WorldWideScience

Sample records for resistance mdr gene

  1. Quantitative analysis of MDR1 (multidrug resistance) gene expression in human tumors by polymerase chain reaction

    International Nuclear Information System (INIS)

    Noonan, K.E.; Beck, C.; Holzmayer, T.A.; Chin, J.E.; Roninson, I.B.; Wunder, J.S.; Andrulis, I.L.; Gazdar, A.F.; Willman, C.L.; Griffith, B.; Von Hoff, D.D.

    1990-01-01

    The resistance of tumor cells ot chemotheraprutic drugs is a major obstacle to successful cancer chemotherapy. In human cells, expression of the MDR1 gene, encoding a transmembrane efflux pump (P-glycoprotein), leads to decreased intracellular accumulation and resistance to a variety of lipophilic drugs (multidrug resistance; MDR). The levels of MDR in cell lines selected in bitro have been shown to correlate with the steady-state levels of MDR1 mRNA and P-glycoprotein. In cells with a severalfold increase in cellular drug resistance, MDR1 expression levels are close to the limits of detection by conventional assays. MDR1 expression has been frequently observed in human tumors after chemotherapy and in some but not all types of clinically refactory tumors untreated with chemotherapeutic drugs. The authors have devised a highly sensitive, specific, and quantitative protocol for measuring the levels of MDR1 mRNA in clincal samples, based on the polymerase chain reaction. They have used this assay to measure MDR1 gene expression in MDR cell lines and >300 normal tissues, tumor-derived cell lines, and clinical specimens of untreated tumors of the types in which MDR1 expression was rarely observed by standard assays. Low levels of MDR1 expression were found by polymerase chain reaction in most solid tumors and leukemias tested. The frequency of samples without detectable MDR1 expression varied among different types of tumors; MDR1-negative samples were ost common among tumor types known to be relatively responsive to chemotherapy

  2. Modulation of human multidrug-resistance MDR-1 gene by natural curcuminoids

    Directory of Open Access Journals (Sweden)

    Buddhasukh Duang

    2004-04-01

    Full Text Available Abstract Background Multidrug resistance (MDR is a phenomenon that is often associated with decreased intracellular drug accumulation in patient's tumor cells resulting from enhanced drug efflux. It is related to the overexpression of a membrane protein, P-glycoprotein (Pgp-170, thereby reducing drug cytotoxicity. A variety of studies have tried to find MDR modulators which increase drug accumulation in cancer cells. Methods In this study, natural curcuminoids, pure curcumin, demethoxycurcumin and bisdemethoxycurcumin, isolated from turmeric (Curcuma longa Linn, were compared for their potential ability to modulate the human MDR-1 gene expression in multidrug resistant human cervical carcinoma cell line, KB-V1 by Western blot analysis and RT-PCR. Results Western blot analysis and RT-PCR showed that all the three curcuminoids inhibited MDR-1 gene expression, and bisdemethoxycurcumin produced maximum effect. In additional studies we found that commercial grade curcuminoid (approximately 77% curcumin, 17% demethoxycurcumin and 3% bisdemthoxycurcumin decreased MDR-1 gene expression in a dose dependent manner and had about the same potent inhibitory effect on MDR-1 gene expression as our natural curcuminoid mixtures. Conclusion These results indicate that bisdemethoxycurcumin is the most active of the curcuminoids present in turmeric for modulation of MDR-1 gene. Treatment of drug resistant KB-V1 cells with curcumin increased their sensitivity to vinblastine, which was consistent with a decreased MDR-1 gene product, a P-glycoprotein, on the cell plasma membrane. Although many drugs that prevent the P-glycoprotein function have been reported, this report describes the inhibition of MDR-1 expression by a phytochemical. The modulation of MDR-1 expression may be an attractive target for new chemosensitizing agents.

  3. Modulation of human multidrug-resistance MDR-1 gene by natural curcuminoids

    International Nuclear Information System (INIS)

    Limtrakul, Pornngarm; Anuchapreeda, Songyot; Buddhasukh, Duang

    2004-01-01

    Multidrug resistance (MDR) is a phenomenon that is often associated with decreased intracellular drug accumulation in patient's tumor cells resulting from enhanced drug efflux. It is related to the overexpression of a membrane protein, P-glycoprotein (Pgp-170), thereby reducing drug cytotoxicity. A variety of studies have tried to find MDR modulators which increase drug accumulation in cancer cells. In this study, natural curcuminoids, pure curcumin, demethoxycurcumin and bisdemethoxycurcumin, isolated from turmeric (Curcuma longa Linn), were compared for their potential ability to modulate the human MDR-1 gene expression in multidrug resistant human cervical carcinoma cell line, KB-V1 by Western blot analysis and RT-PCR. Western blot analysis and RT-PCR showed that all the three curcuminoids inhibited MDR-1 gene expression, and bisdemethoxycurcumin produced maximum effect. In additional studies we found that commercial grade curcuminoid (approximately 77% curcumin, 17% demethoxycurcumin and 3% bisdemthoxycurcumin) decreased MDR-1 gene expression in a dose dependent manner and had about the same potent inhibitory effect on MDR-1 gene expression as our natural curcuminoid mixtures. These results indicate that bisdemethoxycurcumin is the most active of the curcuminoids present in turmeric for modulation of MDR-1 gene. Treatment of drug resistant KB-V1 cells with curcumin increased their sensitivity to vinblastine, which was consistent with a decreased MDR-1 gene product, a P-glycoprotein, on the cell plasma membrane. Although many drugs that prevent the P-glycoprotein function have been reported, this report describes the inhibition of MDR-1 expression by a phytochemical. The modulation of MDR-1 expression may be an attractive target for new chemosensitizing agents

  4. Anaplasia and drug selection-independent overexpression of the multidrug resistance gene, MDR1, in Wilms' tumor.

    Science.gov (United States)

    Re, G G; Willingham, M C; el Bahtimi, R; Brownlee, N A; Hazen-Martin, D J; Garvin, A J

    1997-02-01

    One reason for the failure of chemotherapy is the overexpression of the multidrug resistance gene, MDR1. The product of this gene is the multidrug transporter P-glycoprotein, an ATP-dependent pump that extrudes drugs from the cytoplasm. Some tumors inherently express P-glycoprotein, whereas others acquire the ability to do so after exposure to certain chemotherapeutic agents, often by the mechanism of gene amplification. Classical Wilms' tumors (nephroblastoma) typically respond to therapy and have a good prognosis. On the contrary, anaplastic Wilms' tumors are generally refractory to chemotherapy. These anaplastic variants are rare (4.5% of all Wilms' tumors reported in the United States), aggressive, and often fatal forms of tumor, which are commonly thought to result from the progression of classical Wilms' tumors. To investigate the basis for this differential response to therapy, we examined a number of classical and anaplastic Wilms' tumors for the expression of the MDR1 gene by immunohistochemical and mRNA analysis. Classical Wilms' tumors consistently did not express P-glycoprotein except in areas of tubular differentiation, as in normal kidney. Similarly, two of three anaplastic tumors failed to show P-glycoprotein expression. In contrast, cultured cells derived from a third anaplastic tumor, W4, exhibited strong P-glycoprotein expression and were drug resistant in vitro. Southern analysis revealed that W4 cells contained a single copy of the MDR1 gene per haploid genome similar to normal cells, demonstrating that the overexpression of MDR1 was not caused by gene amplification. Transcriptional activation of the MDR1 gene would be in keeping with the concept that p53 might act as a transcriptional repressor of the MDR1 gene.

  5. Association of ACE and MDR1 Gene Polymorphisms with Steroid Resistance in Children with Idiopathic Nephrotic Syndrome.

    Science.gov (United States)

    Dhandapani, Mohanapriya Chinambedu; Venkatesan, Vettriselvi; Rengaswamy, Nammalwar Bollam; Gowrishankar, Kalpana; Nageswaran, Prahlad; Perumal, Venkatachalam

    2015-08-01

    The purpose of the study was to investigate the distribution of insertion/deletion (I/D) polymorphisms of the angiotensin-converting enzyme (ACE) gene and three exonic polymorphisms of the multidrug resistance 1 (MDR1) gene (C3435T, C1236T, and G2677T) in children diagnosed with idiopathic nephrotic syndrome (INS). The study group consisted of 100 healthy controls and 150 INS patients, of which 50 were steroid resistant. Genomic DNA from blood samples was isolated from both of these groups and genotyping of the ACE and MDR1 genes was performed by polymerase chain reaction (PCR) using specific primers. There was no significant difference observed in the genotypic distribution and D allele frequency of the ACE gene. The two single-nucleotide polymorphisms (SNPs), C1236T and C3435T, of the MDR1 gene showed no significance, whereas the SNP G2677T/A was significantly associated with the genotypes GT and GA of the MDR1 gene, indicating it may be a potential marker to detect drug resistance. Screening these polymorphisms will pave the way to better understand the molecular mechanisms of the disease, which may be useful in developing targeted therapies for INS patients.

  6. Identification of antibiotic resistance genes in the multidrug-resistant Acinetobacter baumannii strain, MDR-SHH02, using whole-genome sequencing.

    Science.gov (United States)

    Wang, Hualiang; Wang, Jinghua; Yu, Peijuan; Ge, Ping; Jiang, Yanqun; Xu, Rong; Chen, Rong; Liu, Xuejie

    2017-02-01

    This study aimed to investigate antibiotic resistance genes in the multidrug-resistant (MDR) Acinetobacter baumannii (A. baumanii) strain, MDR-SHH02, using whole‑genome sequencing (WGS). The antibiotic resistance of MDR-SHH02 isolated from a patient with breast cancer to 19 types of antibiotics was determined using the Kirby‑Bauer method. WGS of MDR-SHH02 was then performed. Following quality control and transcriptome assembly, functional annotation of genes was conducted, and the phylogenetic tree of MDR-SHH02, along with another 5 A. baumanii species and 2 Acinetobacter species, was constructed using PHYLIP 3.695 and FigTree v1.4.2. Furthermore, pathogenicity islands (PAIs) were predicted by the pathogenicity island database. Potential antibiotic resistance genes in MDR-SHH02 were predicted based on the information in the Antibiotic Resistance Genes Database (ARDB). MDR-SHH02 was found to be resistant to all of the tested antibiotics. The total draft genome length of MDR-SHH02 was 4,003,808 bp. There were 74.25% of coding sequences to be annotated into 21 of the Clusters of Orthologous Groups (COGs) of protein terms, such as 'transcription' and 'amino acid transport and metabolism'. Furthermore, there were 45 PAIs homologous to the sequence MDRSHH02000806. Additionally, a total of 12 gene sequences in MDR-SHH02 were highly similar to the sequences of antibiotic resistance genes in ARDB, including genes encoding aminoglycoside‑modifying enzymes [e.g., aac(3)-Ia, ant(2'')‑Ia, aph33ib and aph(3')-Ia], β-lactamase genes (bl2b_tem and bl2b_tem1), sulfonamide-resistant dihydropteroate synthase genes (sul1 and sul2), catb3 and tetb. These results suggest that numerous genes mediate resistance to various antibiotics in MDR-SHH02, and provide a clinical guidance for the personalized therapy of A. baumannii-infected patients.

  7. Multiple drug resistance protein (MDR-1, multidrug resistance-related protein (MRP and lung resistance protein (LRP gene expression in childhood acute lymphoblastic leukemia

    Directory of Open Access Journals (Sweden)

    Elvis Terci Valera

    Full Text Available CONTEXT: Despite the advances in the cure rate for acute lymphoblastic leukemia, approximately 25% of affected children suffer relapses. Expression of genes for the multiple drug resistance protein (MDR-1, multidrug resistance-related protein (MRP, and lung resistance protein (LRP may confer the phenotype of resistance to the treatment of neoplasias. OBJECTIVE: To analyze the expression of the MDR-1, MRP and LRP genes in children with a diagnosis of acute lymphoblastic leukemia via the semiquantitative reverse transcription polymerase chain reaction (RT-PCR, and to determine the correlation between expression and event-free survival and clinical and laboratory variables. DESIGN: A retrospective clinical study. SETTING: Laboratory of Pediatric Oncology, Department of Pediatrics, Faculdade de Medicina de Ribeirão Preto, Universidade de São Paulo, Brazil. METHODS: Bone marrow aspirates from 30 children with a diagnosis of acute lymphoblastic leukemia were assessed for the expression of messenger RNA for the MDR-1, MRP and LRP genes by semi-quantitative RT-PCR. RESULTS: In the three groups studied, only the increased expression of LRP was related to worsened event-free survival (p = 0.005. The presence of the common acute lymphoblastic leukemia antigen (CALLA was correlated with increased LRP expression (p = 0.009 and increased risk of relapse or death (p = 0.05. The relative risk of relapse or death was six times higher among children with high LRP expression upon diagnosis (p = 0.05, as confirmed by multivariate analysis of the three genes studied (p = 0.035. DISCUSSION: Cell resistance to drugs is a determinant of the response to chemotherapy and its detection via RT-PCR may be of clinical importance. CONCLUSIONS: Evaluation of the expression of genes for resistance to antineoplastic drugs in childhood acute lymphoblastic leukemia upon diagnosis, and particularly the expression of the LRP gene, may be of clinical relevance, and should be the

  8. Amplification of genome sections in mammalian somatic cells resistant to colchicine. VII. Localization of original and amplified copes of the mdr gene in the same segment of chromosome 4 of the Dzungarian hamster

    International Nuclear Information System (INIS)

    Sokova, O.I.; Siyanova, E.Yu.; Gudkov, A.V.; Kopnin, B.P.

    1988-01-01

    Using in situ hybridization, the mdr gene was mapped in chromosomes of Dzungarian hamster embryonic cells, amplification of which accompanies development of multidrug resistance (MDR). It was shown that the mdr gene is located in chromosome segment 4q15-21, in which, according to data obtained previously, amplified copes of open quotes MDR genes close quotes (mdr, et al.) are distributed, as a rule. Results obtained, as well as data of other investigators, attest to the fact that integration recombination of amplified copies of DNA occurs primarily at the site of disposition of homologous sequences

  9. [Polymorphisms of the multiple drug resistance gene (MDR1) in Mapuche, Mestizo and Maori populations in Chile].

    Science.gov (United States)

    Wielandt, Ana María; Vollrath, Valeska; Chianale, José

    2004-09-01

    There are significant differences in drug responses among different ethnic groups. The multidrug transporter P-gp, encoded by the MDR1 gene, plays a key role in determining drug bioavailability, and an association between a polymorphism in exon 26 (C3435T) and lower P-gp expression has been found. The co-segregation of this polymorphism with the polymorphism in exon 12 (C1236T) and in exon 21 (G2677T/A) determines several MDR1 haplotypes in humans. To characterize the polymorphisms of exons 26, 21 and 12 of the MDR1 gene in different Chilean populations. Using a polymerase chain reaction and restriction fragment length polymorphism technique, we studied the allelic frequencies and the distribution of MDR1 haplotypes in 3 Chilean populations: Mestizo (n=104), Mapuche (n=96, living in the National Reservation of the Huapi Island, Ranico Lake) and Maori (n=52, living in Eastern Island). The frequency of the normal MDR1*1 haplotype, without mutations, was lower in Mapuches than in Mestizos or Maoris (p0.0.5), but lower than the frequencies reported in Caucasians or Asians (p<0.05). We found significant differences in the frequencies of genetic polymorphisms of the MDR1 gene in Chilean populations, related to the ethnic origins of our ancestors.

  10. Expression of multidrug resistance genes MVP, MDR1, and MRP1 determined sequentially before, during, and after hyperthermic isolated limb perfusion of soft tissue sarcoma and melanoma patients.

    Science.gov (United States)

    Stein, Ulrike; Jürchott, Karsten; Schläfke, Matthias; Hohenberger, Peter

    2002-08-01

    Isolated, hyperthermic limb perfusion (ILP) with recombinant human tumor necrosis factor alpha and melphalan is a highly effective treatment for advanced soft tissue sarcoma (STS) and locoregional metastatic malignant melanoma. Multidrug resistance (MDR)-associated genes are known to be inducible by heat and drugs; expression levels of the major vault protein (MVP), MDR1, and MDR-associated protein 1 (MRP1) were determined sequentially before, during, and after ILP of patients. Twenty-one STS or malignant melanoma patients were treated by ILP. Tumor tissue temperatures were recorded continuously and ranged from 33.4 degrees C initially to peak values of 40.4 degrees C during ILP. Serial true-cut biopsy specimens from tumor tissues were routinely microdissected. Expression analyses for MDR genes were performed by real-time reverse transcriptase polymerase chain reaction and immunohistochemistry. In 83% of the patients, MVP expression was induced during hyperthermic ILP. MVP-mRNA inductions often paralleled the increase in temperature during ILP. Increased MVP protein expressions either were observed simultaneously with the MVP-mRNA induction or were delayed until after the induction at the transcriptional level. Inductions of MDR1 and MRP1 were observed in only 13% and 27% of the specimens analyzed. Temperatures and drugs applied preferentially led to an induction of MVP and were not sufficient to induce MDR1 and MRP1 in the majority of tumors. This study is the first to analyze the expression of MDR-associated genes sequentially during ILP of patients and demonstrates that treatment might lead to increased levels of MVP, whereas enhanced levels of MDR1 and MRP1 remain rare events.

  11. Expression of multi-drug resistance-related genes MDR3 and MRP as prognostic factors in clinical liver cancer patients.

    Science.gov (United States)

    Yu, Zheng; Peng, Sun; Hong-Ming, Pan; Kai-Feng, Wang

    2012-01-01

    To investigate the expression of multi-drug resistance-related genes, MDR3 and MRP, in clinical specimens of primary liver cancer and their potential as prognostic factors in liver cancer patients. A total of 26 patients with primary liver cancer were enrolled. The expression of MDR3 and MRP genes was measured by real-time PCR and the association between gene expression and the prognosis of patients was analyzed by the Kaplan-Meier method and COX regression model. This study showed that increases in MDR3 gene expression were identified in cholangiocellular carcinoma, cirrhosis and HBsAg-positive patients, while MRP expression increased in hepatocellular carcinoma, non-cirrhosis and HBsAg-negative patients. Moreover, conjugated bilirubin and total bile acid in the serum were significantly reduced in patients with high MRP expression compared to patients with low expression. The overall survival tended to be longer in patients with high MDR3 and MRP expression compared to the control group. MRP might be an independent prognostic factor in patients with liver cancer by COX regression analysis. MDR3 and MRP may play important roles in liver cancer patients as prognostic factors and their underlying mechanisms in liver cancer are worthy of further investigation.

  12. Association between C3435T polymorphism of MDR1 gene and the incidence of drug-resistant epilepsy in the population of Polish children.

    Science.gov (United States)

    Stasiołek, Mariusz; Romanowicz, Hanna; Połatyńska, Katarzyna; Chamielec, Maciej; Skalski, Dominik; Makowska, Marianna; Smolarz, Beata

    2016-07-08

    Epilepsy is a disease of neurological character. Approximately one third of epileptic patients demonstrate a drug-resistant phenotype, which is associated with the development of drug-resistant epilepsy. The multidrug resistance protein 1 and glycoprotein P, encoded by MDR1, play a significant role in the transmembrane transport of anti-epileptic agents. Single nucleotide polymorphism C3435T (rs1045642) within MDR1 gene may be associated with an increased expression of P-gp which affects the levels of antiepileptic drugs in plasma. The presented studies analysed the association between C3435T polymorphism of MDR1 gene and the incidence of drug-resistant epilepsy in the population of Polish children. C3435T polymorphism of MDR1 gene was analysed by the high resolution melting technique in a group of patients with drug-resistant (n = 106) and drug-responsive epilepsy (n = 67), as well as in non-epileptic children (n = 98) hospitalised at the Department of Neurology, Polish Mother's Memorial Hospital in Lodz. Genotype and allele distributions were evaluated and their compatibility with the Hardy-Weinberg distribution was assessed by means of the χ(2) test. Genotype and allele evaluation, regarding their relationship with a given feature, was supported by an analysis of odds ratio and 95 % confidence interval, calculated according to the logistic regression model. An association was observed between the incidence rate of DRE and the presence of C allele in C3435T polymorphism of MDR1 gene, which may enhance the risk of the disease. The T allele may then play a protective role. No differences were found in the studied groups, regarding either genotype or allele distribution in reference to patient's gender or concomitant diseases. Following the obtained results, C3435T polymorphism of MDR1 gene may be connected with the incidence of drug-resistant epilepsy in the population of Polish children. ISRCTN ISRCTN73824458. Registered 28th September 2014.

  13. Personalized Medicine Digoxin Theraphy in Individuals with MDR Gene Polymorphism

    Directory of Open Access Journals (Sweden)

    Em Sutrisna

    2015-06-01

    Full Text Available Digoxin is one of digitalis drugs. Wider applicability to heart failure and arrhythmias (supraventricular requires fairly strict scrutiny because of its narrow therapeutic index. Digoxin is a substrate of P-glycoprotein (P-gp encoded by multi drugs resistance-1 (MDR1. MDR-1 gen located on chromosome 7q21.1. This gene contains 28 exons that encoded a protein of 1280 amino acids. This gene plays an important role in the absorption, distribution and elimination of many drugs. MDR1C3435T polymorphism occurs in exon 26. There are three types of MDR1C3435T gene namely MDR1C3435T CC, MDR1C3435T CT and MDR1C3435T TT. These polymorphisms will affect to the formation of P-gp and consequently to change the kinetic profile of digoxin. The change of kinetic profile causes changes in the digoxin blood levels. The method used in this review is data search based on pubmed, medline, and embase with keywords MDR and digoxin. There are several different studies of the influence of polymorphisms MDR1C3435T on blood digoxin levels. Increased levels of digoxin in the blood due to polymorphism of MDR1C3435T will be at risk of digitalis intoxication. Long-term digoxin treatment or large dose should consider the patient’s genetic profile. Distribution of polymorphism of MDR1C3435T in Javanese population is approximately TT (0,10, CT (0,52, and CC(0, 38.

  14. Cholesterol-Containing Nuclease-Resistant siRNA Accumulates in Tumors in a Carrier-free Mode and Silences MDR1 Gene

    Directory of Open Access Journals (Sweden)

    Ivan V. Chernikov

    2017-03-01

    Full Text Available Chemical modifications are an effective way to improve the therapeutic properties of small interfering RNAs (siRNAs, making them more resistant to degradation in serum and ensuring their delivery to target cells and tissues. Here, we studied the carrier-free biodistribution and biological activity of a nuclease-resistant anti-MDR1 cholesterol-siRNA conjugate in healthy and tumor-bearing severe combined immune deficiency (SCID mice. The attachment of cholesterol to siRNA provided its efficient accumulation in the liver and in tumors, and reduced its retention in the kidneys after intravenous and intraperitoneal injection. The major part of cholesterol-siRNA after intramuscular and subcutaneous injections remained in the injection place. Confocal microscopy data demonstrated that cholesterol-siRNA spread deep in the tissue and was present in the cytoplasm of almost all the liver and tumor cells. The reduction of P-glycoprotein level in human KB-8-5 xenograft overexpressing the MDR1 gene by 60% was observed at days 5–6 after injection. Then, its initial level recovered by the eighth day. The data showed that, regardless of the mode of administration (intravenous, intraperitoneal, or peritumoral, cholesterol-siMDR efficiently reduced the P-glycoprotein level in tumors. The designed anti-MDR1 conjugate has potential as an adjuvant therapeutic for the reversal of multiple drug resistance of cancer cells.

  15. Multi-drug resistance (MDR1 gene and P-glycoprotein influence on pharmacokinetic and pharmacodymanic of therapeutic drugs

    Directory of Open Access Journals (Sweden)

    Linardi Renata Lehn

    2006-01-01

    Full Text Available (MDR1 gene expressed in tumor cells and also in several normal tissues, such as intestine, liver, kidney, blood-brain barrier, spinal cord, and placenta. P-gp has been identified in mice, rat, bovine, monkey, rodents, and human beings and has been receiving a particular clinical relevance because this protein expression limits brain access and intestinal absorption of many drugs. This protein plays a role as a protective barrier against a wide variety of substrates, avoiding drug entry into the central nervous system. P-glycoprotein also interferes with drug bioavailability and disposition, including absorption, distribution, metabolization, and excretion, influencing pharmacokinetic and pharmacodynamic of drugs. Modulation of P-gp may help the efficacy of treatment of several diseases and can explain some adverse central nervous system effects induced by drugs after intravenous administration and the poor response of oral administration in patients. Alteration in P-gp expression or function has been associated with several diseases susceptibility in humans and animals. Furthermore, additional studies relating MDR1 and P-gp expression has an important clinical implication also in terms of treatment efficacy.

  16. Silencage du gene MDR1 et resensibilisation des cellules MCF-7 MDR a la doxorubicine en utilisant les nanoparticules chitosane/MDR1-siARN

    Science.gov (United States)

    El-Ariss, Mohamad

    Cancer is the leading cause of death in Canada and is responsible for about 30% of all deaths in the country.[1] It is estimated that by 2015, one in four Canadians (24% women and 29% men) will die from cancer. In the world and only for 2012, 14 million new cancer cases and 8.2 million deaths from the disease were reported.[2] The worst is yet to come because, according to World Health Organization, the number of new cases is expected to increase by about 70% over the next two decades. The high mortality associated with cancer is partly explained by the acquisition of drug resistance that make patients refractory to chemotherapy. In fact, cancer cells exposed to a cytotoxic agent during chemotherapy, may develop a resistance to this agent as well as various agents sharing structural or functional similarities. These cancer cells are known for multidrug resistance ("Multiple Drug resistant cells"). The development of resistance to chimiodrogues is a major public health problem that presents an obstacle for the development of new cancer treatments. MCF-7 MDR are established cell lines of human breast cancer that have developed resistance to chimiodrogues such as doxorubicin. MCF-7 MDR have the particularity to over-express P-gp protein that is responsible for the detoxification of cells by reflux of chimiodrogues. The purpose of this study was therefore to reduce the expression of P-gp, encoded by the MDR1 gene (also called gene ABCB1) in cancer cells MCF-7, and re-sensitize MCF-7 MDR cells to anti-cancer treatments. In order to modify MDR1 gene expression, we used small RNAi called siRNA that are specific to the MDR1 gene. In total, 4 duplexes of siRNA have been used: siRNA_1, siRNA_1M, siRNA_2 and siRNA_2M. Each of the duplexes strands is consists of 21 nucleic acids and has two protruding nucleic acids (overhangs) at the 3' end. siRNA_1 and siRNA_1M are complementary to the nucleic acid sequence (577-595 nucleic acids ) of the MDR1 gene, whereas siARN_2 and si

  17. The roles of variants in human multidrug resistance (MDR1 gene and their haplotypes on antiepileptic drugs response: a meta-analysis of 57 studies.

    Directory of Open Access Journals (Sweden)

    Hui Li

    Full Text Available Previous studies reported the associations between the ATP-binding cassette sub-family B member 1 (ABCB1, also known as MDR1 polymorphisms and their haplotypes with risk of response to antiepileptic drugs in epilepsy, however, the results were inconclusive.The Pubmed, Embase, Web of Science, CNKI and Chinese Biomedicine databases were searched up to July 15, 2014. Pooled odds ratios (ORs and 95% confidence intervals (CIs were calculated using a fixed-effects or random-effects model based on heterogeneity tests. Meta-regression and Galbraith plot analysis were carried out to explore the possible heterogeneity.A total of 57 studies involving 12407 patients (6083 drug-resistant and 6324 drug-responsive patients with epilepsy were included in the pooled-analysis. For all three polymorphisms (C3435T, G2677T/A, and C1236T, we observed a wide spectrum of minor allele frequencies across different ethnicities. A significantly decreased risk of AEDs resistance was observed in Caucasian patients with T allele of C3435T variant, which was still significant after adjusted by multiple testing corrections (T vs C: OR=0.83, 95%CI=0.71-0.96, p=0.01. However, no significant association was observed between the other two variants and AEDs resistance. Of their haplotypes in ABCB1 gene (all studies were in Indians and Asians, no significant association was observed with AEDs resistance. Moreover, sensitivity and Cumulative analysis showed that the results of this meta-analysis were stable.In summary, this meta-analysis demonstrated that effect of C3435T variant on risk of AEDs resistance was ethnicity-dependent, which was significant in Caucasians. Additionally, further studies in different ethnic groups are warranted to clarify possible roles of haplotypes in ABCB1 gene in AEDs resistance, especially in Caucasians.

  18. Multiple Origins of Mutations in the mdr1 Gene--A Putative Marker of Chloroquine Resistance in P. vivax.

    Directory of Open Access Journals (Sweden)

    Mette L Schousboe

    2015-11-01

    Full Text Available Chloroquine combined with primaquine has been the recommended antimalarial treatment of Plasmodium vivax malaria infections for six decades but the efficacy of this treatment regimen is threatened by chloroquine resistance (CQR. Single nucleotide polymorphisms (SNPs in the multidrug resistance gene, Pvmdr1 are putative determinants of CQR but the extent of their emergence at population level remains to be explored.In this study we describe the prevalence of SNPs in the Pvmdr1 among samples collected in seven P. vivax endemic countries and we looked for molecular evidence of drug selection by characterising polymorphism at microsatellite (MS loci flanking the Pvmdr1 gene.We examined the prevalence of SNPs in the Pvmdr1 gene among 267 samples collected from Pakistan, Afghanistan, Sri Lanka, Nepal, Sudan, São Tomé and Ecuador. We measured and diversity in four microsatellite (MS markers flanking the Pvmdr1 gene to look evidence of selection on mutant alleles.SNP polymorphism in the Pvmdr1 gene was largely confined to codons T958M, Y976F and F1076L. Only 2.4% of samples were wildtype at all three codons (TYF, n = 5, 13.3% (n = 28 of the samples were single mutant MYF, 63.0% of samples (n = 133 were double mutant MYL, and 21.3% (n = 45 were triple mutant MFL. Clear geographic differences in the prevalence of these Pvmdr mutation combinations were observed. Significant linkage disequilibrium (LD between Pvmdr1 and MS alleles was found in populations sampled in Ecuador, Nepal and Sri Lanka, while significant LD between Pvmdr1 and the combined 4 MS locus haplotype was only seen in Ecuador and Sri Lanka. When combining the 5 loci, high level diversity, measured as expected heterozygosity (He, was seen in the complete sample set (He = 0.99, while He estimates for individual loci ranged from 0.00-0.93. Although Pvmdr1 haplotypes were not consistently associated with specific flanking MS alleles, there was significant differentiation between geographic

  19. Genome sequencing and annotation of multidrug resistant Mycobacterium tuberculosis (MDR-TB PR10 strain

    Directory of Open Access Journals (Sweden)

    Mohd Zakihalani A. Halim

    2016-03-01

    Full Text Available Here, we report the draft genome sequence and annotation of a multidrug resistant Mycobacterium tuberculosis strain PR10 (MDR-TB PR10 isolated from a patient diagnosed with tuberculosis. The size of the draft genome MDR-TB PR10 is 4.34 Mbp with 65.6% of G + C content and consists of 4637 predicted genes. The determinants were categorized by RAST into 400 subsystems with 4286 coding sequences and 50 RNAs. The whole genome shotgun project has been deposited at DDBJ/EMBL/GenBank under the accession number CP010968. Keywords: Mycobacterium tuberculosis, Genome, MDR, Extrapulmonary

  20. EXSPRESSION OF MDR-GENES AND MONORESISTANCE GENES IN NON-SMALL-CELL LUNG CANCER

    Directory of Open Access Journals (Sweden)

    E. L. Yumov

    2014-01-01

    Full Text Available We studied the expression of multidrug resistance genes (MDR and monoresistance genes in normal bronchial tissue and tumor tissue of the non-small cell lung cancer (NSCLC after neoadjuvant chemotherapy (NACT (vinorelbine-carboplatine. The study included 30 patients with NSCLC (Т2–4N0–3M0. Normal bronchial tissue, normal lung tissue and tumor tissue collected during surgery following neoadjuvant chemotherapy (NACT served as a material of the study. The expression levels of MDR genes (ABCB1, ABCB2, ABCC1, ABCC2, ABCС5, ABCG1, ABCG2, GSTP and MVP, and monoresistance genes (BRCA1, ERCC1, RRM1, TOP1, TOP2A, TUBB3 and TYMS were estimated by quantitative reverse transcriptase PCR (RT-qPCR. The expression levels of some MDR genes and monoresistance genes (АВСВ1, АВСВ2, ABCG1, ERCC1, GSTP1 and MVP were significantly higher in the bronchi than in tumor tissue. The expression of ABCG1, ABCG2 and ERCC1 genes was higher in patients with T1-2 cancer than in patients with T3-4 cancer. Patients with adenocarcinoma had higher expression of BRCA1, MVP and ABCB1 genes than patients with squamous cell lung cancer. A tendency towards reduction in the expression level of MDR-genes and monoresistance genes was observed in patients with partial tumor regression compared to that observed in patients with stable disease. These findings were consistent with the previous data on reduction in the MDR-gene expression after chemotherapy with a good response in breast cancer patients.

  1. Impact of BCRP/MXR, MRP1 and MDR1/P-Glycoprotein on thermoresistant variants of atypical and classical multidrug resistant cancer cells

    DEFF Research Database (Denmark)

    Stein, Ulrike; Lage, Hermann; Jordan, Andreas

    2002-01-01

    The impact of the ABC transporters breast cancer resistance protein/mitoxantrone resistance associated transporter (BCRP/MXR), multidrug resistance-associated protein 1 (MRP1) and multidrug resistance gene-1/P-glycoprotein (MDR1/PGP) on the multidrug resistance (MDR) phenotype in chemoresistance...... expression of BCRP/MXR and of MRP1 were clearly enhanced (vs. parental and classical MDR lines). MDR1/PGP expression was distinctly elevated in the classical MDR subline EPG85-257RDB (vs. parental and atypical MDR sublines). In all thermoresistant counterparts basal expression of BCRP/MXR, MRP1 and MDR1/PGP...... was increased relative to thermosensitive sublines. Although it could be shown that the overexpressed ABC transporters were functionally active, however, no decreased drug accumulations of doxorubicin, mitoxantrone and rhodamine 123 were observed. Thus, expression of BCRP/MXR, MRP1 and MDR1/PGP was found...

  2. The multidrug resistance 1 (MDR1) gene polymorphism G-rs3789243-A is not associated with disease susceptibility in Norwegian patients with colorectal adenoma and colorectal cancer; a case control study

    DEFF Research Database (Denmark)

    Andersen, V.; Agerstjerne, L.; Jensen, D.

    2009-01-01

    Background: Smoking, dietary factors, and alcohol consumption are known life style factors contributing to gastrointestinal carcinogenesis. Genetic variations in carcinogen handling may affect cancer risk. The multidrug resistance 1(MDR1/ABCB1) gene encodes the transport protein P-glycoprotein (a...... in inflammation, and may thereby affect the risk of malignity. Hence, genetic variations that modify the function of P-glycoprotein may be associated with the risk of colorectal cancer (CRC). We have previously found an association between the MDR1 intron 3 G-rs3789243-A polymorphism and the risk of CRC...... of colorectal carcinomas and adenomas in the Norwegian population was assessed in 167 carcinomas, 990 adenomas, and 400 controls. Genotypes were determined by allelic discrimination. Odds ratio (OR) and 95 confidence interval (95% CI) were estimated by binary logistic regression. Results: No association...

  3. Carcinogen-induced mdr overexpression is associated with xenobiotic resistance in rat preneoplastic liver nodules and hepatocellular carcinomas.

    Science.gov (United States)

    Fairchild, C R; Ivy, S P; Rushmore, T; Lee, G; Koo, P; Goldsmith, M E; Myers, C E; Farber, E; Cowan, K H

    1987-11-01

    We have previously reported the isolation of a human breast cancer cell line resistant to doxorubicin (adriamycin; AdrR MCF-7 cells) that has also developed the phenotype of multidrug resistance (MDR). MDR in this cell line is associated with increased expression of mdr (P glycoprotein) gene sequences. The development of MDR in AdrR MCF-7 cells is also associated with changes in the expression of several phase I and phase II drug-detoxifying enzymes. These changes are remarkably similar to those associated with development of xenobiotic resistance in rat hyperplastic liver nodules, a well-studied model system of chemical carcinogenesis. Using an mdr-encoded cDNA sequence isolated from AdrR MCF-7 cells, we have examined the expression of mdr sequences in rat livers under a variety of experimental conditions. The expression of mdr increased 3-fold in regenerating liver. It was also elevated (3- to 12-fold) in several different samples of rat hyperplastic nodules and in four of five hepatomas that developed in this system. This suggests that overexpression of mdr, a gene previously associated with resistance to antineoplastic agents, may also be involved in the development of resistance to xenobiotics in rat hyperplastic nodules. In addition, although the acute administration of 2-acetylaminofluorene induced an 8-fold increase in hepatic mdr-encoded RNA, performance of a partial hepatectomy either before or after administration of 2-acetylaminofluorene resulted in a greater than 80-fold increase in mdr gene expression over that in normal untreated livers. This represents an important in vivo model system in which to study the acute regulation of this drug resistance gene.

  4. High Frequency of a Single Nucleotide Substitution (c.-6-180T>G) of the Canine MDR1/ABCB1 Gene Associated with Phenobarbital-Resistant Idiopathic Epilepsy in Border Collie Dogs

    OpenAIRE

    Mizukami, Keijiro; Yabuki, Akira; Chang, Hye-Sook; Uddin, Mohammad Mejbah; Rahman, Mohammad Mahbubur; Kushida, Kazuya; Kohyama, Moeko; Yamato, Osamu

    2013-01-01

    A single nucleotide substitution (c.-6-180T>G) associated with resistance to phenobarbital therapy has been found in the canine MDR1/ABCB1 gene in Border Collies with idiopathic epilepsy. In the present study, a PCR-restriction fragment length polymorphism assay was developed for genotyping this mutation, and a genotyping survey was carried out in a population of 472 Border Collies in Japan to determine the current allele frequency. The survey demonstrated the frequencies of the T/T wild type...

  5. MDR1 siRNA loaded hyaluronic acid-based CD44 targeted nanoparticle systems circumvent paclitaxel resistance in ovarian cancer

    Science.gov (United States)

    Yang, Xiaoqian; Lyer, Arun K.; Singh, Amit; Choy, Edwin; Hornicek, Francis J.; Amiji, Mansoor M.; Duan, Zhenfeng

    2015-02-01

    Development of multidrug resistance (MDR) is an almost universal phenomenon in patients with ovarian cancer, and this severely limits the ultimate success of chemotherapy in the clinic. Overexpression of the MDR1 gene and corresponding P-glycoprotein (Pgp) is one of the best known MDR mechanisms. MDR1 siRNA based strategies were proposed to circumvent MDR, however, systemic, safe, and effective targeted delivery is still a major challenge. Cluster of differentiation 44 (CD44) targeted hyaluronic acid (HA) based nanoparticle has been shown to successfully deliver chemotherapy agents or siRNAs into tumor cells. The goal of this study is to evaluate the ability of HA-PEI/HA-PEG to deliver MDR1 siRNA and the efficacy of the combination of HA-PEI/HA-PEG/MDR1 siRNA with paclitaxel to suppress growth of ovarian cancer. We observed that HA-PEI/HA-PEG nanoparticles can efficiently deliver MDR1 siRNA into MDR ovarian cancer cells, resulting in down-regulation of MDR1 and Pgp expression. Administration of HA-PEI/HA-PEG/MDR1 siRNA nanoparticles followed by paclitaxel treatment induced a significant inhibitory effect on the tumor growth, decreased Pgp expression and increased apoptosis in MDR ovarian cancer mice model. Our findings suggest that CD44 targeted HA-PEI/HA-PEG/MDR1 siRNA nanoparticles can serve as a therapeutic tool with great potentials to circumvent MDR in ovarian cancer.

  6. High frequency of a single nucleotide substitution (c.-6-180T>G) of the canine MDR1/ABCB1 gene associated with phenobarbital-resistant idiopathic epilepsy in Border Collie dogs.

    Science.gov (United States)

    Mizukami, Keijiro; Yabuki, Akira; Chang, Hye-Sook; Uddin, Mohammad Mejbah; Rahman, Mohammad Mahbubur; Kushida, Kazuya; Kohyama, Moeko; Yamato, Osamu

    2013-01-01

    A single nucleotide substitution (c.-6-180T>G) associated with resistance to phenobarbital therapy has been found in the canine MDR1/ABCB1 gene in Border Collies with idiopathic epilepsy. In the present study, a PCR-restriction fragment length polymorphism assay was developed for genotyping this mutation, and a genotyping survey was carried out in a population of 472 Border Collies in Japan to determine the current allele frequency. The survey demonstrated the frequencies of the T/T wild type, T/G heterozygote, and G/G mutant homozygote to be 60.0%, 30.3%, and 9.8%, respectively, indicating that the frequency of the mutant G allele is extremely high (24.9%) in Border Collies. The results suggest that this high mutation frequency of the mutation is likely to cause a high prevalence of phenobarbital-resistant epilepsy in Border Collies.

  7. High Frequency of a Single Nucleotide Substitution (c.-6-180T>G of the Canine MDR1/ABCB1 Gene Associated with Phenobarbital-Resistant Idiopathic Epilepsy in Border Collie Dogs

    Directory of Open Access Journals (Sweden)

    Keijiro Mizukami

    2013-01-01

    Full Text Available A single nucleotide substitution (c.-6-180T>G associated with resistance to phenobarbital therapy has been found in the canine MDR1/ABCB1 gene in Border Collies with idiopathic epilepsy. In the present study, a PCR-restriction fragment length polymorphism assay was developed for genotyping this mutation, and a genotyping survey was carried out in a population of 472 Border Collies in Japan to determine the current allele frequency. The survey demonstrated the frequencies of the T/T wild type, T/G heterozygote, and G/G mutant homozygote to be 60.0%, 30.3%, and 9.8%, respectively, indicating that the frequency of the mutant G allele is extremely high (24.9% in Border Collies. The results suggest that this high mutation frequency of the mutation is likely to cause a high prevalence of phenobarbital-resistant epilepsy in Border Collies.

  8. Molecular detection of multi drug resistant tuberculosis (mdr-tb) in mdr-tb patients' attendant in north western pakistan

    International Nuclear Information System (INIS)

    Shah, T.; Hayat, A.; Shah, Z.; Hayat, A.; Khan, S.B.

    2017-01-01

    Objective: To determine the drugs susceptibility pattern of mycobacterium tuberculosis (M.TB) in multi-drug resistant tuberculosis (MDR-TB) patients' attendants in North Western, Pakistan. Study Design: Cross sectional study. Place and Duration of Study: This study was conducted at Peshawar Tuberculosis Research Laboratory (PTRL), Provincial TB Control Program Hayatabad Medical Complex Peshawar, (KP) from August 2013 to March 2014. Material and Methods: A cross sectional study in which four hundred and eighty sputum samples from MDR-TB patients' attendants were processed for the detection of M.TB through Ziehl-Neelsen staining, Lowenstein-Jensen, BACTEC MGIT-960 culture and line probe assay. Results: Out of 480 samples, 06 (2.1%) were found positive for M.TB through Ziehl-Neelsen staining while 10 (2.8%) were positive through LJ and BACTEC MGIT-960 culture. The 10 positive samples were further subjected to drugs susceptibility testing and line probes assay test to find out rifampicin, isoniazid, streptomycin and ethambutol resistant and it was found that 6 M.TB isolates were resistant while 4 were sensitive to rifampicin and isoniazid. Among the 6 resistant M.TB strains, 4 showed mutation in rpoB gene at 531, 516 and 526 codons. Conclusion: Majority of MDR-TB patients' attendants had drug-resistant tuberculosis and the rate of drug susceptible TB was low. (author)

  9. Molecular approaches for detection of the multi-drug resistant tuberculosis (MDR-TB in Bangladesh.

    Directory of Open Access Journals (Sweden)

    Tafsina Haque Aurin

    Full Text Available The principal obstacles in the treatment of tuberculosis (TB are delayed and inaccurate diagnosis which often leads to the onset of the drug resistant TB cases. To avail the appropriate treatment of the patients and to hinder the transmission of drug-resistant TB, accurate and rapid detection of resistant isolates is critical. Present study was designed to demonstrate the efficacy of molecular techniques inclusive of line probe assay (LPA and GeneXpert MTB/RIF methods for the detection of multi-drug resistant (MDR TB. Sputum samples from 300 different categories of treated and new TB cases were tested for the detection of possible mutation in the resistance specific genes (rpoB, inhA and katG through Genotype MTBDRplus assay or LPA and GeneXpert MTB/RIF tests. Culture based conventional drug susceptibility test (DST was also carried out to measure the efficacy of the molecular methods employed. Among 300 samples, 191 (63.7% and 193 (64.3% cases were found to be resistant against rifampicin in LPA and GeneXpert methods, respectively; while 189 (63% cases of rifampicin resistance were detected by conventional DST methods. On the other hand, 196 (65.3% and 191 (63.7% isolates showed isoniazid resistance as detected by LPA and conventional drug susceptibility test (DST, respectively. Among the drug resistant isolates (collectively 198 in LPA and 193 in conventional DST, 189 (95.6% and 187 (96.9% were considered to be MDR as examined by LPA and conventional DST, respectively. Category-II and -IV patients encountered higher frequency of drug resistance compared to those from category-I and new cases. Considering the higher sensitivity, specificity and accuracy along with the required time to results significantly shorter, our study supports the adoption of LPA and GeneXpert assay as efficient tools in detecting drug resistant TB in Bangladesh.

  10. Treatment Outcomes of Patients with Multidrug-Resistant Tuberculosis (MDR- TB) Compared with Non-MDR-TB Infections in Peninsular Malaysia.

    Science.gov (United States)

    Elmi, Omar Salad; Hasan, Habsah; Abdullah, Sarimah; Mat Jeab, Mat Zuki; Ba, Zilfalil; Naing, Nyi Nyi

    2016-07-01

    Treating patients with multidrug-resistant tuberculosis (MDR-TB) strains is more complicated, complex, toxic, expensive, than treating patients with susceptible TB strains. This study aims to compare the treatment outcomes and potential factors associated between patients with MDR-TB and non MDR TB infections in peninsular Malaysia. This study was a retrospective cohort study. Data were collected from the medical records of all registered MDR-TB patients and Non-MDR-TB patients at five TB hospitals in peninsular Malaysia from January 2010 to January 2014. A total of 314 subjects were studied, including 105 MDR-TB cases and 209 non-MDR-TB. After TB treatment, 24.8% of the MDR-TB patients and 17.7% of non MDR TB relapsed; 17.1% of the MDR-TB patients and 16.3% of non MDR TB defaulted from TB treatment. A significant difference seen in treatment success rate 17.1% for MDR-TB; 63.1% for non MDR TB (P history of TB treatment, and presence of HIV infection.

  11. Analysis of mdr1-1Δ mutation of MDR1 gene in the “Cimarron Uruguayo” dog

    Directory of Open Access Journals (Sweden)

    Rosa Gagliardi B.

    2013-08-01

    Full Text Available Objective. The aim of this paper is to analyze the frequency of the mdr1-1D mutation of the MDR1 gene in a dog sample of the Uruguayan Cimarron breed with the objective of increasing the knowledge of this breed’s genome. Materials and methods. Thirty-six animals of this breed were analyzed. The MDR1 gene region, which includes the location where the mutation would be present, was amplified by PCR. Results. The mutation was not detected in any of the analyzed Uruguayan Cimarron. Conclusions. The lack of described ivermectin intoxication cases in veterinary clinic in this breed is explained by the lack of the mutation object of this study. The sequence studied in Cimarron dogs is kept compared to other breeds, except Collies and related breeds (Border Collie, Bearded Collie, Old English sheepdog.

  12. HIF-1α inhibition reverses multidrug resistance in colon cancer cells via downregulation of MDR1/P-glycoprotein.

    Directory of Open Access Journals (Sweden)

    Jianfang Chen

    Full Text Available Multidrug resistance (MDR is one of the major reasons chemotherapy-based treatments fail. Hypoxia is generally associated with tumor chemoresistance. However, the correlation between the heterodimeric hypoxia-inducible factor-1 (HIF-1 and the multidrug resistance (MDR1 gene/transporter P-glycoprotein (P-gp remains unclear. This study aims to explore the molecular mechanisms of reversing colon cancer MDR by focusing on the target gene HIF-1α.A chemotherapeutic sensitivity assay was used to observe the efficiency of MDR reversal in LoVo multicellular spheroids (MCS. The apoptotic level induced by different drugs was examined by flow cytometry (FCM. Binding of HIF-1α to the MDR1 gene promoter was evaluated by Chromatin immunoprecipitation (ChIP. The relationship between HIF-1α/P-gp expression and sensitivity to chemotherapy was analyzed.The sensitivity of LoVo MCS to all four chemotherapy drugs was decreased to varying degrees under hypoxic conditions. After silencing the HIF-1α gene, the sensitivities of LoVo MCS to all four chemotherapy drugs were restored. The apoptotic levels that all the drugs induced were all decreased to various extents in the hypoxic group. After silencing HIF-1α, the apoptosis level induced by all four chemotherapy drugs increased. The expression of HIF-1α and P-gp was significantly enhanced in LoVo MCS after treatment with hypoxia. Inhibiting HIF-1α significantly decreased the expression of MDR1/P-gp mRNA or protein in both the LoVo monolayers and LoVo MCS. The ChIP assay showed that HIF-1α was bound to the MDR1 gene promoter. Advanced colon carcinoma patients with expression of both HIF-1α and P-gp were more resistant to chemotherapy than that with non expression.HIF-1α inhibition reverses multidrug resistance in colon cancer cells via downregulation of MDR1/P-gp. The expression of HIF-1α and MDR1/P-gp can be used as a predictive marker for chemotherapy resistance in colon cancer.

  13. Association between MDR1 gene polymorphisms and the risk of Crohn's disease in a cohort of Algerian pediatric patients.

    Science.gov (United States)

    Bouzidi, Amira; Mesbah-Amroun, Hamida; Boukercha, Aziza; Benhassine, Fadila; Belboueb, Réda; Berkouk, Karima; Messadi, Wassila; Touil-Boukoffa, Chafia

    2016-12-01

    The multi-drug resistance gene (MDR1) has raised increasing interest as a susceptibility gene for Crohn's disease (CD). The role of MDR1 single-nucleotide polymorphisms (SNPs) in the predisposition and behavior of CD in the pediatric population is still elusive. Here, we investigated whether SNPs in MDR1 are associated with CD in Algerian pediatric patients. A case-control study was conducted enrolling 47 pediatric CD patients and 100 controls. All subjects were genotyped for the most common MDR1 SNPs (C3434T, C1236T, and G2677A/T) using PCR-RFLP method. We also explored the association between polymorphisms and clinical sub-phenotypes. We have detected no significant association of C3435T SNP and pediatric CD. However, we observed a significantly higher frequency of the risk alleles, 1236T and 2677T/A among the CD patients compared to controls. Moreover, the risk allele 1236T was associated to a higher risk for resective surgery. Our data suggest that the C1236T and G2677A/T SNPs in the MDR1 gene are associated with CD and the C1236T risk allele with a more severe course of disease in Algerian pediatric patients. Further analysis using larger patients group and functional studies would be interesting to elucidate the role of MDR1 gene in pediatric CD.Pediatric Research (2016); doi:10.1038/pr.2016.163.

  14. Splice form variant and amino acid changes in MDR49 confers DDT resistance in transgenic Drosophila.

    Science.gov (United States)

    Seong, Keon Mook; Sun, Weilin; Clark, John M; Pittendrigh, Barry R

    2016-03-22

    The ATP-binding cassette (ABC) transporters represent a superfamily of proteins that have important physiological roles in both prokaryotes and eukaryotes. In insects, ABC transporters have previously been implicated in insecticide resistance. The 91-R strain of Drosophila melanogaster has been intensely selected with DDT over six decades. A recent selective sweeps analysis of 91-R implicated the potential role of MDR49, an ABC transporter, in DDT resistance, however, to date the details of how MDR49 may play a role in resistance have not been elucidated. In this study, we investigated the impact of structural changes and an alternative splicing event in MDR49 on DDT-resistance in 91-R, as compared to the DDT susceptible strain 91-C. We observed three amino acid differences in MDR49 when 91-R was compared with 91-C, and only one isoform (MDR49B) was implicated in DDT resistance. A transgenic Drosophila strain containing the 91-R-MDR49B isoform had a significantly higher LD50 value as compared to the 91-C-MDR49B isoform at the early time points (6 h to 12 h) during DDT exposure. Our data support the hypothesis that the MDR49B isoform, with three amino acid mutations, plays a role in the early aspects of DDT resistance in 91-R.

  15. Expression of the MDR1 gene and P-glycoprotein in canine mast cell tumor cell lines

    OpenAIRE

    NAKAICHI, Munekazu; TAKESHITA, Yoko; OKUDA, Masaru; NAKAMOTO, Yuya; ITAMOTO, Kazuhito; UNE, Satoshi; SASAKI, Nobuo; KADOSAWA, Tsuyoshi; TAKAHASHI, Tomoko; TAURA, Yasuho

    2007-01-01

    Cellular drug resistance to antineoplastic drugs is often due to the presence of a drug efflux pump that reduces intracellular drug accumulation and chemosensitivity. P-glycoprotein (P-gp), which is encoded by the MDR1 gene, is considered to function as an ATP-driven membrane drug efflux pump and appears to play an important role in tumor cell resistance. In the present report, we assessed the expression of MDR1 by RT-PCR in three canine mast cell tumor cell lines, TiMC, CoMS and LuMC, origin...

  16. Prognostic significance of multidrug-resistance protein (MDR-1 in renal clear cell carcinomas: A five year follow-up analysis

    Directory of Open Access Journals (Sweden)

    Strazzullo Viviana

    2006-12-01

    Full Text Available Abstract Background A large number of renal cancer patients shows poor or partial response to chemotherapy and the mechanisms have not been still understood. Multi-drug resistance is the principal mechanism by which many cancers develop resistance to chemotherapic drugs. The role of the multi-drug resistant transporter (MDR-1/P-glycoprotein, the gene product of MDR-1, and that one of the so-called multi-drug resistance associated protein (MRP, two energy-dependent efflux pumps, are commonly known to confer drug resistance. We studied MDR-1 expression in selected cases of renal cell carcinoma (RCC, clear cell type, with long-term follow-up, in order to establish its prognostic role and its possible contribution in the choice of post-surgical therapy. Methods MDR-1 has been studied by standard LSAB-HRP immunohistochemical technique, in paraffin embedded RCC samples. Protein expression has been compared to clinical and histopathological data and to disease specific survival of RCC patients, by Kaplan-Meier curve and Cox multivariate regression analyses. Results Two groups of RCCs were obtained by esteeming MDR-1 expression and disease specific survival (obtained with Kaplan-Meier curve and Cox multivariate regression analyses: the first one presents low or absent MDR-1 expression and good survival; the second one is characterized by high MDR-1 expression and significant poor outcome (p p p p Conclusion In our opinion, the results of this study well prove the relationship between MDR-1 expression and worse clinical prognosis in RCC, because MDR-1 over-expressing RCCs can be considered a group of tumours with a more aggressive behavior. This finding outlines a possible role of MDR-1 as prognostic factor, dependent and independent of multidrug resistance. These results could be useful to predict cancer evolution and to choose the appropriate treatment: this is another step that can stimulate further promising and interesting investigations on broader

  17. Isolation, Characterization and Anti-Multiple Drug Resistant (MDR ...

    African Journals Online (AJOL)

    (MDR) Bacterial Activity of Endophytic Fungi Isolated from ... Institute of Protection & Development of Beibu Wan Ocean Resources, Qinzhou University, Qinzhou, Guangxi Province, ..... isolated from secondary metabolites of the mangrove.

  18. Candida albicans Swi/Snf and Mediator Complexes Differentially Regulate Mrr1-Induced MDR1 Expression and Fluconazole Resistance.

    Science.gov (United States)

    Liu, Zhongle; Myers, Lawrence C

    2017-11-01

    Long-term azole treatment of patients with chronic Candida albicans infections can lead to drug resistance. Gain-of-function (GOF) mutations in the transcription factor Mrr1 and the consequent transcriptional activation of MDR1 , a drug efflux coding gene, is a common pathway by which this human fungal pathogen acquires fluconazole resistance. This work elucidates the previously unknown downstream transcription mechanisms utilized by hyperactive Mrr1. We identified the Swi/Snf chromatin remodeling complex as a key coactivator for Mrr1, which is required to maintain basal and induced open chromatin, and Mrr1 occupancy, at the MDR1 promoter. Deletion of snf2 , the catalytic subunit of Swi/Snf, largely abrogates the increases in MDR1 expression and fluconazole MIC observed in MRR1 GOF mutant strains. Mediator positively and negatively regulates key Mrr1 target promoters. Deletion of the Mediator tail module med3 subunit reduces, but does not eliminate, the increased MDR1 expression and fluconazole MIC conferred by MRR1 GOF mutations. Eliminating the kinase activity of the Mediator Ssn3 subunit suppresses the decreased MDR1 expression and fluconazole MIC of the snf2 null mutation in MRR1 GOF strains. Ssn3 deletion also suppresses MDR1 promoter histone displacement defects in snf2 null mutants. The combination of this work with studies on other hyperactive zinc cluster transcription factors that confer azole resistance in fungal pathogens reveals a complex picture where the induction of drug efflux pump expression requires the coordination of multiple coactivators. The observed variations in transcription factor and target promoter dependence of this process may make the search for azole sensitivity-restoring small molecules more complicated. Copyright © 2017 American Society for Microbiology.

  19. Normal viability and altered pharmacokinetics in mice lacking mdr1-type (drug-transporting) P-glycoproteins

    NARCIS (Netherlands)

    Schinkel, A. H.; Mayer, U.; Wagenaar, E.; Mol, C. A.; van Deemter, L.; Smit, J. J.; van der Valk, M. A.; Voordouw, A. C.; Spits, H.; van Tellingen, O.; Zijlmans, J. M.; Fibbe, W. E.; Borst, P.

    1997-01-01

    The mdr1-type P-glycoproteins (P-gps) confer multidrug resistance to cancer cells by active extrusion of a wide range of drugs from the cell. To study their physiological roles, we have generated mice genetically deficient in the mdr1b gene [mdr1b (-/-) mice] and in both the mdr1a and mdr1b genes

  20. Significance of MDR1 and multiple drug resistance in refractory human epileptic brain

    Directory of Open Access Journals (Sweden)

    Dini Gabriele

    2004-10-01

    Full Text Available Abstract Background The multiple drug resistance protein (MDR1/P-glycoprotein is overexpressed in glia and blood-brain barrier (BBB endothelium in drug refractory human epileptic tissue. Since various antiepileptic drugs (AEDs can act as substrates for MDR1, the enhanced expression/function of this protein may increase their active extrusion from the brain, resulting in decreased responsiveness to AEDs. Methods Human drug resistant epileptic brain tissues were collected after surgical resection. Astrocyte cell cultures were established from these tissues, and commercially available normal human astrocytes were used as controls. Uptake of fluorescent doxorubicin and radioactive-labeled Phenytoin was measured in the two cell populations, and the effect of MDR1 blockers was evaluated. Frozen human epileptic brain tissue slices were double immunostained to locate MDR1 in neurons and glia. Other slices were exposed to toxic concentrations of Phenytoin to study cell viability in the presence or absence of a specific MDR1 blocker. Results MDR1 was overexpressed in blood vessels, astrocytes and neurons in human epileptic drug-resistant brain. In addition, MDR1-mediated cellular drug extrusion was increased in human 'epileptic' astrocytes compared to 'normal' ones. Concomitantly, cell viability in the presence of cytotoxic compounds was increased. Conclusions Overexpression of MDR1 in different cell types in drug-resistant epileptic human brain leads to functional alterations, not all of which are linked to drug pharmacokinetics. In particular, the modulation of glioneuronal MDR1 function in epileptic brain in the presence of toxic concentrations of xenobiotics may constitute a novel cytoprotective mechanism.

  1. Functional evidence of multidrug resistance transporters (MDR in rodent olfactory epithelium.

    Directory of Open Access Journals (Sweden)

    Adrien Molinas

    Full Text Available P-glycoprotein (Pgp and multidrug resistance-associated protein (MRP1 are membrane transporter proteins which function as efflux pumps at cell membranes and are considered to exert a protective function against the entry of xenobiotics. While evidence for Pgp and MRP transporter activity is reported for olfactory tissue, their possible interaction and participation in the olfactory response has not been investigated.Functional activity of putative MDR transporters was assessed by means of the fluorometric calcein acetoxymethyl ester (calcein-AM accumulation assay on acute rat and mouse olfactory tissue slices. Calcein-AM uptake was measured as fluorescence intensity changes in the presence of Pgp or MRP specific inhibitors. Epifluorescence microscopy measured time course analysis in the olfactory epithelium revealed significant inhibitor-dependent calcein uptake in the presence of each of the selected inhibitors. Furthermore, intracellular calcein accumulation in olfactory receptor neurons was also significantly increased in the presence of either one of the Pgp or MRP inhibitors. The presence of Pgp or MRP1 encoding genes in the olfactory mucosa of rat and mouse was confirmed by RT-PCR with appropriate pairs of species-specific primers. Both transporters were expressed in both newborn and adult olfactory mucosa of both species. To assess a possible involvement of MDR transporters in the olfactory response, we examined the electrophysiological response to odorants in the presence of the selected MDR inhibitors by recording electroolfactograms (EOG. In both animal species, MRPs inhibitors induced a marked reduction of the EOG magnitude, while Pgp inhibitors had only a minor or no measurable effect.The findings suggest that both Pgp and MRP transporters are functional in the olfactory mucosa and in olfactory receptor neurons. Pgp and MRPs may be cellular constituents of olfactory receptor neurons and represent potential mechanisms for modulation

  2. Detection of expression and modulation of multidrug-resistance (MDR) and establishment of a new bioassay

    International Nuclear Information System (INIS)

    Berger, W.

    1993-08-01

    The present thesis deals with the resistance of human malignant cells against cellular toxicity of anticancer drugs, a phenomenon representing one of the major obstacles to successful chemotherapy. One mechanism underlying a cross-resistance to different drugs called multidrug resistance (MDR) is characterized by the expression of an active transport protein (P-glycoprotein), causing decreased intracellular drug retention and cytotoxicity. The main subjects of the present work were to establish different detection methods for MDR and its modulation (by substances blocking activity of P-glycoprotein) including immunological methods (immunocytochemistry, radioimmunoassay), molecular biology (slot-blot analysis, in-situ hybridization) and functional assays (drug-accumulation analysis, drug-cytotoxicity analysis). The methods were evaluated and compared using human and mouse MDR control cell lines and human tumor cell lines established in our laboratory. In cell lines derived from human melanoma - a malignancy insensitive to chemotherapy - expression of P-glycoprotein of relatively low transporting activity was detected by different methods in 8 of 33 cases. Furthermore a new sensitive in vitro assay for the functional detection of MDR was established using the biological features of cytochalasins, a microfilament disrupting substance group. These compounds were shown to be substrates for the P-glycoprotein efflux pump and their effects on cell division (blockade of cytokinesis resulting in multinucleate cells) correlated with MDR-activity of the tested cells. With this new assay P-glycoprotein activity can be demonstrated and analysed over a wide range of resistance against different cytotoxic drugs. Therefore it may by a suitable tool for research and diagnosis in the field of drug resistance

  3. Psychiatric disorders in patients with multidrug resistant tuberculosis (MDR-TB in Sardjito Hospital, Yogyakarta, Indonesia

    Directory of Open Access Journals (Sweden)

    Irwan Supriyanto

    2017-08-01

    Full Text Available Introduction: Tuberculosis has become a chronic debilitating disease in developing countries, particularly after the emergence of multidrug resistant tuberculosis (MDR-TB. Second line treatments for the disease which were subsequently developed were associated with psychiatric disorders among patients. Psychiatric disorder can either be induced by treatment regiments or psychosocial factors. Cycloserine administration is frequently reported to be associated with psychiatric disorders. In this study, we examined the prevalence and characteristics of psychiatric disorders among MDR-TB patients in Sardjito Hospital, Yogyakarta, Indonesia. Methods: In this descriptive study, we studied medical records of MDR-TB patients admitted for MDR-TB treatments to Sardjito Hospital from January 2014 to July 2016 and screened for psychiatric disorders. Results: We found that 32.8% of the patients had psychiatric disorders, some of which had multiple psychiatric diagnoses (14.1%. The diagnoses were medication induced delirium, substance/medication induced psychotic disorder, substance/medication use depressive disorder, depressive type schizoaffective disorder, bipolar I disorder current episode severe manic with psychotic features, mild depression, moderate depression, major depression without psychotic features, major depression with psychotic features, adjustment disorders with mixed anxiety and depressed mood, adjustment disorder with anxiety, acute stress disorder, and insomnia. Psychiatric disorders were significantly associated with cycloserine dose and sex. Psychotic symptoms were significantly associated with sex and level of education. Conclusion: The presence of psychiatric disorders might disturb MDR-TB treatment resulting in poor outcomes. Precaution and prompt managements are required for psychiatric disorders in patients receiving MDR-TB treatment regiments.

  4. MDR-1 and MRP2 gene polymorphisms in Mexican epileptic pediatric patients with complex partial seizures.

    Directory of Open Access Journals (Sweden)

    David eEscalante-Santiago

    2014-10-01

    Full Text Available Although the Pgp efflux transport protein is overexpressed in resected tissue of patients with epilepsy, the presence of polymorphisms in MDR1 / ABCB1 and MRP2 / ABCC2 in patients with antiepileptic-drugs resistant epilepsy is controversial. The aim of this study was to perform an exploratory study to identify nucleotide changes and search new and reported mutations in patients with antiepileptic-drugs resistant epilepsy (ADR and patients with good response to anti-epileptic drugs (CTR in a rigorously selected population. We analyzed 22 samples from drug-resistant patients with epilepsy and 7 samples from patients with good response to anti-epileptic drugs. Genomic DNA was obtained from leukocytes. Eleven exons in both genes were genotyped. The concentration of drugs in saliva and plasma was determined. The concentration of valproic acid in saliva was lower in ADR than in CRT. In ABCB1, five reported SNPs and five unreported nucleotide changes were identified; rs2229109 (GA and rs2032582 (AT and AG were found only in the ADR. Of six SNPs associated with the ABCC2 that were found in the study population, rs3740066 (TT and 66744T>A (TG were found only in the ADR. The strongest risk factor in the ABCB1 gene was identified as the TA genotype of rs2032582, whereas for the ABCC2 gene the strongest risk factor was the T allele of rs3740066. The screening of SNPs in ACBC1 and ABCC2 indicates that the Mexican patients with epilepsy in this study display frequently reported ABCC1 polymorphisms; however, in the study subjects with a higher risk factor for drug resistance, new nucleotide changes were found in the ABCC2 gene. Thus, the population of Mexican patients with AED-resistant epilepsy used in this study exhibits genetic variability with respect to those reported in other study populations; however, it is necessary to explore this polymorphism in a larger population of patients with AED-resistant epilepsy.

  5. Functional study of the novel multidrug resistance gene HA117 and its comparison to multidrug resistance gene 1

    Directory of Open Access Journals (Sweden)

    Chen Tingfu

    2010-07-01

    Full Text Available Abstract Background The novel gene HA117 is a multidrug resistance (MDR gene expressed by all-trans retinoic acid-resistant HL-60 cells. In the present study, we compared the multidrug resistance of the HA117 with that of the classical multidrug resistance gene 1 (MDR1 in breast cancer cell line 4T1. Methods Transduction of the breast cancer cell line 4T1 with adenoviral vectors encoding the HA117 gene and the green fluorescence protein gene (GFP (Ad-GFP-HA117, the MDR1 and GFP (Ad-GFP-MDR1 or GFP (Ad-GFP was respectively carried out. The transduction efficiency and the multiplicity of infection (MOI were detected by fluorescence microscope and flow cytometry. The transcription of HA117 gene and MDR1 gene were detected by reverse transcription polymerase chain reaction (RT-PCR. Western blotting analysis was used to detect the expression of P-glycoprotein (P-gp but the expression of HA117 could not be analyzed as it is a novel gene and its antibody has not yet been synthesized. The drug-excretion activity of HA117 and MDR1 were determined by daunorubicin (DNR efflux assay. The drug sensitivities of 4T1/HA117 and 4T1/MDR1 to chemotherapeutic agents were detected by Methyl-Thiazolyl-Tetrazolium (MTT assay. Results The transducted efficiency of Ad-GFP-HA117 and Ad-GFP-MDR1 were 75%-80% when MOI was equal to 50. The transduction of Ad-GFP-HA117 and Ad-GFP-MDR1 could increase the expression of HA117 and MDR1. The drug resistance index to Adriamycin (ADM, vincristine (VCR, paclitaxel (Taxol and bleomycin (BLM increased to19.8050, 9.0663, 9.7245, 3.5650 respectively for 4T1/HA117 and 24.2236, 11.0480, 11.3741, 0.9630 respectively for 4T1/MDR1 as compared to the control cells. There were no significant differences in drug sensitivity between 4T1/HA117 and 4T1/MDR1 for the P-gp substrates (ADM, VCR and Taxol (P Conclusions These results confirm that HA117 is a strong MDR gene in both HL-60 and 4T1 cells. Furthermore, our results indicate that the MDR

  6. Analysis of multi drug resistant tuberculosis (MDR-TB) financial protection policy: MDR-TB health insurance schemes, in Chhattisgarh state, India.

    Science.gov (United States)

    Kundu, Debashish; Sharma, Nandini; Chadha, Sarabjit; Laokri, Samia; Awungafac, George; Jiang, Lai; Asaria, Miqdad

    2018-01-27

    There are significant financial barriers to access treatment for multi drug resistant tuberculosis (MDR-TB) in India. To address these challenges, Chhattisgarh state in India has established a MDR-TB financial protection policy by creating MDR-TB benefit packages as part of the universal health insurance scheme that the state has rolled out in their effort towards attaining Universal Health Coverage for all its residents. In these schemes the state purchases health insurance against set packages of services from third party health insurance agencies on behalf of all its residents. Provider payment reform by strategic purchasing through output based payments (lump sum fee is reimbursed as per the MDR-TB benefit package rates) to the providers - both public and private health facilities empanelled under the insurance scheme was the key intervention. To understand the implementation gap between policy and practice of the benefit packages with respect to equity in utilization of package claims by the poor patients in public and private sector. Data from primary health insurance claims from January 2013 to December 2015, were analysed using an extension of 'Kingdon's multiple streams for policy implementation framework' to explain the implementation gap between policy and practice of the MDR-TB benefit packages. The total number of claims for MDR-TB benefit packages increased over the study period mainly from poor patients treated in public facilities, particularly for the pre-treatment evaluation and hospital stay packages. Variations and inequities in utilizing the packages were observed between poor and non-poor beneficiaries in public and private sector. Private providers participation in the new MDR-TB financial protection mechanism through the universal health insurance scheme was observed to be much lower than might be expected given their share of healthcare provision overall in India. Our findings suggest that there may be an implementation gap due to weak

  7. Asiatic Acid (AA) Sensitizes Multidrug-Resistant Human Lung Adenocarcinoma A549/DDP Cells to Cisplatin (DDP) via Downregulation of P-Glycoprotein (MDR1) and Its Targets.

    Science.gov (United States)

    Cheng, Qilai; Liao, Meixiang; Hu, Haibo; Li, Hongliang; Wu, Longhuo

    2018-01-01

    P-glycoprotein (P-gp, i.e., MDR1) is associated with the phenotype of multidrug resistance (MDR) and causes chemotherapy failure in the management of cancers. Searching for effective MDR modulators and combining them with anticancer drugs is a promising strategy against MDR. Asiatic acid (AA), a natural triterpene isolated from the plant Centella asiatica, may have an antitumor activity. The present study assessed the reversing effect of AA on MDR and possible molecular mechanisms of AA action in MDR1-overexpressing cisplatin (DDP)-resistant lung cancer cells, A549/DDP. Human lung adenocarcinoma A549/DDP cells were either exposed to different concentrations of AA or treated with DDP, and their viability was measured by the MTT assay. A Rhodamine 123 efflux assay, immunofluorescent staining, ATPase assay, reverse-transcription PCR (RT-PCR), and western blot analysis were conducted to elucidate the mechanisms of action of AA on MDR. Our results showed that AA significantly enhanced the cytotoxicity of DDP toward A549/DDP cells but not its parental A549 cells. Furthermore, AA strongly inhibited P-gp expression by blocking MDR1 gene transcription and increased the intracellular accumulation of the P-gp substrate Rhodamine 123 in A549/DDP cells. Nuclear factor (NF)-kB (p65) activity, IkB degradation, and NF-kB/p65 nuclear translocation were markedly inhibited by pretreatment with AA. Additionally, AA inhibited the MAPK-ERK pathway, as indicated by decreased phosphorylation of ERK1 and -2, AKT, p38, and JNK, thus resulting in reduced activity of the Y-box binding protein 1 (YB1) via blockage of its nuclear translocation. AA reversed P-gp-mediated MDR by inhibition of P-gp expression. This effect was likely related to downregulation of YB1, and this effect was mediated by the NF-kB and MAPK-ERK pathways. AA may be useful as an MDR reversal agent for combination therapy in clinical trials. © 2018 The Author(s). Published by S. Karger AG, Basel.

  8. ANTIBACTERIAL ACTIVITY OF DRACONTOMELON DAO EXTRACTS ON METHICILLIN-RESISTANT S. AUREUS (MRSA) AND E. COLI MULTIPLE DRUG RESISTANCE (MDR).

    Science.gov (United States)

    Yuniati, Yuniati; Hasanah, Nurul; Ismail, Sjarif; Anitasari, Silvia; Paramita, Swandari

    2018-01-01

    Staphylococcus aureus , methicillin-resistant and Escherichia coli , multidrug-resistant included in the list of antibiotic-resistant priority pathogens from WHO. As multidrug-resistant bacteria problem is increasing, it is necessary to probe new sources for identifying antimicrobial compounds. Medicinal plants represent a rich source of antimicrobial agents. One of the potential plants for further examined as antibacterial is Dracontomelon dao (Blanco) Merr. & Rolfe. The present study designed to find the antibacterial activity of D. dao stem bark extracts on Methicillin-resistant S. aureus (MRSA) and E. coli Multiple Drug Resistance (MDR), followed by determined secondary metabolites with antibacterial activity and determined the value of MIC (minimum inhibitory concentration) and MBC (minimum bactericidal concentration). D. dao stem bark extracted using 60% ethanol. Disc diffusion test methods used to find the antibacterial activity, following by microdilution methods to find the value of MIC and MBC. Secondary metabolites with antibacterial activity determined by bioautography using TLC (thin layer chromatography) methods. D. dao stem bark extracts are sensitive to MSSA, MRSA and E.coli MDR bacteria. The inhibition zone is 16.0 mm in MSSA, 11.7 mm in MRSA and 10.7 mm in E. coli MDR. The entire MBC/MIC ratios for MSSA, MRSA and E.coli MDR is lower than 4. The ratio showed bactericidal effects of D. dao stem bark extracts. In TLC results, colorless bands found to be secondary metabolites with antibacterial activity. D. dao stem bark extracts are potential to develop as antibacterial agent especially against MRSA and E. coli MDR strain.

  9. The search for the mdr1-1Δ mutation of the MDR1 gene in four canine breeds in Uruguay (preliminary study

    Directory of Open Access Journals (Sweden)

    Rosa Gagliardi B.

    2015-01-01

    Full Text Available Objective. The objective of this study is to analyze the frequency of mdr1-1Δ mutation in German Shepherd, Doberman, Border Collie and Greyhound dog breeds in Uruguay. Materials and methods. A total of 95 animals from the four breeds mentioned above were studied. DNA was isolated from blood using potassium acetate with a subsequent degradation from RNA with RNAsaH. The concentration and quality of the DNA obtained was evaluated with a Nanodrop, ND-1000 spectrophotometer. To determine the presence or absence of the mdr1-1Δ mutation, DNA samples were sent to Gene Seek, Neogen Corporation of Chicago, United States, for genotyping. Results. In all 95 animals studied, the mdr1-1Δ mutation was not present. Conclusions. Based on the preliminary results obtained, other elements that may cause adverse drug reactions must be considered: unidentified mutations in other regions of the MDR1 gene; mutations in other genes involved in the transport of drugs from the same subfamily or another; mutations in enzymes involved in drug metabolism (e.g. Cytochrome P450. Moreover, especially with Border Collies and Greyhounds, it is advisable to increase the number of animals in the study.

  10. Efficacy of moxifloxacin & econazole against multidrug resistant (MDR Mycobacterium tuberculosis in murine model

    Directory of Open Access Journals (Sweden)

    U D Gupta

    2015-01-01

    Full Text Available Background & objectives: Studies have shown the bactericidal potential of econazole and clotrimazole against Mycobacterium tuberculosis under in vitro and ex vivo conditions along with their synergism with conventional antituberculosis drugs. These molecules were also found to be effective against different multidrug resistant (MDR M. tuberculosis isolates in vitro. Hence the present study was designed to evaluate the in vivo antimycobacterial potential of moxifloxacin and econazole alone and in combination against multidrug resistant tuberculosis (MDR-TB in a mice model. Methods: Mice were infected with 2.5×10 [7] bacilli of MDR strain of M. tuberculosis by aerosol route of infection. After four weeks of infection, chemotherapy was started orally by moxifloxacin 8.0 mg/kg body wt and econazole 3.3 mg/kg alone and in combination, as well as with four first line anti-tuberculosis drugs as a positive control. The animals were sacrificed and the lungs and spleen were excised under aspetic conditions. The tissues were homogenized with sterile normal saline, an aliquot of the homogenate was plated on Middlebrook 7H11 agar supplemented with oleate albumin dextrose catalase (OADC and incubated at 37°C for four weeks. The number of visible and individual colonies were counted. Results: The first line anti-tuberculosis drugs (RIF+INH+EMB+PZA after eight weeks of therapy had no impact as the bacillary load in lungs and spleens remained unchanged. However, econazole, moxifloxacin alone as well as in combination significantly reduced the bacillary load in lungs as well as in spleens of MDR-TB bacilli infected mice. Interpretation & conclusions: Co-administration of the two drugs (econazole and moxifloxacin to MDR-TB strain JAL-7782 infected mice exhibited additive effect, the efficacy of the drugs in combination being higher as compared with ECZ or MOX alone. These results were substantiated by histopathological studies. This study suggests the utility of

  11. SNP genetic polymorphisms of MDR-1, CYP1A2 and CYPB11 genes in four canine breeds upon toxicological evaluation.

    Science.gov (United States)

    Gagliardi, Rosa; Llambí, Silvia; Arruga, M Victoria

    2015-01-01

    The fields of pharmacogenetics and pharmacogenomics have become increasingly promising regarding the clinical application of genetic data to aid in prevention of adverse reactions. Specific screening tests can predict which animals express modified proteins or genetic sequences responsible for adverse effects associated with a drug. Among the genetic variations that have been investigated in dogs, the multidrug resistance gene (MDR) is the best studied. However, other genes such as CYP1A2 and CYP2B11 control the protein syntheses involved in the metabolism of many drugs. In the present study, the MDR-1, CYP1A2 and CYP2B11 genes were examined to identify SNP polymorphisms associated with these genes in the following four canine breeds: Uruguayan Cimarron, Border Collie, Labrador Retriever and German Shepherd. The results revealed that several SNPs of the CYP1A2 and CYP2B11 genes are potential targets for drug sensitivity investigations.

  12. Mice heterozygous for the Mdr2 gene demonstrate decreased PEMT activity and diminished steatohepatitis on the MCD diet.

    Science.gov (United States)

    Igolnikov, Alexander C; Green, Richard M

    2006-03-01

    The administration of a methionine and choline deficient (MCD) diet to mice serves as an animal model of NASH. The multidrug resistant 2 (Mdr2) P-glycoprotein encodes for the canalicular phospholipid transporter, and Mdr2 (+/-) mice secrete 40% less phosphatidylcholine than wild-type mice. We have hypothesized that phosphatidylethanolamine-N-methyl transferase (PEMT) up-regulation is a consequence of MCD diet administration, and is important for the pathogenesis of steatohepatitis in this model. However, the effect of decreased phosphatidylcholine secretion and modulation of PEMT on the development of diet-induced steatohepatitis in Mdr2 (+/-) mice has not been explored. Thus, the purpose of the study is to examine the effects of the MCD diet on Mdr2 (+/-) mice. Mdr2 (+/-) and Mdr2 (+/+) mice were treated with an MCD or control diet for up to 30 days, and the severity of steatohepatitis, PEMT activity and hepatic S-adenosylmethionine (SAM), and S-adenosylhomocysteine (SAH) levels were measured. Serum ALT levels, hepatic inflammation, and PEMT activity were significantly lower, and hepatic SAM:SAH ratios were significantly higher in Mdr2 (+/-) mice at 7 and 30 days on the MCD diet. Mdr2 (+/-) mice have diminished susceptibility to MCD diet-induced NASH, which is associated with a relative decrease in PEMT activity and increased SAM:SAH ratios.

  13. JNK1/2 Activation by an Extract from the Roots of Morus alba L. Reduces the Viability of Multidrug-Resistant MCF-7/Dox Cells by Inhibiting YB-1-Dependent MDR1 Expression

    Directory of Open Access Journals (Sweden)

    Youn Kyung Choi

    2013-01-01

    Full Text Available Cancer cells acquire anticancer drug resistance during chemotherapy, which aggravates cancer disease. MDR1 encoded from multidrug resistance gene 1 mainly causes multidrug resistance phenotypes of different cancer cells. In this study, we demonstrate that JNK1/2 activation by an extract from the root of Morus alba L. (White mulberry reduces doxorubicin-resistant MCF-7/Dox cell viability by inhibiting YB-1 regulation of MDR1 gene expression. When MCF-7 or MCF-7/Dox cells, where MDR1 is highly expressed were treated with an extract from roots or leaves of Morus alba L., respectively, the root extract from the mulberry (REM but not the leaf extract (LEM reduced cell viabilities of both MCF-7 and MCF-7/Dox cells, which was enhanced by cotreatment with doxorubicin. REM but not LEM further inhibited YB-1 nuclear translocation and its regulation of MDR1 gene expression. Moreover, REM promoted phosphorylation of c-Jun NH2-terminal kinase 1/2 (JNK1/2 and JNK1/2 inhibitor, SP600125 and rescued REM inhibition of both MDR1 expression and viabilities in MCF-7/Dox cells. Consistently, overexpression of JNK1, c-Jun, or c-Fos inhibited YB-1-dependent MDR1 expression and reduced viabilities in MCF-7/Dox cells. In conclusion, our data indicate that REM-activated JNK-cJun/c-Fos pathway decreases the viability of MCF-7/Dox cells by inhibiting YB-1-dependent MDR1 gene expression. Thus, we suggest that REM may be useful for treating multidrug-resistant cancer cells.

  14. Multi drug resistance to cancer chemotherapy: Genes involved and blockers

    International Nuclear Information System (INIS)

    Sayed-Ahmed, Mohamed M.

    2007-01-01

    During the last three decades, important and considerable research efforts had been performed to investigate the mechanism through which cancer cells overcome the cytotoxic effects of a variety of chemotherapeutic drugs. Most of the previously published work has been focused on the resistance of tumor cells to those anticancer drugs of natural source. Multidrug resistance (MDR) is a cellular cross-resistance to a broad spectrum of natural products used in cancer chemotherapy and is believed to be the major cause of the therapeutic failures of the drugs belonging to different naturally obtained or semisynthetic groups including vinca alkaloids, taxans, epipodophyllotoxins and certain antibiotics. This phenomenon results from overexpression of four MDR genes and their corresponding proteins that act as membrane-bound ATP consuming pumps. These proteins mediate the efflux of many structurally and functionally unrelated anticancer drugs of natural source. MDR may be intrinsic or acquired following exposure to chemotherapy. The existence of intrinsically resistant tumor cell clone before and following chemotherapeutic treatment has been associated with a worse final outcome because of increased incidence of distant metasis. In view of irreplaceability of natural product anticancer drugs as effective chemotherapeutic agents, and in view of MDR as a major obstacle to successful chemotherapy, this review is aimed to highlight the genes involved in MDR, classical MDR blockers and gene therapy approaches to overcome MDR. (author)

  15. Development of PET and SPECT radiopharmaceuticals to study multi-drug resistance (MDR)

    International Nuclear Information System (INIS)

    Katsififs, A.; Dikic, B.; Greguric, I.; Knott, R.; Mattner, F.

    2002-01-01

    Full text: Cellular resistance or Multidrug Resistance (MDR) to cytotoxic agents is the major cause of treatment failure in many human cancers. P-glycoprotein (Pgp), a Mr 17,0000 transmembrane protein and Multi Resistance Protein (MRP) are two proteins that are over expressed and confer resistance to a large number of chemotherapeutic agents by enhancing their extracellular transport. P-glycoprotein is expressed at a relative high level in treated and untreated human malignant tumours, including renal, colonic, adrenal, hepatocellular carcinoma and a considerable percentage of breast carcinomas. 99m Tc-Sestamibi, a lipophilic cationic complex is a transport substrate for Pgp. In clinical studies of human neoplasms it was found that tumour uptake and clearance of this tracer correlate with Pgp expression and may be used for the phenotypic assessment of MDR. However, new tracers with better substrate specificity for Pgp and other drug transporters would greatly assist in optimising chemotherapeutic treatment and improving patient management by predicting tumour response to therapy and to assist in the development of antagonists, which may reverse or halt MDR. The aim of this project is therefore to develop PET and SPECT radiopharmaceuticals with improved affinity and selectivity for Pgp and MRP for the clinical evaluation of MDR in cancer patients. To optimise cellular transport characteristics, a number of chemical families that have been found to be substrates of Pgp and other drug efflux pumps, will be investigated. In the first instance, a series of drugs based on the flavonol natural product, Quercetin will be developed, screened for MDR and radiolabelled with PET and SPECT isotopes. Quercetin and related flavonol derivatives have been selected for this project because of their moderate to good affinity for Pgp. With the assistance of molecular modeling and in vitro studies, structural modification will be undertaken to improve the specificity and affinity for

  16. P-Glycoprotein/MDR1 regulates pokemon gene transcription through p53 expression in human breast cancer cells.

    Science.gov (United States)

    He, Shengnan; Liu, Feng; Xie, Zhenhua; Zu, Xuyu; Xu, Wei; Jiang, Yuyang

    2010-08-27

    P-glycoprotein (Pgp), encoded by the multidrug resistance 1 (MDR1) gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy.

  17. P-Glycoprotein/MDR1 Regulates Pokemon Gene Transcription Through p53 Expression in Human Breast Cancer Cells

    Directory of Open Access Journals (Sweden)

    Wei Xu

    2010-08-01

    Full Text Available P-glycoprotein (Pgp, encoded by the multidrug resistance 1 (MDR1 gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy.

  18. Pharmacological modification of multi-drug resistance (MDR) in vitro detected by a novel fluorometric microculture cytotoxicity assay. Reversal of resistance and selective cytotoxic actions of cyclosporin A and verapamil on MDR leukemia T-cells.

    Science.gov (United States)

    Larsson, R; Nygren, P

    1990-07-15

    A novel fluorometric microculture cytotoxicity assay (FMCA), based on measurements of fluorescein diacetate (FDA) hydrolysis and DNA staining by Hoechst 33342, was used for drug sensitivity testing and detection of resistance reversal in acute lymphoblastic leukemia (ALL) cell lines. The 72-hr assay was found to be sensitive, reproducible and linearly related to the number of viable cells within a broad range of cell concentrations. At clinically achievable drug concentrations, the calcium channel blocker Verapamil (ver) and the immunosuppressant Cyclosporin A (csA) were found to partly reverse acquired Vincristine (vcr) resistance in multi-drug resistant (MDR) T-ALL L100 cells with little or no effect on the drug-sensitive parental L0 cell line. By combining the fluorometric indices, we found that low concentrations of csA were growth-inhibitory, whereas higher concentrations (greater than 10 micrograms/ml) were progressively cytotoxic for drug-sensitive L0 cells. In MDR L100 cells, on the other hand, csA produced significant cell kill even at low drug concentrations. Ver had no effects on sensitive L0 cells but showed considerable cytotoxic action towards MDR L100 cells. There was no apparent relationship between drug reversal of vcr resistance and the cytotoxic actions of the drug per se since the calcium channel blocker diltiazem (dil) significantly potentiated the actions of vcr on MDR L100 cells without being more toxic to these cells (compared to vcr-sensitive L0 cells).

  19. Correlation between ability of biofilm formation with their responsible genes and MDR patterns in clinical and environmental Acinetobacter baumannii isolates.

    Science.gov (United States)

    Bardbari, Ali Mohammadi; Arabestani, Mohammad Reza; Karami, Manoochehr; Keramat, Fariba; Alikhani, Mohammad Yousef; Bagheri, Kamran Pooshang

    2017-07-01

    Acinetobacter baumannii potential to form biofilm and exhibit multiple antibiotic resistances may be responsible in its survival in hospital environment. Accordingly, our study was aimed to determine the correlation between ability of biofilm formation and the frequency of biofilm related genes with antibiotic resistance phenotypes, and also the categorization of their patterns in clinical and environmental isolates. A total of 75 clinical and 32 environmental strains of the A. baumannii were collected and identified via API 20NE. Antibiotic susceptibility was evaluated by disk diffusion and microdilution broth methods. Biofilm formation assay was performed by microtiter plate method. OXA types and biofilm related genes including Bla OXA-51 , Bla OXA-23 , Bla OXA-24 , Bla OXA-58 , bap, bla PER-1 , and ompA were amplified by PCR. The rate of MDR A. baumannii in clinical isolates (100%) was higher than environmental (81.2%) isolates (p baumannii isolates was associated with biofilm formation. There was a significant correlation between multiple drug resistance and biofilm formation. The clinical isolates had a higher ability to form strong biofilms compared to the environmental samples. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Isolation, Identification And Screening Antibacterial Activity from Marine Sponge-Associated Fungi Against Multidrug-Resistant (MDR) Escherichia coli

    Science.gov (United States)

    Triandala Sibero, Mada; Sabdaningsih, Aninditia; Cristianawati, Olvi; Nuryadi, Handung; Karna Radjasa, Ocky; Sabdono, Agus; Trianto, Agus

    2017-02-01

    Irrational used of antibiotic in several decades ago causing resistant in bacteria and decreasing the cure rate of infectious diseases. Multidrug-resistant (MDR) Escherichia coli is known to cause various of infectious diseases such as urinary tract infection, nosocomial bloodstream infection, meningitis, bacteraemia, and gastrointestinal disease. Marine sponge-associated fungi have potential as source of new compound to combat MDR E. coli. The aims of this research were to isolate marine sponge-assosiated fungi, to screen potential fungi against MDR E. coli, to identify the potential fungi and its host sponge. There were 29 marine sponge-associated fungi successfully isolated from 9 sponges. Among 29 sponge-associated fungi screened, there were 7 isolates showed antibacterial activity against MDR E. coli. The best inhibition zone produced by MPS 14.1/MT 02 and MPS 14.3/MT 04 from sponge PP.SP.16.14. According to fungi identification result fungus MPS 14.1/MT 02 was identified as Trichoderma asperellum while MPS 14.3/MT 04 was identified as Trichoderma reesei. Sponge identification leaded the PP.SP.16.14 as Cinachyrella sp.

  1. Inhibition of ABCB1 (MDR1 expression by an siRNA nanoparticulate delivery system to overcome drug resistance in osteosarcoma.

    Directory of Open Access Journals (Sweden)

    Michiro Susa

    2010-05-01

    Full Text Available The use of neo-adjuvant chemotherapy in treating osteosarcoma has improved patients' average 5 year survival rate from 20% to 70% in the past 30 years. However, for patients who progress after chemotherapy, its effectiveness diminishes due to the emergence of multi-drug resistance (MDR after prolonged therapy.In order to overcome both the dose-limiting side effects of conventional chemotherapeutic agents and the therapeutic failure resulting from MDR, we designed and evaluated a novel drug delivery system for MDR1 siRNA delivery. Novel biocompatible, lipid-modified dextran-based polymeric nanoparticles were used as the platform for MDR1 siRNA delivery; and the efficacy of combination therapy with this system was evaluated. In this study, multi-drug resistant osteosarcoma cell lines (KHOS(R2 and U-2OS(R2 were treated with the MDR1 siRNA nanocarriers and MDR1 protein (P-gp expression, drug retention, and immunofluoresence were analyzed. Combination therapy of the MDR1 siRNA loaded nanocarriers with increasing concentrations of doxorubicin was also analyzed. We observed that MDR1 siRNA loaded dextran nanoparticles efficiently suppresses P-gp expression in the drug resistant osteosarcoma cell lines. The results also demonstrated that this approach may be capable of reversing drug resistance by increasing the amount of drug accumulation in MDR cell lines.Lipid-modified dextran-based polymeric nanoparticles are a promising platform for siRNA delivery. Nanocarriers loaded with MDR1 siRNA are a potential treatment strategy for reversing MDR in osteosarcoma.

  2. Comparative evaluation of GenoType MTBDRplus line probe assay with solid culture method in early diagnosis of multidrug resistant tuberculosis (MDR-TB at a tertiary care centre in India.

    Directory of Open Access Journals (Sweden)

    Raj N Yadav

    Full Text Available The objectives of the study were to compare the performance of line probe assay (GenoType MTBDRplus with solid culture method for an early diagnosis of multidrug resistant tuberculosis (MDR-TB, and to study the mutation patterns associated with rpoB, katG and inhA genes at a tertiary care centre in north India.In this cross-sectional study, 269 previously treated sputum-smear acid-fast bacilli (AFB positive MDR-TB suspects were enrolled from January to September 2012 at the All India Institute of Medical Sciences hospital, New Delhi. Line probe assay (LPA was performed directly on the sputum specimens and the results were compared with that of conventional drug susceptibility testing (DST on solid media [Lowenstein Jensen (LJ method].DST results by LPA and LJ methods were compared in 242 MDR-TB suspects. The LPA detected rifampicin (RIF resistance in 70 of 71 cases, isoniazid (INH resistance in 86 of 93 cases, and MDR-TB in 66 of 68 cases as compared to the conventional method. Overall (rifampicin, isoniazid and MDR-TB concordance of the LPA with the conventional DST was 96%. Sensitivity and specificity were 98% and 99% respectively for detection of RIF resistance; 92% and 99% respectively for detection of INH resistance; 97% and 100% respectively for detection of MDR-TB. Frequencies of katG gene, inhA gene and combined katG and inhA gene mutations conferring all INH resistance were 72/87 (83%, 10/87 (11% and 5/87 (6% respectively. The turnaround time of the LPA test was 48 hours.The LPA test provides an early diagnosis of monoresistance to isoniazid and rifampicin and is highly sensitive and specific for an early diagnosis of MDR-TB. Based on these findings, it is concluded that the LPA test can be useful in early diagnosis of drug resistant TB in high TB burden countries.

  3. Heterologously expressed bacterial and human multidrug resistance proteins confer cadmium resistance to Escherichia coli

    NARCIS (Netherlands)

    Achard-Joris, M; van Saparoea, HBV; Driessen, AJM; Bourdineaud, JP; Bourdineaud, Jean-Paul

    2005-01-01

    The human MDR1 gene is induced by cadmium exposure although no resistance to this metal is observed in human cells overexpressing hMDR1. To access the role of MDR proteins in cadmium resistance, human MDR1, Lactococcus lactis lmrA, and Oenococcus oeni omrA were expressed in an Escherichia coli tolC

  4. A Comprehensive Investigation on Common Polymorphisms in the MDR1/ABCB1 Transporter Gene and Susceptibility to Colorectal Cancer

    Czech Academy of Sciences Publication Activity Database

    Campa, D.; Sainz, J.; Pardini, Barbara; Vodičková, Ludmila; Naccarati, Alessio; Rudolph, A.; Novotný, J.; Försti, A.; Buch, S.; von Schönfels, W.; Schafmayer, C.; Völzke, H.; Hoffmeister, M.; Frank, B.; Barale, R.; Hemminki, K.; Hampe, J.; Chang-Claude, J.; Brenner, H.; Vodička, Pavel; Canzian, F.

    2012-01-01

    Roč. 7, č. 3 (2012), e32784 E-ISSN 1932-6203 R&D Projects: GA ČR GA310/07/1430; GA ČR GAP304/10/1286 Institutional research plan: CEZ:AV0Z50390703 Keywords : single-nucleotide polymorphisms * resistance 1 mdr1 * p-glycoprotein Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.730, year: 2012

  5. Polymorphisms in the xenobiotic transporter Multidrug Resistance 1 (MDR1 and interaction with meat intake in relation to risk of colorectal cancer in a Danish prospective case-cohort study

    Directory of Open Access Journals (Sweden)

    Overvad Kim

    2009-11-01

    Full Text Available Abstract Background The xenobiotic transporters, Multidrug Resistance 1 (MDR1/ABCB1 and Breast Cancer Resistance Protein (BCRP/ABCG2 may restrict intestinal absorption of various carcinogens, including heterocyclic amines (HCA and polycyclic aromatic hydrocarbons (PAH. Cyclooxygenase-2 (COX-2 derived prostaglandins promote gastrointestinal carcinogenesis, affecting angiogenesis, apoptosis, and invasiveness. The aim of this study was to investigate if polymorphisms in these genes were associated with risk of colorectal cancer (CRC, and to investigate possible interactions with lifestyle factors such as smoking, meat consumption, and NSAID use. Methods The following polymorphisms were analyzed; a synonymous MDR1 C3435T (rs1045642 in exon26, G-rs3789243-A in intron3, the functional BCRP C421A (rs2231142, the two COX-2 A-1195G (rs689466 and G-765C (rs20417 in the promoter region, and the COX-2 T8473C (rs5275 polymorphisms in the 3'-untranslated region. The polymorphisms were assessed together with lifestyle factors in a nested case-cohort study of 359 cases and a random cohort sample of 765 participants from the Danish prospective Diet, Cancer and Health study. Results Carriers of the variant allele of MDR1 intron 3 polymorphism were at 1.52-fold higher risk of CRC than homozygous wild type allele carriers (Incidence rate ratio (IRR = 1.52, 95% Confidence Interval (CI: 1.12-2.06. Carriers of the variant allele of MDR1 C3435T exon 26 had a lower risk of CRC than homozygous C-allele carriers (IRR = 0.71 (CI:0.50-1.00. There was interaction between these MDR1 polymorphisms and intake of red and processed meat in relation to CRC risk. Homozygous MDR1 C3435T C-allele carriers were at 8% increased risk pr 25 gram meat per day (CI: 1.00-1.16 whereas variant allele carriers were not at increased risk (p for interaction = 0.02. COX-2 and BCRP polymorphisms were not associated with CRC risk. There was interaction between NSAID use and MDR1 C3435T and COX-2 T

  6. Polymorphisms in the xenobiotic transporter Multidrug Resistance 1 (MDR1) and interaction with meat intake in relation to risk of colorectal cancer in a Danish prospective case-cohort study

    International Nuclear Information System (INIS)

    Andersen, Vibeke; Østergaard, Mette; Christensen, Jane; Overvad, Kim; Tjønneland, Anne; Vogel, Ulla

    2009-01-01

    The xenobiotic transporters, Multidrug Resistance 1 (MDR1/ABCB1) and Breast Cancer Resistance Protein (BCRP/ABCG2) may restrict intestinal absorption of various carcinogens, including heterocyclic amines (HCA) and polycyclic aromatic hydrocarbons (PAH). Cyclooxygenase-2 (COX-2) derived prostaglandins promote gastrointestinal carcinogenesis, affecting angiogenesis, apoptosis, and invasiveness. The aim of this study was to investigate if polymorphisms in these genes were associated with risk of colorectal cancer (CRC), and to investigate possible interactions with lifestyle factors such as smoking, meat consumption, and NSAID use. The following polymorphisms were analyzed; a synonymous MDR1 C3435T (rs1045642) in exon26, G-rs3789243-A in intron3, the functional BCRP C421A (rs2231142), the two COX-2 A-1195G (rs689466) and G-765C (rs20417) in the promoter region, and the COX-2 T8473C (rs5275) polymorphisms in the 3'-untranslated region. The polymorphisms were assessed together with lifestyle factors in a nested case-cohort study of 359 cases and a random cohort sample of 765 participants from the Danish prospective Diet, Cancer and Health study. Carriers of the variant allele of MDR1 intron 3 polymorphism were at 1.52-fold higher risk of CRC than homozygous wild type allele carriers (Incidence rate ratio (IRR) = 1.52, 95% Confidence Interval (CI): 1.12-2.06). Carriers of the variant allele of MDR1 C3435T exon 26 had a lower risk of CRC than homozygous C-allele carriers (IRR = 0.71 (CI:0.50-1.00)). There was interaction between these MDR1 polymorphisms and intake of red and processed meat in relation to CRC risk. Homozygous MDR1 C3435T C-allele carriers were at 8% increased risk pr 25 gram meat per day (CI: 1.00-1.16) whereas variant allele carriers were not at increased risk (p for interaction = 0.02). COX-2 and BCRP polymorphisms were not associated with CRC risk. There was interaction between NSAID use and MDR1 C3435T and COX-2 T8473C (p-values for interaction 0

  7. Genetic polymorphisms in MDR1 and CYP3A4 genes in Asians and the influence of MDR1 haplotypes on cyclosporin disposition in heart transplant recipients.

    Science.gov (United States)

    Chowbay, Balram; Cumaraswamy, Sivathasan; Cheung, Yin Bun; Zhou, Qingyu; Lee, Edmund J D

    2003-02-01

    Intestinal cytochrome P450 3A4 (CYP3A4) and P-glycoprotein (P-gp) both play a vital role in the metabolism of oral cyclosporine (CsA). We investigated the genetic polymorphisms in CYP3A4(promoter region and exons 5, 7 and 9) and MDR1 (exons 12, 21 and 26) genes and the impact of these polymorphisms on the pharmacokinetics of oral CsA in stable heart transplant patients (n = 14). CYP3A4 polymorphisms were rare in the Asian population and transplant patients. Haplotype analysis revealed 12 haplotypes in the Chinese, eight in the Malays and 10 in the Indians. T-T-T was the most common haplotype in all ethnic groups. The frequency of the homozygous mutant genotype at all three loci (TT-TT-TT) was highest in the Indians (31%) compared to 19% and 15% in the Chinese and Malays, respectively. In heart transplant patients, CsA exposure (AUC(0-4 h), AUC(0-12 h) and C(max)) was high in patients with the T-T-T haplotypes compared to those with C-G-C haplotypes. These findings suggest that haplotypes rather than genotypes influence CsA disposition in transplant patients.

  8. Factors influencing [F-18]2-fluoro-2-deoxy-D-glucose (F-18 FDG) accumulation in melanoma cells. Is FDG a substrate of multidrug resistance (MDR)?

    International Nuclear Information System (INIS)

    Yamada, Kiyoshi; Brink, I.; Engelhardt, R.

    2005-01-01

    In order to specify the influence of multidrug-resistance (MDR) on the accumulation of the PET tracer, F-18 FDG ([Fluorine-18]2-fluoro-2-deoxy-D-glucose, in melanoma cells, both the MDR function and expression of two human melanoma cell lines SK-MEL 23 and 24, were evaluated. The effects of MDR modulators on FDG accumulation and efflux were also investigated. A functional analysis using representative MDR fluorescent substrates and inhibitors clarified the following characteristics: SK-MEL 23 possesses a highly active function of multidrug resistance-associated protein (MRP), but not P-gp. SK-MEL 24 possesses weak functions of both MRP and P-gp. Western blot analysis using monoclonal antibodies for MDR expression demonstrated an exceedingly high MRP expression of SK-MEL 23 and only slight P-gp and MRP expression of SK-MEL 24, corresponding to the functional data. The efflux inhibition assay using F-18 FDG revealed a considerable retention of FDG in SK-MEL 23 in the presence of the MRP inhibitor probenecid. It was also found that the P-gp inhibitor verapamil depressed the FDG efflux of SK-MEL 24. Our present in vitro study suggests that FDG may be a substrate of MDR in some melanoma cells and further MDR may be one of the important factors affecting FDG-PET melanoma imaging. (author)

  9. Mdr65 decreases toxicity of multiple insecticides in Drosophila melanogaster.

    Science.gov (United States)

    Sun, Haina; Buchon, Nicolas; Scott, Jeffrey G

    2017-10-01

    ABC transporters are ubiquitous membrane-bound proteins, present in both prokaryotes and eukaryotes. The major function of eukaryotic ABC transporters is to mediate the efflux of a variety of substrates (including xenobiotics) out of cells. ABC transporters have been widely investigated in humans, particularly for their involvement in multidrug resistance (MDR). Considerably less is known about their roles in transport and/or excretion in insects. ABC transporters are only known to function as exporters in insects. Drosophila melanogaster has 56 ABC transporter genes, including eight which are phylogenetically most similar to the human Mdr genes (ABCB1 clade). We investigated the role of ABC transporters in the ABCB1 clade in modulating the susceptibility to insecticides. We took advantage of the GAL4/UAS system in D. melanogaster to knockdown the expression levels of Mdr65, Mdr50, Mdr49 and ABCB6 using transgenic UAS-RNAi lines and conditional driver lines. The most notable effects were increased sensitivities to nine different insecticides by silencing of Mdr65. Furthermore, a null mutation of Mdr65 decreased the malathion, malaoxon and fipronil LC 50 values by a factor of 1.9, 2.1 and 3.9, respectively. Altogether, this data demonstrates the critical role of ABC transporters, particularly Mdr65, in altering the toxicity of specific, structurally diverse, insecticides in D. melanogaster. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. vPARP Adjusts MVP Expression in Drug-resistant Cell Lines in Conjunction with MDR Proteins.

    Science.gov (United States)

    Wojtowicz, Karolina; Januchowski, Radoslaw; Nowicki, Michal; Zabel, Maciej

    2017-06-01

    The definition of vault (ribonucleoprotein particles) function remains highly complex. Vaults may cooperate with multidrug resistance (MDR) proteins, supporting their role in drug resistance. This topic is the main theme of this publication. The cell viability was determined by an MTT assay. The protein expression was detected by western blot analysis. The proteins were knocked-down using siRNA. No major vault protein (MVP) in the LoVo/Dx and W1PR cell lines after tunicamycin treatment was shown. In W1PR cells with knocked-down MVP, a statistically significant decrease in cell viability was noted. In LoVo/Dx, W1TR and A2780TR cells were vault poly-ADP-ribose polymerase (vPARP) was knockdown, a decrease in cell viability was shown. Also, MVP silencing induced an increase in glycoprotein P (Pgp) expression in LoVo/Dx cells. MVP is important for the drug resistance of cancer cells, but it probably requires the presence of vPARP for full activation. Some correlations between MDR proteins and vaults exist. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  11. Effect of the mutation (C3435T) at exon 26 of the MDR1 gene on expression level of MDR1 messenger ribonucleic acid in duodenal enterocytes of healthy Japanese subjects.

    Science.gov (United States)

    Nakamura, Tsutomu; Sakaeda, Toshiyuki; Horinouchi, Masanori; Tamura, Takao; Aoyama, Nobuo; Shirakawa, Toshiro; Matsuo, Masafumi; Kasuga, Masato; Okumura, Katsuhiko

    2002-04-01

    The effect of the C3435T mutation at exon 26 of the MDR1 gene on the expression levels of MDR1 messenger ribonucleic acid (mRNA) was evaluated by means of real-time polymerase chain reaction in 51 biopsy specimens of duodenum obtained from 13 healthy Japanese subjects. The mRNA levels of MDR1 were 0.38 +/- 0.15, 0.56 +/- 0.14, and 1.13 +/- 0.42 (mean value +/- SE) in the subjects with the homozygote of wild-type allele (C/C), compound heterozygote with mutant T allele (C/T), and the homozygote of the mutant allele (T/T), respectively, reasonably explaining the lower digoxin serum concentration after administration of a single oral dose to subjects harboring a mutant T allele. Good correlation (r =.797; P CYP3A4 in the individual biopsy specimens. This finding suggested a lower plasma concentration of the substrates for CYP3A4 in subjects harboring the C3435T mutation of the MDR1 gene.

  12. DESAIN PRIMER UNTUK AMPLIFIKASI FRAGMEN GEN inhA ISOLAT 134 MULTIDRUG RESISTANCE TUBERCULOSIS (MDR-TB DENGAN METODE POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Luk Ketut Budi Maitriani

    2015-10-01

    Full Text Available ABSTRAK    : Penelitian ini bertujuan untuk memperoleh sepasang primer terbaik hasil desain secara in silico menggunakan program Clone Manager Suite 6 (University of Groningen. Primer ini didesain untuk digunakan dalam mengamplifikasi fragmen gen inhA isolat klinis Multidrug Resistance Tuberculosis (MDR-TB mencakup kodon 94 (nukleotida 280-282. Kodon 94 gen inhA merupakan posisi yang sering mengalami mutasi dan mengakibatkan koresisten terhadap isoniazid dan ethionamid. Desain primer menggunakan sekuen gen inhA Mycobacterium tuberculosis yang diperoleh dari situs www.ncbi.nlm.nih.gov (GenBank : AF106077. Hasil desain diperoleh sepasang primer terbaik dan diuji secara in vitro menggunakan metode Polymerase Chain Reaction (PCR. Template DNA yang digunakan adalah isolat klinis MDR-TB. Proses amplifikasi diawali dengan denaturasi awal pada 95°C selama 15 menit dan diikuti oleh 45 siklus amplifikasi (denaturasi pada suhu 94°C selama 1 menit, annealing pada 56°C selama 1 menit 20 detik dan elongasi pada 72°C selama 2 menit serta diakhiri dengan elongasi akhir pada 72°C selama 10 menit. Produk PCR dideteksi menggunakan elektroforesis gel agarosa 1,5%. Kesimpulan penelitian adalah diperoleh sepasang primer terbaik berdasarkan kriteria pada program Clone Manager Suite 6 (University of Groningen, meliputi: panjang primer, %GC, Tm (melting temperature, interaksi primer (dimers dan hairpins, stabilitas primer, repeats, runs dan false priming. Primer tersebut meliputi, primer forward (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3’ dan primer reverse (pR-inhA 5’ CGACCGTCATCCA-GTTGTA 3’ dengan ukuran produk 460 pb.   ABSTRACT: The aim of this study was to obtain the best pair of primer as result in silico design using Clone Manager Suite 6 program (University of Groningen. The primer was designed for amplifying inhA gene fragment of Multidrug Resistance Tuberculosis (MDR-TB clinical isolates include codon 94 (nucleotide 280-282. Codon 94 of inhA gene is

  13. [Small interfering RNA-mediated COX-2 gene silencing enhances chemosensitivity of KB/VCR cells by suppressing MDR-1 gene expression and P-glycoprotein activity].

    Science.gov (United States)

    Mo, Xianchao; Li, Weizhong

    2014-05-01

    To investigate the effect of small interfering RNA (siRNA)-mediated COX-2 gene silencing in enhancing the chemosensitivity of KB/VCR cell lines. KB/VCR cells were trasnfected with COX-2 siRNA were examined for expressions of COX-2 and MDR-1 mRNAs with RT-PCR and for Rho-123 accumulation using flow cytometry. MTT assay was used to analyze the proliferation of the transfected KB/VCR cells. Compared with the negative and blank control groups, COX-2 siRNA transfection resulted in significant growth inhibition of KB/VCR cells exposed to vincristine (PKB/VCR cells. COX-2 gene silencing can enhance the chemosensitivity of KB/VCR cells to vincristine, the mechanism of which may involve down-regulated MDR-1 gene expression and inhibition of P-glycoprotein activity.

  14. Distinct genotype distribution and haplotype profiles in MDR1 gene among Chinese Han, Bai, Wa and Tibetan ethnic groups.

    Science.gov (United States)

    Lai, Yong; Huang, Min; Li, Hui; Wang, Xue-Ding; Li, Jia-Li

    2012-11-01

    P-Glycoprotein (P-gp, encoded by MDR1 gene) plays an important role in determining bioavailability and pharmacologic effects of many drugs. There is increasing evidence that P-gp activity may be genetically determined. In this study, we investigated the genotype distribution and the haplotype profiles of MDR1 gene in Chinese Han, Bai, Wa and Tibetan subjects. Much lower frequencies of the 1236T allele and the 2677T allele were found in Wa subjects than those in other three ethnic groups, while the 2677A allele was found about 6-fold more frequently in Han subjects than in subjects of other three ethnic groups. The Han, Bai and Tibetan subjects share the same three predominant haplotypes (T-T-T, T-G-C and C-G-C), and T-T-T is the highest and accounts for more than one third of the number of haplotypes in the subjects from each ethnic group. However, T-T-T was less common than T-G-C, T-G-T and C-G-C and occurring at only 13.8% in Wa subjects, furthermore, higher frequencies of T-G-T, C-T-C, C-G-T and C-T-T were observed in Wa subjects compared to those in other three ethnic groups. Frequencies of C-A-C and T-A-C in Han subjects were higher than those in other three ethnic groups. The findings of this study will be of some relevance in predicting MDR1 phenotype and pharmacokinetics as well as pharmacodynamic effects of many commonly used drugs that are P-gp substrates in these four Chinese ethnic groups.

  15. From MDR to MXR

    DEFF Research Database (Denmark)

    Litman, Thomas; Druley, T E; Stein, W D

    2001-01-01

    The ATP binding cassette (ABC) superfamily of membrane transporters is one of the largest protein classes known, and counts numerous proteins involved in the trafficking of biological molecules across cell membranes. The first known human ABC transporter was P-glycoprotein (P-gp), which confers...... multidrug resistance (MDR) to anticancer drugs. In recent years, we have obtained an increased understanding of the mechanism of action of P-gp as its ATPase activity, substrate specificity and pharmacokinetic interactions have been investigated. This review focuses on the functional characterization of P...... for reversal of MDR in cancer and for drug delivery, are discussed....

  16. Reversing multidrug resistance in Caco-2 by silencing MDR1, MRP1, MRP2, and BCL-2/BCL-xL using liposomal antisense oligonucleotides.

    Directory of Open Access Journals (Sweden)

    Yu-Li Lo

    Full Text Available Multidrug resistance (MDR is a major impediment to chemotherapy. In the present study, we designed antisense oligonucleotides (ASOs against MDR1, MDR-associated protein (MRP1, MRP2, and/or BCL-2/BCL-xL to reverse MDR transporters and induce apoptosis, respectively. The cationic liposomes (100 nm composed of N-[1-(2,3-dioleyloxypropyl]-n,n,n-trimethylammonium chloride and dioleoyl phosphotidylethanolamine core surrounded by a polyethylene glycol (PEG shell were prepared to carry ASOs and/or epirubicin, an antineoplastic agent. We aimed to simultaneously suppress efflux pumps, provoke apoptosis, and enhance the chemosensitivity of human colon adenocarcinoma Caco-2 cells to epirubicin. We evaluated encapsulation efficiency, particle size, cytotoxicity, intracellular accumulation, mRNA levels, cell cycle distribution, and caspase activity of these formulations. We found that PEGylated liposomal ASOs significantly reduced Caco-2 cell viability and thus intensified epirubicin-mediated apoptosis. These formulations also decreased the MDR1 promoter activity levels and enhanced the intracellular retention of epirubicin in Caco-2 cells. Epirubicin and ASOs in PEGylated liposomes remarkably decreased mRNA expression levels of human MDR1, MRP1, MRP2, and BCL-2. The combined treatments all significantly increased the mRNA expressions of p53 and BAX, and activity levels of caspase-3, -8, and -9. The formulation of epirubicin and ASOs targeting both pump resistance of MDR1, MRP1, and MRP2 and nonpump resistance of BCL-2/BCL-xL demonstrated more superior effect to all the other formulations used in this study. Our results provide a novel insight into the mechanisms by which PEGylated liposomal ASOs against both resistance types act as activators to epirubicin-induced apoptosis through suppressing MDR1, MRP1, and MRP2, as well as triggering intrinsic mitochondrial and extrinsic death receptor pathways. The complicated regulation of MDR highlights the necessity

  17. 8__Aisha_Detection ofMDR-TB

    African Journals Online (AJOL)

    User

    Among the MDR-TB cases rifampicin resistance was associated with rpoB WT gene and rpoB MUT gene in 100% and 62% of the ... diagnosis of TB patients, and proper treatment and management of the infected cases to minimize the spread and ..... in an amino acid change and concluded that this is one of the reasons ...

  18. Genetic modification of haematopoietic cells for combined resistance to podophyllotoxins, other agents covered by MDR1-mediated efflux activity and nitrosoureas.

    Science.gov (United States)

    Baum, C; Peinert, S; Carpinteiro, A; Eckert, H G; Fairbairn, L J

    2000-05-01

    Genetic transfer and expression of drug-resistance functions into haematopoietic stem and progenitor cells is a promising means to overcome both the acute and longterm side-effects of cytotoxic drugs in bone marrow. Here, we describe a functional analysis of a retroviral vector that co-expresses human cDNAs for multidrug resistance 1/P-glycoprotein (MDR1) and a double mutant of O(6)-alkylguanine-alkyltransferase (hATPA/GA) to high levels. The hATPA/GA protein contains two amino acid substitutions that render it resistant to compounds such as O(6)-benzylguanine that inhibit the wild-type protein which is often overexpressed in resistant tumour cells. Evidence for simultaneous drug resistance of genetically modified primary murine progenitor cells to colchicine or the podophyllotoxin etoposide, both covered by MDR1-mediated efflux activity, and the nitrosourea BCNU, which is counteracted by hATPA/GA, is presented using in vitro colony assays.

  19. Mechanisms of antibiotic resistance in Mycobacterium tuberculosis, validation of methods BACTECTM MGIT 960 and AnyplexM TII MTB / MDR / XDR Detection for detection of antibiotic resistance to first and second line in Mycobacterium tuberculosis strains

    International Nuclear Information System (INIS)

    Centeno Urena, Yadel

    2014-01-01

    A literature review is developed of drug-resistant TB in the world and in Costa Rica. The mechanisms of resistance to antibiotics are studied of the bacterium that causes tuberculosis; drug resistance to first-line and second-line, treatment regimen according to the World Health Organization and edge detection methods available in the market. The agreement between the results is studied by the phenotypic detection system of resistance of M. tuberculosis BACTEC MGIT960 and PCR, in real-time of commercial kit Anyplex II MTB/MDR/XDR, for genotypic identification of M. tuberculosis and related mutations to resistance with the referring results to thirty strains provided by the Pan American Health Organization, allowing a significant shortening in the time of obtaining reliable results. The results obtained have allowed to suggest a possible implementation at the Centro Nacional de Referencia en Micobacteriologia (CNRM), to perform antibiotic susceptibility testing and genotypic testing of multidrug cases respectively. The study results have allowed the implementation of the technology of genotypic detection of M. tuberculosis in the CNRM, obtaining for the first time in Costa Rica, information about genes of M. tuberculosis related to the generation of resistance to the major drugs of Primary treatment scheme as well as testing of resistance to second-line drug for resistant strains referred to the Centro Nacional de Referencia en Micobacteriologia in 2013. (author) [es

  20. Efficacy and safety profile of linezolid in the treatment of multidrug-resistant (MDR) and extensively drug-resistant (XDR) tuberculosis: a systematic review and meta-analysis.

    Science.gov (United States)

    Agyeman, Akosua Adom; Ofori-Asenso, Richard

    2016-06-22

    Treatment options for drug-resistant tuberculosis are still limited. Linezolid has been recommended for treatment of patients with multidrug-resistant (MDR) or extensively-drug-resistant (XDR) tuberculosis, although uncertainties remain regarding its safety and tolerability in these circumstances. To systematically evaluate the existing evidence regarding the efficacy and tolerability of linezolid in the treatment of MDR or XDR tuberculosis. We conducted a systematic review and meta-analysis in accordance with the PRISMA guidelines. Searches were conducted in PubMed, Web of Science and EMBASE followed by direct search of abstracts in the International Journal of Tuberculosis and Lung Disease to retrieve primary studies published between January 2000 and January 2016 assessing linezolid efficacy and safety in the treatment of drug-resistant TB. We evaluated the occurrence of outcomes including culture conversion, treatment success and incidence of adverse events such as myelosuppression and neuropathy. Twenty-three (23) studies conducted in fourteen (14) countries and involving 507 patients were retrieved. Only 1 randomized controlled trial was identified and none of the identified studies involved participants from Africa. The pooled proportion for treatment success was 77.36 % (95 % CI = 71.38-82.83 %, I(2) = 37.6 %) with culture conversion rate determined as 88.45 % (95 % CI = 83.82-92.38 %, I(2) = 45.4 %). There was no strong evidence for both culture conversion (p = 0.0948) and treatment success (p = 0.0695) between linezolid daily doses ≤ 600 and > 600 mg. Only myelosuppression showed a strong statistical significance (p linezolid also showed no significance upon dose comparisons (p = 0.3213, p = 0.9050 respectively). Available evidence presents Linezolid as a viable option in the treatment of MDR/XDR TB although patients ought to be monitored closely for the incidence of major adverse events such as myelosuppression and

  1. Expression of multidrug resistance markers ABCB1 (MDR-1/P-gp) and ABCC1 (MRP-1) in renal cell carcinoma.

    LENUS (Irish Health Repository)

    Walsh, Naomi

    2009-01-01

    BACKGROUND: Renal cell carcinoma patients respond poorly to conventional chemotherapy, this unresponsiveness may be attributable to multidrug resistance (MDR). The mechanisms of MDR in renal cancer are not fully understood and the specific contribution of ABC transporter proteins which have been implicated in the chemoresistance of various cancers has not been fully defined in this disease. METHODS: In this retrospective study the expression of two of these transporter efflux pumps, namely MDR-1 P-gp (ABCB1) and MRP-1 (ABCC1) were studied by immunohistochemistry in archival material from 95 renal cell carcinoma patients. RESULTS: In the first study investigating MDR-1 P-gp and MRP-1 protein expression patterns in renal cell carcinoma patients, high levels of expression of both efflux pumps are observed with 100% of tumours studied showing MDR-1 P-gp and MRP-1 positivity. CONCLUSION: Although these findings do not prove a causal role, the high frequency of tumours expressing these efflux pumps suggests that they may be important contributors to the chemoresistance of this tumour type.

  2. RNAi validation of resistance genes and their interactions in the highly DDT-resistant 91-R strain of Drosophila melanogaster.

    Science.gov (United States)

    Gellatly, Kyle J; Yoon, Kyong Sup; Doherty, Jeffery J; Sun, Weilin; Pittendrigh, Barry R; Clark, J Marshall

    2015-06-01

    4,4'-dichlorodiphenyltrichloroethane (DDT) has been re-recommended by the World Health Organization for malaria mosquito control. Previous DDT use has resulted in resistance, and with continued use resistance will increase in terms of level and extent. Drosophila melanogaster is a model dipteran that has many available genetic tools, numerous studies done on insecticide resistance mechanisms, and is related to malaria mosquitoes allowing for extrapolation. The 91-R strain of D. melanogaster is highly resistant to DDT (>1500-fold), however, there is no mechanistic scheme that accounts for this level of resistance. Recently, reduced penetration, increased detoxification, and direct excretion have been identified as resistance mechanisms in the 91-R strain. Their interactions, however, remain unclear. Use of UAS-RNAi transgenic lines of D. melanogaster allowed for the targeted knockdown of genes putatively involved in DDT resistance and has validated the role of several cuticular proteins (Cyp4g1 and Lcp1), cytochrome P450 monooxygenases (Cyp6g1 and Cyp12d1), and ATP binding cassette transporters (Mdr50, Mdr65, and Mrp1) involved in DDT resistance. Further, increased sensitivity to DDT in the 91-R strain after intra-abdominal dsRNA injection for Mdr50, Mdr65, and Mrp1 was determined by a DDT contact bioassay, directly implicating these genes in DDT efflux and resistance. Copyright © 2015 Elsevier Inc. All rights reserved.

  3. Do polymorphisms in MDR1 and CYP3A5 genes influence the risk of cytogenetic relapse in patients with chronic myeloid leukemia on imatinib therapy?

    Science.gov (United States)

    Harivenkatesh, Natarajan; Kumar, Lalit; Bakhshi, Sameer; Sharma, Atul; Kabra, Madhulika; Velpandian, Thirumurthy; Gogia, Ajay; Shastri, Shivaram S; Gupta, Yogendra Kumar

    2017-09-01

    Influence of polymorphisms in the genes coding for imatinib transporters and metabolizing enzymes on cytogenetic relapse in patients with chronic myeloid leukemia (CML) is not known. One hundred and four patients (52 cases with cytogenetic relapse and 52 controls without relapse) with chronic-phase CML on imatinib therapy and have completed 5 years of follow-up were enrolled. The following single nucleotide polymorphisms (SNPs) were genotyped; C1236T, C3435T, G2677T/A in MDR1 gene and A6986G in CYP3A5 gene, using PCR-RFLP method and validated by direct gene sequencing. Imatinib trough levels were measured using LC-MS/MS. Patients with CC genotype for MDR1-C1236T polymorphism were at significantly higher risk for cytogenetic relapse [OR =4.382, 95% CI (1.145, 16.774), p = .022], while those with TT genotype for MDR1-C3435T polymorphism had significantly lower risk of relapse [OR =0.309, 95% CI (0.134, 0.708), p = .005]. Imatinib trough levels were lower in patients with relapse compared to those without relapse (1551.4 ± 1324.1 vs. 2154.2 ± 1358.3 ng/mL; p = .041). MDR1-C3435T genotype [adjusted-OR: 0.266; 95% CI (0.111, 0.636); p = .003] and trough levels (p = .014) were independent predictors of relapse in multivariate analysis. To conclude, C1236T and C3435T polymorphisms in MDR1 gene and trough levels significantly influence the risk of cytogenetic relapse. MDR1-C3435T genotype might emerge as a potential biomarker to predict the risk of cytogenetic relapse in patients with CML.

  4. IPEC-J2 MDR1, a Novel High-Resistance Cell Line with Functional Expression of Human P-glycoprotein (ABCB1) for Drug Screening Studies

    DEFF Research Database (Denmark)

    Saaby, Lasse; Helms, Hans Christian Cederberg; Brodin, Birger

    2016-01-01

    The P-glycoprotein (P-gp) efflux pump has been shown to affect drug distribution and absorption in various organs and to cause drug resistance in cancer therapy. The aim of this work was to develop a cell line to serve as a screening system for potential substrates of P-gp. This requires a cell...... line with high paracellular tightness, low expression of nonhuman ABC transporters, and high expression of functional human P-gp (ABCB1). The porcine intestinal epithelial cell line, IPEC-J2, was selected as a transfection host, due to its ability to form extremely high-resistance monolayers (>10,000 Ω......·cm(2)) and its low endogenous expression of ABC-type efflux transporters. The IPEC-J2 cells were transfected with a plasmid that contained the sequence of the human MDR1 gene, which encodes P-gp, followed by a selection of successfully transfected cells with geneticin and puromycin. The resulting cell...

  5. Development of a Patient-Centred, Psychosocial Support Intervention for Multi-Drug-Resistant Tuberculosis (MDR-TB Care in Nepal.

    Directory of Open Access Journals (Sweden)

    Sudeepa Khanal

    Full Text Available Multi-drug-resistant tuberculosis (MDR-TB poses a major threat to public health worldwide, particularly in low-income countries. The current long (20 month and arduous treatment regime uses powerful drugs with side-effects that include mental ill-health. It has a high loss-to-follow-up (25% and higher case fatality and lower cure-rates than those with drug sensitive tuberculosis (TB. While some national TB programmes provide small financial allowances to patients, other aspects of psychosocial ill-health, including iatrogenic ones, are not routinely assessed or addressed. We aimed to develop an intervention to improve psycho-social well-being for MDR-TB patients in Nepal. To do this we conducted qualitative work with MDR-TB patients, health professionals and the National TB programme (NTP in Nepal. We conducted semi-structured interviews (SSIs with 15 patients (10 men and 5 women, aged 21 to 68, four family members and three frontline health workers. In addition, three focus groups were held with MDR-TB patients and three with their family members. We conducted a series of meetings and workshops with key stakeholders to design the intervention, working closely with the NTP to enable government ownership. Our findings highlight the negative impacts of MDR-TB treatment on mental health, with greater impacts felt among those with limited social and financial support, predominantly married women. Michie et al's (2011 framework for behaviour change proved helpful in identifying corresponding practice- and policy-level changes. The findings from this study emphasise the need for tailored psycho-social support. Recent work on simple psychological support packages for the general population can usefully be adapted for use with people with MDR-TB.

  6. Molecular identification of marine symbiont bacteria of gastropods from the waters of the Krakal coast Yogyakarta and its potential as a Multi-Drug Resistant (MDR) antibacterial agent

    Science.gov (United States)

    Bahry, Muhammad Syaifudien; Pringgenies, Delianis; Trianto, Agus

    2017-01-01

    The resistance of pathogenic bacteria may occur to many types of antibiotics, especially in cases of non-compliance use of antibiotics, which likely to allow the evolution of Multi-Drug Resistant (MDR) bacteria. Gastropods seas are marine invertebrates informed capable of production of secondary metabolites as antibacterial MDR. The purpose of the study was the isolation and identification of gastropod symbiont bacteria found in the waters of Krakal, Gunung Kidul, Yogyakarta, which has the ability to produce antibacterial compounds against MDR(Escherichia coli, Enterobacter cloacae, Klebsiella pneumoniae, MRSA (methicillin-Resistant Staphylococcus aureus), Staphylococcus aureus, and Staphylococcus homunis) molecular. Stages of this research began with the isolation of bacteria, bacteria screening for anti-MDR compound, mass culture, and extraction, antibacterial activity test, DNA extraction, amplification by PCR 16S rDNA and sequencing. The results of the study showed that 19 isolates of bacteria were isolated from three species of gastropods namely Littorina scabra, Cypraea moneta and Conus ebraeus. Among them, 4 isolates showed activity against MDR test bacteria (E. coli, E. cloacae, K. pneumoniae, S. aureus and S. homunis). The highest activity was displayed by code LS.G1.8 isolate with the largest inhibition zone 15.47±0.45mm on S. humonis at 250 µg/disk concentration. Isolate CM.G2.1 showed largest inhibition zone, with 21.5±0.07mm on MRSA at 1000 µg/disk concentration and isolate the largest inhibition zone CM.G2.5 14.37±0.81mm on MRSA 14.37±0.81mm at concentrations 1000 µg/disk. The molecular identification of isolates LS.G1.8 has 99% homology with Bacillus subtilis and isolates CM.G2.1 has 99% homology with Bacillus pumillus.

  7. Risk factors associated with multidrug-resistant tuberculosis (MDR-TB) in a tertiary armed force referral and teaching hospital, Ethiopia.

    Science.gov (United States)

    Demile, Biresaw; Zenebu, Amare; Shewaye, Haile; Xia, Siqing; Guadie, Awoke

    2018-05-31

    Ethiopia is one of the world health organization defined higher tuberculosis (TB) burden countries where the disease remains a massive public health threat. This study aimed to identify the prevalence and associated factors of multidrug-resistant tuberculosis (MDR-TB) using all armed force and civilian TB attendants in a tertiary level armed force hospital, where data for MDR-TB are previously unpublished. Cross-sectional study was conducted from September 2014 to August 2015 in a tertiary level Armed Force Referral and Teaching Hospital (AFRTH), Ethiopia. Armed force members (n = 251) and civilians (n = 130) which has been undergone TB diagnosis at AFRTH were included. All the specimens collected were subjected to microscopic smear observation, culture growth and drug susceptibility testing. Data were analyzed using statistical package for social sciences following binary logistic regression and Chi-square. P-values < 0.05 were considered statistically significant. Among 381 TB patients, 355 (93.2%) new and 26 (6.8%) retreatment cases were identified. Culture and smear positive TB cases were identified in 297 (77.9%) and 252 (66.1%) patients, respectively. The overall prevalence of MDR-TB in AFRTH was found 1.8% (1.3% for armed force members and 0.5% for civilian patients) all of which were previously TB treated cases. The entire treatment success rates were 92.6% achieved highest in the armed force (active and pension) than the civilian patients. The failure and dead cases were also found 2.5 and 4.6%, respectively. Using bivariate analysis, category of attendants and TB contact history were strong predictors of MDR-TB in armed force and civilian patients. Moreover, human immunodeficiency virus (HIV) infection also identified a significant (OR = 14.6; 95% CI = 2.3-92.1; p = 0.004) predicting factor for MDR-TB in armed force members. However, sex, age and body mass index were not associated factor for MDR-TB. In AFRTH, lower prevalence of

  8. Expression of multidrug resistance gene and P-glycoprotein in nasopharyngealcarcinoma cells after irradiation

    International Nuclear Information System (INIS)

    Wang Ruoyu; Wang Hui; Fan Kai; Lv Shen

    2007-01-01

    Objective: To mimick a clinical fractionated protocol of exposure to X-radiation in vitro in order to investigate the changes in the function of MDR1 and P-gp in nasopharyngeal carcinoma (NPC) CNE cell before and after irradiation to determine the sequential order of radiotherapy and chemotherapy or the time of chemotherapy after radiotherapy in the treatment of NPC. Methods: Exponentially growing CNE cells were treated with fractionated X-radiation with total dose of 10 Gy (2 Gy per day for 5 days consecutively) in vitro. The expression of MDR1 gene was examined in CNE cells before irradiation and on days 4,8,13,17 and 21 after irradiation by RT-PCR, and its protein P-gp were detected by immunocytochemistry. The function of multidrug resistance protein P-gp was examined by MTT method. Results: Expression of MDR1 gene was below the level of detection before irradiation. Irradiation induced an overexpression of MDR1 gene on day 4, expression of MDR1 was decreased from day 8 to day 21. The overall expression of MDR1 was significantly more than that before irradiation (P<0.05) Expression of P-gp was below the level of detection before irradiation, which demonstrated that irradiation induced an overexpression of P-gp. This overexpression was increased from day 8 to day 21. The overpression of MDR1 gene was maintained dining a short period, however, the emergence of overpression of protein P-gp was later than that of MDR1 gene. Resistance index was 1 for both pre-irradiation and on day 8, and up to 8,10,11.2 on days 13, 17 and 21, respectively. The change of resistance index was accordant with the condition of overexpression of P-gp . Conclusions: Expression of P-gp in nasopharyngeal carcinoma (NPC) CNE cell was below the level of detection before irradiation. Irradiation can induce an overexpression of MDR1 gene and its protein P-gp in CNE cells. The overexpression of MDR1 gene and its protein P-gp lasted a long term. (authors)

  9. Evaluating the Role of Multidrug Resistance Protein 3 (MDR3) Inhibition in Predicting Drug-Induced Liver Injury Using 125 Pharmaceuticals.

    Science.gov (United States)

    Aleo, Michael D; Shah, Falgun; He, Kan; Bonin, Paul D; Rodrigues, A David

    2017-05-15

    The role of bile salt export protein (BSEP) inhibition in drug-induced liver injury (DILI) has been investigated widely, while inhibition of the canalicular multidrug resistant protein 3 (MDR3) has received less attention. This transporter plays a pivotal role in secretion of phospholipids into bile and functions coordinately with BSEP to mediate the formation of bile acid-containing biliary micelles. Therefore, inhibition of MDR3 in human hepatocytes was examined across 125 drugs (70 of Most-DILI-concern and 55 of No-DILI-concern). Of these tested, 41% of Most-DILI-concern and 47% of No-DILI-concern drugs had MDR3 IC 50 values of <50 μM. A better distinction across DILI classifications occurred when systemic exposure was considered where safety margins of 50-fold had low sensitivity (0.29), but high specificity (0.96). Analysis of physical chemical property space showed that basic compounds were twice as likely to be MDR3 inhibitors as acids, neutrals, and zwitterions and that inhibitors were more likely to have polar surface area (PSA) values of <100 Å 2 and cPFLogD values between 1.5 and 5. These descriptors, with different cutoffs, also highlighted a group of compounds that shared dual potency as MDR3 and BSEP inhibitors. Nine drugs classified as Most-DILI-concern compounds (four withdrawn, four boxed warning, and one liver injury warning in their approved label) had intrinsic potency features of <20 μM in both assays, thereby reinforcing the notion that multiple inhibitory mechanisms governing bile formation (bile acid and phospholipid efflux) may confer additional risk factors that play into more severe forms of DILI as shown by others for BSEP inhibitors combined with multidrug resistance-associated protein (MRP2, MRP3, MRP4) inhibitory properties. Avoiding physical property descriptors that highlight dual BSEP and MDR3 inhibition or testing drug candidates for inhibition of multiple efflux transporters (e.g., BSEP, MDR3, and MRPs) may be an effective

  10. Metallo- β-lactamases among Multidrug Resistant (MDR Gram Negative Bacteria Isolated from Clinical Specimens during 2009 in Sanandaj, Kurdistan Province

    Directory of Open Access Journals (Sweden)

    Himen Salimizand

    2012-08-01

    Full Text Available Background: Today, there are numerous reports about emerging multi drug resistant gram negative bacteria all around the world, especially in ICUs. Rarely, Metallo-β-lactamase (MBL enzymes are responsible for these cases. Study of MBLs for diagnosing and preventing distribution of the origin of infection are critical issues. In addition, we would like to compare the efficacy of Iranian and foreign- made antibiotic disks. Materials and Methods: During 2009 all entered clinical specimens to the laboratory tested for detecting gram negative bacteria. Isolated bacteria were tested by Kirby-Bauer method to antibiotic susceptibility test by Iranian and foreign (MAST disks. For gram negative carbapenem resistant isolates, PCR technique used to detect VIM, GIM, and SIM variants of MBLs.Results: During one year, 17890 clinical specimens referred Besat laboratory. The most specimen was Urine (8172 followed by blood culture (5190 that in which 1110 gram negative and positives isolated. Out of which, 778 (70% of isolates were gram negatives. MDR gram negatives were 157 (20.2%. Imipenem and meropenem were the most efficient antibiotics (all susceptible and ceftriaxone was the least (19 % susceptible. E. coli was the most prevalent isolate. 79 Gram negative isolates (10.1% were resistant to Iranian-made discs but all susceptible for foreign ones. All 79 isolates were tested by PCR for MBL genes, that, all were negative. Besides, Iranian imipenem and cefepime disks have had distinguishable difference in susceptibility of isolates.Conclusion: Fortunately, none of gram negative isolates were MBL producer, which revealed no colonization of MBL producing bacteria. Iranian-made disks appear efficient except for imipenem and cefepime.

  11. Active Sputum Monitoring Detects Substantial Rate of Multi-Drug Resistant Tuberculosis (MDR-TB) in an HIV-Infected Population in South Africa

    Science.gov (United States)

    Hassim, Shaheen; Shaw, Pamela A.; Sangweni, Phumelele; Malan, Lizette; Ntshani, Ella; Mathibedi, Monkwe Jethro; Stubbs, Nomso; Metcalf, Julia A; Eckes, Risa; Masur, Henry; Komati, Stephanus

    2010-01-01

    Background Tuberculosis (TB) co-infection with HIV is a substantial problem in South Africa. There has been a presumption that drug resistant strains of TB are common in South Africa, but few studies have documented this impression. Methods In Phidisa, a joint observational and randomized HIV treatment study for South African National Defence Force members and dependents, an initiative obtained microbiologic TB testing in subjects who appeared to be at high risk. We report results for HIV-infected subjects. Results TB was identified by culture in 116/584 (19.9%) of patients selected for sputum examination on the basis of suggestive symptoms. Smear was an insensitive technique for confirming the diagnosis: only 33% of culture-positive patients were identified by smear, with a 0.2% false positive rate. Of the 107 culture-positive individuals with susceptibility testing, 22 (20.6%) were identified to be MDR and 4 (3.7%) became extremely drug resistant tuberculosis (XDR) while under observation. Culture-positive cases with a history of TB treatment had more than twice the rate of MDR than those without, 27.1% vs. 11.9% (p=0.05). Conclusions TB is common in this cohort of HIV-infected patients. Smear was not a sensitive technique for identifying culture-positive cases in this health system. Drug susceptibility testing is essential to proper patient management because MDR was present in 20.6% of culture-positive patients. Better management strategies are needed to reduce the development of MDR-TB since so many such patients had received prior antituberculous therapy that was presumably not curative. PMID:20196651

  12. Detekce polymorfismu v genu MDR1 u ovčáckých a honáckých psů

    OpenAIRE

    Staroveská, Marieta

    2016-01-01

    This thesis is focused on polymorphism of MDR1 gene and related drug resistance. Resistance is caused by deletion of four nucleotids, that resulting in a frame shift and synthesis of nonfunctional transport of P-glycoprotein. The text describes a polymorphism of MDR1 (ABCB1) gene, which results in reduced resistance to drugs belonging to the group of macrocyclic lactones. It also describes inheritance of this phenomenon and it deals with the detection of mutation using PCR (polymerase chain r...

  13. Multidrug resistance gene expression is controlled by steroid hormones in the secretory epithelium of the uterus

    NARCIS (Netherlands)

    Arceci, R. J.; Baas, F.; Raponi, R.; Horwitz, S. B.; Housman, D.; Croop, J. M.

    1990-01-01

    The multidrug resistance (mdr) gene family has been shown to encode a membrane glycoprotein, termed the P-glycoprotein, which functions as a drug efflux pump with broad substrate specificity. This multigene family is expressed in a tissue-specific fashion in a wide variety of normal and neoplastic

  14. Polymorphisms in the xenobiotic transporter Multidrug Resistance 1 (MDR1) and interaction with meat intake in relation to risk of colorectal cancer in a Danish prospective case-cohort study

    DEFF Research Database (Denmark)

    Andersen, Vibeke; Østergaard, Mette; Christensen, Jane

    2009-01-01

    (rs5275) polymorphisms in the 3'-untranslated region. The polymorphisms were assessed together with lifestyle factors in a nested case-cohort study of 359 cases and a random cohort sample of 765 participants from the Danish prospective Diet, Cancer and Health study. Results Carriers of the variant......Background The xenobiotic transporters, Multidrug Resistance 1 (MDR1/ABCB1) and Breast Cancer Resistance Protein (BCRP/ABCG2) may restrict intestinal absorption of various carcinogens, including heterocyclic amines (HCA) and polycyclic aromatic hydrocarbons (PAH). Cyclooxygenase-2 (COX-2) derived...... prostaglandins promote gastrointestinal carcinogenesis, affecting angiogenesis, apoptosis, and invasiveness. The aim of this study was to investigate if polymorphisms in these genes were associated with risk of colorectal cancer (CRC), and to investigate possible interactions with lifestyle factors...

  15. Consolidating and Exploring Antibiotic Resistance Gene Data Resources

    DEFF Research Database (Denmark)

    Xavier, Basil Britto; Das, Anupam J.; Cochrane, Guy

    2016-01-01

    The unrestricted use of antibiotics has resulted in rapid acquisition of antibiotic resistance (AR) and spread of multidrug-resistant (MDR) bacterial pathogens. With the advent of next-generation sequencing technologies and their application in understanding MDR pathogen dynamics, it has become i...

  16. The roles of CDR1, CDR2, and MDR1 in kaempferol-induced suppression with fluconazole-resistant Candida albicans.

    Science.gov (United States)

    Shao, Jing; Zhang, MengXiang; Wang, TianMing; Li, Yue; Wang, ChangZhong

    2016-01-01

    Fungal infections caused by fluconazole-resistant Candida albicans are an intractable clinical problem, calling for new efficient antifungal drugs. Kaempferol, an active flavonoid, has been considered a potential candidate against Candida species. This work investigates the resistance reversion of kaempferol in fluconazole-resistant C. albicans and the underlying mechanism. The antifungal activities of fluconazole and/or kaempferol were assessed by a series of standard procedures including broth microdilution method, checkerboard assay and time-kill (T-K) test in nine clinical strains as well as a standard reference isolate of C. albicans. Subsequently, the morphological changes, the efflux of rhodamine 6G, and the expressions of CDR 1, CDR 2, and MDR 1 were analysed by scanning electron microscope (SEM), inverted fluorescence microscope and quantitative reverse transcription polymerase chain reaction (qRT-PCR) in C. albicans z2003. For all the tested C. albicans strains, the minimum inhibitory concentrations (MICs) of fluconazole and kaempferol ranged 0.25-32 and 128-256 μg/mL with a range of fractional inhibitory concentration index of 0.257-0.531. In C. albicans z2003, the expression of both CDR 1 and CDR 2 were decreased after exposure to kaempferol alone with negligible rhodamine 6G accumulation, while the expression of CDR 1, CDR 2 and MDR 1 were all decreased when fluconazole and kaempferol were used concomitantly with notable fluorescence of rhodamine 6G observed. Kaempferol-induced reversion in fluconazole-resistant C. albicans might be likely due to the suppression of the expression of CDR1, CDR2 and MDR1.

  17. A gene encoding maize caffeoyl-CoA O-methyltransferase confers quantitative resistance to multiple pathogens.

    Science.gov (United States)

    Yang, Qin; He, Yijian; Kabahuma, Mercy; Chaya, Timothy; Kelly, Amy; Borrego, Eli; Bian, Yang; El Kasmi, Farid; Yang, Li; Teixeira, Paulo; Kolkman, Judith; Nelson, Rebecca; Kolomiets, Michael; L Dangl, Jeffery; Wisser, Randall; Caplan, Jeffrey; Li, Xu; Lauter, Nick; Balint-Kurti, Peter

    2017-09-01

    Alleles that confer multiple disease resistance (MDR) are valuable in crop improvement, although the molecular mechanisms underlying their functions remain largely unknown. A quantitative trait locus, qMdr 9.02 , associated with resistance to three important foliar maize diseases-southern leaf blight, gray leaf spot and northern leaf blight-has been identified on maize chromosome 9. Through fine-mapping, association analysis, expression analysis, insertional mutagenesis and transgenic validation, we demonstrate that ZmCCoAOMT2, which encodes a caffeoyl-CoA O-methyltransferase associated with the phenylpropanoid pathway and lignin production, is the gene within qMdr 9.02 conferring quantitative resistance to both southern leaf blight and gray leaf spot. We suggest that resistance might be caused by allelic variation at the level of both gene expression and amino acid sequence, thus resulting in differences in levels of lignin and other metabolites of the phenylpropanoid pathway and regulation of programmed cell death.

  18. Study of tea polyphenol as a reversal agent for carcinoma cell lines' multidrug resistance (study of TP as a MDR reversal agent)

    International Nuclear Information System (INIS)

    Zhu Aizhi; Wang Xiangyun; Guo Zhenquan

    2001-01-01

    The aim of this study was to examine MDR1 expression product P-glycoprotein (Pgp) and study the effect and mechanism of tea polyphenol (TP) in reversion of multidrug resistance (MDR) in carcinoma cell lines. Immunocytochemical method was used for qualitative detection of Pgp. A comparative study of cytotoxicity and multidrug resistance reversion effect was made by MTT assay for tea polyphenol and quinidine in MCF-7 and MCF-7/Adr cell lines. The multidrug resistance reversion effect and mechanism were studied by measuring the uptake of 99m Tc-tetrofosmin in the carcinoma cell lines. (1) The Pgp overexpression in MCF-7/Adr cells was found to be strong positive, while the Pgp expression of MCF-7 was negative. (2) Although both tea polyphenol and quinidine could not remarkably change the toxicity of adriamycin to MCF-7, they could improve the sensitivity of MCF-7/Adr to adriamycin. The reversion index of tea polyphenol and quinidine was 3 and 10 respectively. (3) The cellular uptake of 99m Tc-tetrofosmin was remarkably lower in MCF-7/Adr than in MCF-7. The uptake of 99m Tc-tetrofosmin in MCF-7/Adr exhibited a 4, 13, 16 fold increase in the presence of 200, 400 and 500 μg/ml of tea polyphenol respectively. The uptake of 99m Tc-tetrofosmin in MCF-7/Adr exhibited only a 4-fold increase in the presence of 200 μM of quinidine. Immunocytochemistry can detect P-glycoprotein expression level qualitatively. Tea polyphenol is not only an anti-tumor agent, but also a multidrug resistant modulator similar to quinidine. The multidrug resistance reversion mechanism of tea polyphenol seems to be its inhibition of the activity of P-glycoprotein. Tea polyphenol has the advantage of very low toxicity in tumor treatment

  19. Co-ordinate regulation of the cystic fibrosis and multidrug resistance genes in cystic fibrosis knockout mice.

    Science.gov (United States)

    Trezise, A E; Ratcliff, R; Hawkins, T E; Evans, M J; Freeman, T C; Romano, P R; Higgins, C F; Colledge, W H

    1997-04-01

    The cystic fibrosis (Cftr and multidrug resistance (Mdr1) genes encode structurally similar proteins which are members of the ABC transporter superfamily. These genes exhibit complementary patterns of expression in vivo, suggesting that the regulation of their expression may be co-ordinated. We have tested this hypothesis in vivo by examining Cftr and Mdr1 expression in cystic fibrosis knockout transgenic mice (Cftr(tm1CAM)). Cftr mRNA expression in Cftr(tm1CAM)/Cftr(tm1CAM) mice was 4-fold reduced in the intestine, as compared with littermate wild-type mice. All other Cftr(tm1CAM)/Cftr(tm1CAM) mouse tissues examined showed similar reductions in Cftr expression. In contrast, we observed a 4-fold increase in Mdr1 mRNA expression in the intestines of neonatal and 3- to 4-week-old Cftr(tm1CAM)/Cftr(tm1CAM) mice, as compared with age-matched +/+ mice, and an intermediate level of Mdr1 mRNA in heterozygous Cftr(tm1CAM) mice. In 10-week-old, Cftr(tm1CAM)/Cftr(tm1CAM) mice and in contrast to the younger mice, Mdr1 mRNA expression was reduced, by 3-fold. The expression of two control genes, Pgk-1 and Mdr2, was similar in all genotypes, suggesting that the changes in Mdr1 mRNA levels observed in the Cftr(tm1CAM)/Cftr(tm1CAM) mice are specific to the loss of Cftr expression and/or function. These data provide further evidence supporting the hypothesis that the regulation Cftr and Mdr1 expression is co-ordinated in vivo, and that this co-ordinate regulation is influenced by temporal factors.

  20. Methylation of WTH3, a possible drug resistant gene, inhibits p53 regulated expression

    International Nuclear Information System (INIS)

    Tian, Kegui; Wang, Yuezeng; Huang, Yu; Sun, Boqiao; Li, Yuxin; Xu, Haopeng

    2008-01-01

    Previous results showed that over-expression of the WTH3 gene in MDR cells reduced MDR1 gene expression and converted their resistance to sensitivity to various anticancer drugs. In addition, the WTH3 gene promoter was hypermethylated in the MCF7/AdrR cell line and primary drug resistant breast cancer epithelial cells. WTH3 was also found to be directly targeted and up regulated by the p53 gene. Furthermore, over expression of the WTH3 gene promoted the apoptotic phenotype in various host cells. To further confirm WTH3's drug resistant related characteristics, we recently employed the small hairpin RNA (shRNA) strategy to knockdown its expression in HEK293 cells. In addition, since the WTH3 promoter's p53-binding site was located in a CpG island that was targeted by methylation, we were interested in testing the possible effect this epigenetic modification had on the p53 transcription factor relative to WTH3 expression. To do so, the in vitro methylation method was utilized to examine the p53 transgene's influence on either the methylated or non-methylated WTH3 promoter. The results generated from the gene knockdown strategy showed that reduction of WTH3 expression increased MDR1 expression and elevated resistance to Doxorubicin as compared to the original control cells. Data produced from the methylation studies demonstrated that DNA methylation adversely affected the positive impact of p53 on WTH3 promoter activity. Taken together, our studies provided further evidence that WTH3 played an important role in MDR development and revealed one of its transcription regulatory mechanisms, DNA methylation, which antagonized p53's positive impact on WTH3 expression

  1. Rapid genotyping assays for the 4-base pair deletion of canine MDR1/ABCB1 gene and low frequency of the mutant allele in Border Collie dogs.

    Science.gov (United States)

    Mizukami, Keijiro; Chang, Hye-Sook; Yabuki, Akira; Kawamichi, Takuji; Hossain, Mohammad A; Rahman, Mohammad M; Uddin, Mohammad M; Yamato, Osamu

    2012-01-01

    P-glycoprotein, encoded by the MDR1 or ABCB1 gene, is an integral component of the blood-brain barrier as an efflux pump for xenobiotics crucial in limiting drug uptake into the central nervous system. Dogs homozygous for a 4-base pair deletion of the canine MDR1 gene show altered expression or function of P-glycoprotein, resulting in neurotoxicosis after administration of the substrate drugs. In the present study, the usefulness of microchip electrophoresis for genotyping assays detecting this deletion mutation was evaluated. Mutagenically separated polymerase chain reaction (MS-PCR) and real-time PCR assays were newly developed and evaluated. Furthermore, a genotyping survey was carried out in a population of Border Collies dogs in Japan to determine the allele frequency in this breed. Microchip electrophoresis showed advantages in detection sensitivity and time saving over other modes of electrophoresis. The MS-PCR assay clearly discriminated all genotypes. Real-time PCR assay was most suitable for a large-scale survey due to its high throughput and rapidity. The genotyping survey demonstrated that the carrier and mutant allele frequencies were 0.49% and 0.25%, respectively, suggesting that the mutant allele frequency in Border Collies is markedly low compared to that in the susceptible dog breeds such as rough and smooth Collies.

  2. Monoclonal antibody to an external epitope of the human mdr1 P-glycoprotein

    NARCIS (Netherlands)

    Arceci, R. J.; Stieglitz, K.; Bras, J.; Schinkel, A.; Baas, F.; Croop, J.

    1993-01-01

    A membrane glycoprotein, termed P-glycoprotein, has been shown to be responsible for cross-resistance to a broad range of structurally and functionally distinct cytotoxic agents. P-glycoprotein, encoded in humans by the mdr1 gene, functions as an energy-dependent efflux pump to exclude these

  3. Co-ordinate loss of protein kinase C and multidrug resistance gene expression in revertant MCF-7/Adr breast carcinoma cells.

    Science.gov (United States)

    Budworth, J; Gant, T W; Gescher, A

    1997-01-01

    The aim of this study was to investigate the link between protein kinase C (PKC) and multidrug resistance (mdr) phenotype. The expression of both was studied in doxorubicin-resistant MCF-7/Adr cells as they reverted to the wild-type phenotype when cultured in the absence of drug. The following parameters were measured in cells 4, 10, 15, 20 and 24 weeks after removal of doxorubicin; (1) sensitivity of the cells towards doxorubicin; (2) levels of P-glycoprotein (P-gp) and MDR1 mRNA; (3) levels and cellular localization of PKC isoenzyme proteins alpha, theta and epsilon; and (4) gene copy number of PKC-alpha and MDR1 genes. Cells lost their resistance gradually with time, so that by week 24 they had almost completely regained the drug sensitivity seen in wild-type MCF-7 cells. P-gp levels measured by Western blot mirrored the change in doxorubicin sensitivity. By week 20, P-gp had decreased to 18% of P-gp protein levels at the outset, and P-gp was not detectable at week 24. Similarly, MDR1 mRNA levels had disappeared by week 24. MCF-7/Adr cells expressed more PKCs-alpha and -theta than wild-type cells and possessed a different cellular localization of PKC-epsilon. The expression and distribution pattern of these PKCs did not change for up to 20 weeks, but reverted back to that seen in wild-type cells by week 24. MDR1 gene amplification remained unchanged until week 20, but then was lost precipitously between weeks 20 and 24. The PKC-alpha gene was not amplified in MCF-7/Adr cells. The results suggest that MCF-7/Adr cells lose MDR1 gene expression and PKC activity in a co-ordinate fashion, consistent with the existence of a mechanistic link between MDR1 and certain PKC isoenzymes.

  4. Role of hypoxia-inducible factor-α in hepatitis-B-virus X protein-mediated MDR1 activation

    International Nuclear Information System (INIS)

    Han, Hyo-Kyung; Han, Chang Yeob; Cheon, Eun-Pa; Lee, Jaewon; Kang, Keon Wook

    2007-01-01

    The transition from chemotherapy-responsive cancer cells to chemotherapy-resistant cancer cells is mainly accompanied by the increased expression of multi-drug resistance 1 (MDR1). We found that hepatitis-B-virus X protein (HBx) increases the transcriptional activity and protein level of MDR1 in a hepatoma cell line, H4IIE. In addition, HBx overexpression made H4IIE cells more resistant to verapamil-uptake. HBx stabilized hypoxia-inducible factor-1α (HIF-1α) and induced the nuclear translocation of C/EBPβ. Reporter gene analyses showed that HBx increased the reporter activity in the cells transfected with the reporter containing MDR1 gene promoter. Moreover, the luciferase reporter gene activity was significantly inhibited by HIF-1α siRNA but not by overexpression of C/EBP dominant negative mutant. These results imply that HBx increases the MDR1 transporter activity through the transcriptional activation of the MDR1 gene with HIF-1α activation, and suggest HIF-1α for the therapeutic target of HBV-mediated chemoresistance

  5. Multiple Origins of Mutations in the mdr1 Gene—A Putative Marker of Chloroquine Resistance in P. vivax

    DEFF Research Database (Denmark)

    Schousboe, Mette L; Ranjitkar, Samir; Rajakaruna, Rupika S

    2015-01-01

    BACKGROUND: Chloroquine combined with primaquine has been the recommended antimalarial treatment of Plasmodium vivax malaria infections for six decades but the efficacy of this treatment regimen is threatened by chloroquine resistance (CQR). Single nucleotide polymorphisms (SNPs) in the multidrug...

  6. Antimicrobial resistance and resistance genes in Salmonella strains isolated from broiler chickens along the slaughtering process in China.

    Science.gov (United States)

    Zhu, Yuanting; Lai, Haimei; Zou, Likou; Yin, Sheng; Wang, Chengtao; Han, Xinfeng; Xia, Xiaolong; Hu, Kaidi; He, Li; Zhou, Kang; Chen, Shujuan; Ao, Xiaolin; Liu, Shuliang

    2017-10-16

    A total of 189 Salmonella isolates were recovered from 627 samples which were collected from cecal contents of broilers, chicken carcasses, chicken meat after cutting step and frozen broiler chicken products along the slaughtering process at a slaughterhouse in Sichuan province of China. The Salmonella isolates were subjected to antimicrobial susceptibility testing to 10 categories of antimicrobial agents using the Kirby-Bauer disk diffusion method. Those antibiotics-resistant isolates were further investigated for the occurrence of resistance genes, the presence of class 1 integron as well as the associated gene cassettes, and the mutations within the gyrA and parC genes. Consequently, the prevalence of Salmonella was 30.14% (47.96% for cecal content, 18.78% for chicken carcasses, 31.33% for cutting meat and 14.00% for frozen meat, respectively). The predominant serotypes were S. Typhimurium (15.34%) and S. Enteritidis (69.84%). High resistance rates to the following drugs were observed: nalidixic acid (99.5%), ampicillin (87.8%), tetracycline (51.9%), ciprofloxacin (48.7%), trimethoprim/sulfamethoxazole (48.1%), and spectinomycin (34.4%). Antimicrobial resistance profiling showed that 60.8% of isolates were multidrug resistant (MDR), and MDR strains increased from 44.7% to 78.6% along the slaughtering line. 94.6% (n=157) of beta-lactam-resistant isolates harbored at least one resistance gene of bla TEM or bla CTX-M . The relatively low prevalence of aminoglycoside resistance genes (aac(3)-II, aac(3)-IV, and ant(2″)-I) was found in 49 (66.2%) of antibiotic-resistant isolates. The tetracycline resistance genes (tet(A), tet(B), tet(C), and tet(G) and sulfonamide resistance genes (sul1, sul2, and sul3) were identified in 84 (85.7%) and 89 (97.8%) antibiotic-resistant isolates respectively. floR was identified in 44 (97.8%) florfenicol-resistant isolates. Class 1 integron was detected in 37.4% (n=43) of the MDR isolates. Two different gene cassettes, bla OXA-30 -aad

  7. MDR1 haplotypes conferring an increased expression of intestinal CYP3A4 rather than MDR1 in female living-donor liver transplant patients.

    Science.gov (United States)

    Hosohata, Keiko; Masuda, Satohiro; Yonezawa, Atsushi; Katsura, Toshiya; Oike, Fumitaka; Ogura, Yasuhiro; Takada, Yasutsugu; Egawa, Hiroto; Uemoto, Shinji; Inui, Ken-Ichi

    2009-07-01

    This study investigated whether haplotypes in the multidrug resistance 1 (MDR1) gene had effects on mRNA expression levels of MDR1 and cytochrome P450 (CYP) 3A4, and on the pharmacokinetics of tacrolimus in living-donor liver transplant (LDLT) patients, considering the gender difference. Haplotype analysis of MDR1 with G2677T/A and C3435T was performed in 63 de novo Japanese LDLT patients (17 to 55 years; 44.4% women). The expression levels of MDR1 and CYP3A4 mRNAs in jejunal biopsy specimens were quantified by real-time PCR. Intestinal CYP3A4 mRNA expression levels (amol/microg total RNA) showed significantly higher values in women carrying the 2677TT-3435TT haplotype (median, 10.7; range, 5.92-15.2) than those with 2677GG-3435CC (3.03; range 1.38-4.68) and 2677GT-3435CT (median, 4.31; range, 0.07-9.42) (P = 0.022), but not in men (P = 0.81). However, MDR1 haplotype did not influence mRNA expression levels of MDR1 nor the concentration/dose ratio [(ng/mL)/(mg/day)] of oral tacrolimus for the postoperative 7 days, irrespective of gender. MDR1 haplotype may have a minor association with the tacrolimus pharmacokinetics after LDLT, but could be a good predictor of the inter-individual variation of intestinal expression of CYP3A4 in women.

  8. Study of antagonistic effects of Lactobacillus strains as probiotics on multi drug resistant (MDR bacteria isolated from urinary tract infections (UTIs

    Directory of Open Access Journals (Sweden)

    Atiyeh Naderi

    2014-03-01

    Conclusion: Treatment of E. coli with probiotic suspension was not effective on inhibition of the plasmid carrying hypothetical ampicillin resistant gene. Moreover, the plasmid profiles obtained from probiotic-treated isolates were identical to untreated isolates.

  9. How many sputum culture results do we need to monitor multidrug-resistant-tuberculosis (MDR-TB) patients during treatment?

    NARCIS (Netherlands)

    Janssen, Saskia; Padanilam, Xavier; Louw, Rianna; Mahanyele, Russel; Coetzee, Gerrit; Hänscheid, Thomas; Leenstra, Tjalling; Grobusch, Martin P.

    2013-01-01

    Discharge of a hospital patient after a single negative sputum culture may save money when treating multidrug-resistant tuberculosis. However, after initial sputum conversion in 336 South Africans, 11.6% and 5.4% reconverted after 1 and 2 months, respectively. These findings endorse the WHO

  10. High prevalence of the PER-1 gene among carbapenem-resistant Acinetobacter baumannii in Riyadh, Saudi Arabia.

    Science.gov (United States)

    Aly, M M; Abu Alsoud, N M; Elrobh, M S; Al Johani, S M; Balkhy, H H

    2016-11-01

    The prevalence of carbapenem-resistant Acinetobacter baumannii in Saudi Arabia and their resistance genetic mechanisms are yet to be identified. We studied the prevalence and genetic diversity of extended-spectrum beta-lactamase genes, particularly the PER-1 gene, among carbapenem-resistant A. baumannii strains from patients at a tertiary care hospital in Riyadh, Saudi Arabia between 2006 and 2014. Fresh subcultured samples were tested for antimicrobial susceptibility minimum inhibitory concentration (MIC). Total genomic DNA was extracted from each isolate and further used for polymerase chain reaction (PCR) genotyping, sequence-based typing (SBT) of PER-1 and OXA-51-like gene, and multilocus sequence typing (MLST) of positive isolates. Randomly selected clinical isolates (n = 100) were subjected to MLST. A total of 503 isolates were characterized as multidrug-resistant (MDR) using the MIC. Isolates were further PCR tested for bla -TEM and bla -PER-1 resistance genes (n = 503). The genotyping results showed that 68/503 (14 %) isolates were positive to bla TEM. The genotyping results of PER-1-like genes showed that 384/503 (76.3 %) were positive among MDR Acinetobacter isolates. Based on SBT, the majority of these isolates were clustered into three main groups including isolates harboring PER-1: AB11 (bla -PER-1 ), isolate AB16 (bla -PER-1 ), and, finally, the plasmid pAB154 (bla -PER-7 ). Remarkably, many isolates were concealing the PER-1 gene and harboring the TEM resistance genes as well. MLST results for selected isolates (n = 100) identified four main sequence types (STs: 2, 19, 20, and 25) and four novel isolates (ST 486-489). We report 76.3 % prevalence of the PER-1 resistance gene among Acinetobacter clinical isolates from Riyadh, Saudi Arabia. Further work is needed to explore the clinical risks and patient outcome with such resistance related to healthcare-associated infections and investigate the genetic and molecular mechanisms that confer the MDR

  11. In vivo detection of multidrug-resistant (MDR1) phenotype by technetium-99m sestamibi scan in untreated breast cancer patients

    International Nuclear Information System (INIS)

    Del Vecchio, S.; Ciarmiello, A.; Potena, M.I.; Carriero, M.V.; Mainolfi, C.; Botti, G.; Thomas, R.; Cerra, M.; D'Aiuto, G.; Tsuruo, T.; Salvatore, M.

    1997-01-01

    Technetium-99m sestamibi is a transport substrate recognised by the multidrug-resistant P-glycoprotein (Pgp). To test whether 99m Tc-sestamibi efflux is enhanced in breast carcinomas overexpressing Pgp, we determined the efflux rates of 99m Tc-sestamibi and Pgp levels in tumours from 30 patients with untreated breast carcinoma. Patients were intravenously injected with 740 MBq of 99m Tc-sestamibi and underwent a 15-min dynamic study followed by the acquisition of static planar images at 0.5, 1, 2 and 4 h. Tumour specimens were obtained from each patient 24 h after 99m Tc-sestamibi scan and Pgp levels were determined using 125 I-MRK16 monoclonal antibody and in vitro quantitative autoradiography. All breast carcinomas showed high uptake of 99m Tc-sestamibi and data from region of interest analysis on sequential images were fitted with a monoexponential function. The efflux rates of 99m Tc-sestamibi, calculated from decay-corrected time-activity curves, ranged between 0.00121 and 0.01690 min -1 and were directly correlated with Pgp levels measured in the same tumours (r=0.62; P 99m Tc-sestamibi efflux from tumours of group A was 2.7 times higher than that observed in tumours of group B (0.00686 ±0.00390 min -1 vs 0.00250 ±0.00090 min -1 , P 99m Tc-sestamibi showed a sensitivity and a specificity of 80% and 95%, respectively. In conclusion, the efflux rate of 99m Tc-sestamibi may be used for the in vivo identification of the multidrug resistant (MDR1) phenotype in untreated breast cancer patients. (orig.). With 7 figs., 3 tabs

  12. Obesity genes and insulin resistance.

    Science.gov (United States)

    Belkina, Anna C; Denis, Gerald V

    2010-10-01

    The exploding prevalence of insulin resistance and Type 2 diabetes (T2D) linked to obesity has become an alarming public health concern. Worldwide, approximately 171 million people suffer from obesity-induced diabetes and public health authorities expect this situation to deteriorate rapidly. An interesting clinical population of 'metabolically healthy but obese' (MHO) cases is relatively protected from T2D and its associated cardiovascular risk. The molecular basis for this protection is not well understood but is likely to involve reduced inflammatory responses. The inflammatory cells and pathways that respond to overnutrition are the primary subject matter for this review. The chance discovery of a genetic mutation in the Brd2 gene, which is located in the class II major histocompatibility complex and makes mice enormously fat but protects them from diabetes, offers revolutionary new insights into the cellular mechanisms that link obesity to insulin resistance and T2D. These Brd2-hypomorphic mice have reduced inflammation in fat that is normally associated with insulin resistance, and resemble MHO patients, suggesting novel therapeutic pathways for obese patients at risk for T2D. Deeper understanding of the functional links between genes that control inflammatory responses to diet-induced obesity is crucial to the development of therapies for obese, insulin-resistant patients.

  13. Role of MRP-1 and GST-Pi in MDR and their inhibition by ...

    African Journals Online (AJOL)

    Samia A. Ebeed

    2016-08-16

    Aug 16, 2016 ... Various mechanisms were proposed that underlie MDR in malignant cells. ... the gene that confers MDR in lung cancer cells. MRP1 acts in order to protect ... the many physiological and pathophysiological processes influ-.

  14. Gradient phenomenon of multidrug resistance gene expression in breast cancer during neoadjuvant chemotherapy is related to disease progression

    Directory of Open Access Journals (Sweden)

    N. V. Litviakov

    2013-01-01

    Full Text Available The paper examined 106 patients with breast cancer (BC treated with neoadjuvant chemotherapy (NАС. In the biopsy material, derived from primary tumor before NAC and surgical samples after chemotherapy the expression of 8 multidrug resistance genes (MDR ABCB1, АВСВ2, ABCC1, ABCC2, АВСС5, ABCG1, ABCG2 и MVP was evaluated using quantitative RT-PCR. During the NAC course 75 % of patients manifested gradient phenomenon for gene expression that means a unidirectional change in the expression of all five MDR genes ABCB1, ABCC1, ABCC2, ABCG1 и ABCG2 closely associated with the NAC efficacy: the reduction in MDR gene expression was related to good response to NAC while the expression increase associated with poor response to NAC. In 25% of patients there was no such change in studied gene expression that means the lack of a gradient phenomenon. The objective was to study whether gradient phenomenon for MDR gene expression during NAC is related to disease free survival in breast cancer patients. Five-year metastasis-free survival in patients having a gradient phenomenon was 73 % versus 39 % in patients who lack a gradient phenomenon (log-rank test p=0,0018. So, the presence of a gradient phenomenon in patients is appeared to be associated with a good disease prognosis. It is assumed that the gradiThe paper examined 106 patients with breast cancer (BC treated with neoadjuvant chemotherapy (NАС. In the biopsy material, derived from primary tumor before NAC and surgical samples after chemotherapy the expression of 8 multidrug resistance genes (MDR ABCB1, АВСВ2, ABCC1, ABCC2, АВСС5, ABCG1, ABCG2 и MVP was evaluated using quantitative RT-PCR. During the NAC course 75 % of patients manifested gradient phenomenon for gene expression that means a unidirectional change in the expression of all five MDR genes ABCB1, ABCC1, ABCC2, ABCG1 и ABCG2 closely associated with the NAC efficacy: the reduction in MDR gene expression was related to good

  15. Study of antagonistic effects of Lactobacillus strains as probiotics on multi drug resistant (MDR) bacteria isolated from urinary tract infections (UTIs).

    Science.gov (United States)

    Naderi, Atiyeh; Kasra-Kermanshahi, Roha; Gharavi, Sara; Imani Fooladi, Abbas Ali; Abdollahpour Alitappeh, Meghdad; Saffarian, Parvaneh

    2014-03-01

    Urinary tract infection (UTI) caused by bacteria is one of the most frequent infections in human population. Inappropriate use of antibiotics, often leads to appearance of drug resistance in bacteria. However, use of probiotic bacteria has been suggested as a partial replacement. This study was aimed to assess the antagonistic effects of Lactobacillus standard strains against bacteria isolated from UTI infections. Among 600 samples; those with ≥10,000 cfu/ml were selected as UTI positive samples. Enterococcus sp., Klebsiella pneumoniae, Enterobacter sp., and Escherichia coli were found the most prevalent UTI causative agents. All isolates were screened for multi drug resistance and subjected to the antimicrobial effects of three Lactobacillus strains by using microplate technique and the MICs amounts were determined. In order to verify the origin of antibiotic resistance of isolates, plasmid curing using ethidium bromide and acridine orange was carried out. No antagonistic activity in Lactobacilli suspension was detected against test on Enterococcus and Enterobacter strains and K. pneumoniae, which were resistant to most antibiotics. However, an inhibitory effect was observed for E. coli which were resistant to 8-9 antibiotics. In addition, L. casei was determined to be the most effective probiotic. RESULTS from replica plating suggested one of the plasmids could be related to the gene responsible for ampicillin resistance. Treatment of E. coli with probiotic suspension was not effective on inhibition of the plasmid carrying hypothetical ampicillin resistant gene. Moreover, the plasmid profiles obtained from probiotic-treated isolates were identical to untreated isolates.

  16. Whole Genome Sequencing and Plasmid Genomics of Antimicrobial Resistance – Salmonella’s mobile genetic elements and the antimicrobial resistance genes they carry

    Science.gov (United States)

    With the emergence of antibiotic resistance (AR), multidrug resistance (MDR), and carbapenem resistant Enterobacteriaceae (CRE), the specter of widespread untreatable bacterial infections threatens human and animal health. The ability of these emerging resistances to transfer between bacteria on mob...

  17. Non-p-glycoprotein-mediated multidrug resistance in detransformed rat cells selected for resistance to methylglyoxal bis(guanylhydrazone).

    Science.gov (United States)

    Weber, J M; Sircar, S; Horvath, J; Dion, P

    1989-11-01

    Three independent variants (G2, G4, G5), resistant to methylglyoxal bis(guanylhydrazone), an anticancer drug, have been isolated by single step selection from an adenovirus-transformed rat brain cell line (1). These variants display selective cross-resistance to several natural product drugs of dissimilar structure and action. Multidrug resistance has recently been shown to be caused by overexpression of the membrane-associated p-glycoprotein, most often caused by amplification of the mdr gene. Several types of experiments were conducted to determine whether the observed drug resistance in our cell lines could be due to changes at the mdr locus. The following results were obtained: (a) the mdr locus was not amplified; (b) transcription of the mdr gene and p-glycoprotein synthesis were not increased; (c) multidrug resistance cell lines, which carry an amplified mdr locus, were not cross-resistant to methylglyoxal bis(guanylhydrazone); (d) verapamil did not reverse the resistance of G cells or mdr cells to methylglyoxal bis(guanylhydrazone), nor that of G cells to vincristine; and (e) methylglyoxal bis(guanylhydrazone) resistance was recessive and depended on a block to drug uptake, as opposed to mdr cells which are dominant and express increased drug efflux. The results obtained suggest that the drug resistance in the G2, G4, and G5 cells was atypical and may be due to a mechanism distinct from that mediated by the mdr locus.

  18. Mutations inside rifampicin-resistance determining region of rpoB gene associated with rifampicin-resistance in Mycobacterium tuberculosis.

    Science.gov (United States)

    Zaw, Myo T; Emran, Nor A; Lin, Zaw

    2018-04-26

    Rifampicin (RIF) plays a pivotal role in the treatment of tuberculosis due to its bactericidal effects. Because the action of RIF is on rpoB gene encoding RNA polymerase β subunit, 95% of RIF resistant mutations are present in rpoB gene. The majority of the mutations in rpoB gene are found within an 81bp RIF-resistance determining region (RRDR). Literatures on RIF resistant mutations published between 2010 and 2016 were thoroughly reviewed. The most commonly mutated codons in RRDR of rpoB gene are 531, 526 and 516. The possibilities of absence of mutation in RRDR of rpoB gene in MDR-TB isolates in few studies was due to existence of other rare rpoB mutations outside RRDR or different mechanism of rifampicin resistance. Molecular methods which can identify extensive mutations associated with multiple anti-tuberculous drugs are in urgent need so that the research on drug resistant mutations should be extended. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  19. Vital and dispensable roles of Plasmodium multidrug resistance transporters during blood- and mosquito-stage development.

    Science.gov (United States)

    Rijpma, Sanna R; van der Velden, Maarten; Annoura, Takeshi; Matz, Joachim M; Kenthirapalan, Sanketha; Kooij, Taco W A; Matuschewski, Kai; van Gemert, Geert-Jan; van de Vegte-Bolmer, Marga; Siebelink-Stoter, Rianne; Graumans, Wouter; Ramesar, Jai; Klop, Onny; Russel, Frans G M; Sauerwein, Robert W; Janse, Chris J; Franke-Fayard, Blandine M; Koenderink, Jan B

    2016-07-01

    Multidrug resistance (MDR) proteins belong to the B subfamily of the ATP Binding Cassette (ABC) transporters, which export a wide range of compounds including pharmaceuticals. In this study, we used reverse genetics to study the role of all seven Plasmodium MDR proteins during the life cycle of malaria parasites. Four P. berghei genes (encoding MDR1, 4, 6 and 7) were refractory to deletion, indicating a vital role during blood stage multiplication and validating them as potential targets for antimalarial drugs. Mutants lacking expression of MDR2, MDR3 and MDR5 were generated in both P. berghei and P. falciparum, indicating a dispensable role for blood stage development. Whereas P. berghei mutants lacking MDR3 and MDR5 had a reduced blood stage multiplication in vivo, blood stage growth of P. falciparum mutants in vitro was not significantly different. Oocyst maturation and sporozoite formation in Plasmodium mutants lacking MDR2 or MDR5 was reduced. Sporozoites of these P. berghei mutants were capable of infecting mice and life cycle completion, indicating the absence of vital roles during liver stage development. Our results demonstrate vital and dispensable roles of MDR proteins during blood stages and an important function in sporogony for MDR2 and MDR5 in both Plasmodium species. © 2016 John Wiley & Sons Ltd.

  20. Breed distribution of the nt230(del4) MDR1 mutation in dogs.

    Science.gov (United States)

    Gramer, Irina; Leidolf, Regina; Döring, Barbara; Klintzsch, Stefanie; Krämer, Eva-Maria; Yalcin, Ebru; Petzinger, Ernst; Geyer, Joachim

    2011-07-01

    A 4-bp deletion mutation associated with multiple drug sensitivity exists in the canine multidrug resistance (MDR1) gene. This mutation has been detected in more than 10 purebred dog breeds as well as in mixed breed dogs. To evaluate the breed distribution of this mutation in Germany, 7378 dogs were screened, including 6999 purebred and 379 mixed breed dogs. The study included dog breeds that show close genetic relationship or share breeding history with one of the predisposed breeds but in which the occurrence of the MDR1 mutation has not been reported. The breeds comprised Bearded Collies, Anatolian Shepherd Dog, Greyhound, Belgian Tervuren, Kelpie, Borzoi, Australian Cattle Dog and the Irish Wolfhound. The MDR1 mutation was not detected is any of these breeds, although it was found as expected in the Collie, Longhaired Whippet, Shetland Sheepdog, Miniature Australian Shepherd, Australian Shepherd, Wäller, White Swiss Shepherd, Old English Sheepdog and Border Collie with varying allelic frequencies for the mutant MDR1 allele of 59%, 45%, 30%, 24%, 22%, 17%, 14%, 4% and 1%, respectively. Allelic frequencies of 8% and 2% were determined in herding breed mixes and unclassified mixed breeds, respectively. Because of its widespread breed distribution and occurrence in many mixed breed dogs, it is difficult for veterinarians and dog owners to recognise whether MDR1-related drug sensitivity is relevant for an individual animal. This study provides a comprehensive overview of all affected dog breeds and many dog breeds that are probably unaffected on the basis of ∼15,000 worldwide MDR1 genotyping data. Copyright © 2010 Elsevier Ltd. All rights reserved.

  1. Transmission of MDR and XDR tuberculosis in Shanghai, China.

    Directory of Open Access Journals (Sweden)

    Ming Zhao

    Full Text Available Multidrug-resistant (MDR and extensively drug-resistant (XDR tuberculosis (TB are global health problems. We sought to determine the characteristics, prevalence, and relative frequency of transmission of MDR and XDR TB in Shanghai, one of the largest cities in Asia.TB is diagnosed in district TB hospitals in Shanghai, China. Drug susceptibility testing for first-line drugs was performed for all culture positive TB cases, and tests for second-line drugs were performed for MDR cases. VNTR-7 and VNTR-16 were used to genotype the strains, and prior treatment history and treatment outcomes were determined for each patient.There were 4,379 culture positive TB cases diagnosed with drug susceptibility test results available during March 2004 through November 2007. 247 (5.6% were infected with a MDR strain of M. tuberculosis and 11 (6.3% of the 175 MDR patients whose isolate was tested for susceptibility to second-line drugs, were XDR. More than half of the patients with MDR and XDR were newly diagnosed and had no prior history of TB treatment. Nearly 57% of the patients with MDR were successfully treated.Transmission of MDR and XDR strains is a serious problem in Shanghai. While a history of prior anti-TB treatment indicates which individuals may have acquired MDR or XDR TB, it does not accurately predict which TB patients have disease caused by transmission of MDR and XDR strains. Therefore, universal drug susceptibility testing is recommended for new and retreatment TB cases.

  2. Multidrug-resistant pathogens in the food supply.

    Science.gov (United States)

    Doyle, Marjorie E

    2015-04-01

    Antimicrobial resistance, including multidrug resistance (MDR), is an increasing problem globally. MDR bacteria are frequently detected in humans and animals from both more- and less-developed countries and pose a serious concern for human health. Infections caused by MDR microbes may increase morbidity and mortality and require use of expensive drugs and prolonged hospitalization. Humans may be exposed to MDR pathogens through exposure to environments at health-care facilities and farms, livestock and companion animals, human food, and exposure to other individuals carrying MDR microbes. The Centers for Disease Control and Prevention classifies drug-resistant foodborne bacteria, including Campylobacter, Salmonella Typhi, nontyphoidal salmonellae, and Shigella, as serious threats. MDR bacteria have been detected in both meat and fresh produce. Salmonellae carrying genes coding for resistance to multiple antibiotics have caused numerous foodborne MDR outbreaks. While there is some level of resistance to antimicrobials in environmental bacteria, the widespread use of antibiotics in medicine and agriculture has driven the selection of a great variety of microbes with resistance to multiple antimicrobials. MDR bacteria on meat may have originated in veterinary health-care settings or on farms where animals are given antibiotics in feed or to treat infections. Fresh produce may be contaminated by irrigation or wash water containing MDR bacteria. Livestock, fruits, and vegetables may also be contaminated by food handlers, farmers, and animal caretakers who carry MDR bacteria. All potential sources of MDR bacteria should be considered and strategies devised to reduce their presence in foods. Surveillance studies have documented increasing trends in MDR in many pathogens, although there are a few reports of the decline of certain multidrug pathogens. Better coordination of surveillance programs and strategies for controlling use of antimicrobials need to be implemented in

  3. Antibacterial Activity Test of Nudibranches Polka - Dot (Jorunna funebris (Gastropods : Molusc Extract Against Multi(Aktivitas Antibakteri Ekstrak Nudibranch Polka-Dot (Jorunna funebris (Gastropoda : Moluska Terhadap Bakteri Multidrug Resistant (MDR

    Directory of Open Access Journals (Sweden)

    Delianis Pringgenies

    2015-12-01

    Full Text Available Terjadinya resistensi antibiotik menjadi permasalahan dalam dunia kesehatan. Peningkatan kemampuan patogen dalam menahan efek obat menyebabkan timbulnya resistensi. Beberapa bakteri patogen pada manusia dilaporkan telah mengalami resistensi terhadap lebih dari satu kelas antibiotik. Untuk mengatasi permasalahan tersebut, maka perlu dilakukan pencarian senyawa antibiotik baru yang lebih efektif dalam mengatasi permasalahan bakteri Multi-drug Resistant (MDR. Metabolit sekunder yang diproduksi oleh invertebrata laut  mempunyai prospek sebagai bahan obat dari laut. Nudibranch diduga mampu menghasilkan metabolit sekunder sebagai mekanisme pertahanan diri. Tujuan dari penelitian ini adalah untuk mengetahui fraksi dari ekstrak nudibranch Jorunna funebris yang menunjukkan bioaktivitas terhadap bakteri Multi-drug Resistant (MDR. Proses ekstraksi dilakukan dengan metode maserasi. Fraksinasi dengan Kromatografi Kolom Terbuka (KKT. Uji aktivitas antibakteri menggunakan metode difusi agar. Analisis komponen senyawa dengan GC-MS. Hasil penelitian menunjukkan bahwa 8 fraksi ekstrak nudibranch J. funebris menunjukkan aktivitas antibakteri. Hasil uji aktivitas menunjukkan fraksi I paling aktif terhadap 5 bakteri uji yaitu Klebsiella, Pseudomonas, Escherichia coli, Enterobacter 5 dan Enterobacter 10 dengan rata-rata zona hambatan secara berurutan sebesar 12,78 mm; 12,51 mm; 15,47 mm; 14,09 mm dan 12,46 mm. Fraksi II paling aktif terhadap bakteri Coagulase Negative Staphylococcus dengan rata-rata zona hambatan sebesar 12,70 mm. Analisis GC-MS menunjukkan bahwa dalam fraksi II terdapat senyawa 1-oktadekanol yang berpotensi sebagai antibakteri. Kata kunci : nudibranch, Jorunna funebris, antibakteri, multi-drug resistant, 1-oktadekanol Emergence of antibiotic resistance become a problems on medical world. Increasing pathogen ability to hold the antibiotic effect caused resistance. Several human-patogen bacteria were resistance to one or more classes of antibiotics

  4. Rapid Screening of MDR-TB in Cases of Extra Pulmonary Tuberculosis Using Geno Type MTBDRplus.

    Directory of Open Access Journals (Sweden)

    Richa Kumari

    Full Text Available Drug resistance in tuberculosis is a major public health challenge in developing countries. The limited data available on drug resistance in extra pulmonary tuberculosis stimulated us to design our study on anti-tuberculosis drug resistance pattern in cases of extra pulmonary tuberculosis in a tertiary referral hospital of North India. We performed Geno Type MTBDRplus assay in comparison with conventional drug susceptibility testing by proportion method to study the mutation patterns in rpoB, katG and inhA genes.A total of 510 extra pulmonary samples were included in this study. After the smear microscopy, all the specimens were subjected for culture on Lowenstein Jensen (LJ media. Phenotypic drug susceptibility testing (DST was performed on LJ media for all the MTB isolates and compared with the results of Geno Type MTBDRplus assay which was performed with the DNA isolated from the culture by conventional method.Of 510 specimens cultured, the total culture positivity obtained was 11.8% (60 encompassing 54 (10.6% Mycobacterium tuberculosis and 6 (1.2% non-tubercular mycobacteria (NTM. DST results by Geno Type MTBDRplus assay and solid culture methods were compared in 51 MTB isolates excluding the two Rif indeterminate and one invalid test. Geno Type MTBDRplus accurately identified 13 of 14 rifampicin-resistant strains, 14 of 15 isoniazid-resistant strains and 13 of 14 as multi drug resistant tuberculosis (MDR-TB in comparison with conventional method. Sensitivity and specificity were 92.86% and 97.30% respectively for detection of RIF resistance, 93.33% and 94.44% respectively for detection of INH resistance, 92.86% and 97.30% respectively for detection of MDR-TB, while the overall concordance of Geno Type MTBDRplus assay with conventional DST was 94.11%. The turn-around time for performing Geno Type MTBDRplus assay test was 48 hours.The problem of MDR in extra pulmonary tuberculosis (EPTB cannot be overlooked and due attention on patients

  5. Identification of acquired antimicrobial resistance genes

    DEFF Research Database (Denmark)

    Zankari, Ea; Hasman, Henrik; Cosentino, Salvatore

    2012-01-01

    ObjectivesIdentification of antimicrobial resistance genes is important for understanding the underlying mechanisms and the epidemiology of antimicrobial resistance. As the costs of whole-genome sequencing (WGS) continue to decline, it becomes increasingly available in routine diagnostic laborato......ObjectivesIdentification of antimicrobial resistance genes is important for understanding the underlying mechanisms and the epidemiology of antimicrobial resistance. As the costs of whole-genome sequencing (WGS) continue to decline, it becomes increasingly available in routine diagnostic...... laboratories and is anticipated to substitute traditional methods for resistance gene identification. Thus, the current challenge is to extract the relevant information from the large amount of generated data.MethodsWe developed a web-based method, ResFinder that uses BLAST for identification of acquired...... antimicrobial resistance genes in whole-genome data. As input, the method can use both pre-assembled, complete or partial genomes, and short sequence reads from four different sequencing platforms. The method was evaluated on 1862 GenBank files containing 1411 different resistance genes, as well as on 23 de...

  6. The Prevalence of acrA and acrB Genes Among Multiple-Drug Resistant Uropathogenic Escherichia coli Isolated From Patients With UTI in Milad Hospital, Tehran

    Directory of Open Access Journals (Sweden)

    Maleki

    2016-09-01

    Full Text Available Background Urinary tract infection (UTI is one of the most common infectious diseases and nosocomial infections worldwide, and uropathogenic Escherichia coli is the primary cause of UTI. Due to increased antibiotic resistance and the emergence of multidrug resistant (MDR UPEC clones, the treatment of UTI is difficult. The occurrence of MDR in E. coli has been attributed to the AcrAB-TolC complex of efflux pumps. Objectives The aim of this study was to complete a frequency evaluation of acrA and acrB genes among UPEC MDR strains isolated from patients with UTI who were admitted to Milad hospital in Tehran. Methods For 123 UPEC strains that were isolated and diagnosed from the urine samples of patients using biochemical tests, antibiotic susceptibility was carried out using the disc diffusion method according to CLSI guidelines. Isolates that were resistant to at least one antimicrobial agent in three or more of the categories were considered to be MDR. The presence and frequency of acrA and acrB genes was determined using PCR. Results The rates of antibiotic resistance to ampicillin, cefalotin, tetracycline, cefazolin, ceftriaxone, ceftizoxime, ceftazidime, ciprofloxacin, and cotrimoxazole were 82.9%, 78.1%, 61.1%, 49.5%, 38.2%, 30.2%, 26.1%, 42.2%, and 60.1%, respectively. The isolates were most sensitive to nitrofurantoin (95.9%, gentamicin (77.2%, and amikacin (71.5%. A total of 78% of the isolates were MDR. The frequency of the acrA gene was 82.90%, the acrB gene was 95.90% and acrA + acrB was 95.90%. There was no significant difference between acrA and acrB frequency relating to bacterial antibiotic resistance. Conclusions Our results showed that ways to control the treatment of UTI for the prevention of MDR occurrence should be sought. For a better study of efflux pumps, a comprehensive and detailed study regarding the presence of efflux pumps gees is required.

  7. Prevalence, Virulence Genes and Antimicrobial Resistance Profiles of Salmonella Serovars from Retail Beef in Selangor, Malaysia.

    Science.gov (United States)

    Thung, Tze Y; Radu, Son; Mahyudin, Nor A; Rukayadi, Yaya; Zakaria, Zunita; Mazlan, Nurzafirah; Tan, Boon H; Lee, Epeng; Yeoh, Soo L; Chin, Yih Z; Tan, Chia W; Kuan, Chee H; Basri, Dayang F; Wan Mohamed Radzi, Che W J

    2017-01-01

    The aim of the present study was to investigate the prevalence of Salmonella spp., Salmonella Enteritidis and Salmonella Typhimurium in retail beef from different retail markets of Selangor area, as well as, to assess their pathogenic potential and antimicrobial resistance. A total of 240 retail beef meat samples (chuck = 60; rib = 60; round = 60; sirloin = 60) were randomly collected. The multiplex polymerase chain reaction (mPCR) in combination with the most probable number (MPN) method was employed to detect Salmonella spp., S . Enteritidis and S . Typhimurium in the meat samples. The prevalence of Salmonella spp., S . Enteritidis and S . Typhimurium in 240 beef meat samples were 7.50, 1.25, and 0.83%, respectively. The microbial loads of total Salmonella was found in the range of retail beef products tested were widely contaminated with multi-drug resistant (MDR) Salmonella and various virulence genes are present among the isolated Salmonella serovars.

  8. Resistance Genes in Global Crop Breeding Networks.

    Science.gov (United States)

    Garrett, K A; Andersen, K F; Asche, F; Bowden, R L; Forbes, G A; Kulakow, P A; Zhou, B

    2017-10-01

    Resistance genes are a major tool for managing crop diseases. The networks of crop breeders who exchange resistance genes and deploy them in varieties help to determine the global landscape of resistance and epidemics, an important system for maintaining food security. These networks function as a complex adaptive system, with associated strengths and vulnerabilities, and implications for policies to support resistance gene deployment strategies. Extensions of epidemic network analysis can be used to evaluate the multilayer agricultural networks that support and influence crop breeding networks. Here, we evaluate the general structure of crop breeding networks for cassava, potato, rice, and wheat. All four are clustered due to phytosanitary and intellectual property regulations, and linked through CGIAR hubs. Cassava networks primarily include public breeding groups, whereas others are more mixed. These systems must adapt to global change in climate and land use, the emergence of new diseases, and disruptive breeding technologies. Research priorities to support policy include how best to maintain both diversity and redundancy in the roles played by individual crop breeding groups (public versus private and global versus local), and how best to manage connectivity to optimize resistance gene deployment while avoiding risks to the useful life of resistance genes. [Formula: see text] Copyright © 2017 The Author(s). This is an open access article distributed under the CC BY 4.0 International license .

  9. Construction of retrovirus vector taking MDR1/ACBC1 and its ...

    African Journals Online (AJOL)

    We successfully observed the expression of the reporter gene-GFP by using the green light fluorescence microscope and the p-glycoprotein (P-gp) expressed by exogenous gene MDR1 by Western Blotting. All these facts indicated that the retroviral vector PMX-flag-MDR1-GFP had successfully been transfected into ...

  10. Characterization of a Novel 99mTc-Carbonyl Complex as a Functional Probe of MDR1 P-Glycoprotein Transport Activity

    Directory of Open Access Journals (Sweden)

    Mary Dyszlewski

    2002-01-01

    Full Text Available Multidrug resistance (MDR mediated by overexpression of MDR1 P-glycoprotein (Pgp is one of the best characterized barriers to chemotherapy in cancer patients. Furthermore, the protective function of Pgp-mediated efflux of xenobiotics in various organs has a profound effect on the bioavailability of drugs in general. Thus, there is an expanding requirement to noninvasively interrogate Pgp transport activity in vivo. We herein report the Pgp recognition properties of a novel 99mTc(I-tricarbonyl complex, [99mTc(CO3(MIBI3] + (Tc-CO-MIBI. Tc-CO-MIBI showed 60-fold higher accumulation in drug-sensitive KB 3–1 cells compared to colchicine-selected drug-resistant KB 8-5 cells. In KB 8-5 cells, tracer enhancement was observed with the potent MDR modulator LY335979 (EC50 = 62 nM. Similar behavior was observed using drug-sensitive MCF-7 breast adenocarcinoma cells and MCF-7/MDR1 stable transfectants, confirming that Tc-CO-MIBI is specifically excluded by overexpression of MDR1 Pgp. By comparison, net accumulation in control H69 lung tumor cells was 9-fold higher than in MDR-associated protein (MRP1-expressing H69AR cells, indicating only modest transport by MRP1. Biodistribution analysis following tail vein injection of Tc-CO-MIBI showed delayed liver clearance as well as enhanced brain uptake and retention in mdr1a/1b(−/− gene deleted mice versus wild-type mice, directly demonstrating that Tc-CO-MIBI is a functional probe of Pgp transport activity in vivo.

  11. Lack of Association of Multidrug Resistance Gene-1 Polymorphisms with Treatment Outcome in Chronic Myeloid Leukemia Patients Treated with Imatinib

    Directory of Open Access Journals (Sweden)

    Yaya Kassogue

    2015-10-01

    Full Text Available Background: Despite the impressive results obtained with imatinib, inadequate response or resistance are observed in certain patients. It is known that imatinib is a substrate of a multidrug resistance gene (MDR1. Thus, interindividual genetic differences linked to single nucleotide polymorphisms in MDR1 may influence the metabolism of imatinib. The present study has aimed to examine the impact of MDR1 polymorphisms on the hematologic and cytogenetic responses in 70 chronic myeloid leukemia patients who received imatinib. Methods: We used a polymerase chain reaction followed by restriction fragment length polymorphism to identify different profiles of 1236C>T, 2677G>T and 3435C>T in MDR1. Results: The distribution of the three SNPs in responders and poor responders did not show any particular trend (P>0.05. The T allele was slightly higher in responders, but not significantly regardless of the type of SNP (40.3% vs. 33.8% for 1236C>T; 25% vs. 14.7% for 2677G>T and 33.3% vs. 22% for 3435C>T. The dominant model showed a similar trend (P>0.05. Diplotypes composed by the T allele in different exons were frequent in responders. Haplotype analysis showed that 1236C-2677G-3435C was slightly higher in poor responders (60.02% compared to responders (50.42%. However, 1236T-2677T-3435T was frequent in responders (16.98% compared to poor responders (13.1%. Overall, none of the haplotypes were associated with IM response in our cohort (global haplotype association test, P=0.39. Conclusion: The identification of 1236C>T, 2677G>T and 3435C>T polymorphisms may not be advantageous to predict imatinib response for our chronic myeloid leukemia patients.

  12. Association of the multidrug resistance-1 gene single-nucleotide polymorphisms with the tacrolimus dose requirements in renal transplant recipients.

    Science.gov (United States)

    Anglicheau, Dany; Verstuyft, Céline; Laurent-Puig, Pierre; Becquemont, Laurent; Schlageter, Marie-Hélène; Cassinat, Bruno; Beaune, Philippe; Legendre, Christophe; Thervet, Eric

    2003-07-01

    The immunosuppressive drug tacrolimus, whose pharmacokinetic characteristics display large interindividual variations, is a substrate for P-glycoprotein (P-gp), the product of the multidrug resistance-1 (MDR1) gene. Some of the single nucleotide polymorphisms (SNP) of MDR1 reported correlated with the in vivo activity of P-gp. Because P-gp is known to control tacrolimus intestinal absorption, it was postulated that these polymorphisms are associated with tacrolimus pharmacokinetic variations in renal transplant recipients. The objective of this study was to evaluate in a retrospective study of 81 renal transplant recipients the effect on tacrolimus dosages and concentration/dose ratio of four frequent MDR1 SNP possibly associated with P-gp function (T-129C in exon 1b, 1236C>T in exon 12, 2677G>T,A in exon 21, and 3435C>T in exon 26). As in the general population, the SNP in exons 12, 21, and 26 were frequent (16, 17.3, and 22.2% for the variant homozygous genotype, respectively) and exhibited incomplete linkage disequilibrium. One month after tacrolimus introduction, exon 21 SNP correlated significantly with the daily tacrolimus dose (P < or = 0.05) and the concentration/dose ratio (P < or = 0.02). Tacrolimus dose requirements were 40% higher in homozygous than wild-type patients for this SNP. The concentration/dose ratio was 36% lower in the wild-type patients, suggesting that, for a given dose, their tacrolimus blood concentration is lower. Haplotype analysis substantiated these results and suggested that exons 26 and 21 SNP may be associated with tacrolimus dose requirements. Genotype monitoring of the MDR1 gene reliably predicts the optimal dose of tacrolimus in renal transplant recipients and may predict the initial daily dose needed by individual patients to obtain adequate immunosuppression.

  13. Expression Study of Banana Pathogenic Resistance Genes

    Directory of Open Access Journals (Sweden)

    Fenny M. Dwivany

    2016-10-01

    Full Text Available Banana is one of the world's most important trade commodities. However, infection of banana pathogenic fungi (Fusarium oxysporum race 4 is one of the major causes of decreasing production in Indonesia. Genetic engineering has become an alternative way to control this problem by isolating genes that involved in plant defense mechanism against pathogens. Two of the important genes are API5 and ChiI1, each gene encodes apoptosis inhibitory protein and chitinase enzymes. The purpose of this study was to study the expression of API5 and ChiI1 genes as candidate pathogenic resistance genes. The amplified fragments were then cloned, sequenced, and confirmed with in silico studies. Based on sequence analysis, it is showed that partial API5 gene has putative transactivation domain and ChiI1 has 9 chitinase family GH19 protein motifs. Data obtained from this study will contribute in banana genetic improvement.

  14. Chlortetracycline and florfenicol induce expression of genes associated with pathogenicity in multidrug-resistant Salmonella enterica serovar Typhimurium

    Science.gov (United States)

    Background Multidrug-resistant (MDR) Salmonella enterica serovar Typhimurium (S. Typhimurium) is a serious public health threat as infections caused by these strains are more difficult and expensive to treat. Livestock serve as a reservoir for MDR Salmonella, and the antibiotics chlortetracycline an...

  15. Artemether resistance in vitro is linked to mutations in PfATP6 that also interact with mutations in PfMDR1 in travellers returning with Plasmodium falciparum infections.

    KAUST Repository

    Pillai, Dylan R; Lau, Rachel; Khairnar, Krishna; Lepore, Rosalba; Via, Allegra; Staines, Henry M; Krishna, Sanjeev

    2012-01-01

    BACKGROUND: Monitoring resistance phenotypes for Plasmodium falciparum, using in vitro growth assays, and relating findings to parasite genotype has proved particularly challenging for the study of resistance to artemisinins. METHODS: Plasmodium falciparum isolates cultured from 28 returning travellers diagnosed with malaria were assessed for sensitivity to artemisinin, artemether, dihydroartemisinin and artesunate and findings related to mutations in pfatp6 and pfmdr1. RESULTS: Resistance to artemether in vitro was significantly associated with a pfatp6 haplotype encoding two amino acid substitutions (pfatp6 A623E and S769N; (mean IC50 (95% CI) values of 8.2 (5.7 - 10.7) for A623/S769 versus 623E/769 N 13.5 (9.8 - 17.3) nM with a mean increase of 65%; p = 0.012). Increased copy number of pfmdr1 was not itself associated with increased IC50 values for artemether, but when interactions between the pfatp6 haplotype and increased copy number of pfmdr1 were examined together, a highly significant association was noted with IC50 values for artemether (mean IC50 (95% CI) values of 8.7 (5.9 - 11.6) versus 16.3 (10.7 - 21.8) nM with a mean increase of 87%; p = 0.0068). Previously described SNPs in pfmdr1 are also associated with differences in sensitivity to some artemisinins. CONCLUSIONS: These findings were further explored in molecular modelling experiments that suggest mutations in pfatp6 are unlikely to affect differential binding of artemisinins at their proposed site, whereas there may be differences in such binding associated with mutations in pfmdr1. Implications for a hypothesis that artemisinin resistance may be exacerbated by interactions between PfATP6 and PfMDR1 and for epidemiological studies to monitor emerging resistance are discussed.

  16. Artemether resistance in vitro is linked to mutations in PfATP6 that also interact with mutations in PfMDR1 in travellers returning with Plasmodium falciparum infections.

    KAUST Repository

    Pillai, Dylan R

    2012-04-27

    BACKGROUND: Monitoring resistance phenotypes for Plasmodium falciparum, using in vitro growth assays, and relating findings to parasite genotype has proved particularly challenging for the study of resistance to artemisinins. METHODS: Plasmodium falciparum isolates cultured from 28 returning travellers diagnosed with malaria were assessed for sensitivity to artemisinin, artemether, dihydroartemisinin and artesunate and findings related to mutations in pfatp6 and pfmdr1. RESULTS: Resistance to artemether in vitro was significantly associated with a pfatp6 haplotype encoding two amino acid substitutions (pfatp6 A623E and S769N; (mean IC50 (95% CI) values of 8.2 (5.7 - 10.7) for A623/S769 versus 623E/769 N 13.5 (9.8 - 17.3) nM with a mean increase of 65%; p = 0.012). Increased copy number of pfmdr1 was not itself associated with increased IC50 values for artemether, but when interactions between the pfatp6 haplotype and increased copy number of pfmdr1 were examined together, a highly significant association was noted with IC50 values for artemether (mean IC50 (95% CI) values of 8.7 (5.9 - 11.6) versus 16.3 (10.7 - 21.8) nM with a mean increase of 87%; p = 0.0068). Previously described SNPs in pfmdr1 are also associated with differences in sensitivity to some artemisinins. CONCLUSIONS: These findings were further explored in molecular modelling experiments that suggest mutations in pfatp6 are unlikely to affect differential binding of artemisinins at their proposed site, whereas there may be differences in such binding associated with mutations in pfmdr1. Implications for a hypothesis that artemisinin resistance may be exacerbated by interactions between PfATP6 and PfMDR1 and for epidemiological studies to monitor emerging resistance are discussed.

  17. The expression and significance of multi-drug resistance genes in breast cancer stem cells%乳腺癌干细胞多药耐药基因的表达及意义

    Institute of Scientific and Technical Information of China (English)

    Zhi Li; Chunping Liu; Yanli He; Jinghui Zhang; Tao Huang

    2008-01-01

    Objective:To approach the expressions of MDR1 and BCRP in breast cancer stem cells and differentiated cells.Methods:The breast cancer stem calls were separated from human breast cancer primary tissues and MCF-7 by flow cytometry.Then we measured the expressions of MDR1 and BCRP with different subset cells by Realtime-PCR.Results:Contrasted with breast cancer differentiated cells,the expressions of MDR1 and BCRP in breast cancer stem calls were higher (P<0.01),and the proportion of stem cells rose after chemotherapy (P<0.01).Conclusion:Contrasted with breast cancer differentiated cells,breast cancer stem cells have stronger ability of clrug-resistanca with higher level of multi-drug resistance genes,and it is one of key points for chemotherapy failure of breast cancer.

  18. Reduced intracellular drug accumulation in drug-resistant leukemia cells is not solely due to MDR-mediated efflux but also to decreased uptake

    Directory of Open Access Journals (Sweden)

    Angela Oliveira Pisco

    2014-10-01

    Full Text Available Expression of ABC family transporter proteins that promote drug efflux from cancer cells is a widely observed mechanism of multi-drug resistance of cancer cells. Cell adaptation in long-term culture of HL60 leukemic cells in the presence of chemotherapy leads to induction and maintenance of the ABC transporters expression, preventing further accumulation of drugs. However, we found that decreased accumulation of drugs and fluorescent dyes was also contributed by a reduced uptake by the resistant cells. Confocal time-lapse microscopy and flow cytometry revealed that fluid-phase endocytosis was diminished in drug-resistant cells compared to drug-sensitive cells. Drug uptake was increased by insulin co-treatment when cells were grown in methylcellulose and monitored under the microscope, but not when cultured in suspension. We propose that multi-drug resistance is not solely achieved by enhanced efflux capacity but also by supressed intake of the drug offering an alternative target to overcome drug resistance or potentiate chemotherapy.

  19. Emergence of rifampicin, tigecycline, and colistin-resistant Acinetobacter baumannii in Iran; spreading of MDR strains of novel International Clone variants.

    Science.gov (United States)

    Bahador, Abbas; Taheri, Mohammad; Pourakbari, Babak; Hashemizadeh, Zahra; Rostami, Hossein; Mansoori, Noormohamad; Raoofian, Reza

    2013-10-01

    Multidrug-resistant Acinetobacter baumannii infections are serious challenges for clinicians because of A. baumannii propensity to acquire resistance to a wide spectrum of antimicrobial agents. In this study, 91 A. baumannii isolates from patients in tertiary intensive care units of three university hospitals in the north, central, and south of Iran were selected and tested for susceptibility to 22 antimicrobials; amplified restriction fragment polymorphism and multiplex polymerase chain reaction methods were used to determine genetic relationships and International Clone (IC) of A. baumannii isolates, respectively. Twenty-four genotypes were identified in A. baumannii isolates. About 91.2% of isolates categorized into 4 distinct clusters; one was more heterogeneous and observed across the three locations. A considerable number of the isolates (27.5%) belonged to the novel IC variant, sequence group 7 (SG7), which was geographically widespread in three locations. The drug resistance pattern showed that 14.2%, 20%, and 77% of the A. baumannii isolates were resistant to colistin, tigecycline, and rifampicin, respectively. Nine percent of isolates (8) showed simultaneous resistance to colistin, rifampicin, and tigecycline. Interestingly, all of them were susceptible to ampicillin-sulbactam and/or tobramycin. According to our results, SG7 could be considered as a pan-Iranian clone.

  20. Fungicide-driven evolution and molecular basis of multidrug resistance in field populations of the grey mould fungus Botrytis cinerea.

    Directory of Open Access Journals (Sweden)

    Matthias Kretschmer

    2009-12-01

    Full Text Available The grey mould fungus Botrytis cinerea causes losses of commercially important fruits, vegetables and ornamentals worldwide. Fungicide treatments are effective for disease control, but bear the risk of resistance development. The major resistance mechanism in fungi is target protein modification resulting in reduced drug binding. Multiple drug resistance (MDR caused by increased efflux activity is common in human pathogenic microbes, but rarely described for plant pathogens. Annual monitoring for fungicide resistance in field isolates from fungicide-treated vineyards in France and Germany revealed a rapidly increasing appearance of B. cinerea field populations with three distinct MDR phenotypes. All MDR strains showed increased fungicide efflux activity and overexpression of efflux transporter genes. Similar to clinical MDR isolates of Candida yeasts that are due to transcription factor mutations, all MDR1 strains were shown to harbor activating mutations in a transcription factor (Mrr1 that controls the gene encoding ABC transporter AtrB. MDR2 strains had undergone a unique rearrangement in the promoter region of the major facilitator superfamily transporter gene mfsM2, induced by insertion of a retrotransposon-derived sequence. MDR2 strains carrying the same rearranged mfsM2 allele have probably migrated from French to German wine-growing regions. The roles of atrB, mrr1 and mfsM2 were proven by the phenotypes of knock-out and overexpression mutants. As confirmed by sexual crosses, combinations of mrr1 and mfsM2 mutations lead to MDR3 strains with higher broad-spectrum resistance. An MDR3 strain was shown in field experiments to be selected against sensitive strains by fungicide treatments. Our data document for the first time the rising prevalence, spread and molecular basis of MDR populations in a major plant pathogen in agricultural environments. These populations will increase the risk of grey mould rot and hamper the effectiveness of

  1. Prevalence, Virulence Genes and Antimicrobial Resistance Profiles of Salmonella Serovars from Retail Beef in Selangor, Malaysia

    Directory of Open Access Journals (Sweden)

    Tze Y. Thung

    2018-01-01

    Full Text Available The aim of the present study was to investigate the prevalence of Salmonella spp., Salmonella Enteritidis and Salmonella Typhimurium in retail beef from different retail markets of Selangor area, as well as, to assess their pathogenic potential and antimicrobial resistance. A total of 240 retail beef meat samples (chuck = 60; rib = 60; round = 60; sirloin = 60 were randomly collected. The multiplex polymerase chain reaction (mPCR in combination with the most probable number (MPN method was employed to detect Salmonella spp., S. Enteritidis and S. Typhimurium in the meat samples. The prevalence of Salmonella spp., S. Enteritidis and S. Typhimurium in 240 beef meat samples were 7.50, 1.25, and 0.83%, respectively. The microbial loads of total Salmonella was found in the range of <3 to 15 MPN/g. Eight different serovars of Salmonella were identified among the 23 isolates, and S. Agona was the predominant serovar (26.09%. Interestingly, all the Salmonella isolates were resistant to penicillin, erythromycin and vancomycin, but the sensitivity was observed for tetracycline, gentamicin and amoxicillin/clavulanic acid. All 23 isolates were resistant to at least three antibiotics. Two S. Typhimurium isolates (8.70% exhibited the highest multiple antibiotic resistance (MAR index value of 0.56 which shown resistance to nine antibiotics. PCR analysis of virulence genes showed that all Salmonella isolates (100% were positive for the invA gene. Meanwhile, pefA was only identified in S. Enteritidis and S. Typhimurium. The findings in this study indicate that retail beef products tested were widely contaminated with multi-drug resistant (MDR Salmonella and various virulence genes are present among the isolated Salmonella serovars.

  2. The consequences of a sudden demographic change on the seroprevalence pattern, virulence genes, identification and characterisation of integron-mediated antibiotic resistance in the Salmonella enterica isolated from clinically diarrhoeic humans in Egypt.

    Science.gov (United States)

    Osman, K M; Hassan, W M M; Mohamed, R A H

    2014-08-01

    The present study was undertaken to identify and characterise integrons and integrated resistance gene cassettes among eight multidrug-resistant (MDR) Salmonella serovars isolated from humans in Egypt. Virulotyping by polymerase chain reaction (PCR) was used for the detection of the presence of virulence genes. Integron PCR was used to detect the presence of class 1 in the MDR strains. The associated individual resistance gene cassettes were identified using specific PCRs. The isolated serovars were Salmonella Grampian (C1; 2/5), Larose (C1; 1/5), Hato (B; 1/5) and Texas (B; 1/5). Among the Salmonella serovars, five Salmonella isolates showed the highest resistance to amoxicillin, ampicillin, chloramphenicol, lincomycin, gentamicin, nalidixic acid, streptomycin and trimethoprim (100%), followed by neomycin, norfloxacin and tetracycline (80%), while the lowest resistance was recorded to colistin sulphate and ciprofloxacin in percentages of 20 and 40%, respectively. The invA, avrA, ssaQ, mgtC, siiD and sopB genes were detected in all isolates (100%), while the spvC and gipA genes were totally (100%) absent from all isolates. The remaining three virulence genes were diversely distributed as follows: the bcfC gene was detected in all isolates except Salmonella Hato (80%); the sodC1 gene was detected only in Salmonella Grampian and Salmonella Texas (60%); and the sopE1 gene was detected only in Salmonella Grampian, Hato and Texas (60%). Class 1 integrons were detected in 90% of the MDR isolates, comprising serovars Muenster, Florian, Noya, Grampian, Larose, Hato and Texas. Of the class 1 integron-positive isolates, 45% harboured Salmonella genomic island 1 (SGI1) either right junction or right and left junction having an A-C-S-T phenotype. Of the class 1 integron-positive isolates, 44% harboured integron gene cassette aadA2, while 11% harboured the floR gene present in multidrug resistance flanked by two integrons of SGI1. The results of the present study indicate that

  3. Increased p38-MAPK is responsible for chemotherapy resistance in human gastric cancer cells

    International Nuclear Information System (INIS)

    Guo, Xianling; Zhang, Baihe; Wu, Mengchao; Wei, Lixin; Ma, Nannan; Wang, Jin; Song, Jianrui; Bu, Xinxin; Cheng, Yue; Sun, Kai; Xiong, Haiyan; Jiang, Guocheng

    2008-01-01

    Chemoresistance is one of the main obstacles to successful cancer therapy and is frequently associated with Multidrug resistance (MDR). Many different mechanisms have been suggested to explain the development of an MDR phenotype in cancer cells. One of the most studied mechanisms is the overexpression of P-glycoprotein (P-gp), which is a product of the MDR1 gene. Tumor cells often acquire the drug-resistance phenotype due to upregulation of the MDR1 gene. Overexpression of MDR1 gene has often been reported in primary gastric adenocarcinoma. This study investigated the role of p38-MAPK signal pathway in vincristine-resistant SGC7901/VCR cells. P-gp and MDR1 RNA were detected by Western blot analysis and RT-PCR amplification. Mitgen-activated protein kinases and function of P-gp were demonstrated by Western blot and FACS Aria cytometer analysis. Ap-1 activity and cell apoptosis were detected by Dual-Luciferase Reporter Assay and annexin V-PI dual staining. The vincristine-resistant SGC7901/VCR cells with increased expression of the multidrug-resistance 1 (MDR1) gene were resistant to P-gp-related drug and P-gp-unrelated drugs. Constitutive increases of phosphorylated p38-MAPK and AP-1 activities were also found in the drug-resistant cells. Inhibition of p38-MAPK by SB202190 reduced activator protein-1 (AP-1) activity and MDR1 expression levels and increased the sensitivity of SGC7901/VCR cells to chemotherapy. Activation of the p38-MAPK pathway might be responsible for the modulation of P-glycoprotein-mediated and P-glycoprotein-unmediated multidrug resistance in the SGC7901/VCR cell line

  4. Multidrug resistance and retroviral transduction potential in human small cell lung cancer cell lines

    DEFF Research Database (Denmark)

    Theilade, M D; Gram, G J; Jensen, P B

    1999-01-01

    Multidrug resistance (MDR) remains a major problem in the successful treatment of small cell lung cancer (SCLC). New treatment strategies are needed, such as gene therapy specifically targeting the MDR cells in the tumor. Retroviral LacZ gene-containing vectors that were either pseudotyped...... for the gibbon ape leukemia virus (GALV-1) receptor or had specificity for the amphotropic murine leukemia virus (MLV-A) receptor were used for transduction of five SCLC cell lines differing by a range of MDR mechanisms. Transduction efficiencies in these cell lines were compared by calculating the percentage...... of blue colonies after X-Gal staining of the cells grown in soft agar. All examined SCLC cell lines were transducible with either vector. Transduction efficiencies varied from 5.7% to 33.5% independent of the presence of MDR. These results indicate that MDR does not severely impair transduction of SCLC...

  5. In vitro detection of mdr1 mRNA in murine leukemia cells with 111In-labeled oligonucleotide

    International Nuclear Information System (INIS)

    Bai Jingming; Yokoyama, Kunihiko; Kinuya, Seigo; Michigishi, Takatoshi; Tonami, Norihisa; Shiba, Kazuhiro; Matsushita, Ryo; Nomura, Masaaki

    2004-01-01

    radioactivity and specific uptake of antisense 111 In-ODN in drug-resistant cells may facilitate future gene imaging of mdr1 mRNA. (orig.)

  6. Multimodal transfer of MDR by exosomes in human osteosarcoma.

    Science.gov (United States)

    Torreggiani, Elena; Roncuzzi, Laura; Perut, Francesca; Zini, Nicoletta; Baldini, Nicola

    2016-07-01

    Exosomes are extracellular vesicles released by both normal and tumour cells which are involved in a new intercellular communication pathway by delivering cargo (e.g., proteins, microRNAs, mRNAs) to recipient cells. Tumour-derived exosomes have been shown to play critical roles in different stages of tumour growth and progression. In this study, we investigated the potential role of exosomes to transfer the multidrug resistance (MDR) phenotype in human osteosarcoma cells. Exosomes were isolated by differential centrifugation of culture media from multidrug resistant human osteosarcoma MG-63DXR30 (Exo/DXR) and MG-63 parental cells (Exo/S). Exosome purity was examined by transmission electron microscopy and confirmed by immunoblot analysis for the expression of specific exosomal markers. Our data showed that exosomes derived from doxorubicin-resistant osteosarcoma cells could be taken up into secondary cells and induce a doxorubicin-resistant phenotype. The incubation of osteosarcoma cells with Exo/DXR decreased the sensitivity of parental cells to doxorubicin, while exposure with Exo/S was ineffective. In addition, we demonstrated that Exo/DXR expressed higher levels of MDR-1 mRNA and P-glycoprotein compared to Exo/S (p=0.03). Interestingly, both MDR-1 mRNA and P-gp increased in MG-63 cells after incubation with Exo/DXR, suggesting this as the main mechanism of exosome-mediated transfer of drug resistance. Our findings suggest that multidrug resistant osteosarcoma cells are able to spread their ability to resist the effects of doxorubicin treatment on sensitive cells by transferring exosomes carrying MDR-1 mRNA and its product P-glycoprotein.

  7. Quadruple-first line drug resistance in Mycobacterium tuberculosis in Vietnam: What can we learn from genes?

    Science.gov (United States)

    Nguyen, Huy Quang; Nguyen, Nhung Viet; Contamin, Lucie; Tran, Thanh Hoa Thi; Vu, Thuong Thi; Nguyen, Hung Van; Nguyen, Ngoc Lan Thi; Nguyen, Son Thai; Dang, Anh Duc; Bañuls, Anne-Laure; Nguyen, Van Anh Thi

    2017-06-01

    In Vietnam, a country with high tuberculosis (137/100.000 population) and multidrug-resistant (MDR)-TB burdens (7.8/100.000 population), little is known about the molecular signatures of drug resistance in general and more particularly of second line drug (SLD) resistance. This study is specifically focused on Mycobacterium tuberculosis isolates resistant to four first-line drugs (FLDs) that make TB much more difficult to treat. The aim is to determine the proportion of SLD resistance in these quadruple drug resistant isolates and the genetic determinants linked to drug resistance to better understand the genetic processes leading to quadruple and extremely drug resistance (XDR). 91 quadruple (rifampicin, isoniazid, ethambutol and streptomycin) FLD resistant and 55 susceptible isolates were included. Spoligotyping and 24-locus MIRU-VNTR techniques were performed and 9 genes and promoters linked to FLD and SLD resistance were sequenced. SLD susceptibility testing was carried out on a subsample of isolates. High proportion of quadruple-FLD resistant isolates was resistant to fluoroquinolones (27%) and second-line injectable drugs (30.2%) by drug susceptibility testing. The sequencing revealed high mutation diversity with prevailing mutations at positions katG315, inhA-15, rpoB531, embB306, rrs1401, rpsL43 and gyrA94. The sensitivity and specificity were high for most drug resistances (>86%), but the sensitivity was lower for injectable drug resistances (resistance. Nevertheless, particular mutation patterns linked to high-level resistance and low fitness costs seem to be favored. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Organization of a resistance gene cluster linked to rhizomania resistance in sugar beet

    Science.gov (United States)

    Genetic resistance to rhizomania has been in use for over 40 years. Characterization of the molecular basis for susceptibility and resistance has proved challenging. Nucleotide-binding leucine-rich-repeat-containing (NB-LRR) genes have been implicated in numerous gene-for-gene resistance interaction...

  9. Different phenotypic and molecular mechanisms associated with multidrug resistance in Gram-negative clinical isolates from Egypt

    Directory of Open Access Journals (Sweden)

    Helmy OM

    2017-12-01

    Full Text Available Omneya M Helmy, Mona T Kashef Department of Microbiology and Immunology, Faculty of Pharmacy, Cairo University, Cairo, Egypt Objectives: We set out to investigate the prevalence, different mechanisms, and clonal relatedness of multidrug resistance (MDR among third-generation cephalosporin-resistant Gram-negative clinical isolates from Egypt.Materials and methods: A total of 118 third-generation cephalosporin-resistant Gram-negative clinical isolates were included in this study. Their antimicrobial susceptibility pattern was determined using Kirby–Bauer disk diffusion method. Efflux pump-mediated resistance was tested by the efflux-pump inhibitor-based microplate assay using chlorpromazine. Detection of different aminoglycoside-, β-lactam-, and quinolone-resistance genes was done using polymerase chain reaction. The genetic diversity of MDR isolates was investigated using random amplification of polymorphic DNA.Results: Most of the tested isolates exhibited MDR phenotypes (84.75%. The occurrence of efflux pump-mediated resistance in the different MDR species tested was 40%–66%. Acinetobacter baumannii isolates showed resistance to most of the tested antibiotics, including imipenem. The blaOXA-23-like gene was detected in 69% of the MDR A. baumannii isolates. The MDR phenotype was detected in 65% of Pseudomonas aeruginosa isolates, of which only 23% exhibited efflux pump-mediated resistance. On the contrary, efflux-mediated resistance to piperacillin and gentamicin was recorded in 47.5% of piperacillin-resistant and 25% of gentamicin-resistant MDR Enterobacteriaceae. Moreover, the plasmid-mediated quinolone-resistance genes (aac(6’-Ib-cr, qnrB, and qnrS were detected in 57.6% and 83.33% of quinolone-resistant MDR Escherichia coli and Klebsiella pneumoniae isolates, respectively. The β-lactamase-resistance gene blaSHV-31 was detected for the first time in one MDR K. pneumoniae isolate from an endotracheal tube specimen in Egypt

  10. FAM-MDR: a flexible family-based multifactor dimensionality reduction technique to detect epistasis using related individuals.

    Directory of Open Access Journals (Sweden)

    Tom Cattaert

    Full Text Available We propose a novel multifactor dimensionality reduction method for epistasis detection in small or extended pedigrees, FAM-MDR. It combines features of the Genome-wide Rapid Association using Mixed Model And Regression approach (GRAMMAR with Model-Based MDR (MB-MDR. We focus on continuous traits, although the method is general and can be used for outcomes of any type, including binary and censored traits. When comparing FAM-MDR with Pedigree-based Generalized MDR (PGMDR, which is a generalization of Multifactor Dimensionality Reduction (MDR to continuous traits and related individuals, FAM-MDR was found to outperform PGMDR in terms of power, in most of the considered simulated scenarios. Additional simulations revealed that PGMDR does not appropriately deal with multiple testing and consequently gives rise to overly optimistic results. FAM-MDR adequately deals with multiple testing in epistasis screens and is in contrast rather conservative, by construction. Furthermore, simulations show that correcting for lower order (main effects is of utmost importance when claiming epistasis. As Type 2 Diabetes Mellitus (T2DM is a complex phenotype likely influenced by gene-gene interactions, we applied FAM-MDR to examine data on glucose area-under-the-curve (GAUC, an endophenotype of T2DM for which multiple independent genetic associations have been observed, in the Amish Family Diabetes Study (AFDS. This application reveals that FAM-MDR makes more efficient use of the available data than PGMDR and can deal with multi-generational pedigrees more easily. In conclusion, we have validated FAM-MDR and compared it to PGMDR, the current state-of-the-art MDR method for family data, using both simulations and a practical dataset. FAM-MDR is found to outperform PGMDR in that it handles the multiple testing issue more correctly, has increased power, and efficiently uses all available information.

  11. Integron types, gene cassettes and antimicrobial resistance profile of Acinetobacter baumannii isolated from BAL samples in Babol, north of Iran.

    Science.gov (United States)

    Akrami, Fariba; Shahandashti, Elaheh Ferdosi; Yahyapour, Yousef; Sadeghi, Mohsen; Khafri, Soraya; Pournajaf, Abazar; Rajabnia, Ramazan

    2017-08-01

    Multi-drug resistant isolates of Acinetobacter baumannii have created therapeutic problems worldwide. This current study was intended to determine the Integron types, gene cassettes and antimicrobial resistance profile of A. baumannii isolated from BAL samples in Babol, north of Iran. During a 15-month period, 35 A. baumannii isolates were studied. Different classes of antimicrobial agents were used to determine the resistance ratios. Multiplex-PCR was used to detect different types of integrons and associated gene cassettes. The resistance rates to GM, FEP, AK, TOB, CP, PIP, SAM, IPM, SXT, CTX, CAZ, CL, TIM, MEM, and TZP were 85.7%, 100%, 91.4%, 68.5%, 94.3%, 88.5%, 97.1%, 94.3%, 100%, 100%, 100%, 0.0%, 91.4%, 94.3% and 91.4%, respectively. The distribution analysis of int genes showed that 25.7%, 88.6% and 28.6% of isolates carried the intI, intII and intIII genes, respectively. The prevalence of aadB, dfrA1, bla-OXA 30 and aadA1 genes were 94.3%, 77.1%, 40% and 5.7%, respectively. The current study showed that a high level of A. baumannii isolates harbor integrons in our therapeutic center, which may lead to distribution of multiple antimicrobial resistance. The different types of gene cassette arrays in the present study highlight the important role of geographical features in MDR isolates dissemination which could be credited to different profiles of drug consumption in different areas. The findings emphasized that the need for continuous surveillance to prevent distribution of multidrug resistance among A. baumannii strains in Iran. Copyright © 2017. Published by Elsevier Ltd.

  12. The process behind the expression of mdr-1/P-gp and mrp/MRP in human leukemia/lymphoma.

    Science.gov (United States)

    Hirose, Masao

    2009-04-01

    There is a controversy over the link between phenotypes of multidrug resistance (MDR) and clinical outcome in leukemia/lymphoma patients. This may be because the process behind the induction and loss of expression of genotypes and phenotypes by which MDR develops and the role of MDR in fresh cells of human leukemia/lymphoma are not clearly defined. P-glycoprotein (P-gp) increased and decreased along with mdr-1 expression in three cell lines out of five vincristine (VCR)-resistant cell lines. MRP appeared with increased mrp expression in the other two cell lines. After the drug was removed from the culture system, mdr-1/P-gp changed in parallel with the level of VCR resistance, although mrp and MRP did not. It was concluded that P-gp is directly derived from mdr-1 and that mdr-1/P-gp supports the VCR-resistance but mrp/MRP is not directly linked to the VCR-resistance. These results should contribute to a better understanding of MDR phenomenon in cancer.

  13. Rapid diagnosis of pyrazinamide-resistant multidrug-resistant tuberculosis using a molecular-based diagnostic algorithm.

    Science.gov (United States)

    Simons, S O; van der Laan, T; Mulder, A; van Ingen, J; Rigouts, L; Dekhuijzen, P N R; Boeree, M J; van Soolingen, D

    2014-10-01

    There is an urgent need for rapid and accurate diagnosis of pyrazinamide-resistant multidrug-resistant tuberculosis (MDR-TB). No diagnostic algorithm has been validated in this population. We hypothesized that pncA sequencing added to rpoB mutation analysis can accurately identify patients with pyrazinamide-resistant MDR-TB. We identified from the Dutch national database (2007-11) patients with a positive Mycobacterium tuberculosis culture containing a mutation in the rpoB gene. In these cases, we prospectively sequenced the pncA gene. Results from the rpoB and pncA mutation analysis (pncA added to rpoB) were compared with phenotypic susceptibility testing results to rifampicin, isoniazid and pyrazinamide (reference standard) using the Mycobacterial Growth Indicator Tube 960 system. We included 83 clinical M. tuberculosis isolates containing rpoB mutations in the primary analysis. Rifampicin resistance was seen in 72 isolates (87%), isoniazid resistance in 73 isolates (88%) and MDR-TB in 65 isolates (78%). Phenotypic reference testing identified pyrazinamide-resistant MDR-TB in 31 isolates (48%). Sensitivity of pncA sequencing added to rpoB mutation analysis for detecting pyrazinamide-resistant MDR-TB was 96.8%, the specificity was 94.2%, the positive predictive value was 90.9%, the negative predictive value was 98.0%, the positive likelihood was 16.8 and the negative likelihood was 0.03. In conclusion, pyrazinamide-resistant MDR-TB can be accurately detected using pncA sequencing added to rpoB mutation analysis. We propose to include pncA sequencing in every isolate with an rpoB mutation, allowing for stratification of MDR-TB treatment according to pyrazinamide susceptibility. © 2014 The Authors Clinical Microbiology and Infection © 2014 European Society of Clinical Microbiology and Infectious Diseases.

  14. Transcriptional profiles of pulmonary innate immune responses to isogenic antibiotic-susceptible and multidrug-resistant Pseudomonas aeruginosa.

    Science.gov (United States)

    Tam, Vincent H; Pérez, Cynthia; Ledesma, Kimberly R; Lewis, Russell E

    2018-04-01

    The virulence of an isogenic pair of Pseudomonas aeruginosa strains was studied under similar experimental conditions in two animal infection models. The time to death was significantly longer for the multidrug resistant (MDR) than the wild-type strain. The transcriptional profiles of 84 innate immune response genes in the lungs of immune competent Balb/C mice were further compared. Significantly weaker expression of genes involved in production of soluble pattern recognition receptor and complement were observed in animals infected with the MDR strain. Altered patterns of innate immune system activation may explain the attenuated virulence in MDR bacteria. © 2018 The Societies and John Wiley & Sons Australia, Ltd.

  15. Effects of genetic polymorphisms of CYP2C19*2/*3 and MDR1 C3435T on the pharmacokinetics of lansoprazole in healthy Chinese subjects.

    Science.gov (United States)

    Zhang, Yu-Xin; Wei, Shi-Jie; Yang, Xiao-Ying; Zhang, Wen-Ping; Wang, Xin-Yu; Dang, Hong-Wan

    2014-10-01

    To evaluate the influence of CYP2C19*2/*3 and MDR1 C3435T polymorphisms on the pharmacokinetics of lansoprazole (LPZ) in healthy Chinese subjects. All 24 subjects were from a study of bioequivalence. Plasma concentrations of LPZ were determined by liquid chromatography/mass spectrometry. Cytochrome P450 (CYP) 2C19*2/*3 and multidrug resistance transporter gene 1 (MDR1) C3435T of the subjects were genotyped by polymerase chain reaction-restriction fragment length polymorphism. Significant differences were found in the area under the concentration-time curve from predose to T (AUC(0-T)), area under the concentration-time curve from predose to infinity (AUC(0-∞), t(1/2)), and apparent oral clearance (CL/F) of LPZ between CYP2C19 extensive metabolizers and intermediate metabolizers (p < 0.05). The AUC(0-T), AUC(0-∞), maximum plasma concentration, and CL/F of LPZ were significantly different between subjects with the MDR1 C3435T C/C, C/T, and T/T polymorphisms (p < 0.05). CYP2C19*2/*3 and MDR1 C3435T polymorphisms are important determinants of LPZ pharmacokinetics.

  16. Microarray-based analysis of IncA/C plasmid-associated genes from multidrug-resistant Salmonella enterica.

    Science.gov (United States)

    Lindsey, Rebecca L; Frye, Jonathan G; Fedorka-Cray, Paula J; Meinersmann, Richard J

    2011-10-01

    In the family Enterobacteriaceae, plasmids have been classified according to 27 incompatibility (Inc) or replicon types that are based on the inability of different plasmids with the same replication mechanism to coexist in the same cell. Certain replicon types such as IncA/C are associated with multidrug resistance (MDR). We developed a microarray that contains 286 unique 70-mer oligonucleotide probes based on sequences from five IncA/C plasmids: pYR1 (Yersinia ruckeri), pPIP1202 (Yersinia pestis), pP99-018 (Photobacterium damselae), pSN254 (Salmonella enterica serovar Newport), and pP91278 (Photobacterium damselae). DNA from 59 Salmonella enterica isolates was hybridized to the microarray and analyzed for the presence or absence of genes. These isolates represented 17 serovars from 14 different animal hosts and from different geographical regions in the United States. Qualitative cluster analysis was performed using CLUSTER 3.0 to group microarray hybridization results. We found that IncA/C plasmids occurred in two lineages distinguished by a major insertion-deletion (indel) region that contains genes encoding mostly hypothetical proteins. The most variable genes were represented by transposon-associated genes as well as four antimicrobial resistance genes (aphA, merP, merA, and aadA). Sixteen mercury resistance genes were identified and highly conserved, suggesting that mercury ion-related exposure is a stronger pressure than anticipated. We used these data to construct a core IncA/C genome and an accessory genome. The results of our studies suggest that the transfer of antimicrobial resistance determinants by transfer of IncA/C plasmids is somewhat less common than exchange within the plasmids orchestrated by transposable elements, such as transposons, integrating and conjugative elements (ICEs), and insertion sequence common regions (ISCRs), and thus pose less opportunity for exchange of antimicrobial resistance.

  17. The draft genome sequence of multidrug-resistant Pseudomonas aeruginosa strain CCBH4851, a nosocomial isolate belonging to clone SP (ST277 that is prevalent in Brazil

    Directory of Open Access Journals (Sweden)

    Melise Silveira

    2014-12-01

    Full Text Available The high occurrence of nosocomial multidrug-resistant (MDR microorganisms is considered a global health problem. Here, we report the draft genome sequence of a MDR Pseudomonas aeruginosa strain isolated in Brazil that belongs to the endemic clone ST277. The genome encodes important resistance determinant genes and consists of 6.7 Mb with a G+C content of 66.86% and 6,347 predicted coding regions including 60 RNAs.

  18. Importancia pronóstica de la expresión de MDR-1 en la leucemia mieloblástica aguda

    Directory of Open Access Journals (Sweden)

    J. Arbelbide

    2003-08-01

    Full Text Available Una proporción importante de pacientes con leucemia mieloblástica aguda (LMA presentan recaída o resistencia con el tratamiento. Uno de los mecanismos involucrados en la resistencia a drogas, es la presencia de la glicoproteína P 170 (gp-P 170 resultante de la expresión del gen MDR-1 sobre las células leucémicas. El objetivo de este trabajo es valorar el impacto pronóstico de la expresión de MDR-1 en una población de pacientes tratados por LMA. Se evaluó retrospectivamente la expresión de MDR-1 en una cohorte de 55 pacientes con LMA, mayores de 16 años, que recibieron tratamiento quimioterápico desde 1990 hasta el 2000. Se evaluó sobre biopsia de médula ósea, la expresión de MDR-1/gp-P 170 por inmunohistoquímica. Mediante una curva ROC, se estableció que una expresión de MDR-1 > 50% en células blásticas, resultó significativa para el logro de remisión completa. Esta expresión de MDR-1+ correlacionó con la presencia de leucocitosis: (p:0.002, expresion de células CD34+ (p:0.006, menor tasa de remisión completa (p:0.001, mayor tasa de recaída (p:0.02 y de estudios citogenéticos no favorables (p:0.02. La SLE fue de 21.2% ES:9.3 con un seguimiento de 22 meses para el grupo MDR-1+ versus 56.4% ES:12.5 con un seguimiento de 78 meses en los casos MDR-1- (p:0.007. Se puede concluir que la expresion de MDR-1 ha demostrado ser un factor pronóstico de resistencia a la quimioterapia. Estos pacientes presentan una menor tasa de remisión completa, una mayor tasa de recaída por persistencia de enfermedad residual post-tratamiento, lo que produce una menor sobrevida global.An important number of patients with Acute Myeloid Leukemia (AML experience relapse or resistance to chemotherapy. One of the mechanisms involved in this resistance is the presence of glycoprotein P170 (gp-P 170, which results of the MDR-1 gene in leukemic cells. The objective of this article is to assess the prognostic impact of the expression of MDR-1 in a

  19. Imaging and Targeted Therapy of Multidrug Resistance. Final Report

    International Nuclear Information System (INIS)

    Piwnica-Worms, David

    2009-01-01

    One focus area of DOE Office of Science was the Imaging of Gene Expression in Health and Disease in real time in tissue culture, whole animals and ultimately patients. Investigators of the Molecular Imaging Group, Washington University Medical School, ascribed to this objective and a major focus of this group directly tied into the DOE program through their efforts targeting the multidrug resistance gene (MDR1). Our plans for continuation of the program were to extend and build on this line of investigation, incorporating new molecular tools into our methodology to selectively inhibit MDR1 gene expression with novel modulation strategies. Two approaches were to be pursued: (1) high throughput screening of compounds that disrupted mutant p53 transactivation of the MDR1 promoter, and (2) knockdown of MDR1 messenger RNA with retroviral-mediated delivery of small interfering RNA constructs. These would be combined with our continuing effort to synthesize ligands and examine structure-activity relationships of bis-salicylaldehydes labeled with gallium-68 to generate PET agents for imaging MDR1 P-glycoprotein function. We would be uniquely positioned to correlate therapeutic modulation of MDR1 gene expression and protein function in the same systems in vivo using PET and bioluminescence reporters. Use of animal models such as the mdr1a/1b(-/-) gene deleted mice would also have enabled refined analysis of modulation and tracer pharmacokinetics in vivo. Overall, this DOE program and resultant tools would enable direct monitoring of novel therapeutic strategies and the MDR phenotype in relation to gene expression and protein function in vivo.

  20. Social, economic, and psychological impacts of MDR-TB treatment in Tijuana, Mexico: a patient's perspective.

    Science.gov (United States)

    Morris, M D; Quezada, L; Bhat, P; Moser, K; Smith, J; Perez, H; Laniado-Laborin, R; Estrada-Guzman, J; Rodwell, T C

    2013-07-01

    The State of Baja California, Mexico, had the highest prevalence of multidrug-resistant tuberculosis (MDR-TB) in Mexico in 2009. To understand the socio-economic burden of MDR-TB disease and its treatment on patients in Tijuana and Mexicali, Mexico. From July to November 2009, qualitative interviews were conducted with 12 patients enrolled in a US-Mexico binational MDR-TB treatment program, Puentes de Esperanza (Bridges of Hope), which was designed to support MDR-TB patients. In-depth interviews were coded to identify major themes in patient experiences of MDR-TB diagnosis and care. While some patients were able to maintain their pre-MDR-TB lives to a limited extent, most patients reported losing their sense of identity due to their inability to work, social isolation, and stigmatization from family and friends. The majority of participants expressed appreciation for Puentes' role in 'saving their lives'. Being diagnosed with MDR-TB and undergoing treatment imposes significant psychological, social and economic stress on patients. Strong social support elements within Puentes helped alleviate these burdens. Improvements to the program might include peer-support groups for patients undergoing treatment and transitioning back into the community after treatment.

  1. Dioscin enhances methotrexate absorption by down-regulating MDR1 in vitro and in vivo

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Lijuan, E-mail: jlwang1979@163.com [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Wang, Changyuan, E-mail: wangcyuan@163.com [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University, Dalian, Liaoning (China); Peng, Jinyong, E-mail: jinyongpeng2005@163.com [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University, Dalian, Liaoning (China); Liu, Qi, E-mail: llaqii@yahoo.com.cn [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University, Dalian, Liaoning (China); Meng, Qiang, E-mail: mengq531@yahoo.cn [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University, Dalian, Liaoning (China); Sun, Huijun, E-mail: sunhuijun@hotmail.com [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University, Dalian, Liaoning (China); Huo, Xiaokui, E-mail: huoxiaokui@163.com [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University, Dalian, Liaoning (China); and others

    2014-06-01

    The purpose of this study was to investigate the enhancing effect of dioscin on the absorption of methotrexate (MTX) and clarify the molecular mechanism involved in vivo and in vitro. Dioscin increased MTX chemosensitivity and transepithelial flux in the absorptive direction, significantly inhibiting multidrug resistance 1 (MDR1) mRNA and protein expression and MDR1 promoter and nuclear factor κ-B (NF-κB) activities in Caco-2 cells. Moreover, inhibitor κB-α (IκB-α) degradation was inhibited by dioscin. Dioscin enhanced the intracellular concentration of MTX by down-regulating MDR1 expression through a mechanism that involves NF-κB signaling pathway inhibition in Caco-2 cells. Dioscin strengthened MTX absorption by inhibiting MDR1 expression in rat intestine. In addition, even though MTX is absorbed into the enterocytes, there was no increase in toxicity observed, and that, in fact, decreased toxicity was seen. - Highlights: • Dioscin raised MTX concentration by inhibiting MDR1 in Caco-2 cells. • Dioscin suppresses MDR1 by inhibiting NF-κB signaling pathway in Caco-2 cells. • Dioscin can enhance MTX absorption via inhibiting MDR1 in vivo and in vitro. • Dioscin did not increase MTX-induced gastrointestinal mucosal toxicity.

  2. Molecular detection of disease resistance genes to powdery mildew ...

    African Journals Online (AJOL)

    A study was conducted to detect the presence of disease resistance genes to infection of wheat powdery mildew (Blumeria graminis f. sp. tritici) in selected wheat cultivars from China using molecular markers. Genomic DNA of sixty cultivars was extracted and tested for the presence of selected prominent resistance genes to ...

  3. Genome scanning for identification of resistance gene analogs (RGAs)

    African Journals Online (AJOL)

    Disease resistance in plants is a desirable economic trait. Many disease resistance genes from various plants have been cloned so far. The gene products of some of these can be distinguished by the presence of an N terminal nucleotide binding site and a C-terminal stretch of leucine-rich repeats. Oligonucleotides already ...

  4. Occurrence of integrons and resistance genes among sulphonamide-resistant Shigella spp. from Brazil

    DEFF Research Database (Denmark)

    Peirano, G.; Agersø, Yvonne; Aarestrup, Frank Møller

    2005-01-01

    Objectives: To determine the occurrence of class 1 and 2 integrons and antimicrobial resistance genes among sulphonamide-resistant Shigella strains isolated in Brazil during 1999-2003. Methods: Sixty-two Shigella (Shigella flexneri, n = 47 and Shigella sonnei, n = 15) were tested against 21...... antimicrobial agents. The presence of integrons classes 1 and 2 and antimicrobial resistance genes was investigated by PCR using specific primers. Results: A total of eight antimicrobial resistance profiles were identified, with the profile of resistance to sulfamethoxazole, trimethoprim, spectinomycin...... of 2214 bp harbouring a gene cassette array conferring resistance to trimethoprim, streptothricin and spectinomycin/streptomycin. The genes coding for resistance to chloramphenicol (catA1), tetracycline [tet(A) and tet(B)] and ampicillin (bla(OXA) and bla(TEM)), were detected in resistant strains...

  5. Exploration of Fungal Association From Hard Coral Against Pathogen MDR Staphylococcus haemolyticus

    Science.gov (United States)

    Cristianawati, O.; Radjasa, O. K.; Sabdono, A.; Trianto, A.; Sabdaningsih, A.; Sibero, M. T.; Nuryadi, H.

    2017-02-01

    Staphylococcus haemolyticus are opportunistic bacteria and as the second leading cause of nosocomial infections. It is a disease causing septicemia, peritonitis, otitis, and urinary tract infections and infections of the eye. It also a phenotype resistant to multiple antibiotics commercial. There is now an urgency to find an alternative antibiotics to combat this bacteria. It has been widely reported that many bioactive marine natural products from marine invertebrate have striking similarities to metabolites of their associated microorganisms including fungi. Hard coral associated microorganisms are among of the most interesting and promising marine natural product sources, which produce with various biological activities. The proposed work focused on the discovery of bioactive compounds and also estimated the phylogenetic diversity from fungal association of hard coral against pathogen MDR Staphylococcus haemolyticus. A total of 32 fungal association, FHP 7 which were isolated from Favia sp. capable of inhibiting the growth MDR. Molecular identification based on 18S rRNA gene sequences revealed that the active fungal association belonged 100% to the members from one of the genera Trichoderma longibrachiatum. Accession Number LC185084.1.

  6. Bakteri Simbion Gastropoda Pleuroploca trapesium Dari Perairan Ternate, Sebagai Alternatif Antibakteri MDR (Bacterial Symbiont Gastropoda Pleuroploca trapezium from Ternate, as Alternative Antibacterial MDR

    Directory of Open Access Journals (Sweden)

    Delianis Pringgenies

    2014-03-01

    The bacteria resistant to some antibiotics are known as multi drug resistant (MDR. To overcome the problem, it is needed to search for a new antibiotic compounds more effectively and efficiently. This study aims to identify potential from symbionts of Pleuroploca trapezium as a source of antibacteria MDR and identifying the bacteria that were active against the MDR. Samples were collected from Ternate, Maluku. Isolation of symbiotic bacteria, screening for bacteria which producing secondary metabolites as anti-MDR bacteria, antibacterial test, isolation of clinical pathogenic bacteria of MDR. Conducting anti-bacterial sensitivity test,  sensitivity test for antibacterial,  DNA exctraction, DNA amplification based on PCR method, DNA sequencing.  Result of 16S r-DNA sequence was then analyzed and edited using GENETYX program and followed by 16S rDNA sequence analysis. Screening of bacteria associated with P. trapezium resulted in 19 isolates with 5 active bacteria. Based on the size of the zone forming and the consistency of zone, so the best isolate is TPT 4.7. The identification shows that TPT 4.7 has a close relationship with the Paracoccus sp. MBIC4019 with homologi of 95%, which shows the relationship at the genus level. Its suggest that these results are very promising as a new antibacterial material. Keywords: antibacterial, symbiotic bacteria, Pleuroploca trapezium, multi drugs resistant

  7. Molecular epidemiology of multidrug-resistant Acinetobacter baumannii isolates in a university hospital in Nepal reveals the emergence of a novel epidemic clonal lineage.

    Science.gov (United States)

    Shrestha, Shovita; Tada, Tatsuya; Miyoshi-Akiyama, Tohru; Ohara, Hiroshi; Shimada, Kayo; Satou, Kazuhito; Teruya, Kuniko; Nakano, Kazuma; Shiroma, Akino; Sherchand, Jeevan Bdr; Rijal, Basista Psd; Hirano, Takashi; Kirikae, Teruo; Pokhrel, Bharat Mani

    2015-11-01

    The emergence of multidrug-resistant (MDR) Acinetobacter baumannii has become a serious medical problem worldwide. To clarify the genetic and epidemiological properties of MDR A. baumannii strains isolated from a medical setting in Nepal, 246 Acinetobacter spp. isolates obtained from different patients were screened for MDR A. baumannii by antimicrobial disk susceptibility testing. Whole genomes of the MDR A. baumannii isolates were sequenced by MiSeq™ (Illumina), and the complete genome of one isolate (IOMTU433) was sequenced by PacBio RS II. Phylogenetic trees were constructed from single nucleotide polymorphism concatemers. Multilocus sequence types were deduced and drug resistance genes were identified. Of the 246 Acinetobacter spp. isolates, 122 (49.6%) were MDR A. baumannii, with the majority being resistant to aminoglycosides, carbapenems and fluoroquinolones but not to colistin and tigecycline. These isolates harboured the 16S rRNA methylase gene armA as well as bla(NDM-1), bla(OXA-23) or bla(OXA-58). MDR A. baumannii isolates belonging to clonal complex 1 (CC1) and CC2 as well as a novel clonal complex (CC149) have spread throughout a medical setting in Nepal. The MDR isolates harboured genes encoding carbapenemases (OXA and NDM-1) and a 16S rRNA methylase (ArmA). Copyright © 2015 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

  8. Expression of Drug-Resistant Factor Genes in Hepatocellular Carcinoma Patients Undergoing Chemotherapy with Platinum Complex by Arterial Infusion

    Directory of Open Access Journals (Sweden)

    Shiro Ueda

    2010-09-01

    Full Text Available This study investigated gene expression of drug resistance factors in biopsy tissue samples from hepatocellular carcinoma (HCC patients undergoing chemotherapy by platinum complex. Liver biopsy was performed to collect tissue from the tumor site (T and the non-tumor site (NT prior to the start of treatment. For drug-resistant factors, drug excretion transporters cMOAT and MDR-1, intracellular metal binding protein MT2, DNA repair enzyme ERCC-l and inter-nucleic cell transport protein MVP, were investigated. The comparison of the expression between T and NT indicated a significant decrease of MT2 and MDR-1 in T while a significant increase in ERCC-1 was noted in T. Further, expression was compared between the response cases and non-response cases using the ratios of expression in T to those in NT. The response rate was significantly low in the high expression group when the cutoff value of cMOAT and MT2 was set at 1.5 and 1.0, respectively. Furthermore, when the patients were classified into A group (cMOAT ≧ 1.5 or MT2 ≧ 1.0 and B group (cMOAT < 1.5 and MT2 < 1.0, the response rate of A group was significantly lower than B group when we combined the cutoff values of cMOAT and MT2. It is considered possible to estimate the therapeutic effect of platinum complex at a high probability by combining the expression condition of these two genes.

  9. Transmission of MDR MRSA between primates, their environment and personnel at a United States primate centre.

    Science.gov (United States)

    Soge, Olusegun O; No, David; Michael, Karen E; Dankoff, Jennifer; Lane, Jennifer; Vogel, Keith; Smedley, Jeremy; Roberts, Marilyn C

    2016-10-01

    MDR MRSA isolates cultured from primates, their facility and primate personnel from the Washington National Primate Research Center were characterized to determine whether they were epidemiologically related to each other and if they represented common local human-associated MRSA strains. Human and primate nasal and composite environmental samples were collected, enriched and selected on medium supplemented with oxacillin and polymyxin B. Isolates were biochemically verified as Staphylococcus aureus and screened for the mecA gene. Selected isolates were characterized using SCCmec typing, MLST and WGS. Nasal cultures were performed on 596 primates and 105 (17.6%) were MRSA positive. Two of 79 (2.5%) personnel and two of 56 (3.6%) composite primate environmental facility samples were MRSA positive. Three MRSA isolates from primates, one MRSA from personnel, two environmental MRSA and one primate MSSA were ST188 and were the same strain type by conventional typing methods. ST188 isolates were related to a 2007 ST188 human isolate from Hong Kong. Both MRSA isolates from out-of-state primates had a novel MLST type, ST3268, and an unrelated group. All isolates carried ≥1 other antibiotic resistance gene(s), including tet(38), the only tet gene identified. ST188 is very rare in North America and has almost exclusively been identified in people from Pan-Asia, while ST3268 is a newly reported MRSA type. The data suggest that the primate MDR MRSA was unlikely to come from primate centre employees. Captive primates are likely to be an unappreciated source of MRSA. © The Author 2016. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  10. Sponge microbiota are a reservoir of functional antibiotic resistance genes

    Directory of Open Access Journals (Sweden)

    Dennis Versluis

    2016-11-01

    Full Text Available Wide application of antibiotics has contributed to the evolution of multi-drug resistant human pathogens, resulting in poorer treatment outcomes for infections. In the marine environment, seawater samples have been investigated as a resistance reservoir; however, no studies have methodically examined sponges as a reservoir of antibiotic resistance. Sponges could be important in this respect because they often contain diverse microbial communities that have the capacity to produce bioactive metabolites. Here, we applied functional metagenomics to study the presence and diversity of functional resistance genes in the sponges Aplysina aerophoba, Petrosia ficiformis and Corticium candelabrum. We obtained 37 insert sequences facilitating resistance to D-cycloserine (n=6, gentamicin (n=1, amikacin (n=7, trimethoprim (n=17, chloramphenicol (n=1, rifampicin (n=2 and ampicillin (n=3. Fifteen of 37 inserts harboured resistance genes that shared <90% amino acid identity with known gene products, whereas on 13 inserts no resistance gene could be identified with high confidence, in which case we predicted resistance to be mainly mediated by antibiotic efflux. One marine-specific ampicillin-resistance-conferring β-lactamase was identified in the genus Pseudovibrio with 41% global amino acid identity to the closest β-lactamase with demonstrated functionality, and subsequently classified into a new family termed PSV. Taken together, our results show that sponge microbiota host diverse and novel resistance genes that may be harnessed by phylogenetically distinct bacteria.

  11. The cfr and cfr-like multiple resistance genes

    DEFF Research Database (Denmark)

    Vester, Birte

    2018-01-01

    . The cfr gene is found in various bacteria in many geographical locations and placed on plasmids or associated with transposons. Cfr-related genes providing similar resistance have been identified in Bacillales, and now also in the pathogens Clostridium difficile and Enterococcus faecium. In addition......, the presence of the cfr gene has been detected in harbours and food markets....

  12. Associations between Antimicrobial Resistance Phenotypes, Antimicrobial Resistance Genes, and Virulence Genes of Fecal Escherichia coli Isolates from Healthy Grow-Finish Pigs ▿

    OpenAIRE

    Rosengren, Leigh B.; Waldner, Cheryl L.; Reid-Smith, Richard J.

    2009-01-01

    Escherichia coli often carries linked antimicrobial resistance genes on transmissible genetic elements. Through coselection, antimicrobial use may select for unrelated but linked resistance or virulence genes. This study used unconditional statistical associations to investigate the relationships between antimicrobial resistance phenotypes and antimicrobial resistance genes in 151 E. coli isolates from healthy pigs. Phenotypic resistance to each drug was significantly associated with phenotyp...

  13. Determination of rust resistance genes in pakistani bread wheats

    International Nuclear Information System (INIS)

    Qamar, M.; Ahmad, S.D.; Rabbani, M.A.; Shinwari, Z.K.

    2014-01-01

    Stripe and leaf rusts are the major constraints to bread wheat production in Pakistan. Molecular markers were used to investigate the presence of leaf rust and stripe rust resistance gene cluster Lr34/Yr18 and stem rust resistance gene Sr2 in 52 Pakistani bread wheat cultivars/lines. PCR amplification of DNA fragments using DNA marker csLV-34 showed that 13 of the studied cultivars/lines, namely 03FJ26, NR 337, NR 339, NR 347, NR 350, Manthar, Margalla 99, Iqbal 2000, Saleem 2000, Wafaq 2001, Marwat 2001, Pirsabak 2004 and Fareed 2006 carry leaf rust and stripe rust resistance genes Lr34/Yr18. Stem rust resistance gene Sr2 was observed in 36 Pakistani spring wheat cultivars/lines using stm560.3tgag marker. The slow rusting gene Sr2 needs to be combined with additional stem rust resistance genes to establish durable resistance against Ug99 in modern wheat cultivars. Low frequency of Lr34/Yr18 was found in Pakistani wheats. This gene cluster needs to be incorporated into Pakistani wheats for durable rust resistance. (author)

  14. Isolation of NBS-LRR class resistant gene (I2 gene) from tomato ...

    African Journals Online (AJOL)

    aghomotsegin

    2013-10-16

    Oct 16, 2013 ... type of F. oxysporum f. sp. lycopersici observed commonly which require presence of I1 gene in tomato plant for the incompatibility ... Key words: Fusarium wilt, race, R-gene, resistance, tomato. ... MATERIALS AND METHODS.

  15. Fate of antibiotic resistant bacteria and genes during wastewater chlorination: implication for antibiotic resistance control.

    Directory of Open Access Journals (Sweden)

    Qing-Bin Yuan

    Full Text Available This study investigated fates of nine antibiotic-resistant bacteria as well as two series of antibiotic resistance genes in wastewater treated by various doses of chlorine (0, 15, 30, 60, 150 and 300 mg Cl2 min/L. The results indicated that chlorination was effective in inactivating antibiotic-resistant bacteria. Most bacteria were inactivated completely at the lowest dose (15 mg Cl2 min/L. By comparison, sulfadiazine- and erythromycin-resistant bacteria exhibited tolerance to low chlorine dose (up to 60 mg Cl2 min/L. However, quantitative real-time PCRs revealed that chlorination decreased limited erythromycin or tetracycline resistance genes, with the removal levels of overall erythromycin and tetracycline resistance genes at 0.42 ± 0.12 log and 0.10 ± 0.02 log, respectively. About 40% of erythromycin-resistance genes and 80% of tetracycline resistance genes could not be removed by chlorination. Chlorination was considered not effective in controlling antimicrobial resistance. More concern needs to be paid to the potential risk of antibiotic resistance genes in the wastewater after chlorination.

  16. Genotypic analysis of multidrug-resistant tuberculosis isolates from extra pulmonary tuberculosis cases in tertiary care centers in Northern India

    Directory of Open Access Journals (Sweden)

    Anand K Maurya

    2016-01-01

    Conclusion: The prevalence (13.4% of MDR-TB among EPTB was high, and the most prominent mutations in rpoB, katG, and inhA genes were S531L (67.3%, S315T1 (94.5%, and C15T (20%, respectively. Beijing stains are significantly associated with MDR-TB among EPTB in this region. We found that the transmission of prominent mutations contributes to an unexpected increase in primary resistance, including MDR-TB cases in Northern India.

  17. AMINOGLYCOSIDE RESISTANCE GENES IN Pseudomonas aeruginosa ISOLATES FROM CUMANA, VENEZUELA.

    Science.gov (United States)

    Teixeira, Bertinellys; Rodulfo, Hectorina; Carreño, Numirin; Guzmán, Militza; Salazar, Elsa; De Donato, Marcos

    2016-01-01

    The enzymatic modification of aminoglycosides by aminoglycoside-acetyltransferases (AAC), aminoglycoside-adenyltransferases (AAD), and aminoglycoside-phosphotransferases (APH), is the most common resistance mechanism in P. aeruginosa and these enzymes can be coded on mobile genetic elements that contribute to their dispersion. One hundred and thirty seven P. aeruginosa isolates from the University Hospital, Cumana, Venezuela (HUAPA) were evaluated. Antimicrobial susceptibility was determined by the disk diffusion method and theaac, aadB and aph genes were detected by PCR. Most of the P. aeruginosa isolates (33/137) were identified from the Intensive Care Unit (ICU), mainly from discharges (96/137). The frequency of resistant P. aeruginosaisolates was found to be higher for the aminoglycosides tobramycin and amikacin (30.7 and 29.9%, respectively). Phenotype VI, resistant to these antibiotics, was the most frequent (14/49), followed by phenotype I, resistant to all the aminoglycosides tested (12/49). The aac(6´)-Ib,aphA1 and aadB genes were the most frequently detected, and the simultaneous presence of several resistance genes in the same isolate was demonstrated. Aminoglycoside resistance in isolates ofP. aeruginosa at the HUAPA is partly due to the presence of the aac(6´)-Ib, aphA1 andaadB genes, but the high rates of antimicrobial resistance suggest the existence of several mechanisms acting together. This is the first report of aminoglycoside resistance genes in Venezuela and one of the few in Latin America.

  18. The emergence of a novel sequence type of MDR Acinetobacter baumannii from the intensive care unit of an Egyptian tertiary care hospital.

    Science.gov (United States)

    Ghaith, Doaa Mohammad; Zafer, Mai Mahmoud; Al-Agamy, Mohamed Hamed; Alyamani, Essam J; Booq, Rayan Y; Almoazzamy, Omar

    2017-05-10

    Acinetobacter baumannii is known for nosocomial outbreaks worldwide. In this study, we aimed to investigate the antibiotic susceptibility patterns and the clonal relationship of A. baumannii isolates from the intensive care unit (ICU) of an Egyptian hospital. In the present study, 50 clinical isolates of multidrug resistant (MDR)-A. baumannii were obtained from patients admitted into the ICU from June to December 2015. All isolates were analyzed for antimicrobial susceptibilities. Multiplex PCR was performed to detect genes encoding oxacillinase genes (bla OXA-51 -like, bla OXA-23 -like, bla OXA-24 -like, and bla OXA-58 -like). Multilocus sequence typing (MLST) based on the seven-gene scheme (gltA, gyrB, gdhB, recA, cpn60, gpi, rpoD) was used to examine these isolates. All A. baumannii clinical isolates showed the same resistance pattern, characterized by resistance to most common antibiotics including imipenem (MIC ≥ 8μ/mL), with the only exception being colistin. Most isolates were positive for bla OXA-51 -like and bla OXA-23 -like (100 and 96%, respectively); however, bla OXA-24 -like and bla OXA-58 -like were not detected. MLST analysis identified different sequence types (ST195, ST208, ST231, ST441, ST499, and ST723) and a new sequence type (ST13929) with other sporadic strains. MDR A. baumannii strains harboring bla OXA-23 -like genes were widely circulating in this ICU. MLST was a powerful tool for identifying and epidemiologically typing our strains. Strict infection control measures must be implemented to contain the worldwide spread of MDR A. baumannii in ICUs.

  19. Are duplicated genes responsible for anthracnose resistance in common bean?

    Science.gov (United States)

    Costa, Larissa Carvalho; Nalin, Rafael Storto; Ramalho, Magno Antonio Patto; de Souza, Elaine Aparecida

    2017-01-01

    The race 65 of Colletotrichum lindemuthianum, etiologic agent of anthracnose in common bean, is distributed worldwide, having great importance in breeding programs for anthracnose resistance. Several resistance alleles have been identified promoting resistance to this race. However, the variability that has been detected within race has made it difficult to obtain cultivars with durable resistance, because cultivars may have different reactions to each strain of race 65. Thus, this work aimed at studying the resistance inheritance of common bean lines to different strains of C. lindemuthianum, race 65. We used six C. lindemuthianum strains previously characterized as belonging to the race 65 through the international set of differential cultivars of anthracnose and nine commercial cultivars, adapted to the Brazilian growing conditions and with potential ability to discriminate the variability within this race. To obtain information on the resistance inheritance related to nine commercial cultivars to six strains of race 65, these cultivars were crossed two by two in all possible combinations, resulting in 36 hybrids. Segregation in the F2 generations revealed that the resistance to each strain is conditioned by two independent genes with the same function, suggesting that they are duplicated genes, where the dominant allele promotes resistance. These results indicate that the specificity between host resistance genes and pathogen avirulence genes is not limited to races, it also occurs within strains of the same race. Further research may be carried out in order to establish if the alleles identified in these cultivars are different from those described in the literature.

  20. Overexpression of antibiotic resistance genes in hospital effluents over time.

    Science.gov (United States)

    Rowe, Will P M; Baker-Austin, Craig; Verner-Jeffreys, David W; Ryan, Jim J; Micallef, Christianne; Maskell, Duncan J; Pearce, Gareth P

    2017-06-01

    Effluents contain a diverse abundance of antibiotic resistance genes that augment the resistome of receiving aquatic environments. However, uncertainty remains regarding their temporal persistence, transcription and response to anthropogenic factors, such as antibiotic usage. We present a spatiotemporal study within a river catchment (River Cam, UK) that aims to determine the contribution of antibiotic resistance gene-containing effluents originating from sites of varying antibiotic usage to the receiving environment. Gene abundance in effluents (municipal hospital and dairy farm) was compared against background samples of the receiving aquatic environment (i.e. the catchment source) to determine the resistome contribution of effluents. We used metagenomics and metatranscriptomics to correlate DNA and RNA abundance and identified differentially regulated gene transcripts. We found that mean antibiotic resistance gene and transcript abundances were correlated for both hospital ( ρ  = 0.9, two-tailed P  hospital effluent samples. High β-lactam resistance gene transcript abundance was related to hospital antibiotic usage over time and hospital effluents contained antibiotic residues. We conclude that effluents contribute high levels of antibiotic resistance genes to the aquatic environment; these genes are expressed at significant levels and are possibly related to the level of antibiotic usage at the effluent source. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy.

  1. Induced resistance and gene expression in wheat against leaf rust ...

    African Journals Online (AJOL)

    uvp

    2013-05-15

    May 15, 2013 ... 2Department of Soil, Crop and Climate Sciences, University of the Free State, P.O Box ... Key words: Wheat leaf rust, induced resistance, priming, gene ..... transformation: susceptibility of transgenic Nicotiana sylvestris plants.

  2. Molecular Detection of Virulence Genes and Antibiotic Resistance ...

    African Journals Online (AJOL)

    Pathogen, E. coli O157:H7, virulence genes, antibiotic-resistance, beef meat. Correspondence: ... box to the laboratory for further processing. Isolation and identification of ... Technologies (IDT) Inc, U.S.A. The sequences and annealing ...

  3. Mapping of stripe rust resistance gene in an Aegilops caudata ...

    Indian Academy of Sciences (India)

    PUNEET INDER TOOR

    A pair of stripe rust and leaf rust resistance genes was introgressed from Aegilops caudata, a nonprogenitor diploid species with the CC genome, to cultivated .... infector rows and experimental material with the mixture of uredinospores of Pst ...

  4. Functionalized graphene oxide mediated adriamycin delivery and miR-21 gene silencing to overcome tumor multidrug resistance in vitro.

    Directory of Open Access Journals (Sweden)

    Feng Zhi

    Full Text Available Multidrug resistance (MDR is a major impediment to successful cancer chemotherapy. Co-delivery of novel MDR-reversing agents and anticancer drugs to cancer cells holds great promise for cancer treatment. MicroRNA-21 (miR-21 overexpression is associated with the development and progression of MDR in breast cancer, and it is emerging as a novel and promising MDR-reversing target. In this study, a multifunctional nanocomplex, composed of polyethylenimine (PEI/poly(sodium 4-styrenesulfonates (PSS/graphene oxide (GO and termed PPG, was prepared using the layer-by-layer assembly method to evaluate the reversal effects of PPG as a carrier for adriamycin (ADR along with miR-21 targeted siRNA (anti-miR-21 in cancer drug resistance. ADR was firstly loaded onto the PPG surface (PPGADR by physical mixing and anti-miR-21 was sequentially loaded onto PPGADR through electric absorption to form (anti-miR-21PPGADR. Cell experiments showed that PPG significantly enhanced the accumulation of ADR in MCF-7/ADR cells (an ADR resistant breast cancer cell line and exhibited much higher cytotoxicity than free ADR, suggesting that PPG could effectively reverse ADR resistance of MCF-7/ADR. Furthermore, the enhanced therapeutic efficacy of PPG could be correlated with effective silencing of miR-21 and with increased accumulation of ADR in drug-resistant tumor cells. The endocytosis study confirmed that PPG could effectively carry drug molecules into cells via the caveolae and clathrin-mediated endocytosis pathways. These results suggest that this PPG could be a potential and efficient non-viral vector for reversing MDR, and the strategy of combining anticancer drugs with miRNA therapy to overcome MDR could be an attractive approach in cancer treatment.

  5. Resistance gene management: concepts and practice

    Science.gov (United States)

    Christopher C. Mundt

    2012-01-01

    There is now a very long history of genetics/breeding for disease resistance in annual crops. These efforts have resulted in conceptual advances and frustrations, as well as practical successes and failures. This talk will review this history and its relevance to the genetics of resistance in forest species. All plant breeders and pathologists are familiar with boom-...

  6. Cyclooxygenase-2, multidrug resistance 1, and breast cancer resistance protein gene polymorphisms and inflammatory bowel disease in the Danish population

    DEFF Research Database (Denmark)

    Østergaard, Mette; Ernst, Anja; Labouriau, Rodrigo S.

    2009-01-01

    =0.006) and 1.39 ((0.99-1.92) p=0.054), respectively, and for UC of 2.63 ((1.33-5.26) p=0.005) and 1.28 ((0.96-1.51) p=0.093), respectively, assuming complete dominance. No association was found for BCRP or other MDR1 SNPs, or for selected MDR1 haplotypes. No effect-modification of smoking habit......OBJECTIVE: Crohn's disease (CD) and ulcerative colitis (UC) are characterized by an impaired mucosal defence to normal constituents of the intestinal flora and a dysregulated inflammatory response. The purpose of the study was to investigate whether single nucleotide polymorphisms (SNPs) in genes....../A, C3435T and G-rs3789243-A (intron 3) were assessed in a Danish case-control study comprising 373 CD and 541 UC patients and 796 healthy controls. RESULTS: Carriers of the homozygous COX-2 and MDR1 intron 3 variant had a relatively high risk of CD, odds ratio (95% CI) (OR (95% CI))=2.86 ((1.34-5.88) p...

  7. MicroRNA Expression Profiles Associated with Development of Drug Resistance in Ehrlich Ascites Tumor Cells

    DEFF Research Database (Denmark)

    Husted, Susanne; Søkilde, Rolf; Rask, Lene

    2011-01-01

    Multidrug resistance (MDR) poses a major obstacle to successful chemotherapeutic treatment of cancer, and often involves multiple genes, which may be regulated post-transcriptionally by microRNAs (miRNAs). The purpose of the present study was therefore to identify any resistance-associated change...

  8. Gene Expression Analysis of Four Radiation-resistant Bacteria

    OpenAIRE

    Gao, Na; Ma, Bin-Guang; Zhang, Yu-Sheng; Song, Qin; Chen, Ling-Ling; Zhang, Hong-Yu

    2009-01-01

    To investigate the general radiation-resistant mechanisms of bacteria, bioinformatic method was employed to predict highly expressed genes for four radiation-resistant bacteria, i.e. Deinococcus geothermalis (D. geo), Deinococcus radiodurans (D. rad), Kineococcus radiotolerans (K. rad) and Rubrobacter xylanophilus (R. xyl). It is revealed that most of the three reference gene sets, i.e. ribosomal proteins, transcription factors and major chaperones, are generally highly expressed in the four ...

  9. Overexpression of antibiotic resistance genes in hospital effluents over time

    OpenAIRE

    Rowe, Will P. M.; Baker-Austin, Craig; Verner-Jeffreys, David W.; Ryan, Jim J.; Micallef, Christianne; Maskell, Duncan J.; Pearce, Gareth P.

    2017-01-01

    $\\textbf{Objectives}$: Effluents contain a diverse abundance of antibiotic resistance genes that augment the resistome of receiving aquatic environments. However, uncertainty remains regarding their temporal persistence, transcription and response to anthropogenic factors, such as antibiotic usage. We present a spatiotemporal study within a river catchment (River Cam, UK) that aims to determine the contribution of antibiotic resistance gene-containing effluents originating from sites of varyi...

  10. Analysis of metal and biocides resistance genes in drug resistance and susceptible Salmonella enterica from food animals

    Science.gov (United States)

    Background Generally drug resistant bacteria carry antibiotic resistance genes and heavy metal and biocide resistance genes on large conjugative plasmids. The presence of these metal and biocide resistance genes in susceptible bacteria are not assessed comprehensively. Hence, WGS data of susceptib...

  11. The antimicrobial resistance crisis: management through gene monitoring

    Science.gov (United States)

    2016-01-01

    Antimicrobial resistance (AMR) is an acknowledged crisis for humanity. Its genetic origins and dire potential outcomes are increasingly well understood. However, diagnostic techniques for monitoring the crisis are currently largely limited to enumerating the increasing incidence of resistant pathogens. Being the end-stage of the evolutionary process that produces antimicrobial resistant pathogens, these measurements, while diagnostic, are not prognostic, and so are not optimal in managing this crisis. A better test is required. Here, using insights from an understanding of evolutionary processes ruling the changing abundance of genes under selective pressure, we suggest a predictive framework for the AMR crisis. We then discuss the likely progression of resistance for both existing and prospective antimicrobial therapies. Finally, we suggest that by the environmental monitoring of resistance gene frequency, resistance may be detected and tracked presumptively, and how this tool may be used to guide decision-making in the local and global use of antimicrobials. PMID:27831476

  12. Multidrug-Resistant CTX-M-(15, 9, 2)- and KPC-2-Producing Enterobacter hormaechei and Enterobacter asburiae Isolates Possessed a Set of Acquired Heavy Metal Tolerance Genes Including a Chromosomal sil Operon (for Acquired Silver Resistance).

    Science.gov (United States)

    Andrade, Leonardo N; Siqueira, Thiago E S; Martinez, Roberto; Darini, Ana Lucia C

    2018-01-01

    Bacterial resistance to antibiotics is concern in healthcare-associated infections. On the other hand, bacterial tolerance to other antimicrobials, like heavy metals, has been neglected and underestimated in hospital pathogens. Silver has long been used as an antimicrobial agent and it seems to be an important indicator of heavy metal tolerance. To explore this perspective, we searched for the presence of acquired silver resistance genes ( sil operon: silE, silS, silR, silC, silF, silB, silA , and silP ) and acquired extended-spectrum cephalosporin and carbapenem resistance genes ( bla CTX-M and bla KPC ) in Enterobacter cloacae Complex (EcC) ( n = 27) and Enterobacter aerogenes ( n = 8) isolated from inpatients at a general hospital. Moreover, the genetic background of the silA (silver-efflux pump) and the presence of other acquired heavy metal tolerance genes, pcoD (copper-efflux pump), arsB (arsenite-efflux pump), terF (tellurite resistance protein), and merA (mercuric reductase) were also investigated. Outstandingly, 21/27 (78%) EcC isolates harbored silA gene located in the chromosome. Complete sil operon was found in 19/21 silA -positive EcC isolates. Interestingly, 8/20 (40%) E. hormaechei and 5/6 (83%) E. asburiae co-harbored silA/pcoD genes and bla CTX-M-(15,2,or9) and/or bla KPC-2 genes. Frequent occurrences of arsB, terF , and merA genes were detected, especially in silA/pcoD -positive, multidrug-resistant (MDR) and/or CTX-M-producing isolates. Our study showed co-presence of antibiotic and heavy metal tolerance genes in MDR EcC isolates. In our viewpoint, there are few studies regarding to bacterial heavy metal tolerance and we call attention for more investigations and discussion about this issue in different hospital pathogens.

  13. Multidrug-Resistant CTX-M-(15, 9, 2- and KPC-2-Producing Enterobacter hormaechei and Enterobacter asburiae Isolates Possessed a Set of Acquired Heavy Metal Tolerance Genes Including a Chromosomal sil Operon (for Acquired Silver Resistance

    Directory of Open Access Journals (Sweden)

    Leonardo N. Andrade

    2018-03-01

    Full Text Available Bacterial resistance to antibiotics is concern in healthcare-associated infections. On the other hand, bacterial tolerance to other antimicrobials, like heavy metals, has been neglected and underestimated in hospital pathogens. Silver has long been used as an antimicrobial agent and it seems to be an important indicator of heavy metal tolerance. To explore this perspective, we searched for the presence of acquired silver resistance genes (sil operon: silE, silS, silR, silC, silF, silB, silA, and silP and acquired extended-spectrum cephalosporin and carbapenem resistance genes (blaCTX−M and blaKPC in Enterobacter cloacae Complex (EcC (n = 27 and Enterobacter aerogenes (n = 8 isolated from inpatients at a general hospital. Moreover, the genetic background of the silA (silver-efflux pump and the presence of other acquired heavy metal tolerance genes, pcoD (copper-efflux pump, arsB (arsenite-efflux pump, terF (tellurite resistance protein, and merA (mercuric reductase were also investigated. Outstandingly, 21/27 (78% EcC isolates harbored silA gene located in the chromosome. Complete sil operon was found in 19/21 silA-positive EcC isolates. Interestingly, 8/20 (40% E. hormaechei and 5/6 (83% E. asburiae co-harbored silA/pcoD genes and blaCTX−M−(15,2,or9 and/or blaKPC−2 genes. Frequent occurrences of arsB, terF, and merA genes were detected, especially in silA/pcoD-positive, multidrug-resistant (MDR and/or CTX-M-producing isolates. Our study showed co-presence of antibiotic and heavy metal tolerance genes in MDR EcC isolates. In our viewpoint, there are few studies regarding to bacterial heavy metal tolerance and we call attention for more investigations and discussion about this issue in different hospital pathogens.

  14. The Number of Genes Controlling Resistance in Beans to Common ...

    African Journals Online (AJOL)

    Ten crosses were made between resistant (R), susceptible (S), RxS susceptible and Intermediate (I), SxI and RxR bean lines to common bacterial blight. The F1 were advanced to F2 and in each cross over 250 F2 plants were used to evaluate for the number of genes controlling resistance using Mendelian genetics and ...

  15. Prevalence, antibiotic-resistance properties and enterotoxin gene ...

    African Journals Online (AJOL)

    Prevalence, antibiotic-resistance properties and enterotoxin gene profile of Bacillus cereus strains isolated from milk-based baby foods. ... Conclusion: Considerable prevalence of resistant and toxigenic B. cereus and high consumption of milk-based infant foods in Iran, represent an important public health issue which ...

  16. Spread of tetracycline resistance genes at a conventional dairy farm

    NARCIS (Netherlands)

    Kyselková, Martina; Jirout, Jiří; Vrchotová, Naděžda; Schmitt, Heike; Elhottová, Dana

    2015-01-01

    The use of antibiotics in animal husbandry contributes to the worldwide problem of increasing antibiotic resistance in animal and human pathogens. Intensive animal production is considered an important source of antibiotic resistance genes released to the environment, while the contribution of

  17. Isolation and characterization of a candidate gene for resistance to ...

    African Journals Online (AJOL)

    ARC) domain, and a leucine-rich repeat (LRR) domain, all of which are typical characteristics of resistance genes. We proposed the resistance mechanism of CreV8 based on functional analysis and predictions from its conserved domains and ...

  18. Pediatric fecal microbiota harbor diverse and novel antibiotic resistance genes.

    Directory of Open Access Journals (Sweden)

    Aimée M Moore

    Full Text Available Emerging antibiotic resistance threatens human health. Gut microbes are an epidemiologically important reservoir of resistance genes (resistome, yet prior studies indicate that the true diversity of gut-associated resistomes has been underestimated. To deeply characterize the pediatric gut-associated resistome, we created metagenomic recombinant libraries in an Escherichia coli host using fecal DNA from 22 healthy infants and children (most without recent antibiotic exposure, and performed functional selections for resistance to 18 antibiotics from eight drug classes. Resistance-conferring DNA fragments were sequenced (Illumina HiSeq 2000, and reads assembled and annotated with the PARFuMS computational pipeline. Resistance to 14 of the 18 antibiotics was found in stools of infants and children. Recovered genes included chloramphenicol acetyltransferases, drug-resistant dihydrofolate reductases, rRNA methyltransferases, transcriptional regulators, multidrug efflux pumps, and every major class of beta-lactamase, aminoglycoside-modifying enzyme, and tetracycline resistance protein. Many resistance-conferring sequences were mobilizable; some had low identity to any known organism, emphasizing cryptic organisms as potentially important resistance reservoirs. We functionally confirmed three novel resistance genes, including a 16S rRNA methylase conferring aminoglycoside resistance, and two tetracycline-resistance proteins nearly identical to a bifidobacterial MFS transporter (B. longum s. longum JDM301. We provide the first report to our knowledge of resistance to folate-synthesis inhibitors conferred by a predicted Nudix hydrolase (part of the folate synthesis pathway. This functional metagenomic survey of gut-associated resistomes, the largest of its kind to date, demonstrates that fecal resistomes of healthy children are far more diverse than previously suspected, that clinically relevant resistance genes are present even without recent selective

  19. Mortality among MDR-TB cases: comparison with drug-susceptible tuberculosis and associated factors.

    Directory of Open Access Journals (Sweden)

    Kocfa Chung-Delgado

    Full Text Available An increase in multidrug-resistant tuberculosis (MDR-TB cases is evident worldwide. Its management implies a complex treatment, high costs, more toxic anti-tuberculosis drug use, longer treatment time and increased treatment failure and mortality. The aims of this study were to compare mortality between MDR and drug-susceptible cases of tuberculosis, and to determine risk factors associated with mortality among MDR-TB cases.A retrospective cohort study was performed using data from clinical records of the National Strategy for Prevention and Control of Tuberculosis in Lima, Peru. In the first objective, MDR-TB, compared to drug-susceptible cases, was the main exposure variable and time to death, censored at 180 days, the outcome of interest. For the second objective, different variables obtained from clinical records were assessed as potential risk factors for death among MDR-TB cases. Cox regression analysis was used to determine hazard ratios (HR and 95% confidence intervals (95%CI. A total of 1,232 patients were analyzed: mean age 30.9 ±14.0 years, 60.0% were males. 61 patients (5.0% died during treatment, whereas the MDR-TB prevalence was 19.2%. MDR-TB increased the risk of death during treatment (HR = 7.5; IC95%: 4.1-13.4 when compared to presumed drug-susceptible cases after controlling for potential confounders. Education level (p = 0.01, previous TB episodes (p<0.001, diabetes history (p<0.001 and HIV infection (p = 0.04 were factors associated with mortality among MDR-TB cases.MDR-TB is associated with an increased risk of death during treatment. Lower education, greater number of previous TB episodes, diabetes history, and HIV infection were independently associated with mortality among MDR-TB cases. New strategies for appropriate MDR-TB detection and management should be implemented, including drug sensitivity tests, diabetes and HIV screening, as well as guarantee for a complete adherence to therapy.

  20. Cloning and characterization of NBS-LRR resistance gene ...

    African Journals Online (AJOL)

    biotech

    2013-07-03

    Jul 3, 2013 ... Rose using degernate primers designed from the conserved motifs of different plant resistance genes. A total of 40 sequences were hit with various R genes, of which 20 .... absorption ratio OD260 nm/OD280 nm between 1.80 and ..... status and outlook for small-holders agriculture in C S Gold and B.

  1. Induced mutations of rust resistance genes in wheat

    International Nuclear Information System (INIS)

    McIntosh, R.A.

    1983-01-01

    Induced mutations are being used as a tool to study genes for resistance in wheat. It was found that Pm1 can be separated from Lr20 and Sr15, but these two react like a single pleiotropic gene. Mutants were further examined in crosses and backmutations have been attempted. (author)

  2. Dihydropteroate synthase gene mutations in Pneumocystis and sulfa resistance

    DEFF Research Database (Denmark)

    Huang, Laurence; Crothers, Kristina; Atzori, Chiara

    2004-01-01

    in the dihydropteroate synthase (DHPS) gene. Similar mutations have been observed in P. jirovecii. Studies have consistently demonstrated a significant association between the use of sulfa drugs for PCP prophylaxis and DHPS gene mutations. Whether these mutations confer resistance to TMP-SMX or dapsone plus trimethoprim...

  3. Testing of disease-resistance of pokeweed antiviral protein gene ...

    African Journals Online (AJOL)

    Transformation of pokeweed antiviral protein gene (PAP) into plants was shown to improve plant resistance to several viruses or fungi pathogens with no much negative effect on plant growth. The non-virulent defective PAP inhibits only the virus but does not interfere with the host. A non-virulent defective PAP gene ...

  4. Resistance gene candidates identified by PCR with degenerate oligonucleotide primers map to clusters of resistance genes in lettuce.

    Science.gov (United States)

    Shen, K A; Meyers, B C; Islam-Faridi, M N; Chin, D B; Stelly, D M; Michelmore, R W

    1998-08-01

    The recent cloning of genes for resistance against diverse pathogens from a variety of plants has revealed that many share conserved sequence motifs. This provides the possibility of isolating numerous additional resistance genes by polymerase chain reaction (PCR) with degenerate oligonucleotide primers. We amplified resistance gene candidates (RGCs) from lettuce with multiple combinations of primers with low degeneracy designed from motifs in the nucleotide binding sites (NBSs) of RPS2 of Arabidopsis thaliana and N of tobacco. Genomic DNA, cDNA, and bacterial artificial chromosome (BAC) clones were successfully used as templates. Four families of sequences were identified that had the same similarity to each other as to resistance genes from other species. The relationship of the amplified products to resistance genes was evaluated by several sequence and genetic criteria. The amplified products contained open reading frames with additional sequences characteristic of NBSs. Hybridization of RGCs to genomic DNA and to BAC clones revealed large numbers of related sequences. Genetic analysis demonstrated the existence of clustered multigene families for each of the four RGC sequences. This parallels classical genetic data on clustering of disease resistance genes. Two of the four families mapped to known clusters of resistance genes; these two families were therefore studied in greater detail. Additional evidence that these RGCs could be resistance genes was gained by the identification of leucine-rich repeat (LRR) regions in sequences adjoining the NBS similar to those in RPM1 and RPS2 of A. thaliana. Fluorescent in situ hybridization confirmed the clustered genomic distribution of these sequences. The use of PCR with degenerate oligonucleotide primers is therefore an efficient method to identify numerous RGCs in plants.

  5. Antimicrobial resistance in equine faecal Escherichia coli isolates from North West England

    Directory of Open Access Journals (Sweden)

    Williams Nicola J

    2010-04-01

    Full Text Available Abstract Background Escherichia coli isolates of equine faecal origin were investigated for antibiotic resistance, resistance genes and their ability to perform horizontal transfer. Methods In total, 264 faecal samples were collected from 138 horses in hospital and community livery premises in northwest England, yielding 296 resistant E. coli isolates. Isolates were tested for susceptibility to antimicrobial drugs by disc diffusion and agar dilution methods in order to determine minimum inhibitory concentrations (MIC. PCR amplification was used to detect genes conferring resistance to: ampicillin (TEM and SHV beta-lactamase, chloramphenicol (catI, catII, catIII and cml, tetracycline (tetA, tetB, tetC, tetD, tet E and tetG, and trimethoprim (dfrA1, dfrA9, dfrA12, dfrA13, dfr7, and dfr17. Results The proportion of antibiotic resistant isolates, and multidrug resistant isolates (MDR was significantly higher in hospital samples compared to livery samples (MDR: 48% of hospital isolates; 12% of livery isolates, p dfr, TEM beta-lactamase, tet and cat, conferring resistance to trimethoprim, ampicillin, tetracycline and chloramphenicol, respectively. Within each antimicrobial resistance group, these genes occurred at frequencies of 93% (260/279, 91%, 86.8% and 73.5%, respectively; with 115/296 (38.8% found to be MDR isolates. Conjugation experiments were performed on selected isolates and MDR phenotypes were readily transferred. Conclusions Our findings demonstrate that E. coli of equine faecal origin are commonly resistant to antibiotics used in human and veterinary medicine. Furthermore, our results suggest that most antibiotic resistance observed in equine E. coli is encoded by well-known and well-characterized resistant genes common to E. coli from man and domestic animals. These data support the ongoing concern about antimicrobial resistance, MDR, antimicrobial use in veterinary medicine and the zoonotic risk that horses could potentially pose to

  6. Environmental cycle of antibiotic resistance encoded genes: A systematic review

    Directory of Open Access Journals (Sweden)

    R. ghanbari

    2017-12-01

    Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.

  7. RESISTANCE-RELATED GENE TRANSCRIPTION AND ...

    African Journals Online (AJOL)

    jdx

    2014-02-05

    Feb 5, 2014 ... By 72 hpi, the pathogen switched to necrotrophic growth to avoid contact with the increasing ... A better understanding of the gene network underlying ... 5.0 software under default parameters and were custom-ordered.

  8. Molecular characterization of multidrug-resistant Klebsiella pneumoniae isolates

    Directory of Open Access Journals (Sweden)

    Xiang-hua Hou

    2015-09-01

    Full Text Available Klebsiella pneumoniae is an important cause of healthcare-associated infections worldwide. Selective pressure, the extensive use of antibiotics, and the conjugational transmission of antibiotic resistance genes across bacterial species and genera facilitate the emergence of multidrug-resistant (MDR K. pneumoniae. Here, we examined the occurrence, phenotypes and genetic features of MDR K. pneumoniae isolated from patients in intensive care units (ICUs at the First Affiliated Hospital of Xiamen University in Xiamen, China, from January to December 2011. Thirty-eight MDR K. pneumoniae strains were collected. These MDR K. pneumoniae isolates possessed at least seven antibiotic resistance determinants, which contribute to the high-level resistance of these bacteria to aminoglycosides, macrolides, quinolones and β-lactams. Among these isolates, 24 strains were extended-spectrum β-lactamase (ESBL producers, 2 strains were AmpC producers, and 12 strains were both ESBL and AmpC producers. The 38 MDR isolates also contained class I (28/38 and class II integrons (10/38. All 28 class I-positive isolates contained aacC1, aacC4, orfX, orfX’ and aadA1 genes. β-lactam resistance was conferred through blaSHV (22/38, blaTEM (10/38, and blaCTX-M (7/38. The highly conserved blaKPC-2 (37/38 and blaOXA-23(1/38 alleles were responsible for carbapenem resistance, and a gyrAsite mutation (27/38 and the plasmid-mediated qnrB gene (13/38 were responsible for quinolone resistance. Repetitive-sequence-based PCR (REP-PCR fingerprinting of these MDR strains revealed the presence of five groups and sixteen patterns. The MDR strains from unrelated groups showed different drug resistance patterns; however, some homologous strains also showed different drug resistance profiles. Therefore, REP-PCR-based analyses can provide information to evaluate the epidemic status of nosocomial infection caused by MDR K. pneumoniae; however, this test lacks the power to discriminate some

  9. The Lr34 adult plant rust resistance gene provides seedling resistance in durum wheat without senescence.

    Science.gov (United States)

    Rinaldo, Amy; Gilbert, Brian; Boni, Rainer; Krattinger, Simon G; Singh, Davinder; Park, Robert F; Lagudah, Evans; Ayliffe, Michael

    2017-07-01

    The hexaploid wheat (Triticum aestivum) adult plant resistance gene, Lr34/Yr18/Sr57/Pm38/Ltn1, provides broad-spectrum resistance to wheat leaf rust (Lr34), stripe rust (Yr18), stem rust (Sr57) and powdery mildew (Pm38) pathogens, and has remained effective in wheat crops for many decades. The partial resistance provided by this gene is only apparent in adult plants and not effective in field-grown seedlings. Lr34 also causes leaf tip necrosis (Ltn1) in mature adult plant leaves when grown under field conditions. This D genome-encoded bread wheat gene was transferred to tetraploid durum wheat (T. turgidum) cultivar Stewart by transformation. Transgenic durum lines were produced with elevated gene expression levels when compared with the endogenous hexaploid gene. Unlike nontransgenic hexaploid and durum control lines, these transgenic plants showed robust seedling resistance to pathogens causing wheat leaf rust, stripe rust and powdery mildew disease. The effectiveness of seedling resistance against each pathogen correlated with the level of transgene expression. No evidence of accelerated leaf necrosis or up-regulation of senescence gene markers was apparent in these seedlings, suggesting senescence is not required for Lr34 resistance, although leaf tip necrosis occurred in mature plant flag leaves. Several abiotic stress-response genes were up-regulated in these seedlings in the absence of rust infection as previously observed in adult plant flag leaves of hexaploid wheat. Increasing day length significantly increased Lr34 seedling resistance. These data demonstrate that expression of a highly durable, broad-spectrum adult plant resistance gene can be modified to provide seedling resistance in durum wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  10. Antibiotic resistance and virulence genes in coliform water isolates.

    Science.gov (United States)

    Stange, C; Sidhu, J P S; Tiehm, A; Toze, S

    2016-11-01

    Widespread fecal pollution of surface water may present a major health risk and a significant pathway for dissemination of antibiotic resistance bacteria. The River Rhine is one of the longest and most important rivers in Europe and an important raw water source for drinking water production. A total of 100 coliform isolates obtained from River Rhine (Germany) were examined for their susceptibility to seven antimicrobial agents. Resistances against amoxicillin, trimethoprim/sulfamethoxazole and tetracycline were detected in 48%, 11% and 9% of isolates respectively. The antibiotic resistance could be traced back to the resistance genes bla TEM , bla SHV , ampC, sul1, sul2, dfrA1, tet(A) and tet(B). Whereby, the ampC gene represents a special case, because its presence is not inevitably linked to a phenotypic antibiotic resistance. Multiple antibiotics resistance was often accompanied by the occurrence of class 1 or 2 integrons. E. coli isolates belonging to phylogenetic groups A and B1 (commensal) were more predominant (57%) compared to B2 and D groups (43%) which are known to carry virulent genes. Additionally, six E. coli virulence genes were also detected. However, the prevalence of virulence genes in the E. coli isolates was low (not exceeding 4.3% per gene) and no diarrheagenic E. coli pathotypes were detected. This study demonstrates that surface water is an important reservoir of ARGs for a number of antibiotic classes such as sulfonamide, trimethoprim, beta-lactam-antibiotics and tetracycline. The occurrence of antibiotic resistance in coliform bacteria isolated from River Rhine provides evidence for the need to develop management strategies to limit the spread of antibiotic resistant bacteria in aquatic environment. Copyright © 2016 Elsevier GmbH. All rights reserved.

  11. Deinococcus geothermalis: The Pool of Extreme Radiation Resistance Genes Shrinks

    Energy Technology Data Exchange (ETDEWEB)

    Makarova, Kira S.; Omelchenko, Marina V.; Gaidamakova, Elena K.; Matrosova, Vera Y.; Vasilenko, Alexander; Zhai, Min; Lapidus, Alla; Copeland, Alex; Kim, Edwin; Land, Miriam; Mavrommatis, Konstantinos; Pitluck, Samuel; Richardson, Paul M.; Detter, Chris; Brettin, Thomas; Saunders, Elizabeth; Lai, Barry; Ravel, Bruce; Kemner, Kenneth M.; Wolf, Yuri I.; Sorokin, Alexander; Gerasimova, Anna V.; Gelfand, Mikhail S.; Fredrickson, James K.; Koonin, Eugene V.; Daly, Michael J.

    2007-07-24

    Bacteria of the genus Deinococcus are extremely resistant to ionizing radiation (IR), ultraviolet light (UV) and desiccation. The mesophile Deinococcus radiodurans was the first member of this group whose genome was completely sequenced. Analysis of the genome sequence of D. radiodurans, however, failed to identify unique DNA repair systems. To further delineate the genes underlying the resistance phenotypes, we report the whole-genome sequence of a second Deinococcus species, the thermophile Deinococcus geothermalis, which at itsoptimal growth temperature is as resistant to IR, UV and desiccation as D. radiodurans, and a comparative analysis of the two Deinococcus genomes. Many D. radiodurans genes previously implicated in resistance, but for which no sensitive phenotype was observed upon disruption, are absent in D. geothermalis. In contrast, most D. radiodurans genes whose mutants displayed a radiation-sensitive phenotype in D. radiodurans are conserved in D. geothermalis. Supporting the existence of a Deinococcus radiation response regulon, a common palindromic DNA motif was identified in a conserved set of genes associated with resistance, and a dedicated transcriptional regulator was predicted. We present the case that these two species evolved essentially the same diverse set of gene families, and that the extreme stress-resistance phenotypes of the Deinococcus lineage emerged progressively by amassing cell-cleaning systems from different sources, but not by acquisition of novel DNA repair systems. Our reconstruction of the genomic evolution of the Deinococcus-Thermus phylum indicates that the corresponding set of enzymes proliferated mainly in the common ancestor of Deinococcus. Results of the comparative analysis weaken the arguments for a role of higher-order chromosome alignment structures in resistance; more clearly define and substantially revise downward the number of uncharacterized genes that might participate in DNA repair and contribute to

  12. Identifying resistance gene analogs associated with resistances to different pathogens in common bean.

    Science.gov (United States)

    López, Camilo E; Acosta, Iván F; Jara, Carlos; Pedraza, Fabio; Gaitán-Solís, Eliana; Gallego, Gerardo; Beebe, Steve; Tohme, Joe

    2003-01-01

    ABSTRACT A polymerase chain reaction approach using degenerate primers that targeted the conserved domains of cloned plant disease resistance genes (R genes) was used to isolate a set of 15 resistance gene analogs (RGAs) from common bean (Phaseolus vulgaris). Eight different classes of RGAs were obtained from nucleotide binding site (NBS)-based primers and seven from not previously described Toll/Interleukin-1 receptor-like (TIR)-based primers. Putative amino acid sequences of RGAs were significantly similar to R genes and contained additional conserved motifs. The NBS-type RGAs were classified in two subgroups according to the expected final residue in the kinase-2 motif. Eleven RGAs were mapped at 19 loci on eight linkage groups of the common bean genetic map constructed at Centro Internacional de Agricultura Tropical. Genetic linkage was shown for eight RGAs with partial resistance to anthracnose, angular leaf spot (ALS) and Bean golden yellow mosaic virus (BGYMV). RGA1 and RGA2 were associated with resistance loci to anthracnose and BGYMV and were part of two clusters of R genes previously described. A new major cluster was detected by RGA7 and explained up to 63.9% of resistance to ALS and has a putative contribution to anthracnose resistance. These results show the usefulness of RGAs as candidate genes to detect and eventually isolate numerous R genes in common bean.

  13. The relationship between codon usage bias and cold resistant genes

    International Nuclear Information System (INIS)

    Barozai, M.Y.; Din, M.

    2014-01-01

    This research is based on synonymous codon usage which has been well-known as a feature that affects typical expression level of protein in an organism. Different organisms prefer different codons for same amino acid and this is called Codon Usage Bias (CUB). The codon usage directly affects the level or even direction of changes in protein expression in responses to environmental stimuli. Cold stress is a major abiotic factor that limits the agricultural productivity of plants. In the recent study CUB has been studied in Arabidopsis thaliana cold resistant and housekeeping genes and their homologs in rice (Oryza sativa) to understand the cold stress and housekeeping genes relation with CUB. Six cold resistant and three housekeeping genes in Arabidopsis thaliana and their homologs in rice, were subjected to CUB analysis. The three cold resistant genes (DREB1B, RCI and MYB15) showed more than 50% (52%, 61% and 66% respectively) similar codon usage bias for Arabidopsis thaliana and rice. On the other hand three cold resistant genes (MPK3, ICE1 and ZAT12) showed less than 50% (38%, 38% and 47% respectively) similar codon usage bias for Arabidopsis thaliana and rice. The three housekeeping genes (Actin, Tubulin and Ubiquitin) showed 76% similar codon usage bias for Arabidopsis thaliana and rice. This study will help to manage the plant gene expression through codon optimization under the cold stress. (author)

  14. Persistence of antimicrobial resistance genes from sows to finisher pigs

    DEFF Research Database (Denmark)

    Birkegård, Anna Camilla; Halasa, Tariq; Folkesson, Anders

    2018-01-01

    Antimicrobial resistance in pigs has been under scrutiny for many years. However, many questions remain unanswered, including whether the initial antimicrobial resistance level of a pig will influence the antimicrobial resistance found at slaughter. Faecal samples from finishers pigs from 681 farms...... and from sows from 82 farms were collected, and levels of seven antimicrobial resistance genes, ermB, ermF, sulI, sulII, tet(M), tet(O), and tet(W), were quantified by high-capacity qPCR. There were 40 pairs of observations where the finishers were born in the farms of the sows. The objective of this study...

  15. Evaluation of efficiency of nested multiplex allele-specific PCR assay for detection of multidrug resistant tuberculosis directly from sputum samples.

    Science.gov (United States)

    Mistri, S K; Sultana, M; Kamal, S M M; Alam, M M; Irin, F; Nessa, J; Ahsan, C R; Yasmin, M

    2016-05-01

    For an effective control of tuberculosis, rapid detection of multidrug resistant tuberculosis (MDR-TB) is necessary. Therefore, we developed a modified nested multiplex allele-specific polymerase chain reaction (MAS-PCR) method that enables rapid MDR-TB detection directly from sputum samples. The efficacy of this method was evaluated using 79 sputum samples collected from suspected tuberculosis patients. The performance of nested MAS-PCR method was compared with other MDR-TB detection methods like drug susceptibility testing (DST) and DNA sequencing. As rifampicin (RIF) resistance conforms to MDR-TB in greater than 90% cases, only the presence of RIF-associated mutations in rpoB gene was determined by DNA sequencing and nested MAS-PCR to detect MDR-TB. The concordance between nested MAS-PCR and DNA sequencing results was found to be 96·3%. When compared with DST, the sensitivity and specificity of nested MAS-PCR for RIF-resistance detection were determined to be 92·9 and 100% respectively. For developing- and high-TB burden countries, molecular-based tests have been recommended by the World Health Organization for rapid detection of MDR-TB. The results of this study indicate that, nested MAS-PCR assay might be a practical and relatively cost effective molecular method for rapid detection of MDR-TB from suspected sputum samples in developing countries with resource poor settings. © 2016 The Society for Applied Microbiology.

  16. Molecular screening for erythromycin resistance genes in ...

    African Journals Online (AJOL)

    Aghomotsegin

    2015-07-15

    Jul 15, 2015 ... in Streptococcus pyogenes isolated from Iraqi patients with tonsilo-pharyngites. Hassan .... is an automated colorimetric method used for identification of bacteria and for .... counter medicines in private pharmacies against the regulations. ... Effect of telithromycin on erythromycin resistant S. pyogenes. In this ...

  17. AMINOGLYCOSIDE RESISTANCE GENES IN Pseudomonas aeruginosa ISOLATES FROM CUMANA, VENEZUELA

    Directory of Open Access Journals (Sweden)

    Bertinellys TEIXEIRA

    2016-01-01

    Full Text Available The enzymatic modification of aminoglycosides by aminoglycoside-acetyltransferases (AAC, aminoglycoside-adenyltransferases (AAD, and aminoglycoside-phosphotransferases (APH, is the most common resistance mechanism in P. aeruginosa and these enzymes can be coded on mobile genetic elements that contribute to their dispersion. One hundred and thirty seven P. aeruginosa isolates from the University Hospital, Cumana, Venezuela (HUAPA were evaluated. Antimicrobial susceptibility was determined by the disk diffusion method and theaac, aadB and aph genes were detected by PCR. Most of the P. aeruginosa isolates (33/137 were identified from the Intensive Care Unit (ICU, mainly from discharges (96/137. The frequency of resistant P. aeruginosaisolates was found to be higher for the aminoglycosides tobramycin and amikacin (30.7 and 29.9%, respectively. Phenotype VI, resistant to these antibiotics, was the most frequent (14/49, followed by phenotype I, resistant to all the aminoglycosides tested (12/49. The aac(6´-Ib,aphA1 and aadB genes were the most frequently detected, and the simultaneous presence of several resistance genes in the same isolate was demonstrated. Aminoglycoside resistance in isolates ofP. aeruginosa at the HUAPA is partly due to the presence of the aac(6´-Ib, aphA1 andaadB genes, but the high rates of antimicrobial resistance suggest the existence of several mechanisms acting together. This is the first report of aminoglycoside resistance genes in Venezuela and one of the few in Latin America.

  18. Molecular Scree ning of Blast Resistance Genes in Rice Germplasms Resistant to Magnaporthe oryzae

    Directory of Open Access Journals (Sweden)

    Liang Yan

    2017-01-01

    Full Text Available Molecular screening of major rice blast resistance genes was determined with molecular markers, which showed close-set linkage to 11 major rice blast resistance genes (Pi-d2, Pi-z, Piz-t, Pi-9, Pi-36, Pi-37, Pi5, Pi-b, Pik-p, Pik-h and Pi-ta2, in a collection of 32 accessions resistant to Magnaporthe oryzae. Out of the 32 accessions, the Pi-d2 and Pi-z appeared to be omnipresent and gave positive express. As the second dominant, Pi-b and Piz-t gene frequencies were 96.9% and 87.5%. And Pik-h and Pik-p gene frequencies were 43.8% and 28.1%, respectively. The molecular marker linkage to Pi-ta2 produced positive bands in eleven accessions, while the molecular marker linkage to Pi-36 and Pi-37 in only three and four accessions, respectively. The natural field evaluation analysis showed that 30 of the 32 accessions were resistant, one was moderately resistant and one was susceptible. Infection types were negatively correlated with the genotype scores of Pi-9, Pi5, Pi-b, Pi-ta2 and Pik-p, although the correlation coefficients were very little. These results are useful in identification and incorporation of functional resistance genes from these germplasms into elite cultivars through marker-assisted selection for improved blast resistance in China and worldwide.

  19. A novel gene of Kalanchoe daigremontiana confers plant drought resistance.

    Science.gov (United States)

    Wang, Li; Zhu, Chen; Jin, Lin; Xiao, Aihua; Duan, Jie; Ma, Luyi

    2018-02-07

    Kalanchoe (K.) daigremontiana is important for studying asexual reproduction under different environmental conditions. Here, we describe a novel KdNOVEL41 (KdN41) gene that may confer drought resistance and could thereby affect K. daigremontiana development. The detected subcellular localization of a KdN41/Yellow Fluorescent Protein (YFP) fusion protein was in the nucleus and cell membrane. Drought, salt, and heat stress treatment in tobacco plants containing the KdN41 gene promoter driving β-glucuronidase (GUS) gene transcription revealed that only drought stress triggered strong GUS staining in the vascular tissues. Overexpression (OE) of the KdN41 gene conferred improved drought resistance in tobacco plants compared to wild-type and transformed with empty vector plants by inducing higher antioxidant enzyme activities, decreasing cell membrane damage, increasing abscisic acid (ABA) content, causing reinforced drought resistance related gene expression profiles. The 3,3'-diaminobenzidine (DAB) and nitroblue tetrazolium (NBT) staining results also showed less relative oxygen species (ROS) content in KdN41-overexpressing tobacco leaf during drought stress. Surprisingly, by re-watering after drought stress, KdN41-overexpressing tobacco showed earlier flowering. Overall, the KdN41 gene plays roles in ROS scavenging and osmotic damage reduction to improve tobacco drought resistance, which may increase our understanding of the molecular network involved in developmental manipulation under drought stress in K. daigremontiana.

  20. Antibiotic resistance and resistance genes in Escherichia coli from poultry farms, southwest Nigeria

    OpenAIRE

    Adelowo, Olawale O.; Fagade, Obasola E.; Agersø, Yvonne

    2014-01-01

    Introduction: This study investigated the mechanisms of resistance in 36 E. coli isolated from waste, litter, soil and water samples collected from poultry farms in Southwestern Nigeria. Methodology: Minimum inhibitory concentration (MIC) distributions of the isolates were determined using the methods of the Clinical and Laboratory Standard Institute and resistance genes detected by PCR. Results: A total of 30 isolates (94%) showed resistance to more than one antimicrobial. Percentage resista...

  1. Antimicrobial resistance and resistance gene determinants in clinical Escherichia coli from different animal species in Switzerland.

    Science.gov (United States)

    Lanz, Roland; Kuhnert, Peter; Boerlin, Patrick

    2003-01-02

    Antimicrobial susceptibility testing was performed on a total of 581 clinical Escherichia coli isolates from diarrhea and edema disease in pigs, from acute mastitis in dairy cattle, from urinary tract infections in dogs and cats, and from septicemia in laying hens collected in Switzerland between 1999 and 2001. Among the 16 antimicrobial agents tested, resistance was most frequent for sulfonamides, tetracycline, and streptomycin. Isolates from swine presented significantly more resistance than those from the other animal species. The distribution of the resistance determinants for sulfonamides, tetracycline, and streptomycin was assessed by hybridization and PCR in resistant isolates. Significant differences in the distribution of resistance determinants for tetracycline (tetA, tetB) and sulfonamides (sulII) were observed between the isolates from swine and those from the other species. Resistance to sulfonamides could not be explained by known resistance mechanisms in more than a quarter of the sulfonamide-resistant and sulfonamide-intermediate isolates from swine, dogs and cats. This finding suggests that one or several new resistance mechanisms for sulfonamides may be widespread among E. coli isolates from these animal species. The integrase gene (intI) from class I integrons was detected in a large proportion of resistant isolates in association with the sulI and aadA genes, thus demonstrating the importance of integrons in the epidemiology of resistance in clinical E. coli isolates from animals.

  2. Comparative mapping of powdery mildew resistance gene Pm21 and functional characterization of resistance-related genes in wheat.

    Science.gov (United States)

    He, Huagang; Zhu, Shanying; Jiang, Zhengning; Ji, Yaoyong; Wang, Feng; Zhao, Renhui; Bie, Tongde

    2016-04-01

    The powdery mildew resistance gene Pm21 was physically and comparatively mapped by newly developed markers. Seven candidate genes were verified to be required for Pm21 -mediated resistance to wheat powdery mildew. Pm21, a gene derived from wheat wild relative Dasypyrum villosum, has been transferred into common wheat and widely utilized in wheat resistance breeding for powdery mildew. Previously, Pm21 has been located to the bin FL0.45-0.58 of 6VS by using deletion stocks. However, its fine mapping is still a hard work. In the present study, 30 gene-derived 6VS-specific markers were obtained based on the collinearity among genomes of Brachypodium distachyon, Oryza and Triticeae, and then physically and comparatively mapped in the bin FL0.45-0.58 and its nearby chromosome region. According to the maps, the bin FL0.45-0.58 carrying Pm21 was closely flanked by the markers 6VS-03 and 6VS-23, which further narrowed the orthologous regions to 1.06 Mb in Brachypodium and 1.38 Mb in rice, respectively. Among the conserved genes shared by Brachypodium and rice, four serine/threonine protein kinase genes (DvMPK1, DvMLPK, DvUPK and DvPSYR1), one protein phosphatase gene (DvPP2C) and two transcription factor genes (DvGATA and DvWHY) were confirmed to be required for Pm21-mediated resistance to wheat powdery mildew by barley stripe mosaic virus-induced gene silencing (BSMV-VIGS) and transcriptional pattern analyses. In summary, this study gives new insights into the genetic basis of the Pm21 locus and the disease resistance pathways mediated by Pm21.

  3. Occurrence and Distribution of Antibiotic-resistant Bacteria and Transfer of Resistance Genes in Lake Taihu

    Science.gov (United States)

    Yin, Qian; Yue, Dongmei; Peng, Yuke; Liu, Ying; Xiao, Lin

    2013-01-01

    The overuse of antibiotics has accelerated antibiotic resistance in the natural environment, especially fresh water, generating a potential risk for public health around the world. In this study, antibiotic resistance in Lake Taihu was investigated and this was the first thorough data obtained through culture-dependent methods. High percentages of resistance to streptomycin and ampicillin among bacterial isolates were detected, followed by tetracycline and chloramphenicol. Especially high levels of ampicillin resistance in the western and northern regions were illustrated. Bacterial identification of the isolates selected for further study indicated the prevalence of some opportunistic pathogens and 62.0% of the 78 isolates exhibited multiple antibiotic resistance. The presence of ESBLs genes was in the following sequence: blaTEM > blaSHV > blaCTMX and 38.5% of the isolates had a class I integrase gene. Of all tested strains, 80.8% were able to transfer antibiotic resistance through conjugation. We also concluded that some new families of human-associated ESBLs and AmpC genes can be found in natural environmental isolates. The prevalence of antibiotic resistance and the dissemination of transferable antibiotic resistance in bacterial isolates (especially in opportunistic pathogens) was alarming and clearly indicated the urgency of realizing the health risks of antibiotic resistance to human and animal populations who are dependent on Lake Taihu for water consumption. PMID:24240317

  4. Antibiotic Resistance and Antibiotic Resistance Genes in Escherichia coli Isolates from Hospital Wastewater in Vietnam.

    Science.gov (United States)

    Lien, La Thi Quynh; Lan, Pham Thi; Chuc, Nguyen Thi Kim; Hoa, Nguyen Quynh; Nhung, Pham Hong; Thoa, Nguyen Thi Minh; Diwan, Vishal; Tamhankar, Ashok J; Stålsby Lundborg, Cecilia

    2017-06-29

    The environmental spread of antibiotic-resistant bacteria has been recognised as a growing public health threat for which hospitals play a significant role. The aims of this study were to investigate the prevalence of antibiotic resistance and antibiotic resistance genes (ARGs) in Escherichia coli isolates from hospital wastewater in Vietnam. Wastewater samples before and after treatment were collected using continuous sampling every month over a year. Standard disk diffusion and E-test were used for antibiotic susceptibility testing. Extended-spectrum beta-lactamase (ESBL) production was tested using combined disk diffusion. ARGs were detected by polymerase chain reactions. Resistance to at least one antibiotic was detected in 83% of isolates; multidrug resistance was found in 32%. The highest resistance prevalence was found for co-trimoxazole (70%) and the lowest for imipenem (1%). Forty-three percent of isolates were ESBL-producing, with the bla TEM gene being more common than bla CTX-M . Co-harbouring of the bla CTX-M , bla TEM and qepA genes was found in 46% of isolates resistant to ciprofloxacin. The large presence of antibiotic-resistant E. coli isolates combined with ARGs in hospital wastewater, even post-treatment, poses a threat to public health. It highlights the need to develop effective processes for hospital wastewater treatment plants to eliminate antibiotic resistant bacteria and ARGs.

  5. Antimicrobial resistance and prevalence of resistance genes of obligate anaerobes isolated from periodontal abscesses.

    Science.gov (United States)

    Xie, Yi; Chen, Jiazhen; He, Junlin; Miao, Xinyu; Xu, Meng; Wu, Xingwen; Xu, Beiyun; Yu, Liying; Zhang, Wenhong

    2014-02-01

    This study attempts to determine the antimicrobial resistance profiles of obligate anaerobic bacteria that were isolated from a periodontal abscess and to evaluate the prevalence of resistance genes in these bacteria. Forty-one periodontal abscess samples were cultivated on selective and non-selective culture media to isolate the oral anaerobes. Their antibiotic susceptibilities to clindamycin, doxycycline, amoxicillin, imipenem, cefradine, cefixime, roxithromycin, and metronidazole were determined using the agar dilution method, and polymerase chain reaction assays were performed to detect the presence of the ermF, tetQ, nim, and cfxA drug resistance genes. A total of 60 different bacterial colonies was isolated and identified. All of the isolates were sensitive to imipenem. Of the strains, 6.7%, 13.3%, 16.7%, and 25% were resistant to doxycycline, metronidazole, cefixime, and amoxicillin, respectively. The resistance rate for both clindamycin and roxithromycin was 31.7%. Approximately 60.7% of the strains had the ermF gene, and 53.3% of the amoxicillin-resistant strains were found to have the cfxA gene. Two nim genes that were found in eight metronidazole-resistant strains were identified as nimB. In the present study, the Prevotella species are the most frequently isolated obligate anaerobes from periodontal abscesses. The current results show their alarmingly high resistance rate against clindamycin and roxithromycin; thus, the use of these antibiotics is unacceptable for the empirical therapy of periodontal abscesses. A brief prevalence of four resistance genes in the anaerobic bacteria that were isolated was also demonstrated.

  6. Coumpounds affecting cell membrane functions and integrity: MDR pumps and theit exploration

    Czech Academy of Sciences Publication Activity Database

    Sigler, Karel; Gášková, D.

    2002-01-01

    Roč. 51, č. 24 (2002), s. 19-22 ISSN 0137-1398. [Uroczyste Seminarium z okazji urodzin Profesora Stanislawa Witka /70./. Wroclaw, 21.07.2002] R&D Projects: GA AV ČR IBS5020202; GA MŠk ME 577 Keywords : xenobioticexporting * multidrug resistance * mdr pumps Subject RIV: EE - Microbiology, Virology

  7. Comparative genome analysis and resistance gene mapping in grain legumes

    International Nuclear Information System (INIS)

    Young, N.D.

    1998-01-01

    Using, DNA markers and genome organization, several important disease resistance genes have been analyzed in mungbean (Vigna radiata), cowpea (Vigna unguiculata), common bean (Phaseolus vulgaris), and soybean (Glycine max). In the process, medium-density linkage maps consisting of restriction fragment length polymorphism (RFLP) markers were constructed for both mungbean and cowpea. Comparisons between these maps, as well as the maps of soybean and common bean, indicate that there is significant conservation of DNA marker order, though the conserved blocks in soybean are much shorter than in the others. DNA mapping results also indicate that a gene for seed weight may be conserved between mungbean and cowpea. Using the linkage maps, genes that control bruchid (genus Callosobruchus) and powdery mildew (Erysiphe polygoni) resistance in mungbean, aphid resistance in cowpea (Aphis craccivora), and cyst nematode (Heterodera glycines) resistance in soybean have all been mapped and characterized. For some of these traits resistance was found to be oligogenic and DNA mapping uncovered multiple genes involved in the phenotype. (author)

  8. Virulence-associated genes, antimicrobial resistance and molecular typing of Salmonella Typhimurium strains isolated from swine from 2000 to 2012 in Brazil.

    Science.gov (United States)

    Almeida, F; Medeiros, M I C; Kich, J D; Falcão, J P

    2016-06-01

    The aims of this study were to assess the pathogenic potential, antimicrobial resistance and genotypic diversity of Salmonella Typhimurium strains isolated in Brazil from swine (22) and the surrounding swine environment (5) from 2000 to 2012 and compare them to the profiles of 43 human strains isolated from 1983 to 2010, which had been previously studied. The presence of 12 SPI-1, SPI-2 and plasmid genes was assessed by PCR, the antimicrobial susceptibility to 13 antimicrobials was determined by the disc diffusion assay and genotyping was performed using pulsed-field gel electrophoresis (PFGE), multiple-locus variable-number of tandem repeats analysis (MLVA) and ERIC-PCR. More than 77·8% of the swine strains carried 10 or more of the virulence markers. Ten (37%) strains isolated from swine were multi-drug resistant (MDR). All the molecular typing techniques grouped the strains in two main clusters. Some strains isolated from swine and humans were allocated together in the PFGE-B2, MLVA-A1, MLVA-B and ERIC-A1 clusters. The genotyping results suggest that some strains isolated from swine and humans may descend from a common subtype and may indicate a possible risk of MDR S. Typhimurium with high frequency of virulence genes isolated from swine to contaminate humans in Brazil. This study provided new information about the pathogenic potential, antimicrobial resistance and genotypic diversity of S. Typhimurium isolates from swine origin in Brazil, the fourth largest producer of pigs worldwide. © 2016 The Society for Applied Microbiology.

  9. Antibiotic resistance and resistance genes in Escherichia coli from poultry farms, southwest Nigeria.

    Science.gov (United States)

    Adelowo, Olawale O; Fagade, Obasola E; Agersø, Yvonne

    2014-09-12

    This study investigated the mechanisms of resistance in 36 E. coli isolated from waste, litter, soil and water samples collected from poultry farms in Southwestern Nigeria. Minimum inhibitory concentration (MIC) distributions of the isolates were determined using the methods of the Clinical and Laboratory Standard Institute and resistance genes detected by PCR. A total of 30 isolates (94%) showed resistance to more than one antimicrobial. Percentage resistance was: tetracycline 81%, sulphamethoxazole 67%, streptomycin 56%, trimethoprim 47 %, ciprofloxacin 42%, ampicillin 36%, spectinomycin 28%, nalidixic acid 25%, chloramphenicol 22%, neomycin 14%, gentamicin 8%, amoxicillin-clavulanate, ceftiofur, cefotaxime, colistin, florfenicol and apramycin 0%. Resistance genes found among the isolates include bla-TEM (85%), sul2 (67%), sul3 (17%), aadA (65%), strA (70%), strB (61%), catA1 (25%), cmlA1 (13%), tetA (21%) and tetB (17%). Class 1 and 2 integrons were found in five (14%) and six (17%) isolates, respectively, while one isolate was positive for both classes of integrons. Seven out of eight isolates with resistance to ciprofloxacin and MIC ≤ 32 mg/L to nalidixic acid contained qnrS genes. Our findings provided additional evidence that the poultry production environment in Nigeria represents an important reservoir of antibiotic resistance genes such as qnrS that may spread from livestock production farms to human populations via manure and water.

  10. High chlorpyrifos resistance in Culex pipiens mosquitoes: strong synergy between resistance genes

    Science.gov (United States)

    Alout, H; Labbé, P; Berthomieu, A; Makoundou, P; Fort, P; Pasteur, N; Weill, M

    2016-01-01

    We investigated the genetic determinism of high chlorpyrifos resistance (HCR), a phenotype first described in 1999 in Culex pipiens mosquitoes surviving chlorpyrifos doses ⩾1 mg l−1 and more recently found in field samples from Tunisia, Israel or Indian Ocean islands. Through chlorpyrifos selection, we selected several HCR strains that displayed over 10 000-fold resistance. All strains were homozygous for resistant alleles at two main loci: the ace-1 gene, with the resistant ace-1R allele expressing the insensitive G119S acetylcholinesterase, and a resistant allele of an unknown gene (named T) linked to the sex and ace-2 genes. We constructed a strain carrying only the T-resistant allele and studied its resistance characteristics. By crossing this strain with strains harboring different alleles at the ace-1 locus, we showed that the resistant ace-1R and the T alleles act in strong synergy, as they elicited a resistance 100 times higher than expected from a simple multiplicative effect. This effect was specific to chlorpyrifos and parathion and was not affected by synergists. We also examined how HCR was expressed in strains carrying other ace-1-resistant alleles, such as ace-1V or the duplicated ace-1D allele, currently spreading worldwide. We identified two major parameters that influenced the level of resistance: the number and the nature of the ace-1-resistant alleles and the number of T alleles. Our data fit a model that predicts that the T allele acts by decreasing chlorpyrifos concentration in the compartment targeted in insects. PMID:26463842

  11. Spread of tetracycline resistance genes at a conventional dairy farm

    Directory of Open Access Journals (Sweden)

    Martina eKyselkova

    2015-05-01

    Full Text Available The use of antibiotics in animal husbandry contributes to the worldwide problem of increasing antibiotic resistance in animal and human pathogens. Intensive animal production is considered an important source of antibiotic resistance genes released to the environment, while the contribution of smaller farms remains to be evaluated. Here we monitor the spread of tetracycline resistance (TC-r genes at a middle-size conventional dairy farm, where chlortetracycline (CTC, as intrauterine suppository is prophylactically used after each calving. Our study has shown that animals at the farm acquired the TC-r genes in their early age (1-2 weeks, likely due to colonization with TC-resistant bacteria from their mothers and/or the farm environment. The relative abundance of the TC-r genes tet(W, tet(Q and tet(M in fresh excrements of calves was about 1-2 orders of magnitude higher compared to heifers and dairy cows, possibly due to the presence of antibiotic residues in milk fed to calves. The occurrence and abundance of TC-r genes in fresh excrements of heifers and adult cows remained unaffected by intrauterine CTC applications, with tet(O, tet(Q and tet(W representing a ‘core TC-resistome’ of the farm, and tet(A, tet(M, tet(Y and tet(X occurring occasionally. The genes tet(A, tet(M, tet(Y and tet(X were shown to be respectively harbored by Shigella, Lactobacillus and Clostridium, Acinetobacter, and Wautersiella. Soil in the farm proximity, as well as field soil to which manure from the farm was applied, was contaminated with TC-r genes occurring in the farm, and some of the TC-r genes persisted in the field over 3 months following the manure application. Concluding, our study shows that antibiotic resistance genes may be a stable part of the intestinal metagenome of cattle even if antibiotics are not used for growth stimulation, and that smaller dairy farms may also contribute to environmental pollution with antibiotic resistance genes.

  12. Recessive Resistance to Plant Viruses: Potential Resistance Genes Beyond Translation Initiation Factors

    Directory of Open Access Journals (Sweden)

    Masayoshi Hashimoto

    2016-10-01

    Full Text Available The ability of plant viruses to propagate their genomes in host cells depends on many host factors. In the absence of an agrochemical that specifically targets plant viral infection cycles, one of the most effective methods for controlling viral diseases in plants is taking advantage of the host plant’s resistance machinery. Recessive resistance is conferred by a recessive gene mutation that encodes a host factor critical for viral infection. It is a branch of the resistance machinery and, as an inherited characteristic, is very durable. Moreover, recessive resistance may be acquired by a deficiency in a negative regulator of plant defense responses, possibly due to the autoactivation of defense signaling. Eukaryotic translation initiation factor (eIF 4E and eIF4G and their isoforms are the most widely exploited recessive resistance genes in several crop species, and they are effective against a subset of viral species. However, the establishment of efficient, recessive resistance-type antiviral control strategies against a wider range of plant viral diseases requires genetic resources other than eIF4Es. In this review, we focus on recent advances related to antiviral recessive resistance genes evaluated in model plants and several crop species. We also address the roles of next-generation sequencing and genome editing technologies in improving plant genetic resources for recessive resistance-based antiviral breeding in various crop species.

  13. Prevalence and molecular characterization of pyrazinamide resistance among multidrug-resistant Mycobacterium tuberculosis isolates from Southern China.

    Science.gov (United States)

    Pang, Yu; Zhu, Damian; Zheng, Huiwen; Shen, Jing; Hu, Yan; Liu, Jie; Zhao, Yanlin

    2017-11-06

    Pyrazinamide (PZA) plays a unique role in the treatment for multidrug-resistant tuberculosis (MDR-TB) in both first- and second-line regimens. The aim of this study was to investigate the prevalence and molecular characterization of PZA resistance among MDR-TB isolates collected in Chongqing municipality. A total of 133 MDR-TB isolates were collected from the smear-positive tuberculosis patients who were registered at local TB dispensaries of Chongqing. PZA susceptibility testing was determined with a Bactec MGIT 960 system. In addition, the genes conferring for PZA resistance were screened by DNA sequencing. Of these 133 MDR-TB isolates, 83 (62.4%) were determined as PZA-resistant by MGIT 960. In addition, streptomycin- (83.1% vs. 56.0%, P < 0.01), ofloxacin- (51.8% vs. 18.0%, P < 0.01), kanamycin- (22.9% vs. 2.0%, P < 0.01), amikacin- (18.1% vs. 2.0%, P = 0.01), capromycin-resistance (12.0% vs. 2.0%, P = 0.05), were more frequently observed among PZA-resistant isolates compared with PZA-susceptible isolates. Sequence analysis revealed that 73 out of 83 (88.0%) MDR strains harbored a mutation located in the pncA gene, including 55 (75.3%, 55/73) of single nucleotide substitutions and 18 (24.7%, 18/73) of frameshift mutation, while no genetic mutation associated with PZA resistance was found in the rpsA gene. The pncA expression of strains harboring substitution from A to G at position -11 in the promoter region of pncA was significantly lower than that of H37Rv (P < 0.01). In conclusion, our data have demonstrated that the analysis of the pncA gene rather than rpsA gene provides rapid and accurate information regarding PZA susceptibility for MDR-TB isolates in Chongqing. In addition, loss of pncA expression caused by promoter mutation confers PZA resistance in MDR-TB isolates.

  14. Bacterial metal resistance genes and metal bioavailability in contaminated sediments

    International Nuclear Information System (INIS)

    Roosa, Stéphanie; Wattiez, Ruddy; Prygiel, Emilie; Lesven, Ludovic; Billon, Gabriel; Gillan, David C.

    2014-01-01

    In bacteria a metal may be defined as bioavailable if it crosses the cytoplasmic membrane to reach the cytoplasm. Once inside the cell, specific metal resistance systems may be triggered. In this research, specific metal resistance genes were used to estimate metal bioavailability in sediment microbial communities. Gene levels were measured by quantitative PCR and correlated to metals in sediments using five different protocols to estimate dissolved, particle-adsorbed and occluded metals. The best correlations were obtained with czcA (a Cd/Zn/Co efflux pump) and Cd/Zn adsorbed or occluded in particles. Only adsorbed Co was correlated to czcA levels. We concluded that the measurement of czcA gene levels by quantitative PCR is a promising tool which may complement the classical approaches used to estimate Cd/Zn/Co bioavailability in sediment compartments. - Highlights: • Metal resistance genes were used to estimate metal bioavailability in sediments. • Gene levels were correlated to metals using 5 different metal extraction protocols. • CzcA gene levels determined by quantitative PCR is a promising tool for Cd/Zn/Co. - Capsule Bacterial czcA is a potential biomarker of Cd, Zn and Co bioavailability in aquatic sediments as shown by quantitative PCR and sequential metal extraction

  15. Relation of the Allelic Variants of Multidrug Resistance Gene to Agranulocytosis Associated With Clozapine.

    Science.gov (United States)

    Anıl Yağcioğlu, A Elif; Yoca, Gökhan; Ayhan, Yavuz; Karaca, R Özgür; Çevik, Lokman; Müderrisoğlu, Ahmet; Göktaş, Mustafa T; Eni, Nurhayat; Yazıcı, M Kâzım; Bozkurt, Atilla; Babaoğlu, Melih O

    2016-06-01

    Clozapine use is associated with leukopenia and more rarely agranulocytosis, which may be lethal. The drug and its metabolites are proposed to interact with the multidrug resistance transporter (ABCB1/MDR1) gene product, P-glycoprotein (P-gp). Among various P-glycoprotein genetic polymorphisms, nucleotide changes in exons 26 (C3435T), 21 (G2677T), and 12 (C1236T) have been implicated for changes in pharmacokinetics and pharmacodynamics of many substrate drugs. In this study, we aimed to investigate the association between these specific ABCB1 polymorphisms and clozapine-associated agranulocytosis (CAA). Ten patients with a history of CAA and 91 control patients without a history of CAA, despite 10 years of continuous clozapine use, were included. Patient recruitment and blood sample collection were conducted at the Hacettepe University Faculty of Medicine, Department of Psychiatry, in collaboration with the members of the Schizophrenia and Other Psychotic Disorders Section of the Psychiatric Association of Turkey, working in various psychiatry clinics. After DNA extraction from peripheral blood lymphocytes, genotyping was performed using polymerase chain reaction and endonuclease digestion. Patients with CAA had shorter duration of clozapine use but did not show any significant difference in other clinical, sociodemographic characteristics and in genotypic or allelic distributions of ABCB1 variants and haplotypes compared with control patients. Among the 10 patients with CAA, none carried the ABCB1 all-variant haplotype (TT-TT-TT), whereas the frequency of this haplotype was approximately 12% among the controls. Larger sample size studies and thorough genetic analyses may reveal both genetic risk and protective factors for this serious adverse event.

  16. Sponge Microbiota are a Reservoir of Functional Antibiotic Resistance Genes

    DEFF Research Database (Denmark)

    Versluis, Dennis; de Evgrafov, Mari Cristina Rodriguez; Sommer, Morten Otto Alexander

    2016-01-01

    examined sponges as a reservoir of antibiotic resistance. Sponges could be important in this respect because they often contain diverse microbial communities that have the capacity to produce bioactive metabolites. Here, we applied functional metagenomics to study the presence and diversity of functional...... resistance genes in the sponges Aplysina aerophoba, Petrosia ficiformis, and Corticium candelabrum. We obtained 37 insert sequences facilitating resistance to D-cycloserine (n = 6), gentamicin (n = 1), amikacin (n = 7), trimethoprim (n = 17), chloramphenicol (n = 1), rifampicin (n = 2) and ampicillin (n = 3......-resistance-conferring β-lactamase was identified in the genus Pseudovibrio with 41% global amino acid identity to the closest β-lactamase with demonstrated functionality, and subsequently classified into a new family termed PSV. Taken together, our results show that sponge microbiota host diverse and novel resistance...

  17. Tagging of resistance gene(s) to rhizomania disease in sugar beet ...

    African Journals Online (AJOL)

    SERVER

    2008-02-19

    Feb 19, 2008 ... plasmodiophoride-like fungus, Polymyxa betae Keskin. (1964) (Tamada and Richard, 1992). Source of resistance to rhizomania were found in Holly sugar beet company source (Lewellen, 1987). Resistance in Holly is simply inherited by a single dominant gene(Rz1). (Lewellen et al., 1987; Scholten et al., ...

  18. Tagging of resistance gene(s) to rhizomania disease in sugar beet ...

    African Journals Online (AJOL)

    The rhizomania disease is one of the most important diseases in Iran and some other parts of the world which potentially could play a role in decreasing sugar yield in fields. One approach to combat with this disease is the use of resistance varieties. This varieties have been identified which are having resistance genes to ...

  19. Major Gene for Field Stem Rust Resistance Co-Locates with Resistance Gene Sr12 in 'Thatcher' Wheat.

    Science.gov (United States)

    Hiebert, Colin W; Kolmer, James A; McCartney, Curt A; Briggs, Jordan; Fetch, Tom; Bariana, Harbans; Choulet, Frederic; Rouse, Matthew N; Spielmeyer, Wolfgang

    2016-01-01

    Stem rust, caused by Puccinia graminis (Pgt), is a damaging disease of wheat that can be controlled by utilizing effective stem rust resistance genes. 'Thatcher' wheat carries complex resistance to stem rust that is enhanced in the presence of the resistance gene Lr34. The purpose of this study was to examine APR in 'Thatcher' and look for genetic interactions with Lr34. A RIL population was tested for stem rust resistance in field nurseries in Canada, USA, and Kenya. BSA was used to find SNP markers associated with reduced stem rust severity. A major QTL was identified on chromosome 3BL near the centromere in all environments. Seedling testing showed that Sr12 mapped to the same region as the QTL for APR. The SNP markers were physically mapped and the region carrying the resistance was searched for sequences with homology to members of the NB-LRR resistance gene family. SNP marker from one NB-LRR-like sequence, NB-LRR3 co-segregated with Sr12. Two additional populations, including one that lacked Lr34, were tested in field nurseries. NB-LRR3 mapped near the maximum LOD for reduction in stem rust severity in both populations. Lines from a population that segregated for Sr12 and Lr34 were tested for seedling Pgt biomass and infection type, as well as APR to field stem rust which showed an interaction between the genes. We concluded that Sr12, or a gene closely linked to Sr12, was responsible for 'Thatcher'-derived APR in several environments and this resistance was enhanced in the presence of Lr34.

  20. Major Gene for Field Stem Rust Resistance Co-Locates with Resistance Gene Sr12 in ‘Thatcher’ Wheat

    Science.gov (United States)

    Hiebert, Colin W.; Kolmer, James A.; McCartney, Curt A.; Briggs, Jordan; Fetch, Tom; Bariana, Harbans; Choulet, Frederic; Rouse, Matthew N.; Spielmeyer, Wolfgang

    2016-01-01

    Stem rust, caused by Puccinia graminis (Pgt), is a damaging disease of wheat that can be controlled by utilizing effective stem rust resistance genes. ‘Thatcher’ wheat carries complex resistance to stem rust that is enhanced in the presence of the resistance gene Lr34. The purpose of this study was to examine APR in ‘Thatcher’ and look for genetic interactions with Lr34. A RIL population was tested for stem rust resistance in field nurseries in Canada, USA, and Kenya. BSA was used to find SNP markers associated with reduced stem rust severity. A major QTL was identified on chromosome 3BL near the centromere in all environments. Seedling testing showed that Sr12 mapped to the same region as the QTL for APR. The SNP markers were physically mapped and the region carrying the resistance was searched for sequences with homology to members of the NB-LRR resistance gene family. SNP marker from one NB-LRR-like sequence, NB-LRR3 co-segregated with Sr12. Two additional populations, including one that lacked Lr34, were tested in field nurseries. NB-LRR3 mapped near the maximum LOD for reduction in stem rust severity in both populations. Lines from a population that segregated for Sr12 and Lr34 were tested for seedling Pgt biomass and infection type, as well as APR to field stem rust which showed an interaction between the genes. We concluded that Sr12, or a gene closely linked to Sr12, was responsible for ‘Thatcher’-derived APR in several environments and this resistance was enhanced in the presence of Lr34. PMID:27309724

  1. Global transcriptional profiling of longitudinal clinical isolates of Mycobacterium tuberculosis exhibiting rapid accumulation of drug resistance.

    Directory of Open Access Journals (Sweden)

    Anirvan Chatterjee

    Full Text Available The identification of multidrug resistant (MDR, extensively and totally drug resistant Mycobacterium tuberculosis (Mtb, in vulnerable sites such as Mumbai, is a grave threat to the control of tuberculosis. The current study aimed at explaining the rapid expression of MDR in Directly Observed Treatment Short Course (DOTS compliant patients, represents the first study comparing global transcriptional profiles of 3 pairs of clinical Mtb isolates, collected longitudinally at initiation and completion of DOTS. While the isolates were drug susceptible (DS at onset and MDR at completion of DOTS, they exhibited identical DNA fingerprints at both points of collection. The whole genome transcriptional analysis was performed using total RNA from H37Rv and 3 locally predominant spoligotypes viz. MANU1, CAS and Beijing, hybridized on MTBv3 (BuG@S microarray, and yielded 36, 98 and 45 differentially expressed genes respectively. Genes encoding transcription factors (sig, rpoB, cell wall biosynthesis (emb genes, protein synthesis (rpl and additional central metabolic pathways (ppdK, pknH, pfkB were found to be down regulated in the MDR isolates as compared to the DS isolate of the same genotype. Up regulation of drug efflux pumps, ABC transporters, trans-membrane proteins and stress response transcriptional factors (whiB in the MDR isolates was observed. The data indicated that Mtb, without specific mutations in drug target genes may persist in the host due to additional mechanisms like drug efflux pumps and lowered rate of metabolism. Furthermore this population of Mtb, which also showed reduced DNA repair activity, would result in selection and stabilization of spontaneous mutations in drug target genes, causing selection of a MDR strain in the presence of drug pressures. Efflux pump such as drrA may play a significant role in increasing fitness of low level drug resistant cells and assist in survival of Mtb till acquisition of drug resistant mutations with

  2. Molecular Characterization of Multidrug Resistant Uropathogenic E. Coli Isolates from Jordanian Patients.

    Science.gov (United States)

    Nairoukh, Yacoub R; Mahafzah, Azmi M; Irshaid, Amal; Shehabi, Asem A

    2018-01-01

    Emergence of multi-drug resistant uropathogenic E. coli strains is an increasing problem to empirical treatment of urinary tract infections in many countries. This study investigated the magnitude of this problem in Jordan. A total of 262 E. coli isolates were recovered from urine samples of Jordanian patients which were suspected to have urinary tract infections (UTIs). All isolates were primarily identified by routine biochemical tests and tested for antimicrobial susceptibility by disc diffusion method. Fifty representative Multidrug Resistance (MDR) E. coli isolates to 3 or more antibiotic classes were tested for the presence of resistance genes of blaCTX-M- 1, 9 and 15, carbapenemase ( blaIMP, blaVIM, blaNDM-1, blaOXA-48 ), fluoroquinolones mutated genes ( parC and gyrA ) and clone of ST131 type using PCR methods. A total of 150/262 (57.3%) of E. coli isolates were MDR. Urine samples of hospitalized patients showed significantly more MDR isolates than outpatients. Fifty representative MDR E. coli isolates indicated the following molecular characteristics: All were positive for mutated parC gene and gyrA and for ST131 clone, and 78% were positive for genes of CTX-M-15 , 76% for CTX-M-I and for 8% CTX-M-9 , respectively. Additionally, all 50 MDR E. coli isolates were negative for carbapenemase genes ( blaIMP, blaVIM, blaNDM-1, blaOXA-48 ), except of one isolate was positive for blaKPC-2 . This study indicates alarming high rates recovery of MDR uropathogenic E. coli from Jordanian patients associated with high rates of positive ST131 clone, fluoroquinolone resistant and important types of blaCTX-M.

  3. Conserved hydrogen bonds and water molecules in MDR HIV-1 protease substrate complexes

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Zhigang [Wayne State Univ., Detroit, MI (United States); Case Western Reserve Univ., Cleveland, OH (United States); Harbor Hospital Baltimore, MD (United States); Wang, Yong [Wayne State Univ., Detroit, MI (United States); Yedidi, Ravikiran S. [Wayne State Univ., Detroit, MI (United States); National Institutes of Health, Bethesda, MD (United States); Dewdney, Tamaria G. [Wayne State Univ., Detroit, MI (United States); Reiter, Samuel J. [Wayne State Univ., Detroit, MI (United States); Brunzelle, Joseph S. [Northwestern Univ. Feinberg School of Medicine, Chicago, IL (United States); Kovari, Iulia A. [Wayne State Univ., Detroit, MI (United States); Kovari, Ladislau C. [Wayne State Univ., Detroit, MI (United States)

    2012-12-19

    Success of highly active antiretroviral therapy (HAART) in anti-HIV therapy is severely compromised by the rapidly developing drug resistance. HIV-1 protease inhibitors, part of HAART, are losing their potency and efficacy in inhibiting the target. Multi-drug resistant (MDR) 769 HIV-1 protease (resistant mutations at residues 10, 36, 46, 54, 62, 63, 71, 82, 84, 90) was selected for the present study to understand the binding to its natural substrates. The nine crystal structures of MDR769 HIV-1 protease substrate hepta-peptide complexes were analyzed in order to reveal the conserved structural elements for the purpose of drug design against MDR HIV-1 protease. Our structural studies demonstrated that highly conserved hydrogen bonds between the protease and substrate peptides, together with the conserved crystallographic water molecules, played a crucial role in the substrate recognition, substrate stabilization and protease stabilization. Additionally, the absence of the key flap-ligand bridging water molecule might imply a different catalytic mechanism of MDR769 HIV-1 protease compared to that of wild type (WT) HIV-1 protease.

  4. Management and treatment outcomes of patients enrolled in MDR-TB treatment in Viet Nam.

    Science.gov (United States)

    Phuong, N T M; Nhung, N V; Hoa, N B; Thuy, H T; Takarinda, K C; Tayler-Smith, K; Harries, A D

    2016-03-21

    The programmatic management of drug-resistant tuberculosis (TB) in Viet Nam has been rapidly scaled up since 2009. To document the annual numbers of patients enrolled for multidrug-resistant tuberculosis (MDR-TB) treatment during 2010-2014 and to determine characteristics and treatment outcomes of patients initiating treatment during 2010-2012. A retrospective cohort study using national reports and data from the national electronic data system for drug-resistant TB. The number of patients enrolled annually for MDR-TB treatment increased from 97 in 2010 to 1522 in 2014. The majority of patients were middle-aged men who had pulmonary disease and had failed a retreatment regimen; 77% had received ⩾2 courses of TB treatment. Favourable outcomes (cured and treatment completed) were attained in 73% of patients. Unfavourable outcomes included loss to follow-up (12.5%), death (8%) and failure (6.3%). Having had ⩾2 previous treatment courses and being human immunodeficiency virus-positive were associated with unfavourable outcomes. Increasing numbers of patients are being treated for MDR-TB each year with good treatment outcomes under national programme management in Viet Nam. However, there is a need to increase case detection-currently at 30% of the estimated 5100 MDR-TB cases per year, reduce adverse outcomes and improve monitoring and evaluation.

  5. Resistance-related gene transcription and antioxidant enzyme ...

    African Journals Online (AJOL)

    The two tobacco relatives of Nicotiana alata and Nicotiana longiflora display a high level of resistance against Colletotrichum nicotianae and the two genes NTF6 and NtPAL related to pathogen defense transcription were higher in N. alata and N. longiflora than the commercial cv. K326. Inoculation with C. nicotianae ...

  6. Antibiotic resistance and ndvB gene expression among biofilm ...

    African Journals Online (AJOL)

    A novel antibiotic resistant mechanism among biofilms is glucan-mediated sequestration in which ndvB gene encodes a glucosyltransferase involved in the formation of this glucans. We studied the biofilm formation and antibiotic susceptibility pattern of P. aeruginosa isolated from clinical samples, and measured the ...

  7. Gene pyramiding as a Bt resistance management strategy: How ...

    African Journals Online (AJOL)

    Reports on the emergence of insect resistance to Bacillus thuringiensis delta endotoxins have raised doubts on the sustainability of Bt-toxin based pest management technologies. Corporate industry has responded to this challenge with innovations that include gene pyramiding among others. Pyramiding entails stacking ...

  8. Prevalence, antibiotic-resistance properties and enterotoxin gene ...

    African Journals Online (AJOL)

    milk-based infant foods in Iran, represent an important public health issue which should be considered ... Keywords: Prevalence, Bacillus cereus, Antibiotic resistance, Enterotoxigenic genes, Milk-based infant food. Tropical Journal of Pharmaceutical Research is indexed by Science ..... and cereals collected in Korea.

  9. Spatial patterns of Antimicrobial Resistance Genes in Danish Pig Farms

    DEFF Research Database (Denmark)

    Birkegård, Anna Camilla; Ersbøll, A. K.; Hisham Beshara Halasa, Tariq

    2016-01-01

    antimicrobial resistance genes, ermB, ermF, sulI, sulII, tet(M), tet(O) and tet(W), was quantified by a high-throughput qPCR. It was evaluated whether the sample method resulted in a study population representative of Danish pig farms with finishers where it was found that the study population was biased...

  10. Molecular Detection of Virulence Genes and Antibiotic Resistance ...

    African Journals Online (AJOL)

    Escherichia coli O157:H7 is an important food-borne pathogen that can cause diarrhea, haemorrhagic colitis and haemolytic uremic syndrome. This study was conducted to investigate the prevalence, virulence genes and antibiotic resistance patterns of E. coli O157:H7 in raw beef meat sold in Abeokuta, South west Nigeria ...

  11. Putative resistance genes in the CitEST database

    Directory of Open Access Journals (Sweden)

    Simone Guidetti-Gonzalez

    2007-01-01

    Full Text Available Disease resistance in plants is usually associated with the activation of a wide variety of defense responses to prevent pathogen replication and/or movement. The ability of the host plant to recognize the pathogen and to activate defense responses is regulated by direct or indirect interaction between the products of plant resistance (R and pathogen avirulence (Avr genes. Attempted infection of plants by avirulent pathogens elicits a battery of defenses often followed by the collapse of the challenged host cells. Localized host cell death may help to prevent the pathogen from spreading to uninfected tissues, known as hypersensitive response (HR. When either the plant or the pathogen lacks its cognate gene, activation of the plant’s defense responses fails to occur or is delayed and does not prevent pathogen colonization. In the CitEST database, we identified 1,300 reads related to R genes in Citrus which have been reported in other plant species. These reads were translated in silico, and alignments of their amino acid sequences revealed the presence of characteristic domains and motifs that are specific to R gene classes. The description of the reads identified suggests that they function as resistance genes in citrus.

  12. The multidrug resistance 1 gene Abcb1 in brain and placenta: comparative analysis in human and guinea pig.

    Science.gov (United States)

    Pappas, Jane J; Petropoulos, Sophie; Suderman, Matthew; Iqbal, Majid; Moisiadis, Vasilis; Turecki, Gustavo; Matthews, Stephen G; Szyf, Moshe

    2014-01-01

    The Multidrug Resistance 1 (MDR1; alternatively ABCB1) gene product P-glycoprotein (P-gp), an ATP binding cassette transporter, extrudes multiple endogenous and exogenous substrates from the cell, playing an important role in normal physiology and xenobiotic distribution and bioavailability. To date, the predominant animal models used to investigate the role of P-gp have been the mouse and rat, which have two distinct genes, Abcb1a and Abcb1b. In contrast, the human has a single gene, ABCB1, for which only a single isoform has been validated. We and others have previously shown important differences between Abcb1a and Abcb1b, limiting the extrapolation from rodent findings to the human. Since the guinea pig has a relatively long gestation, hemomonochorial placentation and neuroanatomically mature offspring, it is more similar to the human, and may provide a more comparable model for investigating the regulation of P-gp in the brain and placenta, however, to date, the Abcb1 gene in the guinea pig remains to be characterized. The placenta and fetal brain are barrier sites that express P-gp and that play a critical role of protection of the fetus and the fetal brain from maternally administered drugs and other xenobiotics. Using RNA sequencing (RNA-seq), reverse transcription-polymerase chain reaction (RT-PCR) and quantitative PCR (QPCR) to sequence the expressed isoforms of guinea pig Abcb1, we demonstrate that like the human, the guinea pig genome contains one gene for Abcb1 but that it is expressed as at least three different isoforms via alternative splicing and alternate exon usage. Further, we demonstrate that these isoforms are more closely related to human than to rat or mouse isoforms. This striking, overall similarity and evolutionary relatedness between guinea pig Abcb1 and human ABCB1 indicate that the guinea pig represents a relevant animal model for investigating the function and regulation of P-gp in the placenta and brain.

  13. Identification of antimicrobial resistance genes in multidrug-resistant clinical Bacteroides fragilis isolates by whole genome shotgun sequencing

    DEFF Research Database (Denmark)

    Sydenham, Thomas Vognbjerg; Sóki, József; Hasman, Henrik

    2015-01-01

    Bacteroides fragilis constitutes the most frequent anaerobic bacterium causing bacteremia in humans. The genetic background for antimicrobial resistance in B. fragilis is diverse with some genes requiring insertion sequence (IS) elements inserted upstream for increased expression. To evaluate whole...... genome shotgun sequencing as a method for predicting antimicrobial resistance properties, one meropenem resistant and five multidrug-resistant blood culture isolates were sequenced and antimicrobial resistance genes and IS elements identified using ResFinder 2.1 (http...

  14. Multidrug-resistant tuberculosis in Europe, 2010-2011

    DEFF Research Database (Denmark)

    Günther, Gunar; van Leth, Frank; Alexandru, Sofia

    2015-01-01

    Drug-resistant Mycobacterium tuberculosis is challenging elimination of tuberculosis (TB). We evaluated risk factors for TB and levels of second-line drug resistance in M. tuberculosis in patients in Europe with multidrug-resistant (MDR) TB. A total of 380 patients with MDR TB and 376 patients...... with non-MDR TB were enrolled at 23 centers in 16 countries in Europe during 2010-2011. A total of 52.4% of MDR TB patients had never been treated for TB, which suggests primary transmission of MDR M. tuberculosis. At initiation of treatment for MDR TB, 59.7% of M. tuberculosis strains tested were...

  15. Anthropogenic antibiotic resistance genes mobilization to the polar regions.

    Science.gov (United States)

    Hernández, Jorge; González-Acuña, Daniel

    2016-01-01

    Anthropogenic influences in the southern polar region have been rare, but lately microorganisms associated with humans have reached Antarctica, possibly from military bases, fishing boats, scientific expeditions, and/or ship-borne tourism. Studies of seawater in areas of human intervention and proximal to fresh penguin feces revealed the presence of Escherichia coli strains least resistant to antibiotics in penguins, whereas E. coli from seawater elsewhere showed resistance to one or more of the following antibiotics: ampicillin, tetracycline, streptomycin, and trim-sulfa. In seawater samples, bacteria were found carrying extended-spectrum β-lactamase (ESBL)-type CTX-M genes in which multilocus sequencing typing (MLST) showed different sequence types (STs), previously reported in humans. In the Arctic, on the contrary, people have been present for a long time, and the presence of antibiotic resistance genes (ARGs) appears to be much more wide-spread than was previously reported. Studies of E coli from Arctic birds (Bering Strait) revealed reduced susceptibility to antibiotics, but one globally spreading clone of E. coli genotype O25b-ST131, carrying genes of ESBL-type CTX-M, was identified. In the few years between sample collections in the same area, differences in resistance pattern were observed, with E. coli from birds showing resistance to a maximum of five different antibiotics. Presence of resistance-type ESBLs (TEM, SHV, and CTX-M) in E. coli and Klebsiella pneumoniae was also confirmed by specified PCR methods. MLST revealed that those bacteria carried STs that connect them to previously described strains in humans. In conclusion, bacteria previously related to humans could be found in relatively pristine environments, and presently human-associated, antibiotic-resistant bacteria have reached a high global level of distribution that they are now found even in the polar regions.

  16. Regulation of multidrug resistance by microRNAs in anti-cancer therapy

    Directory of Open Access Journals (Sweden)

    Xin An

    2017-01-01

    Full Text Available Multidrug resistance (MDR remains a major clinical obstacle to successful cancer treatment. Although diverse mechanisms of MDR have been well elucidated, such as dysregulation of drugs transporters, defects of apoptosis and autophagy machinery, alterations of drug metabolism and drug targets, disrupti on of redox homeostasis, the exact mechanisms of MDR in a specific cancer patient and the cross-talk among these different mechanisms and how they are regulated are poorly understood. MicroRNAs (miRNAs are a new class of small noncoding RNAs that could control the global activity of the cell by post-transcriptionally regulating a large variety of target genes and proteins expression. Accumulating evidence shows that miRNAs play a key regulatory role in MDR through modulating various drug resistant mechanisms mentioned above, thereby holding much promise for developing novel and more effective individualized therapies for cancer treatment. This review summarizes the various MDR mechanisms and mainly focuses on the role of miRNAs in regulating MDR in cancer treatment.

  17. Relationship between Psidium species (Myrtaceae) by resistance gene analog markers: focus on nematode resistance.

    Science.gov (United States)

    Noia, L R; Tuler, A C; Ferreira, A; Ferreira, M F S

    2017-03-16

    Guava (Psidium guajava L.) crop is severely affected by the nematode Meloidogyne enterolobii. Native Psidium species have been reported as sources of resistance against this nematode. Knowledge on the molecular relationship between Psidium species based on plant resistance gene analogs (RGA) can be useful in the genetic breeding of guava for resistance to M. enterolobii. In this study, RGA markers from conserved domains, and structural features of plant R genes, were employed to characterize Psidium species and establish genetic proximity, with a focus on nematode resistance. SSR markers were also applied owing to their neutral nature, thus differing from RGA markers. For this, species reported as sources of resistance to M. enterolobii, such as P. cattleianum and P. friedrichsthalianum, as well as species occurring in the Atlantic Rainforest and susceptible genotypes, were investigated. In 10 evaluated Psidium species, high interspecific genetic variability was verified through RGA and SSR markers, with intraspecific variation in P. guajava higher with SSR, as was expected. Resistant species were clustered by RGA markers, and differential amplicons among genotypes resistant and susceptible to M. enterolobii were identified. Knowledge on the molecular relationships between Psidium species constitutes useful information for breeding of the guava tree, providing direction for hybridization and material for rootstocks. Additionally, the genetic relationship between native species, which have been little studied, and P. guajava were estimated by RGAs, which were confirmed as important markers for genetic diversity related to pathogen resistance.

  18. Use of GenoType® MTBDRplus assay to assess drug resistance and mutation patterns of multidrug-resistant tuberculosis isolates in northern India

    Directory of Open Access Journals (Sweden)

    A K Maurya

    2013-01-01

    Full Text Available Purpose: The emergence and spread of multidrug-resistant tuberculosis (MDR-TB is a major public health problem. The diagnosis of MDR-TB is of paramount importance in establishing appropriate clinical management and infection control measures. The aim of this study was to evaluate drug resistance and mutational patterns in clinical isolates MDR-TB by GenoType® MTBDRplus assay. Material and Methods: A total of 350 non-repeated sputum specimens were collected from highly suspected drug-resistant pulmonary tuberculosis (PTB cases; which were processed by microscopy, culture, differentiation and first line drug susceptibility testing (DST using BacT/ALERT 3D system. Results: Among a total of 125 mycobacterium tuberculosis complex (MTBC strains, readable results were obtained from 120 (96% strains by GenoType® MTBDRplus assay. Only 45 MDR-TB isolates were analysed for the performance, frequency and mutational patterns by GenoType® MTBDRplus assay. The sensitivity of the GenoType® MDRTBplus assay for detecting individual resistance to rifampicin (RIF, isoniazid (INH and multidrug resistance was found to be 95.8%, 96.3% and 97.7%, respectively. Mutation in codon S531L of the rpoB gene and codon S315T1 of katG genes were dominated in MDR-TB strains, respectively (P < 0.05. Conclusions: The GenoType® MTBDRplus assay is highly sensitive with short turnaround times and a rapid test for the detection of the most common mutations conferring resistance in MDR-TB strains that can readily be included in a routine laboratory workflow.

  19. Isolation and in vitro evaluation of bacteriophages against MDR-bacterial isolates from septic wound infections.

    Directory of Open Access Journals (Sweden)

    Roja Rani Pallavali

    Full Text Available Multi-drug resistance has become a major problem for the treatment of pathogenic bacterial infections. The use of bacteriophages is an attractive approach to overcome the problem of drug resistance in several pathogens that cause fatal diseases. Our study aimed to isolate multi drug resistant bacteria from patients with septic wounds and then isolate and apply bacteriophages in vitro as alternative therapeutic agents. Pus samples were aseptically collected from Rajiv Gandhi Institute of Medical Science (RIMS, Kadapa, A.P., and samples were analyzed by gram staining, evaluating morphological characteristics, and biochemical methods. MDR-bacterial strains were collected using the Kirby-Bauer disk diffusion method against a variety of antibiotics. Bacteriophages were collected and tested in vitro for lytic activity against MDR-bacterial isolates. Analysis of the pus swab samples revealed that the most of the isolates detected had Pseudomonas aeruginosa as the predominant bacterium, followed by Staphylococcus aureus, Klebsiella pneumoniae and Escherichia coli. Our results suggested that gram-negative bacteria were more predominant than gram-positive bacteria in septic wounds; most of these isolates were resistant to ampicillin, amoxicillin, penicillin, vancomycin and tetracycline. All the gram-positive isolates (100% were multi-drug resistant, whereas 86% of the gram-negative isolates had a drug resistant nature. Further bacteriophages isolated from sewage demonstrated perfect lytic activity against the multi-drug resistant bacteria causing septic wounds. In vitro analysis of the isolated bacteriophages demonstrated perfect lysis against the corresponding MDR-bacteria, and these isolated phages may be promising as a first choice for prophylaxis against wound sepsis, Moreover, phage therapy does not enhance multi-drug resistance in bacteria and could work simultaneously on a wide variety of MDR-bacteria when used in a bacteriophage cocktail. Hence

  20. Polymorphisms in Plasmodium falciparum chloroquine resistance transporter and multidrug resistance 1 genes

    DEFF Research Database (Denmark)

    Venkatesan, Meera; Gadalla, Nahla B; Stepniewska, Kasia

    2014-01-01

    Adequate clinical and parasitologic cure by artemisinin combination therapies relies on the artemisinin component and the partner drug. Polymorphisms in the Plasmodium falciparum chloroquine resistance transporter (pfcrt) and P. falciparum multidrug resistance 1 (pfmdr1) genes are associated...... with decreased sensitivity to amodiaquine and lumefantrine, but effects of these polymorphisms on therapeutic responses to artesunate-amodiaquine (ASAQ) and artemether-lumefantrine (AL) have not been clearly defined. Individual patient data from 31 clinical trials were harmonized and pooled by using standardized...

  1. Recombination Rate Heterogeneity within Arabidopsis Disease Resistance Genes.

    Science.gov (United States)

    Choi, Kyuha; Reinhard, Carsten; Serra, Heïdi; Ziolkowski, Piotr A; Underwood, Charles J; Zhao, Xiaohui; Hardcastle, Thomas J; Yelina, Nataliya E; Griffin, Catherine; Jackson, Matthew; Mézard, Christine; McVean, Gil; Copenhaver, Gregory P; Henderson, Ian R

    2016-07-01

    Meiotic crossover frequency varies extensively along chromosomes and is typically concentrated in hotspots. As recombination increases genetic diversity, hotspots are predicted to occur at immunity genes, where variation may be beneficial. A major component of plant immunity is recognition of pathogen Avirulence (Avr) effectors by resistance (R) genes that encode NBS-LRR domain proteins. Therefore, we sought to test whether NBS-LRR genes would overlap with meiotic crossover hotspots using experimental genetics in Arabidopsis thaliana. NBS-LRR genes tend to physically cluster in plant genomes; for example, in Arabidopsis most are located in large clusters on the south arms of chromosomes 1 and 5. We experimentally mapped 1,439 crossovers within these clusters and observed NBS-LRR gene associated hotspots, which were also detected as historical hotspots via analysis of linkage disequilibrium. However, we also observed NBS-LRR gene coldspots, which in some cases correlate with structural heterozygosity. To study recombination at the fine-scale we used high-throughput sequencing to analyze ~1,000 crossovers within the RESISTANCE TO ALBUGO CANDIDA1 (RAC1) R gene hotspot. This revealed elevated intragenic crossovers, overlapping nucleosome-occupied exons that encode the TIR, NBS and LRR domains. The highest RAC1 recombination frequency was promoter-proximal and overlapped CTT-repeat DNA sequence motifs, which have previously been associated with plant crossover hotspots. Additionally, we show a significant influence of natural genetic variation on NBS-LRR cluster recombination rates, using crosses between Arabidopsis ecotypes. In conclusion, we show that a subset of NBS-LRR genes are strong hotspots, whereas others are coldspots. This reveals a complex recombination landscape in Arabidopsis NBS-LRR genes, which we propose results from varying coevolutionary pressures exerted by host-pathogen relationships, and is influenced by structural heterozygosity.

  2. Mapping fusiform rust resistance genes within a complex mating design of loblolly pine

    Science.gov (United States)

    Tania Quesada; Marcio F.R. Resende Jr.; Patricio Munoz; Jill L. Wegrzyn; David B. Neale; Matias Kirst; Gary F. Peter; Salvador A. Gezan; C.Dana Nelson; John M. Davis

    2014-01-01

    Fusiform rust resistance can involve gene-for-gene interactions where resistance (Fr) genes in the host interact with corresponding avirulence genes in the pathogen, Cronartium quercuum f.sp. fusiforme (Cqf). Here, we identify trees with Fr genes in a loblolly pine population derived from a complex mating design challenged with two Cqf inocula (one gall and 10 gall...

  3. FLT3-ITD and MLL-PTD influence the expression of MDR-1, MRP-1, and BCRP mRNA but not LRP mRNA assessed with RQ-PCR method in adult acute myeloid leukemia.

    Science.gov (United States)

    Nasilowska-Adamska, Barbara; Solarska, Iwona; Paluszewska, Monika; Malinowska, Iwona; Jedrzejczak, Wieslaw W; Warzocha, Krzysztof

    2014-04-01

    Fms-like tyrosine kinase 3-internal tandem duplication (FLT3-ITD) and mixed-lineage leukemia gene-partial tandem duplication (MLL-PTD) are aberrations associated with leukemia which indicate unsatisfactory prognosis. Downstream regulatory targets of FLT3-ITD and MLL-PTD are not well defined. We have analyzed the expression of MDR-1, multidrug resistant protein-1 (MRP-1), breast cancer resistance protein (BCRP), and lung resistance protein (LRP) messenger RNA (mRNA) in relation to the mutational status of FLT3-ITD and MLL-PTD in 185 acute myeloid leukemia (AML) adult patients. The real-time quantitative polymerase chain reaction method was performed to assess the expression of the MDR-1, MRP-1, BCRP, and LRP mRNA, and the results were presented as coefficients calculated using an intermediate method according to Pfaffl's rule. Significantly higher expressions of MDR-1 mRNA were found in patients who did not harbor FLT3-ITD (0.20 vs. 0.05; p = 0.0001) and MRP-1 mRNA in patients with this mutation (0.96 vs. 0.70; p = 0.002) and of BCRP mRNA in patients with MLL-PTD (0.61 vs. 0.38; p = 0.03). In univariate analysis, the high expression of MDR-1 mRNA (≥0.1317) negatively influenced the outcome of induction therapy (p = 0.05), whereas the high expression of BCRP mRNA (≥1.1487) was associated with a high relapse rate (RR) (p = 0.013). We found that the high expression of MDR-1 (≥0.1317), MRP-1 (≥0.8409), and BCRP mRNA (≥1.1487) significantly influenced disease-free survival (DFS; p = 0.059, 0.032, and 0.009, respectively) and overall survival (0.048, 0.014, and 0.059, respectively). Moreover, a high expression of BCRP mRNA (≥1.1487) proved to be an independent prognostic factor for RR (p = 0.01) and DFS (p = 0.002) in multivariate analysis. The significant correlation between the expression of MDR-1, MRP-1, and BCRP mRNA and FLT3-ITD or MLL-PTD in AML patients requires further investigation.

  4. Beyond cellular detoxification: a plethora of physiological roles for MDR transporter homologs in plants

    Science.gov (United States)

    Remy, Estelle; Duque, Paula

    2014-01-01

    Higher plants possess a multitude of Multiple Drug Resistance (MDR) transporter homologs that group into three distinct and ubiquitous families—the ATP-Binding Cassette (ABC) superfamily, the Major Facilitator Superfamily (MFS), and the Multidrug And Toxic compound Extrusion (MATE) family. As in other organisms, such as fungi, mammals, and bacteria, MDR transporters make a primary contribution to cellular detoxification processes in plants, mainly through the extrusion of toxic compounds from the cell or their sequestration in the central vacuole. This review aims at summarizing the currently available information on the in vivo roles of MDR transporters in plant systems. Taken together, these data clearly indicate that the biological functions of ABC, MFS, and MATE carriers are not restricted to xenobiotic and metal detoxification. Importantly, the activity of plant MDR transporters also mediates biotic stress resistance and is instrumental in numerous physiological processes essential for optimal plant growth and development, including the regulation of ion homeostasis and polar transport of the phytohormone auxin. PMID:24910617

  5. Spread of tetracycline resistance genes at a conventional dairy farm

    Czech Academy of Sciences Publication Activity Database

    Kyselková, Martina; Jirout, Jiří; Vrchotová, Naděžda; Schmitt, H.; Elhottová, Dana

    2015-01-01

    Roč. 6, may (2015), s. 536 ISSN 1664-302X R&D Projects: GA ČR GAP504/10/2077; GA MŠk(CZ) EE2.3.30.0032; GA MŠk(CZ) LO1415 Institutional support: RVO:67179843 ; RVO:60077344 Keywords : antibiotic resistance spread * animal manure * cattle intestinal microflora * chlortetracycline * dairy cattle * dairy farm * heavy metals * tetracycline resistance genes Subject RIV: EI - Biotechnology ; Bionics; EE - Microbiology, Virology (BC-A) Impact factor: 4.165, year: 2015

  6. Using SNP genetic markers to elucidate the linkage of the Co-34/Phg-3 anthracnose and angular leaf spot resistance gene cluster with the Ur-14 resistance gene

    Science.gov (United States)

    The Ouro Negro common bean cultivar contains the Co-34/Phg-3 gene cluster that confers resistance to the anthracnose (ANT) and angular leaf spot (ALS) pathogens. These genes are tightly linked on chromosome 4. Ouro Negro also has the Ur-14 rust resistance gene, reportedly in the vicinity of Co- 34; ...

  7. Overexpression of SOS genes in ciprofloxacin resistant Escherichia coli mutants.

    Science.gov (United States)

    Pourahmad Jaktaji, Razieh; Pasand, Shirin

    2016-01-15

    Fluoroquinolones are important antibiotics for the treatment of urinary tract infections caused by Escherichia coli. Mutational studies have shown that ciprofloxacin, a member of fluoroquinolones induces SOS response and mutagenesis in pathogenic bacteria which in turn develop antibiotic resistance. However, inhibition of SOS response can increase recombination activity which in turn leads to genetic variation. The aim of this study was to measure 5 SOS genes expressions in nine E. coli mutants with different MICs for ciprofloxacin following exposure to ciprofloxacin. Gene expression was assessed by quantitative real time PCR. Gene alteration assessment was conducted by PCR amplification and DNA sequencing. Results showed that the expression of recA was increased in 5 mutants. This overexpression is not related to gene alteration, and enhances the expression of polB and umuCD genes encoding nonmutagenic and mutagenic polymerases, respectively. The direct relationship between the level of SOS expression and the level of resistance to ciprofloxacin was also indicated. It was concluded that novel therapeutic strategy that inhibits RecA activity would enhance the efficiency of common antibiotics against pathogenic bacteria. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Environmental and Public Health Implications of Water Reuse: Antibiotics, Antibiotic Resistant Bacteria, and Antibiotic Resistance Genes

    Science.gov (United States)

    Hong, Pei-Ying; Al-Jassim, Nada; Ansari, Mohd Ikram; Mackie, Roderick I.

    2013-01-01

    Water scarcity is a global problem, and is particularly acute in certain regions like Africa, the Middle East, as well as the western states of America. A breakdown on water usage revealed that 70% of freshwater supplies are used for agricultural irrigation. The use of reclaimed water as an alternative water source for agricultural irrigation would greatly alleviate the demand on freshwater sources. This paradigm shift is gaining momentum in several water scarce countries like Saudi Arabia. However, microbial problems associated with reclaimed water may hinder the use of reclaimed water for agricultural irrigation. Of particular concern is that the occurrence of antibiotic residues in the reclaimed water can select for antibiotic resistance genes among the microbial community. Antibiotic resistance genes can be associated with mobile genetic elements, which in turn allow a promiscuous transfer of resistance traits from one bacterium to another. Together with the pathogens that are present in the reclaimed water, antibiotic resistant bacteria can potentially exchange mobile genetic elements to create the “perfect microbial storm”. Given the significance of this issue, a deeper understanding of the occurrence of antibiotics in reclaimed water, and their potential influence on the selection of resistant microorganisms would be essential. In this review paper, we collated literature over the past two decades to determine the occurrence of antibiotics in municipal wastewater and livestock manure. We then discuss how these antibiotic resistant bacteria may impose a potential microbial risk to the environment and public health, and the knowledge gaps that would have to be addressed in future studies. Overall, the collation of the literature in wastewater treatment and agriculture serves to frame and identify potential concerns with respect to antibiotics, antibiotic resistant bacteria, and antibiotic resistance genes in reclaimed water. PMID:27029309

  9. Environmental and Public Health Implications of Water Reuse: Antibiotics, Antibiotic Resistant Bacteria, and Antibiotic Resistance Genes

    KAUST Repository

    Hong, Pei-Ying; Aljassim, Nada I.; Ansari, Mohd Ikram; Mackie, Roderick

    2013-01-01

    Water scarcity is a global problem, and is particularly acute in certain regions like Africa, the Middle East, as well as the western states of America. A breakdown on water usage revealed that 70% of freshwater supplies are used for agricultural irrigation. The use of reclaimed water as an alternative water source for agricultural irrigation would greatly alleviate the demand on freshwater sources. This paradigm shift is gaining momentum in several water scarce countries like Saudi Arabia. However, microbial problems associated with reclaimed water may hinder the use of reclaimed water for agricultural irrigation. Of particular concern is that the occurrence of antibiotic residues in the reclaimed water can select for antibiotic resistance genes among the microbial community. Antibiotic resistance genes can be associated with mobile genetic elements, which in turn allow a promiscuous transfer of resistance traits from one bacterium to another. Together with the pathogens that are present in the reclaimed water, antibiotic resistant bacteria can potentially exchange mobile genetic elements to create the “perfect microbial storm”. Given the significance of this issue, a deeper understanding of the occurrence of antibiotics in reclaimed water, and their potential influence on the selection of resistant microorganisms would be essential. In this review paper, we collated literature over the past two decades to determine the occurrence of antibiotics in municipal wastewater and livestock manure. We then discuss how these antibiotic resistant bacteria may impose a potential microbial risk to the environment and public health, and the knowledge gaps that would have to be addressed in future studies. Overall, the collation of the literature in wastewater treatment and agriculture serves to frame and identify potential concerns with respect to antibiotics, antibiotic resistant bacteria, and antibiotic resistance genes in reclaimed water.

  10. Environmental and Public Health Implications of Water Reuse: Antibiotics, Antibiotic Resistant Bacteria, and Antibiotic Resistance Genes

    Directory of Open Access Journals (Sweden)

    Roderick I. Mackie

    2013-07-01

    Full Text Available Water scarcity is a global problem, and is particularly acute in certain regions like Africa, the Middle East, as well as the western states of America. A breakdown on water usage revealed that 70% of freshwater supplies are used for agricultural irrigation. The use of reclaimed water as an alternative water source for agricultural irrigation would greatly alleviate the demand on freshwater sources. This paradigm shift is gaining momentum in several water scarce countries like Saudi Arabia. However, microbial problems associated with reclaimed water may hinder the use of reclaimed water for agricultural irrigation. Of particular concern is that the occurrence of antibiotic residues in the reclaimed water can select for antibiotic resistance genes among the microbial community. Antibiotic resistance genes can be associated with mobile genetic elements, which in turn allow a promiscuous transfer of resistance traits from one bacterium to another. Together with the pathogens that are present in the reclaimed water, antibiotic resistant bacteria can potentially exchange mobile genetic elements to create the “perfect microbial storm”. Given the significance of this issue, a deeper understanding of the occurrence of antibiotics in reclaimed water, and their potential influence on the selection of resistant microorganisms would be essential. In this review paper, we collated literature over the past two decades to determine the occurrence of antibiotics in municipal wastewater and livestock manure. We then discuss how these antibiotic resistant bacteria may impose a potential microbial risk to the environment and public health, and the knowledge gaps that would have to be addressed in future studies. Overall, the collation of the literature in wastewater treatment and agriculture serves to frame and identify potential concerns with respect to antibiotics, antibiotic resistant bacteria, and antibiotic resistance genes in reclaimed water.

  11. Environmental and Public Health Implications of Water Reuse: Antibiotics, Antibiotic Resistant Bacteria, and Antibiotic Resistance Genes

    KAUST Repository

    Hong, Pei-Ying

    2013-07-31

    Water scarcity is a global problem, and is particularly acute in certain regions like Africa, the Middle East, as well as the western states of America. A breakdown on water usage revealed that 70% of freshwater supplies are used for agricultural irrigation. The use of reclaimed water as an alternative water source for agricultural irrigation would greatly alleviate the demand on freshwater sources. This paradigm shift is gaining momentum in several water scarce countries like Saudi Arabia. However, microbial problems associated with reclaimed water may hinder the use of reclaimed water for agricultural irrigation. Of particular concern is that the occurrence of antibiotic residues in the reclaimed water can select for antibiotic resistance genes among the microbial community. Antibiotic resistance genes can be associated with mobile genetic elements, which in turn allow a promiscuous transfer of resistance traits from one bacterium to another. Together with the pathogens that are present in the reclaimed water, antibiotic resistant bacteria can potentially exchange mobile genetic elements to create the “perfect microbial storm”. Given the significance of this issue, a deeper understanding of the occurrence of antibiotics in reclaimed water, and their potential influence on the selection of resistant microorganisms would be essential. In this review paper, we collated literature over the past two decades to determine the occurrence of antibiotics in municipal wastewater and livestock manure. We then discuss how these antibiotic resistant bacteria may impose a potential microbial risk to the environment and public health, and the knowledge gaps that would have to be addressed in future studies. Overall, the collation of the literature in wastewater treatment and agriculture serves to frame and identify potential concerns with respect to antibiotics, antibiotic resistant bacteria, and antibiotic resistance genes in reclaimed water.

  12. Dissemination of antibiotic resistance genes from antibiotic producers to pathogens

    DEFF Research Database (Denmark)

    Jiang, Xinglin; Ellabaan, Mostafa M Hashim; Charusanti, Pep

    2017-01-01

    It has been hypothesized that some antibiotic resistance genes (ARGs) found in pathogenic bacteria derive from antibiotic-producing actinobacteria. Here we provide bioinformatic and experimental evidence supporting this hypothesis. We identify genes in proteobacteria, including some pathogens...... and experimentally test a 'carry-back' mechanism for the transfer, involving conjugative transfer of a carrier sequence from proteobacteria to actinobacteria, recombination of the carrier sequence with the actinobacterial ARG, followed by natural transformation of proteobacteria with the carrier-sandwiched ARG. Our...... results support the existence of ancient and, possibly, recent transfers of ARGs from antibiotic-producing actinobacteria to proteobacteria, and provide evidence for a defined mechanism....

  13. Transcriptome profiling and digital gene expression analysis of genes associated with salinity resistance in peanut

    Directory of Open Access Journals (Sweden)

    Jiongming Sui

    2018-03-01

    Full Text Available Background: Soil salinity can significantly reduce crop production, but the molecular mechanism of salinity tolerance in peanut is poorly understood. A mutant (S1 with higher salinity resistance than its mutagenic parent HY22 (S3 was obtained. Transcriptome sequencing and digital gene expression (DGE analysis were performed with leaves of S1 and S3 before and after plants were irrigated with 250 mM NaCl. Results: A total of 107,725 comprehensive transcripts were assembled into 67,738 unigenes using TIGR Gene Indices clustering tools (TGICL. All unigenes were searched against the euKaryotic Ortholog Groups (KOG, gene ontology (GO and Kyoto Encyclopedia of Genes and Genomes (KEGG databases, and these unigenes were assigned to 26 functional KOG categories, 56 GO terms, 32 KEGG groups, respectively. In total 112 differentially expressed genes (DEGs between S1 and S3 after salinity stress were screened, among them, 86 were responsive to salinity stress in S1 and/or S3. These 86 DEGs included genes that encoded the following kinds of proteins that are known to be involved in resistance to salinity stress: late embryogenesis abundant proteins (LEAs, major intrinsic proteins (MIPs or aquaporins, metallothioneins (MTs, lipid transfer protein (LTP, calcineurin B-like protein-interacting protein kinases (CIPKs, 9-cis-epoxycarotenoid dioxygenase (NCED and oleosins, etc. Of these 86 DEGs, 18 could not be matched with known proteins. Conclusion: The results from this study will be useful for further research on the mechanism of salinity resistance and will provide a useful gene resource for the variety breeding of salinity resistance in peanut. Keywords: Digital gene expression, Gene, Mutant, NaCl, Peanut (Arachis hypogaea L., RNA-seq, Salinity stress, Salinity tolerance, Soil salinity, Transcripts, Unigenes

  14. A novel resistance gene, lnu(H), conferring resistance to lincosamides in Riemerella anatipestifer CH-2.

    Science.gov (United States)

    Luo, Hong-Yan; Liu, Ma-Feng; Wang, Ming-Shu; Zhao, Xin-Xin; Jia, Ren-Yong; Chen, Shun; Sun, Kun-Feng; Yang, Qiao; Wu, Ying; Chen, Xiao-Yue; Biville, Francis; Zou, Yuan-Feng; Jing, Bo; Cheng, An-Chun; Zhu, De-Kang

    2018-01-01

    The Gram-negative bacterium Riemerella anatipestifer CH-2 is resistant to lincosamides, having a lincomycin (LCM) minimum inhibitory concentration (MIC) of 128 µg/mL. The G148_1775 gene of R. anatipestifer CH-2, designated lnu(H), encodes a 260-amino acid protein with ≤41% identity to other reported lincosamide nucleotidylyltransferases. Escherichia coli Rosetta TM (DE3) containing the pBAD24-lnu(H) plasmid showed four- and two-fold increases in the MICs of LCM and clindamycin (CLI), respectively. A kinetic assay of the purified Lnu(H) enzyme for LCM and CLI showed that the protein could inactive lincosamides. Mass spectrometry analysis demonstrated that the Lnu(H) enzyme catalysed adenylylation of lincosamides. In addition, an lnu(H) gene deletion strain exhibited 512- and 32-fold decreases in LCM and CLI MICs, respectively. The wild-type level of lincosamide resistance could be restored by complementation with a shuttle plasmid carrying the lnu(H) gene. The transformant R. anatipestifer ATCC 11845 [lnu(H)] acquired by natural transformation also exhibited high-level lincosamide resistance. Moreover, among 175 R. anatipestifer field isolates, 56 (32.0%) were positive for the lnu(H) gene by PCR. In conclusion, Lnu(H) is a novel lincosamide nucleotidylyltransferase that inactivates LCM and CLI by nucleotidylylation, thus conferring high-level lincosamide resistance to R. anatipestifer CH-2. Copyright © 2017. Published by Elsevier B.V.

  15. Antibiotic resistance and resistance genes in Escherichia coli from poultry farms, southwest Nigeria

    DEFF Research Database (Denmark)

    Adelowo, Olawale O.; Fagade, Obasola E.; Agersø, Yvonne

    2014-01-01

    %, ampicillin 36%, spectinomycin 28%, nalidixic acid 25%, chloramphenicol 22%, neomycin 14%, gentamicin 8%, amoxicillin-clavulanate, ceftiofur, cefotaxime, colistin, florfenicol and apramycin 0%. Resistance genes found among the isolates include bla-TEM (85%), sul2 (67%), sul3 (17%), aadA (65%), strA (70%), str...

  16. Expression of LRP and MDR1 in locally advanced breast cancer predicts axillary node invasion at the time of rescue mastectomy after induction chemotherapy

    International Nuclear Information System (INIS)

    Schneider, José; Gonzalez-Roces, Severino; Pollán, Marina; Lucas, Raul; Tejerina, Armando; Martin, Miguel; Alba, Alfonso

    2001-01-01

    Axillary node status after induction chemotherapy for locally advanced breast cancer has been shown on multivariate analysis to be an independent predictor of relapse. However, it has been postulated that responders to induction chemotherapy with a clinically negative axilla could be spared the burden of lymphadenectomy, because most of them will not show histological nodal invasion. P-glycoprotein expression in the rescue mastectomy specimen has finally been identified as a significant predictor of patient survival. We studied the expression of the genes encoding multidrug resistance associated protein (MDR1) and lung cancer associated resistance protein (LRP) in formalin-fixed, paraffin-embedded tumor samples from 52 patients treated for locally advanced breast cancer by means of induction chemotherapy followed by rescue mastectomy. P-glycoprotein expression was assessed by means of immunohistochemistry before treatment in 23 cases, and by means of reverse-transcriptase-mediated polymerase chain reaction (RT-PCR) after treatment in 46 (6 failed). LRP expression was detected by means of immunohistochemistry, with the LRP-56 monoclonal antibody, in 31 cases before treatment. Immunohistochemistry for detecting the expression of c-erb-B2, p53, Ki67, estrogen receptor and progesterone receptor are routinely performed in our laboratory in every case, and the results obtained were included in the study. All patients had received between two and six cycles of standard 5-fluorouracil, doxorubicin and cyclophosphamide (FAC) chemotherapy, with two exceptions [one patient received four cycles of a docetaxel-adriamycin combination, and the other four cycles of standard cyclophosphamide-methotrexate-5-fluorouracil (CMF) polychemotherapy]. Response was assessed in accordance with the Response Evaluation Criteria In Solid Tumors (RECIST). By these, 2 patients achieved a complete clinical response, 37 a partial response, and the remaining 13 showed stable disease. This makes a

  17. Antimicrobial susceptibility and occurrence of resistance genes among Salmonella enterica serovar Weltevreden from different countries

    DEFF Research Database (Denmark)

    Aarestrup, Frank Møller; Lertworapreecha, M.; Evans, M.C.

    2003-01-01

    and gentamicin. All nine ampicillin-resistant isolates contained a sequence similar to the bla(TEM-1b) gene, one of the eight chloramphenicol-resistant isolates a sequence similar to the catA1 gene, all three neomycin-resistant isolates a sequence similar to the aphA-2 gene, 16 (73%) of the 22 streptomycin...... isolates were examined for susceptibility to antimicrobial agents, and resistant isolates were examined for the presence of selected resistance genes by PCR. Results: Only 48 (9.5%) of the isolates were resistant to one or more of the antimicrobial agents tested. A low frequency of resistance was found...

  18. IncA/C plasmids harboured in serious multidrug-resistant Vibrio cholerae serogroup O139 strains in China.

    Science.gov (United States)

    Wang, Ruibai; Yu, Dong; Zhu, Lianhui; Li, Jie; Yue, Junjie; Kan, Biao

    2015-03-01

    Vibrio cholerae serogroup O139 emerged in 1992 and is one of two major serogroups to have caused cholera epidemics. After 1998, serious multidrug-resistant (MDR) O139 strains quickly became common in China, showing a multidrug resistance profile to eight antibiotics. It is a great threat to public health, and elucidation of its mechanisms of resistance will provide a helpful guide for the clinical treatment and prevention of cholera. In this study, mega-plasmids from MDR V. cholerae O139 strains were identified by pulsed-field gel electrophoresis (PFGE) without enzyme digestion. One plasmid was isolated and sequenced, belonging to the IncA/C family. Ten antibiotic resistance genes were found in the MDR regions, including a blaTEM-20 gene, and these genes endowed the host with resistance to seven antibiotics. This kind of plasmid was positive in 71.2% (198/278) of toxigenic O139 strains, and the rate of plasmid positivity was consistent with the yearly change in MDR rates of these strains. This study reveals an important role of the IncA/C family plasmid in the spread of multiple antibiotic resistance of epidemic V. cholerae serogroup O139 strains, which has recombined with plasmids from different bacterial species and transferred among V. cholerae strains. Copyright © 2014 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

  19. Evolution of resistance against CRISPR/Cas9 gene drive

    OpenAIRE

    Clark, Andrew; Unckless, Robert; Messer, Philipp

    2016-01-01

    CRISPR/Cas9 gene drive (CGD) promises to be a highly adaptable approach for spreading genetically engineered alleles throughout a species, even if those alleles impair reproductive success. CGD has been shown to be effective in laboratory crosses of insects, yet it remains unclear to what extent potential resistance mechanisms will affect the dynamics of this process in large natural populations. Here we develop a comprehensive population genetic framework for modeling CGD dynamics, which inc...

  20. Inactivation Effect of Antibiotic-Resistant Gene Using Chlorine Disinfection

    Directory of Open Access Journals (Sweden)

    Takashi Furukawa

    2017-07-01

    Full Text Available The aim of this study was to elucidate the inactivation effects on the antibiotic-resistance gene (vanA of vancomycin-resistant enterococci (VRE using chlorination, a disinfection method widely used in various water treatment facilities. Suspensions of VRE were prepared by adding VRE to phosphate-buffered saline, or the sterilized secondary effluent of a wastewater treatment plant. The inactivation experiments were carried out at several chlorine concentrations and stirring time. Enterococci concentration and presence of vanA were determined. The enterococci concentration decreased as chlorine concentrations and stirring times increased, with more than 7.0 log reduction occurring under the following conditions: 40 min stirring at 0.5 mg Cl2/L, 20 min stirring at 1.0 mg Cl2/L, and 3 min stirring at 3.0 mg Cl2/L. In the inactivation experiment using VRE suspended in secondary effluent, the culturable enterococci required much higher chlorine concentration and longer treatment time for complete disinfection than the cases of suspension of VRE. However, vanA was detected in all chlorinated suspensions of VRE, even in samples where no enterococcal colonies were present on the medium agar plate. The chlorine disinfection was not able to destroy antibiotic-resistance genes, though it can inactivate and decrease bacterial counts of antibiotic-resistant bacteria (ARB. Therefore, it was suggested that remaining ARB and/or antibiotic-resistance gene in inactivated bacterial cells after chlorine disinfection tank could be discharged into water environments.

  1. Occurrence of antibiotic resistance and characterization of resistant genes and integrons in Enterobacteriaceae isolated from integrated fish farms south China

    Science.gov (United States)

    Su, Hao-Chang; Ying, Guang-Guo; Tao, Ran; Zhang, Rui-Quan; Fogarty, Lisa R.; Kolpin, Dana W.

    2011-01-01

    Antibiotics are still widely applied in animal husbandry to prevent diseases and used as feed additives to promote animal growth. This could result in antibiotic resistance to bacteria and antibiotic residues in animals. In this paper, Enterobacteriaceae isolated from four integrated fish farms in Zhongshan, South China were tested for antibiotic resistance, tetracycline resistance genes, sulfonamide resistance genes, and class 1 integrons. The Kirby-Bauer disk diffusion method and polymerase chain reaction (PCR) assays were carried out to test antibiotic susceptibility and resistance genes, respectively. Relatively high antibiotic resistance frequencies were found, especially for ampicillin (80%), tetracycline (52%), and trimethoprim (50%). Out of 203 Enterobacteriaceae isolates, 98.5% were resistant to one or more antibiotics tested. Multiple antibiotic resistance (MAR) was found highest in animal manures with a MAR index of 0.56. Tetracycline resistance genes (tet(A), tet(C)) and sulfonamide resistance genes (sul2) were detected in more than 50% of the isolates. The intI1 gene was found in 170 isolates (83.7%). Both classic and non-classic class 1 integrons were found. Four genes, aadA5, aadA22, dfr2, and dfrA17, were detected. To our knowledge, this is the first report for molecular characterization of antibiotic resistance genes in Enterobacteriaceae isolated from integrated fish farms in China and the first time that gene cassette array dfrA17-aadA5 has been detected in such fish farms. Results of this study indicated that fish farms may be a reservoir of highly diverse and abundant antibiotic resistant genes and gene cassettes. Integrons may play a key role in multiple antibiotic resistances posing potential health risks to the general public and aquaculture.

  2. Treatment outcomes of MDR-tuberculosis patients in Brazil: a retrospective cohort analysis

    Directory of Open Access Journals (Sweden)

    Mayara Lisboa Bastos

    2017-11-01

    Full Text Available Abstract Background Multidrug-resistant tuberculosis (MDR-TB is a threat for the global TB epidemic control. Despite existing evidence that individualized treatment of MDR-TB is superior to standardized regimens, the latter are recommended in Brazil, mainly because drug-susceptibility tests (DST are often restricted to first-line drugs in public laboratories. We compared treatment outcomes of MDR-TB patients using standardized versus individualized regimens in Brazil, a high TB-burden, low resistance setting. Methods The 2007–2013 cohort of the national electronic database (SITE-TB, which records all special treatments including drug-resistance, was analysed. Patients classified as MDR-TB in SITE-TB were eligible. Treatment outcomes were classified as successful (cure/treatment completed or unsuccessful (failure/relapse/death/loss to follow-up. The odds for successful treatment according to type of regimen were controlled for demographic and clinical variables. Results Out of 4029 registered patients, we included 1972 recorded from 2010 to 2012, who had more complete outcome data. The overall success proportion was 60%. Success was more likely in non-HIV patients, sputum-negative at baseline, with unilateral disease and without prior DR-TB. Adjusted for these variables, those receiving standardized regimens had 2.7-fold odds of success compared to those receiving individualized treatments when failure/relapse were considered, and 1.4-fold odds of success when death was included as an unsuccessful outcome. When loss to follow-up was added, no difference between types of treatment was observed. Patients who used levofloxacin instead of ofloxacin had 1.5-fold odds of success. Conclusion In this large cohort of MDR-TB patients with a low proportion of successful outcomes, standardized regimens had superior efficacy than individualized regimens, when adjusted for relevant variables. In addition to the limitations of any retrospective observational

  3. Sulfonamide-Resistant Bacteria and Their Resistance Genes in Soils Fertilized with Manures from Jiangsu Province, Southeastern China

    OpenAIRE

    Wang, Na; Yang, Xiaohong; Jiao, Shaojun; Zhang, Jun; Ye, Boping; Gao, Shixiang

    2014-01-01

    Antibiotic-resistant bacteria and genes are recognized as new environmental pollutants that warrant special concern. There were few reports on veterinary antibiotic-resistant bacteria and genes in China. This work systematically analyzed the prevalence and distribution of sulfonamide resistance genes in soils from the environments around poultry and livestock farms in Jiangsu Province, Southeastern China. The results showed that the animal manure application made the spread and abundance of a...

  4. First report on class 1 integrons and Trimethoprim-resistance genes from dfrA group in uropathogenic E. coli (UPEC) from the Aleppo area in Syria

    Science.gov (United States)

    Al-Assil, Bodour; Mahfoud, Maysa; Hamzeh, Abdul Rezzak

    2013-01-01

    Horizontal gene transfer (HGT) introduces advantageous genetic elements into pathogenic bacteria using tools such as class1 integrons. This study aimed at investigating the distribution of these integrons among uropathogenic E. coli (UPEC) isolated from patients in Aleppo, Syria. It also set to uncover the frequencies of the clinically relevant DfrA1 and DfrA17,7, as well as various associations leading to reduced susceptibility. This study involved 75 Trimethoprim-resistant E. coli isolates from in- and outpatients with urinary tract infections (UTIs) from 3 major hospitals in Aleppo. Bacterial identification, resistance and extended-spectrum-β-lactamase (ESBL) production testing were performed according to Clinical Laboratory Standards Institute guidelines. Detection of integrons and DfrA genes was done using PCR and statistical significance was inferred through χ2 (Fisher’s) test. Class1 integrons were detected in 54.6% of isolates while DfrA1 and DfrA17,7 were found in 16% and 70.6% of tested samples respectively. Furthermore, only DfrA17,7 were strongly associated with class1 integrons, as were reduced susceptibility to the majority of individual antibiotics, multidrug resistance and ESBL production. This study demonstrated the high prevalence of class1 integrons among UPEC strains in Aleppo, Syria, as well as their significant associations with MDR. This data give information for local healthcare provision using antibiotic chemotherapy. PMID:23956949

  5. Characteristics of plasmids in multi-drug-resistant Enterobacteriaceae isolated during prospective surveillance of a newly opened hospital in Iraq.

    Directory of Open Access Journals (Sweden)

    Xiao-Zhe Huang

    Full Text Available BACKGROUND: Gram-negative multidrug-resistant (MDR bacteria are major causes of nosocomial infections, and antibiotic resistance in these organisms is often plasmid mediated. Data are scarce pertaining to molecular mechanisms of antibiotic resistance in resource constrained areas such as Iraq. METHODOLOGY/PRINCIPAL FINDINGS: In this study, all MDR Enterobacteriaceae (n = 38 and randomly selected non-MDR counterparts (n = 41 isolated from patients, healthcare workers and environmental surfaces in a newly opened hospital in Iraq were investigated to characterize plasmids found in these isolates and determine their contribution to antibiotic resistance. Our results demonstrated that MDR E. coli and K. pneumoniae isolates harbored significantly more (≥ 3 plasmids compared to their non-MDR counterparts, which carried ≤ 2 plasmids (p<0.01. Various large plasmids (~52 to 100 kb from representative isolates were confirmed to contain multiple resistance genes by DNA microarray analysis. Aminoglycoside (acc, aadA, aph, strA/B, and ksgA, β-lactam (bla(TEM1, bla(AMPC, bla(CTX-M-15, bla(OXA-1, bla(VIM-2 and bla(SHV, sulfamethoxazole/trimethoprim (sul/dfr, tetracycline (tet and chloramphenicol (cat resistance genes were detected on these plasmids. Additionally, multiple plasmids carrying multiple antibiotic resistance genes were found in the same host strain. Genetic transfer-associated genes were identified on the plasmids from both MDR and non-MDR isolates. Seven plasmid replicon types (FII, FIA, FIB, B/O, K, I1 and N were detected in the isolates, while globally disseminated IncA/C and IncHI1 plasmids were not detected in these isolates. CONCLUSIONS/SIGNIFICANCE: This is the first report of the characteristics of the plasmids found in Enterobacteriaceae isolated following the opening of a new hospital in Iraq. The information provided here furthers our understanding of the mechanisms of drug resistance in this specific region and their evolutionary

  6. miR-297 modulates multidrug resistance in human colorectal carcinoma by down-regulating MRP-2.

    Science.gov (United States)

    Xu, Ke; Liang, Xin; Shen, Ke; Cui, Daling; Zheng, Yuanhong; Xu, Jianhua; Fan, Zhongze; Qiu, Yanyan; Li, Qi; Ni, Lei; Liu, Jianwen

    2012-09-01

    Colorectal carcinoma is a frequent cause of cancer-related death in men and women. miRNAs (microRNAs) are endogenous small non-coding RNAs that regulate gene expression negatively at the post-transcriptional level. In the present study we investigated the possible role of microRNAs in the development of MDR (multidrug resistance) in colorectal carcinoma cells. We analysed miRNA expression levels between MDR colorectal carcinoma cell line HCT116/L-OHP cells and their parent cell line HCT116 using a miRNA microarray. miR-297 showed lower expression in HCT116/L-OHP cells compared with its parental cells. MRP-2 (MDR-associated protein 2) is an important MDR protein in platinum-drug-resistance cells and is a predicted target of miR-297. Additionally miR-297 was down-regulated in a panel of human colorectal carcinoma tissues and negatively correlated with expression levels of MRP-2. Furthermore, we found that ectopic expression of miR-297 in MDR colorectal carcinoma cells reduced MRP-2 protein level and sensitized these cells to anti-cancer drugs in vitro and in vivo. Taken together, our findings suggest that miR-297 could play a role in the development of MDR in colorectal carcinoma cells, at least in part by modulation of MRP-2.

  7. Identification of Gene Resistance to Avian InfluenzaVirus (Mx Gene among Wild Waterbirds

    Directory of Open Access Journals (Sweden)

    Dewi Elfidasari

    2013-04-01

    Full Text Available The Mx gene is an antiviral gene used to determine the resistance or the susceptibility to different types of viruses, including the Avian Influenza (AI virus subtype H5N1. The AI virus subtype H5N1 infection in chickens causes Mx gene polymorphism. The Mx+ gene shows resistant to the AIvirus subtype H5N1, whereas the Mx-gene shows signs of susceptible. The objective of thisresearch was to detect the Mxgene in wild aquatic birds using the Polymerase Chain Reaction Restriction Fragment Length Polymorphism (PCR-RFLP method with the primer pairs F2 and NE-R2/R and the RsaI restriction enzyme. DNA samples were obtained from eight species of wild waterbirds with positive and negative exposure to the AI virus subtype H5N1. DNA amplification results showed that the Mxgene in wild aquatic birds is found in a 100 bp fragment, which is the same as the Mx gene found in chickens. However, unlike chickens, the Mxgene in wild aquatic birds did not show any polymorphism. This study proves that Mx- based resistance to AI virus subtype H5N1 in different in wild birds than in chickens.

  8. Ecdysteroids Sensitize MDR and Non-MDR Cancer Cell Lines to Doxorubicin, Paclitaxel, and Vincristine but Tend to Protect Them from Cisplatin

    Directory of Open Access Journals (Sweden)

    Ana Martins

    2015-01-01

    Full Text Available Ecdysteroids, analogs of the insect molting hormone, are known for their various mild, nonhormonal bioactivities in mammals. Previously, we reported that less-polar ecdysteroids can modulate the doxorubicin resistance of a multidrug resistant (MDR mouse lymphoma cell line expressing the human ABCB1 transporter. Here, we describe the ability of 20-hydroxyecdysone (1 and its mono- (2 and diacetonide (3 derivatives to sensitize various MDR and non-MDR cancer cell lines towards doxorubicin, paclitaxel, vincristine, or cisplatin. Drug IC50 values with or without ecdysteroid were determined by MTT assay. Compound 3 significantly sensitized all cell lines to each chemotherapeutic except for cisplatin, whose activity was decreased. In order to overcome solubility and stability issues for the future in vivo administration of compound 3, liposomal formulations were developed. By means of their combination index values obtained via checkerboard microplate method, a formulation showed superior activity to that of compound 3 alone. Because ecdysteroids act also on non-ABCB1 expressing (sensitive cell lines, our results demonstrate that they do not or not exclusively exert their adjuvant anticancer activity as ABCB1 inhibitors, but other mechanisms must be involved, and they opened the way towards their in vivo bioactivity testing against various cancer xenografts.

  9. Molecular detection of multidrug-resistant Mycobacterium leprae from Indian leprosy patients.

    Science.gov (United States)

    Lavania, Mallika; Singh, Itu; Turankar, Ravindra P; Ahuja, Madhvi; Pathak, Vinay; Sengupta, Utpal; Das, Loretta; Kumar, Archana; Darlong, Joydeepa; Nathan, Rajeev; Maseey, Asha

    2018-03-01

    The emergence of multidrug-resistant (MDR) organisms for any infectious disease is a public health concern. Global efforts to control leprosy by intensive chemotherapy have led to a significant decrease in the number of registered patients. Currently recommended control measures for treating leprosy with multidrug therapy (MDT) were designed to prevent the spread of dapsone-resistant Mycobacterium leprae strains. Here we report the identification of MDR M. leprae from relapse leprosy patients from endemic regions in India. Resistance profiles to rifampicin, dapsone and ofloxacin of the isolated strains were confirmed by identification of mutations in genes previously shown to be associated with resistance to each drug. Between 2009-2016, slit-skin smear samples were collected from 239 relapse and 11 new leprosy cases from hospitals of The Leprosy Mission across India. DNA was extracted from the samples and was analysed by PCR targeting the rpoB, folP and gyrA genes associated with resistance to rifampicin, dapsone and ofloxacin, respectively, in M. leprae. M. leprae Thai-53 (wild-type) and Zensho-4 (MDR) were used as reference strains. Fifteen strains showed representative mutations in at least two resistance genes. Two strains showed mutations in all three genes responsible for drug resistance. Seven, seven and one strain, respectively, showed mutations in genes responsible for rifampicin and dapsone resistance, for dapsone and ofloxacin resistance and for rifampicin and ofloxacin resistance. This study showed the emergence of MDR M. leprae in MDT-treated leprosy patients from endemic regions of India. Copyright © 2017 International Society for Chemotherapy of Infection and Cancer. Published by Elsevier Ltd. All rights reserved.

  10. In vitro activity of rifampicin alone and in combination with imipenem against multidrug-resistant Acinetobacter baumannii harboring the blaOXA-72 resistance gene.

    Science.gov (United States)

    Majewski, Piotr; Wieczorek, Piotr; Ojdana, Dominika; Sacha, Paweł Tomasz; Wieczorek, Anna; Tryniszewska, Elżbieta Anna

    2014-04-01

    The growing incidence of multidrug resistance (MDR) in bacteria is an emerging challenge in the treatment of infections. Acinetobacter baumannii is an opportunistic pathogen prone to exhibit MDR that contributes significantly to nosocomial infections, particularly in severely ill patients. Thus, we performed research on rifampicin activity against selected MDR OXA-72 carbapenemase-producing A. baumannii strains. Since it is widely accepted that rifampicin should not be used as monotherapy in order to avoid the rapid development of rifampicin resistance, we evaluated the efficacy of combination therapy with imipenem. Minimal inhibitory concentrations (MICs) of both rifampicin and imipenem were determined by use of the broth microdilution method. Evaluations of the interactions between rifampicin and imipenem were performed by analysis of the fractional inhibitory concentration index (∑FIC), determined using the checkerboard titration method. All tested isolates showed full susceptibility to rifampicin. The checkerboard method revealed synergism in 5 isolates (29%) and an additive effect in another 5 isolates (29%); no difference was reported in the remaining 7 isolates (41%). Strains moderately resistant to imipenem (MIC ≤ 64 mg/l) tended to show synergy or additive interaction. We conclude that in vitro synergism or an additive interaction between rifampicin and imipenem most likely occurs in A. baumannii strains showing moderate resistance to imipenem (MIC ≤ 64 mg/l). Moreover, utilizing this combination in the therapy of infections caused by strains exhibiting higher levels of resistance (MIC > 64 mg/l) is not recommended since in this setting imipenem could not prevent the development of rifampicin resistance.

  11. Presence of antiseptic resistance genes in porcine methicillin-resistant Staphylococcus aureus.

    Science.gov (United States)

    Wong, T Z; Zhang, M; O'Donoghue, M; Boost, M

    2013-03-23

    Numerous studies have documented the presence of methicillin-resistant Staphylococcus aureus (MRSA) in meat-producing animals, which has led to concern about its spread into the community. Disinfectants play an important role in reduction of contamination in both animal husbandry and food-preparation, helping control spread of organisms from foodstuffs, including raw meat. Plasmid-borne antiseptic resistance (AR) genes increasing tolerance to several disinfectants have been reported in S. aureus of human origin (qacA/B and smr) and from bovine, equine, and caprine staphylococcal isolates (qacG, qacH, and qacJ). This study investigated the presence of AR genes in porcine MRSA isolates. Plasmid DNA from 100 MRSA ST9 strains isolated from pig carcasses was amplified for the presence of AR genes. Minimum inhibitory concentrations (MICs) and minimum bactericidal concentrations (MBCs) to benzalkonium chloride (BC) and chlorhexidine gluconate (CHX) were determined in AR gene-positive isolates. qacG was present in 45 strains, eight of which also harbored smr. No strains carried qacA/B, qacH or qacJ. Presence of smr increased MICs to both BC and CHX and MBCs of CHX, but qacG presence only resulted in elevated MBC for CHX. This is the first report of AR genes from a porcine source. AR gene positivity has previously been associated with methicillin resistance and AR gene presence in these strains may increase their ability to persist in the environment. Improved implementation of hygiene measures during transportation and pre- and post-slaughter should be considered to prevent spread in the community. Copyright © 2012 Elsevier B.V. All rights reserved.

  12. A double EPSPS gene mutation endowing glyphosate resistance shows a remarkably high resistance cost.

    Science.gov (United States)

    Han, Heping; Vila-Aiub, Martin M; Jalaludin, Adam; Yu, Qin; Powles, Stephen B

    2017-12-01

    A novel glyphosate resistance double point mutation (T102I/P106S, TIPS) in the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene has been recently identified for the first time only in the weed species Eleusine indica. Quantification of plant resistance cost associated with the TIPS and the often reported glyphosate resistance single P106S mutation was performed. A significant resistance cost (50% in seed number currency) associated with the homozygous TIPS but not the homozygous P106S EPSPS variant was identified in E. indica plants. The resistance cost associated with the TIPS mutation escalated to 85% in plants under resource competition with rice crops. The resistance cost was not detected in nonhomozygous TIPS plants denoting the recessive nature of the cost associated with the TIPS allele. An excess of 11-fold more shikimate and sixfold more quinate in the shikimate pathway was detected in TIPS plants in the absence of glyphosate treatment compared to wild type, whereas no changes in these compounds were observed in P106S plants when compared to wild type. TIPS plants show altered metabolite levels in several other metabolic pathways that may account for the expression of the observed resistance cost. © 2017 John Wiley & Sons Ltd.

  13. Dissemination of Multidrug-Resistant, Class I and II Integrons and Molecular Typing of CTX-M-producing Klebsiella pneumoniae.

    Science.gov (United States)

    Akya, Alisha; Elahi, Azam; Chegenelorestani, Roya; Rezaee, Mahya

    2018-01-01

    Klebsiella pneumoniae ( K. pneumoniae ) is an important opportunistic pathogen causes serious community and hospital-acquired infections, which is highly resistant to antibiotics. We aimed to determine the frequency of multidrug resistant (MDR) and molecular typing of clinical isolates of K. pneumoniae . One hundred isolates of K. pneumoniae were collected from clinical samples in three general hospitals in Kermanshah. The antimicrobial susceptibility and extended-spectrum beta-lactamases (ESBL) production of isolates were determined using disk diffusion and combined disk methods, respectively. The bla CTX-M gene, class I and II integrons were detected using polymerase chain reaction. The bla CTX-M positive isolates were selected for genotyping using pulsed-field gel electrophoresis (PFGE). MDR phenotype was observed in 56% of isolates. The 40% of isolates were ESBL positive and 35 isolates contained bla CTX-M . Class I and II of integrons were detected in 50 (89.2%) and 39 (69.6%) of MDR isolates, respectively. PFGE patterns of K. pneumoniae bla CTX-M positive isolates indicated 19 clusters (X 1-19 ) with different genotype patterns. The study findings highlight the concern of circulating MDR strains of K. pneumoniae with bla CTX-M and class I and II integrons in Kermanshah hospitals. The presence of integrons among isolates may facilitate the spread of new resistance genes in this bacterium. Therefore, surveillance for the spread of MDR strains of this bacterium is recommended in hospitals.

  14. Drug-resistance patterns of Mycobacterium tuberculosis strains and associated risk factors among multi drug-resistant tuberculosis suspected patients from Ethiopia.

    Science.gov (United States)

    Mesfin, Eyob Abera; Beyene, Dereje; Tesfaye, Abreham; Admasu, Addisu; Addise, Desalegn; Amare, Miskir; Dagne, Biniyam; Yaregal, Zelalem; Tesfaye, Ephrem; Tessema, Belay

    2018-01-01

    Multidrug drug-resistant tuberculosis (MDR-TB) is a major health problem and seriously threatens TB control and prevention efforts globally. Ethiopia is among the 30th highest TB burden countries for MDR-TB with 14% prevalence among previously treated cases. The focus of this study was on determining drug resistance patterns of Mycobacterium tuberculosis among MDR-TB suspected cases and associated risk factors. A cross-sectional study was conducted in Addis Ababa from June 2015 to December 2016. Sputum samples and socio-demographic data were collected from 358 MDR-TB suspected cases. Samples were analyzed using Ziehl-Neelsen technique, GeneXpert MTB/RIF assay, and culture using Lowenstein-Jensen and Mycobacterial growth indicator tube. Data were analyzed using SPSS version 23. A total of 226 the study participants were culture positive for Mycobacterium tuberculosis, among them, 133 (58.8%) participants were males. Moreover, 162 (71.7%) had been previously treated for tuberculosis, while 128 (56.6%) were TB/HIV co-infected. A majority [122 (54%)] of the isolates were resistant to any first-line anti-TB drugs. Among the resistant isolates, 110 (48.7%) were determined to be resistant to isoniazid, 94 (41.6%) to streptomycin, 89 (39.4%) to rifampicin, 72 (31.9%) to ethambutol, and 70 (30.9%) to pyrazinamide. The prevalence of MDR-TB was 89 (39.4%), of which 52/89 (58.4%) isolates were resistance to all five first-line drugs. Risk factors such as TB/HIV co-infection (AOR = 5.59, p = 0.00), cigarette smoking (AOR = 3.52, p = 0.045), alcohol drinking (AOR = 5.14, p = 0.001) hospital admission (AOR = 3.49, p = 0.005) and visiting (AOR = 3.34, p = 0.044) were significantly associated with MDR-TB. The prevalence of MDR-TB in the study population was of a significantly high level among previously treated patients and age group of 25-34. TB/HIV coinfection, smoking of cigarette, alcohol drinking, hospital admission and health facility visiting were identified as risk factors

  15. The wheat Lr34 multipathogen resistance gene confers resistance to anthracnose and rust in sorghum.

    Science.gov (United States)

    Schnippenkoetter, Wendelin; Lo, Clive; Liu, Guoquan; Dibley, Katherine; Chan, Wai Lung; White, Jodie; Milne, Ricky; Zwart, Alexander; Kwong, Eunjung; Keller, Beat; Godwin, Ian; Krattinger, Simon G; Lagudah, Evans

    2017-11-01

    The ability of the wheat Lr34 multipathogen resistance gene (Lr34res) to function across a wide taxonomic boundary was investigated in transgenic Sorghum bicolor. Increased resistance to sorghum rust and anthracnose disease symptoms following infection with the biotrophic pathogen Puccinia purpurea and the hemibiotroph Colletotrichum sublineolum, respectively, occurred in transgenic plants expressing the Lr34res ABC transporter. Transgenic sorghum lines that highly expressed the wheat Lr34res gene exhibited immunity to sorghum rust compared to the low-expressing single copy Lr34res genotype that conferred partial resistance. Pathogen-induced pigmentation mediated by flavonoid phytoalexins was evident on transgenic sorghum leaves following P. purpurea infection within 24-72 h, which paralleled Lr34res gene expression. Elevated expression of flavone synthase II, flavanone 4-reductase and dihydroflavonol reductase genes which control the biosynthesis of flavonoid phytoalexins characterized the highly expressing Lr34res transgenic lines 24-h post-inoculation with P. purpurea. Metabolite analysis of mesocotyls infected with C. sublineolum showed increased levels of 3-deoxyanthocyanidin metabolites were associated with Lr34res expression, concomitant with reduced symptoms of anthracnose. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  16. Several Virulence Factors of Multidrug-Resistant Staphylococcus aureus Isolates From Hospitalized Patients in Tehran

    Directory of Open Access Journals (Sweden)

    Abdolmajid Ghasemian

    2015-05-01

    Full Text Available Background: Biofilm formation plays an important role in resistance of Staphylococcus aureus isolates; especially multidrug-resistant isolates are a threat to healthcare settings. Objectives: The aims of this study were to detect biofilm formation and presence of several related genes among multidrug-resistant (MDR isolates of Staphylococcus aureus. Patients and Methods: A total Of 209 S. aureus strains were isolated from patients and identified by conventional diagnostic tests. The multidrug-resistant MRSA isolates were detected by antibiotic susceptibility test. The phenotypic biofilm formation was detected by micro-titre tissue plate assay. The polymerase chain reaction (PCR was performed to detect the mecA, Staphylococcal Cassette Chromosome mec (SCCmec types, accessory gene regulatory (agr genes, the icaADBC and several genes encoding staphylococcal surface proteins including clfAB, fnbAB, fib, eno, can, ebps and bbp genes with specific primers. Results: Sixty-four (30.6% isolates were methicillin-resistant, among which thirty-six (56.2% were MDR. These isolates were resistant to amoxicillin, tetracycline, ciprofloxacin, gentamicin, erythromycin and trimethoprim-sulfamethoxazole (except to 6 isolates. All the isolates were susceptible to vancomycin and linezolid. All the MDR-MRSA harbored SCCmec type III. All the MDR- MRSA isolates were strong biofilm producers in the phenotypic test. The majority of MDR- MRSA was belonged to agrI (67%, n = 24, followed by agr II (17%, n = 6, agrIV (11%, n = 4 and agrIII (5.5%, n = 2. The frequency of icaADBC genes were 75% (n = 27, 61% (n = 22, 72% (n = 26 and 72% (n = 26, respectively. Furthermore, the prevalence of clfA, clfB, fnbA, fnbB, fib, can, eno, ebps and bbp genes was 100%, 100%, 67%, 56%, 80%, 63%, 78%, 7% and 0%, respectively. Furthermore, approximately all the MRSA was strong biofilm producers. Conclusions: Multidrug-resistant isolates produced biofilm strongly and the majority harbored most

  17. Data mining and influential analysis of gene expression data for plant resistance gene identification in tomato (Solanum lycopersicum

    Directory of Open Access Journals (Sweden)

    Francisco Torres-Avilés

    2014-03-01

    Conclusion: Application of different statistical analyses to detect potential resistance genes reliably has shown to conduct interesting results that improve knowledge on molecular mechanisms of plant resistance to pathogens.

  18. [State-of-the-art status on airborne antibiotic resistant bacteria and antibiotic resistance genes].

    Science.gov (United States)

    Li, J; Yao, M S

    2018-04-06

    The world is facing more deaths due to increasing antibiotic-resistant bacterial infections and the shortage of new highly effective antibiotics, however the air media as its important transmission route has not been adequately studied. Based on the latest literature acquired in this work, we have discussed the state-of-the-art research progress of the concentration, distribution and spread of antibiotic resistant bacteria (ARB) and antibiotic resistance genes (ARGs) in different environmental air media, and also analyzed some future prevention and control measures. The large use of antibiotics in the medical settings and animal husbandry places has resulted in higher abundances of ARB and ARGs in the relevant and surrounding atmosphere than in urban and general indoor air environments. ARGs can be spread by adhering to airborne particles, and researchers have also found that air media contain more abundant ARGs than other environmental media such as soil, water and sediment. It was suggested in this review that strengthening the monitoring, study on spreading factors and biological toxicity, and also research and development on pathogen accurate diagnosis and new green antibiotic are expected to help effectively monitor, prevent and control of the impacts of airborne resistant bacteria and resistance genes on both human and ecologies.

  19. Mapping of novel powdery mildew resistance gene(s) from Agropyron cristatum chromosome 2P.

    Science.gov (United States)

    Li, Huanhuan; Jiang, Bo; Wang, Jingchang; Lu, Yuqing; Zhang, Jinpeng; Pan, Cuili; Yang, Xinming; Li, Xiuquan; Liu, Weihua; Li, Lihui

    2017-01-01

    A physical map of Agropyron cristatum 2P chromosome was constructed for the first time and the novel powdery mildew resistance gene(s) from chromosome 2P was(were) also mapped. Agropyron cristatum (L.) Gaertn. (2n = 28, PPPP), a wild relative of common wheat, is highly resistant to powdery mildew. Previous studies showed that wheat-A. cristatum 2P disomic addition line II-9-3 displayed high resistance to powdery mildew, and the resistance was attributable to A. cristatum chromosome 2P. To utilize and physically map the powdery mildew resistance gene(s), 15 wheat-A. cristatum 2P translocation lines and three A. cristatum 2P deletion lines with different chromosomal segment sizes, obtained from II-9-3 using 60 Co-γ ray irradiation, were characterized using cytogenetic and molecular marker analysis. A. cristatum 2P chromosomal segments in the translocations were translocated to different wheat chromosomes, including 1A, 4A, 5A, 6A, 7A, 1B, 2B, 3B, 7B, 3D, 4D, and 6D. A physical map of the 2P chromosome was constructed with 82 STS markers, consisting of nine bins with 34 markers on 2PS and eight bins with 48 markers on 2PL. The BC 1 F 2 populations of seven wheat-A. cristatum 2P translocation lines (2PT-3, 2PT-4, 2PT-5, 2PT-6, 2PT-8, 2PT-9, and 2PT-10) were developed by self-pollination, tested with powdery mildew and genotyped with 2P-specific STS markers. From these results, the gene(s) conferring powdery mildew resistance was(were) located on 2PL bin FL 0.66-0.86 and 19 2P-specific markers were identified in this bin. Moreover, two new powdery mildew-resistant translocation lines (2PT-4 and 2PT-5) with small 2PL chromosome segments were obtained. The newly developed wheat lines with powdery mildew resistance and the closely linked molecular markers will be valuable for wheat disease breeding in the future.

  20. Evolution by Pervasive Gene Fusion in Antibiotic Resistance and Antibiotic Synthesizing Genes

    Directory of Open Access Journals (Sweden)

    Orla Coleman

    2015-03-01

    Full Text Available Phylogenetic (tree-based approaches to understanding evolutionary history are unable to incorporate convergent evolutionary events where two genes merge into one. In this study, as exemplars of what can be achieved when a tree is not assumed a priori, we have analysed the evolutionary histories of polyketide synthase genes and antibiotic resistance genes and have shown that their history is replete with convergent events as well as divergent events. We demonstrate that the overall histories of these genes more closely resembles the remodelling that might be seen with the children’s toy Lego, than the standard model of the phylogenetic tree. This work demonstrates further that genes can act as public goods, available for re-use and incorporation into other genetic goods.

  1. A Novel Phytophthora sojae Resistance Rps12 Gene Mapped to a Genomic Region That Contains Several Rps Genes.

    Science.gov (United States)

    Sahoo, Dipak K; Abeysekara, Nilwala S; Cianzio, Silvia R; Robertson, Alison E; Bhattacharyya, Madan K

    2017-01-01

    Phytophthora sojae Kaufmann and Gerdemann, which causes Phytophthora root rot, is a widespread pathogen that limits soybean production worldwide. Development of Phytophthora resistant cultivars carrying Phytophthora resistance Rps genes is a cost-effective approach in controlling this disease. For this mapping study of a novel Rps gene, 290 recombinant inbred lines (RILs) (F7 families) were developed by crossing the P. sojae resistant cultivar PI399036 with the P. sojae susceptible AR2 line, and were phenotyped for responses to a mixture of three P. sojae isolates that overcome most of the known Rps genes. Of these 290 RILs, 130 were homozygous resistant, 12 heterzygous and segregating for Phytophthora resistance, and 148 were recessive homozygous and susceptible. From this population, 59 RILs homozygous for Phytophthora sojae resistance and 61 susceptible to a mixture of P. sojae isolates R17 and Val12-11 or P7074 that overcome resistance encoded by known Rps genes mapped to Chromosome 18 were selected for mapping novel Rps gene. A single gene accounted for the 1:1 segregation of resistance and susceptibility among the RILs. The gene encoding the Phytophthora resistance mapped to a 5.8 cM interval between the SSR markers BARCSOYSSR_18_1840 and Sat_064 located in the lower arm of Chromosome 18. The gene is mapped 2.2 cM proximal to the NBSRps4/6-like sequence that was reported to co-segregate with the Phytophthora resistance genes Rps4 and Rps6. The gene is mapped to a highly recombinogenic, gene-rich genomic region carrying several nucleotide binding site-leucine rich repeat (NBS-LRR)-like genes. We named this novel gene as Rps12, which is expected to be an invaluable resource in breeding soybeans for Phytophthora resistance.

  2. A Novel Phytophthora sojae Resistance Rps12 Gene Mapped to a Genomic Region That Contains Several Rps Genes.

    Directory of Open Access Journals (Sweden)

    Dipak K Sahoo

    Full Text Available Phytophthora sojae Kaufmann and Gerdemann, which causes Phytophthora root rot, is a widespread pathogen that limits soybean production worldwide. Development of Phytophthora resistant cultivars carrying Phytophthora resistance Rps genes is a cost-effective approach in controlling this disease. For this mapping study of a novel Rps gene, 290 recombinant inbred lines (RILs (F7 families were developed by crossing the P. sojae resistant cultivar PI399036 with the P. sojae susceptible AR2 line, and were phenotyped for responses to a mixture of three P. sojae isolates that overcome most of the known Rps genes. Of these 290 RILs, 130 were homozygous resistant, 12 heterzygous and segregating for Phytophthora resistance, and 148 were recessive homozygous and susceptible. From this population, 59 RILs homozygous for Phytophthora sojae resistance and 61 susceptible to a mixture of P. sojae isolates R17 and Val12-11 or P7074 that overcome resistance encoded by known Rps genes mapped to Chromosome 18 were selected for mapping novel Rps gene. A single gene accounted for the 1:1 segregation of resistance and susceptibility among the RILs. The gene encoding the Phytophthora resistance mapped to a 5.8 cM interval between the SSR markers BARCSOYSSR_18_1840 and Sat_064 located in the lower arm of Chromosome 18. The gene is mapped 2.2 cM proximal to the NBSRps4/6-like sequence that was reported to co-segregate with the Phytophthora resistance genes Rps4 and Rps6. The gene is mapped to a highly recombinogenic, gene-rich genomic region carrying several nucleotide binding site-leucine rich repeat (NBS-LRR-like genes. We named this novel gene as Rps12, which is expected to be an invaluable resource in breeding soybeans for Phytophthora resistance.

  3. Study on drug resistance of mycobacterium tuberculosis in patients with pulmonary tuberculosis by drug resistance gene detecting

    International Nuclear Information System (INIS)

    Wang Wei; Li Hongmin; Wu Xueqiong; Wang Ansheng; Ye Yixiu; Wang Zhongyuan; Liu Jinwei; Chen Hongbing; Lin Minggui; Wang Jinhe; Li Sumei; Jiang Ping; Feng Bai; Chen Dongjing

    2004-01-01

    To investigate drug resistance of mycobacterium tuberculosis in different age group, compare detecting effect of two methods and evaluate their the clinical application value, all of the strains of mycobacterium tuberculosis were tested for resistance to RFP, INH SM PZA and EMB by the absolute concentration method on Lowenstein-Jensen medium and the mutation of the rpoB, katG, rpsL, pncA and embB resistance genes in M. tuberculosis was tested by PCR-SSCP. In youth, middle and old age group, the rate of acquired drug resistance was 89.2%, 85.3% and 67.6% respectively, the gene mutation rate was 76.2%, 81.3% and 63.2% respectively. The rate of acquired drug resistance and multiple drug resistance in youth group was much higher than those in other groups. The gene mutation was correlated with drug resistance level of mycobacterium tuberculosis. The gene mutation rate was higher in strains isolated from high concentration resistance than those in strains isolated from low concentration resistance. The more irregular treatment was longer, the rate of drug resistance was higher. Acquired drug resistance varies in different age group. It suggested that surveillance of drug resistence in different age group should be taken seriously, especially in youth group. PCR - SSCP is a sensitive and specific method for rapid detecting rpoB, katG, rpsL, pncA and embB genes mutations of MTB. (authors)

  4. Multidrug-resistance and presence of class 1 integrons in clinical isolates of Salmonella enterica serotype Enteritidis, circulating in Armenia

    DEFF Research Database (Denmark)

    Sedrakyan, Anahit M.; Arakelova, K. A.; Zakaryan, Magdalina K.

    2014-01-01

    a rapid and large-scale penetration of antibiotic resistance genes into populations of S. Enteritidis, which complicates infection control. More rigorous regulations should be imposed on antibiotic use, together with a vigilant epidemiological surveillance, to prevent the emergence and spread of MDR S...

  5. DNA tagging of blast resistant gene(s in three Brazilian rice cultivars

    Directory of Open Access Journals (Sweden)

    S.S. Sandhu

    2003-12-01

    Full Text Available Rice blast is the most important fungal disease of rice and is caused by Pyricularia oryzae Sacc. (Telomorph Magnoporthe grisea Barr.. Seven randomly amplified polymorphic DNA (RAPD markers OPA5, OPG17, OPG18, OPG19, OPF9, OPF17 and OPF19 showed very clear polymorphism in resistant cultivar lines which differed from susceptible lines. By comparing different susceptible lines, nine DNA amplifications of seven primers (OPA5(1000, OPA5(1200, OPG17(700, OPG18(850, OPG19(500, OPG19(600, OPF9(600, OPF17(1200 and OPF19(600 were identified as dominant markers for the blast resistant gene in resistant cultivar lines. These loci facilitate the indirect scoring of blast resistant and blast susceptible genotypes. The codomine RAPDs markers will facilitate marker-assisted selection of the blast resistant gene in two blast resistant genotypes of rice (Labelle and Line 11 and will be useful in rice breeding programs.

  6. Occurrence of the mcr-1 Colistin Resistance Gene and other Clinically Relevant Antibiotic Resistance Genes in Microbial Populations at Different Municipal Wastewater Treatment Plants in Germany

    Directory of Open Access Journals (Sweden)

    Norman Hembach

    2017-07-01

    Full Text Available Seven wastewater treatment plants (WWTPs with different population equivalents and catchment areas were screened for the prevalence of the colistin resistance gene mcr-1 mediating resistance against last resort antibiotic polymyxin E. The abundance of the plasmid-associated mcr-1 gene in total microbial populations during water treatment processes was quantitatively analyzed by qPCR analyses. The presence of the colistin resistance gene was documented for all of the influent wastewater samples of the seven WWTPs. In some cases the mcr-1 resistance gene was also detected in effluent samples of the WWTPs after conventional treatment reaching the aquatic environment. In addition to the occurrence of mcr-1 gene, CTX-M-32, blaTEM, CTX-M, tetM, CMY-2, and ermB genes coding for clinically relevant antibiotic resistances were quantified in higher abundances in all WWTPs effluents. In parallel, the abundances of Acinetobacter baumannii, Klebsiella pneumoniae, and Escherichia coli were quantified via qPCR using specific taxonomic gene markers which were detected in all influent and effluent wastewaters in significant densities. Hence, opportunistic pathogens and clinically relevant antibiotic resistance genes in wastewaters of the analyzed WWTPs bear a risk of dissemination to the aquatic environment. Since many of the antibiotic resistance gene are associated with mobile genetic elements horizontal gene transfer during wastewater treatment can't be excluded.

  7. Antimicrobial Resistance and Resistance Genes in Aerobic Bacteria Isolated from Pork at Slaughter.

    Science.gov (United States)

    Li, Lili; Heidemann Olsen, Rikke; Ye, Lei; Yan, He; Nie, Qing; Meng, Hecheng; Shi, Lei

    2016-04-01

    The aim of this study was to investigate the phenotypic and genotypic antimicrobial resistance, integrons, and transferability of resistance markers in 243 aerobic bacteria recovered from pork at slaughter in the People's Republic of China. The organisms belonged to 22 genera of gram-negative bacteria (92.2%) and gram-positive bacteria (7.8%). High levels of resistance were detected to tetracycline, trimethoprim-sulfamethoxazole, and ampicillin (36.2 to 54.3%), and lower levels were detected to nitrofurantoin, cefotaxime, gentamicin, ciprofloxacin, and chloramphenicol (7.8 to 29.2%). Across species, genes conferring antimicrobial resistance were observed with the following frequencies: blaTEM, 40.7%; blaCMY-2, 15.2%; blaCTX-M, 11.5%; sul2, 27.2%; sul1, 14.4%; tet(A), 5.4%; tet(L), 5.4%; tet(M), 5.0%; tet(E), 3.7%; tet(C), 3.3%; tet(S), 2.5%; and tet(K), 0.8%. Various antimicrobial resistance genes were found in new carriers: blaTEM in Lactococcus garvieae, Myroides odoratimimus, Aeromonas hydrophila, Staphylococcus sciuri, Raoultella terrigena, Macrococcus caseolyticus, Acinetobacter ursingii, Sphingobacterium sp., and Oceanobacillus sp.; blaCMY-2 in Lactococcus lactis, Klebsiella oxytoca, Serratia marcescens, Acinetobacter baumannii, and Myroides phaeus; tet(L) in M. caseolyticus; sul1 in Vibrio cincinnatiensis; sul2 in Acinetobacter bereziniae, Acinetobacter johnsonii, and V. cincinnatiensis; and the class 1 integron and gene cassette aadA2 in V. cincinnatiensis. Approximately 6.6% of isolates contained class 1 integrons, and one isolate harbored class 2 integrons. Plasmid associated intI1 and androgen receptor- encoding genes were transferred into Escherichia coli J53 and E. coli DH5α by conjugation and transformation experiments, respectively. Our study highlights the importance of aerobic bacteria from pork as reservoirs for antimicrobial resistance genes and mobile genetic elements that can readily be transferred intra- and interspecies.

  8. Promising therapy of XDR-TB/MDR-TB with thioridazine an inhibitor of bacterial efflux pumps

    DEFF Research Database (Denmark)

    Amaral, L; Martins, M; Viveiros, M

    2008-01-01

    -TB) - a M. tuberculosis organism that is resistant to the most effective second line drugs available for the treatment of TB. This review provides detailed, significant evidence that supports the use of an old neuroleptic compound, thioridazine (TZ), for the management of MDR-TB and XDR-TB infections...... therapy predictably ineffective and death is inevitable, compassionate therapy with TZ should be contemplated. The risks are small and the rewards great....

  9. Evaluation of GenoType® MTBDRplus assay for rapid detection of drug susceptibility testing of multi-drug resistance tuberculosis in Northern India

    Directory of Open Access Journals (Sweden)

    Anand Kumar Maurya

    2013-01-01

    Full Text Available Background: The problem of multi-drug resistance tuberculosis (MDR-TB is growing in several hotspots throughout the world. Rapid and accurate diagnosis of MDR-TB is crucial to facilitate early treatment and to reduce its spread in the community. The aim of the present study was to evaluate the new, novel GenoType® MTBDRplus assay for rapid detection of drug susceptibility testing (DST of MDR-TB cases in Northern India. Materials and Methods: A total of 550 specimens were collected from highly suspected drug resistant from pulmonary and extra-pulmonary TB cases. All the specimens were processed by Ziehl- Neelsen staining, culture, differentiation by the GenoType® CM assay, first line DST using BacT/ALERT 3D system and GenoType® MTBDRplus assay. The concordance of the GenoType® MTBDRplus assay was calculated in comparison with conventional DST results. Results: Overall the sensitivity for detection of rifampicin, isoniazid and MDR-TB resistance by GenoType® MTBDRplus assay was 98.0%, 98.4% and 98.2% respectively. Out of 55 MDR-TB strains, 45 (81.8%, 52 (94.5% and 17 (30.9% strains showed mutation in rpoB, katG and inhA genes respectively (P < 0.05. The most prominent mutations in rpoB, katG and inhA genes were; 37 (67.3% in S531L, 52 (94.5% in S315T1 and 11 (20% in C15T regions respectively (P < 0.05. Conclusions: Our study demonstrated a high concordance between the GenoType® MTBDRplus assay resistance patterns and those were observed by conventional DST with good sensitivity, specificity with short turnaround times and to control new cases of MDR-TB in countries with a high prevalence of MDR-TB.

  10. Candidate gene association analyses for ketosis resistance in Holsteins.

    Science.gov (United States)

    Kroezen, V; Schenkel, F S; Miglior, F; Baes, C F; Squires, E J

    2018-06-01

    High-yielding dairy cattle are susceptible to ketosis, a metabolic disease that negatively affects the health, fertility, and milk production of the cow. Interest in breeding for more robust dairy cattle with improved resistance to disease is global; however, genetic evaluations for ketosis would benefit from the additional information provided by genetic markers. Candidate genes that are proposed to have a biological role in the pathogenesis of ketosis were investigated in silico and a custom panel of 998 putative single nucleotide polymorphism (SNP) markers was developed. The objective of this study was to test the associations of these new markers with deregressed estimated breeding values (EBV) for ketosis. A sample of 653 Canadian Holstein cows that had been previously genotyped with a medium-density SNP chip were regenotyped with the custom panel. The EBV for ketosis in first and later lactations were obtained for each animal and deregressed for use as pseudo-phenotypes for association analyses. Results of the mixed inheritance model for single SNP association analyses suggested 15 markers in 6 unique candidate genes were associated with the studied trait. Genes encoding proteins involved in metabolic processes, including the synthesis and degradation of fatty acids and ketone bodies, gluconeogenesis, lipid mobilization, and the citric acid cycle, were identified to contain SNP associated with ketosis resistance. This work confirmed the presence of previously described quantitative trait loci for dairy cattle, suggested novel markers for ketosis-resistance, and provided insight into the underlying biology of this disease. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  11. Molecular study on some antibiotic resistant genes in Salmonella spp. isolates

    Science.gov (United States)

    Nabi, Ari Q.

    2017-09-01

    Studying the genes related with antimicrobial resistance in Salmonella spp. is a crucial step toward a correct and faster treatment of infections caused by the pathogen. In this work Integron mediated antibiotic resistant gene IntI1 (Class I Integrase IntI1) and some plasmid mediated antibiotic resistance genes (Qnr) were scanned among the isolated non-Typhoid Salmonellae strains with known resistance to some important antimicrobial drugs using Sybr Green real time PCR. The aim of the study was to correlate the multiple antibiotics and antimicrobial resistance of Salmonella spp. with the presence of integrase (IntI1) gene and plasmid mediated quinolone resistant genes. Results revealed the presence of Class I Integrase gene in 76% of the isolates with confirmed multiple antibiotic resistances. Moreover, about 32% of the multiple antibiotic resistant serotypes showed a positive R-PCR for plasmid mediated qnrA gene encoding for nalidixic acid and ciprofloxacin resistance. No positive results could be revealed form R-PCRs targeting qnrB or qnrS. In light of these results we can conclude that the presence of at least one of the qnr genes and/or the presence of Integrase Class I gene were responsible for the multiple antibiotic resistance to for nalidixic acid and ciprofloxacin from the studied Salmonella spp. and further studies required to identify the genes related with multiple antibiotic resistance of the pathogen.

  12. Survival of Antibiotic Resistant Bacteria and Horizontal Gene Transfer Control Antibiotic Resistance Gene Content in Anaerobic Digesters.

    Science.gov (United States)

    Miller, Jennifer H; Novak, John T; Knocke, William R; Pruden, Amy

    2016-01-01

    Understanding fate of antibiotic resistant bacteria (ARB) vs. their antibiotic resistance genes (ARGs) during wastewater sludge treatment is critical in order to reduce the spread of antibiotic resistance through process optimization. Here, we spiked high concentrations of tetracycline-resistant bacteria, isolated from mesophilic (Iso M1-1-a Pseudomonas sp.) and thermophilic (Iso T10-a Bacillus sp.) anaerobic digested sludge, into batch digesters and monitored their fate by plate counts and quantitative polymerase chain reaction (QPCR) of their corresponding tetracycline ARGs. In batch studies, spiked ARB plate counts returned to baseline (thermophilic) or 1-log above baseline (mesophilic) while levels of the ARG present in the spiked isolate [tet(G)] remained high in mesophilic batch reactors. To compare results under semi-continuous flow conditions with natural influent variation, tet(O), tet(W), and sul1 ARGs, along with the intI1 integrase gene, were monitored over a 9-month period in the raw feed sludge and effluent sludge of lab-scale thermophilic and mesophilic anaerobic digesters. sul1 and intI1 in mesophilic and thermophilic digesters correlated positively (Spearman rho = 0.457-0.829, P < 0.05) with the raw feed sludge. There was no correlation in tet(O) or tet(W) ratios in raw sludge and mesophilic digested sludge or thermophilic digested sludge (Spearman rho = 0.130-0.486, P = 0.075-0.612). However, in the thermophilic digester, the tet(O) and tet(W) ratios remained consistently low over the entire monitoring period. We conclude that the influent sludge microbial composition can influence the ARG content of a digester, apparently as a result of differential survival or death of ARBs or horizontal gene transfer of genes between raw sludge ARBs and the digester microbial community. Notably, mesophilic digestion was more susceptible to ARG intrusion than thermophilic digestion, which may be attributed to a higher rate of ARB survival and/or horizontal gene

  13. Genetic mapping of the rice resistance-breaking gene of the brown planthopper Nilaparvata lugens

    OpenAIRE

    Kobayashi, Tetsuya; Yamamoto, Kimiko; Suetsugu, Yoshitaka; Kuwazaki, Seigo; Hattori, Makoto; Jairin, Jirapong; Sanada-Morimura, Sachiyo; Matsumura, Masaya

    2014-01-01

    Host plant resistance has been widely used for controlling the major rice pest brown planthopper (BPH, Nilaparvata lugens). However, adaptation of the wild BPH population to resistance limits the effective use of resistant rice varieties. Quantitative trait locus (QTL) analysis was conducted to identify resistance-breaking genes against the anti-feeding mechanism mediated by the rice resistance gene Bph1. QTL analysis in iso-female BPH lines with single-nucleotide polymorphism (SNP) markers d...

  14. Analysis of differentially expressed genes related to resistance in spinosad- and neonicotinoid-resistant Musca domestica L. (Diptera: Muscidae) strains

    DEFF Research Database (Denmark)

    Castberg, Dorte Heidi Højland; Kristensen, Michael

    2017-01-01

    strains differing significantly in their response to insecticides. High differential expression of P450s and genes coding for cuticle protein indicates a combination of factors involved in metabolic neonicotinoid and spinosad resistance. Conclusion Resistance in these strains is apparently not linked...... interesting in terms of neonicotinoid resistance, while cyp4d9 was overexpressed in 791spin compared to spinosad-susceptible strains. GSTs, ESTs and UGTs were mostly overexpressed, but not to the same degree as P450s. We present a comprehensive and comparative picture of gene expression in three housefly......Background The housefly is a global pest that has developed resistance to most insecticides applied against it. Resistance of the spinosad-resistant strain 791spin and the neonicotinoid-resistant 766b strain is believed to be due to metabolism. We investigate differentially expressed genes...

  15. MDR1 P-glycoprotein transports endogenous opioid peptides

    NARCIS (Netherlands)

    Oude Elferink, R. P.; Zadina, J.

    2001-01-01

    MDR1 P-glycoprotein is generally regarded as an efflux pump for amphipathic toxic compounds. The question remains, however, whether certain endogenous compounds are also substrates for this transporter. Certain peptides have been shown to interact with MDR1 Pgp as well and we have therefore

  16. HIV-1 integrase inhibitors are substrates for the multidrug transporter MDR1-P-glycoprotein

    Directory of Open Access Journals (Sweden)

    Cara Andrea

    2007-03-01

    Full Text Available Abstract Background The discovery of diketoacid-containing derivatives as inhibitors of HIV-1 Integrase (IN (IN inhibitors, IINs has played a major role in validating this enzyme as an important target for antiretroviral therapy. Since the in vivo efficacy depends on access of these drugs to intracellular sites where HIV-1 replicates, we determined whether the IINs are recognized by the multidrug transporter MDR1-P-glycoprotein (P-gp thereby reducing their intracellular accumulation. To address the effect of IINs on drug transport, nine quinolonyl diketo acid (DKA derivatives active on the HIV-1 IN strand transfer (ST step and with EC50 ranging from 1.83 to >50 μm in cell-based assays were tested for their in vitro interaction with P-gp in the CEM-MDR cell system. IINs were investigated for the inhibition and induction of the P-gp function and expression as well as for multidrug resistance (MDR reversing ability. Results The HIV-1 IINs act as genuine P-gp substrates by inhibiting doxorubicin efflux and inducing P-gp functional conformation changes as evaluated by the modulation of UIC2 mAb epitope. Further, IINs chemosensitize MDR cells to vinblastine and induce P-gp expression in drug sensitive revertants of CEM-MDR cells. Conclusion To our knowledge, this is the first demonstration that HIV-1 IINs are P-gp substrates. This biological property may influence the absorption, distribution and elimination of these novels anti HIV-1 compounds.

  17. Metabolic Reprogramming During Multidrug Resistance in Leukemias

    Directory of Open Access Journals (Sweden)

    Raphael Silveira Vidal

    2018-04-01

    Full Text Available Cancer outcome has improved since introduction of target therapy. However, treatment success is still impaired by the same drug resistance mechanism of classical chemotherapy, known as multidrug resistance (MDR phenotype. This phenotype promotes resistance to drugs with different structures and mechanism of action. Recent reports have shown that resistance acquisition is coupled to metabolic reprogramming. High-gene expression, increase of active transport, and conservation of redox status are one of the few examples that increase energy and substrate demands. It is not clear if the role of this metabolic shift in the MDR phenotype is related to its maintenance or to its induction. Apart from the nature of this relation, the metabolism may represent a new target to avoid or to block the mechanism that has been impairing treatment success. In this mini-review, we discuss the relation between metabolism and MDR resistance focusing on the multiple non-metabolic functions that enzymes of the glycolytic pathway are known to display, with emphasis with the diverse activities of glyceraldehyde-3-phosphate dehydrogenase.

  18. Pyramiding, alternating or mixing: comparative performances of deployment strategies of nematode resistance genes to promote plant resistance efficiency and durability.

    Science.gov (United States)

    Djian-Caporalino, Caroline; Palloix, Alain; Fazari, Ariane; Marteu, Nathalie; Barbary, Arnaud; Abad, Pierre; Sage-Palloix, Anne-Marie; Mateille, Thierry; Risso, Sabine; Lanza, Roger; Taussig, Catherine; Castagnone-Sereno, Philippe

    2014-02-22

    Resistant cultivars are key elements for pathogen control and pesticide reduction, but their repeated use may lead to the emergence of virulent pathogen populations, able to overcome the resistance. Increased research efforts, mainly based on theoretical studies, explore spatio-temporal deployment strategies of resistance genes in order to maximize their durability. We evaluated experimentally three of these strategies to control root-knot nematodes: cultivar mixtures, alternating and pyramiding resistance genes, under controlled and field conditions over a 3-years period, assessing the efficiency and the durability of resistance in a protected crop rotation system with pepper as summer crop and lettuce as winter crop. The choice of the resistance gene and the genetic background in which it is introgressed, affected the frequency of resistance breakdown. The pyramiding of two different resistance genes in one genotype suppressed the emergence of virulent isolates. Alternating different resistance genes in rotation was also efficient to decrease virulent populations in fields due to the specificity of the virulence and the trapping effect of resistant plants. Mixing resistant cultivars together appeared as a less efficient strategy to control nematodes. This work provides experimental evidence that, in a cropping system with seasonal sequences of vegetable species, pyramiding or alternating resistance genes benefit yields in the long-term by increasing the durability of resistant cultivars and improving the long-term control of a soil-borne pest. To our knowledge, this result is the first one obtained for a plant-nematode interaction, which helps demonstrate the general applicability of such strategies for breeding and sustainable management of resistant cultivars against pathogens.

  19. Sulfonamide-resistant bacteria and their resistance genes in soils fertilized with manures from Jiangsu Province, Southeastern China.

    Science.gov (United States)

    Wang, Na; Yang, Xiaohong; Jiao, Shaojun; Zhang, Jun; Ye, Boping; Gao, Shixiang

    2014-01-01

    Antibiotic-resistant bacteria and genes are recognized as new environmental pollutants that warrant special concern. There were few reports on veterinary antibiotic-resistant bacteria and genes in China. This work systematically analyzed the prevalence and distribution of sulfonamide resistance genes in soils from the environments around poultry and livestock farms in Jiangsu Province, Southeastern China. The results showed that the animal manure application made the spread and abundance of antibiotic resistance genes (ARGs) increasingly in the soil. The frequency of sulfonamide resistance genes was sul1 > sul2 > sul3 in pig-manured soil DNA and sul2 > sul1 > sul3 in chicken-manured soil DNA. Further analysis suggested that the frequency distribution of the sul genes in the genomic DNA and plasmids of the SR isolates from manured soil was sul2 > sul1 > sul3 overall (psulfonamide resistance genes. The present study also indicated that Bacillus, Pseudomonas and Shigella were the most prevalent sul-positive genera in the soil, suggesting a potential human health risk. The above results could be important in the evaluation of antibiotic-resistant bacteria and genes from manure as sources of agricultural soil pollution; the results also demonstrate the necessity and urgency of the regulation and supervision of veterinary antibiotics in China.

  20. Antimicrobial Resistance and Resistance Genes in Aerobic Bacteria Isolated from Pork at Slaughter

    DEFF Research Database (Denmark)

    Li, Lili; Olsen, Rikke Heidemann; Ye, Lei

    2016-01-01

    The aim of this study was to investigate the phenotypic and genotypic antimicrobial resistance, integrons, and transferability of resistance markers in 243 aerobic bacteria recovered from pork at slaughter in the People's Republic of China. The organisms belonged to 22 genera of gram-negative bac......The aim of this study was to investigate the phenotypic and genotypic antimicrobial resistance, integrons, and transferability of resistance markers in 243 aerobic bacteria recovered from pork at slaughter in the People's Republic of China. The organisms belonged to 22 genera of gram......-negative bacteria (92.2%) and gram-positive bacteria (7.8%). High levels of resistance were detected to tetracycline, trimethoprim-sulfamethoxazole, and ampicillin (36.2 to 54.3%), and lower levels were detected to nitrofurantoin, cefotaxime, gentamicin, ciprofloxacin, and chloramphenicol (7.8 to 29.2%). Across.......6% of isolates contained class 1 integrons, and one isolate harbored class 2 integrons. Plasmid associated intI1 and androgen receptor– encoding genes were transferred into Escherichia coli J53 and E. coli DH5α by conjugation and transformation experiments, respectively. Our study highlights the importance...

  1. Evaluation of 11C-Acetate and 18 F-FDG PET/CT in mouse multidrug resistance gene-2 deficient mouse model of hepatocellular carcinoma

    International Nuclear Information System (INIS)

    Territo, Paul R.; Maluccio, Mary; Riley, Amanda A.; McCarthy, Brian P.; Fletcher, James; Tann, Mark; Saxena, Romil; Skill, Nicholas J.

    2015-01-01

    Hepatocellular carcinoma (HCC) remains a global health problem with unique diagnostic and therapeutic challenges, including difficulties in identifying the highest risk patients. Previous work from our lab has established the murine multidrug resistance-2 mouse (MDR2) model of HCC as a reasonable preclinical model that parallels the changes seen in human inflammatory associated HCC. The purpose of this study is to evaluate modalities of PET/CT in MDR2 −/− mice in order to facilitate therapeutic translational studies from bench to bedside. 18 F-FDG and 11 C-acetate PET/CT was performed on 12 m MDR2 −/− mice (n = 3/tracer) with HCC and 12 m MDR2 −/+ control mice (n = 3/tracer) without HCC. To compare PET/CT to biological markers of HCC and cellular function, serum alpha-fetoprotein (AFP), lysophosphatidic acid (LPA), cAMP and hepatic tumor necrosis factor α (TNFα) were quantified in 3-12 m MDR2 −/− (n = 10) mice using commercially available ELISA analysis. To translate results in mice to patients 11 C-acetate PET/CT was also performed in 8 patents suspected of HCC recurrence following treatment and currently on the liver transplant wait list. Hepatic 18 F-FDG metabolism was not significantly increased in MDR2 −/− mice. In contrast, hepatic 11 C-acetate metabolism was significantly elevated in MDR2 −/− mice when compared to MDR2 −/+ controls. Serum AFP and LPA levels increased in MDR2 −/− mice contemporaneous with the emergence of HCC. This was accompanied by a significant decrease in serum cAMP levels and an increase in hepatic TNFα. In patients suspected of HCC recurrence there were 5 true positives, 2 true negatives and 1 suspected false 11 C-acetate negative. Hepatic 11 C-acetate PET/CT tracks well with HCC in MDR2 −/− mice and patients with underlying liver disease. Consequently 11 C-acetate PET/CT is well suited to study 1) HCC emergence/progression in patients and 2) reduce animal numbers required to study new

  2. Inhibitory effect of the reversal agents V-104, GF120918 and Pluronic L61 on MDR1 Pgp-, MRP1- and MRP2-mediated transport

    NARCIS (Netherlands)

    Evers, R.; Kool, M.; Smith, A. J.; van Deemter, L.; de Haas, M.; Borst, P.

    2000-01-01

    The human multidrug transporter MDR1 P-glycoprotein and the multidrug resistance proteins MRP1 and MRP2 transport a range of cytotoxic drugs, resulting in multidrug resistance in tumour cells. To overcome this form of drug resistance in patients, several inhibitors (reversal agents) of these

  3. Transmissible Plasmids and Integrons Shift Escherichia coli Population Toward Larger Multiple Drug Resistance Numbers.

    Science.gov (United States)

    Suhartono, Suhartono; Savin, Mary C; Gbur, Edward E

    2018-04-01

    Transmissible plasmids and integrons may play important roles in the persistence and spread of antibiotic-resistant bacteria throughout aquatic environment by accumulating antibiotic resistance genes (ARG). Class 1 and class 2 integron (intI), mobilization (mob), sulfamethoxazole resistance (sul), and trimethoprim resistance (dfr) genes were PCR-amplified and confirmed through DNA sequencing following plasmid extraction from 139 antibiotic-resistant Escherichia coli. E. coli had previously been recovered from wastewater treatment plant effluent and receiving stream water in Northwest Arkansas and isolates had expressed resistance to one to six antibiotics. Almost half of the total isolates (47%) carried putatively transmissible plasmids with mob F12 gene as the most frequently detected mobilization gene. When two or three mob genes were detected per isolate, there was a significant shift in the population toward larger multiple drug resistance (MDR) number. Class 1 and/or 2 integrons were prevalent (46%), and the presence of integron significantly shifted the isolate population toward larger MDR number. More isolates carried single or coexistence of two or three sul genes (99.3%), and single or a combination up to five dfr genes (89.3%) than had exhibited in vitro resistance to the respective antibiotics. These findings indicate not only the role of the wastewater treatment effluent and the stream environment in coaccumulation of ARG with transmissible plasmids and integrons in multiple antibiotic-resistant E. coli populations but also suggest that density of sul and dfr resistance genes within an isolate may serve as a biomarker for mobile MDR in general.

  4. Multidrug resistance in Lactococcus lactis

    NARCIS (Netherlands)

    Bolhuis, Hendrik

    1996-01-01

    Multidrug resistance (MDR) was initially recongnized as the major cause of the failure of the drug-based treatment of human cancers. It has become increasingly clear that MDR occurs in mammalian cells but also in lower eukaryotes and bacteria. The appearance of multiple antibiotic resistant

  5. Host range of antibiotic resistance genes in wastewater treatment plant influent and effluent.

    Science.gov (United States)

    Hultman, Jenni; Tamminen, Manu; Pärnänen, Katariina; Cairns, Johannes; Karkman, Antti; Virta, Marko

    2018-04-01

    Wastewater treatment plants (WWTPs) collect wastewater from various sources for a multi-step treatment process. By mixing a large variety of bacteria and promoting their proximity, WWTPs constitute potential hotspots for the emergence of antibiotic resistant bacteria. Concerns have been expressed regarding the potential of WWTPs to spread antibiotic resistance genes (ARGs) from environmental reservoirs to human pathogens. We utilized epicPCR (Emulsion, Paired Isolation and Concatenation PCR) to detect the bacterial hosts of ARGs in two WWTPs. We identified the host distribution of four resistance-associated genes (tetM, int1, qacEΔ1and blaOXA-58) in influent and effluent. The bacterial hosts of these resistance genes varied between the WWTP influent and effluent, with a generally decreasing host range in the effluent. Through 16S rRNA gene sequencing, it was determined that the resistance gene carrying bacteria include both abundant and rare taxa. Our results suggest that the studied WWTPs mostly succeed in decreasing the host range of the resistance genes during the treatment process. Still, there were instances where effluent contained resistance genes in bacterial groups not carrying these genes in the influent. By permitting exhaustive profiling of resistance-associated gene hosts in WWTP bacterial communities, the application of epicPCR provides a new level of precision to our resistance gene risk estimates.

  6. Clusters of Antibiotic Resistance Genes Enriched Together Stay Together in Swine Agriculture.

    Science.gov (United States)

    Johnson, Timothy A; Stedtfeld, Robert D; Wang, Qiong; Cole, James R; Hashsham, Syed A; Looft, Torey; Zhu, Yong-Guan; Tiedje, James M

    2016-04-12

    Antibiotic resistance is a worldwide health risk, but the influence of animal agriculture on the genetic context and enrichment of individual antibiotic resistance alleles remains unclear. Using quantitative PCR followed by amplicon sequencing, we quantified and sequenced 44 genes related to antibiotic resistance, mobile genetic elements, and bacterial phylogeny in microbiomes from U.S. laboratory swine and from swine farms from three Chinese regions. We identified highly abundant resistance clusters: groups of resistance and mobile genetic element alleles that cooccur. For example, the abundance of genes conferring resistance to six classes of antibiotics together with class 1 integrase and the abundance of IS6100-type transposons in three Chinese regions are directly correlated. These resistance cluster genes likely colocalize in microbial genomes in the farms. Resistance cluster alleles were dramatically enriched (up to 1 to 10% as abundant as 16S rRNA) and indicate that multidrug-resistant bacteria are likely the norm rather than an exception in these communities. This enrichment largely occurred independently of phylogenetic composition; thus, resistance clusters are likely present in many bacterial taxa. Furthermore, resistance clusters contain resistance genes that confer resistance to antibiotics independently of their particular use on the farms. Selection for these clusters is likely due to the use of only a subset of the broad range of chemicals to which the clusters confer resistance. The scale of animal agriculture and its wastes, the enrichment and horizontal gene transfer potential of the clusters, and the vicinity of large human populations suggest that managing this resistance reservoir is important for minimizing human risk. Agricultural antibiotic use results in clusters of cooccurring resistance genes that together confer resistance to multiple antibiotics. The use of a single antibiotic could select for an entire suite of resistance genes if

  7. Detection of antibiotic resistance and tetracycline resistance genes in Enterobacteriaceae isolated from the Pearl rivers in South China

    International Nuclear Information System (INIS)

    Tao Ran; Ying Guangguo; Su Haochang; Zhou Hongwei; Sidhu, Jatinder P.S.

    2010-01-01

    This study investigated antibiotic resistance profiles and tetracycline resistance genes in Enterobacteriaceae family isolates from the Pearl rivers. The Enterobacteriaceae isolates were tested for susceptibility to seven antibiotics ampicillin, chloramphenicol, ciprofloxacin, levofloxacin, sulphamethoxazole/trimethoprim, tetracycline and trimethoprim. In Liuxi reservoir, with an exception to ampicillin resistant strains (11%) no other antibiotic resistance bacterial strains were detected. However, multiple drug resistance in bacterial isolates from the other sites of Pearl rivers was observed which is possibly due to sewage discharge and input from other anthropogenic sources along the rivers. Four tetracycline resistance genes tet A, tet B, tet C and tet D were detected in the isolates from the rivers. The genes tet A and tet B were widely detected with the detection frequencies of 43% and 40% respectively. Ciprofloxacin and levofloxacin resistant enteric bacteria were also isolated from the pig and duck manures which suggest a wider distribution of human specific drugs in the environment. This investigation provided a baseline data on antibiotic resistance profiles and tetracycline resistance genes in the Pearl rivers delta. - High rates of antibiotic resistance in Enterobacteriaceae from river water are attributed to wastewater contamination.

  8. Detection of antibiotic resistance and tetracycline resistance genes in Enterobacteriaceae isolated from the Pearl rivers in South China

    Energy Technology Data Exchange (ETDEWEB)

    Tao Ran [State Key Laboratory of Organic Geochemistry, Guangzhou Institute of Geochemistry, Chinese Academy of Sciences, 511 Kehua Street, Tianhe District, Guangzhou 510640 (China); Ying Guangguo, E-mail: guangguo.ying@gmail.co [State Key Laboratory of Organic Geochemistry, Guangzhou Institute of Geochemistry, Chinese Academy of Sciences, 511 Kehua Street, Tianhe District, Guangzhou 510640 (China); Su Haochang [State Key Laboratory of Organic Geochemistry, Guangzhou Institute of Geochemistry, Chinese Academy of Sciences, 511 Kehua Street, Tianhe District, Guangzhou 510640 (China); Zhou Hongwei [Department of Environmental Health, School of Public Health and Tropical Medicine, Southern Medical University, 1838 North Guangzhou Street, Baiyun District, Guangzhou 510515 (China); Sidhu, Jatinder P.S. [CSIRO Land and Water, Queensland Bioscience Precinct, 306 Carmody Road, St Lucia QLD 4067 (Australia)

    2010-06-15

    This study investigated antibiotic resistance profiles and tetracycline resistance genes in Enterobacteriaceae family isolates from the Pearl rivers. The Enterobacteriaceae isolates were tested for susceptibility to seven antibiotics ampicillin, chloramphenicol, ciprofloxacin, levofloxacin, sulphamethoxazole/trimethoprim, tetracycline and trimethoprim. In Liuxi reservoir, with an exception to ampicillin resistant strains (11%) no other antibiotic resistance bacterial strains were detected. However, multiple drug resistance in bacterial isolates from the other sites of Pearl rivers was observed which is possibly due to sewage discharge and input from other anthropogenic sources along the rivers. Four tetracycline resistance genes tet A, tet B, tet C and tet D were detected in the isolates from the rivers. The genes tet A and tet B were widely detected with the detection frequencies of 43% and 40% respectively. Ciprofloxacin and levofloxacin resistant enteric bacteria were also isolated from the pig and duck manures which suggest a wider distribution of human specific drugs in the environment. This investigation provided a baseline data on antibiotic resistance profiles and tetracycline resistance genes in the Pearl rivers delta. - High rates of antibiotic resistance in Enterobacteriaceae from river water are attributed to wastewater contamination.

  9. TTFields alone and in combination with chemotherapeutic agents effectively reduce the viability of MDR cell sub-lines that over-express ABC transporters

    International Nuclear Information System (INIS)

    Schneiderman, Rosa S; Shmueli, Esther; Kirson, Eilon D; Palti, Yoram

    2010-01-01

    Exposure of cancer cells to chemotherapeutic agents may result in reduced sensitivity to structurally unrelated agents, a phenomenon known as multidrug resistance, MDR. The purpose of this study is to investigate cell growth inhibition of wild type and the corresponding MDR cells by Tumor Treating Fields - TTFields, a new cancer treatment modality that is free of systemic toxicity. The TTFields were applied alone and in combination with paclitaxel and doxorubicin. Three pairs of wild type/MDR cell lines, having resistivity resulting from over-expression of ABC transporters, were studied: a clonal derivative (C11) of parental Chinese hamster ovary AA8 cells and their emetine-resistant sub-line Emt R1 ; human breast cancer cells MCF-7 and their mitoxantrone-resistant sub lines MCF-7/Mx and human breast cancer cells MDA-MB-231 and their doxorubicin resistant MDA-MB-231/Dox cells. TTFields were applied for 72 hours with and without the chemotherapeutic agents. The numbers of viable cells in the treated cultures and the untreated control groups were determined using the XTT assay. Student t-test was applied to asses the significance of the differences between results obtained for each of the three cell pairs. TTFields caused a similar reduction in the number of viable cells of wild type and MDR cells. Treatments by TTFields/drug combinations resulted in a similar increased reduction in cell survival of wild type and MDR cells. TTFields had no effect on intracellular doxorubicin accumulation in both wild type and MDR cells. The results indicate that TTFields alone and in combination with paclitaxel and doxorubicin effectively reduce the viability of both wild type and MDR cell sub-lines and thus can potentially be used as an effective treatment of drug resistant tumors

  10. Should all suspected tuberculosis cases in high income countries be tested with GeneXpert?

    Science.gov (United States)

    Vella, Venanzio; Broda, Agnieszka; Drobniewski, Francis

    2018-05-01

    In countries with a low incidence of multidrug-resistant tuberculosis (MDR-TB), universal testing with GeneXpert might not be always cost-effective. This study provides hospital managers in low MDR-TB incidence countries with criteria on when decentralised universal GeneXpert testing would make sense. The alternatives taken into consideration include: universal microbiological culture and drug susceptibility testing (DST) only (comparator); as above but with concurrent centralized GeneXpert in a referral laboratory vs a decentralized GeneXpert system in every hospital to test smear-positive cases only; as above but testing all samples with GeneXpert regardless of smear status. The parameters were from the national TB statistics for England and from a systematic review. Decentralised GeneXpert to test any suspected TB case was the most cost-effective option when 6% or more TB patients belonged to the high-risk group, defined as previous TB diagnosis and or being born in countries with a high MDR-TB incidence. Hospital managers in England and other low MDR-TB incidence countries could use these findings to decide when to invest in GeneXpert or other molecular diagnostics with similar performance criteria for TB diagnostics. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Strategy of gene silencing in cassava for validation of resistance genes

    International Nuclear Information System (INIS)

    Cortes, Simon; Lopez, Camilo

    2010-01-01

    Cassava (Manihot esculenta) is a major source of food for more than 1000 million people in the world and constitutes an important staple crop. Cassava bacterial blight, caused by the gram negative bacterium Xanthomonas axonopodis pv. manihotis, is one of the most important constraints for this crop. A candidate resistance gene against cassava bacterial blight, named RXam1, has been identified previously. In this work, we employed the gene silencing approach using the African cassava mosaic virus (ACMV) to validate the function of the RXam1 gene. We used as positive control the su gen, which produce photo blanching in leaves when is silenced. Plants from the SG10735 variety were bombardment with the ACMV-A-SU+ACMV-B y ACMV-A-RXam1+ACMV-B constructions. The silencing efficiency employing the su gene was low, only one of seven plants showed photo blanching. In the putative silenced plants for the RXam1 gene, no presence of siRNAs corresponding to RXam1 was observed; although a low diminution of the RXam1 gene expression was obtained. The growth curves for the Xam strain CIO136 in cassava plants inoculated showing a little but no significance difference in the susceptibility in the silenced plants compared to not silenced

  12. The Role of Adjunctive Therapies in Septic Shock by Gram Negative MDR/XDR Infections.

    Science.gov (United States)

    Busani, Stefano; Roat, Erika; Serafini, Giulia; Mantovani, Elena; Biagioni, Emanuela; Girardis, Massimo

    2017-01-01

    Patients with septic shock by multidrug resistant microorganisms (MDR) are a specific sepsis population with a high mortality risk. The exposure to an initial inappropriate empiric antibiotic therapy has been considered responsible for the increased mortality, although other factors such as immune-paralysis seem to play a pivotal role. Therefore, beyond conventional early antibiotic therapy and fluid resuscitation, this population may benefit from the use of alternative strategies aimed at supporting the immune system. In this review we present an overview of the relationship between MDR infections and immune response and focus on the rationale and the clinical data available on the possible adjunctive immunotherapies, including blood purification techniques and different pharmacological approaches.

  13. The Role of Adjunctive Therapies in Septic Shock by Gram Negative MDR/XDR Infections

    Directory of Open Access Journals (Sweden)

    Stefano Busani

    2017-01-01

    Full Text Available Patients with septic shock by multidrug resistant microorganisms (MDR are a specific sepsis population with a high mortality risk. The exposure to an initial inappropriate empiric antibiotic therapy has been considered responsible for the increased mortality, although other factors such as immune-paralysis seem to play a pivotal role. Therefore, beyond conventional early antibiotic therapy and fluid resuscitation, this population may benefit from the use of alternative strategies aimed at supporting the immune system. In this review we present an overview of the relationship between MDR infections and immune response and focus on the rationale and the clinical data available on the possible adjunctive immunotherapies, including blood purification techniques and different pharmacological approaches.

  14. Management of MDR-TB in HIV co-infected patients in Eastern Europe

    DEFF Research Database (Denmark)

    Efsen, A M W; Schultze, A; Miller, R F

    2018-01-01

    below the target of 90%, reflecting the challenging patient population and the environment in which health care is provided. Urgent improvement of management of patients with TB/HIV in EE, in particular for those with MDR-TB, is needed and includes widespread access to rapid TB diagnostics, better......OBJECTIVES: Mortality among HIV patients with tuberculosis (TB) remains high in Eastern Europe (EE), but details of TB and HIV management remain scarce. METHODS: In this prospective study, we describe the TB treatment regimens of patients with multi-drug resistant (MDR) TB and use of antiretroviral...... access to and use of second-line TB drugs, timely ART initiation with viral load monitoring, and integration of TB/HIV care....

  15. Functional screen for genes responsible for tamoxifen resistance in human breast cancer cells

    NARCIS (Netherlands)

    Meijer, Danielle; van Agthoven, Ton; Bosma, Peter T.; Nooter, Kees; Dorssers, Lambert C. J.

    2006-01-01

    Antiestrogens, such as tamoxifen, are widely used for endocrine treatment of estrogen receptor-positive breast cancer. However, as breast cancer progresses, development of tamoxifen resistance is inevitable. The mechanisms underlying this resistance are not well understood. To identify genes

  16. Comparative Genotypes, Staphylococcal Cassette Chromosome mec (SCCmec) Genes and Antimicrobial Resistance amongst Staphylococcus epidermidis and Staphylococcus haemolyticus Isolates from Infections in Humans and Companion Animals.

    Science.gov (United States)

    McManus, Brenda A; Coleman, David C; Deasy, Emily C; Brennan, Gráinne I; O' Connell, Brian; Monecke, Stefan; Ehricht, Ralf; Leggett, Bernadette; Leonard, Nola; Shore, Anna C

    2015-01-01

    This study compares the characteristics of Staphylococcus epidermidis (SE) and Staphylococcus haemolyticus (SH) isolates from epidemiologically unrelated infections in humans (Hu) (28 SE-Hu; 8 SH-Hu) and companion animals (CpA) (12 SE-CpA; 13 SH-CpA). All isolates underwent antimicrobial susceptibility testing, multilocus sequence typing and DNA microarray profiling to detect antimicrobial resistance and SCCmec-associated genes. All methicillin-resistant (MR) isolates (33/40 SE, 20/21 SH) underwent dru and mecA allele typing. Isolates were predominantly assigned to sequence types (STs) within a single clonal complex (CC2, SE, 84.8%; CC1, SH, 95.2%). SCCmec IV predominated among MRSE with ST2-MRSE-IVc common to both Hu (40.9%) and CpA (54.5%). Identical mecA alleles and nontypeable dru types (dts) were identified in one ST2-MRSE-IVc Hu and CpA isolate, however, all mecA alleles and 2/4 dts detected among 18 ST2-MRSE-IVc isolates were closely related, sharing >96.5% DNA sequence homology. Although only one ST-SCCmec type combination (ST1 with a non-typeable [NT] SCCmec NT9 [class C mec and ccrB4]) was common to four MRSH-Hu and one MRSH-CpA, all MRSH isolates were closely related based on similar STs, SCCmec genes (V/VT or components thereof), mecA alleles and dts. Overall, 39.6% of MR isolates harbored NT SCCmec elements, and ACME was more common amongst MRSE and CpA isolates. Multidrug resistance (MDR) was detected among 96.7% of isolates but they differed in the prevalence of specific macrolide, aminoglycoside and trimethoprim resistance genes amongst SE and SH isolates. Ciprofloxacin, rifampicin, chloramphenicol [fexA, cat-pC221], tetracycline [tet(K)], aminoglycosides [aadD, aphA3] and fusidic acid [fusB] resistance was significantly more common amongst CpA isolates. SE and SH isolates causing infections in Hu and CpA hosts belong predominantly to STs within a single lineage, harboring similar but variable SCCmec genes, mecA alleles and dts. Host and

  17. Comparative Genotypes, Staphylococcal Cassette Chromosome mec (SCCmec Genes and Antimicrobial Resistance amongst Staphylococcus epidermidis and Staphylococcus haemolyticus Isolates from Infections in Humans and Companion Animals.

    Directory of Open Access Journals (Sweden)

    Brenda A McManus

    Full Text Available This study compares the characteristics of Staphylococcus epidermidis (SE and Staphylococcus haemolyticus (SH isolates from epidemiologically unrelated infections in humans (Hu (28 SE-Hu; 8 SH-Hu and companion animals (CpA (12 SE-CpA; 13 SH-CpA. All isolates underwent antimicrobial susceptibility testing, multilocus sequence typing and DNA microarray profiling to detect antimicrobial resistance and SCCmec-associated genes. All methicillin-resistant (MR isolates (33/40 SE, 20/21 SH underwent dru and mecA allele typing. Isolates were predominantly assigned to sequence types (STs within a single clonal complex (CC2, SE, 84.8%; CC1, SH, 95.2%. SCCmec IV predominated among MRSE with ST2-MRSE-IVc common to both Hu (40.9% and CpA (54.5%. Identical mecA alleles and nontypeable dru types (dts were identified in one ST2-MRSE-IVc Hu and CpA isolate, however, all mecA alleles and 2/4 dts detected among 18 ST2-MRSE-IVc isolates were closely related, sharing >96.5% DNA sequence homology. Although only one ST-SCCmec type combination (ST1 with a non-typeable [NT] SCCmec NT9 [class C mec and ccrB4] was common to four MRSH-Hu and one MRSH-CpA, all MRSH isolates were closely related based on similar STs, SCCmec genes (V/VT or components thereof, mecA alleles and dts. Overall, 39.6% of MR isolates harbored NT SCCmec elements, and ACME was more common amongst MRSE and CpA isolates. Multidrug resistance (MDR was detected among 96.7% of isolates but they differed in the prevalence of specific macrolide, aminoglycoside and trimethoprim resistance genes amongst SE and SH isolates. Ciprofloxacin, rifampicin, chloramphenicol [fexA, cat-pC221], tetracycline [tet(K], aminoglycosides [aadD, aphA3] and fusidic acid [fusB] resistance was significantly more common amongst CpA isolates. SE and SH isolates causing infections in Hu and CpA hosts belong predominantly to STs within a single lineage, harboring similar but variable SCCmec genes, mecA alleles and dts. Host and

  18. A maize resistance gene functions against bacterial streak disease in rice

    OpenAIRE

    Zhao, Bingyu; Lin, Xinghua; Poland, Jesse; Trick, Harold; Leach, Jan; Hulbert, Scot

    2005-01-01

    Although cereal crops all belong to the grass family (Poacea), most of their diseases are specific to a particular species. Thus, a given cereal species is typically resistant to diseases of other grasses, and this nonhost resistance is generally stable. To determine the feasibility of transferring nonhost resistance genes (R genes) between distantly related grasses to control specific diseases, we identified a maize R gene that recognizes a rice pathogen, Xanthomonas oryzae pv. oryzicola, wh...

  19. Investigating of four main carbapenem-resistance mechanisms in high-level carbapenem resistant Pseudomonas aeruginosa isolated from burn patients

    Directory of Open Access Journals (Sweden)

    Soodabeh Rostami

    2018-02-01

    Conclusion: Emerging antimicrobial resistance in burn wound bacterial pathogens is a serious therapeutic challenge for clinicians. In the present study, most of the isolates were MDR. This finding indicated an alarming spread of resistant isolates and suggested that infection control strategies should be considered. Resistance to carbapenems is influenced by several factors, not all of which were evaluated in our study; however, the results showed that production of MBLs and overexpression of the mexB gene were the most frequent mechanisms in carbapenem-resistant isolates.

  20. Comparative genomic and transcriptomic analysis of selected fatty acid biosynthesis genes and CNL disease resistance genes in oil palm

    Science.gov (United States)

    Rosli, Rozana; Amiruddin, Nadzirah; Ab Halim, Mohd Amin; Chan, Pek-Lan; Chan, Kuang-Lim; Azizi, Norazah; Morris, Priscilla E.; Leslie Low, Eng-Ti; Ong-Abdullah, Meilina; Sambanthamurthi, Ravigadevi; Singh, Rajinder

    2018-01-01

    Comparative genomics and transcriptomic analyses were performed on two agronomically important groups of genes from oil palm versus other major crop species and the model organism, Arabidopsis thaliana. The first analysis was of two gene families with key roles in regulation of oil quality and in particular the accumulation of oleic acid, namely stearoyl ACP desaturases (SAD) and acyl-acyl carrier protein (ACP) thioesterases (FAT). In both cases, these were found to be large gene families with complex expression profiles across a wide range of tissue types and developmental stages. The detailed classification of the oil palm SAD and FAT genes has enabled the updating of the latest version of the oil palm gene model. The second analysis focused on disease resistance (R) genes in order to elucidate possible candidates for breeding of pathogen tolerance/resistance. Ortholog analysis showed that 141 out of the 210 putative oil palm R genes had homologs in banana and rice. These genes formed 37 clusters with 634 orthologous genes. Classification of the 141 oil palm R genes showed that the genes belong to the Kinase (7), CNL (95), MLO-like (8), RLK (3) and Others (28) categories. The CNL R genes formed eight clusters. Expression data for selected R genes also identified potential candidates for breeding of disease resistance traits. Furthermore, these findings can provide information about the species evolution as well as the identification of agronomically important genes in oil palm and other major crops. PMID:29672525

  1. Comparative genomic and transcriptomic analysis of selected fatty acid biosynthesis genes and CNL disease resistance genes in oil palm.

    Science.gov (United States)

    Rosli, Rozana; Amiruddin, Nadzirah; Ab Halim, Mohd Amin; Chan, Pek-Lan; Chan, Kuang-Lim; Azizi, Norazah; Morris, Priscilla E; Leslie Low, Eng-Ti; Ong-Abdullah, Meilina; Sambanthamurthi, Ravigadevi; Singh, Rajinder; Murphy, Denis J

    2018-01-01

    Comparative genomics and transcriptomic analyses were performed on two agronomically important groups of genes from oil palm versus other major crop species and the model organism, Arabidopsis thaliana. The first analysis was of two gene families with key roles in regulation of oil quality and in particular the accumulation of oleic acid, namely stearoyl ACP desaturases (SAD) and acyl-acyl carrier protein (ACP) thioesterases (FAT). In both cases, these were found to be large gene families with complex expression profiles across a wide range of tissue types and developmental stages. The detailed classification of the oil palm SAD and FAT genes has enabled the updating of the latest version of the oil palm gene model. The second analysis focused on disease resistance (R) genes in order to elucidate possible candidates for breeding of pathogen tolerance/resistance. Ortholog analysis showed that 141 out of the 210 putative oil palm R genes had homologs in banana and rice. These genes formed 37 clusters with 634 orthologous genes. Classification of the 141 oil palm R genes showed that the genes belong to the Kinase (7), CNL (95), MLO-like (8), RLK (3) and Others (28) categories. The CNL R genes formed eight clusters. Expression data for selected R genes also identified potential candidates for breeding of disease resistance traits. Furthermore, these findings can provide information about the species evolution as well as the identification of agronomically important genes in oil palm and other major crops.

  2. The diversity of antimicrobial resistance genes among staphylococci of animal origin.

    Science.gov (United States)

    Wendlandt, Sarah; Feßler, Andrea T; Monecke, Stefan; Ehricht, Ralf; Schwarz, Stefan; Kadlec, Kristina

    2013-08-01

    Staphylococci of animal origin harbor a wide variety of resistance genes. So far, more than 40 different resistance genes have been identified in staphylococci from animals. This includes genes that confer resistance to virtually all classes of antimicrobial agents approved for use in animals, such as penicillins, cephalosporins, tetracyclines, macrolides, lincosamides, phenicols, aminoglycosides, aminocyclitols, pleuromutilins, and diaminopyrimidines. The gene products of some of these resistance genes confer resistance to only specific members of a class of antimicrobial agents, whereas others confer resistance to the entire class or even to members of different classes of antimicrobial agents. The resistance mechanisms specified by the resistance genes fall into three major categories: (i) enzymatic inactivation, (ii) active efflux, or (iii) protection/modification/replacement of the cellular target sites of the antimicrobial agents. Mobile genetic elements, in particular plasmids and transposons, play a major role as carriers of antimicrobial resistance genes in animal staphylococci. They facilitate the exchange of resistance genes with staphylococci of human origin but also with other Gram-positive bacteria. Copyright © 2013 Elsevier GmbH. All rights reserved.

  3. Antimicrobial-Resistant Bacterial Populations and Antimicrobial Resistance Genes Obtained from Environments Impacted by Livestock and Municipal Waste.

    Directory of Open Access Journals (Sweden)

    Getahun E Agga

    Full Text Available This study compared the populations of antimicrobial-resistant bacteria and the repertoire of antimicrobial resistance genes in four environments: effluent of three municipal wastewater treatment facilities, three cattle feedlot runoff catchment ponds, three swine waste lagoons, and two "low impact" environments (an urban lake and a relict prairie. Multiple liquid and solid samples were collected from each environment. The prevalences and concentrations of antimicrobial-resistant (AMR Gram-negative (Escherichia coli and Salmonella enterica and Gram-positive (enterococci bacteria were determined from individual samples (n = 174. The prevalences of 84 antimicrobial resistance genes in metagenomic DNA isolated from samples pooled (n = 44 by collection date, location, and sample type were determined. The prevalences and concentrations of AMR E. coli and Salmonella were similar among the livestock and municipal sample sources. The levels of erythromycin-resistant enterococci were significantly higher in liquid samples from cattle catchment ponds and swine waste lagoons than in liquid samples from municipal wastewater treatment facilities, but solid samples from these environments did not differ significantly. Similarly, trimethoprim/sulfamethoxazole-resistant E. coli concentrations were significantly higher in swine liquid than in municipal liquid samples, but there was no difference in solid samples. Multivariate analysis of the distribution of antimicrobial resistance genes using principal coordinate analysis showed distinct clustering of samples with livestock (cattle and swine, low impact environment and municipal samples forming three separate clusters. The numbers of class A beta-lactamase, class C beta-lactamase, and fluoroquinolone resistance genes detected were significantly higher (P < 0.05 in municipal samples than in cattle runoff or swine lagoon samples. In conclusion, we report that AMR is a very widespread phenomenon and that similar

  4. Thioridazine affects transcription of genes involved in cell wall biosynthesis in methicillin-resistant Staphylococcus aureus

    DEFF Research Database (Denmark)

    Bonde, Mette; Højland, Dorte Heidi; Kolmos, Hans Jørn

    2011-01-01

    have previously shown that the expression of some resistance genes is abolished after treatment with thioridazine and oxacillin. To further understand the mechanism underlying the reversal of resistance, we tested the expression of genes involved in antibiotic resistance and cell wall biosynthesis...... in response to thioridazine in combination with oxacillin. We observed that the oxacillin-induced expression of genes belonging to the VraSR regulon is reduced by the addition of thioridazine. The exclusion of such key factors involved in cell wall biosynthesis will most likely lead to a weakened cell wall...... reversal of resistance by thioridazine relies on decreased expression of specific genes involved in cell wall biosynthesis....

  5. Candidate genes for cross-resistance against DNA-damaging drugs

    DEFF Research Database (Denmark)

    Wittig, Rainer; Nessling, Michelle; Will, Rainer D

    2002-01-01

    Drug resistance of tumor cells leads to major drawbacks in the treatment of cancer. To identify candidate genes for drug resistance, we compared the expression patterns of the drug-sensitive human malignant melanoma cell line MeWo and three derived sublines with acquired resistance to the DNA...... as several apoptosis-related genes, in particular STK17A and CRYAB. As MPP1 and CRYAB are also among the 14 genes differentially expressed in all three of the drug-resistant sublines, they represent the strongest candidates for resistance against DNA-damaging drugs....

  6. Comparison between Radioisotopic and Non-radioisotopic Polymerase Chain Reaction-Single Strand Conformation Polymorphism (PCR-SSCP) Procedures in the Detection of Mutations at the rpoB Gene Associated with Rifampicin Resistance in Mycobacterium tuberculosis

    International Nuclear Information System (INIS)

    Lee, H.; Bang, H.E.; Johnson, R.; Jordaan, A.M.; Victor, T.C. . E-mail : tv@sun.ac.za; Dar, L.; Khan, B.K.; Cho, S.N. . E-mail : raycho@yonsei.ac.kr

    2006-01-01

    Rapid and sensitive detection of mutations at the rpoB gene of Mycobacterium tuberculosis would be of great importance for proper management of tuberculosis (TB) patients and control of multi-drug resistant TB. Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) using both radioisotopic and non-radioisotopic methods have been widely used for detecting such mutations. However, the silver staining method, which is the most frequently employed in PCR-SSCP, has been reported to be producing results of varying sensitivity. Radioisotope-based methods have shown greater sensitivity in detecting the rpoB mutations than the silver staining method. The primary objective of this study was therefore to compare the radioisotopic method with the silver staining method detection of mutations of rpoB gene by PCR-SSCP in the same laboratory. Purified DNAs from M. tuberculosis H37Rv were serially diluted and used for PCR amplification with and without radionuclides. The PCR products were then detected by silver staining and autoradiography methods. In addition, clinical isolates were analyzed by PCR-SSCP. The radioisotopic method showed about four-fold increase in the detection of PCR products over ethidium bromide staining in agarose gel. When compared with silver staining, the radioisotopic method gave a sensitivity of more than 10-fold in detecting PCR products and about 8-fold in PCR-SSCP. Radioisotope-based detection methods provided a clearer resolution in PCR-SSCP than the silver staining method when applied to clinical isolates of M. tuberculosis. Radioisotope-based detection method was shown to be more sensitive than non-isotope-based method in detecting PCR products and mutations at the rpoB gene of M. tuberculosis by PCR-SSCP. It may be noted that mutations in the rpoB gene as a marker have significant clinical importance because of the increasing number of MDR-TB cases in the world. It is especially relevant to MDR and Extreme Drug Resistance TB

  7. Antibiotic resistance genes in anaerobic bacteria isolated from primary dental root canal infections.

    Science.gov (United States)

    Rôças, Isabela N; Siqueira, José F

    2012-12-01

    Fourty-one bacterial strains isolated from infected dental root canals and identified by 16S rRNA gene sequence were screened for the presence of 14 genes encoding resistance to beta-lactams, tetracycline and macrolides. Thirteen isolates (32%) were positive for at least one of the target antibiotic resistance genes. These strains carrying at least one antibiotic resistance gene belonged to 11 of the 26 (42%) infected root canals sampled. Two of these positive cases had two strains carrying resistance genes. Six out of 7 Fusobacterium strains harbored at least one of the target resistance genes. One Dialister invisus strain was positive for 3 resistance genes, and 4 other strains carried two of the target genes. Of the 6 antibiotic resistance genes detected in root canal strains, the most prevalent were blaTEM (17% of the strains), tetW (10%), and ermC (10%). Some as-yet-uncharacterized Fusobacterium and Prevotella isolates were positive for blaTEM, cfxA and tetM. Findings demonstrated that an unexpectedly large proportion of dental root canal isolates, including as-yet-uncharacterized strains previously regarded as uncultivated phylotypes, can carry antibiotic resistance genes. Copyright © 2012 Elsevier Ltd. All rights reserved.

  8. Gene Expression Profiling and Identification of Resistance Genes to Aspergillus flavus Infection in Peanut through EST and Microarray Strategies

    Directory of Open Access Journals (Sweden)

    Baozhu Guo

    2011-06-01

    Full Text Available Aspergillus flavus and A. parasiticus infect peanut seeds and produce aflatoxins, which are associated with various diseases in domestic animals and humans throughout the world. The most cost-effective strategy to minimize aflatoxin contamination involves the development of peanut cultivars that are resistant to fungal infection and/or aflatoxin production. To identify peanut Aspergillus-interactive and peanut Aspergillus-resistance genes, we carried out a large scale peanut Expressed Sequence Tag (EST project which we used to construct a peanut glass slide oligonucleotide microarray. The fabricated microarray represents over 40% of the protein coding genes in the peanut genome. For expression profiling, resistant and susceptible peanut cultivars were infected with a mixture of Aspergillus flavus and parasiticus spores. The subsequent microarray analysis identified 62 genes in resistant cultivars that were up-expressed in response to Aspergillus infection. In addition, we identified 22 putative Aspergillus-resistance genes that were constitutively up-expressed in the resistant cultivar in comparison to the susceptible cultivar. Some of these genes were homologous to peanut, corn, and soybean genes that were previously shown to confer resistance to fungal infection. This study is a first step towards a comprehensive genome-scale platform for developing Aspergillus-resistant peanut cultivars through targeted marker-assisted breeding and genetic engineering.

  9. Mechanisms of first-line antimicrobial resistance in multi-drug and extensively drug resistant strains of Mycobacterium tuberculosis in KwaZulu-Natal, South Africa

    Directory of Open Access Journals (Sweden)

    Navisha Dookie

    2016-10-01

    Full Text Available Abstract Background In South Africa, drug resistant tuberculosis is a major public health crisis in the face of the colossal HIV pandemic. Methods In an attempt to understand the distribution of drug resistance in our setting, we analysed the rpoB, katG, inhA, pncA and embB genes associated with resistance to key drugs used in the treatment of tuberculosis in clinical isolates of Mycobacterium tuberculosis in the KwaZulu-Natal province. Results Classical mutations were detected in the katG, inhA and embB genes associated with resistance to isoniazid and ethambutol. Diverse mutations were recorded in the multidrug resistant (MDR and extensively drug resistant (XDR isolates for the rpoB and pncA gene associated with resistance to rifampicin and pyrazinamide. Conclusions M.tuberculosis strains circulating in our setting display a combination of previously observed mutations, each mediating resistance to a different drug. The MDR and XDR TB isolates analysed in this study displayed classical mutations linked to INH and EMB resistance, whilst diverse mutations were linked to RIF and PZA resistance. The similarity of the XDR strains confirms reports of the clonality of the XDR epidemic. The successful dissemination of the drug resistant strains in the province underscores the need for rapid diagnostics to effectively diagnose drug resistance and guide treatment.

  10. Risk factors associated with multidrug resistant tuberculosis among ...

    African Journals Online (AJOL)

    Background: Multidrug resistant tuberculosis (MDR-TB) remains is an important public health problem in developing world. We conducted this study to determine risk factors associated with MDR-TB and drug susceptibility pattern to second line drug among MDR TB patients in Tanzania. Methods: Unmatched case control ...

  11. Alteration of gene expression and DNA methylation in drug-resistant gastric cancer.

    Science.gov (United States)

    Maeda, Osamu; Ando, Takafumi; Ohmiya, Naoki; Ishiguro, Kazuhiro; Watanabe, Osamu; Miyahara, Ryoji; Hibi, Yoko; Nagai, Taku; Yamada, Kiyofumi; Goto, Hidemi

    2014-04-01

    The mechanisms of drug resistance in cancer are not fully elucidated. To study the drug resistance of gastric cancer, we analyzed gene expression and DNA methylation profiles of 5-fluorouracil (5-FU)- and cisplatin (CDDP)-resistant gastric cancer cells and biopsy specimens. Drug-resistant gastric cancer cells were established with culture for >10 months in a medium containing 5-FU or CDDP. Endoscopic biopsy specimens were obtained from gastric cancer patients who underwent chemotherapy with oral fluoropyrimidine S-1 and CDDP. Gene expression and DNA methylation analyses were performed using microarray, and validated using real-time PCR and pyrosequencing, respectively. Out of 17,933 genes, 541 genes commonly increased and 569 genes decreased in both 5-FU- and CDDP-resistant AGS cells. Genes with expression changed by drugs were related to GO term 'extracellular region' and 'p53 signaling pathway' in both 5-FU- and CDDP-treated cells. Expression of 15 genes including KLK13 increased and 12 genes including ETV7 decreased, in both drug-resistant cells and biopsy specimens of two patients after chemotherapy. Out of 10,365 genes evaluated with both expression microarray and methylation microarray, 74 genes were hypermethylated and downregulated, or hypomethylated and upregulated in either 5-FU-resistant or CDDP-resistant cells. Of these genes, expression of 21 genes including FSCN1, CPT1C and NOTCH3, increased from treatment with a demethylating agent. There are alterations of gene expression and DNA methylation in drug-resistant gastric cancer; they may be related to mechanisms of drug resistance and may be useful as biomarkers of gastric cancer drug sensitivity.

  12. Three distinct clones of carbapenem-resistant Acinetobacter baumannii with high diversity of carbapenemases isolated from patients in two hospitals in Kuwait

    Directory of Open Access Journals (Sweden)

    N.A. Al-Sweih

    2012-02-01

    Full Text Available Summary: Objectives: This study was undertaken to investigate the clonal relatedness of multidrug-resistant (MDR Acinetobacter baumannii isolates collected from patients in two teaching hospitals in Kuwait. Materials and methods: Clinically significant consecutive isolates of A. baumannii obtained from patients in the Mubarak (36 and Adan (58 hospitals over a period of 6 months were studied. These isolates were identified using molecular methods, and their antimicrobial susceptibility was determined by the Etest method. The mechanism of resistance to carbapenem was investigated by PCR, and pulsed-field gel electrophoresis (PFGE was used to determine the clonal relatedness of MDR isolates. Results: Of the 94 isolates investigated, 80 (85.1% were multidrug resistant (MDR. The A. baumannii PFGE clone A and subclone A1 were the most prevalent in patients infected with MDR isolates. Fifty-five (94.8% and 15 (41.7% of the MDR isolates from the Adan and Mubarak hospitals, respectively, belonged to PFGE clone A; isolates in this group showed higher resistance rates to antibiotics than isolates form other groups. Of the 94 isolates, 40 (42.6% were resistant to either imipenem or meropenem or to both (CRAB. Most CRAB isolates (29/40 or 72.5% carried bla genes, which code for MBL (VIM-2 and IMP-1 enzymes. Two isolates harbored blaOXA-23. Conclusion: Three distinct clones of CRAB were isolated, providing evidence of a high diversity of carbapenemases among our geographically related isolates. Keywords: MDR A. baumannii, Genotypes, bla genes, Kuwait hospitals

  13. QTL mapping and transcriptome analysis of cowpea reveals candidate genes for root-knot nematode resistance.

    Science.gov (United States)

    Santos, Jansen Rodrigo Pereira; Ndeve, Arsenio Daniel; Huynh, Bao-Lam; Matthews, William Charles; Roberts, Philip Alan

    2018-01-01

    Cowpea is one of the most important food and forage legumes in drier regions of the tropics and subtropics. However, cowpea yield worldwide is markedly below the known potential due to abiotic and biotic stresses, including parasitism by root-knot nematodes (Meloidogyne spp., RKN). Two resistance genes with dominant effect, Rk and Rk2, have been reported to provide resistance against RKN in cowpea. Despite their description and use in breeding for resistance to RKN and particularly genetic mapping of the Rk locus, the exact genes conferring resistance to RKN remain unknown. In the present work, QTL mapping using recombinant inbred line (RIL) population 524B x IT84S-2049 segregating for a newly mapped locus and analysis of the transcriptome changes in two cowpea near-isogenic lines (NIL) were used to identify candidate genes for Rk and the newly mapped locus. A major QTL, designated QRk-vu9.1, associated with resistance to Meloidogyne javanica reproduction, was detected and mapped on linkage group LG9 at position 13.37 cM using egg production data. Transcriptome analysis on resistant and susceptible NILs 3 and 9 days after inoculation revealed up-regulation of 109 and 98 genes and down-regulation of 110 and 89 genes, respectively, out of 19,922 unique genes mapped to the common bean reference genome. Among the differentially expressed genes, four and nine genes were found within the QRk-vu9.1 and QRk-vu11.1 QTL intervals, respectively. Six of these genes belong to the TIR-NBS-LRR family of resistance genes and three were upregulated at one or more time-points. Quantitative RT-PCR validated gene expression to be positively correlated with RNA-seq expression pattern for eight genes. Future functional analysis of these cowpea genes will enhance our understanding of Rk-mediated resistance and identify the specific gene responsible for the resistance.

  14. QTL mapping and transcriptome analysis of cowpea reveals candidate genes for root-knot nematode resistance.

    Directory of Open Access Journals (Sweden)

    Jansen Rodrigo Pereira Santos

    Full Text Available Cowpea is one of the most important food and forage legumes in drier regions of the tropics and subtropics. However, cowpea yield worldwide is markedly below the known potential due to abiotic and biotic stresses, including parasitism by root-knot nematodes (Meloidogyne spp., RKN. Two resistance genes with dominant effect, Rk and Rk2, have been reported to provide resistance against RKN in cowpea. Despite their description and use in breeding for resistance to RKN and particularly genetic mapping of the Rk locus, the exact genes conferring resistance to RKN remain unknown. In the present work, QTL mapping using recombinant inbred line (RIL population 524B x IT84S-2049 segregating for a newly mapped locus and analysis of the transcriptome changes in two cowpea near-isogenic lines (NIL were used to identify candidate genes for Rk and the newly mapped locus. A major QTL, designated QRk-vu9.1, associated with resistance to Meloidogyne javanica reproduction, was detected and mapped on linkage group LG9 at position 13.37 cM using egg production data. Transcriptome analysis on resistant and susceptible NILs 3 and 9 days after inoculation revealed up-regulation of 109 and 98 genes and down-regulation of 110 and 89 genes, respectively, out of 19,922 unique genes mapped to the common bean reference genome. Among the differentially expressed genes, four and nine genes were found within the QRk-vu9.1 and QRk-vu11.1 QTL intervals, respectively. Six of these genes belong to the TIR-NBS-LRR family of resistance genes and three were upregulated at one or more time-points. Quantitative RT-PCR validated gene expression to be positively correlated with RNA-seq expression pattern for eight genes. Future functional analysis of these cowpea genes will enhance our understanding of Rk-mediated resistance and identify the specific gene responsible for the resistance.

  15. Class 1 and 2 integrons, sul resistance genes and antibiotic resistance in Escherichia coli isolated from Dongjiang River, South China

    International Nuclear Information System (INIS)

    Su Haochang; Ying Guangguo; Tao Ran; Zhang Ruiquan; Zhao Jianliang; Liu Yousheng

    2012-01-01

    Antibiotic susceptibility, detection of sul gene types and presence of class 1, 2 and 3 integrons and gene cassettes using PCR assays were investigated in 3456 Escherichia coli isolates obtained from 38 sampling sites of the Dongjiang River catchment in the dry and wet seasons. 89.1% of the isolates were resistant and 87.5% showed resistance to at least three antibiotics. sul2 was detected most frequently in 89.2% of 1403 SXT-resistant isolates. The presence of integrons (class 1 and 2) was frequently observed (82.3%) while no class 3 integron was found. In these integrons, 21 resistance genes of 14 gene cassette arrays and 10 different families of resistance genes were identified. Three gene cassette arrays, aac(6')-Ib-cr-aar-3-dfrA27-aadA16, aacA4-catB3-dfrA1 and aadA2-lnuF, were detected for the first time in surface water. The results showed that bacterial resistance in the catchment was seriously influenced by human activities, especially discharge of wastewater. Highlights: ► Antibiotic resistance was investigated for a river catchment of southern China. ► 87.5% of E coli isolates showed resistance to at least three antibiotics. ► The presence of integrons (class 1 and 2) was frequently observed (82.3%). ► Bacterial resistance in the catchment was seriously influenced by human activities. - Bacterial resistance to antibiotics in a catchment is related to the discharge of wastewater into the aquatic environment.

  16. Genetic diversity and natural selection of Plasmodium vivax multi-drug resistant gene (pvmdr1) in Mesoamerica.

    Science.gov (United States)

    González-Cerón, Lilia; Montoya, Alberto; Corzo-Gómez, Josselin C; Cerritos, Rene; Santillán, Frida; Sandoval, Marco A

    2017-07-01

    The Plasmodium vivax multidrug resistant 1 gene (pvmdr1) codes for a transmembrane protein of the parasite's digestive vacuole. It is likely that the pvmdr1 gene mutations occur at different sites by convergent evolution. In here, the genetic variation of pvmdr1 at three sites of the Mesoamerican region was studied. Since 1950s, malarious patients of those areas have been treated only with chloroquine and primaquine. Blood samples from patients infected with P. vivax were obtained in southern Mexico (SMX), in the Northwest (NIC-NW) and in the northeast (NIC-NE) of Nicaragua. Genomic DNA was obtained and fragments of pvmdr1 were amplified and sequenced. The nucleotide and amino acid changes as well as the haplotype frequency in pvmdr1 were determined per strain and per geographic site. The sequences of pvmdr1 obtained from the studied regions were compared with homologous sequences from the GenBank database to explore the P. vivax genetic structure. In 141 parasites, eight nucleotide changes (two changes were synonymous and other six were nonsynonymous) were detected in 1536 bp. The PvMDR1 amino acid changes Y976F, F1076FL were predominant in endemic parasites from NIC-NE and outbreak parasites in NIC-NW but absent in SMX. Thirteen haplotypes were resolved, and found to be closely related, but their frequency at each geographic site was different (P = 0.0001). The pvmdr1 codons 925-1083 gene fragment showed higher genetic and haplotype diversity in parasites from NIC-NE than the other areas outside Latin America. The haplotype networks suggested local diversification of pvmdr1 and no significant departure from neutrality. The F ST values were low to moderate regionally, but high between NIC-NE or NIC-NW and other regions inside and outside Latin America. The pvmdr1 gene might have diversified recently at regional level. In the absence of significant natural, genetic drift might have caused differential pvmdr1 haplotype frequencies at different geographic sites

  17. Phylogenetic relatedness determined between antibiotic resistance and 16S rRNA genes in actinobacteria.

    Science.gov (United States)

    Sagova-Mareckova, Marketa; Ulanova, Dana; Sanderova, Petra; Omelka, Marek; Kamenik, Zdenek; Olsovska, Jana; Kopecky, Jan

    2015-04-01

    Distribution and evolutionary history of resistance genes in environmental actinobacteria provide information on intensity of antibiosis and evolution of specific secondary metabolic pathways at a given site. To this day, actinobacteria producing biologically active compounds were isolated mostly from soil but only a limited range of soil environments were commonly sampled. Consequently, soil remains an unexplored environment in search for novel producers and related evolutionary questions. Ninety actinobacteria strains isolated at contrasting soil sites were characterized phylogenetically by 16S rRNA gene, for presence of erm and ABC transporter resistance genes and antibiotic production. An analogous analysis was performed in silico with 246 and 31 strains from Integrated Microbial Genomes (JGI_IMG) database selected by the presence of ABC transporter genes and erm genes, respectively. In the isolates, distances of erm gene sequences were significantly correlated to phylogenetic distances based on 16S rRNA genes, while ABC transporter gene distances were not. The phylogenetic distance of isolates was significantly correlated to soil pH and organic matter content of isolation sites. In the analysis of JGI_IMG datasets the correlation between phylogeny of resistance genes and the strain phylogeny based on 16S rRNA genes or five housekeeping genes was observed for both the erm genes and ABC transporter genes in both actinobacteria and streptomycetes. However, in the analysis of sequences from genomes where both resistance genes occurred together the correlation was observed for both ABC transporter and erm genes in actinobacteria but in streptomycetes only in the erm gene. The type of erm resistance gene sequences was influenced by linkage to 16S rRNA gene sequences and site characteristics. The phylogeny of ABC transporter gene was correlated to 16S rRNA genes mainly above the genus level. The results support the concept of new specific secondary metabolite

  18. A Potato cDNA Encoding a Homologue of Mammalian Multidrug Resistant P-Glycoprotein

    Science.gov (United States)

    Wang, W.; Takezawa, D.; Poovaiah, B. W.

    1996-01-01

    A homologue of the multidrug resistance (MDR) gene was obtained while screening a potato stolon tip cDNA expression library with S-15-labeled calmodulin. The mammalian MDR gene codes for a membrane-bound P-glycoprotein (170-180 kDa) which imparts multidrug resistance to cancerous cells. The potato cDNA (PMDR1) codes for a polypeptide of 1313 amino acid residues (ca. 144 kDa) and its structural features are very similar to the MDR P-glycoprotein. The N-terminal half of the PMDR1-encoded protein shares striking homology with its C-terminal half, and each half contains a conserved ATP-binding site and six putative transmembrane domains. Southern blot analysis indicated that potato has one or two MDR-like genes. PMDR1 mRNA is constitutively expressed in all organs studied with higher expression in the stem and stolon tip. The PMDR1 expression was highest during tuber initiation and decreased during tuber development.

  19. Antibiotic Resistant Bacteria And Their Associated Resistance Genes in a Conventional Municipal Wastewater Treatment Plant

    KAUST Repository

    Aljassim, Nada I.

    2013-12-01

    With water scarcity as a pressing issue in Saudi Arabia and other Middle Eastern countries, the treatment and reuse of municipal wastewater is increasingly being used as an alternative water source to supplement country water needs. Standards are in place to ensure a safe treated wastewater quality, however they do not regulate pathogenic bacteria and emerging contaminants. Information is lacking on the levels of risk to public health associated with these factors, the efficiency of conventional treatment strategies in removing them, and on wastewater treatment in Saudi Arabia in general. In this study, a municipal wastewater treatment plant in Saudi Arabia is investigated to assess the efficiency of conventional treatment in meeting regulations and removing pathogens and emerging contaminants. The study found pathogenic bacterial genera, antibiotic resistance genes and antibiotic resistant bacteria, many of which were multi-resistant in plant discharges. It was found that although the treatments are able to meet traditional quality guidelines, there remains a risk from the discussed contaminants with wastewater reuse. A deeper understanding of this risk, and suggestions for more thorough guidelines and monitoring are needed.

  20. A Gene Homologous to rRNA Methylase Genes Confers Erythromycin and Clindamycin Resistance in Bifidobacterium breve.

    Science.gov (United States)

    Martínez, Noelia; Luque, Roberto; Milani, Christian; Ventura, Marco; Bañuelos, Oscar; Margolles, Abelardo

    2018-05-15

    Bifidobacteria are mutualistic intestinal bacteria, and their presence in the human gut has been associated with health-promoting activities. The presence of antibiotic resistance genes in this genus is controversial, since, although bifidobacteria are nonpathogenic microorganisms, they could serve as reservoirs of resistance determinants for intestinal pathogens. However, until now, few antibiotic resistance determinants have been functionally characterized in this genus. In this work, we show that Bifidobacterium breve CECT7263 displays atypical resistance to erythromycin and clindamycin. In order to delimit the genomic region responsible for the observed resistance phenotype, a library of genomic DNA was constructed and a fragment of 5.8 kb containing a gene homologous to rRNA methylase genes was able to confer erythromycin resistance in Escherichia coli This genomic region seems to be very uncommon, and homologs of the gene have been detected in only one strain of Bifidobacterium longum and two other strains of B. breve In this context, analysis of shotgun metagenomics data sets revealed that the gene is also uncommon in the microbiomes of adults and infants. The structural gene and its upstream region were cloned into a B. breve -sensitive strain, which became resistant after acquiring the genetic material. In vitro conjugation experiments did not allow us to detect gene transfer to other recipients. Nevertheless, prediction of genes potentially acquired through horizontal gene transfer events revealed that the gene is located in a putative genomic island. IMPORTANCE Bifidobacterium breve is a very common human intestinal bacterium. Often described as a pioneer microorganism in the establishment of early-life intestinal microbiota, its presence has been associated with several beneficial effects for the host, including immune stimulation and protection against infections. Therefore, some strains of this species are considered probiotics. In relation to this

  1. Experience with LDR and MDR brachytherapy for cervical cancer

    International Nuclear Information System (INIS)

    Okawa, Tomohiko; Okawa, Midori-Kita; Kaneyasu, Yuko; Karasawa, Kumiko; Fukuhara, Noboru

    1996-01-01

    As the brachytherapy dose-rate increases, it is necessary to reduce the total dose or to increase the fraction number with reducing the fraction dose in order not to increase the incidence of the late effect. With the introduction to the Tokyo Women's Medical College, Hospital of a remote afterloading system of Selectron - MDR, delivering dose-rate to point A became approximately twice of that with our classical cesium LDR manual afterloading technique. Material and Methods: Between 1987 to 1993 a total of, previously untreated 74 patients with cervical cancer received MDR brachytherapy using a Selection - MDR. This analysis is therefore of those patients series who underwent radical radioradiotherapy with MDR, 1987-1993, in comparison with the 347 cases who were treated with classical manual LDR afterloading machine, 1969-1986. The treatment was a brachytherapy during external radiotherapy and dos-rate at point A was 160-180 cGy/hour with MDR and 80-90 cGy/hour with LDR. The mean fraction dose was 800-1000 cGy by MDR and 1000-1200 cGy by LDR and fraction number was increased 1-2times in the MDR group with no change of a total dose at point A. Results: The mean age was 63.3 years in the MDR group and 60.2 in the LDR group. In the MDR group, 4 patients were at stage I, 16 stage II, 32 stage III, and 22 stage IV. In the LDR group, 32 were at stage I, 83 stage II, 183 stage III, and 49 stage IV. The medical rate was not significantly different between two groups. The tumor response by manual examination one month after radiotherapy showed no significant difference. The 5-year survival rate for the MDR and LDR groups were 100% : 78% at stage I, 61% : 71% at stage II and 52% : 53% at stage III, with no significant differences. Late complications by severity with grade II-III according to Kottureire's classification were not significantly different in the rectum or bladder. These results suggested that MDR brachytherapy was useful for the patients' QOL as it reduced the

  2. Frequency of the MDR1 mutant allele associated with multidrug sensitivity in dogs from Brazil

    Directory of Open Access Journals (Sweden)

    Monobe MM

    2015-04-01

    Full Text Available Marina M Monobe,1 João P Araujo Junior,2 Kari V Lunsford,3 Rodrigo C Silva,4 Camilo Bulla41Department of Veterinary Clinics, School of Veterinary Medicine and Animal Science, 2Department of Microbiology and Immunology, Biosciences Institute, Sao Paulo State University (UNESP, Botucatu, Brazil; 3Department of Clinical Sciences and Animal Health Center, 4Department of Pathobiology and Population Medicine, College of Veterinary Medicine, Mississippi State University, Mississippi, MS, USAAbstract: To date, a 4-bp deletion in the MDR1 gene has been detected in more than ten dog breeds, as well as in mixed breed dogs, in several countries, however information regarding this mutation in dogs from Brazil is lacking. For this reason, 103 Collies, 77 Border Collies, 76 Shetland Sheepdogs, 20 Old English Sheepdogs, 55 German Shepherds, 16 Australian Shepherds, and 53 Whippets from Brazil were screened for the presence of the mutation. The heterozygous mutated genotype, MDR1 (+/−, frequency found for Collies, Australian Shepherd, and Shetland Sheepdog was 50.5% (95% CI =41.1%–59.9%, 31.3% (95% CI =8.6%–53.2%, and 15.8% (95% CI =7.7%–23.9%, respectively. Homozygous mutated genotype, MDR1 (−/−, was detected only in Collies 35.9%. The MDR1 allele mutant frequency found for Collies, Australian Shepherd, and Shetland Sheepdog was 61.2% (95% CI =54.8%–67.5%, 15.6% (95% CI =3.1%–28.2%, and 7.9% (95% CI =3.7%–12.1%, respectively. Additionally, even free of the mutant allele, the maximum mutant prevalence (MMP in that population, with 95% CI, was 3.8%, 5.2%, 5.4%, and 13.8% for Border Collies, German Shepherds, Whippets, and Old English Sheepdogs, respectively. In this way, this information is important, not only for MDR1 genotype-based breeding programs and international exchange of breeding animals of predisposed breeds, but also for modification of drug therapy for breeds at risk.Keywords: P-glycoprotein, MDR1 mutation, ivermectin, dog, drug

  3. Fine mapping and identification of a candidate gene for the barley Un8 true loose smut resistance gene.

    Science.gov (United States)

    Zang, Wen; Eckstein, Peter E; Colin, Mark; Voth, Doug; Himmelbach, Axel; Beier, Sebastian; Stein, Nils; Scoles, Graham J; Beattie, Aaron D

    2015-07-01

    The candidate gene for the barley Un8 true loose smut resistance gene encodes a deduced protein containing two tandem protein kinase domains. In North America, durable resistance against all known isolates of barley true loose smut, caused by the basidiomycete pathogen Ustilago nuda (Jens.) Rostr. (U. nuda), is under the control of the Un8 resistance gene. Previous genetic studies mapped Un8 to the long arm of chromosome 5 (1HL). Here, a population of 4625 lines segregating for Un8 was used to delimit the Un8 gene to a 0.108 cM interval on chromosome arm 1HL, and assign it to fingerprinted contig 546 of the barley physical map. The minimal tilling path was identified for the Un8 locus using two flanking markers and consisted of two overlapping bacterial artificial chromosomes. One gene located close to a marker co-segregating with Un8 showed high sequence identity to a disease resistance gene containing two kinase domains. Sequence of the candidate gene from the parents of the segregating population, and in an additional 19 barley lines representing a broader spectrum of diversity, showed there was no intron in alleles present in either resistant or susceptible lines, and fifteen amino acid variations unique to the deduced protein sequence in resistant lines differentiated it from the deduced protein sequences in susceptible lines. Some of these variations were present within putative functional domains which may cause a loss of function in the deduced protein sequences within susceptible lines.

  4. The culturable soil antibiotic resistome: a community of multi-drug resistant bacteria.

    Science.gov (United States)

    Walsh, Fiona; Duffy, Brion

    2013-01-01

    Understanding the soil bacterial resistome is essential to understanding the evolution and development of antibiotic resistance, and its spread between species and biomes. We have identified and characterized multi-drug resistance (MDR) mechanisms in the culturable soil antibiotic resistome and linked the resistance profiles to bacterial species. We isolated 412 antibiotic resistant bacteria from agricultural, urban and pristine soils. All isolates were multi-drug resistant, of which greater than 80% were resistant to 16-23 antibiotics, comprising almost all classes of antibiotic. The mobile resistance genes investigated, (ESBL, bla NDM-1, and plasmid mediated quinolone resistance (PMQR) resistance genes) were not responsible for the respective resistance phenotypes nor were they present in the extracted soil DNA. Efflux was demonstrated to play an important role in MDR and many resistance phenotypes. Clinically relevant Burkholderia species are intrinsically resistant to ciprofloxacin but the soil Burkholderia species were not intrinsically resistant to ciprofloxacin. Using a phenotypic enzyme assay we identified the antibiotic specific inactivation of trimethoprim in 21 bacteria from different soils. The results of this study identified the importance of the efflux mechanism in the soil resistome and variations between the intrinsic resistance profiles of clinical and soil bacteria of the same family.

  5. The culturable soil antibiotic resistome: a community of multi-drug resistant bacteria.

    Directory of Open Access Journals (Sweden)

    Fiona Walsh

    Full Text Available Understanding the soil bacterial resistome is essential to understanding the evolution and development of antibiotic resistance, and its spread between species and biomes. We have identified and characterized multi-drug resistance (MDR mechanisms in the culturable soil antibiotic resistome and linked the resistance profiles to bacterial species. We isolated 412 antibiotic resistant bacteria from agricultural, urban and pristine soils. All isolates were multi-drug resistant, of which greater than 80% were resistant to 16-23 antibiotics, comprising almost all classes of antibiotic. The mobile resistance genes investigated, (ESBL, bla NDM-1, and plasmid mediated quinolone resistance (PMQR resistance genes were not responsible for the respective resistance phenotypes nor were they present in the extracted soil DNA. Efflux was demonstrated to play an important role in MDR and many resistance phenotypes. Clinically relevant Burkholderia species are intrinsically resistant to ciprofloxacin but the soil Burkholderia species were not intrinsically resistant to ciprofloxacin. Using a phenotypic enzyme assay we identified the antibiotic specific inactivation of trimethoprim in 21 bacteria from different soils. The results of this study identified the importance of the efflux mechanism in the soil resistome and variations between the intrinsic resistance profiles of clinical and soil bacteria of the same family.

  6. Yield of facility-based verbal screening amongst household contacts of patients with multi-drug resistant tuberculosis in Pakistan

    Directory of Open Access Journals (Sweden)

    Ejaz Qadeer

    2017-05-01

    Full Text Available Background: Household contacts of multidrug-resistant tuberculosis (MDR-TB patients are at a high risk of getting infected with TB/MDR-TB, therefore symptomatic or vulnerable individuals should be screened and treated early. Methods: A cross-sectional study was conducted among household contacts of MDR-TB patients in three high-burden TB sites in Pakistan from July 2013 to June 2014. MDR-TB index patients were asked to provide a list of all members of their household and were asked whether any of them had TB symptoms such as productive cough, fever, weight loss and night sweat (“facility-based verbal screening”. Symptomatic contacts were defined as presumptive TB cases and were invited for investigations at the facility. Those who did not come were paid a home-visit. Confirmed TB/MDR-TB patients were registered in the nearest treatment facility. Results: Of 209 MDR-TB index patients, 1467 household contacts were identified and screened, 95 of them children < 5 years. Of these 172 (12% were symptomatic. Most common symptoms were cough 157 (91% and fever 107 (62%. 58 (34% presumptive TB contacts were not investigated. Of total contacts, 56 (3.8% were diagnosed with TB, among them 54(96% with MDR-TB and 2(4% with drug-susceptible-TB. The number needed to screen (NNS to identify a new MDR-TB case among adult household contacts was 27 and among presumptive adult and pediatric TB contacts was three. All 56 confirmed patients were registered for treatment. Conclusion: Screening household contacts of MDR-TB index cases may be considered a feasible and high yield option, in high-burden, low-resource settings within Pakistan. The number of presumptive TB contacts required to screen to identify a new MDR-TB case was unusually low, indicating an effective strategy that could easily be scaled-up. The screening and management of vulnerable adults and children living with patients having TB of any form is a major priority in the combined efforts

  7. Identification and characterization of two novel bla(KLUC resistance genes through large-scale resistance plasmids sequencing.

    Directory of Open Access Journals (Sweden)

    Teng Xu

    Full Text Available Plasmids are important antibiotic resistance determinant carriers that can disseminate various drug resistance genes among species or genera. By using a high throughput sequencing approach, two groups of plasmids of Escherichia coli (named E1 and E2, each consisting of 160 clinical E. coli strains isolated from different periods of time were sequenced and analyzed. A total of 20 million reads were obtained and mapped onto the known resistance gene sequences. As a result, a total of 9 classes, including 36 types of antibiotic resistant genes, were identified. Among these genes, 25 and 27 single nucleotide polymorphisms (SNPs appeared, of which 9 and 12 SNPs are nonsynonymous substitutions in the E1 and E2 samples. It is interesting to find that a novel genotype of bla(KLUC, whose close relatives, bla(KLUC-1 and bla(KLUC-2, have been previously reported as carried on the Kluyvera cryocrescens chromosome and Enterobacter cloacae plasmid, was identified. It shares 99% and 98% amino acid identities with Kluc-1 and Kluc-2, respectively. Further PCR screening of 608 Enterobacteriaceae family isolates yielded a second variant (named bla(KLUC-4. It was interesting to find that Kluc-3 showed resistance to several cephalosporins including cefotaxime, whereas bla(KLUC-4 did not show any resistance to the antibiotics tested. This may be due to a positively charged residue, Arg, replaced by a neutral residue, Leu, at position 167, which is located within an omega-loop. This work represents large-scale studies on resistance gene distribution, diversification and genetic variation in pooled multi-drug resistance plasmids, and provides insight into the use of high throughput sequencing technology for microbial resistance gene detection.

  8. Two whitebacked planthopper resistance genes in rice share the same loci with those for brown planthopper resistance.

    Science.gov (United States)

    Tan, G X; Weng, Q M; Ren, X; Huang, Z; Zhu, L L; He, G C

    2004-03-01

    The whitebacked planthopper (WBPH), Sogatella furcifera, and brown planthopper (BPH) Nilaparvata lugens Stål are important sucking insects of rice (Oryza sativa L.) crops throughout the world. Rice 'B5', which has derived its resistance genes from the wild rice O. officinalis Wall ex Watt, is a line that is highly resistant to both WBPH and BPH. Previously, two resistance genes against BPH, Qbp1, and Qbp2 in 'B5' had been mapped onto chromosome 3 and chromosome 4, respectively. In this study, we employed a mapping population composed of 187 recombinant inbred lines (RILs), produced from a cross between 'B5' and susceptible variety 'Minghui63', to locate the WBPH and BPH resistance genes. A RFLP survey of the bulked extremes from the RIL population identified two genomic regions, one on chromosome 3 and the other on chromosome 4, likely containing the resistance genes to planthoppers. QTL analysis of the RILs further confirmed that two WBPH resistance genes were mapped on the same loci as Qbp1 and Qbp2, using a linkage map with 242 molecular markers distributed on 12 rice chromosomes. Of the two WBPH resistance genes, one designated Wbph7(t) was located within a 1.1-cM region between R1925 and G1318 on chromosome 3, the other designated Wbph8(t) was within a 0.3-cM region flanked by R288 and S11182 on chromosome 4. A two-way analysis of variance showed that two loci acted independently with each other in determining WBPH resistance. The results have significant implications in studying the interactions between sucking insects and plants and in breeding programs of resistance to rice planthoppers.

  9. Sulfonamide-resistant bacteria and their resistance genes in soils fertilized with manures from Jiangsu Province, Southeastern China.

    Directory of Open Access Journals (Sweden)

    Na Wang

    Full Text Available Antibiotic-resistant bacteria and genes are recognized as new environmental pollutants that warrant special concern. There were few reports on veterinary antibiotic-resistant bacteria and genes in China. This work systematically analyzed the prevalence and distribution of sulfonamide resistance genes in soils from the environments around poultry and livestock farms in Jiangsu Province, Southeastern China. The results showed that the animal manure application made the spread and abundance of antibiotic resistance genes (ARGs increasingly in the soil. The frequency of sulfonamide resistance genes was sul1 > sul2 > sul3 in pig-manured soil DNA and sul2 > sul1 > sul3 in chicken-manured soil DNA. Further analysis suggested that the frequency distribution of the sul genes in the genomic DNA and plasmids of the SR isolates from manured soil was sul2 > sul1 > sul3 overall (p<0.05. The combination of sul1 and sul2 was the most frequent, and the co-existence of sul1 and sul3 was not found either in the genomic DNA or plasmids. The sample type, animal type and sampling time can influence the prevalence and distribution pattern of sulfonamide resistance genes. The present study also indicated that Bacillus, Pseudomonas and Shigella were the most prevalent sul-positive genera in the soil, suggesting a potential human health risk. The above results could be important in the evaluation of antibiotic-resistant bacteria and genes from manure as sources of agricultural soil pollution; the results also demonstrate the necessity and urgency of the regulation and supervision of veterinary antibiotics in China.

  10. Dissection of Resistance Genes to Pseudomonas syringae pv. phaseolicola in UI3 Common Bean Cultivar.

    Science.gov (United States)

    González, Ana M; Godoy, Luís; Santalla, Marta

    2017-11-23

    Few quantitative trait loci have been mapped for resistance to Pseudomonas syringae pv. phaseolicola in common bean. Two F₂ populations were developed from the host differential UI3 cultivar. The objective of this study was to further characterize the resistance to races 1, 5, 7 and 9 of Psp included in UI3. Using a QTL mapping approach, 16 and 11 main-effect QTLs for pod and primary leaf resistance were located on LG10, explaining up to 90% and 26% of the phenotypic variation, respectively. The homologous genomic region corresponding to primary leaf resistance QTLs detected tested positive for the presence of resistance-associated gene cluster encoding nucleotide-binding and leucine-rich repeat (NL), Natural Resistance Associated Macrophage (NRAMP) and Pentatricopeptide Repeat family (PPR) proteins. It is worth noting that the main effect QTLs for resistance in pod were located inside a 3.5 Mb genomic region that included the Phvul.010G021200 gene, which encodes a protein that has the highest sequence similarity to the RIN4 gene of Arabidopsis, and can be considered an important candidate gene for the organ-specific QTLs identified here. These results support that resistance to Psp from UI3 might result from the immune response activated by combinations of R proteins, and suggest the guard model as an important mechanism in pod resistance to halo blight. The candidate genes identified here warrant functional studies that will help in characterizing the actual defense gene(s) in UI3 genotype.

  11. Effect of pO2 on antitumor drug cytotoxicity on MDR and non-MDR variants selected from the LoVo metastatic colon carcinoma cell line.

    Science.gov (United States)

    Lelong-Rebel, Isabelle; Brisson, Christine; Fabre, Michel; Bergerat, Jean-Pierre; Rebel, Gérard

    2008-01-01

    Two chemosensitive cell lines, LoVo-fusoid (LoVo-f) and LoVo-small cells (LoVo-sc) were derived from the original LoVo cell line. These two variants and the multidrug-resistant (MDR) cell line LoVo-Dox were screened for various properties. In non-permeabilized cells, only LoVo-sc showed mucin-2 staining whereas labelling was positive in all permeabilized cell lines. As shown by electron microscopy screening and by relative resistance to trypsin detachment, only LoVo-sc cells showed strong mucus secretion. All three cell lines displayed strong staining for P-glycoprotein (P-gp), multidrug resistance-associated protein (MRP) and lung-resistance-related protein (LRP) in different locations according to the drug resistance state. The three cell lines showed intracellular labelling of LRP and MRP. The sensitive cells showed P-gp in a large perinuclear ring and in the cytoplasm, but little (LoVo-sc cells) or no staining (LoVo-f cells) was shown at the plasma membrane level. For the Lovo-Dox cells, P-gp was located in the plasma membrane, in cellular anchorages and in the cytoplasm as well. Cell resistance against antineoplastic agents often results from mobilization of various factors, the modulation of which is linked to the culture conditions. As most of the protocols utilize cells growing in (air + 5-10% CO2) atmosphere e.g. 20% O2, balance of the respective participants in the MDR multi-modal mechanism may not be representative of the in vivo situation and may lead to erratic pharmacological response. Indeed, cells within solid tumours were exposed to low pO2, most of them being under hypoxic condition (0.1-5% O2). In the absence of anticancer drugs, all LoVo cell lines grew notably faster at 20% O2 than at 5% O2. Moreover, respective sensitivities of both non-MDR variants to doxorubicin were altered according the pO2. Whatever the pO2 was, virtually none of the antioxidants tested affected the cytotoxic activity of doxorubicin for the three cell lines. By contrast

  12. Natural variation of rice blast resistance gene Pi-d2

    Science.gov (United States)

    Studying natural variation of rice resistance (R) genes in cultivated and wild rice relatives can predict resistance stability to rice blast fungus. In the present study, the protein coding regions of rice R gene Pi-d2 in 35 rice accessions of subgroups, aus (AUS), indica (IND), temperate japonica (...

  13. Transport and transformation of genetic information in the critical zone: The case of antibiotic resistance genes

    Science.gov (United States)

    Zhu, Y. G.

    2015-12-01

    In addition to material and energy flows, the dynamics and functions of the Earth's critical zone are intensively mediated by biological actions performed by diverse organisms. These biological actions are modulated by the expression of functional genes and their translation into enzymes that catalyze geochemical reactions, such as nutrient turnover and pollutant biodegradation. Although geobiology, as an interdisciplinary research area, is playing and vital role in linking biological and geochemical processes at different temporal and spatial scales, the distribution and transport of functional genes have rarely been investigated from the Earth's critical zone perspectives. To illustrate the framework of studies on the transport and transformation of genetic information in the critical zone, antibiotic resistance is taken as an example. Antibiotic resistance genes are considered as a group of emerging contaminants, and their emergence and spread within the critical zone on one hand are induced by anthropogenic activities, and on other hand are threatening human health worldwide. The transport and transformation of antibiotic resistance genes are controlled by both horizontal gene transfer between bacterial cells and the movement of bacteria harboring antibiotic resistance genes. In this paper, the fate and behavior of antibiotic resistance genes will be discussed in the following aspects: 1) general overview of environmental antibiotic resistance; 2) high through quantification of the resistome in various environmental media; 3) pathways of resistance gene flow within the critical zone; and 4) potential strategies in mitigating antibiotic resistance, particularly from the critical zone perspectives.

  14. Molecular characterization of the CRa gene conferring clubroot resistance in Brassica rapa.

    Science.gov (United States)

    Ueno, Hiroki; Matsumoto, Etsuo; Aruga, Daisuke; Kitagawa, Satoshi; Matsumura, Hideo; Hayashida, Nobuaki

    2012-12-01

    Clubroot disease is one of the major diseases affecting Brassicaceae crops, and a number of these crops grown commercially, such as Chinese cabbage (Brassica rapa L. ssp. pekinensis), are known to be highly susceptible to clubroot disease. To provide protection from this disease, plant breeders have introduced genes for resistance to clubroot from the European turnip into susceptible lines. The CRa gene confers specific resistance to the clubroot pathogen Plasmodiophora brassicae isolate M85. Fine mapping of the CRa locus using synteny to the Arabidopsis thaliana genome and partial genome sequences of B. rapa revealed a candidate gene encoding a TIR-NBS-LRR protein. Several structural differences in this candidate gene were found between susceptible and resistant lines, and CRa expression was observed only in the resistant line. Four mutant lines lacking clubroot resistance were obtained by the UV irradiation of pollen from a resistant line, and all of these mutant lines carried independent mutations in the candidate TIR-NBS-LRR gene. This genetic and molecular evidence strongly suggests that the identified gene is CRa. This is the first report on the molecular characterization of a clubroot Resistance gene in Brassicaceae and of the disease resistance gene in B. rapa.

  15. An AFLP marker linked to turnip mosaic virus resistance gene in pak ...

    African Journals Online (AJOL)

    An AFLP marker linked to turnip mosaic virus resistance gene in pak-choi. W Xinhua, C Huoying, Z Yuying, H Ruixian. Abstract. Pak-choi is one of the most important vegetable crops in China. Turnip mosaic virus (TuMV) is one of its main pathogen. Screening the molecular marker linked to the TuMV resistance gene is an ...

  16. Identification of leaf rust resistant gene Lr10 in Pakistani wheat ...

    African Journals Online (AJOL)

    Leaf (brown) rust is the major disease of wheat in Pakistan and other countries. The disease is more effectively controlled when several rust resistance genes are pyramided into a single line. Molecular survey was conducted to screen 25 Pakistan wheat germplasm for the presence of leaf rust resistance gene Lr10 using ...

  17. Characterization of the psoRPM1 gene for resistance to root-knot ...

    African Journals Online (AJOL)

    Several root-knot nematode (Meloidogyne spp.) resistance genes have been discovered in different stone fruit crops. However, none of them has yet been cloned and they were only located on the chromosomes. In this study, a candidate root-knot nematode resistance gene (designated as psoRPM1) was isolated from the ...

  18. Molecular Analysis of Multi-Drug Resistance (MDR) in ...

    African Journals Online (AJOL)

    This review therefore brings to light some of the processes involved in molecular typing of Mycobacterium tuberculosis strains like the use of restriction fragment length polymorphism (RFLP) and spoligotyping, which have become valuable tools in the epidemiology of tuberculosis, identification of genotypes and ...

  19. EDITORIAL Multi-drug-resistant tuberculosis (MDR-TB): Current ...

    African Journals Online (AJOL)

    A South African Health Systems Trust report indicated that despite a global ... less financial resources performed better. ... Healthcare providers need to be better trained at our various nursing colleges and medical schools on how to manage TB, with regular and intense follow-up in-service training sessions. In addition ...

  20. Molecular characterization of multidrug-resistant Mycobacterium tuberculosis isolated in Nepal.

    Science.gov (United States)

    Poudel, Ajay; Nakajima, Chie; Fukushima, Yukari; Suzuki, Haruka; Pandey, Basu Dev; Maharjan, Bhagwan; Suzuki, Yasuhiko

    2012-06-01

    Despite the fact that Nepal is one of the first countries globally to introduce multidrug-resistant tuberculosis (MDR-TB) case management, the number of MDR-TB cases is continuing to rise in Nepal. Rapid molecular tests applicable in this setting to identify resistant organisms would be an effective tool in reversing this trend. To develop such tools, information about the frequency and distribution of mutations that are associated with phenotypic drug resistance in Mycobacterium tuberculosis is required. In the present study, we investigated the prevalence of mutations in rpoB and katG genes and the inhA promoter region in 158 M. tuberculosis isolates (109 phenotypically MDR and 49 non-MDR isolates collected in Nepal) by DNA sequencing. Mutations affecting the 81-bp rifampin (RIF) resistance-determining region (RRDR) of rpoB were identified in 106 of 109 (97.3%) RIF-resistant isolates. Codons 531, 526, and 516 were the most commonly affected, at percentages of 58.7, 15.6, and 15.6%, respectively. Of 113 isoniazid (INH)-resistant isolates, 99 (87.6%) had mutations in the katG gene, with Ser315Thr being the most prevalent (81.4%) substitution. Mutations in the inhA promoter region were detected in 14 (12.4%) INH-resistant isolates. The results from this study provide an overview of the current situation of RIF and INH resistance in M. tuberculosis in Nepal and can serve as a basis for developing or improving rapid molecular tests to monitor drug-resistant strains in this country.

  1. Candida albicans AGE3, the ortholog of the S. cerevisiae ARF-GAP-encoding gene GCS1, is required for hyphal growth and drug resistance.

    Directory of Open Access Journals (Sweden)

    Thomas Lettner

    Full Text Available BACKGROUND: Hyphal growth and multidrug resistance of C. albicans are important features for virulence and antifungal therapy of this pathogenic fungus. METHODOLOGY/PRINCIPAL FINDINGS: Here we show by phenotypic complementation analysis that the C. albicans gene AGE3 is the functional ortholog of the yeast ARF-GAP-encoding gene GCS1. The finding that the gene is required for efficient endocytosis points to an important functional role of Age3p in endosomal compartments. Most C. albicans age3Delta mutant cells which grew as cell clusters under yeast growth conditions showed defects in filamentation under different hyphal growth conditions and were almost completely disabled for invasive filamentous growth. Under hyphal growth conditions only a fraction of age3Delta cells shows a wild-type-like polarization pattern of the actin cytoskeleton and lipid rafts. Moreover, age3Delta cells were highly susceptible to several unrelated toxic compounds including antifungal azole drugs. Irrespective of the AGE3 genotype, C-terminal fusions of GFP to the drug efflux pumps Cdr1p and Mdr1p were predominantly localized in the plasma membrane. Moreover, the plasma membranes of wild-type and age3Delta mutant cells contained similar amounts of Cdr1p, Cdr2p and Mdr1p. CONCLUSIONS/SIGNIFICANCE: The results indicate that the defect in sustaining filament elongation is probably caused by the failure of age3Delta cells to polarize the actin cytoskeleton and possibly of inefficient endocytosis. The high susceptibility of age3Delta cells to azoles is not caused by inefficient transport of efflux pumps to the cell membrane. A possible role of a vacuolar defect of age3Delta cells in drug susceptibility is proposed and discussed. In conclusion, our study shows that the ARF-GAP Age3p is required for hyphal growth which is an important virulence factor of C. albicans and essential for detoxification of azole drugs which are routinely used for antifungal therapy. Thus, it

  2. Identifying clinically relevant drug resistance genes in drug-induced resistant cancer cell lines and post-chemotherapy tissues.

    Science.gov (United States)

    Tong, Mengsha; Zheng, Weicheng; Lu, Xingrong; Ao, Lu; Li, Xiangyu; Guan, Qingzhou; Cai, Hao; Li, Mengyao; Yan, Haidan; Guo, You; Chi, Pan; Guo, Zheng

    2015-12-01

    Until recently, few molecular signatures of drug resistance identified in drug-induced resistant cancer cell models can be translated into clinical practice. Here, we defined differentially expressed genes (DEGs) between pre-chemotherapy colorectal cancer (CRC) tissue samples of non-responders and responders for 5-fluorouracil and oxaliplatin-based therapy as clinically relevant drug resistance genes (CRG5-FU/L-OHP). Taking CRG5-FU/L-OHP as reference, we evaluated the clinical relevance of several types of genes derived from HCT116 CRC cells with resistance to 5-fluorouracil and oxaliplatin, respectively. The results revealed that DEGs between parental and resistant cells, when both were treated with the corresponding drug for a certain time, were significantly consistent with the CRG5-FU/L-OHP as well as the DEGs between the post-chemotherapy CRC specimens of responders and non-responders. This study suggests a novel strategy to extract clinically relevant drug resistance genes from both drug-induced resistant cell models and post-chemotherapy cancer tissue specimens.

  3. The expression of antibiotic resistance genes in antibiotic-producing bacteria.

    Science.gov (United States)

    Mak, Stefanie; Xu, Ye; Nodwell, Justin R

    2014-08-01

    Antibiotic-producing bacteria encode antibiotic resistance genes that protect them from the biologically active molecules that they produce. The expression of these genes needs to occur in a timely manner: either in advance of or concomitantly with biosynthesis. It appears that there have been at least two general solutions to this problem. In many cases, the expression of resistance genes is tightly linked to that of antibiotic biosynthetic genes. In others, the resistance genes can be induced by their cognate antibiotics or by intermediate molecules from their biosynthetic pathways. The regulatory mechanisms that couple resistance to antibiotic biosynthesis are mechanistically diverse and potentially relevant to the origins of clinical antibiotic resistance. © 2014 John Wiley & Sons Ltd.

  4. Isolation and characterization of NBS-LRR- resistance gene candidates in turmeric (Curcuma longa cv. surama).

    Science.gov (United States)

    Joshi, R K; Mohanty, S; Subudhi, E; Nayak, S

    2010-09-08

    Turmeric (Curcuma longa), an important asexually reproducing spice crop of the family Zingiberaceae is highly susceptible to bacterial and fungal pathogens. The identification of resistance gene analogs holds great promise for development of resistant turmeric cultivars. Degenerate primers designed based on known resistance genes (R-genes) were used in combinations to elucidate resistance gene analogs from Curcuma longa cultivar surama. The three primers resulted in amplicons with expected sizes of 450-600 bp. The nucleotide sequence of these amplicons was obtained through sequencing; their predicted amino acid sequences compared to each other and to the amino acid sequences of known R-genes revealed significant sequence similarity. The finding of conserved domains, viz., kinase-1a, kinase-2 and hydrophobic motif, provided evidence that the sequences belong to the NBS-LRR class gene family. The presence of tryptophan as the last residue of kinase-2 motif further qualified them to be in the non-TIR-NBS-LRR subfamily of resistance genes. A cluster analysis based on the neighbor-joining method was carried out using Curcuma NBS analogs together with several resistance gene analogs and known R-genes, which classified them into two distinct subclasses, corresponding to clades N3 and N4 of non-TIR-NBS sequences described in plants. The NBS analogs that we isolated can be used as guidelines to eventually isolate numerous R-genes in turmeric.

  5. MDR-TB Outbreak among HIV-Negative Tunisian Patients followed during 11 Years.

    Directory of Open Access Journals (Sweden)

    Naira Dekhil

    Full Text Available Multidrug-resistant tuberculosis (MDR-TB outbreaks that evolve, from the outset, in a context strictly negative for HIV infection deserve special consideration since they reflect the true intrinsic epidemic potential of the causative strain. To our knowledge, the long-term evolution of such exceptional outbreaks and the treatment outcomes for the involved patients has never been reported hitherto. Here we provide a thorough description, over an 11-year period, of an MDR-TB outbreak that emerged and expanded in an HIV-negative context, Northern Tunisia.From October 2001 to June 2011, the MDR-TB outbreak involved 48 HIV-negative individuals that are mainly young (mean age 31.09 yrs; 89.6% male and noninstitutionalized. Drug susceptibility testing coupled to mutational analysis revealed that initial transmission involved an isolate that was simultaneously resistant to isoniazid, rifampicin, ethambutol, and streptomycin. The causative Haarlem3-ST50 outbreak strain expanded mainly as an 11-banded IS6110 RFLP profile (77.1%, from which a 12-banded subclone evolved. After undergoing a 2-year treatment with second-line drugs, 22 (45.8% patients were cured and 3 (6.2% completed treatment, thus yielding an overall treatment success rate of 52.1%. Among the patients that experienced unfavorable treatment outcomes, 10 (20.8% failed treatment, 3 (6.2% were lost to follow-up, 5 (10.4% died, and 5 (10.4% could not be evaluated. Poor adherence to treatment was found to be the main independent predictor of unfavorable outcomes (HR: 9.15; 95% CI 1.72-48.73; P = 0.014. Intriguingly, the evolved 12-banded subclone proved significantly associated with unfavorable outcomes (HR: 4.90; 95% CI 1.04-23.04, P = 0.044. High rate of fatality and relapse was further demonstrated at the long-term, since 70% of those whose treatment failed have died, and 24% among those deemed successfully treated have relapsed.Taken together, the data obtained in this study indicate that MDR

  6. Mapping, isolation and characterization of genes responsible for late blight resistance in potato

    NARCIS (Netherlands)

    Pel, M.

    2010-01-01

    Late blight (LB), caused by the oomycete Phytophthora infestans, is one of the most
    devastating diseases on potato. Resistance (R) genes from the wild species Solanum demissum
    have been used by breeders to generate late blight resistant cultivars, but resistance was soon
    overcome

  7. In Silico Assigned Resistance Genes Confer Bifidobacterium with Partial Resistance to Aminoglycosides but Not to Β-Lactams

    Science.gov (United States)

    Fouhy, Fiona; O’Connell Motherway, Mary; Fitzgerald, Gerald F.; Ross, R. Paul; Stanton, Catherine; van Sinderen, Douwe; Cotter, Paul D.

    2013-01-01

    Bifidobacteria have received significant attention due to their contribution to human gut health and the use of specific strains as probiotics. It is thus not surprising that there has also been significant interest with respect to their antibiotic resistance profile. Numerous culture-based studies have demonstrated that bifidobacteria are resistant to the majority of aminoglycosides, but are sensitive to β-lactams. However, limited research exists with respect to the genetic basis for the resistance of bifidobacteria to aminoglycosides. Here we performed an in-depth in silico analysis of putative Bifidobacterium-encoded aminoglycoside resistance proteins and β-lactamases and assess the contribution of these proteins to antibiotic resistance. The in silico-based screen detected putative aminoglycoside and β-lactam resistance proteins across the Bifidobacterium genus. Laboratory-based investigations of a number of representative bifidobacteria strains confirmed that despite containing putative β-lactamases, these strains were sensitive to β-lactams. In contrast, all strains were resistant to the aminoglycosides tested. To assess the contribution of genes encoding putative aminoglycoside resistance proteins in Bifidobacterium sp. two genes, namely Bbr_0651 and Bbr_1586, were targeted for insertional inactivation in B. breve UCC2003. As compared to the wild-type, the UCC2003 insertion mutant strains exhibited decreased resistance to gentamycin, kanamycin and streptomycin. This study highlights the associated risks of relying on the in silico assignment of gene function. Although several putative β-lactam resistance proteins are located in bifidobacteria, their presence does not coincide with resistance to these antibiotics. In contrast however, this approach has resulted in the identification of two loci that contribute to the aminoglycoside resistance of B. breve UCC2003 and, potentially, many other bifidobacteria. PMID:24324818

  8. In silico assigned resistance genes confer Bifidobacterium with partial resistance to aminoglycosides but not to β-lactams.

    Directory of Open Access Journals (Sweden)

    Fiona Fouhy

    Full Text Available Bifidobacteria have received significant attention due to their contribution to human gut health and the use of specific strains as probiotics. It is thus not surprising that there has also been significant interest with respect to their antibiotic resistance profile. Numerous culture-based studies have demonstrated that bifidobacteria are resistant to the majority of aminoglycosides, but are sensitive to β-lactams. However, limited research exists with respect to the genetic basis for the resistance of bifidobacteria to aminoglycosides. Here we performed an in-depth in silico analysis of putative Bifidobacterium-encoded aminoglycoside resistance proteins and β-lactamases and assess the contribution of these proteins to antibiotic resistance. The in silico-based screen detected putative aminoglycoside and β-lactam resistance proteins across the Bifidobacterium genus. Laboratory-based investigations of a number of representative bifidobacteria strains confirmed that despite containing putative β-lactamases, these strains were sensitive to β-lactams. In contrast, all strains were resistant to the aminoglycosides tested. To assess the contribution of genes encoding putative aminoglycoside resistance proteins in Bifidobacterium sp. two genes, namely Bbr_0651 and Bbr_1586, were targeted for insertional inactivation in B. breve UCC2003. As compared to the wild-type, the UCC2003 insertion mutant strains exhibited decreased resistance to gentamycin, kanamycin and streptomycin. This study highlights the associated risks of relying on the in silico assignment of gene function. Although several putative β-lactam resistance proteins are located in bifidobacteria, their presence does not coincide with resistance to these antibiotics. In contrast however, this approach has resulted in the identification of two loci that contribute to the aminoglycoside resistance of B. breve UCC2003 and, potentially, many other bifidobacteria.

  9. Characterization of Soybean WRKY Gene Family and Identification of Soybean WRKY Genes that Promote Resistance to Soybean Cyst Nematode.

    Science.gov (United States)

    Yang, Yan; Zhou, Yuan; Chi, Yingjun; Fan, Baofang; Chen, Zhixiang

    2017-12-19

    WRKY proteins are a superfamily of plant transcription factors with important roles in plants. WRKY proteins have been extensively analyzed in plant species including Arabidopsis and rice. Here we report characterization of soybean WRKY gene family and their functional analysis in resistance to soybean cyst nematode (SCN), the most important soybean pathogen. Through search of the soybean genome, we identified 174 genes encoding WRKY proteins that can be classified into seven groups as established in other plants. WRKY variants including a WRKY-related protein unique to legumes have also been identified. Expression analysis reveals both diverse expression patterns in different soybean tissues and preferential expression of specific WRKY groups in certain tissues. Furthermore, a large number of soybean WRKY genes were responsive to salicylic acid. To identify soybean WRKY genes that promote soybean resistance to SCN, we first screened soybean WRKY genes for enhancing SCN resistance when over-expressed in transgenic soybean hairy roots. To confirm the results, we transformed five WRKY genes into a SCN-susceptible soybean cultivar and generated transgenic soybean lines. Transgenic soybean lines overexpressing three WRKY transgenes displayed increased resistance to SCN. Thus, WRKY genes could be explored to develop new soybean cultivars with enhanced resistance to SCN.

  10. Phenotypic low-level isoniazid resistance as a marker to predict ethionamide resistance in Mycobacterium tuberculosis

    Directory of Open Access Journals (Sweden)

    Salima Qamar

    2017-01-01

    Full Text Available Background: Tuberculosis is one of the most prevalent diseases in Pakistan. Pakistan has the highest burden of MDR-TB in the Eastern Mediterranean region. Ethionamide is an anti-tuberculous drug frequently used to treat MDR-TB. Its drug susceptibility testing is not easily available in resource limited settings. Since it acts on the same target protein as isoniazid (inhA protein encoded by inhA gene, we sought to find out if phenotypic isoniazid resistance can be a marker of ethionamide resistance. Materials and Methods: This was a retrospective observational study conducted at the Aga Khan University hospital section of microbiology. Data was retrieved between 2011 to 2014 for all culture positive MTB strains. All culture positive MTB isolates with susceptibilities to isoniazid and ethionamide recorded were included in the study. Isoniazid and ethionamide susceptibilities were performed using agar proportion method on Middlebrook 7H10 agar. Rate of Ethionamide resistance between low-level isoniazid resistant, high level isoniazid resistant and isoniazid sensitive MTB was compared. Results: A total of 11,274 isolates were included in the study. A statistically significant association (P < 0.001 was found between Ethionamide resistance and low-level isoniazid resistance (26.6% as compared to high-level isoniazid resistance (8.85% and isoniazid sensitivity (0.71% in MTB strains. However this association was not seen in XDR-TB strains. Conclusion: Low level isoniazid resistance may be used as marker for phenotypic ethionamide resistance and hence guide clinicians' choice of antituberculous agent for MDR-TB in Pakistan. Further studies involving detection of genotypic association of isoniazid and ethionamide susceptibilities are needed before a final conclusion can be derived.

  11. The tetracycline resistance determinant Tet 39 and the sulphonamide resistance gene sulII are common among resistant Acinetobacter spp. isolated from integrated fish farms in Thailand

    DEFF Research Database (Denmark)

    Agersø, Yvonne; Petersen, Andreas

    2007-01-01

    Objectives: To determine the genetic basis for tetracycline and sulphonamide resistance and the prevalence of class I and II integrons in oxytetracycline-resistant Acinetobacter spp. from integrated fish farms in Thailand. Methods: A total of 222 isolates were screened for tetracycline resistance...... and Southern blots with sulII and tet(39) probes were performed on selected isolates. Results: The recently identified tetracycline resistance gene tet(39) was demonstrated in 75% (166/222) of oxytetracycline-resistant Acinetobacter spp. from integrated fish farms in Thailand. Isolates that were also...

  12. Incorporation of Bacterial Blight Resistance Genes Into Lowland Rice Cultivar Through Marker-Assisted Backcross Breeding.

    Science.gov (United States)

    Pradhan, Sharat Kumar; Nayak, Deepak Kumar; Pandit, Elssa; Behera, Lambodar; Anandan, Annamalai; Mukherjee, Arup Kumar; Lenka, Srikanta; Barik, Durga Prasad

    2016-07-01

    Bacterial blight (BB) of rice caused by Xanthomonas oryzae pv. oryzae is a major disease of rice in many rice growing countries. Pyramided lines carrying two BB resistance gene combinations (Xa21+xa13 and Xa21+xa5) were developed in a lowland cultivar Jalmagna background through backcross breeding by integrating molecular markers. In each backcross generation, markers closely linked to the disease resistance genes were used to select plants possessing the target genes. Background selection was continued in those plants carrying resistant genes until BC(3) generation. Plants having the maximum contribution from the recurrent parent genome were selected in each generation and hybridized with the recipient parent. The BB-pyramided line having the maximum recipient parent genome recovery of 95% was selected among BC3F1 plants and selfed to isolate homozygous BC(3)F(2) plants with different combinations of BB resistance genes. Twenty pyramided lines with two resistance gene combinations exhibited high levels of tolerance against the BB pathogen. In order to confirm the resistance, the pyramided lines were inoculated with different X. oryzae pv. oryzae strains of Odisha for bioassay. The genotypes with combination of two BB resistance genes conferred high levels of resistance to the predominant X. oryzae pv. oryzae isolates prevalent in the region. The pyramided lines showed similarity with the recipient parent with respect to major agro-morphologic traits.

  13. Molecular Identification and Quantification of Tetracycline and Erythromycin Resistance Genes in Spanish and Italian Retail Cheeses

    Directory of Open Access Journals (Sweden)

    Ana Belén Flórez

    2014-01-01

    Full Text Available Large antibiotic resistance gene pools in the microbiota of foods may ultimately pose a risk for human health. This study reports the identification and quantification of tetracycline- and erythromycin-resistant populations, resistance genes, and gene diversity in traditional Spanish and Italian cheeses, via culturing, conventional PCR, real-time quantitative PCR (qPCR, and denaturing gradient gel electrophoresis (DGGE. The numbers of resistant bacteria varied widely among the antibiotics and the different cheese varieties; in some cheeses, all the bacterial populations seemed to be resistant. Up to eight antibiotic resistance genes were sought by gene-specific PCR, six with respect to tetracycline, that is, tet(K, tet(L, tet(M, tet(O, tet(S, and tet(W, and two with respect to erythromycin, that is, erm(B and erm(F. The most common resistance genes in the analysed cheeses were tet(S, tet(W, tet(M, and erm(B. The copy numbers of these genes, as quantified by qPCR, ranged widely between cheeses (from 4.94 to 10.18log⁡10/g. DGGE analysis revealed distinct banding profiles and two polymorphic nucleotide positions for tet(W-carrying cheeses, though the similarity of the sequences suggests this tet(W to have a monophyletic origin. Traditional cheeses would therefore appear to act as reservoirs for large numbers of many types of antibiotic resistance determinants.

  14. Comparison of bacteriological conversion and treatment outcomes among MDR-TB patients with and without diabetes in Mexico: Preliminary data

    Directory of Open Access Journals (Sweden)

    M. Muñoz-Torrico

    2017-01-01

    Full Text Available Diabetes mellitus (DM is a well-known risk factor for tuberculosis (TB. However, it is not known to what extent DM affects the outcome in patients with multidrug-resistant (MDR-TB and extensively drug-resistant TB (XDR-TB treated with second-line anti-TB drugs.The objective of this study was to compare the microbiological evolution (sputum smear and culture conversion and final outcomes of MDR/XDR-TB patients with and without DM, managed at the national TB reference centre in Mexico City. Results: Ninety patients were enrolled between 2010 and 2015: 73 with MDR-TB (81.1%, 11 with pre-XDR-TB (e.g. MDR-TB with additional resistance to one injectable drug or a fluoroquinolone, 12.2% and 6 (6.7% with XDR-TB. Out of these, 49 (54.4% had DM and 42 (86% were undergoing insulin treatment.No statistically significant differences were found in treatment outcomes comparing DM vs. non-DM MDR-TB cases: 18/32 (56.3% of DM cases and 19/24 (79.2% non DM patients achieved treatment success (p = 0.07. The time to sputum smear and culture conversion was longer (although not statistically in patients without DM, as follows: the mean (±SD time to sputum smear conversion was 53.9 (±31.4 days in DM patients and 65.2 (±34.8 days in non-DM ones (p = 0.15, while the time to culture conversion was 66.2 (±27.6 days for DM and 81.4 (±37.7 days for non-DM MDR-TB cases (p = 0.06. Conclusions: The study results support the Mexican National TB programme to strengthen its collaboration with the DM programme, as an entry point for TB (and latent TB infection screening and management. Keywords: Diabetes mellitus, Delay, Sputum and culture conversion, MDR-TB, High treatment adherence

  15. Effective genes for resistance to stripe rust and virulence of Puccinia ...

    African Journals Online (AJOL)

    The results revealed that stripe rust resistance genes Yr3, Yr5, Yr10, Yr15, Yr26, YrSP and YrCV were resistant, while Yr18 showed moderate susceptibility at all locations. Genes YrA-, Yr2, Yr6, Yr7, Yr8, Yr9, Yr17, Yr27 and gene combinations Opata (Yr27+Yr18) and Super Kauz (Yr9, Yr27, Yr18) were found susceptible.

  16. Genetics and mapping of a new leaf rust resistance gene in Triticum ...

    Indian Academy of Sciences (India)

    Genetic analysis in F1, F2 and F2.3 families at the seedling stage revealed that leaf rust resistance in Selection G12 is conditioned by a single incompletely dominant gene. The leaf rust resistance gene was mapped to chromosome 3BL with SSR markers Xgwm114 and Xgwm547 flanking the gene at a distance of 28.3 cM ...

  17. Genetic mapping of the rice resistance-breaking gene of the brown planthopper Nilaparvata lugens.

    Science.gov (United States)

    Kobayashi, Tetsuya; Yamamoto, Kimiko; Suetsugu, Yoshitaka; Kuwazaki, Seigo; Hattori, Makoto; Jairin, Jirapong; Sanada-Morimura, Sachiyo; Matsumura, Masaya

    2014-07-22

    Host plant resistance has been widely used for controlling the major rice pest brown planthopper (BPH, Nilaparvata lugens). However, adaptation of the wild BPH population to resistance limits the effective use of resistant rice varieties. Quantitative trait locus (QTL) analysis was conducted to identify resistance-breaking genes against the anti-feeding mechanism mediated by the rice resistance gene Bph1. QTL analysis in iso-female BPH lines with single-nucleotide polymorphism (SNP) markers detected a single region on the 10th linkage group responsible for the virulence. The QTL explained from 57 to 84% of the total phenotypic variation. Bulked segregant analysis with next-generation sequencing in F2 progenies identified five SNPs genetically linked to the virulence. These analyses showed that virulence to Bph1 was controlled by a single recessive gene. In contrast to previous studies, the gene-for-gene relationship between the major resistance gene Bph1 and virulence gene of BPH was confirmed. Identified markers are available for map-based cloning of the major gene controlling BPH virulence to rice resistance. © 2014 The Author(s) Published by the Royal Society. All rights reserved.

  18. Polymorphisms in the HIV-1 gp41 env gene, natural resistance to enfuvirtide (T-20) and pol resistance among pregnant Brazilian women.

    Science.gov (United States)

    Reis, Mônica Nogueira da Guarda; de Alcântara, Keila Correa; Cardoso, Ludimila Paula Vaz; Stefani, Mariane Martins Araújo

    2014-01-01

    The selective pressure of antiretroviral drugs (ARVs) targeting HIV-1 pol can promote drug resistance mutations in other genomic regions, such as env. Drug resistance among women should be monitored to avoid horizontal and mother-to-child transmission. To describe natural resistance to T-20 (enfuvirtide), gp41 env polymorphisms, mutations in pol and HIV-1 subtypes, 124 pregnant women were recruited. For 98 patients, the gp41 env, protease (PR) and reverse transcriptase (RT) fragments were sequenced. The patients were ARV naïve (n = 30), taking mother-to-child transmission prophylaxis (n = 50), or being treated with highly active ARV therapy/HAART (n = 18). The Stanford and IAS/USA databases and other sources were used to analyze PR/RT, gp41 env resistance mutations. The HIV-1 genetic diversity was analyzed by REGA/phylogenetic analyses. The patients' median age was 25 years (range, 16-42), 18.4% had AIDS. The frequency of natural resistance to T-20 (N42D, L44M, and R46M-low-impact mutations) was 6.1% (6/98); 20.4% (20/98) had compensatory mutations in HR2. The prevalence of transmitted drug resistance in the pol was 13.3% (4/30), and the prevalence of secondary drug resistance was 33.3% (6/18). Two patients were infected with multidrug resistant/MDR viruses. The analysis of HIV-1 subtypes (PR/RT/gp41) revealed that 61.2% (60/98) were subtype B, 12.2% (12/98) were subtype C, 4.1% (4/98) were subtype F1, and 22.4% (22/98) were possible recombinants (BF1 = 20.4%; BC = 2%). Natural resistance to T-20 was not associated with pol resistance or previous ARV use. The high rate of secondary resistance, including MDR, indicates that the number of women that may need T-20 salvage therapy may be higher than anticipated. © 2013 Wiley Periodicals, Inc.

  19. Qualitative analysis of MDR-reversing Anastasia Black (Russian black sweet pepper, Capsicum annuum, Solanaceae) extracts and fractions by HPLC and LC-MS-MS methods.

    Science.gov (United States)

    Schelz, Zsuzsanna; Molnár, Joseph; Fogliano, Vincenzo; Ferracane, Rosalia; Pernice, Rita; Shirataki, Yoshiaki; Motohashi, Noboru

    2006-01-01

    In earlier experiments, the MDR (multidrug resistance)-reversal activities of Anastasia Black (Russian black sweet pepper) extracts had been analysed. Recently, the most effective MDR reversing extracts and fractions have been separated by HPLC (high-performance liquid chromatography, for carotenoids) and LC-MS-MS (HPLC combined with mass spectrometry, for phenolic compounds) methods. As a result of the analytical studies, the following flavonoids had been identified: feruloyl glucopyranoside, quercetin rhamnopyranoside glucopyranoside, luteolin glucopyranoside arabinopyranoside, apigenin glucopyranoside arabinopyranoside, quercetin rhamnopyranoside, luteolin arabinopyranoside diglucopy-ranoside, hesperidine and luteolin glucuronide. According to the literature, the aglycones of these phenolic compounds exhibit MDR-reversal activity in vitro, and the connection between the phenolic content of Anastasia Black and MDR-reversal action was therefore studied by different analytical methods. The results of this study revealed that the identified flavonoids of Anastasia Black may be only partially responsible for the modulation of the MDR of mouse lymphoma cells. Other lipophilic compounds, most probably carotenoids, present in Russian black sweet pepper may act as inhibitors of MDR reversal.

  20. Characterization of resistance to tetracyclines and aminoglycosides of sheep mastitis pathogens: study of the effect of gene content on resistance.

    Science.gov (United States)

    Lollai, S A; Ziccheddu, M; Duprè, I; Piras, D

    2016-10-01

    Mastitis causes economic losses and antimicrobials are frequently used for mastitis treatment. Antimicrobial resistance surveys are still rare in the ovine field and characterization of strains is important in order to acquire information about resistance and for optimization of therapy. Bacterial pathogens recovered in milk samples from mastitis-affected ewes were characterized for resistance to tetracyclines and aminoglycosides, members of which are frequently used antimicrobials in small ruminants. A total of 185 strains of staphylococci, streptococci, and enterococci, common mastitis pathogens, were tested for minimal inhibitory concentration (MIC) to tetracycline, doxycycline, minocycline, gentamicin, kanamycin, streptomycin, and for resistance genes by PCR. Effects of different tet genes arrangements on MICs were also investigated. Staphylococci expressed the lowest MIC for tetracycline and tet(K) was the most common gene recovered; tet(M) and tet(O) were also found. Gene content was shown to influence the tetracycline MIC values. Enterococci and streptococci showed higher MICs to tetracyclines and nonsusceptible strains always harboured at least one ribosomal protection gene (MIC above 8 μg ml(-1) ). Streptococci often harboured two or more tet determinants. As regards the resistance to aminoglycosides, staphylococci showed the lowest gentamicin and kanamycin median MIC along with streptomycin high level resistant (HLR) strains (MIC >1024 μg ml(-1) ) all harbouring str gene. The resistance determinant aac(6')-Ie-aph(2″)-Ia was present in few strains. Streptococci were basically nonsusceptible to aminoglycosides but neither HLR isolates nor resistance genes were detected. Enterococci revealed the highest MICs for gentamicin; two str harbouring isolates were shown to be HLR to streptomycin. Evidence was obtained for the circulation of antimicrobial-resistant strains and genes in sheep dairy farming. Tetracycline MIC of 64 μg ml(-1) and high

  1. Detection and Characterizations of Genes Resistant to Tetracycline and Sulfa among the Bacteria in Mariculture Water

    Science.gov (United States)

    Qu, L.; Li, Y.; Zhu, P.

    2013-12-01

    One hundred and thirty-five bacteria from maricultural environments were tested for sensitivity to tetracycline and sulfa. Result show that 72% of the bacteria were sulfa-resistant, 36% of the bacteria were tetracycline-resistant, and 16.5% of bacteria showed resistance to both tetracyclines and sulfa ,indicating that the proportion of sulfa and tetracycline resistance bacteria isvery large in the maricultural environments. PCR methods were used to detect if these resistant bacteria carry tetracycline and sulfa resistance genes. Out of the 33 tetracycline-resistant bacteria screened, 3 were positive for tetA, 6 were positive for tetB and no isolate wasboth positive for tetA and tetB. Of the 97 sulfa-resistant bacteria screened, 9 were positive for sul2, 6 were positive for sul1, 1 isolate was positive for bothsul1 and sul2. The minimum inhibitory concentration (MIC) of tetracycline for tetA-carrying isolates were higher than those tetB-carrying isolates.while The MIC of sulfa for sul2-carrying isolates were higher than those sul1-carrying isolates. Indicating that tetA and sul2 gene may play ubknown roles in resisting tetracycline and sulfa than tetB and sul1 genes. The results showed the 4 kinds of genes (tetA,tetB,sul1,sul2) has no host specificity. All these 16S sequence are from the isolates which are positive for the above genes, it indicated the above antibiotic resistance genes are widespread in the environment regardless of the host. While the DNA sequence of these four genes showed tetA, sul1, sul2 genes are conservative in different bacteria , etB gene conserved poorly. The research aim is to get a preliminary understanding of resistance mechanism related to the resistant bacteria and the resistance genes in marine aquaculture environment through the analysis of resistant genes, providing research base for the prevention and treatment of drug-resistant bacteria so as to reduce the threat to the ecological environment, aquaculture and human health.

  2. A mutation within the extended X loop abolished substrate-induced ATPase activity of the human liver ATP-binding cassette (ABC) transporter MDR3.

    Science.gov (United States)

    Kluth, Marianne; Stindt, Jan; Dröge, Carola; Linnemann, Doris; Kubitz, Ralf; Schmitt, Lutz

    2015-02-20

    The human multidrug resistance protein 3 (MDR3/ABCB4) belongs to the ubiquitous family of ATP-binding cassette (ABC) transporters and is located in the canalicular membrane of hepatocytes. There it flops the phospholipids of the phosphatidylcholine (PC) family from the inner to the outer leaflet. Here, we report the characterization of wild type MDR3 and the Q1174E mutant, which was identified previously in a patient with progressive familial intrahepatic cholestasis type 3 (PFIC-3). We expressed different variants of MDR3 in the yeast Pichia pastoris, purified the proteins via tandem affinity chromatography, and determined MDR3-specific ATPase activity in the presence or absence of phospholipids. The ATPase activity of wild type MDR3 was stimulated 2-fold by liver PC or 1,2-dioleoyl-sn-glycero-3-phosphatidylethanolamine lipids. Furthermore, the cross-linking of MDR3 with a thiol-reactive fluorophore blocked ATP hydrolysis and exhibited no PC stimulation. Similarly, phosphatidylethanolamine, phosphatidylserine, and sphingomyelin lipids did not induce an increase of wild type MDR3 ATPase activity. The phosphate analogues beryllium fluoride and aluminum fluoride led to complete inhibition of ATPase activity, whereas orthovanadate inhibited exclusively the PC-stimulated ATPase activity of MDR3. The Q1174E mutation is located in the nucleotide-binding domain in direct proximity of the leucine of the ABC signature motif and extended the X loop, which is found in ABC exporters. Our data on the Q1174E mutant demonstrated basal ATPase activity, but PC lipids were incapable of stimulating ATPase activity highlighting the role of the extended X loop in the cross-talk of the nucleotide-binding domain and the transmembrane domain. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. ASSESSMENT OF EFFECT OF MDR - TB/TB ON SOCIAL, FUNCTIONAL AND ECONOMIC WELL BEING OF PATIENTS – A CROSS SECTIONAL STUDY

    Directory of Open Access Journals (Sweden)

    Shiv Kumar

    2015-06-01

    Full Text Available CONTEXT : Tuberculosis is a contagious disease with social stigma attached to it. Various problems which are social and economic in nature are faced by TB patient. Therefore , it is essential to explore the overall effect of MDR - TB/TB on health and patients perception of Well - being. AIMS : To Document the effect of MDR - TB/TB on social , functional and economic well - being of patients. SETTINGS AND DESIGN : A Cross - sectional study , Conveniently Recruited 68 MDR - TB Patients and 136 non - MDR - TB Patients (from Rural as well as urban Area of Surat District diagnosed by CBNAAT were interviewed for investigating the effect of Tuberculosis. METHODS AND MATERIAL : A pre - tested standardized semi - structured questionnaire was used. Data was collected about socio - demographic profile of patients and interpreted in table. Data about effect of MDR - TB/TB was collected on Likert Scale and Frequency was calculated and Data wa s plotted on multiple bar charts. RESULTS : As compared to healthy status in the past , 93% MDR - TB and 82% TB patients have decreased ability to do work , about half of MDR - TB Patients and TB Patients have detiorated relations with family members , 67% of stud y participants have developed disharmonious relations with neighbor’s , 55% of Study participants have decreased income , 88% of study participants have decreased performance in day to day activities and 78% of study participants have faced discordial and di srespectful behavior from co - workers. CONCLUSION : Working ability more detiorated in MDR - TB patients while rest of the effect on social , functional and economic well - being is same in both TB and Multi Drug Resistant TB patients. This study emphasizes very clearly that social stigma still persist in community about Tuberculosis which needs to be eliminated in community by behavior change communication by health workers at all levels of health care.

  4. [Mechanisms of endogenous drug resistance acquisition by spontaneous chromosomal gene mutation].

    Science.gov (United States)

    Fukuda, H; Hiramatsu, K

    1997-05-01

    Endogenous resistance in bacteria is caused by a change or loss of function and generally genetically recessive. However, this type of resistance acquisition are now prevalent in clinical setting. Chromosomal genes that afford endogenous resistance are the genes correlated with the target of the drug, the drug inactivating enzymes, and permeability of the molecules including the antibacterial agents. Endogenous alteration of the drug target are mediated by the spontaneous mutation of their structural gene. This mutation provides much lower affinity of the drugs for the target. Gene expression of the inactivating enzymes, such as class C beta-lactamase, is generally regulated by regulatory genes. Spontaneous mutations in the regulatory genes cause constitutive enzyme production and provides the resistant to the agent which is usually stable for such enzymes. Spontaneous mutation in the structural gene gives the enzyme extra-spectrum substrate specificity, like ESBL (Extra-Spectrum-beta-Lactamase). Expression of structural genes encoding the permeability systems are also regulated by some regulatory genes. The spontaneous mutation of the regulatory genes reduce an amount of porin protein. This mutation causes much lower influx of the drug in the cell. Spontaneous mutation in promoter region of the structural gene of efflux protein was observed. This mutation raised the gene transcription and overproduced efflux protein. This protein progresses the drug efflux from the cell.

  5. Novel understanding of ABC transporters ABCB1/MDR/P-glycoprotein, ABCC2/MRP2, and ABCG2/BCRP in colorectal pathophysiology

    DEFF Research Database (Denmark)

    Andersen, Vibeke; Svenningsen, Katrine; Knudsen, Lina Almind

    2015-01-01

    transporter proteins, inflammatory bowel disease, ulcerative, colitis, Crohns disease, colorectal cancer, colitis, intestinal inflammation, intestinal carcinogenesis, ABCB1/P-glycoprotein (P-gp/CD243/MDR1), ABCC2/multidrug resistance protein 2 (MRP2) and ABCG2/breast cancer resistance protein (BCRP), Abcb1....../Mdr1a, abcc2/Mrp2, abcg2/Bcrp, knock-out mice, tight junction, membrane lipid function. RESULTS: Recently, human studies reported that changes in the levels of ABC transporters were early events in the adenoma-carcinoma sequence leading to CRC. A link between ABCB1, high fat diet and gut microbes...

  6. Gene Expression Profiling of Cecropin B-Resistant Haemophilus parasuis

    NARCIS (Netherlands)

    Wang, Chunmei; Chen, Fangzhou; Hu, Han; Li, Wentao; Wang, Yang; Chen, Pin; Liu, Yingyu; Ku, Xugang; He, Qigai; Chen, Huanchun; Xue, Feiqun

    2014-01-01

    Synthetically designed antimicrobial peptides (AMPs) present the potential of replacing antibiotics in the treatment of bacterial infections. However, microbial resistance to AMPs has been reported and little is known regarding the underlying mechanism of such resistance. The naturally occurring AMP

  7. PCR detection of indicator genes in methicillin-resistant ...

    African Journals Online (AJOL)

    MRSA) isolated from three Saudi hospitals. ... Resistance towards eight antimicrobial agents revealed that most of the tested strains of Staphylococcus aureus showed resistance to the tested antimicrobials in the following order; Oxacillin 100% ...

  8. Initial drug resistance in India

    Indian Academy of Sciences (India)

    First page Back Continue Last page Overview Graphics. Initial drug resistance in India. There is gradual increase in primary MDR all over India : Pondi= Pondicherry 1985; Bangalore =1986; Jaipur = 1991; Jaipur =2000. Overall the MDR is less than 3% (TRC studies).

  9. The LBP Gene and Its Association with Resistance to Aeromonas hydrophila in Tilapia

    Directory of Open Access Journals (Sweden)

    Gui Hong Fu

    2014-12-01

    Full Text Available Resistance to pathogens is important for the sustainability and profitability of food fish production. In immune-related genes, the lipopolysaccharide-binding protein (LBP gene is an important mediator of the inflammatory reaction. We analyzed the cDNA and genomic structure of the LBP gene in tilapia. The full-length cDNA (1901 bp of the gene contained a 1416 bp open reading frame, encoding 471 amino acid residues. Its genomic sequence was 5577 bp, comprising 15 exons and 14 introns. Under normal conditions, the gene was constitutively expressed in all examined tissues. The highest expression was detected in intestine and kidney. We examined the responses of the gene to challenges with two bacterial pathogens Streptcoccus agalactiae and Aeromonas hydrophila. The gene was significantly upregulated in kidney and spleen post-infection with S. agalactiae and A. hydrophila, respectively. However, the expression profiles of the gene after the challenge with the two pathogens were different. Furthermore, we identified three SNPs in the gene. There were significant associations (p < 0.05 of two of the three SNPs with the resistance to A. hydrophila, but not with the resistance to S. agalactiae or growth performance. These results suggest that the LBP gene is involved in the acute-phase immunologic response to the bacterial infections, and the responses to the two bacterial pathogens are different. The two SNPs associated with the resistance to A. hydrophila may be useful in the selection of tilapia resistant to A. hydrophila.

  10. Detection and coexistence of six categories of resistance genes in Escherichia coli strains from chickens in Anhui Province, China

    Directory of Open Access Journals (Sweden)

    Lin Li

    2015-12-01

    Full Text Available The aim of this study was to characterise the prevalence of class 1 integrons and gene cassettes, tetracycline-resistance genes, phenicol-resistance genes, 16S rRNA methylase genes, extended-spectrum β-lactamase genes and plasmid-mediated fluoroquinolone resistance determinants in 184 Escherichia coli isolates from chickens in Anhui Province, China. Susceptibility to 15 antimicrobials was determined using broth micro-dilution. Polymerase chain reaction and DNA sequencing were used to characterise the molecular basis of the antibiotic resistance. High rates of antimicrobial resistance were observed; 131 out of the 184 (72.3% isolates were resistant to at least six antimicrobial agents. The prevalences of class 1 integrons, tetracycline-resistance genes, phenicol-resistance genes, 16S rRNA methylase genes, extended-spectrum β-lactamase genes and plasmid-mediated fluoroquinolone resistance determinants were 49.5, 17.4, 15.8, 0.5, 57.6 and 46.2%, respectively. In 82 isolates, 48 different kinds of coexistence of the different genes were identified. Statistical (χ2 analysis showed that the resistance to amoxicillin, doxycycline, florfenicol, ofloxacin and gentamicin had significant differences (P<0.01 or 0.01resistance genes, which showed a certain correlation between antimicrobial resistance and the presence of resistance genes.

  11. Cloning and characterization of NBS-LRR resistance gene ...

    African Journals Online (AJOL)

    Nendran) cultivar. C6 was expressed only in resistant cultivar not in susceptible one. But there was no change in the expression of C2 and C3 in both resistant and susceptible cultivars. These results indicate that in depth study on C1, and C5 RGAs will be helpful for further improvement of P. coffeae resistance in banana.

  12. Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants

    Science.gov (United States)

    Somerville, Chris R [Portola Valley, CA; Scheible, Wolf [Golm, DE

    2007-07-10

    Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  13. sugE: A gene involved in tributyltin (TBT) resistance of Aeromonas molluscorum Av27.

    Science.gov (United States)

    Cruz, Andreia; Micaelo, Nuno; Félix, Vitor; Song, Jun-Young; Kitamura, Shin-Ichi; Suzuki, Satoru; Mendo, Sónia

    2013-01-01

    The mechanism of bacterial resistance to tributyltin (TBT) is still unclear. The results herein presented contribute to clarify that mechanism in the TBT-resistant bacterium Aeromonas molluscorum Av27. We have identified and cloned a new gene that is involved in TBT resistance in this strain. The gene is highly homologous (84%) to the Aeromonas hydrophila-sugE gene belonging to the small multidrug resistance gene family (SMR), which includes genes involved in the transport of lipophilic drugs. In Av27, expression of the Av27-sugE was observed at the early logarithmic growth phase in the presence of a high TBT concentration (500 μM), thus suggesting the contribution of this gene for TBT resistance. E. coli cells transformed with Av27-sugE become resistant to ethidium bromide (EtBr), chloramphenicol (CP) and tetracycline (TE), besides TBT. According to the Moriguchi logP (miLogP) values, EtBr, CP and TE have similar properties and are substrates for the sugE-efflux system. Despite the different miLogP of TBT, E. coli cells transformed with Av27-sugE become resistant to this compound. So it seems that TBT is also a substrate for the SugE protein. The modelling studies performed also support this hypothesis. The data herein presented clearly indicate that sugE is involved in TBT resistance of this bacterium.

  14. Multidrug-resistant Enterobacteriaceae from indoor air of an urban wastewater treatment plant.

    Science.gov (United States)

    Teixeira, Juliana V; Cecílio, Pedro; Gonçalves, Daniela; Vilar, Vítor J P; Pinto, Eugénia; Ferreira, Helena N

    2016-07-01

    Wastewater treatment plants (WWTPs) have been recognized as sources of bioaerosols that may act as vehicles for dissemination of pathogens and multidrug-resistant (MDR) bacteria. The occurrence of MDR Enterobacteriaceae in indoor air of an urban WWTP was investigated. A possible airborne contamination with extended-spectrum beta-lactamase (ESBL) and carbapenemase-producing Enterobacteriaceae was also explored. Fourteen of 39 Enterobacteriaceae isolates were MDR. These isolates were found at all sampling sites, mainly at the secondary sedimentation settings. The highest levels of resistance were detected in three different species: Enterobacter cloacae, Escherichia coli, and Citrobacter freundii. Furthermore, one of the airborne E. coli isolates was phenotypically characterized as an ESBL producer. Additionally, five isolates showed non-susceptibility to at least one carbapenem tested. The presence of genes encoding relevant beta-lactamase types in these ESBL-producing and carbapenem-resistant Enterobacteriaceae isolates was investigated by PCR. Results showed amplification for bla CTX-M and bla OXA. These findings are relevant both in terms of occupational/public health and of environmental dissemination of MDR bacteria.

  15. A maize resistance gene functions against bacterial streak disease in rice.

    Science.gov (United States)

    Zhao, Bingyu; Lin, Xinghua; Poland, Jesse; Trick, Harold; Leach, Jan; Hulbert, Scot

    2005-10-25

    Although cereal crops all belong to the grass family (Poacea), most of their diseases are specific to a particular species. Thus, a given cereal species is typically resistant to diseases of other grasses, and this nonhost resistance is generally stable. To determine the feasibility of transferring nonhost resistance genes (R genes) between distantly related grasses to control specific diseases, we identified a maize R gene that recognizes a rice pathogen, Xanthomonas oryzae pv. oryzicola, which causes bacterial streak disease. Bacterial streak is an important disease of rice in Asia, and no simply inherited sources of resistance have been identified in rice. Although X. o. pv. oryzicola does not cause disease on maize, we identified a maize gene, Rxo1, that conditions a resistance reaction to a diverse collection of pathogen strains. Surprisingly, Rxo1 also controls resistance to the unrelated pathogen Burkholderia andropogonis, which causes bacterial stripe of sorghum and maize. The same gene thus controls resistance reactions to both pathogens and nonpathogens of maize. Rxo1 has a nucleotide-binding site-leucine-rich repeat structure, similar to many previously identified R genes. Most importantly, Rxo1 functions after transfer as a transgene to rice, demonstrating the feasibility of nonhost R gene transfer between cereals and providing a valuable tool for controlling bacterial streak disease.

  16. The transport of antibiotic resistance genes and residues in groundwater near swine production facilities

    Science.gov (United States)

    Lin, Y. F.; Yannarell, A. C.; Mackie, R. I.; Krapac, I. G.; Chee-Sanford, J. S.; Koike, S.

    2008-12-01

    The use of antibiotics at concentrated animal feeding operations (CAFOs) for disease prevention, disease treatment, and growth promotion can contribute to the spread of antibiotic compounds, their breakdown products, and antibiotic resistant bacteria and/or the genes that confer resistance. In addition, constitutive use of antibiotics at sub-therapeutic levels can select for antibiotic resistance among the bacteria that inhabit animal intestinal tracts, onsite manure treatment facilities, and any environments receiving significant inputs of manure (e.g. through waste lagoon leakage or fertilizer amendments to farm soils). If the antibiotic resistant organisms persist in these new environments, or if they participate in genetic exchanges with the native microflora, then CAFOs may constitute a significant reservoir for the spread of antibiotic resistance to the environment at large. Our results have demonstrated that leakage from waste treatment lagoons can influence the presence and persistence of tetracycline resistance genes in the shallow aquifer adjacent to swine CAFOs, and molecular phylogeny allowed us to distinguish "native" tetracycline resistance genes in control groundwater wells from manure-associated genes introduced from the lagoon. We have also been able to detect the presence of erythromycin resistance genes in CAFO surface and groundwater even though erythromycin is strictly reserved for use in humans and thus is not utilized at any of these sites. Ongoing research, including modeling of particle transport in groundwater, will help to determine the potential spatial and temporal extent of CAFO-derived antibiotic resistance.

  17. PD173074, a selective FGFR inhibitor, reverses MRP7 (ABCC10-mediated MDR

    Directory of Open Access Journals (Sweden)

    Nagaraju Anreddy

    2014-06-01

    Full Text Available Multidrug resistance protein 7 (MRP7, ABCC10 is a recently identified member of the ATP-binding cassette (ABC transporter family, which adequately confers resistance to a diverse group of antineoplastic agents, including taxanes, vinca alkaloids and nucleoside analogs among others. Clinical studies indicate an increased MRP7 expression in non-small cell lung carcinomas (NSCLC compared to a normal healthy lung tissue. Recent studies revealed increased paclitaxel sensitivity in the Mrp7−/− mouse model compared to their wild-type counterparts. This demonstrates that MRP7 is a key contributor in developing drug resistance. Recently our group reported that PD173074, a specific fibroblast growth factor receptor (FGFR inhibitor, could significantly reverse P-glycoprotein-mediated MDR. However, whether PD173074 can interact with and inhibit other MRP members is unknown. In the present study, we investigated the ability of PD173074 to reverse MRP7-mediated MDR. We found that PD173074, at non-toxic concentration, could significantly increase the cellular sensitivity to MRP7 substrates. Mechanistic studies indicated that PD173074 (1 μmol/L significantly increased the intracellular accumulation and in-turn decreased the efflux of paclitaxel by inhibiting the transport activity without altering expression levels of the MRP7 protein, thereby representing a promising therapeutic agent in the clinical treatment of chemoresistant cancer patients.

  18. Characterization of Antibiotic Resistance Genes from Lactobacillus Isolated from Traditional Dairy Products.

    Science.gov (United States)

    Guo, Huiling; Pan, Lin; Li, Lina; Lu, Jie; Kwok, Laiyu; Menghe, Bilige; Zhang, Heping; Zhang, Wenyi

    2017-03-01

    Lactobacilli are widely used as starter cultures or probiotics in yoghurt, cheese, beer, wine, pickles, preserved food, and silage. They are generally recognized as safe (GRAS). However, recent studies have shown that some lactic acid bacteria (LAB) strains carry antibiotic resistance genes and are resistant to antibiotics. Some of them may even transfer their intrinsic antibiotic resistance genes to other LAB or pathogens via horizontal gene transfer, thus threatening human health. A total of 33 Lactobacillus strains was isolated from fermented milk collected from different areas of China. We analyzed (1) their levels of antibiotic resistance using a standardized dilution method, (2) their antibiotic resistance gene profiles by polymerase chain reaction (PCR) using gene-specific primers, and (3) the transferability of some of the detected resistance markers by a filter mating assay. All Lactobacillus strains were found to be resistant to vancomycin, but susceptible to gentamicin, linezolid, neomycin, erythromycin, and clindamycin. Their susceptibilities to tetracycline, kanamycin, ciprofloxacin, streptomycin, quinupristin/dalfopristin, trimethoprim, ampicillin, rifampicin, and chloramphenicol was different. Results from our PCR analysis revealed 19 vancomycin, 10 ciprofloxacin, and 1 tetracycline-resistant bacteria that carried the van(X), van(E), gyr(A), and tet(M) genes, respectively. Finally, no transferal of the monitored antibiotic resistance genes was observed in the filter mating assay. Taken together, our study generated the antibiotic resistance profiles of some milk-originated lactobacilli isolates and preliminarily assessed their risk of transferring antibiotic gene to other bacteria. The study may provide important data concerning the safe use of LAB. © 2017 Institute of Food Technologists®.

  19. SSTAR, a Stand-Alone Easy-To-Use Antimicrobial Resistance Gene Predictor.

    Science.gov (United States)

    de Man, Tom J B; Limbago, Brandi M

    2016-01-01

    We present the easy-to-use Sequence Search Tool for Antimicrobial Resistance, SSTAR. It combines a locally executed BLASTN search against a customizable database with an intuitive graphical user interface for identifying antimicrobial resistance (AR) genes from genomic data. Although the database is initially populated from a public repository of acquired resistance determinants (i.e., ARG-ANNOT), it can be customized for particular pathogen groups and resistance mechanisms. For instance, outer membrane porin sequences associated with carbapenem resistance phenotypes can be added, and known intrinsic mechanisms can be included. Unique about this tool is the ability to easily detect putative new alleles and truncated versions of existing AR genes. Variants and potential new alleles are brought to the attention of the user for further investigation. For instance, SSTAR is able to identify modified or truncated versions of porins, which may be of great importance in carbapenemase-negative carbapenem-resistant Enterobacteriaceae. SSTAR is written in Java and is therefore platform independent and compatible with both Windows and Unix operating systems. SSTAR and its manual, which includes a simple installation guide, are freely available from https://github.com/tomdeman-bio/Sequence-Search-Tool-for-Antimicrobial-Resistance-SSTAR-. IMPORTANCE Whole-genome sequencing (WGS) is quickly becoming a routine method for identifying genes associated with antimicrobial resistance (AR). However, for many microbiologists, the use and analysis of WGS data present a substantial challenge. We developed SSTAR, software with a graphical user interface that enables the identification of known AR genes from WGS and has the unique capacity to easily detect new variants of known AR genes, including truncated protein variants. Current software solutions do not notify the user when genes are truncated and, therefore, likely nonfunctional, which makes phenotype predictions less accurate. SSTAR

  20. Frequency Of C3435 Mdr1 And A6896g Cyp3a5 Single Nucleotide Polymorphism in an Iranian Population and Comparison with Other Ethnic Groups

    Directory of Open Access Journals (Sweden)

    N. AZARPIRA

    2006-11-01

    Full Text Available Background:It is well recognized that different patients respond in different ways to medications. The inter-individual variations are greater than the intera- individual variations,a finding consistent with the notion that inheritance is a determinant of drug responses. The recent identification of genetic polymorphisms in drug-metabolizing enzymes and drug transporters led to the hypothesis that genetic factors may be implicated in this interindividual variation. Single nucleotide polymorphism in common metabolic pathway,cytochrome P450 and common transporter,multidrug resistance-1 gene are two important sites that might involve clinically significant genetic variations. Ethnicity greatly influences these genetic polymorphism distributions. Methods: We studied the inheritance patterns of polymorphisms for MDR1 and CYP3A5 genes in the Iranian population and compared its genotype and allele frequencies with 3 different ethnic groups: Caucasian (United Kingdom, Chinese and Japanese. Results: We found striking differences in the distribution of MDR allelic variants between Iranian,Japanese and Chinese (p<0.02 and similar between the Iranian and Caucasian population.(p=0.06.Almost 50% of Iranian and Caucasian individuals were homozygous carriers of the variant T allele compared with 32% of the Japanese and 43% of the Chinese (p<0.02.More than half of Iranian subjects have at least one T allele,with lower P-gp level in small intestine.We also noted dramatic differences in the CYP3A5 alleles and genotypes distribution between Iranian subjects with other compared populations.99% of Iranian individuals were homozygous carriers of the variant G allele compared with about 70% of the Chinese and Japanese and 19% of the Caucasian population. The G/G genotype has a very low level of active cytochrome P450 enzyme.Conclusion:Our results emphasize the role of ethnicity in interindividual variability of the pharmacokinetic and pharmacodynamic characteristics

  1. RNA-Seq analysis reveals candidate genes for ontogenic resistance in Malus-Venturia pathosystem.

    Directory of Open Access Journals (Sweden)

    Michele Gusberti

    Full Text Available Ontogenic scab resistance in apple leaves and fruits is a horizontal resistance against the plant pathogen Venturia inaequalis and is expressed as a decrease in disease symptoms and incidence with the ageing of the leaves. Several studies at the biochemical level tried to unveil the nature of this resistance; however, no conclusive results were reported. We decided therefore to investigate the genetic origin of this phenomenon by performing a full quantitative transcriptome sequencing and comparison of young (susceptible and old (ontogenic resistant leaves, infected or not with the pathogen. Two time points at 72 and 96 hours post-inoculation were chosen for RNA sampling and sequencing. Comparison between the different conditions (young and old leaves, inoculated or not should allow the identification of differentially expressed genes which may represent different induced plant defence reactions leading to ontogenic resistance or may be the cause of a constitutive (uninoculated with the pathogen shift toward resistance in old leaves. Differentially expressed genes were then characterised for their function by homology to A. thaliana and other plant genes, particularly looking for genes involved in pathways already suspected of appertaining to ontogenic resistance in apple or other hosts, or to plant defence mechanisms in general. IN THIS WORK, FIVE CANDIDATE GENES PUTATIVELY INVOLVED IN THE ONTOGENIC RESISTANCE OF APPLE WERE IDENTIFIED: a gene encoding an "enhanced disease susceptibility 1 protein" was found to be down-regulated in both uninoculated and inoculated old leaves at 96 hpi, while the other four genes encoding proteins (metallothionein3-like protein, lipoxygenase, lipid transfer protein, and a peroxidase 3 were found to be constitutively up-regulated in inoculated and uninoculated old leaves. The modulation of the five candidate genes has been validated using the real-time quantitative PCR. Thus, ontogenic resistance may be the result

  2. Epigenetic mechanisms involved in differential MDR1 mRNA expression between gastric and colon cancer cell lines and rationales for clinical chemotherapy

    Directory of Open Access Journals (Sweden)

    Kim Kyung-Jong

    2008-08-01

    Full Text Available Abstract Background The membrane transporters such as P-glycoprotein (Pgp, the MDR1 gene product, are one of causes of treatment failure in cancer patients. In this study, the epigenetic mechanisms involved in differential MDR1 mRNA expression were compared between 10 gastric and 9 colon cancer cell lines. Methods The MDR1 mRNA levels were determined using PCR and real-time PCR assays after reverse transcription. Cytotoxicity was performed using the MTT assay. Methylation status was explored by quantification PCR-based methylation and bisulfite DNA sequencing analyses. Results The MDR1 mRNA levels obtained by 35 cycles of RT-PCR in gastric cancer cells were just comparable to those obtained by 22 cycles of RT-PCR in colon cancer cells. Real-time RT-PCR analysis revealed that MDR1 mRNA was not detected in the 10 gastric cancer cell lines but variable MDR1 mRNA levels in 7 of 9 colon cancer cell lines except the SNU-C5 and HT-29 cells. MTT assay showed that Pgp inhibitors such as cyclosporine A, verapamil and PSC833 sensitized Colo320HSR (colon, highest MDR1 expression but not SNU-668 (gastric, highest and SNU-C5 (gastric, no expression to paclitaxel. Quantification PCR-based methylation analysis revealed that 90% of gastric cancer cells, and 33% of colon cancer cells were methylated, which were completely matched with the results obtained by bisulfite DNA sequencing analysis. 5-aza-2'-deoxcytidine (5AC, a DNA methyltransferase inhibitor increased the MDR1 mRNA levels in 60% of gastric cells, and in 11% of colon cancer cells. Trichostatin A (TSA, histone deacetylase inhibitor increased the MDR1 mRNA levels in 70% of gastric cancer cells and 55% of colon cancer cells. The combined treatment of 5AC with TSA increased the MDR1 mRNA levels additively in 20% of gastric cancer cells, but synergistically in 40% of gastric and 11% of colon cancer cells. Conclusion These results indicate that the MDR1 mRNA levels in gastric cancer cells are significantly

  3. Gene Expression Analysis of Plum pox virus (Sharka Susceptibility/Resistance in Apricot (Prunus armeniaca L..

    Directory of Open Access Journals (Sweden)

    Manuel Rubio

    Full Text Available RNA-Seq has proven to be a very powerful tool in the analysis of the Plum pox virus (PPV, sharka disease/Prunus interaction. This technique is an important complementary tool to other means of studying genomics. In this work an analysis of gene expression of resistance/susceptibility to PPV in apricot is performed. RNA-Seq has been applied to analyse the gene expression changes induced by PPV infection in leaves from two full-sib apricot genotypes, "Rojo Pasión" and "Z506-7", resistant and susceptible to PPV, respectively. Transcriptomic analyses revealed the existence of more than 2,000 genes related to the pathogen response and resistance to PPV in apricot. These results showed that the response to infection by the virus in the susceptible genotype is associated with an induction of genes involved in pathogen resistance such as the allene oxide synthase, S-adenosylmethionine synthetase 2 and the major MLP-like protein 423. Over-expression of the Dicer protein 2a may indicate the suppression of a gene silencing mechanism of the plant by PPV HCPro and P1 PPV proteins. On the other hand, there were 164 genes involved in resistance mechanisms that have been identified in apricot, 49 of which are located in the PPVres region (scaffold 1 positions from 8,050,804 to 8,244,925, which is responsible for PPV resistance in apricot. Among these genes in apricot there are several MATH domain-containing genes, although other genes inside (Pleiotropic drug resistance 9 gene or outside (CAP, Cysteine-rich secretory proteins, Antigen 5 and Pathogenesis-related 1 protein; and LEA, Late embryogenesis abundant protein PPVres region could also be involved in the resistance.

  4. Gene Expression Analysis of Plum pox virus (Sharka) Susceptibility/Resistance in Apricot (Prunus armeniaca L.).

    Science.gov (United States)

    Rubio, Manuel; Ballester, Ana Rosa; Olivares, Pedro Manuel; Castro de Moura, Manuel; Dicenta, Federico; Martínez-Gómez, Pedro

    2015-01-01

    RNA-Seq has proven to be a very powerful tool in the analysis of the Plum pox virus (PPV, sharka disease)/Prunus interaction. This technique is an important complementary tool to other means of studying genomics. In this work an analysis of gene expression of resistance/susceptibility to PPV in apricot is performed. RNA-Seq has been applied to analyse the gene expression changes induced by PPV infection in leaves from two full-sib apricot genotypes, "Rojo Pasión" and "Z506-7", resistant and susceptible to PPV, respectively. Transcriptomic analyses revealed the existence of more than 2,000 genes related to the pathogen response and resistance to PPV in apricot. These results showed that the response to infection by the virus in the susceptible genotype is associated with an induction of genes involved in pathogen resistance such as the allene oxide synthase, S-adenosylmethionine synthetase 2 and the major MLP-like protein 423. Over-expression of the Dicer protein 2a may indicate the suppression of a gene silencing mechanism of the plant by PPV HCPro and P1 PPV proteins. On the other hand, there were 164 genes involved in resistance mechanisms that have been identified in apricot, 49 of which are located in the PPVres region (scaffold 1 positions from 8,050,804 to 8,244,925), which is responsible for PPV resistance in apricot. Among these genes in apricot there are several MATH domain-containing genes, although other genes inside (Pleiotropic drug resistance 9 gene) or outside (CAP, Cysteine-rich secretory proteins, Antigen 5 and Pathogenesis-related 1 protein; and LEA, Late embryogenesis abundant protein) PPVres region could also be involved in the resistance.

  5. Prevalence of antimicrobial resistance and the cfiA resistance gene in Danish Bacteroides fragilis group isolates since 1973

    DEFF Research Database (Denmark)

    Ferløv-Schwensen, Simon Andreas; Sydenham, Thomas Vognbjerg; Hansen, Kia Cirkeline Møller

    2017-01-01

    Desorption/Ionization Time-Of-Flight Mass Spectrometry (MALDI-TOF MS) on the Biotyper platform. Antimicrobial resistance was determined using a disk diffusion screening method and commercial antibiotic gradient strips. Division I (cfiA-negative) and division II (cfiA-positive) B. fragilis strains were...... differentiated using MALDI-TOF MS and real-time polymerase chain reaction (PCR). RESULTS: From 1973-1980 to 2010-2015 the prevalence of antimicrobial resistance rose from 0% to 21.2%, 2.5%, and 1% for clindamycin, meropenem, and metronidazole, respectively. MALDI-TOF MS and real-time PCR identified 16 of 266 (6...... established in the recent decades in Europe. Resistance to meropenem, facilitated by expression of the cfiA resistance gene, seems to be increasing; therefore, it is imperative to monitor the occurrence of this gene, e.g. using MALDI-TOF MS....

  6. Analysis of cold resistance and identification of SSR markers linked to cold resistance genes in Brassica rapa L.

    Science.gov (United States)

    Huang, Zhen; Zhang, Xuexian; Jiang, Shouhua; Qin, Mengfan; Zhao, Na; Lang, Lina; Liu, Yaping; Tian, Zhengshu; Liu, Xia; Wang, Yang; Zhang, Binbin; Xu, Aixia

    2017-06-01

    Currently, cold temperatures are one of the main factors threatening rapeseed production worldwide; thus, it is imperative to identify cold-resistant germplasm and to cultivate cold-resistant rapeseed varieties. In this study, the cold resistance of four Brassica rapa varieties was analyzed. The cold resistance of Longyou6 and Longyou7 was better than that of Tianyou2 and Tianyou4. Thus, an F 2 population derived from Longyou6 and Tianyou4 was used to study the correlation of cold resistance and physiological indexes. Our results showed that the degree of frost damage was related to the relative conductivity and MDA content (r1 = 0.558 and r2 = 0.447, respectively). In order to identify the markers related to cold resistance, 504 pairs of SSR (simple sequence repeats) primers were used to screen the two parents and F 2 population. Four and five SSR markers had highly significant positive correlation to relative conductivity and MDA, respectively. In addition, three of these SSR markers had a highly significant positive correlation to both of these two indexes. These three SSR markers were subsequently confirmed to be used to distinguish between cold-resistant and non-cold-resistant varieties. The results of this study will lay a solid foundation for the mapping of cold-resistant genes and molecular markers assisted selection for the cold-resistance.

  7. Characterization of antimicrobial resistance genes in Haemophilus parasuis isolated from pigs in China

    Directory of Open Access Journals (Sweden)

    Yongda Zhao

    2018-04-01

    Full Text Available Background Haemophilus parasuis is a common porcine respiratory pathogen that causes high rates of morbidity and mortality in farmed swine. We performed a molecular characterization of antimicrobial resistance genes harbored by H. parasuis from pig farms in China. Methods We screened 143 H. parasuis isolates for antimicrobial susceptibility against six fluoroquinolone antibiotics testing by the broth microdilution method, and the presence of 64 antimicrobial resistance genes by PCR amplification and DNA sequence analysis. We determined quinolone resistance determining region mutations of DNA gyrase (gyrA and gyrB and topoisomerase IV (parC and parE. The genetic relatedness among the strains was analyzed by pulsed-field gel electrophoresis. Results Susceptibility test showed that all isolates were low resistance to lomefloxacin (28.67%, levofloxacin (20.28%, norfloxacin (22.38%, ciprofloxacin (23.78%, however, high resistance levels were found to nalidixic acid (82.52% and enrofloxacin (55.94%. In addition, we found 14 antimicrobial resistance genes were present in these isolates, including blaTEM-1, blaROB-1, ermB, ermA, flor, catl, tetB, tetC, rmtB, rmtD, aadA1, aac(3′-llc, sul1, and sul2 genes. Interestingly, one isolate carried five antibiotic resistance genes (tetB, tetC, flor, rmtB, sul1. The genes tetB, rmtB, and flor were the most prevalent resistance genes in H. parasuis in China. Alterations in the gyrA gene (S83F/Y, D87Y/N/H/G were detected in 81% of the strains and parC mutations were often accompanied by a gyrA mutation. Pulsed-field gel electrophoresis typing revealed 51 unique patterns in the isolates carrying high-level antibiotic resistance genes, indicating considerable genetic diversity and suggesting that the genes were spread horizontally. Discussion The current study demonstrated that the high antibiotic resistance of H. parasuis in piglets is a combination of transferable antibiotic resistance genes and multiple target

  8. Characterization of antimicrobial resistance genes in Haemophilus parasuis isolated from pigs in China.

    Science.gov (United States)

    Zhao, Yongda; Guo, Lili; Li, Jie; Huang, Xianhui; Fang, Binghu

    2018-01-01

    Haemophilus parasuis is a common porcine respiratory pathogen that causes high rates of morbidity and mortality in farmed swine. We performed a molecular characterization of antimicrobial resistance genes harbored by H. parasuis from pig farms in China. We screened 143 H. parasuis isolates for antimicrobial susceptibility against six fluoroquinolone antibiotics testing by the broth microdilution method, and the presence of 64 antimicrobial resistance genes by PCR amplification and DNA sequence analysis. We determined quinolone resistance determining region mutations of DNA gyrase ( gyrA and gyrB ) and topoisomerase IV ( parC and parE ). The genetic relatedness among the strains was analyzed by pulsed-field gel electrophoresis. Susceptibility test showed that all isolates were low resistance to lomefloxacin (28.67%), levofloxacin (20.28%), norfloxacin (22.38%), ciprofloxacin (23.78%), however, high resistance levels were found to nalidixic acid (82.52%) and enrofloxacin (55.94%). In addition, we found 14 antimicrobial resistance genes were present in these isolates, including bla TEM-1 , bla ROB-1 , ermB, ermA, flor, catl, tetB, tetC, rmtB, rmtD, aadA1, aac(3')-llc, sul1, and sul2 genes. Interestingly, one isolate carried five antibiotic resistance genes ( tetB, tetC, flor, rmtB, sul1 ). The genes tetB , rmtB, and flor were the most prevalent resistance genes in H. parasuis in China. Alterations in the gyrA gene (S83F/Y, D87Y/N/H/G) were detected in 81% of the strains and parC mutations were often accompanied by a gyrA mutation. Pulsed-field gel electrophoresis typing revealed 51 unique patterns in the isolates carrying high-level antibiotic resistance genes, indicating considerable genetic diversity and suggesting that the genes were spread horizontally. The current study demonstrated that the high antibiotic resistance of H. parasuis in piglets is a combination of transferable antibiotic resistance genes and multiple target gene mutations. These data provide novel

  9. Identification and characterization of antibiotic resistance genes in Lactobacillus reuteri and Lactobacillus plantarum.

    Science.gov (United States)

    Egervärn, M; Roos, S; Lindmark, H

    2009-11-01

    The study aimed to identify the resistance genes mediating atypical minimum inhibitory concentrations (MICs) for tetracycline, erythromycin, clindamycin and chloramphenicol within two sets of representative strains of the species Lactobacillus reuteri and Lactobacillus plantarum and to characterize identified genes by means of gene location and sequencing of flanking regions. A tet(W) gene was found in 24 of the 28 Lact. reuteri strains with atypical MIC for tetracycline, whereas four of the six strains with atypical MIC for erythromycin were positive for erm(B) and one strain each was positive for erm(C) and erm(T). The two Lact. plantarum strains with atypical MIC for tetracycline harboured a plasmid-encoded tet(M) gene. The majority of the tet(W)-positive Lact. reuteri strains and all erm-positive Lact. reuteri strains carried the genes on plasmids, as determined by Southern blot and a real-time PCR method developed in this study. Most of the antibiotic-resistant strains of Lact. reuteri and Lact. plantarum harboured known plasmid-encoded resistance genes. Examples of putative transfer machineries adjacent to both plasmid- and chromosome-located resistance genes were also demonstrated. These data provide some of the knowledge required for assessing the possible risk of using Lact. reuteri and Lact. plantarum strains carrying antibiotic resistance genes as starter cultures and probiotics.

  10. PCR-based detection of resistance genes in anaerobic bacteria isolated from intra-abdominal infections.

    Science.gov (United States)

    Tran, Chau Minh; Tanaka, Kaori; Watanabe, Kunitomo

    2013-04-01

    Little information is available on the distribution of antimicrobial resistance genes in anaerobes in Japan. To understand the background of antimicrobial resistance in anaerobes involved in intra-abdominal infections, we investigated the distribution of eight antimicrobial resistance genes (cepA, cfiA, cfxA, ermF, ermB, mefA, tetQ, and nim) and a mutation in the gyrA gene in a total of 152 organisms (Bacteroides spp., Prevotella spp., Fusobacterium spp., Porphyromonas spp., Bilophila wadsworthia, Desulfovibrio desulfuricans, Veillonella spp., gram-positive cocci, and non-spore-forming gram-positive bacilli) isolated between 2003 and 2004 in Japan. The cepA gene was distributed primarily in Bacteroides fragilis. Gene cfxA was detected in about 9 % of the Bacteroides isolates and 75 % of the Prevotella spp. isolates and did not appear to contribute to cephamycin resistance. Two strains of B. fragilis contained the metallo-β-lactamase gene cfiA, but they did not produce the protein product. Gene tetQ was detected in about 81, 44, and 63 % of B. fragilis isolates, other Bacteroides spp., and Prevotella spp. isolates, respectively. The ermF gene was detected in 25, 13, 56, 64, and 16 % of Bacteroides spp., Prevotella spp., Fusobacterium spp., B. wadsworthia, and anaerobic cocci, respectively. Gene mefA was found in only 10 % of the B. fragilis strains and 3 % of the non-B. fragilis strains. Genes nim and ermB were not detected in any isolate. Substitution at position 82 (Ser to Phe) in gyrA was detected in B. fragilis isolates that were less susceptible or resistant to moxifloxacin. This study is the first report on the distribution of resistance genes in anaerobes isolated from intra-abdominal infections in Japan. We expect that the results might help in understanding the resistance mechanisms of specific anaerobes.

  11. Microbiological characterization of aquatic microbiomes targeting taxonomical marker genes and antibiotic resistance genes of opportunistic bacteria.

    Science.gov (United States)

    Alexander, Johannes; Bollmann, Anna; Seitz, Wolfram; Schwartz, Thomas

    2015-04-15

    The dissemination of medically relevant antibiotic resistance genes (ARGs) (blaVIM-1, vanA, ampC, ermB, and mecA) and opportunistic bacteria (Enterococcus faecium/faecalis, Pseudomonas aeruginosa, Enterobacteriaceae, Staphylococcus aureus, and CNS) was determined in different anthropogenically influenced aquatic habitats in a selected region of Germany. Over a period of two years, four differently sized wastewater treatment plants (WWTPs) with and without clinical influence, three surface waters, four rain overflow basins, and three groundwater sites were analyzed by quantitative Polymerase Chain Reaction (qPCR). Results were calculated in cell equivalents per 100 ng of total DNA extracted from water samples and per 100 mL sample volume, which seems to underestimate the abundance of antibiotic resistance and opportunistic bacteria. High abundances of opportunistic bacteria and ARG were quantified in clinical wastewaters and influents of the adjacent WWTP. The removal capacities of WWTP were up to 99% for some, but not all investigated bacteria. The abundances of most ARG targets were found to be increased in the bacterial population after conventional wastewater treatment. As a consequence, downstream surface water and also some groundwater compartments displayed high abundances of all four ARGs. It became obvious that the dynamics of the ARG differed from the fate of the opportunistic bacteria. This underlines the necessity of an advanced microbial characterization of anthropogenically influenced environments. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. Molecular characterization of mutations associated with resistance to second-line tuberculosis drug among multidrug-resistant tuberculosis patients from high prevalence tuberculosis city in Morocco.

    Science.gov (United States)

    Oudghiri, Amal; Karimi, Hind; Chetioui, Fouad; Zakham, Fathiah; Bourkadi, Jamal Eddine; Elmessaoudi, My Driss; Laglaoui, Amin; Chaoui, Imane; El Mzibri, Mohammed

    2018-02-27

    The emergence of extensively drug-resistant tuberculosis (XDR-TB) has raised public health concern for global TB control. Although multi drug-resistant tuberculosis (MDR- TB) prevalence and associated genetic mutations in Morocco are well documented, scarce information on XDR TB is available. Hence, the evaluation of pre-XDR and XDR prevalence, as well as the mutation status of gyrA, gyrB, rrs, tlyA genes and eis promoter region, associated with resistance to second line drugs, is of great value for better management of M/XDR TB in Morocco. To evaluate pre-XDR and XDR prevalence, as well as the mutation status of gyrA, gyrB, rrs, tlyA genes and eis promoter region, associated with resistance to second line drug resistance, in 703 clinical isolates from TB patients recruited in Casablanca, and to assess the usefulness of molecular tools in clinical laboratories for better management of M/XDR TB in Morocco. Drug susceptibility testing (DST) was performed by the proportional method for first line drugs, and then the selected MDR isolates were tested for second line drugs (Ofloxacin, Kanamycin, Amikacin and Capreomycin). Along with DST, all samples were subjected to rpoB, katG and p-inhA mutation analysis by PCR and DNA sequencing. MDR isolates as well as 30 pan-susceptible strains were subjected to PCR and DNA sequencing of gyrA, gyrB, rrs, tlyA genes and eis promoter, associated with resistance to fluoroquinolones and injectable drugs. Among the 703 analysed strains, 12.8% were MDR; Ser531Leu and Ser315Thr being the most common recorded mutations within rpoB and katG genes associated with RIF and INH resistance respectively. Drug susceptibility testing for second line drugs showed that among the 90 MDR strains, 22.2% (20/90) were resistant to OFX, 2.22% (2/90) to KAN, 3.33% (3/90) to AMK and 1.11% (1/90) to CAP. Genotypic analysis revealed that 19 MDR strains harbored mutations in the gyrA gene; the most recorded mutation being Asp91Ala accounting for 47.6% (10

  13. Emergence of a Clonal Lineage of Multidrug-Resistant ESBL-Producing Salmonella Infantis Transmitted from Broilers and Broiler Meat to Humans in Italy between 2011 and 2014

    DEFF Research Database (Denmark)

    Franco, Alessia; Leekitcharoenphon, Pimlapas; Feltrin, Fabiola

    2015-01-01

    We report the spread of a clone of multidrug-resistant (MDR), ESBL-producing (blaCTX-M-1) Salmonella enterica subsp. enterica serovar Infantis, in the Italian broiler chicken industry and along the food-chain. This was first detected in Italy in 2011 and led to human infection in Italy in 2013....... This megaplasmid carried the ESBL gene blaCTX-M-1, and additional genes [tet(A), sul1, dfrA1 and dfrA14] mediating cefotaxime, tetracycline, sulfonamide, and trimethoprim resistance. It also contained genes conferring enhanced colonization capability, virulence (fimbriae, yersiniabactin), resistance and fitness...

  14. A bacterial antibiotic-resistance gene that complements the human multidrug-resistance P-glycoprotein gene

    NARCIS (Netherlands)

    van Veen, HW; Callaghan, R; Soceneantu, L; Sardini, A; Konings, WN; Higgins, CF

    1998-01-01

    Bacteria have developed many fascinating antibiotic-resistance mechanisms(1,2). A protein in Lactococcus lactis, LmrA, mediates antibiotic resistance by extruding amphiphilic compounds from the inner leaflet of the cytoplasmic membrane(3,4). Unlike other known bacterial multidrug-resistance

  15. Dissecting the organ specificity of insecticide resistance candidate genes in Anopheles gambiae: known and novel candidate genes.

    Science.gov (United States)

    Ingham, Victoria A; Jones, Christopher M; Pignatelli, Patricia; Balabanidou, Vasileia; Vontas, John; Wagstaff, Simon C; Moore, Jonathan D; Ranson, Hilary

    2014-11-25

    The elevated expression of enzymes with insecticide metabolism activity can lead to high levels of insecticide resistance in the malaria vector, Anopheles gambiae. In this study, adult female mosquitoes from an insecticide susceptible and resistant strain were dissected into four different body parts. RNA from each of these samples was used in microarray analysis to determine the enrichment patterns of the key detoxification gene families within the mosquito and to identify additional candidate insecticide resistance genes that may have been overlooked in previous experiments on whole organisms. A general enrichment in the transcription of genes from the four major detoxification gene families (carboxylesterases, glutathione transferases, UDP glucornyltransferases and cytochrome P450s) was observed in the midgut and malpighian tubules. Yet the subset of P450 genes that have previously been implicated in insecticide resistance in An gambiae, show a surprisingly varied profile of tissue enrichment, confirmed by qPCR and, for three candidates, by immunostaining. A stringent selection process was used to define a list of 105 genes that are significantly (p ≤0.001) over expressed in body parts from the resistant versus susceptible strain. Over half of these, including all the cytochrome P450s on this list, were identified in previous whole organism comparisons between the strains, but several new candidates were detected, notably from comparisons of the transcriptomes from dissected abdomen integuments. The use of RNA extracted from the whole organism to identify candidate insecticide resistance genes has a risk of missing candidates if key genes responsible for the phenotype have restricted expression within the body and/or are over expression only in certain tissues. However, as transcription of genes implicated in metabolic resistance to insecticides is not enriched in any one single organ, comparison of the transcriptome of individual dissected body parts cannot

  16. Characterization and cloning of TMV resistance gene N homologues ...

    African Journals Online (AJOL)

    Tobacco cultivars Nicotiana tabacum cv. Samsun NN plants carrying the N gene contain a multitude of N-related genes. We cloned a few N homologues and isolated two full-length cDNAs of NL-C26 and NL-B69 genes from N. tabacum cv. Samsun NN. Nucleotide sequence analysis showed that the coding regions of ...

  17. Sequence Exchange between Homologous NB-LRR Genes Converts Virus Resistance into Nematode Resistance, and Vice Versa.

    Science.gov (United States)

    Slootweg, Erik; Koropacka, Kamila; Roosien, Jan; Dees, Robert; Overmars, Hein; Lankhorst, Rene Klein; van Schaik, Casper; Pomp, Rikus; Bouwman, Liesbeth; Helder, Johannes; Schots, Arjen; Bakker, Jaap; Smant, Geert; Goverse, Aska

    2017-09-01

    Plants have evolved a limited repertoire of NB-LRR disease resistance ( R ) genes to protect themselves against myriad pathogens. This limitation is thought to be counterbalanced by the rapid evolution of NB-LRR proteins, as only a few sequence changes have been shown to be sufficient to alter resistance specificities toward novel strains of a pathogen. However, little is known about the flexibility of NB-LRR R genes to switch resistance specificities between phylogenetically unrelated pathogens. To investigate this, we created domain swaps between the close homologs Gpa2 and Rx1 , which confer resistance in potato ( Solanum tuberosum ) to the cyst nematode Globodera pallida and Potato virus X , respectively. The genetic fusion of the CC-NB-ARC of Gpa2 with the LRR of Rx1 (Gpa2 CN /Rx1 L ) results in autoactivity, but lowering the protein levels restored its specific activation response, including extreme resistance to Potato virus X in potato shoots. The reciprocal chimera (Rx1 CN /Gpa2 L ) shows a loss-of-function phenotype, but exchange of the first three LRRs of Gpa2 by the corresponding region of Rx1 was sufficient to regain a wild-type resistance response to G. pallida in the roots. These data demonstrate that exchanging the recognition moiety in the LRR is sufficient to convert extreme virus resistance in the leaves into mild nematode resistance in the roots, and vice versa. In addition, we show that the CC-NB-ARC can operate independently of the recognition specificities defined by the LRR domain, either aboveground or belowground. These data show the versatility of NB-LRR genes to generate resistance to unrelated pathogens with completely different lifestyles and routes of invasion. © 2017 American Society of Plant Biologists. All Rights Reserved.

  18. Identification and mapping of two powdery mildew resistance genes in Triticum boeoticum L.

    Science.gov (United States)

    Chhuneja, Parveen; Kumar, Krishan; Stirnweis, Daniel; Hurni, Severine; Keller, Beat; Dhaliwal, Harcharan S; Singh, Kuldeep

    2012-04-01

    Powdery mildew (PM) caused by Blumeria graminis f. sp. tritici (Bgt), is one of the important foliar diseases of wheat that can cause serious yield losses. Breeding for cultivars with diverse resources of resistance is the most promising approach for combating this disease. The diploid A genome progenitor species of wheat are an important resource for new variability for disease resistance genes. An accession of Triticum boeoticum (A(b)A(b)) showed resistance against a number of Bgt isolates, when tested using detached leaf segments. Inheritance studies in a recombinant inbred line population (RIL), developed from crosses of PM resistant T. boeoticum acc. pau5088 with a PM susceptible T. monococcum acc. pau14087, indicated the presence of two powdery mildew resistance genes in T. boeoticum acc. pau5088. Analysis of powdery mildew infection and molecular marker data of the RIL population revealed that both powdery mildew resistance genes are located on the long arm of chromosome 7A. Mapping was conducted using an integrated linkage map of 7A consisting of SSR, RFLP, STS, and DArT markers. These powdery mildew resistance genes are tentatively designated as PmTb7A.1 and PmTb7A.2. The PmTb7A.2 is closely linked to STS markers MAG2185 and MAG1759 derived from RFLP probes which are linked to powdery mildew resistance gene Pm1. This indicated that PmTb7A.2 might be allelic to Pm1. The PmTb7A.1, flanked by a DArT marker wPt4553 and an SSR marker Xcfa2019 in a 4.3 cM interval, maps proximal to PmT7A.2. PmTb7A.1 is putatively a new powdery mildew resistance gene. The powdery mildew resistance genes from T. boeoticum are currently being transferred to cultivated wheat background through marker-assisted backcrossing, using T. durum as bridging species.

  19. Candidate genes revealed by a genome scan for mosquito resistance to a bacterial insecticide: sequence and gene expression variations

    Directory of Open Access Journals (Sweden)

    David Jean-Philippe