactory bulb (OB follow respiration. This respiration-related rhythm (RR in OB depends on nasal air flow, indicating that it is conveyed by sensory inputs from the nasal epithelium. Recently RR was found outside the olfactory system, suggesting that it plays a role in organizing distributed network activity. It is therefore important to measure RR and to delineate it from endogenous electrical rhythms like theta which cover similar frequency bands in small rodents. In order to validate such measurements in freely behaving mice, we compared rhythmic LFP in the OB with two respiration-related biophysical parameters: whole-body plethysmography (PG and nasal temperature (thermocouple; TC. During waking, all three signals reflected respiration with similar reliability. Peak power of RR in OB decreased with increasing respiration rate whereas power of PG increased. During NREM sleep, respiration-related TC signals disappeared and large amplitude slow waves frequently concealed RR in OB. In this situation, PG provided a reliable signal while breathing-related rhythms in TC and OB returned only during microarousals. In summary, local field potentials in the olfactory bulb do reliably reflect respiratory rhythm during wakefulness and REM sleep but not during NREM sleep.

Solar photo-Fenton treatment of microcystin-LR in aqueous environment: Transformation products and toxicity in different water matrices

Science.gov (United States)

Transformation products and toxicity patterns of microcystin-LR (MC-LR), a common cyanotoxin in freshwaters, during degradation by solar photo-Fenton process were studied in the absence and presence of two major water components, namely fulvic acid and alkalinity. The transformat...

Temperature response of soil respiration largely unaltered with experimental warming

DEFF Research Database (Denmark)

Carey, Joanna C; Tang, Jianwu; Templer, Pamela H

2016-01-01

The respiratory release of carbon dioxide (CO2) from soil is a major yet poorly understood flux in the global carbon cycle. Climatic warming is hypothesized to increase rates of soil respiration, potentially fueling further increases in global temperatures. However, despite considerable scientific...... attention in recent decades, the overall response of soil respiration to anticipated climatic warming remains unclear. We synthesize the largest global dataset to date of soil respiration, moisture, and temperature measurements, totaling >3,800 observations representing 27 temperature manipulation studies......, spanning nine biomes and over 2 decades of warming. Our analysis reveals no significant differences in the temperature sensitivity of soil respiration between control and warmed plots in all biomes, with the exception of deserts and boreal forests. Thus, our data provide limited evidence of acclimation...

First successful ionization of Lr (Z = 103) by a surface-ionization technique

Energy Technology Data Exchange (ETDEWEB)

Sato, Tetsuya K., E-mail: sato.tetsuya@jaea.go.jp; Sato, Nozomi; Asai, Masato; Tsukada, Kazuaki; Toyoshima, Atsushi; Ooe, Kazuhiro; Miyashita, Sunao; Schädel, Matthias [Advanced Science Research Center, Japan Atomic Energy Agency (JAEA), 2-4 Shirakata-shirane, Tokai-mura, Ibaraki 319-1195 (Japan); Kaneya, Yusuke; Nagame, Yuichiro [Advanced Science Research Center, Japan Atomic Energy Agency (JAEA), 2-4 Shirakata-shirane, Tokai-mura, Ibaraki 319-1195 (Japan); Graduate School of Science and Engineering, Ibaraki University, 2-1-1, Bunkyo, Mito, Ibaraki 310-8512 (Japan); Osa, Akihiko [Department of Research Reactor and Tandem Accelerator, Japan Atomic Energy Agency (JAEA), 2-4 Shirakata shirane, Tokai-mura, Ibaraki 319-1195 (Japan); Ichikawa, Shin-ichi [Advanced Science Research Center, Japan Atomic Energy Agency (JAEA), 2-4 Shirakata-shirane, Tokai-mura, Ibaraki 319-1195 (Japan); Nishina Center for Accelerator-Based Science, RIKEN, 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan); Stora, Thierry [ISOLDE, CERN, CH-1211 Geneva 23 (Switzerland); Kratz, Jens Volker [Institut für Kernchemie, Universität Mainz, D-55099 Mainz (Germany)

2013-02-15

We have developed a surface ionization ion-source as part of the JAEA-ISOL (Isotope Separator On-Line) setup, which is coupled to a He/CdI{sub 2} gas-jet transport system to determine the first ionization potential of the heaviest actinide lawrencium (Lr, Z = 103). The new ion-source is an improved version of the previous source that provided good ionization efficiencies for lanthanides. An additional filament was newly installed to give better control over its operation. We report, here, on the development of the new gas-jet coupled surface ion-source and on the first successful ionization and mass separation of 27-s {sup 256}Lr produced in the {sup 249}Cf + {sup 11}B reaction.

Evaluation of activation detectors for the SPHINX project at the LR-0 experimental reactor

International Nuclear Information System (INIS)

Lahodova, Zdena; Viererbl, Ladislav; Novak, Evzen; Svadlenkova, Marie; Rypar, Vojtech

2008-01-01

This article summarizes the measurements of neutron fluence distributions carried out at the LR-0 research reactor (Czech Republic) in the frame of the SPHINX project. The influence of fluoride-salts or graphite filling in the SR-0 modules on neutron spectrum was studied using activation detectors. The activation detectors (Mn, Ni, In and Au) were evaluated to determine the changes in neutron field. The In and Au detectors were also irradiated with a cadmium cover. Five different configurations of reactor core (EROS) were realized. (authors)

Evaluation of activation detectors for the SPHINX project at the LR-0 experimental reactor

Energy Technology Data Exchange (ETDEWEB)

Lahodova, Zdena; Viererbl, Ladislav [Research Center Rez Ltd (Czech Republic); Novak, Evzen; Svadlenkova, Marie; Rypar, Vojtech [Nuclear Power and Safety Division, Nuclear Research Institute Rez plc (Czech Republic)

2008-07-01

This article summarizes the measurements of neutron fluence distributions carried out at the LR-0 research reactor (Czech Republic) in the frame of the SPHINX project. The influence of fluoride-salts or graphite filling in the SR-0 modules on neutron spectrum was studied using activation detectors. The activation detectors (Mn, Ni, In and Au) were evaluated to determine the changes in neutron field. The In and Au detectors were also irradiated with a cadmium cover. Five different configurations of reactor core (EROS) were realized. (authors)

Dynamic characteristics of soil respiration in Yellow River Delta wetlands, China

Science.gov (United States)

Wang, Xiao; Luo, Xianxiang; Jia, Hongli; Zheng, Hao

2018-02-01

The stable soil carbon (C) pool in coastal wetlands, referred to as "blue C", which has been extensively damaged by climate change and soil degradation, is of importance to maintain global C cycle. Therefore, to investigate the dynamic characteristics of soil respiration rate and evaluate C budgets in coastal wetlands are urgently. In this study, the diurnal and seasonal variation of soil respiration rate in the reed wetland land (RL) and the bare wetland land (BL) was measured in situ with the dynamic gas-infrared CO2 method in four seasons, and the factors impacted on the dynamic characteristics of soil respiration were investigated. The results showed that the diurnal variation of soil respiration rate consistently presented a "U" curve pattern in April, July, and September, with the maximum values at 12:00 a.m. and the minimum values at 6:00 a.m. In the same season, the diurnal soil respiration rate in RL was significantly greater than those in BL (P respiration rate was 0.14, 0.42, and 0.39 μmol m-2 s-1 in RL, 0.05, 0.22, 0.13, and 0.01 μmol m-2 s-1 in BL, respectively. Soil surface temperature was the primary factor that influenced soil respiration, which was confirmed by the exponential positive correlation between the soil respiration rate and soil surface temperature in BL and RL (P respiration, confirming by the significantly negative correlation between soil respiration rate and the content of soluble salt. These results will be useful for understanding the mechanisms underlying soil respiration and elevating C sequestration potential in the coastal wetlands.

Effects of bioirrigation of non-biting midges (Diptera: Chironomidae) on lake sediment respiration

Science.gov (United States)

Baranov, Viktor; Lewandowski, Jörg; Romeijn, Paul; Singer, Gabriel; Krause, Stefan

2016-06-01

Bioirrigation or the transport of fluids into the sediment matrix due to the activities of organisms such as bloodworms (larvae of Diptera, Chironomidae), has substantial impacts on sediment respiration in lakes. However, previous quantifications of bioirrigation impacts of Chironomidae have been limited by technical challenges such as the difficulty to separate faunal and bacterial respiration. This paper describes a novel method based on the bioreactive tracer resazurin for measuring respiration in-situ in non-sealed systems with constant oxygen supply. Applying this new method in microcosm experiments revealed that bioirrigation enhanced sediment respiration by up to 2.5 times. The new method is yielding lower oxygen consumption than previously reported, as it is only sensitive to aerobic heterotrophous respiration and not to other processes causing oxygen decrease. Hence it decouples the quantification of respiration of animals and inorganic oxygen consumption from microbe respiration in sediment.

Evaluation of 14C abundance in soil respiration using accelerator mass spectrometry

International Nuclear Information System (INIS)

Koarashi, Jun; Iida, Takao; Moriizumi, Jun; Asano, Tomohiro

2004-01-01

To clarify the behavior of 14 C in terrestrial ecosystems, 14 C abundance in soil respiration was evaluated in an urban forest with a new method involving a closed chamber technique and 14 C measurement by accelerator mass spectrometry (AMS). Soil respiration had a higher Δ 14 C than the contemporary atmosphere. This indicates that a significant portion of soil respiration is derived from the decomposition of soil organic matter enriched in 14 C by atmospheric nuclear weapons tests, with a notable time lag between atmospheric 14 C addition and re-emission from soil. On the other hand, δ 14 C in soil respiration demonstrated that 14 C abundance ratio itself in soil-respired CO 2 is not always high compared with that in atmospheric CO 2 because of the isotope fractionation during plant photosynthesis and microbial decomposition of soil organic matter. The Δ 14 C in soil respiration was slightly lower in August than in March, suggesting a relatively high contribution of plant root respiration and decomposition of newly accumulated and/or 14 C-depleted soil organic matter to the total soil respiration in August

Heterotrophic components of soil respiration in pastures and forests in southwestern Amazonia, Acre, Brazil

Directory of Open Access Journals (Sweden)

Eric Atlas Davidson

2008-12-01

Full Text Available In this paper we present data on soil microbial biomass and heterotrophic respiration in pastures, mature and secondary forests, in order to elucidate their contribution to total CO2 flux from soil to atmosphere. The research was conducted in Southwestern Amazonia, Acre State, Brazil. Microbial biomass was estimated using a variation of the traditional fumigation-extraction method and heterotrophic respiration was measured using respirometry flasks attached to an infrared gas analyzer. Soil microbial biomass and heterotrophic respiration did not differ statistically among pastures, mature and secondary forests. These laboratory results indicate that higher CO2 fluxes from pasture soils measured in situ are probably due to higher root respiration by pasture grasses.

Soil respiration fluxes in a temperate mixed forest: seasonality and temperature sensitivities differ among microbial and root-rhizosphere respiration.

Science.gov (United States)

Ruehr, Nadine K; Buchmann, Nina

2010-02-01

Although soil respiration, a major CO(2) flux in terrestrial ecosystems, is known to be highly variable with time, the response of its component fluxes to temperature and phenology is less clear. Therefore, we partitioned soil respiration (SR) into microbial (MR) and root-rhizosphere respiration (RR) using small root exclusion treatments in a mixed mountain forest in Switzerland. In addition, fine root respiration (FRR) was determined with measurements of excised roots. RR and FRR were strongly related to each other (R(2) = 0.92, n = 7), with RR contributing about 46% and FRR about 32% to total SR. RR rates increased more strongly with temperature (Q(10) = 3.2) than MR rates (Q(10) = 2.3). Since the contribution of RR to SR was found to be higher during growing (50%) than during dormant periods (40%), we separated the 2-year data set into phenophases. During the growing period of 2007, the temperature sensitivity of RR (Q(10) = 2.5, R(2) = 0.62) was similar to that of MR (Q(10) = 2.2, R(2) = 0.57). However, during the dormant period of 2006/2007, RR was not related to soil temperature (R(2) = 0.44, n.s.), in contrast to MR (Q(10) = 7.2; R(2) = 0.92). To better understand the influence of plant activity on root respiration, we related RR and FRR rates to photosynthetic active radiation (both R(2) = 0.67, n = 7, P = 0.025), suggesting increased root respiration rates during times with high photosynthesis. During foliage green-up in spring 2008, i.e., from bud break to full leaf expansion, RR increased by a factor of 5, while soil temperature increased only by about 5 degrees C, leading to an extraordinary high Q(10) of 10.6; meanwhile, the contribution of RR to SR increased from 29 to 47%. This clearly shows that root respiration and its apparent temperature sensitivity highly depend on plant phenology and thus on canopy assimilation and carbon allocation belowground.

Rod drop in the LR-0 reactor core comprising 55 fuel assemblies

International Nuclear Information System (INIS)

Hadek, J.; Grundmann, U.

1989-09-01

Data from the third stage of kinetic measurements on the LR-0 reactor, performed in 1988, were employed for additional calculations using the 3-dimensional neutron kinetics code HEXDYN3D. The reactor consists of subassemblies similar to those in the WWER-1000 (PWR) reactor. The theoretical and experimental results are compared for the time behavior of the neutron flux caused by drop of the control rod cluster in various subassemblies of the reactor. The results demonstrate that the HEXDYN3D code is well suited to the treatment of the space-time behavior of the neutron flux. (author). 21 figs., 2 tabs., 16 refs

Similar uptake profiles of microcystin-LR and -RR in an in vitro human intestinal model

International Nuclear Information System (INIS)

Zeller, P.; Clement, M.; Fessard, V.

2011-01-01

Highlights: → First description of in vitro cellular uptake of MCs into intestinal cells. → OATP 3A1 and OATP 4A1 are expressed in Caco-2 cell membranes. → MC-LR and MC-RR show similar uptake in Caco-2 cells. → MCs are probably excreted from Caco-2 cells by an active mechanism. -- Abstract: Microcystins (MCs) are cyclic hepatotoxins produced by various species of cyanobacteria. Their structure includes two variable amino acids (AA) leading to more than 80 MC variants. In this study, we focused on the most common variant, microcystin-LR (MC-LR), and microcystin-RR (MC-RR), a variant differing by only one AA. Despite their structural similarity, MC-LR elicits higher liver toxicity than MC-RR partly due to a discrepancy in their uptake by hepatic organic anion transporters (OATP 1B1 and 1B3). However, even though ingestion is the major pathway of human exposure to MCs, intestinal absorption of MCs has been poorly addressed. Consequently, we investigated the cellular uptake of the two MC variants in the human intestinal cell line Caco-2 by immunolocalization using an anti-MC antibody. Caco-2 cells were treated for 30 min to 24 h with several concentrations (1-50 μM) of both variants. We first confirmed the localization of OATP 3A1 and 4A1 at the cell membrane of Caco-2 cells. Our study also revealed a rapid uptake of both variants in less than 1 h. The uptake profiles of the two variants did not differ in our immunostaining study neither with respect to concentration nor the time of exposure. Furthermore, we have demonstrated for the first time the nuclear localization of MC-RR and confirmed that of MC-LR. Finally, our results suggest a facilitated uptake and an active excretion of MC-LR and MC-RR in Caco-2 cells. Further investigation on the role of OATP 3A1 and 4A1 in MC uptake should be useful to clarify the mechanism of intestinal absorption of MCs and contribute in risk assessment of cyanotoxin exposure.

SR and LR Union Suture for the Treatment of Myopic Strabismus Fixus: Is Scleral Fixation Necessary?

Directory of Open Access Journals (Sweden)

Carol P. S. Lam

2015-01-01

Full Text Available Purpose. To evaluate and compare the effectiveness of scleral fixation SR and LR union suture and nonscleral fixation union suture for the treatment of myopic strabismus fixus. Methods. Retrospective review of 32 eyes of 22 patients with myopic strabismus fixus who had undergone union suture of superior rectus (SR and lateral rectus (LR with or without scleral fixation, and follow-up longer than 6 months at Hong Kong Eye Hospital from 2006 to 2013. Surgical techniques and outcomes in terms of ocular alignment are analyzed. Results. There is significant overall improvement both in postoperative angle of esodeviation (P0.05. Conclusions. Union suture of SR and LR is an effective procedure in correcting myopic strabismus fixus. Fixation of the union suture to the sclera does not improve surgical outcome.

Influence of vestibular activation on respiration in humans

Science.gov (United States)

Monahan, Kevin D.; Sharpe, Melissa K.; Drury, Daniel; Ertl, Andrew C.; Ray, Chester A.

2002-01-01

The purpose of this study was to determine the effects of the semicircular canals and otolith organs on respiration in humans. On the basis of animal studies, we hypothesized that vestibular activation would elicit a vestibulorespiratory reflex. To test this hypothesis, respiratory measures, arterial blood pressure, and heart rate were measured during engagement of semicircular canals and/or otolith organs. Dynamic upright pitch and roll (15 cycles/min), which activate the otolith organs and semicircular canals, increased respiratory rate (Delta2 +/- 1 and Delta3 +/- 1 breaths/min, respectively; P < 0.05). Dynamic yaw and lateral pitch (15 cycles/min), which activate the semicircular canals, increased respiration similarly (Delta3 +/- 1 and Delta2 +/- 1, respectively; P < 0.05). Dynamic chair rotation (15 cycles/min), which mimics dynamic yaw but eliminates neck muscle afferent, increased respiration (Delta3 +/- 1; P < 0.05) comparable to dynamic yaw (15 cycles/min). Increases in respiratory rate were graded as greater responses occurred during upright (Delta5 +/- 2 breaths/min) and lateral pitch (Delta4 +/- 1) and roll (Delta5 +/- 1) performed at 30 cycles/min. Increases in breathing frequency resulted in increases in minute ventilation during most interventions. Static head-down rotation, which activates otolith organs, did not alter respiratory rate (Delta1 +/- 1 breaths/min). Collectively, these data indicate that semicircular canals, but not otolith organs or neck muscle afferents, mediate increased ventilation in humans and support the concept that vestibular activation alters respiration in humans.

Internal respiration of Amazon tree stems greatly exceeds external CO2 efflux

Directory of Open Access Journals (Sweden)

J. Q. Chambers

2012-12-01

Full Text Available Respiration in tree stems is an important component of forest carbon balance. The rate of CO2 efflux from the stem has often been assumed to be a measure of stem respiration. However, recent work in temperate forests has demonstrated that stem CO2 efflux can either overestimate or underestimate respiration rate because of emission or removal of CO2 by transport in xylem water. Here, we studied gas exchange from stems of tropical forest trees using a new approach to better understand respiration in an ecosystem that plays a key role in the global carbon cycle. Our main questions were (1 is internal CO2 transport important in tropical trees, and, if so, (2 does this transport result in net release of CO2 respired in the roots at the stem, or does it cause the opposite effect of net removal of stem-respired CO2? To answer these questions, we measured the ratio of stem CO2 efflux to O2 influx. This ratio, defined here as apparent respiratory quotient (ARQ, is expected to equal 1.0 if carbohydrates are the substrate for respiration, and the net transport of CO2 in the xylem water is negligible. Using a stem chamber approach to quantifying ARQ, we found values of 0.66 ± 0.18. These low ARQ values indicate that a large portion of respired CO2 (~ 35% is not emitted locally, and is probably transported upward in the stem. ARQ values of 0.21 ± 0.10 were found for the steady-state gas concentration within the stem, sampled by in-stem equilibration probes. These lower values may result from the proximity to the xylem water stream. In contrast, we found ARQ values of 1.00 ± 0.13 for soil respiration. Our results indicate the existence of a considerable internal flux of CO2 in the stems of tropical trees. If the transported CO2 is used in the canopy as a substrate for photosynthesis, it could account for up to 10% of the C fixed by the tree, and perhaps serve as a mechanism that buffers the response of the tree to changing CO2 levels. Our results also

Carbon fluxes of surfaces vs. ecosystems. Advantages of measuring eddy covariance and soil respiration simultaneously in dry grassland ecosystems

Czech Academy of Sciences Publication Activity Database

Nagy, Z.; Pintér, K.; Pavelka, Marian; Dařenová, Eva; Balogh, J.

2011-01-01

Roč. 8, č. 9 (2011), s. 2523-2534 ISSN 1726-4170 R&D Projects: GA MŠk(CZ) ED1.1.00/02.0073 Institutional research plan: CEZ:AV0Z60870520 Keywords : carbon fluxes * ecosystems * grassland ecoystems * measuring eddy covariance * soil respiration Subject RIV: EH - Ecology, Behaviour Impact factor: 3.859, year: 2011

Soil Respiration of Three Mangrove Forests on Sanibel Island, Florida

Science.gov (United States)

Cartwright, F.; Bovard, B. D.

2011-12-01

Carbon cycling studies conducted in mangrove forests have typically focused on aboveground processes. Our understanding of carbon storage in these systems is therefore limited by the lack information on belowground processes such as fine root production and soil respiration. To our knowledge there exist no studies investigating temporal patterns in and environmental controls on soil respiration in multiple types of mangrove ecosystems concurrently. This study is part of a larger study on carbon storage in three mangrove forests on Sanibel Island, Florida. Here we report on eight months of soil respiration data within these forests that will ultimately be incorporated into an annual carbon budget for each habitat type. Soil respiration was monitored in the following three mangrove habitat types: a fringe mangrove forest dominated by Rhizophora mangle, a basin mangrove forest dominated by Avicennia germinans, and a higher elevation forest comprised of a mix of Avicennia germinans and Laguncularia racemosa, and non-woody salt marsh species. Beginning in June of 2010, we measured soil emissions of carbon dioxide at 5 random locations within three-100 m2 plots within each habitat type. Sampling was performed at monthly intervals and conducted over the course of three days. For each day, one plot from each habitat type was measured. In addition to soil respiration, soil temperature, salinity and gravimetric moisture content were also measured. Our data indicate the Black mangrove forest, dominated by Avicennia germinans, experiences the highest rates of soil respiration with a mean rate of 4.61 ± 0.60 μmol CO2 m-2 s-1. The mixed mangrove and salt marsh habitat has the lowest soil carbon emission rates with a mean of 2.78 ± 0.40 μmol CO2 m-2 s-1. Soil carbon effluxes appear to peak in the early part of the wet season around May to June and are lower and relatively constant the remainder of the year. Our data also suggest there are important but brief periods where

太冲穴古代文献应用分析%Application Analysis of Taichong(LR3) in the Ancient Literatures

Institute of Scientific and Technical Information of China (English)

王文琴; 张永臣; 贾红玲

2013-01-01

目的：通过对太冲古代文献的整理，总结太冲的应用规律。方法：以《中华医典》（第四版）收录的中医古籍1000部为检索范围，对太冲的主治病症、腧穴配伍、配伍主治病症、刺灸法、刺激量等文献进行系统整理，并建立数据库。结果：太冲应用符合纳入标准的有752条，治疗病症共有689条，涉及87部古籍。太冲配伍的使用频次共有1433次，与太冲穴配伍的经穴为167个。结论：太冲单穴适应于临床各科，尤善于治疗中医内科病症，前7位的内科病症为咳嗽、黄疸、痫病、呕吐、痹症、厥症、淋证；配伍后主治前10位的病症为痹症、胸痹、腹痛、血证、虚劳、黄疸、痉证、水肿、腰痛、中风；太冲的腧穴配伍以合谷、足三里、三阴交、行间、昆仑、照海、悬钟、中封、大敦、百会等经穴频数为较多，常用的配伍“穴对”为太冲与行间、太冲与合谷、太冲与三阴交；常用的刺灸法为灸法，针刺深度为针三分，针刺时间为十呼，灸法刺激量为三壮。%Objective:To sum up the application regularity of Taichong ( LR3) through studying the ancient lit-eratures about Taichong (LR3).Methods:We searched 1000 TCM Ancient Books in the “Encyclopedia of Tra-ditional Chinese”( the Fourth Edition ) and organized the information systematically including the primary disea-ses and symptoms of Taichong (LR3),the compatibility of acupionts, the primary diseases and symptoms of Tai-chong ( LR3 ) with compatible effects , the methods of needling and moxibustion , the stimulating quantity of nee-dling and moxibustion , with which we built a data base .Results:A total of 752 relevant articles of Taichong ( LR3) on the application and 689 primary diseases and symptoms were collected in accordance with the inclu-sive criteria in 87 TCM ancient books .The results also showed that the occurrence frequency of Taichong ( LR3

Management effects on European cropland respiration

DEFF Research Database (Denmark)

Eugster, Werner; Moffat, Antje M.; Ceschia, Eric

2010-01-01

Increases in respiration rates following management activities in croplands are considered a relevant anthropogenic source of CO2. In this paper, we quantify the impact of management events on cropland respiration fluxes of CO2 as they occur under current climate and management conditions. Our....... This allowed us to address the question of how management activities influence ecosystem respiration. This was done by comparing respiration fluxes during 7, 14, and 28 days after the management with those observed during the matching time period before management. Median increases in respiration ranged from...... than management alone are also important at a given site. Temperature is the climatic factor that showed best correlation with site-specific respiration fluxes. Therefore, the effect of temperature changes between the time periods before and after management were taken into account for a subset of 13...

Changes in mitochondrial respiration in the human placenta over gestation.

Science.gov (United States)

Holland, Olivia J; Hickey, Anthony J R; Alvsaker, Anna; Moran, Stephanie; Hedges, Christopher; Chamley, Lawrence W; Perkins, Anthony V

2017-09-01

Placental mitochondria are subjected to micro-environmental changes throughout gestation, in particular large variations in oxygen. How placental mitochondrial respiration adapts to changing oxygen concentrations remains unexplored. Additionally, placental tissue is often studied in culture; however, the effect of culture on placental mitochondria is unclear. Placental tissue was obtained from first trimester and term (laboured and non-laboured) pregnancies, and selectively permeabilized to access mitochondria. Respirometry was used to compare respiration states and substrate use in mitochondria. Additionally, explants of placental tissue were cultured for four, 12, 24, 48, or 96 h and respiration measured. Mitochondrial respiration decreased at 11 weeks compared to earlier gestations (p = 0.05-0.001), and mitochondrial content increased at 12-13 weeks compared to 7-10 weeks (p = 0.042). In term placentae, oxidative phosphorylation (OXPHOS) through mitochondrial complex IV (p Respiration was increased (p ≤ 0.006-0.001) in laboured compared to non-laboured placenta. After four hours of culture, respiration was depressed compared to fresh tissue from the same placenta and continued to decline with time in culture. Markers of apoptosis were increased, while markers of autophagy, mitochondrial biogenesis, and mitochondrial membrane potential were decreased after four hours of culture. Respiration and mitochondrial content alter over gestation/with labour. Decreased respiration at 11 weeks and increased mitochondrial content at 12-13 weeks may relate to onset of maternal blood flow, and increased respiration as a result of labour may be an adaptation to ischaemia-reperfusion. At term, mitochondria were more susceptible to changes in respiratory function relative to first trimester when cultured in vitro, perhaps reflecting changes in metabolic demands as gestation progresses. Metabolic plasticity of placental mitochondria has relevance to placenta

Omega-3 fatty acid docosahexaenoic acid increases SorLA/LR11, a sorting protein with reduced expression in sporadic Alzheimer's disease (AD): relevance to AD prevention.

Science.gov (United States)

Ma, Qiu-Lan; Teter, Bruce; Ubeda, Oliver J; Morihara, Takashi; Dhoot, Dilsher; Nyby, Michael D; Tuck, Michael L; Frautschy, Sally A; Cole, Greg M

2007-12-26

Environmental and genetic factors, notably ApoE4, contribute to the etiology of late-onset Alzheimer's disease (LOAD). Reduced mRNA and protein for an apolipoprotein E (ApoE) receptor family member, SorLA (LR11) has been found in LOAD but not early-onset AD, suggesting that LR11 loss is not secondary to pathology. LR11 is a neuronal sorting protein that reduces amyloid precursor protein (APP) trafficking to secretases that generate beta-amyloid (Abeta). Genetic polymorphisms that reduce LR11 expression are associated with increased AD risk. However these polymorphisms account for only a fraction of cases with LR11 deficits, suggesting involvement of environmental factors. Because lipoprotein receptors are typically lipid-regulated, we postulated that LR11 is regulated by docosahexaenoic acid (DHA), an essential omega-3 fatty acid related to reduced AD risk and reduced Abeta accumulation. In this study, we report that DHA significantly increases LR11 in multiple systems, including primary rat neurons, aged non-Tg mice and an aged DHA-depleted APPsw AD mouse model. DHA also increased LR11 in a human neuronal line. In vivo elevation of LR11 was also observed with dietary fish oil in young rats with insulin resistance, a model for type II diabetes, another AD risk factor. These data argue that DHA induction of LR11 does not require DHA-depleting diets and is not age dependent. Because reduced LR11 is known to increase Abeta production and may be a significant genetic cause of LOAD, our results indicate that DHA increases in SorLA/LR11 levels may play an important role in preventing LOAD.

A MEMS turbine prototype for respiration harvesting

Science.gov (United States)

Goreke, U.; Habibiabad, S.; Azgin, K.; Beyaz, M. I.

2015-12-01

The design, manufacturing, and performance characterization of a MEMS-scale turbine prototype is reported. The turbine is designed for integration into a respiration harvester that can convert normal human breathing into electrical power through electromagnetic induction. The device measures 10 mm in radius, and employs 12 blades located around the turbine periphery along with ball bearings around the center. Finite element simulations showed that an average torque of 3.07 μNm is induced at 12 lpm airflow rate, which lies in normal breathing levels. The turbine and a test package were manufactured using CNC milling on PMMA. Tests were performed at respiration flow rates between 5-25 lpm. The highest rotational speed was measured to be 9.84 krpm at 25 lpm, resulting in 8.96 mbar pressure drop across the device and 370 mW actuation power.

Soil respiration sensitivities to water and temperature in a revegetated desert

Science.gov (United States)

Zhang, Zhi-Shan; Dong, Xue-Jun; Xu, Bing-Xin; Chen, Yong-Le; Zhao, Yang; Gao, Yan-Hong; Hu, Yi-Gang; Huang, Lei

2015-04-01

Soil respiration in water-limited ecosystems is affected intricately by soil water content (SWC), temperature, and soil properties. Eight sites on sand-fixed dunes that revegetated in different years since 1950s, with several topographical positions and various biological soil crusts (BSCs) and soil properties, were selected, as well as a moving sand dune (MSD) and a reference steppe in the Tengger Desert of China. Intact soil samples of 20 cm in depth were taken and incubated randomly at 12 levels of SWC (0 to 0.4 m3 m-3) and at 9 levels of temperature (5 to 45°C) in a growth chamber; additionally, cryptogamic and microbial respirations (RM) were measured. Total soil respiration (RT, including cryptogamic, microbial, and root respiration) was measured for 2 years at the MSD and five sites of sand-fixed dunes. The relationship between RM and SWC under the optimal SWC condition (0.25 m3 m-3) is linear, as is the entire range of RT and SWC. The slope of linear function describes sensitivity of soil respiration to water (SRW) and reflects to soil water availability, which is related significantly to soil physical properties, BSCs, and soil chemical properties, in decreasing importance. Inversely, Q10 for RM is related significantly to abovementioned factors in increasing importance. However, Q10 for RT and respiration rate at 20°C are related significantly to soil texture and depth of BSCs and subsoil only. In conclusion, through affecting SRW, soil physical properties produce significant influences on soil respiration, especially for RT. This indicates that a definition of the biophysical meaning of SRW is necessary, considering the water-limited and coarse-textured soil in most desert ecosystems.

Photocatalytic degradation and mineralization of microcystin-LR under UV-A, solar and visible light using nanostructured nitrogen doped TiO2

International Nuclear Information System (INIS)

Triantis, T.M.; Fotiou, T.; Kaloudis, T.; Kontos, A.G.; Falaras, P.; Dionysiou, D.D.; Pelaez, M.; Hiskia, A.

2012-01-01

Highlights: ► N-TiO 2 exhibited effective degradation of MC-LR under UV-A, solar and visible light. ► Complete photocatalytic mineralization of MC-LR was achieved under UV-A and solar light. ► The organic nitrogen is mainly released as ammonium and nitrate ions. - Abstract: In an attempt to face serious environmental hazards, the degradation of microcystin-LR (MC-LR), one of the most common and more toxic water soluble cyanotoxin compounds released by cyanobacteria blooms, was investigated using nitrogen doped TiO 2 (N-TiO 2 ) photocatalyst, under UV-A, solar and visible light. Commercial Degussa P25 TiO 2 , Kronos and reference TiO 2 nanopowders were used for comparison. It was found that under UV-A irradiation, all photocatalysts were effective in toxin elimination. The higher MC-LR degradation (99%) was observed with Degussa P25 TiO 2 followed by N-TiO 2 with 96% toxin destruction after 20 min of illumination. Under solar light illumination, N-TiO 2 nanocatalyst exhibits similar photocatalytic activity with that of commercially available materials such as Degussa P25 and Kronos TiO 2 for the destruction of MC-LR. Upon irradiation with visible light Degussa P25 practically did not show any response, while the N-TiO 2 displayed remarkable photocatalytic efficiency. In addition, it has been shown that photodegradation products did not present any significant protein phosphatase inhibition activity, proving that toxicity is proportional only to the remaining MC-LR in solution. Finally, total organic carbon (TOC) and inorganic ions (NO 2 − , NO 3 − and NH 4 + ) determinations confirmed that complete photocatalytic mineralization of MC-LR was achieved under both UV-A and solar light.

Inactivation Kinetics of the Cyanobacterial Toxin Microcystin-LR by Free Chlorine

Science.gov (United States)

Worldwide, the increasing occurrence of toxins produced by cyanobacteria in water bodies used as source waters for drinking water has become an important public health issue. Microcystin-LR is one of the most commonly found cyanotoxins. A detailed evaluation of the free chlorine ...

Jumping spark evaluation of α-radiograms taken on strippable LR-115 film

International Nuclear Information System (INIS)

Somogyi, G.; Hunyadi, I.; Varga, Zs.

1978-01-01

Jumping spark counting was used for the automatic measurement of α-ray tracks on Kodak Pathe LR-115 type special cellulose nitrate films. The effect of temperature and interruptions on the etching rate was observed during the etching of the α track detectors. The recommended parameters for the etching are the following: 10% NaOH solution, 60 +- 0.1 deg C, 1.5 h etching time, 20 rotations/min. The final thickness is 6-7 μm. The counting efficiency of the jumping spark evaluation in the function of the track density and the α energy was carefully studied. The angular distribution of the α particles from the Al(p, α) 24 Mg reaction was determined. This method can be effectively used for the measurement of environmental α activity as for 222 Rn release from 226 Ra. (V.N.)

Insulin resistance in HIV-infected youth is associated with decreased mitochondrial respiration.

Science.gov (United States)

Takemoto, Jody K; Miller, Tracie L; Wang, Jiajia; Jacobson, Denise L; Geffner, Mitchell E; Van Dyke, Russell B; Gerschenson, Mariana

2017-01-02

To identify relationships between insulin resistance (IR) and mitochondrial respiration in perinatally HIV-infected youth. Case-control study. Mitochondrial respiration was assessed in perinatally HIV-infected youth in Tanner stages 2-5, 25 youth with IR (IR+) and 50 without IR (IR-) who were enrolled in the Pediatric HIV/AIDS Cohort Study. IR was defined as a homeostatic model of assessment for IR value at least 4.0. A novel, high-throughput oximetry method was used to evaluate cellular respiration in peripheral blood mononuclear cells. Unadjusted and adjusted differences in mitochondrial respiration markers between IR+ and IR- were evaluated, as were correlations between mitochondrial respiration markers and biochemical measurements. IR+ and IR- youth were similar on age, sex, and race/ethnicity. Mean age was 16.5 and 15.6 years in IR+ and IR-, respectively. The IR+ group had significantly higher mean BMI and metabolic analytes (fasting glucose, insulin, cholesterol, triglycerides, and venous lactate and pyruvate) compared with the IR-. Mitochondrial respiration markers were, on average, lower in the IR+ compared with IR-, including basal respiration (417.5 vs. 597.5 pmol, P = 0.074), ATP production (11 513 vs. 15 202 pmol, P = 0.078), proton leak (584.6 vs. 790.0 pmol, P = 0.033), maximal respiration (1815 vs. 2399 pmol, P = 0.025), and spare respiration capacity (1162 vs. 2017 pmol, P = 0.032). Nonmitochondrial respiration did not differ by IR status. The results did not change when adjusted for age. HIV-infected youth with IR have lower mitochondrial respiration markers when compared to youth without IR. Disordered mitochondrial respiration may be a potential mechanism for IR in this population.

The role of p38 in mitochondrial respiration in male and female mice.

Science.gov (United States)

Ju, Xiaohua; Wen, Yi; Metzger, Daniel; Jung, Marianna

2013-06-07

p38 is a mitogen-activated protein kinase and mediates cell growth, cell differentiation, and synaptic plasticity. The aim of this study is to determine the extent to which p38 plays a role in maintaining mitochondrial respiration in male and female mice under a normal condition. To achieve this aim, we have generated transgenic mice that lack p38 in cerebellar Purkinje neurons by crossing Pcp2 (Purkinje cell protein 2)-Cre mice with p38(loxP/loxP) mice. Mitochondria from cerebellum were then isolated from the transgenic and wild-type mice to measure mitochondrial respiration using XF24 respirometer. The mRNA and protein expression of cytochrome c oxidase (COX) in cerebellum were also measured using RT-PCR and immunoblot methods. Separately, HT22 cells were used to determine the involvement of 17β-estradiol (E2) and COX in mitochondrial respiration. The genetic knockout of p38 in Purkinje neurons suppressed the mitochondrial respiration only in male mice and increased COX expression only in female mice. The inhibition of COX by sodium azide (SA) sharply suppressed mitochondrial respiration of HT22 cells in a manner that was protected by E2. These data suggest that p38 is required for the mitochondrial respiration of male mice. When p38 is below a normal level, females may maintain mitochondrial respiration through COX up-regulation. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Soil respiration dynamics in the middle taiga of Central Siberia region

Science.gov (United States)

Makhnykina, Anastasia; Prokushkin, Anatoly; Polosukhina, Daria

2017-04-01

A large amount of carbon in soil is released to the atmosphere through soil respiration, which is the main pathway of transferring carbon from terrestrial ecosystems (Comstedt et al., 2011). Considering that boreal forests is a large terrestrial sink (Tans et al., 1990) and represent approximately 11 % of the Earth's total land area (Gower et al., 2001), even a small change in soil respiration could significantly intensify - or mitigate - current atmospheric increases of CO2, with potential feedbacks to climate change. The objectives of the present study are: (a) to study the dynamic of CO2 emission from the soil surface during summer season (from May to October); (b) to identify the reaction of soil respiration to different amount of precipitation as the main limiting factor in the region. The research was located in the pine forests in Central Siberia (60°N, 90°E), Russia. Sample plots were represented by the lichen pine forest, moss pine forest, mixed forest and anthropogenic destroyed area. We used the automated soil CO2 flux system based on the infrared gas analyzer -LI-8100 for measuring the soil efflux. Soil temperature was measured with Soil Temperature Probe Type E in three depths -5, 10, 15 cm. Volumetric soil moisture was measured with Theta Probe Model ML2. The presence and type of ground cover substantially affects the value of soil respiration fluxes. The carbon dioxide emission from the soil surface averaged 5.4 ±2.3 μmol CO2 m-2 s-1. The destroyed area without plant cover demonstrated the lowest soil respiration (0.1-5.6 μmol CO2 m-2 s-1). The lowest soil respiration among forested areas was observed in the feathermoss pine forest. The lichen pine forest was characterized by the intermediate values of soil respiration. The maximum soil respiration values and seasonal fluctuations were obtained in the mixed forest (2.3-29.3 μmol CO2 m-2 s-1). The analysis of relation between soil CO2 efflux and climatic conditions identified the parameters with

LR1: a candidate RNA virus of Leishmania.

OpenAIRE

Tarr, P I; Aline, R F; Smiley, B L; Scholler, J; Keithly, J; Stuart, K

1988-01-01

Although viruses are important biological agents and useful molecular tools, little is known about the viruses of parasites. We report here the discovery of a candidate for an RNA virus in a kinetoplastid parasite. This potential virus, which we term LR1, is present in the promastigote form of the human pathogen Leishmania braziliensis guyanensis CUMC1-1A but not in 11 other stocks of Leishmania that were examined nor in Trypanosoma brucei. The candidate viral RNA has a size of approximately ...

78 FR 18535 - Respirator Certification Fees

Science.gov (United States)

2013-03-27

... facepiece respirators. The North American respiratory protection market generated revenues around $1,830 million in 2007, the most recent data available.\\4\\ A summary of market segmentation, by respirator type... management. Of the U.S. respirator market of products approved by NIOSH, approximately 35 percent of approval...

Soil and Root Respiration Under Elevated CO2 Concentrations During Seedling Growth of Pinus sylvestris var. sylvestriformis

Institute of Scientific and Technical Information of China (English)

无

2007-01-01

The objectives of this study were to investigate the effect of higher CO2 concentrations (500 and 700 μmol mol-1) in atmosphere on total soil respiration and the contribution of root respiration to total soil respiration during seedling growth of Pinus sylvestris var. sylvestriformis. During the four growing seasons (May-October) from 1999 to 2003, the seedlings were exposed to elevated concentrations of CO2 in open-top chambers. The total soil respiration and contribution of root respiration were measured using an LI-6400-09 soil CO2 flux chamber on June 15 and October 8, 2003. To separate root respiration from total soil respiration, three PVC cylinders were inserted approximately 30 cm deep into the soil in each chamber. There were marked diurnal changes in air and soil temperatures on June 15. Both the total soil respiration and the soil respiration without roots showed a strong diurnal pattern, increasing from before sunrise to about 14:00in the afternoon and then decreasing before the next sunrise. No increase in the mean total soil respiration and mean soil respiration with roots severed was observed under the elevated CO2 treatments on June 15, 2003, as compared to the open field and control chamber with ambient CO2. However, on October 8, 2003, the total soil respiration and soil respiration with roots severed in the open field were lower than those in the control and elevated CO2 chambers. The mean contribution of root respiration measured on June 15, 2003, ranged from 8.3% to 30.5% and on October 8, 2003,from 20.6% to 48.6%.

Does Short-term Litter Input Manipulation Affect Soil Respiration and the Carbon-isotopic Signature of Soil Respired CO2

Science.gov (United States)

Cheng, X.; Wu, J.

2016-12-01

Global change greatly alters the quality and quantity of plant litter inputs to soils, and further impacts soil organic matter (SOM) dynamics and soil respiration. However, the process-based understanding of how soil respiration may change with future shift in litter input is not fully understood. The Detritus Input and Removal Treatment (DIRT) experiment was conducted in coniferous forest (Platycladus orientalis (Linn.) Franco) ecosystem of central China to investigate the impact of above- and belowground litter input on soil respiration and the carbon-isotopic signature of soil respired CO2. Short-term (1-2 years) litter input manipulation significantly affected soil respiration, based on annual flux values, soil respiration was 31.9%, 20.5% and 37.2% lower in no litter (NL), no root (NR) and no input (NRNL), respectively, compared to control (CK). Whereas double litter (DL) treatment increased soil respiration by 9.1% compared to CK. The recalcitrance index of carbon (RIC) and the relative abundance of fungi increased under litter removal or root exclusion treatment (NL, NR and NRNL) compared to CK. Basal soil respiration was positively related to liable C and microbial biomass and negatively related to RIC and fungi to bacteria (F: B) ratio. The carbon-isotopic signature of soil respired CO2 enriched under litter removal and no input treatment, and slightly depleted under litter addition treatment compared to CK. Our results suggest that short-term litter input manipulation can affect the soil respiration by altering substrate availability and microbial community structure, and also impact the carbon-isotopic signature of soil respired CO2 possibly duo to change in the component of soil respiration and soil microclimate.

A mechanical breathing simulator for respirator test

International Nuclear Information System (INIS)

Murata, Mikio; Ikezawa, Yoshio; Yoshida, Yoshikazu

1976-01-01

A mechanical breathing simulator has been developed to produce the human respiration for use in respirator test. The respirations were produced through the strokes of piston controlled by a rockerarm with adjustable fulcrum. The respiration rate was governed by motor-speed control, independent of the tidal volume achieved by adjustment of the piston stroke. By the breather, the simulated respirations for work rate 0, 208, 415, 622 and 830 kg-m/min could be produced through the typical dummy head. (auth.)

Respirators: Supervisors Self-Study #43442

Energy Technology Data Exchange (ETDEWEB)

Chochoms, Michael [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

2016-04-20

This course, Respirators: Supervisors Self-Study (#43442), addresses training requirements for supervisors of respirator wearers as specified by the American National Standard Institute (ANSI) Standard for Respiratory Protection, ANSI Z88.2, and as incorporated by reference in the Department of Energy (DOE) Worker Health and Safety Rule, 10 Code of Federal Regulations (CFR) 851. This course also presents the responsibilities of supervisors of respirator wearers at Los Alamos National Laboratory (LANL).

Soil respiration in Mexico: Advances and future directions

Directory of Open Access Journals (Sweden)

Alejandro Cueva

2016-07-01

Full Text Available Soil respiration (RS is a CO2 efflux from the soil to the atmosphere defined as the sum of autotrophic (respiration by roots and mycorrhizae, and heterotrophic (respiration of microorganisms that decompose fractions of organic matter and of soil fauna respiration. Globally, RS is considered to be the second largest flux of C to the atmosphere. From published literature it is clear that its main controls are soil temperature, soil moisture, photosynthesis, organic matter inputs and soil biota composition. Despite its relevance in C cycle science, there have been only twenty eight studies in Mexico in the last decade where direct measurement of gas exchange was conducted in the field. These studies were held mostly in agricultural and forest ecosystems, in Central and Southern Mexico where mild subtropical conditions prevail. However, arid, semi-arid, tropical and wetland ecosystems may have an important role in Mexico’s CO2 emissions because of their extent and extensive land use changes. From the twenty eight studies, only two provided continuous measurements of RS with high temporal resolution, highlighting the need for long-term studies to evaluate the complex biophysical controls of this flux and associated processes over different ecological succession stages. We conclude that Mexico represents an important opportunity to understand its complex dynamics, in national and global context, as ecosystems in the country cover a wide range of climatic conditions. This is particularly important because deforestation and degradation of Mexican ecosystems is rapidly increasing along with expected changes in climate.

Design of climate respiration chambers, adjustable to the metabolic mass of subjects

NARCIS (Netherlands)

Heetkamp, M.J.W.; Alferink, S.J.J.; Zandstra, T.; Hendriks, P.; Brand, van den H.; Gerrits, W.J.J.

2015-01-01

Open-circuit respiration chambers can be used to measure gas exchange and to calculate heat production (Q) of humans and animals. When studying short-term changes in Q, the size of the respiration chamber in relation to the subject of study is a point of concern. The washout time of a chamber,

Bulk etch rate of LR-115 cellulose nitrate film

International Nuclear Information System (INIS)

Harris, M.J.; Schlenker, R.A.

1977-01-01

Bulk etch rate (V/sub b/) of Kodak LR-115 cellulose nitrate film has been studied, and values for the parameter are presented. An interesting variability of V/sub b/ has been found which has implications for microdosimetry using this type of integrating nuclear track detector. Short-term and longer-term thickness changes have been observed which may increase the uncertainty in estimations of dose using this type of detector

The Lr34 adult plant rust resistance gene provides seedling resistance in durum wheat without senescence.

Science.gov (United States)

Rinaldo, Amy; Gilbert, Brian; Boni, Rainer; Krattinger, Simon G; Singh, Davinder; Park, Robert F; Lagudah, Evans; Ayliffe, Michael

2017-07-01

The hexaploid wheat (Triticum aestivum) adult plant resistance gene, Lr34/Yr18/Sr57/Pm38/Ltn1, provides broad-spectrum resistance to wheat leaf rust (Lr34), stripe rust (Yr18), stem rust (Sr57) and powdery mildew (Pm38) pathogens, and has remained effective in wheat crops for many decades. The partial resistance provided by this gene is only apparent in adult plants and not effective in field-grown seedlings. Lr34 also causes leaf tip necrosis (Ltn1) in mature adult plant leaves when grown under field conditions. This D genome-encoded bread wheat gene was transferred to tetraploid durum wheat (T. turgidum) cultivar Stewart by transformation. Transgenic durum lines were produced with elevated gene expression levels when compared with the endogenous hexaploid gene. Unlike nontransgenic hexaploid and durum control lines, these transgenic plants showed robust seedling resistance to pathogens causing wheat leaf rust, stripe rust and powdery mildew disease. The effectiveness of seedling resistance against each pathogen correlated with the level of transgene expression. No evidence of accelerated leaf necrosis or up-regulation of senescence gene markers was apparent in these seedlings, suggesting senescence is not required for Lr34 resistance, although leaf tip necrosis occurred in mature plant flag leaves. Several abiotic stress-response genes were up-regulated in these seedlings in the absence of rust infection as previously observed in adult plant flag leaves of hexaploid wheat. Increasing day length significantly increased Lr34 seedling resistance. These data demonstrate that expression of a highly durable, broad-spectrum adult plant resistance gene can be modified to provide seedling resistance in durum wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Forest harvesting effects on soil temperature, moisture, and respiration in a bottomland hardwood forest

International Nuclear Information System (INIS)

Londo, A.J.; Messina, M.G.; Schoenholtz, S.H.

1999-01-01

The effect of forest disturbance on C cycling has become an issue, given concerns about escalating atmospheric C content. The authors examined the effects of harvest intensity on in situ and laboratory mineral soil respiration in an East Texas bottomland hardwood forest between 6 and 22 mo after harvesting. Treatments included a clearcut, a partial cut wherein approximately 58% of the basal area was removed, and an unharvested control. The soda-lime absorption technique was used for in situ respiration (CO 2 efflux) and the wet alkali method (NaOH) was used for laboratory mineral soil respiration. Soil temperature and moisture content were also measured. Harvesting significantly increased in situ respiration during most sampling periods. This effect was attributed to an increase in live root and microflora activity associated with postharvesting revegetation. In situ respiration increased exponentially (Q 10 relationship) as treatment soil temperatures increased, but followed a parabolic-type pattern through the range of soil moisture measured (mean range 10.4--31.5%). Mean rates of laboratory mineral soil respiration measured during the study were unaffected by cutting treatment for most sampling sessions. Overall, the mean rate of CO 2 efflux in the clearcuts was significantly higher than that in the partial cuts, which in turn was significantly higher than that in the controls. Mass balance estimates indicate that these treatment differences will have little or no long-term effect on C sequestration of these managed forests

Fast Neutron Transport in the Biological Shielding Model and Other Regions of the VVER-1000 Mock-Up on the LR-0 Research Reactor

Directory of Open Access Journals (Sweden)

Košťál Michal

2016-01-01

Full Text Available A set of benchmark experiments was carried out in the full scale VVER-1000 mock-up on the reactor LR-0 in order to validate neutron transport calculation methodologies and to perform the optimization of the shape and locations of neutron flux operation monitors channels inside the shielding of the new VVER-1000 type reactors. Compared with previous experiments on the VVER-1000 mock-up on the reactor LR-0, the fast neutron spectra were measured in the extended neutron energy interval (0.1–10 MeV and new calculations were carried out with the MCNPX code using various nuclear data libraries (ENDF/B VII.0, JEFF 3.1, JENDL 3.3, JENDL 4, ROSFOND 2009, and CENDL 3.1. Measurements and calculations were carried out at different points in the mock-up. The calculation and experimental data are compared.

Sustained stimulation of soil respiration after 10 years of experimental warming

International Nuclear Information System (INIS)

Reth, S; Graf, W; Reichstein, M; Munch, J C

2009-01-01

A number of forest and grassland studies indicated that stimulation of the soil respiration by soil warming ceases after a couple of years (Luo et al 2001 Nature 413 622-5). Here we present results from a long-term soil warming lysimeter experiment in southern Germany showing sustained stimulation of soil respiration after 10 years. Moreover, both warmed and control treatments exhibited a similar temperature response of soil respiration, indicating that adaptation in terms of temperature sensitivity was absent. Carbon dioxide concentration measurements within the profiles are supporting these findings. The increased soil respiration occurred although vegetation productivity in the warmed treatment was not higher than in the control plots. These findings strongly contrast with current soil carbon modeling concepts, where carbon pools decay according to first-order kinetics, and thus a depletion of labile soil carbon pools leads to an apparent down-regulation of microbial respiration (Knorr et al 2005 Nature 433 298-301). Consequently, the potential for positive climate carbon cycle feedback may be larger than represented in current models of soil carbon turnover.

Detection of trace microcystin-LR on a 20 MHz QCM sensor coated with in situ self-assembled MIPs.

Science.gov (United States)

He, Hao; Zhou, Lianqun; Wang, Yi; Li, Chuanyu; Yao, Jia; Zhang, Wei; Zhang, Qingwen; Li, Mingyu; Li, Haiwen; Dong, Wen-fei

2015-01-01

A 20 MHz quartz crystal microbalance (QCM) sensor coated with in situ self-assembled molecularly imprinted polymers (MIPs) was presented for the detection of trace microcystin-LR (MC-LR) in drinking water. The sensor performance obtained using the in situ self-assembled MIPs was compared with traditionally synthesized MIPs on 20 MHz and normal 10 MHz QCM chip. The results show that the response increases by more than 60% when using the in situ self-assembly method compared using the traditionally method while the 20 MHz QCM chip provides four-fold higher response than the 10 MHz one. Therefore, the in situ self-assembled MIPs coated on a high frequency QCM chip was used in the sensor performance test to detect MC-LR in tap water. It showed a limit of detection (LOD) of 0.04 nM which is lower than the safety guideline level (1 nM MC-LR) of drinking water in China. The low sensor response to other analogs indicated the high specificity of the sensor to MC-LR. The sensor showed high stability and low signal variation less than 2.58% after regeneration. The lake water sample analysis shows the sensor is possible for practical use. The combination of the higher frequency QCM with the in situ self-assembled MIPs provides a good candidate for the detection of other small molecules. Copyright © 2014 Elsevier B.V. All rights reserved.

Modeling Soil Organic Carbon Turnover in Four Temperate Forests Based on Radiocarbon Measurements of Heterotrophic Respiration and Soil Organic Carbon

Science.gov (United States)

Ahrens, B.; Borken, W.; Muhr, J.; Schrumpf, M.; Savage, K. E.; Wutzler, T.; Trumbore, S.; Reichstein, M.

2011-12-01

Soils of temperate forests store significant amounts of soil organic matter and are considered to be net sinks of atmospheric CO2. Soil organic carbon (SOC) dynamics have been studied using the Δ14C signature of bulk SOC or different SOC fractions as observational constraints in SOC models. Further, the Δ14C signature of CO2 evolved during the incubation of soil and roots has been widely used together with Δ14C of total soil respiration to partition soil respiration into heterotrophic respiration (Rh) and root respiration. However, these data have rarely been used together as observational constraints to determine SOC turnover times. Here, we present a multiple constraints approach, where we used SOC stock and its Δ14C signature, and heterotrophic respiration and its Δ14C signature to estimate SOC turnover times of a simple serial two-pool model via Bayesian optimization. We used data from four temperate forest ecosystems in Germany and the USA with different disturbance and management histories from selective logging to afforestation in the late 19th and early 20th century. The Δ14C signature of the atmosphere with its prominent bomb peak was used as a proxy for the Δ14C signature of aboveground and belowground litterfall. The Δ14C signature of litterfall was lagged behind the atmospheric signal to account for the period between photosynthetic fixation of carbon and its addition to SOC pools. We showed that the combined use of Δ14C measurements of Rh and SOC stocks helped to better constrain turnover times of the fast pool (primarily by Δ14C of Rh) and the slow pool (primarily by Δ14C of SOC). In particular, by introducing two additional parameters that describe the deviation from steady state of the fast and slow cycling pool for both SOC and SO14C, we were able to demonstrate that we cannot maintain the often used steady-state assumption of SOC models in general. Furthermore, a new transport version of our model, including SOC transport via

Degradation mechanisms of Microcystin-LR during UV-B photolysis and UV/H2O2 processes: Byproducts and pathways.

Science.gov (United States)

Moon, Bo-Ram; Kim, Tae-Kyoung; Kim, Moon-Kyung; Choi, Jaewon; Zoh, Kyung-Duk

2017-10-01

The removal and degradation pathways of microcystin-LR (MC-LR, [M+H] +  = 995.6) in UV-B photolysis and UV-B/H 2 O 2 processes were examined using liquid chromatography-tandem mass spectrometry. The UV/H 2 O 2 process was more efficient than UV-B photolysis for MC-LR removal. Eight by-products were newly identified in the UV-B photolysis ([M+H] +  = 414.3, 417.3, 709.6, 428.9, 608.6, 847.5, 807.4, and 823.6), and eleven by-products were identified in the UV-B/H 2 O 2 process ([M+H] +  = 707.4, 414.7, 429.3, 445.3, 608.6, 1052.0, 313.4, 823.6, 357.3, 245.2, and 805.7). Most of the MC-LR by-products had lower [M+H] + values than the MC-LR itself during both processes, except for the [M+H] + value of 1052.0 during UV-B photolysis. Based on identified by-products and peak area patterns, we proposed potential degradation pathways during the two processes. Bond cleavage and intramolecular electron rearrangement by electron pair in the nitrogen atom were the major reactions during UV-B photolysis and UV-B/H 2 O 2 processes, and hydroxylation by OH radical and the adduct formation reaction between the produced by-products were identified as additional pathways during the UV-B/H 2 O 2 process. Meanwhile, the degradation by-products identified from MC-LR during UV-B/H 2 O 2 process can be further degraded by increasing H 2 O 2 dose. Copyright © 2017 Elsevier Ltd. All rights reserved.

Photocatalytic degradation and mineralization of microcystin-LR under UV-A, solar and visible light using nanostructured nitrogen doped TiO{sub 2}

Energy Technology Data Exchange (ETDEWEB)

Triantis, T.M.; Fotiou, T. [Laboratory of Catalytic - Photocatalytic Processes (Solar Energy - Environment), Institute of Physical Chemistry, National Center for Scientific Research ' Demokritos' , Neapoleos 25, 15310 Agia Paraskevi, Attiki (Greece); Kaloudis, T. [Organic Micropollutants Laboratory, Athens Water Supply and Sewerage Company (EYDAP SA), WTP Aharnon, Menidi (Greece); Kontos, A.G.; Falaras, P. [Laboratory of Photo-redox Conversion and Storage of Solar Energy, Institute of Physical Chemistry, National Center for Scientific Research ' Demokritos' , Neapoleos 25, 15310 Agia Paraskevi, Attiki (Greece); Dionysiou, D.D.; Pelaez, M. [Environmental Engineering and Science Program, School of Energy, Environmental, Biological and Medical Engineering, University of Cincinnati, OH 45221-0012 (United States); Hiskia, A., E-mail: hiskia@chem.demokritos.gr [Laboratory of Catalytic - Photocatalytic Processes (Solar Energy - Environment), Institute of Physical Chemistry, National Center for Scientific Research ' Demokritos' , Neapoleos 25, 15310 Agia Paraskevi, Attiki (Greece)

2012-04-15

Highlights: Black-Right-Pointing-Pointer N-TiO{sub 2} exhibited effective degradation of MC-LR under UV-A, solar and visible light. Black-Right-Pointing-Pointer Complete photocatalytic mineralization of MC-LR was achieved under UV-A and solar light. Black-Right-Pointing-Pointer The organic nitrogen is mainly released as ammonium and nitrate ions. - Abstract: In an attempt to face serious environmental hazards, the degradation of microcystin-LR (MC-LR), one of the most common and more toxic water soluble cyanotoxin compounds released by cyanobacteria blooms, was investigated using nitrogen doped TiO{sub 2} (N-TiO{sub 2}) photocatalyst, under UV-A, solar and visible light. Commercial Degussa P25 TiO{sub 2}, Kronos and reference TiO{sub 2} nanopowders were used for comparison. It was found that under UV-A irradiation, all photocatalysts were effective in toxin elimination. The higher MC-LR degradation (99%) was observed with Degussa P25 TiO{sub 2} followed by N-TiO{sub 2} with 96% toxin destruction after 20 min of illumination. Under solar light illumination, N-TiO{sub 2} nanocatalyst exhibits similar photocatalytic activity with that of commercially available materials such as Degussa P25 and Kronos TiO{sub 2} for the destruction of MC-LR. Upon irradiation with visible light Degussa P25 practically did not show any response, while the N-TiO{sub 2} displayed remarkable photocatalytic efficiency. In addition, it has been shown that photodegradation products did not present any significant protein phosphatase inhibition activity, proving that toxicity is proportional only to the remaining MC-LR in solution. Finally, total organic carbon (TOC) and inorganic ions (NO{sub 2}{sup -}, NO{sub 3}{sup -} and NH{sub 4}{sup +}) determinations confirmed that complete photocatalytic mineralization of MC-LR was achieved under both UV-A and solar light.

Ultrasound-based logistic regression model LR2 versus magnetic resonance imaging for discriminating between benign and malignant adnexal masses: a prospective study.

Science.gov (United States)

Shimada, Kanane; Matsumoto, Koji; Mimura, Takashi; Ishikawa, Tetsuya; Munechika, Jiro; Ohgiya, Yoshimitsu; Kushima, Miki; Hirose, Yusuke; Asami, Yuka; Iitsuka, Chiaki; Miyamoto, Shingo; Onuki, Mamiko; Tsunoda, Hajime; Matsuoka, Ryu; Ichizuka, Kiyotake; Sekizawa, Akihiko

2018-06-01

The diagnostic performances of the International Ovarian Tumor Analysis (IOTA) ultrasound-based logistic regression model (LR2) and magnetic resonance imaging (MRI) in discriminating between benign and malignant adnexal masses have not been directly compared in a single study. Using the IOTA LR2 model and subjective interpretation of MRI findings by experienced radiologists, 265 consecutive patients with adnexal masses were preoperatively evaluated in two hospitals between February 2014 and December 2015. Definitive histological diagnosis of excised tissues was used as a gold standard. From the 265 study subjects, 54 (20.4%) tumors were histologically diagnosed as malignant (including 11 borderline and 3 metastatic tumors). Preoperative diagnoses of malignant tumors showed 91.7% total agreement between IOTA LR2 and MRI, with a kappa value of 0.77 [95% confidence interval (CI), 0.68-0.86]. Sensitivity of IOTA LR2 (0.94, 95% CI, 0.85-0.98) for predicting malignant tumors was similar to that of MRI (0.96, 95% CI, 0.87-0.99; P = 0.99), whereas specificity of IOTA LR2 (0.98, 95% CI, 0.95-0.99) was significantly higher than that of MRI (0.91, 95% CI, 0.87-0.95; P = 0.002). Combined IOTA LR2 and MRI results gave the greatest sensitivity (1.00, 95% CI, 0.93-1.00) and had similar specificity (0.91, 95% CI, 0.86-0.94) to MRI. The IOTA LR2 model had a similar sensitivity to MRI for discriminating between benign and malignant tumors and a higher specificity compared with MRI. Our findings suggest that the IOTA LR2 model, either alone or in conjunction with MRI, should be included in preoperative evaluation of adnexal masses.

Evaluating a new method to estimate the rate of leaf respiration in the light by analysis of combined gas exchange and chlorophyll fluorescence measurements

NARCIS (Netherlands)

Yin, X.; Sun, Z.; Struik, P.C.; Gu, J.

2011-01-01

Day respiration (R(d)) is an important parameter in leaf ecophysiology. It is difficult to measure directly and is indirectly estimated from gas exchange (GE) measurements of the net photosynthetic rate (A), commonly using the Laisk method or the Kok method. Recently a new method was proposed to

30 CFR 71.100 - Respirable dust standard.

Science.gov (United States)

2010-07-01

... concentration of respirable dust in the mine atmosphere during each shift to which each miner in the active... shall be measured with an approved sampling device and expressed in terms of an equivalent concentration determined in accordance with § 71.206 (Approved sampling devices; equivalent concentrations). ...

The Contribution of Old Carbon to Respiration from Alaskan Tundra Following Permafrost Thaw

Science.gov (United States)

Schuur, E. A.; Vogel, J. G.; Crummer, K. G.; Lee, H.; Sickman, J. O.; Dutta, K.

2007-12-01

More than 450 Pg of soil carbon (C) has accumulated in high latitude ecosystems after the retreat of the last major ice sheets. Recent studies suggest that, due to climate warming, these ecosystems may no longer be accumulating C, and in some cases may be losing stored C to the atmosphere. We used radiocarbon measurements of carbon dioxide to detect the age of C respired from tussock tundra near Denali National Park, Alaska. At this tundra site, permafrost has been observed to warm and thaw over the past several decades, causing the ground surface to subside as ice volume in the soil decreased. We established three sites within this area that differed in vegetation and surface topography; both characteristics varied in relation to the degree of permafrost thaw. We made radiocarbon measurements of ecosystem respiration, incubations of soil organic matter, and incubations of above and belowground plant biomass to determine the age and isotopic value of C respired from these sites. Over the study period from 2004 to 2006, ecosystem respiration radiocarbon values averaged from +35‰ to +95‰ in different months across sites. For soil incubations, surface soil radiocarbon was elevated relative both to ecosystem respiration and the current atmospheric radiocarbon value, demonstrating the significant contribution from C fixed over the past years to several decades. The deeper soil, in contrast, had respiration isotope values that averaged below zero, reflecting the significant effect of radioactive decay on the isotope content of deeper soil layers. The plant and soil incubations were combined in a multi- source mixing model to determine probable contributions from these different sources to ecosystem respiration. Deep soil respiration generally averaged between 5-15% of total ecosystem respiration, but reached as high as 40% in some months. When aggregated across the growing season, the two sites undergoing more disturbance from permafrost thaw had on average 2-3 times

Can we relate respiration rates of bark and wood with tissue nitrogen concentrations and branch-level CO2 fluxes across woody species?

Science.gov (United States)

Eller, A. S.; Wright, I.; Cernusak, L. A.

2013-12-01

Respiration from above-ground woody tissue is generally responsible for 5-15% of ecosystem respiration (~ 30% of total above-ground respiration). The CO2 respired by branches comes from both the sapwood and the living layers within the bark, but because there is considerable movement of respired CO2 within woody tissues (e.g. in the transpiration stream), and because the bark can present a considerable barrier to CO2 diffusion, it can be difficult to interpret measured CO2 efflux from intact branches in relation to the respiration rates of the component tissues, and to relative mass allocation to each. In this study we investigated these issues in 15 evergreen tree and shrub species native to the Sydney area in eastern Australia. We measured CO2 efflux and light-dependent refixation of respired CO2 in photosynthetic bark from the exterior surfaces of branches (0.5-1.5 cm in diameter), and measured the tissue-specific respiration rates of the bark and wood from those same branches. We also measured the nitrogen content and tissue density of the wood and bark to determine: 1) Among species, what is the relationship between %N and tissue respiration? 2) How is photosynthetic refixation of CO2 related to respiration and %N in the bark and underlying wood? and 3) What is the relationship between branch CO2 efflux and the respiration rates of the underlying wood and bark that make up the branch? Across the 15 species %N was a better predictor of respiration in wood than in bark. CO2 efflux measured from the exterior of the stem in the dark was positively correlated with photosynthetic refixation and explained ~40% of the variation in rates of refixation. Refixation rates were not strongly related to bark or wood %N. Differences among species in CO2 efflux rates were not well explained by differences in bark or wood %N and there was a stronger relationship between bark respiration and CO2 efflux than between wood respiration and CO2 efflux. These results suggest that the

Influence of temperature and organic matter content on soil respiration in a deciduous oak forest

Directory of Open Access Journals (Sweden)

Zsolt Kotroczó

2014-12-01

Full Text Available The increasing temperature enhances soil respiration differently depend on different conditions (soil moisture, soil organic matter, the activity of soil microbes. It is an essential factor to predicting the effect of climate change on soil respiration. In a temperate deciduous forest (North-Hungary we added or removal aboveground and belowground litter to determine total soil respiration. We investigated the relationship between total soil CO2 efflux, soil moisture and soil temperature. Soil CO2 efflux was measured at each plot using chamber based soil respiration measurements. We determined the temperature sensitivity of soil respiration. The effect of doubled litter was less than the effect of removal. We found that temperature was more influential in the control of soil respiration than soil moisture in litter removal treatments, particularly in the wetter root exclusion treatments (NR and NI (R2: 0.49-0.61. Soil moisture (R2: 0.18-0.24 and temperature (R2: 0.18-0.20 influenced soil respiration similarly in treatments, where soil was drier (Control, Double Litter, Double Wood. A significantly greater increase in temperature induced higher soil respiration were significantly higher (2-2.5-fold in root exclusion treatments, where soil was wetter throughout the year, than in control and litter addition treatments. The highest bacterial and fungal count was at the DL treatment but the differences is not significant compared to the Control. The bacterial number at the No Litter, No Root, No Input treatment was significantly lower at the Control. Similar phenomenon can be observed at the fungal too, but the differences are not significant. The results of soil respiration suggest that the soil aridity can reduce soil respiration increases with the temperature increase. Soil bacterial and fungal count results show the higher organic matter content and soil surface cover litter favors the activity.

[Effects of Warming and Straw Application on Soil Respiration and Enzyme Activity in a Winter Wheat Cropland].

Science.gov (United States)

Chen, Shu-tao; Sang, Lin; Zhang, Xu; Hu, Zheng-hua

2016-02-15

In order to investigate the effects of warming and straw application on soil respiration and enzyme activity, a field experiment was performed from November 2014 to May 2015. Four treatments, which were control (CK), warming, straw application, and warming and straw application, were arranged in field. Seasonal variability in soil respiration, soil temperature and soil moisture for different treatments were measured. Urease, invertase, and catalase activities for different treatments were measured at the elongation, booting, and anthesis stages. The results showed that soil respiration in different treatments had similar seasonal variation patterns. Seasonal mean soil respiration rates for the CK, warming, straw application, and warming and straw application treatments were 1.46, 1.96, 1.92, and 2.45 micromol x (m2 x s)(-1), respectively. ANOVA indicated that both warming and straw applications significantly (P soil respiration compared to the control treatment. The relationship between soil respiration and soil temperature in different treatments fitted with the exponential regression function. The exponential regression functions explained 34.3%, 28.1%, 24.6%, and 32.0% variations of soil respiration for CK, warming, straw application, and warming and straw application treatments, respectively. Warming and straw applications significantly (P soil respiration and urease activity fitted with a linear regression function, with the P value of 0.061. The relationship between soil respiration and invertase (P = 0.013), and between soil respiration and catalase activity (P = 0.002) fitted well with linear regression functions.

Modeling respiration from snags and coarse woody debris before and after an invasive gypsy moth disturbance

Science.gov (United States)

Heidi J. Renninger; Nicholas Carlo; Kenneth L. Clark; Karina V.R. Schäfer

2014-01-01

Although snags and coarse woody debris are a small component of ecosystem respiration, disturbances can significantly increase the mass and respiration from these carbon (C) pools. The objectives of this study were to (1) measure respiration rates of snags and coarse woody debris throughout the year in a forest previously defoliated by gypsy moths, (2) develop models...

Mitochondrial respiration is sensitive to cytoarchitectural breakdown.

Science.gov (United States)

Kandel, Judith; Angelin, Alessia A; Wallace, Douglas C; Eckmann, David M

2016-11-07

An abundance of research suggests that cellular mitochondrial and cytoskeletal disruption are related, but few studies have directly investigated causative connections between the two. We previously demonstrated that inhibiting microtubule and microfilament polymerization affects mitochondrial motility on the whole-cell level in fibroblasts. Since mitochondrial motility can be indicative of mitochondrial function, we now further characterize the effects of these cytoskeletal inhibitors on mitochondrial potential, morphology and respiration. We found that although they did not reduce mitochondrial inner membrane potential, cytoskeletal toxins induced significant decreases in basal mitochondrial respiration. In some cases, basal respiration was only affected after cells were pretreated with the calcium ionophore A23187 in order to stress mitochondrial function. In most cases, mitochondrial morphology remained unaffected, but extreme microfilament depolymerization or combined intermediate doses of microtubule and microfilament toxins resulted in decreased mitochondrial lengths. Interestingly, these two particular exposures did not affect mitochondrial respiration in cells not sensitized with A23187, indicating an interplay between mitochondrial morphology and respiration. In all cases, inducing maximal respiration diminished differences between control and experimental groups, suggesting that reduced basal respiration originates as a largely elective rather than pathological symptom of cytoskeletal impairment. However, viability experiments suggest that even this type of respiration decrease may be associated with cell death.

42 CFR 84.197 - Respirator containers; minimum requirements.

Science.gov (United States)

2010-10-01

... 42 Public Health 1 2010-10-01 2010-10-01 false Respirator containers; minimum requirements. 84.197... Cartridge Respirators § 84.197 Respirator containers; minimum requirements. Respirators shall be equipped with a substantial, durable container bearing markings which show the applicant's name, the type and...

42 CFR 84.174 - Respirator containers; minimum requirements.

Science.gov (United States)

2010-10-01

... 42 Public Health 1 2010-10-01 2010-10-01 false Respirator containers; minimum requirements. 84.174... Air-Purifying Particulate Respirators § 84.174 Respirator containers; minimum requirements. (a) Except..., durable container bearing markings which show the applicant's name, the type of respirator it contains...

Annual ecosystem respiration variability of alpine peatland on the eastern Qinghai-Tibet Plateau and its controlling factors.

Science.gov (United States)

Peng, Haijun; Hong, Bing; Hong, Yetang; Zhu, Yongxuan; Cai, Chen; Yuan, Lingui; Wang, Yu

2015-09-01

Peatlands are widely developed in the eastern Qinghai-Tibet Plateau, but little is known about carbon budgets for these alpine peatland ecosystems. In this study, we used an automatic chamber system to measure ecosystem respiration in the Hongyuan peatland, which is located in the eastern Qinghai-Tibet Plateau. Annual ecosystem respiration measurements showed a typical seasonal pattern, with the peak appearing in June. The highest respiration was 10.43 μmol CO2/m(2)/s, and the lowest was 0.20 μmol CO2/m(2)/s. The annual average ecosystem respiration was 2.06 μmol CO2/m(2)/s. The total annual respiration was 599.98 g C/m(2), and respiration during the growing season (from May to September) accounted for 78 % of the annual sum. Nonlinear regression revealed that ecosystem respiration has a significant exponential correlation with soil temperature at 10-cm depth (R (2) = 0.98). The Q 10 value was 3.90, which is far higher than the average Q 10 value of terrestrial ecosystems. Ecosystem respiration had an apparent diurnal variation pattern in growing season, with peaks and valleys appearing at approximately 14:00 and 10:00, respectively, which could be explained by soil temperature and soil water content variation at 10-cm depth.

Influence of the datasets size on the stability of the LR in the lower region of the within source distribution

NARCIS (Netherlands)

Haraksim, Rudolf; Meuwly, Didier

2013-01-01

This article focuses on the statistical evaluation of the fingermark evidence using the likelihood ratio (LR) approach. It studies the influence of the quantity of data used to model the within (WS) and between (BS) source variability. The LR system built for the experiment uses an Automated

Dependence of Soil Respiration on Soil Temperature and Soil Moisture in Successional Forests in Southern China

Institute of Scientific and Technical Information of China (English)

Xu-Li Tang; Guo-Yi Zhou; Shu-Guang Liu; De-Qiang Zhang; Shi-Zhong Liu; Jiong Li; Cun-Yu Zhou

2006-01-01

The spatial and temporal variations in soil respiration and its relationship with biophysical factors in forests near the Tropic of Cancer remain highly uncertain. To contribute towards an improvement of actual estimates, soil respiration rates, soil temperature, and soil moisture were measured in three successional subtropical forests at the Dinghushan Nature Reserve (DNR) in southern China from March 2003 to February 2005. The overall objective of the present study was to analyze the temporal variations of soil respiration and its biophysical dependence in these forests. The relationships between biophysical factors and soil respiration rates were compared in successional forests to test the hypothesis that these forests responded similarly to biophysical factors. The seasonality of soil respiration coincided with the seasonal climate pattern, with high respiration rates in the hot humid season (April-September) and with low rates in the cool dry season (October-March). Soil respiration measured at these forests showed a clear increasing trend with the progressive succession. Annual mean (± SD) soil respiration rate in the DNR forests was (9.0±4.6) Mg CO2-C/hm2 per year, ranging from (6.1±3.2) Mg CO2-C/hm2 per year in early successional forests to (10.7±4.9) Mg CO2-C/hm2 per year in advanced successional forests. Soil respiration was correlated with both soil temperature and moisture. The T/M model, where the two biophysical variables are driving factors, accounted for 74%-82% of soil respiration variation in DNR forests. Temperature sensitivity decreased along progressive succession stages, suggesting that advanced-successional forests have a good ability to adjust to temperature. In contrast, moisture increased with progressive succession processes. This increase is caused, in part, by abundant respirators in advanced-successional forest, where more soil moisture is needed to maintain their activities.

Dependence of soil respiration on soil temperature and soil moisture in successional forests in Southern China

Science.gov (United States)

Tang, X.-L.; Zhou, G.-Y.; Liu, S.-G.; Zhang, D.-Q.; Liu, S.-Z.; Li, Ji; Zhou, C.-Y.

2006-01-01

The spatial and temporal variations in soil respiration and its relationship with biophysical factors in forests near the Tropic of Cancer remain highly uncertain. To contribute towards an improvement of actual estimates, soil respiration rates, soil temperature, and soil moisture were measured in three successional subtropical forests at the Dinghushan Nature Reserve (DNR) in southern China from March 2003 to February 2005. The overall objective of the present study was to analyze the temporal variations of soil respiration and its biophysical dependence in these forests. The relationships between biophysical factors and soil respiration rates were compared in successional forests to test the hypothesis that these forests responded similarly to biophysical factors. The seasonality of soil respiration coincided with the seasonal climate pattern, with high respiration rates in the hot humid season (April-September) and with low rates in the cool dry season (October-March). Soil respiration measured at these forests showed a clear increasing trend with the progressive succession. Annual mean (±SD) soil respiration rate in the DNR forests was (9.0 ± 4.6) Mg CO2-C/hm2per year, ranging from (6.1 ± 3.2) Mg CO2-C/hm2per year in early successional forests to (10.7 ± 4.9) Mg CO2-C/hm2 per year in advanced successional forests. Soil respiration was correlated with both soil temperature and moisture. The T/M model, where the two biophysical variables are driving factors, accounted for 74%-82% of soil respiration variation in DNR forests. Temperature sensitivity decreased along progressive succession stages, suggesting that advanced-successional forests have a good ability to adjust to temperature. In contrast, moisture increased with progressive succession processes. This increase is caused, in part, by abundant respirators in advanced-successional forest, where more soil moisture is needed to maintain their activities.

42 CFR 84.134 - Respirator containers; minimum requirements.

Science.gov (United States)

2010-10-01

... 42 Public Health 1 2010-10-01 2010-10-01 false Respirator containers; minimum requirements. 84.134... Respirators § 84.134 Respirator containers; minimum requirements. Supplied-air respirators shall be equipped with a substantial, durable container bearing markings which show the applicant's name, the type and...

Identification of leaf rust resistant gene Lr10 in Pakistani wheat ...

African Journals Online (AJOL)

Leaf (brown) rust is the major disease of wheat in Pakistan and other countries. The disease is more effectively controlled when several rust resistance genes are pyramided into a single line. Molecular survey was conducted to screen 25 Pakistan wheat germplasm for the presence of leaf rust resistance gene Lr10 using ...

Workplace performance of a loose-fitting powered air purifying respirator during nanoparticle synthesis

International Nuclear Information System (INIS)

Koivisto, Antti J.; Aromaa, Mikko; Koponen, Ismo K.; Fransman, Wouter; Jensen, Keld A.; Mäkelä, Jyrki M.; Hämeri, Kaarle J.

2015-01-01

Nanoparticle (particles with diameter ≤100 nm) exposure is recognized as a potentially harmful size fraction for pulmonary particle exposure. During nanoparticle synthesis, the number concentrations in the process room may exceed 10 × 10 6 cm −3 . During such conditions, it is essential that the occupants in the room wear highly reliable high-performance respirators to prevent inhalation exposure. Here we have studied the in-use program protection factor (PPF) of loose-fitting powered air purifying respirators, while workers were coating components with TiO 2 or Cu x O y nanoparticles under a hood using a liquid flame spray process. The PPF was measured using condensation particle counters, an electrical low pressure impactor, and diffusion chargers. The room particle concentrations varied from 4 × 10 6 to 40 × 10 6 cm −3 , and the count median aerodynamic diameter ranged from 32 to 180 nm. Concentrations inside the respirator varied from 0.7 to 7.2 cm −3 . However, on average, tidal breathing was assumed to increase the respirator concentration by 2.3 cm −3 . The derived PPF exceeded 1.1 × 10 6 , which is more than 40 × 10 3 times the respirator assigned protection factor. We were unable to measure clear differences in the PPF of respirators with old and new filters, among two male and one female user, or assess most penetrating particle size. This study shows that the loose-fitting powered air purifying respirator provides very efficient protection against nanoparticle inhalation exposure if used properly

The role of alternative cyanide-insensitive respiration in plants. Final report

Energy Technology Data Exchange (ETDEWEB)

Raskin, Ilya

1997-09-29

This DOE funded research concentrated on the investigation of the role of respiration and oxidative stress in plant biology. Initially the authors concentrated on the possible role of cyanide-insensitive respiration in counteracting the deleterious effects of chilling stress. Although plants are considered to be poikilotherms, there are a few examples of thermogenesis, in which the tissue temperature increases well above ambient. They suggested that differences between thermogenic and non-thermogenic plants may be quantitative rather than qualitative, and that heat from increased respiration may have a local protective effect on the mitochondria, slowing or reducing the effects of chilling. They proposed that this is accomplished by a large increase in respiration, predominantly via the alternative pathway. They measured the increases in respiration, particularly via the alternative pathway, in response to chilling. They have also quantified the associated increases in heat evolution in response to chilling in a number of plant species using a microcalorimeter. For example, after 8 h exposure to 8 C, heat evolution in chilling-sensitive species increased 47--98%, compared to 7--22% for the chilling-resistant species. No increase in heat evolution was observed in the extremely chilling-sensitive ornamental Episcka cupreata (Hook). Increases in heat evolution were observed when plants were chilled in constant light or in the dark, but not when plants were chilled at high humidity. Heat evolution by mitochondria isolated from potato tuber slices were also measured. These values, together with measurements of the heat capacity of isolated mitochondria and counting of the mitochondria by flow cytometry, allow calculation of theoretical maximal rates of heating and the heat produced per mitochondrion. The obtained data was consistent with the protective role of respiratory heat production in cold-stressed plants.

Biophysical controls on soil respiration in the dominant patch types of an old-growth, mixed-conifer forest

Science.gov (United States)

Siyan Ma; Jiquan Chen; John R. Butnor; Malcolm North; Eugénie S. Euskirchen; Brian Oakley

2005-01-01

Little is known about biophysical controls on soil respiration in California's Sierra Nevada old-growth, mixed-conifer forests. Using portable and automated soil respiration sampling units, we measured soil respiration rate (SRR) in three dominant patch types: closed canopy (CC), ceanothus-dominated patches (CECO), and open canopy (OC). SRR varied significantly...

Ecosystem warming does not affect photosynthesis or aboveground autotrophic respiration for boreal black spruce

Energy Technology Data Exchange (ETDEWEB)

Bronson, D.R. [Wyoming Univ., Laramie, WY (United States). Dept. of Renewable Resources; Gower, S.T. [Wisconsin Univ., Madison, WI (United States). Dept. of Forest Ecology and Management

2010-04-15

Substantial increases in climatic temperatures may cause boreal forests to become a carbon source. An improved understanding of the effect of climatic warming on photosynthesis and autotrophic respiration is needed in order to determine the impact of temperature increases on net carbon balances. This study measured the light-saturated photosynthesis foliage respiration and stem respiration of black spruce in heated and control plots during a 3-year period at a site located in Thompson, Manitoba. Greenhouses and soil-heating cables were used to maintain air and soil temperatures at 5 degrees C above ambient air and soil temperatures. Studies were conducted to determine the influence of soil and air warming; soil-only warming; and greenhouses maintained at ambient temperatures. The study showed that treatment differences for photosynthesis, foliage respiration, and stem respiration were not significant over the 3-year period. Results suggested that black spruce may not have significant changes in photosynthesis or respiration rates in warmer climates. 38 refs., 3 tabs., 4 figs.

Quantitative change of EEG and respiration signals during mindfulness meditation

Science.gov (United States)

2014-01-01

Background This study investigates measures of mindfulness meditation (MM) as a mental practice, in which a resting but alert state of mind is maintained. A population of older people with high stress level participated in this study, while electroencephalographic (EEG) and respiration signals were recorded during a MM intervention. The physiological signals during meditation and control conditions were analyzed with signal processing. Methods EEG and respiration data were collected and analyzed on 34 novice meditators after a 6-week meditation intervention. Collected data were analyzed with spectral analysis, phase analysis and classification to evaluate an objective marker for meditation. Results Different frequency bands showed differences in meditation and control conditions. Furthermore, we established a classifier using EEG and respiration signals with a higher accuracy (85%) at discriminating between meditation and control conditions than a classifier using the EEG signal only (78%). Conclusion Support vector machine (SVM) classifier with EEG and respiration feature vector is a viable objective marker for meditation ability. This classifier should be able to quantify different levels of meditation depth and meditation experience in future studies. PMID:24939519

Forest thinning and soil respiration in a ponderosa pine plantation in the Sierra Nevada.

Science.gov (United States)

Tang, Jianwu; Qi, Ye; Xu, Ming; Misson, Laurent; Goldstein, Allen H

2005-01-01

Soil respiration is controlled by soil temperature, soil water, fine roots, microbial activity, and soil physical and chemical properties. Forest thinning changes soil temperature, soil water content, and root density and activity, and thus changes soil respiration. We measured soil respiration monthly and soil temperature and volumetric soil water continuously in a young ponderosa pine (Pinus ponderosa Dougl. ex P. Laws. & C. Laws.) plantation in the Sierra Nevada Mountains in California from June 1998 to May 2000 (before a thinning that removed 30% of the biomass), and from May to December 2001 (after thinning). Thinning increased the spatial homogeneity of soil temperature and respiration. We conducted a multivariate analysis with two independent variables of soil temperature and water and a categorical variable representing the thinning event to simulate soil respiration and assess the effect of thinning. Thinning did not change the sensitivity of soil respiration to temperature or to water, but decreased total soil respiration by 13% at a given temperature and water content. This decrease in soil respiration was likely associated with the decrease in root density after thinning. With a model driven by continuous soil temperature and water time series, we estimated that total soil respiration was 948, 949 and 831 g C m(-2) year(-1) in the years 1999, 2000 and 2001, respectively. Although thinning reduced soil respiration at a given temperature and water content, because of natural climate variability and the thinning effect on soil temperature and water, actual cumulative soil respiration showed no clear trend following thinning. We conclude that the effect of forest thinning on soil respiration is the combined result of a decrease in root respiration, an increase in soil organic matter, and changes in soil temperature and water due to both thinning and interannual climate variability.

Gastrocnemius mitochondrial respiration: are there any differences between men and women?

Science.gov (United States)

Thompson, Jonathan R; Swanson, Stanley A; Casale, George P; Johanning, Jason M; Papoutsi, Evlampia; Koutakis, Panagiotis; Miserlis, Dimitrios; Zhu, Zhen; Pipinos, Iraklis I

2013-11-01

Work on human and mouse skeletal muscle by our group and others has demonstrated that aging and age-related degenerative diseases are associated with mitochondrial dysfunction, which may be more prevalent in males. There have been, however, no studies that specifically examine the influence of male or female sex on human skeletal muscle mitochondrial respiration. The purpose of this study was to compare mitochondrial respiration in the gastrocnemius of adult men and women. Gastrocnemius muscle was obtained from male (n = 19) and female (n = 11) human subjects with healthy lower-extremity musculoskeletal and arterial systems and normal ambulatory function. All patients were undergoing operations for the treatment of varicose veins in their legs. Mitochondrial respiration was determined with a Clark electrode in an oxygraph cell containing saponin-skinned muscle bundles. Complex I-, II-, III-, and IV-dependent respiration was measured individually and normalized to muscle weight, total protein content, and citrate synthase (CS, index of mitochondrial content). Male and female patients had no evidence of musculoskeletal or arterial disease and did not differ with regard to age, race, body mass index, or other clinical characteristics. Complex I-, II-, III-, and IV-dependent respiration normalized to muscle weight, total protein content, and CS did not statistically differ for males compared with females. Our study evaluates, for the first time, gastrocnemius mitochondrial respiration of adult men and women who have healthy musculoskeletal and arterial systems and normal ambulatory function. Our data demonstrate there are no differences in the respiration of gastrocnemius mitochondria between men and women. Copyright © 2013 Elsevier Inc. All rights reserved.

Creating the Chemistry in Cellular Respiration Concept Inventory (CCRCI)

Science.gov (United States)

Forshee, Jay Lance, II

Students at our institution report cellular respiration to be the most difficult concept they encounter in undergraduate biology, but why students find this difficult is unknown. Students may find cellular respiration difficult because there is a large amount of steps, or because there are persistent, long-lasting misconceptions and misunderstandings surrounding their knowledge of chemistry, which affect their performance on cellular respiration assessments. Most studies of cellular respiration focus on student macro understanding of the process related to breathing, and matter and energy. To date, no studies identify which chemistry concepts are most relevant to students' development of an understanding of the process of cellular respiration or have developed an assessment to measure student understanding of them. Following the Delphi method, the researchers conducted expert interviews with faculty members from four-year, masters-, and PhD-granting institutions who teach undergraduate general biology, and are experts in their respective fields of biology. From these interviews, researchers identified twelve chemistry concepts important to understanding cellular respiration and using surveys, these twelve concepts were refined into five (electron transfer, energy transfer, thermodynamics (law/conservation), chemical reactions, and gradients). The researchers then interviewed undergraduate introductory biology students at a large Midwestern university to identify their knowledge and misconceptions of the chemistry concepts that the faculty had identified previously as important. The CCRCI was developed using the five important chemistry concepts underlying cellular respiration. The final version of the CCRCI was administered to n=160 introductory biology students during the spring 2017 semester. Reliability of the CCRCI was evaluated using Cronbach's alpha (=.7) and split-half reliability (=.769), and validity of the instrument was assessed through content validity

Opposite effects of pioglitazone and rosiglitazone on mitochondrial respiration in skeletal muscle of patients with type 2 diabetes

DEFF Research Database (Denmark)

Rabøl, R; Boushel, R; Almdal, T

2010-01-01

mitochondrial respiration per milligram muscle was measured in saponin-treated skinned muscle fibres using high-resolution respirometry. RESULTS: Mitochondrial respiration per milligram muscle was lower in T2DM compared to controls at baseline and decreased during ROSI treatment but increased during PIO...... of ROSI and PIO on mitochondrial respiration, and also show that insulin sensitivity can be improved independently of changes in mitochondrial respiration. We confirm that mitochondrial respiration is reduced in T2DM compared to age- and BMI-matched control subjects....

Soil respiration and photosynthetic uptake of carbon dioxide by ground-cover plants in four ages of jack pine forest

Science.gov (United States)

Striegl, Robert G.; Wickland, K.P.

2001-01-01

Soil carbon dioxide (CO2) emission (soil respiration), net CO2 exchange after photosynthetic uptake by ground-cover plants, and soil CO2 concentration versus depth below land surface were measured at four ages of jack pine (Pinus banksiana Lamb.) forest in central Saskatchewan. Soil respiration was smallest at a clear-cut site, largest in an 8-year-old stand, and decreased with stand age in 20-year-old and mature (60-75 years old) stands during May-September 1994 (12.1, 34.6, 31.5, and 24.9 mol C??m-2, respectively). Simulations of soil respiration at each stand based on continuously recorded soil temperature were within one standard deviation of measured flux for 48 of 52 measurement periods, but were 10%-30% less than linear interpolations of measured flux for the season. This was probably due to decreased soil respiration at night modeled by the temperature-flux relationships, but not documented by daytime chamber measurements. CO2 uptake by ground-cover plants ranged from 0 at the clear-cut site to 29, 25, and 9% of total growing season soil respiration at the 8-year, 20-year, and mature stands. CO2 concentrations were as great as 7150 ppmv in the upper 1 m of unsaturated zone and were proportional to measured soil respiration.

Acclimation and soil moisture constrain sugar maple root respiration in experimentally warmed soil.

Science.gov (United States)

Jarvi, Mickey P; Burton, Andrew J

2013-09-01

The response of root respiration to warmer soil can affect ecosystem carbon (C) allocation and the strength of positive feedbacks between climatic warming and soil CO2 efflux. This study sought to determine whether fine-root (maple (Acer saccharum Marsh.)-dominated northern hardwood forest would adjust to experimentally warmed soil, reducing C return to the atmosphere at the ecosystem scale to levels lower than that would be expected using an exponential temperature response function. Infrared heating lamps were used to warm the soil (+4 to +5 °C) in a mature sugar maple forest in a fully factorial design, including water additions used to offset the effects of warming-induced dry soil. Fine-root-specific respiration rates, root biomass, root nitrogen (N) concentration, soil temperature and soil moisture were measured from 2009 to 2011, with experimental treatments conducted from late 2010 to 2011. Partial acclimation of fine-root respiration to soil warming occurred, with soil moisture deficit further constraining specific respiration rates in heated plots. Fine-root biomass and N concentration remained unchanged. Over the 2011 growing season, ecosystem root respiration was not significantly greater in warmed soil. This result would not be predicted by models that allow respiration to increase exponentially with temperature and do not directly reduce root respiration in drier soil.

Evaluation of respiration-correlated digital tomosynthesis in lung.

Science.gov (United States)

Santoro, Joseph; Kriminski, Sergey; Lovelock, D Michael; Rosenzweig, Kenneth; Mostafavi, Hassan; Amols, Howard I; Mageras, Gig S

2010-03-01

Digital tomosynthesis (DTS) with a linear accelerator-mounted imaging system provides a means of reconstructing tomographic images from radiographic projections over a limited gantry arc, thus requiring only a few seconds to acquire. Its application in the thorax, however, often results in blurred images from respiration-induced motion. This work evaluates the feasibility of respiration-correlated (RC) DTS for soft-tissue visualization and patient positioning. Image data acquired with a gantry-mounted kilovoltage imaging system while recording respiration were retrospectively analyzed from patients receiving radiotherapy for non-small-cell lung carcinoma. Projection images spanning an approximately 30 degrees gantry arc were sorted into four respiration phase bins prior to DTS reconstruction, which uses a backprojection, followed by a procedure to suppress structures above and below the reconstruction plane of interest. The DTS images were reconstructed in planes at different depths through the patient and normal to a user-selected angle close to the center of the arc. The localization accuracy of RC-DTS was assessed via a comparison with CBCT. Evaluation of RC-DTS in eight tumors shows visible reduction in image blur caused by the respiratory motion. It also allows the visualization of tumor motion extent. The best image quality is achieved at the end-exhalation phase of the respiratory motion. Comparison of RC-DTS with respiration-correlated cone-beam CT in determining tumor position, motion extent and displacement between treatment sessions shows agreement in most cases within 2-3 mm, comparable in magnitude to the intraobserver repeatability of the measurement. These results suggest the method's applicability for soft-tissue image guidance in lung, but must be confirmed with further studies in larger numbers of patients.

Towards an HIV-1 cure: measuring the latent reservoir.

Science.gov (United States)

Bruner, Katherine M; Hosmane, Nina N; Siliciano, Robert F

2015-04-01

The latent reservoir (LR) of HIV-1 in resting memory CD4(+) T cells serves as a major barrier to curing HIV-1 infection. While many PCR- and culture-based assays have been used to measure the size of the LR, correlation between results of different assays is poor and recent studies indicate that no available assay provides an accurate measurement of reservoir size. The discrepancies between assays are a hurdle to clinical trials that aim to measure the efficacy of HIV-1 eradication strategies. Here we describe the advantages and disadvantages of various approaches to measuring the LR. Copyright © 2015 Elsevier Ltd. All rights reserved.

Driver-response relationships between frontal EEG and respiration during affective audiovisual stimuli.

Science.gov (United States)

Kroupi, Eleni; Vesin, Jean-Marc; Ebrahimi, Touradj

2013-01-01

The complementary nature and the coordinative tendencies of brain and body are essential to the way humans function. Although static features from brain and body signals have been shown to reflect emotions, the dynamic interrelation of the two systems during emotional processes is still in its infancy. This study aims at investigating the way brain signals captured by Electroencephalography (EEG) and bodily responses reflected in respiration interact when watching music clips. A non-linear measure is applied to frontal EEG and respiration to determine the driver/driven relationship between these two modalities. The results reveal a unidirectional dependence from respiration to EEG which adds evidence to the bodily-feedback theory.

No diurnal variation in rate or carbon isotope composition of soil respiration in a boreal forest

International Nuclear Information System (INIS)

Betson, N.R.; Gottlicher, S.G.; Hogberg, P.; Hall, M.; Wallin, G.; Richter, A.

2007-01-01

This study evaluated the diurnal variability in the rate and stable carbon isotope ratio ((delta) 13 C) of soil respiration in a northern boreal forest, measured with opaque chambers after the removal of understory vegetation. The experiment was conducted in June and August 2004 at the Picea abies L. Karst-dominated Flakaliden Research Forest in northern Sweden, using unfertilized girdled-tree plots and unfertilized non-girdled tree plots. Soil respiration and (delta) 13 C of soil-respired carbon dioxide (CO 2 ) were measured every 4 hours on 6 plots, with a total of 11 sampling times over each 48 hour period. The purpose was to clarify an earlier study regarding the origin of diurnal patterns of soil CO 2 flux. This study explored whether the diurnal patterns were the result of photosynthetic CO 2 uptake during the day by the understory or whether there were underlying trends in soil respiration driven by plant root allocation. The sampling campaigns undertaken in this study investigated whether diurnal variations in soil respiration rate and (delta) 13 C exist in this ecosystem when no understory vegetation is present. Shoot photosynthesis and environmental parameters were measured simultaneously. Despite significant variations in climatic conditions and shoot photosynthetic rates in non-girdled trees, no diurnal patterns in soil respiration rates and (delta) 13 C were noted in either treatment. The lack of detectable diurnal changes in both treatments indicates that modeling of daily boreal forest carbon balances based on single instantaneous measurements are unlikely to be misconstrued by substantial diurnal trends. However, it was suggested that spatial variable should be accounted for, given the large standard errors. The impact of tree girdling on soil respiration rates also emphasized the significance of canopy photosynthesis in driving soil processes. 37 refs., 2 figs

A distinct seasonal pattern of the ratio of soil respiration to total ecosystem respiration in a spruce-dominated forest

Science.gov (United States)

E.A. Davidson; A.D. Richardson; K.E. Savage; D.Y. Hollinger

2006-01-01

Annual budgets and fitted temperature response curves for soil respiration and ecosystem respiration provide useful information for partitioning annual carbon budgets of ecosystems, but they may not adequately reveal seasonal variation in the ratios of these two fluxes. Soil respiration (Rs) typically contributes 30-80% of...

Validity of the MMPI-2-RF (Restructured Form) L-r and K-r Scales in Detecting Underreporting in Clinical and Nonclinical Samples

Science.gov (United States)

Sellbom, Martin; Bagby, R. Michael

2008-01-01

In the current investigation, the authors examined the validity of the L-r and K-r scales on the recently developed Minnesota Multiphasic Personality Inventory-2-Restructured Form (MMPI-2-RF; Y. S. Ben-Porath & A. Tellegen, in press) in measuring underreported response bias. Three archival samples previously collected for examining MMPI-2…

Status Report on Scoping Reactor Physics and Sensitivity/Uncertainty Analysis of LR-0 Reactor Molten Salt Experiments

Energy Technology Data Exchange (ETDEWEB)

Brown, Nicholas R. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Reactor and Nuclear Systems Division; Mueller, Donald E. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Reactor and Nuclear Systems Division; Patton, Bruce W. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Reactor and Nuclear Systems Division; Powers, Jeffrey J. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Reactor and Nuclear Systems Division

2016-08-31

Experiments are being planned at Research Centre Rež (RC Rež) to use the FLiBe (2 ⁷LiF-BeF₂) salt from the Molten Salt Reactor Experiment (MSRE) to perform reactor physics measurements in the LR-0 low power nuclear reactor. These experiments are intended to inform on neutron spectral effects and nuclear data uncertainties for advanced reactor systems utilizing FLiBe salt in a thermal neutron energy spectrum. Oak Ridge National Laboratory (ORNL) is performing sensitivity/uncertainty (S/U) analysis of these planned experiments as part of the ongoing collaboration between the United States and the Czech Republic on civilian nuclear energy research and development. The objective of these analyses is to produce the sensitivity of neutron multiplication to cross section data on an energy-dependent basis for specific nuclides. This report provides a status update on the S/U analyses of critical experiments at the LR-0 Reactor relevant to fluoride salt-cooled high temperature reactor (FHR) and liquid-fueled molten salt reactor (MSR) concepts. The S/U analyses will be used to inform design of FLiBe-based experiments using the salt from MSRE.

Status Report on Scoping Reactor Physics and Sensitivity/Uncertainty Analysis of LR-0 Reactor Molten Salt Experiments

International Nuclear Information System (INIS)

Brown, Nicholas R.; Mueller, Donald E.; Patton, Bruce W.; Powers, Jeffrey J.

2016-01-01

Experiments are being planned at Research Centre Rež (RC Rež) to use the FLiBe (2 "7LiF-BeF_2) salt from the Molten Salt Reactor Experiment (MSRE) to perform reactor physics measurements in the LR-0 low power nuclear reactor. These experiments are intended to inform on neutron spectral effects and nuclear data uncertainties for advanced reactor systems utilizing FLiBe salt in a thermal neutron energy spectrum. Oak Ridge National Laboratory (ORNL) is performing sensitivity/uncertainty (S/U) analysis of these planned experiments as part of the ongoing collaboration between the United States and the Czech Republic on civilian nuclear energy research and development. The objective of these analyses is to produce the sensitivity of neutron multiplication to cross section data on an energy-dependent basis for specific nuclides. This report provides a status update on the S/U analyses of critical experiments at the LR-0 Reactor relevant to fluoride salt-cooled high temperature reactor (FHR) and liquid-fueled molten salt reactor (MSR) concepts. The S/U analyses will be used to inform design of FLiBe-based experiments using the salt from MSRE.

Lettuce (Lactuca sativa L.) leaf-proteome profiles after exposure to cylindrospermopsin and a microcystin-LR/cylindrospermopsin mixture: a concentration-dependent response.

Science.gov (United States)

Freitas, Marisa; Campos, Alexandre; Azevedo, Joana; Barreiro, Aldo; Planchon, Sébastien; Renaut, Jenny; Vasconcelos, Vitor

2015-02-01

The intensification of agricultural productivity is an important challenge worldwide. However, environmental stressors can provide challenges to this intensification. The progressive occurrence of the cyanotoxins cylindrospermopsin (CYN) and microcystin-LR (MC-LR) as a potential consequence of eutrophication and climate change is of increasing concern in the agricultural sector because it has been reported that these cyanotoxins exert harmful effects in crop plants. A proteomic-based approach has been shown to be a suitable tool for the detection and identification of the primary responses of organisms exposed to cyanotoxins. The aim of this study was to compare the leaf-proteome profiles of lettuce plants exposed to environmentally relevant concentrations of CYN and a MC-LR/CYN mixture. Lettuce plants were exposed to 1, 10, and 100 μg/l CYN and a MC-LR/CYN mixture for five days. The proteins of lettuce leaves were separated by two-dimensional electrophoresis (2-DE), and those that were differentially abundant were then identified by matrix-assisted laser desorption/ionization time of flight-mass spectrometry (MALDI-TOF/TOF MS). The biological functions of the proteins that were most represented in both experiments were photosynthesis and carbon metabolism and stress/defense response. Proteins involved in protein synthesis and signal transduction were also highly observed in the MC-LR/CYN experiment. Although distinct protein abundance patterns were observed in both experiments, the effects appear to be concentration-dependent, and the effects of the mixture were clearly stronger than those of CYN alone. The obtained results highlight the putative tolerance of lettuce to CYN at concentrations up to 100 μg/l. Furthermore, the combination of CYN with MC-LR at low concentrations (1 μg/l) stimulated a significant increase in the fresh weight (fr. wt) of lettuce leaves and at the proteomic level resulted in the increase in abundance of a high number of proteins. In

Workplace performance of a loose-fitting powered air purifying respirator during nanoparticle synthesis

Energy Technology Data Exchange (ETDEWEB)

Koivisto, Antti J., E-mail: jok@nrcwe.dk [National Research Centre for the Working Environment (Denmark); Aromaa, Mikko [Tampere University of Technology, Department of Physics (Finland); Koponen, Ismo K. [National Research Centre for the Working Environment (Denmark); Fransman, Wouter [TNO (Netherlands); Jensen, Keld A. [National Research Centre for the Working Environment (Denmark); Mäkelä, Jyrki M. [Tampere University of Technology, Department of Physics (Finland); Hämeri, Kaarle J. [University of Helsinki, Department of Physics (Finland)

2015-04-15

Nanoparticle (particles with diameter ≤100 nm) exposure is recognized as a potentially harmful size fraction for pulmonary particle exposure. During nanoparticle synthesis, the number concentrations in the process room may exceed 10 × 10{sup 6} cm{sup −3}. During such conditions, it is essential that the occupants in the room wear highly reliable high-performance respirators to prevent inhalation exposure. Here we have studied the in-use program protection factor (PPF) of loose-fitting powered air purifying respirators, while workers were coating components with TiO{sub 2} or Cu{sub x}O{sub y} nanoparticles under a hood using a liquid flame spray process. The PPF was measured using condensation particle counters, an electrical low pressure impactor, and diffusion chargers. The room particle concentrations varied from 4 × 10{sup 6} to 40 × 10{sup 6} cm{sup −3}, and the count median aerodynamic diameter ranged from 32 to 180 nm. Concentrations inside the respirator varied from 0.7 to 7.2 cm{sup −3}. However, on average, tidal breathing was assumed to increase the respirator concentration by 2.3 cm{sup −3}. The derived PPF exceeded 1.1 × 10{sup 6}, which is more than 40 × 10{sup 3} times the respirator assigned protection factor. We were unable to measure clear differences in the PPF of respirators with old and new filters, among two male and one female user, or assess most penetrating particle size. This study shows that the loose-fitting powered air purifying respirator provides very efficient protection against nanoparticle inhalation exposure if used properly.

Induction by ethylene of cyanide-resistant respiration

Energy Technology Data Exchange (ETDEWEB)

Solomos, T.; Laties, G.G.

1976-05-17

Ethylene and cyanide induce an increase in respiration in a variety of plant tissues, whereas ethylene has no effect on tissues whose respiration is strongly inhibited by cyanide. It is suggested that the existence of a cyanide-insensitive electron transport path is a prerequisite for stimulation of respiration by ethylene.

TNF-α-induced NF-κB activation promotes myofibroblast differentiation of LR-MSCs and exacerbates bleomycin-induced pulmonary fibrosis.

Science.gov (United States)

Hou, Jiwei; Ma, Tan; Cao, Honghui; Chen, Yabing; Wang, Cong; Chen, Xiang; Xiang, Zou; Han, Xiaodong

2018-03-01

Idiopathic pulmonary fibrosis (IPF) is a chronic, progressive, and irreversible lung disease of unknown cause. It has been reported that both lung resident mesenchymal stem cells (LR-MSCs) and tumor necrosis factor-α (TNF-α) play important roles in the development of pulmonary fibrosis. However, the underlying connections between LR-MSCs and TNF-α in the pathogenesis of pulmonary fibrosis are still elusive. In this study, we found that the pro-inflammatory cytokine TNF-α and the transcription factor nuclear factor kappa B (NF-κB) p65 subunit were both upregulated in bleomycin-induced fibrotic lung tissue. In addition, we discovered that TNF-α promotes myofibroblast differentiation of LR-MSCs through activating NF-κB signaling. Interestingly, we also found that TNF-α promotes the expression of β-catenin. Moreover, we demonstrated that suppression of the NF-κB signaling could attenuate myofibroblast differentiation of LR-MSCs and bleomycin-induced pulmonary fibrosis which were accompanied with decreased expression of β-catenin. Our data implicates that inhibition of the NF-κB signaling pathway may provide a therapeutic strategy for pulmonary fibrosis, a disease that warrants more effective treatment approaches. © 2017 Wiley Periodicals, Inc.

Significance of cold-season respiration and photosynthesis in a subarctic heath ecosystem in Northern Sweden

DEFF Research Database (Denmark)

Larsen, Klaus Steenberg; Ibrom, Andreas; Jonasson, S.

2007-01-01

While substantial cold-season respiration has been documented in most arctic and alpine ecosystems in recent years, the significance of cold-season photosynthesis in these biomes is still believed to be small. In a mesic, subartic heath during both the cold and warm season, we measured in situ...... ecosystem respiration and photosynthesis with a chamber technique at ambient conditions and at artificially, increased frequency of freeze-thaw (FT) cycles during fall and spring. We fitted the measured ecosystem exchange rates to respiration and photosynthesis models with R-2-values ranging from 0.81 to 0.......85. As expected, estimated cold-season (October, November, April and May) respiration was significant and accounted for at least 22% of the annual respiratory CO2 flux. More surprisingly, estimated photosynthesis during this period accounted for up to 19% of the annual gross CO2 uptake, suggesting that cold...

Frost Induces Respiration and Accelerates Carbon Depletion in Trees.

Science.gov (United States)

Sperling, Or; Earles, J Mason; Secchi, Francesca; Godfrey, Jessie; Zwieniecki, Maciej A

2015-01-01

Cellular respiration depletes stored carbohydrates during extended periods of limited photosynthesis, e.g. winter dormancy or drought. As respiration rate is largely a function of temperature, the thermal conditions during such periods may affect non-structural carbohydrate (NSC) availability and, ultimately, recovery. Here, we surveyed stem responses to temperature changes in 15 woody species. For two species with divergent respirational response to frost, P. integerrima and P. trichocarpa, we also examined corresponding changes in NSC levels. Finally, we simulated respiration-induced NSC depletion using historical temperature data for the western US. We report a novel finding that tree stems significantly increase respiration in response to near freezing temperatures. We observed this excess respiration in 13 of 15 species, deviating 10% to 170% over values predicted by the Arrhenius equation. Excess respiration persisted at temperatures above 0 °C during warming and reoccurred over multiple frost-warming cycles. A large adjustment of NSCs accompanied excess respiration in P. integerrima, whereas P. trichocarpa neither excessively respired nor adjusted NSCs. Over the course of the years included in our model, frost-induced respiration accelerated stem NSC consumption by 8.4 mg (glucose eq.) cm(-3) yr(-1) on average in the western US, a level of depletion that may continue to significantly affect spring NSC availability. This novel finding revises the current paradigm of low temperature respiration kinetics.

Frost Induces Respiration and Accelerates Carbon Depletion in Trees.

Directory of Open Access Journals (Sweden)

Or Sperling

Full Text Available Cellular respiration depletes stored carbohydrates during extended periods of limited photosynthesis, e.g. winter dormancy or drought. As respiration rate is largely a function of temperature, the thermal conditions during such periods may affect non-structural carbohydrate (NSC availability and, ultimately, recovery. Here, we surveyed stem responses to temperature changes in 15 woody species. For two species with divergent respirational response to frost, P. integerrima and P. trichocarpa, we also examined corresponding changes in NSC levels. Finally, we simulated respiration-induced NSC depletion using historical temperature data for the western US. We report a novel finding that tree stems significantly increase respiration in response to near freezing temperatures. We observed this excess respiration in 13 of 15 species, deviating 10% to 170% over values predicted by the Arrhenius equation. Excess respiration persisted at temperatures above 0 °C during warming and reoccurred over multiple frost-warming cycles. A large adjustment of NSCs accompanied excess respiration in P. integerrima, whereas P. trichocarpa neither excessively respired nor adjusted NSCs. Over the course of the years included in our model, frost-induced respiration accelerated stem NSC consumption by 8.4 mg (glucose eq. cm(-3 yr(-1 on average in the western US, a level of depletion that may continue to significantly affect spring NSC availability. This novel finding revises the current paradigm of low temperature respiration kinetics.

Effects of microcystin-LR and cylindrospermopsin on plant-soil systems: A review of their relevance for agricultural plant quality and public health

Energy Technology Data Exchange (ETDEWEB)

Machado, J.; Campos, A. [Interdisciplinary Centre of Marine and Environmental Research (CIIMAR/CIMAR), University of Porto, Rua dos Bragas 289, P 4050-123 Porto (Portugal); Vasconcelos, V. [Interdisciplinary Centre of Marine and Environmental Research (CIIMAR/CIMAR), University of Porto, Rua dos Bragas 289, P 4050-123 Porto (Portugal); Department of Biology, Faculty of Sciences, University of Porto, Rua do Campo Alegre, P 4069-007 Porto (Portugal); Freitas, M., E-mail: maf@ess.ipp.pt [Interdisciplinary Centre of Marine and Environmental Research (CIIMAR/CIMAR), University of Porto, Rua dos Bragas 289, P 4050-123 Porto (Portugal); Polytechnic Institute of Porto, Department of Environmental Health, School of Allied Health Technologies, CISA/Research Center in Environment and Health, Rua de Valente Perfeito, 322, P 440-330 Gaia (Portugal)

2017-02-15

Toxic cyanobacterial blooms are recognized as an emerging environmental threat worldwide. Although microcystin-LR is the most frequently documented cyanotoxin, studies on cylindrospermopsin have been increasing due to the invasive nature of cylindrospermopsin-producing cyanobacteria. The number of studies regarding the effects of cyanotoxins on agricultural plants has increased in recent years, and it has been suggested that the presence of microcystin-LR and cylindrospermopsin in irrigation water may cause toxic effects in edible plants. The uptake of these cyanotoxins by agricultural plants has been shown to induce morphological and physiological changes that lead to a potential loss of productivity. There is also evidence that edible terrestrial plants can bioaccumulate cyanotoxins in their tissues in a concentration dependent-manner. Moreover, the number of consecutive cycles of watering and planting in addition to the potential persistence of microcystin-LR and cylindrospermopsin in the environment are likely to result in groundwater contamination. The use of cyanotoxin-contaminated water for agricultural purposes may therefore represent a threat to both food security and food safety. However, the deleterious effects of cyanotoxins on agricultural plants and public health seem to be dependent on the concentrations studied, which in most cases are non-environmentally relevant. Interestingly, at ecologically relevant concentrations, the productivity and nutritional quality of some agricultural plants seem not to be impaired and may even be enhanced. However, studies assessing if the potential tolerance of agricultural plants to these concentrations can result in cyanotoxin and allergen accumulation in the edible tissues are lacking. This review combines the most current information available regarding this topic with a realistic assessment of the impact of cyanobacterial toxins on agricultural plants, groundwater quality and public health. - Highlights: �

Effects of microcystin-LR and cylindrospermopsin on plant-soil systems: A review of their relevance for agricultural plant quality and public health

International Nuclear Information System (INIS)

Machado, J.; Campos, A.; Vasconcelos, V.; Freitas, M.

2017-01-01

Toxic cyanobacterial blooms are recognized as an emerging environmental threat worldwide. Although microcystin-LR is the most frequently documented cyanotoxin, studies on cylindrospermopsin have been increasing due to the invasive nature of cylindrospermopsin-producing cyanobacteria. The number of studies regarding the effects of cyanotoxins on agricultural plants has increased in recent years, and it has been suggested that the presence of microcystin-LR and cylindrospermopsin in irrigation water may cause toxic effects in edible plants. The uptake of these cyanotoxins by agricultural plants has been shown to induce morphological and physiological changes that lead to a potential loss of productivity. There is also evidence that edible terrestrial plants can bioaccumulate cyanotoxins in their tissues in a concentration dependent-manner. Moreover, the number of consecutive cycles of watering and planting in addition to the potential persistence of microcystin-LR and cylindrospermopsin in the environment are likely to result in groundwater contamination. The use of cyanotoxin-contaminated water for agricultural purposes may therefore represent a threat to both food security and food safety. However, the deleterious effects of cyanotoxins on agricultural plants and public health seem to be dependent on the concentrations studied, which in most cases are non-environmentally relevant. Interestingly, at ecologically relevant concentrations, the productivity and nutritional quality of some agricultural plants seem not to be impaired and may even be enhanced. However, studies assessing if the potential tolerance of agricultural plants to these concentrations can result in cyanotoxin and allergen accumulation in the edible tissues are lacking. This review combines the most current information available regarding this topic with a realistic assessment of the impact of cyanobacterial toxins on agricultural plants, groundwater quality and public health. - Highlights: �

Cardiac, Skeletal, and smooth muscle mitochondrial respiration

DEFF Research Database (Denmark)

Park, Song-Young; Gifford, Jayson R; Andtbacka, Robert H I

2014-01-01

, skeletal, and smooth muscle was harvested from a total of 22 subjects (53±6 yrs) and mitochondrial respiration assessed in permeabilized fibers. Complex I+II, state 3 respiration, an index of oxidative phosphorylation capacity, fell progressively from cardiac, skeletal, to smooth muscle (54±1; 39±4; 15......±1 pmol•s(-1)•mg (-1), prespiration rates were normalized by CS (respiration...... per mitochondrial content), oxidative phosphorylation capacity was no longer different between the three muscle types. Interestingly, Complex I state 2 normalized for CS activity, an index of non-phosphorylating respiration per mitochondrial content, increased progressively from cardiac, skeletal...

Comparing organic versus conventional soil management on soil respiration [version 1; referees: 2 approved

Directory of Open Access Journals (Sweden)

Bence Mátyás

2018-03-01

Full Text Available Soil management has great potential to affect soil respiration. In this study, we investigated the effects of organic versus conventional soil management on soil respiration.  We measured the main soil physical-chemical properties from conventional and organic managed soil in Ecuador. Soil respiration was determined using alkaline absorption according to Witkamp.  Soil properties such as organic matter, nitrogen, and humidity, were comparable between conventional and organic soils in the present study, and in a further analysis there was no statically significant correlation with soil respiration. Therefore, even though organic farmers tend to apply more organic material to their fields, but this did not result in a significantly higher CO2 production in their soils in the present study.

Analyses of Heart Rate, Respiration and Cardiorespiratory Coupling in Patients with Schizophrenia

Directory of Open Access Journals (Sweden)

Steffen Schulz

2015-01-01

Full Text Available Schizophrenia is a severe mental disorder associated with a significantly increased cardiovascular mortality rate. However, the underlying mechanisms leading to this cardiovascular disease (CVD are not fully known. Therefore, the objective of this study was to characterize the cardiorespiratory influence by investigating heart rate, respiration and the causal strength and direction of cardiorespiratory coupling (CRC, based mainly on entropy measures. We investigated 23 non-medicated patients with schizophrenia (SZ, comparing them to 23 age- and gender-matched healthy controls (CO. A significantly reduced complexity was found for the heart rate and a significantly increased complexity in respiration and CRC in SZ patients when compared to corresponding measurements from CO (p < 0.001. CRC analyses revealed a clear coupling, with a driver-responder relationship from respiration to heart rate in SZ patients. Moreover, a slight driver-responder relationship from heart rate to respiration could be recognized. These findings lead to the assumption that SZ should be considered to be a high-risk group for CVD. We hypothesize that the varying cardiorespiratory regulation contributes to the increased risk for cardiac mortality. Therefore, regular monitoring of the cardiorespiratory status of SZ is suggested to identify autonomic regulation impairment at an early stage—to develop timely and effective treatment and intervention strategies.

Stem respiration of Populus species in the third year of free-air CO2 enrichment.

Science.gov (United States)

Gielen, Birgit; Scarascia-Mugnozza, Giuseppe; Ceulemans, Reinhart

2003-04-01

Carbon cycling in ecosystems, and especially in forests, is intensively studied to predict the effects of global climate change, and the role which forests may play in 'changing climate change'. One of the questions is whether the carbon balance of forests will be affected by increasing atmospheric CO2 concentrations. Regarding this question, effects of elevated [CO2] on woody-tissue respiration have frequently been neglected. Stem respiration of three Populus species (P. alba L. (Clone 2AS-11), P. nigra L. (Clone Jean Pourtet), and P. x euramericana (Clone I-214)) was measured in a managed, high-density forest plantation exposed to free-air CO2 enrichment (POPFACE). During the period of measurements, in May of the third year, stem respiration rates were not affected by the FACE treatment. Moreover, FACE did not influence the relationships between respiration rate and both stem temperature and relative growth rate. The results were supported by the reported absence of a FACE-effect on growth and stem wood density.

The mTOR inhibitor sirolimus suppresses renal, hepatic, and cardiac tissue cellular respiration.

Science.gov (United States)

Albawardi, Alia; Almarzooqi, Saeeda; Saraswathiamma, Dhanya; Abdul-Kader, Hidaya Mohammed; Souid, Abdul-Kader; Alfazari, Ali S

2015-01-01

The purpose of this in vitro study was to develop a useful biomarker (e.g., cellular respiration, or mitochondrial O2 consumption) for measuring activities of mTOR inhibitors. It measured the effects of commonly used immunosuppressants (sirolimus-rapamycin, tacrolimus, and cyclosporine) on cellular respiration in target tissues (kidney, liver, and heart) from C57BL/6 mice. The mammalian target of rapamycin (mTOR), a serine/ threonine kinase that supports nutrient-dependent cell growth and survival, is known to control energy conversion processes within the mitochondria. Consistently, inhibitors of mTOR (e.g., rapamycin, also known as sirolimus or Rapamune®) have been shown to impair mitochondrial function. Inhibitors of the calcium-dependent serine/threonine phosphatase calcineurin (e.g., tacrolimus and cyclosporine), on the other hand, strictly prevent lymphokine production leading to a reduced T-cell function. Sirolimus (10 μM) inhibited renal (22%, P=0.002), hepatic (39%, Prespiration. Tacrolimus and cyclosporine had no or minimum effects on cellular respiration in these tissues. Thus, these results clearly demonstrate that impaired cellular respiration (bioenergetics) is a sensitive biomarker of the immunosuppressants that target mTOR.

Diurnal variation in soil respiration under different land uses on Taihang Mountain, North China

Science.gov (United States)

Liu, Xiuping; Zhang, Wanjun; Zhang, Bin; Yang, Qihong; Chang, Jianguo; Hou, Ke

2016-01-01

The aim of this paper is to evaluate the diurnal variation in soil respiration under different land use types on Taihang Mountain, North China, and to understand its response to environmental factors (e.g., soil temperature and moisture) and forest management. Diurnal variations in soil respiration from plantations (Robinia pseudoacacia, Punica granatum, and Ziziphus jujuba), naturally regenerated forests (Vitex negundo var. heterophylla), grasslands (Bothriochloa ischaemum), and farmlands (winter wheat/summer maize) were measured using an LI-8100 automated soil CO2 flux system from May 2012 to April 2013. The results indicated that land use type had a significant effect on the diurnal variation of soil respiration. The diurnal soil respiration from farmlands was highest, followed by Ziziphus jujube, R. pseudoacacia, P. granatum, the lower soil CO2 efflux was found from B. ischaemum and V. negundo var. heterophylla. The diurnal soil respiration across different land use types was significantly affected by soil temperature and moisture, and their interaction. Precipitation-stimulated soil respiration increased more in soil with low water content and less in soil with high water content. The lower diurnal soil respiration from naturally regenerated forests suggests that naturally regenerated vegetation is the optimal vegetation type for reducing global warming.

The Evaluation of Basal Respiration for Various Soil Textures in Ecologically Sensitive Area

Science.gov (United States)

Huličová, P.; Kotorová, D.; Fazekašová, D.; Hynšt, J.

2017-10-01

The present contribution was focused on monitoring changes in the soil basal respiration in different textures of soil in the dry polder Beša. The research was conducted between 2012 and 2014 on soil type Fluvisol locations on three soil textures: clay - loam soil, clayey soil and clay soil in three soil depths. The basal respiration (BR) has been determine by soil CO2 production measuring from incubated soil samples in serum bottles in laboratory condition. Release Co2 has been analysed by gas chromatography. Content of clay particles were in the range 52.18 % to 81.31%, indicating the high difference between the minimum and maximum content. By using of multiple LSD-test we recorded statistically significant impact of clay on basal respiration. Results confirm the values of basal respiration with the depth of the soil profile decreased.

Prediction of the transition energies of atomic No and Lr by the intermediate Hamiltonian coupled cluster method

International Nuclear Information System (INIS)

Borschevsky, A.; Eliav, E.; Kaldor, U.; Vilkas, M.J.; Ishikawa, Y.

2007-01-01

Complete text of publication follows: Measurements of the spectroscopic properties of the superheavy elements present a serious challenge to the experimentalist. Their short lifetimes and the low quantities of their production necessitate reliable prediction of transition energies to avoid the need for broad wavelength scans and to assist in identifying the lines. Thus, reliable high-accuracy calculations are necessary prior and parallel to experimental research. Nobelium and Lawrencium are at present the two most likely candidates for spectroscopic measurements, with the first experiments planned at GSI, Darmstadt. The intermediate Hamiltonian (IH) coupled cluster method is applied to the ionization potentials, electron affinities, and excitation energies of atomic nobelium and lawrencium. Large basis sets are used (37s31p26d21f16g11h6i). All levels of a particular atom are obtained simultaneously by diagonalizing the IH matrix. The matrix elements correspond to all excitations from correlated occupied orbitals to virtual orbitals in a large P space, and are 'dressed' by folding in excitations to higher virtual orbitals (Q space) at the coupled cluster singles-and-doubles level. Lamb-shift corrections are included. The same approach was applied to the lighter homologues of Lr and No, lutetium and ytterbium, for which many transition energies are experimentally known, in order to assess the accuracy of the calculation. The average absolute error of 20 excitation energies of Lu is 423 cm -1 , and the error limits for Lr are therefore put at 700 cm -1 . Predicted Lr excitations with large transition moments in the prime range for the planned experiment, 20,000-30,000 cm -1 , are 7p → 8s at 20,100 cm -1 and 7p →p 7d at 28,100 cm -1 . In case of Yb, the calculated ionization potential was within 20 cm -1 of the experiment, and the average error of the 20 lowest calculated excitations was about 300 cm -1 . Hence, the error limits of nobelium are set to 800 cm -1

Calculations of fission rate distribution in the core of WWER-1000 mock-up on the LR-0 reactor using alternative methods and comparison with results of measurements

International Nuclear Information System (INIS)

Zaritskiy, S.; Kovalishin, A.; Tsvetkov, T.; Rypar, V.; Svadlenkova, M.

2011-01-01

General review of experimental and calculation researches on WWER-440 and WWER-1000 mock-ups on the reactor LR-0 was introduced on the twentieth Symposium AER. The experimental core fission rate distribution was obtained by means of gamma-scanning of the fuel pins - 140La single peak (1596 keV) measurements and wide energy range (approximately 600-900 keV) measurements. Altogether from 260 to 500 fuel pins were scanned in different experiments. The measurements were arranged in the middle of the fuel (the active part of pin). Pin-to-pin calculations of the WWER-1000 mock-up core fission rate distribution were performed with several codes: Monte Carlo codes MCU-REA/2 and MCNPX with different nuclear data libraries, diffusion code RADAR (63 energy groups library) and code SVL based on Surface Harmonics Method (69 energy groups). Calculated data are compared with experimental ones. The obtained results allow developing the benchmark for core calculations methodologies, evaluating and validating source reliability for the out-of-core (inside and outside pressure vessel) neutron transport calculations. (Authors)

Thermal effects on growth and respiration rates of the mayfly, Dolania americana (ephemeroptera)

International Nuclear Information System (INIS)

Harvey, R.S.

1975-01-01

The mayfly Dolania Americana, common in the sand of Upper Three Runs Creek, Savannah River Plant, was studied to determine the effects of seasonal changes in temperature on population growth rates and to determine the effects of slight elevations in water temperature on respiration rates of this benthic species. Growth of the population increased with stream temperature until peak emergence of adults in June and July. There was a strong inverse correlation between body weight and respiration rates of immature nymphs. Respiration rates at 2.5, 5, and 10 0 C above ambient creekwater temperatures were not significantly higher than those measured at ambient creekwater temperatures. (auth)

Identification of rust resistance genes Lr10 and Sr9a in Pakistani ...

African Journals Online (AJOL)

Identification of rust resistance genes Lr10 and Sr9a in Pakistani wheat germplasm using PCR based molecular markers. M Babar, AF Mashhadi, A Mehvish, AN Zahra, R Waheed, A Hasnain, S ur-Rahman, N Hussain, M Ali, I Khaliq, A Aziz ...

Acceptable respiratory protection program and LASL respirator research

International Nuclear Information System (INIS)

Skaggs, B.J.

1979-01-01

A short history is presented on the LASL Respiratory Protection Training Programs. Then a discussion is given on the major points of an acceptable respiratory protection program utilizing the points required by the Occupational, Safety, and Health Administration (OSHA) Regulation 29 CFR 1910.134. Contributions to respirator research are reviewed. Discussion is presented under the following section headings: program administration; respirator selection; respirator use; fitting and training; respirator maintenance; medical clearance and surveillance; special problems; program evaluation; and documentation

[Research progress on photosynthesis regulating and controlling soil respiration].

Science.gov (United States)

Jing, Yan-Li; Guan, De-Xin; Wu, Jia-Bing; Wang, An-Zhi; Yuan, Feng-Hui

2013-01-01

To understand the mechanisms of soil respiration and accurately estimate its magnitude are the crucial basis of evaluating global carbon balance. However, the previously built soil respiration forecast models usually neglect the physiological processes that photosynthesis supplies substrates for rhizospheric respiration, leading to the defect in evaluating the mechanisms of soil respiration. This paper summarized the research progress on the mechanisms of photosynthetic regulation and control of soil respiration, introduced the related main research methods, and discussed the existing problems and research hotspots.

What controls respiration rate in stored sugarbeet roots

Science.gov (United States)

Although respiration is estimated to be responsible for 60 to 80% of the sucrose lost during storage, the mechanisms by which sugarbeet roots regulate their respiration rate are unknown. In plants, respiration rate is regulated by (1) available respiratory capacity, (2) cellular energy status, (3) ...

[Soil respiration characteristics in winter wheat field in North China Plain].

Science.gov (United States)

Chen, Shuyue; Li, Jun; Lu, Peiling; Wang, Yinghong; Yu, Qiang

2004-09-01

Experiments were conducted at the Yucheng Comprehensive Experimental Station of the Chinese Academy of Sciences during 2002-2003 to investigate the respiration of a pulverous sandstone soil under cultivation of winter wheat over a growth season. The effluent CO2 was collected and analyzed by the static-chamber/gas chromatography (GC) method at a frequency of once a week in spring and autumn, once two weeks in winter, twice a week for straw manure treatment, once a week for no straw manure treatment and nitrogen fertilization treatment in summer. The results indicated that diurnal variation of soil respiration rate showed a single peak in typical winter wheat farmlands in the North China Plain, and reached the highest at about 13 o'clock, and the lowest at about 4 o'clock in the early morning. In winter wheat growth season, the soil respiration rate was 31.23-606.85 mg x m(-2) x h(-1) under straw manure, 28.99-549.66 x m(-2) x h(-1) under no straw manure, 10.46-590.86 mg x m(-2) x h(-1) in N0, 16.11-349.88 mg x m(-2) x h(-1) in N100, 12.25-415.00 mg x m(-2) x h(-1) in N200, and 23.01-410.58 mg x m(-2) x h(-1) in N300, showing a similar seasonal variation tendency with soil temperature. Among all treatments, the straw manure had the most distinct soil respiration, though the soil respiration also increased slightly with increasing nitrogen fertilization. Soil respiration increased exponentially with increasing soil temperature, and the correlation of soil temperature at the depth of 5 cm was the best. This relationship was usually described with the Q10 model, which represented the sensitivity of soil respiration to temperature. Q10 was not a fixed value, which varied with the depth at which the temperature was measured and the depth of the active soil layer and soil temperature. At same time, the Q10 value decreased with increasing soil temperature. Soil water content was another important factor affecting soil respiration rate, but in this region, the relationship

Modified CC-LR algorithm with three diverse feature sets for motor imagery tasks classification in EEG based brain-computer interface.

Science.gov (United States)

Siuly; Li, Yan; Paul Wen, Peng

2014-03-01

Motor imagery (MI) tasks classification provides an important basis for designing brain-computer interface (BCI) systems. If the MI tasks are reliably distinguished through identifying typical patterns in electroencephalography (EEG) data, a motor disabled people could communicate with a device by composing sequences of these mental states. In our earlier study, we developed a cross-correlation based logistic regression (CC-LR) algorithm for the classification of MI tasks for BCI applications, but its performance was not satisfactory. This study develops a modified version of the CC-LR algorithm exploring a suitable feature set that can improve the performance. The modified CC-LR algorithm uses the C3 electrode channel (in the international 10-20 system) as a reference channel for the cross-correlation (CC) technique and applies three diverse feature sets separately, as the input to the logistic regression (LR) classifier. The present algorithm investigates which feature set is the best to characterize the distribution of MI tasks based EEG data. This study also provides an insight into how to select a reference channel for the CC technique with EEG signals considering the anatomical structure of the human brain. The proposed algorithm is compared with eight of the most recently reported well-known methods including the BCI III Winner algorithm. The findings of this study indicate that the modified CC-LR algorithm has potential to improve the identification performance of MI tasks in BCI systems. The results demonstrate that the proposed technique provides a classification improvement over the existing methods tested. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Associations among methane emission traits measured in the feedlot and in respiration chambers in Angus cattle bred to vary in feed efficiency.

Science.gov (United States)

Herd, R M; Velazco, J I; Arthur, P F; Hegarty, R F

2016-11-01

The objective of the study was to evaluate associations among animal performance and methane emission traits under feedlot conditions and in respiration chambers in Angus cattle bred to vary in residual feed intake (RFI), which is a measure of feed efficiency. Fifty-nine cattle were tested for feedlot RFI, of which 41 had methane production recorded on an ad libitum grain-based ration in the feedlot, 59 on a restricted grain-based ration in respiration chambers, and 57 on a restricted roughage ration in respiration chambers. The cattle became older and heavier as they went through the different phases of the experiment, but their feed intake (expressed as DMI) and daily emission of enteric methane (methane production rate; MPR) did not increase proportionally, as feed offered was restricted in the respiration chamber tests. Methane emissions by individual animals relative to their DMI were calculated as methane yield (MY; MPR/DMI) and as 2 measures of residual methane production (RMP and RMP), which were calculated as the difference between measured MPR and that predicted from feed intake by 2 different equations. Within each test regime, MPR was positively correlated ( = 0.28 to 0.61) with DMI. Phenotypic correlations for MY, RMP, and RMP between the feedlot test and the restricted grain test ( = 0.40 to 0.43) and between the restricted grain test and the restricted roughage test were moderate ( = 0.36 to 0.41) and moderate to strong between the feedlot test and the restricted roughage test ( = 0.54 to 0.58). These results indicate that the rankings of animals for methane production relative to feed consumed are relatively stable over the 3 test phases. Feedlot feed conversion ratio and RFI were not correlated with MPR in the feedlot test and grain-based chamber test but were negatively correlated with MPR in the chamber roughage test ( = -0.31 and -0.37). Both were negatively correlated with MY and RMP in the feedlot test ( = -0.42 to -0.54) and subsequent

Bundvands respiration i Kattegat og Bælthavet

DEFF Research Database (Denmark)

Hansen, Jørgen L. S.; Bendtsen, Jørgen

Der findes generelt meget få direkte målinger af den pelagiske respiration, og det har ikke været muligt at finde repræsentative målinger af den pelagiske respiration for de åbne danske farvande. Her præsenteres et sæsonstudie af bundvandets respiration fra 5 stationer i et transekt gående fra det....... Temperaturfølsomheden af respirationsraten udtrykt som en Q10 var 3,01 ± 1.07 for alle forsøg og uafhængigt af om prøverne blev kølet eller opvarmet under inkubationerne. Den labile pulje af organisk stof blev bestemt og de observerede respirations rater svarede til specifikke kulstof omsætningsrater på mellem 0...... målbar reduktion i det partikulære materiale under inkubationerne, tyder overraskende på,at opløst organisk materiale (DOM) er den vigtigste kulstofkilde for bundvandet respiration....

Species identities, not functional groups, explain the effects of earthworms on litter carbon-derived soil respiration

Science.gov (United States)

Soil respiration is frequently measured as a surrogate for biological activities and is important in soil carbon cycling. The heterotrophic component of soil respiration is primarily driven by microbial decomposition of leaf litter and soil organic matter, and is partially controlled by resource ava...

42 CFR 84.1134 - Respirator containers; minimum requirements.

Science.gov (United States)

2010-10-01

... 42 Public Health 1 2010-10-01 2010-10-01 false Respirator containers; minimum requirements. 84... Combination Gas Masks § 84.1134 Respirator containers; minimum requirements. (a) Except as provided in paragraph (b) of this section each respirator shall be equipped with a substantial, durable container...

21 CFR 892.1970 - Radiographic ECG/respirator synchronizer.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Radiographic ECG/respirator synchronizer. 892.1970... (CONTINUED) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1970 Radiographic ECG/respirator synchronizer. (a) Identification. A radiographic ECG/respirator synchronizer is a device intended to be used to...

Global convergence in leaf respiration from estimates of thermal acclimation across time and space.

Science.gov (United States)

Vanderwel, Mark C; Slot, Martijn; Lichstein, Jeremy W; Reich, Peter B; Kattge, Jens; Atkin, Owen K; Bloomfield, Keith J; Tjoelker, Mark G; Kitajima, Kaoru

2015-09-01

Recent compilations of experimental and observational data have documented global temperature-dependent patterns of variation in leaf dark respiration (R), but it remains unclear whether local adjustments in respiration over time (through thermal acclimation) are consistent with the patterns in R found across geographical temperature gradients. We integrated results from two global empirical syntheses into a simple temperature-dependent respiration framework to compare the measured effects of respiration acclimation-over-time and variation-across-space to one another, and to a null model in which acclimation is ignored. Using these models, we projected the influence of thermal acclimation on: seasonal variation in R; spatial variation in mean annual R across a global temperature gradient; and future increases in R under climate change. The measured strength of acclimation-over-time produces differences in annual R across spatial temperature gradients that agree well with global variation-across-space. Our models further project that acclimation effects could potentially halve increases in R (compared with the null model) as the climate warms over the 21st Century. Convergence in global temperature-dependent patterns of R indicates that physiological adjustments arising from thermal acclimation are capable of explaining observed variation in leaf respiration at ambient growth temperatures across the globe. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

Pulmo uterinus: a history of ideas on fetal respiration.

Science.gov (United States)

Obladen, Michael

2017-05-24

Theories about fetal respiration began in antiquity. Aristotle characterized pneuma as warm air, but also as the enabler of vital functions and instrument of the soul. In Galen's system of physiology, the vital spirit was carried by the umbilical arteries, the nutrients by the umbilical vein from the placenta to the fetus. In 1569 Aranzio postulated that the maternal and fetal vasculatures are distinct. From 1670 to 1690, a century before the discovery of oxygen, researchers understood that during respiration some form of exchange with the air must occur, naming the substance biolychnium, phlogiston, sal-nitro, or nitro-aerial particles. An analogy of placental and pulmonary gas exchange was described in 1674 by Mayow. In 1779, Lavoisier understood the discovery of oxygen, discarded the phlogiston theory, and based respiration physiology on gas exchange. With the invention of the spectroscope, it became possible to measure hemoglobin oxygenation, and in 1876 Zweifel proved fetal oxygen uptake. Major progress in understanding fetal gas exchange was achieved in the 20th century by the physiologists Barcroft in Cambridge and Dawes in Oxford.

Microcystis aeruginos strain [D-Leu1] Mcyst-LR producer, from Buenos Aires province, Argentina

Directory of Open Access Journals (Sweden)

Lorena Rosso

2014-04-01

Full Text Available Objective: To show the toxicological and phylogenetic characterization of a native Microcystis aeruginosa (M. aeruginosa strain (named CAAT 2005-3 isolated from a water body of Buenos Aires province, Argentine. Methods: A M. aeruginosa strain was isolated from the drainage canal of the sewage treatment in the town of Pila, Buenos Aires province, Argentina and acclimated to laboratory conditions. The amplification of cpcBA-IGS Phcocyanin (PC, intergenic spacer and flanking regions was carried out in order to build a phylogenetic tree. An exactive/orbitrap mass spectrometer equipped with an electrospray ionization source (Thermo Fisher Scientific, Bremen, Germany was used for the LC/ESI-HRMS microcystins analysis. The number of cell/mL and [D-Leu1] Mcyst-LR production obtained as a function of time was modelled using the Gompertz equation. Results: The phylogenetic analysis showed that the sequence clustered with others M. aeruginosa sequences obtained from NCBI. The first Argentinian strain of M. aeruginosa (CAAT 2005-3 growing under culture conditions maintains the typical colonial architecture of M. aeruginosa with profuse mucilage. M. aeruginosa CAAT 2005-3 expresses a toxin variant, that was identified by LC-HRMS/Orbitrapas as [D-Leu1] microcystin-LR ([M+H]+=1 037.8 m/z. Conclusions: [D-Leu1] microcystin-LR has been also detected in M. aeruginosa samples from Canada, Brazil and Argentina. This work provides the basis for technological development and production of analytical standards of toxins present in our region.

Neutron flux characterization using Lr-115 NTD and binary glass metal as converter

International Nuclear Information System (INIS)

Alvarado, R.; Palacios, D.; Sajo B, L.; Greaves, E.; Barros, H.; Nemeth, P.; Goncalves, I. F.

2010-01-01

The installed neutron irradiation cell at the Simon Bolivar University Laboratory is employed frequently for applications where the neutron field should be monitored. The ratio of epithermal and thermal neutron flux were determined by the cadmium difference method in three different irradiation locations of a graphite thermalized 252 Cf source. Monte Carlo simulation provided the expected thermal neutron field inside the irradiation cell and the nuclear trace detectors sensitivity. The passive device is a Kodak-Pathe Lr-115 externally coated with a thin (0,1 mm) binary glass metal strip Fe 75 B 25 where the 10 B(n,α) 7 Li reaction converts free neutrons into alpha particles that are registered as etched tracks. The results allow to determine the neutron flux in an easy, reproducible and effective way, with the advantage of a low self-absorption effect due to the converter material. Improved etching process of the Lr-115 nuclear track detectors and the software parameters for track analysis are included. (Author)

Continuous daylight in the high-Arctic summer supports high plankton respiration rates compared to those supported in the dark

KAUST Repository

Mesa, Elena

2017-04-21

Plankton respiration rate is a major component of global CO2 production and is forecasted to increase rapidly in the Arctic with warming. Yet, existing assessments in the Arctic evaluated plankton respiration in the dark. Evidence that plankton respiration may be stimulated in the light is particularly relevant for the high Arctic where plankton communities experience continuous daylight in spring and summer. Here we demonstrate that plankton community respiration evaluated under the continuous daylight conditions present in situ, tends to be higher than that evaluated in the dark. The ratio between community respiration measured in the light (Rlight) and in the dark (Rdark) increased as the 2/3 power of Rlight so that the Rlight:Rdark ratio increased from an average value of 1.37 at the median Rlight measured here (3.62 µmol O2 L-1 d-1) to an average value of 17.56 at the highest Rlight measured here (15.8 µmol O2 L-1 d-1). The role of respiratory processes as a source of CO2 in the Arctic has, therefore, been underestimated and is far more important than previously believed, particularly in the late spring, with 24 h photoperiods, when community respiration rates are highest.

Bond scission cross sections for alpha-particles in cellulose nitrate (LR115)

CERN Document Server

Barillon, R; Chambaudet, A; Katz, R; Stoquert, J P; Pape, A

1999-01-01

Chemical damage created by alpha-particles in cellulose nitrate (LR115) have been studied by infrared spectroscopy. This technique enables identifying the sensitive bonds and giving an order of magnitude of their scission cross sections for given alpha-particle energies. The high cross sections observed suggest a new description of the track etch velocity in this material.

Bioleaching of Primary Nickel Ore Using Acidithiobacillus ferrooxidans LR Cells Immobilized in Glass Beads

Directory of Open Access Journals (Sweden)

Ellen Cristine Giese

2015-06-01

Full Text Available Sulphide minerals are one of the most important sources of value metals. For several years, a large number of hydrometallurgical and biotechnological processes have been developed to leach low-grade sulphide ores and the conditions are well established. However, the management of microorganisms in the bioleaching process is not easy to handle. In this paper, the use of immobilized cells of Acidithiobacillus ferrooxidans LR in glass beads in bioleaching of primary nickel ore was evaluated. The column experiments inoculated with immobilized cells of A. ferrooxidans LR showed the same efficiency than the conventional method using free cells and is promising for application on a larger scale as it ensuring integrity and activity of biomining microorganisms and reduce process costs. DOI: http://dx.doi.org/10.17807/orbital.v7i2.698 

Evolution of the LR56 radioactive liquid waste transportation system for use at Hanford, Oak Ridge, and Savannah River Sites

International Nuclear Information System (INIS)

Clement, G.; Delvecchio, D.J.; Sazawal, V.

1997-01-01

The LR56 system is a radioactive liquid transportation cask licensed for use in France for on-site road transfer of Type B bulk quantities of radioactive liquids. Three LR56 systems (with adaptations for use at the Department of Energy (DOE) sites in the US) have been recently purchased for use at the Hanford site, the Oak Ridge National laboratory site and the Savannah River Site. The paper discussed the main features of the LR56 system and presents the evolution of the design. Particular attention is given to the last version developed for the Savannah River Site to be used for the transfer of highly concentrated alpha bearing liquids. For this application a special enhancement of the secondary vessel has been implemented which provides the system with a double leak tight confinement

The moisture response of soil heterotrophic respiration: interaction with soil properties

DEFF Research Database (Denmark)

Moyano, F E; Vasilyeva, N; Bouckaert, L

2012-01-01

the heterotrophic respiration response to moisture have limited empirical support and introduce an uncertainty of at least 4% in global soil carbon stock predictions by 2100. The necessity of improving the representation of this relationship in models has been highlighted in recent studies. Here we present a data......Soil moisture is of primary importance for predicting the evolution of soil carbon stocks and fluxes, both because it strongly controls organic matter decomposition and because it is predicted to change at global scales in the following decades. However, the soil functions used to model......-driven analysis of soil moisture-respiration relations based on 90 soils. With the use of linear models we show how the relationship between soil heterotrophic respiration and different measures of soil moisture is consistently affected by soil properties. The empirical models derived include main effects...

Quantifying soil respiration at landscape scales. Chapter 11

Science.gov (United States)

John B. Bradford; Michael G. Ryan

2008-01-01

Soil CO2, efflux, or soil respiration, represents a substantial component of carbon cycling in terrestrial ecosystems. Consequently, quantifying soil respiration over large areas and long time periods is an increasingly important goal. However, soil respiration rates vary dramatically in space and time in response to both environmental conditions...

Dose Response of Endotoxin on Hepatocyte and Muscle Mitochondrial Respiration In Vitro

Science.gov (United States)

Brandt, Sebastian; Porta, Francesca; Jakob, Stephan M.; Takala, Jukka; Djafarzadeh, Siamak

2015-01-01

Introduction. Results on mitochondrial dysfunction in sepsis are controversial. We aimed to assess effects of LPS at wide dose and time ranges on hepatocytes and isolated skeletal muscle mitochondria. Methods. Human hepatocellular carcinoma cells (HepG2) were exposed to placebo or LPS (0.1, 1, and 10 μg/mL) for 4, 8, 16, and 24 hours and primary human hepatocytes to 1 μg/mL LPS or placebo (4, 8, and 16 hours). Mitochondria from porcine skeletal muscle samples were exposed to increasing doses of LPS (0.1–100 μg/mg) for 2 and 4 hours. Respiration rates of intact and permeabilized cells and isolated mitochondria were measured by high-resolution respirometry. Results. In HepG2 cells, LPS reduced mitochondrial membrane potential and cellular ATP content but did not modify basal respiration. Stimulated complex II respiration was reduced time-dependently using 1 μg/mL LPS. In primary human hepatocytes, stimulated mitochondrial complex II respiration was reduced time-dependently using 1 μg/mL LPS. In isolated porcine skeletal muscle mitochondria, stimulated respiration decreased at high doses (50 and 100 μg/mL LPS). Conclusion. LPS reduced cellular ATP content of HepG2 cells, most likely as a result of the induced decrease in membrane potential. LPS decreased cellular and isolated mitochondrial respiration in a time-dependent, dose-dependent and complex-dependent manner. PMID:25649304

Separating the effect of respiration from the heart rate variability for cases of constant harmonic breathing

Directory of Open Access Journals (Sweden)

Kircher Michael

2015-09-01

Full Text Available Heart Rate Variability studies are a known measure for the autonomous control of the heart rate. In special situations, its interpretation can be ambiguous, since the respiration has a major influence on the heart rate variability. For this reason it has often been proposed to measure Heart Rate Variability, while the subjects are breathing at a constant respiration rate. That way the spectral influence of the respiration is known. In this work we propose to remove this constant respiratory influence from the heart rate and the Heart Rate Variability parameters to gain respiration free autonomous controlled heart rate signal. The spectral respiratory component in the heart rate signal is detected and characterized. Subsequently the respiratory effect on Heart Rate Variability is removed using spectral filtering approaches, such as the Notch filter or the Raised Cosine filter. As a result new decoupled Heart Variability parameters are gained, which could lead to new additional interpretations of the autonomous control of the heart rate.

The review of the reactor physics experiments carried out on the LR-0 research reactor NRI Rez plc for reactors of the VVER type

International Nuclear Information System (INIS)

Hudec, Frantisek; Jansky, Bohumil; Juricek, Vlastimil; Mikus, Jan; Novak, Evzen; Osmera, Bohumil; Posta, Severin; Rypar, Vojtech; Svadlenkova, Marie

2010-01-01

LR-0 is an experimental zero power reactor mainly used for the determination of the neutron-physical characteristics of WWER and PWR type reactor lattices and shielding with UO2 or MOX fuel. Its major assets include capability to design and operate multizone cores, i.e. substituted cores, with an inner inserted part in hexagonal or square geometry (driven by LR-0 standard assemblies); Standard and special supporting plates for mock-up experiments; special supporting plates, which enables the triangular symmetrical assembly arrangement with an arbitrary pitch; Modeling neutron field parameters of power reactors; Wide range benchmarking possibilities, with high reproducibility of the benchmark design parameters; Wide range of measurement techniques including equipment and experienced personal; Flexible rearrangements of the core. The main experiments included: Pin wise flux distribution measurements; VVER-440 and VVER-1000 mock-ups; compact spent fuel storage; space kinetics experiment; core parameters experimental determination; experiment with new design fuel assembly; WWER-440 control assembly influence; and burnable absorber study. International research projects are also described. (P.A.)

Pattern recognition of obstructive sleep apnoea and Cheyne–Stokes respiration

International Nuclear Information System (INIS)

Weinreich, Gerhard; Teschler, Helmut; Armitstead, Jeff

2008-01-01

The aim of this study was to assess the validity of an artificial neural network based on flow-related spectral entropy as a diagnostic test for obstructive sleep apnoea and Cheyne–Stokes respiration. A data set of 37 subjects was used for spectral analysis of the airflow by performing a fast Fourier transform. The examined intervals were divided into epochs of 3 min. Spectral entropy S was applied as a measure for the spread of the related power spectrum. The spectrum was divided into several frequency areas with various subsets of spectral entropy. We studied 11 subjects with obstructive apnoeas (n = 267 epochs), 10 subjects with obstructive hypopnoeas (n = 80 epochs), 11 subjects with Cheyne–Stokes respiration (n = 253 epochs) and 5 subjects with normal breathing in non-REM sleep (n = 174 epochs). Based on spectral entropy an artificial neural network was built, and we obtained a sensitivity of 90.2% and a specificity of 90.9% for distinguishing between obstructive apnoeas and Cheyne–Stokes respiration, and a sensitivity of 91.3% and a specificity of 94.6% for discriminating between obstructive hypopnoeas and normal breathing in non-REM sleep. This resulted in an accuracy of 91.5% for identifying flow patterns of obstructive sleep apnoea, Cheyne–Stokes respiration and normal breathing in non-REM sleep. It is concluded that the use of an artificial neural network relying on spectral analysis of the airflow could be a useful method as a diagnostic test for obstructive sleep apnoea and Cheyne–Stokes respiration

Effect of nitrogen on the seasonal course of growth and maintenance respiration in stems of Norway spruce trees.

Science.gov (United States)

Stockfors, Jan; Linder, Sune

1998-03-01

To determine effects of stem nitrogen concentration ([N]) on the seasonal course of respiration, rates of stem respiration of ten control and ten irrigated-fertilized (IL), 30-year-old Norway spruce trees (Picea abies (L.) Karst.), growing in northern Sweden, were measured on seven occasions from June 1993 to April 1994. To explore sources of seasonal variation and mechanisms of fertilization effects on respiration, we separated total respiration into growth and maintenance respiration for both xylem and phloem bark. Stem respiration increased in response to the IL treatment and was positively correlated with growth rate, volume of living cells and stem nitrogen content. However, no significant effect of IL treatment or [N] in the living cells was found for respiration per unit volume of live cells. Total stem respiration during the growing season (June to September) was estimated to be 16.7 and 29.7 mol CO(2) m(-2) for control and IL-treated trees, respectively. Respiration during the growing season accounted for approximately 64% of total annual respiration. Depending on the method, estimated growth respiration varied between 40 and 60% of total respiration during the growing season. Between 75 and 80% of the live cell volume in the stems was in the phloem, and phloem maintenance accounted for about 70% of maintenance respiration. Because most of the living cells were found in the phloem, and the living xylem cells were concentrated in the outer growth rings, we concluded that the best base for expressing rates of stem growth and maintenance respiration in young Norway spruce trees is stem surface area.

Pore-scale investigation on the response of heterotrophic respiration to moisture conditions in heterogeneous soils

Energy Technology Data Exchange (ETDEWEB)

Yan, Zhifeng; Liu, Chongxuan; Todd-Brown, Katherine E.; Liu, Yuanyuan; Bond-Lamberty, Ben; Bailey, Vanessa L.

2016-11-15

The relationship between microbial respiration rate and soil moisture content is an important property for understanding and predicting soil organic carbon degradation, CO₂ production and emission, and their subsequent effects on climate change. This paper reports a pore-scale modeling study to investigate the response of heterotrophic respiration to moisture conditions in soils and to evaluate various factors that affect this response. X-ray computed tomography was used to derive soil pore structures, which were then used for pore-scale model investigation. The pore-scale results were then averaged to calculate the effective respiration rates as a function of water content in soils. The calculated effective respiration rate first increases and then decreases with increasing soil water content, showing a maximum respiration rate at water saturation degree of 0.75 that is consistent with field and laboratory observations. The relationship between the respiration rate and moisture content is affected by various factors, including pore-scale organic carbon bioavailability, the rate of oxygen delivery, soil pore structure and physical heterogeneity, soil clay content, and microbial drought resistivity. Simulations also illustrates that a larger fraction of CO₂ produced from microbial respiration can be accumulated inside soil cores under higher saturation conditions, implying that CO₂ flux measured on the top of soil cores may underestimate or overestimate true soil respiration rates under dynamic moisture conditions. Overall, this study provides mechanistic insights into the soil respiration response to the change in moisture conditions, and reveals a complex relationship between heterotrophic microbial respiration rate and moisture content in soils that is affected by various hydrological, geochemical, and biophysical factors.

Seasonal and episodic moisture controls on plant and microbial contributions to soil respiration.

Science.gov (United States)

Carbone, Mariah S; Still, Christopher J; Ambrose, Anthony R; Dawson, Todd E; Williams, A Park; Boot, Claudia M; Schaeffer, Sean M; Schimel, Joshua P

2011-09-01

Moisture inputs drive soil respiration (SR) dynamics in semi-arid and arid ecosystems. However, determining the contributions of root and microbial respiration to SR, and their separate temporal responses to periodic drought and water pulses, remains poorly understood. This study was conducted in a pine forest ecosystem with a Mediterranean-type climate that receives seasonally varying precipitation inputs from both rainfall (in the winter) and fog-drip (primarily in the summer). We used automated SR measurements, radiocarbon SR source partitioning, and a water addition experiment to understand how SR, and its separate root and microbial sources, respond to seasonal and episodic changes in moisture. Seasonal changes in SR were driven by surface soil water content and large changes in root respiration contributions. Superimposed on these seasonal patterns were episodic pulses of precipitation that determined the short-term SR patterns. Warm season precipitation pulses derived from fog-drip, and rainfall following extended dry periods, stimulated the largest SR responses. Microbial respiration dominated these SR responses, increasing within hours, whereas root respiration responded more slowly over days. We conclude that root and microbial respiration sources respond differently in timing and magnitude to both seasonal and episodic moisture inputs. These findings have important implications for the mechanistic representation of SR in models and the response of dry ecosystems to changes in precipitation patterns.

Characterization of small-to-medium head-and-face dimensions for developing respirator fit test panels and evaluating fit of filtering facepiece respirators with different faceseal design

Science.gov (United States)

Lin, Yi-Chun

2017-01-01

A respirator fit test panel (RFTP) with facial size distribution representative of intended users is essential to the evaluation of respirator fit for new models of respirators. In this study an anthropometric survey was conducted among youths representing respirator users in mid-Taiwan to characterize head-and-face dimensions key to RFTPs for application to small-to-medium facial features. The participants were fit-tested for three N95 masks of different facepiece design and the results compared to facial size distribution specified in the RFTPs of bivariate and principal component analysis design developed in this study to realize the influence of facial characteristics to respirator fit in relation to facepiece design. Nineteen dimensions were measured for 206 participants. In fit testing the qualitative fit test (QLFT) procedures prescribed by the U.S. Occupational Safety and Health Administration were adopted. As the results show, the bizygomatic breadth of the male and female participants were 90.1 and 90.8% of their counterparts reported for the U.S. youths (P < 0.001), respectively. Compared to the bivariate distribution, the PCA design better accommodated variation in facial contours among different respirator user groups or populations, with the RFTPs reported in this study and from literature consistently covering over 92% of the participants. Overall, the facial fit of filtering facepieces increased with increasing facial dimensions. The total percentages of the tests wherein the final maneuver being completed was “Moving head up-and-down”, “Talking” or “Bending over” in bivariate and PCA RFTPs were 13.3–61.9% and 22.9–52.8%, respectively. The respirators with a three-panel flat fold structured in the facepiece provided greater fit, particularly when the users moved heads. When the facial size distribution in a bivariate RFTP did not sufficiently represent petite facial size, the fit testing was inclined to overestimate the general fit

Soil respiration in northern forests exposed to elevated atmospheric carbon dioxide and ozone.

Science.gov (United States)

Pregitzer, Kurt; Loya, Wendy; Kubiske, Mark; Zak, Donald

2006-06-01

The aspen free-air CO2 and O3 enrichment (FACTS II-FACE) study in Rhinelander, Wisconsin, USA, is designed to understand the mechanisms by which young northern deciduous forest ecosystems respond to elevated atmospheric carbon dioxide (CO2) and elevated tropospheric ozone (O3) in a replicated, factorial, field experiment. Soil respiration is the second largest flux of carbon (C) in these ecosystems, and the objective of this study was to understand how soil respiration responded to the experimental treatments as these fast-growing stands of pure aspen and birch + aspen approached maximum leaf area. Rates of soil respiration were typically lowest in the elevated O3 treatment. Elevated CO2 significantly stimulated soil respiration (8-26%) compared to the control treatment in both community types over all three growing seasons. In years 6-7 of the experiment, the greatest rates of soil respiration occurred in the interaction treatment (CO2 + O3), and rates of soil respiration were 15-25% greater in this treatment than in the elevated CO2 treatment, depending on year and community type. Two of the treatments, elevated CO2 and elevated CO2 + O3, were fumigated with 13C-depleted CO2, and in these two treatments we used standard isotope mixing models to understand the proportions of new and old C in soil respiration. During the peak of the growing season, C fixed since the initiation of the experiment in 1998 (new C) accounted for 60-80% of total soil respiration. The isotope measurements independently confirmed that more new C was respired from the interaction treatment compared to the elevated CO2 treatment. A period of low soil moisture late in the 2003 growing season resulted in soil respiration with an isotopic signature 4-6 per thousand enriched in 13C compared to sample dates when the percentage soil moisture was higher. In 2004, an extended period of low soil moisture during August and early September, punctuated by a significant rainfall event, resulted in soil

Effects of environmental factors and soil properties on topographic variations of soil respiration

Directory of Open Access Journals (Sweden)

K. Tamai

2010-03-01

Full Text Available Soil respiration rates were measured along different parts of a slope in (a an evergreen forest with common brown forest soil and (b a deciduous forest with immature soil. The effects of soil temperature, soil moisture and soil properties were estimated individually, and the magnitudes of these effects in the deciduous and evergreen forests were compared. In the evergreen forest with common brown forest soil, soil properties had the greatest effect on soil respiration rates, followed by soil moisture and soil temperature. These results may be explained by the fact that different soil properties matured within different environments. It can be argued that the low soil respiration rates in the low parts of the slope in the evergreen forest resulted from soil properties and not from wet soil conditions. In the deciduous forest, soil respiration rates were more strongly affected by soil moisture and soil temperature than by soil properties. These effects were likely due to the immaturity of the forest soil.

Accumulation of free and covalently bound microcystins in tissues of Lymnaea stagnalis (Gastropoda) following toxic cyanobacteria or dissolved microcystin-LR exposure

International Nuclear Information System (INIS)

Lance, Emilie; Neffling, Milla-Riina; Gerard, Claudia; Meriluoto, Jussi; Bormans, Myriam

2010-01-01

Accumulation of free microcystins (MCs) in freshwater gastropods has been demonstrated but accumulation of MCs covalently bound to tissues has never been considered so far. Here, we follow the accumulation of total (free and bound) MCs in Lymnaea stagnalis exposed to i) dissolved MC-LR (33 and 100 μg L -1 ) and ii) Planktothrix agardhii suspensions producing 5 and 33 μg MC-LR equivalents L -1 over a 5-week period, and after a 3-week depuration period. Snails exposed to dissolved MC-LR accumulated up to 0.26 μg total MCs g -1 dry weight (DW), with no detection of bound MCs. Snails exposed to MCs producing P. agardhii accumulated up to 69.9 μg total MCs g -1 DW, of which from 17.7 to 66.7% were bound. After depuration, up to 15.3 μg g -1 DW of bound MCs were detected in snails previously exposed to toxic cyanobacteria, representing a potential source of MCs transfer through the food web. - The study concerns accumulation and elimination of both free and bound microcystins (MCs) in tissues of a gastropod exposed to MCs producing cyanobacteria or dissolved MC-LR.

Accumulation of free and covalently bound microcystins in tissues of Lymnaea stagnalis (Gastropoda) following toxic cyanobacteria or dissolved microcystin-LR exposure

Energy Technology Data Exchange (ETDEWEB)

Lance, Emilie, E-mail: emilie.lance@live.f [UMR CNRS Ecobio 6553, University of Rennes 1, Campus de Beaulieu, 265 Avenue du General Leclerc, 35042 Rennes Cedex (France); Neffling, Milla-Riina [Department of Biochemistry and Pharmacy, Abo Akademi University, Tykistoekatu 6, FI-20520 Turku (Finland); Gerard, Claudia [UMR CNRS Ecobio 6553, University of Rennes 1, Campus de Beaulieu, 265 Avenue du General Leclerc, 35042 Rennes Cedex (France); Meriluoto, Jussi [Department of Biochemistry and Pharmacy, Abo Akademi University, Tykistoekatu 6, FI-20520 Turku (Finland); Bormans, Myriam [UMR CNRS Ecobio 6553, University of Rennes 1, Campus de Beaulieu, 265 Avenue du General Leclerc, 35042 Rennes Cedex (France)

2010-03-15

Accumulation of free microcystins (MCs) in freshwater gastropods has been demonstrated but accumulation of MCs covalently bound to tissues has never been considered so far. Here, we follow the accumulation of total (free and bound) MCs in Lymnaea stagnalis exposed to i) dissolved MC-LR (33 and 100 mug L{sup -1}) and ii) Planktothrix agardhii suspensions producing 5 and 33 mug MC-LR equivalents L{sup -1} over a 5-week period, and after a 3-week depuration period. Snails exposed to dissolved MC-LR accumulated up to 0.26 mug total MCs g{sup -1} dry weight (DW), with no detection of bound MCs. Snails exposed to MCs producing P. agardhii accumulated up to 69.9 mug total MCs g{sup -1} DW, of which from 17.7 to 66.7% were bound. After depuration, up to 15.3 mug g{sup -1} DW of bound MCs were detected in snails previously exposed to toxic cyanobacteria, representing a potential source of MCs transfer through the food web. - The study concerns accumulation and elimination of both free and bound microcystins (MCs) in tissues of a gastropod exposed to MCs producing cyanobacteria or dissolved MC-LR.

Landscape Influences on Potential Soil Respiration Rates in a Forested Watershed of Southeastern Kentucky

Science.gov (United States)

Amanda C. Abnee; James A. Thompson; Randall K. Kolka; Elisa M. D' Angelo; Mark S. Coyne

2004-01-01

Soil respiration measurements conducted in the laboratory have been shown to be related to temperature and moisture, with maximum rates at soil temperatures between 25 and 40°C and soil moisture between -0.01 and -0.10 MPa. A preliminary study using forest soils from eastern Kentucky supported the previous research with soil respiration rates greater at 25°C than at 15...

Plant growth and respiration re-visited: maintenance respiration defined – it is an emergent property of, not a separate process within, the system – and why the respiration : photosynthesis ratio is conservative

Science.gov (United States)

Thornley, John H. M.

2011-01-01

Background and Aims Plant growth and respiration still has unresolved issues, examined here using a model. The aims of this work are to compare the model's predictions with McCree's observation-based respiration equation which led to the ‘growth respiration/maintenance respiration paradigm’ (GMRP) – this is required to give the model credibility; to clarify the nature of maintenance respiration (MR) using a model which does not represent MR explicitly; and to examine algebraic and numerical predictions for the respiration:photosynthesis ratio. Methods A two-state variable growth model is constructed, with structure and substrate, applicable on plant to ecosystem scales. Four processes are represented: photosynthesis, growth with growth respiration (GR), senescence giving a flux towards litter, and a recycling of some of this flux. There are four significant parameters: growth efficiency, rate constants for substrate utilization and structure senescence, and fraction of structure returned to the substrate pool. Key Results The model can simulate McCree's data on respiration, providing an alternative interpretation to the GMRP. The model's parameters are related to parameters used in this paradigm. MR is defined and calculated in terms of the model's parameters in two ways: first during exponential growth at zero growth rate; and secondly at equilibrium. The approaches concur. The equilibrium respiration:photosynthesis ratio has the value of 0·4, depending only on growth efficiency and recycling fraction. Conclusions McCree's equation is an approximation that the model can describe; it is mistaken to interpret his second coefficient as a maintenance requirement. An MR rate is defined and extracted algebraically from the model. MR as a specific process is not required and may be replaced with an approach from which an MR rate emerges. The model suggests that the respiration:photosynthesis ratio is conservative because it depends on two parameters only whose

Plant species richness regulates soil respiration through changes in productivity.

Science.gov (United States)

Dias, André Tavares Corrêa; van Ruijven, Jasper; Berendse, Frank

2010-07-01

Soil respiration is an important pathway of the C cycle. However, it is still poorly understood how changes in plant community diversity can affect this ecosystem process. Here we used a long-term experiment consisting of a gradient of grassland plant species richness to test for effects of diversity on soil respiration. We hypothesized that plant diversity could affect soil respiration in two ways. On the one hand, more diverse plant communities have been shown to promote plant productivity, which could increase soil respiration. On the other hand, the nutrient concentration in the biomass produced has been shown to decrease with diversity, which could counteract the production-induced increase in soil respiration. Our results clearly show that soil respiration increased with species richness. Detailed analysis revealed that this effect was not due to differences in species composition. In general, soil respiration in mixtures was higher than would be expected from the monocultures. Path analysis revealed that species richness predominantly regulates soil respiration through changes in productivity. No evidence supporting the hypothesized negative effect of lower N concentration on soil respiration was found. We conclude that shifts in productivity are the main mechanism by which changes in plant diversity may affect soil respiration.

Soil respiration in typical plant communities in the wetland surrounding the high-salinity Ebinur Lake

Science.gov (United States)

Li, Yanhong; Zhao, Mingliang; Li, Fadong

2018-03-01

Soil respiration in wetlands surrounding lakes is a vital component of the soil carbon cycle in arid regions. However, information remains limited on the soil respiration around highly saline lakes during the plant growing season. Here, we aimed to evaluate diurnal and seasonal variation in soil respiration to elucidate the controlling factors in the wetland of Ebinur Lake, Xinjiang Uygur Autonomous Region, western China. We used a soil carbon flux automatic analyzer (LI-840A) to measure soil respiration rates during the growing season (April to November) in two fields covered by reeds and tamarisk and one field with no vegetation (bare soil) from 2015 to 2016. The results showed a single peak in the diurnal pattern of soil respiration from 11:00 to 17:00 for plots covered in reeds, tamarisk, and bare soil, with minimum values being detected from 03:00 to 07:00. During the growing season, the soil respiration of reeds and tamarisk peaked during the thriving period (4.16 and 3.75 mmol•m-2•s-1, respectively), while that of bare soil peaked during the intermediate growth period (0.74 mmol•m-2•s-1). The soil respiration in all three plots was lowest during the wintering period (0.08, 0.09, and-0.87 mmol•m-2•s-1, respectively). Air temperature and relative humidity significantly influenced soil respiration. A significant linear relationship was detected between soil respiration and soil temperature for reeds, tamarisk, and bare soil. The average Q10 of reeds and tamarisk were larger than that of bare soil. However, soil moisture content was not the main factor controlling soil respiration. Soil respiration was negatively correlated with soil pH and soil salinity in all three plot types. In contrast, soil respiration was positively correlated with organic carbon. Overall, CO2 emissions and greenhouse gases had a relatively weak effect on the wetlands surrounding the highly saline Ebinur Lake.

IMAGING OF BRAIN FUNCTION BASED ON THE ANALYSIS OF FUNCTIONAL CONNECTIVITY - IMAGING ANALYSIS OF BRAIN FUNCTION BY FMRI AFTER ACUPUNCTURE AT LR3 IN HEALTHY INDIVIDUALS.

Science.gov (United States)

Zheng, Yu; Wang, Yuying; Lan, Yujun; Qu, Xiaodong; Lin, Kelin; Zhang, Jiping; Qu, Shanshan; Wang, Yanjie; Tang, Chunzhi; Huang, Yong

2016-01-01

This Study observed the relevant brain areas activated by acupuncture at the Taichong acupoint (LR3) and analyzed the functional connectivity among brain areas using resting state functional magnetic resonance imaging (fMRI) to explore the acupoint specificity of the Taichong acupoint. A total of 45 healthy subjects were randomly divided into the Taichong (LR3) group, sham acupuncture group and sham acupoint group. Subjects received resting state fMRI before acupuncture, after true (sham) acupuncture in each group. Analysis of changes in connectivity among the brain areas was performed using the brain functional connectivity method. The right cerebrum temporal lobe was selected as the seed point to analyze the functional connectivity. It had a functional connectivity with right cerebrum superior frontal gyrus, limbic lobe cingulate gyrus and left cerebrum inferior temporal gyrus (BA 37), inferior parietal lobule compared by before vs. after acupuncture at LR3, and right cerebrum sub-lobar insula and left cerebrum middle frontal gyrus, medial frontal gyrus compared by true vs. sham acupuncture at LR3, and right cerebrum occipital lobe cuneus, occipital lobe sub-gyral, parietal lobe precuneus and left cerebellum anterior lobe culmen by acupuncture at LR3 vs. sham acupoint. Acupuncture at LR3 mainly specifically activated the brain functional network that participates in visual function, associative function, and emotion cognition, which are similar to the features on LR3 in tradition Chinese medicine. These brain areas constituted a neural network structure with specific functions that had specific reference values for the interpretation of the acupoint specificity of the Taichong acupoint.

Unexpected results in Chernozem soil respiration while measuring the effect of a bio-fertilizer on soil microbial activity.

Science.gov (United States)

Bautista, Gabriela; Mátyás, Bence; Carpio, Isabel; Vilches, Richard; Pazmino, Karina

2017-01-01

The number of studies investigating the effect of bio-fertilizers is increasing because of their importance in sustainable agriculture and environmental quality. In our experiments, we measured the effect of different fertilizers on soil respiration. In the present study, we were looking for the cause of unexpected changes in CO2 values while examining Chernozem soil samples. We concluded that CO2 oxidizing microbes or methanotrophs may be present in the soil that periodically consume CO2 . This is unusual for a sample taken from the upper layer of well-ventilated Chernozem soil with optimal moisture content.

Lymphocyte respiration in children with Trisomy 21

Directory of Open Access Journals (Sweden)

Aburawi Elhadi H

2012-12-01

Full Text Available Abstract Background This study measured lymphocyte mitochondrial O2 consumption (cellular respiration in children with trisomy 21. Methods Peripheral blood mononuclear cells were isolated from whole blood of trisomy 21 and control children and these cells were immediately used to measure cellular respiration rate. [O2] was determined as a function of time from the phosphorescence decay rates (1/τ of Pd (II-meso-tetra-(4-sulfonatophenyl-tetrabenzoporphyrin. In sealed vials containing lymphocytes and glucose as a respiratory substrate, [O2] declined linearly with time, confirming the zero-order kinetics of O2 conversion to H2O by cytochrome oxidase. The rate of respiration (k, in μM O2 min-1, thus, was the negative of the slope of [O2] vs. time. Cyanide inhibited O2 consumption, confirming that oxidation occurred in the mitochondrial respiratory chain. Results For control children (age = 8.8 ± 5.6 years, n = 26, the mean (± SD value of kc (in μM O2 per min per 107 cells was 1.36 ± 0.79 (coefficient of variation, Cv = 58%; median = 1.17; range = 0.60 to 3.12; -2SD = 0.61. For children with trisomy 21 (age = 7.2 ± 4.6 years, n = 26, the values of kc were 0.82 ± 0.62 (Cv = 76%; median = 0.60; range = 0.20 to 2.80, pp6.1 mU/L. Fourteen of 26 (54% children with trisomy 21 had kc values of 0.20 to 0.60 (i.e., kc positively correlated with body-mass index (BMI, R >0.302, serum creatinine (R >0.507, blood urea nitrogen (BUN, R >0.535 and albumin (R >0.446. Conclusions Children with trisomy 21 in this study have reduced lymphocyte bioenergetics. The clinical importance of this finding requires further studies.

Respirable versus inhalable dust sampling

International Nuclear Information System (INIS)

Hondros, J.

1987-01-01

The ICRP uses a total inhalable dust figure as the basis of calculations on employee lung dose. This paper was written to look at one aspect of the Olympic Dam dust situation, namely, the inhalable versus respirable fraction of the dust cloud. The results of this study will determine whether it is possible to use respirable dust figures, as obtained during routine monitoring to help in the calculations of employee exposure to internal radioactive contaminants

75 FR 29699 - Total Inward Leakage Requirements for Respirators

Science.gov (United States)

2010-05-27

... or other half-mask respirator inward leakage measurement, and offer any additional comments on the..., facsimile (412) 386-4089, e-mail [email protected] . SUPPLEMENTARY INFORMATION: I. Background The Department of... order to conduct tests and prepare responses. On April 20, 2010, NIOSH responded by reopening the docket...

Investigating the impact of temporal and spatial variation in spring snow melt on summer soil respiration

Science.gov (United States)

John, G. P.; Papuga, S. A.; Wright, C. L.; Nelson, K.; Barron-Gafford, G. A.

2010-12-01

While soil respiration - the flux of carbon dioxide from the soil surface to the atmosphere - is the second largest terrestrial carbon flux, it is the least well constrained component of the terrestrial carbon cycle. This is in part because of its high variability in space and time that can become amplified under certain environmental conditions. Under current climate change scenarios, both summer and winter precipitation are expected to be altered in terrestrial ecosystems of the southwestern US. Precipitation magnitude and intensity influence soil moisture, which is a key control on ecosystem-scale respiration rates. Therefore understanding how changes in snow and rainfall translate to changes in soil moisture is critical to understanding climate change impacts on soil respiration processes. Our study took place within the footprint of a semiarid mixed-conifer flux measurement system on Mount Bigelow just north of Tucson, AZ. We analyzed images from three understory phenology cameras (pheno-cams) to identify areas that represented early and late snowmelt. Within the field of view of each of the three pheno-cams we established three early-melt and three late-melt soil respiration measurement “sites”. To understand the persistence of snowmelt conditions on summer soil respiration, we measured soil respiration, soil moisture, and soil temperature at all six sites on four days representing different summer periods (i.e. pre-monsoon, early monsoon, mid-monsoon, and late monsoon). Throughout the entire study period, at both early- and late-melt sites soil respiration was strongly correlated with amount of soil moisture, and was less responsive to temperature. Soil respiration generally increased throughout the rainy season, peaking by mid-monsoon at both early- and late-melt sites. Interestingly, early-melt sites were wetter than late-melt sites following rainfall occurring in the pre- and early monsoon. However, following rainfall occurring in the mid- to late

Convergence in the temperature response of leaf respiration across biomes and plant functional types.

Science.gov (United States)

Heskel, Mary A; O'Sullivan, Odhran S; Reich, Peter B; Tjoelker, Mark G; Weerasinghe, Lasantha K; Penillard, Aurore; Egerton, John J G; Creek, Danielle; Bloomfield, Keith J; Xiang, Jen; Sinca, Felipe; Stangl, Zsofia R; Martinez-de la Torre, Alberto; Griffin, Kevin L; Huntingford, Chris; Hurry, Vaughan; Meir, Patrick; Turnbull, Matthew H; Atkin, Owen K

2016-04-05

Plant respiration constitutes a massive carbon flux to the atmosphere, and a major control on the evolution of the global carbon cycle. It therefore has the potential to modulate levels of climate change due to the human burning of fossil fuels. Neither current physiological nor terrestrial biosphere models adequately describe its short-term temperature response, and even minor differences in the shape of the response curve can significantly impact estimates of ecosystem carbon release and/or storage. Given this, it is critical to establish whether there are predictable patterns in the shape of the respiration-temperature response curve, and thus in the intrinsic temperature sensitivity of respiration across the globe. Analyzing measurements in a comprehensive database for 231 species spanning 7 biomes, we demonstrate that temperature-dependent increases in leaf respiration do not follow a commonly used exponential function. Instead, we find a decelerating function as leaves warm, reflecting a declining sensitivity to higher temperatures that is remarkably uniform across all biomes and plant functional types. Such convergence in the temperature sensitivity of leaf respiration suggests that there are universally applicable controls on the temperature response of plant energy metabolism, such that a single new function can predict the temperature dependence of leaf respiration for global vegetation. This simple function enables straightforward description of plant respiration in the land-surface components of coupled earth system models. Our cross-biome analyses shows significant implications for such fluxes in cold climates, generally projecting lower values compared with previous estimates.

Soil respiration in relation to photosynthesis of Quercus mongolica trees at elevated CO2.

Science.gov (United States)

Zhou, Yumei; Li, Mai-He; Cheng, Xu-Bing; Wang, Cun-Guo; Fan, A-Nan; Shi, Lian-Xuan; Wang, Xiu-Xiu; Han, Shijie

2010-12-06

Knowledge of soil respiration and photosynthesis under elevated CO(2) is crucial for exactly understanding and predicting the carbon balance in forest ecosystems in a rapid CO(2)-enriched world. Quercus mongolica Fischer ex Ledebour seedlings were planted in open-top chambers exposed to elevated CO(2) (EC = 500 µmol mol(-1)) and ambient CO(2) (AC = 370 µmol mol(-1)) from 2005 to 2008. Daily, seasonal and inter-annual variations in soil respiration and photosynthetic assimilation were measured during 2007 and 2008 growing seasons. EC significantly stimulated the daytime soil respiration by 24.5% (322.4 at EC vs. 259.0 mg CO(2) m(-2) hr(-1) at AC) in 2007 and 21.0% (281.2 at EC vs. 232.6 mg CO(2) m(-2) hr(-1) at AC) in 2008, and increased the daytime CO(2) assimilation by 28.8% (624.1 at EC vs. 484.6 mg CO(2) m(-2) hr(-1) at AC) across the two growing seasons. The temporal variation in soil respiration was positively correlated with the aboveground photosynthesis, soil temperature, and soil water content at both EC and AC. EC did not affect the temperature sensitivity of soil respiration. The increased daytime soil respiration at EC resulted mainly from the increased aboveground photosynthesis. The present study indicates that increases in CO(2) fixation of plants in a CO(2)-rich world will rapidly return to the atmosphere by increased soil respiration.

Experimental demonstration of CMOS-compatible long-range dielectric-loaded surface plasmon-polariton waveguides (LR-DLSPPWs)

DEFF Research Database (Denmark)

Zektzer, Roy; Desiatov, Boris; Mazurski, Noa

2015-01-01

We demonstrate the design, fabrication and experimental characterization of long-range dielectric-loaded surface plasmon-polariton waveguides (LR-DLSPPWs) that are compatible with complementary metal-oxide semiconductor (CMOS) technology. The demonstrated waveguides feature good mode confinement...

Leaf respiration at different canopy positions in sweetgum (Liquidambar styraciflua) grown in ambient and elevated concentrations of carbon dioxide in the field

International Nuclear Information System (INIS)

Tissue, D. T.; Lewis, J. D.; Wullschleger, S. D.; Amthro, J. S.; Griffin, K. L.; Anderson, O. R.

2002-01-01

The effects of elevated carbon dioxide and canopy position on leaf respiration in sweetgum trees in a closed canopy forest were measured in an effort to determine if, and why, enriched atmospheric carbon dioxide might affect leaf respiration in sweetgum. To account for the dark respiratory response to growth in elevated carbon dioxide, cell ultrastructure and cytochrome c oxidase activity in leaves were measured at different seasonal growth periods. Leaf respiration under light conditions was also estimated to determine whether elevated carbon dioxide affected daytime respiration. Results showed that long-term exposure to elevated carbon dioxide did not effect night-time or day- time respiration in trees grown in a plantation in the field. Canopy position affected night-time respiration partially, through the effects on leaf soluble sugar, starch, nitrogen and leaf mass per unit area. In carbon dioxide partial pressure the effects of canopy position were insignificant. It was concluded that elevated carbon dioxide does not directly impact leaf respiration in sweetgum and assuming no changes in leaf nitrogen or leaf chemical composition, the long-term effects on respiration in this species will be minimal. 50 refs., 4 tabs., 3 figs

Non-contact acquisition of respiration and heart rates using Doppler radar with time domain peak-detection algorithm.

Science.gov (United States)

Xiaofeng Yang; Guanghao Sun; Ishibashi, Koichiro

2017-07-01

The non-contact measurement of the respiration rate (RR) and heart rate (HR) using a Doppler radar has attracted more attention in the field of home healthcare monitoring, due to the extremely low burden on patients, unconsciousness and unconstraint. Most of the previous studies have performed the frequency-domain analysis of radar signals to detect the respiration and heartbeat frequency. However, these procedures required long period time (approximately 30 s) windows to obtain a high-resolution spectrum. In this study, we propose a time-domain peak detection algorithm for the fast acquisition of the RR and HR within a breathing cycle (approximately 5 s), including inhalation and exhalation. Signal pre-processing using an analog band-pass filter (BPF) that extracts respiration and heartbeat signals was performed. Thereafter, the HR and RR were calculated using a peak position detection method, which was carried out via LABVIEW. To evaluate the measurement accuracy, we measured the HR and RR of seven subjects in the laboratory. As a reference of HR and RR, the persons wore contact sensors i.e., an electrocardiograph (ECG) and a respiration band. The time domain peak-detection algorithm, based on the Doppler radar, exhibited a significant correlation coefficient of HR of 0.92 and a correlation coefficient of RR of 0.99, between the ECG and respiration band, respectively.

Mitochondrial Respiration in Insulin-Producing β-Cells: General Characteristics and Adaptive Effects of Hypoxia.

Science.gov (United States)

Hals, Ingrid K; Bruerberg, Simon Gustafson; Ma, Zuheng; Scholz, Hanne; Björklund, Anneli; Grill, Valdemar

2015-01-01

To provide novel insights on mitochondrial respiration in β-cells and the adaptive effects of hypoxia. Insulin-producing INS-1 832/13 cells were exposed to 18 hours of hypoxia followed by 20-22 hours re-oxygenation. Mitochondrial respiration was measured by high-resolution respirometry in both intact and permeabilized cells, in the latter after establishing three functional substrate-uncoupler-inhibitor titration (SUIT) protocols. Concomitant measurements included proteins of mitochondrial complexes (Western blotting), ATP and insulin secretion. Intact cells exhibited a high degree of intrinsic uncoupling, comprising about 50% of oxygen consumption in the basal respiratory state. Hypoxia followed by re-oxygenation increased maximal overall respiration. Exploratory experiments in peremabilized cells could not show induction of respiration by malate or pyruvate as reducing substrates, thus glutamate and succinate were used as mitochondrial substrates in SUIT protocols. Permeabilized cells displayed a high capacity for oxidative phosphorylation for both complex I- and II-linked substrates in relation to maximum capacity of electron transfer. Previous hypoxia decreased phosphorylation control of complex I-linked respiration, but not in complex II-linked respiration. Coupling control ratios showed increased coupling efficiency for both complex I- and II-linked substrates in hypoxia-exposed cells. Respiratory rates overall were increased. Also previous hypoxia increased proteins of mitochondrial complexes I and II (Western blotting) in INS-1 cells as well as in rat and human islets. Mitochondrial effects were accompanied by unchanged levels of ATP, increased basal and preserved glucose-induced insulin secretion. Exposure of INS-1 832/13 cells to hypoxia, followed by a re-oxygenation period increases substrate-stimulated respiratory capacity and coupling efficiency. Such effects are accompanied by up-regulation of mitochondrial complexes also in pancreatic islets

Respirators: APR Issuer Self Study 33461

Energy Technology Data Exchange (ETDEWEB)

Chochoms, Michael [Los Alamos National Laboratory

2016-07-13

Respirators: APR Issuer Self-Study (course 33461) is designed to introduce and familiarize employees selected as air-purifying respirator (APR) issuers at Los Alamos National Laboratory (LANL) with the responsibilities, limitations, procedures, and resources for issuing APRs at LANL. The goal is to enable these issuers to consistently provide proper, functioning APRs to authorized users

Effects of environmental factors and soil properties on topographic variations of soil respiration

OpenAIRE

Tamai, K.

2010-01-01

Soil respiration rates were measured along different parts of a slope in (a) an evergreen forest with common brown forest soil and (b) a deciduous forest with immature soil. The effects of soil temperature, soil moisture and soil properties were estimated individually, and the magnitudes of these effects in the deciduous and evergreen forests were compared. In the evergreen forest with common brown forest soil, soil properties had the greatest effect on soil respiration rates, followed by soi...

Development of conformal respirator monitoring technology

International Nuclear Information System (INIS)

Shonka, J.J.; Weismann, J.J.; Logan, R.J.

1997-04-01

This report summarizes the results of a Small Business Innovative Research Phase II project to develop a modular, surface conforming respirator monitor to improve upon the manual survey techniques presently used by the nuclear industry. Research was performed with plastic scintillator and gas proportional modules in an effort to find the most conducive geometry for a surface conformal, position sensitive monitor. The respirator monitor prototype developed is a computer controlled, position-sensitive detection system employing 56 modular proportional counters mounted in molds conforming to the inner and outer surfaces of a commonly used respirator (Scott Model 801450-40). The molds are housed in separate enclosures and hinged to create a open-quotes waffle-ironclose quotes effect so that the closed monitor will simultaneously survey both surfaces of the respirator. The proportional counter prototype was also designed to incorporate Shonka Research Associates previously developed charge-division electronics. This research provided valuable experience into pixellated position sensitive detection systems. The technology developed can be adapted to other monitoring applications where there is a need for deployment of many traditional radiation detectors

Redefinition and global estimation of basal ecosystem respiration rate

DEFF Research Database (Denmark)

Yuan, Wenping; Luo, Yiqi; Li, Xianglan

2011-01-01

Basal ecosystem respiration rate (BR), the ecosystem respiration rate at a given temperature, is a common and important parameter in empirical models for quantifying ecosystem respiration (ER) globally. Numerous studies have indicated that BR varies in space. However, many empirical ER models sti...

Soil respiration and organic carbon dynamics with grassland conversions to woodlands in temperate china.

Directory of Open Access Journals (Sweden)

Wei Wang

Full Text Available Soils are the largest terrestrial carbon store and soil respiration is the second-largest flux in ecosystem carbon cycling. Across China's temperate region, climatic changes and human activities have frequently caused the transformation of grasslands to woodlands. However, the effect of this transition on soil respiration and soil organic carbon (SOC dynamics remains uncertain in this area. In this study, we measured in situ soil respiration and SOC storage over a two-year period (Jan. 2007-Dec. 2008 from five characteristic vegetation types in a forest-steppe ecotone of temperate China, including grassland (GR, shrubland (SH, as well as in evergreen coniferous (EC, deciduous coniferous (DC and deciduous broadleaved forest (DB, to evaluate the changes of soil respiration and SOC storage with grassland conversions to diverse types of woodlands. Annual soil respiration increased by 3%, 6%, 14%, and 22% after the conversion from GR to EC, SH, DC, and DB, respectively. The variation in soil respiration among different vegetation types could be well explained by SOC and soil total nitrogen content. Despite higher soil respiration in woodlands, SOC storage and residence time increased in the upper 20 cm of soil. Our results suggest that the differences in soil environmental conditions, especially soil substrate availability, influenced the level of annual soil respiration produced by different vegetation types. Moreover, shifts from grassland to woody plant dominance resulted in increased SOC storage. Given the widespread increase in woody plant abundance caused by climate change and large-scale afforestation programs, the soils are expected to accumulate and store increased amounts of organic carbon in temperate areas of China.

Diel hysteresis between soil respiration and soil temperature in a biological soil crust covered desert ecosystem.

Science.gov (United States)

Guan, Chao; Li, Xinrong; Zhang, Peng; Chen, Yongle

2018-01-01

Soil respiration induced by biological soil crusts (BSCs) is an important process in the carbon (C) cycle in arid and semi-arid ecosystems, where vascular plants are restricted by the harsh environment, particularly the limited soil moisture. However, the interaction between temperature and soil respiration remains uncertain because of the number of factors that control soil respiration, including temperature and soil moisture, especially in BSC-dominated areas. In this study, the soil respiration in moss-dominated crusts and lichen-dominated crusts was continuously measured using an automated soil respiration system over a one-year period from November 2015 to October 2016 in the Shapotou region of the Tengger Desert, northern China. The results indicated that over daily cycles, the half-hourly soil respiration rates in both types of BSC-covered areas were commonly related to the soil temperature. The observed diel hysteresis between the half-hourly soil respiration rates and soil temperature in the BSC-covered areas was limited by nonlinearity loops with semielliptical shapes, and soil temperature often peaked later than the half-hourly soil respiration rates in the BSC-covered areas. The average lag times between the half-hourly soil respiration rates and soil temperature for both types of BSC-covered areas were two hours over the diel cycles, and they were negatively and linearly related to the volumetric soil water content. Our results highlight the diel hysteresis phenomenon that occurs between soil respiration rates and soil temperatures in BSC-covered areas and the negative response of this phenomenon to soil moisture, which may influence total C budget evaluations. Therefore, the interactive effects of soil temperature and moisture on soil respiration in BSC-covered areas should be considered in global carbon cycle models of desert ecosystems.

Arbuscular mycorrhizal fungi regulate soil respiration and its response to precipitation change in a semiarid steppe.

Science.gov (United States)

Zhang, Bingwei; Li, Shan; Chen, Shiping; Ren, Tingting; Yang, Zhiqiang; Zhao, Hanlin; Liang, Yu; Han, Xingguo

2016-01-28

Arbuscular mycorrhizal fungi (AMF) are critical links in plant-soil continuum and play a critical role in soil carbon cycles. Soil respiration, one of the largest carbon fluxes in global carbon cycle, is sensitive to precipitation change in semiarid ecosystems. In this study, a field experiment with fungicide application and water addition was conducted during 2010-2013 in a semiarid steppe in Inner Mongolia, China, and soil respiration was continuously measured to investigate the influences of AMF on soil respiration under different precipitation regimes. Results showed that soil respiration was promoted by water addition treatment especially during drought seasons, which induced a nonlinear response of soil respiration to precipitation change. Fungicide application suppressed AMF root colonization without impacts on soil microbes. AMF suppression treatment accelerated soil respiration with 2.7, 28.5 and 37.6 g C m(-2) across three seasons, which were mainly caused by the enhanced heterotrophic component. A steeper response of soil respiration rate to precipitation was found under fungicide application treatments, suggesting a greater dampening effect of AMF on soil carbon release as water availability increased. Our study highlighted the importance of AMF on soil carbon stabilization and sequestration in semiarid steppe ecosystems especially during wet seasons.

Arbuscular mycorrhizal fungi regulate soil respiration and its response to precipitation change in a semiarid steppe

Science.gov (United States)

Zhang, Bingwei; Li, Shan; Chen, Shiping; Ren, Tingting; Yang, Zhiqiang; Zhao, Hanlin; Liang, Yu; Han, Xingguo

2016-01-01

Arbuscular mycorrhizal fungi (AMF) are critical links in plant-soil continuum and play a critical role in soil carbon cycles. Soil respiration, one of the largest carbon fluxes in global carbon cycle, is sensitive to precipitation change in semiarid ecosystems. In this study, a field experiment with fungicide application and water addition was conducted during 2010-2013 in a semiarid steppe in Inner Mongolia, China, and soil respiration was continuously measured to investigate the influences of AMF on soil respiration under different precipitation regimes. Results showed that soil respiration was promoted by water addition treatment especially during drought seasons, which induced a nonlinear response of soil respiration to precipitation change. Fungicide application suppressed AMF root colonization without impacts on soil microbes. AMF suppression treatment accelerated soil respiration with 2.7, 28.5 and 37.6 g C m-2 across three seasons, which were mainly caused by the enhanced heterotrophic component. A steeper response of soil respiration rate to precipitation was found under fungicide application treatments, suggesting a greater dampening effect of AMF on soil carbon release as water availability increased. Our study highlighted the importance of AMF on soil carbon stabilization and sequestration in semiarid steppe ecosystems especially during wet seasons.

Stem respiration of Populus species in the third year of free-air CO{sub 2} enrichment

Energy Technology Data Exchange (ETDEWEB)

Bielen, B.; Geulemans, R. [Univ. of Antwerp, Dept. of Biology, Research Group of Plant and Vegetation Ecology, Wilrijk (Belgium); Scarascia-Mugnozza, G. [Univ. degli Studi della Tuscia, Dept. of Forest Environment and Resources, Viterbo (Italy)

2003-04-01

Carbon cycling in ecosystems, and especially in forests, is intensively studied to predict the effects of global climate change, and the role which forests may play in 'changing climate change'. One of the questions is whether the carbon balance of forests will be affected by increasing atmospheric CO{sub 2} concentrations. Regarding this question, effects of elevated [CO{sub 2}] on woody-tissue respiration have frequently been neglected. Stem respiration of three Populus species (P. alba L. (Clone 2AS-11), P. nigra L. (Clone Jean Pourtet), and P. x euramericana (Clone I-214)) was measured in a managed, high-density forest plantation exposed to free-air CO{sub 2} enrichment (POPFACE). During the period of measurements, in May of the third year, stem respiration rates were not affected by the FACE treatment. Moreover, FACE did not influence the relationships between respiration rate and both stem temperature and relative growth rate. The results were supported by the reported absence of a FACE-effect on growth and stem wood density. (au)

Estimation of fractional contribution of root respiration to a forest-floor CO2 flux using carbon isotopes

International Nuclear Information System (INIS)

Hachiya, Masashi; Moriizumi, Jun; Yamazawa, Hiromi

2010-01-01

Efflux of soil respired carbon dioxide(CO 2 ) is very important component for the global carbon cycle and dynamics of 14 C in environment, and to predict the global climate changes caused by increasing CO 2 concentrations in the atmosphere. There are two components that generate CO 2 in soil, soil organic matter decomposition and root respiration. Although the former is relatively well understood, the root-derived CO 2 efflux has not been evaluated sufficiently. The objective of our research is to estimate depth profile of the root respiration rate. Thus we developed a box model which calculates the depth profile. In this paper, we discussed about (1) the adequacy of calculated result by comparing it to the to observed soil respired CO 2 flux with trenching method and (2) sensitivity of the box model to uncertainty in the input data. The result showed that the depth profile of root respiration rate decreased with soil depth. This is attributed to the distribution of fine roots which dominate root respiration. The model results reasonable agreed with the measurement results and characteristics of root respiration. The output of the model was robust to the variation of the input data. (author)

Building an industry-wide occupational exposure database for respirable mineral dust - experiences from the IMA dust monitoring programme

International Nuclear Information System (INIS)

Houba, Remko; Jongen, Richard; Vlaanderen, Jelle; Kromhout, Hans

2009-01-01

Building an industry-wide database with exposure measurements of respirable mineral dust is a challenging operation. The Industrial Minerals Association (IMA-Europe) took the initiative to create an exposure database filled with data from a prospective and ongoing dust monitoring programme that was launched in 2000. More than 20 industrial mineral companies have been collecting exposure data following a common protocol since then. Recently in 2007 ArboUnie and IRAS evaluated the quality of the collected exposure data for data collected up to winter 2005/2006. The data evaluated was collected in 11 sampling campaigns by 24 companies at 84 different worksites and considered about 8,500 respirable dust measurements and 7,500 respirable crystalline silica. In the quality assurance exercise four criteria were used to evaluate the existing measurement data: personal exposure measurements, unique worker identity, sampling duration not longer than one shift and availability of a limit of detection. Review of existing exposure data in the IMA dust monitoring programme database showed that 58% of collected respirable dust measurements and 62% of collected respirable quartz could be regarded as 'good quality data' meeting the four criteria mentioned above. Only one third of the measurement data included repeated measurements (within a sampling campaign) that would allow advanced statistical analysis incorporating estimates of within- and between-worker variability in exposure to respirable mineral dust. This data came from 7 companies comprising measurements from 23 sites. Problematic data was collected in some specific countries and to a large extent this was due to local practices and legislation (e.g. allowing 40-h time weighted averages). It was concluded that the potential of this unique industry-wide exposure database is very high, but that considerable improvements can be made. At the end of 2006 relatively small but essential changes were made in the dust monitoring

A Global Database of Soil Respiration Data, Version 2.0

Data.gov (United States)

National Aeronautics and Space Administration — ABSTRACT: This data set provides an updated soil respiration database (SRDB), a near-universal compendium of published soil respiration (RS) data. Soil respiration,...

Monitoring biodegradation of diesel fuel in bioventing processes using in situ respiration rate.

Science.gov (United States)

Lee, T H; Byun, I G; Kim, Y O; Hwang, I S; Park, T J

2006-01-01

An in situ measuring system of respiration rate was applied for monitoring biodegradation of diesel fuel in a bioventing process for bioremediation of diesel contaminated soil. Two laboratory-scale soil columns were packed with 5 kg of soil that was artificially contaminated by diesel fuel as final TPH (total petroleum hydrocarbon) concentration of 8,000 mg/kg soil. Nutrient was added to make a relative concentration of C:N:P = 100:10:1. One soil column was operated with continuous venting mode, and the other one with intermittent (6 h venting/6 h rest) venting mode. On-line O2 and CO2 gas measuring system was applied to measure O2 utilisation and CO2 production during biodegradation of diesel for 5 months. Biodegradation rate of TPH was calculated from respiration rate measured by the on-line gas measuring system. There were no apparent differences between calculated biodegradation rates from two columns with different venting modes. The variation of biodegradation rates corresponded well with trend of the remaining TPH concentrations comparing other biodegradation indicators, such as C17/pristane and C18/phytane ratio, dehydrogenase activity, and the ratio of hydrocarbon utilising bacteria to total heterotrophic bacteria. These results suggested that the on-line measuring system of respiration rate would be applied to monitoring biodegradation rate and to determine the potential applicability of bioventing process for bioremediation of oil contaminated soil.

Vegetation types alter soil respiration and its temperature sensitivity at the field scale in an estuary wetland.

Directory of Open Access Journals (Sweden)

Guangxuan Han

Full Text Available Vegetation type plays an important role in regulating the temporal and spatial variation of soil respiration. Therefore, vegetation patchiness may cause high uncertainties in the estimates of soil respiration for scaling field measurements to ecosystem level. Few studies provide insights regarding the influence of vegetation types on soil respiration and its temperature sensitivity in an estuary wetland. In order to enhance the understanding of this issue, we focused on the growing season and investigated how the soil respiration and its temperature sensitivity are affected by the different vegetation (Phragmites australis, Suaeda salsa and bare soil in the Yellow River Estuary. During the growing season, there were significant linear relationships between soil respiration rates and shoot and root biomass, respectively. On the diurnal timescale, daytime soil respiration was more dependent on net photosynthesis. A positive correlation between soil respiration and net photosynthesis at the Phragmites australis site was found. There were exponential correlations between soil respiration and soil temperature, and the fitted Q10 values varied among different vegetation types (1.81, 2.15 and 3.43 for Phragmites australis, Suaeda salsa and bare soil sites, respectively. During the growing season, the mean soil respiration was consistently higher at the Phragmites australis site (1.11 µmol CO2 m(-2 s(-1, followed by the Suaeda salsa site (0.77 µmol CO2 m(-2 s(-1 and the bare soil site (0.41 µmol CO2 m(-2 s(-1. The mean monthly soil respiration was positively correlated with shoot and root biomass, total C, and total N among the three vegetation patches. Our results suggest that vegetation patchiness at a field scale might have a large impact on ecosystem-scale soil respiration. Therefore, it is necessary to consider the differences in vegetation types when using models to evaluate soil respiration in an estuary wetland.

Vegetation Types Alter Soil Respiration and Its Temperature Sensitivity at the Field Scale in an Estuary Wetland

Science.gov (United States)

Han, Guangxuan; Xing, Qinghui; Luo, Yiqi; Rafique, Rashad; Yu, Junbao; Mikle, Nate

2014-01-01

Vegetation type plays an important role in regulating the temporal and spatial variation of soil respiration. Therefore, vegetation patchiness may cause high uncertainties in the estimates of soil respiration for scaling field measurements to ecosystem level. Few studies provide insights regarding the influence of vegetation types on soil respiration and its temperature sensitivity in an estuary wetland. In order to enhance the understanding of this issue, we focused on the growing season and investigated how the soil respiration and its temperature sensitivity are affected by the different vegetation (Phragmites australis, Suaeda salsa and bare soil) in the Yellow River Estuary. During the growing season, there were significant linear relationships between soil respiration rates and shoot and root biomass, respectively. On the diurnal timescale, daytime soil respiration was more dependent on net photosynthesis. A positive correlation between soil respiration and net photosynthesis at the Phragmites australis site was found. There were exponential correlations between soil respiration and soil temperature, and the fitted Q 10 values varied among different vegetation types (1.81, 2.15 and 3.43 for Phragmites australis, Suaeda salsa and bare soil sites, respectively). During the growing season, the mean soil respiration was consistently higher at the Phragmites australis site (1.11 µmol CO2 m−2 s−1), followed by the Suaeda salsa site (0.77 µmol CO2 m−2 s−1) and the bare soil site (0.41 µmol CO2 m−2 s−1). The mean monthly soil respiration was positively correlated with shoot and root biomass, total C, and total N among the three vegetation patches. Our results suggest that vegetation patchiness at a field scale might have a large impact on ecosystem-scale soil respiration. Therefore, it is necessary to consider the differences in vegetation types when using models to evaluate soil respiration in an estuary wetland. PMID:24608636

Thermal adaptation of heterotrophic soil respiration in laboratory microcosms.

Science.gov (United States)

Mark A. Bradford; Brian W. Watts; Christian A. Davies

2010-01-01

Respiration of heterotrophic microorganisms decomposing soil organic carbon releases carbon dioxide from soils to the atmosphere. In the short term, soil microbial respiration is strongly dependent on temperature. In the long term, the response of heterotrophic soil respiration to temperature is uncertain. However, following established evolutionary tradeoffs, mass-...

A Global Database of Soil Respiration Data, Version 1.0

Data.gov (United States)

National Aeronautics and Space Administration — ABSTRACT: This data set provides a soil respiration data database (SRDB), a near-universal compendium of published soil respiration (RS) data. Soil respiration, the...

Respirators: Air Purifying, Self-Study, Course 40723

Energy Technology Data Exchange (ETDEWEB)

Chochoms, Michael [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

2017-12-21

Respirators: Air Purifying Self-Study (COURSE 40723) is designed for Los Alamos National Laboratory (LANL) workers, support services subcontractors, and other LANL subcontractors who work under the LANL Respiratory Protection Program (RPP). This course also meets the air-purifying respirators (APRs) retraining requirement.

Experimental warming does not enhance soil respiration in a semiarid temperate forest-steppe ecosystem

DEFF Research Database (Denmark)

Lellei-Kovacs, E.; Kovacs-Lang, E.; Kalapos, T.

2008-01-01

are still limited. Soil respiration rate-measured monthly between April and November from 2003 to 2006-remained very low (0.09 - 1.53 mu mol CO2 m(-2) s(-1))in accordance with the moderate biological activity and low humus content of the nutrient poor, coarse sandy soil. Specific soil respiration rate...... ( calculated for unit soil organic matter content), however, was relatively high (0.36 - 7.92 mu mol CO g(-1) C(org)h(-1)) suggesting substrate limitation for soil biological activity. During the day, soil respiration rate was significantly lower at dawn than at midday, while seasonally clear temperature......The influence of simulated climate change on soil respiration was studied in a field experiment on 4 m x 5 m plots in the semiarid temperate Pannonian sand forest-steppe. This ecosystem type has low productivity and soil organic matter content, and covers large areas, yet data on soil carbon fluxes...

Respirable dust and quartz exposure from three South African farms with sandy, sandy loam, and clay soils.

Science.gov (United States)

Swanepoel, Andrew J; Kromhout, Hans; Jinnah, Zubair A; Portengen, Lützen; Renton, Kevin; Gardiner, Kerry; Rees, David

2011-07-01

To quantify personal time-weighted average respirable dust and quartz exposure on a sandy, a sandy loam, and a clay soil farm in the Free State and North West provinces of South Africa and to ascertain whether soil type is a determinant of exposure to respirable quartz. Three farms, located in the Free State and North West provinces of South Africa, had their soil type confirmed as sandy, sandy loam, and clay; and, from these, a total of 298 respirable dust and respirable quartz measurements were collected between July 2006-November 2009 during periods of major farming operations. Values below the limit of detection (LOD) (22 μg · m(-3)) were estimated using multiple 'imputation'. Non-parametric tests were used to compare quartz exposure from the three different soil types. Exposure to respirable quartz occurred on all three farms with the highest individual concentration measured on the sandy soil farm (626 μg · m(-3)). Fifty-seven, 59, and 81% of the measurements on the sandy soil, sandy loam soil, and clay soil farm, respectively, exceeded the American Conference of Governmental Industrial Hygienists (ACGIH) threshold limit value (TLV) of 25 μg · m(-3). Twelve and 13% of respirable quartz concentrations exceeded 100 μg · m(-3) on the sandy soil and sandy loam soil farms, respectively, but none exceeded this level on the clay soil farm. The proportions of measurements >100 μg · m(-3) were not significantly different between the sandy and sandy loam soil farms ('prop.test'; P = 0.65), but both were significantly larger than for the clay soil farm ('prop.test'; P = 0.0001). The percentage of quartz in respirable dust was determined for all three farms using measurements > the limit of detection. Percentages ranged from 0.5 to 94.4% with no significant difference in the median quartz percentages across the three farms (Kruskal-Wallis test; P = 0.91). This study demonstrates that there is significant potential for over-exposure to respirable quartz in

Microbial properties explain temporal variation in soil respiration in a grassland subjected to nitrogen addition

Science.gov (United States)

Li, Yue; Liu, Yinghui; Wu, Shanmei; Niu, Lei; Tian, Yuqiang

2015-01-01

The role of soil microbial variables in shaping the temporal variability of soil respiration has been well acknowledged but is poorly understood, particularly under elevated nitrogen (N) deposition conditions. We measured soil respiration along with soil microbial properties during the early, middle, and late growing seasons in temperate grassland plots that had been treated with N additions of 0, 2, 4, 8, 16, or 32 g N m−2 yr−1 for 10 years. Representing the averages over three observation periods, total (Rs) and heterotrophic (Rh) respiration were highest with 4 g N m−2 yr−1, but autotrophic respiration (Ra) was highest with 8 to 16 g N m−2 yr−1. Also, the responses of Rh and Ra were unsynchronized considering the periods separately. N addition had no significant impact on the temperature sensitivity (Q10) for Rs but inhibited the Q10 for Rh. Significant interactions between observation period and N level occurred in soil respiration components, and the temporal variations in soil respiration components were mostly associated with changes in microbial biomass carbon (MBC) and phospholipid fatty acids (PLFAs). Further observation on soil organic carbon and root biomass is needed to reveal the long-term effect of N deposition on soil C sequestration. PMID:26678303

Lr-Lp Stability of the Incompressible Flows with Nonzero Far-Field Velocity

Directory of Open Access Journals (Sweden)

Jaiok Roh

2011-01-01

Full Text Available We consider the stability of stationary solutions w for the exterior Navier-Stokes flows with a nonzero constant velocity u∞ at infinity. For u∞=0 with nonzero stationary solution w, Chen (1993, Kozono and Ogawa (1994, and Borchers and Miyakawa (1995 have studied the temporal stability in Lp spaces for 11 and obtain Lr-Lp stability as Kozono and Ogawa and Borchers and Miyakawa obtained for u∞=0.

Modélisation de la réponse des flux de respiration d'un sol forestier selon les principales variables climatiques

Directory of Open Access Journals (Sweden)

Marc Aubinet

2004-01-01

Full Text Available Modelling of the response of forest soil respiration fluxes to the main climatic variables. The objective of this article is to model the carbon dioxide (CO2 efflux to the atmosphere due to soil respiration. First, we will synthesize the main components of soil respiration fluxes as found in the literature. Then, we will present a system of automatic measurements, which was set up in a forest stand in Vielsalm (Ardennes, Belgium. This system recorded measurements of soil efflux and of climatic variables every 30 minutes. Its spatial resolution was limited to six collars of 20 cm diameter in a two-meter diameter curve. The measurements were analyzed according to their climatic components: temperature and relative soil water content. We analyzed 2 2 , 9 2 6 cycles of soil respiration measurements, and we followed a strict procedure of data selection in order to characterize soil respiration fluxes according to the main environmental components. We modelized those soil temperature-dependent fluxes with a Q1 0 function and A r r h e n i u s ' law with temperature-adjusted activation energ y, which both gave very similar results. Our best estimation for Q1 0 is 3.86 and for A in Arrhenius ' l a w, 17,479. We then adjusted two line segments beneath and beyond 0 . 2 7 m3.m- 3 of water in the soil in order to describe the response of respiration fluxes to soil moisture content. The soil temperature at 4.5 cm could explain over 86 % of the soil respiration fluxes. Relative moisture content narrows this by 2 % .

Respiration of midges (Diptera; Chironomidae) in British Columbian lakes: oxy-regulation, temperature and their role as palaeo-indicators

DEFF Research Database (Denmark)

Brodersen, Klaus Peter; Pedersen, Ole; Walker, Ian R.

2008-01-01

1. The specific respiration rate of 13 chironomid taxa and Chaoborus were measured to test the hypothesis of the relation between a species' ability to regulate their oxygen uptake and their distributional patterns among nine study lakes in British Columbia, Canada. 2. Respiration patterns of ind...

Estimation of ecosystem respiration and its components by means of stable isotopes and improved closed-chamber methods

DEFF Research Database (Denmark)

Brændholt, Andreas

Ecosystem respiration (Reco) is the second largest flux of CO2 between the biosphere and the atmosphere. It consists of several components, such as plant respiration and soil respiration (Rsoil), each of which may respond differently to abiotic factors, and thus to global climate change. Rsoil...... and abiotic factors, and before estimating Rsoil fluxes over longer time scales. The work also shows that artificial turbulent air mixing may provide a method to overcome the issue with overestimated fluxes, allowing for measurements even at low atmospheric turbulence. Furthermore, the results show...

Rapid Isolation of a Single-Chain Antibody against the Cyanobacterial Toxin Microcystin-LR by Phage Display and Its Use in the Immunoaffinity Concentration of Microcystins from Water

Science.gov (United States)

McElhiney, Jacqui; Drever, Mathew; Lawton, Linda A.; Porter, Andy J.

2002-01-01

A naïve (unimmunized) human semisynthetic phage display library was employed to isolate recombinant antibody fragments against the cyanobacterial hepatotoxin microcystin-LR. Selected antibody scFv genes were cloned into a soluble expression vector and expressed in Escherichia coli for characterization against purified microcystin-LR by competition enzyme-linked immunosorbent assay (ELISA). The most sensitive single-chain antibody (scAb) isolated was capable of detecting microcystin-LR at levels below the World Health Organization limit in drinking water (1 μg liter−1) and cross-reacted with three other purified microcystin variants (microcystin-RR, -LW, and -LF) and the related cyanotoxin nodularin. Extracts of the cyanobacterium Microcystis aeruginosa were assayed by ELISA, and quantifications of microcystins in toxic samples showed good correlation with analysis by high-performance liquid chromatography. Immobilized scAb was also used to prepare immunoaffinity columns, which were assessed for the ability to concentrate microcystin-LR from water for subsequent analysis by high-performance liquid chromatography. Anti-microcystin-LR scAb was immobilized on columns via a hexahistidine tag, ensuring maximum exposure of antigen binding sites, and the performance of the columns was evaluated by directly applying 150 ml of distilled water spiked with 4 μg of purified microcystin-LR. The procedure was simple, and a recovery rate of 94% was achieved following elution in 1 ml of 100% methanol. Large-scale, low-cost production of anti-microcystin-LR scAb in E. coli is an exciting prospect for the development of biosensors and on-line monitoring systems for microcystins and will also facilitate a range of immunoaffinity applications for the cleanup and concentration of these toxins from environmental samples. PMID:12406716

Transcriptional regulation of respiration in yeast metabolizing differently repressive carbon substrates

OpenAIRE

Fendt, Sarah-Maria; Sauer, Uwe

2010-01-01

Abstract Background Depending on the carbon source, Saccharomyces cerevisiae displays various degrees of respiration. These range from complete respiration as in the case of ethanol, to almost complete fermentation, and thus very low degrees of respiration on glucose. While many key regulators are known for these extreme cases, we focus here on regulators that are relevant at intermediate levels of respiration. Results We address this question by linking the functional degree of respiration t...

Contribution of root to soil respiration and carbon balance in ...

Indian Academy of Sciences (India)

Soil respiration varied from 2.5 to 11.9 g CO2 m-2 d-1 and from 1.5 to 9.3 g CO2 m-2 d-1, and the contribution of root respiration to total soil respiration from 38% to 76% and from 25% to 72% in Communities 1 and 2, respectively. During the growing season (May–September), soil respiration, shoot biomass, live root ...

How much work is expended for respiration?

Science.gov (United States)

Johnson, A T

1993-01-01

The rate of work expended to move air in the respiratory system has been determined for five different airflow waveshapes, a non-linear respiratory model and five exercise levels. As expected, the rectangular waveshape was the most efficient. Model conditions were then changed one a time: (i) starting lung volume was allowed to vary, (ii) exhalation flow limitation was added, (iii) respiration was considered to be a metabolic burden determining part of the ventilation requirement and (iv) a respirator mask was added. Although there is no direct work advantage to varying initial lung volume, such volume changes appear to be dictated by the asymmetry of lung recoil pressure about the lung relaxation volume; allowing the work of respiration to become a metabolic burden clearly shows why respiratory waveforms change from rest to exercise; and, adding a respirator imposes a severe respiratory burden on the wearer engaging in moderate, heavy and very heavy exercise.

Effect of organic matter and roots in soil respiration in a Mediterranean riparian areas in Central Spain

Science.gov (United States)

Gonzalez-Garrido, Laura; Delgado, Juan Antonio; Martinez, Teodora

2010-05-01

Soil respiration is one of the largest carbon flux components within terrestrial ecosystems, and small changes in the magnitude of soil respiration could have a large effect on the concentration of CO2 in the atmosphere. The main objective is evaluating the factors controlling soil respiration on the global carbon cycle in riparian areas of Henares River. We evaluated total soil respiration as it was affected by soil temperature, soil moisture, root respiration and organic matter in four areas differing in vegetation cover. We specifically assessed the contribution of soil organic matter and fine root biomass (≤1 mm.) in soil carbon dioxide flux. The study area is located on the riverbanks of Henares River where it passes through the municipal term of Alcala de Henares (Madrid) in Central Spain. Measurements were performed in spring and autumn of 2009. The study was conducted on four different types of riparian vegetation: natural Mediterranean riparian forest, reforestation of 1994, reforestation of 1999 and riparian grassland without trees. In each area of study 3, 25x25 m, plots were delimited and within each plot three sampling units of 50x50 cm were selected at random. The temperature of the ground was taken during the measures from respiration using a Multi-thermometer (-50°C - +300°C) at 5 cm depth. The moisture content of the ground was measured at 5 cm of depth with a HH2 Moisture meter (Delta Devices, Cambridge, UK). The measures of respiration of the ground were realised in field by means of LCI portable (LC pro ADC Bioscientific, Ltd. UK) connected to a ground respiration camera. We introduced the camera 3 cm into the soil just after eliminating the vegetation grass of the surface of measurement cutting carefully the aerial part, without damaging the roots. Soil CO2 flux measurements were registered after stabilization. Immediately after CO2 measurements, we obtained soil samples by means of a drill of 2.18 cm of diameter taking samples to 10 cm and

Soil respiration in the cold desert environment of the Colorado Plateau (USA): Abiotic regulators and thresholds

Science.gov (United States)

Fernandez, D.P.; Neff, J.C.; Belnap, J.; Reynolds, R.L.

2006-01-01

Decomposition is central to understanding ecosystem carbon exchange and nutrient-release processes. Unlike mesic ecosystems, which have been extensively studied, xeric landscapes have received little attention; as a result, abiotic soil-respiration regulatory processes are poorly understood in xeric environments. To provide a more complete and quantitative understanding about how abiotic factors influence soil respiration in xeric ecosystems, we conducted soil- respiration and decomposition-cloth measurements in the cold desert of southeast Utah. Our study evaluated when and to what extent soil texture, moisture, temperature, organic carbon, and nitrogen influence soil respiration and examined whether the inverse-texture hypothesis applies to decomposition. Within our study site, the effect of texture on moisture, as described by the inverse texture hypothesis, was evident, but its effect on decomposition was not. Our results show temperature and moisture to be the dominant abiotic controls of soil respiration. Specifically, temporal offsets in temperature and moisture conditions appear to have a strong control on soil respiration, with the highest fluxes occurring in spring when temperature and moisture were favorable. These temporal offsets resulted in decomposition rates that were controlled by soil moisture and temperature thresholds. The highest fluxes of CO2 occurred when soil temperature was between 10 and 16??C and volumetric soil moisture was greater than 10%. Decomposition-cloth results, which integrate decomposition processes across several months, support the soil-respiration results and further illustrate the seasonal patterns of high respiration rates during spring and low rates during summer and fall. Results from this study suggest that the parameters used to predict soil respiration in mesic ecosystems likely do not apply in cold-desert environments. ?? Springer 2006.

Impact of Environmental Factors and Biological Soil Crust Types on Soil Respiration in a Desert Ecosystem

Science.gov (United States)

Feng, Wei; Zhang, Yuqing; Jia, Xin; Wu, Bin; Zha, Tianshan; Qin, Shugao; Wang, Ben; Shao, Chenxi; Liu, Jiabin; Fa, Keyu

2014-01-01

The responses of soil respiration to environmental conditions have been studied extensively in various ecosystems. However, little is known about the impacts of temperature and moisture on soils respiration under biological soil crusts. In this study, CO2 efflux from biologically-crusted soils was measured continuously with an automated chamber system in Ningxia, northwest China, from June to October 2012. The highest soil respiration was observed in lichen-crusted soil (0.93±0.43 µmol m−2 s−1) and the lowest values in algae-crusted soil (0.73±0.31 µmol m−2 s−1). Over the diurnal scale, soil respiration was highest in the morning whereas soil temperature was highest in the midday, which resulted in diurnal hysteresis between the two variables. In addition, the lag time between soil respiration and soil temperature was negatively correlated with the soil volumetric water content and was reduced as soil water content increased. Over the seasonal scale, daily mean nighttime soil respiration was positively correlated with soil temperature when moisture exceeded 0.075 and 0.085 m3 m−3 in lichen- and moss-crusted soil, respectively. However, moisture did not affect on soil respiration in algae-crusted soil during the study period. Daily mean nighttime soil respiration normalized by soil temperature increased with water content in lichen- and moss-crusted soil. Our results indicated that different types of biological soil crusts could affect response of soil respiration to environmental factors. There is a need to consider the spatial distribution of different types of biological soil crusts and their relative contributions to the total C budgets at the ecosystem or landscape level. PMID:25050837

Impact of environmental factors and biological soil crust types on soil respiration in a desert ecosystem.

Science.gov (United States)

Feng, Wei; Zhang, Yuqing; Jia, Xin; Wu, Bin; Zha, Tianshan; Qin, Shugao; Wang, Ben; Shao, Chenxi; Liu, Jiabin; Fa, Keyu

2014-01-01

The responses of soil respiration to environmental conditions have been studied extensively in various ecosystems. However, little is known about the impacts of temperature and moisture on soils respiration under biological soil crusts. In this study, CO2 efflux from biologically-crusted soils was measured continuously with an automated chamber system in Ningxia, northwest China, from June to October 2012. The highest soil respiration was observed in lichen-crusted soil (0.93 ± 0.43 µmol m-2 s-1) and the lowest values in algae-crusted soil (0.73 ± 0.31 µmol m-2 s-1). Over the diurnal scale, soil respiration was highest in the morning whereas soil temperature was highest in the midday, which resulted in diurnal hysteresis between the two variables. In addition, the lag time between soil respiration and soil temperature was negatively correlated with the soil volumetric water content and was reduced as soil water content increased. Over the seasonal scale, daily mean nighttime soil respiration was positively correlated with soil temperature when moisture exceeded 0.075 and 0.085 m3 m-3 in lichen- and moss-crusted soil, respectively. However, moisture did not affect on soil respiration in algae-crusted soil during the study period. Daily mean nighttime soil respiration normalized by soil temperature increased with water content in lichen- and moss-crusted soil. Our results indicated that different types of biological soil crusts could affect response of soil respiration to environmental factors. There is a need to consider the spatial distribution of different types of biological soil crusts and their relative contributions to the total C budgets at the ecosystem or landscape level.

Regional anatomic differences in skeletal muscle mitochondrial respiration in type 2 diabetes and obesity

DEFF Research Database (Denmark)

Rabøl, R; Larsen, S; Højberg, P M V

2010-01-01

respiration and markers of mitochondrial content in skeletal muscle of arm and leg in patients with T2DM and obese control subjects. Patients: Ten patients with T2DM (age, 52.3 +/- 2.7 yr; body mass index, 30.1 +/- 1.2 kg/m(2)) (mean +/- se) were studied after a 2-wk washout period of oral antihyperglycemic...... agents. Ten control subjects (age, 54.3 +/- 2.8 yr; body mass index, 30.4 +/- 1.2 kg/m(2)) with normal fasting and 2-h oral glucose tolerance test blood glucose levels were also included. Main Outcome Measure: We measured mitochondrial respiration in saponin-treated skinned muscle fibers from biopsies...

Diet induced thermogenesis measured over 24h in a respiration chamber: effect of diet composition.

NARCIS (Netherlands)

Westerterp, K.R.; Wilson, S.A.; Rolland, V.

1999-01-01

Department of Human Biology, Maastricht University, The Netherlands. OBJECTIVE: To study the effect of diet composition on diet-induced thermogenesis (DIT) over 24h in a respiration chamber. SUBJECTS: Eight healthy female volunteers (age 27 +/- 3 y; body mass index, BMI 23 +/- 3 kg/m2). DIETS: A

Gap filling strategies and error in estimating annual soil respiration

Science.gov (United States)

Soil respiration (Rsoil) is one of the largest CO2 fluxes in the global carbon (C) cycle. Estimation of annual Rsoil requires extrapolation of survey measurements or gap-filling of automated records to produce a complete time series. While many gap-filling methodologies have been employed, there is ...

Occurrence of trace elements in respirable coal dust

International Nuclear Information System (INIS)

Sahoo, B.N.

1991-01-01

Inhalation of fine particles of coal dust contributes significantly to the occurrence of the disease, pneumoconiosis, prevailing in coal mining community. It is not presently known whether only the coal dust or specific chemical compounds or synergistic effects of several compounds associated with respirable coal dust is responsible for the disease, pneumoconiosis. The present paper describes the quantitative determination of ten minor and trace elements in respirable coal dust particles by atomic absorption spectrophotometric methods. The respirable coal dust samples are collected at the mine atmosphere during drilling in coal scams by using Messrs. Casella's Hexlet apparatus specially designed and fitted with horizontal elutriator to collect the respirable coal dust fraction simulating as near as possible to the lung's retention of the coal miners. After destruction of organic matter by wet oxidation and filtering off clay and silica, Fe, Ca, Mg, Na, K, Mn, Cu, Zn, Cd, and Ni were determined directly in the resulting solution by atomic absorption spectrophotometric procedures. The results show that the trace metals are more acute in lower range of size spectrum. Correlation coefficient, enrichment factor and linear regression values and their inverse relationship between the slope and EF values suggest that, in general, the trace metals in respirable particulates are likely to be from coal derived source if their concentrations are likewise high in the coal. The trace metal analytical data of respirable particulates fitted well to the linear regressive equation. The results of the studies are of importance as it may throw some light on the respirable lung disease 'pneumoconiosis' which are predominant in coal mining community. (author). 13 refs., 6 tabs

Use of respirators for protection of workers against airborne radioactive materials

International Nuclear Information System (INIS)

Revoir, W.H.

1990-01-01

The various types of respirators and the requirements for an effective respirator program are outlined. The use of specific types of respirators to protect workers against inhalation of airborne radioactive materials is discussed. Problems encountered in using respirators in the nuclear industry which have resulted in worker injury and death are described

Comparison of fast neutron spectra in graphite and FLINA salt inserted in well-defined core assembled in LR-0 reactor

International Nuclear Information System (INIS)

Košťál, Michal; Veškrna, Martin; Cvachovec, František; Jánský, Bohumil; Novák, Evžen; Rypar, Vojtěch; Milčák, Ján; Losa, Evžen; Mravec, Filip; Matěj, Zdeněk; Rejchrt, Jiří; Forget, Benoit; Harper, Sterling

2015-01-01

Highlights: • Neutron spectra measured in graphite and LiF + NaF. • Comparison of calculated and measured neutron spectra. • Effect of 19F on variation between various library calculated spectra. - Abstract: The present paper aims to compare the calculated and measured spectra after insertion of candidate materials for the Molten salt reactor/Fluoride cooled high temperature reactor system concept into the LR-0 reactor. The calculation is realized with MCNP6 code using ENDF/B-VII.0, JEFF-3.1, JENDL-3.3, JENDL-4, ROSFOND-2010 and CENDL-3.1 nuclear data libraries. Additionally, comparisons between the slowing down power of each media were performed. The slowing down properties are important parameters affecting the thickness of moderator media in a reactor

Sex-dependent effects of microcystin-LR on hypothalamic-pituitary-gonad axis and gametogenesis of adult zebrafish

Science.gov (United States)

Liu, Wanjing; Chen, Chuanyue; Chen, Liang; Wang, Li; Li, Jian; Chen, Yuanyuan; Jin, Jienan; Kawan, Atufa; Zhang, Xuezhen

2016-03-01

While microcystins (MCs) have been reported to exert reproductive toxicity on fish with a sex-dependent effect, the underlying mechanism has been rarely investigated. In the present study, zebrafish were exposed to 1, 5 and 20 μg/L MC-LR for 30 d. The gonad-somatic index declined in all treated males. 17β-estradiol (E2), testosterone (T), 11-keto testosterone (11-KT) and follicle-stimulating hormone (FSH) levels increased in serum from all treated females, while T, FSH and luteinizing hormone (LH) levels changed in all treated males. Histomorphological observation showed that MC-LR exposure evidently retarded oogenesis and spermatogenesis. Transcriptional changes of 22 genes of the hypothalamic-pituitary-gonad (HPG) axis exhibited sex-specific responses, and the relationship between gene transcriptions and gametogenesis was evaluated by principle component analysis (PCA). Major contributors to PC1 (gnrh2, gnrhr3, ar, lhr, hmgra, hmgrb and cyp19a) were positively correlated with the number of post-vitellogenic oocytes, while PC1 (gnrh2, lhβ, erβ, fshr, cyp11a and 17βhsd) were positively correlated with the number of spermatozoa. The protein levels of 17βHSD and CYP19a were affected in both females and males. In conclusion, this study first investigated the sex-dependent effects of microcystins on fish reproduction and revealed some important molecular biomarkers related to gametogenesis in zebrafish suffered from MC-LR.

Measurement of the left-right asymmetry in Z boson production by electron-positron collisions

International Nuclear Information System (INIS)

Elia, R.D.

1994-04-01

We present the first measurement of the left-right cross-section asymmetry (A LR ) in Z boson production at the SLAC Linear Collider. The left-right asymmetry provides a direct measurement of the e - -Z coupling and thus of the effective weak mixing angle; in addition, A LR is sensitive to the unknown top-quark and Higgs-boson masses. In 1992 the SLD detector recorded 10224 Z events produced by the collision of longitudinally polarized electrons with an unpolarized positron beam at a center-of-mass energy of 91.55 GeV. The average electron beam polarization during the run was (22.4 ± 0.6)%. We measure A LR to be 0.101 ± 0.044 (stat.) ± 0.004 (syst.), which determines the effective weak mixing angle to be sin 2 θeff/W = 0.2377 ± 0.0056 (stat.) ± 0.0005 (syst.). This measurement of A LR is in agreement with comparable measurements and is consistent with Standard-Model predictions for allowed top and Higgs masses

Transcriptional regulation of respiration in yeast metabolizing differently repressive carbon substrates

Directory of Open Access Journals (Sweden)

Fendt Sarah-Maria

2010-02-01

Full Text Available Abstract Background Depending on the carbon source, Saccharomyces cerevisiae displays various degrees of respiration. These range from complete respiration as in the case of ethanol, to almost complete fermentation, and thus very low degrees of respiration on glucose. While many key regulators are known for these extreme cases, we focus here on regulators that are relevant at intermediate levels of respiration. Results We address this question by linking the functional degree of respiration to transcriptional regulation via enzyme abundances. Specifically, we investigated aerobic batch cultures with the differently repressive carbon sources glucose, mannose, galactose and pyruvate. Based on 13C flux analysis, we found that the respiratory contribution to cellular energy production was largely absent on glucose and mannose, intermediate on galactose and highest on pyruvate. In vivo abundances of 40 respiratory enzymes were quantified by GFP-fusions under each condition. During growth on the partly and fully respired substrates galactose and pyruvate, several TCA cycle and respiratory chain enzymes were significantly up-regulated. From these enzyme levels and the known regulatory network structure, we determined the probability for a given transcription factor to cause the coordinated expression changes. The most probable transcription factors to regulate the different degrees of respiration were Gcr1p, Cat8p, the Rtg-proteins and the Hap-complex. For the latter three ones we confirmed their importance for respiration by quantifying the degree of respiration and biomass yields in the corresponding deletion strains. Conclusions Cat8p is required for wild-type like respiration, independent of its known activation of gluconeogenic genes. The Rtg-proteins and the Hap-complex are essential for wild-type like respiration under partially respiratory conditions. Under fully respiratory conditions, the Hap-complex, but not the Rtg-proteins are essential

Transcriptional regulation of respiration in yeast metabolizing differently repressive carbon substrates.

Science.gov (United States)

Fendt, Sarah-Maria; Sauer, Uwe

2010-02-18

Depending on the carbon source, Saccharomyces cerevisiae displays various degrees of respiration. These range from complete respiration as in the case of ethanol, to almost complete fermentation, and thus very low degrees of respiration on glucose. While many key regulators are known for these extreme cases, we focus here on regulators that are relevant at intermediate levels of respiration. We address this question by linking the functional degree of respiration to transcriptional regulation via enzyme abundances. Specifically, we investigated aerobic batch cultures with the differently repressive carbon sources glucose, mannose, galactose and pyruvate. Based on 13C flux analysis, we found that the respiratory contribution to cellular energy production was largely absent on glucose and mannose, intermediate on galactose and highest on pyruvate. In vivo abundances of 40 respiratory enzymes were quantified by GFP-fusions under each condition. During growth on the partly and fully respired substrates galactose and pyruvate, several TCA cycle and respiratory chain enzymes were significantly up-regulated. From these enzyme levels and the known regulatory network structure, we determined the probability for a given transcription factor to cause the coordinated expression changes. The most probable transcription factors to regulate the different degrees of respiration were Gcr1p, Cat8p, the Rtg-proteins and the Hap-complex. For the latter three ones we confirmed their importance for respiration by quantifying the degree of respiration and biomass yields in the corresponding deletion strains. Cat8p is required for wild-type like respiration, independent of its known activation of gluconeogenic genes. The Rtg-proteins and the Hap-complex are essential for wild-type like respiration under partially respiratory conditions. Under fully respiratory conditions, the Hap-complex, but not the Rtg-proteins are essential for respiration.

Long term carbon dioxide exchange above a mixed forest in the Belgian Ardennes: evaluation of different approaches to deduce total ecosystem respiration from Eddy covariance measurements

Science.gov (United States)

Jérôme, Elisabeth; Aubinet, Marc; Heinesch, Bernard

2010-05-01

The general aim of this research is to analyze inter annual variability of carbon dioxide (CO2) fluxes exchanged by a mixed forest located at the Vielsalm experimental site in Belgium. At this site, CO2 flux measurements started in 1996 and are still going on. Thirteen complete years of measurements are thus available. Net Ecosystem Exchange (NEE) inter annual variability may be driven by gross primary productivity (GPP) or Total Ecosystem Respiration (TER), which should thus be both quantified. Using flux partitioning methods, TER is deduced from NEE measurements. GPP is then obtained by subtracting TER from NEE. Initially, a robust estimation of TER is required. This work seeks to compare two independent approaches to assess TER in order to quantify the implications on inter-annual variability. The comparison was performed on twelve complete years. TER estimates can be deduced by extrapolating to the whole day NEE measurements taken during selected night or day periods. In both case, the extrapolation is performed by using a respiration response to temperature. The first approach, referred as the night-time approach, consisted in calculating TER using a temperature response function derived from night-time data sets (Reichstein et al., 2005). The second approach, referred as the daytime approach, consisted in assessing TER from the intercept of the NEE/Photosynthetically Photon Flux Density (PPFD) response (Wohlfahrt et al., 2005). For each approach, different modalities were compared: the use of long term (annual) or short term (15 days) data sets for the night-time approach and the use of different types of regression for the daytime approach. In addition, the impact of the temperature choice was studied for each of the approaches. For the night-time approach, main results showed that air temperature sensitivity of ecosystem respiration derived from annual data did not reflect the short-term air temperature sensitivity. Vielsalm is a summer active ecosystem

Elemental Concentration of Inhalable and Respirable Particulate ...

African Journals Online (AJOL)

20537 and respirable foam for I.O.M sampler. The elemental composition (Co, Ni, Zn, Cu, Fe, Pb, Cr, Mn and Cd) were analyzed by using Atomic Absorption Spectrophotometric (AAS). The data generated were subjected to descriptive analysis. In inhalable fraction,the enrichment factor ranged from 1-73.3 while in respirable ...

Respiration rate detection based on intensity modulation using plastic optical fiber

Science.gov (United States)

Anwar, Zawawi Mohd; Ziran Nurul Sufia, Nor; Hadi, Manap

2017-11-01

This paper presents the implementation of respiration rate measurement via a simple intensity-based optical fiber sensor using optical fiber technology. The breathing rate is measured based on the light intensity variation due to the longitudinal gap changes between two separated fibers. In order to monitor the breathing rate continuously, the output from the photodetector conditioning circuit is connected to a low-cost Arduino kit. At the sensing point, two optical fiber cables are positioned in series with a small gap and fitted inside a transparent plastic tube. To ensure smooth movement of the fiber during inhale and exhale processes as well as to maintain the gap of the fiber during idle condition, the fiber is attached firmly to a stretchable bandage. This study shows that this simple fiber arrangement can be applied to detect respiration activity which might be critical for patient monitoring.

Evaluation of respiration in compost landfill biocovers intended for methane oxidation

DEFF Research Database (Denmark)

Scheutz, Charlotte; Pedicone, Alessio; Pedersen, Gitte Bukh

2011-01-01

A low-cost alternative approach to reduce landfill gas (LFG) emissions is to integrate compost into the landfill cover design in order to establish a biocover that is optimized for biological oxidation of methane (CH4). A laboratory and field investigation was performed to quantify respiration...... in an experimental compost biocover in terms of oxygen (O2) consumption and carbon dioxide (CO2) production and emission rates. O2 consumption and CO2 production rates were measured in batch and column experiments containing compost sampled from a landfill biowindow at Fakse landfill in Denmark. Column gas...... concentration profiles were compared to field measurements. Column studies simulating compost respiration in the biowindow showed average CO2 production and O2 consumption rates of 107±14gm−2d−1 and 63±12gm−2d−1, respectively. Gas profiles from the columns showed elevated CO2 concentrations throughout...

Respiration rate detection based on intensity modulation using plastic optical fiber

Directory of Open Access Journals (Sweden)

Mohd Anwar Zawawi

2017-01-01

Full Text Available This paper presents the implementation of respiration rate measurement via a simple intensity-based optical fiber sensor using optical fiber technology. The breathing rate is measured based on the light intensity variation due to the longitudinal gap changes between two separated fibers. In order to monitor the breathing rate continuously, the output from the photodetector conditioning circuit is connected to a low-cost Arduino kit. At the sensing point, two optical fiber cables are positioned in series with a small gap and fitted inside a transparent plastic tube. To ensure smooth movement of the fiber during inhale and exhale processes as well as to maintain the gap of the fiber during idle condition, the fiber is attached firmly to a stretchable bandage. This study shows that this simple fiber arrangement can be applied to detect respiration activity which might be critical for patient monitoring.

[Soil Microbial Respiration Under Different Soil Temperature Conditions and Its Relationship to Soil Dissolved Organic Carbon and Invertase].

Science.gov (United States)

Wu, Jing; Chen, Shu-tao; Hu, Zheng-hua; Zhang, Xu

2015-04-01

In order to investigate the soil microbial respiration under different temperature conditions and its relationship to soil dissolved organic carbon ( DOC) and invertase, an indoor incubation experiment was performed. The soil samples used for the experiment were taken from Laoshan, Zijinshan, and Baohuashan. The responses of soil microbial respiration to the increasing temperature were studied. The soil DOC content and invertase activity were also measured at the end of incubation. Results showed that relationships between cumulative microbial respiration of different soils and soil temperature could be explained by exponential functions, which had P values lower than 0.001. The coefficient of temperature sensitivity (Q10 value) varied from 1.762 to 1.895. The Q10 value of cumulative microbial respiration decreased with the increase of soil temperature for all soils. The Q10 value of microbial respiration on 27 days after incubation was close to that of 1 day after incubation, indicating that the temperature sensitivity of recalcitrant organic carbon may be similar to that of labile organic carbon. For all soils, a highly significant ( P = 0.003 ) linear relationship between cumulative soil microbial respiration and soil DOC content could be observed. Soil DOC content could explain 31.6% variances of cumulative soil microbial respiration. For the individual soil and all soils, the relationship between cumulative soil microbial respiration and invertase activity could be explained by a highly significant (P soil microbial respiration.

Metabolic interactions between methanogenic consortia and anaerobic respiring bacteria

DEFF Research Database (Denmark)

Stams, A.J.; Oude Elferink, S.J.; Westermann, Peter

2003-01-01

Most types of anaerobic respiration are able to outcompete methanogenic consortia for common substrates if the respective electron acceptors are present in sufficient amounts. Furthermore, several products or intermediate compounds formed by anaerobic respiring bacteria are toxic to methanogenic...... consortia. Despite the potentially adverse effects, only few inorganic electron acceptors potentially utilizable for anaerobic respiration have been investigated with respect to negative interactions in anaerobic digesters. In this chapter we review competitive and inhibitory interactions between anaerobic...... respiring populations and methanogenic consortia in bioreactors. Due to the few studies in anaerobic digesters, many of our discussions are based upon studies of defined cultures or natural ecosystems...

MACVIA-LR (Fighting Chronic Diseases for Active and Healthy Ageing in Languedoc-Roussillon): A Success Story of the European Innovation Partnership on Active and Healthy Ageing.

Science.gov (United States)

Bousquet, J; Bourret, R; Camuzat, T; Augé, P; Bringer, J; Noguès, M; Jonquet, O; de la Coussaye, J E; Ankri, J; Cesari, M; Guérin, O; Vellas, B; Blain, H; Arnavielhe, S; Avignon, A; Combe, B; Canovas, G; Daien, C; Dray, G; Dupeyron, A; Jeandel, C; Laffont, I; Laune, D; Marion, C; Pastor, E; Pélissier, J Y; Galan, B; Reynes, J; Reuzeau, J C; Bedbrook, A; Granier, S; Adnet, P A; Amouyal, M; Alomène, B; Bernard, P L; Berr, C; Caimmi, D; Claret, P G; Costa, D J; Cristol, J P; Fesler, P; Hève, D; Millot-Keurinck, J; Morquin, D; Ninot, G; Picot, M C; Raffort, N; Roubille, F; Sultan, A; Touchon, J; Attalin, V; Azevedo, C; Badin, M; Bakhti, K; Bardy, B; Battesti, M P; Bobia, X; Boegner, C; Boichot, S; Bonnin, H Y; Bouly, S; Boubakri, C; Bourrain, J L; Bourrel, G; Bouix, V; Bruguière, V; Cade, S; Camu, W; Carre, V; Cavalli, G; Cayla, G; Chiron, R; Coignard, P; Coroian, F; Costa, P; Cottalorda, J; Coulet, B; Coupet, A L; Courrouy-Michel, M C; Courtet, P; Cros, V; Cuisinier, F; Danko, M; Dauenhauer, P; Dauzat, M; David, M; Davy, J M; Delignières, D; Demoly, P; Desplan, J; Dujols, P; Dupeyron, G; Engberink, O; Enjalbert, M; Fattal, C; Fernandes, J; Fouletier, M; Fraisse, P; Gabrion, P; Gellerat-Rogier, M; Gelis, A; Genis, C; Giraudeau, N; Goucham, A Y; Gouzi, F; Gressard, F; Gris, J C; Guillot, B; Guiraud, D; Handweiler, V; Hayot, M; Hérisson, C; Heroum, C; Hoa, D; Jacquemin, S; Jaber, S; Jakovenko, D; Jorgensen, C; Kouyoudjian, P; Lamoureux, R; Landreau, L; Lapierre, M; Larrey, D; Laurent, C; Léglise, M S; Lemaitre, J M; Le Quellec, A; Leclercq, F; Lehmann, S; Lognos, B; Lussert, Cj M; Makinson, A; Mandrick, K; Mares, P; Martin-Gousset, P; Matheron, A; Mathieu, G; Meissonnier, M; Mercier, G; Messner, P; Meunier, C; Mondain, M; Morales, R; Morel, J; Mottet, D; Nérin, P; Nicolas, P; Nouvel, F; Paccard, D; Pandraud, G; Pasdelou, M P; Pasquié, J L; Patte, K; Perrey, S; Pers, Y M; Portejoie, F; Pujol, J L E; Quantin, X; Quéré, I; Ramdani, S; Ribstein, J; Rédini-Martinez, I; Richard, S; Ritchie, K; Riso, J P; Rivier, F; Robine, J M; Rolland, C; Royère, E; Sablot, D; Savy, J L; Schifano, L; Senesse, P; Sicard, R; Stephan, Y; Strubel, D; Tallon, G; Tanfin, M; Tassery, H; Tavares, I; Torre, K; Tribout, V; Uziel, A; Van de Perre, P; Venail, F; Vergne-Richard, C; Vergotte, G; Vian, L; Vialla, F; Viart, F; Villain, M; Viollet, E; Ychou, M; Mercier, J

2016-01-01

The Région Languedoc Roussillon is the umbrella organisation for an interconnected and integrated project on active and healthy ageing (AHA). It covers the 3 pillars of the European Innovation Partnership on Active and Healthy Ageing (EIP on AHA): (A) Prevention and health promotion, (B) Care and cure, (C) and (D) Active and independent living of elderly people. All sub-activities (poly-pharmacy, falls prevention initiative, prevention of frailty, chronic respiratory diseases, chronic diseases with multimorbidities, chronic infectious diseases, active and independent living and disability) have been included in MACVIA-LR which has a strong political commitment and involves all stakeholders (public, private, patients, policy makers) including CARSAT-LR and the Eurobiomed cluster. It is a Reference Site of the EIP on AHA. The framework of MACVIA-LR has the vision that the prevention and management of chronic diseases is essential for the promotion of AHA and for the reduction of handicap. The main objectives of MACVIA-LR are: (i) to develop innovative solutions for a network of Living labs in order to reduce avoidable hospitalisations and loss of autonomy while improving quality of life, (ii) to disseminate the innovation. The three years of MACVIA-LR activities are reported in this paper.

Development of an Advanced Respirator Fit Test Headform (Postprint)

Science.gov (United States)

2012-11-01

N95 filtering facepiece respirators (FFRs) for pro - tection studies against viable airborne particles. A Static (i.e., non-moving, non-speaking...requiredto wear respirators to reduce their exposure to air- borne hazards.(1) The U.S. Occupational Safety and Health Administration ( OSHA ) Respiratory...13 workplace protection factors.(9,10). Inward leakage (IL) of con - taminants into a respirator facepiece has been described as a combination of

Short term effects of fire on soil respiration in Peruvian Amazon

Science.gov (United States)

Suarez, L. F.; Kruijt, B.

2008-05-01

Severe changes are affecting the role of Amazon in the Earth system. One of these possible effects could be the modification of the role of soils in the carbon cycle due to land use and land cover change activities mainly involving the change of forest by crops. In this sense, fire is the main tool used by farmers for land use and also is an important factor for mobilizing C from the soil to the atmosphere, mainly as CO2. This could have an important effect in the global warming. This proposal will evaluate the variation of the soil respiration related to the seasonality and the fire effects on soils in the Amazon of Peru and Brazil. In experimental locations of Peru with different vegetation cover (forest and pasture), we measured soil respiration along with the organic carbon and the microbial biomass of soils during campaigns covering wet and dry seasons. Complementary measurements of soil temperature, water and nutrient content were performed. Also, we reproduced a fire experiment simulating agricultural local activity by the technique of "slash and burn" to evaluate fire effects on soil respiration. Measurements were taken after the soil cooled and at least 3 days after the fire. Additionally, the carbon stocks of the subplots were evaluated. Evaluation of the variations of CO2 fluxes and the capacity of adaptation to fire and water content are discussed through the comparisons of the different locations, type of soils and concentration of available N (nitrate and ammonium) as an indicator of nutrient content.

Diffusive fractionation complicates isotopic partitioning of autotrophic and heterotrophic sources of soil respiration.

Science.gov (United States)

Moyes, Andrew B; Gaines, Sarah J; Siegwolf, Rolf T W; Bowling, David R

2010-11-01

Carbon isotope ratios (δ¹³C) of heterotrophic and rhizospheric sources of soil respiration under deciduous trees were evaluated over two growing seasons. Fluxes and δ¹³C of soil respiratory CO₂ on trenched and untrenched plots were calculated from closed chambers, profiles of soil CO₂ mole fraction and δ¹³C and continuous open chambers. δ¹³C of respired CO₂ and bulk carbon were measured from excised leaves and roots and sieved soil cores. Large diel variations (>5‰) in δ¹³C of soil respiration were observed when diel flux variability was large relative to average daily fluxes, independent of trenching. Soil gas transport modelling supported the conclusion that diel surface flux δ¹³C variation was driven by non-steady state gas transport effects. Active roots were associated with high summertime soil respiration rates and around 1‰ enrichment in the daily average δ¹³C of the soil surface CO₂ flux. Seasonal δ¹³C variability of about 4‰ (most enriched in summer) was observed on all plots and attributed to the heterotrophic CO₂ source. © 2010 Blackwell Publishing Ltd.

Global variability in leaf respiration in relation to climate and leaf traits

Science.gov (United States)

Atkin, Owen K.

2015-04-01

Leaf respiration plays a vital role in regulating ecosystem functioning and the Earth's climate. Because of this, it is imperative that that Earth-system, climate and ecosystem-level models be able to accurately predict variations in rates of leaf respiration. In the field of photosynthesis research, the F/vC/B model has enabled modellers to accurately predict variations in photosynthesis through time and space. By contrast, we lack an equivalent biochemical model to predict variations in leaf respiration. Consequently, we need to rely on phenomenological approaches to model variations in respiration across the Earth's surface. Such approaches require that we develop a thorough understanding of how rates of respiration vary among species and whether global environmental gradients play a role in determining variations in leaf respiration. Dealing with these issues requires that data sets be assembled on rates of leaf respiration in biomes across the Earth's surface. In this talk, I will use a newly-assembled global database on leaf respiration and associated traits (including photosynthesis) to highlight variation in leaf respiration (and the balance between respiration and photosynthesis) across global gradients in growth temperature and aridity.

Respiration and carbon dynamics of free-living and particle-attached bacteria in coastal waters of NE Pacific

Science.gov (United States)

Guo, C.; Ke, Y.; Liu, H.

2016-02-01

Bacterial respiration (BR) rates are fundamental to understand the role of bacteria in carbon flow in aquatic ecosystem, and therefore it is critical to obtain reliable measurements. Prefiltration- (mostly 1-3μm) and dark-incubation- (mostly 24 h) based direct measurements of oxygen consumption have been the most commonly used method for BR. However, the prefiltration procedure and long incubation time may cause change of the bacterial abundance and structure, leading to inaccurate measurements. In this study, by measuring bacterial abundance, production and respiration of both particle-attached (PA) and free-living (FL) bacteria at two contrasting site in coastal NE Pacific from Nov 2014 to Mar 2015, we found that the 24 h growth rate of FL bacteria in the traditional BR incubations were significantly higher for 30% and 54% than those obtained for FL and total (FL+PA) bacteria in unfiltered incubations respectively, suggesting removal of protist grazers could cause a significant biomass accumulation during 24 h incubation than the in situ condition. This biomass overestimation resulted in 40% (±12%) overestimation of measured FL BR rates compared with the corrected in situ FL BR. Nevertheless, for the corrected in situ total BR, the rates were overestimated by traditional method in three measurements over nine for 6-46%, and were underestimated in the rest six measurements for 7-67%. Interestingly, those underestimations were attributed to the ignorance of PA bacteria due to prefiltration, which had larger cell size than the FL bacteria, accounted for 19% (±16%) in total bacterial abundance, and contributed to 50% (±19%) of total bacterial production. The average bacterial growth efficiency calculated by comparable 24 h integrated bacterial production and respiration was 0.42 (±0.24). Our results confirmed two major flaws in the current BR methodology, i.e., 1) it only measures the respiration of FL bacteria, and 2) the removal of grazers causing dramatic

Estimating daytime ecosystem respiration from eddy-flux data

DEFF Research Database (Denmark)

Bruhn, Dan; Mikkelsen, Teis Nørgaard; Herbst, Mathias

2011-01-01

To understand what governs the patterns of net ecosystem exchange of CO2, an understanding of factors influencing the component fluxes, ecosystem respiration and gross primary production is needed. In the present paper, we introduce an alternative method for estimating daytime ecosystem respiration...... based on whole ecosystem fluxes from a linear regression of photosynthetic photon flux density data vs. daytime net ecosystem exchange data at forest ecosystem level. This method is based on the principles of the Kok-method applied at leaf level for estimating daytime respiration. We demonstrate...

Respirator studies for the Nuclear Regulatory Commission (NRC)

International Nuclear Information System (INIS)

Skaggs, B.J.; Fairchild, C.I.; DeField, J.D.; Hack, A.L.

1985-01-01

A project of the Health, Safety and Environment Division is described. The project provides the NRC with information of respiratory protective devices and programs for their licensee personnel. The following activities were performed during FY 1983: selection of alternate test aerosols for quality assurance testing of high-efficiency particulate air respirator filters; evaluation of MAG-1 spectacles for use with positive and negative-pressure respirators; development of a Manual of Respiratory Protection in Emergencies Involving Airborne Radioactive Materials, and technical assistance to NRC licensees regarding respirator applications. 2 references, 1 figure

Changes in soil respiration after thinning activities in dense Aleppo pine forests