WorldWideScience

Sample records for resistance phenotype mdr

  1. In vivo detection of multidrug-resistant (MDR1) phenotype by technetium-99m sestamibi scan in untreated breast cancer patients

    International Nuclear Information System (INIS)

    Del Vecchio, S.; Ciarmiello, A.; Potena, M.I.; Carriero, M.V.; Mainolfi, C.; Botti, G.; Thomas, R.; Cerra, M.; D'Aiuto, G.; Tsuruo, T.; Salvatore, M.

    1997-01-01

    Technetium-99m sestamibi is a transport substrate recognised by the multidrug-resistant P-glycoprotein (Pgp). To test whether 99m Tc-sestamibi efflux is enhanced in breast carcinomas overexpressing Pgp, we determined the efflux rates of 99m Tc-sestamibi and Pgp levels in tumours from 30 patients with untreated breast carcinoma. Patients were intravenously injected with 740 MBq of 99m Tc-sestamibi and underwent a 15-min dynamic study followed by the acquisition of static planar images at 0.5, 1, 2 and 4 h. Tumour specimens were obtained from each patient 24 h after 99m Tc-sestamibi scan and Pgp levels were determined using 125 I-MRK16 monoclonal antibody and in vitro quantitative autoradiography. All breast carcinomas showed high uptake of 99m Tc-sestamibi and data from region of interest analysis on sequential images were fitted with a monoexponential function. The efflux rates of 99m Tc-sestamibi, calculated from decay-corrected time-activity curves, ranged between 0.00121 and 0.01690 min -1 and were directly correlated with Pgp levels measured in the same tumours (r=0.62; P 99m Tc-sestamibi efflux from tumours of group A was 2.7 times higher than that observed in tumours of group B (0.00686 ±0.00390 min -1 vs 0.00250 ±0.00090 min -1 , P 99m Tc-sestamibi showed a sensitivity and a specificity of 80% and 95%, respectively. In conclusion, the efflux rate of 99m Tc-sestamibi may be used for the in vivo identification of the multidrug resistant (MDR1) phenotype in untreated breast cancer patients. (orig.). With 7 figs., 3 tabs

  2. Impact of BCRP/MXR, MRP1 and MDR1/P-Glycoprotein on thermoresistant variants of atypical and classical multidrug resistant cancer cells

    DEFF Research Database (Denmark)

    Stein, Ulrike; Lage, Hermann; Jordan, Andreas

    2002-01-01

    The impact of the ABC transporters breast cancer resistance protein/mitoxantrone resistance associated transporter (BCRP/MXR), multidrug resistance-associated protein 1 (MRP1) and multidrug resistance gene-1/P-glycoprotein (MDR1/PGP) on the multidrug resistance (MDR) phenotype in chemoresistance...... expression of BCRP/MXR and of MRP1 were clearly enhanced (vs. parental and classical MDR lines). MDR1/PGP expression was distinctly elevated in the classical MDR subline EPG85-257RDB (vs. parental and atypical MDR sublines). In all thermoresistant counterparts basal expression of BCRP/MXR, MRP1 and MDR1/PGP...... was increased relative to thermosensitive sublines. Although it could be shown that the overexpressed ABC transporters were functionally active, however, no decreased drug accumulations of doxorubicin, mitoxantrone and rhodamine 123 were observed. Thus, expression of BCRP/MXR, MRP1 and MDR1/PGP was found...

  3. Carcinogen-induced mdr overexpression is associated with xenobiotic resistance in rat preneoplastic liver nodules and hepatocellular carcinomas.

    Science.gov (United States)

    Fairchild, C R; Ivy, S P; Rushmore, T; Lee, G; Koo, P; Goldsmith, M E; Myers, C E; Farber, E; Cowan, K H

    1987-11-01

    We have previously reported the isolation of a human breast cancer cell line resistant to doxorubicin (adriamycin; AdrR MCF-7 cells) that has also developed the phenotype of multidrug resistance (MDR). MDR in this cell line is associated with increased expression of mdr (P glycoprotein) gene sequences. The development of MDR in AdrR MCF-7 cells is also associated with changes in the expression of several phase I and phase II drug-detoxifying enzymes. These changes are remarkably similar to those associated with development of xenobiotic resistance in rat hyperplastic liver nodules, a well-studied model system of chemical carcinogenesis. Using an mdr-encoded cDNA sequence isolated from AdrR MCF-7 cells, we have examined the expression of mdr sequences in rat livers under a variety of experimental conditions. The expression of mdr increased 3-fold in regenerating liver. It was also elevated (3- to 12-fold) in several different samples of rat hyperplastic nodules and in four of five hepatomas that developed in this system. This suggests that overexpression of mdr, a gene previously associated with resistance to antineoplastic agents, may also be involved in the development of resistance to xenobiotics in rat hyperplastic nodules. In addition, although the acute administration of 2-acetylaminofluorene induced an 8-fold increase in hepatic mdr-encoded RNA, performance of a partial hepatectomy either before or after administration of 2-acetylaminofluorene resulted in a greater than 80-fold increase in mdr gene expression over that in normal untreated livers. This represents an important in vivo model system in which to study the acute regulation of this drug resistance gene.

  4. Quantitative analysis of MDR1 (multidrug resistance) gene expression in human tumors by polymerase chain reaction

    International Nuclear Information System (INIS)

    Noonan, K.E.; Beck, C.; Holzmayer, T.A.; Chin, J.E.; Roninson, I.B.; Wunder, J.S.; Andrulis, I.L.; Gazdar, A.F.; Willman, C.L.; Griffith, B.; Von Hoff, D.D.

    1990-01-01

    The resistance of tumor cells ot chemotheraprutic drugs is a major obstacle to successful cancer chemotherapy. In human cells, expression of the MDR1 gene, encoding a transmembrane efflux pump (P-glycoprotein), leads to decreased intracellular accumulation and resistance to a variety of lipophilic drugs (multidrug resistance; MDR). The levels of MDR in cell lines selected in bitro have been shown to correlate with the steady-state levels of MDR1 mRNA and P-glycoprotein. In cells with a severalfold increase in cellular drug resistance, MDR1 expression levels are close to the limits of detection by conventional assays. MDR1 expression has been frequently observed in human tumors after chemotherapy and in some but not all types of clinically refactory tumors untreated with chemotherapeutic drugs. The authors have devised a highly sensitive, specific, and quantitative protocol for measuring the levels of MDR1 mRNA in clincal samples, based on the polymerase chain reaction. They have used this assay to measure MDR1 gene expression in MDR cell lines and >300 normal tissues, tumor-derived cell lines, and clinical specimens of untreated tumors of the types in which MDR1 expression was rarely observed by standard assays. Low levels of MDR1 expression were found by polymerase chain reaction in most solid tumors and leukemias tested. The frequency of samples without detectable MDR1 expression varied among different types of tumors; MDR1-negative samples were ost common among tumor types known to be relatively responsive to chemotherapy

  5. Treatment Outcomes of Patients with Multidrug-Resistant Tuberculosis (MDR- TB) Compared with Non-MDR-TB Infections in Peninsular Malaysia.

    Science.gov (United States)

    Elmi, Omar Salad; Hasan, Habsah; Abdullah, Sarimah; Mat Jeab, Mat Zuki; Ba, Zilfalil; Naing, Nyi Nyi

    2016-07-01

    Treating patients with multidrug-resistant tuberculosis (MDR-TB) strains is more complicated, complex, toxic, expensive, than treating patients with susceptible TB strains. This study aims to compare the treatment outcomes and potential factors associated between patients with MDR-TB and non MDR TB infections in peninsular Malaysia. This study was a retrospective cohort study. Data were collected from the medical records of all registered MDR-TB patients and Non-MDR-TB patients at five TB hospitals in peninsular Malaysia from January 2010 to January 2014. A total of 314 subjects were studied, including 105 MDR-TB cases and 209 non-MDR-TB. After TB treatment, 24.8% of the MDR-TB patients and 17.7% of non MDR TB relapsed; 17.1% of the MDR-TB patients and 16.3% of non MDR TB defaulted from TB treatment. A significant difference seen in treatment success rate 17.1% for MDR-TB; 63.1% for non MDR TB (P history of TB treatment, and presence of HIV infection.

  6. Splice form variant and amino acid changes in MDR49 confers DDT resistance in transgenic Drosophila.

    Science.gov (United States)

    Seong, Keon Mook; Sun, Weilin; Clark, John M; Pittendrigh, Barry R

    2016-03-22

    The ATP-binding cassette (ABC) transporters represent a superfamily of proteins that have important physiological roles in both prokaryotes and eukaryotes. In insects, ABC transporters have previously been implicated in insecticide resistance. The 91-R strain of Drosophila melanogaster has been intensely selected with DDT over six decades. A recent selective sweeps analysis of 91-R implicated the potential role of MDR49, an ABC transporter, in DDT resistance, however, to date the details of how MDR49 may play a role in resistance have not been elucidated. In this study, we investigated the impact of structural changes and an alternative splicing event in MDR49 on DDT-resistance in 91-R, as compared to the DDT susceptible strain 91-C. We observed three amino acid differences in MDR49 when 91-R was compared with 91-C, and only one isoform (MDR49B) was implicated in DDT resistance. A transgenic Drosophila strain containing the 91-R-MDR49B isoform had a significantly higher LD50 value as compared to the 91-C-MDR49B isoform at the early time points (6 h to 12 h) during DDT exposure. Our data support the hypothesis that the MDR49B isoform, with three amino acid mutations, plays a role in the early aspects of DDT resistance in 91-R.

  7. Isolation, Characterization and Anti-Multiple Drug Resistant (MDR ...

    African Journals Online (AJOL)

    (MDR) Bacterial Activity of Endophytic Fungi Isolated from ... Institute of Protection & Development of Beibu Wan Ocean Resources, Qinzhou University, Qinzhou, Guangxi Province, ..... isolated from secondary metabolites of the mangrove.

  8. Phenotypic Resistance to Antibiotics

    Directory of Open Access Journals (Sweden)

    Jose L. Martinez

    2013-04-01

    Full Text Available The development of antibiotic resistance is usually associated with genetic changes, either to the acquisition of resistance genes, or to mutations in elements relevant for the activity of the antibiotic. However, in some situations resistance can be achieved without any genetic alteration; this is called phenotypic resistance. Non-inherited resistance is associated to specific processes such as growth in biofilms, a stationary growth phase or persistence. These situations might occur during infection but they are not usually considered in classical susceptibility tests at the clinical microbiology laboratories. Recent work has also shown that the susceptibility to antibiotics is highly dependent on the bacterial metabolism and that global metabolic regulators can modulate this phenotype. This modulation includes situations in which bacteria can be more resistant or more susceptible to antibiotics. Understanding these processes will thus help in establishing novel therapeutic approaches based on the actual susceptibility shown by bacteria during infection, which might differ from that determined in the laboratory. In this review, we discuss different examples of phenotypic resistance and the mechanisms that regulate the crosstalk between bacterial metabolism and the susceptibility to antibiotics. Finally, information on strategies currently under development for diminishing the phenotypic resistance to antibiotics of bacterial pathogens is presented.

  9. Modulation of human multidrug-resistance MDR-1 gene by natural curcuminoids

    Directory of Open Access Journals (Sweden)

    Buddhasukh Duang

    2004-04-01

    Full Text Available Abstract Background Multidrug resistance (MDR is a phenomenon that is often associated with decreased intracellular drug accumulation in patient's tumor cells resulting from enhanced drug efflux. It is related to the overexpression of a membrane protein, P-glycoprotein (Pgp-170, thereby reducing drug cytotoxicity. A variety of studies have tried to find MDR modulators which increase drug accumulation in cancer cells. Methods In this study, natural curcuminoids, pure curcumin, demethoxycurcumin and bisdemethoxycurcumin, isolated from turmeric (Curcuma longa Linn, were compared for their potential ability to modulate the human MDR-1 gene expression in multidrug resistant human cervical carcinoma cell line, KB-V1 by Western blot analysis and RT-PCR. Results Western blot analysis and RT-PCR showed that all the three curcuminoids inhibited MDR-1 gene expression, and bisdemethoxycurcumin produced maximum effect. In additional studies we found that commercial grade curcuminoid (approximately 77% curcumin, 17% demethoxycurcumin and 3% bisdemthoxycurcumin decreased MDR-1 gene expression in a dose dependent manner and had about the same potent inhibitory effect on MDR-1 gene expression as our natural curcuminoid mixtures. Conclusion These results indicate that bisdemethoxycurcumin is the most active of the curcuminoids present in turmeric for modulation of MDR-1 gene. Treatment of drug resistant KB-V1 cells with curcumin increased their sensitivity to vinblastine, which was consistent with a decreased MDR-1 gene product, a P-glycoprotein, on the cell plasma membrane. Although many drugs that prevent the P-glycoprotein function have been reported, this report describes the inhibition of MDR-1 expression by a phytochemical. The modulation of MDR-1 expression may be an attractive target for new chemosensitizing agents.

  10. Modulation of human multidrug-resistance MDR-1 gene by natural curcuminoids

    International Nuclear Information System (INIS)

    Limtrakul, Pornngarm; Anuchapreeda, Songyot; Buddhasukh, Duang

    2004-01-01

    Multidrug resistance (MDR) is a phenomenon that is often associated with decreased intracellular drug accumulation in patient's tumor cells resulting from enhanced drug efflux. It is related to the overexpression of a membrane protein, P-glycoprotein (Pgp-170), thereby reducing drug cytotoxicity. A variety of studies have tried to find MDR modulators which increase drug accumulation in cancer cells. In this study, natural curcuminoids, pure curcumin, demethoxycurcumin and bisdemethoxycurcumin, isolated from turmeric (Curcuma longa Linn), were compared for their potential ability to modulate the human MDR-1 gene expression in multidrug resistant human cervical carcinoma cell line, KB-V1 by Western blot analysis and RT-PCR. Western blot analysis and RT-PCR showed that all the three curcuminoids inhibited MDR-1 gene expression, and bisdemethoxycurcumin produced maximum effect. In additional studies we found that commercial grade curcuminoid (approximately 77% curcumin, 17% demethoxycurcumin and 3% bisdemthoxycurcumin) decreased MDR-1 gene expression in a dose dependent manner and had about the same potent inhibitory effect on MDR-1 gene expression as our natural curcuminoid mixtures. These results indicate that bisdemethoxycurcumin is the most active of the curcuminoids present in turmeric for modulation of MDR-1 gene. Treatment of drug resistant KB-V1 cells with curcumin increased their sensitivity to vinblastine, which was consistent with a decreased MDR-1 gene product, a P-glycoprotein, on the cell plasma membrane. Although many drugs that prevent the P-glycoprotein function have been reported, this report describes the inhibition of MDR-1 expression by a phytochemical. The modulation of MDR-1 expression may be an attractive target for new chemosensitizing agents

  11. Significance of MDR1 and multiple drug resistance in refractory human epileptic brain

    Directory of Open Access Journals (Sweden)

    Dini Gabriele

    2004-10-01

    Full Text Available Abstract Background The multiple drug resistance protein (MDR1/P-glycoprotein is overexpressed in glia and blood-brain barrier (BBB endothelium in drug refractory human epileptic tissue. Since various antiepileptic drugs (AEDs can act as substrates for MDR1, the enhanced expression/function of this protein may increase their active extrusion from the brain, resulting in decreased responsiveness to AEDs. Methods Human drug resistant epileptic brain tissues were collected after surgical resection. Astrocyte cell cultures were established from these tissues, and commercially available normal human astrocytes were used as controls. Uptake of fluorescent doxorubicin and radioactive-labeled Phenytoin was measured in the two cell populations, and the effect of MDR1 blockers was evaluated. Frozen human epileptic brain tissue slices were double immunostained to locate MDR1 in neurons and glia. Other slices were exposed to toxic concentrations of Phenytoin to study cell viability in the presence or absence of a specific MDR1 blocker. Results MDR1 was overexpressed in blood vessels, astrocytes and neurons in human epileptic drug-resistant brain. In addition, MDR1-mediated cellular drug extrusion was increased in human 'epileptic' astrocytes compared to 'normal' ones. Concomitantly, cell viability in the presence of cytotoxic compounds was increased. Conclusions Overexpression of MDR1 in different cell types in drug-resistant epileptic human brain leads to functional alterations, not all of which are linked to drug pharmacokinetics. In particular, the modulation of glioneuronal MDR1 function in epileptic brain in the presence of toxic concentrations of xenobiotics may constitute a novel cytoprotective mechanism.

  12. Genome sequencing and annotation of multidrug resistant Mycobacterium tuberculosis (MDR-TB PR10 strain

    Directory of Open Access Journals (Sweden)

    Mohd Zakihalani A. Halim

    2016-03-01

    Full Text Available Here, we report the draft genome sequence and annotation of a multidrug resistant Mycobacterium tuberculosis strain PR10 (MDR-TB PR10 isolated from a patient diagnosed with tuberculosis. The size of the draft genome MDR-TB PR10 is 4.34 Mbp with 65.6% of G + C content and consists of 4637 predicted genes. The determinants were categorized by RAST into 400 subsystems with 4286 coding sequences and 50 RNAs. The whole genome shotgun project has been deposited at DDBJ/EMBL/GenBank under the accession number CP010968. Keywords: Mycobacterium tuberculosis, Genome, MDR, Extrapulmonary

  13. Development of PET and SPECT radiopharmaceuticals to study multi-drug resistance (MDR)

    International Nuclear Information System (INIS)

    Katsififs, A.; Dikic, B.; Greguric, I.; Knott, R.; Mattner, F.

    2002-01-01

    Full text: Cellular resistance or Multidrug Resistance (MDR) to cytotoxic agents is the major cause of treatment failure in many human cancers. P-glycoprotein (Pgp), a Mr 17,0000 transmembrane protein and Multi Resistance Protein (MRP) are two proteins that are over expressed and confer resistance to a large number of chemotherapeutic agents by enhancing their extracellular transport. P-glycoprotein is expressed at a relative high level in treated and untreated human malignant tumours, including renal, colonic, adrenal, hepatocellular carcinoma and a considerable percentage of breast carcinomas. 99m Tc-Sestamibi, a lipophilic cationic complex is a transport substrate for Pgp. In clinical studies of human neoplasms it was found that tumour uptake and clearance of this tracer correlate with Pgp expression and may be used for the phenotypic assessment of MDR. However, new tracers with better substrate specificity for Pgp and other drug transporters would greatly assist in optimising chemotherapeutic treatment and improving patient management by predicting tumour response to therapy and to assist in the development of antagonists, which may reverse or halt MDR. The aim of this project is therefore to develop PET and SPECT radiopharmaceuticals with improved affinity and selectivity for Pgp and MRP for the clinical evaluation of MDR in cancer patients. To optimise cellular transport characteristics, a number of chemical families that have been found to be substrates of Pgp and other drug efflux pumps, will be investigated. In the first instance, a series of drugs based on the flavonol natural product, Quercetin will be developed, screened for MDR and radiolabelled with PET and SPECT isotopes. Quercetin and related flavonol derivatives have been selected for this project because of their moderate to good affinity for Pgp. With the assistance of molecular modeling and in vitro studies, structural modification will be undertaken to improve the specificity and affinity for

  14. Multiple drug resistance protein (MDR-1, multidrug resistance-related protein (MRP and lung resistance protein (LRP gene expression in childhood acute lymphoblastic leukemia

    Directory of Open Access Journals (Sweden)

    Elvis Terci Valera

    Full Text Available CONTEXT: Despite the advances in the cure rate for acute lymphoblastic leukemia, approximately 25% of affected children suffer relapses. Expression of genes for the multiple drug resistance protein (MDR-1, multidrug resistance-related protein (MRP, and lung resistance protein (LRP may confer the phenotype of resistance to the treatment of neoplasias. OBJECTIVE: To analyze the expression of the MDR-1, MRP and LRP genes in children with a diagnosis of acute lymphoblastic leukemia via the semiquantitative reverse transcription polymerase chain reaction (RT-PCR, and to determine the correlation between expression and event-free survival and clinical and laboratory variables. DESIGN: A retrospective clinical study. SETTING: Laboratory of Pediatric Oncology, Department of Pediatrics, Faculdade de Medicina de Ribeirão Preto, Universidade de São Paulo, Brazil. METHODS: Bone marrow aspirates from 30 children with a diagnosis of acute lymphoblastic leukemia were assessed for the expression of messenger RNA for the MDR-1, MRP and LRP genes by semi-quantitative RT-PCR. RESULTS: In the three groups studied, only the increased expression of LRP was related to worsened event-free survival (p = 0.005. The presence of the common acute lymphoblastic leukemia antigen (CALLA was correlated with increased LRP expression (p = 0.009 and increased risk of relapse or death (p = 0.05. The relative risk of relapse or death was six times higher among children with high LRP expression upon diagnosis (p = 0.05, as confirmed by multivariate analysis of the three genes studied (p = 0.035. DISCUSSION: Cell resistance to drugs is a determinant of the response to chemotherapy and its detection via RT-PCR may be of clinical importance. CONCLUSIONS: Evaluation of the expression of genes for resistance to antineoplastic drugs in childhood acute lymphoblastic leukemia upon diagnosis, and particularly the expression of the LRP gene, may be of clinical relevance, and should be the

  15. Radiosensitivity of a monoclonal human lung adenocarcinoma cell line with MDR phenotype induced by CDDP: an in vitro study

    International Nuclear Information System (INIS)

    Zhang Junxiang; Kong Zhaolu; Shen Zhifen; Tong Shungao; Jin Yizun

    2006-01-01

    The study was to evaluate radiosensitivity of a monoclonal human lung adenocarcinoma cell line SPC-A-1/CDDP-4 with MDR phenotype induced by cisplatin (CDDP) compared with its parental cell SPC-A-1 in vitro. The glutathione (GSH) content and the radiosensitivity of SPC-A-1/CDDP-4 and SPC-A-1 cells were investigated in aerobic and under hypoxia, respectively. The radiosensitization effect of buthionine sulfoximine (BSO), an inhibitor of glutathione (GSH) synthesis, to SPC-A-1/CDDP-4 and SPC-A-1 cells was observed. The results indicated that the monoclonal human lung adenocarcinoma cell line SPC-A-1/CDDP-4 showed, to some extent, a cross-resistance to 137 Cs γ-ray, in addition to its resistance to anticancer drugs (CDDP, ADM, MTX and VCR). The GSH content of SPC-A-1/CDDP-4 cells was higher than that of SPC-A-1 cells both in aerobic and under hypoxia which might account for it. BSO had radiosensitization effect to SPC-A-1/CDDP-4 and SPC-A-1 cells both in aerobic and under hypoxia, but it was stronger under hypoxia than in aerobic and it was stronger to SPC-A-1/CDDP-4 cells than to SPC-A-1 cells. (authors)

  16. Detection of expression and modulation of multidrug-resistance (MDR) and establishment of a new bioassay

    International Nuclear Information System (INIS)

    Berger, W.

    1993-08-01

    The present thesis deals with the resistance of human malignant cells against cellular toxicity of anticancer drugs, a phenomenon representing one of the major obstacles to successful chemotherapy. One mechanism underlying a cross-resistance to different drugs called multidrug resistance (MDR) is characterized by the expression of an active transport protein (P-glycoprotein), causing decreased intracellular drug retention and cytotoxicity. The main subjects of the present work were to establish different detection methods for MDR and its modulation (by substances blocking activity of P-glycoprotein) including immunological methods (immunocytochemistry, radioimmunoassay), molecular biology (slot-blot analysis, in-situ hybridization) and functional assays (drug-accumulation analysis, drug-cytotoxicity analysis). The methods were evaluated and compared using human and mouse MDR control cell lines and human tumor cell lines established in our laboratory. In cell lines derived from human melanoma - a malignancy insensitive to chemotherapy - expression of P-glycoprotein of relatively low transporting activity was detected by different methods in 8 of 33 cases. Furthermore a new sensitive in vitro assay for the functional detection of MDR was established using the biological features of cytochalasins, a microfilament disrupting substance group. These compounds were shown to be substrates for the P-glycoprotein efflux pump and their effects on cell division (blockade of cytokinesis resulting in multinucleate cells) correlated with MDR-activity of the tested cells. With this new assay P-glycoprotein activity can be demonstrated and analysed over a wide range of resistance against different cytotoxic drugs. Therefore it may by a suitable tool for research and diagnosis in the field of drug resistance

  17. Asiatic Acid (AA) Sensitizes Multidrug-Resistant Human Lung Adenocarcinoma A549/DDP Cells to Cisplatin (DDP) via Downregulation of P-Glycoprotein (MDR1) and Its Targets.

    Science.gov (United States)

    Cheng, Qilai; Liao, Meixiang; Hu, Haibo; Li, Hongliang; Wu, Longhuo

    2018-01-01

    P-glycoprotein (P-gp, i.e., MDR1) is associated with the phenotype of multidrug resistance (MDR) and causes chemotherapy failure in the management of cancers. Searching for effective MDR modulators and combining them with anticancer drugs is a promising strategy against MDR. Asiatic acid (AA), a natural triterpene isolated from the plant Centella asiatica, may have an antitumor activity. The present study assessed the reversing effect of AA on MDR and possible molecular mechanisms of AA action in MDR1-overexpressing cisplatin (DDP)-resistant lung cancer cells, A549/DDP. Human lung adenocarcinoma A549/DDP cells were either exposed to different concentrations of AA or treated with DDP, and their viability was measured by the MTT assay. A Rhodamine 123 efflux assay, immunofluorescent staining, ATPase assay, reverse-transcription PCR (RT-PCR), and western blot analysis were conducted to elucidate the mechanisms of action of AA on MDR. Our results showed that AA significantly enhanced the cytotoxicity of DDP toward A549/DDP cells but not its parental A549 cells. Furthermore, AA strongly inhibited P-gp expression by blocking MDR1 gene transcription and increased the intracellular accumulation of the P-gp substrate Rhodamine 123 in A549/DDP cells. Nuclear factor (NF)-kB (p65) activity, IkB degradation, and NF-kB/p65 nuclear translocation were markedly inhibited by pretreatment with AA. Additionally, AA inhibited the MAPK-ERK pathway, as indicated by decreased phosphorylation of ERK1 and -2, AKT, p38, and JNK, thus resulting in reduced activity of the Y-box binding protein 1 (YB1) via blockage of its nuclear translocation. AA reversed P-gp-mediated MDR by inhibition of P-gp expression. This effect was likely related to downregulation of YB1, and this effect was mediated by the NF-kB and MAPK-ERK pathways. AA may be useful as an MDR reversal agent for combination therapy in clinical trials. © 2018 The Author(s). Published by S. Karger AG, Basel.

  18. Psychiatric disorders in patients with multidrug resistant tuberculosis (MDR-TB in Sardjito Hospital, Yogyakarta, Indonesia

    Directory of Open Access Journals (Sweden)

    Irwan Supriyanto

    2017-08-01

    Full Text Available Introduction: Tuberculosis has become a chronic debilitating disease in developing countries, particularly after the emergence of multidrug resistant tuberculosis (MDR-TB. Second line treatments for the disease which were subsequently developed were associated with psychiatric disorders among patients. Psychiatric disorder can either be induced by treatment regiments or psychosocial factors. Cycloserine administration is frequently reported to be associated with psychiatric disorders. In this study, we examined the prevalence and characteristics of psychiatric disorders among MDR-TB patients in Sardjito Hospital, Yogyakarta, Indonesia. Methods: In this descriptive study, we studied medical records of MDR-TB patients admitted for MDR-TB treatments to Sardjito Hospital from January 2014 to July 2016 and screened for psychiatric disorders. Results: We found that 32.8% of the patients had psychiatric disorders, some of which had multiple psychiatric diagnoses (14.1%. The diagnoses were medication induced delirium, substance/medication induced psychotic disorder, substance/medication use depressive disorder, depressive type schizoaffective disorder, bipolar I disorder current episode severe manic with psychotic features, mild depression, moderate depression, major depression without psychotic features, major depression with psychotic features, adjustment disorders with mixed anxiety and depressed mood, adjustment disorder with anxiety, acute stress disorder, and insomnia. Psychiatric disorders were significantly associated with cycloserine dose and sex. Psychotic symptoms were significantly associated with sex and level of education. Conclusion: The presence of psychiatric disorders might disturb MDR-TB treatment resulting in poor outcomes. Precaution and prompt managements are required for psychiatric disorders in patients receiving MDR-TB treatment regiments.

  19. Molecular detection of multi drug resistant tuberculosis (mdr-tb) in mdr-tb patients' attendant in north western pakistan

    International Nuclear Information System (INIS)

    Shah, T.; Hayat, A.; Shah, Z.; Hayat, A.; Khan, S.B.

    2017-01-01

    Objective: To determine the drugs susceptibility pattern of mycobacterium tuberculosis (M.TB) in multi-drug resistant tuberculosis (MDR-TB) patients' attendants in North Western, Pakistan. Study Design: Cross sectional study. Place and Duration of Study: This study was conducted at Peshawar Tuberculosis Research Laboratory (PTRL), Provincial TB Control Program Hayatabad Medical Complex Peshawar, (KP) from August 2013 to March 2014. Material and Methods: A cross sectional study in which four hundred and eighty sputum samples from MDR-TB patients' attendants were processed for the detection of M.TB through Ziehl-Neelsen staining, Lowenstein-Jensen, BACTEC MGIT-960 culture and line probe assay. Results: Out of 480 samples, 06 (2.1%) were found positive for M.TB through Ziehl-Neelsen staining while 10 (2.8%) were positive through LJ and BACTEC MGIT-960 culture. The 10 positive samples were further subjected to drugs susceptibility testing and line probes assay test to find out rifampicin, isoniazid, streptomycin and ethambutol resistant and it was found that 6 M.TB isolates were resistant while 4 were sensitive to rifampicin and isoniazid. Among the 6 resistant M.TB strains, 4 showed mutation in rpoB gene at 531, 516 and 526 codons. Conclusion: Majority of MDR-TB patients' attendants had drug-resistant tuberculosis and the rate of drug susceptible TB was low. (author)

  20. Analysis of multi drug resistant tuberculosis (MDR-TB) financial protection policy: MDR-TB health insurance schemes, in Chhattisgarh state, India.

    Science.gov (United States)

    Kundu, Debashish; Sharma, Nandini; Chadha, Sarabjit; Laokri, Samia; Awungafac, George; Jiang, Lai; Asaria, Miqdad

    2018-01-27

    There are significant financial barriers to access treatment for multi drug resistant tuberculosis (MDR-TB) in India. To address these challenges, Chhattisgarh state in India has established a MDR-TB financial protection policy by creating MDR-TB benefit packages as part of the universal health insurance scheme that the state has rolled out in their effort towards attaining Universal Health Coverage for all its residents. In these schemes the state purchases health insurance against set packages of services from third party health insurance agencies on behalf of all its residents. Provider payment reform by strategic purchasing through output based payments (lump sum fee is reimbursed as per the MDR-TB benefit package rates) to the providers - both public and private health facilities empanelled under the insurance scheme was the key intervention. To understand the implementation gap between policy and practice of the benefit packages with respect to equity in utilization of package claims by the poor patients in public and private sector. Data from primary health insurance claims from January 2013 to December 2015, were analysed using an extension of 'Kingdon's multiple streams for policy implementation framework' to explain the implementation gap between policy and practice of the MDR-TB benefit packages. The total number of claims for MDR-TB benefit packages increased over the study period mainly from poor patients treated in public facilities, particularly for the pre-treatment evaluation and hospital stay packages. Variations and inequities in utilizing the packages were observed between poor and non-poor beneficiaries in public and private sector. Private providers participation in the new MDR-TB financial protection mechanism through the universal health insurance scheme was observed to be much lower than might be expected given their share of healthcare provision overall in India. Our findings suggest that there may be an implementation gap due to weak

  1. ANTIBACTERIAL ACTIVITY OF DRACONTOMELON DAO EXTRACTS ON METHICILLIN-RESISTANT S. AUREUS (MRSA) AND E. COLI MULTIPLE DRUG RESISTANCE (MDR).

    Science.gov (United States)

    Yuniati, Yuniati; Hasanah, Nurul; Ismail, Sjarif; Anitasari, Silvia; Paramita, Swandari

    2018-01-01

    Staphylococcus aureus , methicillin-resistant and Escherichia coli , multidrug-resistant included in the list of antibiotic-resistant priority pathogens from WHO. As multidrug-resistant bacteria problem is increasing, it is necessary to probe new sources for identifying antimicrobial compounds. Medicinal plants represent a rich source of antimicrobial agents. One of the potential plants for further examined as antibacterial is Dracontomelon dao (Blanco) Merr. & Rolfe. The present study designed to find the antibacterial activity of D. dao stem bark extracts on Methicillin-resistant S. aureus (MRSA) and E. coli Multiple Drug Resistance (MDR), followed by determined secondary metabolites with antibacterial activity and determined the value of MIC (minimum inhibitory concentration) and MBC (minimum bactericidal concentration). D. dao stem bark extracted using 60% ethanol. Disc diffusion test methods used to find the antibacterial activity, following by microdilution methods to find the value of MIC and MBC. Secondary metabolites with antibacterial activity determined by bioautography using TLC (thin layer chromatography) methods. D. dao stem bark extracts are sensitive to MSSA, MRSA and E.coli MDR bacteria. The inhibition zone is 16.0 mm in MSSA, 11.7 mm in MRSA and 10.7 mm in E. coli MDR. The entire MBC/MIC ratios for MSSA, MRSA and E.coli MDR is lower than 4. The ratio showed bactericidal effects of D. dao stem bark extracts. In TLC results, colorless bands found to be secondary metabolites with antibacterial activity. D. dao stem bark extracts are potential to develop as antibacterial agent especially against MRSA and E. coli MDR strain.

  2. Efficacy of moxifloxacin & econazole against multidrug resistant (MDR Mycobacterium tuberculosis in murine model

    Directory of Open Access Journals (Sweden)

    U D Gupta

    2015-01-01

    Full Text Available Background & objectives: Studies have shown the bactericidal potential of econazole and clotrimazole against Mycobacterium tuberculosis under in vitro and ex vivo conditions along with their synergism with conventional antituberculosis drugs. These molecules were also found to be effective against different multidrug resistant (MDR M. tuberculosis isolates in vitro. Hence the present study was designed to evaluate the in vivo antimycobacterial potential of moxifloxacin and econazole alone and in combination against multidrug resistant tuberculosis (MDR-TB in a mice model. Methods: Mice were infected with 2.5×10 [7] bacilli of MDR strain of M. tuberculosis by aerosol route of infection. After four weeks of infection, chemotherapy was started orally by moxifloxacin 8.0 mg/kg body wt and econazole 3.3 mg/kg alone and in combination, as well as with four first line anti-tuberculosis drugs as a positive control. The animals were sacrificed and the lungs and spleen were excised under aspetic conditions. The tissues were homogenized with sterile normal saline, an aliquot of the homogenate was plated on Middlebrook 7H11 agar supplemented with oleate albumin dextrose catalase (OADC and incubated at 37°C for four weeks. The number of visible and individual colonies were counted. Results: The first line anti-tuberculosis drugs (RIF+INH+EMB+PZA after eight weeks of therapy had no impact as the bacillary load in lungs and spleens remained unchanged. However, econazole, moxifloxacin alone as well as in combination significantly reduced the bacillary load in lungs as well as in spleens of MDR-TB bacilli infected mice. Interpretation & conclusions: Co-administration of the two drugs (econazole and moxifloxacin to MDR-TB strain JAL-7782 infected mice exhibited additive effect, the efficacy of the drugs in combination being higher as compared with ECZ or MOX alone. These results were substantiated by histopathological studies. This study suggests the utility of

  3. Molecular approaches for detection of the multi-drug resistant tuberculosis (MDR-TB in Bangladesh.

    Directory of Open Access Journals (Sweden)

    Tafsina Haque Aurin

    Full Text Available The principal obstacles in the treatment of tuberculosis (TB are delayed and inaccurate diagnosis which often leads to the onset of the drug resistant TB cases. To avail the appropriate treatment of the patients and to hinder the transmission of drug-resistant TB, accurate and rapid detection of resistant isolates is critical. Present study was designed to demonstrate the efficacy of molecular techniques inclusive of line probe assay (LPA and GeneXpert MTB/RIF methods for the detection of multi-drug resistant (MDR TB. Sputum samples from 300 different categories of treated and new TB cases were tested for the detection of possible mutation in the resistance specific genes (rpoB, inhA and katG through Genotype MTBDRplus assay or LPA and GeneXpert MTB/RIF tests. Culture based conventional drug susceptibility test (DST was also carried out to measure the efficacy of the molecular methods employed. Among 300 samples, 191 (63.7% and 193 (64.3% cases were found to be resistant against rifampicin in LPA and GeneXpert methods, respectively; while 189 (63% cases of rifampicin resistance were detected by conventional DST methods. On the other hand, 196 (65.3% and 191 (63.7% isolates showed isoniazid resistance as detected by LPA and conventional drug susceptibility test (DST, respectively. Among the drug resistant isolates (collectively 198 in LPA and 193 in conventional DST, 189 (95.6% and 187 (96.9% were considered to be MDR as examined by LPA and conventional DST, respectively. Category-II and -IV patients encountered higher frequency of drug resistance compared to those from category-I and new cases. Considering the higher sensitivity, specificity and accuracy along with the required time to results significantly shorter, our study supports the adoption of LPA and GeneXpert assay as efficient tools in detecting drug resistant TB in Bangladesh.

  4. MDR1 siRNA loaded hyaluronic acid-based CD44 targeted nanoparticle systems circumvent paclitaxel resistance in ovarian cancer

    Science.gov (United States)

    Yang, Xiaoqian; Lyer, Arun K.; Singh, Amit; Choy, Edwin; Hornicek, Francis J.; Amiji, Mansoor M.; Duan, Zhenfeng

    2015-02-01

    Development of multidrug resistance (MDR) is an almost universal phenomenon in patients with ovarian cancer, and this severely limits the ultimate success of chemotherapy in the clinic. Overexpression of the MDR1 gene and corresponding P-glycoprotein (Pgp) is one of the best known MDR mechanisms. MDR1 siRNA based strategies were proposed to circumvent MDR, however, systemic, safe, and effective targeted delivery is still a major challenge. Cluster of differentiation 44 (CD44) targeted hyaluronic acid (HA) based nanoparticle has been shown to successfully deliver chemotherapy agents or siRNAs into tumor cells. The goal of this study is to evaluate the ability of HA-PEI/HA-PEG to deliver MDR1 siRNA and the efficacy of the combination of HA-PEI/HA-PEG/MDR1 siRNA with paclitaxel to suppress growth of ovarian cancer. We observed that HA-PEI/HA-PEG nanoparticles can efficiently deliver MDR1 siRNA into MDR ovarian cancer cells, resulting in down-regulation of MDR1 and Pgp expression. Administration of HA-PEI/HA-PEG/MDR1 siRNA nanoparticles followed by paclitaxel treatment induced a significant inhibitory effect on the tumor growth, decreased Pgp expression and increased apoptosis in MDR ovarian cancer mice model. Our findings suggest that CD44 targeted HA-PEI/HA-PEG/MDR1 siRNA nanoparticles can serve as a therapeutic tool with great potentials to circumvent MDR in ovarian cancer.

  5. Association between C3435T polymorphism of MDR1 gene and the incidence of drug-resistant epilepsy in the population of Polish children.

    Science.gov (United States)

    Stasiołek, Mariusz; Romanowicz, Hanna; Połatyńska, Katarzyna; Chamielec, Maciej; Skalski, Dominik; Makowska, Marianna; Smolarz, Beata

    2016-07-08

    Epilepsy is a disease of neurological character. Approximately one third of epileptic patients demonstrate a drug-resistant phenotype, which is associated with the development of drug-resistant epilepsy. The multidrug resistance protein 1 and glycoprotein P, encoded by MDR1, play a significant role in the transmembrane transport of anti-epileptic agents. Single nucleotide polymorphism C3435T (rs1045642) within MDR1 gene may be associated with an increased expression of P-gp which affects the levels of antiepileptic drugs in plasma. The presented studies analysed the association between C3435T polymorphism of MDR1 gene and the incidence of drug-resistant epilepsy in the population of Polish children. C3435T polymorphism of MDR1 gene was analysed by the high resolution melting technique in a group of patients with drug-resistant (n = 106) and drug-responsive epilepsy (n = 67), as well as in non-epileptic children (n = 98) hospitalised at the Department of Neurology, Polish Mother's Memorial Hospital in Lodz. Genotype and allele distributions were evaluated and their compatibility with the Hardy-Weinberg distribution was assessed by means of the χ(2) test. Genotype and allele evaluation, regarding their relationship with a given feature, was supported by an analysis of odds ratio and 95 % confidence interval, calculated according to the logistic regression model. An association was observed between the incidence rate of DRE and the presence of C allele in C3435T polymorphism of MDR1 gene, which may enhance the risk of the disease. The T allele may then play a protective role. No differences were found in the studied groups, regarding either genotype or allele distribution in reference to patient's gender or concomitant diseases. Following the obtained results, C3435T polymorphism of MDR1 gene may be connected with the incidence of drug-resistant epilepsy in the population of Polish children. ISRCTN ISRCTN73824458. Registered 28th September 2014.

  6. Functional evidence of multidrug resistance transporters (MDR in rodent olfactory epithelium.

    Directory of Open Access Journals (Sweden)

    Adrien Molinas

    Full Text Available P-glycoprotein (Pgp and multidrug resistance-associated protein (MRP1 are membrane transporter proteins which function as efflux pumps at cell membranes and are considered to exert a protective function against the entry of xenobiotics. While evidence for Pgp and MRP transporter activity is reported for olfactory tissue, their possible interaction and participation in the olfactory response has not been investigated.Functional activity of putative MDR transporters was assessed by means of the fluorometric calcein acetoxymethyl ester (calcein-AM accumulation assay on acute rat and mouse olfactory tissue slices. Calcein-AM uptake was measured as fluorescence intensity changes in the presence of Pgp or MRP specific inhibitors. Epifluorescence microscopy measured time course analysis in the olfactory epithelium revealed significant inhibitor-dependent calcein uptake in the presence of each of the selected inhibitors. Furthermore, intracellular calcein accumulation in olfactory receptor neurons was also significantly increased in the presence of either one of the Pgp or MRP inhibitors. The presence of Pgp or MRP1 encoding genes in the olfactory mucosa of rat and mouse was confirmed by RT-PCR with appropriate pairs of species-specific primers. Both transporters were expressed in both newborn and adult olfactory mucosa of both species. To assess a possible involvement of MDR transporters in the olfactory response, we examined the electrophysiological response to odorants in the presence of the selected MDR inhibitors by recording electroolfactograms (EOG. In both animal species, MRPs inhibitors induced a marked reduction of the EOG magnitude, while Pgp inhibitors had only a minor or no measurable effect.The findings suggest that both Pgp and MRP transporters are functional in the olfactory mucosa and in olfactory receptor neurons. Pgp and MRPs may be cellular constituents of olfactory receptor neurons and represent potential mechanisms for modulation

  7. JNK1/2 Activation by an Extract from the Roots of Morus alba L. Reduces the Viability of Multidrug-Resistant MCF-7/Dox Cells by Inhibiting YB-1-Dependent MDR1 Expression

    Directory of Open Access Journals (Sweden)

    Youn Kyung Choi

    2013-01-01

    Full Text Available Cancer cells acquire anticancer drug resistance during chemotherapy, which aggravates cancer disease. MDR1 encoded from multidrug resistance gene 1 mainly causes multidrug resistance phenotypes of different cancer cells. In this study, we demonstrate that JNK1/2 activation by an extract from the root of Morus alba L. (White mulberry reduces doxorubicin-resistant MCF-7/Dox cell viability by inhibiting YB-1 regulation of MDR1 gene expression. When MCF-7 or MCF-7/Dox cells, where MDR1 is highly expressed were treated with an extract from roots or leaves of Morus alba L., respectively, the root extract from the mulberry (REM but not the leaf extract (LEM reduced cell viabilities of both MCF-7 and MCF-7/Dox cells, which was enhanced by cotreatment with doxorubicin. REM but not LEM further inhibited YB-1 nuclear translocation and its regulation of MDR1 gene expression. Moreover, REM promoted phosphorylation of c-Jun NH2-terminal kinase 1/2 (JNK1/2 and JNK1/2 inhibitor, SP600125 and rescued REM inhibition of both MDR1 expression and viabilities in MCF-7/Dox cells. Consistently, overexpression of JNK1, c-Jun, or c-Fos inhibited YB-1-dependent MDR1 expression and reduced viabilities in MCF-7/Dox cells. In conclusion, our data indicate that REM-activated JNK-cJun/c-Fos pathway decreases the viability of MCF-7/Dox cells by inhibiting YB-1-dependent MDR1 gene expression. Thus, we suggest that REM may be useful for treating multidrug-resistant cancer cells.

  8. Different phenotypic and molecular mechanisms associated with multidrug resistance in Gram-negative clinical isolates from Egypt

    Directory of Open Access Journals (Sweden)

    Helmy OM

    2017-12-01

    Full Text Available Omneya M Helmy, Mona T Kashef Department of Microbiology and Immunology, Faculty of Pharmacy, Cairo University, Cairo, Egypt Objectives: We set out to investigate the prevalence, different mechanisms, and clonal relatedness of multidrug resistance (MDR among third-generation cephalosporin-resistant Gram-negative clinical isolates from Egypt.Materials and methods: A total of 118 third-generation cephalosporin-resistant Gram-negative clinical isolates were included in this study. Their antimicrobial susceptibility pattern was determined using Kirby–Bauer disk diffusion method. Efflux pump-mediated resistance was tested by the efflux-pump inhibitor-based microplate assay using chlorpromazine. Detection of different aminoglycoside-, β-lactam-, and quinolone-resistance genes was done using polymerase chain reaction. The genetic diversity of MDR isolates was investigated using random amplification of polymorphic DNA.Results: Most of the tested isolates exhibited MDR phenotypes (84.75%. The occurrence of efflux pump-mediated resistance in the different MDR species tested was 40%–66%. Acinetobacter baumannii isolates showed resistance to most of the tested antibiotics, including imipenem. The blaOXA-23-like gene was detected in 69% of the MDR A. baumannii isolates. The MDR phenotype was detected in 65% of Pseudomonas aeruginosa isolates, of which only 23% exhibited efflux pump-mediated resistance. On the contrary, efflux-mediated resistance to piperacillin and gentamicin was recorded in 47.5% of piperacillin-resistant and 25% of gentamicin-resistant MDR Enterobacteriaceae. Moreover, the plasmid-mediated quinolone-resistance genes (aac(6’-Ib-cr, qnrB, and qnrS were detected in 57.6% and 83.33% of quinolone-resistant MDR Escherichia coli and Klebsiella pneumoniae isolates, respectively. The β-lactamase-resistance gene blaSHV-31 was detected for the first time in one MDR K. pneumoniae isolate from an endotracheal tube specimen in Egypt

  9. HIF-1α inhibition reverses multidrug resistance in colon cancer cells via downregulation of MDR1/P-glycoprotein.

    Directory of Open Access Journals (Sweden)

    Jianfang Chen

    Full Text Available Multidrug resistance (MDR is one of the major reasons chemotherapy-based treatments fail. Hypoxia is generally associated with tumor chemoresistance. However, the correlation between the heterodimeric hypoxia-inducible factor-1 (HIF-1 and the multidrug resistance (MDR1 gene/transporter P-glycoprotein (P-gp remains unclear. This study aims to explore the molecular mechanisms of reversing colon cancer MDR by focusing on the target gene HIF-1α.A chemotherapeutic sensitivity assay was used to observe the efficiency of MDR reversal in LoVo multicellular spheroids (MCS. The apoptotic level induced by different drugs was examined by flow cytometry (FCM. Binding of HIF-1α to the MDR1 gene promoter was evaluated by Chromatin immunoprecipitation (ChIP. The relationship between HIF-1α/P-gp expression and sensitivity to chemotherapy was analyzed.The sensitivity of LoVo MCS to all four chemotherapy drugs was decreased to varying degrees under hypoxic conditions. After silencing the HIF-1α gene, the sensitivities of LoVo MCS to all four chemotherapy drugs were restored. The apoptotic levels that all the drugs induced were all decreased to various extents in the hypoxic group. After silencing HIF-1α, the apoptosis level induced by all four chemotherapy drugs increased. The expression of HIF-1α and P-gp was significantly enhanced in LoVo MCS after treatment with hypoxia. Inhibiting HIF-1α significantly decreased the expression of MDR1/P-gp mRNA or protein in both the LoVo monolayers and LoVo MCS. The ChIP assay showed that HIF-1α was bound to the MDR1 gene promoter. Advanced colon carcinoma patients with expression of both HIF-1α and P-gp were more resistant to chemotherapy than that with non expression.HIF-1α inhibition reverses multidrug resistance in colon cancer cells via downregulation of MDR1/P-gp. The expression of HIF-1α and MDR1/P-gp can be used as a predictive marker for chemotherapy resistance in colon cancer.

  10. Phenotypic low-level isoniazid resistance as a marker to predict ethionamide resistance in Mycobacterium tuberculosis

    Directory of Open Access Journals (Sweden)

    Salima Qamar

    2017-01-01

    Full Text Available Background: Tuberculosis is one of the most prevalent diseases in Pakistan. Pakistan has the highest burden of MDR-TB in the Eastern Mediterranean region. Ethionamide is an anti-tuberculous drug frequently used to treat MDR-TB. Its drug susceptibility testing is not easily available in resource limited settings. Since it acts on the same target protein as isoniazid (inhA protein encoded by inhA gene, we sought to find out if phenotypic isoniazid resistance can be a marker of ethionamide resistance. Materials and Methods: This was a retrospective observational study conducted at the Aga Khan University hospital section of microbiology. Data was retrieved between 2011 to 2014 for all culture positive MTB strains. All culture positive MTB isolates with susceptibilities to isoniazid and ethionamide recorded were included in the study. Isoniazid and ethionamide susceptibilities were performed using agar proportion method on Middlebrook 7H10 agar. Rate of Ethionamide resistance between low-level isoniazid resistant, high level isoniazid resistant and isoniazid sensitive MTB was compared. Results: A total of 11,274 isolates were included in the study. A statistically significant association (P < 0.001 was found between Ethionamide resistance and low-level isoniazid resistance (26.6% as compared to high-level isoniazid resistance (8.85% and isoniazid sensitivity (0.71% in MTB strains. However this association was not seen in XDR-TB strains. Conclusion: Low level isoniazid resistance may be used as marker for phenotypic ethionamide resistance and hence guide clinicians' choice of antituberculous agent for MDR-TB in Pakistan. Further studies involving detection of genotypic association of isoniazid and ethionamide susceptibilities are needed before a final conclusion can be derived.

  11. Pharmacological modification of multi-drug resistance (MDR) in vitro detected by a novel fluorometric microculture cytotoxicity assay. Reversal of resistance and selective cytotoxic actions of cyclosporin A and verapamil on MDR leukemia T-cells.

    Science.gov (United States)

    Larsson, R; Nygren, P

    1990-07-15

    A novel fluorometric microculture cytotoxicity assay (FMCA), based on measurements of fluorescein diacetate (FDA) hydrolysis and DNA staining by Hoechst 33342, was used for drug sensitivity testing and detection of resistance reversal in acute lymphoblastic leukemia (ALL) cell lines. The 72-hr assay was found to be sensitive, reproducible and linearly related to the number of viable cells within a broad range of cell concentrations. At clinically achievable drug concentrations, the calcium channel blocker Verapamil (ver) and the immunosuppressant Cyclosporin A (csA) were found to partly reverse acquired Vincristine (vcr) resistance in multi-drug resistant (MDR) T-ALL L100 cells with little or no effect on the drug-sensitive parental L0 cell line. By combining the fluorometric indices, we found that low concentrations of csA were growth-inhibitory, whereas higher concentrations (greater than 10 micrograms/ml) were progressively cytotoxic for drug-sensitive L0 cells. In MDR L100 cells, on the other hand, csA produced significant cell kill even at low drug concentrations. Ver had no effects on sensitive L0 cells but showed considerable cytotoxic action towards MDR L100 cells. There was no apparent relationship between drug reversal of vcr resistance and the cytotoxic actions of the drug per se since the calcium channel blocker diltiazem (dil) significantly potentiated the actions of vcr on MDR L100 cells without being more toxic to these cells (compared to vcr-sensitive L0 cells).

  12. Identification of antibiotic resistance genes in the multidrug-resistant Acinetobacter baumannii strain, MDR-SHH02, using whole-genome sequencing.

    Science.gov (United States)

    Wang, Hualiang; Wang, Jinghua; Yu, Peijuan; Ge, Ping; Jiang, Yanqun; Xu, Rong; Chen, Rong; Liu, Xuejie

    2017-02-01

    This study aimed to investigate antibiotic resistance genes in the multidrug-resistant (MDR) Acinetobacter baumannii (A. baumanii) strain, MDR-SHH02, using whole‑genome sequencing (WGS). The antibiotic resistance of MDR-SHH02 isolated from a patient with breast cancer to 19 types of antibiotics was determined using the Kirby‑Bauer method. WGS of MDR-SHH02 was then performed. Following quality control and transcriptome assembly, functional annotation of genes was conducted, and the phylogenetic tree of MDR-SHH02, along with another 5 A. baumanii species and 2 Acinetobacter species, was constructed using PHYLIP 3.695 and FigTree v1.4.2. Furthermore, pathogenicity islands (PAIs) were predicted by the pathogenicity island database. Potential antibiotic resistance genes in MDR-SHH02 were predicted based on the information in the Antibiotic Resistance Genes Database (ARDB). MDR-SHH02 was found to be resistant to all of the tested antibiotics. The total draft genome length of MDR-SHH02 was 4,003,808 bp. There were 74.25% of coding sequences to be annotated into 21 of the Clusters of Orthologous Groups (COGs) of protein terms, such as 'transcription' and 'amino acid transport and metabolism'. Furthermore, there were 45 PAIs homologous to the sequence MDRSHH02000806. Additionally, a total of 12 gene sequences in MDR-SHH02 were highly similar to the sequences of antibiotic resistance genes in ARDB, including genes encoding aminoglycoside‑modifying enzymes [e.g., aac(3)-Ia, ant(2'')‑Ia, aph33ib and aph(3')-Ia], β-lactamase genes (bl2b_tem and bl2b_tem1), sulfonamide-resistant dihydropteroate synthase genes (sul1 and sul2), catb3 and tetb. These results suggest that numerous genes mediate resistance to various antibiotics in MDR-SHH02, and provide a clinical guidance for the personalized therapy of A. baumannii-infected patients.

  13. Candida albicans Swi/Snf and Mediator Complexes Differentially Regulate Mrr1-Induced MDR1 Expression and Fluconazole Resistance.

    Science.gov (United States)

    Liu, Zhongle; Myers, Lawrence C

    2017-11-01

    Long-term azole treatment of patients with chronic Candida albicans infections can lead to drug resistance. Gain-of-function (GOF) mutations in the transcription factor Mrr1 and the consequent transcriptional activation of MDR1 , a drug efflux coding gene, is a common pathway by which this human fungal pathogen acquires fluconazole resistance. This work elucidates the previously unknown downstream transcription mechanisms utilized by hyperactive Mrr1. We identified the Swi/Snf chromatin remodeling complex as a key coactivator for Mrr1, which is required to maintain basal and induced open chromatin, and Mrr1 occupancy, at the MDR1 promoter. Deletion of snf2 , the catalytic subunit of Swi/Snf, largely abrogates the increases in MDR1 expression and fluconazole MIC observed in MRR1 GOF mutant strains. Mediator positively and negatively regulates key Mrr1 target promoters. Deletion of the Mediator tail module med3 subunit reduces, but does not eliminate, the increased MDR1 expression and fluconazole MIC conferred by MRR1 GOF mutations. Eliminating the kinase activity of the Mediator Ssn3 subunit suppresses the decreased MDR1 expression and fluconazole MIC of the snf2 null mutation in MRR1 GOF strains. Ssn3 deletion also suppresses MDR1 promoter histone displacement defects in snf2 null mutants. The combination of this work with studies on other hyperactive zinc cluster transcription factors that confer azole resistance in fungal pathogens reveals a complex picture where the induction of drug efflux pump expression requires the coordination of multiple coactivators. The observed variations in transcription factor and target promoter dependence of this process may make the search for azole sensitivity-restoring small molecules more complicated. Copyright © 2017 American Society for Microbiology.

  14. Anaplasia and drug selection-independent overexpression of the multidrug resistance gene, MDR1, in Wilms' tumor.

    Science.gov (United States)

    Re, G G; Willingham, M C; el Bahtimi, R; Brownlee, N A; Hazen-Martin, D J; Garvin, A J

    1997-02-01

    One reason for the failure of chemotherapy is the overexpression of the multidrug resistance gene, MDR1. The product of this gene is the multidrug transporter P-glycoprotein, an ATP-dependent pump that extrudes drugs from the cytoplasm. Some tumors inherently express P-glycoprotein, whereas others acquire the ability to do so after exposure to certain chemotherapeutic agents, often by the mechanism of gene amplification. Classical Wilms' tumors (nephroblastoma) typically respond to therapy and have a good prognosis. On the contrary, anaplastic Wilms' tumors are generally refractory to chemotherapy. These anaplastic variants are rare (4.5% of all Wilms' tumors reported in the United States), aggressive, and often fatal forms of tumor, which are commonly thought to result from the progression of classical Wilms' tumors. To investigate the basis for this differential response to therapy, we examined a number of classical and anaplastic Wilms' tumors for the expression of the MDR1 gene by immunohistochemical and mRNA analysis. Classical Wilms' tumors consistently did not express P-glycoprotein except in areas of tubular differentiation, as in normal kidney. Similarly, two of three anaplastic tumors failed to show P-glycoprotein expression. In contrast, cultured cells derived from a third anaplastic tumor, W4, exhibited strong P-glycoprotein expression and were drug resistant in vitro. Southern analysis revealed that W4 cells contained a single copy of the MDR1 gene per haploid genome similar to normal cells, demonstrating that the overexpression of MDR1 was not caused by gene amplification. Transcriptional activation of the MDR1 gene would be in keeping with the concept that p53 might act as a transcriptional repressor of the MDR1 gene.

  15. Association of ACE and MDR1 Gene Polymorphisms with Steroid Resistance in Children with Idiopathic Nephrotic Syndrome.

    Science.gov (United States)

    Dhandapani, Mohanapriya Chinambedu; Venkatesan, Vettriselvi; Rengaswamy, Nammalwar Bollam; Gowrishankar, Kalpana; Nageswaran, Prahlad; Perumal, Venkatachalam

    2015-08-01

    The purpose of the study was to investigate the distribution of insertion/deletion (I/D) polymorphisms of the angiotensin-converting enzyme (ACE) gene and three exonic polymorphisms of the multidrug resistance 1 (MDR1) gene (C3435T, C1236T, and G2677T) in children diagnosed with idiopathic nephrotic syndrome (INS). The study group consisted of 100 healthy controls and 150 INS patients, of which 50 were steroid resistant. Genomic DNA from blood samples was isolated from both of these groups and genotyping of the ACE and MDR1 genes was performed by polymerase chain reaction (PCR) using specific primers. There was no significant difference observed in the genotypic distribution and D allele frequency of the ACE gene. The two single-nucleotide polymorphisms (SNPs), C1236T and C3435T, of the MDR1 gene showed no significance, whereas the SNP G2677T/A was significantly associated with the genotypes GT and GA of the MDR1 gene, indicating it may be a potential marker to detect drug resistance. Screening these polymorphisms will pave the way to better understand the molecular mechanisms of the disease, which may be useful in developing targeted therapies for INS patients.

  16. Isolation, Identification And Screening Antibacterial Activity from Marine Sponge-Associated Fungi Against Multidrug-Resistant (MDR) Escherichia coli

    Science.gov (United States)

    Triandala Sibero, Mada; Sabdaningsih, Aninditia; Cristianawati, Olvi; Nuryadi, Handung; Karna Radjasa, Ocky; Sabdono, Agus; Trianto, Agus

    2017-02-01

    Irrational used of antibiotic in several decades ago causing resistant in bacteria and decreasing the cure rate of infectious diseases. Multidrug-resistant (MDR) Escherichia coli is known to cause various of infectious diseases such as urinary tract infection, nosocomial bloodstream infection, meningitis, bacteraemia, and gastrointestinal disease. Marine sponge-associated fungi have potential as source of new compound to combat MDR E. coli. The aims of this research were to isolate marine sponge-assosiated fungi, to screen potential fungi against MDR E. coli, to identify the potential fungi and its host sponge. There were 29 marine sponge-associated fungi successfully isolated from 9 sponges. Among 29 sponge-associated fungi screened, there were 7 isolates showed antibacterial activity against MDR E. coli. The best inhibition zone produced by MPS 14.1/MT 02 and MPS 14.3/MT 04 from sponge PP.SP.16.14. According to fungi identification result fungus MPS 14.1/MT 02 was identified as Trichoderma asperellum while MPS 14.3/MT 04 was identified as Trichoderma reesei. Sponge identification leaded the PP.SP.16.14 as Cinachyrella sp.

  17. Inhibition of ABCB1 (MDR1 expression by an siRNA nanoparticulate delivery system to overcome drug resistance in osteosarcoma.

    Directory of Open Access Journals (Sweden)

    Michiro Susa

    2010-05-01

    Full Text Available The use of neo-adjuvant chemotherapy in treating osteosarcoma has improved patients' average 5 year survival rate from 20% to 70% in the past 30 years. However, for patients who progress after chemotherapy, its effectiveness diminishes due to the emergence of multi-drug resistance (MDR after prolonged therapy.In order to overcome both the dose-limiting side effects of conventional chemotherapeutic agents and the therapeutic failure resulting from MDR, we designed and evaluated a novel drug delivery system for MDR1 siRNA delivery. Novel biocompatible, lipid-modified dextran-based polymeric nanoparticles were used as the platform for MDR1 siRNA delivery; and the efficacy of combination therapy with this system was evaluated. In this study, multi-drug resistant osteosarcoma cell lines (KHOS(R2 and U-2OS(R2 were treated with the MDR1 siRNA nanocarriers and MDR1 protein (P-gp expression, drug retention, and immunofluoresence were analyzed. Combination therapy of the MDR1 siRNA loaded nanocarriers with increasing concentrations of doxorubicin was also analyzed. We observed that MDR1 siRNA loaded dextran nanoparticles efficiently suppresses P-gp expression in the drug resistant osteosarcoma cell lines. The results also demonstrated that this approach may be capable of reversing drug resistance by increasing the amount of drug accumulation in MDR cell lines.Lipid-modified dextran-based polymeric nanoparticles are a promising platform for siRNA delivery. Nanocarriers loaded with MDR1 siRNA are a potential treatment strategy for reversing MDR in osteosarcoma.

  18. Prognostic significance of multidrug-resistance protein (MDR-1 in renal clear cell carcinomas: A five year follow-up analysis

    Directory of Open Access Journals (Sweden)

    Strazzullo Viviana

    2006-12-01

    Full Text Available Abstract Background A large number of renal cancer patients shows poor or partial response to chemotherapy and the mechanisms have not been still understood. Multi-drug resistance is the principal mechanism by which many cancers develop resistance to chemotherapic drugs. The role of the multi-drug resistant transporter (MDR-1/P-glycoprotein, the gene product of MDR-1, and that one of the so-called multi-drug resistance associated protein (MRP, two energy-dependent efflux pumps, are commonly known to confer drug resistance. We studied MDR-1 expression in selected cases of renal cell carcinoma (RCC, clear cell type, with long-term follow-up, in order to establish its prognostic role and its possible contribution in the choice of post-surgical therapy. Methods MDR-1 has been studied by standard LSAB-HRP immunohistochemical technique, in paraffin embedded RCC samples. Protein expression has been compared to clinical and histopathological data and to disease specific survival of RCC patients, by Kaplan-Meier curve and Cox multivariate regression analyses. Results Two groups of RCCs were obtained by esteeming MDR-1 expression and disease specific survival (obtained with Kaplan-Meier curve and Cox multivariate regression analyses: the first one presents low or absent MDR-1 expression and good survival; the second one is characterized by high MDR-1 expression and significant poor outcome (p p p p Conclusion In our opinion, the results of this study well prove the relationship between MDR-1 expression and worse clinical prognosis in RCC, because MDR-1 over-expressing RCCs can be considered a group of tumours with a more aggressive behavior. This finding outlines a possible role of MDR-1 as prognostic factor, dependent and independent of multidrug resistance. These results could be useful to predict cancer evolution and to choose the appropriate treatment: this is another step that can stimulate further promising and interesting investigations on broader

  19. Factors influencing [F-18]2-fluoro-2-deoxy-D-glucose (F-18 FDG) accumulation in melanoma cells. Is FDG a substrate of multidrug resistance (MDR)?

    International Nuclear Information System (INIS)

    Yamada, Kiyoshi; Brink, I.; Engelhardt, R.

    2005-01-01

    In order to specify the influence of multidrug-resistance (MDR) on the accumulation of the PET tracer, F-18 FDG ([Fluorine-18]2-fluoro-2-deoxy-D-glucose, in melanoma cells, both the MDR function and expression of two human melanoma cell lines SK-MEL 23 and 24, were evaluated. The effects of MDR modulators on FDG accumulation and efflux were also investigated. A functional analysis using representative MDR fluorescent substrates and inhibitors clarified the following characteristics: SK-MEL 23 possesses a highly active function of multidrug resistance-associated protein (MRP), but not P-gp. SK-MEL 24 possesses weak functions of both MRP and P-gp. Western blot analysis using monoclonal antibodies for MDR expression demonstrated an exceedingly high MRP expression of SK-MEL 23 and only slight P-gp and MRP expression of SK-MEL 24, corresponding to the functional data. The efflux inhibition assay using F-18 FDG revealed a considerable retention of FDG in SK-MEL 23 in the presence of the MRP inhibitor probenecid. It was also found that the P-gp inhibitor verapamil depressed the FDG efflux of SK-MEL 24. Our present in vitro study suggests that FDG may be a substrate of MDR in some melanoma cells and further MDR may be one of the important factors affecting FDG-PET melanoma imaging. (author)

  20. vPARP Adjusts MVP Expression in Drug-resistant Cell Lines in Conjunction with MDR Proteins.

    Science.gov (United States)

    Wojtowicz, Karolina; Januchowski, Radoslaw; Nowicki, Michal; Zabel, Maciej

    2017-06-01

    The definition of vault (ribonucleoprotein particles) function remains highly complex. Vaults may cooperate with multidrug resistance (MDR) proteins, supporting their role in drug resistance. This topic is the main theme of this publication. The cell viability was determined by an MTT assay. The protein expression was detected by western blot analysis. The proteins were knocked-down using siRNA. No major vault protein (MVP) in the LoVo/Dx and W1PR cell lines after tunicamycin treatment was shown. In W1PR cells with knocked-down MVP, a statistically significant decrease in cell viability was noted. In LoVo/Dx, W1TR and A2780TR cells were vault poly-ADP-ribose polymerase (vPARP) was knockdown, a decrease in cell viability was shown. Also, MVP silencing induced an increase in glycoprotein P (Pgp) expression in LoVo/Dx cells. MVP is important for the drug resistance of cancer cells, but it probably requires the presence of vPARP for full activation. Some correlations between MDR proteins and vaults exist. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  1. Predictable Phenotypes of Antibiotic Resistance Mutations.

    Science.gov (United States)

    Knopp, M; Andersson, D I

    2018-05-15

    Antibiotic-resistant bacteria represent a major threat to our ability to treat bacterial infections. Two factors that determine the evolutionary success of antibiotic resistance mutations are their impact on resistance level and the fitness cost. Recent studies suggest that resistance mutations commonly show epistatic interactions, which would complicate predictions of their stability in bacterial populations. We analyzed 13 different chromosomal resistance mutations and 10 host strains of Salmonella enterica and Escherichia coli to address two main questions. (i) Are there epistatic interactions between different chromosomal resistance mutations? (ii) How does the strain background and genetic distance influence the effect of chromosomal resistance mutations on resistance and fitness? Our results show that the effects of combined resistance mutations on resistance and fitness are largely predictable and that epistasis remains rare even when up to four mutations were combined. Furthermore, a majority of the mutations, especially target alteration mutations, demonstrate strain-independent phenotypes across different species. This study extends our understanding of epistasis among resistance mutations and shows that interactions between different resistance mutations are often predictable from the characteristics of the individual mutations. IMPORTANCE The spread of antibiotic-resistant bacteria imposes an urgent threat to public health. The ability to forecast the evolutionary success of resistant mutants would help to combat dissemination of antibiotic resistance. Previous studies have shown that the phenotypic effects (fitness and resistance level) of resistance mutations can vary substantially depending on the genetic context in which they occur. We conducted a broad screen using many different resistance mutations and host strains to identify potential epistatic interactions between various types of resistance mutations and to determine the effect of strain

  2. Prediction of Phenotypic Antimicrobial Resistance Profiles From Whole Genome Sequences of Non-typhoidal Salmonella enterica.

    Science.gov (United States)

    Neuert, Saskia; Nair, Satheesh; Day, Martin R; Doumith, Michel; Ashton, Philip M; Mellor, Kate C; Jenkins, Claire; Hopkins, Katie L; Woodford, Neil; de Pinna, Elizabeth; Godbole, Gauri; Dallman, Timothy J

    2018-01-01

    Surveillance of antimicrobial resistance (AMR) in non-typhoidal Salmonella enterica (NTS), is essential for monitoring transmission of resistance from the food chain to humans, and for establishing effective treatment protocols. We evaluated the prediction of phenotypic resistance in NTS from genotypic profiles derived from whole genome sequencing (WGS). Genes and chromosomal mutations responsible for phenotypic resistance were sought in WGS data from 3,491 NTS isolates received by Public Health England's Gastrointestinal Bacteria Reference Unit between April 2014 and March 2015. Inferred genotypic AMR profiles were compared with phenotypic susceptibilities determined for fifteen antimicrobials using EUCAST guidelines. Discrepancies between phenotypic and genotypic profiles for one or more antimicrobials were detected for 76 isolates (2.18%) although only 88/52,365 (0.17%) isolate/antimicrobial combinations were discordant. Of the discrepant results, the largest number were associated with streptomycin (67.05%, n = 59). Pan-susceptibility was observed in 2,190 isolates (62.73%). Overall, resistance to tetracyclines was most common (26.27% of isolates, n = 917) followed by sulphonamides (23.72%, n = 828) and ampicillin (21.43%, n = 748). Multidrug resistance (MDR), i.e., resistance to three or more antimicrobial classes, was detected in 848 isolates (24.29%) with resistance to ampicillin, streptomycin, sulphonamides and tetracyclines being the most common MDR profile ( n = 231; 27.24%). For isolates with this profile, all but one were S . Typhimurium and 94.81% ( n = 219) had the resistance determinants bla TEM-1, strA-strB, sul2 and tet (A). Extended-spectrum β-lactamase genes were identified in 41 isolates (1.17%) and multiple mutations in chromosomal genes associated with ciprofloxacin resistance in 82 isolates (2.35%). This study showed that WGS is suitable as a rapid means of determining AMR patterns of NTS for public health surveillance.

  3. Mechanisms of antibiotic resistance in Mycobacterium tuberculosis, validation of methods BACTECTM MGIT 960 and AnyplexM TII MTB / MDR / XDR Detection for detection of antibiotic resistance to first and second line in Mycobacterium tuberculosis strains

    International Nuclear Information System (INIS)

    Centeno Urena, Yadel

    2014-01-01

    A literature review is developed of drug-resistant TB in the world and in Costa Rica. The mechanisms of resistance to antibiotics are studied of the bacterium that causes tuberculosis; drug resistance to first-line and second-line, treatment regimen according to the World Health Organization and edge detection methods available in the market. The agreement between the results is studied by the phenotypic detection system of resistance of M. tuberculosis BACTEC MGIT960 and PCR, in real-time of commercial kit Anyplex II MTB/MDR/XDR, for genotypic identification of M. tuberculosis and related mutations to resistance with the referring results to thirty strains provided by the Pan American Health Organization, allowing a significant shortening in the time of obtaining reliable results. The results obtained have allowed to suggest a possible implementation at the Centro Nacional de Referencia en Micobacteriologia (CNRM), to perform antibiotic susceptibility testing and genotypic testing of multidrug cases respectively. The study results have allowed the implementation of the technology of genotypic detection of M. tuberculosis in the CNRM, obtaining for the first time in Costa Rica, information about genes of M. tuberculosis related to the generation of resistance to the major drugs of Primary treatment scheme as well as testing of resistance to second-line drug for resistant strains referred to the Centro Nacional de Referencia en Micobacteriologia in 2013. (author) [es

  4. Amplification of genome sections in mammalian somatic cells resistant to colchicine. VII. Localization of original and amplified copes of the mdr gene in the same segment of chromosome 4 of the Dzungarian hamster

    International Nuclear Information System (INIS)

    Sokova, O.I.; Siyanova, E.Yu.; Gudkov, A.V.; Kopnin, B.P.

    1988-01-01

    Using in situ hybridization, the mdr gene was mapped in chromosomes of Dzungarian hamster embryonic cells, amplification of which accompanies development of multidrug resistance (MDR). It was shown that the mdr gene is located in chromosome segment 4q15-21, in which, according to data obtained previously, amplified copes of open quotes MDR genes close quotes (mdr, et al.) are distributed, as a rule. Results obtained, as well as data of other investigators, attest to the fact that integration recombination of amplified copies of DNA occurs primarily at the site of disposition of homologous sequences

  5. Expression of multidrug resistance genes MVP, MDR1, and MRP1 determined sequentially before, during, and after hyperthermic isolated limb perfusion of soft tissue sarcoma and melanoma patients.

    Science.gov (United States)

    Stein, Ulrike; Jürchott, Karsten; Schläfke, Matthias; Hohenberger, Peter

    2002-08-01

    Isolated, hyperthermic limb perfusion (ILP) with recombinant human tumor necrosis factor alpha and melphalan is a highly effective treatment for advanced soft tissue sarcoma (STS) and locoregional metastatic malignant melanoma. Multidrug resistance (MDR)-associated genes are known to be inducible by heat and drugs; expression levels of the major vault protein (MVP), MDR1, and MDR-associated protein 1 (MRP1) were determined sequentially before, during, and after ILP of patients. Twenty-one STS or malignant melanoma patients were treated by ILP. Tumor tissue temperatures were recorded continuously and ranged from 33.4 degrees C initially to peak values of 40.4 degrees C during ILP. Serial true-cut biopsy specimens from tumor tissues were routinely microdissected. Expression analyses for MDR genes were performed by real-time reverse transcriptase polymerase chain reaction and immunohistochemistry. In 83% of the patients, MVP expression was induced during hyperthermic ILP. MVP-mRNA inductions often paralleled the increase in temperature during ILP. Increased MVP protein expressions either were observed simultaneously with the MVP-mRNA induction or were delayed until after the induction at the transcriptional level. Inductions of MDR1 and MRP1 were observed in only 13% and 27% of the specimens analyzed. Temperatures and drugs applied preferentially led to an induction of MVP and were not sufficient to induce MDR1 and MRP1 in the majority of tumors. This study is the first to analyze the expression of MDR-associated genes sequentially during ILP of patients and demonstrates that treatment might lead to increased levels of MVP, whereas enhanced levels of MDR1 and MRP1 remain rare events.

  6. From MDR to MXR

    DEFF Research Database (Denmark)

    Litman, Thomas; Druley, T E; Stein, W D

    2001-01-01

    The ATP binding cassette (ABC) superfamily of membrane transporters is one of the largest protein classes known, and counts numerous proteins involved in the trafficking of biological molecules across cell membranes. The first known human ABC transporter was P-glycoprotein (P-gp), which confers...... multidrug resistance (MDR) to anticancer drugs. In recent years, we have obtained an increased understanding of the mechanism of action of P-gp as its ATPase activity, substrate specificity and pharmacokinetic interactions have been investigated. This review focuses on the functional characterization of P...... for reversal of MDR in cancer and for drug delivery, are discussed....

  7. Reversing multidrug resistance in Caco-2 by silencing MDR1, MRP1, MRP2, and BCL-2/BCL-xL using liposomal antisense oligonucleotides.

    Directory of Open Access Journals (Sweden)

    Yu-Li Lo

    Full Text Available Multidrug resistance (MDR is a major impediment to chemotherapy. In the present study, we designed antisense oligonucleotides (ASOs against MDR1, MDR-associated protein (MRP1, MRP2, and/or BCL-2/BCL-xL to reverse MDR transporters and induce apoptosis, respectively. The cationic liposomes (100 nm composed of N-[1-(2,3-dioleyloxypropyl]-n,n,n-trimethylammonium chloride and dioleoyl phosphotidylethanolamine core surrounded by a polyethylene glycol (PEG shell were prepared to carry ASOs and/or epirubicin, an antineoplastic agent. We aimed to simultaneously suppress efflux pumps, provoke apoptosis, and enhance the chemosensitivity of human colon adenocarcinoma Caco-2 cells to epirubicin. We evaluated encapsulation efficiency, particle size, cytotoxicity, intracellular accumulation, mRNA levels, cell cycle distribution, and caspase activity of these formulations. We found that PEGylated liposomal ASOs significantly reduced Caco-2 cell viability and thus intensified epirubicin-mediated apoptosis. These formulations also decreased the MDR1 promoter activity levels and enhanced the intracellular retention of epirubicin in Caco-2 cells. Epirubicin and ASOs in PEGylated liposomes remarkably decreased mRNA expression levels of human MDR1, MRP1, MRP2, and BCL-2. The combined treatments all significantly increased the mRNA expressions of p53 and BAX, and activity levels of caspase-3, -8, and -9. The formulation of epirubicin and ASOs targeting both pump resistance of MDR1, MRP1, and MRP2 and nonpump resistance of BCL-2/BCL-xL demonstrated more superior effect to all the other formulations used in this study. Our results provide a novel insight into the mechanisms by which PEGylated liposomal ASOs against both resistance types act as activators to epirubicin-induced apoptosis through suppressing MDR1, MRP1, and MRP2, as well as triggering intrinsic mitochondrial and extrinsic death receptor pathways. The complicated regulation of MDR highlights the necessity

  8. Phenotypic and genotypic analysis of anti-tuberculosis drug resistance in Mycobacterium tuberculosis isolates in Myanmar.

    Science.gov (United States)

    Aung, Wah Wah; Ei, Phyu Win; Nyunt, Wint Wint; Swe, Thyn Lei; Lwin, Thandar; Htwe, Mi Mi; Kim, Kyung Jun; Lee, Jong Seok; Kim, Chang Ki; Cho, Sang Nae; Song, Sun Dae; Chang, Chulhun L

    2015-09-01

    Tuberculosis (TB) is one of the most serious health problems in Myanmar. Because TB drug resistance is associated with genetic mutation(s) relevant to responses to each drug, genotypic methods for detecting these mutations have been proposed to overcome the limitations of classic phenotypic drug susceptibility testing (DST). We explored the current estimates of drug-resistant TB and evaluated the usefulness of genotypic DST in Myanmar. We determined the drug susceptibility of Mycobacterium tuberculosis isolated from sputum smear-positive patients with newly diagnosed pulmonary TB at two main TB centers in Myanmar during 2013 by using conventional phenotypic DST and the GenoType MTBDRplus assay (Hain Lifescience, Germany). Discrepant results were confirmed by sequencing the genes relevant to each type of resistance (rpoB for rifampicin; katG and inhA for isoniazid). Of 191 isolates, phenotypic DST showed that 27.7% (n=53) were resistant to at least one first-line drug and 20.9% (n=40) were resistant to two or more, including 18.3% (n=35) multidrug-resistant TB (MDR-TB) strains. Monoresistant strains accounted for 6.8% (n=13) of the samples. Genotypic assay of 189 isolates showed 17.5% (n=33) MDR-TB and 5.3% (n=10) isoniazid-monoresistant strains. Genotypic susceptibility results were 99.5% (n=188) concordant and agreed almost perfectly with phenotypic DST (kappa=0.99; 95% confidence interval 0.96-1.01). The results highlight the burden of TB drug resistance and prove the usefulness of the genotypic DST in Myanmar.

  9. The process behind the expression of mdr-1/P-gp and mrp/MRP in human leukemia/lymphoma.

    Science.gov (United States)

    Hirose, Masao

    2009-04-01

    There is a controversy over the link between phenotypes of multidrug resistance (MDR) and clinical outcome in leukemia/lymphoma patients. This may be because the process behind the induction and loss of expression of genotypes and phenotypes by which MDR develops and the role of MDR in fresh cells of human leukemia/lymphoma are not clearly defined. P-glycoprotein (P-gp) increased and decreased along with mdr-1 expression in three cell lines out of five vincristine (VCR)-resistant cell lines. MRP appeared with increased mrp expression in the other two cell lines. After the drug was removed from the culture system, mdr-1/P-gp changed in parallel with the level of VCR resistance, although mrp and MRP did not. It was concluded that P-gp is directly derived from mdr-1 and that mdr-1/P-gp supports the VCR-resistance but mrp/MRP is not directly linked to the VCR-resistance. These results should contribute to a better understanding of MDR phenomenon in cancer.

  10. Genetic modification of haematopoietic cells for combined resistance to podophyllotoxins, other agents covered by MDR1-mediated efflux activity and nitrosoureas.

    Science.gov (United States)

    Baum, C; Peinert, S; Carpinteiro, A; Eckert, H G; Fairbairn, L J

    2000-05-01

    Genetic transfer and expression of drug-resistance functions into haematopoietic stem and progenitor cells is a promising means to overcome both the acute and longterm side-effects of cytotoxic drugs in bone marrow. Here, we describe a functional analysis of a retroviral vector that co-expresses human cDNAs for multidrug resistance 1/P-glycoprotein (MDR1) and a double mutant of O(6)-alkylguanine-alkyltransferase (hATPA/GA) to high levels. The hATPA/GA protein contains two amino acid substitutions that render it resistant to compounds such as O(6)-benzylguanine that inhibit the wild-type protein which is often overexpressed in resistant tumour cells. Evidence for simultaneous drug resistance of genetically modified primary murine progenitor cells to colchicine or the podophyllotoxin etoposide, both covered by MDR1-mediated efflux activity, and the nitrosourea BCNU, which is counteracted by hATPA/GA, is presented using in vitro colony assays.

  11. Efficacy and safety profile of linezolid in the treatment of multidrug-resistant (MDR) and extensively drug-resistant (XDR) tuberculosis: a systematic review and meta-analysis.

    Science.gov (United States)

    Agyeman, Akosua Adom; Ofori-Asenso, Richard

    2016-06-22

    Treatment options for drug-resistant tuberculosis are still limited. Linezolid has been recommended for treatment of patients with multidrug-resistant (MDR) or extensively-drug-resistant (XDR) tuberculosis, although uncertainties remain regarding its safety and tolerability in these circumstances. To systematically evaluate the existing evidence regarding the efficacy and tolerability of linezolid in the treatment of MDR or XDR tuberculosis. We conducted a systematic review and meta-analysis in accordance with the PRISMA guidelines. Searches were conducted in PubMed, Web of Science and EMBASE followed by direct search of abstracts in the International Journal of Tuberculosis and Lung Disease to retrieve primary studies published between January 2000 and January 2016 assessing linezolid efficacy and safety in the treatment of drug-resistant TB. We evaluated the occurrence of outcomes including culture conversion, treatment success and incidence of adverse events such as myelosuppression and neuropathy. Twenty-three (23) studies conducted in fourteen (14) countries and involving 507 patients were retrieved. Only 1 randomized controlled trial was identified and none of the identified studies involved participants from Africa. The pooled proportion for treatment success was 77.36 % (95 % CI = 71.38-82.83 %, I(2) = 37.6 %) with culture conversion rate determined as 88.45 % (95 % CI = 83.82-92.38 %, I(2) = 45.4 %). There was no strong evidence for both culture conversion (p = 0.0948) and treatment success (p = 0.0695) between linezolid daily doses ≤ 600 and > 600 mg. Only myelosuppression showed a strong statistical significance (p linezolid also showed no significance upon dose comparisons (p = 0.3213, p = 0.9050 respectively). Available evidence presents Linezolid as a viable option in the treatment of MDR/XDR TB although patients ought to be monitored closely for the incidence of major adverse events such as myelosuppression and

  12. Expression of multi-drug resistance-related genes MDR3 and MRP as prognostic factors in clinical liver cancer patients.

    Science.gov (United States)

    Yu, Zheng; Peng, Sun; Hong-Ming, Pan; Kai-Feng, Wang

    2012-01-01

    To investigate the expression of multi-drug resistance-related genes, MDR3 and MRP, in clinical specimens of primary liver cancer and their potential as prognostic factors in liver cancer patients. A total of 26 patients with primary liver cancer were enrolled. The expression of MDR3 and MRP genes was measured by real-time PCR and the association between gene expression and the prognosis of patients was analyzed by the Kaplan-Meier method and COX regression model. This study showed that increases in MDR3 gene expression were identified in cholangiocellular carcinoma, cirrhosis and HBsAg-positive patients, while MRP expression increased in hepatocellular carcinoma, non-cirrhosis and HBsAg-negative patients. Moreover, conjugated bilirubin and total bile acid in the serum were significantly reduced in patients with high MRP expression compared to patients with low expression. The overall survival tended to be longer in patients with high MDR3 and MRP expression compared to the control group. MRP might be an independent prognostic factor in patients with liver cancer by COX regression analysis. MDR3 and MRP may play important roles in liver cancer patients as prognostic factors and their underlying mechanisms in liver cancer are worthy of further investigation.

  13. Expression of multidrug resistance markers ABCB1 (MDR-1/P-gp) and ABCC1 (MRP-1) in renal cell carcinoma.

    LENUS (Irish Health Repository)

    Walsh, Naomi

    2009-01-01

    BACKGROUND: Renal cell carcinoma patients respond poorly to conventional chemotherapy, this unresponsiveness may be attributable to multidrug resistance (MDR). The mechanisms of MDR in renal cancer are not fully understood and the specific contribution of ABC transporter proteins which have been implicated in the chemoresistance of various cancers has not been fully defined in this disease. METHODS: In this retrospective study the expression of two of these transporter efflux pumps, namely MDR-1 P-gp (ABCB1) and MRP-1 (ABCC1) were studied by immunohistochemistry in archival material from 95 renal cell carcinoma patients. RESULTS: In the first study investigating MDR-1 P-gp and MRP-1 protein expression patterns in renal cell carcinoma patients, high levels of expression of both efflux pumps are observed with 100% of tumours studied showing MDR-1 P-gp and MRP-1 positivity. CONCLUSION: Although these findings do not prove a causal role, the high frequency of tumours expressing these efflux pumps suggests that they may be important contributors to the chemoresistance of this tumour type.

  14. Phenotypic and Genotypic Antibiotic Resistance of Salmonella from Chicken Carcasses Marketed at Ibague, Colombia

    Directory of Open Access Journals (Sweden)

    D Cortes Vélez

    Full Text Available ABSTRACT Salmonella enterica is responsible for alimentary toxic infections associated with the consumption of contaminated poultry products and the antimicrobial resistant patterns of Salmonella circulating in the Tolima region are currently unknown. To address this issue, both the phenotype and genotype antibiotic resistance patterns of 47 Salmonella isolated from raw chicken carcasses sold at the Ibague city were analyzed by the disc diffusion, microdilution and PCR assays. All 47 Salmonella isolates showed resistance to five or more antimicrobial agents. Resistance to Ampicillin (AMP, Amikacin (AMK, Gentamicin (GEN, Tobramycin (TOB, Cefazoline (CFZ, Cefoxitin (FOX, Nitrofurantoin (NIT, Trimethoprim-Sulfamethoxazole (SXT, Tetracycline (TET, Ciprofloxacin (CIP and Enrofloxacin (ENR was observed in 42.35% of Salmonella isolates. All tested S. Paratyphi B var Java isolates showed resistance to at least 12 antibiotics. S. Hvittingfoss showed resistance to 5 antibiotics, whereas S. Muenster showed resistance to seven antibiotics. Amplification of a number of antibiotic resistance genes showed that blaTEM (100% correlated well with resistance to Ampicilin and Cephalosporin, whereas aadB (87% correlated well with resistance to Aminoglycosides. It is concluded that Salmonella isolated from raw chicken meat marketed at Ibague showed MDR by both phenotypic and genotypic methods and they may represent an important threat to human health. Additional studies are needed to establish the relationship between antibiotic resistance in Salmonella from poultry products and clinical isolates.

  15. Cholesterol-Containing Nuclease-Resistant siRNA Accumulates in Tumors in a Carrier-free Mode and Silences MDR1 Gene

    Directory of Open Access Journals (Sweden)

    Ivan V. Chernikov

    2017-03-01

    Full Text Available Chemical modifications are an effective way to improve the therapeutic properties of small interfering RNAs (siRNAs, making them more resistant to degradation in serum and ensuring their delivery to target cells and tissues. Here, we studied the carrier-free biodistribution and biological activity of a nuclease-resistant anti-MDR1 cholesterol-siRNA conjugate in healthy and tumor-bearing severe combined immune deficiency (SCID mice. The attachment of cholesterol to siRNA provided its efficient accumulation in the liver and in tumors, and reduced its retention in the kidneys after intravenous and intraperitoneal injection. The major part of cholesterol-siRNA after intramuscular and subcutaneous injections remained in the injection place. Confocal microscopy data demonstrated that cholesterol-siRNA spread deep in the tissue and was present in the cytoplasm of almost all the liver and tumor cells. The reduction of P-glycoprotein level in human KB-8-5 xenograft overexpressing the MDR1 gene by 60% was observed at days 5–6 after injection. Then, its initial level recovered by the eighth day. The data showed that, regardless of the mode of administration (intravenous, intraperitoneal, or peritumoral, cholesterol-siMDR efficiently reduced the P-glycoprotein level in tumors. The designed anti-MDR1 conjugate has potential as an adjuvant therapeutic for the reversal of multiple drug resistance of cancer cells.

  16. Development of a Patient-Centred, Psychosocial Support Intervention for Multi-Drug-Resistant Tuberculosis (MDR-TB Care in Nepal.

    Directory of Open Access Journals (Sweden)

    Sudeepa Khanal

    Full Text Available Multi-drug-resistant tuberculosis (MDR-TB poses a major threat to public health worldwide, particularly in low-income countries. The current long (20 month and arduous treatment regime uses powerful drugs with side-effects that include mental ill-health. It has a high loss-to-follow-up (25% and higher case fatality and lower cure-rates than those with drug sensitive tuberculosis (TB. While some national TB programmes provide small financial allowances to patients, other aspects of psychosocial ill-health, including iatrogenic ones, are not routinely assessed or addressed. We aimed to develop an intervention to improve psycho-social well-being for MDR-TB patients in Nepal. To do this we conducted qualitative work with MDR-TB patients, health professionals and the National TB programme (NTP in Nepal. We conducted semi-structured interviews (SSIs with 15 patients (10 men and 5 women, aged 21 to 68, four family members and three frontline health workers. In addition, three focus groups were held with MDR-TB patients and three with their family members. We conducted a series of meetings and workshops with key stakeholders to design the intervention, working closely with the NTP to enable government ownership. Our findings highlight the negative impacts of MDR-TB treatment on mental health, with greater impacts felt among those with limited social and financial support, predominantly married women. Michie et al's (2011 framework for behaviour change proved helpful in identifying corresponding practice- and policy-level changes. The findings from this study emphasise the need for tailored psycho-social support. Recent work on simple psychological support packages for the general population can usefully be adapted for use with people with MDR-TB.

  17. Molecular identification of marine symbiont bacteria of gastropods from the waters of the Krakal coast Yogyakarta and its potential as a Multi-Drug Resistant (MDR) antibacterial agent

    Science.gov (United States)

    Bahry, Muhammad Syaifudien; Pringgenies, Delianis; Trianto, Agus

    2017-01-01

    The resistance of pathogenic bacteria may occur to many types of antibiotics, especially in cases of non-compliance use of antibiotics, which likely to allow the evolution of Multi-Drug Resistant (MDR) bacteria. Gastropods seas are marine invertebrates informed capable of production of secondary metabolites as antibacterial MDR. The purpose of the study was the isolation and identification of gastropod symbiont bacteria found in the waters of Krakal, Gunung Kidul, Yogyakarta, which has the ability to produce antibacterial compounds against MDR(Escherichia coli, Enterobacter cloacae, Klebsiella pneumoniae, MRSA (methicillin-Resistant Staphylococcus aureus), Staphylococcus aureus, and Staphylococcus homunis) molecular. Stages of this research began with the isolation of bacteria, bacteria screening for anti-MDR compound, mass culture, and extraction, antibacterial activity test, DNA extraction, amplification by PCR 16S rDNA and sequencing. The results of the study showed that 19 isolates of bacteria were isolated from three species of gastropods namely Littorina scabra, Cypraea moneta and Conus ebraeus. Among them, 4 isolates showed activity against MDR test bacteria (E. coli, E. cloacae, K. pneumoniae, S. aureus and S. homunis). The highest activity was displayed by code LS.G1.8 isolate with the largest inhibition zone 15.47±0.45mm on S. humonis at 250 µg/disk concentration. Isolate CM.G2.1 showed largest inhibition zone, with 21.5±0.07mm on MRSA at 1000 µg/disk concentration and isolate the largest inhibition zone CM.G2.5 14.37±0.81mm on MRSA 14.37±0.81mm at concentrations 1000 µg/disk. The molecular identification of isolates LS.G1.8 has 99% homology with Bacillus subtilis and isolates CM.G2.1 has 99% homology with Bacillus pumillus.

  18. Risk factors associated with multidrug-resistant tuberculosis (MDR-TB) in a tertiary armed force referral and teaching hospital, Ethiopia.

    Science.gov (United States)

    Demile, Biresaw; Zenebu, Amare; Shewaye, Haile; Xia, Siqing; Guadie, Awoke

    2018-05-31

    Ethiopia is one of the world health organization defined higher tuberculosis (TB) burden countries where the disease remains a massive public health threat. This study aimed to identify the prevalence and associated factors of multidrug-resistant tuberculosis (MDR-TB) using all armed force and civilian TB attendants in a tertiary level armed force hospital, where data for MDR-TB are previously unpublished. Cross-sectional study was conducted from September 2014 to August 2015 in a tertiary level Armed Force Referral and Teaching Hospital (AFRTH), Ethiopia. Armed force members (n = 251) and civilians (n = 130) which has been undergone TB diagnosis at AFRTH were included. All the specimens collected were subjected to microscopic smear observation, culture growth and drug susceptibility testing. Data were analyzed using statistical package for social sciences following binary logistic regression and Chi-square. P-values < 0.05 were considered statistically significant. Among 381 TB patients, 355 (93.2%) new and 26 (6.8%) retreatment cases were identified. Culture and smear positive TB cases were identified in 297 (77.9%) and 252 (66.1%) patients, respectively. The overall prevalence of MDR-TB in AFRTH was found 1.8% (1.3% for armed force members and 0.5% for civilian patients) all of which were previously TB treated cases. The entire treatment success rates were 92.6% achieved highest in the armed force (active and pension) than the civilian patients. The failure and dead cases were also found 2.5 and 4.6%, respectively. Using bivariate analysis, category of attendants and TB contact history were strong predictors of MDR-TB in armed force and civilian patients. Moreover, human immunodeficiency virus (HIV) infection also identified a significant (OR = 14.6; 95% CI = 2.3-92.1; p = 0.004) predicting factor for MDR-TB in armed force members. However, sex, age and body mass index were not associated factor for MDR-TB. In AFRTH, lower prevalence of

  19. Evaluating the Role of Multidrug Resistance Protein 3 (MDR3) Inhibition in Predicting Drug-Induced Liver Injury Using 125 Pharmaceuticals.

    Science.gov (United States)

    Aleo, Michael D; Shah, Falgun; He, Kan; Bonin, Paul D; Rodrigues, A David

    2017-05-15

    The role of bile salt export protein (BSEP) inhibition in drug-induced liver injury (DILI) has been investigated widely, while inhibition of the canalicular multidrug resistant protein 3 (MDR3) has received less attention. This transporter plays a pivotal role in secretion of phospholipids into bile and functions coordinately with BSEP to mediate the formation of bile acid-containing biliary micelles. Therefore, inhibition of MDR3 in human hepatocytes was examined across 125 drugs (70 of Most-DILI-concern and 55 of No-DILI-concern). Of these tested, 41% of Most-DILI-concern and 47% of No-DILI-concern drugs had MDR3 IC 50 values of <50 μM. A better distinction across DILI classifications occurred when systemic exposure was considered where safety margins of 50-fold had low sensitivity (0.29), but high specificity (0.96). Analysis of physical chemical property space showed that basic compounds were twice as likely to be MDR3 inhibitors as acids, neutrals, and zwitterions and that inhibitors were more likely to have polar surface area (PSA) values of <100 Å 2 and cPFLogD values between 1.5 and 5. These descriptors, with different cutoffs, also highlighted a group of compounds that shared dual potency as MDR3 and BSEP inhibitors. Nine drugs classified as Most-DILI-concern compounds (four withdrawn, four boxed warning, and one liver injury warning in their approved label) had intrinsic potency features of <20 μM in both assays, thereby reinforcing the notion that multiple inhibitory mechanisms governing bile formation (bile acid and phospholipid efflux) may confer additional risk factors that play into more severe forms of DILI as shown by others for BSEP inhibitors combined with multidrug resistance-associated protein (MRP2, MRP3, MRP4) inhibitory properties. Avoiding physical property descriptors that highlight dual BSEP and MDR3 inhibition or testing drug candidates for inhibition of multiple efflux transporters (e.g., BSEP, MDR3, and MRPs) may be an effective

  20. [Polymorphisms of the multiple drug resistance gene (MDR1) in Mapuche, Mestizo and Maori populations in Chile].

    Science.gov (United States)

    Wielandt, Ana María; Vollrath, Valeska; Chianale, José

    2004-09-01

    There are significant differences in drug responses among different ethnic groups. The multidrug transporter P-gp, encoded by the MDR1 gene, plays a key role in determining drug bioavailability, and an association between a polymorphism in exon 26 (C3435T) and lower P-gp expression has been found. The co-segregation of this polymorphism with the polymorphism in exon 12 (C1236T) and in exon 21 (G2677T/A) determines several MDR1 haplotypes in humans. To characterize the polymorphisms of exons 26, 21 and 12 of the MDR1 gene in different Chilean populations. Using a polymerase chain reaction and restriction fragment length polymorphism technique, we studied the allelic frequencies and the distribution of MDR1 haplotypes in 3 Chilean populations: Mestizo (n=104), Mapuche (n=96, living in the National Reservation of the Huapi Island, Ranico Lake) and Maori (n=52, living in Eastern Island). The frequency of the normal MDR1*1 haplotype, without mutations, was lower in Mapuches than in Mestizos or Maoris (p0.0.5), but lower than the frequencies reported in Caucasians or Asians (p<0.05). We found significant differences in the frequencies of genetic polymorphisms of the MDR1 gene in Chilean populations, related to the ethnic origins of our ancestors.

  1. Phenotypic and genotypic profile of clinical and animal multidrug-resistant Salmonella enterica isolates from Mexico.

    Science.gov (United States)

    Aguilar-Montes de Oca, S; Talavera-Rojas, M; Soriano-Vargas, E; Barba-León, J; Vázquez-Navarrete, J; Acosta-Dibarrat, J; Salgado-Miranda, C

    2018-01-01

    The objective of this study was to obtain a phenotypic and genotypic profile of Salmonella enterica including multidrug-resistant (MDR) isolates from food-producing animals and clinical isolates, as well as their genetic relatedness in two different States of Mexico (Jalisco and State of Mexico). A total of 243 isolates were evaluated in terms of antimicrobial resistance (AMR) and related genes through a disk diffusion method and PCR respectively; we found 16 MDR isolates, all of them harbouring the bla CMY gene but not qnr genes, these isolates represent less than 10% of the collection. The pulsed-field gel electrophoresis revealed a higher genotypic similitude within isolates of State of Mexico than Jalisco. A low percentage of Salmonella isolates were resistant to relevant antibiotics in human health, nevertheless, the AMR and involved genes were similar despite the different serovars and origin of the isolates. This investigation provided an insight of the current status of AMR of Salmonella isolates in two States of Mexico and pinpoint the genes involved in AMR and their epidemiological relationship, the information could help to determine an adequate therapy in human and veterinary medicine. © 2017 The Society for Applied Microbiology.

  2. Antibacterial activities of selected Cameroonian spices and their synergistic effects with antibiotics against multidrug-resistant phenotypes

    Science.gov (United States)

    2011-01-01

    Background The emergence of multi-drug resistant (MDR) phenotypes is a major public health problem today in the treatment of bacterial infections. The present study was designed to evaluate the antibacterial activities of the methanol extracts of eleven Cameroonian spices on a panel of twenty nine Gram negative bacteria including MDR strains. Methods The phytochemical analysis of the extracts was carried out by standard tests meanwhile the liquid micro-broth dilution was used for all antimicrobial assays. Results Phytochemical analysis showed the presence of alkaloids, phenols and tannins in all plants extracts. The results of the antibacterial assays indicated that all tested extracts exert antibacterial activities, with the minimum inhibitory concentration (MIC) values varying from 32 to 1024 μg/ml. The extracts from Dichrostachys glomerata, Beilschmiedia cinnamomea, Aframomum citratum, Piper capense, Echinops giganteus, Fagara xanthoxyloïdes and Olax subscorpioïdea were the most active. In the presence of efflux pump inhibitor, PAßN, the activity of the extract from D. glomerata significantly increased on 69.2% of the tested MDR bacteria. At MIC/5, synergistic effects were noted with the extract of D. glomerata on 75% of the tested bacteria for chloramphenicol (CHL), tetracycline (TET) and norfloxacin (NOR). With B. cinnamomea synergy were observed on 62.5% of the studied MDR bacteria with CHL, cefepime (FEP), NOR and ciprofloxacin (CIP) and 75% with erythromycin (ERY). Conclusion The overall results provide information for the possible use of the studied extracts of the spices in the control of bacterial infections involving MDR phenotypes. PMID:22044718

  3. Multimodal transfer of MDR by exosomes in human osteosarcoma.

    Science.gov (United States)

    Torreggiani, Elena; Roncuzzi, Laura; Perut, Francesca; Zini, Nicoletta; Baldini, Nicola

    2016-07-01

    Exosomes are extracellular vesicles released by both normal and tumour cells which are involved in a new intercellular communication pathway by delivering cargo (e.g., proteins, microRNAs, mRNAs) to recipient cells. Tumour-derived exosomes have been shown to play critical roles in different stages of tumour growth and progression. In this study, we investigated the potential role of exosomes to transfer the multidrug resistance (MDR) phenotype in human osteosarcoma cells. Exosomes were isolated by differential centrifugation of culture media from multidrug resistant human osteosarcoma MG-63DXR30 (Exo/DXR) and MG-63 parental cells (Exo/S). Exosome purity was examined by transmission electron microscopy and confirmed by immunoblot analysis for the expression of specific exosomal markers. Our data showed that exosomes derived from doxorubicin-resistant osteosarcoma cells could be taken up into secondary cells and induce a doxorubicin-resistant phenotype. The incubation of osteosarcoma cells with Exo/DXR decreased the sensitivity of parental cells to doxorubicin, while exposure with Exo/S was ineffective. In addition, we demonstrated that Exo/DXR expressed higher levels of MDR-1 mRNA and P-glycoprotein compared to Exo/S (p=0.03). Interestingly, both MDR-1 mRNA and P-gp increased in MG-63 cells after incubation with Exo/DXR, suggesting this as the main mechanism of exosome-mediated transfer of drug resistance. Our findings suggest that multidrug resistant osteosarcoma cells are able to spread their ability to resist the effects of doxorubicin treatment on sensitive cells by transferring exosomes carrying MDR-1 mRNA and its product P-glycoprotein.

  4. Active Sputum Monitoring Detects Substantial Rate of Multi-Drug Resistant Tuberculosis (MDR-TB) in an HIV-Infected Population in South Africa

    Science.gov (United States)

    Hassim, Shaheen; Shaw, Pamela A.; Sangweni, Phumelele; Malan, Lizette; Ntshani, Ella; Mathibedi, Monkwe Jethro; Stubbs, Nomso; Metcalf, Julia A; Eckes, Risa; Masur, Henry; Komati, Stephanus

    2010-01-01

    Background Tuberculosis (TB) co-infection with HIV is a substantial problem in South Africa. There has been a presumption that drug resistant strains of TB are common in South Africa, but few studies have documented this impression. Methods In Phidisa, a joint observational and randomized HIV treatment study for South African National Defence Force members and dependents, an initiative obtained microbiologic TB testing in subjects who appeared to be at high risk. We report results for HIV-infected subjects. Results TB was identified by culture in 116/584 (19.9%) of patients selected for sputum examination on the basis of suggestive symptoms. Smear was an insensitive technique for confirming the diagnosis: only 33% of culture-positive patients were identified by smear, with a 0.2% false positive rate. Of the 107 culture-positive individuals with susceptibility testing, 22 (20.6%) were identified to be MDR and 4 (3.7%) became extremely drug resistant tuberculosis (XDR) while under observation. Culture-positive cases with a history of TB treatment had more than twice the rate of MDR than those without, 27.1% vs. 11.9% (p=0.05). Conclusions TB is common in this cohort of HIV-infected patients. Smear was not a sensitive technique for identifying culture-positive cases in this health system. Drug susceptibility testing is essential to proper patient management because MDR was present in 20.6% of culture-positive patients. Better management strategies are needed to reduce the development of MDR-TB since so many such patients had received prior antituberculous therapy that was presumably not curative. PMID:20196651

  5. Refractory versus resistant hypertension: Novel distinctive phenotypes

    Science.gov (United States)

    Dudenbostel, Tanja; Siddiqui, Mohammed; Gharpure, Nitin; Calhoun, David A.

    2017-01-01

    Resistant hypertension (RHTN) is relatively common with an estimated prevalence of 10-20% of treated hypertensive patients. It is defined as blood pressure (BP) >140/90 mmHg treated with ≥3 antihypertensive medications, including a diuretic, if tolerated. Refractory hypertension is a novel phenotype of severe antihypertensive treatment failure. The proposed definition for refractory hypertension, i.e. BP >140/90 mmHg with use of ≥5 different antihypertensive medications, including a diuretic and a mineralocorticoid receptor antagonist (MRA) has been applied inconsistently. In comparison to RHTN, refractory hypertension seems to be less prevalent than RHTN. This review focuses on current knowledge about this novel phenotype compared with RHTN including definition, prevalence, mechanisms, characteristics and comorbidities, including cardiovascular risk. In patients with RHTN excess fluid retention is thought to be a common mechanism for the development of RHTN. Recently, evidence has emerged suggesting that refractory hypertension may be more of neurogenic etiology due to increased sympathetic activity as opposed to excess fluid retention. Treatment recommendations for RHTN are generally based on use and intensification of diuretic therapy, especially with the combination of a long-acting thiazide-like diuretic and an MRA. Based on findings from available studies, such an approach does not seem to be a successful strategy to control BP in patients with refractory hypertension and effective sympathetic inhibition in such patients, either with medications and/or device based approaches may be needed. PMID:29034321

  6. The roles of CDR1, CDR2, and MDR1 in kaempferol-induced suppression with fluconazole-resistant Candida albicans.

    Science.gov (United States)

    Shao, Jing; Zhang, MengXiang; Wang, TianMing; Li, Yue; Wang, ChangZhong

    2016-01-01

    Fungal infections caused by fluconazole-resistant Candida albicans are an intractable clinical problem, calling for new efficient antifungal drugs. Kaempferol, an active flavonoid, has been considered a potential candidate against Candida species. This work investigates the resistance reversion of kaempferol in fluconazole-resistant C. albicans and the underlying mechanism. The antifungal activities of fluconazole and/or kaempferol were assessed by a series of standard procedures including broth microdilution method, checkerboard assay and time-kill (T-K) test in nine clinical strains as well as a standard reference isolate of C. albicans. Subsequently, the morphological changes, the efflux of rhodamine 6G, and the expressions of CDR 1, CDR 2, and MDR 1 were analysed by scanning electron microscope (SEM), inverted fluorescence microscope and quantitative reverse transcription polymerase chain reaction (qRT-PCR) in C. albicans z2003. For all the tested C. albicans strains, the minimum inhibitory concentrations (MICs) of fluconazole and kaempferol ranged 0.25-32 and 128-256 μg/mL with a range of fractional inhibitory concentration index of 0.257-0.531. In C. albicans z2003, the expression of both CDR 1 and CDR 2 were decreased after exposure to kaempferol alone with negligible rhodamine 6G accumulation, while the expression of CDR 1, CDR 2 and MDR 1 were all decreased when fluconazole and kaempferol were used concomitantly with notable fluorescence of rhodamine 6G observed. Kaempferol-induced reversion in fluconazole-resistant C. albicans might be likely due to the suppression of the expression of CDR1, CDR2 and MDR1.

  7. Antibacterial and antibiotic resistance modifying activity of the extracts from Allanblackia gabonensis, Combretum molle and Gladiolus quartinianus against Gram-negative bacteria including multi-drug resistant phenotypes.

    Science.gov (United States)

    Fankam, Aimé G; Kuiate, Jules R; Kuete, Victor

    2015-06-30

    Bacterial resistance to antibiotics is becoming a serious problem worldwide. The discovery of new and effective antimicrobials and/or resistance modulators is necessary to tackle the spread of resistance or to reverse the multi-drug resistance. We investigated the antibacterial and antibiotic-resistance modifying activities of the methanol extracts from Allanblackia gabonensis, Gladiolus quartinianus and Combretum molle against 29 Gram-negative bacteria including multi-drug resistant (MDR) phenotypes. The broth microdilution method was used to determine the minimal inhibitory concentrations (MIC) and minimal bactericidal concentrations (MBC) of the samples meanwhile the standard phytochemical methods were used for the preliminary phytochemical screening of the plant extracts. Phytochemical analysis showed the presence of alkaloids, flavonoids, phenols and tannins in all studied extracts. Other chemical classes of secondary metabolites were selectively presents. Extracts from A. gabonensis and C. molle displayed a broad spectrum of activity with MICs varying from 16 to 1024 μg/mL against about 72.41% of the tested bacteria. The extract from the fruits of A. gabonensis had the best activity, with MIC values below 100 μg/mL on 37.9% of tested bacteria. Percentages of antibiotic-modulating effects ranging from 67 to 100% were observed against tested MDR bacteria when combining the leaves extract from C. molle (at MIC/2 and MIC/4) with chloramphenicol, kanamycin, streptomycin and tetracycline. The overall results of the present study provide information for the possible use of the studied plant, especially Allanblackia gabonensis and Combretum molle in the control of Gram-negative bacterial infections including MDR species as antibacterials as well as resistance modulators.

  8. Comparison of Molecular and Phenotypic Methods for the Detection and Characterization of Carbapenem Resistant Enterobacteriaceae.

    Science.gov (United States)

    Somily, Ali M; Garaween, Ghada A; Abukhalid, Norah; Absar, Muhammad M; Senok, Abiola C

    2016-03-01

    In recent years, there has been a rapid dissemination of carbapenem resistant Enterobacteriaceae (CRE). This study aimed to compare phenotypic and molecular methods for detection and characterization of CRE isolates at a large tertiary care hospital in Saudi Arabia. This study was carried out between January 2011 and November 2013 at the King Khalid University Hospital (KKUH) in Saudi Arabia. Determination of presence of extended-spectrum beta-lactamases (ESBL) and carbapenem resistance was in accordance with Clinical and Laboratory Standards Institute (CLSI) guidelines. Phenotypic classification was done by the MASTDISCS(TM) ID inhibitor combination disk method. Genotypic characterization of ESBL and carbapenemase genes was performed by the Check-MDR CT102. Diversilab rep-PCR was used for the determination of clonal relationship. Of the 883 ESBL-positive Enterobacteriaceae detected during the study period, 14 (1.6%) isolates were carbapenem resistant. Both the molecular genotypic characterization and phenotypic testing were in agreement in the detection of all 8 metalo-beta-lactamases (MBL) producing isolates. Of these 8 MBL-producers, 5 were positive for blaNDM gene and 3 were positive for blaVIM gene. Molecular method identified additional blaOXA gene isolates while MASTDISCS(TM) ID detected one AmpC producer isolate. Both methods agreed in identifying 2 carbapenem resistant isolates which were negative for carbapenemase genes. Diversilab rep-PCR analysis of the 9 Klebsiella pneumoniae isolates revealed polyclonal distribution into eight clusters. MASTDISCS(TM) ID is a reliable simple cheap phenotypic method for detection of majority of carbapenemase genes with the exception of the blaOXA gene. We recommend to use such method in the clinical laboratory.

  9. Study of tea polyphenol as a reversal agent for carcinoma cell lines' multidrug resistance (study of TP as a MDR reversal agent)

    International Nuclear Information System (INIS)

    Zhu Aizhi; Wang Xiangyun; Guo Zhenquan

    2001-01-01

    The aim of this study was to examine MDR1 expression product P-glycoprotein (Pgp) and study the effect and mechanism of tea polyphenol (TP) in reversion of multidrug resistance (MDR) in carcinoma cell lines. Immunocytochemical method was used for qualitative detection of Pgp. A comparative study of cytotoxicity and multidrug resistance reversion effect was made by MTT assay for tea polyphenol and quinidine in MCF-7 and MCF-7/Adr cell lines. The multidrug resistance reversion effect and mechanism were studied by measuring the uptake of 99m Tc-tetrofosmin in the carcinoma cell lines. (1) The Pgp overexpression in MCF-7/Adr cells was found to be strong positive, while the Pgp expression of MCF-7 was negative. (2) Although both tea polyphenol and quinidine could not remarkably change the toxicity of adriamycin to MCF-7, they could improve the sensitivity of MCF-7/Adr to adriamycin. The reversion index of tea polyphenol and quinidine was 3 and 10 respectively. (3) The cellular uptake of 99m Tc-tetrofosmin was remarkably lower in MCF-7/Adr than in MCF-7. The uptake of 99m Tc-tetrofosmin in MCF-7/Adr exhibited a 4, 13, 16 fold increase in the presence of 200, 400 and 500 μg/ml of tea polyphenol respectively. The uptake of 99m Tc-tetrofosmin in MCF-7/Adr exhibited only a 4-fold increase in the presence of 200 μM of quinidine. Immunocytochemistry can detect P-glycoprotein expression level qualitatively. Tea polyphenol is not only an anti-tumor agent, but also a multidrug resistant modulator similar to quinidine. The multidrug resistance reversion mechanism of tea polyphenol seems to be its inhibition of the activity of P-glycoprotein. Tea polyphenol has the advantage of very low toxicity in tumor treatment

  10. METALLOPROTEINS DURING DEVELOPMENT OF WALKER-256 CARCINOSARCOMA RESISTANT PHENOTYPE.

    Science.gov (United States)

    Chekhun, V F; Lozovska, Yu V; Burlaka, A P; Ganusevich, I I; Shvets, Yu V; Lukianova, N Yu; Todor, I M; Demash, D V; Pavlova, A A; Naleskina, L A

    2015-01-01

    The study was focused on the detection of changes in serum and tumor metal-containing proteins in animals during development ofdoxorubicin-resistant phenotype in malignant cells after 12 courses of chemotherapy. We found that on every stage of resistance development there was a significant increase in content of ferritin and transferrin proteins (which take part in iron traffick and storage) in Walker-256 carc'inosarcoma tissue. We observed decreased serumferritin levels at the beginning stage of the resistance development and significant elevation of this protein levels in the cases withfully developed resistance phenotype. Transferrin content showed changes opposite to that offerritin. During the development of resistance phenotype the tumor tissue also exhibited increased 'free iron' concentration that putatively correlate with elevation of ROS generation and levels of MMP-2 and MMP-9 active forms. The tumor non-protein thiol content increases gradually as well. The serum of animals with early stages of resistance phenotype development showed high ceruloplasmin activity and its significant reduction after loss of tumor sensitivity to doxorubicin. Therefore, the development of resistance phenotype in Walker-256 carcinosarcoma is accompanied by both the deregulation of metal-containing proteins in serum and tumor tissue and by the changes in activity of antioxidant defense system. Thus, the results of this study allow us to determine the spectrum of metal-containing proteins that are involved in the development of resistant tumor phenotype and that may be targeted for methods for doxorubicin sensitivity correction therapy.

  11. Metalloproteins during development of Walker-256 carcinosarcoma resistant phenotype

    Directory of Open Access Journals (Sweden)

    V. F. Chekhun

    2015-04-01

    Full Text Available The study was focused on the detection of changes in serum and tumor metal-containing proteins in animals during development of doxorubicin-resistant phenotype in malignant cells after 12 courses of chemotherapy. We found that on every stage of resistance development there was a significant increase in content of ferritin and transferrin proteins (which take part in iron traffick and storage in Walker-256 carcinosarcoma tissue. We observed decreased serum ferritin levels at the beginning stage of the resistance development and significant elevation of this protein levels in the cases with fully developed resistance phenotype. Transferrin content showed changes opposite to that of ferritin. During the development of resistance phenotype the tumor tissue also exhibited increased ‘free iron’ concentration that putatively correlate with elevation of ROS generation and levels of MMP-2 and MMP-9 active forms. The tumor non-protein thiol content increases gradually as well. The serum of animals with early stages of resistance phenotype development showed high ceruloplasmin activity and its significant reduction after loss of tumor sensitivity to doxorubicin. Therefore, the development of resistance phenotype in Walker-256 carcinosarcoma is accompanied by both the deregulation of metal-containing proteins in serum and tumor tissue and by the changes in activity of antioxidant defense system. Thus, the results of this study allow us to determine the spectrum of metal-containing proteins that are involved in the development of resistant tumor phenotype and that may be targeted for methods for doxorubicin sensitivity correction therapy.

  12. Multi-drug resistance (MDR1 gene and P-glycoprotein influence on pharmacokinetic and pharmacodymanic of therapeutic drugs

    Directory of Open Access Journals (Sweden)

    Linardi Renata Lehn

    2006-01-01

    Full Text Available (MDR1 gene expressed in tumor cells and also in several normal tissues, such as intestine, liver, kidney, blood-brain barrier, spinal cord, and placenta. P-gp has been identified in mice, rat, bovine, monkey, rodents, and human beings and has been receiving a particular clinical relevance because this protein expression limits brain access and intestinal absorption of many drugs. This protein plays a role as a protective barrier against a wide variety of substrates, avoiding drug entry into the central nervous system. P-glycoprotein also interferes with drug bioavailability and disposition, including absorption, distribution, metabolization, and excretion, influencing pharmacokinetic and pharmacodynamic of drugs. Modulation of P-gp may help the efficacy of treatment of several diseases and can explain some adverse central nervous system effects induced by drugs after intravenous administration and the poor response of oral administration in patients. Alteration in P-gp expression or function has been associated with several diseases susceptibility in humans and animals. Furthermore, additional studies relating MDR1 and P-gp expression has an important clinical implication also in terms of treatment efficacy.

  13. Artemether resistance in vitro is linked to mutations in PfATP6 that also interact with mutations in PfMDR1 in travellers returning with Plasmodium falciparum infections.

    KAUST Repository

    Pillai, Dylan R; Lau, Rachel; Khairnar, Krishna; Lepore, Rosalba; Via, Allegra; Staines, Henry M; Krishna, Sanjeev

    2012-01-01

    BACKGROUND: Monitoring resistance phenotypes for Plasmodium falciparum, using in vitro growth assays, and relating findings to parasite genotype has proved particularly challenging for the study of resistance to artemisinins. METHODS: Plasmodium falciparum isolates cultured from 28 returning travellers diagnosed with malaria were assessed for sensitivity to artemisinin, artemether, dihydroartemisinin and artesunate and findings related to mutations in pfatp6 and pfmdr1. RESULTS: Resistance to artemether in vitro was significantly associated with a pfatp6 haplotype encoding two amino acid substitutions (pfatp6 A623E and S769N; (mean IC50 (95% CI) values of 8.2 (5.7 - 10.7) for A623/S769 versus 623E/769 N 13.5 (9.8 - 17.3) nM with a mean increase of 65%; p = 0.012). Increased copy number of pfmdr1 was not itself associated with increased IC50 values for artemether, but when interactions between the pfatp6 haplotype and increased copy number of pfmdr1 were examined together, a highly significant association was noted with IC50 values for artemether (mean IC50 (95% CI) values of 8.7 (5.9 - 11.6) versus 16.3 (10.7 - 21.8) nM with a mean increase of 87%; p = 0.0068). Previously described SNPs in pfmdr1 are also associated with differences in sensitivity to some artemisinins. CONCLUSIONS: These findings were further explored in molecular modelling experiments that suggest mutations in pfatp6 are unlikely to affect differential binding of artemisinins at their proposed site, whereas there may be differences in such binding associated with mutations in pfmdr1. Implications for a hypothesis that artemisinin resistance may be exacerbated by interactions between PfATP6 and PfMDR1 and for epidemiological studies to monitor emerging resistance are discussed.

  14. Artemether resistance in vitro is linked to mutations in PfATP6 that also interact with mutations in PfMDR1 in travellers returning with Plasmodium falciparum infections.

    KAUST Repository

    Pillai, Dylan R

    2012-04-27

    BACKGROUND: Monitoring resistance phenotypes for Plasmodium falciparum, using in vitro growth assays, and relating findings to parasite genotype has proved particularly challenging for the study of resistance to artemisinins. METHODS: Plasmodium falciparum isolates cultured from 28 returning travellers diagnosed with malaria were assessed for sensitivity to artemisinin, artemether, dihydroartemisinin and artesunate and findings related to mutations in pfatp6 and pfmdr1. RESULTS: Resistance to artemether in vitro was significantly associated with a pfatp6 haplotype encoding two amino acid substitutions (pfatp6 A623E and S769N; (mean IC50 (95% CI) values of 8.2 (5.7 - 10.7) for A623/S769 versus 623E/769 N 13.5 (9.8 - 17.3) nM with a mean increase of 65%; p = 0.012). Increased copy number of pfmdr1 was not itself associated with increased IC50 values for artemether, but when interactions between the pfatp6 haplotype and increased copy number of pfmdr1 were examined together, a highly significant association was noted with IC50 values for artemether (mean IC50 (95% CI) values of 8.7 (5.9 - 11.6) versus 16.3 (10.7 - 21.8) nM with a mean increase of 87%; p = 0.0068). Previously described SNPs in pfmdr1 are also associated with differences in sensitivity to some artemisinins. CONCLUSIONS: These findings were further explored in molecular modelling experiments that suggest mutations in pfatp6 are unlikely to affect differential binding of artemisinins at their proposed site, whereas there may be differences in such binding associated with mutations in pfmdr1. Implications for a hypothesis that artemisinin resistance may be exacerbated by interactions between PfATP6 and PfMDR1 and for epidemiological studies to monitor emerging resistance are discussed.

  15. The Resistome: A Comprehensive Database of Escherichia coli Resistance Phenotypes.

    Science.gov (United States)

    Winkler, James D; Halweg-Edwards, Andrea L; Erickson, Keesha E; Choudhury, Alaksh; Pines, Gur; Gill, Ryan T

    2016-12-16

    The microbial ability to resist stressful environmental conditions and chemical inhibitors is of great industrial and medical interest. Much of the data related to mutation-based stress resistance, however, is scattered through the academic literature, making it difficult to apply systematic analyses to this wealth of information. To address this issue, we introduce the Resistome database: a literature-curated collection of Escherichia coli genotypes-phenotypes containing over 5,000 mutants that resist hundreds of compounds and environmental conditions. We use the Resistome to understand our current state of knowledge regarding resistance and to detect potential synergy or antagonism between resistance phenotypes. Our data set represents one of the most comprehensive collections of genomic data related to resistance currently available. Future development will focus on the construction of a combined genomic-transcriptomic-proteomic framework for understanding E. coli's resistance biology. The Resistome can be downloaded at https://bitbucket.org/jdwinkler/resistome_release/overview .

  16. Normal viability and altered pharmacokinetics in mice lacking mdr1-type (drug-transporting) P-glycoproteins

    NARCIS (Netherlands)

    Schinkel, A. H.; Mayer, U.; Wagenaar, E.; Mol, C. A.; van Deemter, L.; Smit, J. J.; van der Valk, M. A.; Voordouw, A. C.; Spits, H.; van Tellingen, O.; Zijlmans, J. M.; Fibbe, W. E.; Borst, P.

    1997-01-01

    The mdr1-type P-glycoproteins (P-gps) confer multidrug resistance to cancer cells by active extrusion of a wide range of drugs from the cell. To study their physiological roles, we have generated mice genetically deficient in the mdr1b gene [mdr1b (-/-) mice] and in both the mdr1a and mdr1b genes

  17. Evolutionary Genetic Analysis Uncovers Multiple Species with Distinct Habitat Preferences and Antibiotic Resistance Phenotypes in the Stenotrophomonas maltophilia Complex

    Directory of Open Access Journals (Sweden)

    Luz E. Ochoa-Sánchez

    2017-08-01

    Full Text Available The genus Stenotrophomonas (Gammaproteobacteria has a broad environmental distribution. Stenotrophomonas maltophilia is its best known species because it is a globally emerging, multidrug-resistant (MDR, opportunistic pathogen. Members of this species are known to display high genetic, ecological and phenotypic diversity, forming the so-called S. maltophilia complex (Smc. Heterogeneous resistance and virulence phenotypes have been reported for environmental Smc isolates of diverse ecological origin. We hypothesized that this heterogeneity could be in part due to the potential lumping of several cryptic species in the Smc. Here we used state-of-the-art phylogenetic and population genetics methods to test this hypothesis based on the multilocus dataset available for the genus at pubmlst.org. It was extended with sequences from complete and draft genome sequences to assemble a comprehensive set of reference sequences. This framework was used to analyze 108 environmental isolates obtained in this study from the sediment and water column of four rivers and streams in Central Mexico, affected by contrasting levels of anthropogenic pollution. The aim of the study was to identify species in this collection, defined as genetically cohesive sequence clusters, and to determine the extent of their genetic, ecological and phenotypic differentiation. The multispecies coalescent, coupled with Bayes factor analysis was used to delimit species borders, together with population genetic structure analyses, recombination and gene flow estimates between sequence clusters. These analyses consistently revealed that the Smc contains at least 5 significantly differentiated lineages: S. maltophilia and Smc1 to Smc4. Only S. maltophilia was found to be intrinsically MDR, all its members expressing metallo-β-lactamases (MBLs. The other Smc lineages were not MDR and did not express MBLs. We also obtained isolates related to S. acidaminiphila, S. humi and S. terrae. They

  18. tration on Phenotypic Antibiotic Susceptibility and Resistance

    African Journals Online (AJOL)

    resistance in bacteria of food animal origin (Van den Bogaard and Stobberingh, ... however, the effect of antimicrobial drug use in companion animals like dogs or ...... Antibiotic sensitivity of bacterial isolates from cases of canine dermatitis.

  19. Polymorphisms in the xenobiotic transporter Multidrug Resistance 1 (MDR1 and interaction with meat intake in relation to risk of colorectal cancer in a Danish prospective case-cohort study

    Directory of Open Access Journals (Sweden)

    Overvad Kim

    2009-11-01

    Full Text Available Abstract Background The xenobiotic transporters, Multidrug Resistance 1 (MDR1/ABCB1 and Breast Cancer Resistance Protein (BCRP/ABCG2 may restrict intestinal absorption of various carcinogens, including heterocyclic amines (HCA and polycyclic aromatic hydrocarbons (PAH. Cyclooxygenase-2 (COX-2 derived prostaglandins promote gastrointestinal carcinogenesis, affecting angiogenesis, apoptosis, and invasiveness. The aim of this study was to investigate if polymorphisms in these genes were associated with risk of colorectal cancer (CRC, and to investigate possible interactions with lifestyle factors such as smoking, meat consumption, and NSAID use. Methods The following polymorphisms were analyzed; a synonymous MDR1 C3435T (rs1045642 in exon26, G-rs3789243-A in intron3, the functional BCRP C421A (rs2231142, the two COX-2 A-1195G (rs689466 and G-765C (rs20417 in the promoter region, and the COX-2 T8473C (rs5275 polymorphisms in the 3'-untranslated region. The polymorphisms were assessed together with lifestyle factors in a nested case-cohort study of 359 cases and a random cohort sample of 765 participants from the Danish prospective Diet, Cancer and Health study. Results Carriers of the variant allele of MDR1 intron 3 polymorphism were at 1.52-fold higher risk of CRC than homozygous wild type allele carriers (Incidence rate ratio (IRR = 1.52, 95% Confidence Interval (CI: 1.12-2.06. Carriers of the variant allele of MDR1 C3435T exon 26 had a lower risk of CRC than homozygous C-allele carriers (IRR = 0.71 (CI:0.50-1.00. There was interaction between these MDR1 polymorphisms and intake of red and processed meat in relation to CRC risk. Homozygous MDR1 C3435T C-allele carriers were at 8% increased risk pr 25 gram meat per day (CI: 1.00-1.16 whereas variant allele carriers were not at increased risk (p for interaction = 0.02. COX-2 and BCRP polymorphisms were not associated with CRC risk. There was interaction between NSAID use and MDR1 C3435T and COX-2 T

  20. Polymorphisms in the xenobiotic transporter Multidrug Resistance 1 (MDR1) and interaction with meat intake in relation to risk of colorectal cancer in a Danish prospective case-cohort study

    International Nuclear Information System (INIS)

    Andersen, Vibeke; Østergaard, Mette; Christensen, Jane; Overvad, Kim; Tjønneland, Anne; Vogel, Ulla

    2009-01-01

    The xenobiotic transporters, Multidrug Resistance 1 (MDR1/ABCB1) and Breast Cancer Resistance Protein (BCRP/ABCG2) may restrict intestinal absorption of various carcinogens, including heterocyclic amines (HCA) and polycyclic aromatic hydrocarbons (PAH). Cyclooxygenase-2 (COX-2) derived prostaglandins promote gastrointestinal carcinogenesis, affecting angiogenesis, apoptosis, and invasiveness. The aim of this study was to investigate if polymorphisms in these genes were associated with risk of colorectal cancer (CRC), and to investigate possible interactions with lifestyle factors such as smoking, meat consumption, and NSAID use. The following polymorphisms were analyzed; a synonymous MDR1 C3435T (rs1045642) in exon26, G-rs3789243-A in intron3, the functional BCRP C421A (rs2231142), the two COX-2 A-1195G (rs689466) and G-765C (rs20417) in the promoter region, and the COX-2 T8473C (rs5275) polymorphisms in the 3'-untranslated region. The polymorphisms were assessed together with lifestyle factors in a nested case-cohort study of 359 cases and a random cohort sample of 765 participants from the Danish prospective Diet, Cancer and Health study. Carriers of the variant allele of MDR1 intron 3 polymorphism were at 1.52-fold higher risk of CRC than homozygous wild type allele carriers (Incidence rate ratio (IRR) = 1.52, 95% Confidence Interval (CI): 1.12-2.06). Carriers of the variant allele of MDR1 C3435T exon 26 had a lower risk of CRC than homozygous C-allele carriers (IRR = 0.71 (CI:0.50-1.00)). There was interaction between these MDR1 polymorphisms and intake of red and processed meat in relation to CRC risk. Homozygous MDR1 C3435T C-allele carriers were at 8% increased risk pr 25 gram meat per day (CI: 1.00-1.16) whereas variant allele carriers were not at increased risk (p for interaction = 0.02). COX-2 and BCRP polymorphisms were not associated with CRC risk. There was interaction between NSAID use and MDR1 C3435T and COX-2 T8473C (p-values for interaction 0

  1. Comparative evaluation of GenoType MTBDRplus line probe assay with solid culture method in early diagnosis of multidrug resistant tuberculosis (MDR-TB at a tertiary care centre in India.

    Directory of Open Access Journals (Sweden)

    Raj N Yadav

    Full Text Available The objectives of the study were to compare the performance of line probe assay (GenoType MTBDRplus with solid culture method for an early diagnosis of multidrug resistant tuberculosis (MDR-TB, and to study the mutation patterns associated with rpoB, katG and inhA genes at a tertiary care centre in north India.In this cross-sectional study, 269 previously treated sputum-smear acid-fast bacilli (AFB positive MDR-TB suspects were enrolled from January to September 2012 at the All India Institute of Medical Sciences hospital, New Delhi. Line probe assay (LPA was performed directly on the sputum specimens and the results were compared with that of conventional drug susceptibility testing (DST on solid media [Lowenstein Jensen (LJ method].DST results by LPA and LJ methods were compared in 242 MDR-TB suspects. The LPA detected rifampicin (RIF resistance in 70 of 71 cases, isoniazid (INH resistance in 86 of 93 cases, and MDR-TB in 66 of 68 cases as compared to the conventional method. Overall (rifampicin, isoniazid and MDR-TB concordance of the LPA with the conventional DST was 96%. Sensitivity and specificity were 98% and 99% respectively for detection of RIF resistance; 92% and 99% respectively for detection of INH resistance; 97% and 100% respectively for detection of MDR-TB. Frequencies of katG gene, inhA gene and combined katG and inhA gene mutations conferring all INH resistance were 72/87 (83%, 10/87 (11% and 5/87 (6% respectively. The turnaround time of the LPA test was 48 hours.The LPA test provides an early diagnosis of monoresistance to isoniazid and rifampicin and is highly sensitive and specific for an early diagnosis of MDR-TB. Based on these findings, it is concluded that the LPA test can be useful in early diagnosis of drug resistant TB in high TB burden countries.

  2. DESAIN PRIMER UNTUK AMPLIFIKASI FRAGMEN GEN inhA ISOLAT 134 MULTIDRUG RESISTANCE TUBERCULOSIS (MDR-TB DENGAN METODE POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Luk Ketut Budi Maitriani

    2015-10-01

    Full Text Available ABSTRAK    : Penelitian ini bertujuan untuk memperoleh sepasang primer terbaik hasil desain secara in silico menggunakan program Clone Manager Suite 6 (University of Groningen. Primer ini didesain untuk digunakan dalam mengamplifikasi fragmen gen inhA isolat klinis Multidrug Resistance Tuberculosis (MDR-TB mencakup kodon 94 (nukleotida 280-282. Kodon 94 gen inhA merupakan posisi yang sering mengalami mutasi dan mengakibatkan koresisten terhadap isoniazid dan ethionamid. Desain primer menggunakan sekuen gen inhA Mycobacterium tuberculosis yang diperoleh dari situs www.ncbi.nlm.nih.gov (GenBank : AF106077. Hasil desain diperoleh sepasang primer terbaik dan diuji secara in vitro menggunakan metode Polymerase Chain Reaction (PCR. Template DNA yang digunakan adalah isolat klinis MDR-TB. Proses amplifikasi diawali dengan denaturasi awal pada 95°C selama 15 menit dan diikuti oleh 45 siklus amplifikasi (denaturasi pada suhu 94°C selama 1 menit, annealing pada 56°C selama 1 menit 20 detik dan elongasi pada 72°C selama 2 menit serta diakhiri dengan elongasi akhir pada 72°C selama 10 menit. Produk PCR dideteksi menggunakan elektroforesis gel agarosa 1,5%. Kesimpulan penelitian adalah diperoleh sepasang primer terbaik berdasarkan kriteria pada program Clone Manager Suite 6 (University of Groningen, meliputi: panjang primer, %GC, Tm (melting temperature, interaksi primer (dimers dan hairpins, stabilitas primer, repeats, runs dan false priming. Primer tersebut meliputi, primer forward (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3’ dan primer reverse (pR-inhA 5’ CGACCGTCATCCA-GTTGTA 3’ dengan ukuran produk 460 pb.   ABSTRACT: The aim of this study was to obtain the best pair of primer as result in silico design using Clone Manager Suite 6 program (University of Groningen. The primer was designed for amplifying inhA gene fragment of Multidrug Resistance Tuberculosis (MDR-TB clinical isolates include codon 94 (nucleotide 280-282. Codon 94 of inhA gene is

  3. Phenotypic occurrence of methicillin-resistant Staphylococcus ...

    African Journals Online (AJOL)

    To assess the occurrence of MRSA among camels in Kano abattoir, a total of 300 nasal swabs were collected from camels at the lairage in Kano abattoir, Kano state, Nigeria to isolate and biochemically characterize Staphylococcus aureus and confirm methicillin-resistant Staphylococcus aureus among isolates using ...

  4. The roles of variants in human multidrug resistance (MDR1 gene and their haplotypes on antiepileptic drugs response: a meta-analysis of 57 studies.

    Directory of Open Access Journals (Sweden)

    Hui Li

    Full Text Available Previous studies reported the associations between the ATP-binding cassette sub-family B member 1 (ABCB1, also known as MDR1 polymorphisms and their haplotypes with risk of response to antiepileptic drugs in epilepsy, however, the results were inconclusive.The Pubmed, Embase, Web of Science, CNKI and Chinese Biomedicine databases were searched up to July 15, 2014. Pooled odds ratios (ORs and 95% confidence intervals (CIs were calculated using a fixed-effects or random-effects model based on heterogeneity tests. Meta-regression and Galbraith plot analysis were carried out to explore the possible heterogeneity.A total of 57 studies involving 12407 patients (6083 drug-resistant and 6324 drug-responsive patients with epilepsy were included in the pooled-analysis. For all three polymorphisms (C3435T, G2677T/A, and C1236T, we observed a wide spectrum of minor allele frequencies across different ethnicities. A significantly decreased risk of AEDs resistance was observed in Caucasian patients with T allele of C3435T variant, which was still significant after adjusted by multiple testing corrections (T vs C: OR=0.83, 95%CI=0.71-0.96, p=0.01. However, no significant association was observed between the other two variants and AEDs resistance. Of their haplotypes in ABCB1 gene (all studies were in Indians and Asians, no significant association was observed with AEDs resistance. Moreover, sensitivity and Cumulative analysis showed that the results of this meta-analysis were stable.In summary, this meta-analysis demonstrated that effect of C3435T variant on risk of AEDs resistance was ethnicity-dependent, which was significant in Caucasians. Additionally, further studies in different ethnic groups are warranted to clarify possible roles of haplotypes in ABCB1 gene in AEDs resistance, especially in Caucasians.

  5. IPEC-J2 MDR1, a Novel High-Resistance Cell Line with Functional Expression of Human P-glycoprotein (ABCB1) for Drug Screening Studies

    DEFF Research Database (Denmark)

    Saaby, Lasse; Helms, Hans Christian Cederberg; Brodin, Birger

    2016-01-01

    The P-glycoprotein (P-gp) efflux pump has been shown to affect drug distribution and absorption in various organs and to cause drug resistance in cancer therapy. The aim of this work was to develop a cell line to serve as a screening system for potential substrates of P-gp. This requires a cell...... line with high paracellular tightness, low expression of nonhuman ABC transporters, and high expression of functional human P-gp (ABCB1). The porcine intestinal epithelial cell line, IPEC-J2, was selected as a transfection host, due to its ability to form extremely high-resistance monolayers (>10,000 Ω......·cm(2)) and its low endogenous expression of ABC-type efflux transporters. The IPEC-J2 cells were transfected with a plasmid that contained the sequence of the human MDR1 gene, which encodes P-gp, followed by a selection of successfully transfected cells with geneticin and puromycin. The resulting cell...

  6. Molecular screening of antibiotic-resistant determinants among ...

    African Journals Online (AJOL)

    In Nigeria, increase in bacterial resistance has been phenotypically established but due to high cost, few molecular studies ... ocomial opportunistic infections such as urinary tract .... Twelve (20%) of these MDR isolates were from children.

  7. Multiple Origins of Mutations in the mdr1 Gene—A Putative Marker of Chloroquine Resistance in P. vivax

    DEFF Research Database (Denmark)

    Schousboe, Mette L; Ranjitkar, Samir; Rajakaruna, Rupika S

    2015-01-01

    BACKGROUND: Chloroquine combined with primaquine has been the recommended antimalarial treatment of Plasmodium vivax malaria infections for six decades but the efficacy of this treatment regimen is threatened by chloroquine resistance (CQR). Single nucleotide polymorphisms (SNPs) in the multidrug...

  8. Phenotypic Characterization of Multidrug-resistant Escherichia Coli with Special Reference to Extended-spectrum-beta-lactamases and Metallo-beta-lactamases in a Tertiary Care Center.

    Science.gov (United States)

    Shrestha, B; Shrestha, S; Mishra, S K; Kattel, H P; Tada, T; Ohara, H; Kirikae, T; Rijal, B P; Sherchand, J B; Pokhrel, B M

    2015-01-01

    The increasing reports on extended-spectrum-beta-lactamase and metallo-beta-lactamase producing Escherichia coli have addressed a potential threat to global health since it is found to be highly resistance to most of the currently available antibiotics including carbapenems. The present study was aimed to determine the antibiogram of extended-spectrum-beta-lactamase and metallo-beta-lactamase producing MDR E. coli isolates from various clinical samples. This was a cross-sectional study conducted over a period of seven months from December 2013 to July 2014 at bacteriology laboratory of Tribhuvan University Teaching Hospital. A total of 250 clinical specimens (urine, pus, sputum, blood, body fluid, bile, tissue and central venous pressure line tip) were processed from inpatients, with multidrug-resistant Escherichia coli infections. Standard microbiological techniques were used for isolation and identification of the isolates. The presence of extended-spectrum-beta-lactamase was detected by phenotypic confirmatory test recommended by Clinical and Laboratory Standards Institute and imipenem (IMP) /EDTA combined disc method was performed to detect metallo-beta-lactamase mediated resistance mechanism. We found high level of beta lactamase mediated resistance mechanism as part of multidrug resistance. Among 250 MDR isolates, 60% isolates were extended-spectrum-beta-lactamase producers and 17.2% isolates were metallo-beta-lactamase producers. Co-existence of extended-spectrum-beta-lactamase and metallo-beta-lactamase identified in 6.8% isolates. Beta-lactamase mediated resistance mechanisms are accounting very high in the multidrug resistant isolates of E. coli. Therefore, early detection of beta lactamase mediated resistant strains and their current antibiotic susceptibility pattern is necessary to avoid treatment failure and prevent the spread of MDR.

  9. How many sputum culture results do we need to monitor multidrug-resistant-tuberculosis (MDR-TB) patients during treatment?

    NARCIS (Netherlands)

    Janssen, Saskia; Padanilam, Xavier; Louw, Rianna; Mahanyele, Russel; Coetzee, Gerrit; Hänscheid, Thomas; Leenstra, Tjalling; Grobusch, Martin P.

    2013-01-01

    Discharge of a hospital patient after a single negative sputum culture may save money when treating multidrug-resistant tuberculosis. However, after initial sputum conversion in 336 South Africans, 11.6% and 5.4% reconverted after 1 and 2 months, respectively. These findings endorse the WHO

  10. Association between MDR1 gene polymorphisms and the risk of Crohn's disease in a cohort of Algerian pediatric patients.

    Science.gov (United States)

    Bouzidi, Amira; Mesbah-Amroun, Hamida; Boukercha, Aziza; Benhassine, Fadila; Belboueb, Réda; Berkouk, Karima; Messadi, Wassila; Touil-Boukoffa, Chafia

    2016-12-01

    The multi-drug resistance gene (MDR1) has raised increasing interest as a susceptibility gene for Crohn's disease (CD). The role of MDR1 single-nucleotide polymorphisms (SNPs) in the predisposition and behavior of CD in the pediatric population is still elusive. Here, we investigated whether SNPs in MDR1 are associated with CD in Algerian pediatric patients. A case-control study was conducted enrolling 47 pediatric CD patients and 100 controls. All subjects were genotyped for the most common MDR1 SNPs (C3434T, C1236T, and G2677A/T) using PCR-RFLP method. We also explored the association between polymorphisms and clinical sub-phenotypes. We have detected no significant association of C3435T SNP and pediatric CD. However, we observed a significantly higher frequency of the risk alleles, 1236T and 2677T/A among the CD patients compared to controls. Moreover, the risk allele 1236T was associated to a higher risk for resective surgery. Our data suggest that the C1236T and G2677A/T SNPs in the MDR1 gene are associated with CD and the C1236T risk allele with a more severe course of disease in Algerian pediatric patients. Further analysis using larger patients group and functional studies would be interesting to elucidate the role of MDR1 gene in pediatric CD.Pediatric Research (2016); doi:10.1038/pr.2016.163.

  11. Metallo- β-lactamases among Multidrug Resistant (MDR Gram Negative Bacteria Isolated from Clinical Specimens during 2009 in Sanandaj, Kurdistan Province

    Directory of Open Access Journals (Sweden)

    Himen Salimizand

    2012-08-01

    Full Text Available Background: Today, there are numerous reports about emerging multi drug resistant gram negative bacteria all around the world, especially in ICUs. Rarely, Metallo-β-lactamase (MBL enzymes are responsible for these cases. Study of MBLs for diagnosing and preventing distribution of the origin of infection are critical issues. In addition, we would like to compare the efficacy of Iranian and foreign- made antibiotic disks. Materials and Methods: During 2009 all entered clinical specimens to the laboratory tested for detecting gram negative bacteria. Isolated bacteria were tested by Kirby-Bauer method to antibiotic susceptibility test by Iranian and foreign (MAST disks. For gram negative carbapenem resistant isolates, PCR technique used to detect VIM, GIM, and SIM variants of MBLs.Results: During one year, 17890 clinical specimens referred Besat laboratory. The most specimen was Urine (8172 followed by blood culture (5190 that in which 1110 gram negative and positives isolated. Out of which, 778 (70% of isolates were gram negatives. MDR gram negatives were 157 (20.2%. Imipenem and meropenem were the most efficient antibiotics (all susceptible and ceftriaxone was the least (19 % susceptible. E. coli was the most prevalent isolate. 79 Gram negative isolates (10.1% were resistant to Iranian-made discs but all susceptible for foreign ones. All 79 isolates were tested by PCR for MBL genes, that, all were negative. Besides, Iranian imipenem and cefepime disks have had distinguishable difference in susceptibility of isolates.Conclusion: Fortunately, none of gram negative isolates were MBL producer, which revealed no colonization of MBL producing bacteria. Iranian-made disks appear efficient except for imipenem and cefepime.

  12. Multiple Origins of Mutations in the mdr1 Gene--A Putative Marker of Chloroquine Resistance in P. vivax.

    Directory of Open Access Journals (Sweden)

    Mette L Schousboe

    2015-11-01

    Full Text Available Chloroquine combined with primaquine has been the recommended antimalarial treatment of Plasmodium vivax malaria infections for six decades but the efficacy of this treatment regimen is threatened by chloroquine resistance (CQR. Single nucleotide polymorphisms (SNPs in the multidrug resistance gene, Pvmdr1 are putative determinants of CQR but the extent of their emergence at population level remains to be explored.In this study we describe the prevalence of SNPs in the Pvmdr1 among samples collected in seven P. vivax endemic countries and we looked for molecular evidence of drug selection by characterising polymorphism at microsatellite (MS loci flanking the Pvmdr1 gene.We examined the prevalence of SNPs in the Pvmdr1 gene among 267 samples collected from Pakistan, Afghanistan, Sri Lanka, Nepal, Sudan, São Tomé and Ecuador. We measured and diversity in four microsatellite (MS markers flanking the Pvmdr1 gene to look evidence of selection on mutant alleles.SNP polymorphism in the Pvmdr1 gene was largely confined to codons T958M, Y976F and F1076L. Only 2.4% of samples were wildtype at all three codons (TYF, n = 5, 13.3% (n = 28 of the samples were single mutant MYF, 63.0% of samples (n = 133 were double mutant MYL, and 21.3% (n = 45 were triple mutant MFL. Clear geographic differences in the prevalence of these Pvmdr mutation combinations were observed. Significant linkage disequilibrium (LD between Pvmdr1 and MS alleles was found in populations sampled in Ecuador, Nepal and Sri Lanka, while significant LD between Pvmdr1 and the combined 4 MS locus haplotype was only seen in Ecuador and Sri Lanka. When combining the 5 loci, high level diversity, measured as expected heterozygosity (He, was seen in the complete sample set (He = 0.99, while He estimates for individual loci ranged from 0.00-0.93. Although Pvmdr1 haplotypes were not consistently associated with specific flanking MS alleles, there was significant differentiation between geographic

  13. The multidrug resistance 1 (MDR1) gene polymorphism G-rs3789243-A is not associated with disease susceptibility in Norwegian patients with colorectal adenoma and colorectal cancer; a case control study

    DEFF Research Database (Denmark)

    Andersen, V.; Agerstjerne, L.; Jensen, D.

    2009-01-01

    Background: Smoking, dietary factors, and alcohol consumption are known life style factors contributing to gastrointestinal carcinogenesis. Genetic variations in carcinogen handling may affect cancer risk. The multidrug resistance 1(MDR1/ABCB1) gene encodes the transport protein P-glycoprotein (a...... in inflammation, and may thereby affect the risk of malignity. Hence, genetic variations that modify the function of P-glycoprotein may be associated with the risk of colorectal cancer (CRC). We have previously found an association between the MDR1 intron 3 G-rs3789243-A polymorphism and the risk of CRC...... of colorectal carcinomas and adenomas in the Norwegian population was assessed in 167 carcinomas, 990 adenomas, and 400 controls. Genotypes were determined by allelic discrimination. Odds ratio (OR) and 95 confidence interval (95% CI) were estimated by binary logistic regression. Results: No association...

  14. Phenotypic- and Genotypic-Resistance Detection for Adaptive Resistance Management in Tetranychus urticae Koch.

    Directory of Open Access Journals (Sweden)

    Deok Ho Kwon

    Full Text Available Rapid resistance detection is necessary for the adaptive management of acaricide-resistant populations of Tetranychus urticae. Detection of phenotypic and genotypic resistance was conducted by employing residual contact vial bioassay (RCV and quantitative sequencing (QS methods, respectively. RCV was useful for detecting the acaricide resistance levels of T. urticae, particularly for on-site resistance detection; however, it was only applicable for rapid-acting acaricides (12 out of 19 tested acaricides. QS was effective for determining the frequencies of resistance alleles on a population basis, which corresponded to 12 nonsynonymous point mutations associated with target-site resistance to five types of acaricides [organophosphates (monocrotophos, pirimiphos-methyl, dimethoate and chlorpyrifos, pyrethroids (fenpropathrin and bifenthrin, abamectin, bifenazate and etoxazole]. Most field-collected mites exhibited high levels of multiple resistance, as determined by RCV and QS data, suggesting the seriousness of their current acaricide resistance status in rose cultivation areas in Korea. The correlation analyses revealed moderate to high levels of positive relationships between the resistance allele frequencies and the actual resistance levels in only five of the acaricides evaluated, which limits the general application of allele frequency as a direct indicator for estimating actual resistance levels. Nevertheless, the resistance allele frequency data alone allowed for the evaluation of the genetic resistance potential and background of test mite populations. The combined use of RCV and QS provides basic information on resistance levels, which is essential for choosing appropriate acaricides for the management of resistant T. urticae.

  15. Biofilm is a Major Virulence Determinant in Bacterial Colonization of Chronic Skin Ulcers Independently from the Multidrug Resistant Phenotype

    Directory of Open Access Journals (Sweden)

    Enea Gino Di Domenico

    2017-05-01

    Full Text Available Bacterial biofilm is a major factor in delayed wound healing and high levels of biofilm production have been repeatedly described in multidrug resistant organisms (MDROs. Nevertheless, a quantitative correlation between biofilm production and the profile of antimicrobial drug resistance in delayed wound healing remains to be determined. Microbial identification, antibiotic susceptibility and biofilm production were assessed in 135 clinical isolates from 87 patients. Gram-negative bacteria were the most represented microorganisms (60.8% with MDROs accounting for 31.8% of the total isolates. Assessment of biofilm production revealed that 80% of the strains were able to form biofilm. A comparable level of biofilm production was found with both MDRO and not-MDRO with no significant differences between groups. All the methicillin-resistant Staphylococcus aureus (MRSA and 80% of Pseudomonas aeruginosa MDR strains were found as moderate/high biofilm producers. Conversely, less than 17% of Klebsiella pneumoniae extended-spectrum beta-lactamase (ESBL, Escherichia coli-ESBL and Acinetobacter baumannii were moderate/high biofilm producers. Notably, those strains classified as non-biofilm producers, were always associated with biofilm producer bacteria in polymicrobial colonization. This study shows that biofilm producers were present in all chronic skin ulcers, suggesting that biofilm represents a key virulence determinant in promoting bacterial persistence and chronicity of ulcerative lesions independently from the MDRO phenotype.

  16. Breast cancer resistance protein is localized at the plasma membrane in mitoxantrone- and topotecan-resistant cell lines

    NARCIS (Netherlands)

    Scheffer, GL; Maliepaard, M; Pijnenborg, ACLM; van Gastelen, MA; Schroeijers, AB; Allen, JD; Ross, DD; van der Valk, P; Dalton, WS; Schellens, JHM; Scheper, RJ; de Jong, MC

    2000-01-01

    Tumor cells may display a multidrug resistant phenotype by overexpression of ATP-binding cassette transporters such as multidrug resistance (,MDR1) P-glycoprotein, multidrug resistance protein 1 (MRP1), and breast cancer resistance protein (BCRP). The presence of BCRP has thus far been reported

  17. Personalized Medicine Digoxin Theraphy in Individuals with MDR Gene Polymorphism

    Directory of Open Access Journals (Sweden)

    Em Sutrisna

    2015-06-01

    Full Text Available Digoxin is one of digitalis drugs. Wider applicability to heart failure and arrhythmias (supraventricular requires fairly strict scrutiny because of its narrow therapeutic index. Digoxin is a substrate of P-glycoprotein (P-gp encoded by multi drugs resistance-1 (MDR1. MDR-1 gen located on chromosome 7q21.1. This gene contains 28 exons that encoded a protein of 1280 amino acids. This gene plays an important role in the absorption, distribution and elimination of many drugs. MDR1C3435T polymorphism occurs in exon 26. There are three types of MDR1C3435T gene namely MDR1C3435T CC, MDR1C3435T CT and MDR1C3435T TT. These polymorphisms will affect to the formation of P-gp and consequently to change the kinetic profile of digoxin. The change of kinetic profile causes changes in the digoxin blood levels. The method used in this review is data search based on pubmed, medline, and embase with keywords MDR and digoxin. There are several different studies of the influence of polymorphisms MDR1C3435T on blood digoxin levels. Increased levels of digoxin in the blood due to polymorphism of MDR1C3435T will be at risk of digitalis intoxication. Long-term digoxin treatment or large dose should consider the patient’s genetic profile. Distribution of polymorphism of MDR1C3435T in Javanese population is approximately TT (0,10, CT (0,52, and CC(0, 38.

  18. Coagulase-negative staphylococci (CoNS) isolated from ready-to-eat food of animal origin--phenotypic and genotypic antibiotic resistance.

    Science.gov (United States)

    Chajęcka-Wierzchowska, Wioleta; Zadernowska, Anna; Nalepa, Beata; Sierpińska, Magda; Łaniewska-Trokenheim, Łucja

    2015-04-01

    The aim of this work was to study the pheno- and genotypical antimicrobial resistance profile of coagulase negative staphylococci (CoNS) isolated from 146 ready-to-eat food of animal origin (cheeses, cured meats, sausages, smoked fishes). 58 strains were isolated, they were classified as Staphylococcus xylosus (n = 29), Staphylococcus epidermidis (n = 16); Staphylococcus lentus (n = 7); Staphylococcus saprophyticus (n = 4); Staphylococcus hyicus (n = 1) and Staphylococcus simulans (n = 1) by phenotypic and genotypic methods. Isolates were tested for resistance to erythromycin, clindamycin, gentamicin, cefoxitin, norfloxacin, ciprofloxacin, tetracycline, tigecycline, rifampicin, nitrofurantoin, linezolid, trimetoprim, sulphamethoxazole/trimethoprim, chloramphenicol, quinupristin/dalfopristin by the disk diffusion method. PCR was used for the detection of antibiotic resistance genes encoding: methicillin resistance--mecA; macrolide resistance--erm(A), erm(B), erm(C), mrs(A/B); efflux proteins tet(K) and tet(L) and ribosomal protection proteins tet(M). For all the tet(M)-positive isolates the presence of conjugative transposons of the Tn916-Tn1545 family was determined. Most of the isolates were resistant to cefoxitin (41.3%) followed by clindamycin (36.2%), tigecycline (24.1%), rifampicin (17.2%) and erythromycin (13.8%). 32.2% staphylococcal isolates were multidrug resistant (MDR). All methicillin resistant staphylococci harboured mecA gene. Isolates, phenotypic resistant to tetracycline, harboured at least one tetracycline resistance determinant on which tet(M) was most frequent. All of the isolates positive for tet(M) genes were positive for the Tn916-Tn1545 -like integrase family gene. In the erythromycin-resistant isolates, the macrolide resistance genes erm(C) or msr(A/B) were present. Although coagulase-negative staphylococci are not classical food poisoning bacteria, its presence in food could be of public health significance due to the possible spread of

  19. High Frequency of a Single Nucleotide Substitution (c.-6-180T>G) of the Canine MDR1/ABCB1 Gene Associated with Phenobarbital-Resistant Idiopathic Epilepsy in Border Collie Dogs

    OpenAIRE

    Mizukami, Keijiro; Yabuki, Akira; Chang, Hye-Sook; Uddin, Mohammad Mejbah; Rahman, Mohammad Mahbubur; Kushida, Kazuya; Kohyama, Moeko; Yamato, Osamu

    2013-01-01

    A single nucleotide substitution (c.-6-180T>G) associated with resistance to phenobarbital therapy has been found in the canine MDR1/ABCB1 gene in Border Collies with idiopathic epilepsy. In the present study, a PCR-restriction fragment length polymorphism assay was developed for genotyping this mutation, and a genotyping survey was carried out in a population of 472 Border Collies in Japan to determine the current allele frequency. The survey demonstrated the frequencies of the T/T wild type...

  20. Transmission of MDR and XDR tuberculosis in Shanghai, China.

    Directory of Open Access Journals (Sweden)

    Ming Zhao

    Full Text Available Multidrug-resistant (MDR and extensively drug-resistant (XDR tuberculosis (TB are global health problems. We sought to determine the characteristics, prevalence, and relative frequency of transmission of MDR and XDR TB in Shanghai, one of the largest cities in Asia.TB is diagnosed in district TB hospitals in Shanghai, China. Drug susceptibility testing for first-line drugs was performed for all culture positive TB cases, and tests for second-line drugs were performed for MDR cases. VNTR-7 and VNTR-16 were used to genotype the strains, and prior treatment history and treatment outcomes were determined for each patient.There were 4,379 culture positive TB cases diagnosed with drug susceptibility test results available during March 2004 through November 2007. 247 (5.6% were infected with a MDR strain of M. tuberculosis and 11 (6.3% of the 175 MDR patients whose isolate was tested for susceptibility to second-line drugs, were XDR. More than half of the patients with MDR and XDR were newly diagnosed and had no prior history of TB treatment. Nearly 57% of the patients with MDR were successfully treated.Transmission of MDR and XDR strains is a serious problem in Shanghai. While a history of prior anti-TB treatment indicates which individuals may have acquired MDR or XDR TB, it does not accurately predict which TB patients have disease caused by transmission of MDR and XDR strains. Therefore, universal drug susceptibility testing is recommended for new and retreatment TB cases.

  1. Mdr65 decreases toxicity of multiple insecticides in Drosophila melanogaster.

    Science.gov (United States)

    Sun, Haina; Buchon, Nicolas; Scott, Jeffrey G

    2017-10-01

    ABC transporters are ubiquitous membrane-bound proteins, present in both prokaryotes and eukaryotes. The major function of eukaryotic ABC transporters is to mediate the efflux of a variety of substrates (including xenobiotics) out of cells. ABC transporters have been widely investigated in humans, particularly for their involvement in multidrug resistance (MDR). Considerably less is known about their roles in transport and/or excretion in insects. ABC transporters are only known to function as exporters in insects. Drosophila melanogaster has 56 ABC transporter genes, including eight which are phylogenetically most similar to the human Mdr genes (ABCB1 clade). We investigated the role of ABC transporters in the ABCB1 clade in modulating the susceptibility to insecticides. We took advantage of the GAL4/UAS system in D. melanogaster to knockdown the expression levels of Mdr65, Mdr50, Mdr49 and ABCB6 using transgenic UAS-RNAi lines and conditional driver lines. The most notable effects were increased sensitivities to nine different insecticides by silencing of Mdr65. Furthermore, a null mutation of Mdr65 decreased the malathion, malaoxon and fipronil LC 50 values by a factor of 1.9, 2.1 and 3.9, respectively. Altogether, this data demonstrates the critical role of ABC transporters, particularly Mdr65, in altering the toxicity of specific, structurally diverse, insecticides in D. melanogaster. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Rapid Screening of MDR-TB in Cases of Extra Pulmonary Tuberculosis Using Geno Type MTBDRplus.

    Directory of Open Access Journals (Sweden)

    Richa Kumari

    Full Text Available Drug resistance in tuberculosis is a major public health challenge in developing countries. The limited data available on drug resistance in extra pulmonary tuberculosis stimulated us to design our study on anti-tuberculosis drug resistance pattern in cases of extra pulmonary tuberculosis in a tertiary referral hospital of North India. We performed Geno Type MTBDRplus assay in comparison with conventional drug susceptibility testing by proportion method to study the mutation patterns in rpoB, katG and inhA genes.A total of 510 extra pulmonary samples were included in this study. After the smear microscopy, all the specimens were subjected for culture on Lowenstein Jensen (LJ media. Phenotypic drug susceptibility testing (DST was performed on LJ media for all the MTB isolates and compared with the results of Geno Type MTBDRplus assay which was performed with the DNA isolated from the culture by conventional method.Of 510 specimens cultured, the total culture positivity obtained was 11.8% (60 encompassing 54 (10.6% Mycobacterium tuberculosis and 6 (1.2% non-tubercular mycobacteria (NTM. DST results by Geno Type MTBDRplus assay and solid culture methods were compared in 51 MTB isolates excluding the two Rif indeterminate and one invalid test. Geno Type MTBDRplus accurately identified 13 of 14 rifampicin-resistant strains, 14 of 15 isoniazid-resistant strains and 13 of 14 as multi drug resistant tuberculosis (MDR-TB in comparison with conventional method. Sensitivity and specificity were 92.86% and 97.30% respectively for detection of RIF resistance, 93.33% and 94.44% respectively for detection of INH resistance, 92.86% and 97.30% respectively for detection of MDR-TB, while the overall concordance of Geno Type MTBDRplus assay with conventional DST was 94.11%. The turn-around time for performing Geno Type MTBDRplus assay test was 48 hours.The problem of MDR in extra pulmonary tuberculosis (EPTB cannot be overlooked and due attention on patients

  3. Associations between Antimicrobial Resistance Phenotypes, Antimicrobial Resistance Genes, and Virulence Genes of Fecal Escherichia coli Isolates from Healthy Grow-Finish Pigs ▿

    OpenAIRE

    Rosengren, Leigh B.; Waldner, Cheryl L.; Reid-Smith, Richard J.

    2009-01-01

    Escherichia coli often carries linked antimicrobial resistance genes on transmissible genetic elements. Through coselection, antimicrobial use may select for unrelated but linked resistance or virulence genes. This study used unconditional statistical associations to investigate the relationships between antimicrobial resistance phenotypes and antimicrobial resistance genes in 151 E. coli isolates from healthy pigs. Phenotypic resistance to each drug was significantly associated with phenotyp...

  4. Multiple Genetic Analysis System-Based Antibiotic Susceptibility Testing in Helicobacter pylori and High Eradication Rate With Phenotypic Resistance-Guided Quadruple Therapy.

    Science.gov (United States)

    Dong, Fangyuan; Ji, Danian; Huang, Renxiang; Zhang, Fan; Huang, Yiqin; Xiang, Ping; Kong, Mimi; Nan, Li; Zeng, Xianping; Wu, Yong; Bao, Zhijun

    2015-11-01

    Antibiotics resistance in Helicobacter pylori (H. pylori) is the major factor for eradication failure. Molecular tests including fluorescence in situ hybridization, PCR-restriction fragment length polymorphism, and dual priming oligonucleotide-PCR (DPO-PCR) play critical roles in the detection of antibiotic susceptibility; however, limited knowledge is known about application of multiple genetic analysis system (MGAS) in the area of H. pylori identification and antibiotics resistance detection.The aim of this study is to determine the antibiotics resistance using different molecular tests and evaluate the treatment outcomes of E-test-based genotypic resistance.A total of 297 patients with dyspepsia complaint were recruited for gastroscopies. Ninety patients with H. pylori culture positive were randomly divided into 2 groups (test group and control group). E-test, general PCR, and MGAS assay were performed in test group. Patients in control group were treated with empirical therapy (rabeprazole + bismuth potassium citrate + amoxicillin [AMX] + clarithromycin [CLR]), whereas patients in test group received quadruple therapy based on E-test results twice daily for 14 consecutive days. The eradication effect of H. pylori was confirmed by C-urea breath test after at least 4 weeks when treatment was finished.Rapid urease test showed 46.5% (128/297) patients with H. pylori infection, whereas 30.3% (90/297) patients were H. pylori culture positive. E-test showed that H. pylori primary resistance rate to CLR, AMX, metronidazole, tetracycline, and levofloxacin (LVX) was 40.0% (18/45), 4.4% (2/45), 53.3% (24/45), 0% (0/45), and 55.6% (25/45), respectively. In addition, there are many multidrug resistant (MDR) phenotypes, and the MDR strains have higher minimum inhibitory concentration than their single-drug resistant counterparts. Considering E-test as the reference test, the sensitivities of general PCR and MGAS in detecting CLR resistance were 83.3% (15/18) and 94.4% (17

  5. Antibacterial Activity Test of Nudibranches Polka - Dot (Jorunna funebris (Gastropods : Molusc Extract Against Multi(Aktivitas Antibakteri Ekstrak Nudibranch Polka-Dot (Jorunna funebris (Gastropoda : Moluska Terhadap Bakteri Multidrug Resistant (MDR

    Directory of Open Access Journals (Sweden)

    Delianis Pringgenies

    2015-12-01

    Full Text Available Terjadinya resistensi antibiotik menjadi permasalahan dalam dunia kesehatan. Peningkatan kemampuan patogen dalam menahan efek obat menyebabkan timbulnya resistensi. Beberapa bakteri patogen pada manusia dilaporkan telah mengalami resistensi terhadap lebih dari satu kelas antibiotik. Untuk mengatasi permasalahan tersebut, maka perlu dilakukan pencarian senyawa antibiotik baru yang lebih efektif dalam mengatasi permasalahan bakteri Multi-drug Resistant (MDR. Metabolit sekunder yang diproduksi oleh invertebrata laut  mempunyai prospek sebagai bahan obat dari laut. Nudibranch diduga mampu menghasilkan metabolit sekunder sebagai mekanisme pertahanan diri. Tujuan dari penelitian ini adalah untuk mengetahui fraksi dari ekstrak nudibranch Jorunna funebris yang menunjukkan bioaktivitas terhadap bakteri Multi-drug Resistant (MDR. Proses ekstraksi dilakukan dengan metode maserasi. Fraksinasi dengan Kromatografi Kolom Terbuka (KKT. Uji aktivitas antibakteri menggunakan metode difusi agar. Analisis komponen senyawa dengan GC-MS. Hasil penelitian menunjukkan bahwa 8 fraksi ekstrak nudibranch J. funebris menunjukkan aktivitas antibakteri. Hasil uji aktivitas menunjukkan fraksi I paling aktif terhadap 5 bakteri uji yaitu Klebsiella, Pseudomonas, Escherichia coli, Enterobacter 5 dan Enterobacter 10 dengan rata-rata zona hambatan secara berurutan sebesar 12,78 mm; 12,51 mm; 15,47 mm; 14,09 mm dan 12,46 mm. Fraksi II paling aktif terhadap bakteri Coagulase Negative Staphylococcus dengan rata-rata zona hambatan sebesar 12,70 mm. Analisis GC-MS menunjukkan bahwa dalam fraksi II terdapat senyawa 1-oktadekanol yang berpotensi sebagai antibakteri. Kata kunci : nudibranch, Jorunna funebris, antibakteri, multi-drug resistant, 1-oktadekanol Emergence of antibiotic resistance become a problems on medical world. Increasing pathogen ability to hold the antibiotic effect caused resistance. Several human-patogen bacteria were resistance to one or more classes of antibiotics

  6. Phenotypic changes contributing to Enterobacter gergoviae biocide resistance.

    Science.gov (United States)

    Périamé, M; Philippe, N; Condell, O; Fanning, S; Pagès, J-M; Davin-Regli, A

    2015-08-01

    Enterobacter gergoviae is a recurrent contaminant of cosmetic and hygiene products. To understand how this bacterium adapts to biocides, we studied Ent. gergoviae CIP 76.01 and its triclosan and Methylisothiazolinone-chloromethylisothiazolinone (MIT-CMIT) tolerant isogenic mutants. They were compared with others also isolated from contaminated cosmetics. Phenotypic differences were noted and these included changes in the bacterial envelope and flagella along with differences in motility, and biofilm growth rates. Triclosan and MIT-CMIT derivatives expressed flagella and other MIT-CMIT derivatives exhibited some external appendages. Those bacteria expressing a high-level minimal inhibitory concentration to MIT-CMIT, expressed a strong biofilm formation. No differential phenotypes were noted for carbon source utilisation. Enterobacter gergoviae demonstrated a diverse response to both of these preservatives contained in cosmetic preparations, depending on their concentrations. Interestingly, this adaptive response is associated with modifications of filament structure-related proteins contributing to increase the organism motility and the production of biofilm. Recurrent contaminations of cosmetics products by Ent. gergoviae, needed a better understanding concerning the bacterial adaptation to preservative agents, with particular concern to triclosan and MIT-CMIT. We demonstrated that bacteria response is associated to various mechanisms represented by expression of external appendages (pili or fimbriae) that control cell motility and biofilm formation and evolving as the concentration of biocides adaptation increased. Such mechanisms which are not chemical specific can also promote a cross-resistance to other biocidal agents. The characterization of Ent. gergoviae adaptability to biocides allows industry to adjust the ranges of concentrations and composition of preservatives in formula. © 2015 The Society for Applied Microbiology.

  7. Polymorphisms in the xenobiotic transporter Multidrug Resistance 1 (MDR1) and interaction with meat intake in relation to risk of colorectal cancer in a Danish prospective case-cohort study

    DEFF Research Database (Denmark)

    Andersen, Vibeke; Østergaard, Mette; Christensen, Jane

    2009-01-01

    (rs5275) polymorphisms in the 3'-untranslated region. The polymorphisms were assessed together with lifestyle factors in a nested case-cohort study of 359 cases and a random cohort sample of 765 participants from the Danish prospective Diet, Cancer and Health study. Results Carriers of the variant......Background The xenobiotic transporters, Multidrug Resistance 1 (MDR1/ABCB1) and Breast Cancer Resistance Protein (BCRP/ABCG2) may restrict intestinal absorption of various carcinogens, including heterocyclic amines (HCA) and polycyclic aromatic hydrocarbons (PAH). Cyclooxygenase-2 (COX-2) derived...... prostaglandins promote gastrointestinal carcinogenesis, affecting angiogenesis, apoptosis, and invasiveness. The aim of this study was to investigate if polymorphisms in these genes were associated with risk of colorectal cancer (CRC), and to investigate possible interactions with lifestyle factors...

  8. High frequency of a single nucleotide substitution (c.-6-180T>G) of the canine MDR1/ABCB1 gene associated with phenobarbital-resistant idiopathic epilepsy in Border Collie dogs.

    Science.gov (United States)

    Mizukami, Keijiro; Yabuki, Akira; Chang, Hye-Sook; Uddin, Mohammad Mejbah; Rahman, Mohammad Mahbubur; Kushida, Kazuya; Kohyama, Moeko; Yamato, Osamu

    2013-01-01

    A single nucleotide substitution (c.-6-180T>G) associated with resistance to phenobarbital therapy has been found in the canine MDR1/ABCB1 gene in Border Collies with idiopathic epilepsy. In the present study, a PCR-restriction fragment length polymorphism assay was developed for genotyping this mutation, and a genotyping survey was carried out in a population of 472 Border Collies in Japan to determine the current allele frequency. The survey demonstrated the frequencies of the T/T wild type, T/G heterozygote, and G/G mutant homozygote to be 60.0%, 30.3%, and 9.8%, respectively, indicating that the frequency of the mutant G allele is extremely high (24.9%) in Border Collies. The results suggest that this high mutation frequency of the mutation is likely to cause a high prevalence of phenobarbital-resistant epilepsy in Border Collies.

  9. High Frequency of a Single Nucleotide Substitution (c.-6-180T>G of the Canine MDR1/ABCB1 Gene Associated with Phenobarbital-Resistant Idiopathic Epilepsy in Border Collie Dogs

    Directory of Open Access Journals (Sweden)

    Keijiro Mizukami

    2013-01-01

    Full Text Available A single nucleotide substitution (c.-6-180T>G associated with resistance to phenobarbital therapy has been found in the canine MDR1/ABCB1 gene in Border Collies with idiopathic epilepsy. In the present study, a PCR-restriction fragment length polymorphism assay was developed for genotyping this mutation, and a genotyping survey was carried out in a population of 472 Border Collies in Japan to determine the current allele frequency. The survey demonstrated the frequencies of the T/T wild type, T/G heterozygote, and G/G mutant homozygote to be 60.0%, 30.3%, and 9.8%, respectively, indicating that the frequency of the mutant G allele is extremely high (24.9% in Border Collies. The results suggest that this high mutation frequency of the mutation is likely to cause a high prevalence of phenobarbital-resistant epilepsy in Border Collies.

  10. Defining the Relationship Between Phenotypic and Genotypic Resistance Profiles of Multidrug-Resistant Enterobacterial Clinical Isolates.

    Science.gov (United States)

    Galal, Lamis; Abdel Aziz, Neveen A; Hassan, Walaa M

    2018-05-11

    Fluoroquinolones and aminoglycosides offer effective therapy for extended-spectrum beta-lactamase (ESBL)-producing enterobacterial infections, but their usefulness is threatened by increasing resistant strains. This study was conducted to demonstrate the phenotypic outcomes of the coexistence of genetic determinants mediating resistance to extended-spectrum cephalosporins and quinolones in enterobacterial isolates collected from patients with health-care-associated infections in Egypt. ESBL phenotype was determined using double-disk synergy test (DDST). The PCR technique was used to detect the presence of the genes mediating quinolone resistance (qnr and aac(6')-Ib-cr) and coexistence with ESBL genes. We also examined the association between the genetic makeup of the isolates and their resistance profiles including effect on MIC results. Phenotypically ESBLs were detected in 60-82% of the enterobacterial isolates. ESBL, qnr and aac(6')-Ib-cr genes were detected with the following percentages in Citrobacter isolates (69%, 69%, and 43%, respectively), E.coli isolates (65%, 70%, and 45%, respectively), Enterobacter isolates (56%, 67%, and 33%, respectively), and finally Klebsiella isolates (42%, 66%, and 25%, respectively). The coexistence of these multiresistant genetic elements significantly increased the MIC values of the tested antibiotics from different classes. We suggest using blaTEM, blaCTX-M-15, qnr, and aac(6')-Ib-cr genes for better and faster prediction of suitable antibiotic therapy with effective doses against ESBL-producing isolates harboring plasmid-mediated quinolone resistance (PMQR) determinants. Amikacin, meropenem, gentamicin, and imipenem seem to be better choices of treatment for such life-threatening infections, because of their remaining highest activity.

  11. Phenotypic resistance and the dynamics of bacterial escape from phage control

    DEFF Research Database (Denmark)

    Bull, James J.; Vegge, Christina Skovgaard; Schmerer, Matthew

    2014-01-01

    The canonical view of phage - bacterial interactions in dense, liquid cultures is that the phage will eliminate most of the sensitive cells; genetic resistance will then ascend to restore high bacterial densities. Yet there are various mechanisms by which bacteria may remain sensitive to phages...... mathematical models of these processes and suggest how different types of this 'phenotypic' resistance may be elucidated. We offer preliminary in vitro studies of a previously characterized E. coli model system and Campylobacter jejuni illustrating apparent phenotypic resistance. As phenotypic resistance may...

  12. Phenotypic Characterization of Multidrug-resistant Escherichia Coli with Special Reference to Extended-spectrum-beta-lactamases and Metallo-beta-lactamases in a Tertiary Care Center

    Directory of Open Access Journals (Sweden)

    Basudha Shrestha

    2015-06-01

    Conclusions: Beta-lactamase mediated resistance mechanisms are accounting very high in the multidrug resistant isolates of E. coli. Therefore, early detection of beta lactamase mediated resistant strains and their current antibiotic susceptibility pattern is necessary to avoid treatment failure and prevent the spread of MDR. Keywords: e. coli; extended-spectrum-β-lactamase; metallo-β-lactamase; multidrug-resistance.

  13. Silencage du gene MDR1 et resensibilisation des cellules MCF-7 MDR a la doxorubicine en utilisant les nanoparticules chitosane/MDR1-siARN

    Science.gov (United States)

    El-Ariss, Mohamad

    Cancer is the leading cause of death in Canada and is responsible for about 30% of all deaths in the country.[1] It is estimated that by 2015, one in four Canadians (24% women and 29% men) will die from cancer. In the world and only for 2012, 14 million new cancer cases and 8.2 million deaths from the disease were reported.[2] The worst is yet to come because, according to World Health Organization, the number of new cases is expected to increase by about 70% over the next two decades. The high mortality associated with cancer is partly explained by the acquisition of drug resistance that make patients refractory to chemotherapy. In fact, cancer cells exposed to a cytotoxic agent during chemotherapy, may develop a resistance to this agent as well as various agents sharing structural or functional similarities. These cancer cells are known for multidrug resistance ("Multiple Drug resistant cells"). The development of resistance to chimiodrogues is a major public health problem that presents an obstacle for the development of new cancer treatments. MCF-7 MDR are established cell lines of human breast cancer that have developed resistance to chimiodrogues such as doxorubicin. MCF-7 MDR have the particularity to over-express P-gp protein that is responsible for the detoxification of cells by reflux of chimiodrogues. The purpose of this study was therefore to reduce the expression of P-gp, encoded by the MDR1 gene (also called gene ABCB1) in cancer cells MCF-7, and re-sensitize MCF-7 MDR cells to anti-cancer treatments. In order to modify MDR1 gene expression, we used small RNAi called siRNA that are specific to the MDR1 gene. In total, 4 duplexes of siRNA have been used: siRNA_1, siRNA_1M, siRNA_2 and siRNA_2M. Each of the duplexes strands is consists of 21 nucleic acids and has two protruding nucleic acids (overhangs) at the 3' end. siRNA_1 and siRNA_1M are complementary to the nucleic acid sequence (577-595 nucleic acids ) of the MDR1 gene, whereas siARN_2 and si

  14. Fungicide-driven evolution and molecular basis of multidrug resistance in field populations of the grey mould fungus Botrytis cinerea.

    Directory of Open Access Journals (Sweden)

    Matthias Kretschmer

    2009-12-01

    Full Text Available The grey mould fungus Botrytis cinerea causes losses of commercially important fruits, vegetables and ornamentals worldwide. Fungicide treatments are effective for disease control, but bear the risk of resistance development. The major resistance mechanism in fungi is target protein modification resulting in reduced drug binding. Multiple drug resistance (MDR caused by increased efflux activity is common in human pathogenic microbes, but rarely described for plant pathogens. Annual monitoring for fungicide resistance in field isolates from fungicide-treated vineyards in France and Germany revealed a rapidly increasing appearance of B. cinerea field populations with three distinct MDR phenotypes. All MDR strains showed increased fungicide efflux activity and overexpression of efflux transporter genes. Similar to clinical MDR isolates of Candida yeasts that are due to transcription factor mutations, all MDR1 strains were shown to harbor activating mutations in a transcription factor (Mrr1 that controls the gene encoding ABC transporter AtrB. MDR2 strains had undergone a unique rearrangement in the promoter region of the major facilitator superfamily transporter gene mfsM2, induced by insertion of a retrotransposon-derived sequence. MDR2 strains carrying the same rearranged mfsM2 allele have probably migrated from French to German wine-growing regions. The roles of atrB, mrr1 and mfsM2 were proven by the phenotypes of knock-out and overexpression mutants. As confirmed by sexual crosses, combinations of mrr1 and mfsM2 mutations lead to MDR3 strains with higher broad-spectrum resistance. An MDR3 strain was shown in field experiments to be selected against sensitive strains by fungicide treatments. Our data document for the first time the rising prevalence, spread and molecular basis of MDR populations in a major plant pathogen in agricultural environments. These populations will increase the risk of grey mould rot and hamper the effectiveness of

  15. Same Phenotype in Children with Growth Hormone Deficiency and Resistance

    Science.gov (United States)

    Ioimo, Irene; Guarracino, Carmen; Meazza, Cristina; Domené, Horacio M.

    2018-01-01

    By definition, about 2.5% of children show a short stature due to several causes. Two clinical conditions are characterized by serum IGF-I low levels, idiopathic GH deficiency (IGHD), and GH insensitivity (GHI), and the phenotypic appearance of these patients may be very similar. We studied two children with short stature and similar phenotypes. The first case showed frontal bossing, doll face, acromicria, and truncal obesity, with a GH peak Laron syndrome was confirmed after the molecular analysis of the GH receptor (GHR) gene. IGHD type IA and Laron syndrome is characterized by opposite circulating levels of GH, while both have reduced levels of IGF-I, with an overlapping clinical phenotype, lacking the effects of IGF-I on cartilage. These classical cases show the importance of differential diagnosis in children with severe short stature. PMID:29850346

  16. Study of antagonistic effects of Lactobacillus strains as probiotics on multi drug resistant (MDR) bacteria isolated from urinary tract infections (UTIs).

    Science.gov (United States)

    Naderi, Atiyeh; Kasra-Kermanshahi, Roha; Gharavi, Sara; Imani Fooladi, Abbas Ali; Abdollahpour Alitappeh, Meghdad; Saffarian, Parvaneh

    2014-03-01

    Urinary tract infection (UTI) caused by bacteria is one of the most frequent infections in human population. Inappropriate use of antibiotics, often leads to appearance of drug resistance in bacteria. However, use of probiotic bacteria has been suggested as a partial replacement. This study was aimed to assess the antagonistic effects of Lactobacillus standard strains against bacteria isolated from UTI infections. Among 600 samples; those with ≥10,000 cfu/ml were selected as UTI positive samples. Enterococcus sp., Klebsiella pneumoniae, Enterobacter sp., and Escherichia coli were found the most prevalent UTI causative agents. All isolates were screened for multi drug resistance and subjected to the antimicrobial effects of three Lactobacillus strains by using microplate technique and the MICs amounts were determined. In order to verify the origin of antibiotic resistance of isolates, plasmid curing using ethidium bromide and acridine orange was carried out. No antagonistic activity in Lactobacilli suspension was detected against test on Enterococcus and Enterobacter strains and K. pneumoniae, which were resistant to most antibiotics. However, an inhibitory effect was observed for E. coli which were resistant to 8-9 antibiotics. In addition, L. casei was determined to be the most effective probiotic. RESULTS from replica plating suggested one of the plasmids could be related to the gene responsible for ampicillin resistance. Treatment of E. coli with probiotic suspension was not effective on inhibition of the plasmid carrying hypothetical ampicillin resistant gene. Moreover, the plasmid profiles obtained from probiotic-treated isolates were identical to untreated isolates.

  17. Comparison of phenotyping methods for resistance to stem rot and aggregated sheath spot in rice

    Science.gov (United States)

    Stem and sheath diseases caused by Sclerotium oryzae Cattaneo (SCL) and Rhizoctonia oryzae-sativae Sawada Mordue (ROS) can severely reduce rice (Oryza sativa L.) yield and grain quality. Genetic resistance is the best strategy to control them. Phenotypic selection for resistance is hampered due to a...

  18. Dietary patterns and the insulin resistance phenotype among non-diabetic adults

    Science.gov (United States)

    Background: Information on the relation between dietary patterns derived by cluster analysis and insulin resistance is scarce. Objective: To compare insulin resistance phenotypes, including waist circumference, body mass index, fasting and 2-hour post-challenge insulin, insulin sensitivity index (I...

  19. Study of antagonistic effects of Lactobacillus strains as probiotics on multi drug resistant (MDR bacteria isolated from urinary tract infections (UTIs

    Directory of Open Access Journals (Sweden)

    Atiyeh Naderi

    2014-03-01

    Conclusion: Treatment of E. coli with probiotic suspension was not effective on inhibition of the plasmid carrying hypothetical ampicillin resistant gene. Moreover, the plasmid profiles obtained from probiotic-treated isolates were identical to untreated isolates.

  20. Phenotypic and genetic characteristics of fluoroquinolone- and methicillin-resistant Staphylococcus aureus.

    Science.gov (United States)

    Moreno-Flores, Antonio; Potel-Alvarellos, Carmen; Otero-Fernández, Susana; Álvarez-Fernández, Maximiliano

    2017-07-20

    Fluoroquinolone resistance in methicillin-resistant Staphylococcus aureus (MRSA) has increased in recent years. The objective of this study was to characterise two MRSA populations, one susceptible to fluoroquinolones and other resistant identifying the clonal types and the differential characteristics of both MRSA populations. Molecular typing using PFGE, MLST, spa and SSCmec was performed on 192 MRSA strains isolated from 2009 to 2011, 49 only oxacillin-resistant (OX-R) and 143 oxacillin and levofloxacin-resistant (OX-R-LEV-R). Mutations that conferred resistance to fluoroquinolones, hypermutable phenotypes and the presence of eight microbial surface components recognising adhesive matrix molecules (MSCRAMMs) were also studied. A statistically significant increase in the OX-R-LEV-R phenotype was observed (p<0.05). The most common clone of the OX-R isolates was sequence type (ST) 8 (32.6%), followed by ST72 (26.5%) and ST5 (26.5%). In the OX-R-LEV-R phenotype, the ST5 clone was the most common (65.7%), followed by ST72 (15.4%), and ST125 (12.6%). All isolates except the ST398 clone carried the SCCmecIVc. Clones ST5, ST72, ST125, and ST30 had hypermutable phenotypes. The ST72 clone and the ST30 clone in the OX-R phenotype harboured the highest number of MSCRAMMs. ST5 and ST72 clones were the most frequent clones identified in OX-R-LEV-R phenotype. Both clones showed a hypermutable phenotype that favours their selection as the fluoroquinolone resistant clones. The genetic relationships identified indicate that OX-R-LEV-R clones have evolved from OX-R MRSA clones. Copyright © 2017 Elsevier España, S.L.U. and Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

  1. Lack of phenotypic and evolutionary cross-resistance against parasitoids and pathogens in Drosophila melanogaster.

    Directory of Open Access Journals (Sweden)

    Alex R Kraaijeveld

    Full Text Available When organisms are attacked by multiple natural enemies, the evolution of a resistance mechanism to one natural enemy will be influenced by the degree of cross-resistance to another natural enemy. Cross-resistance can be positive, when a resistance mechanism against one natural enemy also offers resistance to another; or negative, in the form of a trade-off, when an increase in resistance against one natural enemy results in a decrease in resistance against another. Using Drosophila melanogaster, an important model system for the evolution of invertebrate immunity, we test for the existence of cross-resistance against parasites and pathogens, at both a phenotypic and evolutionary level.We used a field strain of D. melanogaster to test whether surviving parasitism by the parasitoid Asobara tabida has an effect on the resistance against Beauveria bassiana, an entomopathogenic fungus; and whether infection with the microsporidian Tubulinosema kingi has an effect on the resistance against A. tabida. We used lines selected for increased resistance to A. tabida to test whether increased parasitoid resistance has an effect on resistance against B. bassiana and T. kingi. We used lines selected for increased tolerance against B. bassiana to test whether increased fungal resistance has an effect on resistance against A. tabida.We found no positive cross-resistance or trade-offs in the resistance to parasites and pathogens. This is an important finding, given the use of D. melanogaster as a model system for the evolution of invertebrate immunity. The lack of any cross-resistance to parasites and pathogens, at both the phenotypic and the evolutionary level, suggests that evolution of resistance against one class of natural enemies is largely independent of evolution of resistance against the other.

  2. Same Phenotype in Children with Growth Hormone Deficiency and Resistance

    Directory of Open Access Journals (Sweden)

    Irene Ioimo

    2018-01-01

    Full Text Available By definition, about 2.5% of children show a short stature due to several causes. Two clinical conditions are characterized by serum IGF-I low levels, idiopathic GH deficiency (IGHD, and GH insensitivity (GHI, and the phenotypic appearance of these patients may be very similar. We studied two children with short stature and similar phenotypes. The first case showed frontal bossing, doll face, acromicria, and truncal obesity, with a GH peak <0.05 ng/ml after stimuli and undetectable serum IGF-I levels. After PCR amplification of the whole GH1 gene, type IA idiopathic GHD was diagnosed. The second case had cranium hypoplasia, a large head, protruding forehead, saddle nose, underdeveloped mandible, and a micropenis. Basal GH levels were high (28.4 ng/ml while serum IGF-I levels were low and unchangeable during the IGF-I generation test. Laron syndrome was confirmed after the molecular analysis of the GH receptor (GHR gene. IGHD type IA and Laron syndrome is characterized by opposite circulating levels of GH, while both have reduced levels of IGF-I, with an overlapping clinical phenotype, lacking the effects of IGF-I on cartilage. These classical cases show the importance of differential diagnosis in children with severe short stature.

  3. 8__Aisha_Detection ofMDR-TB

    African Journals Online (AJOL)

    User

    Among the MDR-TB cases rifampicin resistance was associated with rpoB WT gene and rpoB MUT gene in 100% and 62% of the ... diagnosis of TB patients, and proper treatment and management of the infected cases to minimize the spread and ..... in an amino acid change and concluded that this is one of the reasons ...

  4. Identifying novel phenotypes of vulnerability and resistance to activity-based anorexia in adolescent female rats.

    Science.gov (United States)

    Barbarich-Marsteller, Nicole C; Underwood, Mark D; Foltin, Richard W; Myers, Michael M; Walsh, B Timothy; Barrett, Jeffrey S; Marsteller, Douglas A

    2013-11-01

    Activity-based anorexia is a translational rodent model that results in severe weight loss, hyperactivity, and voluntary self-starvation. The goal of our investigation was to identify vulnerable and resistant phenotypes of activity-based anorexia in adolescent female rats. Sprague-Dawley rats were maintained under conditions of restricted access to food (N = 64; or unlimited access, N = 16) until experimental exit, predefined as a target weight loss of 30-35% or meeting predefined criteria for animal health. Nonlinear mixed effects statistical modeling was used to describe wheel running behavior, time to event analysis was used to assess experimental exit, and a regressive partitioning algorithm was used to classify phenotypes. Objective criteria were identified for distinguishing novel phenotypes of activity-based anorexia, including a vulnerable phenotype that conferred maximal hyperactivity, minimal food intake, and the shortest time to experimental exit, and a resistant phenotype that conferred minimal activity and the longest time to experimental exit. The identification of objective criteria for defining vulnerable and resistant phenotypes of activity-based anorexia in adolescent female rats provides an important framework for studying the neural mechanisms that promote vulnerability to or protection against the development of self-starvation and hyperactivity during adolescence. Ultimately, future studies using these novel phenotypes may provide important translational insights into the mechanisms that promote these maladaptive behaviors characteristic of anorexia nervosa. Copyright © 2013 Wiley Periodicals, Inc.

  5. Phenotypic and genotypic detection of antibiotic resistance of ...

    African Journals Online (AJOL)

    aeruginosa isolated from urinary tract infections. Hisham A Abbas1 ... This high resistance is alarming and necessitates applying strict antibiotic prescription policies. Keywords: ..... ginosa at children's medical center hospital. Journal of Med-.

  6. Rapid diagnosis of multidrug resistance in cancer by electrochemical sensor based on carbon nanotubes-drug supramolecular nanocomposites.

    Science.gov (United States)

    Zhang, Haijun; Jiang, Hui; Sun, Feifei; Wang, Huangping; Zhao, Juan; Chen, Baoan; Wang, Xuemei

    2011-03-15

    The multidrug resistance (MDR) in cancer is a major chemotherapy obstacle, rendering many currently available chemotherapeutic drugs ineffective. The aim of this study was to explore the new strategy to early diagnose the MDR by electrochemical sensor based on carbon nanotubes-drug supramolecular interaction. The carbon nanotubes modified glassy carbon electrodes (CNTs/GCE) were directly immersed into the cells suspension of the sensitive leukemia cells K562 and/or its MDR cells K562/A02 to detect the response of the electrochemical probe of daunorubicin (DNR) residues after incubated with cells for 1h. The fresh evidence from the electrochemical studies based on CNTs/GCE demonstrated that the homogeneous, label-free strategy could directly measure the function of cell membrane transporters in MDR cancer cells, identify the cell phenotype (sensitive or MDR). When the different ratios of the sensitive leukemia cells K562 and its MDR ones K562/A02 were applied as a model of MDR levels to simulate the MDR occurrence in cancer, the cathodic peak current showed good linear response to the fraction of MDR with a correlation coefficient of 0.995. Therefore, the MDR fraction can be easily predicted based on the calibration curve of the cathodic peak current versus the fraction of MDR. These results indicated that the sensing strategy could provide a powerful tool for assessment of MDR in cancer. The new electrochemical sensor based on carbon nanotubes-drug supramolecular nanocomposites could represent promising approach in the rapid diagnosis of MDR in cancer. Copyright © 2011 Elsevier B.V. All rights reserved.

  7. Reduced intracellular drug accumulation in drug-resistant leukemia cells is not solely due to MDR-mediated efflux but also to decreased uptake

    Directory of Open Access Journals (Sweden)

    Angela Oliveira Pisco

    2014-10-01

    Full Text Available Expression of ABC family transporter proteins that promote drug efflux from cancer cells is a widely observed mechanism of multi-drug resistance of cancer cells. Cell adaptation in long-term culture of HL60 leukemic cells in the presence of chemotherapy leads to induction and maintenance of the ABC transporters expression, preventing further accumulation of drugs. However, we found that decreased accumulation of drugs and fluorescent dyes was also contributed by a reduced uptake by the resistant cells. Confocal time-lapse microscopy and flow cytometry revealed that fluid-phase endocytosis was diminished in drug-resistant cells compared to drug-sensitive cells. Drug uptake was increased by insulin co-treatment when cells were grown in methylcellulose and monitored under the microscope, but not when cultured in suspension. We propose that multi-drug resistance is not solely achieved by enhanced efflux capacity but also by supressed intake of the drug offering an alternative target to overcome drug resistance or potentiate chemotherapy.

  8. Emergence of rifampicin, tigecycline, and colistin-resistant Acinetobacter baumannii in Iran; spreading of MDR strains of novel International Clone variants.

    Science.gov (United States)

    Bahador, Abbas; Taheri, Mohammad; Pourakbari, Babak; Hashemizadeh, Zahra; Rostami, Hossein; Mansoori, Noormohamad; Raoofian, Reza

    2013-10-01

    Multidrug-resistant Acinetobacter baumannii infections are serious challenges for clinicians because of A. baumannii propensity to acquire resistance to a wide spectrum of antimicrobial agents. In this study, 91 A. baumannii isolates from patients in tertiary intensive care units of three university hospitals in the north, central, and south of Iran were selected and tested for susceptibility to 22 antimicrobials; amplified restriction fragment polymorphism and multiplex polymerase chain reaction methods were used to determine genetic relationships and International Clone (IC) of A. baumannii isolates, respectively. Twenty-four genotypes were identified in A. baumannii isolates. About 91.2% of isolates categorized into 4 distinct clusters; one was more heterogeneous and observed across the three locations. A considerable number of the isolates (27.5%) belonged to the novel IC variant, sequence group 7 (SG7), which was geographically widespread in three locations. The drug resistance pattern showed that 14.2%, 20%, and 77% of the A. baumannii isolates were resistant to colistin, tigecycline, and rifampicin, respectively. Nine percent of isolates (8) showed simultaneous resistance to colistin, rifampicin, and tigecycline. Interestingly, all of them were susceptible to ampicillin-sulbactam and/or tobramycin. According to our results, SG7 could be considered as a pan-Iranian clone.

  9. Increased p38-MAPK is responsible for chemotherapy resistance in human gastric cancer cells

    International Nuclear Information System (INIS)

    Guo, Xianling; Zhang, Baihe; Wu, Mengchao; Wei, Lixin; Ma, Nannan; Wang, Jin; Song, Jianrui; Bu, Xinxin; Cheng, Yue; Sun, Kai; Xiong, Haiyan; Jiang, Guocheng

    2008-01-01

    Chemoresistance is one of the main obstacles to successful cancer therapy and is frequently associated with Multidrug resistance (MDR). Many different mechanisms have been suggested to explain the development of an MDR phenotype in cancer cells. One of the most studied mechanisms is the overexpression of P-glycoprotein (P-gp), which is a product of the MDR1 gene. Tumor cells often acquire the drug-resistance phenotype due to upregulation of the MDR1 gene. Overexpression of MDR1 gene has often been reported in primary gastric adenocarcinoma. This study investigated the role of p38-MAPK signal pathway in vincristine-resistant SGC7901/VCR cells. P-gp and MDR1 RNA were detected by Western blot analysis and RT-PCR amplification. Mitgen-activated protein kinases and function of P-gp were demonstrated by Western blot and FACS Aria cytometer analysis. Ap-1 activity and cell apoptosis were detected by Dual-Luciferase Reporter Assay and annexin V-PI dual staining. The vincristine-resistant SGC7901/VCR cells with increased expression of the multidrug-resistance 1 (MDR1) gene were resistant to P-gp-related drug and P-gp-unrelated drugs. Constitutive increases of phosphorylated p38-MAPK and AP-1 activities were also found in the drug-resistant cells. Inhibition of p38-MAPK by SB202190 reduced activator protein-1 (AP-1) activity and MDR1 expression levels and increased the sensitivity of SGC7901/VCR cells to chemotherapy. Activation of the p38-MAPK pathway might be responsible for the modulation of P-glycoprotein-mediated and P-glycoprotein-unmediated multidrug resistance in the SGC7901/VCR cell line

  10. Rapid diagnosis of pyrazinamide-resistant multidrug-resistant tuberculosis using a molecular-based diagnostic algorithm.

    Science.gov (United States)

    Simons, S O; van der Laan, T; Mulder, A; van Ingen, J; Rigouts, L; Dekhuijzen, P N R; Boeree, M J; van Soolingen, D

    2014-10-01

    There is an urgent need for rapid and accurate diagnosis of pyrazinamide-resistant multidrug-resistant tuberculosis (MDR-TB). No diagnostic algorithm has been validated in this population. We hypothesized that pncA sequencing added to rpoB mutation analysis can accurately identify patients with pyrazinamide-resistant MDR-TB. We identified from the Dutch national database (2007-11) patients with a positive Mycobacterium tuberculosis culture containing a mutation in the rpoB gene. In these cases, we prospectively sequenced the pncA gene. Results from the rpoB and pncA mutation analysis (pncA added to rpoB) were compared with phenotypic susceptibility testing results to rifampicin, isoniazid and pyrazinamide (reference standard) using the Mycobacterial Growth Indicator Tube 960 system. We included 83 clinical M. tuberculosis isolates containing rpoB mutations in the primary analysis. Rifampicin resistance was seen in 72 isolates (87%), isoniazid resistance in 73 isolates (88%) and MDR-TB in 65 isolates (78%). Phenotypic reference testing identified pyrazinamide-resistant MDR-TB in 31 isolates (48%). Sensitivity of pncA sequencing added to rpoB mutation analysis for detecting pyrazinamide-resistant MDR-TB was 96.8%, the specificity was 94.2%, the positive predictive value was 90.9%, the negative predictive value was 98.0%, the positive likelihood was 16.8 and the negative likelihood was 0.03. In conclusion, pyrazinamide-resistant MDR-TB can be accurately detected using pncA sequencing added to rpoB mutation analysis. We propose to include pncA sequencing in every isolate with an rpoB mutation, allowing for stratification of MDR-TB treatment according to pyrazinamide susceptibility. © 2014 The Authors Clinical Microbiology and Infection © 2014 European Society of Clinical Microbiology and Infectious Diseases.

  11. Beta-lactam resistance in the gram negatives: increasing complexity of conditional, composite and multiply resistant phenotypes.

    Science.gov (United States)

    Iredell, Jon; Thomas, Lee; Espedido, Björn

    2006-12-01

    The greatest impact of microbiology data on clinical care is in the critically ill. Unfortunately, this is also the area in which microbiology laboratories are most often non-contributive. Attempts to move to rapid, culture-independent diagnostics are driven by the need to expedite urgent results. This is difficult in Gram-negative infection because of the complexity of the antibiotic resistance phenotype. Here, we discuss resistance to modern beta-lactams as a case in point. Recent outbreaks of transmissible carbapenem resistance among Gram-negative enteric pathogens in Sydney and Melbourne serve to illustrate the pitfalls of traditional phenotypical approaches. A better understanding of the epidemiology and mosaic nature of antibiotic resistance elements in the microflora is needed for us to move forward.

  12. Phenotype, Genotype, and Drug Resistance in Subtype C HIV-1 Infection.

    Science.gov (United States)

    Derache, Anne; Wallis, Carole L; Vardhanabhuti, Saran; Bartlett, John; Kumarasamy, Nagalingeswaran; Katzenstein, David

    2016-01-15

    Virologic failure in subtype C is characterized by high resistance to first-line antiretroviral (ARV) drugs, including efavirenz, nevirapine, and lamivudine, with nucleoside resistance including type 2 thymidine analog mutations, K65R, a T69del, and M184V. However, genotypic algorithms predicting resistance are mainly based on subtype B viruses and may under- or overestimate drug resistance in non-B subtypes. To explore potential treatment strategies after first-line failure, we compared genotypic and phenotypic susceptibility of subtype C human immunodeficiency virus 1 (HIV-1) following first-line ARV failure. AIDS Clinical Trials Group 5230 evaluated patients failing an initial nonnucleoside reverse-transcriptase inhibitor (NNRTI) regimen in Africa and Asia, comparing the genotypic drug resistance and phenotypic profile from the PhenoSense (Monogram). Site-directed mutagenesis studies of K65R and T69del assessed the phenotypic impact of these mutations. Genotypic algorithms overestimated resistance to etravirine and rilpivirine, misclassifying 28% and 32%, respectively. Despite K65R with the T69del in 9 samples, tenofovir retained activity in >60%. Reversion of the K65R increased susceptibility to tenofovir and other nucleosides, while reversion of the T69del showed increased resistance to zidovudine, with little impact on other NRTI. Although genotype and phenotype were largely concordant for first-line drugs, estimates of genotypic resistance to etravirine and rilpivirine may misclassify subtype C isolates compared to phenotype. © The Author 2015. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

  13. Physiological characterisation of the efflux pump system of antibiotic-susceptible and multidrug-resistant

    OpenAIRE

    Martins , A.; Spengler , G.; Martins , M.; Rodrigues , L.; Viveiros , M.; Davin-Regli , A.; Chevalier , J.; Couto , I.; Pagès , J.M.; Amaral , L.

    2010-01-01

    Abstract Enterobacter aerogenes predominates among Enterobacteriaceae species that are increasingly reported as producers of extended-spectrum ?-lactamases. Although this mechanism of resistance to ?-lactams is important, other mechanisms bestowing a multidrug-resistant (MDR) phenotype in this species are now well documented. Among these mechanisms is the overexpression of efflux pumps that extrude structurally unrelated antibiotics prior to their reaching their targets. Interestin...

  14. Phenotypic and Genotypic Analysis of Antimicrobial Resistance among Listeria monocytogenes Isolated from Australian Food Production Chains

    Directory of Open Access Journals (Sweden)

    Annaleise Wilson

    2018-02-01

    Full Text Available The current global crisis of antimicrobial resistance (AMR among important human bacterial pathogens has been amplified by an increased resistance prevalence. In recent years, a number of studies have reported higher resistance levels among Listeria monocytogenes isolates, which may have implications for treatment of listeriosis infection where resistance to key treatment antimicrobials is noted. This study examined the genotypic and phenotypic AMR patterns of 100 L. monocytogenes isolates originating from food production supplies in Australia and examined this in the context of global population trends. Low levels of resistance were noted to ciprofloxacin (2% and erythromycin (1%; however, no resistance was observed to penicillin G or tetracycline. Resistance to ciprofloxacin was associated with a mutation in the fepR gene in one isolate; however, no genetic basis for resistance in the other isolate was identified. Resistance to erythromycin was correlated with the presence of the ermB resistance gene. Both resistant isolates belonged to clonal complex 1 (CC1, and analysis of these in the context of global CC1 isolates suggested that they were more similar to isolates from India rather than the other CC1 isolates included in this study. This study provides baseline AMR data for L. monocytogenes isolated in Australia, identifies key genetic markers underlying this resistance, and highlights the need for global molecular surveillance of resistance patterns to maintain control over the potential dissemination of AMR isolates.

  15. Exploring the Genome and Phenotype of Multi-Drug Resistant Klebsiella pneumoniae of Clinical Origin

    OpenAIRE

    João Anes; Daniel Hurley; Marta Martins; Séamus Fanning; Séamus Fanning

    2017-01-01

    Klebsiella pneumoniae is an important nosocomial pathogen with an extraordinary resistant phenotype due to a combination of acquired resistant-elements and efflux mechanisms. In this study a detailed molecular characterization of 11 K. pneumoniae isolates of clinical origin was carried out. Eleven clinical isolates were tested for their susceptibilities, by disk diffusion and broth microdilution and interpreted according to CLSI guidelines. Efflux activity was determined by measuring the extr...

  16. Fluorometric assay for phenotypic differentiation of drug-resistant HIV mutants

    OpenAIRE

    Zhu, Qinchang; Yu, Zhiqiang; Kabashima, Tsutomu; Yin, Sheng; Dragusha, Shpend; El-Mahdy, Ahmed F. M.; Ejupi, Valon; Shibata, Takayuki; Kai, Masaaki

    2015-01-01

    Convenient drug-resistance testing of viral mutants is indispensable to effective treatment of viral infection. We developed a novel fluorometric assay for phenotypic differentiation of drug-resistant mutants of human immunodeficiency virus-I protease (HIV-PR) which uses enzymatic and peptide-specific fluorescence (FL) reactions and high-performance liquid chromatography (HPLC) of three HIV-PR substrates. This assay protocol enables use of non-purified enzyme sources and multiple substrates f...

  17. Exploration of Fungal Association From Hard Coral Against Pathogen MDR Staphylococcus haemolyticus

    Science.gov (United States)

    Cristianawati, O.; Radjasa, O. K.; Sabdono, A.; Trianto, A.; Sabdaningsih, A.; Sibero, M. T.; Nuryadi, H.

    2017-02-01

    Staphylococcus haemolyticus are opportunistic bacteria and as the second leading cause of nosocomial infections. It is a disease causing septicemia, peritonitis, otitis, and urinary tract infections and infections of the eye. It also a phenotype resistant to multiple antibiotics commercial. There is now an urgency to find an alternative antibiotics to combat this bacteria. It has been widely reported that many bioactive marine natural products from marine invertebrate have striking similarities to metabolites of their associated microorganisms including fungi. Hard coral associated microorganisms are among of the most interesting and promising marine natural product sources, which produce with various biological activities. The proposed work focused on the discovery of bioactive compounds and also estimated the phylogenetic diversity from fungal association of hard coral against pathogen MDR Staphylococcus haemolyticus. A total of 32 fungal association, FHP 7 which were isolated from Favia sp. capable of inhibiting the growth MDR. Molecular identification based on 18S rRNA gene sequences revealed that the active fungal association belonged 100% to the members from one of the genera Trichoderma longibrachiatum. Accession Number LC185084.1.

  18. Phenotype switching : tumor cell plasticity as a resistance mechanism and target for therapy

    NARCIS (Netherlands)

    Kemper, K.; de Goeje, P.L.; Peeper, D.S.; van Amerongen, R.

    2014-01-01

    Mutations in BRAF are present in the majority of patients with melanoma, rendering these tumors sensitive to targeted therapy with BRAF and MEK inhibitors. Unfortunately, resistance almost invariably develops. Recently, a phenomenon called "phenotype switching" has been identified as an escape

  19. High-throughput phenotyping of plant resistance to aphids by automated video tracking

    NARCIS (Netherlands)

    Kloth, K.J.; Broeke, ten C.J.M.; Thoen, H.P.M.; Hanhart-van den Brink, M.; Wiegers, G.L.; Krips, O.E.; Noldus, L.P.J.J.; Dicke, M.; Jongsma, M.A.

    2015-01-01

    Background: Piercing-sucking insects are major vectors of plant viruses causing significant yield losses in crops.Functional genomics of plant resistance to these insects would greatly benefit from the availability of highthroughput, quantitative phenotyping methods. Results: We have developed an

  20. Prevalence of genetic determinants and phenotypic resistance to ciprofloxacin in Campylobacter jejuni from lithuania

    DEFF Research Database (Denmark)

    Aksomaitiene, Jurgita; Ramonaite, Sigita; Olsen, John E.

    2018-01-01

    Recently, the number of reports on isolation of ciprofloxacin resistant Campylobacter jejuni has increased worldwide. The aim of this study was to determine the prevalence of resistance to ciprofloxacin and its genetic determinants among C. jejuni isolated from humans (n = 100), poultry products (n...... = 96) and wild birds (n = 96) in Lithuania. 91.4% of the C. jejuni isolates were phenotypically resistant to ciprofloxacin. DNA sequence analyses of the gyrA gene from 292 isolates revealed that a change in amino acid sequence, Thr86Ile, was the main substition conferring resistance to ciprofloxacin...... forty-five C. jejuni isolates showed one or more silent mutations, and 32.4% of examined isolates possessed six silent mutations. In addition to the ciprofloxacin resistant isolates harboring only Thr86Ile point mutation (110 isolates), the current study identified resistant isolates (n = 101) harboring...

  1. FAM-MDR: a flexible family-based multifactor dimensionality reduction technique to detect epistasis using related individuals.

    Directory of Open Access Journals (Sweden)

    Tom Cattaert

    Full Text Available We propose a novel multifactor dimensionality reduction method for epistasis detection in small or extended pedigrees, FAM-MDR. It combines features of the Genome-wide Rapid Association using Mixed Model And Regression approach (GRAMMAR with Model-Based MDR (MB-MDR. We focus on continuous traits, although the method is general and can be used for outcomes of any type, including binary and censored traits. When comparing FAM-MDR with Pedigree-based Generalized MDR (PGMDR, which is a generalization of Multifactor Dimensionality Reduction (MDR to continuous traits and related individuals, FAM-MDR was found to outperform PGMDR in terms of power, in most of the considered simulated scenarios. Additional simulations revealed that PGMDR does not appropriately deal with multiple testing and consequently gives rise to overly optimistic results. FAM-MDR adequately deals with multiple testing in epistasis screens and is in contrast rather conservative, by construction. Furthermore, simulations show that correcting for lower order (main effects is of utmost importance when claiming epistasis. As Type 2 Diabetes Mellitus (T2DM is a complex phenotype likely influenced by gene-gene interactions, we applied FAM-MDR to examine data on glucose area-under-the-curve (GAUC, an endophenotype of T2DM for which multiple independent genetic associations have been observed, in the Amish Family Diabetes Study (AFDS. This application reveals that FAM-MDR makes more efficient use of the available data than PGMDR and can deal with multi-generational pedigrees more easily. In conclusion, we have validated FAM-MDR and compared it to PGMDR, the current state-of-the-art MDR method for family data, using both simulations and a practical dataset. FAM-MDR is found to outperform PGMDR in that it handles the multiple testing issue more correctly, has increased power, and efficiently uses all available information.

  2. Lessons from a phenotyping center revealed by the genome-guided mapping of powdery mildew resistance loci

    Science.gov (United States)

    The genomics era brought unprecedented tools for genetic analysis of host resistance, but careful attention is needed on obtaining accurate and reproducible phenotypes so that genomic results appropriately reflect biology. Phenotyping host resistance by natural infection in the field can produce var...

  3. Acinetobacter baumannii Isolated from Lebanese Patients: Phenotypes and Genotypes of Resistance, Clonality, and Determinants of Pathogenicity.

    Science.gov (United States)

    Dahdouh, Elias; Hajjar, Micheline; Suarez, Monica; Daoud, Ziad

    2016-01-01

    Introduction: Acinetobacter baumannii is a nosocomial pathogen that usually affects critically ill patients. High mortality rates have been associated with MDR A. baumannii infections. Carbapenem resistance among these isolates is increasing worldwide and is associated with certain International Clones (ICs) and oxacillinases (OXAs). Moreover, this organism possesses a wide range of virulence factors, whose expression is not yet fully understood. In this study, clinical A. baumannii isolates are characterized in terms of antibiotic resistance, mechanisms of carbapenem resistance, clonality, and virulence. Materials and Methods: A. baumannii clinical isolates ( n = 90) where obtained from a tertiary care center in Beirut, Lebanon. API 20NE strips in addition to the amplification of bla OXA-51-like were used for identification. Antibiotic susceptibility testing by disk diffusion was then performed in addition to PCRs for the detection of the most commonly disseminated carbapenemases. Clonality was determined by tri-locus PCR typing and doubling times were determined for isolates with varying susceptibility profiles. Biofilm formation, hemolysis, siderophore production, proteolytic activity, and surface motility was then determined for all the isolates. Statistical analysis was then performed for the determination of associations. Results and Discussion: 81 (90%) of the isolates were resistant to carbapenems. These high rates are similar to other multi-center studies in the country suggesting the need of intervention on a national level. 74 (91.3%) of the carbapenem resistant isolates harbored bla OXA-23-like including two that also harbored bla OXA-24-like . 88.9% of the A. baumannii isolates pertained to ICII and three other international clones were detected, showing the wide dissemination of clones into geographically distinct locations. Virulence profiles were highly diverse and no specific pattern was observed. Nevertheless, an association between motility

  4. Fluorometric assay for phenotypic differentiation of drug-resistant HIV mutants

    Science.gov (United States)

    Zhu, Qinchang; Yu, Zhiqiang; Kabashima, Tsutomu; Yin, Sheng; Dragusha, Shpend; El-Mahdy, Ahmed F. M.; Ejupi, Valon; Shibata, Takayuki; Kai, Masaaki

    2015-01-01

    Convenient drug-resistance testing of viral mutants is indispensable to effective treatment of viral infection. We developed a novel fluorometric assay for phenotypic differentiation of drug-resistant mutants of human immunodeficiency virus-I protease (HIV-PR) which uses enzymatic and peptide-specific fluorescence (FL) reactions and high-performance liquid chromatography (HPLC) of three HIV-PR substrates. This assay protocol enables use of non-purified enzyme sources and multiple substrates for the enzymatic reaction. In this study, susceptibility of HIV mutations to drugs was evaluated by selective formation of three FL products after the enzymatic HIV-PR reaction. This proof-of-concept study indicates that the present HPLC-FL method could be an alternative to current phenotypic assays for the evaluation of HIV drug resistance. PMID:25988960

  5. Antibiotic resistance profiling and phenotyping of Aeromonas species isolated from aquatic sources

    Directory of Open Access Journals (Sweden)

    Olumide A. Odeyemi

    2017-01-01

    Full Text Available This study aimed to investigate antibiotics resistance pattern and phenotyping of Aeromonas species isolated from different aquatic sources in Melaka, Malaysia. A total of 53 Aeromonas species were isolated from the following sources: sediment (n = 13, bivalve (n = 10, sea cucumber (n = 16 and sea water (n = 14 and resistance to 12 antibiotics – Tetracycline (30 μg, Kanamycin (30 μg, Oxytetracycline (30 μg, Ampicillin (10 μg, Streptomycin (10 μg, Gentamicin (10 μg, Sulphamethoxazole (25 μg, Nalixidic acid (30 μg, Trimethoprim (1.25 μg, Novobiocin (5 μg, Penicilin (10 μg and Chloramphenicol (10 μg was tested. The results obtained from this study reveal multi drug resistance pattern among the isolates. All the isolates were completely resistant to Ampicillin, Novobiocin, Sulphamethoxazole and Trimethoprim, respectively but susceptible to Tetracycline (100%, Kanamycin (5.7%, Gentamicin (5.7% and Oxytetracycline (24.5%. Antibiotics phenotyping of the bacteria revealed 21 different phenotypes among the isolates.

  6. Direct detection of Mycobacterium tuberculosis and drug resistance in respiratory specimen using Abbott Realtime MTB detection and RIF/INH resistance assay.

    Science.gov (United States)

    Tam, Kingsley King-Gee; Leung, Kenneth Siu-Sing; To, Sabrina Wai-Chi; Siu, Gilman Kit-Hang; Lau, Terrence Chi-Kong; Shek, Victor Chi-Man; Tse, Cindy Wing-Sze; Wong, Samson Sai-Yin; Ho, Pak-Leung; Yam, Wing-Cheong

    2017-10-01

    Abbott RealTime MTB (Abbott-RT) in conjunction with Abbott RealTime MTB RIF/INH Resistance (Abbott-RIF/INH) is a new, high-throughput automated nucleic acid amplification platform (Abbott-MDR) for detection of Mycobacterium tuberculosis complex (MTBC) and the genotypic markers for rifampicin (RIF) and isoniazid (INH) resistance directly from respiratory specimens. This prospective study evaluated the diagnostic performance of this new platform for MTBC and multidrug-resistant tuberculosis (MDR-TB) using 610 sputum specimens in a tuberculosis high-burden setting. Using conventional culture results and clinical background as reference standards, Abbott-RT exhibited an overall sensitivity and specificity of 95.2% and 99.8%, respectively. Genotypic RIF/INH resistance of 178 "MTB detected" specimens was subsequently analyzed by Abbott-RIF/INH. Compared to phenotypic drug susceptibility test results, Abbott-RIF/INH detected resistance genotypic markers in 84.6% MDR-TB, 80% mono-RIF-resistant and 66.7% mono-INH-resistant specimens. Two of the RIF-resistant specimens carried a novel single, nonsense mutation at rpoB Q513 and in silico simulation demonstrated that the truncated RpoB protein failed to bind with other subunits for transcription. Overall, Abbott-MDR platform provided high throughput and reliable diagnosis of MDR-TB within a TB high-burden region. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Phenotypic and genotypic characterization of Thai isolates of Plasmodium falciparum after an artemisinin resistance containment project.

    Science.gov (United States)

    Thita, Thunyapit; Jadsri, Pimrat; Thamkhantho, Jarupatr; Ruang-Areerate, Toon; Suwandittakul, Nantana; Sitthichot, Naruemon; Mahotorn, Kittiya; Tan-Ariya, Peerapan; Mungthin, Mathirut

    2018-05-15

    In Thailand, artemisinin-based combination therapy (ACT) has been used to treat uncomplicated falciparum malaria since 1995. Unfortunately, artemisinin resistance has been reported from Thailand and other Southeast Asian countries since 2003. Malarone ® , a combination of atovaquone-proguanil (ATQ-PG), has been used to cease artemisinin pressure in some areas along Thai-Cambodia border, as part of an artemisinin resistance containment project since 2009. This study aimed to determine genotypes and phenotypes of Plasmodium falciparum isolates collected from the Thai-Cambodia border after the artemisinin resistance containment project compared with those collected before. One hundred and nine of P. falciparum isolates collected from Thai-Cambodia border from Chanthaburi and Trat provinces during 1988-2016 were used in this study. Of these, 58 isolates were collected after the containment. These parasite isolates were characterized for in vitro antimalarial sensitivities including chloroquine (CQ), quinine (QN), mefloquine (MQ), piperaquine (PPQ), artesunate (AS), dihydroartemisinin (DHA), ATQ and PG and genetic markers for drug resistance including the Kelch13 (k13), Plasmodium falciparum chloroquine resistance transporter (pfcrt), P. falciparum multidrug resistance 1 (pfmdr1) and cytochrome b (cytb) genes. Mean CQ, QN, MQ, PPQ and AS IC 50 s of the parasite isolates collected from 2009 to 2016 exhibited significantly higher than those of parasites collected before 2009. Approximately 57% exhibited in vitro MQ resistance. Approximately 94% of the isolates collected from 2009 to 2016 contained the pfmdr1 184F allele. Mutations of the k13 gene were detected in approximately 90% of the parasites collected from 2009 to 2016 which were significantly higher than the parasite isolates collected before. No ATQ-resistant genotype and phenotype of P. falciparum were found among the isolates collected after the containment project. Although the containment project had been

  8. Heterologously expressed bacterial and human multidrug resistance proteins confer cadmium resistance to Escherichia coli

    NARCIS (Netherlands)

    Achard-Joris, M; van Saparoea, HBV; Driessen, AJM; Bourdineaud, JP; Bourdineaud, Jean-Paul

    2005-01-01

    The human MDR1 gene is induced by cadmium exposure although no resistance to this metal is observed in human cells overexpressing hMDR1. To access the role of MDR proteins in cadmium resistance, human MDR1, Lactococcus lactis lmrA, and Oenococcus oeni omrA were expressed in an Escherichia coli tolC

  9. Phenotypic Plasticity Determines Cancer Stem Cell Therapeutic Resistance in Oral Squamous Cell Carcinoma

    Directory of Open Access Journals (Sweden)

    Adrian Biddle

    2016-02-01

    Full Text Available Cancer stem cells (CSCs drive tumour spread and therapeutic resistance, and can undergo epithelial-to-mesenchymal transition (EMT and mesenchymal-to-epithelial transition (MET to switch between epithelial and post-EMT sub-populations. Examining oral squamous cell carcinoma (OSCC, we now show that increased phenotypic plasticity, the ability to undergo EMT/MET, underlies increased CSC therapeutic resistance within both the epithelial and post-EMT sub-populations. The post-EMT CSCs that possess plasticity exhibit particularly enhanced therapeutic resistance and are defined by a CD44highEpCAMlow/−CD24+ cell surface marker profile. Treatment with TGFβ and retinoic acid (RA enabled enrichment of this sub-population for therapeutic testing, through which the endoplasmic reticulum (ER stressor and autophagy inhibitor Thapsigargin was shown to selectively target these cells. Demonstration of the link between phenotypic plasticity and therapeutic resistance, and development of an in vitro method for enrichment of a highly resistant CSC sub-population, provides an opportunity for the development of improved chemotherapeutic agents that can eliminate CSCs.

  10. Phenotypic Plasticity Determines Cancer Stem Cell Therapeutic Resistance in Oral Squamous Cell Carcinoma.

    Science.gov (United States)

    Biddle, Adrian; Gammon, Luke; Liang, Xiao; Costea, Daniela Elena; Mackenzie, Ian C

    2016-02-01

    Cancer stem cells (CSCs) drive tumour spread and therapeutic resistance, and can undergo epithelial-to-mesenchymal transition (EMT) and mesenchymal-to-epithelial transition (MET) to switch between epithelial and post-EMT sub-populations. Examining oral squamous cell carcinoma (OSCC), we now show that increased phenotypic plasticity, the ability to undergo EMT/MET, underlies increased CSC therapeutic resistance within both the epithelial and post-EMT sub-populations. The post-EMT CSCs that possess plasticity exhibit particularly enhanced therapeutic resistance and are defined by a CD44(high)EpCAM(low/-) CD24(+) cell surface marker profile. Treatment with TGFβ and retinoic acid (RA) enabled enrichment of this sub-population for therapeutic testing, through which the endoplasmic reticulum (ER) stressor and autophagy inhibitor Thapsigargin was shown to selectively target these cells. Demonstration of the link between phenotypic plasticity and therapeutic resistance, and development of an in vitro method for enrichment of a highly resistant CSC sub-population, provides an opportunity for the development of improved chemotherapeutic agents that can eliminate CSCs.

  11. Phenotypic and genetic diversity of chlorine-resistant Methylobacterium strains isolated from various environments.

    Science.gov (United States)

    Hiraishi, A; Furuhata, K; Matsumoto, A; Koike, K A; Fukuyama, M; Tabuchi, K

    1995-01-01

    Strains of pink-pigmented facultative methylotrophs which were isolated previously from various environments and assigned tentatively to the genus Methylobacterium were characterized in comparison with authentic strains of previously known species of this genus. Most of the isolates derived from chlorinated water supplies exhibited resistance to chlorine, whereas 29 to 40% of the isolates from air, natural aquatic environments, and clinical materials were chlorine resistant. None of the tested authentic strains of Methylobacterium species obtained from culture collections exhibited chlorine resistance. Numerical analysis of phenotypic profiles showed that the test organisms tested were separated from each other except M. organophilum and M. rhodesianum. The chlorine-resistant isolates were randomly distributed among all clusters. The 16S ribosomal DNA (rDNA) sequence-based phylogenetic analyses showed that representatives of the isolates together with known Methylobacterium species formed a line of descent distinct from that of members of related genera in the alpha-2 subclass of the Proteobacteria and were divided into three subclusters within the Methylobacterium group. These results demonstrate that there is phenotypic and genetic diversity among chlorine-resistant Methylobacterium strains within the genus. PMID:7793931

  12. Phenotypic and genetic diversity of chlorine-resistant Methylobacterium strains isolated from various environments.

    Science.gov (United States)

    Hiraishi, A; Furuhata, K; Matsumoto, A; Koike, K A; Fukuyama, M; Tabuchi, K

    1995-06-01

    Strains of pink-pigmented facultative methylotrophs which were isolated previously from various environments and assigned tentatively to the genus Methylobacterium were characterized in comparison with authentic strains of previously known species of this genus. Most of the isolates derived from chlorinated water supplies exhibited resistance to chlorine, whereas 29 to 40% of the isolates from air, natural aquatic environments, and clinical materials were chlorine resistant. None of the tested authentic strains of Methylobacterium species obtained from culture collections exhibited chlorine resistance. Numerical analysis of phenotypic profiles showed that the test organisms tested were separated from each other except M. organophilum and M. rhodesianum. The chlorine-resistant isolates were randomly distributed among all clusters. The 16S ribosomal DNA (rDNA) sequence-based phylogenetic analyses showed that representatives of the isolates together with known Methylobacterium species formed a line of descent distinct from that of members of related genera in the alpha-2 subclass of the Proteobacteria and were divided into three subclusters within the Methylobacterium group. These results demonstrate that there is phenotypic and genetic diversity among chlorine-resistant Methylobacterium strains within the genus.

  13. Culture and Next-generation sequencing-based drug susceptibility testing unveil high levels of drug-resistant-TB in Djibouti: results from the first national survey.

    Science.gov (United States)

    Tagliani, Elisa; Hassan, Mohamed Osman; Waberi, Yacine; De Filippo, Maria Rosaria; Falzon, Dennis; Dean, Anna; Zignol, Matteo; Supply, Philip; Abdoulkader, Mohamed Ali; Hassangue, Hawa; Cirillo, Daniela Maria

    2017-12-15

    Djibouti is a small country in the Horn of Africa with a high TB incidence (378/100,000 in 2015). Multidrug-resistant TB (MDR-TB) and resistance to second-line agents have been previously identified in the country but the extent of the problem has yet to be quantified. A national survey was conducted to estimate the proportion of MDR-TB among a representative sample of TB patients. Sputum was tested using XpertMTB/RIF and samples positive for MTB and resistant to rifampicin underwent first line phenotypic susceptibility testing. The TB supranational reference laboratory in Milan, Italy, undertook external quality assurance, genotypic testing based on whole genome and targeted-deep sequencing and phylogenetic studies. 301 new and 66 previously treated TB cases were enrolled. MDR-TB was detected in 34 patients: 4.7% of new and 31% of previously treated cases. Resistance to pyrazinamide, aminoglycosides and capreomycin was detected in 68%, 18% and 29% of MDR-TB strains respectively, while resistance to fluoroquinolones was not detected. Cluster analysis identified transmission of MDR-TB as a critical factor fostering drug resistance in the country. Levels of MDR-TB in Djibouti are among the highest on the African continent. High prevalence of resistance to pyrazinamide and second-line injectable agents have important implications for treatment regimens.

  14. Viral phenotype, antiretroviral resistance and clinical evolution in human immunodeficiency virus-infected children.

    Science.gov (United States)

    Mellado, M J; Cilleruelo, M J; Ortiz, M; Villota, J; García, M; Perez-Jurado, M L; Barreiro, G; Martín-Fontelos, P; Bernal, A

    1997-11-01

    The syncytium-inducing (SI) viral phenotype and the emergence of viral strains resistant to zidovudine have been described in persons infected with HIV, and in some cases they have been associated with poor prognosis. HIV isolates obtained from 37 HIV-infected children were analyzed to determine whether the SI viral phenotype and the mutation on the 215 position of the reverse transcriptase (M215) could be used as markers of disease progression. We performed peripheral blood coculture mononuclear cells, and we analyzed the induction of syncytia using the MT-2 cell line. The emergence of mutations on the 215 position was determined by PCR. We found a statistically significant association (P < 0.05) between SI viral phenotype and (1) recurrent serious bacterial infections, (2) absolute CD4+ cell counts <2 SD, (3) progression to AIDS and (4) death. Sixty percent of the children treated with zidovudine developed 215 mutant viral strains without statistically significant association with clinical or immunologic findings. The SI viral phenotype was statistically associated with the presence of the 215 mutation (P < 0.05). SI viral phenotype is a marker associated with a poor clinical and immunologic progression of the disease and it may facilitate the emergence of mutant strains in children treated with zidovudine.

  15. A Mutator Phenotype Promoting the Emergence of Spontaneous Oxidative Stress-Resistant Mutants in Campylobacter jejuni.

    Science.gov (United States)

    Dai, Lei; Sahin, Orhan; Tang, Yizhi; Zhang, Qijing

    2017-12-15

    Campylobacter jejuni is a leading cause of foodborne illnesses worldwide. As a microaerophilic organism, C. jejuni must be able to defend against oxidative stress encountered both in the host and in the environment. How Campylobacter utilizes a mutation-based mechanism for adaptation to oxidative stress is still unknown. Here we present a previously undescribed phenotypic and genetic mechanism that promotes the emergence of oxidative stress-resistant mutants. Specifically, we showed that a naturally occurring mutator phenotype, resulting from a loss of function mutation in the DNA repair enzyme MutY, increased oxidative stress resistance (OX R ) in C. jejuni We further demonstrated that MutY malfunction did not directly contribute to the OX R phenotype but increased the spontaneous mutation rate in the peroxide regulator gene perR , which functions as a repressor for multiple genes involved in oxidative stress resistance. Mutations in PerR resulted in loss of its DNA binding function and derepression of PerR-controlled oxidative stress defense genes, thereby conferring an OX R phenotype and facilitating Campylobacter survival under oxidative stress. These findings reveal a new mechanism that promotes the emergence of spontaneous OX R mutants in bacterial organisms. IMPORTANCE Although a mutator phenotype has been shown to promote antibiotic resistance in many bacterial species, little is known about its contribution to the emergence of OX R mutants. This work describes the link between a mutator phenotype and the enhanced emergence of OX R mutants as well as its underlying mechanism involving DNA repair and mutations in PerR. Since DNA repair systems and PerR are well conserved in many bacterial species, especially in Gram positives, the same mechanism may operate in multiple bacterial species. Additionally, we developed a novel method that allows for rapid quantification of spontaneous OX R mutants in a bacterial population. This method represents a technical

  16. Novel Conserved Genotypes Correspond to Antibiotic Resistance Phenotypes of E. coli Clinical Isolates.

    Science.gov (United States)

    Swick, Michelle C; Evangelista, Michael A; Bodine, Truston J; Easton-Marks, Jeremy R; Barth, Patrick; Shah, Minita J; Bormann Chung, Christina A; Stanley, Sarah; McLaughlin, Stephen F; Lee, Clarence C; Sheth, Vrunda; Doan, Quynh; Hamill, Richard J; Steffen, David; Becnel, Lauren B; Sucgang, Richard; Zechiedrich, Lynn

    2013-01-01

    Current efforts to understand antibiotic resistance on the whole genome scale tend to focus on known genes even as high throughput sequencing strategies uncover novel mechanisms. To identify genomic variations associated with antibiotic resistance, we employed a modified genome-wide association study; we sequenced genomic DNA from pools of E. coli clinical isolates with similar antibiotic resistance phenotypes using SOLiD technology to uncover single nucleotide polymorphisms (SNPs) unanimously conserved in each pool. The multidrug-resistant pools were genotypically similar to SMS-3-5, a previously sequenced multidrug-resistant isolate from a polluted environment. The similarity was evenly spread across the entire genome and not limited to plasmid or pathogenicity island loci. Among the pools of clinical isolates, genomic variation was concentrated adjacent to previously reported inversion and duplication differences between the SMS-3-5 isolate and the drug-susceptible laboratory strain, DH10B. SNPs that result in non-synonymous changes in gyrA (encoding the well-known S83L allele associated with fluoroquinolone resistance), mutM, ligB, and recG were unanimously conserved in every fluoroquinolone-resistant pool. Alleles of the latter three genes are tightly linked among most sequenced E. coli genomes, and had not been implicated in antibiotic resistance previously. The changes in these genes map to amino acid positions in alpha helices that are involved in DNA binding. Plasmid-encoded complementation of null strains with either allelic variant of mutM or ligB resulted in variable responses to ultraviolet light or hydrogen peroxide treatment as markers of induced DNA damage, indicating their importance in DNA metabolism and revealing a potential mechanism for fluoroquinolone resistance. Our approach uncovered evidence that additional DNA binding enzymes may contribute to fluoroquinolone resistance and further implicate environmental bacteria as a reservoir for

  17. Social, economic, and psychological impacts of MDR-TB treatment in Tijuana, Mexico: a patient's perspective.

    Science.gov (United States)

    Morris, M D; Quezada, L; Bhat, P; Moser, K; Smith, J; Perez, H; Laniado-Laborin, R; Estrada-Guzman, J; Rodwell, T C

    2013-07-01

    The State of Baja California, Mexico, had the highest prevalence of multidrug-resistant tuberculosis (MDR-TB) in Mexico in 2009. To understand the socio-economic burden of MDR-TB disease and its treatment on patients in Tijuana and Mexicali, Mexico. From July to November 2009, qualitative interviews were conducted with 12 patients enrolled in a US-Mexico binational MDR-TB treatment program, Puentes de Esperanza (Bridges of Hope), which was designed to support MDR-TB patients. In-depth interviews were coded to identify major themes in patient experiences of MDR-TB diagnosis and care. While some patients were able to maintain their pre-MDR-TB lives to a limited extent, most patients reported losing their sense of identity due to their inability to work, social isolation, and stigmatization from family and friends. The majority of participants expressed appreciation for Puentes' role in 'saving their lives'. Being diagnosed with MDR-TB and undergoing treatment imposes significant psychological, social and economic stress on patients. Strong social support elements within Puentes helped alleviate these burdens. Improvements to the program might include peer-support groups for patients undergoing treatment and transitioning back into the community after treatment.

  18. Dioscin enhances methotrexate absorption by down-regulating MDR1 in vitro and in vivo

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Lijuan, E-mail: jlwang1979@163.com [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Wang, Changyuan, E-mail: wangcyuan@163.com [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University, Dalian, Liaoning (China); Peng, Jinyong, E-mail: jinyongpeng2005@163.com [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University, Dalian, Liaoning (China); Liu, Qi, E-mail: llaqii@yahoo.com.cn [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University, Dalian, Liaoning (China); Meng, Qiang, E-mail: mengq531@yahoo.cn [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University, Dalian, Liaoning (China); Sun, Huijun, E-mail: sunhuijun@hotmail.com [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University, Dalian, Liaoning (China); Huo, Xiaokui, E-mail: huoxiaokui@163.com [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University, Dalian, Liaoning (China); and others

    2014-06-01

    The purpose of this study was to investigate the enhancing effect of dioscin on the absorption of methotrexate (MTX) and clarify the molecular mechanism involved in vivo and in vitro. Dioscin increased MTX chemosensitivity and transepithelial flux in the absorptive direction, significantly inhibiting multidrug resistance 1 (MDR1) mRNA and protein expression and MDR1 promoter and nuclear factor κ-B (NF-κB) activities in Caco-2 cells. Moreover, inhibitor κB-α (IκB-α) degradation was inhibited by dioscin. Dioscin enhanced the intracellular concentration of MTX by down-regulating MDR1 expression through a mechanism that involves NF-κB signaling pathway inhibition in Caco-2 cells. Dioscin strengthened MTX absorption by inhibiting MDR1 expression in rat intestine. In addition, even though MTX is absorbed into the enterocytes, there was no increase in toxicity observed, and that, in fact, decreased toxicity was seen. - Highlights: • Dioscin raised MTX concentration by inhibiting MDR1 in Caco-2 cells. • Dioscin suppresses MDR1 by inhibiting NF-κB signaling pathway in Caco-2 cells. • Dioscin can enhance MTX absorption via inhibiting MDR1 in vivo and in vitro. • Dioscin did not increase MTX-induced gastrointestinal mucosal toxicity.

  19. Bakteri Simbion Gastropoda Pleuroploca trapesium Dari Perairan Ternate, Sebagai Alternatif Antibakteri MDR (Bacterial Symbiont Gastropoda Pleuroploca trapezium from Ternate, as Alternative Antibacterial MDR

    Directory of Open Access Journals (Sweden)

    Delianis Pringgenies

    2014-03-01

    The bacteria resistant to some antibiotics are known as multi drug resistant (MDR. To overcome the problem, it is needed to search for a new antibiotic compounds more effectively and efficiently. This study aims to identify potential from symbionts of Pleuroploca trapezium as a source of antibacteria MDR and identifying the bacteria that were active against the MDR. Samples were collected from Ternate, Maluku. Isolation of symbiotic bacteria, screening for bacteria which producing secondary metabolites as anti-MDR bacteria, antibacterial test, isolation of clinical pathogenic bacteria of MDR. Conducting anti-bacterial sensitivity test,  sensitivity test for antibacterial,  DNA exctraction, DNA amplification based on PCR method, DNA sequencing.  Result of 16S r-DNA sequence was then analyzed and edited using GENETYX program and followed by 16S rDNA sequence analysis. Screening of bacteria associated with P. trapezium resulted in 19 isolates with 5 active bacteria. Based on the size of the zone forming and the consistency of zone, so the best isolate is TPT 4.7. The identification shows that TPT 4.7 has a close relationship with the Paracoccus sp. MBIC4019 with homologi of 95%, which shows the relationship at the genus level. Its suggest that these results are very promising as a new antibacterial material. Keywords: antibacterial, symbiotic bacteria, Pleuroploca trapezium, multi drugs resistant

  20. Identification of Striga hermonthica-Resistant Upland Rice Varieties in Sudan and Their Resistance Phenotypes

    OpenAIRE

    Samejima, Hiroaki; Babiker, Abdel G.; Mustafa, Ahmed; Sugimoto, Yukihiro

    2016-01-01

    Rice has become a major staple cereal in sub-Saharan Africa. Currently, upland rice cultivation is expanding particularly in rainfed areas where the root parasitic weed Striga hermonthica, a major constraint to cereal production, is endemic. Laboratory, pot, and semi-controlled open air experiments were performed to evaluate resistance of selected rice varieties in Sudan to a resident S. hermonthica population. In the laboratory, 27 varieties were screened for post-attachment resistance using...

  1. Metabolic Reprogramming During Multidrug Resistance in Leukemias

    Directory of Open Access Journals (Sweden)

    Raphael Silveira Vidal

    2018-04-01

    Full Text Available Cancer outcome has improved since introduction of target therapy. However, treatment success is still impaired by the same drug resistance mechanism of classical chemotherapy, known as multidrug resistance (MDR phenotype. This phenotype promotes resistance to drugs with different structures and mechanism of action. Recent reports have shown that resistance acquisition is coupled to metabolic reprogramming. High-gene expression, increase of active transport, and conservation of redox status are one of the few examples that increase energy and substrate demands. It is not clear if the role of this metabolic shift in the MDR phenotype is related to its maintenance or to its induction. Apart from the nature of this relation, the metabolism may represent a new target to avoid or to block the mechanism that has been impairing treatment success. In this mini-review, we discuss the relation between metabolism and MDR resistance focusing on the multiple non-metabolic functions that enzymes of the glycolytic pathway are known to display, with emphasis with the diverse activities of glyceraldehyde-3-phosphate dehydrogenase.

  2. Phenotypic characterization and colistin susceptibilities of carbapenem-resistant of Pseudomonas aeruginosa and Acinetobacter spp.

    Science.gov (United States)

    Mohanty, Srujana; Maurya, Vijeta; Gaind, Rajni; Deb, Monorama

    2013-11-15

    Pseudomonas aeruginosa and Acinetobcter spp. are important nosocomial pathogens and carbapenem resistance is an emerging threat. Therapeutic options for infections with these isolates include colistin. This study was conducted to determine the prevalence of carbapenem resistance in P. aeruginosa and Acinetobacter spp. bloodstream isolates, phenotypically characterize the resistance mechanisms and evaluate the in vitro activity of colistin. Consecutive 145 (95 P.aeruginosa and 50 Acinetobacter spp.) non-repeat isolates were included. Antibiotic susceptibility testing was performed per CLSI guidelines. MIC for carbapenems and colistin was performed using Etest. Isolates showing reduced susceptibility or resistance to the carbapenems were tested for metallo-β-lactamase (MBL) production using imipenem-EDTA combined disk and MBL Etest. Carbapenem resistance was observed in 40% P. aeruginosa and 66.0% Acinetobacter spp. Carbapenem-resistant (CA-R) isolates were significantly (p carbapenem-susceptible isolates. Approximately half of the CA-R strains were multidrug-resistant, and 3.1-5.5% were resistant to all antibiotics tested. MBL was found in 76.3% and 69.7% of the P. aeruginosa and Acinetobacter spp., respectively. Colistin resistance was observed in three (6.0%) Acinetobacter isolates and eight (8.4%) P. aeruginosa. MIC50 for carbapenems were two to four times higher for MBL-positive compared to MBL-negative isolates, but no difference was seen in MIC for colistin. Carbapenem resistance was observed to be mediated by MBL in a considerable number of isolates. Colistin is an alternative for infections caused by CA-R isolates; however, MIC testing should be performed whenever clinical use of colistin is considered.

  3. Associations between resistance phenotype and gene expression in response to serial exposure to oxacillin and ciprofloxacin in Staphylococcus aureus.

    Science.gov (United States)

    Uddin, M J; Ahn, J

    2017-12-01

    This study was designed to delineate the relationship between resistance phenotypes and gene expression in wild-type (SA WT ), oxacillin-induced (SA OXA ), ciprofloxacin-induced (SA CIP ) and clinically acquired antibiotic-resistant Staphylococcus aureus (SA CA ) exposed to oxacillin (β-lactam) and ciprofloxacin (fluoroquinolone). The phenotypic response and gene expression were varied with the antibiotic exposure. SA WT was highly resistant to oxacillin (MIC = 8 μg ml -1 ) after serial exposure to oxacillin, while the oxacillin susceptibility was not changed in SA WT when exposed to ciprofloxacin (MIC = 0·25 μg ml -1 ). The clinical isolate, SA CA , was highly resistant to all classes of antibiotics used in this study. The increased resistance of SA OXA and SA CIP to penicillinase-labile penicillins was attributed to the production of β-lactamase, which is in good agreement with the overexpression of blaZ (>2-fold). The overexpression of efflux pump-related genes (norA, norB, norC, mdeA, mepR, mgrA and lmrS) was associated with the increased resistance of SA CIP and SA CA to aminoglycosides and quinolones. This study confirmed that the linkage between resistance phenotypes and molecular genotypes highly varied depending on intrinsic resistance profile, response to antibiotic exposure and genes conferring resistance. This study provides useful information for understanding the mechanisms of methicillin resistance in S. aureus in association with phenotypic and genotypic resistance determinants. The improvement in current standards is essential to accurately detect methicillin-resistant Staphylococcus aureus in consideration of various resistance phenotypes and genotypes. The varied and distinctive expression patterns of antibiotic resistance-related genes were observed in S. aureus exposed to oxacillin and ciprofloxacin. It is worth noting the relationship between resistance phenotype and resistance genotype in terms of MIC values and expression of

  4. A simple phenotypic method for screening of MCR-1-mediated colistin resistance.

    Science.gov (United States)

    Coppi, M; Cannatelli, A; Antonelli, A; Baccani, I; Di Pilato, V; Sennati, S; Giani, T; Rossolini, G M

    2018-02-01

    To evaluate a novel method, the colistin-MAC test, for phenotypic screening of acquired colistin resistance mediated by transferable mcr-1 resistance determinants, based on colistin MIC reduction in the presence of dipicolinic acid (DPA). The colistin-MAC test consists in a broth microdilution method, in which colistin MIC is tested in the absence or presence of DPA (900 μg/mL). Overall, 74 colistin-resistant strains of Enterobacteriaceae (65 Escherichia coli and nine other species), including 61 strains carrying mcr-1-like genes and 13 strains negative for mcr genes, were evaluated with the colistin-MAC test. The presence of mcr-1-like and mcr-2-like genes was assessed by real-time PCR and end-point PCR. For 20 strains, whole-genome sequencing data were also available. A ≥8-fold reduction of colistin MIC in the presence of DPA was observed with 59 mcr-1-positive strains, including 53 E. coli of clinical origin, three E. coli transconjugants carrying MCR-1-encoding plasmids, one Enterobacter cloacae complex and two Citrobacter spp. Colistin MICs were unchanged, increased or at most reduced by twofold with the 13 mcr-negative colistin-resistant strains (nine E. coli and four Klebsiella pneumoniae), but also with two mcr-1-like-positive K. pneumoniae strains. The colistin-MAC test could be a simple phenotypic test for presumptive identification of mcr-1-positive strains among isolates of colistin-resistant E. coli, based on a ≥8-fold reduction of colistin MIC in the presence of DPA. Evaluation of the test with a larger number of strains, species and mcr-type resistance determinants would be of interest. Copyright © 2017 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  5. High-throughput phenotyping of plant resistance to aphids by automated video tracking.

    Science.gov (United States)

    Kloth, Karen J; Ten Broeke, Cindy Jm; Thoen, Manus Pm; Hanhart-van den Brink, Marianne; Wiegers, Gerrie L; Krips, Olga E; Noldus, Lucas Pjj; Dicke, Marcel; Jongsma, Maarten A

    2015-01-01

    Piercing-sucking insects are major vectors of plant viruses causing significant yield losses in crops. Functional genomics of plant resistance to these insects would greatly benefit from the availability of high-throughput, quantitative phenotyping methods. We have developed an automated video tracking platform that quantifies aphid feeding behaviour on leaf discs to assess the level of plant resistance. Through the analysis of aphid movement, the start and duration of plant penetrations by aphids were estimated. As a case study, video tracking confirmed the near-complete resistance of lettuce cultivar 'Corbana' against Nasonovia ribisnigri (Mosely), biotype Nr:0, and revealed quantitative resistance in Arabidopsis accession Co-2 against Myzus persicae (Sulzer). The video tracking platform was benchmarked against Electrical Penetration Graph (EPG) recordings and aphid population development assays. The use of leaf discs instead of intact plants reduced the intensity of the resistance effect in video tracking, but sufficiently replicated experiments resulted in similar conclusions as EPG recordings and aphid population assays. One video tracking platform could screen 100 samples in parallel. Automated video tracking can be used to screen large plant populations for resistance to aphids and other piercing-sucking insects.

  6. Identification of Striga hermonthica-resistant Upland Rice Varieties in Sudan and Their Resistance Phenotypes

    Directory of Open Access Journals (Sweden)

    Hiroaki eSamejima

    2016-05-01

    Full Text Available Rice has become a major staple cereal in sub-Saharan Africa. Currently, upland rice cultivation is expanding particularly in rainfed areas where the root parasitic weed Striga hermonthica, a major constraint to cereal production, is endemic. Laboratory, pot, and semi-controlled open air experiments were performed to evaluate resistance of selected rice varieties in Sudan to a resident S. hermonthica population. In the laboratory, 27 varieties were screened for post-attachment resistance using the rhizotron technique. Varieties displaying high post-attachment resistance, Umgar, NERICA5, and NERICA13 together with NERICA4, NERICA18, and Nipponbare, a lowland rice variety, were further evaluated for performance and Striga resistance in pot and semi-controlled open air experiments and for germination inducing activity in a laboratory. In addition, comparative studies on reaction of Umgar, Kosti1 and Kosti2, released varieties for commercial production in Sudan, to the parasite were performed in two pot experiments. In the pot experiments Umgar and NERICA5, consistently, sustained the lowest Striga emergence (< 2.2 Striga plants per pot, while NERICA13 and NERICA4 supported 1.8–5.7 and 8.7–16.4 Striga plants per pot, respectively. In an artificially Striga-infested field, number of emergent Striga plants per 10 rice hills, at harvest, was 2.0, 2.0, 4.8, 13.5, 13.3, and 18.3 on Umgar, NERICA5, NERICA13, NERICA4, NERICA18, and Nipponbare, respectively. Striga had no adverse effects on total above-ground parts and panicle dry weight (DW in Umgar and NERICA5. Germination-inducing activity of root exudates, at 14 days after sowing onwards, was markedly lower for Umgar than for NERICA5, NERICA13, NERICA4, and NERICA18. Based on these findings, Umgar has both pre and post-attachment resistance to a resident Striga population in Sudan. Kosti1 and Kosti2, did not exhibit Striga-resistance at the same level as Umgar. Further the resistance of NERICA5, a

  7. Identification of Striga hermonthica-Resistant Upland Rice Varieties in Sudan and Their Resistance Phenotypes.

    Science.gov (United States)

    Samejima, Hiroaki; Babiker, Abdel G; Mustafa, Ahmed; Sugimoto, Yukihiro

    2016-01-01

    Rice has become a major staple cereal in sub-Saharan Africa. Currently, upland rice cultivation is expanding particularly in rainfed areas where the root parasitic weed Striga hermonthica, a major constraint to cereal production, is endemic. Laboratory, pot, and semi-controlled open air experiments were performed to evaluate resistance of selected rice varieties in Sudan to a resident S. hermonthica population. In the laboratory, 27 varieties were screened for post-attachment resistance using the rhizotron technique. Varieties displaying high post-attachment resistance, Umgar, NERICA5, and NERICA13 together with NERICA4, NERICA18, and Nipponbare, a lowland rice variety, were further evaluated for performance and Striga resistance in pot and semi-controlled open air experiments and for germination inducing activity in a laboratory. In addition, comparative studies on reaction of Umgar, Kosti1 and Kosti2, released varieties for commercial production in Sudan, to the parasite were performed in two pot experiments. In the pot experiments Umgar and NERICA5, consistently, sustained the lowest Striga emergence (pot), while NERICA13 and NERICA4 supported 1.8-5.7 and 8.7-16.4 Striga plants per pot, respectively. In an artificially Striga-infested field, number of emergent Striga plants per 10 rice hills, at harvest, was 2.0, 2.0, 4.8, 13.5, 13.3, and 18.3 on Umgar, NERICA5, NERICA13, NERICA4, NERICA18, and Nipponbare, respectively. Striga had no adverse effects on total above-ground parts and panicle dry weight in Umgar and NERICA5. Germination-inducing activity of root exudates, at 14 days after sowing onward, was markedly lower for Umgar than for NERICA5, NERICA13, NERICA4, and NERICA18. Based on these findings, Umgar has both pre and post-attachment resistance to a resident Striga population in Sudan. Kosti1 and Kosti2 did not exhibit Striga-resistance at the same level as Umgar. Further the resistance of NERICA5, a variety reported to be endowed with a broad spectrum

  8. Antibacterial activity of herbal extracts against multi-drug resistant Escherichia coli recovered from retail chicken meat.

    Science.gov (United States)

    Shaheen, Arfat Yousaf; Sheikh, Ali Ahmad; Rabbani, Masood; Aslam, Asim; Bibi, Tasra; Liaqat, Fakhra; Muhammad, Javed; Rehmani, Shafqat Fatima

    2015-07-01

    Increasing incidence rate of multiple drug resistance in Escherichia coli (E. coli) due to extensive uses of antibiotics is a serious challenge to disease treatment. Contaminated retail chicken meat is one of the major sources of spread of multi drug resistant (MDR) E. coli. Current study has been conducted to study the prevalence of MDR E. coli in retail chicken meat samples from Lahore city of Pakistan and it was found that 73.86% of E. coli isolates have MDR pattern. In vitro evaluation of antibacterial activity of crude ethanolic extracts of six herbs against MDR E. coli phenotypes has revealed that clove and cinnamon have maximum zones of inhibition as compared to other herbal extracts. Mint and coriander gave the intermediate results while garlic and kalonji showed the least antibacterial activity against the MDR E. coli phenotypes using the agar well diffusion technique. Average Minimum Inhibitory Concentrations (MICs) for clove, mint, cinnamon, coriander, kalonji and garlic extracts were 1.15, 1.38, 0.5, 1.99, 2.41, 8.60 mg/mL respectively using the broth micro dilution method. The results obtained in present study were revealed that crude ethanol extracts of selected herbs have had significant antibacterial activity. Hence they can be used as promising alternatives of antimicrobials against MDR E. coli species and can be used for cooked food preservation.

  9. Distinctive Risk Factors and Phenotype of Younger Patients With Resistant Hypertension: Age Is Relevant.

    Science.gov (United States)

    Ghazi, Lama; Oparil, Suzanne; Calhoun, David A; Lin, Chee Paul; Dudenbostel, Tanja

    2017-05-01

    Resistant hypertension, defined as blood pressure >140/90 mm Hg despite using ≥3 antihypertensive medications, is a well-recognized clinical entity. Patients with resistant hypertension are at an increased risk of cardiovascular disease compared with those with more easily controlled hypertension. Coronary heart disease mortality rates of younger adults are stagnating or on the rise. The purpose of our study was to characterize the phenotype and risk factors of younger patients with resistant hypertension, given the dearth of data on cardiovascular risk profile in this cohort. We conducted a cross-sectional analysis with predefined age groups of a large, ethnically diverse cohort of 2170 patients referred to the Hypertension Clinic at the University of Alabama at Birmingham. Patients (n=2068) met the inclusion criteria and were classified by age groups, that is, ≤40 years (12.7% of total cohort), 41 to 55 years (32.1%), 56 to 70 years (36.1%), and ≥71 years (19.1%). Patients aged ≤40 years compared with those aged ≥71 years had significantly earlier onset of hypertension (24.7±7.4 versus 55.0±14.1 years; P hypertension, younger individuals have a distinct phenotype characterized by overlapping risk factors and comorbidities, including obesity, high aldosterone, and high dietary sodium intake compared with elderly. © 2017 American Heart Association, Inc.

  10. Phenotypic and Genotypic Detection of Metallo-beta-lactamases among Imipenem-Resistant Gram Negative Isolates

    Directory of Open Access Journals (Sweden)

    Mohammad Mohammadzadeh

    2016-08-01

    Full Text Available Background:   Imipenem-resistant gram negative bacteria, resulting from metallo-beta-lactamase (MBLs-producing strains have been reported to be among the important causes of nosocomial infections and of serious therapeutic problem worldwide. Because of their broad range, potent carbapenemase activity and resistance to inhibitors, these enzymes can confer resistance to almost all beta-lactams. The prevalence of metallo-beta-lactamase among imipenem-resistant Acinetobacter spp., Pseudomonas spp. and Enerobacteriaceae isolates is determined.Methods:   In this descriptive study 864 clinical isolates of Acinetobacter spp., Pseudomonas spp. and Enterobacteriaceae, were initially tested for imipenem susceptibility. The metallo-beta-lactamase production was detected using combined disk diffusion, double disk synergy test, and Hodge test. Then all imipenem resistant isolates were tested by PCR for imp, vim and ndm genes. Results:   Among 864 isolates, 62 (7.17 % were imipenem-resistant. Positive phonetypic test for metallo-beta-lactamase was 40 (64.5%, of which 24 (17.1% and 16 (9.2% isolates were Acinetobacter spp. and Pseudomonas spp., respectively. By PCR method 30 (48.4% of imipenem resistant Acinetobacter, and Pseudomonas isolates were positive for MBL-producing genes. None of the Enterobacteriaceae isolates were positive for metallo-beta-lactamase activity. Conclusion:   The results of this study are indicative of the growing number of nosocomial infections associated with multidrug-resistant gram negative bacteria in this region leading to difficulties in antibiotic therapy. Thereby, using of phenotypic methods can be helpful for management of this problem.

  11. Tetracycline resistance phenotypes and genotypes of coagulase-negative staphylococcal isolates from bubaline mastitis in Egypt.

    Science.gov (United States)

    El-Razik, K A Abd; Arafa, A A; Hedia, R H; Ibrahim, E S

    2017-06-01

    This study was devoted to elucidate the tetracycline resistance of coagulase-negative staphylococci (CNS) derived from normal and subclinical mastitic (SCM) buffaloes' milk in Egypt. A total of 81 milk samples from 46 normal buffalo milk samples and 35 SCM buffalo milk samples at private dairy farms of Egypt were used in this study. CNS were identified using phenotypic and molecular methods (polymerase chain reaction [PCR]). CNS isolates were tested for tetracycline resistance using routine methods and multiplex PCR targeting tetracycline ( tet ) resistance genes followed by sequencing of positive PCR products and phylogenetic analysis. Isolation and identification of 28 (34.5%) CNS from normal and SCM buffaloes' milk, namely, Staphylococcus intermedius (39.2%), Staphylococcus xylosus (25.0%), Staphylococcus epidermidis (10.7%), Staphylococcus hominis (10.7%), and 3.5% to each of Staphylococcus sciuri , Staphylococcus hyicus , Staphylococcus lugdunensis , and Staphylococcus simulans . Using nested PCR, all the 28 CNS isolates revealed positive for 16srRNA gene specific for genus staphylococci and negative for thermonuclease ( nuc ) gene specific for Staphylococcus aureus species. The presence of tetracycline resistance-encoding genes ( tet K, tet L, tet M, and tet O) was detected by multiplex PCR. All isolates were negative for tet L, M, and O genes while 14 (50%) CNS isolates were positive for tet K gene, namely, S. lugdunensis (100%), S. hominis (100%), S. epidermidis (66.6%), S. intermedius (45.4%), and S. xylosus (42.8%). Nucleotide sequencing of tet K gene followed by phylogenetic analysis showed the high homology between our CNS isolates genes of tetracycline resistance with S. aureus isolates including Egyptian ones. This proves the transfer of the tetracycline resistance encoding genes between coagulase-negative and coagulase positive Staphylococcus spp. CNS isolates have distinguishingly high resistance to tetracycline. Abundant tetracycline usage for

  12. Association between embB mutations and ethambutol resistance in Mycobacterium tuberculosis isolates from Cuba and the Dominican Republic: reproducible patterns and problems Asociación entre las mutaciones en embB y la resistencia a etambutol en aislamientos de Mycobacterium tuberculosis de Cuba y República Dominicana: patrones y problemas reproducibles

    Directory of Open Access Journals (Sweden)

    Elba Guerrero

    2013-03-01

    Full Text Available The relation of ethambutol resistance to embB mutations remains unclear, and there are no reports on ethambutol resistance from the Caribbean. We examined the sequence of embB in 57 distinct Multi-Drug Resistant (MDR and non-MDR strains of Mycobacterium tuberculosis, mostly from Cuba and the Dominican Republic. embB306 codon mutations were found exclusively in MDR-TB, but in both ethambutol sensitive and resistant strains. Valine substitutions predominated in ethambutol resistant strains, while isoleucine replacements were more common in sensitive strains. Three ethambutol resistant MDR strains without embB306 substitutions had replacements in embB406 or embB497, but these were also found in ethambutol sensitive MDR strains. The results confirm previous findings that amino acid substitutions in EmbB306, EmbB406 and EmbB497 are found only in MDR-TB strains but in both phenotypically resistant and sensitive strains. One ethambutol resistant non-MDR strain did not have any embB mutation suggesting that other undefined mutations can also confer ethambutol resistance.La relación entre resistencia a etambutol y mutaciones en embB no se ha establecido claramente y no existen comunicaciones sobre la resistencia a etambutol en cepas provenientes de países Caribeños. Se evaluó la secuencia del gen embB en 57 cepas de Mycobacterium tuberculosis multi-drogo resistentes (MDR y no-MDR, la mayoría aislada en Cuba y República Dominicana. Se encontraron mutaciones en el codón embB306 exclusivamente en cepas MDR, tanto en cepas sensibles como resistentes a etambutol. Tres cepas MDR resistentes a etambutol, sin sustituciones en embB306, tenían mutaciones en los codones embB406 o embB497, pero estos cambios se encontraron también en cepas sensibles. Los resultados confirman otros estudios, mostrando que sustituciones aminoacídicas en EmbB306, EmbB406 y EmbB497 se encuentran exclusivamente en cepas MDR, tanto resistentes como sensibles a etambutol

  13. Short communication: Phenotypic protease inhibitor resistance and cross-resistance in the clinic from 2006 to 2008 and mutational prevalences in HIV from patients with discordant tipranavir and darunavir susceptibility phenotypes.

    Science.gov (United States)

    Bethell, Richard; Scherer, Joseph; Witvrouw, Myriam; Paquet, Agnes; Coakley, Eoin; Hall, David

    2012-09-01

    To test tipranavir (TPV) or darunavir (DRV) as treatment options for patients with phenotypic resistance to protease inhibitors (PIs), including lopinavir, saquinavir, atazanavir, and fosamprenavir, the PhenoSense GT database was analyzed for susceptibility to DRV or TPV among PI-resistant isolates. The Monogram Biosciences HIV database (South San Francisco, CA) containing 7775 clinical isolates (2006-2008) not susceptible to at least one first-generation PI was analyzed. Phenotypic responses [resistant (R), partially susceptible (PS), or susceptible (S)] were defined by upper and lower clinical cut-offs to each PI. Genotypes were screened for amino acid substitutions associated with TPV-R/DRV-S and TPV-S/DRV-R phenotypes. In all, 4.9% (378) of isolates were resistant to all six PIs and 31.0% (2407) were resistant to none. Among isolates resistant to all four first-generation PIs, DRV resistance increased from 21.2% to 41.9% from 2006 to 2008, respectively, and resistance to TPV remained steady (53.9 to 57.3%, respectively). Higher prevalence substitutions in DRV-S/TPV-R isolates versus DRV-R/TPV-S isolates, respectively, were 82L/T (44.4% vs. 0%) and 83D (5.8% vs. 0%). Higher prevalence substitutions in DRV-R/TPV-S virus were 50V (0.0% vs. 28.9%), 54L (1.0% vs. 36.1%), and 76V (0.4% vs. 15.5%). Mutations to help predict discordant susceptibility to DRV and TPV in isolates with reduced susceptibility to other PIs were identified. DRV resistance mutations associated with improved virologic response to TPV were more prevalent in DRV-R/TPV-S isolates. TPV resistance mutations were more prevalent in TPV-R and DRV-S isolates. These results confirm the impact of genotype on phenotype, illustrating how HIV genotype and phenotype data assist regimen optimization.

  14. Phenotypic and molecular characterization of antimicrobial resistance in Enterobacter spp. isolates from companion animals in Japan.

    Science.gov (United States)

    Harada, Kazuki; Shimizu, Takae; Mukai, Yujiro; Kuwajima, Ken; Sato, Tomomi; Kajino, Akari; Usui, Masaru; Tamura, Yutaka; Kimura, Yui; Miyamoto, Tadashi; Tsuyuki, Yuzo; Ohki, Asami; Kataoka, Yasushi

    2017-01-01

    The emergence of antimicrobial resistance among Enterobacter spp., including resistance to extended-spectrum cephalosporins (ESC), is of great concern in both human and veterinary medicine. In this study, we investigated the prevalence of antimicrobial resistance among 60 isolates of Enterobacter spp., including E. cloacae (n = 44), E. aerogenes (n = 10), and E. asburiae (n = 6), from clinical specimens of dogs and cats from 15 prefectures in Japan. Furthermore, we characterized the resistance mechanisms harbored by these isolates, including extended-spectrum β-lactamases (ESBLs) and plasmid-mediated quinolone resistance (PMQR); and assessed the genetic relatedness of ESC-resistant Enterobacter spp. strains by multilocus sequence typing (MLST) and pulsed-field gel electrophoresis (PFGE). Antimicrobial susceptibility testing demonstrated the resistance rates to ampicillin (93.3%), amoxicillin-clavulanic acid (93.3%), cefmetazole (93.3%), chloramphenicol (46.7%), ciprofloxacin (43.3%), tetracycline (40.0%), ceftazidime (33.3%), cefotaxime (33.3%), trimethoprim/sulfamethoxazole (28.3%), gentamicin (23.3%), and meropenem (0%). Phenotypic testing detected ESBLs in 16 of 18 ESC-resistant E. cloacae isolates but not in the other species. The most frequent ESBL was CTX-M-15 (n = 8), followed by SHV-12 (n = 7), and CTX-M-3 (n = 1). As for AmpC β-lactamases, CMY-2 (n = 2) and DHA-1 (n = 2) were identified in ESC-resistant E. cloacae strains with or without ESBLs. All of the ESC-resistant E. cloacae strains also harbored one or two PMQRs, including qnrB (n = 15), aac(6')-Ib-cr (n = 8), and qnrS (n = 2). Based on MLST and PFGE analysis, E. cloacae clones of ST591-SHV-12, ST171-CTX-M-15, and ST121-CTX-M-15 were detected in one or several hospitals. These results suggested intra- and inter-hospital dissemination of E. cloacae clones co-harboring ESBLs and PMQRs among companion animals. This is the first report on the large-scale monitoring of antimicrobial-resistant isolates

  15. Methylator phenotype of malignant germ cell tumours in children identifies strong candidates for chemotherapy resistance.

    Science.gov (United States)

    Jeyapalan, J N; Noor, D A Mohamed; Lee, S-H; Tan, C L; Appleby, V A; Kilday, J P; Palmer, R D; Schwalbe, E C; Clifford, S C; Walker, D A; Murray, M J; Coleman, N; Nicholson, J C; Scotting, P J

    2011-08-09

    Yolk sac tumours (YSTs) and germinomas are the two major pure histological subtypes of germ cell tumours. To date, the role of DNA methylation in the aetiology of this class of tumour has only been analysed in adult testicular forms and with respect to only a few genes. A bank of paediatric tumours was analysed for global methylation of LINE-1 repeat elements and global methylation of regulatory elements using GoldenGate methylation arrays. Both germinomas and YSTs exhibited significant global hypomethylation of LINE-1 elements. However, in germinomas, methylation of gene regulatory regions differed little from control samples, whereas YSTs exhibited increased methylation at a large proportion of the loci tested, showing a 'methylator' phenotype, including silencing of genes associated with Caspase-8-dependent apoptosis. Furthermore, we found that the methylator phenotype of YSTs was coincident with higher levels of expression of the DNA methyltransferase, DNA (cytosine-5)-methyltransferase 3B, suggesting a mechanism underlying the phenotype. Epigenetic silencing of a large number of potential tumour suppressor genes in YSTs might explain why they exhibit a more aggressive natural history than germinomas and silencing of genes associated with Caspase-8-dependent cell death might explain the relative resistance of YSTs to conventional therapy.

  16. MDR1 haplotypes conferring an increased expression of intestinal CYP3A4 rather than MDR1 in female living-donor liver transplant patients.

    Science.gov (United States)

    Hosohata, Keiko; Masuda, Satohiro; Yonezawa, Atsushi; Katsura, Toshiya; Oike, Fumitaka; Ogura, Yasuhiro; Takada, Yasutsugu; Egawa, Hiroto; Uemoto, Shinji; Inui, Ken-Ichi

    2009-07-01

    This study investigated whether haplotypes in the multidrug resistance 1 (MDR1) gene had effects on mRNA expression levels of MDR1 and cytochrome P450 (CYP) 3A4, and on the pharmacokinetics of tacrolimus in living-donor liver transplant (LDLT) patients, considering the gender difference. Haplotype analysis of MDR1 with G2677T/A and C3435T was performed in 63 de novo Japanese LDLT patients (17 to 55 years; 44.4% women). The expression levels of MDR1 and CYP3A4 mRNAs in jejunal biopsy specimens were quantified by real-time PCR. Intestinal CYP3A4 mRNA expression levels (amol/microg total RNA) showed significantly higher values in women carrying the 2677TT-3435TT haplotype (median, 10.7; range, 5.92-15.2) than those with 2677GG-3435CC (3.03; range 1.38-4.68) and 2677GT-3435CT (median, 4.31; range, 0.07-9.42) (P = 0.022), but not in men (P = 0.81). However, MDR1 haplotype did not influence mRNA expression levels of MDR1 nor the concentration/dose ratio [(ng/mL)/(mg/day)] of oral tacrolimus for the postoperative 7 days, irrespective of gender. MDR1 haplotype may have a minor association with the tacrolimus pharmacokinetics after LDLT, but could be a good predictor of the inter-individual variation of intestinal expression of CYP3A4 in women.

  17. Stability and fitness of pyraclostrobin- and boscalid-resistant phenotypes in field isolates of Botrytis cinerea from apple.

    Science.gov (United States)

    Kim, Y K; Xiao, C L

    2011-11-01

    Phenotype stability, fitness, and competitive ability of pyraclostrobin- and boscalid-resistant isolates of Botrytis cinerea from apple were investigated. Stability of resistance was determined after consecutive transfers on potato dextrose agar (PDA) or being cycled on apple fruit. In vitro fitness components mycelial growth, osmotic sensitivity, conidial germination, and sporulation were evaluated on agar media. Pathogenicity, virulence and sporulation on apple fruit were evaluated at both 20 and 0°C. Competition between fungicide-resistant and -sensitive isolates on apple fruit also was evaluated. Resistance to the two fungicides was retained at levels similar to that of the initial generation after 20 and 10 transfers on PDA and five and three disease cycles on apple fruit at 20 and 0°C, respectively. Great variability in individual fitness components tested was observed among isolates within the same phenotype groups either sensitive or resistant to the fungicides but, when compared as phenotype groups, there were no significant differences in the mean values of these fitness components between resistant and sensitive phenotypes except that the phenotype resistant only to boscalid produced fewer conidia in vitro than sensitive isolates. Resistant isolates were as pathogenic and virulent on apple fruit as sensitive isolates. There was no significant correlation between the values of individual fitness components tested and the level of resistance to pyraclostrobin or boscalid, except that virulence at 20°C positively correlated with the level of resistance to the two fungicides. The final frequency of pyraclostrobin-resistant individuals in the populations was significantly decreased compared with the initial generation and no boscalid-resistant individuals were detected after four disease cycles on apple fruit inoculated with a pair mixture of a dual-sensitive isolate and one isolate each of the three phenotypes resistant to pyraclostrobin, boscalid, or

  18. Phenotypic and genotypic characterization of vancomycin-resistant Enterococcus faecium clinical isolates from two hospitals in Mexico: First detection of VanB phenotype-vanA genotype.

    Science.gov (United States)

    Bocanegra-Ibarias, Paola; Flores-Treviño, Samantha; Camacho-Ortiz, Adrián; Morfin-Otero, Rayo; Villarreal-Treviño, Licet; Llaca-Díaz, Jorge; Martínez-Landeros, Erik Alan; Rodríguez-Noriega, Eduardo; Calzada-Güereca, Andrés; Maldonado-Garza, Héctor Jesús; Garza-González, Elvira

    2016-01-01

    Enterococcus faecium has emerged as a multidrug-resistant nosocomial pathogen involved in outbreaks worldwide. Our aim was to determine the antimicrobial susceptibility, biofilm production, and clonal relatedness of vancomycin-resistant E. faecium (VREF) clinical isolates from two hospitals in Mexico. Consecutive clinical isolates (n=56) were collected in two tertiary care hospitals in Mexico from 2011 to 2014. VREF isolates were characterized by phenotypic and molecular methods including pulsed-field gel electrophoresis (PFGE). VREF isolates were highly resistant to vancomycin, erythromycin, norfloxacin, high-level streptomycin, and teicoplanin, and showed lower resistance to tetracycline, nitrofurantoin and quinupristin-dalfopristin. None of the isolates were resistant to linezolid. The vanA gene was detected in all isolates. Two VanB phenotype-vanA genotype isolates, highly resistant to vancomycin and susceptible to teicoplanin, were detected. Furthermore, 17.9% of the isolates were classified as biofilm producers, and the espfm gene was found in 98.2% of the isolates. A total of 37 distinct PFGE patterns and 6 clones (25% of the isolates as clone A, 5.4% as clone B, and 3.6% each as clone C, D, E, and F) were detected. Clone A was detected in 5 different wards of the same hospital during 14 months of surveillance. The high resistance to most antimicrobial agents and the moderate cross-transmission of VREF detected accentuates the need for continuous surveillance of E. faecium in the hospital setting. This is also the first reported incidence of the E. faecium VanB phenotype-vanA genotype in the Americas. Copyright © 2015 Elsevier España, S.L.U. and Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

  19. Molecular and phenotypic characteristics of methicillin-resistant Staphylococcus aureus isolated from hospitalized patients.

    Science.gov (United States)

    de Oliveira, Caio Ferreira; Morey, Alexandre Tadachi; Santos, Jussevania Pereira; Gomes, Ludmila Vilela Pereira; Cardoso, Juscélio Donizete; Pinge-Filho, Phileno; Perugini, Márcia Regina Eches; Yamauchi, Lucy Megumi; Yamada-Ogatta, Sueli Fumie

    2015-07-30

    Methicillin-resistant Staphylococcus aureus (MRSA) is one of the leading causes of infections acquired in both community and hospital settings. In this study, MRSA isolated from different sources of hospitalized patients was characterized by molecular and phenotypic methods. A total of 123 S. aureus isolates were characterized according to their genetic relatedness by repetitive element sequence based-PCR (REP-PCR), in vitro antimicrobial susceptibility profile, SCCmec typing and presence of seven virulence factor-encoding genes. REP-PCR fingerprinting showed low relatedness between the isolates, and the predominance of one specific lineage or clonal group was not observed. All isolates were susceptible to teicoplanin and linezolide. All isolates were resistant to cefoxitin and penicillin, and the majority were also resistant to one or more other antimicrobials. Fifty isolates (41.7%) were intermediately resistant to vancomycin. Most isolates harbored SCCmec type II (53.7%), followed by type I (22.8%), type IV (8.1%) and type III (1.6%). All isolates harbored at least two virulence factor-encoding genes, and the prevalence was as follows: coa, 100%; icaA, 100%; hla, 13.0%; hlb, 91.1%, hld, 91.1%; lukS-PV and lukF-PV, 2.4%; and tst, 34.1%. A positive association with the presence of hla and SCCmec type II, and tst and SCCmec type I was observed. This study showed the high virulence potential of multidrug-resistant MRSA circulating in a teaching hospital. A high prevalence of MRSA showing intermediate vancomycin resistance was also observed, indicating the urgent need to improve strategies for controlling the use of antimicrobials for appropriate management of S. aureus infections.

  20. Mice heterozygous for the Mdr2 gene demonstrate decreased PEMT activity and diminished steatohepatitis on the MCD diet.

    Science.gov (United States)

    Igolnikov, Alexander C; Green, Richard M

    2006-03-01

    The administration of a methionine and choline deficient (MCD) diet to mice serves as an animal model of NASH. The multidrug resistant 2 (Mdr2) P-glycoprotein encodes for the canalicular phospholipid transporter, and Mdr2 (+/-) mice secrete 40% less phosphatidylcholine than wild-type mice. We have hypothesized that phosphatidylethanolamine-N-methyl transferase (PEMT) up-regulation is a consequence of MCD diet administration, and is important for the pathogenesis of steatohepatitis in this model. However, the effect of decreased phosphatidylcholine secretion and modulation of PEMT on the development of diet-induced steatohepatitis in Mdr2 (+/-) mice has not been explored. Thus, the purpose of the study is to examine the effects of the MCD diet on Mdr2 (+/-) mice. Mdr2 (+/-) and Mdr2 (+/+) mice were treated with an MCD or control diet for up to 30 days, and the severity of steatohepatitis, PEMT activity and hepatic S-adenosylmethionine (SAM), and S-adenosylhomocysteine (SAH) levels were measured. Serum ALT levels, hepatic inflammation, and PEMT activity were significantly lower, and hepatic SAM:SAH ratios were significantly higher in Mdr2 (+/-) mice at 7 and 30 days on the MCD diet. Mdr2 (+/-) mice have diminished susceptibility to MCD diet-induced NASH, which is associated with a relative decrease in PEMT activity and increased SAM:SAH ratios.

  1. Mortality among MDR-TB cases: comparison with drug-susceptible tuberculosis and associated factors.

    Directory of Open Access Journals (Sweden)

    Kocfa Chung-Delgado

    Full Text Available An increase in multidrug-resistant tuberculosis (MDR-TB cases is evident worldwide. Its management implies a complex treatment, high costs, more toxic anti-tuberculosis drug use, longer treatment time and increased treatment failure and mortality. The aims of this study were to compare mortality between MDR and drug-susceptible cases of tuberculosis, and to determine risk factors associated with mortality among MDR-TB cases.A retrospective cohort study was performed using data from clinical records of the National Strategy for Prevention and Control of Tuberculosis in Lima, Peru. In the first objective, MDR-TB, compared to drug-susceptible cases, was the main exposure variable and time to death, censored at 180 days, the outcome of interest. For the second objective, different variables obtained from clinical records were assessed as potential risk factors for death among MDR-TB cases. Cox regression analysis was used to determine hazard ratios (HR and 95% confidence intervals (95%CI. A total of 1,232 patients were analyzed: mean age 30.9 ±14.0 years, 60.0% were males. 61 patients (5.0% died during treatment, whereas the MDR-TB prevalence was 19.2%. MDR-TB increased the risk of death during treatment (HR = 7.5; IC95%: 4.1-13.4 when compared to presumed drug-susceptible cases after controlling for potential confounders. Education level (p = 0.01, previous TB episodes (p<0.001, diabetes history (p<0.001 and HIV infection (p = 0.04 were factors associated with mortality among MDR-TB cases.MDR-TB is associated with an increased risk of death during treatment. Lower education, greater number of previous TB episodes, diabetes history, and HIV infection were independently associated with mortality among MDR-TB cases. New strategies for appropriate MDR-TB detection and management should be implemented, including drug sensitivity tests, diabetes and HIV screening, as well as guarantee for a complete adherence to therapy.

  2. Imaging and Targeted Therapy of Multidrug Resistance. Final Report

    International Nuclear Information System (INIS)

    Piwnica-Worms, David

    2009-01-01

    One focus area of DOE Office of Science was the Imaging of Gene Expression in Health and Disease in real time in tissue culture, whole animals and ultimately patients. Investigators of the Molecular Imaging Group, Washington University Medical School, ascribed to this objective and a major focus of this group directly tied into the DOE program through their efforts targeting the multidrug resistance gene (MDR1). Our plans for continuation of the program were to extend and build on this line of investigation, incorporating new molecular tools into our methodology to selectively inhibit MDR1 gene expression with novel modulation strategies. Two approaches were to be pursued: (1) high throughput screening of compounds that disrupted mutant p53 transactivation of the MDR1 promoter, and (2) knockdown of MDR1 messenger RNA with retroviral-mediated delivery of small interfering RNA constructs. These would be combined with our continuing effort to synthesize ligands and examine structure-activity relationships of bis-salicylaldehydes labeled with gallium-68 to generate PET agents for imaging MDR1 P-glycoprotein function. We would be uniquely positioned to correlate therapeutic modulation of MDR1 gene expression and protein function in the same systems in vivo using PET and bioluminescence reporters. Use of animal models such as the mdr1a/1b(-/-) gene deleted mice would also have enabled refined analysis of modulation and tracer pharmacokinetics in vivo. Overall, this DOE program and resultant tools would enable direct monitoring of novel therapeutic strategies and the MDR phenotype in relation to gene expression and protein function in vivo.

  3. Phenotypic subgroups of polycystic ovary syndrome have different intra-renal resistance symptoms.

    Science.gov (United States)

    Ciftci, Ceylan F; Uckuyu, Ayla; Karadeli, Elif; Turhan, Erdem; Toprak, Erzat; Ozcimen, Emel E

    2012-12-01

    The polycystic ovary syndrome (PCOS) is known to be related with increased metabolic and cardiovascular risks. Various phenotypic subgroups of PCOS have been proven to have metabolic and endocrine disorders with varying degrees of severity However, intra-renal vascular resistance, which is an indirect indication of atherosclerosis, remains unknown in PCOS subgroups. In this study we examined whether PCOS subgroups have different intra-renal resistance symptoms. 98 PCOS patients (diagnosed according to the Rotterdam criteria) 30 controls were included in the study The diagnosis of PCOS was established in the presence of at least two of the following criteria: 1-oligo and/or amenorrhea (OM); 2-clinic and/or biochemical signs of hyperandrogenism (HA); 3-polycystic ovarian morphology (PCO) detected by transvaginal ultrasonography 37 patients (Group 1) met all three criteria (HA+OM+PCO), 29 patients (Group 2) met two of the criteria including hyperandrogenism (HA+OM or HA+PCO) and the remaining 32 patients (Group 3) had no hyperandrogenism but fulfilled the other two criteria; PCO+OM. Renal Doppler ultrasonography and hormonal/biochemical analyses were carried out. The first outcome measure was designated as the differences in the renal resistive index (RRI) values of the groups, and the second outcome measure was designated as the relation of RRI with the insulin resistance and lipid profile. In Group 1, the RRI and the homeostasis model assessment of insulin resistance (HOMA-IR) values were significantly higher than in Group 3 and controls (P PCOS subgroups have metabolic and endocrine disorders and cardiovascular risks of varying degrees of severity Moreover, we showed that there was no increase of metabolic and cardiovascular risks in PCOS patients without hyperandrogenism.

  4. Phenotypic and molecular characteristics of methicillin-resistant Staphylococcus aureus isolates from Ekiti State, Nigeria

    Directory of Open Access Journals (Sweden)

    Olowe OA

    2013-08-01

    Full Text Available Olugbenga Adekunle Olowe,1 Olayinka Oluwatoyin Kukoyi,2 Samuel Sunday Taiwo,1 Olusola Ojurongbe,1 Oluyinka Oladele Opaleye,1 Oloyede Samuel Bolaji,1 Abiodun Adebimpe Adegoke,1 Olufunmilola Bamidele Makanjuola,1 David Olusoga Ogbolu,3 Oyebode Terry Alli31Department of Medical Microbiology and Parasitology, College of Health Sciences, Ladoke Akintola University of Technology, Ogbomoso, Nigeria; 2Department of Microbiology, College of Sciences, Afe Babalola University, Ado-Ekiti, Nigeria; 3Department of Biomedical Sciences, College of Health Sciences, Lautech, Osogbo, NigeriaIntroduction: The characteristics and antimicrobial resistance profiles of Staphylococcus aureus differs according to geographical regions and in relation to antibiotic usage. The aim of this study was to determine the biochemical characteristics of the prevalent S. aureus from Ekiti State, Nigeria, and to evaluate three commonly used disk diffusion methods (cefoxitin, oxacillin, and methicillin for the detection of methicillin resistance in comparison with mecA gene detection by polymerase chain reaction.Materials and methods: A total of 208 isolates of S. aureus recovered from clinical specimens were included in this study. Standard microbiological procedures were employed in isolating the strains. Susceptibility of each isolate to methicillin (5 µg, oxacillin (1 µg, and cefoxitin (30 µg was carried out using the modified Kirby–Bauer/Clinical and Laboratory Standard Institute disk diffusion technique. They were also tested against panels of antibiotics including vancomycin. The conventional polymerase chain reaction method was used to detect the presence of the mecA gene.Results: Phenotypic resistance to methicillin, oxacillin, and cefoxitin were 32.7%, 40.3%, and 46.5%, respectively. The mecA gene was detected in 40 isolates, giving a methicillin-resistant S. aureus (MRSA prevalence of 19.2%. The S. aureus isolates were resistant to penicillin (82.7% and tetracycline

  5. Tetracycline resistance phenotypes and genotypes of coagulase-negative staphylococcal isolates from bubaline mastitis in Egypt

    Directory of Open Access Journals (Sweden)

    K. A. Abd El-Razik

    2017-06-01

    Full Text Available Aim: This study was devoted to elucidate the tetracycline resistance of coagulase-negative staphylococci (CNS derived from normal and subclinical mastitic (SCM buffaloes' milk in Egypt. Materials and Methods: A total of 81 milk samples from 46 normal buffalo milk samples and 35 SCM buffalo milk samples at private dairy farms of Egypt were used in this study. CNS were identified using phenotypic and molecular methods (polymerase chain reaction [PCR]. CNS isolates were tested for tetracycline resistance using routine methods and multiplex PCR targeting tetracycline (tet resistance genes followed by sequencing of positive PCR products and phylogenetic analysis. Results: Isolation and identification of 28 (34.5% CNS from normal and SCM buffaloes' milk, namely, Staphylococcus intermedius (39.2%, Staphylococcus xylosus (25.0%, Staphylococcus epidermidis (10.7%, Staphylococcus hominis (10.7%, and 3.5% to each of Staphylococcus sciuri, Staphylococcus hyicus, Staphylococcus lugdunensis, and Staphylococcus simulans. Using nested PCR, all the 28 CNS isolates revealed positive for 16srRNA gene specific for genus staphylococci and negative for thermonuclease (nuc gene specific for Staphylococcus aureus species. The presence of tetracycline resistance-encoding genes (tetK, tetL, tetM, and tetO was detected by multiplex PCR. All isolates were negative for tetL, M, and O genes while 14 (50% CNS isolates were positive for tetK gene, namely, S. lugdunensis (100%, S. hominis (100%, S. epidermidis (66.6%, S. intermedius (45.4%, and S. xylosus (42.8%. Nucleotide sequencing of tetK gene followed by phylogenetic analysis showed the high homology between our CNS isolates genes of tetracycline resistance with S. aureus isolates including Egyptian ones. This proves the transfer of the tetracycline resistance encoding genes between coagulase-negative and coagulase-positive Staphylococcus spp. Conclusion: CNS isolates have distinguishingly high resistance to tetracycline

  6. Transit through the flea vector induces a pretransmission innate immunity resistance phenotype in Yersinia pestis.

    Directory of Open Access Journals (Sweden)

    Viveka Vadyvaloo

    2010-02-01

    Full Text Available Yersinia pestis, the agent of plague, is transmitted to mammals by infected fleas. Y. pestis exhibits a distinct life stage in the flea, where it grows in the form of a cohesive biofilm that promotes transmission. After transmission, the temperature shift to 37 degrees C induces many known virulence factors of Y. pestis that confer resistance to innate immunity. These factors are not produced in the low-temperature environment of the flea, however, suggesting that Y. pestis is vulnerable to the initial encounter with innate immune cells at the flea bite site. In this study, we used whole-genome microarrays to compare the Y. pestis in vivo transcriptome in infective fleas to in vitro transcriptomes in temperature-matched biofilm and planktonic cultures, and to the previously characterized in vivo gene expression profile in the rat bubo. In addition to genes involved in metabolic adaptation to the flea gut and biofilm formation, several genes with known or predicted roles in resistance to innate immunity and pathogenicity in the mammal were upregulated in the flea. Y. pestis from infected fleas were more resistant to phagocytosis by macrophages than in vitro-grown bacteria, in part attributable to a cluster of insecticidal-like toxin genes that were highly expressed only in the flea. Our results suggest that transit through the flea vector induces a phenotype that enhances survival and dissemination of Y. pestis after transmission to the mammalian host.

  7. Transient erythromycin resistance phenotype associated with peptidyl-tRNA drop-off on early UGG and GGG codons

    DEFF Research Database (Denmark)

    Macvanin, Mirjana; Gonzalez de Valdivia, Ernesto I; Ardell, David H

    2007-01-01

    -peptide-encoding sequence, we asked whether the codons UGG and GGG, which are known to promote peptidyl-tRNA drop-off at early positions in mRNA, would result in a phenotype of erythromycin resistance if located after this sequence. We find that UGG or GGG, at either position +4 or +5, without a following stop codon......, is associated with an erythromycin resistance phenotype upon gene induction. Our results suggest that, while a stop codon at +4 gives a tripeptide product (MIL) and erythromycin sensitivity, UGG or GGG codons at the same position give a tetrapeptide product (MILW or MILG) and phenotype of erythromycin...... resistance. Thus, the drop-off event on GGG or UGG codons occurs after incorporation of the corresponding amino acid into the growing peptide chain. Drop-off gives rise to a peptidyl-tRNA where the peptide moiety functionally mimics a minigene peptide product of the type previously associated...

  8. Development and evaluation of a phenotypic assay monitoring resistance formation to protease inhibitors in HIV-1-infected patients.

    Science.gov (United States)

    Gehringer, Heike; Von der Helm, Klaus; Seelmeir, Sigrid; Weissbrich, Benedikt; Eberle, Josef; Nitschko, Hans

    2003-05-01

    A novel phenotypic assay, based on recombinant expression of the HIV-1-protease was developed and evaluated; it monitors the formation of resistance to protease inhibitors. The HIV-1 protease-encoding region from the blood sample of patients was amplified, ligated into the expression vector pBD2, and recombinantly expressed in Escherichia coli TG1 cells. The resulting recombinant enzyme was purified by a newly developed one-step acid extraction protocol. The protease activity was determined in presence of five selected HIV protease inhibitors and the 50% inhibitory concentration (IC(50)) to the respective protease inhibitors determined. The degree of resistance was expressed in terms of x-fold increase in IC(50) compared to the IC(50) value of an HIV-1 wild type protease preparation. The established test system showed a reproducible recombinant expression of each individual patients' HIV-1 protease population. Samples of nine clinically well characterised HIV-1-infected patients with varying degrees of resistance were analysed. There was a good correlation between clinical parameters and the results obtained by this phenotypic assay. For the majority of patients a blind genotypic analysis of the patients' protease domain revealed a fair correlation to the results of the phenotypic assay. In a minority of patients our phenotypic results diverged from the genotypic ones. This novel phenotypic assay can be carried out within 8-10 days, and offers a significant advantage in time to the current employed phenotypic tests.

  9. Molecular characterization of multidrug-resistant Klebsiella pneumoniae isolates

    Directory of Open Access Journals (Sweden)

    Xiang-hua Hou

    2015-09-01

    Full Text Available Klebsiella pneumoniae is an important cause of healthcare-associated infections worldwide. Selective pressure, the extensive use of antibiotics, and the conjugational transmission of antibiotic resistance genes across bacterial species and genera facilitate the emergence of multidrug-resistant (MDR K. pneumoniae. Here, we examined the occurrence, phenotypes and genetic features of MDR K. pneumoniae isolated from patients in intensive care units (ICUs at the First Affiliated Hospital of Xiamen University in Xiamen, China, from January to December 2011. Thirty-eight MDR K. pneumoniae strains were collected. These MDR K. pneumoniae isolates possessed at least seven antibiotic resistance determinants, which contribute to the high-level resistance of these bacteria to aminoglycosides, macrolides, quinolones and β-lactams. Among these isolates, 24 strains were extended-spectrum β-lactamase (ESBL producers, 2 strains were AmpC producers, and 12 strains were both ESBL and AmpC producers. The 38 MDR isolates also contained class I (28/38 and class II integrons (10/38. All 28 class I-positive isolates contained aacC1, aacC4, orfX, orfX’ and aadA1 genes. β-lactam resistance was conferred through blaSHV (22/38, blaTEM (10/38, and blaCTX-M (7/38. The highly conserved blaKPC-2 (37/38 and blaOXA-23(1/38 alleles were responsible for carbapenem resistance, and a gyrAsite mutation (27/38 and the plasmid-mediated qnrB gene (13/38 were responsible for quinolone resistance. Repetitive-sequence-based PCR (REP-PCR fingerprinting of these MDR strains revealed the presence of five groups and sixteen patterns. The MDR strains from unrelated groups showed different drug resistance patterns; however, some homologous strains also showed different drug resistance profiles. Therefore, REP-PCR-based analyses can provide information to evaluate the epidemic status of nosocomial infection caused by MDR K. pneumoniae; however, this test lacks the power to discriminate some

  10. Clinical phenotype of South-East Asian temporomandibular disorder patients with upper airway resistance syndrome.

    Science.gov (United States)

    Tay, D K L; Pang, K P

    2018-01-01

    Clinical and radiographic characteristics of a subset of South East Asian temporomandibular disorder (TMD) patients with comorbid upper airway resistance syndrome (UARS) were documented in a multi-center prospective series of 86 patients (26 men and 60 women / mean age 35.7 years). All had excessive daytime sleepiness, high arousal index and Apnoea-Hypopnoea Index (AHI) temporomandibular joint (TMJ) arthralgia while 90·7% reported sleep bruxism (SB). Unlike patients with obstructive sleep apnoea (OSA), hypertension was uncommon (4·7%) while depression was prevalent at 68·6% with short REM latency of 25% documented in 79·6% and 57·6% of these depressed patients, respectively. 65·1% displayed a posteriorly displaced condyle at maximum intercuspation with or without TMJ clicking. Most exhibited a forward head posture (FHP) characterised by loss of normal cervical lordosis (80·2%), C0-C1 narrowing (38·4%) or an elevated hyoid position (50%), and 91·9% had nasal congestion. We postulate the TMD-UARS phenotype may have originally developed as an adaptive response to 'awake' disordered breathing during growth. Patients with persistent TMD and/or reporting SB should be screened for UARS and chronic nasal obstruction, especially when they also present with FHP. The lateral cephalogram is a useful tool in the differentiation of UARS from other OSA phenotypes. © 2017 John Wiley & Sons Ltd.

  11. Multidrug-resistant gram-negative bacteria colonization of healthy US military personnel in the US and Afghanistan.

    Science.gov (United States)

    Vento, Todd J; Cole, David W; Mende, Katrin; Calvano, Tatjana P; Rini, Elizabeth A; Tully, Charla C; Zera, Wendy C; Guymon, Charles H; Yu, Xin; Cheatle, Kristelle A; Akers, Kevin S; Beckius, Miriam L; Landrum, Michael L; Murray, Clinton K

    2013-02-05

    The US military has seen steady increases in multidrug-resistant (MDR) gram-negative bacteria (GNB) infections in casualties from Iraq and Afghanistan. This study evaluates the prevalence of MDR GNB colonization in US military personnel. GNB colonization surveillance of healthy, asymptomatic military personnel (101 in the US and 100 in Afghanistan) was performed by swabbing 7 anatomical sites. US-based personnel had received no antibiotics within 30 days of specimen collection, and Afghanistan-based personnel were receiving doxycycline for malaria chemoprophylaxis at time of specimen collection. Isolates underwent genotypic and phenotypic characterization. The only colonizing MDR GNB recovered in both populations was Escherichia coli (p=0.01), which was seen in 2% of US-based personnel (all perirectal) and 11% of Afghanistan-based personnel (10 perirectal, 1 foot+groin). Individuals with higher off-base exposures in Afghanistan did not show a difference in overall GNB colonization or MDR E. coli colonization, compared with those with limited off-base exposures. Healthy US- and Afghanistan-based military personnel have community onset-MDR E. coli colonization, with Afghanistan-based personnel showing a 5.5-fold higher prevalence. The association of doxycycline prophylaxis or other exposures with antimicrobial resistance and increased rates of MDR E. coli colonization needs further evaluation.

  12. The CAPN10 Gene Is Associated with Insulin Resistance Phenotypes in the Spanish Population

    Science.gov (United States)

    Sáez, María E.; González-Sánchez, José L.; Ramírez-Lorca, Reposo; Martínez-Larrad, María T.; Zabena, Carina; González, Alejandro; Morón, Francisco J.; Ruiz, Agustín; Serrano-Ríos, Manuel

    2008-01-01

    Cardiovascular disease is the leading cause of morbidity and mortality in the industrialized world. Familial aggregation of cardiovascular risk factors is a frequent finding, but genetic factors affecting its presentation are still poorly understood. The calpain 10 gene (CAPN10) has been associated with type 2 diabetes (T2DM), a complex metabolic disorder with increased risk of cardiovascular disease. Moreover, the CAPN10 gene has been associated with the presence of metabolic syndrome (MS) in T2DM and in polycystic ovary syndrome (PCOS). In this work, we have analysed whether the polymorphisms UCSNP44, -43, -19 and -63 are related to several cardiovascular risk factors in the context of MS. Molecular analysis of CAPN10 gene was performed in 899 individuals randomly chosen from a cross-sectional population-based epidemiological survey. We have found that CAPN10 gene in our population is mainly associated with two indicators of the presence of insulin resistance: glucose levels two hours after a 75-g oral glucose tolerance test (OGTT) and HOMA values, although cholesterol levels and blood pressure values are also influenced by CAPN10 variants. In addition, the 1221/1121 haplogenotype is under-represented in individuals that fulfil the International Diabetes Federation (IDF) diagnostic criteria for MS. Our results suggest that CAPN10 gene is associated with insulin resistance phenotypes in the Spanish population. PMID:18698425

  13. The CAPN10 gene is associated with insulin resistance phenotypes in the Spanish population.

    Directory of Open Access Journals (Sweden)

    María E Sáez

    Full Text Available Cardiovascular disease is the leading cause of morbidity and mortality in the industrialized world. Familial aggregation of cardiovascular risk factors is a frequent finding, but genetic factors affecting its presentation are still poorly understood. The calpain 10 gene (CAPN10 has been associated with type 2 diabetes (T2DM, a complex metabolic disorder with increased risk of cardiovascular disease. Moreover, the CAPN10 gene has been associated with the presence of metabolic syndrome (MS in T2DM and in polycystic ovary syndrome (PCOS. In this work, we have analysed whether the polymorphisms UCSNP44, -43, -19 and -63 are related to several cardiovascular risk factors in the context of MS. Molecular analysis of CAPN10 gene was performed in 899 individuals randomly chosen from a cross-sectional population-based epidemiological survey. We have found that CAPN10 gene in our population is mainly associated with two indicators of the presence of insulin resistance: glucose levels two hours after a 75-g oral glucose tolerance test (OGTT and HOMA values, although cholesterol levels and blood pressure values are also influenced by CAPN10 variants. In addition, the 1221/1121 haplogenotype is under-represented in individuals that fulfil the International Diabetes Federation (IDF diagnostic criteria for MS. Our results suggest that CAPN10 gene is associated with insulin resistance phenotypes in the Spanish population.

  14. The culturable soil antibiotic resistome: a community of multi-drug resistant bacteria.

    Science.gov (United States)

    Walsh, Fiona; Duffy, Brion

    2013-01-01

    Understanding the soil bacterial resistome is essential to understanding the evolution and development of antibiotic resistance, and its spread between species and biomes. We have identified and characterized multi-drug resistance (MDR) mechanisms in the culturable soil antibiotic resistome and linked the resistance profiles to bacterial species. We isolated 412 antibiotic resistant bacteria from agricultural, urban and pristine soils. All isolates were multi-drug resistant, of which greater than 80% were resistant to 16-23 antibiotics, comprising almost all classes of antibiotic. The mobile resistance genes investigated, (ESBL, bla NDM-1, and plasmid mediated quinolone resistance (PMQR) resistance genes) were not responsible for the respective resistance phenotypes nor were they present in the extracted soil DNA. Efflux was demonstrated to play an important role in MDR and many resistance phenotypes. Clinically relevant Burkholderia species are intrinsically resistant to ciprofloxacin but the soil Burkholderia species were not intrinsically resistant to ciprofloxacin. Using a phenotypic enzyme assay we identified the antibiotic specific inactivation of trimethoprim in 21 bacteria from different soils. The results of this study identified the importance of the efflux mechanism in the soil resistome and variations between the intrinsic resistance profiles of clinical and soil bacteria of the same family.

  15. The culturable soil antibiotic resistome: a community of multi-drug resistant bacteria.

    Directory of Open Access Journals (Sweden)

    Fiona Walsh

    Full Text Available Understanding the soil bacterial resistome is essential to understanding the evolution and development of antibiotic resistance, and its spread between species and biomes. We have identified and characterized multi-drug resistance (MDR mechanisms in the culturable soil antibiotic resistome and linked the resistance profiles to bacterial species. We isolated 412 antibiotic resistant bacteria from agricultural, urban and pristine soils. All isolates were multi-drug resistant, of which greater than 80% were resistant to 16-23 antibiotics, comprising almost all classes of antibiotic. The mobile resistance genes investigated, (ESBL, bla NDM-1, and plasmid mediated quinolone resistance (PMQR resistance genes were not responsible for the respective resistance phenotypes nor were they present in the extracted soil DNA. Efflux was demonstrated to play an important role in MDR and many resistance phenotypes. Clinically relevant Burkholderia species are intrinsically resistant to ciprofloxacin but the soil Burkholderia species were not intrinsically resistant to ciprofloxacin. Using a phenotypic enzyme assay we identified the antibiotic specific inactivation of trimethoprim in 21 bacteria from different soils. The results of this study identified the importance of the efflux mechanism in the soil resistome and variations between the intrinsic resistance profiles of clinical and soil bacteria of the same family.

  16. Genotypic and Phenotypic Markers of Livestock-Associated Methicillin-Resistant Staphylococcus aureus CC9 in Humans

    OpenAIRE

    Ye, Xiaohua; Wang, Xiaolin; Fan, Yanping; Peng, Yang; Li, Ling; Li, Shunming; Huang, Jingya; Yao, Zhenjiang; Chen, Sidong

    2016-01-01

    Use of antimicrobials in industrial food animal production is associated with the presence of multidrug-resistant Staphylococcus aureus among animals and humans. The livestock-associated (LA) methicillin-resistant S. aureus (MRSA) clonal complex 9 (CC9) is associated with animals and related workers in Asia. This study aimed to explore the genotypic and phenotypic markers of LA-MRSA CC9 in humans. We conducted a cross-sectional study of livestock workers and controls in Guangdong, China. The ...

  17. Coumpounds affecting cell membrane functions and integrity: MDR pumps and theit exploration

    Czech Academy of Sciences Publication Activity Database

    Sigler, Karel; Gášková, D.

    2002-01-01

    Roč. 51, č. 24 (2002), s. 19-22 ISSN 0137-1398. [Uroczyste Seminarium z okazji urodzin Profesora Stanislawa Witka /70./. Wroclaw, 21.07.2002] R&D Projects: GA AV ČR IBS5020202; GA MŠk ME 577 Keywords : xenobioticexporting * multidrug resistance * mdr pumps Subject RIV: EE - Microbiology, Virology

  18. Monoclonal antibody to an external epitope of the human mdr1 P-glycoprotein

    NARCIS (Netherlands)

    Arceci, R. J.; Stieglitz, K.; Bras, J.; Schinkel, A.; Baas, F.; Croop, J.

    1993-01-01

    A membrane glycoprotein, termed P-glycoprotein, has been shown to be responsible for cross-resistance to a broad range of structurally and functionally distinct cytotoxic agents. P-glycoprotein, encoded in humans by the mdr1 gene, functions as an energy-dependent efflux pump to exclude these

  19. Antimicrobial resistance in equine faecal Escherichia coli isolates from North West England

    Directory of Open Access Journals (Sweden)

    Williams Nicola J

    2010-04-01

    Full Text Available Abstract Background Escherichia coli isolates of equine faecal origin were investigated for antibiotic resistance, resistance genes and their ability to perform horizontal transfer. Methods In total, 264 faecal samples were collected from 138 horses in hospital and community livery premises in northwest England, yielding 296 resistant E. coli isolates. Isolates were tested for susceptibility to antimicrobial drugs by disc diffusion and agar dilution methods in order to determine minimum inhibitory concentrations (MIC. PCR amplification was used to detect genes conferring resistance to: ampicillin (TEM and SHV beta-lactamase, chloramphenicol (catI, catII, catIII and cml, tetracycline (tetA, tetB, tetC, tetD, tet E and tetG, and trimethoprim (dfrA1, dfrA9, dfrA12, dfrA13, dfr7, and dfr17. Results The proportion of antibiotic resistant isolates, and multidrug resistant isolates (MDR was significantly higher in hospital samples compared to livery samples (MDR: 48% of hospital isolates; 12% of livery isolates, p dfr, TEM beta-lactamase, tet and cat, conferring resistance to trimethoprim, ampicillin, tetracycline and chloramphenicol, respectively. Within each antimicrobial resistance group, these genes occurred at frequencies of 93% (260/279, 91%, 86.8% and 73.5%, respectively; with 115/296 (38.8% found to be MDR isolates. Conjugation experiments were performed on selected isolates and MDR phenotypes were readily transferred. Conclusions Our findings demonstrate that E. coli of equine faecal origin are commonly resistant to antibiotics used in human and veterinary medicine. Furthermore, our results suggest that most antibiotic resistance observed in equine E. coli is encoded by well-known and well-characterized resistant genes common to E. coli from man and domestic animals. These data support the ongoing concern about antimicrobial resistance, MDR, antimicrobial use in veterinary medicine and the zoonotic risk that horses could potentially pose to

  20. Tannic acid affects the phenotype of Staphylococcus aureus resistant to tetracycline and erythromycin by inhibition of efflux pumps.

    Science.gov (United States)

    Tintino, Saulo R; Morais-Tintino, Cícera D; Campina, Fábia F; Costa, Maria do S; Menezes, Irwin R A; de Matos, Yedda Maria L S; Calixto-Júnior, João T; Pereira, Pedro S; Siqueira-Junior, José P; Leal-Balbino, Teresa C; Coutinho, Henrique D M; Balbino, Valdir Q

    2017-10-01

    The widespread use of antibiotics created selective pressure for the emergence of strains that would persist despite antibiotic toxicity. The bacterial resistance mechanisms are several, with efflux pumps being one of the main ones. These pumps are membrane proteins with the function of removing antibiotics from the cell cytoplasm. Due to this importance, the aim of this work was to evaluate the inhibitory effect of tannic acid against efflux pumps expressed by the Staphylococcus aureus RN4220 and IS-58 strains. The efflux pump inhibition was assayed using a sub-inhibitory concentration of efflux pump standard inhibitors and tannic acid (MIC/8), observing their capacity to decrease the MIC of Ethidium bromide (EtBr) and antibiotics due the possible inhibitory effect of these substances. The MICs of EtBr and antibiotics were significantly different in the presence of tannic acid, indicating the inhibitory effect of this product against efflux pumps of both strains. These results indicate the possible usage of tannic acid asan inhibitor and an adjuvant in the antibiotic therapy against multidrug resistant bacteria (MDR). Copyright © 2017 Elsevier Inc. All rights reserved.

  1. Detekce polymorfismu v genu MDR1 u ovčáckých a honáckých psů

    OpenAIRE

    Staroveská, Marieta

    2016-01-01

    This thesis is focused on polymorphism of MDR1 gene and related drug resistance. Resistance is caused by deletion of four nucleotids, that resulting in a frame shift and synthesis of nonfunctional transport of P-glycoprotein. The text describes a polymorphism of MDR1 (ABCB1) gene, which results in reduced resistance to drugs belonging to the group of macrocyclic lactones. It also describes inheritance of this phenomenon and it deals with the detection of mutation using PCR (polymerase chain r...

  2. Global Phenotypic Characterization of Effects of Fluoroquinolone Resistance Selection on the Metabolic Activities and Drug Susceptibilities of Clostridium perfringens Strains

    Directory of Open Access Journals (Sweden)

    Miseon Park

    2014-01-01

    Full Text Available Fluoroquinolone resistance affects toxin production of Clostridium perfringens strains differently. To investigate the effect of fluoroquinolone resistance selection on global changes in metabolic activities and drug susceptibilities, four C. perfringens strains and their norfloxacin-, ciprofloxacin-, and gatifloxacin-resistant mutants were compared in nearly 2000 assays, using phenotype microarray plates. Variations among mutant strains resulting from resistance selection were observed in all aspects of metabolism. Carbon utilization, pH range, osmotic tolerance, and chemical sensitivity of resistant strains were affected differently in the resistant mutants depending on both the bacterial genotype and the fluoroquinolone to which the bacterium was resistant. The susceptibilities to gentamicin and erythromycin of all resistant mutants except one increased, but some resistant strains were less susceptible to amoxicillin, cefoxitin, ceftriaxone, chloramphenicol, and metronidazole than their wild types. Sensitivity to ethidium bromide decreased in some resistant mutants and increased in others. Microarray analysis of two gatifloxacin-resistant mutants showed changes in metabolic activities that were correlated with altered expression of various genes. Both the chemical structures of fluoroquinolones and the genomic makeup of the wild types influenced the changes found in resistant mutants, which may explain some inconsistent reports of the effects of therapeutic use of fluoroquinolones on clinical isolates of bacteria.

  3. Characterization of the multiple drug resistance phenotype expressed by tumour cells following in vitro exposure to fractionated X-irradiation

    International Nuclear Information System (INIS)

    Hill, B.T.; McClean, S.; Hosking, L.; Shellard, S.; Dempke, W.; Whelan, R.

    1992-01-01

    The major clinical problem of the emergence of drug resistant tumor cell populations is recognized in patients previously treated with antitumor drugs and with radiotherapy. It is proposed that, although radiation-induced vascular fibrosis may limit drug delivery to the tumor, exposure to radiation may 'induce' or 'select for' drug resistance. This hypothesis was examined by establishing in vitro model systems to investigate the resistance phenotype of tumor cells following exposure to X-rays. Characteristically tumor cells surviving exposure to a series of fractions of X-irradiation are shown to have consistently expressed resistance to multiple drugs, including the Vinca alkaloids and the epipodophyllotoxins. Currently this research is aimed at determining whether distinctive resistance mechanisms operate depending on whether resistance results following drug or X-ray exposure. Initial results indicate that whilst some common mechanisms operate, drug resistant tumor cells identified following exposure to X-irradiation appear to exhibit a novel multidrug resistance phenotype. (author). 13 refs., 1 tab

  4. Role of wild birds as carriers of multi-drug resistant Escherichia coli and Escherichia vulneris

    Directory of Open Access Journals (Sweden)

    Mohammed Y. Shobrak

    2014-12-01

    Full Text Available Emergence and distribution of multi-drug resistant (MDR bacteria in environments pose a risk to human and animal health. A total of 82 isolates of Escherichia spp. were recovered from cloacal swabs of migrating and non-migrating wild birds. All bacterial isolates were identified and characterized morphologically and biochemically. 72% and 50% of isolates recovered from non-migrating and migrating birds, respectively, showed positive congo red dye binding (a virulence factor. Also, hemolysin production (a virulence factor was showed in 8% of isolates recovered from non-migrating birds and 75% of isolates recovered from migrating birds. All isolates recovered from non-migrating birds were found resistant to Oxacillin while all isolates recovered from migrating birds demonstrated resistance to Oxacillin, Chloramphenicol, Oxytetracycline and Lincomycin. Some bacterial isolates recovered from non-migrating birds and migrating birds exhibited MDR phenotype. The MDR isolates were further characterized by API 20E and 16S rRNA as E. coli and E. vulneris. MDR Escherichia isolates contain ~1-5 plasmids of high-molecular weights. Accordingly, wild birds could create a potential threat to human and animal health by transmitting MDR bacteria to water streams and other environmental sources through their faecal residues, and to remote regions by migration.

  5. Role of wild birds as carriers of multi-drug resistant Escherichia coli and Escherichia vulneris

    Science.gov (United States)

    Shobrak, Mohammed Y.; Abo-Amer, Aly E.

    2014-01-01

    Emergence and distribution of multi-drug resistant (MDR) bacteria in environments pose a risk to human and animal health. A total of 82 isolates of Escherichia spp. were recovered from cloacal swabs of migrating and non-migrating wild birds. All bacterial isolates were identified and characterized morphologically and biochemically. 72% and 50% of isolates recovered from non-migrating and migrating birds, respectively, showed positive congo red dye binding (a virulence factor). Also, hemolysin production (a virulence factor) was showed in 8% of isolates recovered from non-migrating birds and 75% of isolates recovered from migrating birds. All isolates recovered from non-migrating birds were found resistant to Oxacillin while all isolates recovered from migrating birds demonstrated resistance to Oxacillin, Chloramphenicol, Oxytetracycline and Lincomycin. Some bacterial isolates recovered from non-migrating birds and migrating birds exhibited MDR phenotype. The MDR isolates were further characterized by API 20E and 16S rRNA as E. coli and E. vulneris. MDR Escherichia isolates contain ~1–5 plasmids of high-molecular weights. Accordingly, wild birds could create a potential threat to human and animal health by transmitting MDR bacteria to water streams and other environmental sources through their faecal residues, and to remote regions by migration. PMID:25763023

  6. Phenotypic and genotypic profiling of antimicrobial resistance in enteric Escherichia coli communities isolated from finisher pigs in Australia.

    Science.gov (United States)

    Smith, M G; Jordan, D; Gibson, J S; Cobbold, R N; Chapman, T A; Abraham, S; Trott, D J

    2016-10-01

    To assess herd-to-herd variation in antimicrobial resistance phenotypes and associated antimicrobial resistance genes (ARGs) in faecal commensal Escherichia coli communities isolated from Australian slaughter-age pigs. Hydrophobic grid-membrane filtration (HGMF) was used to screen populations of E. coli isolated from faecal samples obtained from pigs prior to or at slaughter. Multiplex PCRs were applied to the pooled DNA extracted from the samples to identify specific ARGs. Pooled faecal samples from 30 finishers, from 72 different Australian pig farms, produced 5003 isolates for screening. HGMF techniques and image analysis were used to confirm E. coli resistance phenotypes to four antimicrobial agents (ampicillin, gentamicin, florfenicol and ceftiofur) using selective agars. Multiplex PCRs were performed on DNA from pooled samples for 35 ARGs associated with seven chemical classes. The prevalence of E. coli isolates showing no resistance to any of the drugs was 50.2% (95% confidence interval (CI) 41.8-58.6%). Ceftiofur resistance was very low (1.8%; CI 0.8-3.9%) and no ARGs associated with 3rd-generation cephalosporin resistance were detected. By contrast, ampicillin (29.4%, CI 22.8-37.0%), florfenicol (24.3%, CI 17.8-32.3%) and gentamicin (CI 17.5%, 10.7-27.2%) resistance prevalence varied greatly between farms and associated ARGs were common. The most common combined resistance phenotype was ampicillin-florfenicol. The use of registered antimicrobials in Australian pigs leads to the enteric commensal populations acquiring associated ARGs. However, despite a high intensity of sampling, ARGs imparting resistance to the critically important 3rd-generation cephalosporins were not detected. © 2016 Australian Veterinary Association.

  7. Trends in darunavir resistance-associated mutations and phenotypic resistance in commercially tested United States clinical samples between 2006 and 2012.

    Science.gov (United States)

    Lathouwers, Erkki; Gupta, Soumi; Haddad, Mojgan; Paquet, Agnes; de Meyer, Sandra; Baugh, Bryan

    2015-06-01

    HIV-1 samples submitted by clinicians from the United States for routine drug susceptibility testing (PhenoSense GT) were evaluated for genotypic and phenotypic resistance to darunavir and other protease inhibitors (PIs). Among these samples (Monogram Biosciences database January 2006-June 2012; N=78,843), isolates harboring zero IAS-USA darunavir resistance-associated mutations (RAMs) increased from 77.7% in 2006 to 92.8% through the first half of 2012 (H1 2012; upward trend, p=0.0008); a downward trend seen for samples with three or more darunavir RAMs (7.5% in 2006 and 2.6% in H1 2012; p=0.002). Among samples with any PI resistance (N=15,932), samples harboring zero darunavir RAMs gradually increased (39.9% in 2006 vs. 55.0% in H1 2012; upward trend, p=0.005), but three or more darunavir RAMs did not change over time (21.7% in 2006 and 19.2% in H1 2012; p=0.27). During this period, the frequency of the 11 individual darunavir RAMs (IAS-USA 2011 list) decreased among all samples. The frequency of each darunavir RAM in PI-resistant samples decreased or remained relatively stable. The prevalence of samples with phenotypic resistance to darunavir (partial-to-full) decreased over time in all samples (8.2% in 2006 vs. 2.3% in H1 2012), as did resistance to other PIs (p<0.006 for all PIs). Phenotypic resistance to darunavir and other PIs also decreased in PI-resistant samples (darunavir: 23.9% in 2006 vs. 17.1% in H1 2012; p<0.013 for all PIs). Since approval of darunavir in 2006, there was a significant decrease in prevalence of samples with genotypic and phenotypic resistance to darunavir in commercially tested HIV-1 isolates. Furthermore, the prevalence of phenotypic resistance to darunavir was lower than all other PIs.

  8. Conserved hydrogen bonds and water molecules in MDR HIV-1 protease substrate complexes

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Zhigang [Wayne State Univ., Detroit, MI (United States); Case Western Reserve Univ., Cleveland, OH (United States); Harbor Hospital Baltimore, MD (United States); Wang, Yong [Wayne State Univ., Detroit, MI (United States); Yedidi, Ravikiran S. [Wayne State Univ., Detroit, MI (United States); National Institutes of Health, Bethesda, MD (United States); Dewdney, Tamaria G. [Wayne State Univ., Detroit, MI (United States); Reiter, Samuel J. [Wayne State Univ., Detroit, MI (United States); Brunzelle, Joseph S. [Northwestern Univ. Feinberg School of Medicine, Chicago, IL (United States); Kovari, Iulia A. [Wayne State Univ., Detroit, MI (United States); Kovari, Ladislau C. [Wayne State Univ., Detroit, MI (United States)

    2012-12-19

    Success of highly active antiretroviral therapy (HAART) in anti-HIV therapy is severely compromised by the rapidly developing drug resistance. HIV-1 protease inhibitors, part of HAART, are losing their potency and efficacy in inhibiting the target. Multi-drug resistant (MDR) 769 HIV-1 protease (resistant mutations at residues 10, 36, 46, 54, 62, 63, 71, 82, 84, 90) was selected for the present study to understand the binding to its natural substrates. The nine crystal structures of MDR769 HIV-1 protease substrate hepta-peptide complexes were analyzed in order to reveal the conserved structural elements for the purpose of drug design against MDR HIV-1 protease. Our structural studies demonstrated that highly conserved hydrogen bonds between the protease and substrate peptides, together with the conserved crystallographic water molecules, played a crucial role in the substrate recognition, substrate stabilization and protease stabilization. Additionally, the absence of the key flap-ligand bridging water molecule might imply a different catalytic mechanism of MDR769 HIV-1 protease compared to that of wild type (WT) HIV-1 protease.

  9. Management and treatment outcomes of patients enrolled in MDR-TB treatment in Viet Nam.

    Science.gov (United States)

    Phuong, N T M; Nhung, N V; Hoa, N B; Thuy, H T; Takarinda, K C; Tayler-Smith, K; Harries, A D

    2016-03-21

    The programmatic management of drug-resistant tuberculosis (TB) in Viet Nam has been rapidly scaled up since 2009. To document the annual numbers of patients enrolled for multidrug-resistant tuberculosis (MDR-TB) treatment during 2010-2014 and to determine characteristics and treatment outcomes of patients initiating treatment during 2010-2012. A retrospective cohort study using national reports and data from the national electronic data system for drug-resistant TB. The number of patients enrolled annually for MDR-TB treatment increased from 97 in 2010 to 1522 in 2014. The majority of patients were middle-aged men who had pulmonary disease and had failed a retreatment regimen; 77% had received ⩾2 courses of TB treatment. Favourable outcomes (cured and treatment completed) were attained in 73% of patients. Unfavourable outcomes included loss to follow-up (12.5%), death (8%) and failure (6.3%). Having had ⩾2 previous treatment courses and being human immunodeficiency virus-positive were associated with unfavourable outcomes. Increasing numbers of patients are being treated for MDR-TB each year with good treatment outcomes under national programme management in Viet Nam. However, there is a need to increase case detection-currently at 30% of the estimated 5100 MDR-TB cases per year, reduce adverse outcomes and improve monitoring and evaluation.

  10. Genotypic and phenotypic β-lactam resistance and presence of PVL gene in Staphylococci from dry bovine udder

    Science.gov (United States)

    Sivasailam, Asok; Sasidharan, Suchithra; Kollannur, Justin Davis; Syam, Radhika

    2017-01-01

    Dairy cows affected with subclinical mastitis can be sources of virulent, antimicrobial-resistant Staphylococci to humans because of the excretion of the bacteria through their milk. This study focussed on the phenotypic and genotypic antibiotic resistance patterns of Staphylococci isolated from dairy cows in early dry period. Among 96 isolates of Gram positive cocci from 157 cows, 76 were identified as Coagulase Negative Staphylococci and the remaining 20 were Staphylococcus aureus. Typical amplicons of coagulase gene were obtained for all 20 samples of S. aureus with three major coagulase types being identified as giving 627 bp (40%), 910 bp (35%) and 710 bp (25%) long PCR products. The groEL gene was amplified in PCR of all 76 isolates of Coagulase Negative Staphylococci, and incubation of PCR products with restriction enzyme PvuII yielded three distinct PCR-RFLP fragment patterns bearing resemblance to S. chromogenes and S. hyicus. Highest sensitivity of Coagulase Negative Staphylococci was noted for Azithromycin (92.5%) and the least to Tetracyclines (76.3%), whereas for S. aureus, it was Cefoperazone (95%) and Azithromycin (72.2%) respectively. Phenotypic resistance to Oxacillin (25 isolates), and Cefoxitin (11 isolates) was detected by dilution method with a commercial strip (Ezy MICTM). Genotypic resistance to β-Lactam antibiotics was found in 65 (34 with mecA gene and 31 with blaZ gene) isolates. Eighteen isolates possessed both the genes, with the PVL gene for virulence being detected in five of them. Nine isolates which had mecA gene were phenotypically susceptible to oxacillin while phenotypic resistance to oxacillin was observed in seven isolates that did not have either mecA or blaZ gene. This is the first report of persistent Staphylococcal infections possessing PVL gene and high level of genotypic resistance to β-Lactam antibiotics in small- holder dairy cattle from India. PMID:29091956

  11. Genotypic and phenotypic β-lactam resistance and presence of PVL gene in Staphylococci from dry bovine udder.

    Directory of Open Access Journals (Sweden)

    Vinodkumar Kulangara

    Full Text Available Dairy cows affected with subclinical mastitis can be sources of virulent, antimicrobial-resistant Staphylococci to humans because of the excretion of the bacteria through their milk. This study focussed on the phenotypic and genotypic antibiotic resistance patterns of Staphylococci isolated from dairy cows in early dry period. Among 96 isolates of Gram positive cocci from 157 cows, 76 were identified as Coagulase Negative Staphylococci and the remaining 20 were Staphylococcus aureus. Typical amplicons of coagulase gene were obtained for all 20 samples of S. aureus with three major coagulase types being identified as giving 627 bp (40%, 910 bp (35% and 710 bp (25% long PCR products. The groEL gene was amplified in PCR of all 76 isolates of Coagulase Negative Staphylococci, and incubation of PCR products with restriction enzyme PvuII yielded three distinct PCR-RFLP fragment patterns bearing resemblance to S. chromogenes and S. hyicus. Highest sensitivity of Coagulase Negative Staphylococci was noted for Azithromycin (92.5% and the least to Tetracyclines (76.3%, whereas for S. aureus, it was Cefoperazone (95% and Azithromycin (72.2% respectively. Phenotypic resistance to Oxacillin (25 isolates, and Cefoxitin (11 isolates was detected by dilution method with a commercial strip (Ezy MICTM. Genotypic resistance to β-Lactam antibiotics was found in 65 (34 with mecA gene and 31 with blaZ gene isolates. Eighteen isolates possessed both the genes, with the PVL gene for virulence being detected in five of them. Nine isolates which had mecA gene were phenotypically susceptible to oxacillin while phenotypic resistance to oxacillin was observed in seven isolates that did not have either mecA or blaZ gene. This is the first report of persistent Staphylococcal infections possessing PVL gene and high level of genotypic resistance to β-Lactam antibiotics in small- holder dairy cattle from India.

  12. CD133+CD24lo defines a 5-Fluorouracil-resistant colon cancer stem cell-like phenotype

    Science.gov (United States)

    Paschall, Amy V.; Yang, Dafeng; Lu, Chunwan; Redd, Priscilla S.; Choi, Jeong-Hyeon; Heaton, Christopher M.; Lee, Jeffrey R.; Nayak-Kapoor, Asha; Liu, Kebin

    2016-01-01

    The chemotherapeutic agent 5-Fluorouracil (5-FU) is the most commonly used drug for patients with advanced colon cancer. However, development of resistance to 5-FU is inevitable in almost all patients. The mechanism by which colon cancer develops 5-FU resistance is still unclear. One recently proposed theory is that cancer stem-like cells underlie colon cancer 5-FU resistance, but the phenotypes of 5-FU-resistant colon cancer stem cells are still controversial. We report here that 5-FU treatment selectively enriches a subset of CD133+ colon cancer cells in vitro. 5-FU chemotherapy also increases CD133+ tumor cells in human colon cancer patients. However, sorted CD133+ colon cancer cells exhibit no increased resistance to 5-FU, and CD133 levels exhibit no correlation with colon cancer patient survival or cancer recurrence. Genome-wide analysis of gene expression between sorted CD133+ colon cancer cells and 5-FU-selected colon cancer cells identifies 207 differentially expressed genes. CD24 is one of the genes whose expression level is lower in the CD133+ and 5-FU-resistant colon cancer cells as compared to CD133+ and 5-FU-sensitive colon cancer cells. Consequently, CD133+CD24lo cells exhibit decreased sensitivity to 5-FU. Therefore, we determine that CD133+CD24lo phenotype defines 5-FU-resistant human colon cancer stem cell-like cells. PMID:27659530

  13. Correlation between ability of biofilm formation with their responsible genes and MDR patterns in clinical and environmental Acinetobacter baumannii isolates.

    Science.gov (United States)

    Bardbari, Ali Mohammadi; Arabestani, Mohammad Reza; Karami, Manoochehr; Keramat, Fariba; Alikhani, Mohammad Yousef; Bagheri, Kamran Pooshang

    2017-07-01

    Acinetobacter baumannii potential to form biofilm and exhibit multiple antibiotic resistances may be responsible in its survival in hospital environment. Accordingly, our study was aimed to determine the correlation between ability of biofilm formation and the frequency of biofilm related genes with antibiotic resistance phenotypes, and also the categorization of their patterns in clinical and environmental isolates. A total of 75 clinical and 32 environmental strains of the A. baumannii were collected and identified via API 20NE. Antibiotic susceptibility was evaluated by disk diffusion and microdilution broth methods. Biofilm formation assay was performed by microtiter plate method. OXA types and biofilm related genes including Bla OXA-51 , Bla OXA-23 , Bla OXA-24 , Bla OXA-58 , bap, bla PER-1 , and ompA were amplified by PCR. The rate of MDR A. baumannii in clinical isolates (100%) was higher than environmental (81.2%) isolates (p baumannii isolates was associated with biofilm formation. There was a significant correlation between multiple drug resistance and biofilm formation. The clinical isolates had a higher ability to form strong biofilms compared to the environmental samples. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Multidrug-resistant tuberculosis in Europe, 2010-2011

    DEFF Research Database (Denmark)

    Günther, Gunar; van Leth, Frank; Alexandru, Sofia

    2015-01-01

    Drug-resistant Mycobacterium tuberculosis is challenging elimination of tuberculosis (TB). We evaluated risk factors for TB and levels of second-line drug resistance in M. tuberculosis in patients in Europe with multidrug-resistant (MDR) TB. A total of 380 patients with MDR TB and 376 patients...... with non-MDR TB were enrolled at 23 centers in 16 countries in Europe during 2010-2011. A total of 52.4% of MDR TB patients had never been treated for TB, which suggests primary transmission of MDR M. tuberculosis. At initiation of treatment for MDR TB, 59.7% of M. tuberculosis strains tested were...

  15. Co-ordinate loss of protein kinase C and multidrug resistance gene expression in revertant MCF-7/Adr breast carcinoma cells.

    Science.gov (United States)

    Budworth, J; Gant, T W; Gescher, A

    1997-01-01

    The aim of this study was to investigate the link between protein kinase C (PKC) and multidrug resistance (mdr) phenotype. The expression of both was studied in doxorubicin-resistant MCF-7/Adr cells as they reverted to the wild-type phenotype when cultured in the absence of drug. The following parameters were measured in cells 4, 10, 15, 20 and 24 weeks after removal of doxorubicin; (1) sensitivity of the cells towards doxorubicin; (2) levels of P-glycoprotein (P-gp) and MDR1 mRNA; (3) levels and cellular localization of PKC isoenzyme proteins alpha, theta and epsilon; and (4) gene copy number of PKC-alpha and MDR1 genes. Cells lost their resistance gradually with time, so that by week 24 they had almost completely regained the drug sensitivity seen in wild-type MCF-7 cells. P-gp levels measured by Western blot mirrored the change in doxorubicin sensitivity. By week 20, P-gp had decreased to 18% of P-gp protein levels at the outset, and P-gp was not detectable at week 24. Similarly, MDR1 mRNA levels had disappeared by week 24. MCF-7/Adr cells expressed more PKCs-alpha and -theta than wild-type cells and possessed a different cellular localization of PKC-epsilon. The expression and distribution pattern of these PKCs did not change for up to 20 weeks, but reverted back to that seen in wild-type cells by week 24. MDR1 gene amplification remained unchanged until week 20, but then was lost precipitously between weeks 20 and 24. The PKC-alpha gene was not amplified in MCF-7/Adr cells. The results suggest that MCF-7/Adr cells lose MDR1 gene expression and PKC activity in a co-ordinate fashion, consistent with the existence of a mechanistic link between MDR1 and certain PKC isoenzymes.

  16. Phenotypic and Genotypic Resistance of Salmonella Isolates from Healthy and Diseased Pigs in China During 2008-2015.

    Science.gov (United States)

    Jiu, Yueguang; Zhu, Shun; Khan, Sher Bahadar; Sun, Mengzhen; Zou, Geng; Meng, Xianrong; Wu, Bin; Zhou, Rui; Li, Shaowen

    2017-07-01

    The antimicrobial resistance of Salmonella strains is rapidly increasing worldwide, which poses significant threats to animal and public health. In this study, a total of 249 porcine Salmonella isolates collected in China during 2008-2015 were examined, including 155 clinical isolates from diseased pigs and 94 nonclinical isolates from healthy pigs. Based on the minimum inhibitory concentration of seven antimicrobial agents, 96.4% of the isolates were resistant to at least one of the tested antibiotics and 81.0% of them showed multidrug resistance. The highest antimicrobial resistance was observed for tetracycline (85.9%), and the lowest was found for cefotaxime (13.3%). The isolates from diseased pigs exhibited significantly higher levels of antimicrobial resistance than those from healthy pigs. Twenty-two isolates from healthy pigs were resistant to ciprofloxacin, which may inhibit the curative effectiveness of fluoroquinolones on bacterial food-borne poisoning and infections in humans caused by contaminated food. Moreover, cefotaxime resistance of the strains isolated from diseased pigs during 2013-2015 was significantly higher compared with the strains isolated during 2008-2010. Further study showed that the correlation between phenotypic and genotypic resistance varied among the isolates from different sources, and in many cases, the presence of resistance genes was not consistent with the resistance to the corresponding antimicrobials. These results are very significant for veterinary practice and public health.

  17. The Burden of Drug-Resistant Tuberculosis in Papua New Guinea: Results of a Large Population-Based Survey.

    Directory of Open Access Journals (Sweden)

    Paul Aia

    Full Text Available Reliable estimates of the burden of multidrug-resistant tuberculosis (MDR-TB are crucial for effective control and prevention of tuberculosis (TB. Papua New Guinea (PNG is a high TB burden country with limited information on the magnitude of the MDR-TB problem.A cross-sectional study was conducted in four PNG provinces: Madang, Morobe, National Capital District and Western Province. Patient sputum samples were tested for rifampicin resistance by the Xpert MTB/RIF assay and those showing the presence of resistance underwent phenotypic susceptibility testing to first- and second-line anti-TB drugs including streptomycin, isoniazid, rifampicin, ethambutol, pyrazinamide, ofloxacin, amikacin, kanamycin and capreomycin.Among 1,182 TB patients enrolled in the study, MDR-TB was detected in 20 new (2.7%; 95% confidence intervals [CI] 1.1-4.3% and 24 previously treated (19.1%; 95%CI: 8.5-29.8% TB cases. No case of extensively drug-resistant TB (XDR-TB was detected. Thirty percent (6/20 of new and 33.3% (8/24 of previously treated cases with MDR-TB were detected in a single cluster in Western Province.In PNG the proportion of MDR-TB in new cases is slightly lower than the regional average of 4.4% (95%CI: 2.6-6.3%. A large proportion of MDR-TB cases were identified from a single hospital in Western Province, suggesting that the prevalence of MDR-TB across the country is heterogeneous. Future surveys should further explore this finding. The survey also helped strengthening the use of smear microscopy and Xpert MTB/RIF testing as diagnostic tools for TB in the country.

  18. Isolation and in vitro evaluation of bacteriophages against MDR-bacterial isolates from septic wound infections.

    Directory of Open Access Journals (Sweden)

    Roja Rani Pallavali

    Full Text Available Multi-drug resistance has become a major problem for the treatment of pathogenic bacterial infections. The use of bacteriophages is an attractive approach to overcome the problem of drug resistance in several pathogens that cause fatal diseases. Our study aimed to isolate multi drug resistant bacteria from patients with septic wounds and then isolate and apply bacteriophages in vitro as alternative therapeutic agents. Pus samples were aseptically collected from Rajiv Gandhi Institute of Medical Science (RIMS, Kadapa, A.P., and samples were analyzed by gram staining, evaluating morphological characteristics, and biochemical methods. MDR-bacterial strains were collected using the Kirby-Bauer disk diffusion method against a variety of antibiotics. Bacteriophages were collected and tested in vitro for lytic activity against MDR-bacterial isolates. Analysis of the pus swab samples revealed that the most of the isolates detected had Pseudomonas aeruginosa as the predominant bacterium, followed by Staphylococcus aureus, Klebsiella pneumoniae and Escherichia coli. Our results suggested that gram-negative bacteria were more predominant than gram-positive bacteria in septic wounds; most of these isolates were resistant to ampicillin, amoxicillin, penicillin, vancomycin and tetracycline. All the gram-positive isolates (100% were multi-drug resistant, whereas 86% of the gram-negative isolates had a drug resistant nature. Further bacteriophages isolated from sewage demonstrated perfect lytic activity against the multi-drug resistant bacteria causing septic wounds. In vitro analysis of the isolated bacteriophages demonstrated perfect lysis against the corresponding MDR-bacteria, and these isolated phages may be promising as a first choice for prophylaxis against wound sepsis, Moreover, phage therapy does not enhance multi-drug resistance in bacteria and could work simultaneously on a wide variety of MDR-bacteria when used in a bacteriophage cocktail. Hence

  19. Modeling the effects of space structure and combination therapies on phenotypic heterogeneity and drug resistance in solid tumors.

    Science.gov (United States)

    Lorz, Alexander; Lorenzi, Tommaso; Clairambault, Jean; Escargueil, Alexandre; Perthame, Benoît

    2015-01-01

    Histopathological evidence supports the idea that the emergence of phenotypic heterogeneity and resistance to cytotoxic drugs can be considered as a process of selection in tumor cell populations. In this framework, can we explain intra-tumor heterogeneity in terms of selection driven by the local cell environment? Can we overcome the emergence of resistance and favor the eradication of cancer cells by using combination therapies? Bearing these questions in mind, we develop a model describing cell dynamics inside a tumor spheroid under the effects of cytotoxic and cytostatic drugs. Cancer cells are assumed to be structured as a population by two real variables standing for space position and the expression level of a phenotype of resistance to cytotoxic drugs. The model takes explicitly into account the dynamics of resources and anticancer drugs as well as their interactions with the cell population under treatment. We analyze the effects of space structure and combination therapies on phenotypic heterogeneity and chemotherapeutic resistance. Furthermore, we study the efficacy of combined therapy protocols based on constant infusion and bang-bang delivery of cytotoxic and cytostatic drugs.

  20. Phenotypic and genotypic anti-microbial resistance profiles of campylobacters from untreated feedlot cattle and their environment.

    Science.gov (United States)

    Minihan, D; Whyte, P; O'mahony, M; Cowley, D; O'halloran, F; Corcoran, D; Fanning, S; Collins, J D

    2006-05-01

    Anti-microbial resistance is an emerging public health issue. Farmed animals may act as reservoirs and potential sources of anti-microbial resistant Campylobacters. The aim of this study was to investigate the anti-microbial resistance profile of cattle and environmental Campylobacter isolates from normal untreated feedlot cattle, the role of the gyrA Thr-86-Ile mutation in ciprofloxacin-resistant Campylobacter jejuni isolates and the involvement of the tripartite CmeABC efflux system for multi-resistant C. jejuni isolates. The phenotypic anti-microbial resistance testing was carried out on 500 Campylobacter isolates (445 cattle isolates and 55 environmental isolates). In general, there was a higher level of anti-microbial resistance for the environmental isolates compared with the animal isolates, 45% of the animal isolates were resistant to one or more of the seven anti-microbials compared with 84% of the environmental isolates. The combined cattle and environmental Campylobacters had 34 (6.8%) isolates resistant to three or more of the seven anti-microbials tested on all isolates and 11 (2.2%) isolates were resistant to the seven anti-microbials. There was a substantial level of ciprofloxacin-resistant Campylobacters in both animal (8.5%) and environmental (21.8%) isolates. The gyrA Thr-86-Ile mutation was only present in five of 22 ciprofloxacin-resistant C. jejuni isolates investigated. No multi-drug-resistant associated mutation was detected in the CmeB or the CmeR regions investigated. In conclusion, our study observed a substantial level of Campylobacter anti-microbial resistance, highlighting the need for an active anti-microbial surveillance program for food animals in Ireland and the importance of the chosen sampling point can have on the findings of such a program.

  1. Ceftolozane/tazobactam for febrile UTI due to multidrug-resistant Pseudomonas aeruginosa in a patient with neurogenic bladder.

    Science.gov (United States)

    Dinh, Aurélien; Davido, Benjamin; Calin, Ruxandra; Paquereau, Julie; Duran, Clara; Bouchand, Frédérique; Phé, Véronique; Chartier-Kastler, Emmanuel; Rottman, Martin; Salomon, Jérôme; Plésiat, Patrick; Potron, Anaïs

    2017-01-01

    Urinary tract infections (UTI) are a major public health problem among spinal cord injury (SCI) patients. They frequently involve multidrug-resistant (MDR) bacteria. Ceftolozane/tazobactam (C/T) is a novel antibiotic combination approved for complicated intra-abdominal and UTI caused by Gram-positive and Gram-negative organisms, including some MDR strains. Little is known about the use of this agent for complicated febrile UTI occurring among SCI patients with neurogenic bladder due to MDR Pseudomonas aeruginosa (PSA). We describe the case of a 35-year-old man with SCI due to multiple sclerosis, with a neurogenic bladder necessitating a bilateral nephrostomy and double J catheter, who developed a febrile UTI due to a MDR PSA, which was susceptible only to amikacin and colistin. Because of this MDR phenotype and the underlying kidney disease, a 1000 mg (1000 mg per 500 mg) dose of C/T was given as monotherapy every 8 h for 7 days, after 3 days of colistin and amikacin. Thanks to this treatment, the patient had a favorable outcome with no clinical signs of UTI or positive urine culture up to 1 month after diagnosis. C/T seems to be an effective and safe therapeutic option for febrile UTI due to MDR PSA in SCI patients with neurogenic bladder, even when administered in monotherapy for 10 days.

  2. Global DNA hypermethylation-associated cancer chemotherapy resistance and its reversion with the demethylating agent hydralazine

    Directory of Open Access Journals (Sweden)

    Benitez-Bribiesca Luis

    2006-08-01

    Full Text Available Abstract Background The development of resistance to cytotoxic chemotherapy continues to be a major obstacle for successful anticancer therapy. It has been shown that cells exposed to toxic concentrations of commonly used cancer chemotherapy agents develop DNA hypermetylation. Hence, demethylating agents could play a role in overcoming drug resistance. Methods MCF-7 cells were rendered adriamycin-resistant by weekly treatment with adriamycin. Wild-type and the resulting MCF-7/Adr cells were analyzed for global DNA methylation. DNA methyltransferase activity and DNA methyltransferase (dnmt gene expression were also determined. MCF-7/Adr cells were then subjected to antisense targeting of dnmt1, -3a, and -b genes and to treatment with the DNA methylation inhibitor hydralazine to investigate whether DNA demethylation restores sensitivity to adriamycin. Results MCF-7/Adr cells exhibited the multi-drug resistant phenotype as demonstrated by adriamycin resistance, mdr1 gene over-expression, decreased intracellular accumulation of adriamycin, and cross-resistance to paclitaxel. The mdr phenotype was accompanied by global DNA hypermetylation, over-expression of dnmt genes, and increased DNA methyltransferase activity as compared with wild-type MCF-7 cells. DNA demethylation through antisense targeting of dnmts or hydralazine restored adriamycin sensitivity of MCF-7/Adr cells to a greater extent than verapamil, a known inhibitor of mdr protein, suggesting that DNA demethylation interferes with the epigenetic reprogramming that participates in the drug-resistant phenotype. Conclusion We provide evidence that DNA hypermethylation is at least partly responsible for development of the multidrug-resistant phenotype in the MCF-7/Adr model and that hydralazine, a known DNA demethylating agent, can revert the resistant phenotype.

  3. Beyond cellular detoxification: a plethora of physiological roles for MDR transporter homologs in plants

    Science.gov (United States)

    Remy, Estelle; Duque, Paula

    2014-01-01

    Higher plants possess a multitude of Multiple Drug Resistance (MDR) transporter homologs that group into three distinct and ubiquitous families—the ATP-Binding Cassette (ABC) superfamily, the Major Facilitator Superfamily (MFS), and the Multidrug And Toxic compound Extrusion (MATE) family. As in other organisms, such as fungi, mammals, and bacteria, MDR transporters make a primary contribution to cellular detoxification processes in plants, mainly through the extrusion of toxic compounds from the cell or their sequestration in the central vacuole. This review aims at summarizing the currently available information on the in vivo roles of MDR transporters in plant systems. Taken together, these data clearly indicate that the biological functions of ABC, MFS, and MATE carriers are not restricted to xenobiotic and metal detoxification. Importantly, the activity of plant MDR transporters also mediates biotic stress resistance and is instrumental in numerous physiological processes essential for optimal plant growth and development, including the regulation of ion homeostasis and polar transport of the phytohormone auxin. PMID:24910617

  4. Dissemination of Multidrug-Resistant, Class I and II Integrons and Molecular Typing of CTX-M-producing Klebsiella pneumoniae.

    Science.gov (United States)

    Akya, Alisha; Elahi, Azam; Chegenelorestani, Roya; Rezaee, Mahya

    2018-01-01

    Klebsiella pneumoniae ( K. pneumoniae ) is an important opportunistic pathogen causes serious community and hospital-acquired infections, which is highly resistant to antibiotics. We aimed to determine the frequency of multidrug resistant (MDR) and molecular typing of clinical isolates of K. pneumoniae . One hundred isolates of K. pneumoniae were collected from clinical samples in three general hospitals in Kermanshah. The antimicrobial susceptibility and extended-spectrum beta-lactamases (ESBL) production of isolates were determined using disk diffusion and combined disk methods, respectively. The bla CTX-M gene, class I and II integrons were detected using polymerase chain reaction. The bla CTX-M positive isolates were selected for genotyping using pulsed-field gel electrophoresis (PFGE). MDR phenotype was observed in 56% of isolates. The 40% of isolates were ESBL positive and 35 isolates contained bla CTX-M . Class I and II of integrons were detected in 50 (89.2%) and 39 (69.6%) of MDR isolates, respectively. PFGE patterns of K. pneumoniae bla CTX-M positive isolates indicated 19 clusters (X 1-19 ) with different genotype patterns. The study findings highlight the concern of circulating MDR strains of K. pneumoniae with bla CTX-M and class I and II integrons in Kermanshah hospitals. The presence of integrons among isolates may facilitate the spread of new resistance genes in this bacterium. Therefore, surveillance for the spread of MDR strains of this bacterium is recommended in hospitals.

  5. Breed distribution of the nt230(del4) MDR1 mutation in dogs.

    Science.gov (United States)

    Gramer, Irina; Leidolf, Regina; Döring, Barbara; Klintzsch, Stefanie; Krämer, Eva-Maria; Yalcin, Ebru; Petzinger, Ernst; Geyer, Joachim

    2011-07-01

    A 4-bp deletion mutation associated with multiple drug sensitivity exists in the canine multidrug resistance (MDR1) gene. This mutation has been detected in more than 10 purebred dog breeds as well as in mixed breed dogs. To evaluate the breed distribution of this mutation in Germany, 7378 dogs were screened, including 6999 purebred and 379 mixed breed dogs. The study included dog breeds that show close genetic relationship or share breeding history with one of the predisposed breeds but in which the occurrence of the MDR1 mutation has not been reported. The breeds comprised Bearded Collies, Anatolian Shepherd Dog, Greyhound, Belgian Tervuren, Kelpie, Borzoi, Australian Cattle Dog and the Irish Wolfhound. The MDR1 mutation was not detected is any of these breeds, although it was found as expected in the Collie, Longhaired Whippet, Shetland Sheepdog, Miniature Australian Shepherd, Australian Shepherd, Wäller, White Swiss Shepherd, Old English Sheepdog and Border Collie with varying allelic frequencies for the mutant MDR1 allele of 59%, 45%, 30%, 24%, 22%, 17%, 14%, 4% and 1%, respectively. Allelic frequencies of 8% and 2% were determined in herding breed mixes and unclassified mixed breeds, respectively. Because of its widespread breed distribution and occurrence in many mixed breed dogs, it is difficult for veterinarians and dog owners to recognise whether MDR1-related drug sensitivity is relevant for an individual animal. This study provides a comprehensive overview of all affected dog breeds and many dog breeds that are probably unaffected on the basis of ∼15,000 worldwide MDR1 genotyping data. Copyright © 2010 Elsevier Ltd. All rights reserved.

  6. Toward understanding of the role of reversibility of phenotypic switching in the evolution of resistance to therapy

    Science.gov (United States)

    Horvath, D.; Brutovsky, B.

    2018-06-01

    Reversibility of state transitions is intensively studied topic in many scientific disciplines over many years. In cell biology, it plays an important role in epigenetic variation of phenotypes, known as phenotypic plasticity. More interestingly, the cell state reversibility is probably crucial in the adaptation of population phenotypic heterogeneity to environmental fluctuations by evolving bet-hedging strategy, which might confer to cancer cells resistance to therapy. In this article, we propose a formalization of the evolution of highly reversible states in the environments of periodic variability. Two interrelated models of heterogeneous cell populations are proposed and their behavior is studied. The first model captures selection dynamics of the cell clones for the respective levels of phenotypic reversibility. The second model focuses on the interplay between reversibility and drug resistance in the particular case of cancer. Overall, our results show that the threshold dependencies are emergent features of the investigated model with eventual therapeutic relevance. Presented examples demonstrate importance of taking into account cell to cell heterogeneity within a system of clones with different reversibility quantified by appropriately chosen genetic and epigenetic entropy measures.

  7. In vitro susceptibility and resistance phenotypes in contemporary Enterobacter isolates in a university hospital in Crete, Greece.

    Science.gov (United States)

    Maraki, Sofia; Vardakas, Konstantinos Z; Samonis, George; Perdikis, Dimitrios; Mavromanolaki, Viktoria Eirini; Kofteridis, Diamantis P; Falagas, Matthew E

    2017-06-01

    To study the evolution in the susceptibility of Enterobacter spp. in Crete, Greece from 2010 to 2015. Non-duplicate isolates were studied using automated systems. Phenotypic confirmatory tests were applied. A total of 939 Enterobacter isolates were included. Colistin was the most active antibiotic (97.9%) followed by imipenem (96.1%), gentamicin (95.7%), tigecycline (91.8%), cefepime (89.4%), chloramphenicol (85.8%), fosfomycin (85.5%), trimethoprim/sulfamethoxazole (83.3%) and piperacillin/tazobactam (73.3%). Antibiotic resistance did not increase during the study period for most antibiotics. Lower susceptibility was observed among multidrug-resistant strains and carbapenem-nonsusceptible isolates. AmpC was the most common resistant mechanism (21%); carbapenemases (3.7%) and aminoglycoside-modifying enzymes (6.5%) were also detected. A significant proportion of Enterobacter spp. was resistant to several antibiotics, most notably β-lactams.

  8. Mutation in the Sodium Channel Gene Corresponds With Phenotypic Resistance of Rhipicephalus sanguineus sensu lato (Acari: Ixodidae) to Pyrethroids.

    Science.gov (United States)

    Klafke, G M; Miller, R J; Tidwell, J; Barreto, R; Guerrero, F D; Kaufman, P E; Pérez de León, A A

    2017-11-07

    The brown dog tick, Rhipicephalus sanguineus sensu lato (Latreille), is a cosmopolitan ectoparasite and vector of pathogens that kill humans and animals. Pyrethroids represent a class of synthetic acaricides that have been used intensely to try to control the brown dog tick and mitigate the risk of tick-borne disease transmission. However, acaricide resistance is an emerging problem in the management of the brown dog tick. Understanding the mechanism of resistance to acaricides, including pyrethroids, is important to adapt brown dog tick control strategies. The main objective of this study was to determine if target-site mutations associated with pyrethroid resistance in other pests could be associated with phenotypic resistance detected in a brown dog tick population from Florida. We amplified segment 6 of the domain III of the voltage-sensitive sodium channel protein, using cDNAs synthesized from pyrethroid-susceptible and pyrethroid-resistant tick strains. A single nucleotide point mutation (SNP) identified in a highly conserved region of domain III S6 in the resistant ticks resulted in an amino acid change from phenylalanine to leucine. This mutation is characteristic of resistance phenotypes in other tick species, and is the first report of this mutation in R. sanguineus. Molecular assays based on this knowledge could be developed to diagnose the risk for pyrethroid resistance, and to inform decisions on integrated brown dog tick management practices. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  9. Genotypic and phenotypic characterization of antimicrobial-resistant Escherichia coli from farm-raised diarrheic sika deer in Northeastern China.

    Directory of Open Access Journals (Sweden)

    Rui Li

    Full Text Available In China, overuse and/or abuse of antimicrobials are common in stockbreeding, which possess high risks of antimicrobial-resistant contaminations. The serogroups, major virulence genes, and antimicrobial resistant patterns of the antimicrobial-resistant Escherichia coli (E. coli were investigated in the feces of diarrheic farm-raised sika deer from 50 farms in three Northeastern provinces of China. A total of 220 E. coli isolates were obtained and characterized. Twenty-eight O serogroups were identified from the obtained E. coli isolates with O2, O26, O128, O142 and O154 being dominant. Nearly all the isolates were resistant to at least four of the tested antimicrobials. More than 90% of the E. coli isolates carried at least one of the tested virulence genes. About 85% of the E. coli isolates carried one or more antimicrobial-resistant genes responsible for resistant phenotypes of sulfonamides, streptomycin/spectionomycin or tetracycline. The antimicrobial resistant level and pathogenic group occurrences of the obtained E. coli isolates were higher than that of livestock and wild animals reported in some developed countries. Thus, the fecal-carrying antimicrobial-resistant E. coli from the farm-raised sika deer is potentially a significant contamination source for freshwater systems and food chain, and may pose great health risks for human and animals in Northeastern China.

  10. [Changes of resistant phenotype and CRISPR/Cas system of four Shigella strains passaged for 90 times without antibiotics].

    Science.gov (United States)

    Zhang, B; Hong, L J; Duan, G C; Liang, W J; Yang, H Y; Xi, Y L

    2017-02-10

    Objective: To explore the stability of resistant phenotypes and changes of clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) gene system on four Shigella strains in the absence of antibiotics. Methods: Four clinical isolated Shigella strains that resistant to different antibiotics were consecutive passaged for 90 times without antibiotics. Agar dilution method was used to determine the minimum inhibitory concentration of Shigella strains. After sequence analysis with PCR, CRISPR Finder and Clustal X 2.1 were applied to identify the changes of CRISPR loci in the Shigella strains. Results: After the consecutive transfer of 90 generations, sensitivity to certain antibiotics of four Shigella strains with different drug resistant spectrums increased. Mel-sf1998024/zz resistance to ampicillin, cephalexin, cefotaxime, chloramphenicol decreased, mel-s2014026/sx resistance to norfloxacin, trimethoprim decreased, mel-sf2004004/sx drug resistance to ampicillin, cefuroxime, cefotaxime, chloramphenicol, trimethoprim decreased and mel-sf2013004/bj resistance to chloramphenicol decreased. The spacer of which matched gene codes Cas and its upstream repeat in 3'end of CRISPR3 got lost in mel-sf1998024/zz and mel-sf2013004/bj. Conclusions: Shigella strains could reduce or lose their resistance to some antibiotics after consecutive transfers, without the interference of antibiotics. CRISPR3 locus had dynamic spacers in Shigella strains while CRISPR3 locus and cas genes might have been co-evolved.

  11. Treatment outcomes of MDR-tuberculosis patients in Brazil: a retrospective cohort analysis

    Directory of Open Access Journals (Sweden)

    Mayara Lisboa Bastos

    2017-11-01

    Full Text Available Abstract Background Multidrug-resistant tuberculosis (MDR-TB is a threat for the global TB epidemic control. Despite existing evidence that individualized treatment of MDR-TB is superior to standardized regimens, the latter are recommended in Brazil, mainly because drug-susceptibility tests (DST are often restricted to first-line drugs in public laboratories. We compared treatment outcomes of MDR-TB patients using standardized versus individualized regimens in Brazil, a high TB-burden, low resistance setting. Methods The 2007–2013 cohort of the national electronic database (SITE-TB, which records all special treatments including drug-resistance, was analysed. Patients classified as MDR-TB in SITE-TB were eligible. Treatment outcomes were classified as successful (cure/treatment completed or unsuccessful (failure/relapse/death/loss to follow-up. The odds for successful treatment according to type of regimen were controlled for demographic and clinical variables. Results Out of 4029 registered patients, we included 1972 recorded from 2010 to 2012, who had more complete outcome data. The overall success proportion was 60%. Success was more likely in non-HIV patients, sputum-negative at baseline, with unilateral disease and without prior DR-TB. Adjusted for these variables, those receiving standardized regimens had 2.7-fold odds of success compared to those receiving individualized treatments when failure/relapse were considered, and 1.4-fold odds of success when death was included as an unsuccessful outcome. When loss to follow-up was added, no difference between types of treatment was observed. Patients who used levofloxacin instead of ofloxacin had 1.5-fold odds of success. Conclusion In this large cohort of MDR-TB patients with a low proportion of successful outcomes, standardized regimens had superior efficacy than individualized regimens, when adjusted for relevant variables. In addition to the limitations of any retrospective observational

  12. Role of hypoxia-inducible factor-α in hepatitis-B-virus X protein-mediated MDR1 activation

    International Nuclear Information System (INIS)

    Han, Hyo-Kyung; Han, Chang Yeob; Cheon, Eun-Pa; Lee, Jaewon; Kang, Keon Wook

    2007-01-01

    The transition from chemotherapy-responsive cancer cells to chemotherapy-resistant cancer cells is mainly accompanied by the increased expression of multi-drug resistance 1 (MDR1). We found that hepatitis-B-virus X protein (HBx) increases the transcriptional activity and protein level of MDR1 in a hepatoma cell line, H4IIE. In addition, HBx overexpression made H4IIE cells more resistant to verapamil-uptake. HBx stabilized hypoxia-inducible factor-1α (HIF-1α) and induced the nuclear translocation of C/EBPβ. Reporter gene analyses showed that HBx increased the reporter activity in the cells transfected with the reporter containing MDR1 gene promoter. Moreover, the luciferase reporter gene activity was significantly inhibited by HIF-1α siRNA but not by overexpression of C/EBP dominant negative mutant. These results imply that HBx increases the MDR1 transporter activity through the transcriptional activation of the MDR1 gene with HIF-1α activation, and suggest HIF-1α for the therapeutic target of HBV-mediated chemoresistance

  13. Expression of the MDR1 gene and P-glycoprotein in canine mast cell tumor cell lines

    OpenAIRE

    NAKAICHI, Munekazu; TAKESHITA, Yoko; OKUDA, Masaru; NAKAMOTO, Yuya; ITAMOTO, Kazuhito; UNE, Satoshi; SASAKI, Nobuo; KADOSAWA, Tsuyoshi; TAKAHASHI, Tomoko; TAURA, Yasuho

    2007-01-01

    Cellular drug resistance to antineoplastic drugs is often due to the presence of a drug efflux pump that reduces intracellular drug accumulation and chemosensitivity. P-glycoprotein (P-gp), which is encoded by the MDR1 gene, is considered to function as an ATP-driven membrane drug efflux pump and appears to play an important role in tumor cell resistance. In the present report, we assessed the expression of MDR1 by RT-PCR in three canine mast cell tumor cell lines, TiMC, CoMS and LuMC, origin...

  14. Ecdysteroids Sensitize MDR and Non-MDR Cancer Cell Lines to Doxorubicin, Paclitaxel, and Vincristine but Tend to Protect Them from Cisplatin

    Directory of Open Access Journals (Sweden)

    Ana Martins

    2015-01-01

    Full Text Available Ecdysteroids, analogs of the insect molting hormone, are known for their various mild, nonhormonal bioactivities in mammals. Previously, we reported that less-polar ecdysteroids can modulate the doxorubicin resistance of a multidrug resistant (MDR mouse lymphoma cell line expressing the human ABCB1 transporter. Here, we describe the ability of 20-hydroxyecdysone (1 and its mono- (2 and diacetonide (3 derivatives to sensitize various MDR and non-MDR cancer cell lines towards doxorubicin, paclitaxel, vincristine, or cisplatin. Drug IC50 values with or without ecdysteroid were determined by MTT assay. Compound 3 significantly sensitized all cell lines to each chemotherapeutic except for cisplatin, whose activity was decreased. In order to overcome solubility and stability issues for the future in vivo administration of compound 3, liposomal formulations were developed. By means of their combination index values obtained via checkerboard microplate method, a formulation showed superior activity to that of compound 3 alone. Because ecdysteroids act also on non-ABCB1 expressing (sensitive cell lines, our results demonstrate that they do not or not exclusively exert their adjuvant anticancer activity as ABCB1 inhibitors, but other mechanisms must be involved, and they opened the way towards their in vivo bioactivity testing against various cancer xenografts.

  15. Molecular characterization of multidrug-resistant Mycobacterium tuberculosis isolated in Nepal.

    Science.gov (United States)

    Poudel, Ajay; Nakajima, Chie; Fukushima, Yukari; Suzuki, Haruka; Pandey, Basu Dev; Maharjan, Bhagwan; Suzuki, Yasuhiko

    2012-06-01

    Despite the fact that Nepal is one of the first countries globally to introduce multidrug-resistant tuberculosis (MDR-TB) case management, the number of MDR-TB cases is continuing to rise in Nepal. Rapid molecular tests applicable in this setting to identify resistant organisms would be an effective tool in reversing this trend. To develop such tools, information about the frequency and distribution of mutations that are associated with phenotypic drug resistance in Mycobacterium tuberculosis is required. In the present study, we investigated the prevalence of mutations in rpoB and katG genes and the inhA promoter region in 158 M. tuberculosis isolates (109 phenotypically MDR and 49 non-MDR isolates collected in Nepal) by DNA sequencing. Mutations affecting the 81-bp rifampin (RIF) resistance-determining region (RRDR) of rpoB were identified in 106 of 109 (97.3%) RIF-resistant isolates. Codons 531, 526, and 516 were the most commonly affected, at percentages of 58.7, 15.6, and 15.6%, respectively. Of 113 isoniazid (INH)-resistant isolates, 99 (87.6%) had mutations in the katG gene, with Ser315Thr being the most prevalent (81.4%) substitution. Mutations in the inhA promoter region were detected in 14 (12.4%) INH-resistant isolates. The results from this study provide an overview of the current situation of RIF and INH resistance in M. tuberculosis in Nepal and can serve as a basis for developing or improving rapid molecular tests to monitor drug-resistant strains in this country.

  16. Genotypic and Phenotypic Markers of Livestock-Associated Methicillin-Resistant Staphylococcus aureus CC9 in Humans.

    Science.gov (United States)

    Ye, Xiaohua; Wang, Xiaolin; Fan, Yanping; Peng, Yang; Li, Ling; Li, Shunming; Huang, Jingya; Yao, Zhenjiang; Chen, Sidong

    2016-07-01

    Use of antimicrobials in industrial food animal production is associated with the presence of multidrug-resistant Staphylococcus aureus among animals and humans. The livestock-associated (LA) methicillin-resistant S. aureus (MRSA) clonal complex 9 (CC9) is associated with animals and related workers in Asia. This study aimed to explore the genotypic and phenotypic markers of LA-MRSA CC9 in humans. We conducted a cross-sectional study of livestock workers and controls in Guangdong, China. The study participants responded to a questionnaire and provided a nasal swab for S. aureus analysis. The resulting isolates were assessed for antibiotic susceptibility, multilocus sequence type, and immune evasion cluster (IEC) genes. Livestock workers had significantly higher rates of S. aureus CC9 (odds ratio [OR] = 30.98; 95% confidence interval [CI], 4.06 to 236.39) and tetracycline-resistant S. aureus (OR = 3.26; 95% CI, 2.12 to 5.00) carriage than controls. All 19 S. aureus CC9 isolates from livestock workers were MRSA isolates and also exhibited the characteristics of resistance to several classes of antibiotics and absence of the IEC genes. Notably, the interaction analyses indicated phenotype-phenotype (OR = 525.7; 95% CI, 60.0 to 4,602.1) and gene-environment (OR = 232.3; 95% CI, 28.7 to 1,876.7) interactions associated with increased risk for livestock-associated S. aureus CC9 carriage. These findings suggest that livestock-associated S. aureus and MRSA (CC9, IEC negative, and tetracycline resistant) in humans are associated with occupational livestock contact, raising questions about the potential for occupational exposure to opportunistic S. aureus This study adds to existing knowledge by giving insight into the genotypic and phenotypic markers of LA-MRSA. Our findings suggest that livestock-associated S. aureus and MRSA (CC9, IEC negative, and tetracycline resistant) in humans are associated with occupational livestock contact. Future studies should direct more

  17. Antibacterial and antibiotic-potentiation activities of the methanol extract of some cameroonian spices against Gram-negative multi-drug resistant phenotypes

    Science.gov (United States)

    2012-01-01

    Background The present work was designed to evaluate the antibacterial properties of the methanol extracts of eleven selected Cameroonian spices on multi-drug resistant bacteria (MDR), and their ability to potentiate the effect of some common antibiotics used in therapy. Results The extract of Cinnamomum zeylanicum against Escherichia coli ATCC 8739 and AG100 strains showed the best activities, with the lowest minimal inhibitory concentration (MIC) of 64 μg/ml. The extract of Dorstenia psilurus was the most active when tested in the presence of an efflux pump inhibitor, phenylalanine Arginine-β- Naphtylamide (PAβN), a synergistic effect being observed in 56.25 % of the tested bacteria when it was combined with Erythromycin (ERY). Conclusion The present work evidently provides information on the role of some Cameroonian spices in the fight against multi-resistant bacteria. PMID:22709668

  18. Antibacterial and antibiotic-potentiation activities of the methanol extract of some cameroonian spices against Gram-negative multi-drug resistant phenotypes

    Directory of Open Access Journals (Sweden)

    Voukeng Igor K

    2012-06-01

    Full Text Available Abstract Background The present work was designed to evaluate the antibacterial properties of the methanol extracts of eleven selected Cameroonian spices on multi-drug resistant bacteria (MDR, and their ability to potentiate the effect of some common antibiotics used in therapy. Results The extract of Cinnamomum zeylanicum against Escherichia coli ATCC 8739 and AG100 strains showed the best activities, with the lowest minimal inhibitory concentration (MIC of 64 μg/ml. The extract of Dorstenia psilurus was the most active when tested in the presence of an efflux pump inhibitor, phenylalanine Arginine-β- Naphtylamide (PAβN, a synergistic effect being observed in 56.25 % of the tested bacteria when it was combined with Erythromycin (ERY. Conclusion The present work evidently provides information on the role of some Cameroonian spices in the fight against multi-resistant bacteria.

  19. Carbapenem-resistant and cephalosporin-susceptible: a worrisome phenotype among Pseudomonas aeruginosa clinical isolates in Brazil.

    Science.gov (United States)

    Campana, Eloiza Helena; Xavier, Danilo Elias; Petrolini, Fernanda Villas-Boas; Cordeiro-Moura, Jhonatha Rodrigo; Araujo, Maria Rita Elmor de; Gales, Ana Cristina

    The mechanisms involved in the uncommon resistance phenotype, carbapenem resistance and broad-spectrum cephalosporin susceptibility, were investigated in 25 Pseudomonas aeruginosa clinical isolates that exhibited this phenotype, which were recovered from three different hospitals located in São Paulo, Brazil. The antimicrobial susceptibility profile was determined by CLSI broth microdilution. β-lactamase-encoding genes were investigated by PCR followed by DNA sequencing. Carbapenem hydrolysis activity was investigated by spectrophotometer and MALDI-TOF assays. The mRNA transcription level of oprD was assessed by qRT-PCR and the outer membrane proteins profile was evaluated by SDS-PAGE. Genetic relationship among P. aeruginosa isolates was assessed by PFGE. Carbapenems hydrolysis was not detected by carbapenemase assay in the carbapenem-resistant and cephalosporin-susceptible P. aueruginosa clinical isolates. OprD decreased expression was observed in all P. aeruginosa isolates by qRT-PCR. The outer membrane protein profile by SDS-PAGE suggested a change in the expression of the 46kDa porin that could correspond to OprD porin. The isolates were clustered into 17 genotypes without predominance of a specific PFGE pattern. These results emphasize the involvement of multiple chromosomal mechanisms in carbapenem-resistance among clinical isolates of P. aeruginosa, alert for adaptation of P. aeruginosa clinical isolates under antimicrobial selective pressure and make aware of the emergence of an uncommon phenotype among P. aeruginosa clinical isolates. Copyright © 2016 Sociedade Brasileira de Infectologia. Published by Elsevier Editora Ltda. All rights reserved.

  20. Genotypic characterization of multi-drug-resistant Mycobacterium tuberculosis isolates in Myanmar.

    Science.gov (United States)

    Aye, Khin Saw; Nakajima, Chie; Yamaguchi, Tomoyuki; Win, Min Min; Shwe, Mu Mu; Win, Aye Aye; Lwin, Thandar; Nyunt, Wint Wint; Ti, Ti; Suzuki, Yasuhiko

    2016-03-01

    The number of multi-drug-resistant tuberculosis (MDR-TB) cases is rising worldwide. As a countermeasure against this situation, the implementation of rapid molecular tests to identify MDR-TB would be effective. To develop such tests, information on the frequency and distribution of mutations associating with phenotypic drug resistance in Mycobacterium tuberculosis is required in each country. During 2010, the common mutations in the rpoB, katG and inhA of 178 phenotypically MDR M. tuberculosis isolates collected by the National Tuberculosis Control Program (NTP) in Myanmar were investigated by DNA sequencing. Mutations affecting the 81-bp rifampicin (RIF) resistance-determining region (RRDR) of the rpoB were identified in 127 of 178 isolates (71.3%). Two of the most frequently affected codons were 531 and 526, with percentages of 48.3% and 14.0% respectively. For isoniazid (INH) resistance, 114 of 178 MDR-TB isolates (64.0%) had mutations in the katG in which a mutation-conferring amino acid substitution at codon 315 from Ser to Thr was the most common. Mutations in the inhA regulatory region were also detected in 20 (11.2%) isolates, with the majority at position -15. Distinct mutation rate and pattern from surrounding countries might suggest that MDR-TB has developed and spread domestically in Myanmar. Copyright © 2015 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  1. Oral Fosfomycin for the Treatment of Acute and Chronic Bacterial Prostatitis Caused by Multidrug-Resistant Escherichia coli

    Directory of Open Access Journals (Sweden)

    George G. Zhanel

    2018-01-01

    Full Text Available Acute and chronic bacterial prostatitis in outpatients is commonly treated with oral fluoroquinolones; however, the worldwide dissemination of multidrug-resistant (MDR Escherichia coli has resulted in therapeutic failures with fluoroquinolones. We reviewed the literature regarding the use of oral fosfomycin in the treatment of acute and chronic prostatitis caused by MDR E. coli. All English-language references on PubMed from 1986 to June 2017, inclusive, were reviewed from the search “fosfomycin prostatitis.” Fosfomycin demonstrates potent in vitro activity against a variety of antimicrobial-resistant E. coli genotypes/phenotypes including ciprofloxacin-resistant, trimethoprim-sulfamethoxazole-resistant, extended-spectrum β-lactamase- (ESBL- producing, and MDR isolates. Fosfomycin attains therapeutic concentrations (≥4 μg/g in uninflamed prostatic tissue and maintains a high prostate/plasma ratio up to 17 hours after oral administration. Oral fosfomycin’s clinical cure rates in the treatment of bacterial prostatitis caused by antimicrobial-resistant E. coli ranged from 50 to 77% with microbiological eradication rates of >50%. An oral regimen of fosfomycin tromethamine of 3 g·q 24 h for one week followed by 3 g·q 48 h for a total treatment duration of 6–12 weeks appeared to be effective. Oral fosfomycin may represent an efficacious and safe treatment for acute and chronic prostatitis caused by MDR E. coli.

  2. Phenotypic and genotypic bacterial antimicrobial resistance in liquid pig manure is variously associated with contents of tetracyclines and sulfonamides.

    Science.gov (United States)

    Hölzel, C S; Harms, K S; Küchenhoff, H; Kunz, A; Müller, C; Meyer, K; Schwaiger, K; Bauer, J

    2010-05-01

    Antibiotic residues as well as antibiotic-resistant bacteria in environmental samples might pose a risk to human health. This study aimed to investigate the association between antibiotic residues and bacterial antimicrobial resistance in liquid pig manure used as fertilizer. Concentrations of tetracyclines (TETs) and sulfonamides (SULs) were determined by liquid chromatography-mass spectrometry in 305 pig manure samples; antibiotic contents were correlated to the phenotypic resistance of Escherichia coli (n = 613) and enterococci (n = 564) towards up to 24 antibiotics. In 121 samples, the concentration of the TET resistance genes tet(M), tet(O) and tet(B) was quantified by real-time-PCR. TETs were found in 54% of the samples. The median sum concentration of all investigated TETs in the positive samples was 0.73 mg kg(-1). SULs were found with a similar frequency (51%) and a median sum concentration of 0.15 mg kg(-1) in the positive samples. Associated with the detection of TETs and/or SULs, resistance rates were significantly elevated for several substances - some of them not used in farm animals, e.g. chloramphenicol and synercid. In addition, multiresistant isolates were found more often in samples containing antibiotics. Analysis of the resistance genes tet(M) and tet(O) already showed a significant increase in their concentrations - but not in tet(B) - in the lowest range of total TET concentration. Mean tet(M) concentrations increased by the factor of 4.5 in the TET concentration range of 0.1-1 mg kg(-1), compared to negative manure samples. Antibiotic contamination of manure seems to be associated with a variety of changes in bacterial resistance, calling for a prudent use of antibiotics in farm animals. This study provides an interdisciplinary approach to assess antimicrobial resistance by combining the microbiological analysis of bacterial resistance with high quality chemical analysis of antibiotic residues in a representative number of environmental

  3. Promising therapy of XDR-TB/MDR-TB with thioridazine an inhibitor of bacterial efflux pumps

    DEFF Research Database (Denmark)

    Amaral, L; Martins, M; Viveiros, M

    2008-01-01

    -TB) - a M. tuberculosis organism that is resistant to the most effective second line drugs available for the treatment of TB. This review provides detailed, significant evidence that supports the use of an old neuroleptic compound, thioridazine (TZ), for the management of MDR-TB and XDR-TB infections...... therapy predictably ineffective and death is inevitable, compassionate therapy with TZ should be contemplated. The risks are small and the rewards great....

  4. Phenotypic and genotypic characterization of antibiotic resistance of methicillin-resistant Staphylococcus aureus isolated from hospital food

    Directory of Open Access Journals (Sweden)

    Farhad Safarpoor Dehkordi

    2017-10-01

    Full Text Available Abstract Background Pathogenic biotypes of the Methicillin-resistant Staphylococcus aureus (MRSA strains are considered to be one of the major cause of food-borne diseases in hospitals. The present investigation was done to study the pattern of antibiotic resistance and prevalence of antibiotic resistance genes of different biotypes of the MRSA strains isolated from various types of hospital food samples. Methods Four-hundred and eighty-five raw and cooked hospital food samples were cultured and MRSA strains were identified using the oxacillin and cefoxitin disk diffusion tests and mecA-based PCR amplification. Isolated strains were subjected to biotyping and their antibiotic resistance patterns were analyzed using the disk diffusion and PCR methods. Results Prevalence of S. aureus and MRSA were 9.69 and 7.62%, respectively. Meat and chicken barbecues had the highest prevalence of MRSA. Prevalence of bovine, ovine, poultry and human-based biotypes in the MRSA strains were 8.10, 8.10, 32.43 and 48.64%, respectively. All of the MRSA strains recovered from soup, salad and rice samples were related to human-based biotypes. MRSA strains harbored the highest prevalence of resistance against penicillin (100%, ceftaroline (100%, tetracycline (100%, erythromycin (89.18% and trimethoprim-sulfamethoxazole (83.78%. TetK (72.97%, ermA (72.97%, msrA (64.86% and aacA-D (62.16% were the most commonly detected antibiotic resistance genes. Conclusions Pattern of antibiotic resistance and also distribution of antibiotic resistance genes were related to the biotype of MRSA strains. Presence of multi-drug resistance and also simultaneous presence of several antibiotic resistance genes in some MRSA isolates showed an important public health issue Further researches are required to found additional epidemiological aspects of the MRSA strains in hospital food samples.

  5. MDR1 P-glycoprotein transports endogenous opioid peptides

    NARCIS (Netherlands)

    Oude Elferink, R. P.; Zadina, J.

    2001-01-01

    MDR1 P-glycoprotein is generally regarded as an efflux pump for amphipathic toxic compounds. The question remains, however, whether certain endogenous compounds are also substrates for this transporter. Certain peptides have been shown to interact with MDR1 Pgp as well and we have therefore

  6. EXSPRESSION OF MDR-GENES AND MONORESISTANCE GENES IN NON-SMALL-CELL LUNG CANCER

    Directory of Open Access Journals (Sweden)

    E. L. Yumov

    2014-01-01

    Full Text Available We studied the expression of multidrug resistance genes (MDR and monoresistance genes in normal bronchial tissue and tumor tissue of the non-small cell lung cancer (NSCLC after neoadjuvant chemotherapy (NACT (vinorelbine-carboplatine. The study included 30 patients with NSCLC (Т2–4N0–3M0. Normal bronchial tissue, normal lung tissue and tumor tissue collected during surgery following neoadjuvant chemotherapy (NACT served as a material of the study. The expression levels of MDR genes (ABCB1, ABCB2, ABCC1, ABCC2, ABCС5, ABCG1, ABCG2, GSTP and MVP, and monoresistance genes (BRCA1, ERCC1, RRM1, TOP1, TOP2A, TUBB3 and TYMS were estimated by quantitative reverse transcriptase PCR (RT-qPCR. The expression levels of some MDR genes and monoresistance genes (АВСВ1, АВСВ2, ABCG1, ERCC1, GSTP1 and MVP were significantly higher in the bronchi than in tumor tissue. The expression of ABCG1, ABCG2 and ERCC1 genes was higher in patients with T1-2 cancer than in patients with T3-4 cancer. Patients with adenocarcinoma had higher expression of BRCA1, MVP and ABCB1 genes than patients with squamous cell lung cancer. A tendency towards reduction in the expression level of MDR-genes and monoresistance genes was observed in patients with partial tumor regression compared to that observed in patients with stable disease. These findings were consistent with the previous data on reduction in the MDR-gene expression after chemotherapy with a good response in breast cancer patients.

  7. HIV-1 integrase inhibitors are substrates for the multidrug transporter MDR1-P-glycoprotein

    Directory of Open Access Journals (Sweden)

    Cara Andrea

    2007-03-01

    Full Text Available Abstract Background The discovery of diketoacid-containing derivatives as inhibitors of HIV-1 Integrase (IN (IN inhibitors, IINs has played a major role in validating this enzyme as an important target for antiretroviral therapy. Since the in vivo efficacy depends on access of these drugs to intracellular sites where HIV-1 replicates, we determined whether the IINs are recognized by the multidrug transporter MDR1-P-glycoprotein (P-gp thereby reducing their intracellular accumulation. To address the effect of IINs on drug transport, nine quinolonyl diketo acid (DKA derivatives active on the HIV-1 IN strand transfer (ST step and with EC50 ranging from 1.83 to >50 μm in cell-based assays were tested for their in vitro interaction with P-gp in the CEM-MDR cell system. IINs were investigated for the inhibition and induction of the P-gp function and expression as well as for multidrug resistance (MDR reversing ability. Results The HIV-1 IINs act as genuine P-gp substrates by inhibiting doxorubicin efflux and inducing P-gp functional conformation changes as evaluated by the modulation of UIC2 mAb epitope. Further, IINs chemosensitize MDR cells to vinblastine and induce P-gp expression in drug sensitive revertants of CEM-MDR cells. Conclusion To our knowledge, this is the first demonstration that HIV-1 IINs are P-gp substrates. This biological property may influence the absorption, distribution and elimination of these novels anti HIV-1 compounds.

  8. Presence of the resistance genes vanC1 and pbp5 in phenotypically vancomycin and ampicillin susceptible Enterococcus faecalis.

    Science.gov (United States)

    Schwaiger, Karin; Bauer, Johann; Hörmansdorfer, Stefan; Mölle, Gabriele; Preikschat, Petra; Kämpf, Peter; Bauer-Unkauf, Ilse; Bischoff, Meike; Hölzel, Christina

    2012-08-01

    Ampicillin and vancomycin are important antibiotics for the therapy of Enterococcus faecalis infections. The ampicillin resistance gene pbp5 is intrinsic in Enterococcus faecium. The vanC1 gene confers resistance to vancomycin and serves as a species marker for Enterococcus gallinarum. Both genes are chromosomally located. Resistance to ampicillin and vancomycin was determined in 484 E. faecalis of human and porcine origin by microdilution. Since E. faecalis are highly skilled to acquire resistance genes, all strains were investigated for the presence of pbp5 (and, in positive strains, for the penicillin-binding protein synthesis repressor gene psr) and vanC1 (and, in positive strains, for vanXYc and vanT) by using polymerase chain reaction (PCR). One porcine and one human isolate were phenotypically resistant to ampicillin; no strain was vancomycin resistant. Four E. faecalis (3/1 of porcine/human origin) carried pbp5 (MIC=1 mg/L), and four porcine strains were vanC1 positive (minimum inhibitory concentration [MIC]=1 mg/L). Real-time reverse transcriptase (RT)-PCR revealed that the genes were not expressed. The psr gene was absent in the four pbp5-positive strains; the vanXYc gene was absent in the four vanC1-positive strains. However, vanT of the vanC gene cluster was detected in two vanC1-positive strains. To our knowledge, this is the first report on the presence of pbp5, identical with the "E. faecium pbp5 gene," and of vanC1/vanT in E. faecalis. Even if resistance is not expressed in these strains, this study shows that E. faecalis have a strong ability to acquire resistance genes-and potentially to spread them to other bacteria. Therefore, close monitoring of this species should be continued.

  9. Long-term effects of inducible mutagenic DNA repair on relative fitness and phenotypic diversification in Pseudomonas cichorii 302959.

    Science.gov (United States)

    Weigand, Michael R; Sundin, George W

    2009-01-01

    Mutagenic DNA repair (MDR) employs low-fidelity DNA polymerases capable of replicating past DNA lesions resulting from exposure to high-energy ultraviolet radiation (UVR). MDR confers UVR tolerance and activation initiates a transient mutator phenotype that may provide opportunities for adaptation. To investigate the potential role of MDR in adaptation, we have propagated parallel lineages of the highly mutable epiphytic plant pathogen Pseudomonas cichorii 302959 with daily UVR activation (UVR lineages) for approximately 500 generations. Here we examine those lineages through the measurement of relative fitness and observation of distinct colony morphotypes that emerged. Isolates and population samples from UVR lineages displayed gains in fitness relative to the ancestor despite increased rates of inducible mutation to rifampicin resistance. Regular activation of MDR resulted in the maintenance of genetic diversity within UVR lineages, including the reproducible diversification and coexistence of "round" and "fuzzy" colony morphotypes. These results suggest that inducible mutability may present a reasonable strategy for adaptive evolution in stressful environments by contributing to gains in relative fitness and diversification.

  10. Adaptive Laboratory Evolution of Antibiotic Resistance Using Different Selection Regimes Lead to Similar Phenotypes and Genotypes

    DEFF Research Database (Denmark)

    Jahn, Leonie Johanna; Munck, Christian; Ellabaan, Mostafa M Hashim

    2017-01-01

    independently of the selection regime. Yet, lineages that underwent evolution under mild selection displayed a growth advantage independently of the acquired level of antibiotic resistance compared to lineages adapted under maximal selection in a drug gradient. Our data suggests that even though different......Antibiotic resistance is a global threat to human health, wherefore it is crucial to study the mechanisms of antibiotic resistance as well as its emergence and dissemination. One way to analyze the acquisition of de novo mutations conferring antibiotic resistance is adaptive laboratory evolution....... However, various evolution methods exist that utilize different population sizes, selection strengths, and bottlenecks. While evolution in increasing drug gradients guarantees high-level antibiotic resistance promising to identify the most potent resistance conferring mutations, other selection regimes...

  11. Phenotypic and genotypic antimicrobial resistance and virulence genes of Salmonella enterica isolated from pet dogs and cats

    Science.gov (United States)

    Srisanga, Songsak; Angkititrakul, Sunpetch; Sringam, Patcharee; Le Ho, Phuong T.; Vo, An T. T.

    2017-01-01

    Salmonella enterica isolates (n = 122), including 32 serotypes from 113 dogs and 9 cats, were obtained from household dogs (n = 250) and cats (n = 50) during 2012–2015. The isolates were characterized by serotyping, antimicrobial resistance phenotyping and genotyping, and virulence gene screening. Serovars Weltevreden (15.6%) and Typhimurium (13.9%) were the most common. The majority (43%) of the isolates were multidrug resistant. The dog isolates (12.3%) harbored class 1 integrons, of which the dfrA12-aadA2 cassette was most frequent (66.7%). The only class integron in serovar Albany was located on a conjugative plasmid. Two ESBL-producing isolates (i.e., a serovar Krefeld and a serovar Enteritridis) carried blaTEM and blaCTX-M, and the blaTEM gene in both was horizontally transferred. Of the plasmid-mediated quinolone resistance genes tested, only qnrS (4.9%) was detected. Most Salmonella isolates harbored invA (100%), prgH (91.8%), and sipB (91%). Positive associations between resistance and virulence genes were observed for blaPSE-1/orgA, cmlA/spaN, tolC, and sul1/tolC (p resistance and virulence genes and that antimicrobial use in companion animals may select for the examined Salmonella virulence factors. PMID:27586467

  12. Phenotypical and Genotypical Antimicrobial Resistance of Coagulase-negative staphylococci Isolated from Cow Mastitis.

    Science.gov (United States)

    Klimiene, I; Virgailis, M; Pavilonis, A; Siugzdiniene, R; Mockeliunas, R; Ruzauskas, M

    2016-09-01

    The objectives of this study were to determine the prevalence and antimicrobial resistance of coagulase-negative staphylococci (CNS) isolated from dairy cows with subclinical mastitis. Antimicrobial resistance in staphylococci were evaluated by breakpoint values specific to the species (EU-CAST). The presence of resistance-encoding genes was detected by multiplex PCR. A total of 191 CNS isolates were obtained. The CNS isolates were typically resistant to penicillin (67.4%), tetracyc-line (18.9%), and erythromycin (13.7%). CNS isolates (78.0%) were resistant to at least one antimicrobial compound, and 22.0% were multiresistant. The multiresistant isolates were predominantly Staphylococcus chromogenes (28.6%), Staphylococcus warneri (19%) and Staphylococcus haemolyticus (14.3%). According to MIC pattern data, multiresistant isolates showed the highest resistance (p<0.05) rates to penicillin (85.7%), tetracycline (66.7%), and erythromycin (48.2%), but all of them were sensitive to daptomycin, oxacillin, qiunupristin/dalfopristin, and vancomycin. S. chromogenes (9.5%), S. haemolyticus (4.8%), and S. capitis ss capitis (2.4%) strains were resistant to methicillin; their resistance to oxacillin and penicillin was more than 8 mg/l. A high rate of resistance to penicillin was linked to a blaZ gene found in 66.6% of the isolated multiresistant CNS strains. Resistance to tetracycline via the tetK (38.1%) gene and penicillin via the mecA (23.8%) gene were detected less frequently. Gene msrAB was responsible for macrolides and lincosamides resistance and detected in 28.6% of the CNS isolates. Antimicrobial resistance genes were identified more frequently in S. epidermidis, S. chromogenes, and S. warneri.

  13. Context matters — the complex interplay between resistome genotypes and resistance phenotypes

    DEFF Research Database (Denmark)

    Dantas, Gautam; Sommer, Morten

    2012-01-01

    Application of metagenomic functional selections to study antibiotic resistance genes is revealing a highly diverse and complex network of genetic exchange between bacterial pathogens and environmental reservoirs, which likely contributes significantly to increasing resistance levels in pathogens...... the resistome genotype, and we highlight examples of genes and their hosts where this distinction becomes important in order to understand the relevance of environmental niches that contribute most to clinical problems associated with antibiotic resistance....

  14. Inhibitory effect of the reversal agents V-104, GF120918 and Pluronic L61 on MDR1 Pgp-, MRP1- and MRP2-mediated transport

    NARCIS (Netherlands)

    Evers, R.; Kool, M.; Smith, A. J.; van Deemter, L.; de Haas, M.; Borst, P.

    2000-01-01

    The human multidrug transporter MDR1 P-glycoprotein and the multidrug resistance proteins MRP1 and MRP2 transport a range of cytotoxic drugs, resulting in multidrug resistance in tumour cells. To overcome this form of drug resistance in patients, several inhibitors (reversal agents) of these

  15. DETERMINATION OF THE SPECTRUM OF ANTIBIOTIC RESISTANCE GENES HAVE PHENOTYPIC RESISTANT STRAINS OF PARIETAL INTESTINAL MICROBIOTA IN RATS BY RT-PCR

    Directory of Open Access Journals (Sweden)

    Bukina Y.V.

    2016-06-01

    Full Text Available Introduction. The problem of formation of bacterial resistance to glycopeptides and beta-lactam antibiotics (cephalosporins and carbapenems are used worldwide for the treatment of severe community acquired and nosocomial infections, especially caused by polymicrobial flora has become global and is a major factor limiting the effectiveness of antibiotic therapy. In this regard, the study of genetic microbial resistance determinants allows not only to carry out an effective antibiotic therapy, but also to identify two main processes leading to the development of epidemiologically significant events: the introduction of the agent in the risk population from the outside and in situ pathogen (spontaneous genetic drift targeted restructuring of the population. Therefore, the aim of our study was to investigate the resistance genes to carbapenems, cephalosporins, glycopeptides have clinically important phenotype of resistant strains of microorganisms families Enterobacteriaceae, Pseudomonadaceae, Bacteroidaceae, Enterococcaceae, Peptostreptococcaceae. Materials and methods. As a material for PCR studies 712 phenotypically resistant strains of microorganisms isolated from 80 rats "Wistar" line in microbiological study microflora of the wall were used. During the investigation 474 isolates of bacteria of the family Enterobacteriaceae, 39 - Pseudomonadaceae, 71 - Bacteroidaceae, 96 - Enterococcaceae, 32 - Peptostreptococcaceae were studied. Isolation of DNA from bacteria in the study was performed using reagents "DNA-Express" ("Litekh", Russia. For the detection of resistance genes by PCR in real time (RT-PCR reagent kits "FLUOROPOL-RV" ("Litekh", Russia were used. During the experiment, the VIM genes, OXA-48, NDM, KPC, responsible for the resistance of microorganisms to carbapenems, CTX-M - resistance to cephalosporins, as well as genes Van A and van B, the development of resistance to glycopeptides (vancomycin and teicoplanin were determined. Analysis

  16. Phenotypic and molecular characterization of antimicrobial resistance in Proteus mirabilis isolates from dogs.

    Science.gov (United States)

    Harada, Kazuki; Niina, Ayaka; Shimizu, Takae; Mukai, Yujiro; Kuwajima, Ken; Miyamoto, Tadashi; Kataoka, Yasushi

    2014-11-01

    Large-scale monitoring of resistance to 14 antimicrobial agents was performed using 103 Proteus mirabilis strains isolated from dogs in Japan. Resistant strains were analysed to identify their resistance mechanisms. Rates of resistance to chloramphenicol, streptomycin, enrofloxacin, trimethoprim/sulfamethoxazole, kanamycin, ampicillin, ciprofloxacin, cephalothin, gentamicin, cefoxitin and cefotaxime were 20.4, 15.5, 12.6, 10.7, 9.7, 8.7, 5.8, 2.9, 2.9, 1.9 and 1.9%, respectively. No resistance to ceftazidime, aztreonam or imipenem was found. Class 1 and 2 integrases were detected in 2.9 and 11.7% of isolates, respectively. Class 1 integrons contained aadB or aadB-catB-like-blaOXA10-aadA1, whereas those of class 2 contained sat-aadA1, dhfr1-sat-aadA1 or none of the anticipated resistance genes. Of five distinct plasmid-mediated quinolone-resistance (PMQR) genes, only qnrD gene was detected in 1.9% of isolates. Quinolone-resistance determining regions (QRDRs) of gyrA and parC from 13 enrofloxacin-intermediate and -resistant isolates were sequenced. Seven strains had double mutations and three had single mutations. Three of nine ampicillin-resistant isolates harboured AmpC-type β-lactamases (i.e. blaCMY-2, blaCMY-4 and blaDHA-1). These results suggest that canine Proteus mirabilis deserves continued surveillance as an important reservoir of antimicrobial resistance determinants. This is the first report, to our knowledge, describing integrons, PMQRs and QRDR mutations in Proteus mirabilis isolates from companion animals. © 2014 The Authors.

  17. Glucocorticoids promote a glioma stem cell-like phenotype and resistance to chemotherapy in human glioblastoma primary cells

    DEFF Research Database (Denmark)

    Kostopoulou, Ourania N; Mohammad, Abdul-Aleem; Bartek, Jiri

    2018-01-01

    Glioma stem cells (GSCs) are glioblastoma (GBM) cells that are resistant to therapy and can give rise to recurrent tumors. The identification of patient-related factors that support GSCs is thus necessary to design effective therapies for GBM patients. Glucocorticoids (GCs) are used to treat GBM......-associated edema. However, glucocorticoids participate in the physiological response to psychosocial stress, which has been linked to poor cancer prognosis. This raises concern that glucocorticoids affect the tumor and GSCs. Here, we treated primary human GBM cells with dexamethasone and evaluated GC......-driven changes in cell morphology, proliferation, migration, gene expression, secretory activity and growth as neurospheres. Dexamethasone treatment of GBM cells appeared to promote the development of a GSC-like phenotype and conferred resistance to physiological stress and chemotherapy. We also analyzed...

  18. Multidrug-resistant Enterobacteriaceae from indoor air of an urban wastewater treatment plant.

    Science.gov (United States)

    Teixeira, Juliana V; Cecílio, Pedro; Gonçalves, Daniela; Vilar, Vítor J P; Pinto, Eugénia; Ferreira, Helena N

    2016-07-01

    Wastewater treatment plants (WWTPs) have been recognized as sources of bioaerosols that may act as vehicles for dissemination of pathogens and multidrug-resistant (MDR) bacteria. The occurrence of MDR Enterobacteriaceae in indoor air of an urban WWTP was investigated. A possible airborne contamination with extended-spectrum beta-lactamase (ESBL) and carbapenemase-producing Enterobacteriaceae was also explored. Fourteen of 39 Enterobacteriaceae isolates were MDR. These isolates were found at all sampling sites, mainly at the secondary sedimentation settings. The highest levels of resistance were detected in three different species: Enterobacter cloacae, Escherichia coli, and Citrobacter freundii. Furthermore, one of the airborne E. coli isolates was phenotypically characterized as an ESBL producer. Additionally, five isolates showed non-susceptibility to at least one carbapenem tested. The presence of genes encoding relevant beta-lactamase types in these ESBL-producing and carbapenem-resistant Enterobacteriaceae isolates was investigated by PCR. Results showed amplification for bla CTX-M and bla OXA. These findings are relevant both in terms of occupational/public health and of environmental dissemination of MDR bacteria.

  19. Phenotypic evidence suggests a possible major-gene element to weevil resistance in Sitka spruce

    Science.gov (United States)

    John N. King; René I. Alfaro; Peter Ott; Lara vanAkker

    2012-01-01

    The weevil resistance breeding program against the white pine weevil, Pissodes strobi Peck (Coleoptera: Curculionidae), particularly for Sitka spruce (Picea sitchensis (Bong.) Carr), is arguably one of the most successful pest resistance breeding programs for plantation forest species, and it has done a lot to rehabilitate...

  20. Multidrug resistance in Lactococcus lactis

    NARCIS (Netherlands)

    Bolhuis, Hendrik

    1996-01-01

    Multidrug resistance (MDR) was initially recongnized as the major cause of the failure of the drug-based treatment of human cancers. It has become increasingly clear that MDR occurs in mammalian cells but also in lower eukaryotes and bacteria. The appearance of multiple antibiotic resistant

  1. Phenotypic and genotypic evaluation of fluoroquinolone resistance in clinical isolates of Staphylococcus aureus in Tehran.

    Science.gov (United States)

    Aligholi, Marzieh; Mirsalehian, Akbar; Halimi, Shahnaz; Imaneini, Hossein; Taherikalani, Morovat; Jabalameli, Fereshteh; Asadollahi, Parisa; Mohajer, Babak; Abdollahi, Alireza; Emaneini, Mohammad

    2011-09-01

    Fluoroquinolones are broad-spectrum antibiotics widely used in the treatment of bacterial infections such as Staphylococcus aureus isolates. Resistance to these antibiotics is increasing. The occurrence of mutations in the grlA and gyrA loci were evaluated in 69 fluoroquinolone-resistant S. aureus isolates from 2 teaching hospitals of Tehran University of Medical Sciences. Out of the 165 S. aureus isolates, 87 (52.7%) were resistant to methicillin and 69 (41.8%) were resistant to fluoroquinolone. Fluoroquinolone-resistant S. aureus isolates had a mutation at codon 80 in the grlA gene and different mutational combinations in the gyrA gene. These mutational combinations included 45 isolates at codons 84 and 86, 23 isolates at codons 84, 86 and 106 and 1 isolate at codons 84, 86 and 90. Fluoroquinolone-resistant S. aureus isolates were clustered into 33 PFGE types. The findings of this study show that the fluoroquinolone-resistant S. aureus strains isolated in the teaching hospitals in Tehran had multiple mutations in the QRDRs region of both grlA and gyrA genes.

  2. Epithelial Plasticity in Castration-Resistant Prostate Cancer: Biology of the Lethal Phenotype

    Science.gov (United States)

    2011-07-01

    647, cytokeratin (AbD Serotec #MCA 1907HT) labeled with Alexa 555, and Vimentin (BD Biosciences, San Jose , CA #550513) labeled with Alexa 488. Nuclear...importance of the transitional phenotypic state to lethal cancer biology. In: Proceedings of the Genitourinary Cancers Symposium; 5–7 March 2010; San ...resulting gene list was used to determine the significantly differentially expressed genes between AT3-M and AT3-T using the "Filtering on Volcano

  3. Extending Injury- and Disease-Resistant CNS Phenotypes by Repetitive Epigenetic Conditioning

    Directory of Open Access Journals (Sweden)

    Jeffrey M. Gidday

    2015-03-01

    Full Text Available Significant reductions in the extent of acute injury in the CNS can be achieved by exposure to different preconditioning stimuli, but the duration of the induced protective phenotype is typically short-lasting, and thus is deemed as limiting its clinical applicability. Extending the period over which such adaptive epigenetic changes persist – in effect, expanding conditioning’s therapeutic window – would significantly broaden the potential applications of such a treatment approach in patients. The frequency of the conditioning stimulus may hold the key. While transient (1-3 days protection against CNS ischemic injury is well established preclinically following a single preconditioning stimulus, repetitively presenting preconditioning stimuli extends the duration of ischemic tolerance by many weeks. Moreover, repetitive intermittent postconditioning enhances postischemic recovery metrics and improves long-term survival. Intermittent conditioning is also efficacious for preventing or delaying injury in preclinical models of chronic neurodegenerative disease, and for promoting long-lasting functional improvements in a number of other pathologies as well. Although the detailed mechanisms underlying these protracted kinds of neuroplasticity remain largely unstudied, accumulating empirical evidence supports the contention that all of these adaptive phenotypes are epigenetically mediated. Going forward, additional preclinical demonstrations of the ability to induce sustained beneficial phenotypes that reduce the burden of acute and chronic neurodegeneration, and experimental interrogations of the regulatory constructs responsible for these epigenetic responses, will accelerate the identification of not only efficacious, but practical, adaptive epigenetics-based treatments for individuals with neurological disease.

  4. TTFields alone and in combination with chemotherapeutic agents effectively reduce the viability of MDR cell sub-lines that over-express ABC transporters

    International Nuclear Information System (INIS)

    Schneiderman, Rosa S; Shmueli, Esther; Kirson, Eilon D; Palti, Yoram

    2010-01-01

    Exposure of cancer cells to chemotherapeutic agents may result in reduced sensitivity to structurally unrelated agents, a phenomenon known as multidrug resistance, MDR. The purpose of this study is to investigate cell growth inhibition of wild type and the corresponding MDR cells by Tumor Treating Fields - TTFields, a new cancer treatment modality that is free of systemic toxicity. The TTFields were applied alone and in combination with paclitaxel and doxorubicin. Three pairs of wild type/MDR cell lines, having resistivity resulting from over-expression of ABC transporters, were studied: a clonal derivative (C11) of parental Chinese hamster ovary AA8 cells and their emetine-resistant sub-line Emt R1 ; human breast cancer cells MCF-7 and their mitoxantrone-resistant sub lines MCF-7/Mx and human breast cancer cells MDA-MB-231 and their doxorubicin resistant MDA-MB-231/Dox cells. TTFields were applied for 72 hours with and without the chemotherapeutic agents. The numbers of viable cells in the treated cultures and the untreated control groups were determined using the XTT assay. Student t-test was applied to asses the significance of the differences between results obtained for each of the three cell pairs. TTFields caused a similar reduction in the number of viable cells of wild type and MDR cells. Treatments by TTFields/drug combinations resulted in a similar increased reduction in cell survival of wild type and MDR cells. TTFields had no effect on intracellular doxorubicin accumulation in both wild type and MDR cells. The results indicate that TTFields alone and in combination with paclitaxel and doxorubicin effectively reduce the viability of both wild type and MDR cell sub-lines and thus can potentially be used as an effective treatment of drug resistant tumors

  5. The Role of Adjunctive Therapies in Septic Shock by Gram Negative MDR/XDR Infections.

    Science.gov (United States)

    Busani, Stefano; Roat, Erika; Serafini, Giulia; Mantovani, Elena; Biagioni, Emanuela; Girardis, Massimo

    2017-01-01

    Patients with septic shock by multidrug resistant microorganisms (MDR) are a specific sepsis population with a high mortality risk. The exposure to an initial inappropriate empiric antibiotic therapy has been considered responsible for the increased mortality, although other factors such as immune-paralysis seem to play a pivotal role. Therefore, beyond conventional early antibiotic therapy and fluid resuscitation, this population may benefit from the use of alternative strategies aimed at supporting the immune system. In this review we present an overview of the relationship between MDR infections and immune response and focus on the rationale and the clinical data available on the possible adjunctive immunotherapies, including blood purification techniques and different pharmacological approaches.

  6. The Role of Adjunctive Therapies in Septic Shock by Gram Negative MDR/XDR Infections

    Directory of Open Access Journals (Sweden)

    Stefano Busani

    2017-01-01

    Full Text Available Patients with septic shock by multidrug resistant microorganisms (MDR are a specific sepsis population with a high mortality risk. The exposure to an initial inappropriate empiric antibiotic therapy has been considered responsible for the increased mortality, although other factors such as immune-paralysis seem to play a pivotal role. Therefore, beyond conventional early antibiotic therapy and fluid resuscitation, this population may benefit from the use of alternative strategies aimed at supporting the immune system. In this review we present an overview of the relationship between MDR infections and immune response and focus on the rationale and the clinical data available on the possible adjunctive immunotherapies, including blood purification techniques and different pharmacological approaches.

  7. Management of MDR-TB in HIV co-infected patients in Eastern Europe

    DEFF Research Database (Denmark)

    Efsen, A M W; Schultze, A; Miller, R F

    2018-01-01

    below the target of 90%, reflecting the challenging patient population and the environment in which health care is provided. Urgent improvement of management of patients with TB/HIV in EE, in particular for those with MDR-TB, is needed and includes widespread access to rapid TB diagnostics, better......OBJECTIVES: Mortality among HIV patients with tuberculosis (TB) remains high in Eastern Europe (EE), but details of TB and HIV management remain scarce. METHODS: In this prospective study, we describe the TB treatment regimens of patients with multi-drug resistant (MDR) TB and use of antiretroviral...... access to and use of second-line TB drugs, timely ART initiation with viral load monitoring, and integration of TB/HIV care....

  8. Several Virulence Factors of Multidrug-Resistant Staphylococcus aureus Isolates From Hospitalized Patients in Tehran

    Directory of Open Access Journals (Sweden)

    Abdolmajid Ghasemian

    2015-05-01

    Full Text Available Background: Biofilm formation plays an important role in resistance of Staphylococcus aureus isolates; especially multidrug-resistant isolates are a threat to healthcare settings. Objectives: The aims of this study were to detect biofilm formation and presence of several related genes among multidrug-resistant (MDR isolates of Staphylococcus aureus. Patients and Methods: A total Of 209 S. aureus strains were isolated from patients and identified by conventional diagnostic tests. The multidrug-resistant MRSA isolates were detected by antibiotic susceptibility test. The phenotypic biofilm formation was detected by micro-titre tissue plate assay. The polymerase chain reaction (PCR was performed to detect the mecA, Staphylococcal Cassette Chromosome mec (SCCmec types, accessory gene regulatory (agr genes, the icaADBC and several genes encoding staphylococcal surface proteins including clfAB, fnbAB, fib, eno, can, ebps and bbp genes with specific primers. Results: Sixty-four (30.6% isolates were methicillin-resistant, among which thirty-six (56.2% were MDR. These isolates were resistant to amoxicillin, tetracycline, ciprofloxacin, gentamicin, erythromycin and trimethoprim-sulfamethoxazole (except to 6 isolates. All the isolates were susceptible to vancomycin and linezolid. All the MDR-MRSA harbored SCCmec type III. All the MDR- MRSA isolates were strong biofilm producers in the phenotypic test. The majority of MDR- MRSA was belonged to agrI (67%, n = 24, followed by agr II (17%, n = 6, agrIV (11%, n = 4 and agrIII (5.5%, n = 2. The frequency of icaADBC genes were 75% (n = 27, 61% (n = 22, 72% (n = 26 and 72% (n = 26, respectively. Furthermore, the prevalence of clfA, clfB, fnbA, fnbB, fib, can, eno, ebps and bbp genes was 100%, 100%, 67%, 56%, 80%, 63%, 78%, 7% and 0%, respectively. Furthermore, approximately all the MRSA was strong biofilm producers. Conclusions: Multidrug-resistant isolates produced biofilm strongly and the majority harbored most

  9. Insulin sensitivity and metabolic flexibility following exercise training among different obese insulin resistant phenotypes

    DEFF Research Database (Denmark)

    Malin, Steven K; Haus, Jacob M; Solomon, Thomas

    2013-01-01

    Impaired fasting glucose (IFG) blunts the reversal of impaired glucose tolerance (IGT) after exercise training. Metabolic inflexibility has been implicated in the etiology of insulin resistance, however, the efficacy of exercise on peripheral and hepatic insulin sensitivity or substrate utilizati...

  10. Molecular Tools for the Detection and Deduction of Azole Antifungal Drug Resistance Phenotypes in Aspergillus Species.

    Science.gov (United States)

    Dudakova, Anna; Spiess, Birgit; Tangwattanachuleeporn, Marut; Sasse, Christoph; Buchheidt, Dieter; Weig, Michael; Groß, Uwe; Bader, Oliver

    2017-10-01

    The incidence of azole resistance in Aspergillus species has increased over the past years, most importantly for Aspergillus fumigatus . This is partially attributable to the global spread of only a few resistance alleles through the environment. Secondary resistance is a significant clinical concern, as invasive aspergillosis with drug-susceptible strains is already difficult to treat, and exclusion of azole-based antifungals from prophylaxis or first-line treatment of invasive aspergillosis in high-risk patients would dramatically limit drug choices, thus increasing mortality rates for immunocompromised patients. Management options for invasive aspergillosis caused by azole-resistant A. fumigatus strains were recently reevaluated by an international expert panel, which concluded that drug resistance testing of cultured isolates is highly indicated when antifungal therapy is intended. In geographical regions with a high environmental prevalence of azole-resistant strains, initial therapy should be guided by such analyses. More environmental and clinical screening studies are therefore needed to generate the local epidemiologic data if such measures are to be implemented on a sound basis. Here we propose a first workflow for evaluating isolates from screening studies, and we compile the MIC values correlating with individual amino acid substitutions in the products of cyp51 genes for interpretation of DNA sequencing data, especially in the absence of cultured isolates. Copyright © 2017 American Society for Microbiology.

  11. Therapeutic efficacy of interleukin-2 activated killer cells against adriamycin resistant mouse B16-BL6 melanoma.

    Science.gov (United States)

    Gautam, S C; Chikkala, N F; Lewis, I; Grabowski, D R; Finke, J H; Ganapathi, R

    1992-01-01

    Development of multidrug-resistance (MDR) remains a major cause of failure in the treatment of cancer with chemotherapeutic agents. In our efforts to explore alternative treatment regimens for multidrug-resistant tumors we have examined the sensitivity of MDR tumor cell lines to lymphokine activated killer (LAK) cells. Adriamycin (ADM) resistant B16-BL6 melanoma, L1210 and P388 leukemic cell lines were tested for sensitivity to lysis by LAK cells in vitro. While ADM-resistant B16-BL6 and L1210 sublines were found to exhibit at least 2-fold greater susceptibility to lysis by LAK cells, sensitivity of ADM-resistant P388 cell was similar to that of parental cells. Since ADM-resistant B16-BL6 cells were efficiently lysed by LAK cells in vitro, the efficacy of therapy with LAK cells against the ADM-resistant B16-BL6 subline in vivo was evaluated. Compared to mice bearing parental B16-BL6 tumor cells, the adoptive transfer of LAK cells and rIL2 significantly reduced formation of experimental metastases (P less than 0.009) and extended median survival time (P less than 0.001) of mice bearing ADM-resistant B16-BL6 tumor cells. Results suggest that immunotherapy with LAK cells and rIL2 may be a useful modality in the treatment of cancers with the MDR phenotype.

  12. In Vivo Evolution of Bacterial Resistance in Two Cases of Enterobacter aerogenes Infections during Treatment with Imipenem.

    Science.gov (United States)

    Philippe, Nadège; Maigre, Laure; Santini, Sébastien; Pinet, Elizabeth; Claverie, Jean-Michel; Davin-Régli, Anne-Véronique; Pagès, Jean-Marie; Masi, Muriel

    2015-01-01

    Infections caused by multidrug resistant (MDR) bacteria are a major concern worldwide. Changes in membrane permeability, including decreased influx and/or increased efflux of antibiotics, are known as key contributors of bacterial MDR. Therefore, it is of critical importance to understand molecular mechanisms that link membrane permeability to MDR in order to design new antimicrobial strategies. In this work, we describe genotype-phenotype correlations in Enterobacter aerogenes, a clinically problematic and antibiotic resistant bacterium. To do this, series of clinical isolates have been periodically collected from two patients during chemotherapy with imipenem. The isolates exhibited different levels of resistance towards multiple classes of antibiotics, consistently with the presence or the absence of porins and efflux pumps. Transport assays were used to characterize membrane permeability defects. Simultaneous genome-wide analysis allowed the identification of putative mutations responsible for MDR. The genome of the imipenem-susceptible isolate G7 was sequenced to closure and used as a reference for comparative genomics. This approach uncovered several loci that were specifically mutated in MDR isolates and whose products are known to control membrane permeability. These were omp35 and omp36, encoding the two major porins; rob, encoding a global AraC-type transcriptional activator; cpxA, phoQ and pmrB, encoding sensor kinases of the CpxRA, PhoPQ and PmrAB two-component regulatory systems, respectively. This report provides a comprehensive analysis of membrane alterations relative to mutational steps in the evolution of MDR of a recognized nosocomial pathogen.

  13. Staphylococcal phenotypes induced by naturally occurring and synthetic membrane-interactive polyphenolic β-lactam resistance modifiers.

    Directory of Open Access Journals (Sweden)

    Lucia Palacios

    Full Text Available Galloyl catechins, in particular (--epicatechin gallate (ECg, have the capacity to abrogate β-lactam resistance in methicillin-resistant strains of Staphylococcus aureus (MRSA; they also prevent biofilm formation, reduce the secretion of a large proportion of the exoproteome and induce profound changes to cell morphology. Current evidence suggests that these reversible phenotypic traits result from their intercalation into the bacterial cytoplasmic membrane. We have endeavoured to potentiate the capacity of ECg to modify the MRSA phenotype by stepwise removal of hydroxyl groups from the B-ring pharmacophore and the A:C fused ring system of the naturally occurring molecule. ECg binds rapidly to the membrane, inducing up-regulation of genes responsible for protection against cell wall stress and maintenance of membrane integrity and function. Studies with artificial membranes modelled on the lipid composition of the staphylococcal bilayer indicated that ECg adopts a position deep within the lipid palisade, eliciting major alterations in the thermotropic behaviour of the bilayer. The non-galloylated homolog (--epicatechin enhanced ECg-mediated effects by facilitating entry of ECg molecules into the membrane. ECg analogs with unnatural B-ring hydroxylation patterns induced higher levels of gene expression and more profound changes to MRSA membrane fluidity than ECg but adopted a more superficial location within the bilayer. ECg possessed a high affinity for the positively charged staphylococcal membrane and induced changes to the biophysical properties of the bilayer that are likely to account for its capacity to disperse the cell wall biosynthetic machinery responsible for β-lactam resistance. The ability to enhance these properties by chemical modification of ECg raises the possibility that more potent analogs could be developed for clinical evaluation.

  14. Genotype to phenotype, the molecular and physiological dimensions of resistance in arthropods.

    Science.gov (United States)

    Feyereisen, René; Dermauw, Wannes; Van Leeuwen, Thomas

    2015-06-01

    The recent accumulation of molecular studies on mutations in insects, ticks and mites conferring resistance to insecticides, acaricides and biopesticides is reviewed. Resistance is traditionally classified by physiological and biochemical criteria, such as target-site insensitivity and metabolic resistance. However, mutations are discrete molecular changes that differ in their intrinsic frequency, effects on gene dosage and fitness consequences. These attributes in turn impact the population genetics of resistance and resistance management strategies, thus calling for a molecular genetic classification. Mutations in structural genes remain the most abundantly described, mostly in genes coding for target proteins. These provide the most compelling examples of parallel mutations in response to selection. Mutations causing upregulation and downregulation of genes, both in cis (in the gene itself) and in trans (in regulatory processes) remain difficult to characterize precisely. Gene duplications and gene disruption are increasingly reported. Gene disruption appears prevalent in the case of multiple, hetero-oligomeric or redundant targets. Copyright © 2015 Elsevier Inc. All rights reserved.

  15. Risk factors associated with multidrug resistant tuberculosis among ...

    African Journals Online (AJOL)

    Background: Multidrug resistant tuberculosis (MDR-TB) remains is an important public health problem in developing world. We conducted this study to determine risk factors associated with MDR-TB and drug susceptibility pattern to second line drug among MDR TB patients in Tanzania. Methods: Unmatched case control ...

  16. Phenotypic analysis of antibiotic resistant E. coli recovered from urban aquatic environment in Banda Aceh, Indonesia

    Science.gov (United States)

    Suhartono, S.; Ismail, Y. S.; Yulvizar, C.; Nursanty, R.; Mahyuddin, M.; Jannah, M.

    2018-03-01

    Of aquatic environment, antibiotic resistant bacteria, including total coliforms and E. coli disseminate and emerge at an alarming rate. The study aims to determine enumerate, isolate,E. coliand determine their antibiotic resistance and compare between those which were recovered from residentials and home industries in Banda Aceh and its surrounding area. The bacterial density and antibiotic susceptibility of total coliforms and E. coli were determined using Standard Total Coliform Multiple-Tube (MPN) Fermentation method and the disk diffusion method, respectively. Despite there was no significant difference of total coliforms and E. coli population between residentials and home industries (P > 0.05) in this study, their density as well as prevalence remained high in the water sample. This might expose serious health risks since the resistance might be easily spread acquired through horizontal gene transfer within the aquatic environment.

  17. Phenotypic and Genotypic Antimicrobial Resistance of Lactococcus Sp. Strains Isolated from Rainbow Trout (Oncorhynchus Mykiss

    Directory of Open Access Journals (Sweden)

    Ture Mustafa

    2015-04-01

    Full Text Available A current profile of antimicrobial resistance and plasmid of 29 Lactococcus garvieae and one Lactococcus lactis strains isolated from rainbow trouts (Oncorhynchus mykiss from farms throughout Turkey were investigated. All isolates were sensitive to penicillin G (90%, ampicillin (86.7%, florfenicol (83.3%, amoxicillin (80.1%, and tetracycline (73.4%, and resistant to trimethoprim+sulfamethoxazole (86.6% and gentamycin (46.6% by disc diffusion method. Twenty-eight (93% isolates had two to seven antibiotic resistance genes (ARGs determined by PCR. The most prevalent ARGs were tetracycline (tetB, erythromycin (ereB, and β-lactam (blaTEM. Bacterial strains were also screened for plasmid DNA by agarose gel electrophoresis and two strains harboured plasmids, with sizes ranging from 3 to 9 kb.

  18. Celastraceae sesquiterpenes as a new class of modulators that bind specifically to human P-glycoprotein and reverse cellular multidrug resistance.

    Science.gov (United States)

    Muñoz-Martínez, Francisco; Lu, Peihua; Cortés-Selva, Fernando; Pérez-Victoria, José María; Jiménez, Ignacio A; Ravelo, Angel G; Sharom, Frances J; Gamarro, Francisco; Castanys, Santiago

    2004-10-01

    Overexpression of ABCB1 (MDR1) P-glycoprotein, a multidrug efflux pump, is one mechanism by which tumor cells may develop multidrug resistance (MDR), preventing the successful chemotherapeutic treatment of cancer. Sesquiterpenes from Celastraceae family are natural compounds shown previously to reverse MDR in several human cancer cell lines and Leishmania strains. However, their molecular mechanism of reversion has not been characterized. In the present work, we have studied the ability of 28 dihydro-beta-agarofuran sesquiterpenes to reverse the P-glycoprotein-dependent MDR phenotype and elucidated their molecular mechanism of action. Cytotoxicity assays using human MDR1-transfected NIH-3T3 cells allowed us to select the most potent sesquiterpenes reversing the in vitro resistance to daunomycin and vinblastine. Flow cytometry experiments showed that the above active compounds specifically inhibited drug transport activity of P-glycoprotein in a saturable, concentration-dependent manner (K(i) down to 0.24 +/- 0.01 micromol/L) but not that of ABCC1 (multidrug resistance protein 1; MRP1), ABCC2 (MRP2), and ABCG2 (breast cancer resistance protein; BCRP) transporters. Moreover, sesquiterpenes inhibited at submicromolar concentrations the P-glycoprotein-mediated transport of [(3)H]colchicine and tetramethylrosamine in plasma membrane from CH(R)B30 cells and P-glycoprotein-enriched proteoliposomes, supporting that P-glycoprotein is their molecular target. Photoaffinity labeling in plasma membrane and fluorescence spectroscopy experiments with purified protein suggested that sesquiterpenes interact with transmembrane domains of P-glycoprotein. Finally, sesquiterpenes modulated P-glycoprotein ATPase-activity in a biphasic, concentration-dependent manner: they stimulated at very low concentrations but inhibited ATPase activity as noncompetitive inhibitors at higher concentrations. Sesquiterpenes from Celastraceae are promising P-glycoprotein modulators with potential

  19. New Roads Leading to Old Destinations: Efflux Pumps as Targets to Reverse Multidrug Resistance in Bacteria

    Directory of Open Access Journals (Sweden)

    Gabriella Spengler

    2017-03-01

    Full Text Available Multidrug resistance (MDR has appeared in response to selective pressures resulting from the incorrect use of antibiotics and other antimicrobials. This inappropriate application and mismanagement of antibiotics have led to serious problems in the therapy of infectious diseases. Bacteria can develop resistance by various mechanisms and one of the most important factors resulting in MDR is efflux pump-mediated resistance. Because of the importance of the efflux-related multidrug resistance the development of new therapeutic approaches aiming to inhibit bacterial efflux pumps is a promising way to combat bacteria having over-expressed MDR efflux systems. The definition of an efflux pump inhibitor (EPI includes the ability to render the bacterium increasingly more sensitive to a given antibiotic or even reverse the multidrug resistant phenotype. In the recent years numerous EPIs have been developed, although so far their clinical application has not yet been achieved due to their in vivo toxicity and side effects. In this review, we aim to give a short overview of efflux mediated resistance in bacteria, EPI compounds of plant and synthetic origin, and the possible methods to investigate and screen EPI compounds in bacterial systems.

  20. Analysis of phenotype, genotype and serotype distribution in erythromycin-resistant group B streptococci isolated from vaginal flora in Southern Ireland.

    LENUS (Irish Health Repository)

    Kiely, R A

    2010-02-01

    The screening of 2000 women of childbearing age in Cork between 2004 and 2006 produced 37 erythromycin-resistant group B streptococcus (GBS) isolates. PCR analysis was performed to determine the basis for erythromycin resistance. The ermTR gene was most frequently expressed (n = 19), followed by the ermB gene (n = 8). Four isolates harboured the mefA gene. Six isolates yielded no PCR products. Some phenotype-genotype correlation was observed. All isolates expressing the mefA gene displayed the M phenotype whilst all those expressing ermB displayed the constitutive macrolide resistance (cMLS(B)) phenotype. Of 19 isolates that expressed the ermTR gene, 16 displayed the inducible macrolide resistance (iMLS(B)) phenotype. Serotype analysis revealed that serotypes III and V predominated in these isolates. The identification of two erythromycin-resistant serotype VIII isolates among this collection represents the first reported finding of erythromycin resistance in this serotype. A single isolate was non-typable using two latex agglutination serotyping kits.

  1. Comparison of three phenotypic techniques for detection of methicillin resistance in Staphylococcus spp. reveals a species-dependent performance.

    Science.gov (United States)

    John, Michael A; Burden, Julia; Stuart, J Ian; Reyes, Romina C; Lannigan, Robert; Milburn, Sue; Diagre, Deb; Wilson, Bev; Hussain, Zafar

    2009-03-01

    To evaluate the usefulness of the cefoxitin screen in Vitek 2 Gram-positive panels for recognizing methicillin-resistant strains of staphylococci. Seven hundred and ninety-nine non-duplicate isolates of Staphylococcus aureus and coagulase-negative strains were included in the study. Methicillin resistance was measured using PCR for the mecA gene, the CLSI cefoxitin disc diffusion method, the Vitek 2 cefoxitin screen and the Vitek 2 oxacillin susceptibility test. Compared with the molecular detection of methicillin resistance the overall sensitivities and specificities of the phenotypic tests for cefoxitin disc diffusion were 94.9% and 97.0%, for Vitek 2 cefoxitin screen were 94.6% and 93.5% and for Vitek 2 oxacillin susceptibility test were 93.8% and 77.9%. The cephamycin tests (cefoxitin disc diffusion and Vitek 2 screen) were not able to identify mecA-positive strains of Staphylococcus simulans. In addition, the performance of the Vitek 2 system was poor against Staphylococcus cohnii subspecies, Staphylococcus hominis hominis and Staphylococcus saprophyticus. Overall, the performance of the Vitek 2 system for differentiating mecA-positive staphylococci was comparable to PCR and the CLSI disc diffusion method; however, performance was species-dependent. Thus, before accepting the results produced by Vitek 2, species identification may be required.

  2. Alterations in Outer Membrane Permeability Favor Drug-Resistant Phenotype of Klebsiella pneumoniae

    Czech Academy of Sciences Publication Activity Database

    Pulzová, L.; Navrátilová, Lucie; Comor, L.

    2017-01-01

    Roč. 23, č. 4 (2017), s. 413-420 ISSN 1076-6294 Institutional support: RVO:61389030 Keywords : drug resistance * efflux pumps * influx * Klebsiella * porin Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 2.306, year: 2016

  3. Phenotypic, fermentation characterization, and resistance mechanism analysis of bacteriophage-resistant mutants of Lactobacillus delbrueckii ssp. bulgaricus isolated from traditional Chinese dairy products.

    Science.gov (United States)

    Deng, Kaibo; Fang, Wei; Zheng, Baodong; Miao, Song; Huo, Guicheng

    2018-03-01

    Bacteriophage infection is a large factor in dairy industrial production failure on the basis of pure inoculation fermentation, and developing good commercial starter cultures from wild dairy products and improving the environmental vigor of starter cultures by enhancing their phage resistance are still the most effective solutions. Here we used a spontaneous isolation method to obtain bacteriophage-resistant mutants of Lactobacillus delbrueckii ssp. bulgaricus strains that are used in traditional Chinese fermented dairy products. We analyzed their phenotypes, fermentation characteristics, and resistance mechanisms. The results showed that bacteriophage-insensitive mutants (BIM) BIM8 and BIM12 had high bacteriophage resistance while exhibiting fermentation and coagulation attributes that were as satisfying as those of their respective parent strains KLDS1.1016 and KLDS1.1028. According to the attachment receptor detection, mutants BIM8 and BIM12 exhibited reduced absorption to bacteriophage phiLdb compared with their respective bacteriophage-sensitive parent strains because of changes to the polysaccharides or teichoic acids connected to their peptidoglycan layer. Additionally, genes, including HSDR, HSDM, and HSDS, encoding 3 subunits of a type I restriction-modification system were identified in their respective parent strains. We also discovered that HSDR and HSDM were highly conserved but that HSDS was variable because it is responsible for the DNA specificity of the complex. The late lysis that occurred only in strain KLDS1.1016 and not in strain KLDS1.1028 suggests that the former and its mutant BIM8 also may have an activatable restriction-modification mechanism. We conclude that the L. bulgaricus BIM8 and BIM12 mutants have great potential in the dairy industry as starter cultures, and their phage-resistance mechanism was effective mainly due to the adsorption interference and restriction-modification system. Copyright © 2018 American Dairy Science

  4. Experience with LDR and MDR brachytherapy for cervical cancer

    International Nuclear Information System (INIS)

    Okawa, Tomohiko; Okawa, Midori-Kita; Kaneyasu, Yuko; Karasawa, Kumiko; Fukuhara, Noboru

    1996-01-01

    As the brachytherapy dose-rate increases, it is necessary to reduce the total dose or to increase the fraction number with reducing the fraction dose in order not to increase the incidence of the late effect. With the introduction to the Tokyo Women's Medical College, Hospital of a remote afterloading system of Selectron - MDR, delivering dose-rate to point A became approximately twice of that with our classical cesium LDR manual afterloading technique. Material and Methods: Between 1987 to 1993 a total of, previously untreated 74 patients with cervical cancer received MDR brachytherapy using a Selection - MDR. This analysis is therefore of those patients series who underwent radical radioradiotherapy with MDR, 1987-1993, in comparison with the 347 cases who were treated with classical manual LDR afterloading machine, 1969-1986. The treatment was a brachytherapy during external radiotherapy and dos-rate at point A was 160-180 cGy/hour with MDR and 80-90 cGy/hour with LDR. The mean fraction dose was 800-1000 cGy by MDR and 1000-1200 cGy by LDR and fraction number was increased 1-2times in the MDR group with no change of a total dose at point A. Results: The mean age was 63.3 years in the MDR group and 60.2 in the LDR group. In the MDR group, 4 patients were at stage I, 16 stage II, 32 stage III, and 22 stage IV. In the LDR group, 32 were at stage I, 83 stage II, 183 stage III, and 49 stage IV. The medical rate was not significantly different between two groups. The tumor response by manual examination one month after radiotherapy showed no significant difference. The 5-year survival rate for the MDR and LDR groups were 100% : 78% at stage I, 61% : 71% at stage II and 52% : 53% at stage III, with no significant differences. Late complications by severity with grade II-III according to Kottureire's classification were not significantly different in the rectum or bladder. These results suggested that MDR brachytherapy was useful for the patients' QOL as it reduced the

  5. The Role of Oxidative Stress in the Longevity and Insecticide Resistance Phenotype of the Major Malaria Vectors Anopheles arabiensis and Anopheles funestus.

    Directory of Open Access Journals (Sweden)

    Shüné V Oliver

    Full Text Available Oxidative stress plays numerous biological roles, both functional and pathological. The role of oxidative stress in various epidemiologically relevant biological traits in Anopheles mosquitoes is not well established. In this study, the effects of oxidative stress on the longevity and insecticide resistance phenotype in the major malaria vector species An. arabiensis and An. funestus were examined. Responses to dietary copper sulphate and hydrogen peroxide were used as proxies for the oxidative stress phenotype by determining the effect of copper on longevity and hydrogen peroxide lethal dose. Glutathione peroxidase and catalase activities were determined colorimetrically. Oxidative burden was quantified as protein carbonyl content. Changes in insecticide resistance phenotype were monitored by WHO bioassay. Insecticide resistant individuals showed an increased capacity for coping with oxidative stress, mediated by increased glutathione peroxidase and catalase activity. This effect was observed in both species, as well as in laboratory strains and F1 individuals derived from wild-caught An. funestus mothers. Phenotypic capacity for coping with oxidative stress was greatest in strains with elevated Cytochrome P450 activity. Synergism of oxidative stress defence enzymes by dietary supplementation with haematin, 3-Amino-1, 2, 4-triazole and Sodium diethyldithiocarbamate significantly increased pyrethroid-induced mortality in An. arabiensis and An. funestus. It is therefore concluded that defence against oxidative stress underlies the augmentation of the insecticide resistance phenotype associated with multiple blood-feeding. This is because multiple blood-feeding ultimately leads to a reduction of oxidative stress in insecticide resistant females, and also reduces the oxidative burden induced by DDT and pyrethroids, by inducing increased glutathione peroxidase activity. This study highlights the importance of oxidative stress in the longevity and

  6. The Role of Oxidative Stress in the Longevity and Insecticide Resistance Phenotype of the Major Malaria Vectors Anopheles arabiensis and Anopheles funestus.

    Science.gov (United States)

    Oliver, Shüné V; Brooke, Basil D

    2016-01-01

    Oxidative stress plays numerous biological roles, both functional and pathological. The role of oxidative stress in various epidemiologically relevant biological traits in Anopheles mosquitoes is not well established. In this study, the effects of oxidative stress on the longevity and insecticide resistance phenotype in the major malaria vector species An. arabiensis and An. funestus were examined. Responses to dietary copper sulphate and hydrogen peroxide were used as proxies for the oxidative stress phenotype by determining the effect of copper on longevity and hydrogen peroxide lethal dose. Glutathione peroxidase and catalase activities were determined colorimetrically. Oxidative burden was quantified as protein carbonyl content. Changes in insecticide resistance phenotype were monitored by WHO bioassay. Insecticide resistant individuals showed an increased capacity for coping with oxidative stress, mediated by increased glutathione peroxidase and catalase activity. This effect was observed in both species, as well as in laboratory strains and F1 individuals derived from wild-caught An. funestus mothers. Phenotypic capacity for coping with oxidative stress was greatest in strains with elevated Cytochrome P450 activity. Synergism of oxidative stress defence enzymes by dietary supplementation with haematin, 3-Amino-1, 2, 4-triazole and Sodium diethyldithiocarbamate significantly increased pyrethroid-induced mortality in An. arabiensis and An. funestus. It is therefore concluded that defence against oxidative stress underlies the augmentation of the insecticide resistance phenotype associated with multiple blood-feeding. This is because multiple blood-feeding ultimately leads to a reduction of oxidative stress in insecticide resistant females, and also reduces the oxidative burden induced by DDT and pyrethroids, by inducing increased glutathione peroxidase activity. This study highlights the importance of oxidative stress in the longevity and insecticide resistance

  7. A Rapid Phenotypic Whole Cell Screening Approach for the Identification of Small Molecule Inhibitors that Counter Beta-lactamase Resistance in Pseudomonas aeruginosa

    Science.gov (United States)

    Collia, Deanna; Bannister, Thomas D.; Tan, Hao; Jin, Shouguang; Langaee, Taimour; Shumate, Justin; Scampavia, Louis; Spicer, Timothy P.

    2017-01-01

    Pseudomonas aeruginosa is an opportunistic human pathogen which is prevalent in hospitals and continues to develop resistance to multiple classes of antibiotics. Historically, β-lactam antibiotics have been the first line of therapeutic defense. However, the emergence of multidrug-resistant (MDR) strains of P. aeruginosa, such as AmpC β-lactamase overproducing mutants, limits the effectiveness of current antibiotics. Among AmpC hyper producing clinical isolates, inactivation of AmpG, which is essential for the expression of AmpC, increases bacterial sensitivity to β-lactam antibiotics. We hypothesize that inhibition of AmpG activity will enhance the efficacy of β-lactams against P. aeruginosa. Here, using a highly drug resistant AmpC inducible laboratory strain PAO1, we describe an ultra-high throughput whole cell turbidity assay designed to identify small molecule inhibitors of the AmpG. We screened 645K compounds to identify compounds with the ability to inhibit bacterial growth in the presence of Cefoxitin; an AmpC inducer, and identified 2,663 inhibitors which were also tested in the absence of Cefoxitin to determine AmpG specificity. The Z′ and S:B were robust at 0.87 ± 0.05 and 2.2 ± 0.2, respectively. Through a series of secondary and tertiary studies, including a novel luciferase based counterscreen, we ultimately identified 8 potential AmpG specific inhibitors. PMID:28850797

  8. Novel insight into antimicrobial resistance and sensitivity phenotypes associated to qac and norA genotypes in Staphylococcus aureus.

    Science.gov (United States)

    Marchi, Emmanuela; Furi, Leonardo; Arioli, Stefania; Morrissey, Ian; Di Lorenzo, Valeria; Mora, Diego; Giovannetti, Luciana; Oggioni, Marco Rinaldo; Viti, Carlo

    2015-01-01

    Staphylococcus aureus strains harboring QacA, QacB, QacC, QacG transporters and norA promoter up-regulating mutations were characterized by phenotype microarray (PM), standard methods for susceptibility testing, and ethidium bromide efflux assays, in order to increase knowledge on phenotypes associated to efflux pumps and their substrates. PM data and standard susceptibility testing lead to the identification of new potential efflux targets, such as guanidine hydrochloride or 8-hydroxyquinoline for QacA and QacC pumps, respectively. The identification of compounds to which the presence of efflux pumps induced increased susceptibility opens new perspectives for potential adjunct anti-resistance treatment (i.e. strains bearing QacB transporters showed increased susceptibility to thioridazine, amitriptyline and orphenadrine). Although the tested isolates were characterized by high degree of heterogeneity, a hallmark of clinical isolates, direct ethidium bromide efflux assays were effective in highlighting differences in efflux efficiency among strains. These data add to characterization of substrate specificity in the different classes of staphylococcal multidrug efflux systems conferring specific substrate profiles and efflux features to each of them. Copyright © 2014 Elsevier GmbH. All rights reserved.

  9. Screening of melon genotypes for resistance to vegetable leafminer and your phenotypic correlations with colorimetry.

    Science.gov (United States)

    Oliveira, Frederico I C DE; Fiege, Leonardo B C; Celin, Elaine F; Innecco, Renato; Nunes, Glauber H S; Aragão, Fernando A S DE

    2017-01-01

    Melon is one of the most important vegetable crops in the world. With short cycle in a system of phased planting, phytosanitary control is compromised, and a great volume of agricultural chemicals is used to control vegetable leafminer. Genetic control is an ideal alternative to avoid the damage caused by this insect. Thus, the aim of this study was to evaluate Cucumis accessions in regard to resistance to leafminer and correlate the variables analyzed. Fifty-four accessions and four commercial hybrids of melon were tested. The study was divided into two experiments: with and with no choice. The following characteristics were evaluated: with choice, in field - subjective score based on the infestation and the number of mines per leaf; and with no choice, in cage - number of mines per leaf, chlorophyll content, and leaf colorimetry. The results showed variability among the accessions and some genotypes showed favorable results for resistance in both experiments. There was correlation between the two variables in the experiment in the field. The accessions CNPH 11-282, CNPH 06-1047, and CNPH 11-1077 are the most recommended for future breeding programs with aim on introgression of resistance to vegetable leafminer in melon.

  10. Imipenem Treatment Induces Expression of Important Genes and Phenotypes in a Resistant Acinetobacter baumannii Isolate.

    Science.gov (United States)

    Dhabaan, Ghulam Nasser; AbuBakar, Sazaly; Cerqueira, Gustavo Maia; Al-Haroni, Mohammed; Pang, Sui Ping; Hassan, Hamimah

    2015-12-14

    Acinetobacter baumannii has emerged as a notorious multidrug-resistant pathogen, and development of novel control measures is of the utmost importance. Understanding the factors that play a role in drug resistance may contribute to the identification of novel therapeutic targets. Pili are essential for A. baumannii adherence to and biofilm formation on abiotic surfaces as well as virulence. In the present study, we found that biofilm formation was significantly induced in an imipenem-resistant (Imp(r)) strain treated with a subinhibitory concentration of antibiotic compared to that in an untreated control and an imipenem-susceptible (Imp(s)) isolate. Using microarray and quantitative PCR analyses, we observed that several genes responsible for the synthesis of type IV pili were significantly upregulated in the Imp(r) but not in the Imp(s) isolate. Notably, this finding is corroborated by an increase in the motility of the Imp(r) strain. Our results suggest that the ability to overproduce colonization factors in response to imipenem treatment confers biological advantage to A. baumannii and may contribute to clinical success. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  11. Effect of pO2 on antitumor drug cytotoxicity on MDR and non-MDR variants selected from the LoVo metastatic colon carcinoma cell line.

    Science.gov (United States)

    Lelong-Rebel, Isabelle; Brisson, Christine; Fabre, Michel; Bergerat, Jean-Pierre; Rebel, Gérard

    2008-01-01

    Two chemosensitive cell lines, LoVo-fusoid (LoVo-f) and LoVo-small cells (LoVo-sc) were derived from the original LoVo cell line. These two variants and the multidrug-resistant (MDR) cell line LoVo-Dox were screened for various properties. In non-permeabilized cells, only LoVo-sc showed mucin-2 staining whereas labelling was positive in all permeabilized cell lines. As shown by electron microscopy screening and by relative resistance to trypsin detachment, only LoVo-sc cells showed strong mucus secretion. All three cell lines displayed strong staining for P-glycoprotein (P-gp), multidrug resistance-associated protein (MRP) and lung-resistance-related protein (LRP) in different locations according to the drug resistance state. The three cell lines showed intracellular labelling of LRP and MRP. The sensitive cells showed P-gp in a large perinuclear ring and in the cytoplasm, but little (LoVo-sc cells) or no staining (LoVo-f cells) was shown at the plasma membrane level. For the Lovo-Dox cells, P-gp was located in the plasma membrane, in cellular anchorages and in the cytoplasm as well. Cell resistance against antineoplastic agents often results from mobilization of various factors, the modulation of which is linked to the culture conditions. As most of the protocols utilize cells growing in (air + 5-10% CO2) atmosphere e.g. 20% O2, balance of the respective participants in the MDR multi-modal mechanism may not be representative of the in vivo situation and may lead to erratic pharmacological response. Indeed, cells within solid tumours were exposed to low pO2, most of them being under hypoxic condition (0.1-5% O2). In the absence of anticancer drugs, all LoVo cell lines grew notably faster at 20% O2 than at 5% O2. Moreover, respective sensitivities of both non-MDR variants to doxorubicin were altered according the pO2. Whatever the pO2 was, virtually none of the antioxidants tested affected the cytotoxic activity of doxorubicin for the three cell lines. By contrast

  12. Molecular and phenotypic characteristics of healthcare- and community-associated methicillin-resistant Staphylococcus aureus at a rural hospital.

    Directory of Open Access Journals (Sweden)

    Amy E Peterson

    Full Text Available BACKGROUND: While methicillin-resistant Staphylococcus aureus (MRSA originally was associated with healthcare, distinct strains later emerged in patients with no prior hospital contact. The epidemiology of MRSA continues to evolve. METHODS: To characterize the current epidemiology of MRSA-colonized patients entering a hospital serving both rural and urban communities, we interviewed patients with MRSA-positive admission nasal swabs between August 2009 and March 2010. We applied hospitalization risk factor, antimicrobial resistance phenotype, and multi-locus sequence genotype (MLST classification schemes to 94 case-patients. RESULTS: By MLST analysis, we identified 15 strains with two dominant clonal complexes (CCs-CC5 (51 isolates, historically associated with hospitals, and CC8 (27 isolates, historically of community origin. Among patients with CC5 isolates, 43% reported no history of hospitalization within the past six months; for CC8, 67% reported the same. Classification by hospitalization risk factor did not correlate strongly with genotypic classification. Sensitivity of isolates to ciprofloxacin, clindamycin, or amikacin was associated with the CC8 genotype; however, among CC8 strains, 59% were resistant to ciprofloxacin, 15% to clindamycin, and 15% to amikacin. CONCLUSIONS: Hospitalization history was not a strong surrogate for the CC5 genotype. Conversely, patients with a history of hospitalization were identified with the CC8 genotype. Although ciprofloxacin, clindamycin, and amikacin susceptibility distinguished CC8 strains, the high prevalence of ciprofloxacin resistance limited its predictive value. As CC8 strains become established in healthcare settings and CC5 strains disseminate into the community, community-associated MRSA definitions based on case-patient hospitalization history may prove less valuable in tracking community MRSA strains.

  13. Molecular Analysis of Multi-Drug Resistance (MDR) in ...

    African Journals Online (AJOL)

    This review therefore brings to light some of the processes involved in molecular typing of Mycobacterium tuberculosis strains like the use of restriction fragment length polymorphism (RFLP) and spoligotyping, which have become valuable tools in the epidemiology of tuberculosis, identification of genotypes and ...

  14. EDITORIAL Multi-drug-resistant tuberculosis (MDR-TB): Current ...

    African Journals Online (AJOL)

    A South African Health Systems Trust report indicated that despite a global ... less financial resources performed better. ... Healthcare providers need to be better trained at our various nursing colleges and medical schools on how to manage TB, with regular and intense follow-up in-service training sessions. In addition ...

  15. Phenotypic evaluation of the resistance in F1 carnation populations to vascular wilt caused by Fusarium oxysporum f.sp. dianthi

    Directory of Open Access Journals (Sweden)

    Johana Carolina Soto-Sedano

    2012-08-01

    Full Text Available One of the most important phytosanitary problems of the carnation crops in Colombia and in the entire world is vascular wilting produced by Fusarium oxysporum f.sp. dianthi. Currently, an effective treatment against the pathogen does not exist; the search for resistant varieties has been the most successful method for control of this disease. Breeding programs are vital to solving the problem of the carnation fusariosis. The objective of this research was the phenotypic evaluation of carnation F1 populations, products of contrasting crossing, resistant per susceptible to F. oxysporum f.sp. dianthi, in order to determine if the resistance is inherited in the lines. This information will contribute to the selection of material and to the successful introduction of the resistant characteristic, whose expression is commercially acceptable, to the gene pool. The methodology adopted was a phenotypic evaluation of the response to the parasite in the population (450 individuals and in the parental. This evaluation estimated the area under the curve (AU DPC, using a scale of symptoms reported for carnation vascular wilt. Three different phenotypes were established with this evaluation. The moderately susceptible one is the predominant phenotype and an analysis of phenotypic frequencies was carried out on it. The results show that the individuals of the evaluated F1 population were distributed between two extreme ranges, resistant and susceptible; this shows that there is segregation for the trait resistant to F. oxysporum f.sp dianthi. We did not observe clearly differentiated classes, i.e. with complete absence or presence of the disease, indicating a possible control of the resistance in the evaluated carnation material, governed by more than one gene and with a possible additive genetic action

  16. MDR-TB Outbreak among HIV-Negative Tunisian Patients followed during 11 Years.

    Directory of Open Access Journals (Sweden)

    Naira Dekhil

    Full Text Available Multidrug-resistant tuberculosis (MDR-TB outbreaks that evolve, from the outset, in a context strictly negative for HIV infection deserve special consideration since they reflect the true intrinsic epidemic potential of the causative strain. To our knowledge, the long-term evolution of such exceptional outbreaks and the treatment outcomes for the involved patients has never been reported hitherto. Here we provide a thorough description, over an 11-year period, of an MDR-TB outbreak that emerged and expanded in an HIV-negative context, Northern Tunisia.From October 2001 to June 2011, the MDR-TB outbreak involved 48 HIV-negative individuals that are mainly young (mean age 31.09 yrs; 89.6% male and noninstitutionalized. Drug susceptibility testing coupled to mutational analysis revealed that initial transmission involved an isolate that was simultaneously resistant to isoniazid, rifampicin, ethambutol, and streptomycin. The causative Haarlem3-ST50 outbreak strain expanded mainly as an 11-banded IS6110 RFLP profile (77.1%, from which a 12-banded subclone evolved. After undergoing a 2-year treatment with second-line drugs, 22 (45.8% patients were cured and 3 (6.2% completed treatment, thus yielding an overall treatment success rate of 52.1%. Among the patients that experienced unfavorable treatment outcomes, 10 (20.8% failed treatment, 3 (6.2% were lost to follow-up, 5 (10.4% died, and 5 (10.4% could not be evaluated. Poor adherence to treatment was found to be the main independent predictor of unfavorable outcomes (HR: 9.15; 95% CI 1.72-48.73; P = 0.014. Intriguingly, the evolved 12-banded subclone proved significantly associated with unfavorable outcomes (HR: 4.90; 95% CI 1.04-23.04, P = 0.044. High rate of fatality and relapse was further demonstrated at the long-term, since 70% of those whose treatment failed have died, and 24% among those deemed successfully treated have relapsed.Taken together, the data obtained in this study indicate that MDR

  17. Tamoxifen reduces P-gp-mediated multidrug resistance via inhibiting the PI3K/Akt signaling pathway in ER-negative human gastric cancer cells.

    Science.gov (United States)

    Mao, Zonglei; Zhou, Jin; Luan, Junwei; Sheng, Weihua; Shen, Xiaochun; Dong, Xiaoqiang

    2014-03-01

    Multidrug resistance (MDR), mediated by overexpression of drug efflux transporters such as P-glycoprotein (P-gp), is a major problem limiting successful chemotherapy of gastric cancer. Tamoxifen (TAM), a triphenylethylene nonsteroidal antiestrogen agent, shows broad-spectrum antitumor properties. Emerging studies demonstrated that TAM could significantly reduce the MDR in a variety of human cancers. Here we investigated the effects and possible underlying mechanisms of action of TAM on the reversion of MDR in ER-negative human gastric cancer cells. Our results demonstrated that in MDR phenotype SGC7901/CDDP gastric cancer cells TAM dramatically lowered the IC50 of CDDP, 5-FU and ADM, increased the intracellular Rhodamine123 accumulation and induced G0/G1 phase arrest, while G2/M phase decreased accordingly. Furthermore, at the molecular level, TAM substantially decreased the expression of P-gp, p-Akt and the Akt-regulated downstream effectors such as p-GSK-3β, p-BAD, Bcl-XL and cyclinD1 proteins without affecting the expression of t-Akt, t-GSK-3β, t-BAD proteins in SGC7901/CDDP cells. Thus, our findings demonstrate that TAM reverses P-gp-mediated gastric cancer cell MDR via inhibiting the PI3K/Akt signaling pathway. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  18. Phenotypic and genotypic detection of methicillin-resistant Staphylococcus aureus in hunting dogs in Maiduguri metropolitan, Borno State, Nigeria.

    Science.gov (United States)

    Mustapha, Muhammad; Bukar-Kolo, Yachilla Maryam; Geidam, Yaqub Ahmed; Gulani, Isa Adamu

    2016-05-01

    To determine the presence of MRSA in hunting dogs in Maiduguri metropolitan. Phenotypic methods used includes microscopic technique, colony morphology study, catalase-coagulase tests, and the use of mannitol salt agar test, oxacillin resistance screening agar base, and antibiotic susceptibility testing methods. Genotypic approach was used for deoxyribonucleic acid extraction, and the presence of nuc and mecA gene was detected using polymerase chain reaction (PCR) techniques. Examination of 416 swab samples from nasal and perineal region of dogs revealed a total of 79.5% of S. aureus, where 62.5% of the isolates were MRSA. Molecular analysis revealed that 7nuc genes specific for S. aureus from 20 presumptive MRSA assay were all mecA PCR negative. The isolates were sensitive to gentamicin and ciprofloxacin but proved resistant to cefoxitin and oxacillin. High isolation rate of MRSA was found in hunting dogs. Significant level (p<0.05) of MRSA was isolated in the nasal cavity of hunting dogs than its perineum. Only nuc genes were detected from the MRSA isolates.

  19. Phenotypic and genotypic detection of methicillin-resistant Staphylococcus aureus in hunting dogs in Maiduguri metropolitan, Borno State, Nigeria

    Directory of Open Access Journals (Sweden)

    Muhammad Mustapha

    2016-05-01

    Full Text Available Aim: To determine the presence of MRSA in hunting dogs in Maiduguri metropolitan. Materials and Methods: Phenotypic methods used includes microscopic technique, colony morphology study, catalase-coagulase tests, and the use of mannitol salt agar test, oxacillin resistance screening agar base, and antibiotic susceptibility testing methods. Genotypic approach was used for deoxyribonucleic acid extraction, and the presence of nuc and mecA gene was detected using polymerase chain reaction (PCR techniques. Results: Examination of 416 swab samples from nasal and perineal region of dogs revealed a total of 79.5% of S. aureus, where 62.5% of the isolates were MRSA. Molecular analysis revealed that 7nuc genes specific for S. aureus from 20 presumptive MRSA assay were all mecA PCR negative. The isolates were sensitive to gentamicin and ciprofloxacin but proved resistant to cefoxitin and oxacillin. Conclusion: High isolation rate of MRSA was found in hunting dogs. Significant level (p<0.05 of MRSA was isolated in the nasal cavity of hunting dogs than its perineum. Only nuc genes were detected from the MRSA isolates.

  20. Comparison of bacteriological conversion and treatment outcomes among MDR-TB patients with and without diabetes in Mexico: Preliminary data

    Directory of Open Access Journals (Sweden)

    M. Muñoz-Torrico

    2017-01-01

    Full Text Available Diabetes mellitus (DM is a well-known risk factor for tuberculosis (TB. However, it is not known to what extent DM affects the outcome in patients with multidrug-resistant (MDR-TB and extensively drug-resistant TB (XDR-TB treated with second-line anti-TB drugs.The objective of this study was to compare the microbiological evolution (sputum smear and culture conversion and final outcomes of MDR/XDR-TB patients with and without DM, managed at the national TB reference centre in Mexico City. Results: Ninety patients were enrolled between 2010 and 2015: 73 with MDR-TB (81.1%, 11 with pre-XDR-TB (e.g. MDR-TB with additional resistance to one injectable drug or a fluoroquinolone, 12.2% and 6 (6.7% with XDR-TB. Out of these, 49 (54.4% had DM and 42 (86% were undergoing insulin treatment.No statistically significant differences were found in treatment outcomes comparing DM vs. non-DM MDR-TB cases: 18/32 (56.3% of DM cases and 19/24 (79.2% non DM patients achieved treatment success (p = 0.07. The time to sputum smear and culture conversion was longer (although not statistically in patients without DM, as follows: the mean (±SD time to sputum smear conversion was 53.9 (±31.4 days in DM patients and 65.2 (±34.8 days in non-DM ones (p = 0.15, while the time to culture conversion was 66.2 (±27.6 days for DM and 81.4 (±37.7 days for non-DM MDR-TB cases (p = 0.06. Conclusions: The study results support the Mexican National TB programme to strengthen its collaboration with the DM programme, as an entry point for TB (and latent TB infection screening and management. Keywords: Diabetes mellitus, Delay, Sputum and culture conversion, MDR-TB, High treatment adherence

  1. Characterization of the Drug Resistance Profiles of Patients Infected with CRF07_BC Using Phenotypic Assay and Ultra-Deep Pyrosequencing.

    Directory of Open Access Journals (Sweden)

    Szu-Wei Huang

    Full Text Available The usefulness of ultra-deep pyrosequencing (UDPS for the diagnosis of HIV-1 drug resistance (DR remains to be determined. Previously, we reported an explosive outbreak of HIV-1 circulating recombinant form (CRF 07_BC among injection drug users (IDUs in Taiwan in 2004. The goal of this study was to characterize the DR of CRF07_BC strains using different assays including UDPS. Seven CRF07_BC isolates including 4 from early epidemic (collected in 2004-2005 and 3 from late epidemic (collected in 2008 were obtained from treatment-naïve patient's peripheral blood mononuclear cells. Viral RNA was extracted directly from patient's plasma or from cultural supernatant and the pol sequences were determined using RT-PCR sequencing or UDPS. For comparison, phenotypic drug susceptibility assay using MAGIC-5 cells (in-house phenotypic assay and Antivirogram were performed. In-house phenotypic assay showed that all the early epidemic and none of the late epidemic CRF07_BC isolates were resistant to most protease inhibitors (PIs (4.4-47.3 fold. Neither genotypic assay nor Antivirogram detected any DR mutations. UDPS showed that early epidemic isolates contained 0.01-0.08% of PI DR major mutations. Furthermore, the combinations of major and accessory PI DR mutations significantly correlated with the phenotypic DR. The in-house phenotypic assay is superior to other conventional phenotypic assays in the detection of DR variants with a frequency as low as 0.01%.

  2. Phenotypic and genotypic detection of ESBL mediated cephalosporin resistance in Klebsiella pneumoniae: emergence of high resistance against cefepime, the fourth generation cephalosporin.

    Science.gov (United States)

    Grover, S S; Sharma, Meenakshi; Chattopadhya, D; Kapoor, Hema; Pasha, S T; Singh, Gajendra

    2006-10-01

    common resistance phenotypes probably belonged to a single strain as evident by MIC patterns, genotypic characterization and resistance profile to non-cephalosporin group of antimicrobials thereby pointing out the possibility of an outbreak. PCR may be regarded as a reliable method for detection of ESBL since in addition to the strains that could be identified as ESBL producers by DDST and E-test ESBL; PCR could demonstrate ESBL production among additional 32 strains (15 in phase I and 17 in phase II). Continued uses of cephalosporin group appear to be a potential risk factor for emergence of ESBL producing K. pneumoniae strains. In addition, as noted in the present study, the rise of resistance to cefepime that has been introduced recently in this country for therapeutic use could be of concern.

  3. Qualitative analysis of MDR-reversing Anastasia Black (Russian black sweet pepper, Capsicum annuum, Solanaceae) extracts and fractions by HPLC and LC-MS-MS methods.

    Science.gov (United States)

    Schelz, Zsuzsanna; Molnár, Joseph; Fogliano, Vincenzo; Ferracane, Rosalia; Pernice, Rita; Shirataki, Yoshiaki; Motohashi, Noboru

    2006-01-01

    In earlier experiments, the MDR (multidrug resistance)-reversal activities of Anastasia Black (Russian black sweet pepper) extracts had been analysed. Recently, the most effective MDR reversing extracts and fractions have been separated by HPLC (high-performance liquid chromatography, for carotenoids) and LC-MS-MS (HPLC combined with mass spectrometry, for phenolic compounds) methods. As a result of the analytical studies, the following flavonoids had been identified: feruloyl glucopyranoside, quercetin rhamnopyranoside glucopyranoside, luteolin glucopyranoside arabinopyranoside, apigenin glucopyranoside arabinopyranoside, quercetin rhamnopyranoside, luteolin arabinopyranoside diglucopy-ranoside, hesperidine and luteolin glucuronide. According to the literature, the aglycones of these phenolic compounds exhibit MDR-reversal activity in vitro, and the connection between the phenolic content of Anastasia Black and MDR-reversal action was therefore studied by different analytical methods. The results of this study revealed that the identified flavonoids of Anastasia Black may be only partially responsible for the modulation of the MDR of mouse lymphoma cells. Other lipophilic compounds, most probably carotenoids, present in Russian black sweet pepper may act as inhibitors of MDR reversal.

  4. A mutation within the extended X loop abolished substrate-induced ATPase activity of the human liver ATP-binding cassette (ABC) transporter MDR3.

    Science.gov (United States)

    Kluth, Marianne; Stindt, Jan; Dröge, Carola; Linnemann, Doris; Kubitz, Ralf; Schmitt, Lutz

    2015-02-20

    The human multidrug resistance protein 3 (MDR3/ABCB4) belongs to the ubiquitous family of ATP-binding cassette (ABC) transporters and is located in the canalicular membrane of hepatocytes. There it flops the phospholipids of the phosphatidylcholine (PC) family from the inner to the outer leaflet. Here, we report the characterization of wild type MDR3 and the Q1174E mutant, which was identified previously in a patient with progressive familial intrahepatic cholestasis type 3 (PFIC-3). We expressed different variants of MDR3 in the yeast Pichia pastoris, purified the proteins via tandem affinity chromatography, and determined MDR3-specific ATPase activity in the presence or absence of phospholipids. The ATPase activity of wild type MDR3 was stimulated 2-fold by liver PC or 1,2-dioleoyl-sn-glycero-3-phosphatidylethanolamine lipids. Furthermore, the cross-linking of MDR3 with a thiol-reactive fluorophore blocked ATP hydrolysis and exhibited no PC stimulation. Similarly, phosphatidylethanolamine, phosphatidylserine, and sphingomyelin lipids did not induce an increase of wild type MDR3 ATPase activity. The phosphate analogues beryllium fluoride and aluminum fluoride led to complete inhibition of ATPase activity, whereas orthovanadate inhibited exclusively the PC-stimulated ATPase activity of MDR3. The Q1174E mutation is located in the nucleotide-binding domain in direct proximity of the leucine of the ABC signature motif and extended the X loop, which is found in ABC exporters. Our data on the Q1174E mutant demonstrated basal ATPase activity, but PC lipids were incapable of stimulating ATPase activity highlighting the role of the extended X loop in the cross-talk of the nucleotide-binding domain and the transmembrane domain. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  5. ASSESSMENT OF EFFECT OF MDR - TB/TB ON SOCIAL, FUNCTIONAL AND ECONOMIC WELL BEING OF PATIENTS – A CROSS SECTIONAL STUDY

    Directory of Open Access Journals (Sweden)

    Shiv Kumar

    2015-06-01

    Full Text Available CONTEXT : Tuberculosis is a contagious disease with social stigma attached to it. Various problems which are social and economic in nature are faced by TB patient. Therefore , it is essential to explore the overall effect of MDR - TB/TB on health and patients perception of Well - being. AIMS : To Document the effect of MDR - TB/TB on social , functional and economic well - being of patients. SETTINGS AND DESIGN : A Cross - sectional study , Conveniently Recruited 68 MDR - TB Patients and 136 non - MDR - TB Patients (from Rural as well as urban Area of Surat District diagnosed by CBNAAT were interviewed for investigating the effect of Tuberculosis. METHODS AND MATERIAL : A pre - tested standardized semi - structured questionnaire was used. Data was collected about socio - demographic profile of patients and interpreted in table. Data about effect of MDR - TB/TB was collected on Likert Scale and Frequency was calculated and Data wa s plotted on multiple bar charts. RESULTS : As compared to healthy status in the past , 93% MDR - TB and 82% TB patients have decreased ability to do work , about half of MDR - TB Patients and TB Patients have detiorated relations with family members , 67% of stud y participants have developed disharmonious relations with neighbor’s , 55% of Study participants have decreased income , 88% of study participants have decreased performance in day to day activities and 78% of study participants have faced discordial and di srespectful behavior from co - workers. CONCLUSION : Working ability more detiorated in MDR - TB patients while rest of the effect on social , functional and economic well - being is same in both TB and Multi Drug Resistant TB patients. This study emphasizes very clearly that social stigma still persist in community about Tuberculosis which needs to be eliminated in community by behavior change communication by health workers at all levels of health care.

  6. Phenotypic and genotypic characteristics of carbapenem-resistant Enterobacteriaceae in a tertiary-level reference hospital in Turkey.

    Science.gov (United States)

    Baran, Irmak; Aksu, Neriman

    2016-04-06

    Enterobacteriaceae are among the most common pathogens that are responsible for serious community-acquired, hospital-acquired, and health-care associated infections. The emergence and spread of carbapenem-resistant Enterobacteriaceae (CRE) have become an increasing concern for healthcare services worldwide. Infections caused by these bacteria have been associated with significant morbidity and mortality and treatment options have been limited. The rapid and accurate detection of carbapenem resistance in these bacteria is important for infection control. The aim of this study was to investigate the phenotypic and genotypic features of CRE strains isolated in a tertiary-level reference hospital in Turkey. A total of 181 CRE strains were included in the study. Antimicrobial susceptibility rates were tested using Vitek 2 system. Modified Hodge test (MHT) was performed using meropenem and ertapenem discs. Metallo-β-lactamase antimicrobial gradient test (E-test MBL strips) were used for evaluation of metallo-β-lactamase production. A multiplex PCR was used for detection of carbapenems resistance genes (IMP, VIM, KPC, NDM-1 and OXA-48). The OXA-48 gene was detected in 86 strains, NDM-1 gene in six strains, VIM gene in one strain. IMP and KPC genes were not identified. Three strains produced both OXA-48 and NDM-1 and one strain produced both OXA-48 and VIM. In two patients more than one genus of OXA-48 positive CREs was isolated. Ninety-two of the isolates were multidrug-resistant. One hundred and ten isolates were MHT with meropenem (MEM-MHT) positive and 109 isolates were MHT with ertapenem (ERT-MHT) positive. Nine of the isolates were positive with E-test MBL strips. The sensitivity of MEM-MHT and ERT-MHT for detection of OXA-48 was 70.9 and 70.6 %, respectively. MEM-MHT was found highly discriminative for OXA-48 Escherichia coli (p Enterobacteriaceae in the hospital environment. While OXA-48 is still the most common source of carbapenem resistance in

  7. Novel understanding of ABC transporters ABCB1/MDR/P-glycoprotein, ABCC2/MRP2, and ABCG2/BCRP in colorectal pathophysiology

    DEFF Research Database (Denmark)

    Andersen, Vibeke; Svenningsen, Katrine; Knudsen, Lina Almind

    2015-01-01

    transporter proteins, inflammatory bowel disease, ulcerative, colitis, Crohns disease, colorectal cancer, colitis, intestinal inflammation, intestinal carcinogenesis, ABCB1/P-glycoprotein (P-gp/CD243/MDR1), ABCC2/multidrug resistance protein 2 (MRP2) and ABCG2/breast cancer resistance protein (BCRP), Abcb1....../Mdr1a, abcc2/Mrp2, abcg2/Bcrp, knock-out mice, tight junction, membrane lipid function. RESULTS: Recently, human studies reported that changes in the levels of ABC transporters were early events in the adenoma-carcinoma sequence leading to CRC. A link between ABCB1, high fat diet and gut microbes...

  8. Initial drug resistance in India

    Indian Academy of Sciences (India)

    First page Back Continue Last page Overview Graphics. Initial drug resistance in India. There is gradual increase in primary MDR all over India : Pondi= Pondicherry 1985; Bangalore =1986; Jaipur = 1991; Jaipur =2000. Overall the MDR is less than 3% (TRC studies).

  9. Detection of Class I and II integrons for the assessment of antibiotic and multidrug resistance among Escherichia coli isolates from agricultural irrigation waters in Bulacan, Philippines.

    Science.gov (United States)

    Paraoan, Cielo Emar M; Rivera, Windell L; Vital, Pierangeli G

    2017-05-04

    Contaminated irrigation water may greatly affect not only the quality of produce but also the people exposed to it. In this study, agricultural irrigation waters in Bulacan, Philippines were assessed and found to be contaminated with Escherichia coli (E. coli) ranging from 0.58 to 4.51 log 10 CFU/mL. A total of 79 isolates of E. coli were confirmed through polymerase chain reaction (PCR) amplifying the uidA gene and were tested for phenotypic resistance using 10 antimicrobials through the Kirby-Bauer disc diffusion method. Forty-six isolates (58.22%) were noted to be multidrug resistant (MDR) with high resistance rate to cephalothin, tetracycline, streptomycin, ampicillin, trimethoprim, nalidixic acid, and chloramphenicol. Moreover, this study also examined the prevalence of Class I and II integrons accounting to 67.39% and 17.39%, respectively, of the MDR E. coli strains using multiplex PCR. The results imply that the agricultural water used in Bulacan is contaminated with the fecal material of man or other animals present in the area, and the presence of MDR bacteria, which pose a potential threat to individuals in these areas, is alarming. In addition, detection of integrons could be a good marker for the identification of MDR isolates. Lastly, this study could develop strategies for the proper management of farming sites leading to the detection of food-borne pathogens and prevention of infectious diseases.

  10. Anti-Mullerian hormone and insulin resistance in classic phenotype lean PCOS.

    Science.gov (United States)

    Caglar, Gamze Sinem; Kahyaoglu, Inci; Pabuccu, Recai; Demirtas, Selda; Seker, Rabia

    2013-10-01

    This study is designed to explore the correlation between AMH levels and IR in normal weight PCOS women. This prospective study was conducted on 55 patients, who were admitted to obstetrics and gynecology department of a university clinic. Study group was consisted of 34 patients diagnosed as polycystic ovary syndrome (PCOS) according to the Rotterdam Criteria, whereas control group was consisted of 21 healthy volunteers without any features of clinical or biochemical hyperandrogenism, who had regular menstrual cycles. BMI ≥ 25 kg/m(2) were considered overweight and obese and excluded. Blood samples were obtained during days 2-3 after spontaneous menses or progesterone-induced withdrawal bleeding after overnight fasting for at least 12 h. The weight, height, hip and waist circumferences of the patients were measured. Fasting insulin and glucose (FPG) levels were used for calculating different insulin resistance indexes (Homeostatic Model Assessment (HOMA-IR), Quantitative Insulin Sensitivity Check Index (QUICKI)). No significant difference was found between PCOS and control groups regarding the mean age, BMI, waist to hip ratio (WHR), mean values of FPG, FPG/insulin ratio and HOMA B (p > 0.05). AMH values were significantly higher in PCOS cases when compared with controls (4.7 vs. 3.4 ng/mL) (p PCOS cases when compared with controls. E2 levels were significantly lower and Total-T were significantly higher in PCOS patients. When PCOS cases are categorized according to the existence of IR, no difference in Total-T and AMH levels between both groups. Although not statistically significant, a negative correlation of AMH with HOMA-IR and a positive correlation with QUICKI index were found. Among the hormone parameters, AMH was found to be positively correlated with Total-T (r = 0.332, p = 0.013). Although the relation between AMH and androgen production is supported by current evidence, the mechanism underlying the relation between AMH and insulin

  11. Acute Respiratory Distress Syndrome Neutrophils Have a Distinct Phenotype and Are Resistant to Phosphoinositide 3-Kinase Inhibition.

    Science.gov (United States)

    Juss, Jatinder K; House, David; Amour, Augustin; Begg, Malcolm; Herre, Jurgen; Storisteanu, Daniel M L; Hoenderdos, Kim; Bradley, Glyn; Lennon, Mark; Summers, Charlotte; Hessel, Edith M; Condliffe, Alison; Chilvers, Edwin R

    2016-10-15

    Acute respiratory distress syndrome is refractory to pharmacological intervention. Inappropriate activation of alveolar neutrophils is believed to underpin this disease's complex pathophysiology, yet these cells have been little studied. To examine the functional and transcriptional profiles of patient blood and alveolar neutrophils compared with healthy volunteer cells, and to define their sensitivity to phosphoinositide 3-kinase inhibition. Twenty-three ventilated patients underwent bronchoalveolar lavage. Alveolar and blood neutrophil apoptosis, phagocytosis, and adhesion molecules were quantified by flow cytometry, and oxidase responses were quantified by chemiluminescence. Cytokine and transcriptional profiling were used in multiplex and GeneChip arrays. Patient blood and alveolar neutrophils were distinct from healthy circulating cells, with increased CD11b and reduced CD62L expression, delayed constitutive apoptosis, and primed oxidase responses. Incubating control cells with disease bronchoalveolar lavage recapitulated the aberrant functional phenotype, and this could be reversed by phosphoinositide 3-kinase inhibitors. In contrast, the prosurvival phenotype of patient cells was resistant to phosphoinositide 3-kinase inhibition. RNA transcriptomic analysis revealed modified immune, cytoskeletal, and cell death pathways in patient cells, aligning closely to sepsis and burns datasets but not to phosphoinositide 3-kinase signatures. Acute respiratory distress syndrome blood and alveolar neutrophils display a distinct primed prosurvival profile and transcriptional signature. The enhanced respiratory burst was phosphoinositide 3-kinase-dependent but delayed apoptosis and the altered transcriptional profile were not. These unexpected findings cast doubt over the utility of phosphoinositide 3-kinase inhibition in acute respiratory distress syndrome and highlight the importance of evaluating novel therapeutic strategies in patient-derived cells.

  12. Phenotypic changes of methicillin-resistant Staphylococcus aureus during vancomycin therapy for persistent bacteraemia and related clinical outcome.

    Science.gov (United States)

    Kim, T; Kim, E S; Park, S Y; Sung, H; Kim, M-N; Kim, S-H; Lee, S-O; Choi, S-H; Jeong, J-Y; Woo, J H; Chong, Y P; Kim, Y S

    2017-08-01

    Persistent bacteraemia (PB) due to methicillin-resistant Staphylococcus aureus (MRSA) that fails to respond to glycopeptide therapy is a well-documented clinical problem. There are limited data on changes in agr functionality, vancomycin susceptibility and heteroresistance during MRSA PB. Thus, the frequency of these changes and their clinical significance remain unclear. Only patients with MRSA PB (≥7 days) from a prospective cohort of S. aureus bacteraemia were included. We collected isogenic paired strains and compared vancomycin MIC, vancomycin heteroresistance, and agr functionality between initial and final blood isolates. We also assessed the clinical outcome. A total of 49 patients had MRSA PB over 22 months. Bacteraemia persisted for a median of 13 days and most patients (98%) received glycopeptide as initial therapy. Among 49 isogenic pairs, only one pair showed a vancomycin MIC increase ≥2-fold by broth microdilution method, and only seven (14%) by E-test. Significant portions of initial isolates had vancomycin heteroresistance (49%) and agr dysfunction (76%). Development of vancomycin heteroresistance during PB occurred in four (16%) among 25 initial vancomycin-susceptible isolates, and acquisition of agr dysfunction occurred in two (16%) among 12 initial agr-functional isolates. Changes in the opposite direction occasionally occurred. These phenotypic changes during PB were not associated with mortality, whereas agr dysfunction of the initial isolates was significantly associated with mortality. During MRSA PB, phenotypic changes of MRSA isolates occurred occasionally under prolonged vancomycin exposure but were not significantly associated with clinical outcome. In contrast, initial agr dysfunction could be a predictor for mortality in MRSA PB.

  13. Insulin sensitivity and metabolic flexibility following exercise training among different obese insulin-resistant phenotypes.

    Science.gov (United States)

    Malin, Steven K; Haus, Jacob M; Solomon, Thomas P J; Blaszczak, Alecia; Kashyap, Sangeeta R; Kirwan, John P

    2013-11-15

    Impaired fasting glucose (IFG) blunts the reversal of impaired glucose tolerance (IGT) after exercise training. Metabolic inflexibility has been implicated in the etiology of insulin resistance; however, the efficacy of exercise on peripheral and hepatic insulin sensitivity or substrate utilization in adults with IFG, IGT, or IFG + IGT is unknown. Twenty-four older (66.7 ± 0.8 yr) obese (34.2 ± 0.9 kg/m(2)) adults were categorized as IFG (n = 8), IGT (n = 8), or IFG + IGT (n = 8) according to a 75-g oral glucose tolerance test (OGTT). Subjects underwent 12-wk of exercise (60 min/day for 5 days/wk at ∼85% HRmax) and were instructed to maintain a eucaloric diet. A euglycemic hyperinsulinemic clamp (40 mU·m(2)·min(-1)) with [6,6-(2)H]glucose was used to determine peripheral and hepatic insulin sensitivity. Nonoxidative glucose disposal and metabolic flexibility [insulin-stimulated respiratory quotient (RQ) minus fasting RQ] were also assessed. Glucose incremental area under the curve (iAUCOGTT) was calculated from the OGTT. Exercise increased clamp-derived peripheral and hepatic insulin sensitivity more in adults with IFG or IGT alone than with IFG + IGT (P work is required to assess the molecular mechanism(s) by which chronic hyperglycemia modifies insulin sensitivity following exercise training.

  14. Genotypic and phenotypic characterization of multidrug resistant Salmonella Typhimurium and Salmonella Kentucky strains recovered from chicken carcasses.

    Directory of Open Access Journals (Sweden)

    Rizwana Tasmin

    Full Text Available Salmonella Typhimurium is the leading cause of human non-typhoidal gastroenteritis in the US. S. Kentucky is one the most commonly recovered serovars from commercially processed poultry carcasses. This study compared the genotypic and phenotypic properties of two Salmonella enterica strains Typhimurium (ST221_31B and Kentucky (SK222_32B recovered from commercially processed chicken carcasses using whole genome sequencing, phenotype characterizations and an intracellular killing assay. Illumina MiSeq platform was used for sequencing of two Salmonella genomes. Phylogenetic analysis employing homologous alignment of a 1,185 non-duplicated protein-coding gene in the Salmonella core genome demonstrated fully resolved bifurcating patterns with varying levels of diversity that separated ST221_31B and SK222_32B genomes into distinct monophyletic serovar clades. Single nucleotide polymorphism (SNP analysis identified 2,432 (ST19 SNPs within 13 Typhimurium genomes including ST221_31B representing Sequence Type ST19 and 650 (ST152 SNPs were detected within 13 Kentucky genomes including SK222_32B representing Sequence Type ST152. In addition to serovar-specific conserved coding sequences, the genomes of ST221_31B and SK222_32B harbor several genomic regions with significant genetic differences. These included phage and phage-like elements, carbon utilization or transport operons, fimbriae operons, putative membrane associated protein-encoding genes, antibiotic resistance genes, siderophore operons, and numerous hypothetical protein-encoding genes. Phenotype microarray results demonstrated that ST221_31B is capable of utilizing certain carbon compounds more efficiently as compared to SK222_3B; namely, 1,2-propanediol, M-inositol, L-threonine, α-D-lactose, D-tagatose, adonitol, formic acid, acetoacetic acid, and L-tartaric acid. ST221_31B survived for 48 h in macrophages, while SK222_32B was mostly eliminated. Further, a 3-fold growth of ST221_31B was

  15. PD173074, a selective FGFR inhibitor, reverses MRP7 (ABCC10-mediated MDR

    Directory of Open Access Journals (Sweden)

    Nagaraju Anreddy

    2014-06-01

    Full Text Available Multidrug resistance protein 7 (MRP7, ABCC10 is a recently identified member of the ATP-binding cassette (ABC transporter family, which adequately confers resistance to a diverse group of antineoplastic agents, including taxanes, vinca alkaloids and nucleoside analogs among others. Clinical studies indicate an increased MRP7 expression in non-small cell lung carcinomas (NSCLC compared to a normal healthy lung tissue. Recent studies revealed increased paclitaxel sensitivity in the Mrp7−/− mouse model compared to their wild-type counterparts. This demonstrates that MRP7 is a key contributor in developing drug resistance. Recently our group reported that PD173074, a specific fibroblast growth factor receptor (FGFR inhibitor, could significantly reverse P-glycoprotein-mediated MDR. However, whether PD173074 can interact with and inhibit other MRP members is unknown. In the present study, we investigated the ability of PD173074 to reverse MRP7-mediated MDR. We found that PD173074, at non-toxic concentration, could significantly increase the cellular sensitivity to MRP7 substrates. Mechanistic studies indicated that PD173074 (1 μmol/L significantly increased the intracellular accumulation and in-turn decreased the efflux of paclitaxel by inhibiting the transport activity without altering expression levels of the MRP7 protein, thereby representing a promising therapeutic agent in the clinical treatment of chemoresistant cancer patients.

  16. Short communication prevalence of susceptibility to etravirine by genotype and phenotype in samples received for routine HIV type 1 resistance testing in the United States.

    Science.gov (United States)

    Picchio, Gaston; Vingerhoets, Johan; Tambuyzer, Lotke; Coakley, Eoin; Haddad, Mojgan; Witek, James

    2011-12-01

    Abstract The prevalence of susceptibility to etravirine was investigated among clinical samples submitted for routine clinical testing in the United States using two separate weighted genotypic scoring systems. The presence of etravirine mutations and susceptibility to etravirine by phenotype of clinical samples from HIV-1-infected patients, submitted to Monogram Biosciences for routine resistance testing between June 2008 and June 2009, were analyzed. Susceptibility by genotype was determined using the Monogram and Tibotec etravirine-weighted genotypic scoring systems, with scores of ≤3 and ≤2, respectively, indicating full susceptibility. Susceptibility by phenotype was determined using the PhenoSense HIV assay, with lower and higher clinical cut-offs of 2.9 and 10, respectively. The frequency of individual etravirine mutations and the impact of the K103N mutation on susceptibility to etravirine by genotype were also determined. Among the 5482 samples with ≥1 defined nonnucleoside reverse transcriptase inhibitor (NNRTI) mutations associated with resistance, 67% were classed as susceptible to etravirine by genotype by both scoring systems. Susceptibility to etravirine by phenotype was higher (76%). The proportion of first-generation NNRTI-resistant samples with (n=3598) and without (n=1884) K103N with susceptibility to etravirine by genotype was 77% and 49%, respectively. Among samples susceptible to first-generation NNRTIs (n=9458), >99% of samples were susceptible to etravirine by phenotype (FC <2.9); the remaining samples had FC ≥2.9-10. In summary, among samples submitted for routine clinical testing in the United States, a high proportion of samples with first-generation NNRTI resistance was susceptible to etravirine by genotype and phenotype. A higher proportion of NNRTI-resistant samples with K103N than without was susceptible to etravirine.

  17. Syzygium jambos Displayed Antibacterial and Antibiotic-Modulating Activities against Resistant Phenotypes

    Directory of Open Access Journals (Sweden)

    Brice E. N. Wamba

    2018-01-01

    Full Text Available The present study was designed to evaluate the antibacterial activities of methanol extracts of bark and leaves of Syzygium jambos, as well as their synergistic effects with selected antibiotics against drug-resistant Gram-positive and Gram-negative bacteria. The crude extracts were subjected to qualitative phytochemical screening; broth microdilution method was used for antibacterial assays. Phytochemical studies indicate that leaves and bark extracts contained polyphenols, anthraquinones, tannins, and steroids. Extract of the leaves was active against all the 26 strains of Staphylococcus aureus and all the 21 strains of Gram-negative bacteria tested, within the minimum inhibitory concentration (MIC range of 32–512 μg/mL. The lowest MIC value of 32 μg/mL was obtained with extract of the leaves against Staphylococcus aureus MRSA9 strain. In Gram-negative bacteria, the lowest MIC value of 64 μg/mL was also obtained against Enterobacter aerogenes EA294 and Klebsiella pneumoniae K24 strains. Against S. aureus strains, antibiotic-modulating activity of extracts at MIC/2 towards more than 70% of the tested strains was obtained when leaves and bark extracts were tested in association with chloramphenicol (CHL. This was also the case when leaves extract was combined with CHL, kanamycin (KAN, tetracycline (TET, and erythromycin (ERY and when bark extract was combined with ciprofloxacin (CIP, TET, and ERY against Gram-negative bacteria. In conclusion, this study demonstrated that Syzygium jambos has antibacterial and antibiotic-modulating activities.

  18. Characterization of a Novel 99mTc-Carbonyl Complex as a Functional Probe of MDR1 P-Glycoprotein Transport Activity

    Directory of Open Access Journals (Sweden)

    Mary Dyszlewski

    2002-01-01

    Full Text Available Multidrug resistance (MDR mediated by overexpression of MDR1 P-glycoprotein (Pgp is one of the best characterized barriers to chemotherapy in cancer patients. Furthermore, the protective function of Pgp-mediated efflux of xenobiotics in various organs has a profound effect on the bioavailability of drugs in general. Thus, there is an expanding requirement to noninvasively interrogate Pgp transport activity in vivo. We herein report the Pgp recognition properties of a novel 99mTc(I-tricarbonyl complex, [99mTc(CO3(MIBI3] + (Tc-CO-MIBI. Tc-CO-MIBI showed 60-fold higher accumulation in drug-sensitive KB 3–1 cells compared to colchicine-selected drug-resistant KB 8-5 cells. In KB 8-5 cells, tracer enhancement was observed with the potent MDR modulator LY335979 (EC50 = 62 nM. Similar behavior was observed using drug-sensitive MCF-7 breast adenocarcinoma cells and MCF-7/MDR1 stable transfectants, confirming that Tc-CO-MIBI is specifically excluded by overexpression of MDR1 Pgp. By comparison, net accumulation in control H69 lung tumor cells was 9-fold higher than in MDR-associated protein (MRP1-expressing H69AR cells, indicating only modest transport by MRP1. Biodistribution analysis following tail vein injection of Tc-CO-MIBI showed delayed liver clearance as well as enhanced brain uptake and retention in mdr1a/1b(−/− gene deleted mice versus wild-type mice, directly demonstrating that Tc-CO-MIBI is a functional probe of Pgp transport activity in vivo.

  19. A Public Platform for the Verification of the Phenotypic Effect of Candidate Genes for Resistance to Aflatoxin Accumulation and Aspergillus flavus Infection in Maize

    Directory of Open Access Journals (Sweden)

    Xueyan Shan

    2011-06-01

    Full Text Available A public candidate gene testing pipeline for resistance to aflatoxin accumulation or Aspergillus flavus infection in maize is presented here. The pipeline consists of steps for identifying, testing, and verifying the association of selected maize gene sequences with resistance under field conditions. Resources include a database of genetic and protein sequences associated with the reduction in aflatoxin contamination from previous studies; eight diverse inbred maize lines for polymorphism identification within any maize gene sequence; four Quantitative Trait Loci (QTL mapping populations and one association mapping panel, all phenotyped for aflatoxin accumulation resistance and associated phenotypes; and capacity for Insertion/Deletion (InDel and SNP genotyping in the population(s for mapping. To date, ten genes have been identified as possible candidate genes and put through the candidate gene testing pipeline, and results are presented here to demonstrate the utility of the pipeline.

  20. Phenotypes and genotypes of erythromycin-resistant Streptococcus pyogenes strains isolated from invasive and non-invasive infections from Mexico and the USA during 1999–2010

    Science.gov (United States)

    Villaseñor-Sierra, Alberto; Katahira, Eva; Jaramillo-Valdivia, Abril N.; de los Angeles Barajas-García, María; Bryant, Amy; Morfín-Otero, Rayo; Márquez-Díaz, Francisco; Tinoco, Juan Carlos; Sánchez-Corona, José; Stevens, Dennis L.

    2012-01-01

    Summary Objective To compare the prevalence, phenotypes, and genes responsible for erythromycin resistance among Streptococcus pyogenes isolates from Mexico and the USA. Methods Eighty-nine invasive and 378 non-invasive isolates from Mexico, plus 148 invasive, 21 non-invasive, and five unclassified isolates from the USA were studied. Susceptibilities to penicillin, erythromycin, clindamycin, ceftriaxone, and vancomycin were evaluated according to Clinical and Laboratory Standards Institute (CLSI) standards. Phenotypes of erythromycin resistance were identified by triple disk test, and screening for mefA, ermTR, and ermB genes was carried out by PCR. Results All isolates were susceptible to penicillin, ceftriaxone, and vancomycin. Erythromycin resistance was found in 4.9% of Mexican strains and 5.2% of USA strains. Phenotypes in Mexican strains were 95% M and 5% cMLS; in strains from the USA, phenotypes were 33.3% iMLS, 33.3% iMLS-D, and 33.3% M. Erythromycin resistance genes in strains from Mexico were mefA (95%) and ermB (5%); USA strains harbored ermTR (56%), mefA (33%), and none (11%). In Mexico, all erythromycin-resistant strains were non-invasive, whereas 89% of strains from the USA were invasive. Conclusions Erythromycin resistance continues to exist at low levels in both Mexico and the USA, although the genetic mechanisms responsible differ between the two nations. These genetic differences may be related to the invasive character of the S. pyogenes isolated. PMID:22217469

  1. A Comprehensive Investigation on Common Polymorphisms in the MDR1/ABCB1 Transporter Gene and Susceptibility to Colorectal Cancer

    Czech Academy of Sciences Publication Activity Database

    Campa, D.; Sainz, J.; Pardini, Barbara; Vodičková, Ludmila; Naccarati, Alessio; Rudolph, A.; Novotný, J.; Försti, A.; Buch, S.; von Schönfels, W.; Schafmayer, C.; Völzke, H.; Hoffmeister, M.; Frank, B.; Barale, R.; Hemminki, K.; Hampe, J.; Chang-Claude, J.; Brenner, H.; Vodička, Pavel; Canzian, F.

    2012-01-01

    Roč. 7, č. 3 (2012), e32784 E-ISSN 1932-6203 R&D Projects: GA ČR GA310/07/1430; GA ČR GAP304/10/1286 Institutional research plan: CEZ:AV0Z50390703 Keywords : single-nucleotide polymorphisms * resistance 1 mdr1 * p-glycoprotein Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.730, year: 2012

  2. Resistance to DNA Damaging Agents Produced Invasive Phenotype of Rat Glioma Cells—Characterization of a New in Vivo Model

    Directory of Open Access Journals (Sweden)

    Sonja Stojković

    2016-06-01

    Full Text Available Chemoresistance and invasion properties are severe limitations to efficient glioma therapy. Therefore, development of glioma in vivo models that more accurately resemble the situation observed in patients emerges. Previously, we established RC6 rat glioma cell line resistant to DNA damaging agents including antiglioma approved therapies such as 3-bis(2-chloroethyl-1-nitrosourea (BCNU and temozolomide (TMZ. Herein, we evaluated the invasiveness of RC6 cells in vitro and in a new orthotopic animal model. For comparison, we used C6 cells from which RC6 cells originated. Differences in cell growth properties were assessed by real-time cell analyzer. Cells’ invasive potential in vitro was studied in fluorescently labeled gelatin and by formation of multicellular spheroids in hydrogel. For animal studies, fluorescently labeled cells were inoculated into adult male Wistar rat brains. Consecutive coronal and sagittal brain sections were analyzed 10 and 25 days post-inoculation, while rats’ behavior was recorded during three days in the open field test starting from 25th day post-inoculation. We demonstrated that development of chemoresistance induced invasive phenotype of RC6 cells with significant behavioral impediments implying usefulness of orthotopic RC6 glioma allograft in preclinical studies for the examination of new approaches to counteract both chemoresistance and invasion of glioma cells.

  3. Canine Mammary Cancer Stem Cells are Radio- and Chemo-Resistant and Exhibit an Epithelial-Mesenchymal Transition Phenotype

    International Nuclear Information System (INIS)

    Pang, Lisa Y.; Cervantes-Arias, Alejandro; Else, Rod W.; Argyle, David J.

    2011-01-01

    Canine mammary carcinoma is the most common cancer among female dogs and is often fatal due to the development of distant metastases. In humans, solid tumors are made up of heterogeneous cell populations, which perform different roles in the tumor economy. A small subset of tumor cells can hold or acquire stem cell characteristics, enabling them to drive tumor growth, recurrence and metastasis. In veterinary medicine, the molecular drivers of canine mammary carcinoma are as yet undefined. Here we report that putative cancer stem cells (CSCs) can be isolated form a canine mammary carcinoma cell line, REM134. We show that these cells have an increased ability to form tumorspheres, a characteristic of stem cells, and that they express embryonic stem cell markers associated with pluripotency. Moreover, canine CSCs are relatively resistant to the cytotoxic effects of common chemotherapeutic drugs and ionizing radiation, indicating that failure of clinical therapy to eradicate canine mammary cancer may be due to the survival of CSCs. The epithelial to mesenchymal transition (EMT) has been associated with cancer invasion, metastasis, and the acquisition of stem cell characteristics. Our results show that canine CSCs predominantly express mesenchymal markers and are more invasive than parental cells, indicating that these cells have a mesenchymal phenotype. Furthermore, we show that canine mammary cancer cells can be induced to undergo EMT by TGFβ and that these cells have an increased ability to form tumorspheres. Our findings indicate that EMT induction can enrich for cells with CSC properties, and provide further insight into canine CSC biology

  4. Canine Mammary Cancer Stem Cells are Radio- and Chemo-Resistant and Exhibit an Epithelial-Mesenchymal Transition Phenotype

    Energy Technology Data Exchange (ETDEWEB)

    Pang, Lisa Y., E-mail: lisa.pang@ed.ac.uk; Cervantes-Arias, Alejandro; Else, Rod W.; Argyle, David J. [Royal (Dick) School of Veterinary Studies and Roslin Institute, The University of Edinburgh, Easter Bush, Midlothian, EH25 9RG (United Kingdom)

    2011-03-30

    Canine mammary carcinoma is the most common cancer among female dogs and is often fatal due to the development of distant metastases. In humans, solid tumors are made up of heterogeneous cell populations, which perform different roles in the tumor economy. A small subset of tumor cells can hold or acquire stem cell characteristics, enabling them to drive tumor growth, recurrence and metastasis. In veterinary medicine, the molecular drivers of canine mammary carcinoma are as yet undefined. Here we report that putative cancer stem cells (CSCs) can be isolated form a canine mammary carcinoma cell line, REM134. We show that these cells have an increased ability to form tumorspheres, a characteristic of stem cells, and that they express embryonic stem cell markers associated with pluripotency. Moreover, canine CSCs are relatively resistant to the cytotoxic effects of common chemotherapeutic drugs and ionizing radiation, indicating that failure of clinical therapy to eradicate canine mammary cancer may be due to the survival of CSCs. The epithelial to mesenchymal transition (EMT) has been associated with cancer invasion, metastasis, and the acquisition of stem cell characteristics. Our results show that canine CSCs predominantly express mesenchymal markers and are more invasive than parental cells, indicating that these cells have a mesenchymal phenotype. Furthermore, we show that canine mammary cancer cells can be induced to undergo EMT by TGFβ and that these cells have an increased ability to form tumorspheres. Our findings indicate that EMT induction can enrich for cells with CSC properties, and provide further insight into canine CSC biology.

  5. JNK signaling maintains the mesenchymal properties of multi-drug resistant human epidermoid carcinoma KB cells through snail and twist1

    International Nuclear Information System (INIS)

    Zhan, Xia; Feng, Xiaobing; Kong, Ying; Chen, Yi; Tan, Wenfu

    2013-01-01

    In addition to possess cross drug resistance characteristic, emerging evidences have shown that multiple-drug resistance (MDR) cancer cells exhibit aberrant metastatic capacity when compared to parental cells. In this study, we explored the contribution of c-Jun N-terminal kinases (JNK) signaling to the mesenchymal phenotypes and the aberrant motile capacity of MDR cells utilizing a well characterized MDR cell line KB/VCR, which is established from KB human epidermoid carcinoma cells by vincristine (VCR), and its parental cell line KB. Taking advantage of experimental strategies including pharmacological tool and gene knockdown, we showed here that interference with JNK signaling pathway by targeting JNK1/2 or c-Jun reversed the mesenchymal properties of KB/VCR cells to epithelial phenotypes and suppressed the motile capacity of KB/VCR cells, such as migration and invasion. These observations support a critical role of JNK signaling in maintaining the mesenchymal properties of KB/VCR cells. Furthermore, we observed that JNK signaling may control the expression of both snail and twist1 in KB/VCR cells, indicating that both snail and twist1 are involved in controlling the mesenchymal characteristics of KB/VCR cells by JNK signaling. JNK signaling is required for maintaining the mesenchymal phenotype of KB/VCR cells; and JNK signaling may maintain the mesenchymal characteristics of KB/VCR cells potentially through snail and twist1

  6. JNK signaling maintains the mesenchymal properties of multi-drug resistant human epidermoid carcinoma KB cells through snail and twist1.

    Science.gov (United States)

    Zhan, Xia; Feng, Xiaobing; Kong, Ying; Chen, Yi; Tan, Wenfu

    2013-04-04

    In addition to possess cross drug resistance characteristic, emerging evidences have shown that multiple-drug resistance (MDR) cancer cells exhibit aberrant metastatic capacity when compared to parental cells. In this study, we explored the contribution of c-Jun N-terminal kinases (JNK) signaling to the mesenchymal phenotypes and the aberrant motile capacity of MDR cells utilizing a well characterized MDR cell line KB/VCR, which is established from KB human epidermoid carcinoma cells by vincristine (VCR), and its parental cell line KB. Taking advantage of experimental strategies including pharmacological tool and gene knockdown, we showed here that interference with JNK signaling pathway by targeting JNK1/2 or c-Jun reversed the mesenchymal properties of KB/VCR cells to epithelial phenotypes and suppressed the motile capacity of KB/VCR cells, such as migration and invasion. These observations support a critical role of JNK signaling in maintaining the mesenchymal properties of KB/VCR cells. Furthermore, we observed that JNK signaling may control the expression of both snail and twist1 in KB/VCR cells, indicating that both snail and twist1 are involved in controlling the mesenchymal characteristics of KB/VCR cells by JNK signaling. JNK signaling is required for maintaining the mesenchymal phenotype of KB/VCR cells; and JNK signaling may maintain the mesenchymal characteristics of KB/VCR cells potentially through snail and twist1.

  7. Analysis of mdr1-1Δ mutation of MDR1 gene in the “Cimarron Uruguayo” dog

    Directory of Open Access Journals (Sweden)

    Rosa Gagliardi B.

    2013-08-01

    Full Text Available Objective. The aim of this paper is to analyze the frequency of the mdr1-1D mutation of the MDR1 gene in a dog sample of the Uruguayan Cimarron breed with the objective of increasing the knowledge of this breed’s genome. Materials and methods. Thirty-six animals of this breed were analyzed. The MDR1 gene region, which includes the location where the mutation would be present, was amplified by PCR. Results. The mutation was not detected in any of the analyzed Uruguayan Cimarron. Conclusions. The lack of described ivermectin intoxication cases in veterinary clinic in this breed is explained by the lack of the mutation object of this study. The sequence studied in Cimarron dogs is kept compared to other breeds, except Collies and related breeds (Border Collie, Bearded Collie, Old English sheepdog.

  8. Multidrug Resistance Among New Tuberculosis Cases Detecting Local Variation Through Lot Quality-assurance Sampling

    NARCIS (Netherlands)

    Hedt, Bethany Lynn; van Leth, Frank; Zignol, Matteo; Cobelens, Frank; van Gemert, Wayne; Nhung, Nguyen Viet; Lyepshina, Svitlana; Egwaga, Saidi; Cohen, Ted

    2012-01-01

    Background: Current methodology for multidrug-resistant tuberculosis (MDR TB) surveys endorsed by the World Health Organization provides estimates of MDR TB prevalence among new cases at the national level. On the aggregate, local variation in the burden of MDR TB may be masked. This paper

  9. The effect of multiple blood-feeding on the longevity and insecticide resistant phenotype in the major malaria vector Anopheles arabiensis (Diptera: Culicidae).

    Science.gov (United States)

    Oliver, Shüné V; Brooke, Basil D

    2014-08-23

    Anopheles arabiensis is a major malaria vector in Africa. Adult females are likely to imbibe multiple blood meals during their lifetime. This results in regular exposure to potential toxins and blood-meal induced oxidative stress. Defence responses to these stressors may affect other factors of epidemiological significance, such as insecticide resistance and longevity. The aims of this study were to examine the effect of multiple blood-feeding on insecticide tolerance/resistance with increasing age, to assess the underlying biochemical mechanisms for the responses recorded, and to assess the effect of multiple blood-feeding on the life histories of adult females drawn from insecticide resistant and susceptible laboratory reared An. arabiensis. Laboratory reared An. arabiensis females from an insecticide resistant and an insecticide susceptible colony were offered either a single blood meal or multiple blood meals at 3-day intervals. Their tolerance or resistance to insecticide was then monitored by WHO bioassay four hours post blood-feeding. The biochemical basis of the phenotypic response was assessed by examining the effect of blood on detoxification enzyme activity and the effect of blood-meals on detoxification enzyme activity in ageing mosquitoes. Control cohorts that were not offered any blood meals showed steadily decreasing levels of insecticide tolerance/resistance with age, whereas a single blood meal significantly increased tolerance/resistance primarily at the age of three days. The expression of resistance/tolerance in those cohorts fed multiple blood meals generally showed the least variation with age. These results were consistent following exposure to DDT and pyrethroids but not to malathion. Multiple blood-meals also maintained the DDT and permethrin resistant phenotype, even after treatment females had stopped taking blood-meals. Biochemical analysis suggests that this phenotypic effect in resistant females may be mediated by the maintenance of

  10. Leishmania donovani isolates with antimony-resistant but not -sensitive phenotype inhibit sodium antimony gluconate-induced dendritic cell activation.

    Directory of Open Access Journals (Sweden)

    Arun Kumar Haldar

    2010-05-01

    Full Text Available The inability of sodium antimony gluconate (SAG-unresponsive kala-azar patients to clear Leishmania donovani (LD infection despite SAG therapy is partly due to an ill-defined immune-dysfunction. Since dendritic cells (DCs typically initiate anti-leishmanial immunity, a role for DCs in aberrant LD clearance was investigated. Accordingly, regulation of SAG-induced activation of murine DCs following infection with LD isolates exhibiting two distinct phenotypes such as antimony-resistant (Sb(RLD and antimony-sensitive (Sb(SLD was compared in vitro. Unlike Sb(SLD, infection of DCs with Sb(RLD induced more IL-10 production and inhibited SAG-induced secretion of proinflammatory cytokines, up-regulation of co-stimulatory molecules and leishmanicidal effects. Sb(RLD inhibited these effects of SAG by blocking activation of PI3K/AKT and NF-kappaB pathways. In contrast, Sb(SLD failed to block activation of SAG (20 microg/ml-induced PI3K/AKT pathway; which continued to stimulate NF-kappaB signaling, induce leishmanicidal effects and promote DC activation. Notably, prolonged incubation of DCs with Sb(SLD also inhibited SAG (20 microg/ml-induced activation of PI3K/AKT and NF-kappaB pathways and leishmanicidal effects, which was restored by increasing the dose of SAG to 40 microg/ml. In contrast, Sb(RLD inhibited these SAG-induced events regardless of duration of DC exposure to Sb(RLD or dose of SAG. Interestingly, the inhibitory effects of isogenic Sb(SLD expressing ATP-binding cassette (ABC transporter MRPA on SAG-induced leishmanicidal effects mimicked that of Sb(RLD to some extent, although antimony resistance in clinical LD isolates is known to be multifactorial. Furthermore, NF-kappaB was found to transcriptionally regulate expression of murine gammaglutamylcysteine synthetase heavy-chain (mgammaGCS(hc gene, presumably an important regulator of antimony resistance. Importantly, Sb(RLD but not Sb(SLD blocked SAG-induced mgammaGCS expression in DCs by

  11. In vitro detection of mdr1 mRNA in murine leukemia cells with 111In-labeled oligonucleotide

    International Nuclear Information System (INIS)

    Bai Jingming; Yokoyama, Kunihiko; Kinuya, Seigo; Michigishi, Takatoshi; Tonami, Norihisa; Shiba, Kazuhiro; Matsushita, Ryo; Nomura, Masaaki

    2004-01-01

    The feasibility of intracellular mdr1 mRNA expression detection with radiolabeled antisense oligonucleotide (ODN) was investigated in the murine leukemia cell line, P388/S, and its subclonal, adriamycin-resistant cell line, P388/R. The expression level of mdr1 mRNA was analyzed by reverse transcription-polymerase chain reaction (RT-PCR). Existence of the multidrug resistance (MDR) phenomenon was assessed via cellular uptake of 99m Tc-sestamibi (MIBI), a known substrate for P-glycoprotein. A 15-mer phosphorothioate antisense ODN complementary to the sequences located at -1 to 14 of mdr1 mRNA and its corresponding sense ODN were conjugated with the cyclic anhydride of diethylene triamine penta-acetic acid (cDTPA) via an amino group linked to the terminal phosphate at the 5' end at pH 8-9. The DTPA-ODN complexes at concentrations of 0.1-17.4 μMwere reacted with 111 InCl 3 at pH 5 for 1 h. The hybridization affinity of labeled ODN was evaluated with size-exclusion high-performance liquid chromatography following incubation with the complementary sequence. Cellular uptake of labeled ODN was examined in vitro. Furthermore, enhancing effects of synthetic lipid carriers (Transfast) on transmembrane delivery of ODN were assessed. P388/R cells displayed intense mdr1 mRNA expression in comparison with P388/S cells. 99m Tc-MIBI uptake in P388/S cells was higher than that in P388/R cells. Specific radioactivity up to 1,634 MBq/nmol was achieved via elevation of added radioactivity relative to ODN molar amount. The hybridization affinity of antisense 111 In-ODN was preserved at approximately 85% irrespective of specific activity. Cellular uptake of antisense 111 In-ODN did not differ from that of sense 111 In-ODN in either P388/S cells or P388/R cells. However, lipid carrier incorporation significantly increased transmembrane delivery of 111 In-ODN; moreover, specific uptake of antisense 111 In-ODN was demonstrated in P388/R cells. Radiolabeling of ODN at high specific

  12. The Prevalence and Molecular Epidemiology of Multidrug-Resistant Enterobacteriaceae Colonization in a Pediatric Intensive Care Unit.

    Science.gov (United States)

    Suwantarat, Nuntra; Logan, Latania K; Carroll, Karen C; Bonomo, Robert A; Simner, Patricia J; Rudin, Susan D; Milstone, Aaron M; Tekle, Tsigereda; Ross, Tracy; Tamma, Pranita D

    2016-05-01

    To determine the prevalence and acquisition of extended-spectrum β-lactamases (ESBLs), plasmid-mediated AmpCs (pAmpCs), and carbapenemases ("MDR Enterobacteriaceae") colonizing children admitted to a pediatric intensive care unit (PICU). Prospective study. 40-bed PICU. Admission and weekly thereafter rectal surveillance swabs were collected on all pediatric patients during a 6-month study period. Routine phenotypic identification and antibiotic susceptibility testing were performed. Enterobacteriaceae displaying characteristic resistance profiles underwent further molecular characterization to identify genetic determinants of resistance likely to be transmitted on mobile genetic elements and to evaluate relatedness of strains including DNA microarray, multilocus sequence typing, repetitive sequence-based PCR, and hsp60 sequencing typing. Evaluating 854 swabs from unique children, the overall prevalence of colonization with an MDR Enterobacteriaceae upon admission to the PICU based on β-lactamase gene identification was 4.3% (n=37), including 2.8% ESBLs (n=24), 1.3% pAmpCs (n=11), and 0.2% carbapenemases (n=2). Among 157 pediatric patients contributing 603 subsequent weekly swabs, 6 children (3.8%) acquired an incident MDR Enterobacteriaceae during their PICU stay. One child acquired a pAmpC (E. coli containing bla DHA) related to an isolate from another patient. Approximately 4% of children admitted to a PICU were colonized with MDR Enterobacteriaceae (based on β-lactamase gene identification) and an additional 4% of children who remained in the PICU for at least 1 week acquired 1 of these organisms during their PICU stay. The acquired MDR Enterobacteriaceae were relatively heterogeneous, suggesting that a single source was not responsible for the introduction of these resistance mechanisms into the PICU setting.

  13. The Prevalence and Molecular Epidemiology of Multidrug-Resistant Enterobacteriaceae Colonization in a Pediatric Intensive Care Unit

    Science.gov (United States)

    Suwantarat, Nuntra; Logan, Latania K.; Carroll, Karen C.; Bonomo, Robert A.; Simner, Patricia J.; Rudin, Susan D.; Milstone, Aaron M.; Tekle, Tsigereda; Ross, Tracy; Tamma, Pranita D.

    2016-01-01

    OBJECTIVE To determine the prevalence and acquisition of extended-spectrum β-lactamases (ESBLs), plasmid-mediated AmpCs (pAmpCs), and carbapenemases (“MDR Enterobacteriaceae”) colonizing children admitted to a pediatric intensive care unit (PICU). DESIGN Prospective study. SETTING 40-bed PICU. METHODS Admission and weekly thereafter rectal surveillance swabs were collected on all pediatric patients during a 6-month study period. Routine phenotypic identification and antibiotic susceptibility testing were performed. Enterobacteriaceae displaying characteristic resistance profiles underwent further molecular characterization to identify genetic determinants of resistance likely to be transmitted on mobile genetic elements and to evaluate relatedness of strains including DNA microarray, multilocus sequence typing, repetitive sequence-based PCR, and hsp60 sequencing typing. Results Evaluating 854 swabs from unique children, the overall prevalence of colonization with an MDR Enterobacteriaceae upon admission to the PICU based on β-lactamase gene identification was 4.3% (n = 37), including 2.8% ESBLs (n =24), 1.3% pAmpCs (n =11), and 0.2% carbapenemases (n =2). Among 157 pediatric patients contributing 603 subsequent weekly swabs, 6 children (3.8%) acquired an incident MDR Enterobacteriaceae during their PICU stay. One child acquired a pAmpC (E. coli containing blaDHA) related to an isolate from another patient. Conclusions Approximately 4% of children admitted to a PICU were colonized with MDR Enterobacteriaceae (based on β-lactamase gene identification) and an additional 4% of children who remained in the PICU for at least 1 week acquired 1 of these organisms during their PICU stay. The acquired MDR Enterobacteriaceae were relatively heterogeneous, suggesting that a single source was not responsible for the introduction of these resistance mechanisms into the PICU setting. PMID:26856439

  14. Prevalence of Multidrug-Resistant Tuberculosis and Associated Factors in Ethiopia: A Systematic Review

    OpenAIRE

    Asgedom, Solomon Weldegebreal; Teweldemedhin, Mebrahtu; Gebreyesus, Hailay

    2018-01-01

    Background. Multidrug-resistant tuberculosis (MDR-TB) has continued to be a challenge for tuberculosis (TB) control globally. Ethiopia is one of the countries with high MDR-TB burden. Objective. The main purpose of this study was to determine the prevalence of MDR-TB and associated factors in Ethiopia. Methods. A systematic review of the literatures on prevalence of MDR-TB and associated factors was conducted in the country. Results. In our electronic search, 546 citations were depicted. Amon...

  15. Genomic and Transcriptomic Associations Identify a New Insecticide Resistance Phenotype for the Selective Sweep at the Cyp6g1 Locus of Drosophila melanogaster.

    Science.gov (United States)

    Battlay, Paul; Schmidt, Joshua M; Fournier-Level, Alexandre; Robin, Charles

    2016-08-09

    Scans of the Drosophila melanogaster genome have identified organophosphate resistance loci among those with the most pronounced signature of positive selection. In this study, the molecular basis of resistance to the organophosphate insecticide azinphos-methyl was investigated using the Drosophila Genetic Reference Panel, and genome-wide association. Recently released full transcriptome data were used to extend the utility of the Drosophila Genetic Reference Panel resource beyond traditional genome-wide association studies to allow systems genetics analyses of phenotypes. We found that both genomic and transcriptomic associations independently identified Cyp6g1, a gene involved in resistance to DDT and neonicotinoid insecticides, as the top candidate for azinphos-methyl resistance. This was verified by transgenically overexpressing Cyp6g1 using natural regulatory elements from a resistant allele, resulting in a 6.5-fold increase in resistance. We also identified four novel candidate genes associated with azinphos-methyl resistance, all of which are involved in either regulation of fat storage, or nervous system development. In Cyp6g1, we find a demonstrable resistance locus, a verification that transcriptome data can be used to identify variants associated with insecticide resistance, and an overlap between peaks of a genome-wide association study, and a genome-wide selective sweep analysis. Copyright © 2016 Battlay et al.

  16. Role of MRP-1 and GST-Pi in MDR and their inhibition by ...

    African Journals Online (AJOL)

    Samia A. Ebeed

    2016-08-16

    Aug 16, 2016 ... Various mechanisms were proposed that underlie MDR in malignant cells. ... the gene that confers MDR in lung cancer cells. MRP1 acts in order to protect ... the many physiological and pathophysiological processes influ-.

  17. Efficacy, safety and tolerability of linezolid containing regimens in treating MDR-TB and XDR-TB : systematic review and meta-analysis

    NARCIS (Netherlands)

    Sotgiu, Giovanni; Centis, Rosella; D'Ambrosio, Lia; Alffenaar, Jan-William C.; Anger, Holly A.; Caminero, Jose A.; Castiglia, Paolo; De Lorenzo, Saverio; Ferrara, Giovanni; Koh, Won-Jung; Schecter, Giesela F.; Shim, Tae S.; Singla, Rupak; Skrahina, Alena; Spanevello, Antonio; Udwadia, Zarir F.; Villar, Miquel; Zampogna, Elisabetta; Zellweger, Jean-Pierre; Zumla, Alimuddin; Migliori, Giovanni Battista

    2012-01-01

    Linezolid is used off-label to treat multidrug-resistant tuberculosis (MDR-TB) in absence of systematic evidence. We performed a systematic review and meta-analysis on efficacy, safety and tolerability of linezolid-containing regimes based on individual data analysis. 12 studies (11 countries from

  18. Comparison of effectiveness and safety of imipenem/clavulanate- versus meropenem/clavulanate-containing regimens in the treatment of MDR- and XDR-TB

    NARCIS (Netherlands)

    Tiberi, Simon; Sotgiu, Giovanni; D'Ambrosio, Lia; Centis, Rosella; Arbex, Marcos Abdo; Arrascue, Edith Alarcon; Alffenaar, Jan Willem; Caminero, Jose A.; Gaga, Mina; Gualano, Gina; Skrahina, Alena; Solovic, Ivan; Sulis, Giorgia; Tadolini, Marina; Alarcon Guizado, Valentina; De Lorenzo, Saverio; Roby Arias, Aurora Jazmin; Scardigli, Anna; Akkerman, Onno W.; Aleksa, Alena; Artsukevich, Janina; Auchynka, Vera; Bonini, Eduardo Henrique; Chong Marin, Felix Antonio; Collahuazo Lopez, Lorena; de Vries, Gerard; Dore, Simone; Kunst, Heinke; Matteelli, Alberto; Moschos, Charalampos; Palmieri, Fabrizio; Papavasileiou, Apostolos; Payen, Marie-Christine; Piana, Andrea; Spanevello, Antonio; Vargas Vasquez, Dante; Viggiani, Pietro; White, Veronica; Zumla, Alimuddin; Migliori, Giovanni Battista

    No large study to date has ever evaluated the effectiveness, safety and tolerability of imipenem/clavulanate versus meropenem/clavulanate to treat multidrug-and extensively drug-resistant tuberculosis (MDR- and XDR-TB). The aim of this observational study was to compare the therapeutic contribution

  19. Whole Genome Sequencing and Plasmid Genomics of Antimicrobial Resistance – Salmonella’s mobile genetic elements and the antimicrobial resistance genes they carry

    Science.gov (United States)

    With the emergence of antibiotic resistance (AR), multidrug resistance (MDR), and carbapenem resistant Enterobacteriaceae (CRE), the specter of widespread untreatable bacterial infections threatens human and animal health. The ability of these emerging resistances to transfer between bacteria on mob...

  20. Characterization of the etiological structure and genotypically determined phenotypic resistance to carbapenems of infectious complications leading pathogens in critically ill patients

    Directory of Open Access Journals (Sweden)

    O. A. Nazarchuk

    2018-06-01

    Full Text Available The aim is to investigate the genotypically determined phenotypic resistance to carbapenems of gram-negative microorganisms isolated from patients with critical states. Material and methods. Microbiological etiology of infectious complications in critically ill patients (n = 726 was investigated. In total, during the years 2011–2016, 933 clinical strains of infectious complications pathogens from patients with severe burns (n = 435 and from patients treated in intensive care units (n = 291 were isolated and identified. The sensitivity of microorganisms clinical isolates to antibiotics was investigated by means of the standard microbiological methods. In gram-negative bacteria resistant to carbapenems, a molecular genetic study of mechanisms of resistance, determined by the presence of VIM genes, was carried out using the method of real-time polymerase chain reaction. Results. Studies have shown that gram-negative microorganisms (Acinetobacter spp. – 36.3 %, P. aeruginosa – 31.7 %, Enterobacter spp. – 13.5 %, Proteus spp. – 7.9 %, E. coli – 3.8 %; K. pneumoniae – 3.6 %, etc. account for a significant part of infectious complications pathogens structure in critically ill patients. A. baumannii strains (67 % have expressed phenotypic resistance to most antibiotics, in particular to carbapenems (up to 63.2 %. Poly-antibiotic resistance was also found in P. aeruginosa (72 %, and above one the 3rd part of strains of this pathogen was found to have phenotypic resistance to carbapenems. In-depth study of molecular genetic determinants of the resistance mechanism to β-lactam antibiotics among clinical strains of gram-negative bacteria there was proved VIM-induced resistance to carbapenems in A. baumannii, P. aeruginosa, P. mirabilis. Conclusions. Enterobacteriaceae and non-fermenting gram-negative microorganisms (P. aeruginosa, P. mirabilis, A. baumannii, which are the leading causative agents of infectious complications in patients with

  1. In vitro and in vivo reversal of cancer cell multidrug resistance by the semi-synthetic antibiotic tiamulin.

    Science.gov (United States)

    Baggetto, L G; Dong, M; Bernaud, J; Espinosa, L; Rigal, D; Bonvallet, R; Marthinet, E

    1998-11-01

    A large number of multidrug resistance (MDR) modulators, termed chemosensitizers, have been identified from a variety of chemicals, but most have been proven to be clinically toxic. Low concentrations of the pleuromutilin-derived semi-synthetic antibiotic tiamulin (0.1 to 10 microM) sensitized the three highly resistant P-glycoprotein (Pgp)-overexpressing tumor cell lines P388 (murine lymphoid leukemia), AS30-D (rat hepatoma), CEM (human lymphoblastic leukemia), and the barely resistant AS30-D/S cell lines to several MDR-related anticancer drugs. Flow cytometric analysis showed that tiamulin significantly increased the intracellular accumulation of daunomycin. When compared to reference modulating agents such as verapamil and cyclosporin A, tiamulin proved to be 1.1 to 8.3 times more efficient in sensitizing the resistant cell lines. Moreover, when given i.p. (1.6 microg/mg body weight), tiamulin increased the survival rate of adriamycin-treated mice bearing the P388/ADR25 tumor line by 29%. In the presence of an anticancer drug, tiamulin inhibited both ATPase and drug transport activities of Pgp in plasma membranes from tumor cells. Tiamulin is thus a potent chemosensitizer that antagonizes the Pgp-mediated chemoresistance in many tumor cell lines expressing the MDR phenotype at different levels and displays no toxic effects on contractile tissues at active doses, therefore providing the promise for potential clinical applications.

  2. Phenotypic and molecular characteristics of Staphylococcus aureus and methicillin-resistant Staphylococcus aureus in slaughterhouse pig-related workers and control workers in Guangdong Province, China.

    Science.gov (United States)

    Wang, X L; Li, L; Li, S M; Huang, J Y; Fan, Y P; Yao, Z J; Ye, X H; Chen, S D

    2017-07-01

    Pig farmers and veterinarians have high prevalence of methicillin-resistant Staphylococcus aureus (MRSA) due to the occupational livestock exposure, while few reported this association on slaughterhouse workers. We conducted this cross-sectional study to explore the phenotypic and molecular characteristics of S. aureus and MRSA in slaughterhouse pig-related workers and control workers in Guangdong Province, China. Participants were interviewed and provided two nasal swabs. Swabs were tested for S. aureus, and isolates were further tested for antimicrobial susceptibility, virulence genes and multi-locus sequence typing. Compared with control workers, pig-related workers have significantly higher prevalence of MRSA carriage (adjusted odd ratio (aOR) 3·70, 95% CI 1·63-8·40). The proportions of MRSA resistant to clindamycin, erythromycin, tetracycline or chloromycetin were significantly higher in pig-related workers than in control workers. The predominant phenotypes of S. aureus were resistant to penicillin, clindamycin, erythromycin and tetracycline. Three MRSA CC9 isolates with livestock-associated characteristics (resistance to tetracycline and absence of immune evasion cluster (IEC) genes) were detected in pig-related workers but not in control workers. For human-associated CCs (CC7, CC59, CC6, and CC188), there was no significant difference in IEC profile or antimicrobial resistance between the groups. These findings reveal that there may be a potential risk for livestock-to-human transmission of LA-MRSA and human-to-human transmission of human-associated MRSA.

  3. Is it the resistance training itself or the combined associated weight loss that improves the metabolic syndrome-related phenotypes in postmenopausal women?

    Directory of Open Access Journals (Sweden)

    Soyluk O

    2015-10-01

    Full Text Available Ozlem Soyluk,1 Gulistan Bahat21Division of Endocrinology and Metabolism, Department of Internal Medicine, Istanbul Medical School, Istanbul University, Capa, Istanbul, Turkey; 2Division of Geriatrics, Department of Internal Medicine, Istanbul Medical School, Istanbul University, Capa, Istanbul, TurkeyWe read the article entitled “Resistance training improves isokinetic strength and metabolic syndrome-related phenotypes in postmenopausal women” by Oliveira et al1 with great interest. In the study, the authors examined the effects of 12 weeks of resistance training (RT on metabolic syndrome-related phenotypes in postmenopausal women. They reported that total cholesterol, low-density lipoprotein cholesterol levels, total cholesterol/high-density lipoprotein cholesterol ratio, blood glucose, basal insulin, and homeostatic model assessment of insulin resistance were all significantly reduced with RT (P<0.01. Accordingly, they concluded that a 12-week progressive RT program induces beneficial alterations on metabolic syndrome-related phenotypes in postmenopausal women. View original paper by Oliveira and colleagues.

  4. Specificity of drug transport mediated by CaMDR1: a major facilitator ...

    Indian Academy of Sciences (India)

    Unknown

    CaMDR1 encodes a major facilitator superfamily (MFS) protein in Candida albicans whose expression has been linked to .... by plaque assay and the integration of CaMDR1 at the ... with recombinant virus, vAcCaMDR1 and cells infected.

  5. Frequency of the cancer-resistant phenotype in SR/CR mice and the effect of litter seriation

    DEFF Research Database (Denmark)

    Koch, Janne; Boschian, Anna; Hau, Jann

    2008-01-01

    . The frequency of the SR/CR phenotype in the present study was 30% for the BALB/c strain and 22% for the C57BL/6 strain in the first litters, but the overall frequency was 8% for both strains. A frequency of about 30% was reported in the original US colony. A litter seriation effect on the frequency of the SR....../CR phenotype was recorded. The phenotype frequency in the first-born litters was similar to that recorded in the founder colony in the US. There was no significant difference in the frequency of the SR/CR phenotype between the two genders, but the overall frequency of the SR/CR phenotype was significantly...

  6. Clinical and programmatic considerations in the treatment of MDR-TB in children: a series of 16 patients from Lima, Peru.

    Science.gov (United States)

    Mukherjee, J S; Joseph, J K; Rich, M L; Shin, S S; Furin, J J; Seung, K J; Sloutsky, A; Socci, A R; Vanderwarker, C; Vasquez, L; Palacios, E; Guerra, D; Viru, F A; Farmer, P; Del Castillo, H E

    2003-07-01

    Since 2000, the directly observed treatment, short-course (DOTS) strategy has been expanded in several countries to include treatment of multidrug-resistant tuberculosis (MDR-TB). This strategy is known as DOTS-Plus. Tuberculosis is a common cause of morbidity and mortality for children throughout the developing world. Children may also be infected with MDR-TB, yet most developing countries do not specifically address pediatric MDR-TB. To present the intermediate outcomes of the first 16 children enrolled in the Peruvian DOTS-Plus program and to demonstrate the tolerability of second-line anti-tuberculosis drugs. Three children completed therapy and are cured, one child had bacteriologic and clinical failure after 12 months of therapy and died of respiratory insufficiency, and 12 have intermediate outcomes demonstrating favorable clinical, bacteriologic, and radiographic evidence of improvement after 9-19 months of therapy. Of the 16 pediatric DOTS-Plus patients, 15 have tolerated therapy well and have had favorable clinical evolution. However, the diagnosis of pediatric MDR-TB is often extremely delayed due to reliance on the adult case definition and should be changed to prevent progressive, chronic illness in such children. Programmatic changes could facilitate earlier diagnosis and treatment of pediatric MDR-TB in Peru and in other DOTS-Plus programs.

  7. Risk factors for MDR and XDR-TB in a tertiary referral hospital in India.

    Directory of Open Access Journals (Sweden)

    V Balaji

    Full Text Available BACKGROUND: India has a high burden of drug resistant TB, although there are few data on XDR-TB. Although XDR-TB has existed previously in India, the definition has not been widely applied, and surveillance using second line drug susceptibility testing has not been performed. Our objective was to analyze clinical and demographic risk factors associated with isolation of MDR and XDR TB as compared to susceptible controls, at a tertiary center. METHODOLOGY/FINDINGS: Retrospective chart review based on positive cultures isolated in a high volume mycobacteriology laboratory between 2002 and 2007. 47 XDR, 30 MDR and 117 susceptible controls were examined. Drug resistant cases were less likely to be extrapulmonary, and had received more previous treatment regimens. Significant risk factors for XDR-TB included residence outside the local state (OR 7.43, 3.07-18.0 and care costs subsidized (OR 0.23, 0.097-0.54 in bivariate analysis and previous use of a fluoroquinolone and injectable agent (other than streptomycin (OR 7.00, 95% C.I. 1.14-43.03 and an initial treatment regimen which did not follow national guidelines (OR 5.68, 1.24-25.96 in multivariate analysis. Cavitation and HIV did not influence drug resistance. CONCLUSIONS/SIGNIFICANCE: There is significant selection bias in the sample available. Selection pressure from previous treatment and an inadequate initial regimen increases risk of drug resistance. Local patients and those requiring financial subsidies may be at lower risk of XDR-TB.

  8. Emergence of multidrug-resistant Acinetobacter baumannii producing OXA-23 Carbapenemase in Qatar

    Directory of Open Access Journals (Sweden)

    J.-M. Rolain

    2016-05-01

    Full Text Available The objective of our study was to describe the molecular support of carbapenem resistance from randomly selected clinical isolates of multidrug-resistant (MDR Acinetobacter baumannii as a pilot study from the Hamad Medical Corporation (HMC, Qatar. Results of our report will be used to study carbapenemases using molecular techniques in all isolated MDR A. baumannii. Forty-eight MDR A. baumannii were randomly selected from isolates preserved at HMC. Identification of all isolates was confirmed by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. Antibiotic resistance was tested phenotypically by Phoenix and confirmed by Etest. The molecular support of carbapenemases (blaOXA-23, blaOXA-24, blaOXA-58, blaNDM was investigated by real-time PCR. The epidemiologic relatedness of the isolates was verified by phylogenetic analysis based on partial sequences of CsuE and blaOXA-51 genes. All 48 isolates were identified as A. baumannii and were confirmed to be resistant to most antibiotics, especially meropenem, imipenems, ciprofloxacin, levofloxacin, amikacin, gentamicin and most of the β-lactams; they were sensitive to colistin. All the isolates were positive for blaOXA-23 and negative for the other tested carbapenemase genes. Clonality analysis demonstrated that different lineages were actually circulating in Qatar; and we suggest that an outbreak occurred in the medical intensive care unit of HMC between 2011 and 2012. Here we report the emergence of MDR A. baumannii producing the carbapenemase OXA-23 in Qatar.

  9. Methylation of WTH3, a possible drug resistant gene, inhibits p53 regulated expression

    International Nuclear Information System (INIS)

    Tian, Kegui; Wang, Yuezeng; Huang, Yu; Sun, Boqiao; Li, Yuxin; Xu, Haopeng

    2008-01-01

    Previous results showed that over-expression of the WTH3 gene in MDR cells reduced MDR1 gene expression and converted their resistance to sensitivity to various anticancer drugs. In addition, the WTH3 gene promoter was hypermethylated in the MCF7/AdrR cell line and primary drug resistant breast cancer epithelial cells. WTH3 was also found to be directly targeted and up regulated by the p53 gene. Furthermore, over expression of the WTH3 gene promoted the apoptotic phenotype in various host cells. To further confirm WTH3's drug resistant related characteristics, we recently employed the small hairpin RNA (shRNA) strategy to knockdown its expression in HEK293 cells. In addition, since the WTH3 promoter's p53-binding site was located in a CpG island that was targeted by methylation, we were interested in testing the possible effect this epigenetic modification had on the p53 transcription factor relative to WTH3 expression. To do so, the in vitro methylation method was utilized to examine the p53 transgene's influence on either the methylated or non-methylated WTH3 promoter. The results generated from the gene knockdown strategy showed that reduction of WTH3 expression increased MDR1 expression and elevated resistance to Doxorubicin as compared to the original control cells. Data produced from the methylation studies demonstrated that DNA methylation adversely affected the positive impact of p53 on WTH3 promoter activity. Taken together, our studies provided further evidence that WTH3 played an important role in MDR development and revealed one of its transcription regulatory mechanisms, DNA methylation, which antagonized p53's positive impact on WTH3 expression

  10. The phenotypic and genotypic characteristics of antibiotic resistance in Escherichia coli populations isolated from farm animals with different exposure to antimicrobial agents.

    Science.gov (United States)

    Mazurek, Justyna; Pusz, Paweł; Bok, Ewa; Stosik, Michał; Baldy-Chudzik, Katarzyna

    2013-01-01

    The aim of the study was to determine the influence of the presence or the absence of antibiotic input on the emergence and maintenance of resistance in commensal bacteria from food producing animals. The research material constituted E. coli isolates from two animal species: swine at different age from one conventional pig farm with antibiotic input in young pigs and from beef and dairy cattle originated from organic breeding farm. The sensitivity to 16 antimicrobial agents was tested, and the presence of 15 resistance genes was examined. In E. coli from swine, the most prevalent resistance was resistance to streptomycin (88.3%), co-trimoxazole (78.8%), tetracycline (57.3%) ampicillin (49.3%) and doxycycline (44.9%) with multiple resistance in the majority. The most commonly observed resistance genes were: bla(TEM) (45.2%), tetA (35.8%), aadA1 (35.0%), sul3 (29.5%), dfrA1 (20.4%). Differences in phenotypes and genotypes of E. coli between young swine undergoing prevention program and the older ones without the antibiotic pressure occurred. A disparate resistance was found in E. coli from cattle: cephalothin (36.9%), cefuroxime (18.9%), doxycycline (8.2%), nitrofurantoin (7.7%), and concerned mainly dairy cows. Among isolates from cattle, multidrug resistance was outnumbered by resistance to one or two antibiotics and the only found gene markers were: bla(SHV), (3.4%), tetA (1.29%), bla(TEM) (0.43%) and tetC (0.43%). The presented outcomes provide evidence that antimicrobial pressure contributes to resistance development, and enteric microflora constitutes an essential reservoir of resistance genes.

  11. Non-p-glycoprotein-mediated multidrug resistance in detransformed rat cells selected for resistance to methylglyoxal bis(guanylhydrazone).

    Science.gov (United States)

    Weber, J M; Sircar, S; Horvath, J; Dion, P

    1989-11-01

    Three independent variants (G2, G4, G5), resistant to methylglyoxal bis(guanylhydrazone), an anticancer drug, have been isolated by single step selection from an adenovirus-transformed rat brain cell line (1). These variants display selective cross-resistance to several natural product drugs of dissimilar structure and action. Multidrug resistance has recently been shown to be caused by overexpression of the membrane-associated p-glycoprotein, most often caused by amplification of the mdr gene. Several types of experiments were conducted to determine whether the observed drug resistance in our cell lines could be due to changes at the mdr locus. The following results were obtained: (a) the mdr locus was not amplified; (b) transcription of the mdr gene and p-glycoprotein synthesis were not increased; (c) multidrug resistance cell lines, which carry an amplified mdr locus, were not cross-resistant to methylglyoxal bis(guanylhydrazone); (d) verapamil did not reverse the resistance of G cells or mdr cells to methylglyoxal bis(guanylhydrazone), nor that of G cells to vincristine; and (e) methylglyoxal bis(guanylhydrazone) resistance was recessive and depended on a block to drug uptake, as opposed to mdr cells which are dominant and express increased drug efflux. The results obtained suggest that the drug resistance in the G2, G4, and G5 cells was atypical and may be due to a mechanism distinct from that mediated by the mdr locus.

  12. Vital and dispensable roles of Plasmodium multidrug resistance transporters during blood- and mosquito-stage development.

    Science.gov (United States)

    Rijpma, Sanna R; van der Velden, Maarten; Annoura, Takeshi; Matz, Joachim M; Kenthirapalan, Sanketha; Kooij, Taco W A; Matuschewski, Kai; van Gemert, Geert-Jan; van de Vegte-Bolmer, Marga; Siebelink-Stoter, Rianne; Graumans, Wouter; Ramesar, Jai; Klop, Onny; Russel, Frans G M; Sauerwein, Robert W; Janse, Chris J; Franke-Fayard, Blandine M; Koenderink, Jan B

    2016-07-01

    Multidrug resistance (MDR) proteins belong to the B subfamily of the ATP Binding Cassette (ABC) transporters, which export a wide range of compounds including pharmaceuticals. In this study, we used reverse genetics to study the role of all seven Plasmodium MDR proteins during the life cycle of malaria parasites. Four P. berghei genes (encoding MDR1, 4, 6 and 7) were refractory to deletion, indicating a vital role during blood stage multiplication and validating them as potential targets for antimalarial drugs. Mutants lacking expression of MDR2, MDR3 and MDR5 were generated in both P. berghei and P. falciparum, indicating a dispensable role for blood stage development. Whereas P. berghei mutants lacking MDR3 and MDR5 had a reduced blood stage multiplication in vivo, blood stage growth of P. falciparum mutants in vitro was not significantly different. Oocyst maturation and sporozoite formation in Plasmodium mutants lacking MDR2 or MDR5 was reduced. Sporozoites of these P. berghei mutants were capable of infecting mice and life cycle completion, indicating the absence of vital roles during liver stage development. Our results demonstrate vital and dispensable roles of MDR proteins during blood stages and an important function in sporogony for MDR2 and MDR5 in both Plasmodium species. © 2016 John Wiley & Sons Ltd.

  13. Cluster-distinguishing genotypic and phenotypic diversity of carbapenem-resistant Gram-negative bacteria in solid-organ transplantation patients: a comparative study.

    Science.gov (United States)

    Karampatakis, Theodoros; Geladari, Anastasia; Politi, Lida; Antachopoulos, Charalampos; Iosifidis, Elias; Tsiatsiou, Olga; Karyoti, Aggeliki; Papanikolaou, Vasileios; Tsakris, Athanassios; Roilides, Emmanuel

    2017-07-31

    Solid-organ transplant recipients may display high rates of colonization and/or infection by multidrug-resistant bacteria. We analysed and compared the phenotypic and genotypic diversity of carbapenem-resistant (CR) strains of Klebsiella pneumoniae, Pseudomonas aeruginosa and Acinetobacter baumannii isolated from patients in the Solid Organ Transplantation department of our hospital. Between March 2012 and August 2013, 56 CR strains from various biological fluids underwent antimicrobial susceptibility testing with VITEK 2, molecular analysis by PCR amplification and genotypic analysis with pulsed-field gel electrophoresis (PFGE). They were clustered according to antimicrobial drug susceptibility and genotypic profiles. Diversity analyses were performed by calculating Simpson's diversity index and applying computed rarefaction curves.Results/Key findings. Among K. pneumoniae, KP-producers predominated (57.1 %). VIM and OXA-23 carbapenemases prevailed among P. aeruginosa and A. baumannii (89.4 and 88.9 %, respectively). KPC-producing K. pneumoniae and OXA-23 A. baumannii were assigned in single PFGE pulsotypes. VIM-producing P. aeruginosa generated multiple pulsotypes. CR K. pneumoniae strains displayed phenotypic diversity in tigecycline, colistin (CS), amikacin (AMK), gentamicin (GEN) and co-trimoxazole (SXT) (16 clusters); P. aeruginosa displayed phenotypic diversity in cefepime (FEP), ceftazidime, aztreonam, piperacillin, piperacillin-tazobactam, AMK, GEN and CS (9 clusters); and A. baumannii displayed phenotypic diversity in AMK, GEN, SXT, FEP, tobramycin and rifampicin (8 clusters). The Simpson diversity indices for the interpretative phenotype and PFGE analysis were 0.89 and 0.6, respectively, for K. pneumoniae strains (P<0.001); 0.77 and 0.6 for P. aeruginosa (P=0.22); and 0.86 and 0.19 for A. baumannii (P=0.004). The presence of different antimicrobial susceptibility profiles does not preclude the possibility that two CR K. pneumoniae or A. baumannii

  14. Differential contributions of five ABC transporters to mutidrug resistance, antioxidion and virulence of Beauveria bassiana, an entomopathogenic fungus.

    Directory of Open Access Journals (Sweden)

    Ting-Ting Song

    Full Text Available Multidrug resistance (MDR confers agrochemical compatibility to fungal cells-based mycoinsecticdes but mechanisms involved in MDR remain poorly understood for entomopathogenic fungi, which have been widely applied as biocontrol agents against arthropod pests. Here we characterized the functions of five ATP-binding cassette (ABC transporters, which were classified to the subfamilies ABC-B (Mdr1, ABC-C (Mrp1 and ABC-G (Pdr1, Pdr2 and Pdr5 and selected from 54 full-size ABC proteins of Beauveria bassiana based on their main domain architecture, membrane topology and transcriptional responses to three antifungal inducers. Disruption of each transporter gene resulted in significant reduction in resistance to four to six of eight fungicides or antifungal drugs tested due to their differences in structure and function. Compared with wild-type and complemented (control strains, disruption mutants of all the five transporter genes became significantly less tolerant to the oxidants menadione and H₂O₂ based on 22-41% and 10-31% reductions of their effective concentrations required for the suppression of 50% colony growth at 25°C. Under a standardized spray, the killing actions of ΔPdr5 and ΔMrp1 mutants against Spodoptera litura second-instar larvae were delayed by 59% and 33% respectively. However, no significant virulence change was observed in three other delta mutants. Taken together, the examined five ABC transporters contribute differentially to not only the fungal MDR but antioxidant capability, a phenotype rarely associated with ABC efflux pumps in previous reports; at least some of them are required for the full virulence of B. bassiana, thereby affecting the fungal biocontrol potential. Our results indicate that ABC pump-dependent MDR mechanisms exist in entomopathogenic fungi as do in yeasts and human and plant pathogenic fungi.

  15. Betulinic Acid Exerts Cytotoxic Activity Against Multidrug-Resistant Tumor Cells via Targeting Autocrine Motility Factor Receptor (AMFR

    Directory of Open Access Journals (Sweden)

    Mohamed E. M. Saeed

    2018-05-01

    Full Text Available Betulinic acid (BetA is a naturally occurring pentacyclic triterpene isolated from the outer bark of white-barked birch trees and many other medicinal plants. Here, we studied betulinic acid's cytotoxic activity against drug-resistant tumor cell lines. P-glycoprotein (MDR1/ABCB1 and BCRP (ABCG2 are known ATP-binding cassette (ABC drug transporters that mediating MDR. ABCB5 is a close relative to ABCB1, which also mediates MDR. Constitutive activation of the EGF receptor is tightly linked to the development of chemotherapeutic resistance. BetA inhibited P-gp, BCRP, ABCB5 and mutation activated EGFR overexpressing cells with similar efficacy as their drug-sensitive parental counterparts. Furthermore, the mRNA expressions of ABCB1, BCRP, ABCB5 and EGFR were not related to the 50% inhibition concentrations (IC50 for BetA in a panel of 60 cell lines of the National Cancer Institute (NCI, USA. In addition to well-established MDR mechanisms, we attempted to identify other molecular mechanisms that play a role in mediating BetA's cytotoxic activity. For this reason, we performed COMPARE and hierarchical cluster analyses of the transcriptome-wide microarray-based mRNA expression of the NCI cell lines panel. Various genes significantly correlating to BetA's activity were involved in different biological processes, e.g., cell cycle regulation, microtubule formation, signal transduction, transcriptional regulation, chromatin remodeling, cell adhesion, tumor suppression, ubiquitination and proteasome degradation. Immunoblotting and in silico analyses revealed that the inhibition of AMFR activity might be one of the mechanisms for BetA to overcome MDR phenotypes. In conclusion, BetA may have therapeutic potential for the treatment of refractory tumors.

  16. Activity of Topical Antimicrobial Agents Against Multidrug-Resistant Bacteria Recovered from Burn Patients

    Science.gov (United States)

    2010-01-01

    Spectrum of activity Pros Cons Resistance/ other Prior studies Bacitracin Polypeptide produced by Bacillus subtilis that inhibits cell wall synthesis and...concentrations (MICs) and zones of inhibition (ZI). Isolates had systemic antibiotic resistance and clonality determined. MDR included resistance to... antibiotics in three or more classes. Results: We assessed 22 ESBL-producing K. pneumoniae, 20 ABC (75% MDR), 20 P. aeruginosa (45% MDR), and 20 MRSA

  17. Multidrug-resistant pathogens in the food supply.

    Science.gov (United States)

    Doyle, Marjorie E

    2015-04-01

    Antimicrobial resistance, including multidrug resistance (MDR), is an increasing problem globally. MDR bacteria are frequently detected in humans and animals from both more- and less-developed countries and pose a serious concern for human health. Infections caused by MDR microbes may increase morbidity and mortality and require use of expensive drugs and prolonged hospitalization. Humans may be exposed to MDR pathogens through exposure to environments at health-care facilities and farms, livestock and companion animals, human food, and exposure to other individuals carrying MDR microbes. The Centers for Disease Control and Prevention classifies drug-resistant foodborne bacteria, including Campylobacter, Salmonella Typhi, nontyphoidal salmonellae, and Shigella, as serious threats. MDR bacteria have been detected in both meat and fresh produce. Salmonellae carrying genes coding for resistance to multiple antibiotics have caused numerous foodborne MDR outbreaks. While there is some level of resistance to antimicrobials in environmental bacteria, the widespread use of antibiotics in medicine and agriculture has driven the selection of a great variety of microbes with resistance to multiple antimicrobials. MDR bacteria on meat may have originated in veterinary health-care settings or on farms where animals are given antibiotics in feed or to treat infections. Fresh produce may be contaminated by irrigation or wash water containing MDR bacteria. Livestock, fruits, and vegetables may also be contaminated by food handlers, farmers, and animal caretakers who carry MDR bacteria. All potential sources of MDR bacteria should be considered and strategies devised to reduce their presence in foods. Surveillance studies have documented increasing trends in MDR in many pathogens, although there are a few reports of the decline of certain multidrug pathogens. Better coordination of surveillance programs and strategies for controlling use of antimicrobials need to be implemented in

  18. Genomic analysis of globally diverse Mycobacterium tuberculosis strains provides insights into emergence and spread of multidrug resistance

    Science.gov (United States)

    Manson, Abigail L.; Cohen, Keira A.; Abeel, Thomas; Desjardins, Christopher A.; Armstrong, Derek T.; Barry, Clifton E.; Brand, Jeannette; Chapman, Sinéad B.; Cho, Sang-Nae; Gabrielian, Andrei; Gomez, James; Jodals, Andreea M.; Joloba, Moses; Jureen, Pontus; Lee, Jong Seok; Malinga, Lesibana; Maiga, Mamoudou; Nordenberg, Dale; Noroc, Ecaterina; Romancenco, Elena; Salazar, Alex; Ssengooba, Willy; Velayati, A. A.; Winglee, Kathryn; Zalutskaya, Aksana; Via, Laura E.; Cassell, Gail H.; Dorman, Susan E.; Ellner, Jerrold; Farnia, Parissa; Galagan, James E.; Rosenthal, Alex; Crudu, Valeriu; Homorodean, Daniela; Hsueh, Po-Ren; Narayanan, Sujatha; Pym, Alexander S.; Skrahina, Alena; Swaminathan, Soumya; Van der Walt, Martie; Alland, David; Bishai, William R.; Cohen, Ted; Hoffner, Sven; Birren, Bruce W.; Earl, Ashlee M.

    2017-01-01

    Multidrug-resistant tuberculosis (MDR-TB), caused by drug resistant strains of Mycobacterium tuberculosis, is an increasingly serious problem worldwide. In this study, we examined a dataset of 5,310 M. tuberculosis whole genome sequences from five continents. Despite great diversity with respect to geographic point of isolation, genetic background and drug resistance, patterns of drug resistance emergence were conserved globally. We have identified harbinger mutations that often precede MDR. In particular, the katG S315T mutation, conferring resistance to isoniazid, overwhelmingly arose before rifampicin resistance across all lineages, geographic regions, and time periods. Molecular diagnostics that include markers for rifampicin resistance alone will be insufficient to identify pre-MDR strains. Incorporating knowledge of pre-MDR polymorphisms, particularly katG S315, into molecular diagnostics will enable targeted treatment of patients with pre-MDR-TB to prevent further development of MDR-TB. PMID:28092681

  19. Consolidating and Exploring Antibiotic Resistance Gene Data Resources

    DEFF Research Database (Denmark)

    Xavier, Basil Britto; Das, Anupam J.; Cochrane, Guy

    2016-01-01

    The unrestricted use of antibiotics has resulted in rapid acquisition of antibiotic resistance (AR) and spread of multidrug-resistant (MDR) bacterial pathogens. With the advent of next-generation sequencing technologies and their application in understanding MDR pathogen dynamics, it has become i...

  20. Phenotypic evaluation and genetic dissection of resistance to Phytophthora sojae in the Chinese soybean mini core collection.

    Science.gov (United States)

    Huang, Jing; Guo, Na; Li, Yinghui; Sun, Jutao; Hu, Guanjun; Zhang, Haipeng; Li, Yanfei; Zhang, Xing; Zhao, Jinming; Xing, Han; Qiu, Lijuan

    2016-06-18

    Phytophthora root and stem rot (PRR) caused by Phytophthora sojae is one of the most serious diseases affecting soybean (Glycine max (L.) Merr.) production all over the world. The most economical and environmentally-friendly way to control the disease is the exploration and utilization of resistant varieties. We screened a soybean mini core collection composed of 224 germplasm accessions for resistance against eleven P. sojae isolates. Soybean accessions from the Southern and Huanghuai regions, especially the Hubei, Jiangsu, Sichuan and Fujian provinces, had the most varied and broadest spectrum of resistance. Based on gene postulation, Rps1b, Rps1c, Rps4, Rps7 and novel resistance genes were identified in resistant accessions. Consequently, association mapping of resistance to each isolate was performed with 1,645 single nucleotide polymorphism (SNP) markers. A total of 14 marker-trait associations for Phytophthora resistance were identified. Among them, four were located in known PRR resistance loci intervals, five were located in other disease resistance quantitative trait locus (QTL) regions, and five associations unmasked novel loci for PRR resistance. In addition, we also identified candidate genes related to resistance. This is the first P. sojae resistance evaluation conducted using the Chinese soybean mini core collection, which is a representative sample of Chinese soybean cultivars. The resistance reaction analyses provided an excellent database of resistant resources and genetic variations for future breeding programs. The SNP markers associated with resistance will facilitate marker-assisted selection (MAS) in breeding programs for resistance to PRR, and the candidate genes may be useful for exploring the mechanism underlying P. sojae resistance.

  1. Phenotypical and biochemical characterisation of resistance for parasitic weed (Orobanche foetida Poir.) in radiation-mutagenised mutants of chickpea.

    Science.gov (United States)

    Brahmi, Ines; Mabrouk, Yassine; Brun, Guillaume; Delavault, Philippe; Belhadj, Omrane; Simier, Philippe

    2016-12-01

    Some radiation-mutagenised chickpea mutants potentially resistant to the broomrape, Orobanche foetida Poir., were selected through field trials. The objectives of this work were to confirm resistance under artificial infestation, in pots and mini-rhizotron systems, and to determine the developmental stages of broomrape affected by resistance and the relevant resistance mechanisms induced by radiation mutagenesis. Among 30 mutants tested for resistance to O. foetida, five shared strong resistance in both pot experiments and mini-rhizotron systems. Resistance was not complete, but the few individuals that escaped resistance displayed high disorders of shoot development. Results demonstrated a 2-3-fold decrease in stimulatory activity of root exudates towards broomrape seed germination in resistant mutants in comparison with non-irradiated control plants and susceptible mutants. Resistance was associated with an induction of broomrape necrosis early during infection. When infested, most of the resistant mutants shared enhanced levels of soluble phenolic contents, phenylalanine ammonia lyase activity, guaiacol peroxidase activity and polyphenol oxidase activity, in addition to glutathione and notably ascorbate peroxidase gene expression in roots. Results confirmed enhanced resistance in chickpea radiation-mutagenised mutants, and demonstrated that resistance is based on alteration of root exudation, presumed cell-wall reinforcement and change in root oxidative status in response to infection. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  2. CHANGES IN THE PREVALENCE OF DRUG RESISTANT TUBERCULOSIS

    Directory of Open Access Journals (Sweden)

    V. B. Galkin

    2017-01-01

    Full Text Available The tendency of tuberculosis prevalence reduction observed in the Russian Federation is mostly related to the cases without multiple drug resistance (MDR. In general the number of MDR TB cases still tends to be increasing in the Russian Federation. Confident long-term reduction is registered only in the Central and North-Western Districts with relatively low level of MDR TB prevalence. From 2017 MDR TB patients are expected to prevail in the structure of the sputum positive cases which surely provides negative impact on the treatment efficiency and epidemic trends. The system of dispensary follow-up allows evaluating the annual number of MDT TB cases and following the ways of its increase and reduction. Taking MDR TB sources on and off the register is less intensive compared to the same flows of non-MDR infectious cases. The number of MDR TB sources is increasing mostly due new tuberculosis cases however acquired MDR TB makes significant contribution to the growth of MDR TB sources number. The increase in the ratio of respiratory MDR TB patients with sputum conversion to those died reflects the success in the improvement of the treatment strategy of MDR TB patients.

  3. Typing Discrepancy Between Phenotypic and Molecular Characterization Revealing an Emerging Biovar 9 Variant of Smooth Phage-Resistant B. abortus Strain 8416 in China.

    Science.gov (United States)

    Kang, Yao-Xia; Li, Xu-Ming; Piao, Dong-Ri; Tian, Guo-Zhong; Jiang, Hai; Jia, En-Hou; Lin, Liang; Cui, Bu-Yun; Chang, Yung-Fu; Guo, Xiao-Kui; Zhu, Yong-Zhang

    2015-01-01

    A newly isolated smooth colony morphology phage-resistant strain 8416 isolated from a 45-year-old cattle farm cleaner with clinical features of brucellosis in China was reported. The most unusual phenotype was its resistance to two Brucella phages Tbilisi and Weybridge, but sensitive to Berkeley 2, a pattern similar to that of Brucella melitensis biovar 1. VITEK 2 biochemical identification system found that both strain 8416 and B. melitensis strains shared positive ILATk, but negative in other B. abortus strains. However, routine biochemical and phenotypic characteristics of strain 8416 were most similar to that of B. abortus biovar 9 except CO2 requirement. In addition, multiple PCR molecular typing assays including AMOS-PCR, B. abortus special PCR (B-ab PCR) and a novel sub-biovar typing PCR, indicated that strain 8416 may belong to either biovar 3b or 9 of B. abortus. Surprisingly, further MLVA typing results showed that strain 8416 was most closely related to B. abortus biovar 3 in the Brucella MLVA database, primarily differing in 4 out of 16 screened loci. Therefore, due to the unusual discrepancy between phenotypic (biochemical reactions and particular phage lysis profile) and molecular typing characteristics, strain 8416 could not be exactly classified to any of the existing B. abortus biovars and might be a new variant of B. abortus biovar 9. The present study also indicates that the present phage typing scheme for Brucella sp. is subject to variation and the routine Brucella biovar typing needs further studies.

  4. Taxonomically-linked growth phenotypes during arsenic stress among arsenic resistant bacteria isolated from soils overlying the Centralia coal seam fire.

    Science.gov (United States)

    Dunivin, Taylor K; Miller, Justine; Shade, Ashley

    2018-01-01

    Arsenic (As), a toxic element, has impacted life since early Earth. Thus, microorganisms have evolved many As resistance and tolerance mechanisms to improve their survival outcomes given As exposure. We isolated As resistant bacteria from Centralia, PA, the site of an underground coal seam fire that has been burning since 1962. From a 57.4°C soil collected from a vent above the fire, we isolated 25 unique aerobic As resistant bacterial strains spanning seven genera. We examined their diversity, resistance gene content, transformation abilities, inhibitory concentrations, and growth phenotypes. Although As concentrations were low at the time of soil collection (2.58 ppm), isolates had high minimum inhibitory concentrations (MICs) of arsenate and arsenite (>300 mM and 20 mM respectively), and most isolates were capable of arsenate reduction. We screened isolates (PCR and sequencing) using 12 published primer sets for six As resistance genes (AsRGs). Genes encoding arsenate reductase (arsC) and arsenite efflux pumps (arsB, ACR3(2)) were present, and phylogenetic incongruence between 16S rRNA genes and AsRGs provided evidence for horizontal gene transfer. A detailed investigation of differences in isolate growth phenotypes across As concentrations (lag time to exponential growth, maximum growth rate, and maximum OD590) showed a relationship with taxonomy, providing information that could help to predict an isolate's performance given As exposure in situ. Our results suggest that microbiological management and remediation of environmental As could be informed by taxonomically-linked As tolerance, potential for resistance gene transferability, and the rare biosphere.

  5. Motility in the L3 stage is a poor phenotype for detecting and measuring resistance to avermectin/milbemycin drugs in gastrointestinal nematodes of livestock

    Directory of Open Access Journals (Sweden)

    Melissa M. George

    2018-04-01

    Full Text Available Motility is a commonly used in vitro phenotype for assessing anthelmintic activity of candidate compounds, and for detecting anthelmintic resistance in nematodes. Third-stage larvae (L3 of parasitic nematodes are commonly used in motility-based assays because L3 are simple to obtain and can remain viable in storage for extended periods. To improve the measurement of motility of microscopic stages of nematodes, our laboratory developed the Worminator, which quantitatively measures motility of parasites. Using the Worminator, we compared the dose-response characteristics of several avermectin/milbemycin (AM compounds using L3 from both AM-susceptible and AM-resistant Cooperia spp. (abamectin, doramectin, eprinomectin, ivermectin, moxidectin and Haemonchus contortus (eprinomectin, ivermectin, moxidectin. Concentrations tested with the Worminator ranged from 0.156 to 40 μM. Differences in EC50 between AM-susceptible and AM-resistant isolates of Cooperia spp. and Haemonchus contortus were small, with resistance ratios ranging from 1.00 to 1.34 for Cooperia spp., 0.99 to 1.65 for Haemonchus contortus. Larval migration inhibition assays were conducted using the same isolates and were equally ineffective for detection of resistance with resistance ratios less than 2.0. These results contrast with those of the Larval Development Assay where we obtained a resistance ratio of 16.48 using the same isolates of Haemonchus contortus. Moreover, even at the highest concentration tested (40 μM, 100% inhibition of motility was never achieved and EC50 for Worminator assays were more than 100× higher than peak plasma levels achieved in vivo following treatment. These data demonstrate that dose-response characteristics for inhibition of motility in L3 of gastrointestinal nematodes of livestock do not significantly differ for AM-susceptible and AM-resistant isolates. These data challenge the suitability of motility as a phenotype for detecting and measuring

  6. Replicative phenotyping adds value to genotypic resistance testing in heavily pre-treated HIV-infected individuals - the Swiss HIV Cohort Study

    Directory of Open Access Journals (Sweden)

    Martinetti Gladys

    2011-01-01

    Full Text Available Abstract Background Replicative phenotypic HIV resistance testing (rPRT uses recombinant infectious virus to measure viral replication in the presence of antiretroviral drugs. Due to its high sensitivity of detection of viral minorities and its dissecting power for complex viral resistance patterns and mixed virus populations rPRT might help to improve HIV resistance diagnostics, particularly for patients with multiple drug failures. The aim was to investigate whether the addition of rPRT to genotypic resistance testing (GRT compared to GRT alone is beneficial for obtaining a virological response in heavily pre-treated HIV-infected patients. Methods Patients with resistance tests between 2002 and 2006 were followed within the Swiss HIV Cohort Study (SHCS. We assessed patients' virological success after their antiretroviral therapy was switched following resistance testing. Multilevel logistic regression models with SHCS centre as a random effect were used to investigate the association between the type of resistance test and virological response (HIV-1 RNA Results Of 1158 individuals with resistance tests 221 with GRT+rPRT and 937 with GRT were eligible for analysis. Overall virological response rates were 85.1% for GRT+rPRT and 81.4% for GRT. In the subgroup of patients with >2 previous failures, the odds ratio (OR for virological response of GRT+rPRT compared to GRT was 1.45 (95% CI 1.00-2.09. Multivariate analyses indicate a significant improvement with GRT+rPRT compared to GRT alone (OR 1.68, 95% CI 1.31-2.15. Conclusions In heavily pre-treated patients rPRT-based resistance information adds benefit, contributing to a higher rate of treatment success.

  7. Malnutrition associated with unfavorable outcome and death among South African MDR-TB and HIV co-infected children.

    Science.gov (United States)

    Hicks, R M; Padayatchi, N; Shah, N S; Wolf, A; Werner, L; Sunkari, V B; O'Donnell, M R

    2014-09-01

    Pediatric multidrug-resistant tuberculosis (MDR-TB) is complicated by difficult diagnosis, complex treatment, and high mortality. In South Africa, these challenges are amplified by human immunodeficiency virus (HIV) co-infection; however, evidence on treatment outcomes among co-infected children is limited. Using conventional and new pediatric definitions, to describe treatment outcomes and identify risk factors for unfavorable outcome and mortality in children aged children (median age 8 years, IQR 4-12) with MDR-TB (n = 78) or XDR-TB (n = 6) initiated treatment. Sixty-four (77%) were HIV-positive and 62 (97%) received antiretroviral therapy. Sixty-six (79%) achieved favorable treatment outcomes. Overall mortality was 11% (n = 9) at 18 months after initiation of treatment. Malnutrition (aOR 27.4, 95%CI 2.7-278.7) and severe radiographic findings (aOR 4.68, 95%CI 1.01-21.9) were associated with unfavorable outcome. New pediatric outcome definitions increased the proportion classified as cured. It is possible to successfully treat pediatric MDR-TB-HIV even in resource-poor settings. Malnutrition is a marker for severe TB-HIV disease, and is a potential target for future interventions in these patients.

  8. Comparison of Chemical Sensitivity of Fresh and Long-Stored Heat Resistant Neosartorya fischeri Environmental Isolates Using BIOLOG Phenotype MicroArray System.

    Directory of Open Access Journals (Sweden)

    Jacek Panek

    Full Text Available Spoilage of heat processed food and beverage by heat resistant fungi (HRF is a major problem for food industry in many countries. Neosartorya fischeri is the leading source of spoilage in thermally processed products. Its resistance to heat processing and toxigenicity makes studies about Neosartorya fischeri metabolism and chemical sensitivity essential. In this study chemical sensitivity of two environmental Neosartorya fischeri isolates were compared. One was isolated from canned apples in 1923 (DSM3700, the other from thermal processed strawberry product in 2012 (KC179765, used as long-stored and fresh isolate, respectively. The study was conducted using Biolog Phenotype MicroArray platforms of chemical sensitivity panel and traditional hole-plate method. The study allowed for obtaining data about Neosartorya fischeri growth inhibitors. The fresh isolate appeared to be much more resistant to chemical agents than the long-stored isolate. Based on phenotype microarray assay nitrogen compounds, toxic cations and membrane function compounds were the most effective in growth inhibition of N. fischeri isolates. According to the study zaragozic acid A, thallium(I acetate and sodium selenate were potent and promising N. fischeri oriented fungicides which was confirmed by both chemical sensitivity microplates panel and traditional hole-plate methods.

  9. Antibacterial effect of silver nanoparticles and capsaicin against MDR-ESBL producing Escherichia coli: An in vitro study

    Directory of Open Access Journals (Sweden)

    Debasish Kar

    2016-10-01

    Full Text Available Objective: To evaluate the antibacterial property of silver nanoparticles (AgNPs and capsaicin against multidrug resistant (MDR and extended spectrum beta-lactamase (ESBL producing Escherichia coli of bovine and poultry origin. Methods: Antibacterial efficacy of AgNPs and capsaicin was measured using broth dilution method. Five MDR-ESBL producing E. coli isolates of poultry (PEC4, PEC6, PEC15 and PEC16 and cattle mastitis origin (MEC2 were taken to evaluate the antibacterial effect of AgNPs and capsaicin. Results: At 50 mmol/L AgNPs, the viability of MDR of bacterial pathogens was reduced to almost 80%–90% and at 1000 mmol/L, the viability went down to 0%–3%. The minimum inhibitory concentration (MIC50 of AgNPs against these MDR-ESBL producing isolates was found to vary between 172–218 mmol/L whereas the MIC80 varied between 450–640 mmol/L. Capsaicin showed more prominent bactericidal effect and only at 2.5 mmol/L concentration, the viability was shown to be reduced by 20%–35% whereas at 7.5 mmol/L concentration, there was approximately 60% reduction in viability. Further at 25 mmol/L concentration, the viability was reduced to 0%–8%. The MIC50 and MIC80 of capsaicin against these MDRESBL producing isolates were found to vary between 4.6–7.5 mmol/L and 10.9–16.9 mmol/L, respectively. Conclusions: The results point out that capsaicin and AgNPs could be of use in treating ESBL infection.

  10. Motility in the L3 stage is a poor phenotype for detecting and measuring resistance to avermectin/milbemycin drugs in gastrointestinal nematodes of livestock.

    Science.gov (United States)

    George, Melissa M; Lopez-Soberal, Lorraine; Storey, Bob E; Howell, Sue B; Kaplan, Ray M

    2018-04-01

    Motility is a commonly used in vitro phenotype for assessing anthelmintic activity of candidate compounds, and for detecting anthelmintic resistance in nematodes. Third-stage larvae (L3) of parasitic nematodes are commonly used in motility-based assays because L3 are simple to obtain and can remain viable in storage for extended periods. To improve the measurement of motility of microscopic stages of nematodes, our laboratory developed the Worminator, which quantitatively measures motility of parasites. Using the Worminator, we compared the dose-response characteristics of several avermectin/milbemycin (AM) compounds using L3 from both AM-susceptible and AM-resistant Cooperia spp. (abamectin, doramectin, eprinomectin, ivermectin, moxidectin) and Haemonchus contortus (eprinomectin, ivermectin, moxidectin). Concentrations tested with the Worminator ranged from 0.156 to 40 μM. Differences in EC 50 between AM-susceptible and AM-resistant isolates of Cooperia spp. and Haemonchus contortus were small, with resistance ratios ranging from 1.00 to 1.34 for Cooperia spp., 0.99 to 1.65 for Haemonchus contortus. Larval migration inhibition assays were conducted using the same isolates and were equally ineffective for detection of resistance with resistance ratios less than 2.0. These results contrast with those of the Larval Development Assay where we obtained a resistance ratio of 16.48 using the same isolates of Haemonchus contortus. Moreover, even at the highest concentration tested (40 μM), 100% inhibition of motility was never achieved and EC 50 for Worminator assays were more than 100× higher than peak plasma levels achieved in vivo following treatment. These data demonstrate that dose-response characteristics for inhibition of motility in L3 of gastrointestinal nematodes of livestock do not significantly differ for AM-susceptible and AM-resistant isolates. These data challenge the suitability of motility as a phenotype for detecting and measuring resistance to AM

  11. In vitro antibacterial activity of crude extracts of 9 selected medicinal plants against UTI causing MDR bacteria

    Directory of Open Access Journals (Sweden)

    Monali P. Mishra

    2017-01-01

    Full Text Available Urinary tract infection (UTI has become a more grievous problem today, due to multidrug resistance of infecting Gram-positive (GP and Gram-negative (GN bacteria, sometimes even with multiple infections. This study examines effectivity of 9 tropical flowering plants (Anogeissus acuminata, Azadirachta indica, Bauhinia variegata, Boerhaavia diffusa, Punica granatum, Soymida febrifuga, Terminalia chebula, Tinospora cordifolia and Tribulus terrestris for possible use as source of antimicrobials for multidrug resistant (MDR bacteria, along with main-stream antibiotics. Pathogenic bacteria were isolated from urine samples of patients attending and admitted in the hospital. Antibiograms of 11 isolated bacteria (GPs, Enterococcus faecalis and Staphylococcus aureus; and GNs, Acinetobacter baumannii, Citrobacter freundii, Enterobacter aerogenes, Escherichia coli, Klebsiella oxytoca, Klebsiella pneumoniae, Proteus mirabilis, Proteus vulgaris and Pseudomonas aeruginosa were ascertained by the disc-diffusion method, and antibacterial effectivity of plant extracts was monitored by the agar-well diffusion method. Isolated bacteria were floridly MDR to most antibiotics of the day. Methanol extracts of 9 plants were used, and extracts of 3 plants, A. acuminata, P. granatum and S. febrifuga at least caused 25–29 mm as the maximum size of zone of inhibition on bacterial lawns. Minimum inhibitory concentration (MIC and minimum bactericidal concentration (MBC values of methanol extracts of 9 plants were recorded. The methanol extract of A. acuminata had 0.29 mg/ml as the lowest MIC value and 0.67 mg/ml as the lowest MBC value, against MDR S. aureus, signifying effectivity; but, it had the highest MIC value of 3.41 mg/ml. and the highest MBC value of 4.27 mg/ml for most other MDR bacteria including E. coli. Qualitative phytochemical analysis was done for these 9 plants and information on leading phytochemicals was presented retrieved from PubChem database. Thus

  12. PfMDR2 and PfMDR5 are dispensable for Plasmodium falciparum asexual parasite multiplication but change in vitro susceptibility to anti-malarial drugs

    NARCIS (Netherlands)

    Velden, M. van der; Rijpma, S.R.; Russel, F.G.M.; Sauerwein, R.W.; Koenderink, J.B.

    2015-01-01

    BACKGROUND: Membrane-associated ATP binding cassette (ABC) transport proteins hydrolyze ATP in order to translocate a broad spectrum of substrates, from single ions to macromolecules across membranes. In humans, members from this transport family have been linked to drug resistance phenotypes, e.g.,

  13. Expression of P-glycoprotein and multidrug resistance associated protein in Ehrlich ascites tumor cells after fractionated irradiation

    International Nuclear Information System (INIS)

    Nielsen, Dorte; Maare, Christian; Eriksen, Jens; Litman, Thomas; Skovsgaard, Torben

    2001-01-01

    Purpose: To characterize irradiated murine tumor cells with respect to drug resistance, drug kinetics, and ATPase activity, and to evaluate the possible role of P-glycoprotein (PGP) and murine multidrug resistance associated protein (Mrp1) in the drug-resistant phenotype of these cells. Methods and Materials: Sensitive Ehrlich ascites tumor cells (EHR2) were in vitro exposed to fractionated irradiation (60 Gy). Western blot analysis was performed for determination of PGP and Mrp1, reverse transcriptase-polymerase chain reaction (RT-PCR) for determination of mdr1a + b mRNA, and semiquantitative RT-PCR for Mrp1 mRNA. The clonogenic assay was applied to investigate sensitivity, whereas the steady-state drug accumulation of daunorubicin (DNR), 3 H-vincristine (VCR), and 3 H-etoposide (VP16) was measured by spectrofluorometry and scintillation counting, respectively. For determining of ATPase activity, the release of inorganic phosphate from ATP was quantified using a colorimetric method. Results: Compared with EHR2, the irradiated cell line EHR2/irr showed increased expression of PGP (threefold), Mrp1 (eightfold), and Mrp1 mRNA (sixfold), and a slight reduction of mdr1b mRNA, whereas mdr1a was present in EHR2 but could not be detected in EHR2/irr. EHR2/irr developed sixfold resistance to VP16, twofold resistance to vincristine, but remained sensitive to DNR. Addition of the PGP inhibitor, verapamil (VER) or depletion of glutathione by buthionine sulfoximine (BSO) partly reversed the resistance in EHR2/irr. In EHR2/irr, the steady-state accumulation of 3 H-VCR and 3 H-VP16 was significantly decreased as compared with EHR2, whereas the accumulation of DNR was unchanged. The ATPase activity of plasma membrane vesicles prepared from EHR2/irr cells was similar to that of wild-type EHR2 cells. The ATPase activity was neither stimulated by vinblastine nor VER. Conclusion: Irradiation induced a multidrug-resistant phenotype in sensitive tumor cells. This phenotype was

  14. Importancia pronóstica de la expresión de MDR-1 en la leucemia mieloblástica aguda

    Directory of Open Access Journals (Sweden)

    J. Arbelbide

    2003-08-01

    Full Text Available Una proporción importante de pacientes con leucemia mieloblástica aguda (LMA presentan recaída o resistencia con el tratamiento. Uno de los mecanismos involucrados en la resistencia a drogas, es la presencia de la glicoproteína P 170 (gp-P 170 resultante de la expresión del gen MDR-1 sobre las células leucémicas. El objetivo de este trabajo es valorar el impacto pronóstico de la expresión de MDR-1 en una población de pacientes tratados por LMA. Se evaluó retrospectivamente la expresión de MDR-1 en una cohorte de 55 pacientes con LMA, mayores de 16 años, que recibieron tratamiento quimioterápico desde 1990 hasta el 2000. Se evaluó sobre biopsia de médula ósea, la expresión de MDR-1/gp-P 170 por inmunohistoquímica. Mediante una curva ROC, se estableció que una expresión de MDR-1 > 50% en células blásticas, resultó significativa para el logro de remisión completa. Esta expresión de MDR-1+ correlacionó con la presencia de leucocitosis: (p:0.002, expresion de células CD34+ (p:0.006, menor tasa de remisión completa (p:0.001, mayor tasa de recaída (p:0.02 y de estudios citogenéticos no favorables (p:0.02. La SLE fue de 21.2% ES:9.3 con un seguimiento de 22 meses para el grupo MDR-1+ versus 56.4% ES:12.5 con un seguimiento de 78 meses en los casos MDR-1- (p:0.007. Se puede concluir que la expresion de MDR-1 ha demostrado ser un factor pronóstico de resistencia a la quimioterapia. Estos pacientes presentan una menor tasa de remisión completa, una mayor tasa de recaída por persistencia de enfermedad residual post-tratamiento, lo que produce una menor sobrevida global.An important number of patients with Acute Myeloid Leukemia (AML experience relapse or resistance to chemotherapy. One of the mechanisms involved in this resistance is the presence of glycoprotein P170 (gp-P 170, which results of the MDR-1 gene in leukemic cells. The objective of this article is to assess the prognostic impact of the expression of MDR-1 in a

  15. Profiles of phenotype resistance to antibiotic other than β-lactams in Klebsiella pneumoniae ESBLs-producers, carrying blaSHV genes

    Directory of Open Access Journals (Sweden)

    Pawel Sacha

    2010-04-01

    Full Text Available Extended spectrum β-lactamases production is one of the most common mechanism of resistance to extendedspectrum β-lactam antibiotics is increasing worldwide. Twenty five strains of Klebsiella pneumoniae isolated from clinicalspecimens were tested. Based on the phenotypic confirmatory test all these strains were defined as ESBL producers namedESBL(+. The plasmid DNA from each strains was used to investigate the presence of blaSHV genes responsible for extendedspectrum β-lactamases production. Moreover, susceptibility of these strains to antibiotic other than β-lactams in was tested.

  16. Resident cats in small animal veterinary hospitals carry multi-drug resistant enterococci and are likely involved in cross-contamination of the hospital environment

    Directory of Open Access Journals (Sweden)

    Anuradha eGhosh

    2012-02-01

    Full Text Available In the U.S., small animal veterinary hospitals (SAVHs commonly keep resident cats living permanently as pets within their facilities. Previously, multi-drug resistant (MDR enterococci were found as a contaminant of multiple surfaces within such veterinary hospitals, and nosocomial infections are a concern. The objectives of this study were to determine whether resident cats carry MDR enterococci and if they potentially play a role in the contamination of the hospital environment. Enterococcal strains (n=180 were isolated from the feces of six healthy resident cats from different SAVHs. The concentration of enterococci ranged from 1.1 x 105 to 6.0 x 108 CFU g-1 of feces, and the population comprised E. hirae (38.3±18.6%, E. faecium (35.0±14.3%, E. faecalis (23.9±11.0%, and E. avium (2.8±2.2%. Testing of phenotypic resistance to 14 antimicrobial agents revealed multi-drug resistance (≥3 antimicrobials in 48.9% of all enterococcal isolates with most frequent resistance to tetracycline (72.8%, erythromycin (47.8%, and rifampicin (35.6%. Vancomycin resistant E. faecalis (3.9% with vanB not horizontally transferable in in vitro conjugation assays were detected from one cat. Genotyping (pulsed-field gel electrophoresis demonstrated a host-specific clonal population of MDR E. faecalis and E. faecium. Importantly, several feline isolates were genotypically identical or closely related to isolates from surfaces of cage door, thermometer, and stethoscope of the corresponding SAVHs. These data demonstrate that healthy resident cats at SAVHs carry MDR enterococci and likely contribute to contamination of the SAVH environment. Proper disposal and handling of fecal material and restricted movement of resident cats within the ward is recommended.

  17. Direct nitrate reductase assay versus microscopic observation drug susceptibility test for rapid detection of MDR-TB in Uganda.

    Directory of Open Access Journals (Sweden)

    Freddie Bwanga

    Full Text Available The most common method for detection of drug resistant (DR TB in resource-limited settings (RLSs is indirect susceptibility testing on Lowenstein-Jensen medium (LJ which is very time consuming with results available only after 2-3 months. Effective therapy of DR TB is therefore markedly delayed and patients can transmit resistant strains. Rapid and accurate tests suitable for RLSs in the diagnosis of DR TB are thus highly needed. In this study we compared two direct techniques--Nitrate Reductase Assay (NRA and Microscopic Observation Drug Susceptibility (MODS for rapid detection of MDR-TB in a high burden RLS. The sensitivity, specificity, and proportion of interpretable results were studied. Smear positive sputum was collected from 245 consecutive re-treatment TB patients attending a TB clinic in Kampala, Uganda. Samples were processed at the national reference laboratory and tested for susceptibility to rifampicin and isoniazid with direct NRA, direct MODS and the indirect LJ proportion method as reference. A total of 229 specimens were confirmed as M. tuberculosis, of these interpretable results were obtained in 217 (95% with either the NRA or MODS. Sensitivity, specificity and kappa agreement for MDR-TB diagnosis was 97%, 98% and 0.93 with the NRA; and 87%, 95% and 0.78 with the MODS, respectively. The median time to results was 10, 7 and 64 days with NRA, MODS and the reference technique, respectively. The cost of laboratory supplies per sample was low, around 5 USD, for the rapid tests. The direct NRA and MODS offered rapid detection of resistance almost eight weeks earlier than with the reference method. In the study settings, the direct NRA was highly sensitive and specific. We consider it to have a strong potential for timely detection of MDR-TB in RLS.

  18. High prevalence of the PER-1 gene among carbapenem-resistant Acinetobacter baumannii in Riyadh, Saudi Arabia.

    Science.gov (United States)

    Aly, M M; Abu Alsoud, N M; Elrobh, M S; Al Johani, S M; Balkhy, H H

    2016-11-01

    The prevalence of carbapenem-resistant Acinetobacter baumannii in Saudi Arabia and their resistance genetic mechanisms are yet to be identified. We studied the prevalence and genetic diversity of extended-spectrum beta-lactamase genes, particularly the PER-1 gene, among carbapenem-resistant A. baumannii strains from patients at a tertiary care hospital in Riyadh, Saudi Arabia between 2006 and 2014. Fresh subcultured samples were tested for antimicrobial susceptibility minimum inhibitory concentration (MIC). Total genomic DNA was extracted from each isolate and further used for polymerase chain reaction (PCR) genotyping, sequence-based typing (SBT) of PER-1 and OXA-51-like gene, and multilocus sequence typing (MLST) of positive isolates. Randomly selected clinical isolates (n = 100) were subjected to MLST. A total of 503 isolates were characterized as multidrug-resistant (MDR) using the MIC. Isolates were further PCR tested for bla -TEM and bla -PER-1 resistance genes (n = 503). The genotyping results showed that 68/503 (14 %) isolates were positive to bla TEM. The genotyping results of PER-1-like genes showed that 384/503 (76.3 %) were positive among MDR Acinetobacter isolates. Based on SBT, the majority of these isolates were clustered into three main groups including isolates harboring PER-1: AB11 (bla -PER-1 ), isolate AB16 (bla -PER-1 ), and, finally, the plasmid pAB154 (bla -PER-7 ). Remarkably, many isolates were concealing the PER-1 gene and harboring the TEM resistance genes as well. MLST results for selected isolates (n = 100) identified four main sequence types (STs: 2, 19, 20, and 25) and four novel isolates (ST 486-489). We report 76.3 % prevalence of the PER-1 resistance gene among Acinetobacter clinical isolates from Riyadh, Saudi Arabia. Further work is needed to explore the clinical risks and patient outcome with such resistance related to healthcare-associated infections and investigate the genetic and molecular mechanisms that confer the MDR

  19. Phenotypic and molecular characterization of antimicrobial resistance and virulence factors in Pseudomonas aeruginosa clinical isolates from Recife, State of Pernambuco, Brazil

    Directory of Open Access Journals (Sweden)

    Paula Regina Luna de Araújo Jácome

    2012-12-01

    Full Text Available INTRODUCTION: The emergence of carbapenem resistance mechanisms in Pseudomonas aeruginosa has been outstanding due to the wide spectrum of antimicrobial degradation of these bacteria, reducing of therapeutic options. METHODS: Sixty-one clinical strains of P. aeruginosa isolated from five public hospitals in Recife, Pernambuco, Brazil, were examined between 2006 and 2010, aiming of evaluating the profiles of virulence, resistance to antimicrobials, presence of metallo-β-lactamase (MBL genes, and clonal relationship among isolates. RESULTS: A high percentage of virulence factors (34.4% mucoid colonies; 70.5% pyocyanin; 93.4% gelatinase positives; and 72.1% hemolysin positive and a high percentage of antimicrobial resistance rates (4.9% pan-resistant and 54.1% multi-drug resistant isolates were observed. Among the 29 isolates resistant to imipenem and/or ceftazidime, 44.8% (13/29 were MBL producers by phenotypic evaluation, and of these, 46.2% (6/13 were positive for the blaSPM-1 gene. The blaIMP and blaVIM genes were not detected. The molecular typing revealed 21 molecular profiles of which seven were detected in distinct hospitals and periods. Among the six positive blaSPM-1 isolates, three presented the same clonal profile and were from the same hospital, whereas the other three presented different clonal profiles. CONCLUSIONS: These results revealed that P. aeruginosa is able to accumulate different resistance and virulence factors, making the treatment of infections difficult. The identification of blaSPM-1 genes and the dissemination of clones in different hospitals, indicate the need for stricter application of infection control measures in hospitals in Recife, Brazil, aiming at reducing costs and damages caused by P. aeruginosa infections.

  20. Inhibition of bacterial multidrug resistance by celecoxib, a cyclooxygenase-2 inhibitor.

    Science.gov (United States)

    Kalle, Arunasree M; Rizvi, Arshad

    2011-01-01

    Multidrug resistance (MDR) is a major problem in the treatment of infectious diseases and cancer. Accumulating evidence suggests that the cyclooxygenase-2 (COX-2)-specific inhibitor celecoxib would not only inhibit COX-2 but also help in the reversal of drug resistance in cancers by inhibiting the MDR1 efflux pump. Here, we demonstrate that celecoxib increases the sensitivity of bacteria to the antibiotics ampicillin, kanamycin, chloramphenicol, and ciprofloxacin by accumulating the drugs inside the cell, thus reversing MDR in bacteria.

  1. Antimicrobial Activity of Ceftolozane-Tazobactam Tested against Enterobacteriaceae and Pseudomonas aeruginosa with Various Resistance Patterns Isolated in U.S. Hospitals (2011-2012)

    Science.gov (United States)

    Flamm, Robert K.; Sader, Helio S.; Jones, Ronald N.

    2013-01-01

    Ceftolozane/tazobactam, a novel antimicrobial agent with activity against Pseudomonas aeruginosa (including drug-resistant strains) and other common Gram-negative pathogens (including most extended-spectrum-β-lactamase [ESBL]-producing Enterobacteriaceae strains), and comparator agents were susceptibility tested by a reference broth microdilution method against 7,071 Enterobacteriaceae and 1,971 P. aeruginosa isolates. Isolates were collected consecutively from patients in 32 medical centers across the United States during 2011 to 2012. Overall, 15.7% and 8.9% of P. aeruginosa isolates were classified as multidrug resistant (MDR) and extensively drug resistant (XDR), and 8.4% and 1.2% of Enterobacteriaceae were classified as MDR and XDR. No pandrug-resistant (PDR) Enterobacteriaceae isolates and only one PDR P. aeruginosa isolate were detected. Ceftolozane/tazobactam was the most potent (MIC50/90, 0.5/2 μg/ml) agent tested against P. aeruginosa and demonstrated good activity against 310 MDR strains (MIC50/90, 2/8 μg/ml) and 175 XDR strains (MIC50/90, 4/16 μg/ml). Ceftolozane/tazobactam exhibited high overall activity (MIC50/90, 0.25/1 μg/ml) against Enterobacteriaceae and retained activity (MIC50/90, 4/>32 μg/ml) against many 601 MDR strains but not against the 86 XDR strains (MIC50, >32 μg/ml). Ceftolozane/tazobactam was highly potent (MIC50/90, 0.25/0.5 μg/ml) against 2,691 Escherichia coli isolates and retained good activity against most ESBL-phenotype E. coli isolates (MIC50/90, 0.5/4 μg/ml), but activity was low against ESBL-phenotype Klebsiella pneumoniae isolates (MIC50/90, 32/>32 μg/ml), explained by the high rate (39.8%) of meropenem coresistance observed in this species phenotype. In summary, ceftolozane/tazobactam demonstrated high potency and broad-spectrum activity against many contemporary Enterobacteriaceae and P. aeruginosa isolates collected in U.S. medical centers. Importantly, ceftolozane/tazobactam retained potency against many MDR and

  2. Prolonged exposure of methicillin-resistant Staphylococcus aureus (MRSA) COL strain to increasing concentrations of oxacillin results in a multidrug-resistant phenotype

    DEFF Research Database (Denmark)

    Martins, Ana; Couto, Isabel; Aagaard, Lone

    2007-01-01

    Our previous studies demonstrated that exposure of a bacterium to increasing concentrations of an antibiotic would increase resistance to that antibiotic as a consequence of activating efflux pumps. This study utilises the same approach; however, it employs the methicillin-resistant Staphylococcus...... aureus (MRSA) COL strain, which is highly resistant to oxacillin (OXA). MRSA COL was adapted to 3200 mg/L of OXA. Changes in resistance to other antibiotics were evaluated and efflux pump activity during the adaptation process was determined. MRSA COL was exposed to stepwise two-fold increases of OXA....... At the end of each step, minimum inhibitory concentration determination for erythromycin (ERY) and other antibiotics was conducted. Reserpine (RES) was employed to evaluate whether resistance to ERY was dependent on efflux pump activity. Efflux pump activity was also evaluated using the ethidium bromide (EB...

  3. Phenotypic Detection of Metallo-Beta-Lactamases in Carbapenem Resistant Acinetobacter baumannii Isolated from Pediatric Patients in Pakistan

    Directory of Open Access Journals (Sweden)

    Muneeza Anwar

    2016-01-01

    Full Text Available Multidrug resistant A. baumannii has emerged as an important and problematic human pathogen as it is the causative agent of several types of infections especially in neonates and immunocompromised patients because they have least capacity to fight against infections. Carbapenems are used as last resort antibiotics for treating these infections but currently resistance against carbapenems due to MBL production is on the rise. The objective of this study was to determine the frequency of antibiotic resistance in A. baumannii and also to compare the efficacy of combined disk test and double disk synergy test for detection of metallo-beta-lactamases. A total of 112 A. baumannii were identified from various clinical samples and antibiotic susceptibility profile was determined by Kirby-Bauer Disk Diffusion method. Out of 112, 66 (58.9% isolates were resistant to both imipenem and meropenem (OXOID. These resistant isolates were tested for carbapenemase production, and 55 (83.3% were carbapenemase producers by Modified Hodge Test. These isolates were further tested for MBL production by combined disk test and double disk synergy test. Out of 66, 49 isolates were positive by both methods, CDT and DDST, and only one isolate was detected as negative (with kappa value = 0.038. All MBL producing strains showed remarkable resistance to cephalosporins, fluoroquinolones, aminoglycosides, and piperacillin/tazobactam (OXOID. The antibiotic resistance was very high in A. baumannii which were isolated from children in Pakistan specially attending a nephrology unit.

  4. Resistance phenotypes and genotypes of Salmonella enterica subsp. enterica isolates from feed, pigs, and carcasses in Brazil.

    Science.gov (United States)

    Lopes, Graciela Volz; Pissetti, Caroline; da Cruz Payão Pellegrini, Débora; da Silva, Luis Eduardo; Cardoso, Marisa

    2015-02-01

    Salmonella enterica subsp. enterica plays a role as a foodborne pathogen worldwide. The consumption of contaminated pork has been associated with human salmonellosis and the increase in antimicrobial resistance among Salmonella from pigs and pork products is a concern. A total of 225 Salmonella isolates from feed mills, the lairage environment, and the intestinal contents of pigs and carcasses were investigated for their antimicrobial susceptibility. A MIC for ciprofloxacin was screened by agar dilution, and antimicrobial resistance genes were investigated by PCR assays. Among the tested isolates, 171 (76%) showed resistance to at least one antimicrobial agent, and 91 (40.4%) were multiresistant. Resistance occurred most frequently to tetracycline (54.5%), sulfonamides (39.6%), and streptomycin (33.7%). Thirty-two (94.1%) nalidixic acid-resistant isolates exhibited decreased susceptibility to ciprofloxacin. The resistance genes found were blaTEM (ampicillin), tet(A) (tetracycline), tet(B) (tetracycline/minocycline), sul1, sul2, and sul3 (sulfonamides), catA1 (chloramphenicol), floR (florfenicol/chloramphenicol), strA and strB (streptomycin), aph(3')-Ia (kanamycin), aac(3)-IIa and aac(3)-IVa (apramycin/gentamicin), aadA variant (streptomycin/spectinomycin), and dfrA1 (trimethoprim). Salmonella isolates from pig feces and carcasses displayed a higher frequency of resistance to most antimicrobials tested than isolates from feed mills. Common resistance gene profiles were found in isolates from the lairage and the intestinal content of pigs and carcasses, demonstrating that resistance genes selected on farms may be found in pork.

  5. Streptococcus sanguinis isolate displaying a phenotype with cross-resistance to several rRNA-targeting agents.

    Science.gov (United States)

    Mendes, Rodrigo E; Deshpande, Lalitagauri M; Kim, Jihye; Myers, Debra S; Ross, James E; Jones, Ronald N

    2013-08-01

    This study describes a clinical case of a 71-year-old male with a history of ischemic cardiomyopathy after left ventricular assist device (LVAD) endocarditis caused by methicillin-resistant Staphylococcus epidermidis (MRSE) and a rare linezolid-resistant Streptococcus sanguinis strain (MIC, 32 μg/ml). The patient received courses of several antimicrobial agents, including linezolid for 79 days. The S. sanguinis strain had mutations in the 23S rRNA (T2211C, T2406C, G2576T, C2610T) and an amino acid substitution (N56D) in L22 and exhibited cross-resistance to ribosome-targeting agents.

  6. Typing discrepancy between phenotypic and molecular characterization revealing an emerging biovar 9 variant of smooth phage-resistant B. abortus strain 8416 in China

    Directory of Open Access Journals (Sweden)

    YaoXia eKang

    2015-12-01

    Full Text Available A newly isolated smooth colony morphology phage-resistant (SPR strain 8416 isolated from a 45-year-old cattle farm cleaner with clinical features of brucellosis in China was reported. The most unusual phenotype was its resistance to two Brucella phages Tbilisi and Weybridge, but sensitive to Berkeley 2, a pattern similar to that of B. melitensis biovar 1. VITEK 2 biochemical identification system found that both strain 8416 and B. melitensis strains shared positive ILATk, but negative in other B. abortus strains. However, routine biochemical and phenotypic characteristics of strain 8416 were most similar to that of B. abortus biovar 9 except CO2 requirement. In addition, multiple PCR molecular typing assays including AMOS-PCR, B. abortus special PCR (B-ab PCR and a novel sub-biovar typing PCR, indicated that strain 8416 may belong to either biovar 3b or 9 of B. abortus. Surprisingly, further MLVA typing results showed that strain 8416 was most closely related to B. abortus biovar 3 in the Brucella MLVA database, primarily differing in 4 out of 16 screened loci. Therefore, due to the unusual discrepancy between phenotypic (biochemical reactions and particular phage lysis profile and molecular typing characteristics, strain 8416 couldn’t be exactly classified to any of the existing B. abortus biovars and might be a new variant of B. abortus biovar 9. The present study also indicates that the present phage typing scheme for Brucella spp. is subject to variation and the routine Brucella biovar typing needs further studies.

  7. Community-based MDR-TB care project improves treatment initiation in patients diagnosed with MDR-TB in Myanmar.

    Science.gov (United States)

    Wai, Pyae Phyo; Shewade, Hemant Deepak; Kyaw, Nang Thu Thu; Thein, Saw; Si Thu, Aung; Kyaw, Khine Wut Yee; Aye, Nyein Nyein; Phyo, Aye Mon; Maung, Htet Myet Win; Soe, Kyaw Thu; Aung, Si Thu

    2018-01-01

    The Union in collaboration with national TB programme (NTP) started the community-based MDR-TB care (CBMDR-TBC) project in 33 townships of upper Myanmar to improve treatment initiation and treatment adherence. Patients with MDR-TB diagnosed/registered under NTP received support through the project staff, in addition to the routine domiciliary care provided by NTP staff. Each township had a project nurse exclusively for MDR-TB and 30 USD per month (max. for 4 months) were provided to the patient as a pre-treatment support. To assess whether CBMDR-TBC project's support improved treatment initiation. In this cohort study (involving record review) of all diagnosed MDR-TB between January 2015 and June 2016 in project townships, CBMDR-TBC status was categorized as "receiving support" if date of project initiation in patient's township was before the date of diagnosis and "not receiving support", if otherwise. Cox proportional hazards regression (censored on 31 Dec 2016) was done to identify predictors of treatment initiation. Of 456 patients, 57% initiated treatment: 64% and 56% among patients "receiving support (n = 208)" and "not receiving support (n = 228)" respectively (CBMDR-TBC status was not known in 20 (4%) patients due to missing diagnosis dates). Among those initiated on treatment (n = 261), median (IQR) time to initiate treatment was 38 (20, 76) days: 31 (18, 50) among patients "receiving support" and 50 (26,101) among patients "not receiving support". After adjusting other potential confounders (age, sex, region, HIV, past history of TB treatment), patients "receiving support" had 80% higher chance of initiating treatment [aHR (0.95 CI): 1.8 (1.3, 2.3)] when compared to patients "not receiving support". In addition, age 15-54 years, previous history of TB and being HIV negative were independent predictors of treatment initiation. Receiving support under CBMDR-TBC project improved treatment initiation: it not only improved the proportion initiated but also

  8. Detection of Enterohemorrhagic Escherichia coli Related Genes in E. coli Strains Belonging to B2 Phylogroup Isolated from Urinary Tract Infections in Combination with Antimicrobial Resistance Phenotypes

    Directory of Open Access Journals (Sweden)

    Hamid Staji

    2017-07-01

    Full Text Available Background:  This study was conducted to detect the prevalence of EHEC virulence genes and antimicrobial resistance profile of Escherichia coli strains belonging to B2 phylogroup implicated in Urinary tract infections in Semnan, Iran.Methods:   From 240 urine samples 160 E. coli strains were isolated, biochemically. Then, E. coli isolates were examined by Multiplex-PCR for phylogenetic typing and detection of virulence genes (hly, stx1, stx2, eae associated with Enterohemorrhagic E. coli. Finally, Antimicrobial resistance of E. coli isolates were characterized using Disk Diffusion method.  Results:  From 160 E. coli isolates, 75 strains (47% were assigned to B2 phylogenetic group and prevalence of virulence genes were as follow: hly (21.3%, stx1 (16%, stx2 (10.6% and eae (6.7%, subsequently.  Phenotypic antimicrobial resistance of B2 isolates showed that all isolates were sensitive to Meropenem and Furazolidone and then highest frequency of resistance was observed to Streptomycin, Oxytetracycline, Neomycin, Nalidixic acid and Ampicillin (98.7% to 49.3%. Also low resistance prevalence was observed in case of Ceftizoxime, Lincospectin, Imipenem, Chloramphenicol and flurefenicole (16% to 1.3%.Conclusion:   The data suggest a high prevalence of antibiotic resistance in UPEC strains belonging to B2 phylogroup even for the antimicrobials using in pet and farm animals and their potential to cause EHEC specific clinical symptoms which may represent a serious health risk since these strains can be transmitted to GI tract and act as a reservoir for other uropathogenic E. coli and commensal strains.

  9. Phenotypic and molecular characterization of Neisseria gonorrhoeae isolates from Slovenia, 2006-12: rise and fall of the multidrug-resistant NG-MAST genogroup 1407 clone?

    Science.gov (United States)

    Jeverica, Samo; Golparian, Daniel; Matičič, Mojca; Potočnik, Marko; Mlakar, Boštjan; Unemo, Magnus

    2014-06-01

    To determine the phenotypic and molecular characteristics of Neisseria gonorrhoeae isolates obtained between 2006 and 2012 in Slovenia. Gonococcal isolates obtained between 2006 and 2012 in Slovenia (n = 194) were investigated with Etest for susceptibility to cefixime, ceftriaxone, penicillin, ciprofloxacin, azithromycin, tetracycline, gentamicin and spectinomycin. All isolates were examined with N. gonorrhoeae multiantigen sequence typing for molecular epidemiology and sequencing of the major extended-spectrum cephalosporin (ESC) resistance determinants (penA, mtrR and penB) was performed. The overall prevalence of decreased susceptibility or resistance to cefixime and ceftriaxone (MIC ≥0.125 mg/L) was 11% and 5%, respectively. The decreased susceptibility or resistance showed an epidemic peak in 2011 (33% for cefixime and 11% for ceftriaxone), decreasing to 6% and 4%, respectively, in 2012. ST1407 (9% of isolates), ST21 (6%) and ST225 (6%) were the most common sequence types (STs) during 2006-12. Genogroup G1407 (ST1407 most prevalent ST), an internationally spread clone with decreased susceptibility or resistance to ESCs, was most prevalent (48%) in 2009. However, the G1407 prevalence then declined: in 2010, 30%; in 2011, 28%; and in 2012, 8%. Instead, in 2012 the ESC- and ciprofloxacin-susceptible G21 was the predominant genogroup (26%). The prevalence of gonococcal resistance to ESCs in Slovenia has been high, but fluctuating. Fortunately, in 2012 some ESC- and ciprofloxacin-susceptible clones, such as genogroups G21, G1195 and G2992, appeared to have mainly replaced the multidrug-resistant G1407 clone, a replacement also seen in several European countries. © The Author 2014. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  10. Impact of the Triglyceride/High-Density Lipoprotein Cholesterol Ratio and the Hypertriglyceremic-Waist Phenotype to Predict the Metabolic Syndrome and Insulin Resistance.

    Science.gov (United States)

    von Bibra, Helene; Saha, Sarama; Hapfelmeier, Alexander; Müller, Gabriele; Schwarz, Peter E H

    2017-07-01

    Insulin resistance is the underlying mechanism for the metabolic syndrome and associated dyslipidaemia that theoretically implies a practical tool for identifying individuals at risk for cardiovascular disease and type-2-diabetes. Another screening tool is the hypertriglyceremic-waist phenotype (HTW). There is important impact of the ethnic background but a lack of studied European populations for the association of the triglyceride/high-density lipoprotein cholesterol (HDL-C) ratio and insulin resistance. This observational, retrospective study evaluated lipid ratios and the HTW for predicting the metabolic syndrome/insulin resistance in 1932 non-diabetic individuals from Germany in the fasting state and during a glucose tolerance test. The relations of triglyceride/HDL-C, total-cholesterol/HDL-C, and low-density lipoprotein cholesterol/HDL-C with 5 surrogate estimates of insulin resistance/sensitivity and metabolic syndrome were analysed by linear regression analysis and receiver operating characteristics (ROC) in participants with normal (n=1 333) or impaired fasting glucose (n=599), also for the impact of gender. Within the lipid ratios, triglyceride/HDL-C had the strongest associations with insulin resistance/sensitivity markers. In the prediction of metabolic syndrome, diagnostic accuracy was good for triglyceride/HDL-C (area under the ROC curve 0.817) with optimal cut-off points (in mg/dl units) of 2.8 for men (80% sensitivity, 71% specificity) and 1.9 for women (80% sensitivity, 75% specificity) and fair for HTW and HOMA-IR (area under the curve 0.773 and 0.761). These data suggest the triglyceride/HDL-C ratio as a physiologically relevant and practical index for predicting the concomitant presence of metabolic syndrome, insulin resistance and dyslipidaemia for therapeutic and preventive care in apparently healthy European populations. © Georg Thieme Verlag KG Stuttgart · New York.

  11. Effects of genetic polymorphisms of CYP2C19*2/*3 and MDR1 C3435T on the pharmacokinetics of lansoprazole in healthy Chinese subjects.

    Science.gov (United States)

    Zhang, Yu-Xin; Wei, Shi-Jie; Yang, Xiao-Ying; Zhang, Wen-Ping; Wang, Xin-Yu; Dang, Hong-Wan

    2014-10-01

    To evaluate the influence of CYP2C19*2/*3 and MDR1 C3435T polymorphisms on the pharmacokinetics of lansoprazole (LPZ) in healthy Chinese subjects. All 24 subjects were from a study of bioequivalence. Plasma concentrations of LPZ were determined by liquid chromatography/mass spectrometry. Cytochrome P450 (CYP) 2C19*2/*3 and multidrug resistance transporter gene 1 (MDR1) C3435T of the subjects were genotyped by polymerase chain reaction-restriction fragment length polymorphism. Significant differences were found in the area under the concentration-time curve from predose to T (AUC(0-T)), area under the concentration-time curve from predose to infinity (AUC(0-∞), t(1/2)), and apparent oral clearance (CL/F) of LPZ between CYP2C19 extensive metabolizers and intermediate metabolizers (p < 0.05). The AUC(0-T), AUC(0-∞), maximum plasma concentration, and CL/F of LPZ were significantly different between subjects with the MDR1 C3435T C/C, C/T, and T/T polymorphisms (p < 0.05). CYP2C19*2/*3 and MDR1 C3435T polymorphisms are important determinants of LPZ pharmacokinetics.

  12. E-health systems for management of MDR-TB in resource-poor environments: a decade of experience and recommendations for future work.

    Science.gov (United States)

    Fraser, Hamish S F; Habib, Ali; Goodrich, Mark; Thomas, David; Blaya, Joaquin A; Fils-Aime, Joseph Reginald; Jazayeri, Darius; Seaton, Michael; Khan, Aamir J; Choi, Sharon S; Kerrison, Foster; Falzon, Dennis; Becerra, Mercedes C

    2013-01-01

    Multi-drug resistant TB (MDR-TB) is a complex infectious disease that is a growing threat to global health. It requires lengthy treatment with multiple drugs and specialized laboratory testing. To effectively scale up treatment to thousands of patients requires good information systems to support clinical care, reporting, drug forecasting, supply chain management and monitoring. Over the last decade we have developed the PIH-EMR electronic medical record system, and subsequently OpenMRS-TB, to support the treatment of MDR-TB in Peru, Haiti, Pakistan, and other resource-poor environments. We describe here the experience with implementing these systems and evaluating many aspects of their performance, and review other systems for MDR-TB management. We recommend a new approach to information systems to address the barriers to scale up MDR-TB treatment, particularly access to the appropriate drugs and lab data. We propose moving away from fragmented, vertical systems to focus on common platforms, addressing all stages of TB care, support for open data standards and interoperability, care for a wide range of diseases including HIV, integration with mHealth applications, and ability to function in resource-poor environments.

  13. Helicobacter pylori Primary Antibiotic Resistance in 2015 in Morocco: A Phenotypic and Genotypic Prospective and Multicenter Study.

    Science.gov (United States)

    Bouihat, Najat; Burucoa, Christophe; Benkirane, Ahmed; Seddik, Hassan; Sentissi, Sara; Al Bouzidi, Abderrahmane; Elouennas, Mustapha; Benouda, Amina

    2017-09-01

    Knowledge of local antibiotic resistance is crucial to adaption of the choice of effective empirical first-line treatment for Helicobacter pylori infection. The aim of this study was to evaluate, for the first time in Morocco, the prevalence of the primary resistance of H. pylori to clarithromycin, metronidazole, amoxicillin, levofloxacin, tetracycline, and rifamycin. We conducted a 1-year prospective study (2015), including 255 Moroccan patients referred for gastro-duodenal endoscopy to two hospitals of Rabat (Morocco) and never previously treated for H. pylori infection. Three gastric biopsies were collected: one for histology, one for culture, and one for molecular detection of H. pylori and the mutations in 23S rRNA genes that confer resistance to clarithromycin. Antimicrobial susceptibility testing was performed on isolated strains by Etest and disk diffusion methods. One hundred seventy-seven patients were infected (69.4%). The prevalence of primary resistances of H. pylori to clarithromycin was 29%, 40% to metronidazole, 0% to amoxicillin, tetracycline, and rifamycin, and 11% to levofloxacin. Only four isolates (2%) were resistant to both clarithromycin and metronidazole. The high level of primary clarithromycin resistance in the H. pylori strains infecting the Moroccan population leads us to recommend the abandonment of the standard clarithromycin-based triple therapy as a first-line treatment in Morocco and to prefer a concomitant quadruple therapy.

  14. Distinct genotype distribution and haplotype profiles in MDR1 gene among Chinese Han, Bai, Wa and Tibetan ethnic groups.

    Science.gov (United States)

    Lai, Yong; Huang, Min; Li, Hui; Wang, Xue-Ding; Li, Jia-Li

    2012-11-01

    P-Glycoprotein (P-gp, encoded by MDR1 gene) plays an important role in determining bioavailability and pharmacologic effects of many drugs. There is increasing evidence that P-gp activity may be genetically determined. In this study, we investigated the genotype distribution and the haplotype profiles of MDR1 gene in Chinese Han, Bai, Wa and Tibetan subjects. Much lower frequencies of the 1236T allele and the 2677T allele were found in Wa subjects than those in other three ethnic groups, while the 2677A allele was found about 6-fold more frequently in Han subjects than in subjects of other three ethnic groups. The Han, Bai and Tibetan subjects share the same three predominant haplotypes (T-T-T, T-G-C and C-G-C), and T-T-T is the highest and accounts for more than one third of the number of haplotypes in the subjects from each ethnic group. However, T-T-T was less common than T-G-C, T-G-T and C-G-C and occurring at only 13.8% in Wa subjects, furthermore, higher frequencies of T-G-T, C-T-C, C-G-T and C-T-T were observed in Wa subjects compared to those in other three ethnic groups. Frequencies of C-A-C and T-A-C in Han subjects were higher than those in other three ethnic groups. The findings of this study will be of some relevance in predicting MDR1 phenotype and pharmacokinetics as well as pharmacodynamic effects of many commonly used drugs that are P-gp substrates in these four Chinese ethnic groups.

  15. Risk factors for acquiring MDR pathogen in a tertiary care hospital

    International Nuclear Information System (INIS)

    Noman, F.; Usmani, B.; Imtiaz, A.; Mahmood, F.

    2012-01-01

    Objective: To find out common risk factors in patients from whose samples Multi-Drug Resistant pathogens were isolated. Study Design Prospective observational study. Setting: Microbiology department of Liaquat National Hospital Karachi, a 750-bedded tertiary care Hospital. Material and Method All multi-drug resistant pathogens (resistant to representative antibiotics of at least three different classes of antimicrobial agents including carbapenems) isolated from samples like blood, bronchial wash, sputum, pus, etc, received from different units of hospital at Microbiology laboratory Liaquat National Hospital from December 2006 through February 2007 were included in this study. Patient information was collected from their personal file and through concerned treating physicians. Results and Conclusion A total of 228 MDR pathogens were isolated from different samples in 3 months, these included: Acinetobacter spp 184 (81 %) and Pseudomonas aeruginosa 44 (19%). Majority were from lower respiratory tract specimen, followed by blood. Most (86%) patients were in intensive care unit or high dependency unit. Mechanical ventilation was predominant finding in patients with Acinetobacter spp while surgical procedures were more frequently associated with Pseudomonas aeruginosa. Only 3% of Acinetobacter spp and 7 % of Pseudomonas aeruginosa were isolated during first 48 hours of hospital stay. (author)

  16. Cytotoxicity and Phytochemical Profiling of Sargassum Sp. Extract As Anti-Mdr Bacteria

    Science.gov (United States)

    Setyati, Wilis A.; Pramesti, Rini; Zainuddin, Muhamad; Puspita, Maya; Renta, Person P.

    2018-02-01

    Sargassum sp. contains bioactive compounds having the potential as an antibacterial agent. Sargassum sp. was collected from five different locations, i.e., Teluk Awur, Panjang Island, Bandengan, Ujung Piring, and Bondo. There were several different species of Sargassum sp. identified from each sampling locations. The collected seaweeds were washed, naturally dried, and ground to the powder-sized dry material. Dry seaweed was extracted gradually using n-hexane, ethyl acetate, and methanol (1:3 w/v). The antibacterial analysis was conducted based on Agar Diffusion method using Zobell as media. Resistance analysis was performed to evaluate the resistance of pathogen against commercial antibiotics, namely, chloramphenicol, ampicillin, erythromycin, amoxycillin, and tetracycline. Each Sargassum sp. extract was tested against three candidates of MDR bacteria, i.e., Staphylococcus aureus, Escherichia coli, and S. epidermidis. Results showed that S. aureus was resistant towards four out of five commercial antibiotics. E. coli and S. epidermidis were not susceptible to two and three out of five commercial antibiotics, respectively. N-hexane, ethyl acetate and methanol yielded 0.1-0.3%, 0.3-0.7 % and 0.8-4.7% of dry extract. Ethyl acetate extract of Sargassum from Teluk Awur performed the best antibacterial activity and contained an alkaloid, flavonoid, and phenolic compounds. Toxicity analysis showed that this ethyl acetate extract had LC50 at 463 ppm and categorized as chronic toxicity.

  17. Transmission of MDR MRSA between primates, their environment and personnel at a United States primate centre.

    Science.gov (United States)

    Soge, Olusegun O; No, David; Michael, Karen E; Dankoff, Jennifer; Lane, Jennifer; Vogel, Keith; Smedley, Jeremy; Roberts, Marilyn C

    2016-10-01

    MDR MRSA isolates cultured from primates, their facility and primate personnel from the Washington National Primate Research Center were characterized to determine whether they were epidemiologically related to each other and if they represented common local human-associated MRSA strains. Human and primate nasal and composite environmental samples were collected, enriched and selected on medium supplemented with oxacillin and polymyxin B. Isolates were biochemically verified as Staphylococcus aureus and screened for the mecA gene. Selected isolates were characterized using SCCmec typing, MLST and WGS. Nasal cultures were performed on 596 primates and 105 (17.6%) were MRSA positive. Two of 79 (2.5%) personnel and two of 56 (3.6%) composite primate environmental facility samples were MRSA positive. Three MRSA isolates from primates, one MRSA from personnel, two environmental MRSA and one primate MSSA were ST188 and were the same strain type by conventional typing methods. ST188 isolates were related to a 2007 ST188 human isolate from Hong Kong. Both MRSA isolates from out-of-state primates had a novel MLST type, ST3268, and an unrelated group. All isolates carried ≥1 other antibiotic resistance gene(s), including tet(38), the only tet gene identified. ST188 is very rare in North America and has almost exclusively been identified in people from Pan-Asia, while ST3268 is a newly reported MRSA type. The data suggest that the primate MDR MRSA was unlikely to come from primate centre employees. Captive primates are likely to be an unappreciated source of MRSA. © The Author 2016. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  18. Gefitinib inhibits invasive phenotype and epithelial-mesenchymal transition in drug-resistant NSCLC cells with MET amplification.

    Directory of Open Access Journals (Sweden)

    Silvia La Monica

    Full Text Available Despite the initial response, all patients with epidermal growth factor receptor (EGFR-mutant non-small cell lung cancer (NSCLC eventually develop acquired resistance to EGFR tyrosine kinase inhibitors (TKIs. The EGFR-T790M secondary mutation is responsible for half of acquired resistance cases, while MET amplification has been associated with acquired resistance in about 5-15% of NSCLCs. Clinical findings indicate the retained addiction of resistant tumors on EGFR signaling. Therefore, we evaluated the molecular mechanisms supporting the therapeutic potential of gefitinib maintenance in the HCC827 GR5 NSCLC cell line harbouring MET amplification as acquired resistance mechanism. We demonstrated that resistant cells can proliferate and survive regardless of the presence of gefitinib, whereas the absence of the drug significantly enhanced cell migration and invasion. Moreover, the continuous exposure to gefitinib prevented the epithelial-mesenchymal transition (EMT with increased E-cadherin expression and down-regulation of vimentin and N-cadherin. Importantly, the inhibition of cellular migration was correlated with the suppression of EGFR-dependent Src, STAT5 and p38 signaling as assessed by a specific kinase array, western blot analysis and silencing functional studies. On the contrary, the lack of effect of gefitinib on EGFR phosphorylation in the H1975 cells (EGFR-T790M correlated with the absence of effects on cell migration and invasion. In conclusion, our findings suggest that certain EGFR-mutated patients may still benefit from a second-line therapy including gefitinib based on the specific mechanism underlying tumor cell resistance.

  19. Phosphatidyl inositol-3 kinase (PIK3CA) E545K mutation confers cisplatin resistance and a migratory phenotype in cervical cancer cells

    Science.gov (United States)

    Arjumand, Wani; Merry, Cole D.; Wang, Chen; Saba, Elias; McIntyre, John B.; Fang, Shujuan; Kornaga, Elizabeth; Ghatage, Prafull; Doll, Corinne M.; Lees, Susan P.

    2016-01-01

    The phosphatidylinositol-3 kinase (PI3K)/Akt/mTOR signaling pathway is activated in many human cancers. Previously, we reported that patients with early stage cervical cancer whose tumours harbour PIK3CA exon 9 or 20 mutations have worse overall survival in response to treatment with radiation and cisplatin than patients with wild-type PIK3CA. The purpose of this study was to determine whether PIK3CA-E545K mutation renders cervical cancer cells more resistant to cisplatin and/or radiation, and whether PI3K inhibition reverses the phenotype. We found that CaSki cells that are heterozygous for the PIK3CA-E545K mutation are more resistant to cisplatin or cisplatin plus radiation than either HeLa or SiHa cells that express only wild-type PIK3CA. Similarly, HeLa cells engineered to stably express PIK3CA-E545K were more resistant to cisplatin or cisplatin plus radiation than cells expressing only wild-type PIK3CA or with PIK3CA depleted. Cells expressing the PIK3CA-E545K mutation also had constitutive PI3K pathway activation and increased cellular migration and each of these phenotypes was reversed by treatment with the PI3K inhibitor GDC-0941/Pictilisib. Our results suggests that cervical cancer patients whose tumours are positive for the PIK3CA-E545K mutation may benefit from PI3K inhibitor therapy in concert with standard cisplatin and radiation therapy. PMID:27489350

  20. [Expression and significance of P-gp/mdr1 mRNA, MRP and LRP in non-Hodgkin's lymphoma].

    Science.gov (United States)

    Li, Le; Su, Li-ping; Ma, Li; Zhao, Jin; Zhu, Lei; Zhou, Yong-an

    2009-03-01

    To explore the expression and clinical significance of P-glycoprotein (P-gp)/mdr1mRNA, multidrug resistance-associated protein (MRP) and lung resistance protein (LRP) in newly diagnosed non-Hodgkin's lymphoma. mdr1 mRNA of in 41 patients with non-Hodgkin's lymphoma was assayed by semi-quantitative RT-PCR. The expressions of P-gp, MRP and LRP proteins in lymph node viable blasts were identified by flow cytometry. The results were compared with those obtained from control cases, and the correlation of the changes with clinical outcomes was analyzed. (1) Among the 41 cases, the positive expression of P-gp protein was detected in 8 cases, MRP in 7 cases, LRP in 15 cases, and mdr 1 mRNA in 11 cases. (2) The P-gp and LRP levels in NHL were significantly higher than those in control group, but MRP wasn't. The P-gp over-expression was significantly associated with mdr1mRNA (r = 0.396, P = 0.01). No correlation was showed among the expressions of P-gp, MRP and LRP. (3) Patients with P-gp expression had a poorer outcome of chemotherapy than those with P-gp-negative (P = 0.005). P-gp expression was significantly associated with higher clinical stage (P = 0.046) and elevated serum lactate dehydrogenase level (P = 0.032), but not associated with malignant degree (P = 0.298). MRP had no impact on the outcome of chemotherapy (P = 0.212), and wasn't significantly associated with higher clinical stage (P = 0.369), elevated LDH (P = 0.762) and higher malignant degree (P = 0.451). Patients with LRP expression had a poorer outcome of chemotherapy than those LRP-negative (P = 0.012). LRP expression was significantly associated with higher clinical stage (P = 0.0019), elevated LDH (P = 0.02) and higher malignant degree (P = 0.01). The data of this study indicate that P-gp and LRP expressions but not MRP expression are important in the mechanism of drug resistance associated with a poor clinical outcome in previously untreated NHL.

  1. Characterization of ST258 Colistin-Resistant, blaKPC-Producing Klebsiella pneumoniae in a Greek Hospital.

    Science.gov (United States)

    Mavroidi, Angeliki; Katsiari, Maria; Likousi, Sofia; Palla, Eleftheria; Roussou, Zoi; Nikolaou, Charikleia; Maguina, Asimina; Platsouka, Evangelia D

    2016-07-01

    The emergence of colistin resistance may further contribute to treatment failure of infection caused by multidrug-resistant (MDR) Klebsiella pneumoniae. The colistin resistance rates were determined and colistin-resistant carbapenemase-producing K. pneumoniae (COL-R CP-Kp) were characterized over an 18-month period in a Greek hospital. Out of 135 carbapenemase producers, 19 isolates (14%) were categorized as resistant to colistin. Phenotypic and molecular characterization of the COL-R CP-Kp isolates revealed that all were MDR blaKPC producers and, excluding one isolate of MLST ST383, belonged to the international clonal lineage ST258. Furthermore, PCR amplification and sequencing of the mgrB locus revealed nucleotide sequences of different sizes and insertions of IS1- and IS5-like mobile elements. The majority (63%) of the COL-R blaKPC producers was recovered from patients in the intensive care unit (ICU) and clinical data indicated that all patients should have acquired these isolates in the ICU. The findings of the present study underscore a concerning evolution of colistin resistance in a setting of high K. pneumoniae carbapenemase (KPC)-Kp endemicity, such as Greece. Thus, continuous surveillance, molecular characterization, prudent use of antibiotics, and implementation of infection control measures for K. pneumoniae are urgent.

  2. Heightened vulnerability to MDR-TB epidemics after controlling drug-susceptible TB.

    Directory of Open Access Journals (Sweden)

    Jason D Bishai

    2010-09-01

    Full Text Available Prior infection with one strain TB has been linked with diminished likelihood of re-infection by a new strain. This paper attempts to determine the role of declining prevalence of drug-susceptible TB in enabling future epidemics of MDR-TB.A computer simulation of MDR-TB epidemics was developed using an agent-based model platform programmed in NetLogo (See http://mdr.tbtools.org/. Eighty-one scenarios were created, varying levels of treatment quality, diagnostic accuracy, microbial fitness cost, and the degree of immunogenicity elicited by drug-susceptible TB. Outcome measures were the number of independent MDR-TB cases per trial and the proportion of trials resulting in MDR-TB epidemics for a 500 year period after drug therapy for TB is introduced.MDR-TB epidemics propagated more extensively after TB prevalence had fallen. At a case detection rate of 75%, improving therapeutic compliance from 50% to 75% can reduce the probability of an epidemic from 45% to 15%. Paradoxically, improving the case-detection rate from 50% to 75% when compliance with DOT is constant at 75% increases the probability of MDR-TB epidemics from 3% to 45%.The ability of MDR-TB to spread depends on the prevalence of drug-susceptible TB. Immunologic protection conferred by exposure to drug-susceptible TB can be a crucial factor that prevents MDR-TB epidemics when TB treatment is poor. Any single population that successfully reduces its burden of drug-susceptible TB will have reduced herd immunity to externally or internally introduced strains of MDR-TB and can experience heightened vulnerability to an epidemic. Since countries with good TB control may be more vulnerable, their self interest dictates greater promotion of case detection and DOTS implementation in countries with poor control to control their risk of MDR-TB.

  3. Multidrug resistance-selective antiproliferative activity of Piper amide alkaloids and synthetic analogues.

    Science.gov (United States)

    Wang, Yue-Hu; Goto, Masuo; Wang, Li-Ting; Hsieh, Kan-Yen; Morris-Natschke, Susan L; Tang, Gui-Hua; Long, Chun-Lin; Lee, Kuo-Hsiung

    2014-10-15

    Twenty-five amide alkaloids (1-25) from Piper boehmeriifolium and 10 synthetic amide alkaloid derivatives (39-48) were evaluated for antiproliferative activity against eight human tumor cell lines, including chemosensitive and multidrug-resistant (MDR) cell lines. The results suggested tumor type-selectivity. 1-[7-(3,4,5-Trimethoxyphenyl)heptanoyl]piperidine (46) exhibited the best inhibitory activity (IC50=4.94 μM) against the P-glycoprotein (P-gp)-overexpressing KBvin MDR sub-line, while it and all other tested compounds, except 9, were inactive (IC50 >40 μM) against MDA-MB-231 and SK-BR-3. Structure-activity relationships (SARs) indicated that (i) 3,4,5-trimethoxy phenyl substitution is critical for selectivity against KBvin, (ii) the 4-methoxy group in this pattern is crucial for antiproliferative activity, (iii) double bonds in the side chain are not needed for activity, and (iv), in arylalkenylacyl amide alkaloids, replacement of an isobutylamino group with pyrrolidin-1-yl or piperidin-1-yl significantly improved activity. Further study on Piper amides is warranted, particularly whether side chain length affects the ability to overcome the MDR cancer phenotype. Copyright © 2014 Elsevier Ltd. All rights reserved.

  4. The impact of herbicide-resistant rice technology on phenotypic diversity and population structure of United States weedy rice.

    Science.gov (United States)

    Burgos, Nilda Roma; Singh, Vijay; Tseng, Te Ming; Black, Howard; Young, Nelson D; Huang, Zhongyun; Hyma, Katie E; Gealy, David R; Caicedo, Ana L

    2014-11-01

    The use of herbicide-resistant (HR) Clearfield rice (Oryza sativa) to control weedy rice has increased in the past 12 years to constitute about 60% of rice acreage in Arkansas, where most U.S. rice is grown. To assess the impact of HR cultivated rice on the herbicide resistance and population structure of weedy rice, weedy samples were collected from commercial fields with a history of Clearfield rice. Panicles from each weedy type were harvested and tested for resistance to imazethapyr. The majority of plants sampled had at least 20% resistant offspring. These resistant weeds were 97 to 199 cm tall and initiated flowering from 78 to 128 d, generally later than recorded for accessions collected prior to the widespread use of Clearfield rice (i.e. historical accessions). Whereas the majority (70%) of historical accessions had straw-colored hulls, only 30% of contemporary HR weedy rice had straw-colored hulls. Analysis of genotyping-by-sequencing data showed that HR weeds were not genetically structured according to hull color, whereas historical weedy rice was separated into straw-hull and black-hull populations. A significant portion of the local rice crop genome was introgressed into HR weedy rice, which was rare in historical weedy accessions. Admixture analyses showed that HR weeds tend to possess crop haplotypes in the portion of chromosome 2 containing the ACETOLACTATE SYNTHASE gene, which confers herbicide resistance to Clearfield rice. Thus, U.S. HR weedy rice is a distinct population relative to historical weedy rice and shows modifications in morphology and phenology that are relevant to weed management. © 2014 American Society of Plant Biologists. All Rights Reserved.

  5. Enterotoxigenicity and Antimicrobial Resistance of Staphylococcus aureus Isolated from Retail Food in China

    Science.gov (United States)

    Wang, Wei; Baloch, Zulqarnain; Jiang, Tao; Zhang, Cunshan; Peng, Zixin; Li, Fengqin; Fanning, Séamus; Ma, Aiguo; Xu, Jin

    2017-01-01

    Staphylococcus aureus is one of the most common causes of zoonotic agent in the world, which are attributable to the contamination of food with enterotoxins. In this study, a total of 1,150 S. aureus isolates were cultured from 27,000 retail foods items from 203 cities of 24 provinces in China in 2015 and were test for antimicrobial susceptibility. Additionally, the role of the genes responsible for the staphylococcal enterotoxins (SEA to SEE), methicillin resistance (mecA) and the toxigenic capabilities were also assessed. The results showed that 4.3% retail foods were contaminated with S. aureus, and 7.9% retail foods isolates were mecA positive. Some 97.6% of S. aureus isolates were resistant to at least one antimicrobial compound, and 57.5% of these were multi drug resistant (MDR). Resistance to penicillin (83.7%, 963/1,150), was common, followed by linezolid (67.7%, 778/1,150) and erythromycin (52.1%, 599/1,150). The isolates cultured from raw meats showed high levels of resistant to tetracycline (42.8%), ciprofloxacin (17.4%), and chloramphenicol (12.0%) and expressed a MDR phenotype (62.4%). A total of 29.7% S. aureus isolates harbored the classical SEs genes (sea, seb, sec, and sed). The sea and seb genes were the most frequent SEs genes detected. Of note, 22% of the SEs genes positive S. aureus harbored two or three SEs genes, and 16 isolates were confirmed with the capacity to simultaneously produce two or three enterotoxin types. Moreover, nearly 50% of the MRSA isolates were positive for at least one SE gene in this study. Therefore, it is important to monitor the antimicrobial susceptibility and enterotoxigenicity of MDR S. aureus and MRSA in the food chain and to use these data to develop food safety measures, designed to reduce the contamination and transmission of this bacterium. PMID:29209290

  6. A 5-year Surveillance Study on Antimicrobial Resistance of Acinetobacter baumannii Clinical Isolates from a Tertiary Greek Hospital.

    Science.gov (United States)

    Maraki, Sofia; Mantadakis, Elpis; Mavromanolaki, Viktoria Eirini; Kofteridis, Diamantis P; Samonis, George

    2016-09-01

    , no antibiotic was associated with a susceptibility rate >40% for the entire study period. The most common phenotype showed resistance against ampicillin/sulbactam, cephalosporins, carbapenems, aminoglycosides, ciprofloxacin, and tigecycline. An extremely concerning increase in colistin-resistant isolates (7.9%) was noted in 2014, the most recent study year. The vast majority of A. baumannii clinical isolates in our hospital are MDR. The remaining therapeutic options for critically ill patients who suffer from MDR A. baumannii infections are severely limited, with A. baumannii beginning to develop resistance even against colistin. Scrupulous application of infection control practices should be implemented in every hospital unit. Lastly, given the lack of available therapeutic options for MDR A. baumannii infections, well-controlled clinical trials of combinations of existing antibiotics are clearly needed.

  7. Initial infection of roots and leaves reveals different resistance phenotypes associated with coat protein gene-mediated resistance to Potato mop-top virus.

    Science.gov (United States)

    Germundsson, Anna; Sandgren, Maria; Barker, Hugh; Savenkov, Eugene I; Valkonen, Jari P T

    2002-05-01

    Resistance to the pomovirus Potato mop-top virus (PMTV) was studied in potato (Solanum tuberosum cv. Saturna) and Nicotiana benthamiana transformed with the coat protein (CP) gene of PMTV. The incidence of PMTV infections was reduced in tubers of the CP-transgenic potatoes grown in the field in soil infested with the viruliferous vector, Spongospora subterranea. However, in those tubers that were infected, all three virus RNAs were detected and virus titres were high. The CP-transgenic N. benthamiana plants were inoculated with PMTV using two methods. Following mechanical inoculation of leaves, no RNA 3 (the CP-encoding RNA homologous to the transgene) was detected in leaves, but in some plants low amounts of RNA 3 were detected in roots; RNA 2 was readily detected in leaves and roots of several plants. Inoculation of roots using viruliferous S. subterranea resulted in infection of roots in all plants and the three PMTV RNAs were detected. However, no systemic movement of PMTV from roots to the above-ground parts was observed, indicating a novel expression of resistance. These data indicate that the CP gene-mediated resistance to PMTV specifically restricts accumulation of PMTV RNA 3, and is more effective in leaves than roots. Furthermore, expression of resistance is different depending on whether leaves or roots are inoculated. Data do not exclude the possibility that both a protein-mediated and an RNA-mediated resistance mechanism are involved.

  8. The multidrug-resistant phenotype associated with overexpression of the new ABC half-transporter, MXR (ABCG2)

    DEFF Research Database (Denmark)

    Litman, Thomas; Brangi, M; Hudson, E

    2000-01-01

    by PCR, immunoblot assay and immunohistochemistry. These MXR overexpressing sublines were compared to cell lines with P-glycoprotein- and MRP-mediated resistance. High levels of cross-resistance were observed for mitoxantrone, the anthracyclines, bisantrene and topotecan. Reduced levels of mitoxantrone......, daunorubicin, bisantrene, topotecan, rhodamine 123 and prazosin were observed in the two sublines with high MXR expression. Neither the P-glycoprotein substrates vinblastine, paclitaxel, verapamil and calcein-AM, nor the MRP substrate calcein, were extruded from MCF-7 AdVp3000 and S1-M1-80 cells. Thus...

  9. Persistence of Escherichia coli clones and phenotypic and genotypic antibiotic resistance in recurrent urinary tract infections in childhood

    DEFF Research Database (Denmark)

    Kõljalg, Siiri; Truusalu, Kai; Vainumäe, Inga

    2009-01-01

    . Altogether, 78 urinary E. coli isolates from 27 children, who experienced recurrences during a 1-year follow-up after the first attack of acute pyelonephritis, were investigated. The MICs of sulfamethoxazole, trimethoprim-sulfamethoxazole (SXT), ampicillin, cefuroxime, cefotaxime, and gentamicin...... and the presence or absence of the intI gene for class 1 integrons and the sulfamethoxazole resistance-encoding genes sul1, sul2, and sul3 were determined. All E. coli strains were genotyped by pulsed-field gel electrophoresis. There were no significant differences in the prevalences of resistance to beta...

  10. PHENOTYPIC CHARACTERISATION AND GENETIC ANALYSIS OF MUTANTS OF ASPERGILLUS NIDULANS RESISTANT TO THE FUNGICIDE TOLCLOFOS-METHYL

    Directory of Open Access Journals (Sweden)

    A CHIBANI

    2000-12-01

    Full Text Available Spontaneous mutants of Aspergillus nidulans were recovered from 0,55.10+7  conidia incubated on synthetic medium supplemented with 100 mg tolclofos-methyl/ml. They differed considerably in morphology, growth rate, and level of resistance to two other fungicides. All mutants tested were cross-resistant to quintozene and vinclozolin; they produced fewer conidia than their wild-type parent. Some mutants required fungicides for maximum growth. Genetic analysis revealed that the mutants carried mutations in one gene located on linkage group III.

  11. Characterization of multi-drug resistant ESBL producing nonfermenter bacteria isolated from patients blood samples using phenotypic methods in Shiraz (Iran

    Directory of Open Access Journals (Sweden)

    Maneli Amin Shahidi

    2015-10-01

    Full Text Available Background and Aim: The emergence of  nonfermenter bacteria that are resistant to multidrug resistant ESBL  are  nowadays a principal problem  for hospitalized patients. The present study aimed at surveying the emergence of nonfermenter bacteria resistant to multi-drug ESBL producing isolated from patients blood samples using BACTEC 9240 automatic system in Shiraz. Materials and Methods: In this cross-sectional study, 4825 blood specimens were collected from hospitalized patients in Shiraz (Iran, and positive samples were detected by means of  BACTEC 9240 automatic system. The isolates  containing nonfermenter bacteria were identified based on biochemical tests embedded in the API-20E system. Antibiotic sensitivity  test was performed  and identification of  ESBL producing strains were done  using phenotypic detection of extended spectrum beta-lactamase producing isolates(DDST according to CLSI(2013 guidelines.   Results: Out of 4825 blood samples, 1145 (24% specimen were gram-positive using BACTEC system. Among all isolated microorganisms, 206 isolates were non-fermenting gram- negative bacteria. The most common non-fermenter isolates were Pseudomonas spp. (48%, Acinetobacter spp. (41.7% ,and Stenotrophomonas spp. (8.2%. Seventy of them (81.4% were  Acinetobacter spp. which were ESBL positive. Among &beta-lactam antibiotics, Pseudomonas spp. showed  the best sensitivity to piperacillin-tazobactam (46.5%.  Conclusion: It was found that  &beta-lactam antibiotics are not effective against more than 40% of Pseudomonas spp. infections and 78% Acinetobacter infections. Emergence of multi-drug resistant strains that are resistant to most antibiotic classes is a major public health problem in Iran. To resolve this problem using of practical guidelines is critical.

  12. Increased multi-drug resistant Escherichia coli from hospitals in ...

    African Journals Online (AJOL)

    Background: Multidrug-resistant Escherichia coli (MDR E. coli) has become a major public health concern in Sudan and many countries, causing failure in treatment with consequent huge health burden. Objectives: To determine the prevalence and susceptibility of MDR E. coli isolated from patients in hospitals at Khartoum ...

  13. Whole genome sequencing reveals complex evolution patterns of multidrug-resistant Mycobacterium tuberculosis Beijing strains in patients.

    Directory of Open Access Journals (Sweden)

    Matthias Merker

    Full Text Available Multidrug-resistant (MDR Mycobacterium tuberculosis complex (MTBC strains represent a major threat for tuberculosis (TB control. Treatment of MDR-TB patients is long and less effective, resulting in a significant number of treatment failures. The development of further resistances leads to extensively drug-resistant (XDR variants. However, data on the individual reasons for treatment failure, e.g. an induced mutational burst, and on the evolution of bacteria in the patient are only sparsely available. To address this question, we investigated the intra-patient evolution of serial MTBC isolates obtained from three MDR-TB patients undergoing longitudinal treatment, finally leading to XDR-TB. Sequential isolates displayed identical IS6110 fingerprint patterns, suggesting the absence of exogenous re-infection. We utilized whole genome sequencing (WGS to screen for variations in three isolates from Patient A and four isolates from Patient B and C, respectively. Acquired polymorphisms were subsequently validated in up to 15 serial isolates by Sanger sequencing. We determined eight (Patient A and nine (Patient B polymorphisms, which occurred in a stepwise manner during the course of the therapy and were linked to resistance or a potential compensatory mechanism. For both patients, our analysis revealed the long-term co-existence of clonal subpopulations that displayed different drug resistance allele combinations. Out of these, the most resistant clone was fixed in the population. In contrast, baseline and follow-up isolates of Patient C were distinguished each by eleven unique polymorphisms, indicating an exogenous re-infection with an XDR strain not detected by IS6110 RFLP typing. Our study demonstrates that intra-patient microevolution of MDR-MTBC strains under longitudinal treatment is more complex than previously anticipated. However, a mutator phenotype was not detected. The presence of different subpopulations might confound phenotypic and

  14. Comparison of antimicrobial resistance phenotypes and resistance genes in Enterococcus faecalis and Enterococcus faecium from humans in the community, broilers and pigs in Denmark

    DEFF Research Database (Denmark)

    Aarestrup, Frank Møller; Agersø, Yvonne; Gerner-Smidt, P.

    2000-01-01

    . faecium isolates of human and animal origin, examined. tet(K) was not observed, whereas tet(L) was detected in 17% of tetracycline resistant E. faecalis isolates and in 16% of the E. faecium isolates. tet(O) was not detected in any of the isolates from pigs, but was observed in 38% of E. faecalis isolates...... from broilers, in two E. faecalis isolates from humans and in three E. faecium isolates from broilers. tet(S) was not detected among isolates from animals, but was observed in 31% of E. faecalis and one E. faecium isolate from humans. This study showed a frequent occurrence of antimicrobial resistance...

  15. Comparison of effectiveness and safety of imipenem/clavulanate- versus meropenem/clavulanate-containing regimens in the treatment of MDR- and XDR-TB.

    Science.gov (United States)

    Tiberi, Simon; Sotgiu, Giovanni; D'Ambrosio, Lia; Centis, Rosella; Abdo Arbex, Marcos; Alarcon Arrascue, Edith; Alffenaar, Jan Willem; Caminero, Jose A; Gaga, Mina; Gualano, Gina; Skrahina, Alena; Solovic, Ivan; Sulis, Giorgia; Tadolini, Marina; Alarcon Guizado, Valentina; De Lorenzo, Saverio; Roby Arias, Aurora Jazmín; Scardigli, Anna; Akkerman, Onno W; Aleksa, Alena; Artsukevich, Janina; Auchynka, Vera; Bonini, Eduardo Henrique; Chong Marín, Félix Antonio; Collahuazo López, Lorena; de Vries, Gerard; Dore, Simone; Kunst, Heinke; Matteelli, Alberto; Moschos, Charalampos; Palmieri, Fabrizio; Papavasileiou, Apostolos; Payen, Marie-Christine; Piana, Andrea; Spanevello, Antonio; Vargas Vasquez, Dante; Viggiani, Pietro; White, Veronica; Zumla, Alimuddin; Migliori, Giovanni Battista

    2016-06-01

    No large study to date has ever evaluated the effectiveness, safety and tolerability of imipenem/clavulanate versus meropenem/clavulanate to treat multidrug- and extensively drug-resistant tuberculosis (MDR- and XDR-TB). The aim of this observational study was to compare the therapeutic contribution of imipenem/clavulanate versus meropenem/clavulanate added to background regimens to treat MDR- and XDR-TB cases.84 patients treated with imipenem/clavulanate-containing regimens showed a similar median number of antibiotic resistances (8 versus 8) but more fluoroquinolone resistance (79.0% versus 48.9%, pimipenem/clavulanate- and meropenem/clavulanate-containing regimens for a median (interquartile range) of 187 (60-428) versus 85 (49-156) days, respectively.Statistically significant differences were observed on sputum smear and culture conversion rates (79.7% versus 94.8%, p=0.02 and 71.9% versus 94.8%, pimipenem/clavulanate and meropenem/clavulanate were reported in 5.4% and 6.5% of cases only.Our study suggests that meropenem/clavulanate is more effective than imipenem/clavulanate in treating MDR/XDR-TB patients. Copyright ©ERS 2016.

  16. Surveillance of extensively drug-resistant tuberculosis in Europe, 2003-2007.

    NARCIS (Netherlands)

    Devaux, I.; Manissero, D.; Fernandez de la Hoz, K.; Kremer, K.; Soolingen, D. van

    2010-01-01

    This paper describes the results of second-line drug (SLD) susceptibility tests among multidrug-resistant tuberculosis (MDR TB) cases reported in 20 European countries aiming to identify extensively drug-resistant tuberculosis (XDR TB) cases. A project on molecular surveillance of MDR TB cases was

  17. Klebsiella pneumoniae Carbapenemase-2 (KPC-2), Substitutions at Ambler Position Asp179, and Resistance to Ceftazidime-Avibactam: Unique Antibiotic-Resistant Phenotypes Emerge from β-Lactamase Protein Engineering.

    Science.gov (United States)

    Barnes, Melissa D; Winkler, Marisa L; Taracila, Magdalena A; Page, Malcolm G; Desarbre, Eric; Kreiswirth, Barry N; Shields, Ryan K; Nguyen, Minh-Hong; Clancy, Cornelius; Spellberg, Brad; Papp-Wallace, Krisztina M; Bonomo, Robert A

    2017-10-31

    The emergence of Klebsiella pneumoniae carbapenemases (KPCs), β-lactamases that inactivate "last-line" antibiotics such as imipenem, represents a major challenge to contemporary antibiotic therapies. The combination of ceftazidime (CAZ) and avibactam (AVI), a potent β-lactamase inhibitor, represents an attempt to overcome this formidable threat and to restore the efficacy of the antibiotic against Gram-negative bacteria bearing KPCs. CAZ-AVI-resistant clinical strains expressing KPC variants with substitutions in the Ω-loop are emerging. We engineered 19 KPC-2 variants bearing targeted mutations at amino acid residue Ambler position 179 in Escherichia coli and identified a unique antibiotic resistance phenotype. We focus particularly on the CAZ-AVI resistance of the clinically relevant Asp179Asn variant. Although this variant demonstrated less hydrolytic activity, we demonstrated that there was a prolonged period during which an acyl-enzyme intermediate was present. Using mass spectrometry and transient kinetic analysis, we demonstrated that Asp179Asn "traps" β-lactams, preferentially binding β-lactams longer than AVI owing to a decreased rate of deacylation. Molecular dynamics simulations predict that (i) the Asp179Asn variant confers more flexibility to the Ω-loop and expands the active site significantly; (ii) the catalytic nucleophile, S70, is shifted more than 1.5 Å and rotated more than 90°, altering the hydrogen bond networks; and (iii) E166 is displaced by 2 Å when complexed with ceftazidime. These analyses explain the increased hydrolytic profile of KPC-2 and suggest that the Asp179Asn substitution results in an alternative complex mechanism leading to CAZ-AVI resistance. The future design of novel β-lactams and β-lactamase inhibitors must consider the mechanistic basis of resistance of this and other threatening carbapenemases. IMPORTANCE Antibiotic resistance is emerging at unprecedented rates and threatens to reach crisis levels. One key

  18. Antibiotic Resistance and Virulence Phenotypes of Recent Bacterial Strains Isolated from Urinary Tract Infections in Elderly Patients with Prostatic Disease

    Directory of Open Access Journals (Sweden)

    Cristina Delcaru

    2017-05-01

    Full Text Available Acute bacterial prostatitis is one of the frequent complications of urinary tract infection (UTI. From the approximately 10% of men having prostatitis, 7% experience a bacterial prostatitis. The purpose of this study was to investigate the prevalence of uropathogens associated with UTIs in older patients with benign prostatic hyperplasia and to assess their susceptibility to commonly prescribed antibiotics as well as the relationships between microbial virulence and resistance features. Uropathogenic Escherichia coli was found to be the most frequent bacterial strain isolated from patients with benign prostatic hyperplasia, followed by Enterococcus spp., Enterobacter spp., Klebsiella spp., Proteus spp., Pseudomonas aeruginosa, and Serratia marcescens. Increased resistance rates to tetracyclines, quinolones, and sulfonamides were registered. Besides their resistance profiles, the uropathogenic isolates produced various virulence factors with possible implications in the pathogenesis process. The great majority of the uropathogenic isolates revealed a high capacity to adhere to HEp-2 cell monolayer in vitro, mostly exhibiting a localized adherence pattern. Differences in the repertoire of soluble virulence factors that can affect bacterial growth and persistence within the urinary tract were detected. The Gram-negative strains produced pore-forming toxins—such as hemolysins, lecithinases, and lipases—proteases, siderophore-like molecules resulted from the esculin hydrolysis and amylases, while Enterococcus sp. strains were positive only for caseinase and esculin hydrolase. Our study demonstrates that necessity of investigating the etiology and local resistance patterns of uropathogenic organisms, which is crucial for determining appropriate empirical antibiotic treatment in elderly patients with UTI, while establishing correlations between resistance and virulence profiles could provide valuable input about the clinical evolution and

  19. Use of a molecular diagnostic test in AFB smear positive tuberculosis suspects greatly reduces time to detection of multidrug resistant tuberculosis.

    Directory of Open Access Journals (Sweden)

    Nestani Tukvadze

    Full Text Available The WHO has recommended the implementation of rapid diagnostic tests to detect and help combat M/XDR tuberculosis (TB. There are limited data on the performance and impact of these tests in field settings.The performance of the commercially available Genotype MTBDRplus molecular assay was compared to conventional methods including AFB smear, culture and drug susceptibility testing (DST using both an absolute concentration method on Löwenstein-Jensen media and broth-based method using the MGIT 960 system. Sputum specimens were obtained from TB suspects in the country of Georgia who received care through the National TB Program.Among 500 AFB smear-positive sputum specimens, 458 (91.6% had both a positive sputum culture for Mycobacterium tuberculosis and a valid MTBDRplus assay result. The MTBDRplus assay detected isoniazid (INH resistance directly from the sputum specimen in 159 (89.8% of 177 specimens and MDR-TB in 109 (95.6% of 114 specimens compared to conventional methods. There was high agreement between the MTBDRplus assay and conventional DST results in detecting MDR-TB (kappa = 0.95, p<0.01. The most prevalent INH resistance mutation was S315T (78% in the katG codon and the most common rifampicin resistance mutation was S531L (68% in the rpoB codon. Among 13 specimens from TB suspects with negative sputum cultures, 7 had a positive MTBDRplus assay (3 with MDR-TB. The time to detection of MDR-TB was significantly less using the MTBDRplus assay (4.2 days compared to the use of standard phenotypic tests (67.3 days with solid media and 21.6 days with broth-based media.Compared to conventional methods, the MTBDRplus assay had high accuracy and significantly reduced time to detection of MDR-TB in an area with high MDR-TB prevalence. The use of rapid molecular diagnostic tests for TB and drug resistance should increase the proportion of patients promptly placed on appropriate therapy.

  20. Construction of retrovirus vector taking MDR1/ACBC1 and its ...

    African Journals Online (AJOL)

    We successfully observed the expression of the reporter gene-GFP by using the green light fluorescence microscope and the p-glycoprotein (P-gp) expressed by exogenous gene MDR1 by Western Blotting. All these facts indicated that the retroviral vector PMX-flag-MDR1-GFP had successfully been transfected into ...

  1. Recovery, modernization and computerization of the monochromator MDR-23

    International Nuclear Information System (INIS)

    Miranda, L. J.

    2012-01-01

    For use in the Optics Laboratory, newly created in the CEADEN, one of the necessary equipment is the Monochromator MDR-23, which was necessary for recovery, modernization (replacing the power supply and control) and computerization by designing a VI (virtual instrument) to control stepper motor through a PC using Lab VIEW 7.1 that allows users to select the address mode, the number of steps and the engine speed and give the initial value of the position and limits the range of the monochromator to start working with it. The principle of operation of the program is done in detail to facilitate understanding of how to operate and use the graphical programming designed and achieve efficient use of equipment. (Author)

  2. Screening Antibacterial Agent from Crude Extract of Marine-Derived Fungi Associated with Soft Corals against MDR-Staphylococcus haemolyticus

    Science.gov (United States)

    Sabdaningsih, A.; Cristianawati, O.; Sibero, M. T.; Nuryadi, H.; Radjasa, O. K.; Sabdono, A.; Trianto, A.

    2017-02-01

    Multidrug resistant Staphylococcus haemolyticus is a Gram-positive bacteria and member of coagulase negative staphylococci (CoNS) which has the highest level of antimicrobial resistance. This nosocomial pathogen due to skin or soft tissue infections, bacteremia, septicemia, peritonitis, otitis media, meningitis and urinary tract infections. The ability to produce enterotoxins, hemolysins, biofilm, and cytotoxins could be an important characteristic for the successful of infection. Marine-derived fungi have potency as a continuous supply of bioactive compound. The aim of this research was screening antibacterial agent from crude extracts of marine-derived fungi associated with soft corals against MDR-S. haemolyticus. Among 23 isolates of marine-derived fungi isolated from 7 soft corals, there were 4 isolates active against MDR-S. haemolyticus. The screening was conducted by using agar plug diffusion method. Isolate PPSC-27-A4 had the highest antibacterial activity with diameter 23±9,6 mm. The crude extract from this isolate had been confirmed to antibacterial susceptibility test and it had the highest antibacterial activity in 12.2 mm with concentration of 300μg/ml from mycelia extract. PPSC-27-A4 had been characterized in molecular, based on the sequence analysis of 18S rRNA, PPSC-27-A4 isolate was identified as Trichoderma longibrachiatum.

  3. Procurement and Supply Management System for MDR-TB in Nigeria: Are the Early Warning Targets for Drug Stock Outs and Over Stock of Drugs Being Achieved?

    Science.gov (United States)

    Jatau, Bolajoko; Avong, Yohanna; Ogundahunsi, Olumide; Shah, Safieh; Tayler Smith, Katherine; Van den Bergh, Rafael; Zachariah, Rony; van Griensven, Johan; Ekong, Ernest; Dakum, Patrick

    2015-01-01

    The World Health Organisation (WHO) introduced the twelve early warning indicators for monitoring and evaluating drug Procurement and Supply management (PSM) systems, intended to prevent drug stock-outs and overstocking. Nigeria--one of the high Multi Drug Resistant Tuberculosis (MDR-TB) burden countries, scaled-up treatment in 2012 with the concurrent implementation of a PSM system. We evaluated how well this system functioned using the WHO indicators, including all seven MDR-TB treatment centres in the country that were functional throughout 2013. The quantity of MDR-TB drugs ordered for 2013 matched the annual forecast and all central orders placed during the year were delivered in full and on time. Drug consumption was 81%-106% of the quantity allocated for routine consumption. Timely submission of complete inventory reports ranged from 86-100%, late submissions being 5-15 days late. Forty to 71% of treatment centres placed a drug order when stock was below the minimum level of three months. The proportion of drug orders received at the treatment centres in full and on time ranged from 29-80%, late orders being 1-19 days late. The PSM was found to be performing well in terms of forecasting and procurement of MDR-TB drugs, but there were shortcomings in drug distribution, reporting at treatment centre level and in drug order placements. Despite these gaps, there were no stock outs. These findings indicate that where it matters most, namely ensuring that no drug stock outs affect patient management, the PSM system is effective. Addressing the observed shortcomings will help to strengthen the existing PSM system in anticipation of a growing MDR-TB case burden in the country.

  4. Functional study of the novel multidrug resistance gene HA117 and its comparison to multidrug resistance gene 1

    Directory of Open Access Journals (Sweden)

    Chen Tingfu

    2010-07-01

    Full Text Available Abstract Background The novel gene HA117 is a multidrug resistance (MDR gene expressed by all-trans retinoic acid-resistant HL-60 cells. In the present study, we compared the multidrug resistance of the HA117 with that of the classical multidrug resistance gene 1 (MDR1 in breast cancer cell line 4T1. Methods Transduction of the breast cancer cell line 4T1 with adenoviral vectors encoding the HA117 gene and the green fluorescence protein gene (GFP (Ad-GFP-HA117, the MDR1 and GFP (Ad-GFP-MDR1 or GFP (Ad-GFP was respectively carried out. The transduction efficiency and the multiplicity of infection (MOI were detected by fluorescence microscope and flow cytometry. The transcription of HA117 gene and MDR1 gene were detected by reverse transcription polymerase chain reaction (RT-PCR. Western blotting analysis was used to detect the expression of P-glycoprotein (P-gp but the expression of HA117 could not be analyzed as it is a novel gene and its antibody has not yet been synthesized. The drug-excretion activity of HA117 and MDR1 were determined by daunorubicin (DNR efflux assay. The drug sensitivities of 4T1/HA117 and 4T1/MDR1 to chemotherapeutic agents were detected by Methyl-Thiazolyl-Tetrazolium (MTT assay. Results The transducted efficiency of Ad-GFP-HA117 and Ad-GFP-MDR1 were 75%-80% when MOI was equal to 50. The transduction of Ad-GFP-HA117 and Ad-GFP-MDR1 could increase the expression of HA117 and MDR1. The drug resistance index to Adriamycin (ADM, vincristine (VCR, paclitaxel (Taxol and bleomycin (BLM increased to19.8050, 9.0663, 9.7245, 3.5650 respectively for 4T1/HA117 and 24.2236, 11.0480, 11.3741, 0.9630 respectively for 4T1/MDR1 as compared to the control cells. There were no significant differences in drug sensitivity between 4T1/HA117 and 4T1/MDR1 for the P-gp substrates (ADM, VCR and Taxol (P Conclusions These results confirm that HA117 is a strong MDR gene in both HL-60 and 4T1 cells. Furthermore, our results indicate that the MDR

  5. A preliminary characterisation of recovered uranium produced by MDR

    International Nuclear Information System (INIS)

    Kwon, Hyuk Il; Davison, J.; Marsh, G.

    1997-10-01

    The CANFLEX-RU fuel to be developed for the future should be verified if it has any major problems in RU handling techniques and related technology development. For this purpose, a preliminary R and D efforts on the RU handling characteristics were executed by joint effort with BNFL in following area. 1) preparation of RU powder by the MDR process 2) Compaction and sintering characteristics of RU powder 3) required special process for the production of CANFLEX-RU fuel 4) characterization of fission product residue composition in the RU powder 5) radiological characterization of RU powder and sintered pellets. Physical characterization of RU UO 2 powder and pellet produced by the MDR process were similar with those of NU UO 2 powder and pellet. The density of RU pellets, however, were higher than those of NU pellets and RU pellets showed little higher values in pore size distributions. RU contained only negligibly low concentrations of fission products and actinides. Especially, the Cs-137 content in the powder (before sintering) were undetectable and therefore would not contaminate the sintering furnace. RU pellet showed higher impurity levels, especially in the Ni content. Radioactivity on the RU powder showed about twice higher value at the surface than those of NU, but showed drastic reduction by distance and became similar at the 1 meter distance. RU pellets showed close coincidence between NU and RU at any distance. This result could be used close coincidence between NU and RU at any distance. This result could be used as a basis of the feasibility assessment on the development of CANFLEX-RU. Through basic research works on the improvement of CANFLEX-RU fabrication processes, compatibility with CANFLEX-NU fabrication process will be evaluated and analysed. (author). 4 refs

  6. A preliminary characterisation of recovered uranium produced by MDR

    Energy Technology Data Exchange (ETDEWEB)

    Kwon, Hyuk Il [Korea Atomic Energy Research Inst., Daeduk (Korea, Republic of); Davison, J.; Marsh, G. [British Nuclear Forum, London (United Kingdom)

    1997-10-01

    The CANFLEX-RU fuel to be developed for the future should be verified if it has any major problems in RU handling techniques and related technology development. For this purpose, a preliminary R and D efforts on the RU handling characteristics were executed by joint effort with BNFL in following area. 1) preparation of RU powder by the MDR process 2) Compaction and sintering characteristics of RU powder 3) required special process for the production of CANFLEX-RU fuel 4) characterization of fission product residue composition in the RU powder 5) radiological characterization of RU powder and sintered pellets. Physical characterization of RU UO{sub 2} powder and pellet produced by the MDR process were similar with those of NU UO{sub 2} powder and pellet. The density of RU pellets, however, were higher than those of NU pellets and RU pellets showed little higher values in pore size distributions. RU contained only negligibly low concentrations of fission products and actinides. Especially, the Cs-137 content in the powder (before sintering) were undetectable and therefore would not contaminate the sintering furnace. RU pellet showed higher impurity levels, especially in the Ni content. Radioactivity on the RU powder showed about twice higher value at the surface than those of NU, but showed drastic reduction by distance and became similar at the 1 meter distance. RU pellets showed close coincidence between NU and RU at any distance. This result could be used close coincidence between NU and RU at any distance. This result could be used as a basis of the feasibility assessment on the development of CANFLEX-RU. Through basic research works on the improvement of CANFLEX-RU fabrication processes, compatibility with CANFLEX-NU fabrication process will be evaluated and analysed. (author). 4 refs.

  7. Detection of the tetM resistance determinant among phenotypically sensitive Ureaplasma species by a novel real-time PCR method.

    Science.gov (United States)

    Kotrotsiou, Tzimoula; Tzimoula, Kotrotsiou; Exindari, Maria; Maria, Exindari; Diza, Eudoxia; Eudoxia, Diza; Gioula, Georgia; Georgia, Gioula; Melidou, Angeliki; Angeliki, Melidou; Malisiovas, Nikolaos; Nikolaos, Malisiovas

    2015-02-01

    The study aimed to identify the proportion of tetM-positive Ureaplasma spp. isolates phenotypically susceptible to tetracycline by real-time PCR. Ureaplasma spp. strains of urogenital origin were isolated from 100 female or male adults on A7 agar plates. The presence of Ureaplasma was confirmed by the presence of urease gene by a novel real-time PCR method. Genotyping and sensitivity to tetracyclines were examined using commercial methods. The tetM gene was detected by a novel real-time PCR method especially designed for this study. Ureaplasma parvum was isolated from 87 of the specimens; Ureaplasma urealyticum, from 12; and both species were isolated from a single specimen. All isolates were phenotypically susceptible to tetracyclines. Thirty-five strains were tetM carriers; 29 (82.9%), U. parvum; 5 (14.3%), U. urealyticum; and 1 (2.9%), U. parvum/U. urealyticum. No statistically significant difference was observed between the 3 groups. Four (40%) tetM carriers were isolated from 10 symptomatic men; 11 (32.4%), from 34 symptomatic women; and 20 (35.7%), from 56 asymptomatic women. No statistically significant difference was observed between the 3 groups. The tetM determinant is detected in 35% of phenotypically susceptible to tetracycline Ureaplasma spp. Greek isolates. The use of a real-time PCR technique is particularly helpful, as it makes its detection easy; cost-effective; rapid; and, therefore, more convenient for the surveillance of the dissemination of the tetM resistance gene. Copyright © 2015 Elsevier Inc. All rights reserved.

  8. Novel plasmids and resistance phenotypes in Yersinia pestis: unique plasmid inventory of strain Java 9 mediates high levels of arsenic resistance.

    Science.gov (United States)

    Eppinger, Mark; Radnedge, Lyndsay; Andersen, Gary; Vietri, Nicholas; Severson, Grant; Mou, Sherry; Ravel, Jacques; Worsham, Patricia L

    2012-01-01

    Growing evidence suggests that the plasmid repertoire of Yersinia pestis is not restricted to the three classical virulence plasmids. The Java 9 strain of Y. pestis is a biovar Orientalis isolate obtained from a rat in Indonesia. Although it lacks the Y. pestis-specific plasmid pMT, which encodes the F1 capsule, it retains virulence in mouse and non-human primate animal models. While comparing diverse Y. pestis strains using subtractive hybridization, we identified sequences in Java 9 that were homologous to a Y. enterocolitica strain carrying the transposon Tn2502, which is known to encode arsenic resistance. Here we demonstrate that Java 9 exhibits high levels of arsenic and arsenite resistance mediated by a novel promiscuous class II transposon, named Tn2503. Arsenic resistance was self-transmissible from Java 9 to other Y. pestis strains via conjugation. Genomic analysis of the atypical plasmid inventory of Java 9 identified pCD and pPCP plasmids of atypical size and two previously uncharacterized cryptic plasmids. Unlike the Tn2502-mediated arsenic resistance encoded on the Y. enterocolitica virulence plasmid; the resistance loci in Java 9 are found on all four indigenous plasmids, including the two novel cryptic plasmids. This unique mobilome introduces more than 105 genes into the species gene pool. The majority of these are encoded by the two entirely novel self-transmissible plasmids, which show partial homology and synteny to other enterics. In contrast to the reductive evolution in Y. pestis, this study underlines the major impact of a dynamic mobilome and lateral acquisition in the genome evolution of the plague bacterium.

  9. Novel plasmids and resistance phenotypes in Yersinia pestis: unique plasmid inventory of strain Java 9 mediates high levels of arsenic resistance.

    Directory of Open Access Journals (Sweden)

    Mark Eppinger

    Full Text Available Growing evidence suggests that the plasmid repertoire of Yersinia pestis is not restricted to the three classical virulence plasmids. The Java 9 strain of Y. pestis is a biovar Orientalis isolate obtained from a rat in Indonesia. Although it lacks the Y. pestis-specific plasmid pMT, which encodes the F1 capsule, it retains virulence in mouse and non-human primate animal models. While comparing diverse Y. pestis strains using subtractive hybridization, we identified sequences in Java 9 that were homologous to a Y. enterocolitica strain carrying the transposon Tn2502, which is known to encode arsenic resistance. Here we demonstrate that Java 9 exhibits high levels of arsenic and arsenite resistance mediated by a novel promiscuous class II transposon, named Tn2503. Arsenic resistance was self-transmissible from Java 9 to other Y. pestis strains via conjugation. Genomic analysis of the atypical plasmid inventory of Java 9 identified pCD and pPCP plasmids of atypical size and two previously uncharacterized cryptic plasmids. Unlike the Tn2502-mediated arsenic resistance encoded on the Y. enterocolitica virulence plasmid; the resistance loci in Java 9 are found on all four indigenous plasmids, including the two novel cryptic plasmids. This unique mobilome introduces more than 105 genes into the species gene pool. The majority of these are encoded by the two entirely novel self-transmissible plasmids, which show partial homology and synteny to other enterics. In contrast to the reductive evolution in Y. pestis, this study underlines the major impact of a dynamic mobilome and lateral acquisition in the genome evolution of the plague bacterium.