Genome sequencing and annotation of multidrug resistant Mycobacterium tuberculosis (MDR-TB PR10 strain

Directory of Open Access Journals (Sweden)

Mohd Zakihalani A. Halim

2016-03-01

Full Text Available Here, we report the draft genome sequence and annotation of a multidrug resistant Mycobacterium tuberculosis strain PR10 (MDR-TB PR10 isolated from a patient diagnosed with tuberculosis. The size of the draft genome MDR-TB PR10 is 4.34 Mbp with 65.6% of G + C content and consists of 4637 predicted genes. The determinants were categorized by RAST into 400 subsystems with 4286 coding sequences and 50 RNAs. The whole genome shotgun project has been deposited at DDBJ/EMBL/GenBank under the accession number CP010968. Keywords: Mycobacterium tuberculosis, Genome, MDR, Extrapulmonary

Molecular approaches for detection of the multi-drug resistant tuberculosis (MDR-TB in Bangladesh.

Directory of Open Access Journals (Sweden)

Tafsina Haque Aurin

Full Text Available The principal obstacles in the treatment of tuberculosis (TB are delayed and inaccurate diagnosis which often leads to the onset of the drug resistant TB cases. To avail the appropriate treatment of the patients and to hinder the transmission of drug-resistant TB, accurate and rapid detection of resistant isolates is critical. Present study was designed to demonstrate the efficacy of molecular techniques inclusive of line probe assay (LPA and GeneXpert MTB/RIF methods for the detection of multi-drug resistant (MDR TB. Sputum samples from 300 different categories of treated and new TB cases were tested for the detection of possible mutation in the resistance specific genes (rpoB, inhA and katG through Genotype MTBDRplus assay or LPA and GeneXpert MTB/RIF tests. Culture based conventional drug susceptibility test (DST was also carried out to measure the efficacy of the molecular methods employed. Among 300 samples, 191 (63.7% and 193 (64.3% cases were found to be resistant against rifampicin in LPA and GeneXpert methods, respectively; while 189 (63% cases of rifampicin resistance were detected by conventional DST methods. On the other hand, 196 (65.3% and 191 (63.7% isolates showed isoniazid resistance as detected by LPA and conventional drug susceptibility test (DST, respectively. Among the drug resistant isolates (collectively 198 in LPA and 193 in conventional DST, 189 (95.6% and 187 (96.9% were considered to be MDR as examined by LPA and conventional DST, respectively. Category-II and -IV patients encountered higher frequency of drug resistance compared to those from category-I and new cases. Considering the higher sensitivity, specificity and accuracy along with the required time to results significantly shorter, our study supports the adoption of LPA and GeneXpert assay as efficient tools in detecting drug resistant TB in Bangladesh.

Treatment Outcomes of Patients with Multidrug-Resistant Tuberculosis (MDR- TB) Compared with Non-MDR-TB Infections in Peninsular Malaysia.

Science.gov (United States)

Elmi, Omar Salad; Hasan, Habsah; Abdullah, Sarimah; Mat Jeab, Mat Zuki; Ba, Zilfalil; Naing, Nyi Nyi

2016-07-01

Treating patients with multidrug-resistant tuberculosis (MDR-TB) strains is more complicated, complex, toxic, expensive, than treating patients with susceptible TB strains. This study aims to compare the treatment outcomes and potential factors associated between patients with MDR-TB and non MDR TB infections in peninsular Malaysia. This study was a retrospective cohort study. Data were collected from the medical records of all registered MDR-TB patients and Non-MDR-TB patients at five TB hospitals in peninsular Malaysia from January 2010 to January 2014. A total of 314 subjects were studied, including 105 MDR-TB cases and 209 non-MDR-TB. After TB treatment, 24.8% of the MDR-TB patients and 17.7% of non MDR TB relapsed; 17.1% of the MDR-TB patients and 16.3% of non MDR TB defaulted from TB treatment. A significant difference seen in treatment success rate 17.1% for MDR-TB; 63.1% for non MDR TB (P history of TB treatment, and presence of HIV infection.

Expression of the MDR1 gene and P-glycoprotein in canine mast cell tumor cell lines

OpenAIRE

NAKAICHI, Munekazu; TAKESHITA, Yoko; OKUDA, Masaru; NAKAMOTO, Yuya; ITAMOTO, Kazuhito; UNE, Satoshi; SASAKI, Nobuo; KADOSAWA, Tsuyoshi; TAKAHASHI, Tomoko; TAURA, Yasuho

2007-01-01

Cellular drug resistance to antineoplastic drugs is often due to the presence of a drug efflux pump that reduces intracellular drug accumulation and chemosensitivity. P-glycoprotein (P-gp), which is encoded by the MDR1 gene, is considered to function as an ATP-driven membrane drug efflux pump and appears to play an important role in tumor cell resistance. In the present report, we assessed the expression of MDR1 by RT-PCR in three canine mast cell tumor cell lines, TiMC, CoMS and LuMC, origin...

Multi drug resistance to cancer chemotherapy: Genes involved and blockers

International Nuclear Information System (INIS)

Sayed-Ahmed, Mohamed M.

2007-01-01

During the last three decades, important and considerable research efforts had been performed to investigate the mechanism through which cancer cells overcome the cytotoxic effects of a variety of chemotherapeutic drugs. Most of the previously published work has been focused on the resistance of tumor cells to those anticancer drugs of natural source. Multidrug resistance (MDR) is a cellular cross-resistance to a broad spectrum of natural products used in cancer chemotherapy and is believed to be the major cause of the therapeutic failures of the drugs belonging to different naturally obtained or semisynthetic groups including vinca alkaloids, taxans, epipodophyllotoxins and certain antibiotics. This phenomenon results from overexpression of four MDR genes and their corresponding proteins that act as membrane-bound ATP consuming pumps. These proteins mediate the efflux of many structurally and functionally unrelated anticancer drugs of natural source. MDR may be intrinsic or acquired following exposure to chemotherapy. The existence of intrinsically resistant tumor cell clone before and following chemotherapeutic treatment has been associated with a worse final outcome because of increased incidence of distant metasis. In view of irreplaceability of natural product anticancer drugs as effective chemotherapeutic agents, and in view of MDR as a major obstacle to successful chemotherapy, this review is aimed to highlight the genes involved in MDR, classical MDR blockers and gene therapy approaches to overcome MDR. (author)

Prognostic significance of multidrug-resistance protein (MDR-1 in renal clear cell carcinomas: A five year follow-up analysis

Directory of Open Access Journals (Sweden)

Strazzullo Viviana

2006-12-01

Full Text Available Abstract Background A large number of renal cancer patients shows poor or partial response to chemotherapy and the mechanisms have not been still understood. Multi-drug resistance is the principal mechanism by which many cancers develop resistance to chemotherapic drugs. The role of the multi-drug resistant transporter (MDR-1/P-glycoprotein, the gene product of MDR-1, and that one of the so-called multi-drug resistance associated protein (MRP, two energy-dependent efflux pumps, are commonly known to confer drug resistance. We studied MDR-1 expression in selected cases of renal cell carcinoma (RCC, clear cell type, with long-term follow-up, in order to establish its prognostic role and its possible contribution in the choice of post-surgical therapy. Methods MDR-1 has been studied by standard LSAB-HRP immunohistochemical technique, in paraffin embedded RCC samples. Protein expression has been compared to clinical and histopathological data and to disease specific survival of RCC patients, by Kaplan-Meier curve and Cox multivariate regression analyses. Results Two groups of RCCs were obtained by esteeming MDR-1 expression and disease specific survival (obtained with Kaplan-Meier curve and Cox multivariate regression analyses: the first one presents low or absent MDR-1 expression and good survival; the second one is characterized by high MDR-1 expression and significant poor outcome (p p p p Conclusion In our opinion, the results of this study well prove the relationship between MDR-1 expression and worse clinical prognosis in RCC, because MDR-1 over-expressing RCCs can be considered a group of tumours with a more aggressive behavior. This finding outlines a possible role of MDR-1 as prognostic factor, dependent and independent of multidrug resistance. These results could be useful to predict cancer evolution and to choose the appropriate treatment: this is another step that can stimulate further promising and interesting investigations on broader

Expression of multidrug resistance genes MVP, MDR1, and MRP1 determined sequentially before, during, and after hyperthermic isolated limb perfusion of soft tissue sarcoma and melanoma patients.

Science.gov (United States)

Stein, Ulrike; Jürchott, Karsten; Schläfke, Matthias; Hohenberger, Peter

2002-08-01

Isolated, hyperthermic limb perfusion (ILP) with recombinant human tumor necrosis factor alpha and melphalan is a highly effective treatment for advanced soft tissue sarcoma (STS) and locoregional metastatic malignant melanoma. Multidrug resistance (MDR)-associated genes are known to be inducible by heat and drugs; expression levels of the major vault protein (MVP), MDR1, and MDR-associated protein 1 (MRP1) were determined sequentially before, during, and after ILP of patients. Twenty-one STS or malignant melanoma patients were treated by ILP. Tumor tissue temperatures were recorded continuously and ranged from 33.4 degrees C initially to peak values of 40.4 degrees C during ILP. Serial true-cut biopsy specimens from tumor tissues were routinely microdissected. Expression analyses for MDR genes were performed by real-time reverse transcriptase polymerase chain reaction and immunohistochemistry. In 83% of the patients, MVP expression was induced during hyperthermic ILP. MVP-mRNA inductions often paralleled the increase in temperature during ILP. Increased MVP protein expressions either were observed simultaneously with the MVP-mRNA induction or were delayed until after the induction at the transcriptional level. Inductions of MDR1 and MRP1 were observed in only 13% and 27% of the specimens analyzed. Temperatures and drugs applied preferentially led to an induction of MVP and were not sufficient to induce MDR1 and MRP1 in the majority of tumors. This study is the first to analyze the expression of MDR-associated genes sequentially during ILP of patients and demonstrates that treatment might lead to increased levels of MVP, whereas enhanced levels of MDR1 and MRP1 remain rare events.

Significance of MDR1 and multiple drug resistance in refractory human epileptic brain

Directory of Open Access Journals (Sweden)

Dini Gabriele

2004-10-01

Full Text Available Abstract Background The multiple drug resistance protein (MDR1/P-glycoprotein is overexpressed in glia and blood-brain barrier (BBB endothelium in drug refractory human epileptic tissue. Since various antiepileptic drugs (AEDs can act as substrates for MDR1, the enhanced expression/function of this protein may increase their active extrusion from the brain, resulting in decreased responsiveness to AEDs. Methods Human drug resistant epileptic brain tissues were collected after surgical resection. Astrocyte cell cultures were established from these tissues, and commercially available normal human astrocytes were used as controls. Uptake of fluorescent doxorubicin and radioactive-labeled Phenytoin was measured in the two cell populations, and the effect of MDR1 blockers was evaluated. Frozen human epileptic brain tissue slices were double immunostained to locate MDR1 in neurons and glia. Other slices were exposed to toxic concentrations of Phenytoin to study cell viability in the presence or absence of a specific MDR1 blocker. Results MDR1 was overexpressed in blood vessels, astrocytes and neurons in human epileptic drug-resistant brain. In addition, MDR1-mediated cellular drug extrusion was increased in human 'epileptic' astrocytes compared to 'normal' ones. Concomitantly, cell viability in the presence of cytotoxic compounds was increased. Conclusions Overexpression of MDR1 in different cell types in drug-resistant epileptic human brain leads to functional alterations, not all of which are linked to drug pharmacokinetics. In particular, the modulation of glioneuronal MDR1 function in epileptic brain in the presence of toxic concentrations of xenobiotics may constitute a novel cytoprotective mechanism.

Normal viability and altered pharmacokinetics in mice lacking mdr1-type (drug-transporting) P-glycoproteins

NARCIS (Netherlands)

Schinkel, A. H.; Mayer, U.; Wagenaar, E.; Mol, C. A.; van Deemter, L.; Smit, J. J.; van der Valk, M. A.; Voordouw, A. C.; Spits, H.; van Tellingen, O.; Zijlmans, J. M.; Fibbe, W. E.; Borst, P.

1997-01-01

The mdr1-type P-glycoproteins (P-gps) confer multidrug resistance to cancer cells by active extrusion of a wide range of drugs from the cell. To study their physiological roles, we have generated mice genetically deficient in the mdr1b gene [mdr1b (-/-) mice] and in both the mdr1a and mdr1b genes

Splice form variant and amino acid changes in MDR49 confers DDT resistance in transgenic Drosophila.

Science.gov (United States)

Seong, Keon Mook; Sun, Weilin; Clark, John M; Pittendrigh, Barry R

2016-03-22

The ATP-binding cassette (ABC) transporters represent a superfamily of proteins that have important physiological roles in both prokaryotes and eukaryotes. In insects, ABC transporters have previously been implicated in insecticide resistance. The 91-R strain of Drosophila melanogaster has been intensely selected with DDT over six decades. A recent selective sweeps analysis of 91-R implicated the potential role of MDR49, an ABC transporter, in DDT resistance, however, to date the details of how MDR49 may play a role in resistance have not been elucidated. In this study, we investigated the impact of structural changes and an alternative splicing event in MDR49 on DDT-resistance in 91-R, as compared to the DDT susceptible strain 91-C. We observed three amino acid differences in MDR49 when 91-R was compared with 91-C, and only one isoform (MDR49B) was implicated in DDT resistance. A transgenic Drosophila strain containing the 91-R-MDR49B isoform had a significantly higher LD50 value as compared to the 91-C-MDR49B isoform at the early time points (6 h to 12 h) during DDT exposure. Our data support the hypothesis that the MDR49B isoform, with three amino acid mutations, plays a role in the early aspects of DDT resistance in 91-R.

Comparative evaluation of GenoType MTBDRplus line probe assay with solid culture method in early diagnosis of multidrug resistant tuberculosis (MDR-TB at a tertiary care centre in India.

Directory of Open Access Journals (Sweden)

Raj N Yadav

Full Text Available The objectives of the study were to compare the performance of line probe assay (GenoType MTBDRplus with solid culture method for an early diagnosis of multidrug resistant tuberculosis (MDR-TB, and to study the mutation patterns associated with rpoB, katG and inhA genes at a tertiary care centre in north India.In this cross-sectional study, 269 previously treated sputum-smear acid-fast bacilli (AFB positive MDR-TB suspects were enrolled from January to September 2012 at the All India Institute of Medical Sciences hospital, New Delhi. Line probe assay (LPA was performed directly on the sputum specimens and the results were compared with that of conventional drug susceptibility testing (DST on solid media [Lowenstein Jensen (LJ method].DST results by LPA and LJ methods were compared in 242 MDR-TB suspects. The LPA detected rifampicin (RIF resistance in 70 of 71 cases, isoniazid (INH resistance in 86 of 93 cases, and MDR-TB in 66 of 68 cases as compared to the conventional method. Overall (rifampicin, isoniazid and MDR-TB concordance of the LPA with the conventional DST was 96%. Sensitivity and specificity were 98% and 99% respectively for detection of RIF resistance; 92% and 99% respectively for detection of INH resistance; 97% and 100% respectively for detection of MDR-TB. Frequencies of katG gene, inhA gene and combined katG and inhA gene mutations conferring all INH resistance were 72/87 (83%, 10/87 (11% and 5/87 (6% respectively. The turnaround time of the LPA test was 48 hours.The LPA test provides an early diagnosis of monoresistance to isoniazid and rifampicin and is highly sensitive and specific for an early diagnosis of MDR-TB. Based on these findings, it is concluded that the LPA test can be useful in early diagnosis of drug resistant TB in high TB burden countries.

JNK1/2 Activation by an Extract from the Roots of Morus alba L. Reduces the Viability of Multidrug-Resistant MCF-7/Dox Cells by Inhibiting YB-1-Dependent MDR1 Expression

Directory of Open Access Journals (Sweden)

Youn Kyung Choi

2013-01-01

Full Text Available Cancer cells acquire anticancer drug resistance during chemotherapy, which aggravates cancer disease. MDR1 encoded from multidrug resistance gene 1 mainly causes multidrug resistance phenotypes of different cancer cells. In this study, we demonstrate that JNK1/2 activation by an extract from the root of Morus alba L. (White mulberry reduces doxorubicin-resistant MCF-7/Dox cell viability by inhibiting YB-1 regulation of MDR1 gene expression. When MCF-7 or MCF-7/Dox cells, where MDR1 is highly expressed were treated with an extract from roots or leaves of Morus alba L., respectively, the root extract from the mulberry (REM but not the leaf extract (LEM reduced cell viabilities of both MCF-7 and MCF-7/Dox cells, which was enhanced by cotreatment with doxorubicin. REM but not LEM further inhibited YB-1 nuclear translocation and its regulation of MDR1 gene expression. Moreover, REM promoted phosphorylation of c-Jun NH2-terminal kinase 1/2 (JNK1/2 and JNK1/2 inhibitor, SP600125 and rescued REM inhibition of both MDR1 expression and viabilities in MCF-7/Dox cells. Consistently, overexpression of JNK1, c-Jun, or c-Fos inhibited YB-1-dependent MDR1 expression and reduced viabilities in MCF-7/Dox cells. In conclusion, our data indicate that REM-activated JNK-cJun/c-Fos pathway decreases the viability of MCF-7/Dox cells by inhibiting YB-1-dependent MDR1 gene expression. Thus, we suggest that REM may be useful for treating multidrug-resistant cancer cells.

Association between MDR1 gene polymorphisms and the risk of Crohn's disease in a cohort of Algerian pediatric patients.

Science.gov (United States)

Bouzidi, Amira; Mesbah-Amroun, Hamida; Boukercha, Aziza; Benhassine, Fadila; Belboueb, Réda; Berkouk, Karima; Messadi, Wassila; Touil-Boukoffa, Chafia

2016-12-01

The multi-drug resistance gene (MDR1) has raised increasing interest as a susceptibility gene for Crohn's disease (CD). The role of MDR1 single-nucleotide polymorphisms (SNPs) in the predisposition and behavior of CD in the pediatric population is still elusive. Here, we investigated whether SNPs in MDR1 are associated with CD in Algerian pediatric patients. A case-control study was conducted enrolling 47 pediatric CD patients and 100 controls. All subjects were genotyped for the most common MDR1 SNPs (C3434T, C1236T, and G2677A/T) using PCR-RFLP method. We also explored the association between polymorphisms and clinical sub-phenotypes. We have detected no significant association of C3435T SNP and pediatric CD. However, we observed a significantly higher frequency of the risk alleles, 1236T and 2677T/A among the CD patients compared to controls. Moreover, the risk allele 1236T was associated to a higher risk for resective surgery. Our data suggest that the C1236T and G2677A/T SNPs in the MDR1 gene are associated with CD and the C1236T risk allele with a more severe course of disease in Algerian pediatric patients. Further analysis using larger patients group and functional studies would be interesting to elucidate the role of MDR1 gene in pediatric CD.Pediatric Research (2016); doi:10.1038/pr.2016.163.

Expression of multidrug resistance gene and P-glycoprotein in nasopharyngealcarcinoma cells after irradiation

International Nuclear Information System (INIS)

Wang Ruoyu; Wang Hui; Fan Kai; Lv Shen

2007-01-01

Objective: To mimick a clinical fractionated protocol of exposure to X-radiation in vitro in order to investigate the changes in the function of MDR1 and P-gp in nasopharyngeal carcinoma (NPC) CNE cell before and after irradiation to determine the sequential order of radiotherapy and chemotherapy or the time of chemotherapy after radiotherapy in the treatment of NPC. Methods: Exponentially growing CNE cells were treated with fractionated X-radiation with total dose of 10 Gy (2 Gy per day for 5 days consecutively) in vitro. The expression of MDR1 gene was examined in CNE cells before irradiation and on days 4,8,13,17 and 21 after irradiation by RT-PCR, and its protein P-gp were detected by immunocytochemistry. The function of multidrug resistance protein P-gp was examined by MTT method. Results: Expression of MDR1 gene was below the level of detection before irradiation. Irradiation induced an overexpression of MDR1 gene on day 4, expression of MDR1 was decreased from day 8 to day 21. The overall expression of MDR1 was significantly more than that before irradiation (P<0.05) Expression of P-gp was below the level of detection before irradiation, which demonstrated that irradiation induced an overexpression of P-gp. This overexpression was increased from day 8 to day 21. The overpression of MDR1 gene was maintained dining a short period, however, the emergence of overpression of protein P-gp was later than that of MDR1 gene. Resistance index was 1 for both pre-irradiation and on day 8, and up to 8,10,11.2 on days 13, 17 and 21, respectively. The change of resistance index was accordant with the condition of overexpression of P-gp . Conclusions: Expression of P-gp in nasopharyngeal carcinoma (NPC) CNE cell was below the level of detection before irradiation. Irradiation can induce an overexpression of MDR1 gene and its protein P-gp in CNE cells. The overexpression of MDR1 gene and its protein P-gp lasted a long term. (authors)

Analysis of mdr1-1Δ mutation of MDR1 gene in the “Cimarron Uruguayo” dog

Directory of Open Access Journals (Sweden)

Rosa Gagliardi B.

2013-08-01

Full Text Available Objective. The aim of this paper is to analyze the frequency of the mdr1-1D mutation of the MDR1 gene in a dog sample of the Uruguayan Cimarron breed with the objective of increasing the knowledge of this breed’s genome. Materials and methods. Thirty-six animals of this breed were analyzed. The MDR1 gene region, which includes the location where the mutation would be present, was amplified by PCR. Results. The mutation was not detected in any of the analyzed Uruguayan Cimarron. Conclusions. The lack of described ivermectin intoxication cases in veterinary clinic in this breed is explained by the lack of the mutation object of this study. The sequence studied in Cimarron dogs is kept compared to other breeds, except Collies and related breeds (Border Collie, Bearded Collie, Old English sheepdog.

MDR1 siRNA loaded hyaluronic acid-based CD44 targeted nanoparticle systems circumvent paclitaxel resistance in ovarian cancer

Science.gov (United States)

Yang, Xiaoqian; Lyer, Arun K.; Singh, Amit; Choy, Edwin; Hornicek, Francis J.; Amiji, Mansoor M.; Duan, Zhenfeng

2015-02-01

Development of multidrug resistance (MDR) is an almost universal phenomenon in patients with ovarian cancer, and this severely limits the ultimate success of chemotherapy in the clinic. Overexpression of the MDR1 gene and corresponding P-glycoprotein (Pgp) is one of the best known MDR mechanisms. MDR1 siRNA based strategies were proposed to circumvent MDR, however, systemic, safe, and effective targeted delivery is still a major challenge. Cluster of differentiation 44 (CD44) targeted hyaluronic acid (HA) based nanoparticle has been shown to successfully deliver chemotherapy agents or siRNAs into tumor cells. The goal of this study is to evaluate the ability of HA-PEI/HA-PEG to deliver MDR1 siRNA and the efficacy of the combination of HA-PEI/HA-PEG/MDR1 siRNA with paclitaxel to suppress growth of ovarian cancer. We observed that HA-PEI/HA-PEG nanoparticles can efficiently deliver MDR1 siRNA into MDR ovarian cancer cells, resulting in down-regulation of MDR1 and Pgp expression. Administration of HA-PEI/HA-PEG/MDR1 siRNA nanoparticles followed by paclitaxel treatment induced a significant inhibitory effect on the tumor growth, decreased Pgp expression and increased apoptosis in MDR ovarian cancer mice model. Our findings suggest that CD44 targeted HA-PEI/HA-PEG/MDR1 siRNA nanoparticles can serve as a therapeutic tool with great potentials to circumvent MDR in ovarian cancer.

Role of hypoxia-inducible factor-α in hepatitis-B-virus X protein-mediated MDR1 activation

International Nuclear Information System (INIS)

Han, Hyo-Kyung; Han, Chang Yeob; Cheon, Eun-Pa; Lee, Jaewon; Kang, Keon Wook

2007-01-01

The transition from chemotherapy-responsive cancer cells to chemotherapy-resistant cancer cells is mainly accompanied by the increased expression of multi-drug resistance 1 (MDR1). We found that hepatitis-B-virus X protein (HBx) increases the transcriptional activity and protein level of MDR1 in a hepatoma cell line, H4IIE. In addition, HBx overexpression made H4IIE cells more resistant to verapamil-uptake. HBx stabilized hypoxia-inducible factor-1α (HIF-1α) and induced the nuclear translocation of C/EBPβ. Reporter gene analyses showed that HBx increased the reporter activity in the cells transfected with the reporter containing MDR1 gene promoter. Moreover, the luciferase reporter gene activity was significantly inhibited by HIF-1α siRNA but not by overexpression of C/EBP dominant negative mutant. These results imply that HBx increases the MDR1 transporter activity through the transcriptional activation of the MDR1 gene with HIF-1α activation, and suggest HIF-1α for the therapeutic target of HBV-mediated chemoresistance

Candida albicans Swi/Snf and Mediator Complexes Differentially Regulate Mrr1-Induced MDR1 Expression and Fluconazole Resistance.

Science.gov (United States)

Liu, Zhongle; Myers, Lawrence C

2017-11-01

Long-term azole treatment of patients with chronic Candida albicans infections can lead to drug resistance. Gain-of-function (GOF) mutations in the transcription factor Mrr1 and the consequent transcriptional activation of MDR1 , a drug efflux coding gene, is a common pathway by which this human fungal pathogen acquires fluconazole resistance. This work elucidates the previously unknown downstream transcription mechanisms utilized by hyperactive Mrr1. We identified the Swi/Snf chromatin remodeling complex as a key coactivator for Mrr1, which is required to maintain basal and induced open chromatin, and Mrr1 occupancy, at the MDR1 promoter. Deletion of snf2 , the catalytic subunit of Swi/Snf, largely abrogates the increases in MDR1 expression and fluconazole MIC observed in MRR1 GOF mutant strains. Mediator positively and negatively regulates key Mrr1 target promoters. Deletion of the Mediator tail module med3 subunit reduces, but does not eliminate, the increased MDR1 expression and fluconazole MIC conferred by MRR1 GOF mutations. Eliminating the kinase activity of the Mediator Ssn3 subunit suppresses the decreased MDR1 expression and fluconazole MIC of the snf2 null mutation in MRR1 GOF strains. Ssn3 deletion also suppresses MDR1 promoter histone displacement defects in snf2 null mutants. The combination of this work with studies on other hyperactive zinc cluster transcription factors that confer azole resistance in fungal pathogens reveals a complex picture where the induction of drug efflux pump expression requires the coordination of multiple coactivators. The observed variations in transcription factor and target promoter dependence of this process may make the search for azole sensitivity-restoring small molecules more complicated. Copyright © 2017 American Society for Microbiology.

8__Aisha_Detection ofMDR-TB

African Journals Online (AJOL)

User

Among the MDR-TB cases rifampicin resistance was associated with rpoB WT gene and rpoB MUT gene in 100% and 62% of the ... diagnosis of TB patients, and proper treatment and management of the infected cases to minimize the spread and ..... in an amino acid change and concluded that this is one of the reasons ...

ANTIBACTERIAL ACTIVITY OF DRACONTOMELON DAO EXTRACTS ON METHICILLIN-RESISTANT S. AUREUS (MRSA) AND E. COLI MULTIPLE DRUG RESISTANCE (MDR).

Science.gov (United States)

Yuniati, Yuniati; Hasanah, Nurul; Ismail, Sjarif; Anitasari, Silvia; Paramita, Swandari

2018-01-01

Staphylococcus aureus , methicillin-resistant and Escherichia coli , multidrug-resistant included in the list of antibiotic-resistant priority pathogens from WHO. As multidrug-resistant bacteria problem is increasing, it is necessary to probe new sources for identifying antimicrobial compounds. Medicinal plants represent a rich source of antimicrobial agents. One of the potential plants for further examined as antibacterial is Dracontomelon dao (Blanco) Merr. & Rolfe. The present study designed to find the antibacterial activity of D. dao stem bark extracts on Methicillin-resistant S. aureus (MRSA) and E. coli Multiple Drug Resistance (MDR), followed by determined secondary metabolites with antibacterial activity and determined the value of MIC (minimum inhibitory concentration) and MBC (minimum bactericidal concentration). D. dao stem bark extracted using 60% ethanol. Disc diffusion test methods used to find the antibacterial activity, following by microdilution methods to find the value of MIC and MBC. Secondary metabolites with antibacterial activity determined by bioautography using TLC (thin layer chromatography) methods. D. dao stem bark extracts are sensitive to MSSA, MRSA and E.coli MDR bacteria. The inhibition zone is 16.0 mm in MSSA, 11.7 mm in MRSA and 10.7 mm in E. coli MDR. The entire MBC/MIC ratios for MSSA, MRSA and E.coli MDR is lower than 4. The ratio showed bactericidal effects of D. dao stem bark extracts. In TLC results, colorless bands found to be secondary metabolites with antibacterial activity. D. dao stem bark extracts are potential to develop as antibacterial agent especially against MRSA and E. coli MDR strain.

The search for the mdr1-1Δ mutation of the MDR1 gene in four canine breeds in Uruguay (preliminary study

Directory of Open Access Journals (Sweden)

Rosa Gagliardi B.

2015-01-01

Full Text Available Objective. The objective of this study is to analyze the frequency of mdr1-1Δ mutation in German Shepherd, Doberman, Border Collie and Greyhound dog breeds in Uruguay. Materials and methods. A total of 95 animals from the four breeds mentioned above were studied. DNA was isolated from blood using potassium acetate with a subsequent degradation from RNA with RNAsaH. The concentration and quality of the DNA obtained was evaluated with a Nanodrop, ND-1000 spectrophotometer. To determine the presence or absence of the mdr1-1Δ mutation, DNA samples were sent to Gene Seek, Neogen Corporation of Chicago, United States, for genotyping. Results. In all 95 animals studied, the mdr1-1Δ mutation was not present. Conclusions. Based on the preliminary results obtained, other elements that may cause adverse drug reactions must be considered: unidentified mutations in other regions of the MDR1 gene; mutations in other genes involved in the transport of drugs from the same subfamily or another; mutations in enzymes involved in drug metabolism (e.g. Cytochrome P450. Moreover, especially with Border Collies and Greyhounds, it is advisable to increase the number of animals in the study.

RNAi validation of resistance genes and their interactions in the highly DDT-resistant 91-R strain of Drosophila melanogaster.

Science.gov (United States)

Gellatly, Kyle J; Yoon, Kyong Sup; Doherty, Jeffery J; Sun, Weilin; Pittendrigh, Barry R; Clark, J Marshall

2015-06-01

4,4'-dichlorodiphenyltrichloroethane (DDT) has been re-recommended by the World Health Organization for malaria mosquito control. Previous DDT use has resulted in resistance, and with continued use resistance will increase in terms of level and extent. Drosophila melanogaster is a model dipteran that has many available genetic tools, numerous studies done on insecticide resistance mechanisms, and is related to malaria mosquitoes allowing for extrapolation. The 91-R strain of D. melanogaster is highly resistant to DDT (>1500-fold), however, there is no mechanistic scheme that accounts for this level of resistance. Recently, reduced penetration, increased detoxification, and direct excretion have been identified as resistance mechanisms in the 91-R strain. Their interactions, however, remain unclear. Use of UAS-RNAi transgenic lines of D. melanogaster allowed for the targeted knockdown of genes putatively involved in DDT resistance and has validated the role of several cuticular proteins (Cyp4g1 and Lcp1), cytochrome P450 monooxygenases (Cyp6g1 and Cyp12d1), and ATP binding cassette transporters (Mdr50, Mdr65, and Mrp1) involved in DDT resistance. Further, increased sensitivity to DDT in the 91-R strain after intra-abdominal dsRNA injection for Mdr50, Mdr65, and Mrp1 was determined by a DDT contact bioassay, directly implicating these genes in DDT efflux and resistance. Copyright © 2015 Elsevier Inc. All rights reserved.

Antimicrobial resistance and resistance genes in Salmonella strains isolated from broiler chickens along the slaughtering process in China.

Science.gov (United States)

Zhu, Yuanting; Lai, Haimei; Zou, Likou; Yin, Sheng; Wang, Chengtao; Han, Xinfeng; Xia, Xiaolong; Hu, Kaidi; He, Li; Zhou, Kang; Chen, Shujuan; Ao, Xiaolin; Liu, Shuliang

2017-10-16

A total of 189 Salmonella isolates were recovered from 627 samples which were collected from cecal contents of broilers, chicken carcasses, chicken meat after cutting step and frozen broiler chicken products along the slaughtering process at a slaughterhouse in Sichuan province of China. The Salmonella isolates were subjected to antimicrobial susceptibility testing to 10 categories of antimicrobial agents using the Kirby-Bauer disk diffusion method. Those antibiotics-resistant isolates were further investigated for the occurrence of resistance genes, the presence of class 1 integron as well as the associated gene cassettes, and the mutations within the gyrA and parC genes. Consequently, the prevalence of Salmonella was 30.14% (47.96% for cecal content, 18.78% for chicken carcasses, 31.33% for cutting meat and 14.00% for frozen meat, respectively). The predominant serotypes were S. Typhimurium (15.34%) and S. Enteritidis (69.84%). High resistance rates to the following drugs were observed: nalidixic acid (99.5%), ampicillin (87.8%), tetracycline (51.9%), ciprofloxacin (48.7%), trimethoprim/sulfamethoxazole (48.1%), and spectinomycin (34.4%). Antimicrobial resistance profiling showed that 60.8% of isolates were multidrug resistant (MDR), and MDR strains increased from 44.7% to 78.6% along the slaughtering line. 94.6% (n=157) of beta-lactam-resistant isolates harbored at least one resistance gene of bla TEM or bla CTX-M . The relatively low prevalence of aminoglycoside resistance genes (aac(3)-II, aac(3)-IV, and ant(2″)-I) was found in 49 (66.2%) of antibiotic-resistant isolates. The tetracycline resistance genes (tet(A), tet(B), tet(C), and tet(G) and sulfonamide resistance genes (sul1, sul2, and sul3) were identified in 84 (85.7%) and 89 (97.8%) antibiotic-resistant isolates respectively. floR was identified in 44 (97.8%) florfenicol-resistant isolates. Class 1 integron was detected in 37.4% (n=43) of the MDR isolates. Two different gene cassettes, bla OXA-30 -aad

Detection of expression and modulation of multidrug-resistance (MDR) and establishment of a new bioassay

International Nuclear Information System (INIS)

Berger, W.

1993-08-01

The present thesis deals with the resistance of human malignant cells against cellular toxicity of anticancer drugs, a phenomenon representing one of the major obstacles to successful chemotherapy. One mechanism underlying a cross-resistance to different drugs called multidrug resistance (MDR) is characterized by the expression of an active transport protein (P-glycoprotein), causing decreased intracellular drug retention and cytotoxicity. The main subjects of the present work were to establish different detection methods for MDR and its modulation (by substances blocking activity of P-glycoprotein) including immunological methods (immunocytochemistry, radioimmunoassay), molecular biology (slot-blot analysis, in-situ hybridization) and functional assays (drug-accumulation analysis, drug-cytotoxicity analysis). The methods were evaluated and compared using human and mouse MDR control cell lines and human tumor cell lines established in our laboratory. In cell lines derived from human melanoma - a malignancy insensitive to chemotherapy - expression of P-glycoprotein of relatively low transporting activity was detected by different methods in 8 of 33 cases. Furthermore a new sensitive in vitro assay for the functional detection of MDR was established using the biological features of cytochalasins, a microfilament disrupting substance group. These compounds were shown to be substrates for the P-glycoprotein efflux pump and their effects on cell division (blockade of cytokinesis resulting in multinucleate cells) correlated with MDR-activity of the tested cells. With this new assay P-glycoprotein activity can be demonstrated and analysed over a wide range of resistance against different cytotoxic drugs. Therefore it may by a suitable tool for research and diagnosis in the field of drug resistance

Inhibition of ABCB1 (MDR1 expression by an siRNA nanoparticulate delivery system to overcome drug resistance in osteosarcoma.

Directory of Open Access Journals (Sweden)

Michiro Susa

2010-05-01

Full Text Available The use of neo-adjuvant chemotherapy in treating osteosarcoma has improved patients' average 5 year survival rate from 20% to 70% in the past 30 years. However, for patients who progress after chemotherapy, its effectiveness diminishes due to the emergence of multi-drug resistance (MDR after prolonged therapy.In order to overcome both the dose-limiting side effects of conventional chemotherapeutic agents and the therapeutic failure resulting from MDR, we designed and evaluated a novel drug delivery system for MDR1 siRNA delivery. Novel biocompatible, lipid-modified dextran-based polymeric nanoparticles were used as the platform for MDR1 siRNA delivery; and the efficacy of combination therapy with this system was evaluated. In this study, multi-drug resistant osteosarcoma cell lines (KHOS(R2 and U-2OS(R2 were treated with the MDR1 siRNA nanocarriers and MDR1 protein (P-gp expression, drug retention, and immunofluoresence were analyzed. Combination therapy of the MDR1 siRNA loaded nanocarriers with increasing concentrations of doxorubicin was also analyzed. We observed that MDR1 siRNA loaded dextran nanoparticles efficiently suppresses P-gp expression in the drug resistant osteosarcoma cell lines. The results also demonstrated that this approach may be capable of reversing drug resistance by increasing the amount of drug accumulation in MDR cell lines.Lipid-modified dextran-based polymeric nanoparticles are a promising platform for siRNA delivery. Nanocarriers loaded with MDR1 siRNA are a potential treatment strategy for reversing MDR in osteosarcoma.

Mdr65 decreases toxicity of multiple insecticides in Drosophila melanogaster.

Science.gov (United States)

Sun, Haina; Buchon, Nicolas; Scott, Jeffrey G

2017-10-01

ABC transporters are ubiquitous membrane-bound proteins, present in both prokaryotes and eukaryotes. The major function of eukaryotic ABC transporters is to mediate the efflux of a variety of substrates (including xenobiotics) out of cells. ABC transporters have been widely investigated in humans, particularly for their involvement in multidrug resistance (MDR). Considerably less is known about their roles in transport and/or excretion in insects. ABC transporters are only known to function as exporters in insects. Drosophila melanogaster has 56 ABC transporter genes, including eight which are phylogenetically most similar to the human Mdr genes (ABCB1 clade). We investigated the role of ABC transporters in the ABCB1 clade in modulating the susceptibility to insecticides. We took advantage of the GAL4/UAS system in D. melanogaster to knockdown the expression levels of Mdr65, Mdr50, Mdr49 and ABCB6 using transgenic UAS-RNAi lines and conditional driver lines. The most notable effects were increased sensitivities to nine different insecticides by silencing of Mdr65. Furthermore, a null mutation of Mdr65 decreased the malathion, malaoxon and fipronil LC 50 values by a factor of 1.9, 2.1 and 3.9, respectively. Altogether, this data demonstrates the critical role of ABC transporters, particularly Mdr65, in altering the toxicity of specific, structurally diverse, insecticides in D. melanogaster. Copyright © 2017 Elsevier Ltd. All rights reserved.

SNP genetic polymorphisms of MDR-1, CYP1A2 and CYPB11 genes in four canine breeds upon toxicological evaluation.

Science.gov (United States)

Gagliardi, Rosa; Llambí, Silvia; Arruga, M Victoria

2015-01-01

The fields of pharmacogenetics and pharmacogenomics have become increasingly promising regarding the clinical application of genetic data to aid in prevention of adverse reactions. Specific screening tests can predict which animals express modified proteins or genetic sequences responsible for adverse effects associated with a drug. Among the genetic variations that have been investigated in dogs, the multidrug resistance gene (MDR) is the best studied. However, other genes such as CYP1A2 and CYP2B11 control the protein syntheses involved in the metabolism of many drugs. In the present study, the MDR-1, CYP1A2 and CYP2B11 genes were examined to identify SNP polymorphisms associated with these genes in the following four canine breeds: Uruguayan Cimarron, Border Collie, Labrador Retriever and German Shepherd. The results revealed that several SNPs of the CYP1A2 and CYP2B11 genes are potential targets for drug sensitivity investigations.

A gene encoding maize caffeoyl-CoA O-methyltransferase confers quantitative resistance to multiple pathogens.

Science.gov (United States)

Yang, Qin; He, Yijian; Kabahuma, Mercy; Chaya, Timothy; Kelly, Amy; Borrego, Eli; Bian, Yang; El Kasmi, Farid; Yang, Li; Teixeira, Paulo; Kolkman, Judith; Nelson, Rebecca; Kolomiets, Michael; L Dangl, Jeffery; Wisser, Randall; Caplan, Jeffrey; Li, Xu; Lauter, Nick; Balint-Kurti, Peter

2017-09-01

Alleles that confer multiple disease resistance (MDR) are valuable in crop improvement, although the molecular mechanisms underlying their functions remain largely unknown. A quantitative trait locus, qMdr 9.02 , associated with resistance to three important foliar maize diseases-southern leaf blight, gray leaf spot and northern leaf blight-has been identified on maize chromosome 9. Through fine-mapping, association analysis, expression analysis, insertional mutagenesis and transgenic validation, we demonstrate that ZmCCoAOMT2, which encodes a caffeoyl-CoA O-methyltransferase associated with the phenylpropanoid pathway and lignin production, is the gene within qMdr 9.02 conferring quantitative resistance to both southern leaf blight and gray leaf spot. We suggest that resistance might be caused by allelic variation at the level of both gene expression and amino acid sequence, thus resulting in differences in levels of lignin and other metabolites of the phenylpropanoid pathway and regulation of programmed cell death.

Pharmacological modification of multi-drug resistance (MDR) in vitro detected by a novel fluorometric microculture cytotoxicity assay. Reversal of resistance and selective cytotoxic actions of cyclosporin A and verapamil on MDR leukemia T-cells.

Science.gov (United States)

Larsson, R; Nygren, P

1990-07-15

A novel fluorometric microculture cytotoxicity assay (FMCA), based on measurements of fluorescein diacetate (FDA) hydrolysis and DNA staining by Hoechst 33342, was used for drug sensitivity testing and detection of resistance reversal in acute lymphoblastic leukemia (ALL) cell lines. The 72-hr assay was found to be sensitive, reproducible and linearly related to the number of viable cells within a broad range of cell concentrations. At clinically achievable drug concentrations, the calcium channel blocker Verapamil (ver) and the immunosuppressant Cyclosporin A (csA) were found to partly reverse acquired Vincristine (vcr) resistance in multi-drug resistant (MDR) T-ALL L100 cells with little or no effect on the drug-sensitive parental L0 cell line. By combining the fluorometric indices, we found that low concentrations of csA were growth-inhibitory, whereas higher concentrations (greater than 10 micrograms/ml) were progressively cytotoxic for drug-sensitive L0 cells. In MDR L100 cells, on the other hand, csA produced significant cell kill even at low drug concentrations. Ver had no effects on sensitive L0 cells but showed considerable cytotoxic action towards MDR L100 cells. There was no apparent relationship between drug reversal of vcr resistance and the cytotoxic actions of the drug per se since the calcium channel blocker diltiazem (dil) significantly potentiated the actions of vcr on MDR L100 cells without being more toxic to these cells (compared to vcr-sensitive L0 cells).

Methylation of WTH3, a possible drug resistant gene, inhibits p53 regulated expression

International Nuclear Information System (INIS)

Tian, Kegui; Wang, Yuezeng; Huang, Yu; Sun, Boqiao; Li, Yuxin; Xu, Haopeng

2008-01-01

Previous results showed that over-expression of the WTH3 gene in MDR cells reduced MDR1 gene expression and converted their resistance to sensitivity to various anticancer drugs. In addition, the WTH3 gene promoter was hypermethylated in the MCF7/AdrR cell line and primary drug resistant breast cancer epithelial cells. WTH3 was also found to be directly targeted and up regulated by the p53 gene. Furthermore, over expression of the WTH3 gene promoted the apoptotic phenotype in various host cells. To further confirm WTH3's drug resistant related characteristics, we recently employed the small hairpin RNA (shRNA) strategy to knockdown its expression in HEK293 cells. In addition, since the WTH3 promoter's p53-binding site was located in a CpG island that was targeted by methylation, we were interested in testing the possible effect this epigenetic modification had on the p53 transcription factor relative to WTH3 expression. To do so, the in vitro methylation method was utilized to examine the p53 transgene's influence on either the methylated or non-methylated WTH3 promoter. The results generated from the gene knockdown strategy showed that reduction of WTH3 expression increased MDR1 expression and elevated resistance to Doxorubicin as compared to the original control cells. Data produced from the methylation studies demonstrated that DNA methylation adversely affected the positive impact of p53 on WTH3 promoter activity. Taken together, our studies provided further evidence that WTH3 played an important role in MDR development and revealed one of its transcription regulatory mechanisms, DNA methylation, which antagonized p53's positive impact on WTH3 expression

Functional evidence of multidrug resistance transporters (MDR in rodent olfactory epithelium.

Directory of Open Access Journals (Sweden)

Adrien Molinas

Full Text Available P-glycoprotein (Pgp and multidrug resistance-associated protein (MRP1 are membrane transporter proteins which function as efflux pumps at cell membranes and are considered to exert a protective function against the entry of xenobiotics. While evidence for Pgp and MRP transporter activity is reported for olfactory tissue, their possible interaction and participation in the olfactory response has not been investigated.Functional activity of putative MDR transporters was assessed by means of the fluorometric calcein acetoxymethyl ester (calcein-AM accumulation assay on acute rat and mouse olfactory tissue slices. Calcein-AM uptake was measured as fluorescence intensity changes in the presence of Pgp or MRP specific inhibitors. Epifluorescence microscopy measured time course analysis in the olfactory epithelium revealed significant inhibitor-dependent calcein uptake in the presence of each of the selected inhibitors. Furthermore, intracellular calcein accumulation in olfactory receptor neurons was also significantly increased in the presence of either one of the Pgp or MRP inhibitors. The presence of Pgp or MRP1 encoding genes in the olfactory mucosa of rat and mouse was confirmed by RT-PCR with appropriate pairs of species-specific primers. Both transporters were expressed in both newborn and adult olfactory mucosa of both species. To assess a possible involvement of MDR transporters in the olfactory response, we examined the electrophysiological response to odorants in the presence of the selected MDR inhibitors by recording electroolfactograms (EOG. In both animal species, MRPs inhibitors induced a marked reduction of the EOG magnitude, while Pgp inhibitors had only a minor or no measurable effect.The findings suggest that both Pgp and MRP transporters are functional in the olfactory mucosa and in olfactory receptor neurons. Pgp and MRPs may be cellular constituents of olfactory receptor neurons and represent potential mechanisms for modulation

Analysis of multi drug resistant tuberculosis (MDR-TB) financial protection policy: MDR-TB health insurance schemes, in Chhattisgarh state, India.

Science.gov (United States)

Kundu, Debashish; Sharma, Nandini; Chadha, Sarabjit; Laokri, Samia; Awungafac, George; Jiang, Lai; Asaria, Miqdad

2018-01-27

There are significant financial barriers to access treatment for multi drug resistant tuberculosis (MDR-TB) in India. To address these challenges, Chhattisgarh state in India has established a MDR-TB financial protection policy by creating MDR-TB benefit packages as part of the universal health insurance scheme that the state has rolled out in their effort towards attaining Universal Health Coverage for all its residents. In these schemes the state purchases health insurance against set packages of services from third party health insurance agencies on behalf of all its residents. Provider payment reform by strategic purchasing through output based payments (lump sum fee is reimbursed as per the MDR-TB benefit package rates) to the providers - both public and private health facilities empanelled under the insurance scheme was the key intervention. To understand the implementation gap between policy and practice of the benefit packages with respect to equity in utilization of package claims by the poor patients in public and private sector. Data from primary health insurance claims from January 2013 to December 2015, were analysed using an extension of 'Kingdon's multiple streams for policy implementation framework' to explain the implementation gap between policy and practice of the MDR-TB benefit packages. The total number of claims for MDR-TB benefit packages increased over the study period mainly from poor patients treated in public facilities, particularly for the pre-treatment evaluation and hospital stay packages. Variations and inequities in utilizing the packages were observed between poor and non-poor beneficiaries in public and private sector. Private providers participation in the new MDR-TB financial protection mechanism through the universal health insurance scheme was observed to be much lower than might be expected given their share of healthcare provision overall in India. Our findings suggest that there may be an implementation gap due to weak

Heterologously expressed bacterial and human multidrug resistance proteins confer cadmium resistance to Escherichia coli

NARCIS (Netherlands)

Achard-Joris, M; van Saparoea, HBV; Driessen, AJM; Bourdineaud, JP; Bourdineaud, Jean-Paul

2005-01-01

The human MDR1 gene is induced by cadmium exposure although no resistance to this metal is observed in human cells overexpressing hMDR1. To access the role of MDR proteins in cadmium resistance, human MDR1, Lactococcus lactis lmrA, and Oenococcus oeni omrA were expressed in an Escherichia coli tolC

Efficacy of moxifloxacin & econazole against multidrug resistant (MDR Mycobacterium tuberculosis in murine model

Directory of Open Access Journals (Sweden)

U D Gupta

2015-01-01

Full Text Available Background & objectives: Studies have shown the bactericidal potential of econazole and clotrimazole against Mycobacterium tuberculosis under in vitro and ex vivo conditions along with their synergism with conventional antituberculosis drugs. These molecules were also found to be effective against different multidrug resistant (MDR M. tuberculosis isolates in vitro. Hence the present study was designed to evaluate the in vivo antimycobacterial potential of moxifloxacin and econazole alone and in combination against multidrug resistant tuberculosis (MDR-TB in a mice model. Methods: Mice were infected with 2.5×10 [7] bacilli of MDR strain of M. tuberculosis by aerosol route of infection. After four weeks of infection, chemotherapy was started orally by moxifloxacin 8.0 mg/kg body wt and econazole 3.3 mg/kg alone and in combination, as well as with four first line anti-tuberculosis drugs as a positive control. The animals were sacrificed and the lungs and spleen were excised under aspetic conditions. The tissues were homogenized with sterile normal saline, an aliquot of the homogenate was plated on Middlebrook 7H11 agar supplemented with oleate albumin dextrose catalase (OADC and incubated at 37°C for four weeks. The number of visible and individual colonies were counted. Results: The first line anti-tuberculosis drugs (RIF+INH+EMB+PZA after eight weeks of therapy had no impact as the bacillary load in lungs and spleens remained unchanged. However, econazole, moxifloxacin alone as well as in combination significantly reduced the bacillary load in lungs as well as in spleens of MDR-TB bacilli infected mice. Interpretation & conclusions: Co-administration of the two drugs (econazole and moxifloxacin to MDR-TB strain JAL-7782 infected mice exhibited additive effect, the efficacy of the drugs in combination being higher as compared with ECZ or MOX alone. These results were substantiated by histopathological studies. This study suggests the utility of

Co-ordinate loss of protein kinase C and multidrug resistance gene expression in revertant MCF-7/Adr breast carcinoma cells.

Science.gov (United States)

Budworth, J; Gant, T W; Gescher, A

1997-01-01

The aim of this study was to investigate the link between protein kinase C (PKC) and multidrug resistance (mdr) phenotype. The expression of both was studied in doxorubicin-resistant MCF-7/Adr cells as they reverted to the wild-type phenotype when cultured in the absence of drug. The following parameters were measured in cells 4, 10, 15, 20 and 24 weeks after removal of doxorubicin; (1) sensitivity of the cells towards doxorubicin; (2) levels of P-glycoprotein (P-gp) and MDR1 mRNA; (3) levels and cellular localization of PKC isoenzyme proteins alpha, theta and epsilon; and (4) gene copy number of PKC-alpha and MDR1 genes. Cells lost their resistance gradually with time, so that by week 24 they had almost completely regained the drug sensitivity seen in wild-type MCF-7 cells. P-gp levels measured by Western blot mirrored the change in doxorubicin sensitivity. By week 20, P-gp had decreased to 18% of P-gp protein levels at the outset, and P-gp was not detectable at week 24. Similarly, MDR1 mRNA levels had disappeared by week 24. MCF-7/Adr cells expressed more PKCs-alpha and -theta than wild-type cells and possessed a different cellular localization of PKC-epsilon. The expression and distribution pattern of these PKCs did not change for up to 20 weeks, but reverted back to that seen in wild-type cells by week 24. MDR1 gene amplification remained unchanged until week 20, but then was lost precipitously between weeks 20 and 24. The PKC-alpha gene was not amplified in MCF-7/Adr cells. The results suggest that MCF-7/Adr cells lose MDR1 gene expression and PKC activity in a co-ordinate fashion, consistent with the existence of a mechanistic link between MDR1 and certain PKC isoenzymes.

Multi-drug resistance (MDR1 gene and P-glycoprotein influence on pharmacokinetic and pharmacodymanic of therapeutic drugs

Directory of Open Access Journals (Sweden)

Linardi Renata Lehn

2006-01-01

Full Text Available (MDR1 gene expressed in tumor cells and also in several normal tissues, such as intestine, liver, kidney, blood-brain barrier, spinal cord, and placenta. P-gp has been identified in mice, rat, bovine, monkey, rodents, and human beings and has been receiving a particular clinical relevance because this protein expression limits brain access and intestinal absorption of many drugs. This protein plays a role as a protective barrier against a wide variety of substrates, avoiding drug entry into the central nervous system. P-glycoprotein also interferes with drug bioavailability and disposition, including absorption, distribution, metabolization, and excretion, influencing pharmacokinetic and pharmacodynamic of drugs. Modulation of P-gp may help the efficacy of treatment of several diseases and can explain some adverse central nervous system effects induced by drugs after intravenous administration and the poor response of oral administration in patients. Alteration in P-gp expression or function has been associated with several diseases susceptibility in humans and animals. Furthermore, additional studies relating MDR1 and P-gp expression has an important clinical implication also in terms of treatment efficacy.

High Frequency of a Single Nucleotide Substitution (c.-6-180T>G) of the Canine MDR1/ABCB1 Gene Associated with Phenobarbital-Resistant Idiopathic Epilepsy in Border Collie Dogs

OpenAIRE

Mizukami, Keijiro; Yabuki, Akira; Chang, Hye-Sook; Uddin, Mohammad Mejbah; Rahman, Mohammad Mahbubur; Kushida, Kazuya; Kohyama, Moeko; Yamato, Osamu

2013-01-01

A single nucleotide substitution (c.-6-180T>G) associated with resistance to phenobarbital therapy has been found in the canine MDR1/ABCB1 gene in Border Collies with idiopathic epilepsy. In the present study, a PCR-restriction fragment length polymorphism assay was developed for genotyping this mutation, and a genotyping survey was carried out in a population of 472 Border Collies in Japan to determine the current allele frequency. The survey demonstrated the frequencies of the T/T wild type...

The multidrug resistance 1 (MDR1) gene polymorphism G-rs3789243-A is not associated with disease susceptibility in Norwegian patients with colorectal adenoma and colorectal cancer; a case control study

DEFF Research Database (Denmark)

Andersen, V.; Agerstjerne, L.; Jensen, D.

2009-01-01

Background: Smoking, dietary factors, and alcohol consumption are known life style factors contributing to gastrointestinal carcinogenesis. Genetic variations in carcinogen handling may affect cancer risk. The multidrug resistance 1(MDR1/ABCB1) gene encodes the transport protein P-glycoprotein (a...... in inflammation, and may thereby affect the risk of malignity. Hence, genetic variations that modify the function of P-glycoprotein may be associated with the risk of colorectal cancer (CRC). We have previously found an association between the MDR1 intron 3 G-rs3789243-A polymorphism and the risk of CRC...... of colorectal carcinomas and adenomas in the Norwegian population was assessed in 167 carcinomas, 990 adenomas, and 400 controls. Genotypes were determined by allelic discrimination. Odds ratio (OR) and 95 confidence interval (95% CI) were estimated by binary logistic regression. Results: No association...

Development of PET and SPECT radiopharmaceuticals to study multi-drug resistance (MDR)

International Nuclear Information System (INIS)

Katsififs, A.; Dikic, B.; Greguric, I.; Knott, R.; Mattner, F.

2002-01-01

Full text: Cellular resistance or Multidrug Resistance (MDR) to cytotoxic agents is the major cause of treatment failure in many human cancers. P-glycoprotein (Pgp), a Mr 17,0000 transmembrane protein and Multi Resistance Protein (MRP) are two proteins that are over expressed and confer resistance to a large number of chemotherapeutic agents by enhancing their extracellular transport. P-glycoprotein is expressed at a relative high level in treated and untreated human malignant tumours, including renal, colonic, adrenal, hepatocellular carcinoma and a considerable percentage of breast carcinomas. 99m Tc-Sestamibi, a lipophilic cationic complex is a transport substrate for Pgp. In clinical studies of human neoplasms it was found that tumour uptake and clearance of this tracer correlate with Pgp expression and may be used for the phenotypic assessment of MDR. However, new tracers with better substrate specificity for Pgp and other drug transporters would greatly assist in optimising chemotherapeutic treatment and improving patient management by predicting tumour response to therapy and to assist in the development of antagonists, which may reverse or halt MDR. The aim of this project is therefore to develop PET and SPECT radiopharmaceuticals with improved affinity and selectivity for Pgp and MRP for the clinical evaluation of MDR in cancer patients. To optimise cellular transport characteristics, a number of chemical families that have been found to be substrates of Pgp and other drug efflux pumps, will be investigated. In the first instance, a series of drugs based on the flavonol natural product, Quercetin will be developed, screened for MDR and radiolabelled with PET and SPECT isotopes. Quercetin and related flavonol derivatives have been selected for this project because of their moderate to good affinity for Pgp. With the assistance of molecular modeling and in vitro studies, structural modification will be undertaken to improve the specificity and affinity for

Detekce polymorfismu v genu MDR1 u ovčáckých a honáckých psů

OpenAIRE

Staroveská, Marieta

2016-01-01

This thesis is focused on polymorphism of MDR1 gene and related drug resistance. Resistance is caused by deletion of four nucleotids, that resulting in a frame shift and synthesis of nonfunctional transport of P-glycoprotein. The text describes a polymorphism of MDR1 (ABCB1) gene, which results in reduced resistance to drugs belonging to the group of macrocyclic lactones. It also describes inheritance of this phenomenon and it deals with the detection of mutation using PCR (polymerase chain r...

Asiatic Acid (AA) Sensitizes Multidrug-Resistant Human Lung Adenocarcinoma A549/DDP Cells to Cisplatin (DDP) via Downregulation of P-Glycoprotein (MDR1) and Its Targets.

Science.gov (United States)

Cheng, Qilai; Liao, Meixiang; Hu, Haibo; Li, Hongliang; Wu, Longhuo

2018-01-01

P-glycoprotein (P-gp, i.e., MDR1) is associated with the phenotype of multidrug resistance (MDR) and causes chemotherapy failure in the management of cancers. Searching for effective MDR modulators and combining them with anticancer drugs is a promising strategy against MDR. Asiatic acid (AA), a natural triterpene isolated from the plant Centella asiatica, may have an antitumor activity. The present study assessed the reversing effect of AA on MDR and possible molecular mechanisms of AA action in MDR1-overexpressing cisplatin (DDP)-resistant lung cancer cells, A549/DDP. Human lung adenocarcinoma A549/DDP cells were either exposed to different concentrations of AA or treated with DDP, and their viability was measured by the MTT assay. A Rhodamine 123 efflux assay, immunofluorescent staining, ATPase assay, reverse-transcription PCR (RT-PCR), and western blot analysis were conducted to elucidate the mechanisms of action of AA on MDR. Our results showed that AA significantly enhanced the cytotoxicity of DDP toward A549/DDP cells but not its parental A549 cells. Furthermore, AA strongly inhibited P-gp expression by blocking MDR1 gene transcription and increased the intracellular accumulation of the P-gp substrate Rhodamine 123 in A549/DDP cells. Nuclear factor (NF)-kB (p65) activity, IkB degradation, and NF-kB/p65 nuclear translocation were markedly inhibited by pretreatment with AA. Additionally, AA inhibited the MAPK-ERK pathway, as indicated by decreased phosphorylation of ERK1 and -2, AKT, p38, and JNK, thus resulting in reduced activity of the Y-box binding protein 1 (YB1) via blockage of its nuclear translocation. AA reversed P-gp-mediated MDR by inhibition of P-gp expression. This effect was likely related to downregulation of YB1, and this effect was mediated by the NF-kB and MAPK-ERK pathways. AA may be useful as an MDR reversal agent for combination therapy in clinical trials. © 2018 The Author(s). Published by S. Karger AG, Basel.

Isolation, Identification And Screening Antibacterial Activity from Marine Sponge-Associated Fungi Against Multidrug-Resistant (MDR) Escherichia coli

Science.gov (United States)

Triandala Sibero, Mada; Sabdaningsih, Aninditia; Cristianawati, Olvi; Nuryadi, Handung; Karna Radjasa, Ocky; Sabdono, Agus; Trianto, Agus

2017-02-01

Irrational used of antibiotic in several decades ago causing resistant in bacteria and decreasing the cure rate of infectious diseases. Multidrug-resistant (MDR) Escherichia coli is known to cause various of infectious diseases such as urinary tract infection, nosocomial bloodstream infection, meningitis, bacteraemia, and gastrointestinal disease. Marine sponge-associated fungi have potential as source of new compound to combat MDR E. coli. The aims of this research were to isolate marine sponge-assosiated fungi, to screen potential fungi against MDR E. coli, to identify the potential fungi and its host sponge. There were 29 marine sponge-associated fungi successfully isolated from 9 sponges. Among 29 sponge-associated fungi screened, there were 7 isolates showed antibacterial activity against MDR E. coli. The best inhibition zone produced by MPS 14.1/MT 02 and MPS 14.3/MT 04 from sponge PP.SP.16.14. According to fungi identification result fungus MPS 14.1/MT 02 was identified as Trichoderma asperellum while MPS 14.3/MT 04 was identified as Trichoderma reesei. Sponge identification leaded the PP.SP.16.14 as Cinachyrella sp.

High prevalence of the PER-1 gene among carbapenem-resistant Acinetobacter baumannii in Riyadh, Saudi Arabia.

Science.gov (United States)

Aly, M M; Abu Alsoud, N M; Elrobh, M S; Al Johani, S M; Balkhy, H H

2016-11-01

The prevalence of carbapenem-resistant Acinetobacter baumannii in Saudi Arabia and their resistance genetic mechanisms are yet to be identified. We studied the prevalence and genetic diversity of extended-spectrum beta-lactamase genes, particularly the PER-1 gene, among carbapenem-resistant A. baumannii strains from patients at a tertiary care hospital in Riyadh, Saudi Arabia between 2006 and 2014. Fresh subcultured samples were tested for antimicrobial susceptibility minimum inhibitory concentration (MIC). Total genomic DNA was extracted from each isolate and further used for polymerase chain reaction (PCR) genotyping, sequence-based typing (SBT) of PER-1 and OXA-51-like gene, and multilocus sequence typing (MLST) of positive isolates. Randomly selected clinical isolates (n = 100) were subjected to MLST. A total of 503 isolates were characterized as multidrug-resistant (MDR) using the MIC. Isolates were further PCR tested for bla -TEM and bla -PER-1 resistance genes (n = 503). The genotyping results showed that 68/503 (14 %) isolates were positive to bla TEM. The genotyping results of PER-1-like genes showed that 384/503 (76.3 %) were positive among MDR Acinetobacter isolates. Based on SBT, the majority of these isolates were clustered into three main groups including isolates harboring PER-1: AB11 (bla -PER-1 ), isolate AB16 (bla -PER-1 ), and, finally, the plasmid pAB154 (bla -PER-7 ). Remarkably, many isolates were concealing the PER-1 gene and harboring the TEM resistance genes as well. MLST results for selected isolates (n = 100) identified four main sequence types (STs: 2, 19, 20, and 25) and four novel isolates (ST 486-489). We report 76.3 % prevalence of the PER-1 resistance gene among Acinetobacter clinical isolates from Riyadh, Saudi Arabia. Further work is needed to explore the clinical risks and patient outcome with such resistance related to healthcare-associated infections and investigate the genetic and molecular mechanisms that confer the MDR

Non-p-glycoprotein-mediated multidrug resistance in detransformed rat cells selected for resistance to methylglyoxal bis(guanylhydrazone).

Science.gov (United States)

Weber, J M; Sircar, S; Horvath, J; Dion, P

1989-11-01

Three independent variants (G2, G4, G5), resistant to methylglyoxal bis(guanylhydrazone), an anticancer drug, have been isolated by single step selection from an adenovirus-transformed rat brain cell line (1). These variants display selective cross-resistance to several natural product drugs of dissimilar structure and action. Multidrug resistance has recently been shown to be caused by overexpression of the membrane-associated p-glycoprotein, most often caused by amplification of the mdr gene. Several types of experiments were conducted to determine whether the observed drug resistance in our cell lines could be due to changes at the mdr locus. The following results were obtained: (a) the mdr locus was not amplified; (b) transcription of the mdr gene and p-glycoprotein synthesis were not increased; (c) multidrug resistance cell lines, which carry an amplified mdr locus, were not cross-resistant to methylglyoxal bis(guanylhydrazone); (d) verapamil did not reverse the resistance of G cells or mdr cells to methylglyoxal bis(guanylhydrazone), nor that of G cells to vincristine; and (e) methylglyoxal bis(guanylhydrazone) resistance was recessive and depended on a block to drug uptake, as opposed to mdr cells which are dominant and express increased drug efflux. The results obtained suggest that the drug resistance in the G2, G4, and G5 cells was atypical and may be due to a mechanism distinct from that mediated by the mdr locus.

Prevalence and molecular characterization of pyrazinamide resistance among multidrug-resistant Mycobacterium tuberculosis isolates from Southern China.

Science.gov (United States)

Pang, Yu; Zhu, Damian; Zheng, Huiwen; Shen, Jing; Hu, Yan; Liu, Jie; Zhao, Yanlin

2017-11-06

Pyrazinamide (PZA) plays a unique role in the treatment for multidrug-resistant tuberculosis (MDR-TB) in both first- and second-line regimens. The aim of this study was to investigate the prevalence and molecular characterization of PZA resistance among MDR-TB isolates collected in Chongqing municipality. A total of 133 MDR-TB isolates were collected from the smear-positive tuberculosis patients who were registered at local TB dispensaries of Chongqing. PZA susceptibility testing was determined with a Bactec MGIT 960 system. In addition, the genes conferring for PZA resistance were screened by DNA sequencing. Of these 133 MDR-TB isolates, 83 (62.4%) were determined as PZA-resistant by MGIT 960. In addition, streptomycin- (83.1% vs. 56.0%, P < 0.01), ofloxacin- (51.8% vs. 18.0%, P < 0.01), kanamycin- (22.9% vs. 2.0%, P < 0.01), amikacin- (18.1% vs. 2.0%, P = 0.01), capromycin-resistance (12.0% vs. 2.0%, P = 0.05), were more frequently observed among PZA-resistant isolates compared with PZA-susceptible isolates. Sequence analysis revealed that 73 out of 83 (88.0%) MDR strains harbored a mutation located in the pncA gene, including 55 (75.3%, 55/73) of single nucleotide substitutions and 18 (24.7%, 18/73) of frameshift mutation, while no genetic mutation associated with PZA resistance was found in the rpsA gene. The pncA expression of strains harboring substitution from A to G at position -11 in the promoter region of pncA was significantly lower than that of H37Rv (P < 0.01). In conclusion, our data have demonstrated that the analysis of the pncA gene rather than rpsA gene provides rapid and accurate information regarding PZA susceptibility for MDR-TB isolates in Chongqing. In addition, loss of pncA expression caused by promoter mutation confers PZA resistance in MDR-TB isolates.

The roles of variants in human multidrug resistance (MDR1 gene and their haplotypes on antiepileptic drugs response: a meta-analysis of 57 studies.

Directory of Open Access Journals (Sweden)

Hui Li

Full Text Available Previous studies reported the associations between the ATP-binding cassette sub-family B member 1 (ABCB1, also known as MDR1 polymorphisms and their haplotypes with risk of response to antiepileptic drugs in epilepsy, however, the results were inconclusive.The Pubmed, Embase, Web of Science, CNKI and Chinese Biomedicine databases were searched up to July 15, 2014. Pooled odds ratios (ORs and 95% confidence intervals (CIs were calculated using a fixed-effects or random-effects model based on heterogeneity tests. Meta-regression and Galbraith plot analysis were carried out to explore the possible heterogeneity.A total of 57 studies involving 12407 patients (6083 drug-resistant and 6324 drug-responsive patients with epilepsy were included in the pooled-analysis. For all three polymorphisms (C3435T, G2677T/A, and C1236T, we observed a wide spectrum of minor allele frequencies across different ethnicities. A significantly decreased risk of AEDs resistance was observed in Caucasian patients with T allele of C3435T variant, which was still significant after adjusted by multiple testing corrections (T vs C: OR=0.83, 95%CI=0.71-0.96, p=0.01. However, no significant association was observed between the other two variants and AEDs resistance. Of their haplotypes in ABCB1 gene (all studies were in Indians and Asians, no significant association was observed with AEDs resistance. Moreover, sensitivity and Cumulative analysis showed that the results of this meta-analysis were stable.In summary, this meta-analysis demonstrated that effect of C3435T variant on risk of AEDs resistance was ethnicity-dependent, which was significant in Caucasians. Additionally, further studies in different ethnic groups are warranted to clarify possible roles of haplotypes in ABCB1 gene in AEDs resistance, especially in Caucasians.

Consolidating and Exploring Antibiotic Resistance Gene Data Resources

DEFF Research Database (Denmark)

Xavier, Basil Britto; Das, Anupam J.; Cochrane, Guy

2016-01-01

The unrestricted use of antibiotics has resulted in rapid acquisition of antibiotic resistance (AR) and spread of multidrug-resistant (MDR) bacterial pathogens. With the advent of next-generation sequencing technologies and their application in understanding MDR pathogen dynamics, it has become i...

Effect of the mutation (C3435T) at exon 26 of the MDR1 gene on expression level of MDR1 messenger ribonucleic acid in duodenal enterocytes of healthy Japanese subjects.

Science.gov (United States)

Nakamura, Tsutomu; Sakaeda, Toshiyuki; Horinouchi, Masanori; Tamura, Takao; Aoyama, Nobuo; Shirakawa, Toshiro; Matsuo, Masafumi; Kasuga, Masato; Okumura, Katsuhiko

2002-04-01

The effect of the C3435T mutation at exon 26 of the MDR1 gene on the expression levels of MDR1 messenger ribonucleic acid (mRNA) was evaluated by means of real-time polymerase chain reaction in 51 biopsy specimens of duodenum obtained from 13 healthy Japanese subjects. The mRNA levels of MDR1 were 0.38 +/- 0.15, 0.56 +/- 0.14, and 1.13 +/- 0.42 (mean value +/- SE) in the subjects with the homozygote of wild-type allele (C/C), compound heterozygote with mutant T allele (C/T), and the homozygote of the mutant allele (T/T), respectively, reasonably explaining the lower digoxin serum concentration after administration of a single oral dose to subjects harboring a mutant T allele. Good correlation (r =.797; P CYP3A4 in the individual biopsy specimens. This finding suggested a lower plasma concentration of the substrates for CYP3A4 in subjects harboring the C3435T mutation of the MDR1 gene.

MDR1 haplotypes conferring an increased expression of intestinal CYP3A4 rather than MDR1 in female living-donor liver transplant patients.

Science.gov (United States)

Hosohata, Keiko; Masuda, Satohiro; Yonezawa, Atsushi; Katsura, Toshiya; Oike, Fumitaka; Ogura, Yasuhiro; Takada, Yasutsugu; Egawa, Hiroto; Uemoto, Shinji; Inui, Ken-Ichi

2009-07-01

This study investigated whether haplotypes in the multidrug resistance 1 (MDR1) gene had effects on mRNA expression levels of MDR1 and cytochrome P450 (CYP) 3A4, and on the pharmacokinetics of tacrolimus in living-donor liver transplant (LDLT) patients, considering the gender difference. Haplotype analysis of MDR1 with G2677T/A and C3435T was performed in 63 de novo Japanese LDLT patients (17 to 55 years; 44.4% women). The expression levels of MDR1 and CYP3A4 mRNAs in jejunal biopsy specimens were quantified by real-time PCR. Intestinal CYP3A4 mRNA expression levels (amol/microg total RNA) showed significantly higher values in women carrying the 2677TT-3435TT haplotype (median, 10.7; range, 5.92-15.2) than those with 2677GG-3435CC (3.03; range 1.38-4.68) and 2677GT-3435CT (median, 4.31; range, 0.07-9.42) (P = 0.022), but not in men (P = 0.81). However, MDR1 haplotype did not influence mRNA expression levels of MDR1 nor the concentration/dose ratio [(ng/mL)/(mg/day)] of oral tacrolimus for the postoperative 7 days, irrespective of gender. MDR1 haplotype may have a minor association with the tacrolimus pharmacokinetics after LDLT, but could be a good predictor of the inter-individual variation of intestinal expression of CYP3A4 in women.

Monoclonal antibody to an external epitope of the human mdr1 P-glycoprotein

NARCIS (Netherlands)

Arceci, R. J.; Stieglitz, K.; Bras, J.; Schinkel, A.; Baas, F.; Croop, J.

1993-01-01

A membrane glycoprotein, termed P-glycoprotein, has been shown to be responsible for cross-resistance to a broad range of structurally and functionally distinct cytotoxic agents. P-glycoprotein, encoded in humans by the mdr1 gene, functions as an energy-dependent efflux pump to exclude these

Mice heterozygous for the Mdr2 gene demonstrate decreased PEMT activity and diminished steatohepatitis on the MCD diet.

Science.gov (United States)

Igolnikov, Alexander C; Green, Richard M

2006-03-01

The administration of a methionine and choline deficient (MCD) diet to mice serves as an animal model of NASH. The multidrug resistant 2 (Mdr2) P-glycoprotein encodes for the canalicular phospholipid transporter, and Mdr2 (+/-) mice secrete 40% less phosphatidylcholine than wild-type mice. We have hypothesized that phosphatidylethanolamine-N-methyl transferase (PEMT) up-regulation is a consequence of MCD diet administration, and is important for the pathogenesis of steatohepatitis in this model. However, the effect of decreased phosphatidylcholine secretion and modulation of PEMT on the development of diet-induced steatohepatitis in Mdr2 (+/-) mice has not been explored. Thus, the purpose of the study is to examine the effects of the MCD diet on Mdr2 (+/-) mice. Mdr2 (+/-) and Mdr2 (+/+) mice were treated with an MCD or control diet for up to 30 days, and the severity of steatohepatitis, PEMT activity and hepatic S-adenosylmethionine (SAM), and S-adenosylhomocysteine (SAH) levels were measured. Serum ALT levels, hepatic inflammation, and PEMT activity were significantly lower, and hepatic SAM:SAH ratios were significantly higher in Mdr2 (+/-) mice at 7 and 30 days on the MCD diet. Mdr2 (+/-) mice have diminished susceptibility to MCD diet-induced NASH, which is associated with a relative decrease in PEMT activity and increased SAM:SAH ratios.

Psychiatric disorders in patients with multidrug resistant tuberculosis (MDR-TB in Sardjito Hospital, Yogyakarta, Indonesia

Directory of Open Access Journals (Sweden)

Irwan Supriyanto

2017-08-01

Full Text Available Introduction: Tuberculosis has become a chronic debilitating disease in developing countries, particularly after the emergence of multidrug resistant tuberculosis (MDR-TB. Second line treatments for the disease which were subsequently developed were associated with psychiatric disorders among patients. Psychiatric disorder can either be induced by treatment regiments or psychosocial factors. Cycloserine administration is frequently reported to be associated with psychiatric disorders. In this study, we examined the prevalence and characteristics of psychiatric disorders among MDR-TB patients in Sardjito Hospital, Yogyakarta, Indonesia. Methods: In this descriptive study, we studied medical records of MDR-TB patients admitted for MDR-TB treatments to Sardjito Hospital from January 2014 to July 2016 and screened for psychiatric disorders. Results: We found that 32.8% of the patients had psychiatric disorders, some of which had multiple psychiatric diagnoses (14.1%. The diagnoses were medication induced delirium, substance/medication induced psychotic disorder, substance/medication use depressive disorder, depressive type schizoaffective disorder, bipolar I disorder current episode severe manic with psychotic features, mild depression, moderate depression, major depression without psychotic features, major depression with psychotic features, adjustment disorders with mixed anxiety and depressed mood, adjustment disorder with anxiety, acute stress disorder, and insomnia. Psychiatric disorders were significantly associated with cycloserine dose and sex. Psychotic symptoms were significantly associated with sex and level of education. Conclusion: The presence of psychiatric disorders might disturb MDR-TB treatment resulting in poor outcomes. Precaution and prompt managements are required for psychiatric disorders in patients receiving MDR-TB treatment regiments.

Mutations inside rifampicin-resistance determining region of rpoB gene associated with rifampicin-resistance in Mycobacterium tuberculosis.

Science.gov (United States)

Zaw, Myo T; Emran, Nor A; Lin, Zaw

2018-04-26

Rifampicin (RIF) plays a pivotal role in the treatment of tuberculosis due to its bactericidal effects. Because the action of RIF is on rpoB gene encoding RNA polymerase β subunit, 95% of RIF resistant mutations are present in rpoB gene. The majority of the mutations in rpoB gene are found within an 81bp RIF-resistance determining region (RRDR). Literatures on RIF resistant mutations published between 2010 and 2016 were thoroughly reviewed. The most commonly mutated codons in RRDR of rpoB gene are 531, 526 and 516. The possibilities of absence of mutation in RRDR of rpoB gene in MDR-TB isolates in few studies was due to existence of other rare rpoB mutations outside RRDR or different mechanism of rifampicin resistance. Molecular methods which can identify extensive mutations associated with multiple anti-tuberculous drugs are in urgent need so that the research on drug resistant mutations should be extended. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

The Prevalence of acrA and acrB Genes Among Multiple-Drug Resistant Uropathogenic Escherichia coli Isolated From Patients With UTI in Milad Hospital, Tehran

Directory of Open Access Journals (Sweden)

Maleki

2016-09-01

Full Text Available Background Urinary tract infection (UTI is one of the most common infectious diseases and nosocomial infections worldwide, and uropathogenic Escherichia coli is the primary cause of UTI. Due to increased antibiotic resistance and the emergence of multidrug resistant (MDR UPEC clones, the treatment of UTI is difficult. The occurrence of MDR in E. coli has been attributed to the AcrAB-TolC complex of efflux pumps. Objectives The aim of this study was to complete a frequency evaluation of acrA and acrB genes among UPEC MDR strains isolated from patients with UTI who were admitted to Milad hospital in Tehran. Methods For 123 UPEC strains that were isolated and diagnosed from the urine samples of patients using biochemical tests, antibiotic susceptibility was carried out using the disc diffusion method according to CLSI guidelines. Isolates that were resistant to at least one antimicrobial agent in three or more of the categories were considered to be MDR. The presence and frequency of acrA and acrB genes was determined using PCR. Results The rates of antibiotic resistance to ampicillin, cefalotin, tetracycline, cefazolin, ceftriaxone, ceftizoxime, ceftazidime, ciprofloxacin, and cotrimoxazole were 82.9%, 78.1%, 61.1%, 49.5%, 38.2%, 30.2%, 26.1%, 42.2%, and 60.1%, respectively. The isolates were most sensitive to nitrofurantoin (95.9%, gentamicin (77.2%, and amikacin (71.5%. A total of 78% of the isolates were MDR. The frequency of the acrA gene was 82.90%, the acrB gene was 95.90% and acrA + acrB was 95.90%. There was no significant difference between acrA and acrB frequency relating to bacterial antibiotic resistance. Conclusions Our results showed that ways to control the treatment of UTI for the prevention of MDR occurrence should be sought. For a better study of efflux pumps, a comprehensive and detailed study regarding the presence of efflux pumps gees is required.

Reversing multidrug resistance in Caco-2 by silencing MDR1, MRP1, MRP2, and BCL-2/BCL-xL using liposomal antisense oligonucleotides.

Directory of Open Access Journals (Sweden)

Yu-Li Lo

Full Text Available Multidrug resistance (MDR is a major impediment to chemotherapy. In the present study, we designed antisense oligonucleotides (ASOs against MDR1, MDR-associated protein (MRP1, MRP2, and/or BCL-2/BCL-xL to reverse MDR transporters and induce apoptosis, respectively. The cationic liposomes (100 nm composed of N-[1-(2,3-dioleyloxypropyl]-n,n,n-trimethylammonium chloride and dioleoyl phosphotidylethanolamine core surrounded by a polyethylene glycol (PEG shell were prepared to carry ASOs and/or epirubicin, an antineoplastic agent. We aimed to simultaneously suppress efflux pumps, provoke apoptosis, and enhance the chemosensitivity of human colon adenocarcinoma Caco-2 cells to epirubicin. We evaluated encapsulation efficiency, particle size, cytotoxicity, intracellular accumulation, mRNA levels, cell cycle distribution, and caspase activity of these formulations. We found that PEGylated liposomal ASOs significantly reduced Caco-2 cell viability and thus intensified epirubicin-mediated apoptosis. These formulations also decreased the MDR1 promoter activity levels and enhanced the intracellular retention of epirubicin in Caco-2 cells. Epirubicin and ASOs in PEGylated liposomes remarkably decreased mRNA expression levels of human MDR1, MRP1, MRP2, and BCL-2. The combined treatments all significantly increased the mRNA expressions of p53 and BAX, and activity levels of caspase-3, -8, and -9. The formulation of epirubicin and ASOs targeting both pump resistance of MDR1, MRP1, and MRP2 and nonpump resistance of BCL-2/BCL-xL demonstrated more superior effect to all the other formulations used in this study. Our results provide a novel insight into the mechanisms by which PEGylated liposomal ASOs against both resistance types act as activators to epirubicin-induced apoptosis through suppressing MDR1, MRP1, and MRP2, as well as triggering intrinsic mitochondrial and extrinsic death receptor pathways. The complicated regulation of MDR highlights the necessity

High frequency of a single nucleotide substitution (c.-6-180T>G) of the canine MDR1/ABCB1 gene associated with phenobarbital-resistant idiopathic epilepsy in Border Collie dogs.

Science.gov (United States)

Mizukami, Keijiro; Yabuki, Akira; Chang, Hye-Sook; Uddin, Mohammad Mejbah; Rahman, Mohammad Mahbubur; Kushida, Kazuya; Kohyama, Moeko; Yamato, Osamu

2013-01-01

A single nucleotide substitution (c.-6-180T>G) associated with resistance to phenobarbital therapy has been found in the canine MDR1/ABCB1 gene in Border Collies with idiopathic epilepsy. In the present study, a PCR-restriction fragment length polymorphism assay was developed for genotyping this mutation, and a genotyping survey was carried out in a population of 472 Border Collies in Japan to determine the current allele frequency. The survey demonstrated the frequencies of the T/T wild type, T/G heterozygote, and G/G mutant homozygote to be 60.0%, 30.3%, and 9.8%, respectively, indicating that the frequency of the mutant G allele is extremely high (24.9%) in Border Collies. The results suggest that this high mutation frequency of the mutation is likely to cause a high prevalence of phenobarbital-resistant epilepsy in Border Collies.

Gradient phenomenon of multidrug resistance gene expression in breast cancer during neoadjuvant chemotherapy is related to disease progression

Directory of Open Access Journals (Sweden)

N. V. Litviakov

2013-01-01

Full Text Available The paper examined 106 patients with breast cancer (BC treated with neoadjuvant chemotherapy (NАС. In the biopsy material, derived from primary tumor before NAC and surgical samples after chemotherapy the expression of 8 multidrug resistance genes (MDR ABCB1, АВСВ2, ABCC1, ABCC2, АВСС5, ABCG1, ABCG2 и MVP was evaluated using quantitative RT-PCR. During the NAC course 75 % of patients manifested gradient phenomenon for gene expression that means a unidirectional change in the expression of all five MDR genes ABCB1, ABCC1, ABCC2, ABCG1 и ABCG2 closely associated with the NAC efficacy: the reduction in MDR gene expression was related to good response to NAC while the expression increase associated with poor response to NAC. In 25% of patients there was no such change in studied gene expression that means the lack of a gradient phenomenon. The objective was to study whether gradient phenomenon for MDR gene expression during NAC is related to disease free survival in breast cancer patients. Five-year metastasis-free survival in patients having a gradient phenomenon was 73 % versus 39 % in patients who lack a gradient phenomenon (log-rank test p=0,0018. So, the presence of a gradient phenomenon in patients is appeared to be associated with a good disease prognosis. It is assumed that the gradiThe paper examined 106 patients with breast cancer (BC treated with neoadjuvant chemotherapy (NАС. In the biopsy material, derived from primary tumor before NAC and surgical samples after chemotherapy the expression of 8 multidrug resistance genes (MDR ABCB1, АВСВ2, ABCC1, ABCC2, АВСС5, ABCG1, ABCG2 и MVP was evaluated using quantitative RT-PCR. During the NAC course 75 % of patients manifested gradient phenomenon for gene expression that means a unidirectional change in the expression of all five MDR genes ABCB1, ABCC1, ABCC2, ABCG1 и ABCG2 closely associated with the NAC efficacy: the reduction in MDR gene expression was related to good

Rapid diagnosis of pyrazinamide-resistant multidrug-resistant tuberculosis using a molecular-based diagnostic algorithm.

Science.gov (United States)

Simons, S O; van der Laan, T; Mulder, A; van Ingen, J; Rigouts, L; Dekhuijzen, P N R; Boeree, M J; van Soolingen, D

2014-10-01

There is an urgent need for rapid and accurate diagnosis of pyrazinamide-resistant multidrug-resistant tuberculosis (MDR-TB). No diagnostic algorithm has been validated in this population. We hypothesized that pncA sequencing added to rpoB mutation analysis can accurately identify patients with pyrazinamide-resistant MDR-TB. We identified from the Dutch national database (2007-11) patients with a positive Mycobacterium tuberculosis culture containing a mutation in the rpoB gene. In these cases, we prospectively sequenced the pncA gene. Results from the rpoB and pncA mutation analysis (pncA added to rpoB) were compared with phenotypic susceptibility testing results to rifampicin, isoniazid and pyrazinamide (reference standard) using the Mycobacterial Growth Indicator Tube 960 system. We included 83 clinical M. tuberculosis isolates containing rpoB mutations in the primary analysis. Rifampicin resistance was seen in 72 isolates (87%), isoniazid resistance in 73 isolates (88%) and MDR-TB in 65 isolates (78%). Phenotypic reference testing identified pyrazinamide-resistant MDR-TB in 31 isolates (48%). Sensitivity of pncA sequencing added to rpoB mutation analysis for detecting pyrazinamide-resistant MDR-TB was 96.8%, the specificity was 94.2%, the positive predictive value was 90.9%, the negative predictive value was 98.0%, the positive likelihood was 16.8 and the negative likelihood was 0.03. In conclusion, pyrazinamide-resistant MDR-TB can be accurately detected using pncA sequencing added to rpoB mutation analysis. We propose to include pncA sequencing in every isolate with an rpoB mutation, allowing for stratification of MDR-TB treatment according to pyrazinamide susceptibility. © 2014 The Authors Clinical Microbiology and Infection © 2014 European Society of Clinical Microbiology and Infectious Diseases.

Molecular characterization of multidrug-resistant Klebsiella pneumoniae isolates

Directory of Open Access Journals (Sweden)

Xiang-hua Hou

2015-09-01

Full Text Available Klebsiella pneumoniae is an important cause of healthcare-associated infections worldwide. Selective pressure, the extensive use of antibiotics, and the conjugational transmission of antibiotic resistance genes across bacterial species and genera facilitate the emergence of multidrug-resistant (MDR K. pneumoniae. Here, we examined the occurrence, phenotypes and genetic features of MDR K. pneumoniae isolated from patients in intensive care units (ICUs at the First Affiliated Hospital of Xiamen University in Xiamen, China, from January to December 2011. Thirty-eight MDR K. pneumoniae strains were collected. These MDR K. pneumoniae isolates possessed at least seven antibiotic resistance determinants, which contribute to the high-level resistance of these bacteria to aminoglycosides, macrolides, quinolones and β-lactams. Among these isolates, 24 strains were extended-spectrum β-lactamase (ESBL producers, 2 strains were AmpC producers, and 12 strains were both ESBL and AmpC producers. The 38 MDR isolates also contained class I (28/38 and class II integrons (10/38. All 28 class I-positive isolates contained aacC1, aacC4, orfX, orfX’ and aadA1 genes. β-lactam resistance was conferred through blaSHV (22/38, blaTEM (10/38, and blaCTX-M (7/38. The highly conserved blaKPC-2 (37/38 and blaOXA-23(1/38 alleles were responsible for carbapenem resistance, and a gyrAsite mutation (27/38 and the plasmid-mediated qnrB gene (13/38 were responsible for quinolone resistance. Repetitive-sequence-based PCR (REP-PCR fingerprinting of these MDR strains revealed the presence of five groups and sixteen patterns. The MDR strains from unrelated groups showed different drug resistance patterns; however, some homologous strains also showed different drug resistance profiles. Therefore, REP-PCR-based analyses can provide information to evaluate the epidemic status of nosocomial infection caused by MDR K. pneumoniae; however, this test lacks the power to discriminate some

Increased p38-MAPK is responsible for chemotherapy resistance in human gastric cancer cells

International Nuclear Information System (INIS)

Guo, Xianling; Zhang, Baihe; Wu, Mengchao; Wei, Lixin; Ma, Nannan; Wang, Jin; Song, Jianrui; Bu, Xinxin; Cheng, Yue; Sun, Kai; Xiong, Haiyan; Jiang, Guocheng

2008-01-01

Chemoresistance is one of the main obstacles to successful cancer therapy and is frequently associated with Multidrug resistance (MDR). Many different mechanisms have been suggested to explain the development of an MDR phenotype in cancer cells. One of the most studied mechanisms is the overexpression of P-glycoprotein (P-gp), which is a product of the MDR1 gene. Tumor cells often acquire the drug-resistance phenotype due to upregulation of the MDR1 gene. Overexpression of MDR1 gene has often been reported in primary gastric adenocarcinoma. This study investigated the role of p38-MAPK signal pathway in vincristine-resistant SGC7901/VCR cells. P-gp and MDR1 RNA were detected by Western blot analysis and RT-PCR amplification. Mitgen-activated protein kinases and function of P-gp were demonstrated by Western blot and FACS Aria cytometer analysis. Ap-1 activity and cell apoptosis were detected by Dual-Luciferase Reporter Assay and annexin V-PI dual staining. The vincristine-resistant SGC7901/VCR cells with increased expression of the multidrug-resistance 1 (MDR1) gene were resistant to P-gp-related drug and P-gp-unrelated drugs. Constitutive increases of phosphorylated p38-MAPK and AP-1 activities were also found in the drug-resistant cells. Inhibition of p38-MAPK by SB202190 reduced activator protein-1 (AP-1) activity and MDR1 expression levels and increased the sensitivity of SGC7901/VCR cells to chemotherapy. Activation of the p38-MAPK pathway might be responsible for the modulation of P-glycoprotein-mediated and P-glycoprotein-unmediated multidrug resistance in the SGC7901/VCR cell line

MDR-1 and MRP2 gene polymorphisms in Mexican epileptic pediatric patients with complex partial seizures.

Directory of Open Access Journals (Sweden)

David eEscalante-Santiago

2014-10-01

Full Text Available Although the Pgp efflux transport protein is overexpressed in resected tissue of patients with epilepsy, the presence of polymorphisms in MDR1 / ABCB1 and MRP2 / ABCC2 in patients with antiepileptic-drugs resistant epilepsy is controversial. The aim of this study was to perform an exploratory study to identify nucleotide changes and search new and reported mutations in patients with antiepileptic-drugs resistant epilepsy (ADR and patients with good response to anti-epileptic drugs (CTR in a rigorously selected population. We analyzed 22 samples from drug-resistant patients with epilepsy and 7 samples from patients with good response to anti-epileptic drugs. Genomic DNA was obtained from leukocytes. Eleven exons in both genes were genotyped. The concentration of drugs in saliva and plasma was determined. The concentration of valproic acid in saliva was lower in ADR than in CRT. In ABCB1, five reported SNPs and five unreported nucleotide changes were identified; rs2229109 (GA and rs2032582 (AT and AG were found only in the ADR. Of six SNPs associated with the ABCC2 that were found in the study population, rs3740066 (TT and 66744T>A (TG were found only in the ADR. The strongest risk factor in the ABCB1 gene was identified as the TA genotype of rs2032582, whereas for the ABCC2 gene the strongest risk factor was the T allele of rs3740066. The screening of SNPs in ACBC1 and ABCC2 indicates that the Mexican patients with epilepsy in this study display frequently reported ABCC1 polymorphisms; however, in the study subjects with a higher risk factor for drug resistance, new nucleotide changes were found in the ABCC2 gene. Thus, the population of Mexican patients with AED-resistant epilepsy used in this study exhibits genetic variability with respect to those reported in other study populations; however, it is necessary to explore this polymorphism in a larger population of patients with AED-resistant epilepsy.

Co-ordinate regulation of the cystic fibrosis and multidrug resistance genes in cystic fibrosis knockout mice.

Science.gov (United States)

Trezise, A E; Ratcliff, R; Hawkins, T E; Evans, M J; Freeman, T C; Romano, P R; Higgins, C F; Colledge, W H

1997-04-01

The cystic fibrosis (Cftr and multidrug resistance (Mdr1) genes encode structurally similar proteins which are members of the ABC transporter superfamily. These genes exhibit complementary patterns of expression in vivo, suggesting that the regulation of their expression may be co-ordinated. We have tested this hypothesis in vivo by examining Cftr and Mdr1 expression in cystic fibrosis knockout transgenic mice (Cftr(tm1CAM)). Cftr mRNA expression in Cftr(tm1CAM)/Cftr(tm1CAM) mice was 4-fold reduced in the intestine, as compared with littermate wild-type mice. All other Cftr(tm1CAM)/Cftr(tm1CAM) mouse tissues examined showed similar reductions in Cftr expression. In contrast, we observed a 4-fold increase in Mdr1 mRNA expression in the intestines of neonatal and 3- to 4-week-old Cftr(tm1CAM)/Cftr(tm1CAM) mice, as compared with age-matched +/+ mice, and an intermediate level of Mdr1 mRNA in heterozygous Cftr(tm1CAM) mice. In 10-week-old, Cftr(tm1CAM)/Cftr(tm1CAM) mice and in contrast to the younger mice, Mdr1 mRNA expression was reduced, by 3-fold. The expression of two control genes, Pgk-1 and Mdr2, was similar in all genotypes, suggesting that the changes in Mdr1 mRNA levels observed in the Cftr(tm1CAM)/Cftr(tm1CAM) mice are specific to the loss of Cftr expression and/or function. These data provide further evidence supporting the hypothesis that the regulation Cftr and Mdr1 expression is co-ordinated in vivo, and that this co-ordinate regulation is influenced by temporal factors.

Transmission of MDR and XDR tuberculosis in Shanghai, China.

Directory of Open Access Journals (Sweden)

Ming Zhao

Full Text Available Multidrug-resistant (MDR and extensively drug-resistant (XDR tuberculosis (TB are global health problems. We sought to determine the characteristics, prevalence, and relative frequency of transmission of MDR and XDR TB in Shanghai, one of the largest cities in Asia.TB is diagnosed in district TB hospitals in Shanghai, China. Drug susceptibility testing for first-line drugs was performed for all culture positive TB cases, and tests for second-line drugs were performed for MDR cases. VNTR-7 and VNTR-16 were used to genotype the strains, and prior treatment history and treatment outcomes were determined for each patient.There were 4,379 culture positive TB cases diagnosed with drug susceptibility test results available during March 2004 through November 2007. 247 (5.6% were infected with a MDR strain of M. tuberculosis and 11 (6.3% of the 175 MDR patients whose isolate was tested for susceptibility to second-line drugs, were XDR. More than half of the patients with MDR and XDR were newly diagnosed and had no prior history of TB treatment. Nearly 57% of the patients with MDR were successfully treated.Transmission of MDR and XDR strains is a serious problem in Shanghai. While a history of prior anti-TB treatment indicates which individuals may have acquired MDR or XDR TB, it does not accurately predict which TB patients have disease caused by transmission of MDR and XDR strains. Therefore, universal drug susceptibility testing is recommended for new and retreatment TB cases.

Different phenotypic and molecular mechanisms associated with multidrug resistance in Gram-negative clinical isolates from Egypt

Directory of Open Access Journals (Sweden)

Helmy OM

2017-12-01

Full Text Available Omneya M Helmy, Mona T Kashef Department of Microbiology and Immunology, Faculty of Pharmacy, Cairo University, Cairo, Egypt Objectives: We set out to investigate the prevalence, different mechanisms, and clonal relatedness of multidrug resistance (MDR among third-generation cephalosporin-resistant Gram-negative clinical isolates from Egypt.Materials and methods: A total of 118 third-generation cephalosporin-resistant Gram-negative clinical isolates were included in this study. Their antimicrobial susceptibility pattern was determined using Kirby–Bauer disk diffusion method. Efflux pump-mediated resistance was tested by the efflux-pump inhibitor-based microplate assay using chlorpromazine. Detection of different aminoglycoside-, β-lactam-, and quinolone-resistance genes was done using polymerase chain reaction. The genetic diversity of MDR isolates was investigated using random amplification of polymorphic DNA.Results: Most of the tested isolates exhibited MDR phenotypes (84.75%. The occurrence of efflux pump-mediated resistance in the different MDR species tested was 40%–66%. Acinetobacter baumannii isolates showed resistance to most of the tested antibiotics, including imipenem. The blaOXA-23-like gene was detected in 69% of the MDR A. baumannii isolates. The MDR phenotype was detected in 65% of Pseudomonas aeruginosa isolates, of which only 23% exhibited efflux pump-mediated resistance. On the contrary, efflux-mediated resistance to piperacillin and gentamicin was recorded in 47.5% of piperacillin-resistant and 25% of gentamicin-resistant MDR Enterobacteriaceae. Moreover, the plasmid-mediated quinolone-resistance genes (aac(6’-Ib-cr, qnrB, and qnrS were detected in 57.6% and 83.33% of quinolone-resistant MDR Escherichia coli and Klebsiella pneumoniae isolates, respectively. The β-lactamase-resistance gene blaSHV-31 was detected for the first time in one MDR K. pneumoniae isolate from an endotracheal tube specimen in Egypt

vPARP Adjusts MVP Expression in Drug-resistant Cell Lines in Conjunction with MDR Proteins.

Science.gov (United States)

Wojtowicz, Karolina; Januchowski, Radoslaw; Nowicki, Michal; Zabel, Maciej

2017-06-01

The definition of vault (ribonucleoprotein particles) function remains highly complex. Vaults may cooperate with multidrug resistance (MDR) proteins, supporting their role in drug resistance. This topic is the main theme of this publication. The cell viability was determined by an MTT assay. The protein expression was detected by western blot analysis. The proteins were knocked-down using siRNA. No major vault protein (MVP) in the LoVo/Dx and W1PR cell lines after tunicamycin treatment was shown. In W1PR cells with knocked-down MVP, a statistically significant decrease in cell viability was noted. In LoVo/Dx, W1TR and A2780TR cells were vault poly-ADP-ribose polymerase (vPARP) was knockdown, a decrease in cell viability was shown. Also, MVP silencing induced an increase in glycoprotein P (Pgp) expression in LoVo/Dx cells. MVP is important for the drug resistance of cancer cells, but it probably requires the presence of vPARP for full activation. Some correlations between MDR proteins and vaults exist. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

High Frequency of a Single Nucleotide Substitution (c.-6-180T>G of the Canine MDR1/ABCB1 Gene Associated with Phenobarbital-Resistant Idiopathic Epilepsy in Border Collie Dogs

Directory of Open Access Journals (Sweden)

Keijiro Mizukami

2013-01-01

Full Text Available A single nucleotide substitution (c.-6-180T>G associated with resistance to phenobarbital therapy has been found in the canine MDR1/ABCB1 gene in Border Collies with idiopathic epilepsy. In the present study, a PCR-restriction fragment length polymorphism assay was developed for genotyping this mutation, and a genotyping survey was carried out in a population of 472 Border Collies in Japan to determine the current allele frequency. The survey demonstrated the frequencies of the T/T wild type, T/G heterozygote, and G/G mutant homozygote to be 60.0%, 30.3%, and 9.8%, respectively, indicating that the frequency of the mutant G allele is extremely high (24.9% in Border Collies. The results suggest that this high mutation frequency of the mutation is likely to cause a high prevalence of phenobarbital-resistant epilepsy in Border Collies.

From MDR to MXR

DEFF Research Database (Denmark)

Litman, Thomas; Druley, T E; Stein, W D

2001-01-01

The ATP binding cassette (ABC) superfamily of membrane transporters is one of the largest protein classes known, and counts numerous proteins involved in the trafficking of biological molecules across cell membranes. The first known human ABC transporter was P-glycoprotein (P-gp), which confers...... multidrug resistance (MDR) to anticancer drugs. In recent years, we have obtained an increased understanding of the mechanism of action of P-gp as its ATPase activity, substrate specificity and pharmacokinetic interactions have been investigated. This review focuses on the functional characterization of P...... for reversal of MDR in cancer and for drug delivery, are discussed....

The process behind the expression of mdr-1/P-gp and mrp/MRP in human leukemia/lymphoma.

Science.gov (United States)

Hirose, Masao

2009-04-01

There is a controversy over the link between phenotypes of multidrug resistance (MDR) and clinical outcome in leukemia/lymphoma patients. This may be because the process behind the induction and loss of expression of genotypes and phenotypes by which MDR develops and the role of MDR in fresh cells of human leukemia/lymphoma are not clearly defined. P-glycoprotein (P-gp) increased and decreased along with mdr-1 expression in three cell lines out of five vincristine (VCR)-resistant cell lines. MRP appeared with increased mrp expression in the other two cell lines. After the drug was removed from the culture system, mdr-1/P-gp changed in parallel with the level of VCR resistance, although mrp and MRP did not. It was concluded that P-gp is directly derived from mdr-1 and that mdr-1/P-gp supports the VCR-resistance but mrp/MRP is not directly linked to the VCR-resistance. These results should contribute to a better understanding of MDR phenomenon in cancer.

Molecular characterization of mutations associated with resistance to second-line tuberculosis drug among multidrug-resistant tuberculosis patients from high prevalence tuberculosis city in Morocco.

Science.gov (United States)

Oudghiri, Amal; Karimi, Hind; Chetioui, Fouad; Zakham, Fathiah; Bourkadi, Jamal Eddine; Elmessaoudi, My Driss; Laglaoui, Amin; Chaoui, Imane; El Mzibri, Mohammed

2018-02-27

The emergence of extensively drug-resistant tuberculosis (XDR-TB) has raised public health concern for global TB control. Although multi drug-resistant tuberculosis (MDR- TB) prevalence and associated genetic mutations in Morocco are well documented, scarce information on XDR TB is available. Hence, the evaluation of pre-XDR and XDR prevalence, as well as the mutation status of gyrA, gyrB, rrs, tlyA genes and eis promoter region, associated with resistance to second line drugs, is of great value for better management of M/XDR TB in Morocco. To evaluate pre-XDR and XDR prevalence, as well as the mutation status of gyrA, gyrB, rrs, tlyA genes and eis promoter region, associated with resistance to second line drug resistance, in 703 clinical isolates from TB patients recruited in Casablanca, and to assess the usefulness of molecular tools in clinical laboratories for better management of M/XDR TB in Morocco. Drug susceptibility testing (DST) was performed by the proportional method for first line drugs, and then the selected MDR isolates were tested for second line drugs (Ofloxacin, Kanamycin, Amikacin and Capreomycin). Along with DST, all samples were subjected to rpoB, katG and p-inhA mutation analysis by PCR and DNA sequencing. MDR isolates as well as 30 pan-susceptible strains were subjected to PCR and DNA sequencing of gyrA, gyrB, rrs, tlyA genes and eis promoter, associated with resistance to fluoroquinolones and injectable drugs. Among the 703 analysed strains, 12.8% were MDR; Ser531Leu and Ser315Thr being the most common recorded mutations within rpoB and katG genes associated with RIF and INH resistance respectively. Drug susceptibility testing for second line drugs showed that among the 90 MDR strains, 22.2% (20/90) were resistant to OFX, 2.22% (2/90) to KAN, 3.33% (3/90) to AMK and 1.11% (1/90) to CAP. Genotypic analysis revealed that 19 MDR strains harbored mutations in the gyrA gene; the most recorded mutation being Asp91Ala accounting for 47.6% (10

Rapid Screening of MDR-TB in Cases of Extra Pulmonary Tuberculosis Using Geno Type MTBDRplus.

Directory of Open Access Journals (Sweden)

Richa Kumari

Full Text Available Drug resistance in tuberculosis is a major public health challenge in developing countries. The limited data available on drug resistance in extra pulmonary tuberculosis stimulated us to design our study on anti-tuberculosis drug resistance pattern in cases of extra pulmonary tuberculosis in a tertiary referral hospital of North India. We performed Geno Type MTBDRplus assay in comparison with conventional drug susceptibility testing by proportion method to study the mutation patterns in rpoB, katG and inhA genes.A total of 510 extra pulmonary samples were included in this study. After the smear microscopy, all the specimens were subjected for culture on Lowenstein Jensen (LJ media. Phenotypic drug susceptibility testing (DST was performed on LJ media for all the MTB isolates and compared with the results of Geno Type MTBDRplus assay which was performed with the DNA isolated from the culture by conventional method.Of 510 specimens cultured, the total culture positivity obtained was 11.8% (60 encompassing 54 (10.6% Mycobacterium tuberculosis and 6 (1.2% non-tubercular mycobacteria (NTM. DST results by Geno Type MTBDRplus assay and solid culture methods were compared in 51 MTB isolates excluding the two Rif indeterminate and one invalid test. Geno Type MTBDRplus accurately identified 13 of 14 rifampicin-resistant strains, 14 of 15 isoniazid-resistant strains and 13 of 14 as multi drug resistant tuberculosis (MDR-TB in comparison with conventional method. Sensitivity and specificity were 92.86% and 97.30% respectively for detection of RIF resistance, 93.33% and 94.44% respectively for detection of INH resistance, 92.86% and 97.30% respectively for detection of MDR-TB, while the overall concordance of Geno Type MTBDRplus assay with conventional DST was 94.11%. The turn-around time for performing Geno Type MTBDRplus assay test was 48 hours.The problem of MDR in extra pulmonary tuberculosis (EPTB cannot be overlooked and due attention on patients

Several Virulence Factors of Multidrug-Resistant Staphylococcus aureus Isolates From Hospitalized Patients in Tehran

Directory of Open Access Journals (Sweden)

Abdolmajid Ghasemian

2015-05-01

Full Text Available Background: Biofilm formation plays an important role in resistance of Staphylococcus aureus isolates; especially multidrug-resistant isolates are a threat to healthcare settings. Objectives: The aims of this study were to detect biofilm formation and presence of several related genes among multidrug-resistant (MDR isolates of Staphylococcus aureus. Patients and Methods: A total Of 209 S. aureus strains were isolated from patients and identified by conventional diagnostic tests. The multidrug-resistant MRSA isolates were detected by antibiotic susceptibility test. The phenotypic biofilm formation was detected by micro-titre tissue plate assay. The polymerase chain reaction (PCR was performed to detect the mecA, Staphylococcal Cassette Chromosome mec (SCCmec types, accessory gene regulatory (agr genes, the icaADBC and several genes encoding staphylococcal surface proteins including clfAB, fnbAB, fib, eno, can, ebps and bbp genes with specific primers. Results: Sixty-four (30.6% isolates were methicillin-resistant, among which thirty-six (56.2% were MDR. These isolates were resistant to amoxicillin, tetracycline, ciprofloxacin, gentamicin, erythromycin and trimethoprim-sulfamethoxazole (except to 6 isolates. All the isolates were susceptible to vancomycin and linezolid. All the MDR-MRSA harbored SCCmec type III. All the MDR- MRSA isolates were strong biofilm producers in the phenotypic test. The majority of MDR- MRSA was belonged to agrI (67%, n = 24, followed by agr II (17%, n = 6, agrIV (11%, n = 4 and agrIII (5.5%, n = 2. The frequency of icaADBC genes were 75% (n = 27, 61% (n = 22, 72% (n = 26 and 72% (n = 26, respectively. Furthermore, the prevalence of clfA, clfB, fnbA, fnbB, fib, can, eno, ebps and bbp genes was 100%, 100%, 67%, 56%, 80%, 63%, 78%, 7% and 0%, respectively. Furthermore, approximately all the MRSA was strong biofilm producers. Conclusions: Multidrug-resistant isolates produced biofilm strongly and the majority harbored most

Multimodal transfer of MDR by exosomes in human osteosarcoma.

Science.gov (United States)

Torreggiani, Elena; Roncuzzi, Laura; Perut, Francesca; Zini, Nicoletta; Baldini, Nicola

2016-07-01

Exosomes are extracellular vesicles released by both normal and tumour cells which are involved in a new intercellular communication pathway by delivering cargo (e.g., proteins, microRNAs, mRNAs) to recipient cells. Tumour-derived exosomes have been shown to play critical roles in different stages of tumour growth and progression. In this study, we investigated the potential role of exosomes to transfer the multidrug resistance (MDR) phenotype in human osteosarcoma cells. Exosomes were isolated by differential centrifugation of culture media from multidrug resistant human osteosarcoma MG-63DXR30 (Exo/DXR) and MG-63 parental cells (Exo/S). Exosome purity was examined by transmission electron microscopy and confirmed by immunoblot analysis for the expression of specific exosomal markers. Our data showed that exosomes derived from doxorubicin-resistant osteosarcoma cells could be taken up into secondary cells and induce a doxorubicin-resistant phenotype. The incubation of osteosarcoma cells with Exo/DXR decreased the sensitivity of parental cells to doxorubicin, while exposure with Exo/S was ineffective. In addition, we demonstrated that Exo/DXR expressed higher levels of MDR-1 mRNA and P-glycoprotein compared to Exo/S (p=0.03). Interestingly, both MDR-1 mRNA and P-gp increased in MG-63 cells after incubation with Exo/DXR, suggesting this as the main mechanism of exosome-mediated transfer of drug resistance. Our findings suggest that multidrug resistant osteosarcoma cells are able to spread their ability to resist the effects of doxorubicin treatment on sensitive cells by transferring exosomes carrying MDR-1 mRNA and its product P-glycoprotein.

Correlation between ability of biofilm formation with their responsible genes and MDR patterns in clinical and environmental Acinetobacter baumannii isolates.

Science.gov (United States)

Bardbari, Ali Mohammadi; Arabestani, Mohammad Reza; Karami, Manoochehr; Keramat, Fariba; Alikhani, Mohammad Yousef; Bagheri, Kamran Pooshang

2017-07-01

Acinetobacter baumannii potential to form biofilm and exhibit multiple antibiotic resistances may be responsible in its survival in hospital environment. Accordingly, our study was aimed to determine the correlation between ability of biofilm formation and the frequency of biofilm related genes with antibiotic resistance phenotypes, and also the categorization of their patterns in clinical and environmental isolates. A total of 75 clinical and 32 environmental strains of the A. baumannii were collected and identified via API 20NE. Antibiotic susceptibility was evaluated by disk diffusion and microdilution broth methods. Biofilm formation assay was performed by microtiter plate method. OXA types and biofilm related genes including Bla OXA-51 , Bla OXA-23 , Bla OXA-24 , Bla OXA-58 , bap, bla PER-1 , and ompA were amplified by PCR. The rate of MDR A. baumannii in clinical isolates (100%) was higher than environmental (81.2%) isolates (p baumannii isolates was associated with biofilm formation. There was a significant correlation between multiple drug resistance and biofilm formation. The clinical isolates had a higher ability to form strong biofilms compared to the environmental samples. Copyright © 2017 Elsevier Ltd. All rights reserved.

Expression of multidrug resistance markers ABCB1 (MDR-1/P-gp) and ABCC1 (MRP-1) in renal cell carcinoma.

LENUS (Irish Health Repository)

Walsh, Naomi

2009-01-01

BACKGROUND: Renal cell carcinoma patients respond poorly to conventional chemotherapy, this unresponsiveness may be attributable to multidrug resistance (MDR). The mechanisms of MDR in renal cancer are not fully understood and the specific contribution of ABC transporter proteins which have been implicated in the chemoresistance of various cancers has not been fully defined in this disease. METHODS: In this retrospective study the expression of two of these transporter efflux pumps, namely MDR-1 P-gp (ABCB1) and MRP-1 (ABCC1) were studied by immunohistochemistry in archival material from 95 renal cell carcinoma patients. RESULTS: In the first study investigating MDR-1 P-gp and MRP-1 protein expression patterns in renal cell carcinoma patients, high levels of expression of both efflux pumps are observed with 100% of tumours studied showing MDR-1 P-gp and MRP-1 positivity. CONCLUSION: Although these findings do not prove a causal role, the high frequency of tumours expressing these efflux pumps suggests that they may be important contributors to the chemoresistance of this tumour type.

[Small interfering RNA-mediated COX-2 gene silencing enhances chemosensitivity of KB/VCR cells by suppressing MDR-1 gene expression and P-glycoprotein activity].

Science.gov (United States)

Mo, Xianchao; Li, Weizhong

2014-05-01

To investigate the effect of small interfering RNA (siRNA)-mediated COX-2 gene silencing in enhancing the chemosensitivity of KB/VCR cell lines. KB/VCR cells were trasnfected with COX-2 siRNA were examined for expressions of COX-2 and MDR-1 mRNAs with RT-PCR and for Rho-123 accumulation using flow cytometry. MTT assay was used to analyze the proliferation of the transfected KB/VCR cells. Compared with the negative and blank control groups, COX-2 siRNA transfection resulted in significant growth inhibition of KB/VCR cells exposed to vincristine (PKB/VCR cells. COX-2 gene silencing can enhance the chemosensitivity of KB/VCR cells to vincristine, the mechanism of which may involve down-regulated MDR-1 gene expression and inhibition of P-glycoprotein activity.

Bakteri Simbion Gastropoda Pleuroploca trapesium Dari Perairan Ternate, Sebagai Alternatif Antibakteri MDR (Bacterial Symbiont Gastropoda Pleuroploca trapezium from Ternate, as Alternative Antibacterial MDR

Directory of Open Access Journals (Sweden)

Delianis Pringgenies

2014-03-01

The bacteria resistant to some antibiotics are known as multi drug resistant (MDR. To overcome the problem, it is needed to search for a new antibiotic compounds more effectively and efficiently. This study aims to identify potential from symbionts of Pleuroploca trapezium as a source of antibacteria MDR and identifying the bacteria that were active against the MDR. Samples were collected from Ternate, Maluku. Isolation of symbiotic bacteria, screening for bacteria which producing secondary metabolites as anti-MDR bacteria, antibacterial test, isolation of clinical pathogenic bacteria of MDR. Conducting anti-bacterial sensitivity test,  sensitivity test for antibacterial,  DNA exctraction, DNA amplification based on PCR method, DNA sequencing.  Result of 16S r-DNA sequence was then analyzed and edited using GENETYX program and followed by 16S rDNA sequence analysis. Screening of bacteria associated with P. trapezium resulted in 19 isolates with 5 active bacteria. Based on the size of the zone forming and the consistency of zone, so the best isolate is TPT 4.7. The identification shows that TPT 4.7 has a close relationship with the Paracoccus sp. MBIC4019 with homologi of 95%, which shows the relationship at the genus level. Its suggest that these results are very promising as a new antibacterial material. Keywords: antibacterial, symbiotic bacteria, Pleuroploca trapezium, multi drugs resistant

Multidrug resistance gene expression is controlled by steroid hormones in the secretory epithelium of the uterus

NARCIS (Netherlands)

Arceci, R. J.; Baas, F.; Raponi, R.; Horwitz, S. B.; Housman, D.; Croop, J. M.

1990-01-01

The multidrug resistance (mdr) gene family has been shown to encode a membrane glycoprotein, termed the P-glycoprotein, which functions as a drug efflux pump with broad substrate specificity. This multigene family is expressed in a tissue-specific fashion in a wide variety of normal and neoplastic

Evaluating the Role of Multidrug Resistance Protein 3 (MDR3) Inhibition in Predicting Drug-Induced Liver Injury Using 125 Pharmaceuticals.

Science.gov (United States)

Aleo, Michael D; Shah, Falgun; He, Kan; Bonin, Paul D; Rodrigues, A David

2017-05-15

The role of bile salt export protein (BSEP) inhibition in drug-induced liver injury (DILI) has been investigated widely, while inhibition of the canalicular multidrug resistant protein 3 (MDR3) has received less attention. This transporter plays a pivotal role in secretion of phospholipids into bile and functions coordinately with BSEP to mediate the formation of bile acid-containing biliary micelles. Therefore, inhibition of MDR3 in human hepatocytes was examined across 125 drugs (70 of Most-DILI-concern and 55 of No-DILI-concern). Of these tested, 41% of Most-DILI-concern and 47% of No-DILI-concern drugs had MDR3 IC 50 values of <50 μM. A better distinction across DILI classifications occurred when systemic exposure was considered where safety margins of 50-fold had low sensitivity (0.29), but high specificity (0.96). Analysis of physical chemical property space showed that basic compounds were twice as likely to be MDR3 inhibitors as acids, neutrals, and zwitterions and that inhibitors were more likely to have polar surface area (PSA) values of <100 Å 2 and cPFLogD values between 1.5 and 5. These descriptors, with different cutoffs, also highlighted a group of compounds that shared dual potency as MDR3 and BSEP inhibitors. Nine drugs classified as Most-DILI-concern compounds (four withdrawn, four boxed warning, and one liver injury warning in their approved label) had intrinsic potency features of <20 μM in both assays, thereby reinforcing the notion that multiple inhibitory mechanisms governing bile formation (bile acid and phospholipid efflux) may confer additional risk factors that play into more severe forms of DILI as shown by others for BSEP inhibitors combined with multidrug resistance-associated protein (MRP2, MRP3, MRP4) inhibitory properties. Avoiding physical property descriptors that highlight dual BSEP and MDR3 inhibition or testing drug candidates for inhibition of multiple efflux transporters (e.g., BSEP, MDR3, and MRPs) may be an effective

Genetic modification of haematopoietic cells for combined resistance to podophyllotoxins, other agents covered by MDR1-mediated efflux activity and nitrosoureas.

Science.gov (United States)

Baum, C; Peinert, S; Carpinteiro, A; Eckert, H G; Fairbairn, L J

2000-05-01

Genetic transfer and expression of drug-resistance functions into haematopoietic stem and progenitor cells is a promising means to overcome both the acute and longterm side-effects of cytotoxic drugs in bone marrow. Here, we describe a functional analysis of a retroviral vector that co-expresses human cDNAs for multidrug resistance 1/P-glycoprotein (MDR1) and a double mutant of O(6)-alkylguanine-alkyltransferase (hATPA/GA) to high levels. The hATPA/GA protein contains two amino acid substitutions that render it resistant to compounds such as O(6)-benzylguanine that inhibit the wild-type protein which is often overexpressed in resistant tumour cells. Evidence for simultaneous drug resistance of genetically modified primary murine progenitor cells to colchicine or the podophyllotoxin etoposide, both covered by MDR1-mediated efflux activity, and the nitrosourea BCNU, which is counteracted by hATPA/GA, is presented using in vitro colony assays.

The consequences of a sudden demographic change on the seroprevalence pattern, virulence genes, identification and characterisation of integron-mediated antibiotic resistance in the Salmonella enterica isolated from clinically diarrhoeic humans in Egypt.

Science.gov (United States)

Osman, K M; Hassan, W M M; Mohamed, R A H

2014-08-01

The present study was undertaken to identify and characterise integrons and integrated resistance gene cassettes among eight multidrug-resistant (MDR) Salmonella serovars isolated from humans in Egypt. Virulotyping by polymerase chain reaction (PCR) was used for the detection of the presence of virulence genes. Integron PCR was used to detect the presence of class 1 in the MDR strains. The associated individual resistance gene cassettes were identified using specific PCRs. The isolated serovars were Salmonella Grampian (C1; 2/5), Larose (C1; 1/5), Hato (B; 1/5) and Texas (B; 1/5). Among the Salmonella serovars, five Salmonella isolates showed the highest resistance to amoxicillin, ampicillin, chloramphenicol, lincomycin, gentamicin, nalidixic acid, streptomycin and trimethoprim (100%), followed by neomycin, norfloxacin and tetracycline (80%), while the lowest resistance was recorded to colistin sulphate and ciprofloxacin in percentages of 20 and 40%, respectively. The invA, avrA, ssaQ, mgtC, siiD and sopB genes were detected in all isolates (100%), while the spvC and gipA genes were totally (100%) absent from all isolates. The remaining three virulence genes were diversely distributed as follows: the bcfC gene was detected in all isolates except Salmonella Hato (80%); the sodC1 gene was detected only in Salmonella Grampian and Salmonella Texas (60%); and the sopE1 gene was detected only in Salmonella Grampian, Hato and Texas (60%). Class 1 integrons were detected in 90% of the MDR isolates, comprising serovars Muenster, Florian, Noya, Grampian, Larose, Hato and Texas. Of the class 1 integron-positive isolates, 45% harboured Salmonella genomic island 1 (SGI1) either right junction or right and left junction having an A-C-S-T phenotype. Of the class 1 integron-positive isolates, 44% harboured integron gene cassette aadA2, while 11% harboured the floR gene present in multidrug resistance flanked by two integrons of SGI1. The results of the present study indicate that

Factors influencing [F-18]2-fluoro-2-deoxy-D-glucose (F-18 FDG) accumulation in melanoma cells. Is FDG a substrate of multidrug resistance (MDR)?

International Nuclear Information System (INIS)

Yamada, Kiyoshi; Brink, I.; Engelhardt, R.

2005-01-01

In order to specify the influence of multidrug-resistance (MDR) on the accumulation of the PET tracer, F-18 FDG ([Fluorine-18]2-fluoro-2-deoxy-D-glucose, in melanoma cells, both the MDR function and expression of two human melanoma cell lines SK-MEL 23 and 24, were evaluated. The effects of MDR modulators on FDG accumulation and efflux were also investigated. A functional analysis using representative MDR fluorescent substrates and inhibitors clarified the following characteristics: SK-MEL 23 possesses a highly active function of multidrug resistance-associated protein (MRP), but not P-gp. SK-MEL 24 possesses weak functions of both MRP and P-gp. Western blot analysis using monoclonal antibodies for MDR expression demonstrated an exceedingly high MRP expression of SK-MEL 23 and only slight P-gp and MRP expression of SK-MEL 24, corresponding to the functional data. The efflux inhibition assay using F-18 FDG revealed a considerable retention of FDG in SK-MEL 23 in the presence of the MRP inhibitor probenecid. It was also found that the P-gp inhibitor verapamil depressed the FDG efflux of SK-MEL 24. Our present in vitro study suggests that FDG may be a substrate of MDR in some melanoma cells and further MDR may be one of the important factors affecting FDG-PET melanoma imaging. (author)

Polymorphisms in the xenobiotic transporter Multidrug Resistance 1 (MDR1 and interaction with meat intake in relation to risk of colorectal cancer in a Danish prospective case-cohort study

Directory of Open Access Journals (Sweden)

Overvad Kim

2009-11-01

Full Text Available Abstract Background The xenobiotic transporters, Multidrug Resistance 1 (MDR1/ABCB1 and Breast Cancer Resistance Protein (BCRP/ABCG2 may restrict intestinal absorption of various carcinogens, including heterocyclic amines (HCA and polycyclic aromatic hydrocarbons (PAH. Cyclooxygenase-2 (COX-2 derived prostaglandins promote gastrointestinal carcinogenesis, affecting angiogenesis, apoptosis, and invasiveness. The aim of this study was to investigate if polymorphisms in these genes were associated with risk of colorectal cancer (CRC, and to investigate possible interactions with lifestyle factors such as smoking, meat consumption, and NSAID use. Methods The following polymorphisms were analyzed; a synonymous MDR1 C3435T (rs1045642 in exon26, G-rs3789243-A in intron3, the functional BCRP C421A (rs2231142, the two COX-2 A-1195G (rs689466 and G-765C (rs20417 in the promoter region, and the COX-2 T8473C (rs5275 polymorphisms in the 3'-untranslated region. The polymorphisms were assessed together with lifestyle factors in a nested case-cohort study of 359 cases and a random cohort sample of 765 participants from the Danish prospective Diet, Cancer and Health study. Results Carriers of the variant allele of MDR1 intron 3 polymorphism were at 1.52-fold higher risk of CRC than homozygous wild type allele carriers (Incidence rate ratio (IRR = 1.52, 95% Confidence Interval (CI: 1.12-2.06. Carriers of the variant allele of MDR1 C3435T exon 26 had a lower risk of CRC than homozygous C-allele carriers (IRR = 0.71 (CI:0.50-1.00. There was interaction between these MDR1 polymorphisms and intake of red and processed meat in relation to CRC risk. Homozygous MDR1 C3435T C-allele carriers were at 8% increased risk pr 25 gram meat per day (CI: 1.00-1.16 whereas variant allele carriers were not at increased risk (p for interaction = 0.02. COX-2 and BCRP polymorphisms were not associated with CRC risk. There was interaction between NSAID use and MDR1 C3435T and COX-2 T

Polymorphisms in the xenobiotic transporter Multidrug Resistance 1 (MDR1) and interaction with meat intake in relation to risk of colorectal cancer in a Danish prospective case-cohort study

International Nuclear Information System (INIS)

Andersen, Vibeke; Østergaard, Mette; Christensen, Jane; Overvad, Kim; Tjønneland, Anne; Vogel, Ulla

2009-01-01

The xenobiotic transporters, Multidrug Resistance 1 (MDR1/ABCB1) and Breast Cancer Resistance Protein (BCRP/ABCG2) may restrict intestinal absorption of various carcinogens, including heterocyclic amines (HCA) and polycyclic aromatic hydrocarbons (PAH). Cyclooxygenase-2 (COX-2) derived prostaglandins promote gastrointestinal carcinogenesis, affecting angiogenesis, apoptosis, and invasiveness. The aim of this study was to investigate if polymorphisms in these genes were associated with risk of colorectal cancer (CRC), and to investigate possible interactions with lifestyle factors such as smoking, meat consumption, and NSAID use. The following polymorphisms were analyzed; a synonymous MDR1 C3435T (rs1045642) in exon26, G-rs3789243-A in intron3, the functional BCRP C421A (rs2231142), the two COX-2 A-1195G (rs689466) and G-765C (rs20417) in the promoter region, and the COX-2 T8473C (rs5275) polymorphisms in the 3'-untranslated region. The polymorphisms were assessed together with lifestyle factors in a nested case-cohort study of 359 cases and a random cohort sample of 765 participants from the Danish prospective Diet, Cancer and Health study. Carriers of the variant allele of MDR1 intron 3 polymorphism were at 1.52-fold higher risk of CRC than homozygous wild type allele carriers (Incidence rate ratio (IRR) = 1.52, 95% Confidence Interval (CI): 1.12-2.06). Carriers of the variant allele of MDR1 C3435T exon 26 had a lower risk of CRC than homozygous C-allele carriers (IRR = 0.71 (CI:0.50-1.00)). There was interaction between these MDR1 polymorphisms and intake of red and processed meat in relation to CRC risk. Homozygous MDR1 C3435T C-allele carriers were at 8% increased risk pr 25 gram meat per day (CI: 1.00-1.16) whereas variant allele carriers were not at increased risk (p for interaction = 0.02). COX-2 and BCRP polymorphisms were not associated with CRC risk. There was interaction between NSAID use and MDR1 C3435T and COX-2 T8473C (p-values for interaction 0

Antimicrobial resistance in equine faecal Escherichia coli isolates from North West England

Directory of Open Access Journals (Sweden)

Williams Nicola J

2010-04-01

Full Text Available Abstract Background Escherichia coli isolates of equine faecal origin were investigated for antibiotic resistance, resistance genes and their ability to perform horizontal transfer. Methods In total, 264 faecal samples were collected from 138 horses in hospital and community livery premises in northwest England, yielding 296 resistant E. coli isolates. Isolates were tested for susceptibility to antimicrobial drugs by disc diffusion and agar dilution methods in order to determine minimum inhibitory concentrations (MIC. PCR amplification was used to detect genes conferring resistance to: ampicillin (TEM and SHV beta-lactamase, chloramphenicol (catI, catII, catIII and cml, tetracycline (tetA, tetB, tetC, tetD, tet E and tetG, and trimethoprim (dfrA1, dfrA9, dfrA12, dfrA13, dfr7, and dfr17. Results The proportion of antibiotic resistant isolates, and multidrug resistant isolates (MDR was significantly higher in hospital samples compared to livery samples (MDR: 48% of hospital isolates; 12% of livery isolates, p dfr, TEM beta-lactamase, tet and cat, conferring resistance to trimethoprim, ampicillin, tetracycline and chloramphenicol, respectively. Within each antimicrobial resistance group, these genes occurred at frequencies of 93% (260/279, 91%, 86.8% and 73.5%, respectively; with 115/296 (38.8% found to be MDR isolates. Conjugation experiments were performed on selected isolates and MDR phenotypes were readily transferred. Conclusions Our findings demonstrate that E. coli of equine faecal origin are commonly resistant to antibiotics used in human and veterinary medicine. Furthermore, our results suggest that most antibiotic resistance observed in equine E. coli is encoded by well-known and well-characterized resistant genes common to E. coli from man and domestic animals. These data support the ongoing concern about antimicrobial resistance, MDR, antimicrobial use in veterinary medicine and the zoonotic risk that horses could potentially pose to

Multidrug-resistant pathogens in the food supply.

Science.gov (United States)

Doyle, Marjorie E

2015-04-01

Antimicrobial resistance, including multidrug resistance (MDR), is an increasing problem globally. MDR bacteria are frequently detected in humans and animals from both more- and less-developed countries and pose a serious concern for human health. Infections caused by MDR microbes may increase morbidity and mortality and require use of expensive drugs and prolonged hospitalization. Humans may be exposed to MDR pathogens through exposure to environments at health-care facilities and farms, livestock and companion animals, human food, and exposure to other individuals carrying MDR microbes. The Centers for Disease Control and Prevention classifies drug-resistant foodborne bacteria, including Campylobacter, Salmonella Typhi, nontyphoidal salmonellae, and Shigella, as serious threats. MDR bacteria have been detected in both meat and fresh produce. Salmonellae carrying genes coding for resistance to multiple antibiotics have caused numerous foodborne MDR outbreaks. While there is some level of resistance to antimicrobials in environmental bacteria, the widespread use of antibiotics in medicine and agriculture has driven the selection of a great variety of microbes with resistance to multiple antimicrobials. MDR bacteria on meat may have originated in veterinary health-care settings or on farms where animals are given antibiotics in feed or to treat infections. Fresh produce may be contaminated by irrigation or wash water containing MDR bacteria. Livestock, fruits, and vegetables may also be contaminated by food handlers, farmers, and animal caretakers who carry MDR bacteria. All potential sources of MDR bacteria should be considered and strategies devised to reduce their presence in foods. Surveillance studies have documented increasing trends in MDR in many pathogens, although there are a few reports of the decline of certain multidrug pathogens. Better coordination of surveillance programs and strategies for controlling use of antimicrobials need to be implemented in

Characteristics of plasmids in multi-drug-resistant Enterobacteriaceae isolated during prospective surveillance of a newly opened hospital in Iraq.

Directory of Open Access Journals (Sweden)

Xiao-Zhe Huang

Full Text Available BACKGROUND: Gram-negative multidrug-resistant (MDR bacteria are major causes of nosocomial infections, and antibiotic resistance in these organisms is often plasmid mediated. Data are scarce pertaining to molecular mechanisms of antibiotic resistance in resource constrained areas such as Iraq. METHODOLOGY/PRINCIPAL FINDINGS: In this study, all MDR Enterobacteriaceae (n = 38 and randomly selected non-MDR counterparts (n = 41 isolated from patients, healthcare workers and environmental surfaces in a newly opened hospital in Iraq were investigated to characterize plasmids found in these isolates and determine their contribution to antibiotic resistance. Our results demonstrated that MDR E. coli and K. pneumoniae isolates harbored significantly more (≥ 3 plasmids compared to their non-MDR counterparts, which carried ≤ 2 plasmids (p<0.01. Various large plasmids (~52 to 100 kb from representative isolates were confirmed to contain multiple resistance genes by DNA microarray analysis. Aminoglycoside (acc, aadA, aph, strA/B, and ksgA, β-lactam (bla(TEM1, bla(AMPC, bla(CTX-M-15, bla(OXA-1, bla(VIM-2 and bla(SHV, sulfamethoxazole/trimethoprim (sul/dfr, tetracycline (tet and chloramphenicol (cat resistance genes were detected on these plasmids. Additionally, multiple plasmids carrying multiple antibiotic resistance genes were found in the same host strain. Genetic transfer-associated genes were identified on the plasmids from both MDR and non-MDR isolates. Seven plasmid replicon types (FII, FIA, FIB, B/O, K, I1 and N were detected in the isolates, while globally disseminated IncA/C and IncHI1 plasmids were not detected in these isolates. CONCLUSIONS/SIGNIFICANCE: This is the first report of the characteristics of the plasmids found in Enterobacteriaceae isolated following the opening of a new hospital in Iraq. The information provided here furthers our understanding of the mechanisms of drug resistance in this specific region and their evolutionary

The roles of CDR1, CDR2, and MDR1 in kaempferol-induced suppression with fluconazole-resistant Candida albicans.

Science.gov (United States)

Shao, Jing; Zhang, MengXiang; Wang, TianMing; Li, Yue; Wang, ChangZhong

2016-01-01

Fungal infections caused by fluconazole-resistant Candida albicans are an intractable clinical problem, calling for new efficient antifungal drugs. Kaempferol, an active flavonoid, has been considered a potential candidate against Candida species. This work investigates the resistance reversion of kaempferol in fluconazole-resistant C. albicans and the underlying mechanism. The antifungal activities of fluconazole and/or kaempferol were assessed by a series of standard procedures including broth microdilution method, checkerboard assay and time-kill (T-K) test in nine clinical strains as well as a standard reference isolate of C. albicans. Subsequently, the morphological changes, the efflux of rhodamine 6G, and the expressions of CDR 1, CDR 2, and MDR 1 were analysed by scanning electron microscope (SEM), inverted fluorescence microscope and quantitative reverse transcription polymerase chain reaction (qRT-PCR) in C. albicans z2003. For all the tested C. albicans strains, the minimum inhibitory concentrations (MICs) of fluconazole and kaempferol ranged 0.25-32 and 128-256 μg/mL with a range of fractional inhibitory concentration index of 0.257-0.531. In C. albicans z2003, the expression of both CDR 1 and CDR 2 were decreased after exposure to kaempferol alone with negligible rhodamine 6G accumulation, while the expression of CDR 1, CDR 2 and MDR 1 were all decreased when fluconazole and kaempferol were used concomitantly with notable fluorescence of rhodamine 6G observed. Kaempferol-induced reversion in fluconazole-resistant C. albicans might be likely due to the suppression of the expression of CDR1, CDR2 and MDR1.

Construction of retrovirus vector taking MDR1/ACBC1 and its ...

African Journals Online (AJOL)

We successfully observed the expression of the reporter gene-GFP by using the green light fluorescence microscope and the p-glycoprotein (P-gp) expressed by exogenous gene MDR1 by Western Blotting. All these facts indicated that the retroviral vector PMX-flag-MDR1-GFP had successfully been transfected into ...

Isolation, Characterization and Anti-Multiple Drug Resistant (MDR ...

African Journals Online (AJOL)

(MDR) Bacterial Activity of Endophytic Fungi Isolated from ... Institute of Protection & Development of Beibu Wan Ocean Resources, Qinzhou University, Qinzhou, Guangxi Province, ..... isolated from secondary metabolites of the mangrove.

Molecular detection of multidrug-resistant Mycobacterium leprae from Indian leprosy patients.

Science.gov (United States)

Lavania, Mallika; Singh, Itu; Turankar, Ravindra P; Ahuja, Madhvi; Pathak, Vinay; Sengupta, Utpal; Das, Loretta; Kumar, Archana; Darlong, Joydeepa; Nathan, Rajeev; Maseey, Asha

2018-03-01

The emergence of multidrug-resistant (MDR) organisms for any infectious disease is a public health concern. Global efforts to control leprosy by intensive chemotherapy have led to a significant decrease in the number of registered patients. Currently recommended control measures for treating leprosy with multidrug therapy (MDT) were designed to prevent the spread of dapsone-resistant Mycobacterium leprae strains. Here we report the identification of MDR M. leprae from relapse leprosy patients from endemic regions in India. Resistance profiles to rifampicin, dapsone and ofloxacin of the isolated strains were confirmed by identification of mutations in genes previously shown to be associated with resistance to each drug. Between 2009-2016, slit-skin smear samples were collected from 239 relapse and 11 new leprosy cases from hospitals of The Leprosy Mission across India. DNA was extracted from the samples and was analysed by PCR targeting the rpoB, folP and gyrA genes associated with resistance to rifampicin, dapsone and ofloxacin, respectively, in M. leprae. M. leprae Thai-53 (wild-type) and Zensho-4 (MDR) were used as reference strains. Fifteen strains showed representative mutations in at least two resistance genes. Two strains showed mutations in all three genes responsible for drug resistance. Seven, seven and one strain, respectively, showed mutations in genes responsible for rifampicin and dapsone resistance, for dapsone and ofloxacin resistance and for rifampicin and ofloxacin resistance. This study showed the emergence of MDR M. leprae in MDT-treated leprosy patients from endemic regions of India. Copyright © 2017 International Society for Chemotherapy of Infection and Cancer. Published by Elsevier Ltd. All rights reserved.

Use of GenoType® MTBDRplus assay to assess drug resistance and mutation patterns of multidrug-resistant tuberculosis isolates in northern India

Directory of Open Access Journals (Sweden)

A K Maurya

2013-01-01

Full Text Available Purpose: The emergence and spread of multidrug-resistant tuberculosis (MDR-TB is a major public health problem. The diagnosis of MDR-TB is of paramount importance in establishing appropriate clinical management and infection control measures. The aim of this study was to evaluate drug resistance and mutational patterns in clinical isolates MDR-TB by GenoType® MTBDRplus assay. Material and Methods: A total of 350 non-repeated sputum specimens were collected from highly suspected drug-resistant pulmonary tuberculosis (PTB cases; which were processed by microscopy, culture, differentiation and first line drug susceptibility testing (DST using BacT/ALERT 3D system. Results: Among a total of 125 mycobacterium tuberculosis complex (MTBC strains, readable results were obtained from 120 (96% strains by GenoType® MTBDRplus assay. Only 45 MDR-TB isolates were analysed for the performance, frequency and mutational patterns by GenoType® MTBDRplus assay. The sensitivity of the GenoType® MDRTBplus assay for detecting individual resistance to rifampicin (RIF, isoniazid (INH and multidrug resistance was found to be 95.8%, 96.3% and 97.7%, respectively. Mutation in codon S531L of the rpoB gene and codon S315T1 of katG genes were dominated in MDR-TB strains, respectively (P < 0.05. Conclusions: The GenoType® MTBDRplus assay is highly sensitive with short turnaround times and a rapid test for the detection of the most common mutations conferring resistance in MDR-TB strains that can readily be included in a routine laboratory workflow.

Development of a Patient-Centred, Psychosocial Support Intervention for Multi-Drug-Resistant Tuberculosis (MDR-TB Care in Nepal.

Directory of Open Access Journals (Sweden)

Sudeepa Khanal

Full Text Available Multi-drug-resistant tuberculosis (MDR-TB poses a major threat to public health worldwide, particularly in low-income countries. The current long (20 month and arduous treatment regime uses powerful drugs with side-effects that include mental ill-health. It has a high loss-to-follow-up (25% and higher case fatality and lower cure-rates than those with drug sensitive tuberculosis (TB. While some national TB programmes provide small financial allowances to patients, other aspects of psychosocial ill-health, including iatrogenic ones, are not routinely assessed or addressed. We aimed to develop an intervention to improve psycho-social well-being for MDR-TB patients in Nepal. To do this we conducted qualitative work with MDR-TB patients, health professionals and the National TB programme (NTP in Nepal. We conducted semi-structured interviews (SSIs with 15 patients (10 men and 5 women, aged 21 to 68, four family members and three frontline health workers. In addition, three focus groups were held with MDR-TB patients and three with their family members. We conducted a series of meetings and workshops with key stakeholders to design the intervention, working closely with the NTP to enable government ownership. Our findings highlight the negative impacts of MDR-TB treatment on mental health, with greater impacts felt among those with limited social and financial support, predominantly married women. Michie et al's (2011 framework for behaviour change proved helpful in identifying corresponding practice- and policy-level changes. The findings from this study emphasise the need for tailored psycho-social support. Recent work on simple psychological support packages for the general population can usefully be adapted for use with people with MDR-TB.

Molecular Characterization of Multidrug Resistant Uropathogenic E. Coli Isolates from Jordanian Patients.

Science.gov (United States)

Nairoukh, Yacoub R; Mahafzah, Azmi M; Irshaid, Amal; Shehabi, Asem A

2018-01-01

Emergence of multi-drug resistant uropathogenic E. coli strains is an increasing problem to empirical treatment of urinary tract infections in many countries. This study investigated the magnitude of this problem in Jordan. A total of 262 E. coli isolates were recovered from urine samples of Jordanian patients which were suspected to have urinary tract infections (UTIs). All isolates were primarily identified by routine biochemical tests and tested for antimicrobial susceptibility by disc diffusion method. Fifty representative Multidrug Resistance (MDR) E. coli isolates to 3 or more antibiotic classes were tested for the presence of resistance genes of blaCTX-M- 1, 9 and 15, carbapenemase ( blaIMP, blaVIM, blaNDM-1, blaOXA-48 ), fluoroquinolones mutated genes ( parC and gyrA ) and clone of ST131 type using PCR methods. A total of 150/262 (57.3%) of E. coli isolates were MDR. Urine samples of hospitalized patients showed significantly more MDR isolates than outpatients. Fifty representative MDR E. coli isolates indicated the following molecular characteristics: All were positive for mutated parC gene and gyrA and for ST131 clone, and 78% were positive for genes of CTX-M-15 , 76% for CTX-M-I and for 8% CTX-M-9 , respectively. Additionally, all 50 MDR E. coli isolates were negative for carbapenemase genes ( blaIMP, blaVIM, blaNDM-1, blaOXA-48 ), except of one isolate was positive for blaKPC-2 . This study indicates alarming high rates recovery of MDR uropathogenic E. coli from Jordanian patients associated with high rates of positive ST131 clone, fluoroquinolone resistant and important types of blaCTX-M.

P-Glycoprotein/MDR1 regulates pokemon gene transcription through p53 expression in human breast cancer cells.

Science.gov (United States)

He, Shengnan; Liu, Feng; Xie, Zhenhua; Zu, Xuyu; Xu, Wei; Jiang, Yuyang

2010-08-27

P-glycoprotein (Pgp), encoded by the multidrug resistance 1 (MDR1) gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy.

Efficacy and safety profile of linezolid in the treatment of multidrug-resistant (MDR) and extensively drug-resistant (XDR) tuberculosis: a systematic review and meta-analysis.

Science.gov (United States)

Agyeman, Akosua Adom; Ofori-Asenso, Richard

2016-06-22

Treatment options for drug-resistant tuberculosis are still limited. Linezolid has been recommended for treatment of patients with multidrug-resistant (MDR) or extensively-drug-resistant (XDR) tuberculosis, although uncertainties remain regarding its safety and tolerability in these circumstances. To systematically evaluate the existing evidence regarding the efficacy and tolerability of linezolid in the treatment of MDR or XDR tuberculosis. We conducted a systematic review and meta-analysis in accordance with the PRISMA guidelines. Searches were conducted in PubMed, Web of Science and EMBASE followed by direct search of abstracts in the International Journal of Tuberculosis and Lung Disease to retrieve primary studies published between January 2000 and January 2016 assessing linezolid efficacy and safety in the treatment of drug-resistant TB. We evaluated the occurrence of outcomes including culture conversion, treatment success and incidence of adverse events such as myelosuppression and neuropathy. Twenty-three (23) studies conducted in fourteen (14) countries and involving 507 patients were retrieved. Only 1 randomized controlled trial was identified and none of the identified studies involved participants from Africa. The pooled proportion for treatment success was 77.36 % (95 % CI = 71.38-82.83 %, I(2) = 37.6 %) with culture conversion rate determined as 88.45 % (95 % CI = 83.82-92.38 %, I(2) = 45.4 %). There was no strong evidence for both culture conversion (p = 0.0948) and treatment success (p = 0.0695) between linezolid daily doses ≤ 600 and > 600 mg. Only myelosuppression showed a strong statistical significance (p linezolid also showed no significance upon dose comparisons (p = 0.3213, p = 0.9050 respectively). Available evidence presents Linezolid as a viable option in the treatment of MDR/XDR TB although patients ought to be monitored closely for the incidence of major adverse events such as myelosuppression and

Characterization of a Novel 99mTc-Carbonyl Complex as a Functional Probe of MDR1 P-Glycoprotein Transport Activity

Directory of Open Access Journals (Sweden)

Mary Dyszlewski

2002-01-01

Full Text Available Multidrug resistance (MDR mediated by overexpression of MDR1 P-glycoprotein (Pgp is one of the best characterized barriers to chemotherapy in cancer patients. Furthermore, the protective function of Pgp-mediated efflux of xenobiotics in various organs has a profound effect on the bioavailability of drugs in general. Thus, there is an expanding requirement to noninvasively interrogate Pgp transport activity in vivo. We herein report the Pgp recognition properties of a novel 99mTc(I-tricarbonyl complex, [99mTc(CO3(MIBI3] + (Tc-CO-MIBI. Tc-CO-MIBI showed 60-fold higher accumulation in drug-sensitive KB 3–1 cells compared to colchicine-selected drug-resistant KB 8-5 cells. In KB 8-5 cells, tracer enhancement was observed with the potent MDR modulator LY335979 (EC50 = 62 nM. Similar behavior was observed using drug-sensitive MCF-7 breast adenocarcinoma cells and MCF-7/MDR1 stable transfectants, confirming that Tc-CO-MIBI is specifically excluded by overexpression of MDR1 Pgp. By comparison, net accumulation in control H69 lung tumor cells was 9-fold higher than in MDR-associated protein (MRP1-expressing H69AR cells, indicating only modest transport by MRP1. Biodistribution analysis following tail vein injection of Tc-CO-MIBI showed delayed liver clearance as well as enhanced brain uptake and retention in mdr1a/1b(−/− gene deleted mice versus wild-type mice, directly demonstrating that Tc-CO-MIBI is a functional probe of Pgp transport activity in vivo.

Do polymorphisms in MDR1 and CYP3A5 genes influence the risk of cytogenetic relapse in patients with chronic myeloid leukemia on imatinib therapy?

Science.gov (United States)

Harivenkatesh, Natarajan; Kumar, Lalit; Bakhshi, Sameer; Sharma, Atul; Kabra, Madhulika; Velpandian, Thirumurthy; Gogia, Ajay; Shastri, Shivaram S; Gupta, Yogendra Kumar

2017-09-01

Influence of polymorphisms in the genes coding for imatinib transporters and metabolizing enzymes on cytogenetic relapse in patients with chronic myeloid leukemia (CML) is not known. One hundred and four patients (52 cases with cytogenetic relapse and 52 controls without relapse) with chronic-phase CML on imatinib therapy and have completed 5 years of follow-up were enrolled. The following single nucleotide polymorphisms (SNPs) were genotyped; C1236T, C3435T, G2677T/A in MDR1 gene and A6986G in CYP3A5 gene, using PCR-RFLP method and validated by direct gene sequencing. Imatinib trough levels were measured using LC-MS/MS. Patients with CC genotype for MDR1-C1236T polymorphism were at significantly higher risk for cytogenetic relapse [OR =4.382, 95% CI (1.145, 16.774), p = .022], while those with TT genotype for MDR1-C3435T polymorphism had significantly lower risk of relapse [OR =0.309, 95% CI (0.134, 0.708), p = .005]. Imatinib trough levels were lower in patients with relapse compared to those without relapse (1551.4 ± 1324.1 vs. 2154.2 ± 1358.3 ng/mL; p = .041). MDR1-C3435T genotype [adjusted-OR: 0.266; 95% CI (0.111, 0.636); p = .003] and trough levels (p = .014) were independent predictors of relapse in multivariate analysis. To conclude, C1236T and C3435T polymorphisms in MDR1 gene and trough levels significantly influence the risk of cytogenetic relapse. MDR1-C3435T genotype might emerge as a potential biomarker to predict the risk of cytogenetic relapse in patients with CML.

P-Glycoprotein/MDR1 Regulates Pokemon Gene Transcription Through p53 Expression in Human Breast Cancer Cells

Directory of Open Access Journals (Sweden)

Wei Xu

2010-08-01

Full Text Available P-glycoprotein (Pgp, encoded by the multidrug resistance 1 (MDR1 gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy.

Breed distribution of the nt230(del4) MDR1 mutation in dogs.

Science.gov (United States)

Gramer, Irina; Leidolf, Regina; Döring, Barbara; Klintzsch, Stefanie; Krämer, Eva-Maria; Yalcin, Ebru; Petzinger, Ernst; Geyer, Joachim

2011-07-01

A 4-bp deletion mutation associated with multiple drug sensitivity exists in the canine multidrug resistance (MDR1) gene. This mutation has been detected in more than 10 purebred dog breeds as well as in mixed breed dogs. To evaluate the breed distribution of this mutation in Germany, 7378 dogs were screened, including 6999 purebred and 379 mixed breed dogs. The study included dog breeds that show close genetic relationship or share breeding history with one of the predisposed breeds but in which the occurrence of the MDR1 mutation has not been reported. The breeds comprised Bearded Collies, Anatolian Shepherd Dog, Greyhound, Belgian Tervuren, Kelpie, Borzoi, Australian Cattle Dog and the Irish Wolfhound. The MDR1 mutation was not detected is any of these breeds, although it was found as expected in the Collie, Longhaired Whippet, Shetland Sheepdog, Miniature Australian Shepherd, Australian Shepherd, Wäller, White Swiss Shepherd, Old English Sheepdog and Border Collie with varying allelic frequencies for the mutant MDR1 allele of 59%, 45%, 30%, 24%, 22%, 17%, 14%, 4% and 1%, respectively. Allelic frequencies of 8% and 2% were determined in herding breed mixes and unclassified mixed breeds, respectively. Because of its widespread breed distribution and occurrence in many mixed breed dogs, it is difficult for veterinarians and dog owners to recognise whether MDR1-related drug sensitivity is relevant for an individual animal. This study provides a comprehensive overview of all affected dog breeds and many dog breeds that are probably unaffected on the basis of ∼15,000 worldwide MDR1 genotyping data. Copyright © 2010 Elsevier Ltd. All rights reserved.

The emergence of a novel sequence type of MDR Acinetobacter baumannii from the intensive care unit of an Egyptian tertiary care hospital.

Science.gov (United States)

Ghaith, Doaa Mohammad; Zafer, Mai Mahmoud; Al-Agamy, Mohamed Hamed; Alyamani, Essam J; Booq, Rayan Y; Almoazzamy, Omar

2017-05-10

Acinetobacter baumannii is known for nosocomial outbreaks worldwide. In this study, we aimed to investigate the antibiotic susceptibility patterns and the clonal relationship of A. baumannii isolates from the intensive care unit (ICU) of an Egyptian hospital. In the present study, 50 clinical isolates of multidrug resistant (MDR)-A. baumannii were obtained from patients admitted into the ICU from June to December 2015. All isolates were analyzed for antimicrobial susceptibilities. Multiplex PCR was performed to detect genes encoding oxacillinase genes (bla OXA-51 -like, bla OXA-23 -like, bla OXA-24 -like, and bla OXA-58 -like). Multilocus sequence typing (MLST) based on the seven-gene scheme (gltA, gyrB, gdhB, recA, cpn60, gpi, rpoD) was used to examine these isolates. All A. baumannii clinical isolates showed the same resistance pattern, characterized by resistance to most common antibiotics including imipenem (MIC ≥ 8μ/mL), with the only exception being colistin. Most isolates were positive for bla OXA-51 -like and bla OXA-23 -like (100 and 96%, respectively); however, bla OXA-24 -like and bla OXA-58 -like were not detected. MLST analysis identified different sequence types (ST195, ST208, ST231, ST441, ST499, and ST723) and a new sequence type (ST13929) with other sporadic strains. MDR A. baumannii strains harboring bla OXA-23 -like genes were widely circulating in this ICU. MLST was a powerful tool for identifying and epidemiologically typing our strains. Strict infection control measures must be implemented to contain the worldwide spread of MDR A. baumannii in ICUs.

Fungicide-driven evolution and molecular basis of multidrug resistance in field populations of the grey mould fungus Botrytis cinerea.

Directory of Open Access Journals (Sweden)

Matthias Kretschmer

2009-12-01

Full Text Available The grey mould fungus Botrytis cinerea causes losses of commercially important fruits, vegetables and ornamentals worldwide. Fungicide treatments are effective for disease control, but bear the risk of resistance development. The major resistance mechanism in fungi is target protein modification resulting in reduced drug binding. Multiple drug resistance (MDR caused by increased efflux activity is common in human pathogenic microbes, but rarely described for plant pathogens. Annual monitoring for fungicide resistance in field isolates from fungicide-treated vineyards in France and Germany revealed a rapidly increasing appearance of B. cinerea field populations with three distinct MDR phenotypes. All MDR strains showed increased fungicide efflux activity and overexpression of efflux transporter genes. Similar to clinical MDR isolates of Candida yeasts that are due to transcription factor mutations, all MDR1 strains were shown to harbor activating mutations in a transcription factor (Mrr1 that controls the gene encoding ABC transporter AtrB. MDR2 strains had undergone a unique rearrangement in the promoter region of the major facilitator superfamily transporter gene mfsM2, induced by insertion of a retrotransposon-derived sequence. MDR2 strains carrying the same rearranged mfsM2 allele have probably migrated from French to German wine-growing regions. The roles of atrB, mrr1 and mfsM2 were proven by the phenotypes of knock-out and overexpression mutants. As confirmed by sexual crosses, combinations of mrr1 and mfsM2 mutations lead to MDR3 strains with higher broad-spectrum resistance. An MDR3 strain was shown in field experiments to be selected against sensitive strains by fungicide treatments. Our data document for the first time the rising prevalence, spread and molecular basis of MDR populations in a major plant pathogen in agricultural environments. These populations will increase the risk of grey mould rot and hamper the effectiveness of

Transmissible Plasmids and Integrons Shift Escherichia coli Population Toward Larger Multiple Drug Resistance Numbers.

Science.gov (United States)

Suhartono, Suhartono; Savin, Mary C; Gbur, Edward E

2018-04-01

Transmissible plasmids and integrons may play important roles in the persistence and spread of antibiotic-resistant bacteria throughout aquatic environment by accumulating antibiotic resistance genes (ARG). Class 1 and class 2 integron (intI), mobilization (mob), sulfamethoxazole resistance (sul), and trimethoprim resistance (dfr) genes were PCR-amplified and confirmed through DNA sequencing following plasmid extraction from 139 antibiotic-resistant Escherichia coli. E. coli had previously been recovered from wastewater treatment plant effluent and receiving stream water in Northwest Arkansas and isolates had expressed resistance to one to six antibiotics. Almost half of the total isolates (47%) carried putatively transmissible plasmids with mob F12 gene as the most frequently detected mobilization gene. When two or three mob genes were detected per isolate, there was a significant shift in the population toward larger multiple drug resistance (MDR) number. Class 1 and/or 2 integrons were prevalent (46%), and the presence of integron significantly shifted the isolate population toward larger MDR number. More isolates carried single or coexistence of two or three sul genes (99.3%), and single or a combination up to five dfr genes (89.3%) than had exhibited in vitro resistance to the respective antibiotics. These findings indicate not only the role of the wastewater treatment effluent and the stream environment in coaccumulation of ARG with transmissible plasmids and integrons in multiple antibiotic-resistant E. coli populations but also suggest that density of sul and dfr resistance genes within an isolate may serve as a biomarker for mobile MDR in general.

Active Sputum Monitoring Detects Substantial Rate of Multi-Drug Resistant Tuberculosis (MDR-TB) in an HIV-Infected Population in South Africa

Science.gov (United States)

Hassim, Shaheen; Shaw, Pamela A.; Sangweni, Phumelele; Malan, Lizette; Ntshani, Ella; Mathibedi, Monkwe Jethro; Stubbs, Nomso; Metcalf, Julia A; Eckes, Risa; Masur, Henry; Komati, Stephanus

2010-01-01

Background Tuberculosis (TB) co-infection with HIV is a substantial problem in South Africa. There has been a presumption that drug resistant strains of TB are common in South Africa, but few studies have documented this impression. Methods In Phidisa, a joint observational and randomized HIV treatment study for South African National Defence Force members and dependents, an initiative obtained microbiologic TB testing in subjects who appeared to be at high risk. We report results for HIV-infected subjects. Results TB was identified by culture in 116/584 (19.9%) of patients selected for sputum examination on the basis of suggestive symptoms. Smear was an insensitive technique for confirming the diagnosis: only 33% of culture-positive patients were identified by smear, with a 0.2% false positive rate. Of the 107 culture-positive individuals with susceptibility testing, 22 (20.6%) were identified to be MDR and 4 (3.7%) became extremely drug resistant tuberculosis (XDR) while under observation. Culture-positive cases with a history of TB treatment had more than twice the rate of MDR than those without, 27.1% vs. 11.9% (p=0.05). Conclusions TB is common in this cohort of HIV-infected patients. Smear was not a sensitive technique for identifying culture-positive cases in this health system. Drug susceptibility testing is essential to proper patient management because MDR was present in 20.6% of culture-positive patients. Better management strategies are needed to reduce the development of MDR-TB since so many such patients had received prior antituberculous therapy that was presumably not curative. PMID:20196651

Conserved hydrogen bonds and water molecules in MDR HIV-1 protease substrate complexes

Energy Technology Data Exchange (ETDEWEB)

Liu, Zhigang [Wayne State Univ., Detroit, MI (United States); Case Western Reserve Univ., Cleveland, OH (United States); Harbor Hospital Baltimore, MD (United States); Wang, Yong [Wayne State Univ., Detroit, MI (United States); Yedidi, Ravikiran S. [Wayne State Univ., Detroit, MI (United States); National Institutes of Health, Bethesda, MD (United States); Dewdney, Tamaria G. [Wayne State Univ., Detroit, MI (United States); Reiter, Samuel J. [Wayne State Univ., Detroit, MI (United States); Brunzelle, Joseph S. [Northwestern Univ. Feinberg School of Medicine, Chicago, IL (United States); Kovari, Iulia A. [Wayne State Univ., Detroit, MI (United States); Kovari, Ladislau C. [Wayne State Univ., Detroit, MI (United States)

2012-12-19

Success of highly active antiretroviral therapy (HAART) in anti-HIV therapy is severely compromised by the rapidly developing drug resistance. HIV-1 protease inhibitors, part of HAART, are losing their potency and efficacy in inhibiting the target. Multi-drug resistant (MDR) 769 HIV-1 protease (resistant mutations at residues 10, 36, 46, 54, 62, 63, 71, 82, 84, 90) was selected for the present study to understand the binding to its natural substrates. The nine crystal structures of MDR769 HIV-1 protease substrate hepta-peptide complexes were analyzed in order to reveal the conserved structural elements for the purpose of drug design against MDR HIV-1 protease. Our structural studies demonstrated that highly conserved hydrogen bonds between the protease and substrate peptides, together with the conserved crystallographic water molecules, played a crucial role in the substrate recognition, substrate stabilization and protease stabilization. Additionally, the absence of the key flap-ligand bridging water molecule might imply a different catalytic mechanism of MDR769 HIV-1 protease compared to that of wild type (WT) HIV-1 protease.

A Potato cDNA Encoding a Homologue of Mammalian Multidrug Resistant P-Glycoprotein

Science.gov (United States)

Wang, W.; Takezawa, D.; Poovaiah, B. W.

1996-01-01

A homologue of the multidrug resistance (MDR) gene was obtained while screening a potato stolon tip cDNA expression library with S-15-labeled calmodulin. The mammalian MDR gene codes for a membrane-bound P-glycoprotein (170-180 kDa) which imparts multidrug resistance to cancerous cells. The potato cDNA (PMDR1) codes for a polypeptide of 1313 amino acid residues (ca. 144 kDa) and its structural features are very similar to the MDR P-glycoprotein. The N-terminal half of the PMDR1-encoded protein shares striking homology with its C-terminal half, and each half contains a conserved ATP-binding site and six putative transmembrane domains. Southern blot analysis indicated that potato has one or two MDR-like genes. PMDR1 mRNA is constitutively expressed in all organs studied with higher expression in the stem and stolon tip. The PMDR1 expression was highest during tuber initiation and decreased during tuber development.

DESAIN PRIMER UNTUK AMPLIFIKASI FRAGMEN GEN inhA ISOLAT 134 MULTIDRUG RESISTANCE TUBERCULOSIS (MDR-TB DENGAN METODE POLYMERASE CHAIN REACTION

Directory of Open Access Journals (Sweden)

Luk Ketut Budi Maitriani

2015-10-01

Full Text Available ABSTRAK    : Penelitian ini bertujuan untuk memperoleh sepasang primer terbaik hasil desain secara in silico menggunakan program Clone Manager Suite 6 (University of Groningen. Primer ini didesain untuk digunakan dalam mengamplifikasi fragmen gen inhA isolat klinis Multidrug Resistance Tuberculosis (MDR-TB mencakup kodon 94 (nukleotida 280-282. Kodon 94 gen inhA merupakan posisi yang sering mengalami mutasi dan mengakibatkan koresisten terhadap isoniazid dan ethionamid. Desain primer menggunakan sekuen gen inhA Mycobacterium tuberculosis yang diperoleh dari situs www.ncbi.nlm.nih.gov (GenBank : AF106077. Hasil desain diperoleh sepasang primer terbaik dan diuji secara in vitro menggunakan metode Polymerase Chain Reaction (PCR. Template DNA yang digunakan adalah isolat klinis MDR-TB. Proses amplifikasi diawali dengan denaturasi awal pada 95°C selama 15 menit dan diikuti oleh 45 siklus amplifikasi (denaturasi pada suhu 94°C selama 1 menit, annealing pada 56°C selama 1 menit 20 detik dan elongasi pada 72°C selama 2 menit serta diakhiri dengan elongasi akhir pada 72°C selama 10 menit. Produk PCR dideteksi menggunakan elektroforesis gel agarosa 1,5%. Kesimpulan penelitian adalah diperoleh sepasang primer terbaik berdasarkan kriteria pada program Clone Manager Suite 6 (University of Groningen, meliputi: panjang primer, %GC, Tm (melting temperature, interaksi primer (dimers dan hairpins, stabilitas primer, repeats, runs dan false priming. Primer tersebut meliputi, primer forward (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3’ dan primer reverse (pR-inhA 5’ CGACCGTCATCCA-GTTGTA 3’ dengan ukuran produk 460 pb.   ABSTRACT: The aim of this study was to obtain the best pair of primer as result in silico design using Clone Manager Suite 6 program (University of Groningen. The primer was designed for amplifying inhA gene fragment of Multidrug Resistance Tuberculosis (MDR-TB clinical isolates include codon 94 (nucleotide 280-282. Codon 94 of inhA gene is

Imaging and Targeted Therapy of Multidrug Resistance. Final Report

International Nuclear Information System (INIS)

Piwnica-Worms, David

2009-01-01

One focus area of DOE Office of Science was the Imaging of Gene Expression in Health and Disease in real time in tissue culture, whole animals and ultimately patients. Investigators of the Molecular Imaging Group, Washington University Medical School, ascribed to this objective and a major focus of this group directly tied into the DOE program through their efforts targeting the multidrug resistance gene (MDR1). Our plans for continuation of the program were to extend and build on this line of investigation, incorporating new molecular tools into our methodology to selectively inhibit MDR1 gene expression with novel modulation strategies. Two approaches were to be pursued: (1) high throughput screening of compounds that disrupted mutant p53 transactivation of the MDR1 promoter, and (2) knockdown of MDR1 messenger RNA with retroviral-mediated delivery of small interfering RNA constructs. These would be combined with our continuing effort to synthesize ligands and examine structure-activity relationships of bis-salicylaldehydes labeled with gallium-68 to generate PET agents for imaging MDR1 P-glycoprotein function. We would be uniquely positioned to correlate therapeutic modulation of MDR1 gene expression and protein function in the same systems in vivo using PET and bioluminescence reporters. Use of animal models such as the mdr1a/1b(-/-) gene deleted mice would also have enabled refined analysis of modulation and tracer pharmacokinetics in vivo. Overall, this DOE program and resultant tools would enable direct monitoring of novel therapeutic strategies and the MDR phenotype in relation to gene expression and protein function in vivo.

In vitro detection of mdr1 mRNA in murine leukemia cells with 111In-labeled oligonucleotide

International Nuclear Information System (INIS)

Bai Jingming; Yokoyama, Kunihiko; Kinuya, Seigo; Michigishi, Takatoshi; Tonami, Norihisa; Shiba, Kazuhiro; Matsushita, Ryo; Nomura, Masaaki

2004-01-01

radioactivity and specific uptake of antisense 111 In-ODN in drug-resistant cells may facilitate future gene imaging of mdr1 mRNA. (orig.)

Risk factors associated with multidrug-resistant tuberculosis (MDR-TB) in a tertiary armed force referral and teaching hospital, Ethiopia.

Science.gov (United States)

Demile, Biresaw; Zenebu, Amare; Shewaye, Haile; Xia, Siqing; Guadie, Awoke

2018-05-31

Ethiopia is one of the world health organization defined higher tuberculosis (TB) burden countries where the disease remains a massive public health threat. This study aimed to identify the prevalence and associated factors of multidrug-resistant tuberculosis (MDR-TB) using all armed force and civilian TB attendants in a tertiary level armed force hospital, where data for MDR-TB are previously unpublished. Cross-sectional study was conducted from September 2014 to August 2015 in a tertiary level Armed Force Referral and Teaching Hospital (AFRTH), Ethiopia. Armed force members (n = 251) and civilians (n = 130) which has been undergone TB diagnosis at AFRTH were included. All the specimens collected were subjected to microscopic smear observation, culture growth and drug susceptibility testing. Data were analyzed using statistical package for social sciences following binary logistic regression and Chi-square. P-values < 0.05 were considered statistically significant. Among 381 TB patients, 355 (93.2%) new and 26 (6.8%) retreatment cases were identified. Culture and smear positive TB cases were identified in 297 (77.9%) and 252 (66.1%) patients, respectively. The overall prevalence of MDR-TB in AFRTH was found 1.8% (1.3% for armed force members and 0.5% for civilian patients) all of which were previously TB treated cases. The entire treatment success rates were 92.6% achieved highest in the armed force (active and pension) than the civilian patients. The failure and dead cases were also found 2.5 and 4.6%, respectively. Using bivariate analysis, category of attendants and TB contact history were strong predictors of MDR-TB in armed force and civilian patients. Moreover, human immunodeficiency virus (HIV) infection also identified a significant (OR = 14.6; 95% CI = 2.3-92.1; p = 0.004) predicting factor for MDR-TB in armed force members. However, sex, age and body mass index were not associated factor for MDR-TB. In AFRTH, lower prevalence of

Role of MRP-1 and GST-Pi in MDR and their inhibition by ...

African Journals Online (AJOL)

Samia A. Ebeed

2016-08-16

Aug 16, 2016 ... Various mechanisms were proposed that underlie MDR in malignant cells. ... the gene that confers MDR in lung cancer cells. MRP1 acts in order to protect ... the many physiological and pathophysiological processes influ-.

Multidrug-Resistant CTX-M-(15, 9, 2)- and KPC-2-Producing Enterobacter hormaechei and Enterobacter asburiae Isolates Possessed a Set of Acquired Heavy Metal Tolerance Genes Including a Chromosomal sil Operon (for Acquired Silver Resistance).

Science.gov (United States)

Andrade, Leonardo N; Siqueira, Thiago E S; Martinez, Roberto; Darini, Ana Lucia C

2018-01-01

Bacterial resistance to antibiotics is concern in healthcare-associated infections. On the other hand, bacterial tolerance to other antimicrobials, like heavy metals, has been neglected and underestimated in hospital pathogens. Silver has long been used as an antimicrobial agent and it seems to be an important indicator of heavy metal tolerance. To explore this perspective, we searched for the presence of acquired silver resistance genes ( sil operon: silE, silS, silR, silC, silF, silB, silA , and silP ) and acquired extended-spectrum cephalosporin and carbapenem resistance genes ( bla CTX-M and bla KPC ) in Enterobacter cloacae Complex (EcC) ( n = 27) and Enterobacter aerogenes ( n = 8) isolated from inpatients at a general hospital. Moreover, the genetic background of the silA (silver-efflux pump) and the presence of other acquired heavy metal tolerance genes, pcoD (copper-efflux pump), arsB (arsenite-efflux pump), terF (tellurite resistance protein), and merA (mercuric reductase) were also investigated. Outstandingly, 21/27 (78%) EcC isolates harbored silA gene located in the chromosome. Complete sil operon was found in 19/21 silA -positive EcC isolates. Interestingly, 8/20 (40%) E. hormaechei and 5/6 (83%) E. asburiae co-harbored silA/pcoD genes and bla CTX-M-(15,2,or9) and/or bla KPC-2 genes. Frequent occurrences of arsB, terF , and merA genes were detected, especially in silA/pcoD -positive, multidrug-resistant (MDR) and/or CTX-M-producing isolates. Our study showed co-presence of antibiotic and heavy metal tolerance genes in MDR EcC isolates. In our viewpoint, there are few studies regarding to bacterial heavy metal tolerance and we call attention for more investigations and discussion about this issue in different hospital pathogens.

Multidrug-Resistant CTX-M-(15, 9, 2- and KPC-2-Producing Enterobacter hormaechei and Enterobacter asburiae Isolates Possessed a Set of Acquired Heavy Metal Tolerance Genes Including a Chromosomal sil Operon (for Acquired Silver Resistance

Directory of Open Access Journals (Sweden)

Leonardo N. Andrade

2018-03-01

Full Text Available Bacterial resistance to antibiotics is concern in healthcare-associated infections. On the other hand, bacterial tolerance to other antimicrobials, like heavy metals, has been neglected and underestimated in hospital pathogens. Silver has long been used as an antimicrobial agent and it seems to be an important indicator of heavy metal tolerance. To explore this perspective, we searched for the presence of acquired silver resistance genes (sil operon: silE, silS, silR, silC, silF, silB, silA, and silP and acquired extended-spectrum cephalosporin and carbapenem resistance genes (blaCTX−M and blaKPC in Enterobacter cloacae Complex (EcC (n = 27 and Enterobacter aerogenes (n = 8 isolated from inpatients at a general hospital. Moreover, the genetic background of the silA (silver-efflux pump and the presence of other acquired heavy metal tolerance genes, pcoD (copper-efflux pump, arsB (arsenite-efflux pump, terF (tellurite resistance protein, and merA (mercuric reductase were also investigated. Outstandingly, 21/27 (78% EcC isolates harbored silA gene located in the chromosome. Complete sil operon was found in 19/21 silA-positive EcC isolates. Interestingly, 8/20 (40% E. hormaechei and 5/6 (83% E. asburiae co-harbored silA/pcoD genes and blaCTX−M−(15,2,or9 and/or blaKPC−2 genes. Frequent occurrences of arsB, terF, and merA genes were detected, especially in silA/pcoD-positive, multidrug-resistant (MDR and/or CTX-M-producing isolates. Our study showed co-presence of antibiotic and heavy metal tolerance genes in MDR EcC isolates. In our viewpoint, there are few studies regarding to bacterial heavy metal tolerance and we call attention for more investigations and discussion about this issue in different hospital pathogens.

Molecular characterization of multidrug-resistant Mycobacterium tuberculosis isolated in Nepal.

Science.gov (United States)

Poudel, Ajay; Nakajima, Chie; Fukushima, Yukari; Suzuki, Haruka; Pandey, Basu Dev; Maharjan, Bhagwan; Suzuki, Yasuhiko

2012-06-01

Despite the fact that Nepal is one of the first countries globally to introduce multidrug-resistant tuberculosis (MDR-TB) case management, the number of MDR-TB cases is continuing to rise in Nepal. Rapid molecular tests applicable in this setting to identify resistant organisms would be an effective tool in reversing this trend. To develop such tools, information about the frequency and distribution of mutations that are associated with phenotypic drug resistance in Mycobacterium tuberculosis is required. In the present study, we investigated the prevalence of mutations in rpoB and katG genes and the inhA promoter region in 158 M. tuberculosis isolates (109 phenotypically MDR and 49 non-MDR isolates collected in Nepal) by DNA sequencing. Mutations affecting the 81-bp rifampin (RIF) resistance-determining region (RRDR) of rpoB were identified in 106 of 109 (97.3%) RIF-resistant isolates. Codons 531, 526, and 516 were the most commonly affected, at percentages of 58.7, 15.6, and 15.6%, respectively. Of 113 isoniazid (INH)-resistant isolates, 99 (87.6%) had mutations in the katG gene, with Ser315Thr being the most prevalent (81.4%) substitution. Mutations in the inhA promoter region were detected in 14 (12.4%) INH-resistant isolates. The results from this study provide an overview of the current situation of RIF and INH resistance in M. tuberculosis in Nepal and can serve as a basis for developing or improving rapid molecular tests to monitor drug-resistant strains in this country.

Polymorphisms in the xenobiotic transporter Multidrug Resistance 1 (MDR1) and interaction with meat intake in relation to risk of colorectal cancer in a Danish prospective case-cohort study

DEFF Research Database (Denmark)

Andersen, Vibeke; Østergaard, Mette; Christensen, Jane

2009-01-01

(rs5275) polymorphisms in the 3'-untranslated region. The polymorphisms were assessed together with lifestyle factors in a nested case-cohort study of 359 cases and a random cohort sample of 765 participants from the Danish prospective Diet, Cancer and Health study. Results Carriers of the variant......Background The xenobiotic transporters, Multidrug Resistance 1 (MDR1/ABCB1) and Breast Cancer Resistance Protein (BCRP/ABCG2) may restrict intestinal absorption of various carcinogens, including heterocyclic amines (HCA) and polycyclic aromatic hydrocarbons (PAH). Cyclooxygenase-2 (COX-2) derived...... prostaglandins promote gastrointestinal carcinogenesis, affecting angiogenesis, apoptosis, and invasiveness. The aim of this study was to investigate if polymorphisms in these genes were associated with risk of colorectal cancer (CRC), and to investigate possible interactions with lifestyle factors...

IncA/C plasmids harboured in serious multidrug-resistant Vibrio cholerae serogroup O139 strains in China.

Science.gov (United States)

Wang, Ruibai; Yu, Dong; Zhu, Lianhui; Li, Jie; Yue, Junjie; Kan, Biao

2015-03-01

Vibrio cholerae serogroup O139 emerged in 1992 and is one of two major serogroups to have caused cholera epidemics. After 1998, serious multidrug-resistant (MDR) O139 strains quickly became common in China, showing a multidrug resistance profile to eight antibiotics. It is a great threat to public health, and elucidation of its mechanisms of resistance will provide a helpful guide for the clinical treatment and prevention of cholera. In this study, mega-plasmids from MDR V. cholerae O139 strains were identified by pulsed-field gel electrophoresis (PFGE) without enzyme digestion. One plasmid was isolated and sequenced, belonging to the IncA/C family. Ten antibiotic resistance genes were found in the MDR regions, including a blaTEM-20 gene, and these genes endowed the host with resistance to seven antibiotics. This kind of plasmid was positive in 71.2% (198/278) of toxigenic O139 strains, and the rate of plasmid positivity was consistent with the yearly change in MDR rates of these strains. This study reveals an important role of the IncA/C family plasmid in the spread of multiple antibiotic resistance of epidemic V. cholerae serogroup O139 strains, which has recombined with plasmids from different bacterial species and transferred among V. cholerae strains. Copyright © 2014 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

Molecular screening of antibiotic-resistant determinants among multidrug-resistant clinical isolates of Proteus mirabilis from SouthWest Nigeria.

Science.gov (United States)

Alabi, Olumuyiwa Samuel; Mendonça, Nuno; Adeleke, Olufemi Ezekiel; da Silva, Gabriela Jorge

2017-06-01

Globally, and particularly in developing countries, the menace of anti-microbial resistance is an accelerating problem. In Nigeria, increase in bacterial resistance has been phenotypically established but due to high cost, few molecular studies have been reported. This study screened for presence of transferable resistance genes and mobile genetic elements (MGEs) such as integron among multi-drug resistant (MDR) P. mirabilis . A total of 108 P. mirabilis strains collected from five tertiary hospitals in SouthWest Nigeria were subjected to antibiotic susceptibility study using disc-diffusion method. Transferable resistance genes and MGEs were amplified using Polymerase chain reaction (PCR) analysis and amplicons sequenced. Varied resistance was observed against all the antibiotics tested. About 56% of the isolates were MDR including those from 0-12 years old children. PCR analysis revealed the presence of aac(6')-Ib (33.3%), plasmid mediated quinolone resistance (PMQR) genes [qnrA (36.7%), acc(6')-Ib-cr (5%)], TEM (48.3%), CTX-M (6.7%) and integrons class 1 (58.3%) and class 2 (26.7%). Sequencing analysis revealed bla TEM-1 , bla CTX-M-15 associated with IS Ecp1 and eight different arrays of gene cassettes: aadA1, aadA1-qacH, aadB-aadA2, aadA5, dfrA7, dfrA15, dfrA17, dfrA17-aadA5 . Transferable resistance genes in association with MGEs are present in Nigerian P. mirabilis thus their potential in disseminating resistance.

Regulation of multidrug resistance by microRNAs in anti-cancer therapy

Directory of Open Access Journals (Sweden)

Xin An

2017-01-01

Full Text Available Multidrug resistance (MDR remains a major clinical obstacle to successful cancer treatment. Although diverse mechanisms of MDR have been well elucidated, such as dysregulation of drugs transporters, defects of apoptosis and autophagy machinery, alterations of drug metabolism and drug targets, disrupti on of redox homeostasis, the exact mechanisms of MDR in a specific cancer patient and the cross-talk among these different mechanisms and how they are regulated are poorly understood. MicroRNAs (miRNAs are a new class of small noncoding RNAs that could control the global activity of the cell by post-transcriptionally regulating a large variety of target genes and proteins expression. Accumulating evidence shows that miRNAs play a key regulatory role in MDR through modulating various drug resistant mechanisms mentioned above, thereby holding much promise for developing novel and more effective individualized therapies for cancer treatment. This review summarizes the various MDR mechanisms and mainly focuses on the role of miRNAs in regulating MDR in cancer treatment.

Ecdysteroids Sensitize MDR and Non-MDR Cancer Cell Lines to Doxorubicin, Paclitaxel, and Vincristine but Tend to Protect Them from Cisplatin

Directory of Open Access Journals (Sweden)

Ana Martins

2015-01-01

Full Text Available Ecdysteroids, analogs of the insect molting hormone, are known for their various mild, nonhormonal bioactivities in mammals. Previously, we reported that less-polar ecdysteroids can modulate the doxorubicin resistance of a multidrug resistant (MDR mouse lymphoma cell line expressing the human ABCB1 transporter. Here, we describe the ability of 20-hydroxyecdysone (1 and its mono- (2 and diacetonide (3 derivatives to sensitize various MDR and non-MDR cancer cell lines towards doxorubicin, paclitaxel, vincristine, or cisplatin. Drug IC50 values with or without ecdysteroid were determined by MTT assay. Compound 3 significantly sensitized all cell lines to each chemotherapeutic except for cisplatin, whose activity was decreased. In order to overcome solubility and stability issues for the future in vivo administration of compound 3, liposomal formulations were developed. By means of their combination index values obtained via checkerboard microplate method, a formulation showed superior activity to that of compound 3 alone. Because ecdysteroids act also on non-ABCB1 expressing (sensitive cell lines, our results demonstrate that they do not or not exclusively exert their adjuvant anticancer activity as ABCB1 inhibitors, but other mechanisms must be involved, and they opened the way towards their in vivo bioactivity testing against various cancer xenografts.

A Comprehensive Investigation on Common Polymorphisms in the MDR1/ABCB1 Transporter Gene and Susceptibility to Colorectal Cancer

Czech Academy of Sciences Publication Activity Database

Campa, D.; Sainz, J.; Pardini, Barbara; Vodičková, Ludmila; Naccarati, Alessio; Rudolph, A.; Novotný, J.; Försti, A.; Buch, S.; von Schönfels, W.; Schafmayer, C.; Völzke, H.; Hoffmeister, M.; Frank, B.; Barale, R.; Hemminki, K.; Hampe, J.; Chang-Claude, J.; Brenner, H.; Vodička, Pavel; Canzian, F.

2012-01-01

Roč. 7, č. 3 (2012), e32784 E-ISSN 1932-6203 R&D Projects: GA ČR GA310/07/1430; GA ČR GAP304/10/1286 Institutional research plan: CEZ:AV0Z50390703 Keywords : single-nucleotide polymorphisms * resistance 1 mdr1 * p-glycoprotein Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.730, year: 2012

Molecular identification of marine symbiont bacteria of gastropods from the waters of the Krakal coast Yogyakarta and its potential as a Multi-Drug Resistant (MDR) antibacterial agent

Science.gov (United States)

Bahry, Muhammad Syaifudien; Pringgenies, Delianis; Trianto, Agus

2017-01-01

The resistance of pathogenic bacteria may occur to many types of antibiotics, especially in cases of non-compliance use of antibiotics, which likely to allow the evolution of Multi-Drug Resistant (MDR) bacteria. Gastropods seas are marine invertebrates informed capable of production of secondary metabolites as antibacterial MDR. The purpose of the study was the isolation and identification of gastropod symbiont bacteria found in the waters of Krakal, Gunung Kidul, Yogyakarta, which has the ability to produce antibacterial compounds against MDR(Escherichia coli, Enterobacter cloacae, Klebsiella pneumoniae, MRSA (methicillin-Resistant Staphylococcus aureus), Staphylococcus aureus, and Staphylococcus homunis) molecular. Stages of this research began with the isolation of bacteria, bacteria screening for anti-MDR compound, mass culture, and extraction, antibacterial activity test, DNA extraction, amplification by PCR 16S rDNA and sequencing. The results of the study showed that 19 isolates of bacteria were isolated from three species of gastropods namely Littorina scabra, Cypraea moneta and Conus ebraeus. Among them, 4 isolates showed activity against MDR test bacteria (E. coli, E. cloacae, K. pneumoniae, S. aureus and S. homunis). The highest activity was displayed by code LS.G1.8 isolate with the largest inhibition zone 15.47±0.45mm on S. humonis at 250 µg/disk concentration. Isolate CM.G2.1 showed largest inhibition zone, with 21.5±0.07mm on MRSA at 1000 µg/disk concentration and isolate the largest inhibition zone CM.G2.5 14.37±0.81mm on MRSA 14.37±0.81mm at concentrations 1000 µg/disk. The molecular identification of isolates LS.G1.8 has 99% homology with Bacillus subtilis and isolates CM.G2.1 has 99% homology with Bacillus pumillus.

IPEC-J2 MDR1, a Novel High-Resistance Cell Line with Functional Expression of Human P-glycoprotein (ABCB1) for Drug Screening Studies

DEFF Research Database (Denmark)

Saaby, Lasse; Helms, Hans Christian Cederberg; Brodin, Birger

2016-01-01

The P-glycoprotein (P-gp) efflux pump has been shown to affect drug distribution and absorption in various organs and to cause drug resistance in cancer therapy. The aim of this work was to develop a cell line to serve as a screening system for potential substrates of P-gp. This requires a cell...... line with high paracellular tightness, low expression of nonhuman ABC transporters, and high expression of functional human P-gp (ABCB1). The porcine intestinal epithelial cell line, IPEC-J2, was selected as a transfection host, due to its ability to form extremely high-resistance monolayers (>10,000 Ω......·cm(2)) and its low endogenous expression of ABC-type efflux transporters. The IPEC-J2 cells were transfected with a plasmid that contained the sequence of the human MDR1 gene, which encodes P-gp, followed by a selection of successfully transfected cells with geneticin and puromycin. The resulting cell...

Molecular epidemiology of multidrug-resistant Acinetobacter baumannii isolates in a university hospital in Nepal reveals the emergence of a novel epidemic clonal lineage.

Science.gov (United States)

Shrestha, Shovita; Tada, Tatsuya; Miyoshi-Akiyama, Tohru; Ohara, Hiroshi; Shimada, Kayo; Satou, Kazuhito; Teruya, Kuniko; Nakano, Kazuma; Shiroma, Akino; Sherchand, Jeevan Bdr; Rijal, Basista Psd; Hirano, Takashi; Kirikae, Teruo; Pokhrel, Bharat Mani

2015-11-01

The emergence of multidrug-resistant (MDR) Acinetobacter baumannii has become a serious medical problem worldwide. To clarify the genetic and epidemiological properties of MDR A. baumannii strains isolated from a medical setting in Nepal, 246 Acinetobacter spp. isolates obtained from different patients were screened for MDR A. baumannii by antimicrobial disk susceptibility testing. Whole genomes of the MDR A. baumannii isolates were sequenced by MiSeq™ (Illumina), and the complete genome of one isolate (IOMTU433) was sequenced by PacBio RS II. Phylogenetic trees were constructed from single nucleotide polymorphism concatemers. Multilocus sequence types were deduced and drug resistance genes were identified. Of the 246 Acinetobacter spp. isolates, 122 (49.6%) were MDR A. baumannii, with the majority being resistant to aminoglycosides, carbapenems and fluoroquinolones but not to colistin and tigecycline. These isolates harboured the 16S rRNA methylase gene armA as well as bla(NDM-1), bla(OXA-23) or bla(OXA-58). MDR A. baumannii isolates belonging to clonal complex 1 (CC1) and CC2 as well as a novel clonal complex (CC149) have spread throughout a medical setting in Nepal. The MDR isolates harboured genes encoding carbapenemases (OXA and NDM-1) and a 16S rRNA methylase (ArmA). Copyright © 2015 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

Beyond cellular detoxification: a plethora of physiological roles for MDR transporter homologs in plants

Science.gov (United States)

Remy, Estelle; Duque, Paula

2014-01-01

Higher plants possess a multitude of Multiple Drug Resistance (MDR) transporter homologs that group into three distinct and ubiquitous families—the ATP-Binding Cassette (ABC) superfamily, the Major Facilitator Superfamily (MFS), and the Multidrug And Toxic compound Extrusion (MATE) family. As in other organisms, such as fungi, mammals, and bacteria, MDR transporters make a primary contribution to cellular detoxification processes in plants, mainly through the extrusion of toxic compounds from the cell or their sequestration in the central vacuole. This review aims at summarizing the currently available information on the in vivo roles of MDR transporters in plant systems. Taken together, these data clearly indicate that the biological functions of ABC, MFS, and MATE carriers are not restricted to xenobiotic and metal detoxification. Importantly, the activity of plant MDR transporters also mediates biotic stress resistance and is instrumental in numerous physiological processes essential for optimal plant growth and development, including the regulation of ion homeostasis and polar transport of the phytohormone auxin. PMID:24910617

Importancia pronóstica de la expresión de MDR-1 en la leucemia mieloblástica aguda

Directory of Open Access Journals (Sweden)

J. Arbelbide

2003-08-01

Full Text Available Una proporción importante de pacientes con leucemia mieloblástica aguda (LMA presentan recaída o resistencia con el tratamiento. Uno de los mecanismos involucrados en la resistencia a drogas, es la presencia de la glicoproteína P 170 (gp-P 170 resultante de la expresión del gen MDR-1 sobre las células leucémicas. El objetivo de este trabajo es valorar el impacto pronóstico de la expresión de MDR-1 en una población de pacientes tratados por LMA. Se evaluó retrospectivamente la expresión de MDR-1 en una cohorte de 55 pacientes con LMA, mayores de 16 años, que recibieron tratamiento quimioterápico desde 1990 hasta el 2000. Se evaluó sobre biopsia de médula ósea, la expresión de MDR-1/gp-P 170 por inmunohistoquímica. Mediante una curva ROC, se estableció que una expresión de MDR-1 > 50% en células blásticas, resultó significativa para el logro de remisión completa. Esta expresión de MDR-1+ correlacionó con la presencia de leucocitosis: (p:0.002, expresion de células CD34+ (p:0.006, menor tasa de remisión completa (p:0.001, mayor tasa de recaída (p:0.02 y de estudios citogenéticos no favorables (p:0.02. La SLE fue de 21.2% ES:9.3 con un seguimiento de 22 meses para el grupo MDR-1+ versus 56.4% ES:12.5 con un seguimiento de 78 meses en los casos MDR-1- (p:0.007. Se puede concluir que la expresion de MDR-1 ha demostrado ser un factor pronóstico de resistencia a la quimioterapia. Estos pacientes presentan una menor tasa de remisión completa, una mayor tasa de recaída por persistencia de enfermedad residual post-tratamiento, lo que produce una menor sobrevida global.An important number of patients with Acute Myeloid Leukemia (AML experience relapse or resistance to chemotherapy. One of the mechanisms involved in this resistance is the presence of glycoprotein P170 (gp-P 170, which results of the MDR-1 gene in leukemic cells. The objective of this article is to assess the prognostic impact of the expression of MDR-1 in a

Exploration of Fungal Association From Hard Coral Against Pathogen MDR Staphylococcus haemolyticus

Science.gov (United States)

Cristianawati, O.; Radjasa, O. K.; Sabdono, A.; Trianto, A.; Sabdaningsih, A.; Sibero, M. T.; Nuryadi, H.

2017-02-01

Staphylococcus haemolyticus are opportunistic bacteria and as the second leading cause of nosocomial infections. It is a disease causing septicemia, peritonitis, otitis, and urinary tract infections and infections of the eye. It also a phenotype resistant to multiple antibiotics commercial. There is now an urgency to find an alternative antibiotics to combat this bacteria. It has been widely reported that many bioactive marine natural products from marine invertebrate have striking similarities to metabolites of their associated microorganisms including fungi. Hard coral associated microorganisms are among of the most interesting and promising marine natural product sources, which produce with various biological activities. The proposed work focused on the discovery of bioactive compounds and also estimated the phylogenetic diversity from fungal association of hard coral against pathogen MDR Staphylococcus haemolyticus. A total of 32 fungal association, FHP 7 which were isolated from Favia sp. capable of inhibiting the growth MDR. Molecular identification based on 18S rRNA gene sequences revealed that the active fungal association belonged 100% to the members from one of the genera Trichoderma longibrachiatum. Accession Number LC185084.1.

Metabolic Reprogramming During Multidrug Resistance in Leukemias

Directory of Open Access Journals (Sweden)

Raphael Silveira Vidal

2018-04-01

Full Text Available Cancer outcome has improved since introduction of target therapy. However, treatment success is still impaired by the same drug resistance mechanism of classical chemotherapy, known as multidrug resistance (MDR phenotype. This phenotype promotes resistance to drugs with different structures and mechanism of action. Recent reports have shown that resistance acquisition is coupled to metabolic reprogramming. High-gene expression, increase of active transport, and conservation of redox status are one of the few examples that increase energy and substrate demands. It is not clear if the role of this metabolic shift in the MDR phenotype is related to its maintenance or to its induction. Apart from the nature of this relation, the metabolism may represent a new target to avoid or to block the mechanism that has been impairing treatment success. In this mini-review, we discuss the relation between metabolism and MDR resistance focusing on the multiple non-metabolic functions that enzymes of the glycolytic pathway are known to display, with emphasis with the diverse activities of glyceraldehyde-3-phosphate dehydrogenase.

Global transcriptional profiling of longitudinal clinical isolates of Mycobacterium tuberculosis exhibiting rapid accumulation of drug resistance.

Directory of Open Access Journals (Sweden)

Anirvan Chatterjee

Full Text Available The identification of multidrug resistant (MDR, extensively and totally drug resistant Mycobacterium tuberculosis (Mtb, in vulnerable sites such as Mumbai, is a grave threat to the control of tuberculosis. The current study aimed at explaining the rapid expression of MDR in Directly Observed Treatment Short Course (DOTS compliant patients, represents the first study comparing global transcriptional profiles of 3 pairs of clinical Mtb isolates, collected longitudinally at initiation and completion of DOTS. While the isolates were drug susceptible (DS at onset and MDR at completion of DOTS, they exhibited identical DNA fingerprints at both points of collection. The whole genome transcriptional analysis was performed using total RNA from H37Rv and 3 locally predominant spoligotypes viz. MANU1, CAS and Beijing, hybridized on MTBv3 (BuG@S microarray, and yielded 36, 98 and 45 differentially expressed genes respectively. Genes encoding transcription factors (sig, rpoB, cell wall biosynthesis (emb genes, protein synthesis (rpl and additional central metabolic pathways (ppdK, pknH, pfkB were found to be down regulated in the MDR isolates as compared to the DS isolate of the same genotype. Up regulation of drug efflux pumps, ABC transporters, trans-membrane proteins and stress response transcriptional factors (whiB in the MDR isolates was observed. The data indicated that Mtb, without specific mutations in drug target genes may persist in the host due to additional mechanisms like drug efflux pumps and lowered rate of metabolism. Furthermore this population of Mtb, which also showed reduced DNA repair activity, would result in selection and stabilization of spontaneous mutations in drug target genes, causing selection of a MDR strain in the presence of drug pressures. Efflux pump such as drrA may play a significant role in increasing fitness of low level drug resistant cells and assist in survival of Mtb till acquisition of drug resistant mutations with

FAM-MDR: a flexible family-based multifactor dimensionality reduction technique to detect epistasis using related individuals.

Directory of Open Access Journals (Sweden)

Tom Cattaert

Full Text Available We propose a novel multifactor dimensionality reduction method for epistasis detection in small or extended pedigrees, FAM-MDR. It combines features of the Genome-wide Rapid Association using Mixed Model And Regression approach (GRAMMAR with Model-Based MDR (MB-MDR. We focus on continuous traits, although the method is general and can be used for outcomes of any type, including binary and censored traits. When comparing FAM-MDR with Pedigree-based Generalized MDR (PGMDR, which is a generalization of Multifactor Dimensionality Reduction (MDR to continuous traits and related individuals, FAM-MDR was found to outperform PGMDR in terms of power, in most of the considered simulated scenarios. Additional simulations revealed that PGMDR does not appropriately deal with multiple testing and consequently gives rise to overly optimistic results. FAM-MDR adequately deals with multiple testing in epistasis screens and is in contrast rather conservative, by construction. Furthermore, simulations show that correcting for lower order (main effects is of utmost importance when claiming epistasis. As Type 2 Diabetes Mellitus (T2DM is a complex phenotype likely influenced by gene-gene interactions, we applied FAM-MDR to examine data on glucose area-under-the-curve (GAUC, an endophenotype of T2DM for which multiple independent genetic associations have been observed, in the Amish Family Diabetes Study (AFDS. This application reveals that FAM-MDR makes more efficient use of the available data than PGMDR and can deal with multi-generational pedigrees more easily. In conclusion, we have validated FAM-MDR and compared it to PGMDR, the current state-of-the-art MDR method for family data, using both simulations and a practical dataset. FAM-MDR is found to outperform PGMDR in that it handles the multiple testing issue more correctly, has increased power, and efficiently uses all available information.

Drug-resistance patterns of Mycobacterium tuberculosis strains and associated risk factors among multi drug-resistant tuberculosis suspected patients from Ethiopia.

Science.gov (United States)

Mesfin, Eyob Abera; Beyene, Dereje; Tesfaye, Abreham; Admasu, Addisu; Addise, Desalegn; Amare, Miskir; Dagne, Biniyam; Yaregal, Zelalem; Tesfaye, Ephrem; Tessema, Belay

2018-01-01

Multidrug drug-resistant tuberculosis (MDR-TB) is a major health problem and seriously threatens TB control and prevention efforts globally. Ethiopia is among the 30th highest TB burden countries for MDR-TB with 14% prevalence among previously treated cases. The focus of this study was on determining drug resistance patterns of Mycobacterium tuberculosis among MDR-TB suspected cases and associated risk factors. A cross-sectional study was conducted in Addis Ababa from June 2015 to December 2016. Sputum samples and socio-demographic data were collected from 358 MDR-TB suspected cases. Samples were analyzed using Ziehl-Neelsen technique, GeneXpert MTB/RIF assay, and culture using Lowenstein-Jensen and Mycobacterial growth indicator tube. Data were analyzed using SPSS version 23. A total of 226 the study participants were culture positive for Mycobacterium tuberculosis, among them, 133 (58.8%) participants were males. Moreover, 162 (71.7%) had been previously treated for tuberculosis, while 128 (56.6%) were TB/HIV co-infected. A majority [122 (54%)] of the isolates were resistant to any first-line anti-TB drugs. Among the resistant isolates, 110 (48.7%) were determined to be resistant to isoniazid, 94 (41.6%) to streptomycin, 89 (39.4%) to rifampicin, 72 (31.9%) to ethambutol, and 70 (30.9%) to pyrazinamide. The prevalence of MDR-TB was 89 (39.4%), of which 52/89 (58.4%) isolates were resistance to all five first-line drugs. Risk factors such as TB/HIV co-infection (AOR = 5.59, p = 0.00), cigarette smoking (AOR = 3.52, p = 0.045), alcohol drinking (AOR = 5.14, p = 0.001) hospital admission (AOR = 3.49, p = 0.005) and visiting (AOR = 3.34, p = 0.044) were significantly associated with MDR-TB. The prevalence of MDR-TB in the study population was of a significantly high level among previously treated patients and age group of 25-34. TB/HIV coinfection, smoking of cigarette, alcohol drinking, hospital admission and health facility visiting were identified as risk factors

Management and treatment outcomes of patients enrolled in MDR-TB treatment in Viet Nam.

Science.gov (United States)

Phuong, N T M; Nhung, N V; Hoa, N B; Thuy, H T; Takarinda, K C; Tayler-Smith, K; Harries, A D

2016-03-21

The programmatic management of drug-resistant tuberculosis (TB) in Viet Nam has been rapidly scaled up since 2009. To document the annual numbers of patients enrolled for multidrug-resistant tuberculosis (MDR-TB) treatment during 2010-2014 and to determine characteristics and treatment outcomes of patients initiating treatment during 2010-2012. A retrospective cohort study using national reports and data from the national electronic data system for drug-resistant TB. The number of patients enrolled annually for MDR-TB treatment increased from 97 in 2010 to 1522 in 2014. The majority of patients were middle-aged men who had pulmonary disease and had failed a retreatment regimen; 77% had received ⩾2 courses of TB treatment. Favourable outcomes (cured and treatment completed) were attained in 73% of patients. Unfavourable outcomes included loss to follow-up (12.5%), death (8%) and failure (6.3%). Having had ⩾2 previous treatment courses and being human immunodeficiency virus-positive were associated with unfavourable outcomes. Increasing numbers of patients are being treated for MDR-TB each year with good treatment outcomes under national programme management in Viet Nam. However, there is a need to increase case detection-currently at 30% of the estimated 5100 MDR-TB cases per year, reduce adverse outcomes and improve monitoring and evaluation.

Whole Genome Sequencing and Plasmid Genomics of Antimicrobial Resistance – Salmonella’s mobile genetic elements and the antimicrobial resistance genes they carry

Science.gov (United States)

With the emergence of antibiotic resistance (AR), multidrug resistance (MDR), and carbapenem resistant Enterobacteriaceae (CRE), the specter of widespread untreatable bacterial infections threatens human and animal health. The ability of these emerging resistances to transfer between bacteria on mob...

Treatment outcomes of MDR-tuberculosis patients in Brazil: a retrospective cohort analysis

Directory of Open Access Journals (Sweden)

Mayara Lisboa Bastos

2017-11-01

Full Text Available Abstract Background Multidrug-resistant tuberculosis (MDR-TB is a threat for the global TB epidemic control. Despite existing evidence that individualized treatment of MDR-TB is superior to standardized regimens, the latter are recommended in Brazil, mainly because drug-susceptibility tests (DST are often restricted to first-line drugs in public laboratories. We compared treatment outcomes of MDR-TB patients using standardized versus individualized regimens in Brazil, a high TB-burden, low resistance setting. Methods The 2007–2013 cohort of the national electronic database (SITE-TB, which records all special treatments including drug-resistance, was analysed. Patients classified as MDR-TB in SITE-TB were eligible. Treatment outcomes were classified as successful (cure/treatment completed or unsuccessful (failure/relapse/death/loss to follow-up. The odds for successful treatment according to type of regimen were controlled for demographic and clinical variables. Results Out of 4029 registered patients, we included 1972 recorded from 2010 to 2012, who had more complete outcome data. The overall success proportion was 60%. Success was more likely in non-HIV patients, sputum-negative at baseline, with unilateral disease and without prior DR-TB. Adjusted for these variables, those receiving standardized regimens had 2.7-fold odds of success compared to those receiving individualized treatments when failure/relapse were considered, and 1.4-fold odds of success when death was included as an unsuccessful outcome. When loss to follow-up was added, no difference between types of treatment was observed. Patients who used levofloxacin instead of ofloxacin had 1.5-fold odds of success. Conclusion In this large cohort of MDR-TB patients with a low proportion of successful outcomes, standardized regimens had superior efficacy than individualized regimens, when adjusted for relevant variables. In addition to the limitations of any retrospective observational

Mechanisms of antibiotic resistance in Mycobacterium tuberculosis, validation of methods BACTECTM MGIT 960 and AnyplexM TII MTB / MDR / XDR Detection for detection of antibiotic resistance to first and second line in Mycobacterium tuberculosis strains

International Nuclear Information System (INIS)

Centeno Urena, Yadel

2014-01-01

A literature review is developed of drug-resistant TB in the world and in Costa Rica. The mechanisms of resistance to antibiotics are studied of the bacterium that causes tuberculosis; drug resistance to first-line and second-line, treatment regimen according to the World Health Organization and edge detection methods available in the market. The agreement between the results is studied by the phenotypic detection system of resistance of M. tuberculosis BACTEC MGIT960 and PCR, in real-time of commercial kit Anyplex II MTB/MDR/XDR, for genotypic identification of M. tuberculosis and related mutations to resistance with the referring results to thirty strains provided by the Pan American Health Organization, allowing a significant shortening in the time of obtaining reliable results. The results obtained have allowed to suggest a possible implementation at the Centro Nacional de Referencia en Micobacteriologia (CNRM), to perform antibiotic susceptibility testing and genotypic testing of multidrug cases respectively. The study results have allowed the implementation of the technology of genotypic detection of M. tuberculosis in the CNRM, obtaining for the first time in Costa Rica, information about genes of M. tuberculosis related to the generation of resistance to the major drugs of Primary treatment scheme as well as testing of resistance to second-line drug for resistant strains referred to the Centro Nacional de Referencia en Micobacteriologia in 2013. (author) [es

Mechanisms of first-line antimicrobial resistance in multi-drug and extensively drug resistant strains of Mycobacterium tuberculosis in KwaZulu-Natal, South Africa

Directory of Open Access Journals (Sweden)

Navisha Dookie

2016-10-01

Full Text Available Abstract Background In South Africa, drug resistant tuberculosis is a major public health crisis in the face of the colossal HIV pandemic. Methods In an attempt to understand the distribution of drug resistance in our setting, we analysed the rpoB, katG, inhA, pncA and embB genes associated with resistance to key drugs used in the treatment of tuberculosis in clinical isolates of Mycobacterium tuberculosis in the KwaZulu-Natal province. Results Classical mutations were detected in the katG, inhA and embB genes associated with resistance to isoniazid and ethambutol. Diverse mutations were recorded in the multidrug resistant (MDR and extensively drug resistant (XDR isolates for the rpoB and pncA gene associated with resistance to rifampicin and pyrazinamide. Conclusions M.tuberculosis strains circulating in our setting display a combination of previously observed mutations, each mediating resistance to a different drug. The MDR and XDR TB isolates analysed in this study displayed classical mutations linked to INH and EMB resistance, whilst diverse mutations were linked to RIF and PZA resistance. The similarity of the XDR strains confirms reports of the clonality of the XDR epidemic. The successful dissemination of the drug resistant strains in the province underscores the need for rapid diagnostics to effectively diagnose drug resistance and guide treatment.

Distinct genotype distribution and haplotype profiles in MDR1 gene among Chinese Han, Bai, Wa and Tibetan ethnic groups.

Science.gov (United States)

Lai, Yong; Huang, Min; Li, Hui; Wang, Xue-Ding; Li, Jia-Li

2012-11-01

P-Glycoprotein (P-gp, encoded by MDR1 gene) plays an important role in determining bioavailability and pharmacologic effects of many drugs. There is increasing evidence that P-gp activity may be genetically determined. In this study, we investigated the genotype distribution and the haplotype profiles of MDR1 gene in Chinese Han, Bai, Wa and Tibetan subjects. Much lower frequencies of the 1236T allele and the 2677T allele were found in Wa subjects than those in other three ethnic groups, while the 2677A allele was found about 6-fold more frequently in Han subjects than in subjects of other three ethnic groups. The Han, Bai and Tibetan subjects share the same three predominant haplotypes (T-T-T, T-G-C and C-G-C), and T-T-T is the highest and accounts for more than one third of the number of haplotypes in the subjects from each ethnic group. However, T-T-T was less common than T-G-C, T-G-T and C-G-C and occurring at only 13.8% in Wa subjects, furthermore, higher frequencies of T-G-T, C-T-C, C-G-T and C-T-T were observed in Wa subjects compared to those in other three ethnic groups. Frequencies of C-A-C and T-A-C in Han subjects were higher than those in other three ethnic groups. The findings of this study will be of some relevance in predicting MDR1 phenotype and pharmacokinetics as well as pharmacodynamic effects of many commonly used drugs that are P-gp substrates in these four Chinese ethnic groups.

TTFields alone and in combination with chemotherapeutic agents effectively reduce the viability of MDR cell sub-lines that over-express ABC transporters

International Nuclear Information System (INIS)

Schneiderman, Rosa S; Shmueli, Esther; Kirson, Eilon D; Palti, Yoram

2010-01-01

Exposure of cancer cells to chemotherapeutic agents may result in reduced sensitivity to structurally unrelated agents, a phenomenon known as multidrug resistance, MDR. The purpose of this study is to investigate cell growth inhibition of wild type and the corresponding MDR cells by Tumor Treating Fields - TTFields, a new cancer treatment modality that is free of systemic toxicity. The TTFields were applied alone and in combination with paclitaxel and doxorubicin. Three pairs of wild type/MDR cell lines, having resistivity resulting from over-expression of ABC transporters, were studied: a clonal derivative (C11) of parental Chinese hamster ovary AA8 cells and their emetine-resistant sub-line Emt R1 ; human breast cancer cells MCF-7 and their mitoxantrone-resistant sub lines MCF-7/Mx and human breast cancer cells MDA-MB-231 and their doxorubicin resistant MDA-MB-231/Dox cells. TTFields were applied for 72 hours with and without the chemotherapeutic agents. The numbers of viable cells in the treated cultures and the untreated control groups were determined using the XTT assay. Student t-test was applied to asses the significance of the differences between results obtained for each of the three cell pairs. TTFields caused a similar reduction in the number of viable cells of wild type and MDR cells. Treatments by TTFields/drug combinations resulted in a similar increased reduction in cell survival of wild type and MDR cells. TTFields had no effect on intracellular doxorubicin accumulation in both wild type and MDR cells. The results indicate that TTFields alone and in combination with paclitaxel and doxorubicin effectively reduce the viability of both wild type and MDR cell sub-lines and thus can potentially be used as an effective treatment of drug resistant tumors

Multidrug resistance and retroviral transduction potential in human small cell lung cancer cell lines

DEFF Research Database (Denmark)

Theilade, M D; Gram, G J; Jensen, P B

1999-01-01

Multidrug resistance (MDR) remains a major problem in the successful treatment of small cell lung cancer (SCLC). New treatment strategies are needed, such as gene therapy specifically targeting the MDR cells in the tumor. Retroviral LacZ gene-containing vectors that were either pseudotyped...... for the gibbon ape leukemia virus (GALV-1) receptor or had specificity for the amphotropic murine leukemia virus (MLV-A) receptor were used for transduction of five SCLC cell lines differing by a range of MDR mechanisms. Transduction efficiencies in these cell lines were compared by calculating the percentage...... of blue colonies after X-Gal staining of the cells grown in soft agar. All examined SCLC cell lines were transducible with either vector. Transduction efficiencies varied from 5.7% to 33.5% independent of the presence of MDR. These results indicate that MDR does not severely impair transduction of SCLC...

Three distinct clones of carbapenem-resistant Acinetobacter baumannii with high diversity of carbapenemases isolated from patients in two hospitals in Kuwait

Directory of Open Access Journals (Sweden)

N.A. Al-Sweih

2012-02-01

Full Text Available Summary: Objectives: This study was undertaken to investigate the clonal relatedness of multidrug-resistant (MDR Acinetobacter baumannii isolates collected from patients in two teaching hospitals in Kuwait. Materials and methods: Clinically significant consecutive isolates of A. baumannii obtained from patients in the Mubarak (36 and Adan (58 hospitals over a period of 6 months were studied. These isolates were identified using molecular methods, and their antimicrobial susceptibility was determined by the Etest method. The mechanism of resistance to carbapenem was investigated by PCR, and pulsed-field gel electrophoresis (PFGE was used to determine the clonal relatedness of MDR isolates. Results: Of the 94 isolates investigated, 80 (85.1% were multidrug resistant (MDR. The A. baumannii PFGE clone A and subclone A1 were the most prevalent in patients infected with MDR isolates. Fifty-five (94.8% and 15 (41.7% of the MDR isolates from the Adan and Mubarak hospitals, respectively, belonged to PFGE clone A; isolates in this group showed higher resistance rates to antibiotics than isolates form other groups. Of the 94 isolates, 40 (42.6% were resistant to either imipenem or meropenem or to both (CRAB. Most CRAB isolates (29/40 or 72.5% carried bla genes, which code for MBL (VIM-2 and IMP-1 enzymes. Two isolates harbored blaOXA-23. Conclusion: Three distinct clones of CRAB were isolated, providing evidence of a high diversity of carbapenemases among our geographically related isolates. Keywords: MDR A. baumannii, Genotypes, bla genes, Kuwait hospitals

Global DNA hypermethylation-associated cancer chemotherapy resistance and its reversion with the demethylating agent hydralazine

Directory of Open Access Journals (Sweden)

Benitez-Bribiesca Luis

2006-08-01

Full Text Available Abstract Background The development of resistance to cytotoxic chemotherapy continues to be a major obstacle for successful anticancer therapy. It has been shown that cells exposed to toxic concentrations of commonly used cancer chemotherapy agents develop DNA hypermetylation. Hence, demethylating agents could play a role in overcoming drug resistance. Methods MCF-7 cells were rendered adriamycin-resistant by weekly treatment with adriamycin. Wild-type and the resulting MCF-7/Adr cells were analyzed for global DNA methylation. DNA methyltransferase activity and DNA methyltransferase (dnmt gene expression were also determined. MCF-7/Adr cells were then subjected to antisense targeting of dnmt1, -3a, and -b genes and to treatment with the DNA methylation inhibitor hydralazine to investigate whether DNA demethylation restores sensitivity to adriamycin. Results MCF-7/Adr cells exhibited the multi-drug resistant phenotype as demonstrated by adriamycin resistance, mdr1 gene over-expression, decreased intracellular accumulation of adriamycin, and cross-resistance to paclitaxel. The mdr phenotype was accompanied by global DNA hypermetylation, over-expression of dnmt genes, and increased DNA methyltransferase activity as compared with wild-type MCF-7 cells. DNA demethylation through antisense targeting of dnmts or hydralazine restored adriamycin sensitivity of MCF-7/Adr cells to a greater extent than verapamil, a known inhibitor of mdr protein, suggesting that DNA demethylation interferes with the epigenetic reprogramming that participates in the drug-resistant phenotype. Conclusion We provide evidence that DNA hypermethylation is at least partly responsible for development of the multidrug-resistant phenotype in the MCF-7/Adr model and that hydralazine, a known DNA demethylating agent, can revert the resistant phenotype.

Chlortetracycline and florfenicol induce expression of genes associated with pathogenicity in multidrug-resistant Salmonella enterica serovar Typhimurium

Science.gov (United States)

Background Multidrug-resistant (MDR) Salmonella enterica serovar Typhimurium (S. Typhimurium) is a serious public health threat as infections caused by these strains are more difficult and expensive to treat. Livestock serve as a reservoir for MDR Salmonella, and the antibiotics chlortetracycline an...

Sequence Analysis of IncA/C and IncI1 Plasmids Isolated from Multidrug-Resistant Salmonella Newport Using Single-Molecule Real-Time Sequencing.

Science.gov (United States)

Cao, Guojie; Allard, Marc; Hoffmann, Maria; Muruvanda, Tim; Luo, Yan; Payne, Justin; Meng, Kevin; Zhao, Shaohua; McDermott, Patrick; Brown, Eric; Meng, Jianghong

2018-04-05

Multidrug-resistant (MDR) plasmids play an important role in disseminating antimicrobial resistance genes. To elucidate the antimicrobial resistance gene compositions in A/C incompatibility complex (IncA/C) plasmids carried by animal-derived MDR Salmonella Newport, and to investigate the spread mechanism of IncA/C plasmids, this study characterizes the complete nucleotide sequences of IncA/C plasmids by comparative analysis. Complete nucleotide sequencing of plasmids and chromosomes of six MDR Salmonella Newport strains was performed using PacBio RSII. Open reading frames were assigned using prokaryotic genome annotation pipeline (PGAP). To understand genomic diversity and evolutionary relationships among Salmonella Newport IncA/C plasmids, we included three complete IncA/C plasmid sequences with similar backbones from Salmonella Newport and Escherichia coli: pSN254, pAM04528, and peH4H, and additional 200 draft chromosomes. With the exception of canine isolate CVM22462, which contained an additional IncI1 plasmid, each of the six MDR Salmonella Newport strains contained only the IncA/C plasmid. These IncA/C plasmids (including references) ranged in size from 80.1 (pCVM21538) to 176.5 kb (pSN254) and carried various resistance genes. Resistance genes floR, tetA, tetR, strA, strB, sul, and mer were identified in all IncA/C plasmids. Additionally, bla CMY-2 and sugE were present in all IncA/C plasmids, excepting pCVM21538. Plasmid pCVM22462 was capable of being transferred by conjugation. The IncI1 plasmid pCVM22462b in CVM22462 carried bla CMY-2 and sugE. Our data showed that MDR Salmonella Newport strains carrying similar IncA/C plasmids clustered together in the phylogenetic tree using chromosome sequences and the IncA/C plasmids from animal-derived Salmonella Newport contained diverse resistance genes. In the current study, we analyzed genomic diversities and phylogenetic relationships among MDR Salmonella Newport using complete plasmids and chromosome

Enterotoxigenicity and Antimicrobial Resistance of Staphylococcus aureus Isolated from Retail Food in China

Science.gov (United States)

Wang, Wei; Baloch, Zulqarnain; Jiang, Tao; Zhang, Cunshan; Peng, Zixin; Li, Fengqin; Fanning, Séamus; Ma, Aiguo; Xu, Jin

2017-01-01

Staphylococcus aureus is one of the most common causes of zoonotic agent in the world, which are attributable to the contamination of food with enterotoxins. In this study, a total of 1,150 S. aureus isolates were cultured from 27,000 retail foods items from 203 cities of 24 provinces in China in 2015 and were test for antimicrobial susceptibility. Additionally, the role of the genes responsible for the staphylococcal enterotoxins (SEA to SEE), methicillin resistance (mecA) and the toxigenic capabilities were also assessed. The results showed that 4.3% retail foods were contaminated with S. aureus, and 7.9% retail foods isolates were mecA positive. Some 97.6% of S. aureus isolates were resistant to at least one antimicrobial compound, and 57.5% of these were multi drug resistant (MDR). Resistance to penicillin (83.7%, 963/1,150), was common, followed by linezolid (67.7%, 778/1,150) and erythromycin (52.1%, 599/1,150). The isolates cultured from raw meats showed high levels of resistant to tetracycline (42.8%), ciprofloxacin (17.4%), and chloramphenicol (12.0%) and expressed a MDR phenotype (62.4%). A total of 29.7% S. aureus isolates harbored the classical SEs genes (sea, seb, sec, and sed). The sea and seb genes were the most frequent SEs genes detected. Of note, 22% of the SEs genes positive S. aureus harbored two or three SEs genes, and 16 isolates were confirmed with the capacity to simultaneously produce two or three enterotoxin types. Moreover, nearly 50% of the MRSA isolates were positive for at least one SE gene in this study. Therefore, it is important to monitor the antimicrobial susceptibility and enterotoxigenicity of MDR S. aureus and MRSA in the food chain and to use these data to develop food safety measures, designed to reduce the contamination and transmission of this bacterium. PMID:29209290

Emergence of multidrug-resistant Acinetobacter baumannii producing OXA-23 Carbapenemase in Qatar

Directory of Open Access Journals (Sweden)

J.-M. Rolain

2016-05-01

Full Text Available The objective of our study was to describe the molecular support of carbapenem resistance from randomly selected clinical isolates of multidrug-resistant (MDR Acinetobacter baumannii as a pilot study from the Hamad Medical Corporation (HMC, Qatar. Results of our report will be used to study carbapenemases using molecular techniques in all isolated MDR A. baumannii. Forty-eight MDR A. baumannii were randomly selected from isolates preserved at HMC. Identification of all isolates was confirmed by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. Antibiotic resistance was tested phenotypically by Phoenix and confirmed by Etest. The molecular support of carbapenemases (blaOXA-23, blaOXA-24, blaOXA-58, blaNDM was investigated by real-time PCR. The epidemiologic relatedness of the isolates was verified by phylogenetic analysis based on partial sequences of CsuE and blaOXA-51 genes. All 48 isolates were identified as A. baumannii and were confirmed to be resistant to most antibiotics, especially meropenem, imipenems, ciprofloxacin, levofloxacin, amikacin, gentamicin and most of the β-lactams; they were sensitive to colistin. All the isolates were positive for blaOXA-23 and negative for the other tested carbapenemase genes. Clonality analysis demonstrated that different lineages were actually circulating in Qatar; and we suggest that an outbreak occurred in the medical intensive care unit of HMC between 2011 and 2012. Here we report the emergence of MDR A. baumannii producing the carbapenemase OXA-23 in Qatar.

Comparative Sequence Analysis of Multidrug-Resistant IncA/C Plasmids from Salmonella enterica.

Science.gov (United States)

Hoffmann, Maria; Pettengill, James B; Gonzalez-Escalona, Narjol; Miller, John; Ayers, Sherry L; Zhao, Shaohua; Allard, Marc W; McDermott, Patrick F; Brown, Eric W; Monday, Steven R

2017-01-01

Determinants of multidrug resistance (MDR) are often encoded on mobile elements, such as plasmids, transposons, and integrons, which have the potential to transfer among foodborne pathogens, as well as to other virulent pathogens, increasing the threats these traits pose to human and veterinary health. Our understanding of MDR among Salmonella has been limited by the lack of closed plasmid genomes for comparisons across resistance phenotypes, due to difficulties in effectively separating the DNA of these high-molecular weight, low-copy-number plasmids from chromosomal DNA. To resolve this problem, we demonstrate an efficient protocol for isolating, sequencing and closing IncA/C plasmids from Salmonella sp. using single molecule real-time sequencing on a Pacific Biosciences (Pacbio) RS II Sequencer. We obtained six Salmonella enterica isolates from poultry, representing six different serovars, each exhibiting the MDR-Ampc resistance profile. Salmonella plasmids were obtained using a modified mini preparation and transformed with Escherichia coli DH10Br. A Qiagen Large-Construct kit™ was used to recover highly concentrated and purified plasmid DNA that was sequenced using PacBio technology. These six closed IncA/C plasmids ranged in size from 104 to 191 kb and shared a stable, conserved backbone containing 98 core genes, with only six differences among those core genes. The plasmids encoded a number of antimicrobial resistance genes, including those for quaternary ammonium compounds and mercury. We then compared our six IncA/C plasmid sequences: first with 14 IncA/C plasmids derived from S. enterica available at the National Center for Biotechnology Information (NCBI), and then with an additional 38 IncA/C plasmids derived from different taxa. These comparisons allowed us to build an evolutionary picture of how antimicrobial resistance may be mediated by this common plasmid backbone. Our project provides detailed genetic information about resistance genes in

Comparative Sequence Analysis of Multidrug-Resistant IncA/C Plasmids from Salmonella enterica

Directory of Open Access Journals (Sweden)

Maria Hoffmann

2017-08-01

Full Text Available Determinants of multidrug resistance (MDR are often encoded on mobile elements, such as plasmids, transposons, and integrons, which have the potential to transfer among foodborne pathogens, as well as to other virulent pathogens, increasing the threats these traits pose to human and veterinary health. Our understanding of MDR among Salmonella has been limited by the lack of closed plasmid genomes for comparisons across resistance phenotypes, due to difficulties in effectively separating the DNA of these high-molecular weight, low-copy-number plasmids from chromosomal DNA. To resolve this problem, we demonstrate an efficient protocol for isolating, sequencing and closing IncA/C plasmids from Salmonella sp. using single molecule real-time sequencing on a Pacific Biosciences (Pacbio RS II Sequencer. We obtained six Salmonella enterica isolates from poultry, representing six different serovars, each exhibiting the MDR-Ampc resistance profile. Salmonella plasmids were obtained using a modified mini preparation and transformed with Escherichia coli DH10Br. A Qiagen Large-Construct kit™ was used to recover highly concentrated and purified plasmid DNA that was sequenced using PacBio technology. These six closed IncA/C plasmids ranged in size from 104 to 191 kb and shared a stable, conserved backbone containing 98 core genes, with only six differences among those core genes. The plasmids encoded a number of antimicrobial resistance genes, including those for quaternary ammonium compounds and mercury. We then compared our six IncA/C plasmid sequences: first with 14 IncA/C plasmids derived from S. enterica available at the National Center for Biotechnology Information (NCBI, and then with an additional 38 IncA/C plasmids derived from different taxa. These comparisons allowed us to build an evolutionary picture of how antimicrobial resistance may be mediated by this common plasmid backbone. Our project provides detailed genetic information about

Direct sequencing for rapid detection of multidrug resistant Mycobacterium tuberculosis strains in Morocco.

Science.gov (United States)

Zakham, Fathiah; Chaoui, Imane; Echchaoui, Amina Hadbae; Chetioui, Fouad; Elmessaoudi, My Driss; Ennaji, My Mustapha; Abid, Mohammed; Mzibri, Mohammed El

2013-01-01

Tuberculosis (TB) is a major public health problem with high mortality and morbidity rates, especially in low-income countries. Disturbingly, the emergence of multidrug resistant (MDR) and extensively drug resistant (XDR) TB cases has worsened the situation, raising concerns of a future epidemic of virtually untreatable TB. Indeed, the rapid diagnosis of MDR TB is a critical issue for TB management. This study is an attempt to establish a rapid diagnosis of MDR TB by sequencing the target fragments of the rpoB gene which linked to resistance against rifampicin and the katG gene and inhA promoter region, which are associated with resistance to isoniazid. For this purpose, 133 sputum samples of TB patients from Morocco were enrolled in this study. One hundred samples were collected from new cases, and the remaining 33 were from previously treated patients (drug relapse or failure, chronic cases) and did not respond to anti-TB drugs after a sufficient duration of treatment. All samples were subjected to rpoB, katG and pinhA mutation analysis by polymerase chain reaction and DNA sequencing. Molecular analysis showed that seven strains were isoniazid-monoresistant and 17 were rifampicin-monoresistant. MDR TB strains were identified in nine cases (6.8%). Among them, eight were traditionally diagnosed as critical cases, comprising four chronic and four drug-relapse cases. The last strain was isolated from a new case. The most recorded mutation in the rpoB gene was the substitution TCG > TTG at codon 531 (Ser531 Leu), accounting for 46.15%. Significantly, the only mutation found in the katG gene was at codon 315 (AGC to ACC) with a Ser315Thr amino acid change. Only one sample harbored mutation in the inhA promoter region and was a point mutation at the -15p position (C > T). The polymerase chain reaction sequencing approach is an accurate and rapid method for detection of drug-resistant TB in clinical specimens, and could be of great interest in the management of TB in

Dioscin enhances methotrexate absorption by down-regulating MDR1 in vitro and in vivo

Energy Technology Data Exchange (ETDEWEB)

Wang, Lijuan, E-mail: jlwang1979@163.com [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Wang, Changyuan, E-mail: wangcyuan@163.com [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University, Dalian, Liaoning (China); Peng, Jinyong, E-mail: jinyongpeng2005@163.com [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University, Dalian, Liaoning (China); Liu, Qi, E-mail: llaqii@yahoo.com.cn [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University, Dalian, Liaoning (China); Meng, Qiang, E-mail: mengq531@yahoo.cn [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University, Dalian, Liaoning (China); Sun, Huijun, E-mail: sunhuijun@hotmail.com [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University, Dalian, Liaoning (China); Huo, Xiaokui, E-mail: huoxiaokui@163.com [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University, Dalian, Liaoning (China); and others

2014-06-01

The purpose of this study was to investigate the enhancing effect of dioscin on the absorption of methotrexate (MTX) and clarify the molecular mechanism involved in vivo and in vitro. Dioscin increased MTX chemosensitivity and transepithelial flux in the absorptive direction, significantly inhibiting multidrug resistance 1 (MDR1) mRNA and protein expression and MDR1 promoter and nuclear factor κ-B (NF-κB) activities in Caco-2 cells. Moreover, inhibitor κB-α (IκB-α) degradation was inhibited by dioscin. Dioscin enhanced the intracellular concentration of MTX by down-regulating MDR1 expression through a mechanism that involves NF-κB signaling pathway inhibition in Caco-2 cells. Dioscin strengthened MTX absorption by inhibiting MDR1 expression in rat intestine. In addition, even though MTX is absorbed into the enterocytes, there was no increase in toxicity observed, and that, in fact, decreased toxicity was seen. - Highlights: • Dioscin raised MTX concentration by inhibiting MDR1 in Caco-2 cells. • Dioscin suppresses MDR1 by inhibiting NF-κB signaling pathway in Caco-2 cells. • Dioscin can enhance MTX absorption via inhibiting MDR1 in vivo and in vitro. • Dioscin did not increase MTX-induced gastrointestinal mucosal toxicity.

Social, economic, and psychological impacts of MDR-TB treatment in Tijuana, Mexico: a patient's perspective.

Science.gov (United States)

Morris, M D; Quezada, L; Bhat, P; Moser, K; Smith, J; Perez, H; Laniado-Laborin, R; Estrada-Guzman, J; Rodwell, T C

2013-07-01

The State of Baja California, Mexico, had the highest prevalence of multidrug-resistant tuberculosis (MDR-TB) in Mexico in 2009. To understand the socio-economic burden of MDR-TB disease and its treatment on patients in Tijuana and Mexicali, Mexico. From July to November 2009, qualitative interviews were conducted with 12 patients enrolled in a US-Mexico binational MDR-TB treatment program, Puentes de Esperanza (Bridges of Hope), which was designed to support MDR-TB patients. In-depth interviews were coded to identify major themes in patient experiences of MDR-TB diagnosis and care. While some patients were able to maintain their pre-MDR-TB lives to a limited extent, most patients reported losing their sense of identity due to their inability to work, social isolation, and stigmatization from family and friends. The majority of participants expressed appreciation for Puentes' role in 'saving their lives'. Being diagnosed with MDR-TB and undergoing treatment imposes significant psychological, social and economic stress on patients. Strong social support elements within Puentes helped alleviate these burdens. Improvements to the program might include peer-support groups for patients undergoing treatment and transitioning back into the community after treatment.

Multidrug-resistant Enterobacteriaceae from indoor air of an urban wastewater treatment plant.

Science.gov (United States)

Teixeira, Juliana V; Cecílio, Pedro; Gonçalves, Daniela; Vilar, Vítor J P; Pinto, Eugénia; Ferreira, Helena N

2016-07-01

Wastewater treatment plants (WWTPs) have been recognized as sources of bioaerosols that may act as vehicles for dissemination of pathogens and multidrug-resistant (MDR) bacteria. The occurrence of MDR Enterobacteriaceae in indoor air of an urban WWTP was investigated. A possible airborne contamination with extended-spectrum beta-lactamase (ESBL) and carbapenemase-producing Enterobacteriaceae was also explored. Fourteen of 39 Enterobacteriaceae isolates were MDR. These isolates were found at all sampling sites, mainly at the secondary sedimentation settings. The highest levels of resistance were detected in three different species: Enterobacter cloacae, Escherichia coli, and Citrobacter freundii. Furthermore, one of the airborne E. coli isolates was phenotypically characterized as an ESBL producer. Additionally, five isolates showed non-susceptibility to at least one carbapenem tested. The presence of genes encoding relevant beta-lactamase types in these ESBL-producing and carbapenem-resistant Enterobacteriaceae isolates was investigated by PCR. Results showed amplification for bla CTX-M and bla OXA. These findings are relevant both in terms of occupational/public health and of environmental dissemination of MDR bacteria.

Functionalized graphene oxide mediated adriamycin delivery and miR-21 gene silencing to overcome tumor multidrug resistance in vitro.

Directory of Open Access Journals (Sweden)

Feng Zhi

Full Text Available Multidrug resistance (MDR is a major impediment to successful cancer chemotherapy. Co-delivery of novel MDR-reversing agents and anticancer drugs to cancer cells holds great promise for cancer treatment. MicroRNA-21 (miR-21 overexpression is associated with the development and progression of MDR in breast cancer, and it is emerging as a novel and promising MDR-reversing target. In this study, a multifunctional nanocomplex, composed of polyethylenimine (PEI/poly(sodium 4-styrenesulfonates (PSS/graphene oxide (GO and termed PPG, was prepared using the layer-by-layer assembly method to evaluate the reversal effects of PPG as a carrier for adriamycin (ADR along with miR-21 targeted siRNA (anti-miR-21 in cancer drug resistance. ADR was firstly loaded onto the PPG surface (PPGADR by physical mixing and anti-miR-21 was sequentially loaded onto PPGADR through electric absorption to form (anti-miR-21PPGADR. Cell experiments showed that PPG significantly enhanced the accumulation of ADR in MCF-7/ADR cells (an ADR resistant breast cancer cell line and exhibited much higher cytotoxicity than free ADR, suggesting that PPG could effectively reverse ADR resistance of MCF-7/ADR. Furthermore, the enhanced therapeutic efficacy of PPG could be correlated with effective silencing of miR-21 and with increased accumulation of ADR in drug-resistant tumor cells. The endocytosis study confirmed that PPG could effectively carry drug molecules into cells via the caveolae and clathrin-mediated endocytosis pathways. These results suggest that this PPG could be a potential and efficient non-viral vector for reversing MDR, and the strategy of combining anticancer drugs with miRNA therapy to overcome MDR could be an attractive approach in cancer treatment.

Isolation and in vitro evaluation of bacteriophages against MDR-bacterial isolates from septic wound infections.

Directory of Open Access Journals (Sweden)

Roja Rani Pallavali

Full Text Available Multi-drug resistance has become a major problem for the treatment of pathogenic bacterial infections. The use of bacteriophages is an attractive approach to overcome the problem of drug resistance in several pathogens that cause fatal diseases. Our study aimed to isolate multi drug resistant bacteria from patients with septic wounds and then isolate and apply bacteriophages in vitro as alternative therapeutic agents. Pus samples were aseptically collected from Rajiv Gandhi Institute of Medical Science (RIMS, Kadapa, A.P., and samples were analyzed by gram staining, evaluating morphological characteristics, and biochemical methods. MDR-bacterial strains were collected using the Kirby-Bauer disk diffusion method against a variety of antibiotics. Bacteriophages were collected and tested in vitro for lytic activity against MDR-bacterial isolates. Analysis of the pus swab samples revealed that the most of the isolates detected had Pseudomonas aeruginosa as the predominant bacterium, followed by Staphylococcus aureus, Klebsiella pneumoniae and Escherichia coli. Our results suggested that gram-negative bacteria were more predominant than gram-positive bacteria in septic wounds; most of these isolates were resistant to ampicillin, amoxicillin, penicillin, vancomycin and tetracycline. All the gram-positive isolates (100% were multi-drug resistant, whereas 86% of the gram-negative isolates had a drug resistant nature. Further bacteriophages isolated from sewage demonstrated perfect lytic activity against the multi-drug resistant bacteria causing septic wounds. In vitro analysis of the isolated bacteriophages demonstrated perfect lysis against the corresponding MDR-bacteria, and these isolated phages may be promising as a first choice for prophylaxis against wound sepsis, Moreover, phage therapy does not enhance multi-drug resistance in bacteria and could work simultaneously on a wide variety of MDR-bacteria when used in a bacteriophage cocktail. Hence

Multidrug-resistant tuberculosis in Europe, 2010-2011

DEFF Research Database (Denmark)

Günther, Gunar; van Leth, Frank; Alexandru, Sofia

2015-01-01

Drug-resistant Mycobacterium tuberculosis is challenging elimination of tuberculosis (TB). We evaluated risk factors for TB and levels of second-line drug resistance in M. tuberculosis in patients in Europe with multidrug-resistant (MDR) TB. A total of 380 patients with MDR TB and 376 patients...... with non-MDR TB were enrolled at 23 centers in 16 countries in Europe during 2010-2011. A total of 52.4% of MDR TB patients had never been treated for TB, which suggests primary transmission of MDR M. tuberculosis. At initiation of treatment for MDR TB, 59.7% of M. tuberculosis strains tested were...

Transcriptional profiles of pulmonary innate immune responses to isogenic antibiotic-susceptible and multidrug-resistant Pseudomonas aeruginosa.

Science.gov (United States)

Tam, Vincent H; Pérez, Cynthia; Ledesma, Kimberly R; Lewis, Russell E

2018-04-01

The virulence of an isogenic pair of Pseudomonas aeruginosa strains was studied under similar experimental conditions in two animal infection models. The time to death was significantly longer for the multidrug resistant (MDR) than the wild-type strain. The transcriptional profiles of 84 innate immune response genes in the lungs of immune competent Balb/C mice were further compared. Significantly weaker expression of genes involved in production of soluble pattern recognition receptor and complement were observed in animals infected with the MDR strain. Altered patterns of innate immune system activation may explain the attenuated virulence in MDR bacteria. © 2018 The Societies and John Wiley & Sons Australia, Ltd.

Mortality among MDR-TB cases: comparison with drug-susceptible tuberculosis and associated factors.

Directory of Open Access Journals (Sweden)

Kocfa Chung-Delgado

Full Text Available An increase in multidrug-resistant tuberculosis (MDR-TB cases is evident worldwide. Its management implies a complex treatment, high costs, more toxic anti-tuberculosis drug use, longer treatment time and increased treatment failure and mortality. The aims of this study were to compare mortality between MDR and drug-susceptible cases of tuberculosis, and to determine risk factors associated with mortality among MDR-TB cases.A retrospective cohort study was performed using data from clinical records of the National Strategy for Prevention and Control of Tuberculosis in Lima, Peru. In the first objective, MDR-TB, compared to drug-susceptible cases, was the main exposure variable and time to death, censored at 180 days, the outcome of interest. For the second objective, different variables obtained from clinical records were assessed as potential risk factors for death among MDR-TB cases. Cox regression analysis was used to determine hazard ratios (HR and 95% confidence intervals (95%CI. A total of 1,232 patients were analyzed: mean age 30.9 ±14.0 years, 60.0% were males. 61 patients (5.0% died during treatment, whereas the MDR-TB prevalence was 19.2%. MDR-TB increased the risk of death during treatment (HR = 7.5; IC95%: 4.1-13.4 when compared to presumed drug-susceptible cases after controlling for potential confounders. Education level (p = 0.01, previous TB episodes (p<0.001, diabetes history (p<0.001 and HIV infection (p = 0.04 were factors associated with mortality among MDR-TB cases.MDR-TB is associated with an increased risk of death during treatment. Lower education, greater number of previous TB episodes, diabetes history, and HIV infection were independently associated with mortality among MDR-TB cases. New strategies for appropriate MDR-TB detection and management should be implemented, including drug sensitivity tests, diabetes and HIV screening, as well as guarantee for a complete adherence to therapy.

Resistance patterns and trends of extensively drug-resistant tuberculosis: 5-year experience

Directory of Open Access Journals (Sweden)

Amresh Kumar Singh

2013-12-01

Full Text Available Objective:Extensively drug-resistant tuberculosis (XDR-TB strains were emerged when multidrug-resistant TB (MDR- TB was inadequately treated. Inadequate treatment of MDR-TB cases may result in additional resistance especially non-XDR-TB and then XDR-TB. The aim of this study was to know the prevalence, resistance patterns and trends of the XDR-TB strains among the MDR-TB at a tertiary care hospital in Lucknow, India Methods: A total of 430 Mycobacterium isolates were underwent NAP test and TB MPT64 Ag test for the identification of Mycobacterium tuberculosis complex (MTBC. Drug-susceptibility test (DST was performed over MTBC for the first line drugs by 1% proportion method (Bactec and for the second-line drugs by 1% proportion method (Lowenstein- Jensen media. The XDR-TB status was further confirmed by line probe assay (GenoType® MTBDRsl assay. Results: Among the 430 isolates of mycobacterium, 365 (84.9% were MTBC and 139 (38.1% were MDR-TB respectively. Further 97 MDR-TB from “highly suspected drug resistant-TB (DR-TB” cases among MDR-TB were tested with second line drugs in which 15 (15.5% XDR-TB and 82 (84.5% were non-XDR-TB. Regarding XDR-TB status, using the 1% proportion method a 100% agreement was seen with the GenoType® MTBDRsl assay. Resistance patterns of XDR-TB were as; 10/15 (66.7% as isoniazid + rifampicin + ciprofloxacin + amikacin resistance and 5/15 (33.3% as isoniazid + rifampicin + ciprofloxacin + amikacin + kanamycin resistance. Conclusion:The prevalence of XDR-TB was 15.5% among MDR-TB. Hence laboratory testing of “highly suspected drug resistant-TB” isolates should be done for both first and second line drugs simultaneously especially in developing countries.J Microbiol Infect Dis 2013;3(4: 169-175

Multidrug resistant commensal Escherichia coli in animals and its impact for public health

Directory of Open Access Journals (Sweden)

Ama eSzmolka

2013-09-01

Full Text Available After the era of plentiful antibiotics we are alarmed by the increasing number of antibiotic resistant strains. The genetic flexibility and adaptability of E. coli to constantly changing environments allows to acquire a great number of antimicrobial resistance mechanisms. Commensal strains of E. coli as versatile residents of the lower intestine are also repeatedly challenged by antimicrobial pressures during the lifetime of their host. As a consequence, commensal strains acquire the respective resistance genes, and/or develop resistant mutants in order to survive and maintain microbial homeostasis in the lower intestinal tract. Thus, commensal E. coli strains are regarded as indicators of antimicrobial load on their hosts. This chapter provides a short historic background of the appearance and presumed origin and transfer of antimicrobial resistance genes in commensal intestinal E. coli of animals with comparative information on their pathogenic counterparts. The dynamics, development and ways of evolution of resistance in the E. coli populations differ according to hosts, resistance mechanisms and antimicrobial classes used. The most frequent tools of E. coli against a variety of antimicrobials are the efflux pumps and mobile resistance mechanisms carried by plasmids and/or other transferable elements. The emergence of hybrid plasmids (both resistance and virulence among E. coli is of further concern. Co-existence and co-transfer of these bad genes in this huge and most versatile in vivo compartment may represent an increased public health risk in the future. Significance of multidrug resistant (MDR commensal E. coli seem to be highest in the food animal industry, acting as reservoir for intra- and interspecific exchange and a source for spread of MDR determinants through contaminated food to humans. Thus, public health potential of MDR commensal E. coli of food animals can be a concern and needs monitoring and more molecular analysis in the

Microarray-based analysis of IncA/C plasmid-associated genes from multidrug-resistant Salmonella enterica.

Science.gov (United States)

Lindsey, Rebecca L; Frye, Jonathan G; Fedorka-Cray, Paula J; Meinersmann, Richard J

2011-10-01

In the family Enterobacteriaceae, plasmids have been classified according to 27 incompatibility (Inc) or replicon types that are based on the inability of different plasmids with the same replication mechanism to coexist in the same cell. Certain replicon types such as IncA/C are associated with multidrug resistance (MDR). We developed a microarray that contains 286 unique 70-mer oligonucleotide probes based on sequences from five IncA/C plasmids: pYR1 (Yersinia ruckeri), pPIP1202 (Yersinia pestis), pP99-018 (Photobacterium damselae), pSN254 (Salmonella enterica serovar Newport), and pP91278 (Photobacterium damselae). DNA from 59 Salmonella enterica isolates was hybridized to the microarray and analyzed for the presence or absence of genes. These isolates represented 17 serovars from 14 different animal hosts and from different geographical regions in the United States. Qualitative cluster analysis was performed using CLUSTER 3.0 to group microarray hybridization results. We found that IncA/C plasmids occurred in two lineages distinguished by a major insertion-deletion (indel) region that contains genes encoding mostly hypothetical proteins. The most variable genes were represented by transposon-associated genes as well as four antimicrobial resistance genes (aphA, merP, merA, and aadA). Sixteen mercury resistance genes were identified and highly conserved, suggesting that mercury ion-related exposure is a stronger pressure than anticipated. We used these data to construct a core IncA/C genome and an accessory genome. The results of our studies suggest that the transfer of antimicrobial resistance determinants by transfer of IncA/C plasmids is somewhat less common than exchange within the plasmids orchestrated by transposable elements, such as transposons, integrating and conjugative elements (ICEs), and insertion sequence common regions (ISCRs), and thus pose less opportunity for exchange of antimicrobial resistance.

Phenotypic low-level isoniazid resistance as a marker to predict ethionamide resistance in Mycobacterium tuberculosis

Directory of Open Access Journals (Sweden)

Salima Qamar

2017-01-01

Full Text Available Background: Tuberculosis is one of the most prevalent diseases in Pakistan. Pakistan has the highest burden of MDR-TB in the Eastern Mediterranean region. Ethionamide is an anti-tuberculous drug frequently used to treat MDR-TB. Its drug susceptibility testing is not easily available in resource limited settings. Since it acts on the same target protein as isoniazid (inhA protein encoded by inhA gene, we sought to find out if phenotypic isoniazid resistance can be a marker of ethionamide resistance. Materials and Methods: This was a retrospective observational study conducted at the Aga Khan University hospital section of microbiology. Data was retrieved between 2011 to 2014 for all culture positive MTB strains. All culture positive MTB isolates with susceptibilities to isoniazid and ethionamide recorded were included in the study. Isoniazid and ethionamide susceptibilities were performed using agar proportion method on Middlebrook 7H10 agar. Rate of Ethionamide resistance between low-level isoniazid resistant, high level isoniazid resistant and isoniazid sensitive MTB was compared. Results: A total of 11,274 isolates were included in the study. A statistically significant association (P < 0.001 was found between Ethionamide resistance and low-level isoniazid resistance (26.6% as compared to high-level isoniazid resistance (8.85% and isoniazid sensitivity (0.71% in MTB strains. However this association was not seen in XDR-TB strains. Conclusion: Low level isoniazid resistance may be used as marker for phenotypic ethionamide resistance and hence guide clinicians' choice of antituberculous agent for MDR-TB in Pakistan. Further studies involving detection of genotypic association of isoniazid and ethionamide susceptibilities are needed before a final conclusion can be derived.

Association of the multidrug resistance-1 gene single-nucleotide polymorphisms with the tacrolimus dose requirements in renal transplant recipients.

Science.gov (United States)

Anglicheau, Dany; Verstuyft, Céline; Laurent-Puig, Pierre; Becquemont, Laurent; Schlageter, Marie-Hélène; Cassinat, Bruno; Beaune, Philippe; Legendre, Christophe; Thervet, Eric

2003-07-01

The immunosuppressive drug tacrolimus, whose pharmacokinetic characteristics display large interindividual variations, is a substrate for P-glycoprotein (P-gp), the product of the multidrug resistance-1 (MDR1) gene. Some of the single nucleotide polymorphisms (SNP) of MDR1 reported correlated with the in vivo activity of P-gp. Because P-gp is known to control tacrolimus intestinal absorption, it was postulated that these polymorphisms are associated with tacrolimus pharmacokinetic variations in renal transplant recipients. The objective of this study was to evaluate in a retrospective study of 81 renal transplant recipients the effect on tacrolimus dosages and concentration/dose ratio of four frequent MDR1 SNP possibly associated with P-gp function (T-129C in exon 1b, 1236C>T in exon 12, 2677G>T,A in exon 21, and 3435C>T in exon 26). As in the general population, the SNP in exons 12, 21, and 26 were frequent (16, 17.3, and 22.2% for the variant homozygous genotype, respectively) and exhibited incomplete linkage disequilibrium. One month after tacrolimus introduction, exon 21 SNP correlated significantly with the daily tacrolimus dose (P < or = 0.05) and the concentration/dose ratio (P < or = 0.02). Tacrolimus dose requirements were 40% higher in homozygous than wild-type patients for this SNP. The concentration/dose ratio was 36% lower in the wild-type patients, suggesting that, for a given dose, their tacrolimus blood concentration is lower. Haplotype analysis substantiated these results and suggested that exons 26 and 21 SNP may be associated with tacrolimus dose requirements. Genotype monitoring of the MDR1 gene reliably predicts the optimal dose of tacrolimus in renal transplant recipients and may predict the initial daily dose needed by individual patients to obtain adequate immunosuppression.

MicroRNA Expression Profiles Associated with Development of Drug Resistance in Ehrlich Ascites Tumor Cells

DEFF Research Database (Denmark)

Husted, Susanne; Søkilde, Rolf; Rask, Lene

2011-01-01

Multidrug resistance (MDR) poses a major obstacle to successful chemotherapeutic treatment of cancer, and often involves multiple genes, which may be regulated post-transcriptionally by microRNAs (miRNAs). The purpose of the present study was therefore to identify any resistance-associated change...

The culturable soil antibiotic resistome: a community of multi-drug resistant bacteria.

Science.gov (United States)

Walsh, Fiona; Duffy, Brion

2013-01-01

Understanding the soil bacterial resistome is essential to understanding the evolution and development of antibiotic resistance, and its spread between species and biomes. We have identified and characterized multi-drug resistance (MDR) mechanisms in the culturable soil antibiotic resistome and linked the resistance profiles to bacterial species. We isolated 412 antibiotic resistant bacteria from agricultural, urban and pristine soils. All isolates were multi-drug resistant, of which greater than 80% were resistant to 16-23 antibiotics, comprising almost all classes of antibiotic. The mobile resistance genes investigated, (ESBL, bla NDM-1, and plasmid mediated quinolone resistance (PMQR) resistance genes) were not responsible for the respective resistance phenotypes nor were they present in the extracted soil DNA. Efflux was demonstrated to play an important role in MDR and many resistance phenotypes. Clinically relevant Burkholderia species are intrinsically resistant to ciprofloxacin but the soil Burkholderia species were not intrinsically resistant to ciprofloxacin. Using a phenotypic enzyme assay we identified the antibiotic specific inactivation of trimethoprim in 21 bacteria from different soils. The results of this study identified the importance of the efflux mechanism in the soil resistome and variations between the intrinsic resistance profiles of clinical and soil bacteria of the same family.

The culturable soil antibiotic resistome: a community of multi-drug resistant bacteria.

Directory of Open Access Journals (Sweden)

Fiona Walsh

Full Text Available Understanding the soil bacterial resistome is essential to understanding the evolution and development of antibiotic resistance, and its spread between species and biomes. We have identified and characterized multi-drug resistance (MDR mechanisms in the culturable soil antibiotic resistome and linked the resistance profiles to bacterial species. We isolated 412 antibiotic resistant bacteria from agricultural, urban and pristine soils. All isolates were multi-drug resistant, of which greater than 80% were resistant to 16-23 antibiotics, comprising almost all classes of antibiotic. The mobile resistance genes investigated, (ESBL, bla NDM-1, and plasmid mediated quinolone resistance (PMQR resistance genes were not responsible for the respective resistance phenotypes nor were they present in the extracted soil DNA. Efflux was demonstrated to play an important role in MDR and many resistance phenotypes. Clinically relevant Burkholderia species are intrinsically resistant to ciprofloxacin but the soil Burkholderia species were not intrinsically resistant to ciprofloxacin. Using a phenotypic enzyme assay we identified the antibiotic specific inactivation of trimethoprim in 21 bacteria from different soils. The results of this study identified the importance of the efflux mechanism in the soil resistome and variations between the intrinsic resistance profiles of clinical and soil bacteria of the same family.

Study of tea polyphenol as a reversal agent for carcinoma cell lines' multidrug resistance (study of TP as a MDR reversal agent)

International Nuclear Information System (INIS)

Zhu Aizhi; Wang Xiangyun; Guo Zhenquan

2001-01-01

The aim of this study was to examine MDR1 expression product P-glycoprotein (Pgp) and study the effect and mechanism of tea polyphenol (TP) in reversion of multidrug resistance (MDR) in carcinoma cell lines. Immunocytochemical method was used for qualitative detection of Pgp. A comparative study of cytotoxicity and multidrug resistance reversion effect was made by MTT assay for tea polyphenol and quinidine in MCF-7 and MCF-7/Adr cell lines. The multidrug resistance reversion effect and mechanism were studied by measuring the uptake of 99m Tc-tetrofosmin in the carcinoma cell lines. (1) The Pgp overexpression in MCF-7/Adr cells was found to be strong positive, while the Pgp expression of MCF-7 was negative. (2) Although both tea polyphenol and quinidine could not remarkably change the toxicity of adriamycin to MCF-7, they could improve the sensitivity of MCF-7/Adr to adriamycin. The reversion index of tea polyphenol and quinidine was 3 and 10 respectively. (3) The cellular uptake of 99m Tc-tetrofosmin was remarkably lower in MCF-7/Adr than in MCF-7. The uptake of 99m Tc-tetrofosmin in MCF-7/Adr exhibited a 4, 13, 16 fold increase in the presence of 200, 400 and 500 μg/ml of tea polyphenol respectively. The uptake of 99m Tc-tetrofosmin in MCF-7/Adr exhibited only a 4-fold increase in the presence of 200 μM of quinidine. Immunocytochemistry can detect P-glycoprotein expression level qualitatively. Tea polyphenol is not only an anti-tumor agent, but also a multidrug resistant modulator similar to quinidine. The multidrug resistance reversion mechanism of tea polyphenol seems to be its inhibition of the activity of P-glycoprotein. Tea polyphenol has the advantage of very low toxicity in tumor treatment

Effects of genetic polymorphisms of CYP2C19*2/*3 and MDR1 C3435T on the pharmacokinetics of lansoprazole in healthy Chinese subjects.

Science.gov (United States)

Zhang, Yu-Xin; Wei, Shi-Jie; Yang, Xiao-Ying; Zhang, Wen-Ping; Wang, Xin-Yu; Dang, Hong-Wan

2014-10-01

To evaluate the influence of CYP2C19*2/*3 and MDR1 C3435T polymorphisms on the pharmacokinetics of lansoprazole (LPZ) in healthy Chinese subjects. All 24 subjects were from a study of bioequivalence. Plasma concentrations of LPZ were determined by liquid chromatography/mass spectrometry. Cytochrome P450 (CYP) 2C19*2/*3 and multidrug resistance transporter gene 1 (MDR1) C3435T of the subjects were genotyped by polymerase chain reaction-restriction fragment length polymorphism. Significant differences were found in the area under the concentration-time curve from predose to T (AUC(0-T)), area under the concentration-time curve from predose to infinity (AUC(0-∞), t(1/2)), and apparent oral clearance (CL/F) of LPZ between CYP2C19 extensive metabolizers and intermediate metabolizers (p < 0.05). The AUC(0-T), AUC(0-∞), maximum plasma concentration, and CL/F of LPZ were significantly different between subjects with the MDR1 C3435T C/C, C/T, and T/T polymorphisms (p < 0.05). CYP2C19*2/*3 and MDR1 C3435T polymorphisms are important determinants of LPZ pharmacokinetics.

Characterization of Multidrug Resistant ESBL-Producing Escherichia coli Isolates from Hospitals in Malaysia

Directory of Open Access Journals (Sweden)

King-Ting Lim

2009-01-01

Full Text Available The emergence of Escherichia coli that produce extended spectrum β-lactamases (ESBLs and are multidrug resistant (MDR poses antibiotic management problems. Forty-seven E. coli isolates from various public hospitals in Malaysia were studied. All isolates were sensitive to imipenem whereas 36 were MDR (resistant to 2 or more classes of antibiotics. PCR detection using gene-specific primers showed that 87.5% of the ESBL-producing E. coli harbored the blaTEM gene. Other ESBL-encoding genes detected were blaOXA, blaSHV, and blaCTX-M. Integron-encoded integrases were detected in 55.3% of isolates, with class 1 integron-encoded intI1 integrase being the majority. Amplification and sequence analysis of the 5′CS region of the integrons showed known antibiotic resistance-encoding gene cassettes of various sizes that were inserted within the respective integrons. Conjugation and transformation experiments indicated that some of the antibiotic resistance genes were likely plasmid-encoded and transmissible. All 47 isolates were subtyped by PFGE and PCR-based fingerprinting using random amplified polymorphic DNA (RAPD, repetitive extragenic palindromes (REPs, and enterobacterial repetitive intergenic consensus (ERIC. These isolates were very diverse and heterogeneous. PFGE, ERIC, and REP-PCR methods were more discriminative than RAPD in subtyping the E. coli isolates.

Investigating of four main carbapenem-resistance mechanisms in high-level carbapenem resistant Pseudomonas aeruginosa isolated from burn patients

Directory of Open Access Journals (Sweden)

Soodabeh Rostami

2018-02-01

Conclusion: Emerging antimicrobial resistance in burn wound bacterial pathogens is a serious therapeutic challenge for clinicians. In the present study, most of the isolates were MDR. This finding indicated an alarming spread of resistant isolates and suggested that infection control strategies should be considered. Resistance to carbapenems is influenced by several factors, not all of which were evaluated in our study; however, the results showed that production of MBLs and overexpression of the mexB gene were the most frequent mechanisms in carbapenem-resistant isolates.

Evaluation of GenoType® MTBDRplus assay for rapid detection of drug susceptibility testing of multi-drug resistance tuberculosis in Northern India

Directory of Open Access Journals (Sweden)

Anand Kumar Maurya

2013-01-01

Full Text Available Background: The problem of multi-drug resistance tuberculosis (MDR-TB is growing in several hotspots throughout the world. Rapid and accurate diagnosis of MDR-TB is crucial to facilitate early treatment and to reduce its spread in the community. The aim of the present study was to evaluate the new, novel GenoType® MTBDRplus assay for rapid detection of drug susceptibility testing (DST of MDR-TB cases in Northern India. Materials and Methods: A total of 550 specimens were collected from highly suspected drug resistant from pulmonary and extra-pulmonary TB cases. All the specimens were processed by Ziehl- Neelsen staining, culture, differentiation by the GenoType® CM assay, first line DST using BacT/ALERT 3D system and GenoType® MTBDRplus assay. The concordance of the GenoType® MTBDRplus assay was calculated in comparison with conventional DST results. Results: Overall the sensitivity for detection of rifampicin, isoniazid and MDR-TB resistance by GenoType® MTBDRplus assay was 98.0%, 98.4% and 98.2% respectively. Out of 55 MDR-TB strains, 45 (81.8%, 52 (94.5% and 17 (30.9% strains showed mutation in rpoB, katG and inhA genes respectively (P < 0.05. The most prominent mutations in rpoB, katG and inhA genes were; 37 (67.3% in S531L, 52 (94.5% in S315T1 and 11 (20% in C15T regions respectively (P < 0.05. Conclusions: Our study demonstrated a high concordance between the GenoType® MTBDRplus assay resistance patterns and those were observed by conventional DST with good sensitivity, specificity with short turnaround times and to control new cases of MDR-TB in countries with a high prevalence of MDR-TB.

Lack of Association of Multidrug Resistance Gene-1 Polymorphisms with Treatment Outcome in Chronic Myeloid Leukemia Patients Treated with Imatinib

Directory of Open Access Journals (Sweden)

Yaya Kassogue

2015-10-01

Full Text Available Background: Despite the impressive results obtained with imatinib, inadequate response or resistance are observed in certain patients. It is known that imatinib is a substrate of a multidrug resistance gene (MDR1. Thus, interindividual genetic differences linked to single nucleotide polymorphisms in MDR1 may influence the metabolism of imatinib. The present study has aimed to examine the impact of MDR1 polymorphisms on the hematologic and cytogenetic responses in 70 chronic myeloid leukemia patients who received imatinib. Methods: We used a polymerase chain reaction followed by restriction fragment length polymorphism to identify different profiles of 1236C>T, 2677G>T and 3435C>T in MDR1. Results: The distribution of the three SNPs in responders and poor responders did not show any particular trend (P>0.05. The T allele was slightly higher in responders, but not significantly regardless of the type of SNP (40.3% vs. 33.8% for 1236C>T; 25% vs. 14.7% for 2677G>T and 33.3% vs. 22% for 3435C>T. The dominant model showed a similar trend (P>0.05. Diplotypes composed by the T allele in different exons were frequent in responders. Haplotype analysis showed that 1236C-2677G-3435C was slightly higher in poor responders (60.02% compared to responders (50.42%. However, 1236T-2677T-3435T was frequent in responders (16.98% compared to poor responders (13.1%. Overall, none of the haplotypes were associated with IM response in our cohort (global haplotype association test, P=0.39. Conclusion: The identification of 1236C>T, 2677G>T and 3435C>T polymorphisms may not be advantageous to predict imatinib response for our chronic myeloid leukemia patients.

The expression and significance of multi-drug resistance genes in breast cancer stem cells%乳腺癌干细胞多药耐药基因的表达及意义

Institute of Scientific and Technical Information of China (English)

Zhi Li; Chunping Liu; Yanli He; Jinghui Zhang; Tao Huang

2008-01-01

Objective:To approach the expressions of MDR1 and BCRP in breast cancer stem cells and differentiated cells.Methods:The breast cancer stem calls were separated from human breast cancer primary tissues and MCF-7 by flow cytometry.Then we measured the expressions of MDR1 and BCRP with different subset cells by Realtime-PCR.Results:Contrasted with breast cancer differentiated cells,the expressions of MDR1 and BCRP in breast cancer stem calls were higher (P＜0.01),and the proportion of stem cells rose after chemotherapy (P＜0.01).Conclusion:Contrasted with breast cancer differentiated cells,breast cancer stem cells have stronger ability of clrug-resistanca with higher level of multi-drug resistance genes,and it is one of key points for chemotherapy failure of breast cancer.

Metallo- β-lactamases among Multidrug Resistant (MDR Gram Negative Bacteria Isolated from Clinical Specimens during 2009 in Sanandaj, Kurdistan Province

Directory of Open Access Journals (Sweden)

Himen Salimizand

2012-08-01

Full Text Available Background: Today, there are numerous reports about emerging multi drug resistant gram negative bacteria all around the world, especially in ICUs. Rarely, Metallo-β-lactamase (MBL enzymes are responsible for these cases. Study of MBLs for diagnosing and preventing distribution of the origin of infection are critical issues. In addition, we would like to compare the efficacy of Iranian and foreign- made antibiotic disks. Materials and Methods: During 2009 all entered clinical specimens to the laboratory tested for detecting gram negative bacteria. Isolated bacteria were tested by Kirby-Bauer method to antibiotic susceptibility test by Iranian and foreign (MAST disks. For gram negative carbapenem resistant isolates, PCR technique used to detect VIM, GIM, and SIM variants of MBLs.Results: During one year, 17890 clinical specimens referred Besat laboratory. The most specimen was Urine (8172 followed by blood culture (5190 that in which 1110 gram negative and positives isolated. Out of which, 778 (70% of isolates were gram negatives. MDR gram negatives were 157 (20.2%. Imipenem and meropenem were the most efficient antibiotics (all susceptible and ceftriaxone was the least (19 % susceptible. E. coli was the most prevalent isolate. 79 Gram negative isolates (10.1% were resistant to Iranian-made discs but all susceptible for foreign ones. All 79 isolates were tested by PCR for MBL genes, that, all were negative. Besides, Iranian imipenem and cefepime disks have had distinguishable difference in susceptibility of isolates.Conclusion: Fortunately, none of gram negative isolates were MBL producer, which revealed no colonization of MBL producing bacteria. Iranian-made disks appear efficient except for imipenem and cefepime.

Resistance patterns among multidrug-resistant tuberculosis patients in greater metropolitan Mumbai: trends over time.

Science.gov (United States)

Dalal, Alpa; Pawaskar, Akshay; Das, Mrinalini; Desai, Ranjan; Prabhudesai, Pralhad; Chhajed, Prashant; Rajan, Sujeet; Reddy, Deepesh; Babu, Sajit; Jayalakshmi, T K; Saranchuk, Peter; Rodrigues, Camilla; Isaakidis, Petros

2015-01-01

While the high burden of multidrug-resistant tuberculosis (MDR-TB) itself is a matter of great concern, the emergence and rise of advanced forms of drug-resistance such as extensively drug-resistant TB (XDR-TB) and extremely drug-resistant TB (XXDR-TB) is more troubling. The aim of this study was to investigate the trends over time of patterns of drug resistance in a sample of MDR-TB patients in greater metropolitan Mumbai, India. This was a retrospective, observational study of drug susceptibility testing (DST) results among MDR-TB patients from eight health care facilities in greater Mumbai between 2005 and 2013. We classified resistance patterns into four categories: MDR-TB, pre-XDR-TB, XDR-TB and XXDR-TB. A total of 340 MDR-TB patients were included in the study. Pre-XDR-TB was the most common form of drug-resistant TB observed overall in this Mumbai population at 56.8% compared to 29.4% for MDR-TB. The proportion of patients with MDR-TB was 39.4% in the period 2005-2007 and 27.8% in 2011-2013, while the proportion of those with XDR-TB and XXDR-TB was changed from 6.1% and 0% respectively to 10.6% and 5.6% during the same time period. During the same periods, the proportions of patients with ofloxacin, moxifloxacin and ethionamide resistance significantly increased from 57.6% to 75.3%, from 60.0% to 69.5% and from 24.2% to 52.5% respectively (pMumbai highlight the need for individualized drug regimens, designed on the basis of DST results involving first- and second-line anti-TB drugs and treatment history of the patient. A drug-resistant TB case-finding strategy based on molecular techniques that identify only rifampicin resistance will lead to initiation of suboptimal treatment regimens for a significant number of patients, which may in turn contribute to amplification of resistance and transmission of strains with increasingly advanced resistance within the community.

Dissemination of Multidrug-Resistant, Class I and II Integrons and Molecular Typing of CTX-M-producing Klebsiella pneumoniae.

Science.gov (United States)

Akya, Alisha; Elahi, Azam; Chegenelorestani, Roya; Rezaee, Mahya

2018-01-01

Klebsiella pneumoniae ( K. pneumoniae ) is an important opportunistic pathogen causes serious community and hospital-acquired infections, which is highly resistant to antibiotics. We aimed to determine the frequency of multidrug resistant (MDR) and molecular typing of clinical isolates of K. pneumoniae . One hundred isolates of K. pneumoniae were collected from clinical samples in three general hospitals in Kermanshah. The antimicrobial susceptibility and extended-spectrum beta-lactamases (ESBL) production of isolates were determined using disk diffusion and combined disk methods, respectively. The bla CTX-M gene, class I and II integrons were detected using polymerase chain reaction. The bla CTX-M positive isolates were selected for genotyping using pulsed-field gel electrophoresis (PFGE). MDR phenotype was observed in 56% of isolates. The 40% of isolates were ESBL positive and 35 isolates contained bla CTX-M . Class I and II of integrons were detected in 50 (89.2%) and 39 (69.6%) of MDR isolates, respectively. PFGE patterns of K. pneumoniae bla CTX-M positive isolates indicated 19 clusters (X 1-19 ) with different genotype patterns. The study findings highlight the concern of circulating MDR strains of K. pneumoniae with bla CTX-M and class I and II integrons in Kermanshah hospitals. The presence of integrons among isolates may facilitate the spread of new resistance genes in this bacterium. Therefore, surveillance for the spread of MDR strains of this bacterium is recommended in hospitals.

Should all suspected tuberculosis cases in high income countries be tested with GeneXpert?

Science.gov (United States)

Vella, Venanzio; Broda, Agnieszka; Drobniewski, Francis

2018-05-01

In countries with a low incidence of multidrug-resistant tuberculosis (MDR-TB), universal testing with GeneXpert might not be always cost-effective. This study provides hospital managers in low MDR-TB incidence countries with criteria on when decentralised universal GeneXpert testing would make sense. The alternatives taken into consideration include: universal microbiological culture and drug susceptibility testing (DST) only (comparator); as above but with concurrent centralized GeneXpert in a referral laboratory vs a decentralized GeneXpert system in every hospital to test smear-positive cases only; as above but testing all samples with GeneXpert regardless of smear status. The parameters were from the national TB statistics for England and from a systematic review. Decentralised GeneXpert to test any suspected TB case was the most cost-effective option when 6% or more TB patients belonged to the high-risk group, defined as previous TB diagnosis and or being born in countries with a high MDR-TB incidence. Hospital managers in England and other low MDR-TB incidence countries could use these findings to decide when to invest in GeneXpert or other molecular diagnostics with similar performance criteria for TB diagnostics. Copyright © 2017 Elsevier Ltd. All rights reserved.

In vitro activity of rifampicin alone and in combination with imipenem against multidrug-resistant Acinetobacter baumannii harboring the blaOXA-72 resistance gene.

Science.gov (United States)

Majewski, Piotr; Wieczorek, Piotr; Ojdana, Dominika; Sacha, Paweł Tomasz; Wieczorek, Anna; Tryniszewska, Elżbieta Anna

2014-04-01

The growing incidence of multidrug resistance (MDR) in bacteria is an emerging challenge in the treatment of infections. Acinetobacter baumannii is an opportunistic pathogen prone to exhibit MDR that contributes significantly to nosocomial infections, particularly in severely ill patients. Thus, we performed research on rifampicin activity against selected MDR OXA-72 carbapenemase-producing A. baumannii strains. Since it is widely accepted that rifampicin should not be used as monotherapy in order to avoid the rapid development of rifampicin resistance, we evaluated the efficacy of combination therapy with imipenem. Minimal inhibitory concentrations (MICs) of both rifampicin and imipenem were determined by use of the broth microdilution method. Evaluations of the interactions between rifampicin and imipenem were performed by analysis of the fractional inhibitory concentration index (∑FIC), determined using the checkerboard titration method. All tested isolates showed full susceptibility to rifampicin. The checkerboard method revealed synergism in 5 isolates (29%) and an additive effect in another 5 isolates (29%); no difference was reported in the remaining 7 isolates (41%). Strains moderately resistant to imipenem (MIC ≤ 64 mg/l) tended to show synergy or additive interaction. We conclude that in vitro synergism or an additive interaction between rifampicin and imipenem most likely occurs in A. baumannii strains showing moderate resistance to imipenem (MIC ≤ 64 mg/l). Moreover, utilizing this combination in the therapy of infections caused by strains exhibiting higher levels of resistance (MIC > 64 mg/l) is not recommended since in this setting imipenem could not prevent the development of rifampicin resistance.

Genotypic analysis of multidrug-resistant tuberculosis isolates from extra pulmonary tuberculosis cases in tertiary care centers in Northern India

Directory of Open Access Journals (Sweden)

Anand K Maurya

2016-01-01

Conclusion: The prevalence (13.4% of MDR-TB among EPTB was high, and the most prominent mutations in rpoB, katG, and inhA genes were S531L (67.3%, S315T1 (94.5%, and C15T (20%, respectively. Beijing stains are significantly associated with MDR-TB among EPTB in this region. We found that the transmission of prominent mutations contributes to an unexpected increase in primary resistance, including MDR-TB cases in Northern India.

Antibacterial Activity Test of Nudibranches Polka - Dot (Jorunna funebris (Gastropods : Molusc Extract Against Multi(Aktivitas Antibakteri Ekstrak Nudibranch Polka-Dot (Jorunna funebris (Gastropoda : Moluska Terhadap Bakteri Multidrug Resistant (MDR

Directory of Open Access Journals (Sweden)

Delianis Pringgenies

2015-12-01

Full Text Available Terjadinya resistensi antibiotik menjadi permasalahan dalam dunia kesehatan. Peningkatan kemampuan patogen dalam menahan efek obat menyebabkan timbulnya resistensi. Beberapa bakteri patogen pada manusia dilaporkan telah mengalami resistensi terhadap lebih dari satu kelas antibiotik. Untuk mengatasi permasalahan tersebut, maka perlu dilakukan pencarian senyawa antibiotik baru yang lebih efektif dalam mengatasi permasalahan bakteri Multi-drug Resistant (MDR. Metabolit sekunder yang diproduksi oleh invertebrata laut  mempunyai prospek sebagai bahan obat dari laut. Nudibranch diduga mampu menghasilkan metabolit sekunder sebagai mekanisme pertahanan diri. Tujuan dari penelitian ini adalah untuk mengetahui fraksi dari ekstrak nudibranch Jorunna funebris yang menunjukkan bioaktivitas terhadap bakteri Multi-drug Resistant (MDR. Proses ekstraksi dilakukan dengan metode maserasi. Fraksinasi dengan Kromatografi Kolom Terbuka (KKT. Uji aktivitas antibakteri menggunakan metode difusi agar. Analisis komponen senyawa dengan GC-MS. Hasil penelitian menunjukkan bahwa 8 fraksi ekstrak nudibranch J. funebris menunjukkan aktivitas antibakteri. Hasil uji aktivitas menunjukkan fraksi I paling aktif terhadap 5 bakteri uji yaitu Klebsiella, Pseudomonas, Escherichia coli, Enterobacter 5 dan Enterobacter 10 dengan rata-rata zona hambatan secara berurutan sebesar 12,78 mm; 12,51 mm; 15,47 mm; 14,09 mm dan 12,46 mm. Fraksi II paling aktif terhadap bakteri Coagulase Negative Staphylococcus dengan rata-rata zona hambatan sebesar 12,70 mm. Analisis GC-MS menunjukkan bahwa dalam fraksi II terdapat senyawa 1-oktadekanol yang berpotensi sebagai antibakteri. Kata kunci : nudibranch, Jorunna funebris, antibakteri, multi-drug resistant, 1-oktadekanol Emergence of antibiotic resistance become a problems on medical world. Increasing pathogen ability to hold the antibiotic effect caused resistance. Several human-patogen bacteria were resistance to one or more classes of antibiotics

Virulence-associated genes, antimicrobial resistance and molecular typing of Salmonella Typhimurium strains isolated from swine from 2000 to 2012 in Brazil.

Science.gov (United States)

Almeida, F; Medeiros, M I C; Kich, J D; Falcão, J P

2016-06-01

The aims of this study were to assess the pathogenic potential, antimicrobial resistance and genotypic diversity of Salmonella Typhimurium strains isolated in Brazil from swine (22) and the surrounding swine environment (5) from 2000 to 2012 and compare them to the profiles of 43 human strains isolated from 1983 to 2010, which had been previously studied. The presence of 12 SPI-1, SPI-2 and plasmid genes was assessed by PCR, the antimicrobial susceptibility to 13 antimicrobials was determined by the disc diffusion assay and genotyping was performed using pulsed-field gel electrophoresis (PFGE), multiple-locus variable-number of tandem repeats analysis (MLVA) and ERIC-PCR. More than 77·8% of the swine strains carried 10 or more of the virulence markers. Ten (37%) strains isolated from swine were multi-drug resistant (MDR). All the molecular typing techniques grouped the strains in two main clusters. Some strains isolated from swine and humans were allocated together in the PFGE-B2, MLVA-A1, MLVA-B and ERIC-A1 clusters. The genotyping results suggest that some strains isolated from swine and humans may descend from a common subtype and may indicate a possible risk of MDR S. Typhimurium with high frequency of virulence genes isolated from swine to contaminate humans in Brazil. This study provided new information about the pathogenic potential, antimicrobial resistance and genotypic diversity of S. Typhimurium isolates from swine origin in Brazil, the fourth largest producer of pigs worldwide. © 2016 The Society for Applied Microbiology.

Comparison of bacteriological conversion and treatment outcomes among MDR-TB patients with and without diabetes in Mexico: Preliminary data

Directory of Open Access Journals (Sweden)

M. Muñoz-Torrico

2017-01-01

Full Text Available Diabetes mellitus (DM is a well-known risk factor for tuberculosis (TB. However, it is not known to what extent DM affects the outcome in patients with multidrug-resistant (MDR-TB and extensively drug-resistant TB (XDR-TB treated with second-line anti-TB drugs.The objective of this study was to compare the microbiological evolution (sputum smear and culture conversion and final outcomes of MDR/XDR-TB patients with and without DM, managed at the national TB reference centre in Mexico City. Results: Ninety patients were enrolled between 2010 and 2015: 73 with MDR-TB (81.1%, 11 with pre-XDR-TB (e.g. MDR-TB with additional resistance to one injectable drug or a fluoroquinolone, 12.2% and 6 (6.7% with XDR-TB. Out of these, 49 (54.4% had DM and 42 (86% were undergoing insulin treatment.No statistically significant differences were found in treatment outcomes comparing DM vs. non-DM MDR-TB cases: 18/32 (56.3% of DM cases and 19/24 (79.2% non DM patients achieved treatment success (p = 0.07. The time to sputum smear and culture conversion was longer (although not statistically in patients without DM, as follows: the mean (±SD time to sputum smear conversion was 53.9 (±31.4 days in DM patients and 65.2 (±34.8 days in non-DM ones (p = 0.15, while the time to culture conversion was 66.2 (±27.6 days for DM and 81.4 (±37.7 days for non-DM MDR-TB cases (p = 0.06. Conclusions: The study results support the Mexican National TB programme to strengthen its collaboration with the DM programme, as an entry point for TB (and latent TB infection screening and management. Keywords: Diabetes mellitus, Delay, Sputum and culture conversion, MDR-TB, High treatment adherence

Emergence of fluoroquinolone resistance among drug resistant tuberculosis patients at a tertiary care facility in Karachi, Pakistan.

Science.gov (United States)

Zaidi, Syed Mohammad Asad; Haseeb, Abdul; Habib, Shifa Salman; Malik, Amyn; Khowaja, Saira; SaifUllah, Nausheen; Rizvi, Nadeem

2017-07-25

Pakistan is classified as one of the high multi-drug resistant tuberculosis (MDR-TB) burden countries. A poorly regulated private sector, over-prescription of antibiotics and self-medication has led to augmented rates of drug-resistance in the country. Pakistan's first national anti-tuberculosis drug resistance survey identified high prevalence of fluoroquinolone resistance among MDR-TB patients. Further institutional evidence of fluoroquinolone drug-resistance can support re-evaluation of treatment regimens as well as invigorate efforts to control antibiotic resistance in the country. In this study, data for drug-susceptibility testing (DST) was retrospectively analyzed for a total of 133 patients receiving MDR-TB treatment at the Chest Department of Jinnah Postgraduate Medical Center, Karachi, Pakistan. Frequency analyses for resistance patterns was carried out and association of fluoroquinolone (ofloxacin) resistance with demographics and past TB treatment category were assessed. Within first-line drugs, resistance to isoniazid was detected in 97.7% of cases, followed by rifampicin (96.9%), pyrazinamide (86.4%), ethambutol (69.2%) and streptomycin (64.6%). Within second-line drugs, ofloxacin resistance was detected in 34.6% of cases. Resistance to ethionamide and amikacin was 2.3% and 1.6%, respectively. Combined resistance of oflaxacin and isoniazid was detected in 33.9% of cases. Age, gender and past TB treatment category were not significantly associated with resistance to ofloxacin. Fluoroquinolone resistance was observed in an alarmingly high proportion of MDR-TB cases. Our results suggest caution in their use for empirical management of MDR-TB cases and recommended treatment regimens for MDR-TB may require re-evaluation. Greater engagement of private providers and stringent pharmacy regulations are urgently required.

Persistence of Multidrug-Resistant Acinetobacter baumannii Isolates Harboring blaOXA-23 and bap for 5 Years.

Science.gov (United States)

Sung, Ji Youn; Koo, Sun Hoe; Kim, Semi; Kwon, Gye Cheol

2016-08-28

The emergence and dissemination of carbapenemase-producing Acinetobacter baumannii isolates have been reported worldwide, and A. baumannii isolates harboring blaOXA-23 are often resistant to various antimicrobial agents. Antimicrobial resistance can be particularly strong for biofilm-forming A. baumannii isolates. We investigated the genetic basis for carbapenem resistance and biofilm-forming ability of multidrug-resistant (MDR) clinical isolates. Ninety-two MDR A. baumannii isolates were collected from one university hospital located in the Chungcheong area of Korea over a 5-year period. Multiplex PCR and DNA sequencing were performed to characterize carbapenemase and bap genes. Clonal characteristics were analyzed using REP-PCR. In addition, imaging and quantification of biofilms were performed using a crystal violet assay. All 92 MDR A. baumannii isolates involved in our study contained the blaOXA-23 and bap genes. The average absorbance of biomass in Bap-producing strains was much greater than that in non-Bap-producing strains. In our study, only three REP-PCR types were found, and the isolates showing type A or type B were found more than 60 times among unique patients during the 5 years of surveillance. These results suggest that the isolates have persisted and colonized for 5 years, and biofilm formation ability has been responsible for their persistence and colonization.

Expression of Drug-Resistant Factor Genes in Hepatocellular Carcinoma Patients Undergoing Chemotherapy with Platinum Complex by Arterial Infusion

Directory of Open Access Journals (Sweden)

Shiro Ueda

2010-09-01

Full Text Available This study investigated gene expression of drug resistance factors in biopsy tissue samples from hepatocellular carcinoma (HCC patients undergoing chemotherapy by platinum complex. Liver biopsy was performed to collect tissue from the tumor site (T and the non-tumor site (NT prior to the start of treatment. For drug-resistant factors, drug excretion transporters cMOAT and MDR-1, intracellular metal binding protein MT2, DNA repair enzyme ERCC-l and inter-nucleic cell transport protein MVP, were investigated. The comparison of the expression between T and NT indicated a significant decrease of MT2 and MDR-1 in T while a significant increase in ERCC-1 was noted in T. Further, expression was compared between the response cases and non-response cases using the ratios of expression in T to those in NT. The response rate was significantly low in the high expression group when the cutoff value of cMOAT and MT2 was set at 1.5 and 1.0, respectively. Furthermore, when the patients were classified into A group (cMOAT ≧ 1.5 or MT2 ≧ 1.0 and B group (cMOAT < 1.5 and MT2 < 1.0, the response rate of A group was significantly lower than B group when we combined the cutoff values of cMOAT and MT2. It is considered possible to estimate the therapeutic effect of platinum complex at a high probability by combining the expression condition of these two genes.

Evaluation of efficiency of nested multiplex allele-specific PCR assay for detection of multidrug resistant tuberculosis directly from sputum samples.

Science.gov (United States)

Mistri, S K; Sultana, M; Kamal, S M M; Alam, M M; Irin, F; Nessa, J; Ahsan, C R; Yasmin, M

2016-05-01

For an effective control of tuberculosis, rapid detection of multidrug resistant tuberculosis (MDR-TB) is necessary. Therefore, we developed a modified nested multiplex allele-specific polymerase chain reaction (MAS-PCR) method that enables rapid MDR-TB detection directly from sputum samples. The efficacy of this method was evaluated using 79 sputum samples collected from suspected tuberculosis patients. The performance of nested MAS-PCR method was compared with other MDR-TB detection methods like drug susceptibility testing (DST) and DNA sequencing. As rifampicin (RIF) resistance conforms to MDR-TB in greater than 90% cases, only the presence of RIF-associated mutations in rpoB gene was determined by DNA sequencing and nested MAS-PCR to detect MDR-TB. The concordance between nested MAS-PCR and DNA sequencing results was found to be 96·3%. When compared with DST, the sensitivity and specificity of nested MAS-PCR for RIF-resistance detection were determined to be 92·9 and 100% respectively. For developing- and high-TB burden countries, molecular-based tests have been recommended by the World Health Organization for rapid detection of MDR-TB. The results of this study indicate that, nested MAS-PCR assay might be a practical and relatively cost effective molecular method for rapid detection of MDR-TB from suspected sputum samples in developing countries with resource poor settings. © 2016 The Society for Applied Microbiology.

Phenotypic and genotypic profile of clinical and animal multidrug-resistant Salmonella enterica isolates from Mexico.

Science.gov (United States)

Aguilar-Montes de Oca, S; Talavera-Rojas, M; Soriano-Vargas, E; Barba-León, J; Vázquez-Navarrete, J; Acosta-Dibarrat, J; Salgado-Miranda, C

2018-01-01

The objective of this study was to obtain a phenotypic and genotypic profile of Salmonella enterica including multidrug-resistant (MDR) isolates from food-producing animals and clinical isolates, as well as their genetic relatedness in two different States of Mexico (Jalisco and State of Mexico). A total of 243 isolates were evaluated in terms of antimicrobial resistance (AMR) and related genes through a disk diffusion method and PCR respectively; we found 16 MDR isolates, all of them harbouring the bla CMY gene but not qnr genes, these isolates represent less than 10% of the collection. The pulsed-field gel electrophoresis revealed a higher genotypic similitude within isolates of State of Mexico than Jalisco. A low percentage of Salmonella isolates were resistant to relevant antibiotics in human health, nevertheless, the AMR and involved genes were similar despite the different serovars and origin of the isolates. This investigation provided an insight of the current status of AMR of Salmonella isolates in two States of Mexico and pinpoint the genes involved in AMR and their epidemiological relationship, the information could help to determine an adequate therapy in human and veterinary medicine. © 2017 The Society for Applied Microbiology.

The draft genome sequence of multidrug-resistant Pseudomonas aeruginosa strain CCBH4851, a nosocomial isolate belonging to clone SP (ST277 that is prevalent in Brazil

Directory of Open Access Journals (Sweden)

Melise Silveira

2014-12-01

Full Text Available The high occurrence of nosocomial multidrug-resistant (MDR microorganisms is considered a global health problem. Here, we report the draft genome sequence of a MDR Pseudomonas aeruginosa strain isolated in Brazil that belongs to the endemic clone ST277. The genome encodes important resistance determinant genes and consists of 6.7 Mb with a G+C content of 66.86% and 6,347 predicted coding regions including 60 RNAs.

Effect of pO2 on antitumor drug cytotoxicity on MDR and non-MDR variants selected from the LoVo metastatic colon carcinoma cell line.

Science.gov (United States)

Lelong-Rebel, Isabelle; Brisson, Christine; Fabre, Michel; Bergerat, Jean-Pierre; Rebel, Gérard

2008-01-01

Two chemosensitive cell lines, LoVo-fusoid (LoVo-f) and LoVo-small cells (LoVo-sc) were derived from the original LoVo cell line. These two variants and the multidrug-resistant (MDR) cell line LoVo-Dox were screened for various properties. In non-permeabilized cells, only LoVo-sc showed mucin-2 staining whereas labelling was positive in all permeabilized cell lines. As shown by electron microscopy screening and by relative resistance to trypsin detachment, only LoVo-sc cells showed strong mucus secretion. All three cell lines displayed strong staining for P-glycoprotein (P-gp), multidrug resistance-associated protein (MRP) and lung-resistance-related protein (LRP) in different locations according to the drug resistance state. The three cell lines showed intracellular labelling of LRP and MRP. The sensitive cells showed P-gp in a large perinuclear ring and in the cytoplasm, but little (LoVo-sc cells) or no staining (LoVo-f cells) was shown at the plasma membrane level. For the Lovo-Dox cells, P-gp was located in the plasma membrane, in cellular anchorages and in the cytoplasm as well. Cell resistance against antineoplastic agents often results from mobilization of various factors, the modulation of which is linked to the culture conditions. As most of the protocols utilize cells growing in (air + 5-10% CO2) atmosphere e.g. 20% O2, balance of the respective participants in the MDR multi-modal mechanism may not be representative of the in vivo situation and may lead to erratic pharmacological response. Indeed, cells within solid tumours were exposed to low pO2, most of them being under hypoxic condition (0.1-5% O2). In the absence of anticancer drugs, all LoVo cell lines grew notably faster at 20% O2 than at 5% O2. Moreover, respective sensitivities of both non-MDR variants to doxorubicin were altered according the pO2. Whatever the pO2 was, virtually none of the antioxidants tested affected the cytotoxic activity of doxorubicin for the three cell lines. By contrast

Antimicrobial Resistance and Cytotoxicity of Citrobacter spp. in Maanshan Anhui Province, China

Directory of Open Access Journals (Sweden)

Liyun Liu

2017-07-01

Full Text Available Objectives:Citrobacter spp. especially Citrobacter freundii, is frequently causing nosocomial infections, and increasingly becoming multi-drug resistant (MDR. In this study, we aimed to determine the genetic diversity and relationships of Citrobacter spp. from diarrheal patients and food sources, their antimicrobial resistance profiles and in vitro virulence properties.Methods: Sixty two Citrobacter isolates, including 13 C. freundii, 41 C. youngae and eight C. braakii isolates, were obtained from human diarrheal patients and food sources. Multilocus Sequence Typing (MLST of seven housekeeping genes and antimicrobial susceptibility testing using the broth microdilution method according to CLSI recommendations were carried out. Adhesion and cytotoxicity to HEp-2 cells were performed. PCR and sequencing were used to identify blaCTX−M, blaSHV, blaTEM and qnr genes.Results: The 62 isolates were divided into 53 sequence types (STs with all STs being novel, displaying high genetic diversity. ST39 was a predominant ST shared by 5 C. youngae strains isolated from four foods and a diarrheal patient. All isolates were resistant to cefoxitin, and sensitive to imipenem, meropenem and amikacin. The majority of Citrobacter isolates (61.3% were MDR of three or more antibiotics out of the 22 antibiotics tested. Two C. freundii isolates each carried the blaTEM−1 gene and a variant of qnrB77. Three Citrobacter isolates each carried qnrS1 and aac(6'-Ib-cr genes. Seven isolates that showed strong cytotoxicity to HEp-2 cells were MDR.Conclusions:Citrobacter spp. from human and food sources are diverse with variation in virulence properties and antibiotic resistance profiles. Food may be an important source of Citrobacter species in transmission to humans. C. freundii and C. youngae are potential foodborne pathogens.

Incidence of multidrug-resistant, extensively drug-resistant and pan-drug-resistant bacteria in children hospitalized at Dr. Hasan Sadikin general hospital Bandung Indonesia

Science.gov (United States)

Adrizain, R.; Suryaningrat, F.; Alam, A.; Setiabudi, D.

2018-03-01

Antibiotic resistance has become a global issue, with 700,000 deaths attributable to multidrug-resistance (MDR) occurring each year. Centers for Disease Control and Prevention (CDC) show rapidly increasing rates of infection due to antibiotic-resistant bacteria. The aim of the study isto describe the incidence of MDR, extensively drug-resistant (XDR) and pan drug-resistant (PDR) in Enterococcus spp., Staphylococcus aureus, K. pneumonia, Acinetobacter baumanii, P. aeruginosin, and Enterobacter spp. (ESKAPE) pathogens in children admitted to Dr. Hasan Sadikin Hospital. All pediatric patients having blood culture drawn from January 2015 to December 2016 were retrospectively studied. Data include the number of drawn blood culture, number of positive results, type of bacteria, sensitivity pattern. International standard definitions for acquired resistance by ECDC and CDC was used as definitions for MDR, XDR and PDR bacteria. From January 2015 to December 2016, 299 from 2.542 (11.7%) blood culture was positive, with Staphylococcus aureus, Enterococcus spp., Enterobacteriaceae, Pseudomonas aeruginosa, Acinetobacter spp., respectively 5, 6, 24, 5, 20 with total 60 (20%). The MDR and XDR pathogen found were 47 and 13 patients, respectively.

Estimating the future burden of multidrug-resistant and extensively drug-resistant tuberculosis in India, the Philippines, Russia, and South Africa: a mathematical modelling study.

Science.gov (United States)

Sharma, Aditya; Hill, Andrew; Kurbatova, Ekaterina; van der Walt, Martie; Kvasnovsky, Charlotte; Tupasi, Thelma E; Caoili, Janice C; Gler, Maria Tarcela; Volchenkov, Grigory V; Kazennyy, Boris Y; Demikhova, Olga V; Bayona, Jaime; Contreras, Carmen; Yagui, Martin; Leimane, Vaira; Cho, Sang Nae; Kim, Hee Jin; Kliiman, Kai; Akksilp, Somsak; Jou, Ruwen; Ershova, Julia; Dalton, Tracy; Cegielski, Peter

2017-07-01

Multidrug-resistant (MDR) and extensively drug-resistant (XDR) tuberculosis are emerging worldwide. The Green Light Committee initiative supported programmatic management of drug-resistant tuberculosis in 90 countries. We used estimates from the Preserving Effective TB Treatment Study to predict MDR and XDR tuberculosis trends in four countries with a high burden of MDR tuberculosis: India, the Philippines, Russia, and South Africa. We calibrated a compartmental model to data from drug resistance surveys and WHO tuberculosis reports to forecast estimates of incident MDR and XDR tuberculosis and the percentage of incident MDR and XDR tuberculosis caused by acquired drug resistance, assuming no fitness cost of resistance from 2000 to 2040 in India, the Philippines, Russia, and South Africa. The model forecasted the percentage of MDR tuberculosis among incident cases of tuberculosis to increase, reaching 12·4% (95% prediction interval 9·4-16·2) in India, 8·9% (4·5-11·7) in the Philippines, 32·5% (27·0-35·8) in Russia, and 5·7% (3·0-7·6) in South Africa in 2040. It also predicted the percentage of XDR tuberculosis among incident MDR tuberculosis to increase, reaching 8·9% (95% prediction interval 5·1-12·9) in India, 9·0% (4·0-14·7) in the Philippines, 9·0% (4·8-14·2) in Russia, and 8·5% (2·5-14·7) in South Africa in 2040. Acquired drug resistance would cause less than 30% of incident MDR tuberculosis during 2000-40. Acquired drug resistance caused 80% of incident XDR tuberculosis in 2000, but this estimate would decrease to less than 50% by 2040. MDR and XDR tuberculosis were forecast to increase in all four countries despite improvements in acquired drug resistance shown by the Green Light Committee-supported programmatic management of drug-resistant tuberculosis. Additional control efforts beyond improving acquired drug resistance rates are needed to stop the spread of MDR and XDR tuberculosis in countries with a high burden of MDR

Integron types, gene cassettes and antimicrobial resistance profile of Acinetobacter baumannii isolated from BAL samples in Babol, north of Iran.

Science.gov (United States)

Akrami, Fariba; Shahandashti, Elaheh Ferdosi; Yahyapour, Yousef; Sadeghi, Mohsen; Khafri, Soraya; Pournajaf, Abazar; Rajabnia, Ramazan

2017-08-01

Multi-drug resistant isolates of Acinetobacter baumannii have created therapeutic problems worldwide. This current study was intended to determine the Integron types, gene cassettes and antimicrobial resistance profile of A. baumannii isolated from BAL samples in Babol, north of Iran. During a 15-month period, 35 A. baumannii isolates were studied. Different classes of antimicrobial agents were used to determine the resistance ratios. Multiplex-PCR was used to detect different types of integrons and associated gene cassettes. The resistance rates to GM, FEP, AK, TOB, CP, PIP, SAM, IPM, SXT, CTX, CAZ, CL, TIM, MEM, and TZP were 85.7%, 100%, 91.4%, 68.5%, 94.3%, 88.5%, 97.1%, 94.3%, 100%, 100%, 100%, 0.0%, 91.4%, 94.3% and 91.4%, respectively. The distribution analysis of int genes showed that 25.7%, 88.6% and 28.6% of isolates carried the intI, intII and intIII genes, respectively. The prevalence of aadB, dfrA1, bla-OXA 30 and aadA1 genes were 94.3%, 77.1%, 40% and 5.7%, respectively. The current study showed that a high level of A. baumannii isolates harbor integrons in our therapeutic center, which may lead to distribution of multiple antimicrobial resistance. The different types of gene cassette arrays in the present study highlight the important role of geographical features in MDR isolates dissemination which could be credited to different profiles of drug consumption in different areas. The findings emphasized that the need for continuous surveillance to prevent distribution of multidrug resistance among A. baumannii strains in Iran. Copyright © 2017. Published by Elsevier Ltd.

The Prevalence and Molecular Epidemiology of Multidrug-Resistant Enterobacteriaceae Colonization in a Pediatric Intensive Care Unit.

Science.gov (United States)

Suwantarat, Nuntra; Logan, Latania K; Carroll, Karen C; Bonomo, Robert A; Simner, Patricia J; Rudin, Susan D; Milstone, Aaron M; Tekle, Tsigereda; Ross, Tracy; Tamma, Pranita D

2016-05-01

To determine the prevalence and acquisition of extended-spectrum β-lactamases (ESBLs), plasmid-mediated AmpCs (pAmpCs), and carbapenemases ("MDR Enterobacteriaceae") colonizing children admitted to a pediatric intensive care unit (PICU). Prospective study. 40-bed PICU. Admission and weekly thereafter rectal surveillance swabs were collected on all pediatric patients during a 6-month study period. Routine phenotypic identification and antibiotic susceptibility testing were performed. Enterobacteriaceae displaying characteristic resistance profiles underwent further molecular characterization to identify genetic determinants of resistance likely to be transmitted on mobile genetic elements and to evaluate relatedness of strains including DNA microarray, multilocus sequence typing, repetitive sequence-based PCR, and hsp60 sequencing typing. Evaluating 854 swabs from unique children, the overall prevalence of colonization with an MDR Enterobacteriaceae upon admission to the PICU based on β-lactamase gene identification was 4.3% (n=37), including 2.8% ESBLs (n=24), 1.3% pAmpCs (n=11), and 0.2% carbapenemases (n=2). Among 157 pediatric patients contributing 603 subsequent weekly swabs, 6 children (3.8%) acquired an incident MDR Enterobacteriaceae during their PICU stay. One child acquired a pAmpC (E. coli containing bla DHA) related to an isolate from another patient. Approximately 4% of children admitted to a PICU were colonized with MDR Enterobacteriaceae (based on β-lactamase gene identification) and an additional 4% of children who remained in the PICU for at least 1 week acquired 1 of these organisms during their PICU stay. The acquired MDR Enterobacteriaceae were relatively heterogeneous, suggesting that a single source was not responsible for the introduction of these resistance mechanisms into the PICU setting.

Management of MDR-TB in HIV co-infected patients in Eastern Europe

DEFF Research Database (Denmark)

Efsen, A M W; Schultze, A; Miller, R F

2018-01-01

below the target of 90%, reflecting the challenging patient population and the environment in which health care is provided. Urgent improvement of management of patients with TB/HIV in EE, in particular for those with MDR-TB, is needed and includes widespread access to rapid TB diagnostics, better......OBJECTIVES: Mortality among HIV patients with tuberculosis (TB) remains high in Eastern Europe (EE), but details of TB and HIV management remain scarce. METHODS: In this prospective study, we describe the TB treatment regimens of patients with multi-drug resistant (MDR) TB and use of antiretroviral...... access to and use of second-line TB drugs, timely ART initiation with viral load monitoring, and integration of TB/HIV care....

Prevalence, Virulence Genes and Antimicrobial Resistance Profiles of Salmonella Serovars from Retail Beef in Selangor, Malaysia

Directory of Open Access Journals (Sweden)

Tze Y. Thung

2018-01-01

Full Text Available The aim of the present study was to investigate the prevalence of Salmonella spp., Salmonella Enteritidis and Salmonella Typhimurium in retail beef from different retail markets of Selangor area, as well as, to assess their pathogenic potential and antimicrobial resistance. A total of 240 retail beef meat samples (chuck = 60; rib = 60; round = 60; sirloin = 60 were randomly collected. The multiplex polymerase chain reaction (mPCR in combination with the most probable number (MPN method was employed to detect Salmonella spp., S. Enteritidis and S. Typhimurium in the meat samples. The prevalence of Salmonella spp., S. Enteritidis and S. Typhimurium in 240 beef meat samples were 7.50, 1.25, and 0.83%, respectively. The microbial loads of total Salmonella was found in the range of <3 to 15 MPN/g. Eight different serovars of Salmonella were identified among the 23 isolates, and S. Agona was the predominant serovar (26.09%. Interestingly, all the Salmonella isolates were resistant to penicillin, erythromycin and vancomycin, but the sensitivity was observed for tetracycline, gentamicin and amoxicillin/clavulanic acid. All 23 isolates were resistant to at least three antibiotics. Two S. Typhimurium isolates (8.70% exhibited the highest multiple antibiotic resistance (MAR index value of 0.56 which shown resistance to nine antibiotics. PCR analysis of virulence genes showed that all Salmonella isolates (100% were positive for the invA gene. Meanwhile, pefA was only identified in S. Enteritidis and S. Typhimurium. The findings in this study indicate that retail beef products tested were widely contaminated with multi-drug resistant (MDR Salmonella and various virulence genes are present among the isolated Salmonella serovars.

Coumpounds affecting cell membrane functions and integrity: MDR pumps and theit exploration

Czech Academy of Sciences Publication Activity Database

Sigler, Karel; Gášková, D.

2002-01-01

Roč. 51, č. 24 (2002), s. 19-22 ISSN 0137-1398. [Uroczyste Seminarium z okazji urodzin Profesora Stanislawa Witka /70./. Wroclaw, 21.07.2002] R&D Projects: GA AV ČR IBS5020202; GA MŠk ME 577 Keywords : xenobioticexporting * multidrug resistance * mdr pumps Subject RIV: EE - Microbiology, Virology

Multiple Origins of Mutations in the mdr1 Gene--A Putative Marker of Chloroquine Resistance in P. vivax.

Directory of Open Access Journals (Sweden)

Mette L Schousboe

2015-11-01

Full Text Available Chloroquine combined with primaquine has been the recommended antimalarial treatment of Plasmodium vivax malaria infections for six decades but the efficacy of this treatment regimen is threatened by chloroquine resistance (CQR. Single nucleotide polymorphisms (SNPs in the multidrug resistance gene, Pvmdr1 are putative determinants of CQR but the extent of their emergence at population level remains to be explored.In this study we describe the prevalence of SNPs in the Pvmdr1 among samples collected in seven P. vivax endemic countries and we looked for molecular evidence of drug selection by characterising polymorphism at microsatellite (MS loci flanking the Pvmdr1 gene.We examined the prevalence of SNPs in the Pvmdr1 gene among 267 samples collected from Pakistan, Afghanistan, Sri Lanka, Nepal, Sudan, São Tomé and Ecuador. We measured and diversity in four microsatellite (MS markers flanking the Pvmdr1 gene to look evidence of selection on mutant alleles.SNP polymorphism in the Pvmdr1 gene was largely confined to codons T958M, Y976F and F1076L. Only 2.4% of samples were wildtype at all three codons (TYF, n = 5, 13.3% (n = 28 of the samples were single mutant MYF, 63.0% of samples (n = 133 were double mutant MYL, and 21.3% (n = 45 were triple mutant MFL. Clear geographic differences in the prevalence of these Pvmdr mutation combinations were observed. Significant linkage disequilibrium (LD between Pvmdr1 and MS alleles was found in populations sampled in Ecuador, Nepal and Sri Lanka, while significant LD between Pvmdr1 and the combined 4 MS locus haplotype was only seen in Ecuador and Sri Lanka. When combining the 5 loci, high level diversity, measured as expected heterozygosity (He, was seen in the complete sample set (He = 0.99, while He estimates for individual loci ranged from 0.00-0.93. Although Pvmdr1 haplotypes were not consistently associated with specific flanking MS alleles, there was significant differentiation between geographic

Transmission of MDR MRSA between primates, their environment and personnel at a United States primate centre.

Science.gov (United States)

Soge, Olusegun O; No, David; Michael, Karen E; Dankoff, Jennifer; Lane, Jennifer; Vogel, Keith; Smedley, Jeremy; Roberts, Marilyn C

2016-10-01

MDR MRSA isolates cultured from primates, their facility and primate personnel from the Washington National Primate Research Center were characterized to determine whether they were epidemiologically related to each other and if they represented common local human-associated MRSA strains. Human and primate nasal and composite environmental samples were collected, enriched and selected on medium supplemented with oxacillin and polymyxin B. Isolates were biochemically verified as Staphylococcus aureus and screened for the mecA gene. Selected isolates were characterized using SCCmec typing, MLST and WGS. Nasal cultures were performed on 596 primates and 105 (17.6%) were MRSA positive. Two of 79 (2.5%) personnel and two of 56 (3.6%) composite primate environmental facility samples were MRSA positive. Three MRSA isolates from primates, one MRSA from personnel, two environmental MRSA and one primate MSSA were ST188 and were the same strain type by conventional typing methods. ST188 isolates were related to a 2007 ST188 human isolate from Hong Kong. Both MRSA isolates from out-of-state primates had a novel MLST type, ST3268, and an unrelated group. All isolates carried ≥1 other antibiotic resistance gene(s), including tet(38), the only tet gene identified. ST188 is very rare in North America and has almost exclusively been identified in people from Pan-Asia, while ST3268 is a newly reported MRSA type. The data suggest that the primate MDR MRSA was unlikely to come from primate centre employees. Captive primates are likely to be an unappreciated source of MRSA. © The Author 2016. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Vital and dispensable roles of Plasmodium multidrug resistance transporters during blood- and mosquito-stage development.

Science.gov (United States)

Rijpma, Sanna R; van der Velden, Maarten; Annoura, Takeshi; Matz, Joachim M; Kenthirapalan, Sanketha; Kooij, Taco W A; Matuschewski, Kai; van Gemert, Geert-Jan; van de Vegte-Bolmer, Marga; Siebelink-Stoter, Rianne; Graumans, Wouter; Ramesar, Jai; Klop, Onny; Russel, Frans G M; Sauerwein, Robert W; Janse, Chris J; Franke-Fayard, Blandine M; Koenderink, Jan B

2016-07-01

Multidrug resistance (MDR) proteins belong to the B subfamily of the ATP Binding Cassette (ABC) transporters, which export a wide range of compounds including pharmaceuticals. In this study, we used reverse genetics to study the role of all seven Plasmodium MDR proteins during the life cycle of malaria parasites. Four P. berghei genes (encoding MDR1, 4, 6 and 7) were refractory to deletion, indicating a vital role during blood stage multiplication and validating them as potential targets for antimalarial drugs. Mutants lacking expression of MDR2, MDR3 and MDR5 were generated in both P. berghei and P. falciparum, indicating a dispensable role for blood stage development. Whereas P. berghei mutants lacking MDR3 and MDR5 had a reduced blood stage multiplication in vivo, blood stage growth of P. falciparum mutants in vitro was not significantly different. Oocyst maturation and sporozoite formation in Plasmodium mutants lacking MDR2 or MDR5 was reduced. Sporozoites of these P. berghei mutants were capable of infecting mice and life cycle completion, indicating the absence of vital roles during liver stage development. Our results demonstrate vital and dispensable roles of MDR proteins during blood stages and an important function in sporogony for MDR2 and MDR5 in both Plasmodium species. © 2016 John Wiley & Sons Ltd.

Prevalence of resistance to second-line tuberculosis drug among multidrug-resistant tuberculosis patients in Viet Nam, 2011.

Science.gov (United States)

Nguyen, Hoa Binh; Nguyen, Nhung Viet; Tran, Huong Thi Giang; Nguyen, Hai Viet; Bui, Quyen Thi Tu

2016-01-01

Extensively drug-resistant tuberculosis (XDR-TB) represents an emerging public health problem worldwide. According to the World Health Organization, an estimated 9.7% of multidrug-resistant TB (MDR-TB) cases are defined as XDR-TB globally. The objective of this study was to determine the prevalence of drug resistance to second-line TB drugs among MDR-TB cases detected in the Fourth National Anti-Tuberculosis Drug Resistance Survey in Viet Nam. Eighty clusters of TB cases were selected using a probability-proportion-to-size approach. To identify MDR-TB cases, drug susceptibility testing (DST) was performed for the four major first-line TB drugs. DST of second-line drugs (ofloxacin, amikacin, kanamycin, capreomycin) was performed on isolates from MDR-TB cases to identify pre-XDR and XDR cases. A total of 1629 smear-positive TB cases were eligible for culture and DST. Of those, DST results for first-line drugs were available for 1312 cases, and 91 (6.9%) had MDR-TB. Second-line DST results were available for 84 of these cases. Of those, 15 cases (17.9%) had ofloxacin resistance and 6.0% were resistant to kanamycin and capreomycin. Five MDR-TB cases (6.0%) met the criteria of XDR-TB. This survey provides the first estimates of the proportion of XDR-TB among MDR-TB cases in Viet Nam and provides important information for local policies regarding second-line DST. Local policies and programmes that are geared towards TB prevention, early diagnosis and treatment with effective regimens are of high importance.

Multidrug resistance in Lactococcus lactis

NARCIS (Netherlands)

Bolhuis, Hendrik

1996-01-01

Multidrug resistance (MDR) was initially recongnized as the major cause of the failure of the drug-based treatment of human cancers. It has become increasingly clear that MDR occurs in mammalian cells but also in lower eukaryotes and bacteria. The appearance of multiple antibiotic resistant

Direct sequencing for rapid detection of multidrug resistant Mycobacterium tuberculosis strains in Morocco

Directory of Open Access Journals (Sweden)

Zakham F

2013-11-01

Full Text Available Fathiah Zakham,1,4 Imane Chaoui,1 Amina Hadbae Echchaoui,2 Fouad Chetioui,3 My Driss Elmessaoudi,3 My Mustapha Ennaji,4 Mohammed Abid,2 Mohammed El Mzibri11Unité de Biologie et Recherché Médicale, Centre National de l'Energie, des Sciences et des Techniques Nucléaires (CNESTEN, Rabat, 2Laboratoire de Génétique Mycobacterienne, Institut Pasteur, Tangier, 3Laboratoire de Tuberculose Institut Pasteur, Casablanca, 4Laboratoire de Microbiologie, Hygiène et Virologie, Faculté des Sciences et Techniques, Mohammedia, MoroccoBackground: Tuberculosis (TB is a major public health problem with high mortality and morbidity rates, especially in low-income countries. Disturbingly, the emergence of multidrug resistant (MDR and extensively drug resistant (XDR TB cases has worsened the situation, raising concerns of a future epidemic of virtually untreatable TB. Indeed, the rapid diagnosis of MDR TB is a critical issue for TB management. This study is an attempt to establish a rapid diagnosis of MDR TB by sequencing the target fragments of the rpoB gene which linked to resistance against rifampicin and the katG gene and inhA promoter region, which are associated with resistance to isoniazid.Methods: For this purpose, 133 sputum samples of TB patients from Morocco were enrolled in this study. One hundred samples were collected from new cases, and the remaining 33 were from previously treated patients (drug relapse or failure, chronic cases and did not respond to anti-TB drugs after a sufficient duration of treatment. All samples were subjected to rpoB, katG and pinhA mutation analysis by polymerase chain reaction and DNA sequencing.Results: Molecular analysis showed that seven strains were isoniazid-monoresistant and 17 were rifampicin-monoresistant. MDR TB strains were identified in nine cases (6.8%. Among them, eight were traditionally diagnosed as critical cases, comprising four chronic and four drug-relapse cases. The last strain was isolated from a

The Salmonella genomic island 1 is specifically mobilized in trans by the IncA/C multidrug resistance plasmid family.

Science.gov (United States)

Douard, Gregory; Praud, Karine; Cloeckaert, Axel; Doublet, Benoît

2010-12-20

The Salmonella genomic island 1 (SGI1) is a Salmonella enterica-derived integrative mobilizable element (IME) containing various complex multiple resistance integrons identified in several S. enterica serovars and in Proteus mirabilis. Previous studies have shown that SGI1 transfers horizontally by in trans mobilization in the presence of the IncA/C conjugative helper plasmid pR55. Here, we report the ability of different prevalent multidrug resistance (MDR) plasmids including extended-spectrum β-lactamase (ESBL) gene-carrying plasmids to mobilize the multidrug resistance genomic island SGI1. Through conjugation experiments, none of the 24 conjugative plasmids tested of the IncFI, FII, HI2, I1, L/M, N, P incompatibility groups were able to mobilize SGI1 at a detectable level (transfer frequency IncA/C incompatibility group. Several conjugative IncA/C MDR plasmids as well as the sequenced IncA/C reference plasmid pRA1 of 143,963 bp were shown to mobilize in trans SGI1 from a S. enterica donor to the Escherichia coli recipient strain. Depending on the IncA/C plasmid used, the conjugative transfer of SGI1 occurred at frequencies ranging from 10(-3) to 10(-6) transconjugants per donor. Of particular concern, some large IncA/C MDR plasmids carrying the extended-spectrum cephalosporinase bla(CMY-2) gene were shown to mobilize in trans SGI1. The ability of the IncA/C MDR plasmid family to mobilize SGI1 could contribute to its spread by horizontal transfer among enteric pathogens. Moreover, the increasing prevalence of IncA/C plasmids in MDR S. enterica isolates worldwide has potential implications for the epidemic success of the antibiotic resistance genomic island SGI1 and its close derivatives.

Biofilm Formation Potential of Heat-Resistant Escherichia coli Dairy Isolates and the Complete Genome of Multidrug-Resistant, Heat-Resistant Strain FAM21845.

Science.gov (United States)

Marti, Roger; Schmid, Michael; Kulli, Sandra; Schneeberger, Kerstin; Naskova, Javorka; Knøchel, Susanne; Ahrens, Christian H; Hummerjohann, Jörg

2017-08-01

We tested the biofilm formation potential of 30 heat-resistant and 6 heat-sensitive Escherichia coli dairy isolates. Production of curli and cellulose, static biofilm formation on polystyrene (PS) and stainless steel surfaces, biofilm formation under dynamic conditions (Bioflux), and initial adhesion rates (IAR) were evaluated. Biofilm formation varied greatly between strains, media, and assays. Our results highlight the importance of the experimental setup in determining biofilm formation under conditions of interest, as correlation between different assays was often not a given. The heat-resistant, multidrug-resistant (MDR) strain FAM21845 showed the strongest biofilm formation on PS and the highest IAR and was the only strain that formed significant biofilms on stainless steel under conditions relevant to the dairy industry, and it was therefore fully sequenced. Its chromosome is 4.9 Mb long, and it harbors a total of five plasmids (147.2, 54.2, 5.8, 2.5, and 1.9 kb). The strain carries a broad range of genes relevant to antimicrobial resistance and biofilm formation, including some on its two large conjugative plasmids, as demonstrated in plate mating assays. IMPORTANCE In biofilms, cells are embedded in an extracellular matrix that protects them from stresses, such as UV radiation, osmotic shock, desiccation, antibiotics, and predation. Biofilm formation is a major bacterial persistence factor of great concern in the clinic and the food industry. Many tested strains formed strong biofilms, and especially strains such as the heat-resistant, MDR strain FAM21845 may pose a serious issue for food production. Strong biofilm formation combined with diverse resistances (some encoded on conjugative plasmids) may allow for increased persistence, coselection, and possible transfer of these resistance factors. Horizontal gene transfer may conceivably occur in the food production setting or the gastrointestinal tract after consumption. Copyright © 2017 Marti et al.

Prevalence, Virulence Genes and Antimicrobial Resistance Profiles of Salmonella Serovars from Retail Beef in Selangor, Malaysia.

Science.gov (United States)

Thung, Tze Y; Radu, Son; Mahyudin, Nor A; Rukayadi, Yaya; Zakaria, Zunita; Mazlan, Nurzafirah; Tan, Boon H; Lee, Epeng; Yeoh, Soo L; Chin, Yih Z; Tan, Chia W; Kuan, Chee H; Basri, Dayang F; Wan Mohamed Radzi, Che W J

2017-01-01

The aim of the present study was to investigate the prevalence of Salmonella spp., Salmonella Enteritidis and Salmonella Typhimurium in retail beef from different retail markets of Selangor area, as well as, to assess their pathogenic potential and antimicrobial resistance. A total of 240 retail beef meat samples (chuck = 60; rib = 60; round = 60; sirloin = 60) were randomly collected. The multiplex polymerase chain reaction (mPCR) in combination with the most probable number (MPN) method was employed to detect Salmonella spp., S . Enteritidis and S . Typhimurium in the meat samples. The prevalence of Salmonella spp., S . Enteritidis and S . Typhimurium in 240 beef meat samples were 7.50, 1.25, and 0.83%, respectively. The microbial loads of total Salmonella was found in the range of retail beef products tested were widely contaminated with multi-drug resistant (MDR) Salmonella and various virulence genes are present among the isolated Salmonella serovars.

Expression of LRP and MDR1 in locally advanced breast cancer predicts axillary node invasion at the time of rescue mastectomy after induction chemotherapy

International Nuclear Information System (INIS)

Schneider, José; Gonzalez-Roces, Severino; Pollán, Marina; Lucas, Raul; Tejerina, Armando; Martin, Miguel; Alba, Alfonso

2001-01-01

Axillary node status after induction chemotherapy for locally advanced breast cancer has been shown on multivariate analysis to be an independent predictor of relapse. However, it has been postulated that responders to induction chemotherapy with a clinically negative axilla could be spared the burden of lymphadenectomy, because most of them will not show histological nodal invasion. P-glycoprotein expression in the rescue mastectomy specimen has finally been identified as a significant predictor of patient survival. We studied the expression of the genes encoding multidrug resistance associated protein (MDR1) and lung cancer associated resistance protein (LRP) in formalin-fixed, paraffin-embedded tumor samples from 52 patients treated for locally advanced breast cancer by means of induction chemotherapy followed by rescue mastectomy. P-glycoprotein expression was assessed by means of immunohistochemistry before treatment in 23 cases, and by means of reverse-transcriptase-mediated polymerase chain reaction (RT-PCR) after treatment in 46 (6 failed). LRP expression was detected by means of immunohistochemistry, with the LRP-56 monoclonal antibody, in 31 cases before treatment. Immunohistochemistry for detecting the expression of c-erb-B2, p53, Ki67, estrogen receptor and progesterone receptor are routinely performed in our laboratory in every case, and the results obtained were included in the study. All patients had received between two and six cycles of standard 5-fluorouracil, doxorubicin and cyclophosphamide (FAC) chemotherapy, with two exceptions [one patient received four cycles of a docetaxel-adriamycin combination, and the other four cycles of standard cyclophosphamide-methotrexate-5-fluorouracil (CMF) polychemotherapy]. Response was assessed in accordance with the Response Evaluation Criteria In Solid Tumors (RECIST). By these, 2 patients achieved a complete clinical response, 37 a partial response, and the remaining 13 showed stable disease. This makes a

Multidrug-resistant and extensively drug-resistant tuberculosis: implications for the HIV epidemic and antiretroviral therapy rollout in South Africa.

Science.gov (United States)

Andrews, Jason R; Shah, N Sarita; Gandhi, Neel; Moll, Tony; Friedland, Gerald

2007-12-01

Drug-resistant tuberculosis (TB) is emerging as a major clinical and public health challenge in areas of sub-Saharan Africa where there is a high prevalence of human immunodeficiency virus (HIV) infection. TB drug-resistance surveillance in this region has been limited by laboratory capacity and the public health infrastructure; however, with the maturation of the HIV epidemic, the burden of drug-resistant TB is increasing rapidly. The recent discovery of large numbers of cases of multidrug-resistant (MDR) TB and extensively drug-resistant (XDR) TB in South Africa likely represents an unrecognized and evolving epidemic rather than sporadic, localized outbreaks. The combination of a large population of HIV-infected susceptible hosts with poor TB treatment success rates, a lack of airborne infection control, limited drug-resistance testing, and an overburdened MDR-TB treatment program provides ideal conditions for an MDR-TB and XDR-TB epidemic of unparalleled magnitude. In the present article, we review the history of drug-resistant TB in South Africa, describe its interaction with the HIV epidemic and the resultant consequences, and suggest measures necessary for controlling MDR-TB and XDR-TB in this context. A successful response to the emergence of MDR-TB and XDR-TB will necessitate increased resources for and collaboration between TB and HIV programs.

miR-297 modulates multidrug resistance in human colorectal carcinoma by down-regulating MRP-2.

Science.gov (United States)

Xu, Ke; Liang, Xin; Shen, Ke; Cui, Daling; Zheng, Yuanhong; Xu, Jianhua; Fan, Zhongze; Qiu, Yanyan; Li, Qi; Ni, Lei; Liu, Jianwen

2012-09-01

Colorectal carcinoma is a frequent cause of cancer-related death in men and women. miRNAs (microRNAs) are endogenous small non-coding RNAs that regulate gene expression negatively at the post-transcriptional level. In the present study we investigated the possible role of microRNAs in the development of MDR (multidrug resistance) in colorectal carcinoma cells. We analysed miRNA expression levels between MDR colorectal carcinoma cell line HCT116/L-OHP cells and their parent cell line HCT116 using a miRNA microarray. miR-297 showed lower expression in HCT116/L-OHP cells compared with its parental cells. MRP-2 (MDR-associated protein 2) is an important MDR protein in platinum-drug-resistance cells and is a predicted target of miR-297. Additionally miR-297 was down-regulated in a panel of human colorectal carcinoma tissues and negatively correlated with expression levels of MRP-2. Furthermore, we found that ectopic expression of miR-297 in MDR colorectal carcinoma cells reduced MRP-2 protein level and sensitized these cells to anti-cancer drugs in vitro and in vivo. Taken together, our findings suggest that miR-297 could play a role in the development of MDR in colorectal carcinoma cells, at least in part by modulation of MRP-2.

The Prevalence and Molecular Epidemiology of Multidrug-Resistant Enterobacteriaceae Colonization in a Pediatric Intensive Care Unit

Science.gov (United States)

Suwantarat, Nuntra; Logan, Latania K.; Carroll, Karen C.; Bonomo, Robert A.; Simner, Patricia J.; Rudin, Susan D.; Milstone, Aaron M.; Tekle, Tsigereda; Ross, Tracy; Tamma, Pranita D.

2016-01-01

OBJECTIVE To determine the prevalence and acquisition of extended-spectrum β-lactamases (ESBLs), plasmid-mediated AmpCs (pAmpCs), and carbapenemases (“MDR Enterobacteriaceae”) colonizing children admitted to a pediatric intensive care unit (PICU). DESIGN Prospective study. SETTING 40-bed PICU. METHODS Admission and weekly thereafter rectal surveillance swabs were collected on all pediatric patients during a 6-month study period. Routine phenotypic identification and antibiotic susceptibility testing were performed. Enterobacteriaceae displaying characteristic resistance profiles underwent further molecular characterization to identify genetic determinants of resistance likely to be transmitted on mobile genetic elements and to evaluate relatedness of strains including DNA microarray, multilocus sequence typing, repetitive sequence-based PCR, and hsp60 sequencing typing. Results Evaluating 854 swabs from unique children, the overall prevalence of colonization with an MDR Enterobacteriaceae upon admission to the PICU based on β-lactamase gene identification was 4.3% (n = 37), including 2.8% ESBLs (n =24), 1.3% pAmpCs (n =11), and 0.2% carbapenemases (n =2). Among 157 pediatric patients contributing 603 subsequent weekly swabs, 6 children (3.8%) acquired an incident MDR Enterobacteriaceae during their PICU stay. One child acquired a pAmpC (E. coli containing blaDHA) related to an isolate from another patient. Conclusions Approximately 4% of children admitted to a PICU were colonized with MDR Enterobacteriaceae (based on β-lactamase gene identification) and an additional 4% of children who remained in the PICU for at least 1 week acquired 1 of these organisms during their PICU stay. The acquired MDR Enterobacteriaceae were relatively heterogeneous, suggesting that a single source was not responsible for the introduction of these resistance mechanisms into the PICU setting. PMID:26856439

Mechanisms of azole resistance in a clinical isolate of Candida tropicalis.

Science.gov (United States)

Vandeputte, Patrick; Larcher, Gérald; Bergès, Thierry; Renier, Gilles; Chabasse, Dominique; Bouchara, Jean-Philippe

2005-11-01

Azole resistance has been insufficiently investigated in the yeast Candida tropicalis. Here we determined the molecular mechanisms responsible for azole resistance in a clinical isolate of this pathogenic yeast. Antifungal susceptibility testing performed by a disk diffusion method showed resistance or markedly decreased susceptibility to azoles, which was confirmed by determination of MICs. Considering the relationship between azole susceptibility and the respiration reported for other yeast species, the respiratory activity of this isolate was investigated. Flow cytometry using rhodamine 123 and oxygraphy demonstrated an increased respiratory activity, which was not linked to an overexpression or increased number of copies of the mitochondrial genome. Among previously described resistance mechanisms, an increased activity of efflux pumps was investigated by flow cytometry using rhodamine 6G. However, the efflux of rhodamine 6G was lower in the resistant isolate than in susceptible ones. Likewise, real-time reverse transcription-PCR quantification of the expression of C. tropicalis MDR1 (CtMDR1), which encodes an efflux protein belonging to the major facilitator superfamily, did not show overexpression of this gene. In contrast, the resistant isolate overexpressed the CtERG11 gene coding for lanosterol 14alpha-demethylase. This was in agreement with the larger amount of ergosterol found in this isolate. Moreover, sequencing of CtERG11 showed a point mutation leading to a tyrosine substitution in the protein sequence, which might lead to decreased binding affinity for azoles. In conclusion, overexpression of CtERG11 associated with a missense mutation in this gene seemed to be responsible for the acquired azole resistance of this clinical isolate.

HIV-1 integrase inhibitors are substrates for the multidrug transporter MDR1-P-glycoprotein

Directory of Open Access Journals (Sweden)

Cara Andrea

2007-03-01

Full Text Available Abstract Background The discovery of diketoacid-containing derivatives as inhibitors of HIV-1 Integrase (IN (IN inhibitors, IINs has played a major role in validating this enzyme as an important target for antiretroviral therapy. Since the in vivo efficacy depends on access of these drugs to intracellular sites where HIV-1 replicates, we determined whether the IINs are recognized by the multidrug transporter MDR1-P-glycoprotein (P-gp thereby reducing their intracellular accumulation. To address the effect of IINs on drug transport, nine quinolonyl diketo acid (DKA derivatives active on the HIV-1 IN strand transfer (ST step and with EC50 ranging from 1.83 to >50 μm in cell-based assays were tested for their in vitro interaction with P-gp in the CEM-MDR cell system. IINs were investigated for the inhibition and induction of the P-gp function and expression as well as for multidrug resistance (MDR reversing ability. Results The HIV-1 IINs act as genuine P-gp substrates by inhibiting doxorubicin efflux and inducing P-gp functional conformation changes as evaluated by the modulation of UIC2 mAb epitope. Further, IINs chemosensitize MDR cells to vinblastine and induce P-gp expression in drug sensitive revertants of CEM-MDR cells. Conclusion To our knowledge, this is the first demonstration that HIV-1 IINs are P-gp substrates. This biological property may influence the absorption, distribution and elimination of these novels anti HIV-1 compounds.

FLT3-ITD and MLL-PTD influence the expression of MDR-1, MRP-1, and BCRP mRNA but not LRP mRNA assessed with RQ-PCR method in adult acute myeloid leukemia.

Science.gov (United States)

Nasilowska-Adamska, Barbara; Solarska, Iwona; Paluszewska, Monika; Malinowska, Iwona; Jedrzejczak, Wieslaw W; Warzocha, Krzysztof

2014-04-01

Fms-like tyrosine kinase 3-internal tandem duplication (FLT3-ITD) and mixed-lineage leukemia gene-partial tandem duplication (MLL-PTD) are aberrations associated with leukemia which indicate unsatisfactory prognosis. Downstream regulatory targets of FLT3-ITD and MLL-PTD are not well defined. We have analyzed the expression of MDR-1, multidrug resistant protein-1 (MRP-1), breast cancer resistance protein (BCRP), and lung resistance protein (LRP) messenger RNA (mRNA) in relation to the mutational status of FLT3-ITD and MLL-PTD in 185 acute myeloid leukemia (AML) adult patients. The real-time quantitative polymerase chain reaction method was performed to assess the expression of the MDR-1, MRP-1, BCRP, and LRP mRNA, and the results were presented as coefficients calculated using an intermediate method according to Pfaffl's rule. Significantly higher expressions of MDR-1 mRNA were found in patients who did not harbor FLT3-ITD (0.20 vs. 0.05; p = 0.0001) and MRP-1 mRNA in patients with this mutation (0.96 vs. 0.70; p = 0.002) and of BCRP mRNA in patients with MLL-PTD (0.61 vs. 0.38; p = 0.03). In univariate analysis, the high expression of MDR-1 mRNA (≥0.1317) negatively influenced the outcome of induction therapy (p = 0.05), whereas the high expression of BCRP mRNA (≥1.1487) was associated with a high relapse rate (RR) (p = 0.013). We found that the high expression of MDR-1 (≥0.1317), MRP-1 (≥0.8409), and BCRP mRNA (≥1.1487) significantly influenced disease-free survival (DFS; p = 0.059, 0.032, and 0.009, respectively) and overall survival (0.048, 0.014, and 0.059, respectively). Moreover, a high expression of BCRP mRNA (≥1.1487) proved to be an independent prognostic factor for RR (p = 0.01) and DFS (p = 0.002) in multivariate analysis. The significant correlation between the expression of MDR-1, MRP-1, and BCRP mRNA and FLT3-ITD or MLL-PTD in AML patients requires further investigation.

Novel understanding of ABC transporters ABCB1/MDR/P-glycoprotein, ABCC2/MRP2, and ABCG2/BCRP in colorectal pathophysiology

DEFF Research Database (Denmark)

Andersen, Vibeke; Svenningsen, Katrine; Knudsen, Lina Almind

2015-01-01

transporter proteins, inflammatory bowel disease, ulcerative, colitis, Crohns disease, colorectal cancer, colitis, intestinal inflammation, intestinal carcinogenesis, ABCB1/P-glycoprotein (P-gp/CD243/MDR1), ABCC2/multidrug resistance protein 2 (MRP2) and ABCG2/breast cancer resistance protein (BCRP), Abcb1....../Mdr1a, abcc2/Mrp2, abcg2/Bcrp, knock-out mice, tight junction, membrane lipid function. RESULTS: Recently, human studies reported that changes in the levels of ABC transporters were early events in the adenoma-carcinoma sequence leading to CRC. A link between ABCB1, high fat diet and gut microbes...

MDR-TB Outbreak among HIV-Negative Tunisian Patients followed during 11 Years.

Directory of Open Access Journals (Sweden)

Naira Dekhil

Full Text Available Multidrug-resistant tuberculosis (MDR-TB outbreaks that evolve, from the outset, in a context strictly negative for HIV infection deserve special consideration since they reflect the true intrinsic epidemic potential of the causative strain. To our knowledge, the long-term evolution of such exceptional outbreaks and the treatment outcomes for the involved patients has never been reported hitherto. Here we provide a thorough description, over an 11-year period, of an MDR-TB outbreak that emerged and expanded in an HIV-negative context, Northern Tunisia.From October 2001 to June 2011, the MDR-TB outbreak involved 48 HIV-negative individuals that are mainly young (mean age 31.09 yrs; 89.6% male and noninstitutionalized. Drug susceptibility testing coupled to mutational analysis revealed that initial transmission involved an isolate that was simultaneously resistant to isoniazid, rifampicin, ethambutol, and streptomycin. The causative Haarlem3-ST50 outbreak strain expanded mainly as an 11-banded IS6110 RFLP profile (77.1%, from which a 12-banded subclone evolved. After undergoing a 2-year treatment with second-line drugs, 22 (45.8% patients were cured and 3 (6.2% completed treatment, thus yielding an overall treatment success rate of 52.1%. Among the patients that experienced unfavorable treatment outcomes, 10 (20.8% failed treatment, 3 (6.2% were lost to follow-up, 5 (10.4% died, and 5 (10.4% could not be evaluated. Poor adherence to treatment was found to be the main independent predictor of unfavorable outcomes (HR: 9.15; 95% CI 1.72-48.73; P = 0.014. Intriguingly, the evolved 12-banded subclone proved significantly associated with unfavorable outcomes (HR: 4.90; 95% CI 1.04-23.04, P = 0.044. High rate of fatality and relapse was further demonstrated at the long-term, since 70% of those whose treatment failed have died, and 24% among those deemed successfully treated have relapsed.Taken together, the data obtained in this study indicate that MDR

Direct detection of Mycobacterium tuberculosis and drug resistance in respiratory specimen using Abbott Realtime MTB detection and RIF/INH resistance assay.

Science.gov (United States)

Tam, Kingsley King-Gee; Leung, Kenneth Siu-Sing; To, Sabrina Wai-Chi; Siu, Gilman Kit-Hang; Lau, Terrence Chi-Kong; Shek, Victor Chi-Man; Tse, Cindy Wing-Sze; Wong, Samson Sai-Yin; Ho, Pak-Leung; Yam, Wing-Cheong

2017-10-01

Abbott RealTime MTB (Abbott-RT) in conjunction with Abbott RealTime MTB RIF/INH Resistance (Abbott-RIF/INH) is a new, high-throughput automated nucleic acid amplification platform (Abbott-MDR) for detection of Mycobacterium tuberculosis complex (MTBC) and the genotypic markers for rifampicin (RIF) and isoniazid (INH) resistance directly from respiratory specimens. This prospective study evaluated the diagnostic performance of this new platform for MTBC and multidrug-resistant tuberculosis (MDR-TB) using 610 sputum specimens in a tuberculosis high-burden setting. Using conventional culture results and clinical background as reference standards, Abbott-RT exhibited an overall sensitivity and specificity of 95.2% and 99.8%, respectively. Genotypic RIF/INH resistance of 178 "MTB detected" specimens was subsequently analyzed by Abbott-RIF/INH. Compared to phenotypic drug susceptibility test results, Abbott-RIF/INH detected resistance genotypic markers in 84.6% MDR-TB, 80% mono-RIF-resistant and 66.7% mono-INH-resistant specimens. Two of the RIF-resistant specimens carried a novel single, nonsense mutation at rpoB Q513 and in silico simulation demonstrated that the truncated RpoB protein failed to bind with other subunits for transcription. Overall, Abbott-MDR platform provided high throughput and reliable diagnosis of MDR-TB within a TB high-burden region. Copyright © 2017 Elsevier Inc. All rights reserved.

The Role of Adjunctive Therapies in Septic Shock by Gram Negative MDR/XDR Infections.

Science.gov (United States)

Busani, Stefano; Roat, Erika; Serafini, Giulia; Mantovani, Elena; Biagioni, Emanuela; Girardis, Massimo

2017-01-01

Patients with septic shock by multidrug resistant microorganisms (MDR) are a specific sepsis population with a high mortality risk. The exposure to an initial inappropriate empiric antibiotic therapy has been considered responsible for the increased mortality, although other factors such as immune-paralysis seem to play a pivotal role. Therefore, beyond conventional early antibiotic therapy and fluid resuscitation, this population may benefit from the use of alternative strategies aimed at supporting the immune system. In this review we present an overview of the relationship between MDR infections and immune response and focus on the rationale and the clinical data available on the possible adjunctive immunotherapies, including blood purification techniques and different pharmacological approaches.

The Role of Adjunctive Therapies in Septic Shock by Gram Negative MDR/XDR Infections

Directory of Open Access Journals (Sweden)

Stefano Busani

2017-01-01

Full Text Available Patients with septic shock by multidrug resistant microorganisms (MDR are a specific sepsis population with a high mortality risk. The exposure to an initial inappropriate empiric antibiotic therapy has been considered responsible for the increased mortality, although other factors such as immune-paralysis seem to play a pivotal role. Therefore, beyond conventional early antibiotic therapy and fluid resuscitation, this population may benefit from the use of alternative strategies aimed at supporting the immune system. In this review we present an overview of the relationship between MDR infections and immune response and focus on the rationale and the clinical data available on the possible adjunctive immunotherapies, including blood purification techniques and different pharmacological approaches.

Resistance to antibiotics in Lacid acid bacteria - strain Lactococcus

Directory of Open Access Journals (Sweden)

Filipić Brankica

2015-01-01

Full Text Available Lactic acid bacteria (LAB are widely used in the food industry, especially in the production of fermented dairy products and meat. The most studied species among Lis Lactococcus lactis. L. lactis strains are of great importance in the production of fermented dairy products such as yogurt, butter, fresh cheese and some kind of semi-hard cheese. Although L. lactis acquired the „Generally Regarded As Safe“ (GRAS status, many investigations indicated that lactococci may act as reservoirs of antibiotic resistance genes, which could be transferred to other bacterial species in human gastrointestinal tract includ­ing pathogens. The genome analysis of L. lactis indicated the presence of at least 40 putative drug transporter genes, and only four multidrug resistance (MDR transporters are functionally characterized: LmrA, LmrP, LmrCD i CmbT. LmrA is the first described MDR transporter in prokaryotes. LmrCD is responsible for resistance to cholate, which is an integral part of human bile and LmrCD is important for intestinal survival of lactococci that are used as probiotics. Secondary multidrug transporter LmrP confers resistance to lincosamides, macrolides, streptogramins and tetracyclines. CmbT protein has an effect on the host cell resistance to lincomycin, sulfadiazine, streptomycin, rifampicin, puromycin and sulfametox­azole. Since the food chain is an important way of transmitting resistance genes in human and animal population, it is of great importance to study the mechanisms of resistance in lactococci and other LAB, intended for the food industry. [Projekat Ministarstva nauke Republike Srbije, br. 173019: Izučavanje gena i molekularnih mehanizama u osnovi probiotičke aktivnosti bakterija mlečne kiseline izolovanih sa područja Zapadnog Balkana

Genomic analysis of globally diverse Mycobacterium tuberculosis strains provides insights into emergence and spread of multidrug resistance

Science.gov (United States)

Manson, Abigail L.; Cohen, Keira A.; Abeel, Thomas; Desjardins, Christopher A.; Armstrong, Derek T.; Barry, Clifton E.; Brand, Jeannette; Chapman, Sinéad B.; Cho, Sang-Nae; Gabrielian, Andrei; Gomez, James; Jodals, Andreea M.; Joloba, Moses; Jureen, Pontus; Lee, Jong Seok; Malinga, Lesibana; Maiga, Mamoudou; Nordenberg, Dale; Noroc, Ecaterina; Romancenco, Elena; Salazar, Alex; Ssengooba, Willy; Velayati, A. A.; Winglee, Kathryn; Zalutskaya, Aksana; Via, Laura E.; Cassell, Gail H.; Dorman, Susan E.; Ellner, Jerrold; Farnia, Parissa; Galagan, James E.; Rosenthal, Alex; Crudu, Valeriu; Homorodean, Daniela; Hsueh, Po-Ren; Narayanan, Sujatha; Pym, Alexander S.; Skrahina, Alena; Swaminathan, Soumya; Van der Walt, Martie; Alland, David; Bishai, William R.; Cohen, Ted; Hoffner, Sven; Birren, Bruce W.; Earl, Ashlee M.

2017-01-01

Multidrug-resistant tuberculosis (MDR-TB), caused by drug resistant strains of Mycobacterium tuberculosis, is an increasingly serious problem worldwide. In this study, we examined a dataset of 5,310 M. tuberculosis whole genome sequences from five continents. Despite great diversity with respect to geographic point of isolation, genetic background and drug resistance, patterns of drug resistance emergence were conserved globally. We have identified harbinger mutations that often precede MDR. In particular, the katG S315T mutation, conferring resistance to isoniazid, overwhelmingly arose before rifampicin resistance across all lineages, geographic regions, and time periods. Molecular diagnostics that include markers for rifampicin resistance alone will be insufficient to identify pre-MDR strains. Incorporating knowledge of pre-MDR polymorphisms, particularly katG S315, into molecular diagnostics will enable targeted treatment of patients with pre-MDR-TB to prevent further development of MDR-TB. PMID:28092681

Experience with LDR and MDR brachytherapy for cervical cancer

International Nuclear Information System (INIS)

Okawa, Tomohiko; Okawa, Midori-Kita; Kaneyasu, Yuko; Karasawa, Kumiko; Fukuhara, Noboru

1996-01-01

As the brachytherapy dose-rate increases, it is necessary to reduce the total dose or to increase the fraction number with reducing the fraction dose in order not to increase the incidence of the late effect. With the introduction to the Tokyo Women's Medical College, Hospital of a remote afterloading system of Selectron - MDR, delivering dose-rate to point A became approximately twice of that with our classical cesium LDR manual afterloading technique. Material and Methods: Between 1987 to 1993 a total of, previously untreated 74 patients with cervical cancer received MDR brachytherapy using a Selection - MDR. This analysis is therefore of those patients series who underwent radical radioradiotherapy with MDR, 1987-1993, in comparison with the 347 cases who were treated with classical manual LDR afterloading machine, 1969-1986. The treatment was a brachytherapy during external radiotherapy and dos-rate at point A was 160-180 cGy/hour with MDR and 80-90 cGy/hour with LDR. The mean fraction dose was 800-1000 cGy by MDR and 1000-1200 cGy by LDR and fraction number was increased 1-2times in the MDR group with no change of a total dose at point A. Results: The mean age was 63.3 years in the MDR group and 60.2 in the LDR group. In the MDR group, 4 patients were at stage I, 16 stage II, 32 stage III, and 22 stage IV. In the LDR group, 32 were at stage I, 83 stage II, 183 stage III, and 49 stage IV. The medical rate was not significantly different between two groups. The tumor response by manual examination one month after radiotherapy showed no significant difference. The 5-year survival rate for the MDR and LDR groups were 100% : 78% at stage I, 61% : 71% at stage II and 52% : 53% at stage III, with no significant differences. Late complications by severity with grade II-III according to Kottureire's classification were not significantly different in the rectum or bladder. These results suggested that MDR brachytherapy was useful for the patients' QOL as it reduced the

Frequency, Antimicrobial Resistance and Genetic Diversity of Klebsiella pneumoniae in Food Samples.

Directory of Open Access Journals (Sweden)

Yumei Guo

Full Text Available This study aimed to assess the frequency of Klebsiella pneumoniae in food samples and to detect antibiotic resistance phenotypes, antimicrobial resistance genes and the molecular subtypes of the recovered isolates. A total of 998 food samples were collected, and 99 (9.9% K. pneumoniae strains were isolated; the frequencies were 8.2% (4/49 in fresh raw seafood, 13.8% (26/188 in fresh raw chicken, 11.4% (34/297 in frozen raw food and 7.5% (35/464 in cooked food samples. Antimicrobial resistance was observed against 16 antimicrobials. The highest resistance rate was observed for ampicillin (92.3%, followed by tetracycline (31.3%, trimethoprim-sulfamethoxazole (18.2%, and chloramphenicol (10.1%. Two K. pneumoniae strains were identified as extended-spectrum β-lactamase (ESBL-one strain had three beta-lactamases genes (blaSHV, blaCTX-M-1, and blaCTX-M-10 and one had only the blaSHV gene. Nineteen multidrug-resistant (MDR strains were detected; the percentage of MDR strains in fresh raw chicken samples was significantly higher than in other sample types (P<0.05. Six of the 18 trimethoprim-sulfamethoxazole-resistant strains carried the folate pathway inhibitor gene (dhfr. Four isolates were screened by PCR for quinolone resistance genes; aac(6'-Ib-cr, qnrB, qnrA and qnrS were detected. In addition, gyrA gene mutations such as T247A (Ser83Ile, C248T (Ser83Phe, and A260C (Asp87Ala and a parC C240T (Ser80Ile mutation were identified. Five isolates were screened for aminoglycosides resistance genes; aacA4, aacC2, and aadA1 were detected. Pulsed-field gel electrophoresis-based subtyping identified 91 different patterns. Our results indicate that food, especially fresh raw chicken, is a reservoir of antimicrobial-resistant K. pneumoniae, and the potential health risks posed by such strains should not be underestimated. Our results demonstrated high prevalence, antibiotic resistance rate and genetic diversity of K. pneumoniae in food in China. Improved

Development of pVCR94ΔX from Vibrio cholerae, a prototype for studying multidrug resistant IncA/C conjugative plasmids.

Science.gov (United States)

Carraro, Nicolas; Sauvé, Maxime; Matteau, Dominick; Lauzon, Guillaume; Rodrigue, Sébastien; Burrus, Vincent

2014-01-01

Antibiotic resistance has grown steadily in Vibrio cholerae over the last few decades to become a major threat in countries affected by cholera. Multi-drug resistance (MDR) spreads among clinical and environmental V. cholerae strains by lateral gene transfer often mediated by integrative and conjugative elements (ICEs) of the SXT/R391 family. However, in a few reported but seemingly isolated cases, MDR in V. cholerae was shown to be associated with other self-transmissible genetic elements such as conjugative plasmids. IncA/C conjugative plasmids are often found associated with MDR in isolates of Enterobacteriaceae. To date, IncA/C plasmids have not been commonly found in V. cholerae or other species of Vibrio. Here we present a detailed analysis of pVCR94ΔX derived from pVCR94, a novel IncA/C conjugative plasmid identified in a V. cholerae clinical strain isolated during the 1994 Rwandan cholera outbreak. pVCR94 was found to confer resistance to sulfamethoxazole, trimethoprim, ampicillin, streptomycin, tetracycline, and chloramphenicol and to transfer at very high frequency. Sequence analysis revealed its mosaic nature as well as high similarity of the core genes responsible for transfer and maintenance with other IncA/C plasmids and ICEs of the SXT/R391 family. Although IncA/C plasmids are considered a major threat in antibiotics resistance, their basic biology has received little attention, mostly because of the difficulty to genetically manipulate these MDR conferring elements. Therefore, we developed a convenient derivative from pVCR94, pVCR94Δ X, a 120.5-kb conjugative plasmid which only codes for sulfamethoxazole resistance. Using pVCR94Δ X, we identified the origin of transfer (oriT) and discovered an essential gene for transfer, both located within the shared backbone, allowing for an annotation update of all IncA/C plasmids. pVCR94Δ X may be a useful model that will provide new insights on the basic biology of IncA/C conjugative plasmids.

Quadruple-first line drug resistance in Mycobacterium tuberculosis in Vietnam: What can we learn from genes?

Science.gov (United States)

Nguyen, Huy Quang; Nguyen, Nhung Viet; Contamin, Lucie; Tran, Thanh Hoa Thi; Vu, Thuong Thi; Nguyen, Hung Van; Nguyen, Ngoc Lan Thi; Nguyen, Son Thai; Dang, Anh Duc; Bañuls, Anne-Laure; Nguyen, Van Anh Thi

2017-06-01

In Vietnam, a country with high tuberculosis (137/100.000 population) and multidrug-resistant (MDR)-TB burdens (7.8/100.000 population), little is known about the molecular signatures of drug resistance in general and more particularly of second line drug (SLD) resistance. This study is specifically focused on Mycobacterium tuberculosis isolates resistant to four first-line drugs (FLDs) that make TB much more difficult to treat. The aim is to determine the proportion of SLD resistance in these quadruple drug resistant isolates and the genetic determinants linked to drug resistance to better understand the genetic processes leading to quadruple and extremely drug resistance (XDR). 91 quadruple (rifampicin, isoniazid, ethambutol and streptomycin) FLD resistant and 55 susceptible isolates were included. Spoligotyping and 24-locus MIRU-VNTR techniques were performed and 9 genes and promoters linked to FLD and SLD resistance were sequenced. SLD susceptibility testing was carried out on a subsample of isolates. High proportion of quadruple-FLD resistant isolates was resistant to fluoroquinolones (27%) and second-line injectable drugs (30.2%) by drug susceptibility testing. The sequencing revealed high mutation diversity with prevailing mutations at positions katG315, inhA-15, rpoB531, embB306, rrs1401, rpsL43 and gyrA94. The sensitivity and specificity were high for most drug resistances (>86%), but the sensitivity was lower for injectable drug resistances (resistance. Nevertheless, particular mutation patterns linked to high-level resistance and low fitness costs seem to be favored. Copyright © 2017 Elsevier B.V. All rights reserved.

Cyclooxygenase-2, multidrug resistance 1, and breast cancer resistance protein gene polymorphisms and inflammatory bowel disease in the Danish population

DEFF Research Database (Denmark)

Østergaard, Mette; Ernst, Anja; Labouriau, Rodrigo S.

2009-01-01

=0.006) and 1.39 ((0.99-1.92) p=0.054), respectively, and for UC of 2.63 ((1.33-5.26) p=0.005) and 1.28 ((0.96-1.51) p=0.093), respectively, assuming complete dominance. No association was found for BCRP or other MDR1 SNPs, or for selected MDR1 haplotypes. No effect-modification of smoking habit......OBJECTIVE: Crohn's disease (CD) and ulcerative colitis (UC) are characterized by an impaired mucosal defence to normal constituents of the intestinal flora and a dysregulated inflammatory response. The purpose of the study was to investigate whether single nucleotide polymorphisms (SNPs) in genes....../A, C3435T and G-rs3789243-A (intron 3) were assessed in a Danish case-control study comprising 373 CD and 541 UC patients and 796 healthy controls. RESULTS: Carriers of the homozygous COX-2 and MDR1 intron 3 variant had a relatively high risk of CD, odds ratio (95% CI) (OR (95% CI))=2.86 ((1.34-5.88) p...

Comparison of effectiveness and safety of imipenem/clavulanate- versus meropenem/clavulanate-containing regimens in the treatment of MDR- and XDR-TB.

Science.gov (United States)

Tiberi, Simon; Sotgiu, Giovanni; D'Ambrosio, Lia; Centis, Rosella; Abdo Arbex, Marcos; Alarcon Arrascue, Edith; Alffenaar, Jan Willem; Caminero, Jose A; Gaga, Mina; Gualano, Gina; Skrahina, Alena; Solovic, Ivan; Sulis, Giorgia; Tadolini, Marina; Alarcon Guizado, Valentina; De Lorenzo, Saverio; Roby Arias, Aurora Jazmín; Scardigli, Anna; Akkerman, Onno W; Aleksa, Alena; Artsukevich, Janina; Auchynka, Vera; Bonini, Eduardo Henrique; Chong Marín, Félix Antonio; Collahuazo López, Lorena; de Vries, Gerard; Dore, Simone; Kunst, Heinke; Matteelli, Alberto; Moschos, Charalampos; Palmieri, Fabrizio; Papavasileiou, Apostolos; Payen, Marie-Christine; Piana, Andrea; Spanevello, Antonio; Vargas Vasquez, Dante; Viggiani, Pietro; White, Veronica; Zumla, Alimuddin; Migliori, Giovanni Battista

2016-06-01

No large study to date has ever evaluated the effectiveness, safety and tolerability of imipenem/clavulanate versus meropenem/clavulanate to treat multidrug- and extensively drug-resistant tuberculosis (MDR- and XDR-TB). The aim of this observational study was to compare the therapeutic contribution of imipenem/clavulanate versus meropenem/clavulanate added to background regimens to treat MDR- and XDR-TB cases.84 patients treated with imipenem/clavulanate-containing regimens showed a similar median number of antibiotic resistances (8 versus 8) but more fluoroquinolone resistance (79.0% versus 48.9%, pimipenem/clavulanate- and meropenem/clavulanate-containing regimens for a median (interquartile range) of 187 (60-428) versus 85 (49-156) days, respectively.Statistically significant differences were observed on sputum smear and culture conversion rates (79.7% versus 94.8%, p=0.02 and 71.9% versus 94.8%, pimipenem/clavulanate and meropenem/clavulanate were reported in 5.4% and 6.5% of cases only.Our study suggests that meropenem/clavulanate is more effective than imipenem/clavulanate in treating MDR/XDR-TB patients. Copyright ©ERS 2016.

ECG-triggered MDR-CT for the detection of pulmonary metastases

International Nuclear Information System (INIS)

Pauls, S.; Wahl, J.; Aschoff, A.J.; Brambs, H.J.; Fleiter, T.R.

2003-01-01

Purpose: Comparison of multidetector-row CT (MDR-CT) of the chest with and without ECG triggering for the detection of pulmonary metastases. Materials and Methods: Fifty patients with malignant tumors underwent CT of the chest. The unenhanced phase was performed with ECG-triggered MDR-CT and the contrast-enhanced phase with helical MDR-CT. The ECG-triggered and standard helical scans were interpreted in separate sessions, with the analysis determining the number and demarcation of the intrapulmonary nodules and the delineation of the mediastinal structure (rated 1 = excellent to 5 = poor). Results: ECG-MDR-CT images detected 38% more pulmonary nodules than MDR-CT. The detection rate for tumors [de

Current trends of human infections and antibiotic resistance of the genus Shewanella.

Science.gov (United States)

Yousfi, K; Bekal, S; Usongo, V; Touati, A

2017-08-01

Shewanella spp. are commonly known as environmental bacteria and are most frequently isolated from aquatic areas. Currently, diseases syndromes and multidrug resistance have increasingly been reported in the genus Shewanella. Some species are associated with various infections, such as skin and soft tissue infections, as well as bacteremia. Generally, these bacteria are opportunistic and mostly affect people with an impaired immune system. This genus is also a probable vehicle and progenitor of antibiotic resistance genes. In fact, several resistance genes and mobile genetic elements have been identified in some resistant species isolated from environmental or clinical settings. These genes confer resistance to different antibiotic classes, including those used in therapies such as β-lactams and quinolones, and are generally located on the chromosome. Recently, a multidrug-resistant (MDR) plasmid harboring several drug resistance genes associated with transposons and integrons has been identified in Shewanella xiamenensis. These antibiotic resistance genes can circulate in the environment and contribute to the emergence of antibiotic resistance. This review describes different aspects of Shewanella, focusing on the infections caused by this genus, as well as their role in the propagation of antibiotic resistance via mobile genetic elements.

Modulation of P-glycoprotein-mediated multidrug resistance in K562 leukemic cells by indole-3-carbinol

International Nuclear Information System (INIS)

Arora, Annu; Seth, Kavita; Kalra, Neetu; Shukla, Yogeshwer

2005-01-01

Resistance to chemotherapeutic drugs is one of the major problems in the treatment of cancer. P-glycoprotein (P-gp) encoded by the mdr gene is a highly conserved protein, acts as a multidrug transporter, and has a major role in multiple drug resistance (MDR). Targeting of P-gp by naturally occurring compounds is an effective strategy to overcome MDR. Indole-3-carbinol (I3C), a glucosinolates present in cruciferous vegetables, is a promising chemopreventive agent as it is reported to possess antimutagenic, antitumorigenic, and antiestrogenic properties in experimental studies. In the present investigation, the potential of I3C to modulate P-gp expression was evaluated in vinblastine (VBL)-resistant K562 human leukemic cells. The resistant K562 cells (K562/R10) were found to be cross-resistant to vincristine (VCR), doxorubicin (DXR), and other antineoplastic agents. I3C at a nontoxic dose (10 x 10 -3 M) enhanced the cytotoxic effects of VBL time dependently in VBL-resistant human leukemia (K562/R10) cells but had no effect on parent-sensitive cells (K562/S). The Western blot analysis of K 562/R 10 cells showed that I3C downregulates the induced levels of P-gp in resistant cells near to normal levels. The quantitation of immunocytochemically stained K562/R10 cells showed 24%, 48%, and 80% decrease in the levels of P-gp by I3C for 24, 48, and 72 h of incubation. The above features thus indicate that I3C could be used as a novel modulator of P-gp-mediated multidrug resistance in vitro and may be effective as a dietary adjuvant in the treatment of MDR cancers

MicroRNA signatures from multidrug-resistant Mycobacterium tuberculosis

Science.gov (United States)

REN, NA; GAO, GUIJU; SUN, YUE; ZHANG, LING; WANG, HUIZHU; HUA, WENHAO; WAN, KANGLIN; LI, XINGWANG

2015-01-01

Tuberculosis (TB) infections, caused by multi-drug-resistant Mycobacterium tuberculosis (MDR MTB), remain a significant public health concern worldwide. The regulatory mechanisms underlying the emergence of MDR MTB strains remain to be fully elucidated, and further investigation is required in order to develop better strategies for TB control. The present study investigated the expression profile of microRNA (miRNA) in MTB strains, and examined the differences between sensitive MTB and MDR MTB using next generation sequencing (NGS) with Illumina Deep Sequencing technology to better understand the mechanisms of resistance in MDR MTB, A total of 5, 785 and 195, and 6, 290 and 595 qualified Illumina reads were obtained from two MDR MTB strains, and 6, 673 and 665, and 7, 210 and 217 qualified Illumina reads were obtained from two sensitive MTB strains. The overall de novo assembly of miRNA sequence data generated 62 and 62, and 95 and 112 miRNAs between the 18 and 30 bp long from sensitive MTB strains and MDR MTB strains, respectively. Comparative miRNA analysis revealed that 142 miRNAs were differentially expressed in the MDR MTB strain, compared with the sensitive MTB strain, of which 48 were upregulated and 94 were downregulated. There were six similarly expressed miRNAs between the MDR and sensitive MTB strains, and 108 miRNAs were expressed only in the MDR MTB strain. The present study acquired miRNA data from sensitive MTB and MDR MTB strains using NGS techniques, and this identification miRNAs may serve as an invaluable resource for revealing the molecular basis of the regulation of expression associated with the mechanism of drug-resistance in MTB. PMID:26324150

MicroRNA signatures from multidrug‑resistant Mycobacterium tuberculosis.

Science.gov (United States)

Ren, Na; Gao, Guiju; Sun, Yue; Zhang, Ling; Wang, Huizhu; Hua, Wenhao; Wan, Kanglin; Li, Xingwang

2015-11-01

Tuberculosis (TB) infections, caused by multidrug‑resistant Mycobacterium tuberculosis (MDR MTB), remain a significant public health concern worldwide. The regulatory mechanisms underlying the emergence of MDR MTB strains remain to be fully elucidated, and further investigation is required in order to develop better strategies for TB control. The present study investigated the expression profile of microRNA (miRNA) in MTB strains, and examined the differences between sensitive MTB and MDR MTB using next generation sequencing (NGS) with Illumina Deep Sequencing technology to better understand the mechanisms of resistance in MDR MTB, A total of 5, 785 and 195, and 6, 290 and 595 qualified Illumina reads were obtained from two MDR MTB strains, and 6, 673 and 665, and 7, 210 and 217 qualified Illumina reads were obtained from two sensitive MTB strains. The overall de novo assembly of miRNA sequence data generated 62 and 62, and 95 and 112 miRNAs between the 18 and 30 bp long from sensitive MTB strains and MDR MTB strains, respectively. Comparative miRNA analysis revealed that 142 miRNAs were differentially expressed in the MDR MTB strain, compared with the sensitive MTB strain, of which 48 were upregulated and 94 were downregulated. There were six similarly expressed miRNAs between the MDR and sensitive MTB strains, and 108 miRNAs were expressed only in the MDR MTB strain. The present study acquired miRNA data from sensitive MTB and MDR MTB strains using NGS techniques, and this identification miRNAs may serve as an invaluable resource for revealing the molecular basis of the regulation of expression associated with the mechanism of drug‑resistance in MTB.

Overview of drug-resistant tuberculosis worldwide

Directory of Open Access Journals (Sweden)

Ali A Velayati

2016-01-01

Full Text Available Even in the 21st century, we are losing the battle against eradication of tuberculosis (TB. In 2015, 9.6 million people were estimated to have fallen ill with TB, of which 1.5 million people died. This is the real situation despite the well-structured treatment programs and availability of effective treatment options since the 1950s. The high mortality rate has been associated with other risk factors, such as the HIV epidemic, underlying diseases, and decline of socioeconomic standards. Furthermore, the problem of drug resistance that was recognized in the early days of the chemotherapeutic era raises serious concerns. Although resistance to a single agent is the most common type, resistance to multiple agents is less frequent but of greater concern. The World Health Organization estimated approximately 5% of all new TB cases involved multidrug-resistant (MDR-TB. The estimation for MDR-TB is 3.3% for new cases, and 20.5% for previously treated cases. Failure to identify and appropriately treat MDR-TB patients has led to more dangerous forms of resistant TB. Based on World Health Organization reports, 5% of global TB cases are now considered to be extensively drug resistant (XDR, defined as MDR with additional resistance to both fluoroquinolones and at least one second-line injectable drug. XDR-TB had been reported by 105 countries by 2015. An estimated 9.7% of people with MDR-TB have XDR-TB. More recently, another dangerous form of TB bacillus was identified, which was named totally drug resistant (TDR-TB or extremely drug resistant TB. These strains were resistant to all first- and second-line anti-TB drugs. Collectively, it is accepted that 2% of MDR-TB strains turn to be TDR-TB. This number, however, may not reflect the real situation, as many laboratories in endemic TB countries do not have proper facilities and updated protocols to detect the XDR or TDR-TB strains. Nevertheless, existing data emphasize the need for additional control

Activity of Topical Antimicrobial Agents Against Multidrug-Resistant Bacteria Recovered from Burn Patients

Science.gov (United States)

2010-01-01

Spectrum of activity Pros Cons Resistance/ other Prior studies Bacitracin Polypeptide produced by Bacillus subtilis that inhibits cell wall synthesis and...concentrations (MICs) and zones of inhibition (ZI). Isolates had systemic antibiotic resistance and clonality determined. MDR included resistance to... antibiotics in three or more classes. Results: We assessed 22 ESBL-producing K. pneumoniae, 20 ABC (75% MDR), 20 P. aeruginosa (45% MDR), and 20 MRSA

Multiplex TaqMan® detection of pathogenic and multi-drug resistant Salmonella.

Science.gov (United States)

Singh, Prashant; Mustapha, Azlin

2013-09-02

Overuse of antibiotics in the medical and animal industries is one of the major causes for the development of multi-drug-resistant (MDR) food pathogens that are often difficult to treat. In the past few years, higher incidences of outbreaks caused by MDR Salmonella have been increasingly documented. The objective of this study was to develop a rapid multiplex real-time polymerase chain reaction (PCR) assay for simultaneous detection of pathogenic and MDR Salmonella spp. A multiplex TaqMan®real-time PCR was designed by targeting the invasin virulence gene (invA), and four commonly found antibiotic resistance genes, viz. ampicillin, chloramphenicol, streptomycin and tetracycline. To avoid false negative results and to increase the reliability of the assay, an internal amplification control (IAC) was added which was detected using a locked nucleic acid (LNA) probe. In serially diluted (5 ng-50 fg) DNA samples, the assay was able to detect 100 genomic equivalents of Salmonella, while in a multiplex format, the sensitivity was 1000 genomic equivalents. The assay performed equally well on artificially contaminated samples of beef trim, ground beef of different fat contents (73:27, 80:20, 85:15 and 93:7), chicken rinse, ground chicken, ground turkey, egg, spinach and tomato. While the detection limit for un-enriched inoculated food samples was 10(4) CFU/g, this was improved to 10 CFU/g after a 12-h enrichment in buffered peptone water, with 100% reproducibility. The multiplex real-time assay developed in this study can be used as a valuable tool to detect MDR virulent Salmonella, thus enhancing the safety of food. © 2013.

Molecular characterization of two high-level ceftriaxone-resistant Neisseria gonorrhoeae isolates detected in Catalonia, Spain.

Science.gov (United States)

Cámara, Jordi; Serra, Judit; Ayats, Josefina; Bastida, Teresa; Carnicer-Pont, Dolors; Andreu, Antònia; Ardanuy, Carmen

2012-08-01

The aim of this study was to characterize the first two extended-spectrum cephalosporin-resistant and multidrug-resistant (MDR) Neisseria gonorrhoeae isolates collected from two sexually related patients (men who have sex with men) in Spain. Antimicrobial susceptibility was studied by Etest. Genes involved in quinolone, ceftriaxone and multidrug resistance were amplified by PCR and sequenced in both directions. The isolates were typed by N. gonorrhoeae multi-antigen sequence typing (NG-MAST). The two isolates had the same MDR profile, showing resistance to penicillin (MIC 0.094 mg/L; β-lactamase negative), ceftriaxone (MIC 1.5 mg/L), cefixime (MIC 1.5 mg/L), cefotaxime (MIC 1 mg/L), ciprofloxacin (MIC >32 mg/L) and tetracycline (MIC 1.5 mg/L). NG-MAST showed that both isolates belonged to sequence type (ST) 1407 (porB-908 and tbpB-110). Ciprofloxacin resistance was due to amino acid substitutions in GyrA (S91F and D95G) and ParC (S87R). An A deletion in the promoter of the MtrCDE efflux pump (mtrR) was detected. No changes were detected in the pilQ gene. The outer membrane protein PorB showed two substitutions at G120K and A121N. An L421P substitution was observed in the PBP1A (ponA) sequence. The sequence of PBP2 (penA) showed a mosaic structure related to genotype XXXIV with a single additional amino acid substitution (A501P). This genotype was identical to a recently described French isolate (F89). This is the first reported case of high-level extended-spectrum cephalosporin-resistant N. gonorrhoeae transmission. The molecular typing and MDR genotype suggest possible European spread of this strain, highlighting the need for surveillance and the importance of testing the susceptibility of N. gonorrhoeae to extended-spectrum cephalosporins.

Detection of Methicillin-Resistant Staphylococci Isolated from Food Producing Animals: A Public Health Implication

Directory of Open Access Journals (Sweden)

Etinosa O. Igbinosa

2016-07-01

Full Text Available The emergence of antibiotic-resistant bacteria in food animals is a potential public health concern. Staphylococci are a significant opportunistic pathogen both in humans and dairy cattle. In the present study, the genotypic characterization of methicillin-resistant staphylococcal strains recovered from dairy cattle in a rural community (Okada, Edo State, Nigeria was investigated. A total of 283 samples from cattle (137 milk samples and 146 nasal swabs were assessed between February and April 2015. Antimicrobial susceptibility was performed by Kirby-Bauer disc diffusion method. Polymerase chain reaction (PCR assay was employed for the detection of 16S rRNA, mecA and Panton-Valentine Leucocidinis (PVL genes. The staphylococcal strains were identified through partial 16S ribosomal ribonucleic acids (rRNA nucleotide sequencing, and Basic Local Alignment Search Tool (BLAST analysis of the gene sequence showed that the staphylococcal strains have 96%–100% similarity to Staphylococcus aureus (30, S. epidermidis (17, S. haemolyticus (15, S. saprophyticus (13, S. chromogenes (8, S. simulans (7, S. pseudintermedius (6 and S. xylosus (4. Resistance of 100% was observed in all Staphylococcus spp. against MET, PEN, CLN, CHL and SXT. Multi-drug resistant (MDR bacteria from nasal cavities and raw milk reveals 13 isolates were MDR against METR, PENR, AMXR, CLNR, CHLR, SXTR CLXR, KANR, ERYR, and VANR. Of all isolates, 100% harboured the mecA gene, while 30% of the isolates possess the PVL gene. All S. aureus harboured the PVL gene while other Staphylococcus spp. were negative for the PVL gene. The presence of methicillin-resistant Staphylococcus spp. isolates in dairy cattle is a potential public health risk and thus findings in this study can be used as a baseline for further surveillance.

Multiple drug resistant carbapenemases producing Acinetobacter baumannii isolates harbours multiple R-plasmids

Directory of Open Access Journals (Sweden)

Rajagopalan Saranathan

2014-01-01

Full Text Available Background & objectives: The nosocomial human pathogen Acinetobacter baumannii has high propensity to develop resistance to antimicrobials and to become multidrug resistant (MDR, consequently complicating the treatment. This study was carried out to investigate the presence of resistant plasmids (R-plasmids among the clinical isolates of A. baumannii. In addition, the study was performed to check the presence of common β-lactamases encoding genes on these plasmids. Methods: A total of 55 clinical isolates of A. baumannii were included in the study and all were subjected to plasmid DNA isolation, followed by PCR to check the presence of resistance gene determinants such as blaOXA-23 , blaOXA-51, blaOXA-58 and blaIMP-1 on these plasmids that encode for oxacillinase (OXA and metallo-β-lactamase (MBL type of carbapenemases. Plasmid curing experiments were carried out on selected isolates using ethidium bromide and acridine orange as curing agents and the antibiotic resistance profiles were evaluated before and after curing. Results: All the isolates were identified as A. baumannii by 16SrDNA amplification and sequencing. Plasmid DNA isolated from these isolates showed the occurrence of multiple plasmids with size ranging from 500bp to ≥ 25 kb. The percentage of blaOXA-51 and blaOXA-23 on plasmids were found to be 78 and 42 per cent, respectively and 20 isolates (36% carried blaIMP-1 gene on plasmids. Significant difference was observed in the antibiograms of plasmid cured isolates when compared to their parental ones. The clinical isolates became susceptible to more than two antibiotic classes after curing of plasmids indicating plasmid borne resistance. Interpretation & conclusions: Our study determined the plasmid mediated resistance mechanisms and occurrence of different resistance genes on various plasmids isolated from MDR A. baumannii. The present findings showed the evidence for antibiotic resistance mediated through multiple plasmids in

Cisplatin Resistant Spheroids Model Clinically Relevant Survival Mechanisms in Ovarian Tumors.

Directory of Open Access Journals (Sweden)

Winyoo Chowanadisai

Full Text Available The majority of ovarian tumors eventually recur in a drug resistant form. Using cisplatin sensitive and resistant cell lines assembled into 3D spheroids we profiled gene expression and identified candidate mechanisms and biological pathways associated with cisplatin resistance. OVCAR-8 human ovarian carcinoma cells were exposed to sub-lethal concentrations of cisplatin to create a matched cisplatin-resistant cell line, OVCAR-8R. Genome-wide gene expression profiling of sensitive and resistant ovarian cancer spheroids identified 3,331 significantly differentially expressed probesets coding for 3,139 distinct protein-coding genes (Fc >2, FDR < 0.05 (S2 Table. Despite significant expression changes in some transporters including MDR1, cisplatin resistance was not associated with differences in intracellular cisplatin concentration. Cisplatin resistant cells were significantly enriched for a mesenchymal gene expression signature. OVCAR-8R resistance derived gene sets were significantly more biased to patients with shorter survival. From the most differentially expressed genes, we derived a 17-gene expression signature that identifies ovarian cancer patients with shorter overall survival in three independent datasets. We propose that the use of cisplatin resistant cell lines in 3D spheroid models is a viable approach to gain insight into resistance mechanisms relevant to ovarian tumors in patients. Our data support the emerging concept that ovarian cancers can acquire drug resistance through an epithelial-to-mesenchymal transition.

Analysis of β-Lactamase Resistance Determinants in Enterobacteriaceae from Chicago Children: a Multicenter Survey

Science.gov (United States)

Hujer, Andrea M.; Marshall, Steven H.; Domitrovic, T. Nicholas; Rudin, Susan D.; Zheng, Xiaotian; Qureshi, Nadia K.; Hayden, Mary K.; Scaggs, Felicia A.; Karadkhele, Anand; Bonomo, Robert A.

2016-01-01

Multidrug-resistant (MDR) Enterobacteriaceae infections are increasing in U.S. children; however, there is a paucity of multicentered analyses of antibiotic resistance genes responsible for MDR phenotypes among pediatric Enterobacteriaceae isolates. In this study, 225 isolates phenotypically identified as extended-spectrum β-lactamase (ESBL) or carbapenemase producers, recovered from children ages 0 to 18 years hospitalized between January 2011 and April 2015 at three Chicago area hospitals, were analyzed. We used DNA microarray platforms to detect ESBL, plasmid-mediated AmpC (pAmpC), and carbapenemase type β-lactamase (bla) genes. Repetitive-sequence-based PCR and multilocus sequence typing (MLST) were performed to assess isolate similarity. Plasmid replicon typing was conducted to classify plasmids. The median patient age was 4.2 years, 56% were female, and 44% presented in the outpatient setting. The majority (60.9%) of isolates were Escherichia coli and from urinary sources (69.8%). Of 225 isolates exhibiting ESBL- or carbapenemase-producing phenotypes, 90.7% contained a bla gene. The most common genotype was the blaCTX-M-1 group (49.8%); 1.8% were carbapenem-resistant Enterobacteriaceae (three blaKPC and one blaIMP). Overall, pAmpC (blaACT/MIR and blaCMY) were present in 14.2%. The predominant E. coli phylogenetic group was the virulent B2 group (67.6%) associated with ST43/ST131 (Pasteur/Achtman MLST scheme) containing the blaCTX-M-1 group (84%), and plasmid replicon types FIA, FII, and FIB. K. pneumoniae harboring blaKPC were non-ST258 with replicon types I1 and A/C. Enterobacter spp. carrying blaACT/MIR contained plasmid replicon FIIA. We found that β-lactam resistance in children is diverse and that certain resistance mechanisms differ from known circulating genotypes in adults in an endemic area. The potential impact of complex molecular types and the silent dissemination of MDR Enterobacteriaceae in a vulnerable population needs to be studied further

Virulence factors and mechanisms of antimicrobial resistance in Shigella strains from periurban areas of Lima (Peru).

Science.gov (United States)

Lluque, Angela; Mosquito, Susan; Gomes, Cláudia; Riveros, Maribel; Durand, David; Tilley, Drake H; Bernal, María; Prada, Ana; Ochoa, Theresa J; Ruiz, Joaquim

2015-01-01

The study was aimed to describe the serotype, mechanisms of antimicrobial resistance, and virulence determinants in Shigella spp. isolated from Peruvian children. Eighty three Shigella spp. were serogrouped and serotyped being established the antibiotic susceptibility. The presence of 12 virulence factors (VF) and integrase 1 and 2, along with commonly found antibiotic resistance genes was established by PCR. S. flexneri was the most relevant serogroup (55 isolates, 66%), with serotype 2a most frequently detected (27 of 55, 49%), followed by S. boydii and S. sonnei at 12 isolates each (14%) and S. dysenteriae (four isolates, 5%). Fifty isolates (60%) were multi-drug resistant (MDR) including 100% of S. sonnei and 64% of S. flexneri. Resistance levels were high to trimethoprim-sulfamethoxazole (86%), tetracycline (74%), ampicillin (67%), and chloramphenicol (65%). Six isolates showed decreased azithromycin susceptibility. No isolate was resistant to nalidixic acid, ciprofloxacin, nitrofurantoin, or ceftriaxone. The most frequent resistance genes were sul2 (95%), tet(B) (92%), cat (80%), dfrA1 (47%), blaOXA-1like (40%), with intl1 and intl2 detected in 51 and 52% of the isolates, respectively. Thirty-one different VF profiles were observed, being the ipaH (100%), sen (77%), virA and icsA (75%) genes the most frequently found. Differences in the prevalence of VF were observed between species with S. flexneri isolates, particularly serotype 2a, possessing high numbers of VF. In conclusion, this study highlights the high heterogeneity of Shigella VF and resistance genes, and prevalence of MDR organisms within this geographic region. Copyright © 2015 Elsevier GmbH. All rights reserved.

Multidrug-resistance and presence of class 1 integrons in clinical isolates of Salmonella enterica serotype Enteritidis, circulating in Armenia

DEFF Research Database (Denmark)

Sedrakyan, Anahit M.; Arakelova, K. A.; Zakaryan, Magdalina K.

2014-01-01

a rapid and large-scale penetration of antibiotic resistance genes into populations of S. Enteritidis, which complicates infection control. More rigorous regulations should be imposed on antibiotic use, together with a vigilant epidemiological surveillance, to prevent the emergence and spread of MDR S...

Risk factors associated with multidrug resistant tuberculosis among ...

African Journals Online (AJOL)

Background: Multidrug resistant tuberculosis (MDR-TB) remains is an important public health problem in developing world. We conducted this study to determine risk factors associated with MDR-TB and drug susceptibility pattern to second line drug among MDR TB patients in Tanzania. Methods: Unmatched case control ...

PD173074, a selective FGFR inhibitor, reverses MRP7 (ABCC10-mediated MDR

Directory of Open Access Journals (Sweden)

Nagaraju Anreddy

2014-06-01

Full Text Available Multidrug resistance protein 7 (MRP7, ABCC10 is a recently identified member of the ATP-binding cassette (ABC transporter family, which adequately confers resistance to a diverse group of antineoplastic agents, including taxanes, vinca alkaloids and nucleoside analogs among others. Clinical studies indicate an increased MRP7 expression in non-small cell lung carcinomas (NSCLC compared to a normal healthy lung tissue. Recent studies revealed increased paclitaxel sensitivity in the Mrp7−/− mouse model compared to their wild-type counterparts. This demonstrates that MRP7 is a key contributor in developing drug resistance. Recently our group reported that PD173074, a specific fibroblast growth factor receptor (FGFR inhibitor, could significantly reverse P-glycoprotein-mediated MDR. However, whether PD173074 can interact with and inhibit other MRP members is unknown. In the present study, we investigated the ability of PD173074 to reverse MRP7-mediated MDR. We found that PD173074, at non-toxic concentration, could significantly increase the cellular sensitivity to MRP7 substrates. Mechanistic studies indicated that PD173074 (1 μmol/L significantly increased the intracellular accumulation and in-turn decreased the efflux of paclitaxel by inhibiting the transport activity without altering expression levels of the MRP7 protein, thereby representing a promising therapeutic agent in the clinical treatment of chemoresistant cancer patients.

Initial drug resistance in India

Indian Academy of Sciences (India)

First page Back Continue Last page Overview Graphics. Initial drug resistance in India. There is gradual increase in primary MDR all over India : Pondi= Pondicherry 1985; Bangalore =1986; Jaipur = 1991; Jaipur =2000. Overall the MDR is less than 3% (TRC studies).

Qualitative analysis of MDR-reversing Anastasia Black (Russian black sweet pepper, Capsicum annuum, Solanaceae) extracts and fractions by HPLC and LC-MS-MS methods.

Science.gov (United States)

Schelz, Zsuzsanna; Molnár, Joseph; Fogliano, Vincenzo; Ferracane, Rosalia; Pernice, Rita; Shirataki, Yoshiaki; Motohashi, Noboru

2006-01-01

In earlier experiments, the MDR (multidrug resistance)-reversal activities of Anastasia Black (Russian black sweet pepper) extracts had been analysed. Recently, the most effective MDR reversing extracts and fractions have been separated by HPLC (high-performance liquid chromatography, for carotenoids) and LC-MS-MS (HPLC combined with mass spectrometry, for phenolic compounds) methods. As a result of the analytical studies, the following flavonoids had been identified: feruloyl glucopyranoside, quercetin rhamnopyranoside glucopyranoside, luteolin glucopyranoside arabinopyranoside, apigenin glucopyranoside arabinopyranoside, quercetin rhamnopyranoside, luteolin arabinopyranoside diglucopy-ranoside, hesperidine and luteolin glucuronide. According to the literature, the aglycones of these phenolic compounds exhibit MDR-reversal activity in vitro, and the connection between the phenolic content of Anastasia Black and MDR-reversal action was therefore studied by different analytical methods. The results of this study revealed that the identified flavonoids of Anastasia Black may be only partially responsible for the modulation of the MDR of mouse lymphoma cells. Other lipophilic compounds, most probably carotenoids, present in Russian black sweet pepper may act as inhibitors of MDR reversal.

Heightened vulnerability to MDR-TB epidemics after controlling drug-susceptible TB.

Directory of Open Access Journals (Sweden)

Jason D Bishai

2010-09-01

Full Text Available Prior infection with one strain TB has been linked with diminished likelihood of re-infection by a new strain. This paper attempts to determine the role of declining prevalence of drug-susceptible TB in enabling future epidemics of MDR-TB.A computer simulation of MDR-TB epidemics was developed using an agent-based model platform programmed in NetLogo (See http://mdr.tbtools.org/. Eighty-one scenarios were created, varying levels of treatment quality, diagnostic accuracy, microbial fitness cost, and the degree of immunogenicity elicited by drug-susceptible TB. Outcome measures were the number of independent MDR-TB cases per trial and the proportion of trials resulting in MDR-TB epidemics for a 500 year period after drug therapy for TB is introduced.MDR-TB epidemics propagated more extensively after TB prevalence had fallen. At a case detection rate of 75%, improving therapeutic compliance from 50% to 75% can reduce the probability of an epidemic from 45% to 15%. Paradoxically, improving the case-detection rate from 50% to 75% when compliance with DOT is constant at 75% increases the probability of MDR-TB epidemics from 3% to 45%.The ability of MDR-TB to spread depends on the prevalence of drug-susceptible TB. Immunologic protection conferred by exposure to drug-susceptible TB can be a crucial factor that prevents MDR-TB epidemics when TB treatment is poor. Any single population that successfully reduces its burden of drug-susceptible TB will have reduced herd immunity to externally or internally introduced strains of MDR-TB and can experience heightened vulnerability to an epidemic. Since countries with good TB control may be more vulnerable, their self interest dictates greater promotion of case detection and DOTS implementation in countries with poor control to control their risk of MDR-TB.

Drug resistance-related mutations in multidrug-resistant Mycobacterium tuberculosis isolates from diverse geographical regions

Directory of Open Access Journals (Sweden)

Senia Rosales-Klintz

2012-01-01

Conclusion: This study confirms that there are significant geographical differences in the distribution of resistance-related mutations and suggests that an increased understanding of such differences in the specific distribution of resistance conferring mutations is crucial for development of new, generally applicable, molecular tools for rapid diagnosis of drug-resistant TB. The fact that a narrower distribution of mutations in high MDR-TB prevalence settings was seen suggests that much of the problems in these settings can be a result of an ongoing transmission of certain MDR-TB strains.

β-Elemene Reverses Chemoresistance of Breast Cancer Cells by Reducing Resistance Transmission via Exosomes

Directory of Open Access Journals (Sweden)

Jun Zhang

2015-07-01

Full Text Available Background: Currently, exosomes that act as mediators of intercellular communication are being researched extensively. Our previous studies confirmed that these exosomes contain microRNAs (miRNAs that could alter chemo-susceptibility, which is partly attributed to the successful intercellular transfer of multidrug resistance (MDR-specific miRNAs. We also confirmed that β-elemene could influence MDR-related miRNA expression and regulate the expression of the target genes PTEN and Pgp, which may lead to the reversal of the chemoresistant breast cancer (BCA cells. We are the first to report these findings, and we propose the following logical hypothesis: β-elemene can mediate MDR-related miRNA expression in cells, thereby affecting the exosome contents, reducing chemoresistance transmission via exosomes, and reversing the drug resistance of breast cancer cells. Methods: MTT-cytotoxic, miRNA microarray, real-time quantitative PCR, Dual Luciferase Activity Assay, and Western blot analysis were performed to investigate the impact of β-elemene on the expression of chemoresistance specific miRNA and PTEN as well as Pgp in chemoresistant BCA exosomes. Results: Drug resistance can be reversed by β-elemene related to exosomes. There were 104 differentially expressed miRNAs in the exosomes of two chemoresistant BCA cells: adriacin (Adr - resistant MCF-7 cells (MCF-7/Adr and docetaxel (Doc - resistant MCF-7 cells (MCF-7/Doc that underwent treatment. Of these, 31 miRNAs were correlated with the constant changes in the MDR. The expression of miR-34a and miR-452 can lead to changes in the characteristics of two chemoresistant BCA exosomes: MCF-7/Adr exosomes (A/exo and MCF-7/Doc exosomes (D/exo. The PTEN expression affected by β-elemene was significantly increased, and the Pgp expression affected by β-elemene was significantly decreased in both cells and exosomes. β-elemene induced a significant increase in the apoptosis rate in both MCF-7/Doc and MCF-7

Antimicrobial Resistance Mechanisms and Genetic Diversity of Multidrug-Resistant Acinetobacter baumannii Isolated from a Teaching Hospital in Malaysia.

Science.gov (United States)

Biglari, Shirin; Hanafiah, Alfizah; Mohd Puzi, Shaliawani; Ramli, Ramliza; Rahman, Mostafizur; Lopes, Bruno Silvester

2017-07-01

Multidrug-resistant (MDR) Acinetobacter baumannii has increasingly emerged as an important nosocomial pathogen. The aim of this study was to determine the resistance profiles and genetic diversity in A. baumannii clinical isolates in a tertiary medical center in Malaysia. The minimum inhibitory concentrations of carbapenems (imipenem and meropenem), cephalosporins (ceftazidime and cefepime), and ciprofloxacin were determined by E-test. PCR and sequencing were carried out for the detection of antibiotic resistance genes and mutations. Clonal relatedness among A. baumannii isolates was determined by REP-PCR. Sequence-based typing of OXA-51 and multilocus sequence typing were performed. One hundred twenty-five of 162 (77.2%) A. baumannii isolates had MDR phenotype. From the 162 A. baumannii isolates, 20 strain types were identified and majority of A. baumannii isolates (66%, n = 107) were classified as strain type 1 and were positive for ISAba1-bla OXA-23 and ISAba1-bla ADC and had mutations in both gyrA and parC genes at positions, 83 and 80, resulting in serine-to-leucine conversion. REP-PCR analysis showed 129 REP types that generated 31 clones with a 90% similarity cutoff value. OXA-66 variant of the bla OXA-51-like genes was predominantly detected among our A. baumannii clinical isolates belonging to ST195 (found in six clones: 1, 8, 9, 19, 27, and 30) and ST208 (found in clone 21). The study helps us in understanding the genetic diversity of A. baumannii isolates in our setting and confirms that international clone II is the most widely distributed clone in Universiti Kebangsaan Malaysia Medical Centre, Malaysia.

Role of Risk Factors in the Incidence of Multidrug-Resistant Tuberculosis

Directory of Open Access Journals (Sweden)

Alya Putri Khairani

2017-09-01

Full Text Available Objective: To determine the risk factors that played roles in the incidence of multidrug-resistant tuberculosis (MDR-TB in such patients. Multidrug-Resistant Tuberculosis is a form of tuberculosis caused by Mycobacterium tuberculosis that is resistant to at least isoniazid and rifampicin. Methods: This was a case control study to compare MDR-TB to non-MDR-TB pulmonary tuberculosis outpatients in Dr. Hasan Sadikin General Hospital, Bandung on August–September 2014. Fifty MDR-TB outpatients were included as the cases and 50 non-MDR-TB outpatients as controls. Data was collected by questionnaires and patient’s registration forms. Bivariate and multivariate analyses were performed using chi-square test and multiple logistic regression test, with p<0.05 considered significant. Results: From bivariate analysis, number of previous tuberculosis treatments, regularity of previous treatment, and burden of cost were significant risk factors for developing MDR-TB (p<0.05; while from multivariate analysis, number of previous TB treatments was the only risk factor that played a significant role in the incidence of MDR-TB (OR 24.128 95% CI 6.771-85,976. Conclusions: Patients and medication factors are risk factors that play roles in the incidence of MDR-TB. The significant risk factor is the number of previous TB treatment.

Rapid molecular diagnostics for multi-drug resistant tuberculosis in India.

Science.gov (United States)

Ramachandran, Rajeswari; Muniyandi, M

2018-03-01

Rapid molecular diagnostic methods help in the detection of TB and Rifampicin resistance. These methods detect TB early, are accurate and play a crucial role in reducing the burden of drug resistant tuberculosis. Areas covered: This review analyses rapid molecular diagnostic tools used in the diagnosis of MDR-TB in India, such as the Line Probe Assay and GeneXpert. We have discussed the burden of MDR-TB and the impact of recent diagnostic tools on case detection and treatment outcomes. This review also discusses the costs involved in establishing these new techniques in India. Expert commentary: Molecular methods have considerable advantages for the programmatic management of drug resistant TB. These include speed, standardization of testing, potentially high throughput and reduced laboratory biosafety requirements. There is a desperate need for India to adopt modern, rapid, molecular tools with point-of-care tests being currently evaluated. New molecular diagnostic tests appear to be cost effective and also help in detecting missing cases. There is enough evidence to support the scaling up of these new tools in India.

In vitro antibacterial activity of crude extracts of 9 selected medicinal plants against UTI causing MDR bacteria

Directory of Open Access Journals (Sweden)

Monali P. Mishra

2017-01-01

Full Text Available Urinary tract infection (UTI has become a more grievous problem today, due to multidrug resistance of infecting Gram-positive (GP and Gram-negative (GN bacteria, sometimes even with multiple infections. This study examines effectivity of 9 tropical flowering plants (Anogeissus acuminata, Azadirachta indica, Bauhinia variegata, Boerhaavia diffusa, Punica granatum, Soymida febrifuga, Terminalia chebula, Tinospora cordifolia and Tribulus terrestris for possible use as source of antimicrobials for multidrug resistant (MDR bacteria, along with main-stream antibiotics. Pathogenic bacteria were isolated from urine samples of patients attending and admitted in the hospital. Antibiograms of 11 isolated bacteria (GPs, Enterococcus faecalis and Staphylococcus aureus; and GNs, Acinetobacter baumannii, Citrobacter freundii, Enterobacter aerogenes, Escherichia coli, Klebsiella oxytoca, Klebsiella pneumoniae, Proteus mirabilis, Proteus vulgaris and Pseudomonas aeruginosa were ascertained by the disc-diffusion method, and antibacterial effectivity of plant extracts was monitored by the agar-well diffusion method. Isolated bacteria were floridly MDR to most antibiotics of the day. Methanol extracts of 9 plants were used, and extracts of 3 plants, A. acuminata, P. granatum and S. febrifuga at least caused 25–29 mm as the maximum size of zone of inhibition on bacterial lawns. Minimum inhibitory concentration (MIC and minimum bactericidal concentration (MBC values of methanol extracts of 9 plants were recorded. The methanol extract of A. acuminata had 0.29 mg/ml as the lowest MIC value and 0.67 mg/ml as the lowest MBC value, against MDR S. aureus, signifying effectivity; but, it had the highest MIC value of 3.41 mg/ml. and the highest MBC value of 4.27 mg/ml for most other MDR bacteria including E. coli. Qualitative phytochemical analysis was done for these 9 plants and information on leading phytochemicals was presented retrieved from PubChem database. Thus

[Expression and significance of P-gp/mdr1 mRNA, MRP and LRP in non-Hodgkin's lymphoma].

Science.gov (United States)

Li, Le; Su, Li-ping; Ma, Li; Zhao, Jin; Zhu, Lei; Zhou, Yong-an

2009-03-01

To explore the expression and clinical significance of P-glycoprotein (P-gp)/mdr1mRNA, multidrug resistance-associated protein (MRP) and lung resistance protein (LRP) in newly diagnosed non-Hodgkin's lymphoma. mdr1 mRNA of in 41 patients with non-Hodgkin's lymphoma was assayed by semi-quantitative RT-PCR. The expressions of P-gp, MRP and LRP proteins in lymph node viable blasts were identified by flow cytometry. The results were compared with those obtained from control cases, and the correlation of the changes with clinical outcomes was analyzed. (1) Among the 41 cases, the positive expression of P-gp protein was detected in 8 cases, MRP in 7 cases, LRP in 15 cases, and mdr 1 mRNA in 11 cases. (2) The P-gp and LRP levels in NHL were significantly higher than those in control group, but MRP wasn't. The P-gp over-expression was significantly associated with mdr1mRNA (r = 0.396, P = 0.01). No correlation was showed among the expressions of P-gp, MRP and LRP. (3) Patients with P-gp expression had a poorer outcome of chemotherapy than those with P-gp-negative (P = 0.005). P-gp expression was significantly associated with higher clinical stage (P = 0.046) and elevated serum lactate dehydrogenase level (P = 0.032), but not associated with malignant degree (P = 0.298). MRP had no impact on the outcome of chemotherapy (P = 0.212), and wasn't significantly associated with higher clinical stage (P = 0.369), elevated LDH (P = 0.762) and higher malignant degree (P = 0.451). Patients with LRP expression had a poorer outcome of chemotherapy than those LRP-negative (P = 0.012). LRP expression was significantly associated with higher clinical stage (P = 0.0019), elevated LDH (P = 0.02) and higher malignant degree (P = 0.01). The data of this study indicate that P-gp and LRP expressions but not MRP expression are important in the mechanism of drug resistance associated with a poor clinical outcome in previously untreated NHL.

Rapid molecular detection of rifampicin resistance facilitates early diagnosis and treatment of multi-drug resistant tuberculosis: case control study.

Directory of Open Access Journals (Sweden)

Philly O'Riordan

2008-09-01

Full Text Available Multi-drug resistant tuberculosis (MDR-TB is a major public health concern since diagnosis is often delayed, increasing the risk of spread to the community and health care workers. Treatment is prolonged, and the total cost of treating a single case is high. Diagnosis has traditionally relied upon clinical suspicion, based on risk factors and culture with sensitivity testing, a process that can take weeks or months. Rapid diagnostic molecular techniques have the potential to shorten the time to commencing appropriate therapy, but have not been put to the test under field conditions.This retrospective case-control study aimed to identify risk factors for MDR-TB, and analyse the impact of testing for rifampicin resistance using RNA polymerase B (rpoB mutations as a surrogate for MDR-TB. Forty two MDR-TB cases and 84 fully sensitive TB controls were matched by date of diagnosis; and factors including demographics, clinical presentation, microbiology findings, management and outcome were analysed using their medical records. Conventionally recognised risk factors for MDR-TB were absent in almost half (43% of the cases, and 15% of cases were asymptomatic. A significant number of MDR-TB cases were identified in new entrants to the country. Using rpoB mutation testing, the time to diagnosis of MDR-TB was dramatically shortened by a median of 6 weeks, allowing patients to be commenced on appropriate therapy a median of 51days earlier than those diagnosed by conventional culture and sensitivity testing.MDR-TB is frequently an unexpected finding, may be asymptomatic, and is particularly prevalent among TB infected new entrants to the country. Molecular resistance testing of all acid fast bacilli positive specimens has the potential to rapidly identify MDR-TB patients and commence them on appropriate therapy significantly earlier than by conventional methods.

Trends of 9,416 multidrug-resistant Gram-negative bacteria

Directory of Open Access Journals (Sweden)

Viviane Decicera Colombo Oliveira

2015-06-01

Full Text Available Summary Objective: a resistance of hospital-acquired bacteria to multiple antibiotics is a major concern worldwide. The objective of this study was to investigate multidrugresistant (MDR bacteria, clinical specimens, origin of specimen and trends, and correlate these with bacterial sensitivity and consumption of antimicrobials. Methods: 9,416 bacteria of nosocomial origin were evaluated in a tertiary hospital, from 1999 to 2008. MDR was defined for Gram-negative bacteria (GNB as resistance to two or more classes/groups of antibiotics. Results: GNB MDR increased by 3.7 times over the study period (p<0.001. Acinetobacter baumannii was the most prevalent (36.2%. Over the study period, there were significant 4.8-fold and 14.6-fold increases for A. baumannii and K. pneumoniae (p<0.001, respectively. Sixty-seven percent of isolates of MDR GNB were isolated in intensive care units. The resistance of A. baumannii to carbapenems increased from 7.4 to 57.5% during the study period and concomitant with an increased consumption. Conclusion: that decade showed prevalence of GNB and a gradual increase in MDR GNB. There was an increase in carbapenem resistance of 50.1% during the study.

Anti-cancer effect of oncolytic adenovirus-armed shRNA targeting MYCN gene on doxorubicin-resistant neuroblastoma cells.

Science.gov (United States)

Li, Yuan; Zhuo, Baobiao; Yin, Yiyu; Han, Tao; Li, Shixian; Li, Zhengwei; Wang, Jian

2017-09-09

Chemotherapy is one of the few effective choices for patients with neuroblastoma. However, the development of muti-drug resistance (MDR) to chemotherapy is a major obstacle to the effective treatment of advanced or recurrent neuroblastoma. The muti-drug resistance-associated protein (MRP), which encodes a transmembrane glycoprotein, is a key regulator of MDR. The expression of MRP is a close correlation with MYCN oncogene in neuroblastoma. We have recently shown ZD55-shMYCN (oncolytic virus armed with shRNA against MYCN) can down-regulate MYCN to inhibit tumor cells proliferation and induce apoptosis in neuroblastoma. Here we further report ZD55-shMYCN re-sensitized doxorubicin-resistant cells to doxorubicin (as shown by reduced proliferation, increased apoptosis, and inhibited cell migration), and reduced the in vivo growth rate of neuroblastoma xenografts by down-regulation of MRP expression. Sequential therapy with doxorubicin did not affect the replication of ZD55-shMYCN in doxorubicin-resistant neuroblastoma cells, but decreased the expression of Bcl-2, Bcl-X L , MMP-1. Thus, this synergistic effect of ZD55-shMYCN in combination with doxorubicin provides a novel therapy strategy for doxorubicin-resistant neuroblastoma, and is a promising approach for further clinical development. Copyright © 2017 Elsevier Inc. All rights reserved.

Risk factors for MDR and XDR-TB in a tertiary referral hospital in India.

Directory of Open Access Journals (Sweden)

V Balaji

Full Text Available BACKGROUND: India has a high burden of drug resistant TB, although there are few data on XDR-TB. Although XDR-TB has existed previously in India, the definition has not been widely applied, and surveillance using second line drug susceptibility testing has not been performed. Our objective was to analyze clinical and demographic risk factors associated with isolation of MDR and XDR TB as compared to susceptible controls, at a tertiary center. METHODOLOGY/FINDINGS: Retrospective chart review based on positive cultures isolated in a high volume mycobacteriology laboratory between 2002 and 2007. 47 XDR, 30 MDR and 117 susceptible controls were examined. Drug resistant cases were less likely to be extrapulmonary, and had received more previous treatment regimens. Significant risk factors for XDR-TB included residence outside the local state (OR 7.43, 3.07-18.0 and care costs subsidized (OR 0.23, 0.097-0.54 in bivariate analysis and previous use of a fluoroquinolone and injectable agent (other than streptomycin (OR 7.00, 95% C.I. 1.14-43.03 and an initial treatment regimen which did not follow national guidelines (OR 5.68, 1.24-25.96 in multivariate analysis. Cavitation and HIV did not influence drug resistance. CONCLUSIONS/SIGNIFICANCE: There is significant selection bias in the sample available. Selection pressure from previous treatment and an inadequate initial regimen increases risk of drug resistance. Local patients and those requiring financial subsidies may be at lower risk of XDR-TB.

Identification of acquired antimicrobial resistance genes

DEFF Research Database (Denmark)

Zankari, Ea; Hasman, Henrik; Cosentino, Salvatore

2012-01-01

ObjectivesIdentification of antimicrobial resistance genes is important for understanding the underlying mechanisms and the epidemiology of antimicrobial resistance. As the costs of whole-genome sequencing (WGS) continue to decline, it becomes increasingly available in routine diagnostic laborato......ObjectivesIdentification of antimicrobial resistance genes is important for understanding the underlying mechanisms and the epidemiology of antimicrobial resistance. As the costs of whole-genome sequencing (WGS) continue to decline, it becomes increasingly available in routine diagnostic...... laboratories and is anticipated to substitute traditional methods for resistance gene identification. Thus, the current challenge is to extract the relevant information from the large amount of generated data.MethodsWe developed a web-based method, ResFinder that uses BLAST for identification of acquired...... antimicrobial resistance genes in whole-genome data. As input, the method can use both pre-assembled, complete or partial genomes, and short sequence reads from four different sequencing platforms. The method was evaluated on 1862 GenBank files containing 1411 different resistance genes, as well as on 23 de...

Targeting glucosylceramide synthase induction of cell surface globotriaosylceramide (Gb3) in acquired cisplatin-resistance of lung cancer and malignant pleural mesothelioma cells

Energy Technology Data Exchange (ETDEWEB)

Tyler, Andreas, E-mail: andreas.tyler@medbio.umu.se [Department of Medical Biosciences, Umeå University, S-901 85 Umea (Sweden); Johansson, Anders [Department of Odontology, Umeå University, S-901 85 Umea (Sweden); Karlsson, Terese [Department of Radiation Sciences, Oncology, S-901 85 Umea (Sweden); Gudey, Shyam Kumar; Brännström, Thomas; Grankvist, Kjell; Behnam-Motlagh, Parviz [Department of Medical Biosciences, Umeå University, S-901 85 Umea (Sweden)

2015-08-01

Background: Acquired resistance to cisplatin treatment is a caveat when treating patients with non-small cell lung cancer (NSCLC) and malignant pleural mesothelioma (MPM). Ceramide increases in response to chemotherapy, leading to proliferation arrest and apoptosis. However, a tumour stress activation of glucosylceramide synthase (GCS) follows to eliminate ceramide by formation of glycosphingolipids (GSLs) such as globotriaosylceramide (Gb3), the functional receptor of verotoxin-1. Ceramide elimination enhances cell proliferation and apoptosis blockade, thus stimulating tumor progression. GSLs transactivate multidrug resistance 1/P-glycoprotein (MDR1) and multidrug resistance-associated protein 1 (MRP1) expression which further prevents ceramide accumulation and stimulates drug efflux. We investigated the expression of Gb3, MDR1 and MRP1 in NSCLC and MPM cells with acquired cisplatin resistance, and if GCS activity or MDR1 pump inhibitors would reduce their expression and reverse cisplatin-resistance. Methods: Cell surface expression of Gb3, MDR1 and MRP1 and intracellular expression of MDR1 and MRP1 was analyzed by flow cytometry and confocal microscopy on P31 MPM and H1299 NSCLC cells and subline cells with acquired cisplatin resistance. The effect of GCS inhibitor PPMP and MDR1 pump inhibitor cyclosporin A for 72 h on expression and cisplatin cytotoxicity was tested. Results: The cisplatin-resistant cells expressed increased cell surface Gb3. Cell surface Gb3 expression of resistant cells was annihilated by PPMP whereas cyclosporin A decreased Gb3 and MDR1 expression in H1299 cells. No decrease of MDR1 by PPMP was noted in using flow cytometry, whereas a decrease of MDR1 in H1299 and H1299res was indicated with confocal microscopy. No certain co-localization of Gb3 and MDR1 was noted. PPMP, but not cyclosporin A, potentiated cisplatin cytotoxicity in all cells. Conclusions: Cell surface Gb3 expression is a likely tumour biomarker for acquired cisplatin

MDR1 P-glycoprotein transports endogenous opioid peptides

NARCIS (Netherlands)

Oude Elferink, R. P.; Zadina, J.

2001-01-01

MDR1 P-glycoprotein is generally regarded as an efflux pump for amphipathic toxic compounds. The question remains, however, whether certain endogenous compounds are also substrates for this transporter. Certain peptides have been shown to interact with MDR1 Pgp as well and we have therefore

Genomic Analysis of Multidrug-Resistant Escherichia coli from North Carolina Community Hospitals: Ongoing Circulation of CTX-M-Producing ST131-H30Rx and ST131-H30R1 Strains.

Science.gov (United States)

Kanamori, Hajime; Parobek, Christian M; Juliano, Jonathan J; Johnson, James R; Johnston, Brian D; Johnson, Timothy J; Weber, David J; Rutala, William A; Anderson, Deverick J

2017-08-01

Escherichia coli sequence type 131 (ST131) predominates globally among multidrug-resistant (MDR) E. coli strains. We used whole-genome sequencing (WGS) to investigate 63 MDR E. coli isolates from 7 North Carolina community hospitals (2010 to 2015). Of these, 39 (62%) represented ST131, including 37 (95%) from the ST131- H 30R subclone: 10 (27%) from its H 30R1 subset and 27 (69%) from its H 30Rx subset. ST131 core genomes differed by a median of 15 (range, 0 to 490) single-nucleotide variants (SNVs) overall versus only 7 within H 30R1 (range, 3 to 12 SNVs) and 11 within H 30Rx (range, 0 to 21). The four isolates with identical core genomes were all H 30Rx. Epidemiological and clinical characteristics did not vary significantly by strain type, but many patients with MDR E. coli or H 30Rx infection were critically ill and had poor outcomes. H 30Rx isolates characteristically exhibited fluoroquinolone resistance and CTX-M-15 production, had a high prevalence of trimethoprim-sulfamethoxazole resistance (89%), sul1 (89%), and dfrA17 (85%), and were enriched for specific virulence traits, and all qualified as extraintestinal pathogenic E. coli The high overall prevalence of CTX-M-15 appeared to be possibly attributable to its association with the ST131- H 30Rx subclone and IncF[F2:A1:B-] plasmids. Some phylogenetically clustered non-ST131 MDR E. coli isolates also had distinctive serotypes/ fimH types, fluoroquinolone mutations, CTX-M variants, and IncF types. Thus, WGS analysis of our community hospital source MDR E. coli isolates suggested ongoing circulation and differentiation of E. coli ST131 subclones, with clonal segregation of CTX-M variants, other resistance genes, Inc-type plasmids, and virulence genes. Copyright © 2017 American Society for Microbiology.

Risk score modeling of multiple gene to gene interactions using aggregated-multifactor dimensionality reduction

Directory of Open Access Journals (Sweden)

Dai Hongying

2013-01-01

Full Text Available Abstract Background Multifactor Dimensionality Reduction (MDR has been widely applied to detect gene-gene (GxG interactions associated with complex diseases. Existing MDR methods summarize disease risk by a dichotomous predisposing model (high-risk/low-risk from one optimal GxG interaction, which does not take the accumulated effects from multiple GxG interactions into account. Results We propose an Aggregated-Multifactor Dimensionality Reduction (A-MDR method that exhaustively searches for and detects significant GxG interactions to generate an epistasis enriched gene network. An aggregated epistasis enriched risk score, which takes into account multiple GxG interactions simultaneously, replaces the dichotomous predisposing risk variable and provides higher resolution in the quantification of disease susceptibility. We evaluate this new A-MDR approach in a broad range of simulations. Also, we present the results of an application of the A-MDR method to a data set derived from Juvenile Idiopathic Arthritis patients treated with methotrexate (MTX that revealed several GxG interactions in the folate pathway that were associated with treatment response. The epistasis enriched risk score that pooled information from 82 significant GxG interactions distinguished MTX responders from non-responders with 82% accuracy. Conclusions The proposed A-MDR is innovative in the MDR framework to investigate aggregated effects among GxG interactions. New measures (pOR, pRR and pChi are proposed to detect multiple GxG interactions.

Prediction of Phenotypic Antimicrobial Resistance Profiles From Whole Genome Sequences of Non-typhoidal Salmonella enterica.

Science.gov (United States)

Neuert, Saskia; Nair, Satheesh; Day, Martin R; Doumith, Michel; Ashton, Philip M; Mellor, Kate C; Jenkins, Claire; Hopkins, Katie L; Woodford, Neil; de Pinna, Elizabeth; Godbole, Gauri; Dallman, Timothy J

2018-01-01

Surveillance of antimicrobial resistance (AMR) in non-typhoidal Salmonella enterica (NTS), is essential for monitoring transmission of resistance from the food chain to humans, and for establishing effective treatment protocols. We evaluated the prediction of phenotypic resistance in NTS from genotypic profiles derived from whole genome sequencing (WGS). Genes and chromosomal mutations responsible for phenotypic resistance were sought in WGS data from 3,491 NTS isolates received by Public Health England's Gastrointestinal Bacteria Reference Unit between April 2014 and March 2015. Inferred genotypic AMR profiles were compared with phenotypic susceptibilities determined for fifteen antimicrobials using EUCAST guidelines. Discrepancies between phenotypic and genotypic profiles for one or more antimicrobials were detected for 76 isolates (2.18%) although only 88/52,365 (0.17%) isolate/antimicrobial combinations were discordant. Of the discrepant results, the largest number were associated with streptomycin (67.05%, n = 59). Pan-susceptibility was observed in 2,190 isolates (62.73%). Overall, resistance to tetracyclines was most common (26.27% of isolates, n = 917) followed by sulphonamides (23.72%, n = 828) and ampicillin (21.43%, n = 748). Multidrug resistance (MDR), i.e., resistance to three or more antimicrobial classes, was detected in 848 isolates (24.29%) with resistance to ampicillin, streptomycin, sulphonamides and tetracyclines being the most common MDR profile ( n = 231; 27.24%). For isolates with this profile, all but one were S . Typhimurium and 94.81% ( n = 219) had the resistance determinants bla TEM-1, strA-strB, sul2 and tet (A). Extended-spectrum β-lactamase genes were identified in 41 isolates (1.17%) and multiple mutations in chromosomal genes associated with ciprofloxacin resistance in 82 isolates (2.35%). This study showed that WGS is suitable as a rapid means of determining AMR patterns of NTS for public health surveillance.

Surveillance of extensively drug-resistant tuberculosis in Europe, 2003-2007.

NARCIS (Netherlands)

Devaux, I.; Manissero, D.; Fernandez de la Hoz, K.; Kremer, K.; Soolingen, D. van

2010-01-01

This paper describes the results of second-line drug (SLD) susceptibility tests among multidrug-resistant tuberculosis (MDR TB) cases reported in 20 European countries aiming to identify extensively drug-resistant tuberculosis (XDR TB) cases. A project on molecular surveillance of MDR TB cases was

Molecular epidemiological survey of the quinolone- and carbapenem-resistant genotype and its association with the type III secretion system in Pseudomonas aeruginosa.

Science.gov (United States)

Ferreira, Melina Lorraine; Dantas, Raquel Cavalcanti; Faria, Ana Luiza Souza; Gonçalves, Iara Rossi; Silveira de Brito, Cristiane; Queiroz, Lícia Ludendorff; Gontijo-Filho, Paulo P; Ribas, Rosineide Marques

2015-03-01

This study evaluated the predictors of mortality and the impact of inappropriate therapy on the outcomes of patients with bacteraemia and ventilator-associated pneumonia (VAP). Additionally, we evaluated the correlation of the type III secretion system (TTSS) effector genotype with resistance to carbapenems and fluoroquinolones, mutations in the quinolone resistance-determining regions (QRDRs), metallo-β-lactamase and virulence factors. A retrospective cohort was conducted at a tertiary hospital in patients with multidrug-resistant (MDR) P. aeruginosa bacteraemia (157 patients) and VAP (60 patients). The genes for blaIMP, blaVIM, blaSIM, blaGIM and blaSPM and virulence genes (exoT, exoS, exoY, exoU, lasB, algD and toxA) were detected; sequencing was conducted for QRDR genes on fluoroquinolone-resistant strains. The multivariate analyses showed that the predictors independently associated with death in patients with bacteraemia were cancer and inappropriate therapy. Carbapenem resistance was more frequent among strains causing VAP (53.3 %), and in blood we observed the blaSPM genotype (66.6 %) and blaVIM genotype (33.3 %). The exoS gene was found in all isolates, whilst the frequency was low for exoU (9.4 %). Substitution of threonine to isoleucine at position 83 in gyrA was the most frequent mutation among fluoroquinolone-resistant strains. Our study showed a mutation at position 91 in the parC gene (Glu91Lys) associated with a mutation in gyrA (Thre83Ile) in a strain of extensively drug-resistant P. aeruginosa, with the exoT(+)exoS(+)exoU(+) genotype, that has not yet been described in Brazil to the best of our knowledge. This comprehensive analysis of resistance mechanisms to carbapenem and fluoroquinolones and their association with TTSS virulence genes, covering MDR P. aeruginosa in Brazil, is the largest reported to date. © 2015 The Authors.

Multidrug-resistant tuberculosis

Directory of Open Access Journals (Sweden)

McNerney Ruth

2008-01-01

Full Text Available Abstract Background With almost 9 million new cases each year, tuberculosis remains one of the most feared diseases on the planet. Led by the STOP-TB Partnership and WHO, recent efforts to combat the disease have made considerable progress in a number of countries. However, the emergence of mutated strains of Mycobacterium tuberculosis that are resistant to the major anti-tuberculosis drugs poses a deadly threat to control efforts. Multidrug-resistant tuberculosis (MDR-TB has been reported in all regions of the world. More recently, extensively drug resistant-tuberculosis (XDR-TB that is also resistant to second line drugs has emerged in a number of countries. To ensure that adequate resources are allocated to prevent the emergence and spread of drug resistance it is important to understand the scale of the problem. In this article we propose that current methods of describing the epidemiology of drug resistant tuberculosis are not adequate for this purpose and argue for the inclusion of population based statistics in global surveillance data. Discussion Whereas the prevalence of tuberculosis is presented as the proportion of individuals within a defined population having disease, the prevalence of drug resistant tuberculosis is usually presented as the proportion of tuberculosis cases exhibiting resistance to anti-tuberculosis drugs. Global surveillance activities have identified countries in Eastern Europe, the former Soviet Union and regions of China as having a high proportion of MDR-TB cases and international commentary has focused primarily on the urgent need to improve control in these settings. Other regions, such as sub-Saharan Africa have been observed as having a low proportion of drug resistant cases. However, if one considers the incidence of new tuberculosis cases with drug resistant disease in terms of the population then countries of sub-Saharan Africa have amongst the highest rates of transmitted MDR-TB in the world. We propose

Rapid genotyping assays for the 4-base pair deletion of canine MDR1/ABCB1 gene and low frequency of the mutant allele in Border Collie dogs.

Science.gov (United States)

Mizukami, Keijiro; Chang, Hye-Sook; Yabuki, Akira; Kawamichi, Takuji; Hossain, Mohammad A; Rahman, Mohammad M; Uddin, Mohammad M; Yamato, Osamu

2012-01-01

P-glycoprotein, encoded by the MDR1 or ABCB1 gene, is an integral component of the blood-brain barrier as an efflux pump for xenobiotics crucial in limiting drug uptake into the central nervous system. Dogs homozygous for a 4-base pair deletion of the canine MDR1 gene show altered expression or function of P-glycoprotein, resulting in neurotoxicosis after administration of the substrate drugs. In the present study, the usefulness of microchip electrophoresis for genotyping assays detecting this deletion mutation was evaluated. Mutagenically separated polymerase chain reaction (MS-PCR) and real-time PCR assays were newly developed and evaluated. Furthermore, a genotyping survey was carried out in a population of Border Collies dogs in Japan to determine the allele frequency in this breed. Microchip electrophoresis showed advantages in detection sensitivity and time saving over other modes of electrophoresis. The MS-PCR assay clearly discriminated all genotypes. Real-time PCR assay was most suitable for a large-scale survey due to its high throughput and rapidity. The genotyping survey demonstrated that the carrier and mutant allele frequencies were 0.49% and 0.25%, respectively, suggesting that the mutant allele frequency in Border Collies is markedly low compared to that in the susceptible dog breeds such as rough and smooth Collies.

Clinical and programmatic considerations in the treatment of MDR-TB in children: a series of 16 patients from Lima, Peru.

Science.gov (United States)

Mukherjee, J S; Joseph, J K; Rich, M L; Shin, S S; Furin, J J; Seung, K J; Sloutsky, A; Socci, A R; Vanderwarker, C; Vasquez, L; Palacios, E; Guerra, D; Viru, F A; Farmer, P; Del Castillo, H E

2003-07-01

Since 2000, the directly observed treatment, short-course (DOTS) strategy has been expanded in several countries to include treatment of multidrug-resistant tuberculosis (MDR-TB). This strategy is known as DOTS-Plus. Tuberculosis is a common cause of morbidity and mortality for children throughout the developing world. Children may also be infected with MDR-TB, yet most developing countries do not specifically address pediatric MDR-TB. To present the intermediate outcomes of the first 16 children enrolled in the Peruvian DOTS-Plus program and to demonstrate the tolerability of second-line anti-tuberculosis drugs. Three children completed therapy and are cured, one child had bacteriologic and clinical failure after 12 months of therapy and died of respiratory insufficiency, and 12 have intermediate outcomes demonstrating favorable clinical, bacteriologic, and radiographic evidence of improvement after 9-19 months of therapy. Of the 16 pediatric DOTS-Plus patients, 15 have tolerated therapy well and have had favorable clinical evolution. However, the diagnosis of pediatric MDR-TB is often extremely delayed due to reliance on the adult case definition and should be changed to prevent progressive, chronic illness in such children. Programmatic changes could facilitate earlier diagnosis and treatment of pediatric MDR-TB in Peru and in other DOTS-Plus programs.

Bloodstream infections caused by multi-drug resistant Proteus mirabilis: Epidemiology, risk factors and impact of multi-drug resistance.

Science.gov (United States)

Korytny, Alexander; Riesenberg, Klaris; Saidel-Odes, Lisa; Schlaeffer, Fransisc; Borer, Abraham

2016-01-01

The prevalence of antimicrobial co-resistance among ESBL-producing Enterobactereaceae is extremely high in Israel. Multidrug-resistant Proteus mirabilis strains (MDR-PM), resistant to almost all antibiotic classes have been described. The aim was to determine the risk factors for bloodstream infections caused by MDR-PM and clinical outcomes. A retrospective case-control study. Adult patients with PM bacteremia during 7 years were identified retrospectively and their files reviewed for demographics, underlying diseases, Charlson Comorbidity Index, treatment and outcome. One hundred and eighty patients with PM-bloodstream infection (BSI) were included; 90 cases with MDR-PM and 90 controls with sensitive PM (S-PM). Compared to controls, cases more frequently were from nursing homes, had recurrent hospital admissions in the past year and received antibiotic therapy in the previous 3 months, were bedridden and suffered from peripheral vascular disease and peptic ulcer disease (p < 0.001). Two-thirds of the MDR-PM isolates were ESBL-producers vs 4.4% of S-PM isolates (p < 0.001, OR = 47.6, 95% CI = 15.9-142.6). In-hospital crude mortality rate of patients with MDR-PM BSI was 37.7% vs 23.3% in those with S-PM BSI (p = 0.0359, OR = 2, 95% CI = 1.4-3.81). PM bacteremia in elderly and functionally-dependent patients is likely to be caused by nearly pan-resistant PM strains in the institution; 51.8% of the patients received inappropriate empiric antibiotic treatment. The crude mortality rate of patients with MDR-PM BSI was significantly higher than that of patients with S-PM BSI.

Assessment of trends of ofloxacin resistance in Mycobacterium tuberculosis

Directory of Open Access Journals (Sweden)

J S Verma

2011-01-01

Full Text Available Purpose: Ofloxacin (OFX is one of the potent fluoroquinolone (FQ recommended to treat MDR-TB. Over a decade, the preexposure of this drug for the treatment of other bacterial infections has resulted in acquisition of FQ resistance among Mycobacterium tuberculosis strains. Considering this possibility, a study was undertaken in a tertiary care center in the capital city (India to assess the drug resistance trends of OFX among susceptible and multidrug resistant (MDR strains of M. tuberculosis. Materials and Methods: A total of 102 M. tuberculosis isolates (47 susceptible to first-line drugs and 55 MDR isolates were screened for susceptibility testing of OFX with a critical concentration of 2 μg/ml by Lowenstein Jensen (LJ proportion method. Results: The results showed 40 (85.1% isolates among 47 susceptible isolates and 34 (61.8% isolates among 55 MDR isolates, were found to be susceptible to OFX. Fisher′s exact test showed significant P-value (0.0136 demonstrating 1.377 fold (95% confidence interval increased risk to become resistant to OFX than susceptible isolates. These finding shows decreased OFX susceptibility is not only limited to MDR isolates but also increasingly seen in susceptible strains as a result of drug abuse. Conclusions: Our finding were not alarming, but highlights the general risk of acquiring resistance to OFX, jeopardizing the potential for these drugs to be used as second-line anti-TB agents in the management of drug-resistant TB and creating incurable TB strains .

Differential contributions of five ABC transporters to mutidrug resistance, antioxidion and virulence of Beauveria bassiana, an entomopathogenic fungus.

Directory of Open Access Journals (Sweden)

Ting-Ting Song

Full Text Available Multidrug resistance (MDR confers agrochemical compatibility to fungal cells-based mycoinsecticdes but mechanisms involved in MDR remain poorly understood for entomopathogenic fungi, which have been widely applied as biocontrol agents against arthropod pests. Here we characterized the functions of five ATP-binding cassette (ABC transporters, which were classified to the subfamilies ABC-B (Mdr1, ABC-C (Mrp1 and ABC-G (Pdr1, Pdr2 and Pdr5 and selected from 54 full-size ABC proteins of Beauveria bassiana based on their main domain architecture, membrane topology and transcriptional responses to three antifungal inducers. Disruption of each transporter gene resulted in significant reduction in resistance to four to six of eight fungicides or antifungal drugs tested due to their differences in structure and function. Compared with wild-type and complemented (control strains, disruption mutants of all the five transporter genes became significantly less tolerant to the oxidants menadione and H₂O₂ based on 22-41% and 10-31% reductions of their effective concentrations required for the suppression of 50% colony growth at 25°C. Under a standardized spray, the killing actions of ΔPdr5 and ΔMrp1 mutants against Spodoptera litura second-instar larvae were delayed by 59% and 33% respectively. However, no significant virulence change was observed in three other delta mutants. Taken together, the examined five ABC transporters contribute differentially to not only the fungal MDR but antioxidant capability, a phenotype rarely associated with ABC efflux pumps in previous reports; at least some of them are required for the full virulence of B. bassiana, thereby affecting the fungal biocontrol potential. Our results indicate that ABC pump-dependent MDR mechanisms exist in entomopathogenic fungi as do in yeasts and human and plant pathogenic fungi.

[The effect and mechanism of vinorelbine on cisplatin resistance of human lung cancer cell line A549/DDP].

Science.gov (United States)

Qi, Chunsheng; Gao, Sen; Li, Huiqiang; Gao, Weizhen

2014-02-01

Drug resistance is a major obstacle on lung cancer treatment and Vinorelbine is an effective drug to inhibition of tumor proliferation and metastasis. In this study, we investigated the effect and mechanism of Vinorelbine on reversing the cisplatin resistance of human lung cancer A549/DDP cell line. With 1 μmol/L and 5 μmol/L Vinorelbine treatment, MTS assay was employed to determine the effect of the cisplatin sensitivity of tumor cells, flow cytometry to determine the apoptosis rate and change of Rh-123 content; Western blot to determine the expression of MDR1, Bcl-2, surviving, PTEN, caspase-3/8 and phosphorylation level of Akt (p-Akt); Real-time PCR was to determine the mRNA expression of MDR1, Bcl-2, survivin and PTEN. Finally the transcriptional activities of NF-κB, Twist and Snail were determined by reporter gene system. With 1 μmol/L and 5 μmol/L Vinorelbine treatment, the sensitivity of cancer cells to cisplatin was increased by 1.91- and 2.54- folds respectively, flow cytometry showed that the content of Rh-123 was elevated 1.93- and 2.95- folds and apoptosis rate was increased 2.25- and 3.82- folds, Western blot showed that the expression of multidrug resistance related proteins MDR, Bcl-2 and survivin were downregulated, caspase-3/8 and PTEN was upregulated, phosphorylation of Akt was downregulated as well, real-time assay showed that the mRNA expression of MDR1 was downregulated 43.5% and 25.8%, Bcl-2 was downregulated 57.3% and 34.1%, survivin was downregulated 37.6% and 12.4%, PTEN was upregulated 183.4% and 154.2%, the transcriptional activities of NF-κB was downregulated 53.2% and 34.5%, Twist was downregulated 61.4% and 33.5%, and Snail was downregulated 57.8% and 18.7%. Vinorelbine treatment led to increase of cisplatin sensitivity of A549/DDP cells and the mechanisms included the regulation of PTEN/AKT/NF-κB signal pathway to decreased drug resistance gene expression and increased pro-apoptosis gene expression.

Polymorphisms in the HIV-1 gp41 env gene, natural resistance to enfuvirtide (T-20) and pol resistance among pregnant Brazilian women.

Science.gov (United States)

Reis, Mônica Nogueira da Guarda; de Alcântara, Keila Correa; Cardoso, Ludimila Paula Vaz; Stefani, Mariane Martins Araújo

2014-01-01

The selective pressure of antiretroviral drugs (ARVs) targeting HIV-1 pol can promote drug resistance mutations in other genomic regions, such as env. Drug resistance among women should be monitored to avoid horizontal and mother-to-child transmission. To describe natural resistance to T-20 (enfuvirtide), gp41 env polymorphisms, mutations in pol and HIV-1 subtypes, 124 pregnant women were recruited. For 98 patients, the gp41 env, protease (PR) and reverse transcriptase (RT) fragments were sequenced. The patients were ARV naïve (n = 30), taking mother-to-child transmission prophylaxis (n = 50), or being treated with highly active ARV therapy/HAART (n = 18). The Stanford and IAS/USA databases and other sources were used to analyze PR/RT, gp41 env resistance mutations. The HIV-1 genetic diversity was analyzed by REGA/phylogenetic analyses. The patients' median age was 25 years (range, 16-42), 18.4% had AIDS. The frequency of natural resistance to T-20 (N42D, L44M, and R46M-low-impact mutations) was 6.1% (6/98); 20.4% (20/98) had compensatory mutations in HR2. The prevalence of transmitted drug resistance in the pol was 13.3% (4/30), and the prevalence of secondary drug resistance was 33.3% (6/18). Two patients were infected with multidrug resistant/MDR viruses. The analysis of HIV-1 subtypes (PR/RT/gp41) revealed that 61.2% (60/98) were subtype B, 12.2% (12/98) were subtype C, 4.1% (4/98) were subtype F1, and 22.4% (22/98) were possible recombinants (BF1 = 20.4%; BC = 2%). Natural resistance to T-20 was not associated with pol resistance or previous ARV use. The high rate of secondary resistance, including MDR, indicates that the number of women that may need T-20 salvage therapy may be higher than anticipated. © 2013 Wiley Periodicals, Inc.

Inhibitory effect of the reversal agents V-104, GF120918 and Pluronic L61 on MDR1 Pgp-, MRP1- and MRP2-mediated transport

NARCIS (Netherlands)

Evers, R.; Kool, M.; Smith, A. J.; van Deemter, L.; de Haas, M.; Borst, P.

2000-01-01

The human multidrug transporter MDR1 P-glycoprotein and the multidrug resistance proteins MRP1 and MRP2 transport a range of cytotoxic drugs, resulting in multidrug resistance in tumour cells. To overcome this form of drug resistance in patients, several inhibitors (reversal agents) of these

Strategies to overcome or circumvent P-glycoprotein mediated multidrug resistance.

Science.gov (United States)

Yuan, Hongyu; Li, Xun; Wu, Jifeng; Li, Jinpei; Qu, Xianjun; Xu, Wenfang; Tang, Wei

2008-01-01

Cancer patients who receive chemotherapy often experience intrinsic or acquired resistance to a broad spectrum of chemotherapeutic agents. The phenomenon, termed multidrug resistance (MDR), is often associated with the over-expression of P-glycoprotein, a transmembrane protein pump, which can enhance efflux of a various chemicals structurally unrelated at the expense of ATP depletion, resulting in decrease of the intracellular cytotoxic drug accumulation. The MDR has been a big threaten to the human health and the war fight for it continues. Although several other mechanisms for MDR are elucidated in recent years, considerable efforts attempting to inverse MDR are involved in exploring P-glycoprotein modulators and suppressing P-glycoprotein expression. In this review, we will report on the recent advances in various strategies for overcoming or circumventing MDR mediated by P-glycoprotein.

Management of multidrug-resistant tuberculosis in human immunodeficiency virus patients

Science.gov (United States)

Jamil, K. F.

2018-03-01

Tuberculosis (TB) is a chronic infectious disease mainly caused by Mycobacterium tuberculosis(MTB). 10.4 million new TB cases will appear in 2015 worldwide. There were an estimated 1.4 million TB deaths in 2015, and an additional 0.4 million deaths resulting from TB disease among people living with human immunodeficiency virus (HIV). Multidrug- resistant and extensively drug-resistant tuberculosis (MDR and XDR-TB) are major public health concerns worldwide. 480.000 new cases of MDR-TB will appear in 2015 and an additional 100,000 people with rifampicin-resistant TB (RR-TB) who were also newly eligible for MDR-TB treatment. Their association with HIV infection has contributed to the slowing down of TB incidence decline over the last two decades, therefore representing one important barrier to reach TB elimination. Patients infected with MDR-TB require more expensive treatment regimens than drug-susceptible TB, with poor treatment.Patients with multidrug- resistant tuberculosis do not receive rifampin; drug interactions risk is markedly reduced. However, overlapping toxicities may limit options for co-treatment of HIV and multidrug- resistant tuberculosis.

Emergence of a Clonal Lineage of Multidrug-Resistant ESBL-Producing Salmonella Infantis Transmitted from Broilers and Broiler Meat to Humans in Italy between 2011 and 2014

DEFF Research Database (Denmark)

Franco, Alessia; Leekitcharoenphon, Pimlapas; Feltrin, Fabiola

2015-01-01

We report the spread of a clone of multidrug-resistant (MDR), ESBL-producing (blaCTX-M-1) Salmonella enterica subsp. enterica serovar Infantis, in the Italian broiler chicken industry and along the food-chain. This was first detected in Italy in 2011 and led to human infection in Italy in 2013....... This megaplasmid carried the ESBL gene blaCTX-M-1, and additional genes [tet(A), sul1, dfrA1 and dfrA14] mediating cefotaxime, tetracycline, sulfonamide, and trimethoprim resistance. It also contained genes conferring enhanced colonization capability, virulence (fimbriae, yersiniabactin), resistance and fitness...

Enzyme-mediated formulation of stable elliptical silver nanoparticles tested against clinical pathogens and MDR bacteria and development of antimicrobial surgical thread.

Science.gov (United States)

Thapa, Rupak; Bhagat, Chintan; Shrestha, Pragya; Awal, Suvash; Dudhagara, Pravin

2017-05-16

Silver nanoparticles (AgNPs) are believed to be emerging tool against various infectious diseases including multi-drug resistant (MDR) bacteria. In the present study, in vitro synthesis of AgNPs was optimized using 1:50 ratio of macerozyme (25 μg/μl) and 1 mM AgNO 3 incubated at 80 °C for 8 h. AgNPs were characterized by UV-Visible spectroscopy, dynamic light scattering (DLS), scanning electron microscopy, energy-dispersive X-ray spectroscopy, transmission electron microscopy (TEM) and X-ray diffraction (XRD). Characterization studies suggest the synthesis of elliptical, stable and crystalline AgNPs with an average size of 38.26 ± 0.4 nm calculated using TEM. The XRD pattern revealed the face-centered-cubic (fcc) form of metallic silver. Good shape integrity and dispersion of AgNPs after 1 year of incubation confirmed their stability. AgNPs were exibited the antimicrobial property against ten pathogenic bacteria, three molds and one yeast. The AgNPs also revealed remarkable antimicrobial activity against three MDR strains i.e. Extended spectrum beta-lactamase positive Escherichia coli, Staphylococcus aureus (MRSA) and Teicoplanin resistant Streptococcus Pneumoniae. The AgNPs coated surgical threads (suture) were revealed the remarkble antibacterial activity against three MDR strains. This is the first report to synthesize antimicrobial elliptical AgNPs using enzymes. The results suggest the possibilities to develop the nanoparticles coated antimicrobial medical fabric to combat against MDR infection.

Drug-resistant tuberculosis: time for visionary political leadership.

Science.gov (United States)

Abubakar, Ibrahim; Zignol, Matteo; Falzon, Dennis; Raviglione, Mario; Ditiu, Lucica; Masham, Susan; Adetifa, Ifedayo; Ford, Nathan; Cox, Helen; Lawn, Stephen D; Marais, Ben J; McHugh, Timothy D; Mwaba, Peter; Bates, Matthew; Lipman, Marc; Zijenah, Lynn; Logan, Simon; McNerney, Ruth; Zumla, Adam; Sarda, Krishna; Nahid, Payam; Hoelscher, Michael; Pletschette, Michel; Memish, Ziad A; Kim, Peter; Hafner, Richard; Cole, Stewart; Migliori, Giovanni Battista; Maeurer, Markus; Schito, Marco; Zumla, Alimuddin

2013-06-01

Two decades ago, WHO declared tuberculosis a global emergency, and invested in the highly cost-effective directly observed treatment short-course programme to control the epidemic. At that time, most strains of Mycobacterium tuberculosis were susceptible to first-line tuberculosis drugs, and drug resistance was not a major issue. However, in 2013, tuberculosis remains a major public health concern worldwide, with prevalence of multidrug-resistant (MDR) tuberculosis rising. WHO estimates roughly 630 000 cases of MDR tuberculosis worldwide, with great variation in the frequency of MDR tuberculosis between countries. In the past 8 years, extensively drug-resistant (XDR) tuberculosis has emerged, and has been reported in 84 countries, heralding the possibility of virtually untreatable tuberculosis. Increased population movement, the continuing HIV pandemic, and the rise in MDR tuberculosis pose formidable challenges to the global control of tuberculosis. We provide an overview of the global burden of drug-resistant disease; discuss the social, health service, management, and control issues that fuel and sustain the epidemic; and suggest specific recommendations for important next steps. Visionary political leadership is needed to curb the rise of MDR and XDR tuberculosis worldwide, through sustained funding and the implementation of global and regional action plans. Copyright © 2013 World Health Organization. Published by Elsevier Ltd/Inc/BV. All rights reserved. Published by Elsevier Ltd. All rights reserved.

Cancer multidrug resistance: mechanisms involved and strategies for circumvention using a drug delivery system.

Science.gov (United States)

Kibria, Golam; Hatakeyama, Hiroto; Harashima, Hideyoshi

2014-01-01

Multidrug resistance (MDR), the principal mechanism by which many cancers develop resistance to chemotherapy, is one of the major obstacles to the successful clinical treatment of various types of cancer. Several key regulators are responsible for mediating MDR, a process that renders chemotherapeutic drugs ineffective in the internal organelles of target cells. A nanoparticulate drug delivery system (DDS) is a potentially promising tool for circumventing such MDR, which can be achieved by targeting tumor cells themselves or tumor endothelial cells that support the survival of MDR cancer cells. The present article discusses key factors that are responsible for MDR in cancer cells, with a specific focus on the application of DDS to overcome MDR via the use of chemotherapy or macromolecules.

Multidrug resistance among new tuberculosis cases: detecting local variation through lot quality-assurance sampling.

Science.gov (United States)

Hedt, Bethany Lynn; van Leth, Frank; Zignol, Matteo; Cobelens, Frank; van Gemert, Wayne; Nhung, Nguyen Viet; Lyepshina, Svitlana; Egwaga, Saidi; Cohen, Ted

2012-03-01

Current methodology for multidrug-resistant tuberculosis (MDR TB) surveys endorsed by the World Health Organization provides estimates of MDR TB prevalence among new cases at the national level. On the aggregate, local variation in the burden of MDR TB may be masked. This paper investigates the utility of applying lot quality-assurance sampling to identify geographic heterogeneity in the proportion of new cases with multidrug resistance. We simulated the performance of lot quality-assurance sampling by applying these classification-based approaches to data collected in the most recent TB drug-resistance surveys in Ukraine, Vietnam, and Tanzania. We explored 3 classification systems- two-way static, three-way static, and three-way truncated sequential sampling-at 2 sets of thresholds: low MDR TB = 2%, high MDR TB = 10%, and low MDR TB = 5%, high MDR TB = 20%. The lot quality-assurance sampling systems identified local variability in the prevalence of multidrug resistance in both high-resistance (Ukraine) and low-resistance settings (Vietnam). In Tanzania, prevalence was uniformly low, and the lot quality-assurance sampling approach did not reveal variability. The three-way classification systems provide additional information, but sample sizes may not be obtainable in some settings. New rapid drug-sensitivity testing methods may allow truncated sequential sampling designs and early stopping within static designs, producing even greater efficiency gains. Lot quality-assurance sampling study designs may offer an efficient approach for collecting critical information on local variability in the burden of multidrug-resistant TB. Before this methodology is adopted, programs must determine appropriate classification thresholds, the most useful classification system, and appropriate weighting if unbiased national estimates are also desired.

National Survey of Practices to Prevent Methicillin-Resistant Staphylococcus aureus and Multidrug-Resistant Acinetobacter baumannii in Thailand.

Science.gov (United States)

Apisarnthanarak, Anucha; Ratz, David; Khawcharoenporn, Thana; Patel, Payal K; Weber, David J; Saint, Sanjay; Greene, M Todd

2017-05-15

We evaluated the extent to which hospital characteristics, infection control practices, and compliance with prevention bundles impacted multidrug-resistant organism (MDRO) infections in Thai hospitals. From 1 January 2014 to 30 November 2014, we surveyed all Thai hospitals with an intensive care unit and ≥250 beds. Infection control practices for methicillin-resistant Staphylococcus aureus (MRSA) and multidrug-resistant Acinetobacter baumannii (MDR-AB) were assessed. Linear regression was used to examine associations between hospital characteristics and prevention bundle compliance and changes in MDRO infection rates. A total of 212 of 245 (86.5%) eligible hospitals responded. Most hospitals regularly used several fundamental infection control practices for MRSA and MDR-AB (ie, contact precautions, private room/cohorting, hand hygiene, environmental cleaning, and antibiotic stewardship); advanced infection control practices (ie, active surveillance, chlorhexidine bathing, decolonization for MRSA, and hydrogen peroxide vaporizer for MDR-AB) were used less commonly. Facilities with ≥75% compliance with the MRSA prevention bundle experienced a 17.4% reduction in MRSA rates (P = .03). Although the presence of environmental cleaning services (41.3% reduction, P = .01) and a microbiology laboratory (82.8% reduction, P = .02) were among characteristics associated with decreases in MDR-AB rates, greater compliance with the MDR-AB prevention bundle did not lead to reductions in MDR-AB rates. Although fundamental MRSA and MDR-AB control practices are used regularly in most Thai hospitals, compliance with more comprehensive bundled prevention approaches is suboptimal. Improving compliance with bundled infection prevention approaches and promoting the integration of certain hospital factors into infection control efforts may help reduce MDRO infections in Thai hospitals. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America

Comparison between Radioisotopic and Non-radioisotopic Polymerase Chain Reaction-Single Strand Conformation Polymorphism (PCR-SSCP) Procedures in the Detection of Mutations at the rpoB Gene Associated with Rifampicin Resistance in Mycobacterium tuberculosis

International Nuclear Information System (INIS)

Lee, H.; Bang, H.E.; Johnson, R.; Jordaan, A.M.; Victor, T.C. . E-mail : tv@sun.ac.za; Dar, L.; Khan, B.K.; Cho, S.N. . E-mail : raycho@yonsei.ac.kr

2006-01-01

Rapid and sensitive detection of mutations at the rpoB gene of Mycobacterium tuberculosis would be of great importance for proper management of tuberculosis (TB) patients and control of multi-drug resistant TB. Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) using both radioisotopic and non-radioisotopic methods have been widely used for detecting such mutations. However, the silver staining method, which is the most frequently employed in PCR-SSCP, has been reported to be producing results of varying sensitivity. Radioisotope-based methods have shown greater sensitivity in detecting the rpoB mutations than the silver staining method. The primary objective of this study was therefore to compare the radioisotopic method with the silver staining method detection of mutations of rpoB gene by PCR-SSCP in the same laboratory. Purified DNAs from M. tuberculosis H37Rv were serially diluted and used for PCR amplification with and without radionuclides. The PCR products were then detected by silver staining and autoradiography methods. In addition, clinical isolates were analyzed by PCR-SSCP. The radioisotopic method showed about four-fold increase in the detection of PCR products over ethidium bromide staining in agarose gel. When compared with silver staining, the radioisotopic method gave a sensitivity of more than 10-fold in detecting PCR products and about 8-fold in PCR-SSCP. Radioisotope-based detection methods provided a clearer resolution in PCR-SSCP than the silver staining method when applied to clinical isolates of M. tuberculosis. Radioisotope-based detection method was shown to be more sensitive than non-isotope-based method in detecting PCR products and mutations at the rpoB gene of M. tuberculosis by PCR-SSCP. It may be noted that mutations in the rpoB gene as a marker have significant clinical importance because of the increasing number of MDR-TB cases in the world. It is especially relevant to MDR and Extreme Drug Resistance TB

Frequency of the MDR1 mutant allele associated with multidrug sensitivity in dogs from Brazil

Directory of Open Access Journals (Sweden)

Monobe MM

2015-04-01

Full Text Available Marina M Monobe,1 João P Araujo Junior,2 Kari V Lunsford,3 Rodrigo C Silva,4 Camilo Bulla41Department of Veterinary Clinics, School of Veterinary Medicine and Animal Science, 2Department of Microbiology and Immunology, Biosciences Institute, Sao Paulo State University (UNESP, Botucatu, Brazil; 3Department of Clinical Sciences and Animal Health Center, 4Department of Pathobiology and Population Medicine, College of Veterinary Medicine, Mississippi State University, Mississippi, MS, USAAbstract: To date, a 4-bp deletion in the MDR1 gene has been detected in more than ten dog breeds, as well as in mixed breed dogs, in several countries, however information regarding this mutation in dogs from Brazil is lacking. For this reason, 103 Collies, 77 Border Collies, 76 Shetland Sheepdogs, 20 Old English Sheepdogs, 55 German Shepherds, 16 Australian Shepherds, and 53 Whippets from Brazil were screened for the presence of the mutation. The heterozygous mutated genotype, MDR1 (+/−, frequency found for Collies, Australian Shepherd, and Shetland Sheepdog was 50.5% (95% CI =41.1%–59.9%, 31.3% (95% CI =8.6%–53.2%, and 15.8% (95% CI =7.7%–23.9%, respectively. Homozygous mutated genotype, MDR1 (−/−, was detected only in Collies 35.9%. The MDR1 allele mutant frequency found for Collies, Australian Shepherd, and Shetland Sheepdog was 61.2% (95% CI =54.8%–67.5%, 15.6% (95% CI =3.1%–28.2%, and 7.9% (95% CI =3.7%–12.1%, respectively. Additionally, even free of the mutant allele, the maximum mutant prevalence (MMP in that population, with 95% CI, was 3.8%, 5.2%, 5.4%, and 13.8% for Border Collies, German Shepherds, Whippets, and Old English Sheepdogs, respectively. In this way, this information is important, not only for MDR1 genotype-based breeding programs and international exchange of breeding animals of predisposed breeds, but also for modification of drug therapy for breeds at risk.Keywords: P-glycoprotein, MDR1 mutation, ivermectin, dog, drug

ASSESSMENT OF EFFECT OF MDR - TB/TB ON SOCIAL, FUNCTIONAL AND ECONOMIC WELL BEING OF PATIENTS – A CROSS SECTIONAL STUDY

Directory of Open Access Journals (Sweden)

Shiv Kumar

2015-06-01

Full Text Available CONTEXT : Tuberculosis is a contagious disease with social stigma attached to it. Various problems which are social and economic in nature are faced by TB patient. Therefore , it is essential to explore the overall effect of MDR - TB/TB on health and patients perception of Well - being. AIMS : To Document the effect of MDR - TB/TB on social , functional and economic well - being of patients. SETTINGS AND DESIGN : A Cross - sectional study , Conveniently Recruited 68 MDR - TB Patients and 136 non - MDR - TB Patients (from Rural as well as urban Area of Surat District diagnosed by CBNAAT were interviewed for investigating the effect of Tuberculosis. METHODS AND MATERIAL : A pre - tested standardized semi - structured questionnaire was used. Data was collected about socio - demographic profile of patients and interpreted in table. Data about effect of MDR - TB/TB was collected on Likert Scale and Frequency was calculated and Data wa s plotted on multiple bar charts. RESULTS : As compared to healthy status in the past , 93% MDR - TB and 82% TB patients have decreased ability to do work , about half of MDR - TB Patients and TB Patients have detiorated relations with family members , 67% of stud y participants have developed disharmonious relations with neighbor’s , 55% of Study participants have decreased income , 88% of study participants have decreased performance in day to day activities and 78% of study participants have faced discordial and di srespectful behavior from co - workers. CONCLUSION : Working ability more detiorated in MDR - TB patients while rest of the effect on social , functional and economic well - being is same in both TB and Multi Drug Resistant TB patients. This study emphasizes very clearly that social stigma still persist in community about Tuberculosis which needs to be eliminated in community by behavior change communication by health workers at all levels of health care.

Network Graph Analysis of Gene-Gene Interactions in Genome-Wide Association Study Data

Directory of Open Access Journals (Sweden)

Sungyoung Lee

2012-12-01

Full Text Available Most common complex traits, such as obesity, hypertension, diabetes, and cancers, are known to be associated with multiple genes, environmental factors, and their epistasis. Recently, the development of advanced genotyping technologies has allowed us to perform genome-wide association studies (GWASs. For detecting the effects of multiple genes on complex traits, many approaches have been proposed for GWASs. Multifactor dimensionality reduction (MDR is one of the powerful and efficient methods for detecting high-order gene-gene (GxG interactions. However, the biological interpretation of GxG interactions identified by MDR analysis is not easy. In order to aid the interpretation of MDR results, we propose a network graph analysis to elucidate the meaning of identified GxG interactions. The proposed network graph analysis consists of three steps. The first step is for performing GxG interaction analysis using MDR analysis. The second step is to draw the network graph using the MDR result. The third step is to provide biological evidence of the identified GxG interaction using external biological databases. The proposed method was applied to Korean Association Resource (KARE data, containing 8838 individuals with 327,632 single-nucleotide polymorphisms, in order to perform GxG interaction analysis of body mass index (BMI. Our network graph analysis successfully showed that many identified GxG interactions have known biological evidence related to BMI. We expect that our network graph analysis will be helpful to interpret the biological meaning of GxG interactions.

Network graph analysis of gene-gene interactions in genome-wide association study data.

Science.gov (United States)

Lee, Sungyoung; Kwon, Min-Seok; Park, Taesung

2012-12-01

Most common complex traits, such as obesity, hypertension, diabetes, and cancers, are known to be associated with multiple genes, environmental factors, and their epistasis. Recently, the development of advanced genotyping technologies has allowed us to perform genome-wide association studies (GWASs). For detecting the effects of multiple genes on complex traits, many approaches have been proposed for GWASs. Multifactor dimensionality reduction (MDR) is one of the powerful and efficient methods for detecting high-order gene-gene (GxG) interactions. However, the biological interpretation of GxG interactions identified by MDR analysis is not easy. In order to aid the interpretation of MDR results, we propose a network graph analysis to elucidate the meaning of identified GxG interactions. The proposed network graph analysis consists of three steps. The first step is for performing GxG interaction analysis using MDR analysis. The second step is to draw the network graph using the MDR result. The third step is to provide biological evidence of the identified GxG interaction using external biological databases. The proposed method was applied to Korean Association Resource (KARE) data, containing 8838 individuals with 327,632 single-nucleotide polymorphisms, in order to perform GxG interaction analysis of body mass index (BMI). Our network graph analysis successfully showed that many identified GxG interactions have known biological evidence related to BMI. We expect that our network graph analysis will be helpful to interpret the biological meaning of GxG interactions.

Resistance gene candidates identified by PCR with degenerate oligonucleotide primers map to clusters of resistance genes in lettuce.

Science.gov (United States)

Shen, K A; Meyers, B C; Islam-Faridi, M N; Chin, D B; Stelly, D M; Michelmore, R W

1998-08-01

The recent cloning of genes for resistance against diverse pathogens from a variety of plants has revealed that many share conserved sequence motifs. This provides the possibility of isolating numerous additional resistance genes by polymerase chain reaction (PCR) with degenerate oligonucleotide primers. We amplified resistance gene candidates (RGCs) from lettuce with multiple combinations of primers with low degeneracy designed from motifs in the nucleotide binding sites (NBSs) of RPS2 of Arabidopsis thaliana and N of tobacco. Genomic DNA, cDNA, and bacterial artificial chromosome (BAC) clones were successfully used as templates. Four families of sequences were identified that had the same similarity to each other as to resistance genes from other species. The relationship of the amplified products to resistance genes was evaluated by several sequence and genetic criteria. The amplified products contained open reading frames with additional sequences characteristic of NBSs. Hybridization of RGCs to genomic DNA and to BAC clones revealed large numbers of related sequences. Genetic analysis demonstrated the existence of clustered multigene families for each of the four RGC sequences. This parallels classical genetic data on clustering of disease resistance genes. Two of the four families mapped to known clusters of resistance genes; these two families were therefore studied in greater detail. Additional evidence that these RGCs could be resistance genes was gained by the identification of leucine-rich repeat (LRR) regions in sequences adjoining the NBS similar to those in RPM1 and RPS2 of A. thaliana. Fluorescent in situ hybridization confirmed the clustered genomic distribution of these sequences. The use of PCR with degenerate oligonucleotide primers is therefore an efficient method to identify numerous RGCs in plants.

Inhibition of bacterial multidrug resistance by celecoxib, a cyclooxygenase-2 inhibitor.

Science.gov (United States)

Kalle, Arunasree M; Rizvi, Arshad

2011-01-01

Multidrug resistance (MDR) is a major problem in the treatment of infectious diseases and cancer. Accumulating evidence suggests that the cyclooxygenase-2 (COX-2)-specific inhibitor celecoxib would not only inhibit COX-2 but also help in the reversal of drug resistance in cancers by inhibiting the MDR1 efflux pump. Here, we demonstrate that celecoxib increases the sensitivity of bacteria to the antibiotics ampicillin, kanamycin, chloramphenicol, and ciprofloxacin by accumulating the drugs inside the cell, thus reversing MDR in bacteria.

Specificity of drug transport mediated by CaMDR1: a major facilitator ...

Indian Academy of Sciences (India)

Unknown

CaMDR1 encodes a major facilitator superfamily (MFS) protein in Candida albicans whose expression has been linked to .... by plaque assay and the integration of CaMDR1 at the ... with recombinant virus, vAcCaMDR1 and cells infected.

A population-based study of first and second-line drug-resistant tuberculosis in a high-burden area of the Mexico/United States border

Directory of Open Access Journals (Sweden)

Pola Becerril-Montes

2013-04-01

Full Text Available The resistance of 139 Mycobacterium tuberculosis (MTB isolates from the city of Monterrey, Northeast Mexico, to first and second-line anti-TB drugs was analysed. A total of 73 isolates were susceptible and 66 were resistant to anti-TB drugs. Monoresistance to streptomycin, isoniazid (INH and ethambutol was observed in 29 cases. Resistance to INH was found in 52 cases and in 29 cases INH resistance was combined with resistance to two or three drugs. A total of 24 isolates were multidrug-resistant (MDR resistant to at least INH and rifampicin and 11 MDR cases were resistant to five drugs. The proportion of MDR-TB among new TB cases in our target population was 0.72% (1/139 cases. The proportion of MDR-TB among previously treated cases was 25.18% (35/139 cases. The 13 polyresistant and 24 MDR isolates were assayed against the following seven second-line drugs: amikacin (AMK, kanamycin (KAN, capreomycin (CAP, clofazimine (CLF, ethionamide (ETH, ofloxacin (OFL and cycloserine (CLS. Resistance to CLF, OFL or CLS was not observed. Resistance was detected to ETH (10.80% and to AMK (2.70%, KAN (2.70% and CAP (2.70%. One isolate of MDR with primary resistance was also resistant to three second-line drugs. Monterrey has a high prevalence of MDR-TB among previously treated cases and extensively drug-resistant-MTB strains may soon appear.

Use of generalized ordered logistic regression for the analysis of multidrug resistance data.

Science.gov (United States)

Agga, Getahun E; Scott, H Morgan

2015-10-01

Statistical analysis of antimicrobial resistance data largely focuses on individual antimicrobial's binary outcome (susceptible or resistant). However, bacteria are becoming increasingly multidrug resistant (MDR). Statistical analysis of MDR data is mostly descriptive often with tabular or graphical presentations. Here we report the applicability of generalized ordinal logistic regression model for the analysis of MDR data. A total of 1,152 Escherichia coli, isolated from the feces of weaned pigs experimentally supplemented with chlortetracycline (CTC) and copper, were tested for susceptibilities against 15 antimicrobials and were binary classified into resistant or susceptible. The 15 antimicrobial agents tested were grouped into eight different antimicrobial classes. We defined MDR as the number of antimicrobial classes to which E. coli isolates were resistant ranging from 0 to 8. Proportionality of the odds assumption of the ordinal logistic regression model was violated only for the effect of treatment period (pre-treatment, during-treatment and post-treatment); but not for the effect of CTC or copper supplementation. Subsequently, a partially constrained generalized ordinal logistic model was built that allows for the effect of treatment period to vary while constraining the effects of treatment (CTC and copper supplementation) to be constant across the levels of MDR classes. Copper (Proportional Odds Ratio [Prop OR]=1.03; 95% CI=0.73-1.47) and CTC (Prop OR=1.1; 95% CI=0.78-1.56) supplementation were not significantly associated with the level of MDR adjusted for the effect of treatment period. MDR generally declined over the trial period. In conclusion, generalized ordered logistic regression can be used for the analysis of ordinal data such as MDR data when the proportionality assumptions for ordered logistic regression are violated. Published by Elsevier B.V.

Occurrence of integrons and resistance genes among sulphonamide-resistant Shigella spp. from Brazil

DEFF Research Database (Denmark)

Peirano, G.; Agersø, Yvonne; Aarestrup, Frank Møller

2005-01-01

Objectives: To determine the occurrence of class 1 and 2 integrons and antimicrobial resistance genes among sulphonamide-resistant Shigella strains isolated in Brazil during 1999-2003. Methods: Sixty-two Shigella (Shigella flexneri, n = 47 and Shigella sonnei, n = 15) were tested against 21...... antimicrobial agents. The presence of integrons classes 1 and 2 and antimicrobial resistance genes was investigated by PCR using specific primers. Results: A total of eight antimicrobial resistance profiles were identified, with the profile of resistance to sulfamethoxazole, trimethoprim, spectinomycin...... of 2214 bp harbouring a gene cassette array conferring resistance to trimethoprim, streptothricin and spectinomycin/streptomycin. The genes coding for resistance to chloramphenicol (catA1), tetracycline [tet(A) and tet(B)] and ampicillin (bla(OXA) and bla(TEM)), were detected in resistant strains...

Synergistic antimicrobial therapy using nanoparticles and antibiotics for the treatment of multidrug-resistant bacterial infection

Science.gov (United States)

Gupta, Akash; Saleh, Neveen M.; Das, Riddha; Landis, Ryan F.; Bigdeli, Arafeh; Motamedchaboki, Khatereh; Rosa Campos, Alexandre; Pomeroy, Kenneth; Mahmoudi, Morteza; Rotello, Vincent M.

2017-06-01

Infections caused by multidrug-resistant (MDR) bacteria pose a serious global burden of mortality, causing thousands of deaths each year. Antibiotic treatment of resistant infections further contributes to the rapidly increasing number of antibiotic-resistant species and strains. Synthetic macromolecules such as nanoparticles (NPs) exhibit broad-spectrum activity against MDR species, however lack of specificity towards bacteria relative to their mammalian hosts limits their widespread therapeutic application. Here, we demonstrate synergistic antimicrobial therapy using hydrophobically functionalized NPs and fluoroquinolone antibiotics for treatment of MDR bacterial strains. An 8-16-fold decrease in antibiotic dosage is achieved in presence of engineered NPs to combat MDR strains. This strategy demonstrates the potential of using NPs to ‘revive’ antibiotics that have been rendered ineffective due to the development of resistance by pathogenic bacteria.

Organization of a resistance gene cluster linked to rhizomania resistance in sugar beet

Science.gov (United States)

Genetic resistance to rhizomania has been in use for over 40 years. Characterization of the molecular basis for susceptibility and resistance has proved challenging. Nucleotide-binding leucine-rich-repeat-containing (NB-LRR) genes have been implicated in numerous gene-for-gene resistance interaction...

Multi-drug-resistant tuberculosis in HIV positive patients in Eastern Europe

DEFF Research Database (Denmark)

Post, Frank A; Grint, Daniel; Efsen, Anne Marie Werlinrud

2014-01-01

Observational data from Eastern Europe on the management and outcome of multi-drug-resistant tuberculosis (MDR TB) in HIV positive populations remain sparse in the English-language literature.We compared clinical characteristics and outcomes of 55 patients who were diagnosed with HIV and MDR TB...... in Eastern Europe between 2004 and 2006 to 89 patients whose Mycobacterium tuberculosis isolates were susceptible to isoniazid and rifampicin.Patients with HIV and MDR TB were young and predominantly male with high rates of intravenous drug use, imprisonment and hepatitis C co-infection. Eighty-four per cent...... of patients with MDR TB had no history of previous TB drug exposure suggesting that the majority of MDR TB resulted from transmission of drug-resistant M. tuberculosis. The use of non-standardized tuberculosis treatment was common, and the use of antiretroviral therapy infrequent. Compared to those...

Impact of drug resistance on the tuberculosis treatment outcome

Directory of Open Access Journals (Sweden)

E. Lesnic

2017-03-01

Full Text Available Background. The standard treatment of a new case of multidrug-resistant tuberculosis (MDR-TB according to WHO recommendations in the Republic of Moldova is performed since 2005 showing a low treatment succes. Actually the treatment success rate increased due to excluding of MDR-TB patients from the general cohort. The major rate of patients with low outcome is represented by the failed and lost to follow-up cases. The purpose of the study was to assess the impact of multidrug-resiatnce and MDR-TB on the tuberculosis treatment outcome. Materials and methods. A retrospective selective, descriptive study targeting social, demographic, economic and epidemiological peculiarities, case-management, diagnostic radiological aspects and microbiological characteristics of 187 patients with pulmonary tuberculosis registered during 2013–2015 distributed in two groups: 1st group (61 patients with established multidrug-resistant strains using conventional cultural methods and the 2nd group (126 patients with MDR-TB. Results. Multidrug-resistance was established more frequently in new cases and MDR-TB in two thirds of retreated patients. No difference was identified in gender and age distribution, social, economical, educational characteristics; case-management assessment identified a similar proportion of patients revealed by general practitioners and specialists, with low rate of screened high risk groups. All patients from the multidrug-resistant group began the standard treatment for drug-responsiveness tuberculosis before drug susceptibility testing and one third of MDR-TB group was treated from the onset with the DOTS-Plus regimen. Highest success rate was identified in the new-case subgroups of both groups and higher rate of died patients was determined in the retreated subgroups. Such a low rate of patients aggrevates the resistance. Conclusions. Early diagnosis, drug responsiveness testing and raising awareness among about treatment compliance will

Superbugs in the supermarket? Assessing the rate of contamination with third-generation cephalosporin-resistant gram-negative bacteria in fresh Australian pork and chicken.

Science.gov (United States)

McLellan, Jade E; Pitcher, Joshua I; Ballard, Susan A; Grabsch, Elizabeth A; Bell, Jan M; Barton, Mary; Grayson, M Lindsay

2018-01-01

Antibiotic misuse in food-producing animals is potentially associated with human acquisition of multidrug-resistant (MDR; resistance to ≥ 3 drug classes) bacteria via the food chain. We aimed to determine if MDR Gram-negative (GNB) organisms are present in fresh Australian chicken and pork products. We sampled raw, chicken drumsticks (CD) and pork ribs (PR) from 30 local supermarkets/butchers across Melbourne on two occasions. Specimens were sub-cultured onto selective media for third-generation cephalosporin-resistant (3GCR) GNBs, with species identification and antibiotic susceptibility determined for all unique colonies. Isolates were assessed by PCR for SHV, TEM, CTX-M, AmpC and carbapenemase genes (encoding IMP, VIM, KPC, OXA-48, NDM). From 120 specimens (60 CD, 60 PR), 112 (93%) grew a 3GCR-GNB ( n  = 164 isolates; 86 CD, 78 PR); common species were Acinetobacter baumannii (37%), Pseudomonas aeruginosa (13%) and Serratia fonticola (12%), but only one E. coli isolate. Fifty-nine (36%) had evidence of 3GCR alone, 93/163 (57%) displayed 3GCR plus resistance to one additional antibiotic class, and 9/163 (6%) were 3GCR plus resistance to two additional classes. Of 158 DNA specimens, all were negative for ESBL/carbapenemase genes, except 23 (15%) which were positive for AmpC, with 22/23 considered to be inherently chromosomal, but the sole E. coli isolate contained a plasmid-mediated CMY-2 AmpC. We found low rates of MDR-GNBs in Australian chicken and pork meat, but potential 3GCR-GNBs are common (93% specimens). Testing programs that only assess for E. coli are likely to severely underestimate the diversity of 3GCR organisms in fresh meat.

Differences in virulence genes and genome patterns of mastitis-associated Staphylococcus aureus among goat, cow, and human isolates in Taiwan.

Science.gov (United States)

Chu, Chishih; Wei, Yajiun; Chuang, Shih-Te; Yu, Changyou; Changchien, Chih-Hsuan; Su, Yaochi

2013-03-01

A total of 117 mastitis-associated Staphylococcus aureus isolates from cow, goat, and human patients were analyzed for differences in antibiotic susceptibility, virulence genes, and genotypes using accessory gene regulator (agr) typing, pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST). Multidrug-resistant (MDR) S. aureus were commonly found in all sources, though they were predominantly found in human and goat isolates. Almost 70% of the isolates were resistant to ampicillin and penicillin. Host-associated virulence genes were identified as follows: tst, a gene encoding toxic shock syndrome toxin, was found in goat isolates; lukED and lukM, genes encoding leukocidin, found in cow isolates; lukPV, a gene encoding leukocidin, found in human isolates; and eta, a gene encoding for exfoliative toxin, found in both human and cow isolates. All four types of hemolysin, α, β, γ, and δ, were identified in human isolates, three types (α, γ, and δ), were identified in cow isolates, and two types (α and δ) were identified in goat isolates. Agr-typing determined agr1 to be the main subtype in human and cow isolates. PFGE and MLST analysis revealed the presence of diverse genotypes among the three sources. In conclusion, mastitis-associated, genetically diverse strains of MDR S. aureus differed in virulence genes among human, cow, and goat isolates.

Characterization of quinolone-resistant Enterobacteriaceae strains isolated from poultry in Western Algeria: First report of qnrS in an Enterobacter cloacae

Directory of Open Access Journals (Sweden)

Qada Benameur

2018-04-01

Full Text Available Aim: Multidrug-resistant (MDR Enterobacteriaceae have frequently been reported, in both human and veterinary medicine, from different parts of the world as a consequence of antibiotic usage. However, there is a lack of published data regarding antimicrobial resistance in non-Escherichia coli (E. coli Enterobacteriaceae from animals in Algeria. This study aimed to evaluate the frequency of resistance to antibiotics with a focus on quinolones and to investigate the presence of qnr genes in Enterobacteriaceae of poultry origin. Materials and Methods: A total of 310 samples of poultry origin were collected from 2010 to 2014 from broiler and layer farms and hatcheries located in different geographic areas of Western Algeria (including Mostaganem, Oran, Mascara, Relizane, Chlef, Tiaret, and Tissemsilt. Antimicrobial susceptibility testing was performed using disc diffusion assay. Polymerase chain reaction and sequencing accomplished the characterization of qnr genes (qnrA, qnrB, and qnrS. Results: A total of 253 Enterobacteriaceae strains were isolated in this study. These isolates exhibited high levels of resistance to quinolones and other families of antibiotics. All the strains isolated in this study were resistant to at least one antibiotic. Among them, 233 (92.09% were considered MDR. Among the 18 randomly selected nalidixic acid (NA- resistant Enterobacteriaceae isolates, one E. coli and one Enterobacter cloacae were carrying qnrS1. By contrast, qnrA and qnrB were not detected in this study. Conclusion: This is the first report on the identification of the qnrS gene in E. cloacae isolated from animal source in Algeria. Further studies have to be conducted to determine the real prevalence of qnr genes.

Investigational drugs for the treatment of infections caused by multidrug-resistant Gram-negative bacteria.

Science.gov (United States)

Avery, Lindsay M; Nicolau, David P

2018-04-01

Infections caused by multidrug-resistant Gram-negative bacteria (MDR-GNB) are associated with significant mortality and costs. New drugs in development to combat these difficult-to-treat infections primarily target carbapenem-resistant Enterobacteriaceae, MDR Pseudomonas aeruginosa, and MDR Acinetobacter baumannii. Areas covered: The authors summarize in vitro and in vivo efficacy studies, as well as available clinical trial findings, for new agents in development for treatment of infection caused by MDR-GNB. Information regarding dosage regimens utilized in clinical trials and key pharmacokinetic and pharmacodynamic considerations are provided if available. A summary of recently approved agents, delafloxacin and meropenem/vaborbactam, is also included. Expert opinion: The development of multiple novel agents to fight MDR-GNB is promising to help save the lives of patients who acquire infection, and judicious use of these agents is imperative once they come to market to prevent the development of resistance. The other component paramount to this field of research is implementation of effective infection control policies and carbapenem-resistant Enterobacteriaceae (CRE) carrier screening protocols to mitigate the worldwide spread of MDR-GNB. Further investigation of anti-infective synergistic combinations will also be important, as well as support for economic research to reveal the true cost-benefit of utilization of the new agents discussed herein.

Adverse Events among HIV/MDR-TB Co-Infected Patients Receiving Antiretroviral and Second Line Anti-TB Treatment in Mumbai, India

Science.gov (United States)

Isaakidis, Petros; Varghese, Bhanumati; Mansoor, Homa; Cox, Helen S.; Ladomirska, Joanna; Saranchuk, Peter; Da Silva, Esdras; Khan, Samsuddin; Paryani, Roma; Udwadia, Zarir; Migliori, Giovanni Battista; Sotgiu, Giovanni; Reid, Tony

2012-01-01

Background Significant adverse events (AE) have been reported in patients receiving medications for multidrug- and extensively-drug-resistant tuberculosis (MDR-TB & XDR-TB). However, there is little prospective data on AE in MDR- or XDR-TB/HIV co-infected patients on antituberculosis and antiretroviral therapy (ART) in programmatic settings. Methods Médecins Sans Frontières (MSF) is supporting a community-based treatment program for drug-resistant tuberculosis in HIV-infected patients in a slum setting in Mumbai, India since 2007. Patients are being treated for both diseases and the management of AE is done on an outpatient basis whenever possible. Prospective data were analysed to determine the occurrence and nature of AE. Results Between May 2007 and September 2011, 67 HIV/MDR-TB co-infected patients were being treated with anti-TB treatment and ART; 43.3% were female, median age was 35.5 years (Interquartile Range: 30.5–42) and the median duration of anti-TB treatment was 10 months (range 0.5–30). Overall, AE were common in this cohort: 71%, 63% and 40% of patients experienced one or more mild, moderate or severe AE, respectively. However, they were rarely life-threatening or debilitating. AE occurring most frequently included gastrointestinal symptoms (45% of patients), peripheral neuropathy (38%), hypothyroidism (32%), psychiatric symptoms (29%) and hypokalaemia (23%). Eleven patients were hospitalized for AE and one or more suspect drugs had to be permanently discontinued in 27 (40%). No AE led to indefinite suspension of an entire MDR-TB or ART regimen. Conclusions AE occurred frequently in this Mumbai HIV/MDR-TB cohort but not more frequently than in non-HIV patients on similar anti-TB treatment. Most AE can be successfully managed on an outpatient basis through a community-based treatment program, even in a resource-limited setting. Concerns about severe AE in the management of co-infected patients are justified, however, they should not cause delays

Laboratory-Based Surveillance of Extensively Drug-Resistant Tuberculosis in Eastern China.

Science.gov (United States)

Huang, Yu; Wu, Qingqing; Xu, Shuiyang; Zhong, Jieming; Chen, Songhua; Xu, Jinghang; Zhu, Liping; He, Haibo; Wang, Xiaomeng

2017-03-01

With 25% of the global burden, China has the highest incidence of drug-resistant tuberculosis (TB) in the world. However, surveillance data on extensively drug-resistant TB (XDR-TB) from China are scant. To estimate the prevalence of XDR-TB in Zhejiang, Eastern China, 30 of 90 TB treatment centers in Zhejiang were recruited. Patients with suspected TB who reported to the clinics for diagnosis were requested to undergo a smear sputum test. Positive sputum samples were tested for drug susceptibility. Data on anti-TB drug resistance from 1999 to 2008 were also collected to assess drug resistance trends. A total of 931 cases were recruited for drug susceptibility testing (DST). Among these, 23.6% (95% confidence interval [CI], 18.8-24.4) were resistant to any of the following drugs: isoniazid, rifampin, streptomycin, and ethambutol. Multidrug resistant (MDR) strains were identified in 5.1% of all cases (95% CI, 3.61-6.49). Among MDR-TB cases, 6.4% were XDR (95% CI, 1.7-18.6) and 8.9% (95% CI, 7.0-10.8) of all cases were resistant to either isoniazid or rifampin (but not both). Among MDR-TB cases, 23.4% (95% CI, 12.8-38.4) were resistant to either fluoroquinolones or a second-line anti-TB injectable drug, but not both. From 1999 to 2014, the percentage of MDR cases decreased significantly, from 8.6% to 5.1% (p = 0.00). The Global Fund to Fight TB program showed signs of success in Eastern China. However, drug-resistant TB, MDR-TB, and XDR-TB still pose a challenge for TB control in Eastern China. High-quality directly observed treatment, short-course, and universal DST for TB cases to determine appropriate treatment regimens are urgently needed to prevent acquired drug resistance.

Resistance to fluoroquinolones and second-line injectable drugs: impact on multidrug-resistant TB outcomes

NARCIS (Netherlands)

Falzon, Dennis; Gandhi, Neel; Migliori, Giovanni B.; Sotgiu, Giovanni; Cox, Helen S.; Holtz, Timothy H.; Hollm-Delgado, Maria-Graciela; Keshavjee, Salmaan; Deriemer, Kathryn; Centis, Rosella; D'Ambrosio, Lia; Lange, Christoph G.; Bauer, Melissa; Menzies, Dick; Ahuja, S. D.; Ashkin, D.; Avendaño, M.; Banerjee, R.; Bauer, M.; Becerra, M. C.; Benedetti, A.; Burgos, M.; Centis, R.; Chan, E. D.; Chiang, C. Y.; Cobelens, F.; Cox, H.; D'Ambrosio, L.; de Lange, W. C. M.; DeRiemer, K.; Enarson, D.; Falzon, D.; Flanagan, K. L.; Flood, J.; Gandhi, N.; Garcia-Garcia, M. L.; Granich, R. M.; Hollm-Delgado, M. G.; Holtz, T. H.; Hopewell, P.; Iseman, M. D.; Jarlsberg, L. G.; Keshavjee, S.; Kim, H. R.; Koh, W. J.; Lancaster, J. L.; Lange, C.; Leimane, V.; Leung, C. C.; Li, J.

2013-01-01

A meta-analysis for response to treatment was undertaken using individual data of multidrug-resistant tuberculosis (MDR-TB) (resistance to isoniazid and rifampicin) patients from 26 centres. The analysis assessed the impact of additional resistance to fluoroquinolones and/or second-line injectable

Outbreak of resistant Acinetobacter baumannii- measures and proposal for prevention and control.

Science.gov (United States)

Romanelli, Roberta Maia de Castro; Jesus, Lenize Adriana de; Clemente, Wanessa Trindade; Lima, Stella Sala Soares; Rezende, Edna Maria; Coutinho, Rosane Luiza; Moreira, Ricardo Luiz Fontes; Neves, Francelli Aparecida Cordeiro; Brás, Nelma de Jesus

2009-10-01

Acinetobacter baumannii colonization and infection, frequent in Intensive Care Unit (ICU) patients, is commonly associated with high morbimortality. Several outbreaks due to multidrug-resistant (MDR) A. baumanii have been reported but few of them in Brazil. This study aimed to identify risk factors associated with colonization and infection by MDR and carbapenem-resistant A. baumannii strains isolated from patients admitted to the adult ICU at HC/UFMG. A case-control study was performed from January 2007 to June 2008. Cases were defined as patients colonized or infected by MDR/carbapenem-resistant A. baumannii, and controls were patients without MDR/carbapenem-resistant A. baumannii isolation, in a 1:2 proportion. For statistical analysis, due to changes in infection control guidelines, infection criteria and the notification process, this study was divided into two periods. During the first period analyzed, from January to December 2007, colonization or infection by MDR/carbapenem-resistant A. baumannii was associated with prior infection, invasive device utilization, prior carbapenem use and clinical severity. In the multivariate analysis, prior infection and mechanical ventilation proved to be statistically significant risk factors. Carbapenem use showed a tendency towards a statistical association. During the second study period, from January to June 2008, variables with a significant association with MDR/carbapenem-resistant A. baumannii colonization/infection were catheter utilization, carbapenem and third-generation cephalosporin use, hepatic transplantation, and clinical severity. In the multivariate analysis, only CVC use showed a statistical difference. Carbapenem and third-generation cephalosporin use displayed a tendency to be risk factors. Risk factors must be focused on infection control and prevention measures considering A. baumanni dissemination.

Outbreak of resistant Acinetobacter baumannii: measures and proposal for prevention and control

Directory of Open Access Journals (Sweden)

Roberta Maia de Castro Romanelli

Full Text Available Acinetobacter baumannii colonization and infection, frequent in Intensive Care Unit (ICU patients, is commonly associated with high morbimortality. Several outbreaks due to multidrug-resistant (MDR A. baumanii have been reported but few of them in Brazil. This study aimed to identify risk factors associated with colonization and infection by MDR and carbapenem-resistant A. baumannii strains isolated from patients admitted to the adult ICU at HC/UFMG. A case-control study was performed from January 2007 to June 2008. Cases were defined as patients colonized or infected by MDR/carbapenem-resistant A. baumannii, and controls were patients without MDR/carbapenem-resistant A. baumannii isolation, in a 1:2 proportion. For statistical analysis, due to changes in infection control guidelines, infection criteria and the notification process, this study was divided into two periods. During the first period analyzed, from January to December 2007, colonization or infection by MDR/carbapenem-resistant A. baumannii was associated with prior infection, invasive device utilization, prior carbapenem use and clinical severity. In the multivariate analysis, prior infection and mechanical ventilation proved to be statistically significant risk factors. Carbapenem use showed a tendency towards a statistical association. During the second study period, from January to June 2008, variables with a significant association with MDR/carbapenem-resistant A. baumannii colonization/infection were catheter utilization, carbapenem and third-generation cephalosporin use, hepatic transplantation, and clinical severity. In the multivariate analysis, only CVC use showed a statistical difference. Carbapenem and third-generation cephalosporin use displayed a tendency to be risk factors. Risk factors must be focused on infection control and prevention measures considering A. baumanni dissemination.

A Livestock-Associated, Multidrug-Resistant, Methicillin-Resistant Staphylococcus aureus Clonal Complex 97 Lineage Spreading in Dairy Cattle and Pigs in Italy

DEFF Research Database (Denmark)

Feltrin, Fabiola; Alba, Patricia; Kraushaar, Britta

2016-01-01

by macrorestriction pulsed-field gel electrophoresis (PFGE) analysis, multilocus sequence typing (MLST), spa typing, staphylococcal cassette chromosome mec (SCCmec) typing, and antimicrobial resistance pattern analysis. Virulence and resistance genes were investigated by PCR and microarray analysis. Most...... resistance, fluoroquinolone resistance (n = 33), tet(K) in 32/37 tet(M)-positive isolates, and blaZ in almost all MRSA isolates. Few host-associated differences were detected among CC97 MRSA isolates: their extensive MDR nature in both pigs and dairy cattle may be a consequence of a spillback from pigs......Pandemic methicillin-resistant Staphylococcus aureus (MRSA) clonal complex 97 (CC97) lineages originated from livestock-to-human host jumps. In recent years, CC97 has become one of the major MRSA lineages detected in Italian farmed animals. The aim of this study was to characterize and analyze...

Prevalence of multidrug resistance among retreatment pulmonary tuberculosis cases in a tertiary care hospital, Hyderabad, India

Directory of Open Access Journals (Sweden)

Subhakar Kandi

2013-01-01

Full Text Available Background: India is one of the high tuberculosis (TB burden countries in the world. India ranks second in harboring multi drug resistant (MDR-TB cases. About 50,000 of MDR cases are recorded in retreatment pulmonary TB cases. This study was conducted in a tertiary care facility (Government General and Chest Hospital in Hyderabad, India. Objectives: Toassess: Proportion of the TB patients having MDR-TB at the initiation of retreatment regimen; the prevalence of isoniazid (INH resistance in this geographical area. Materials and Methods: An analytical, observational, prospective cohort study of patients attending the out-patient department from December 2010 to March 2011. Results: Sputum samples from 100 patients were subjected to acid fast bacilli (AFB culture and drug sensitivity testing. Of these, 28 (28% were MDR-TB, 42 (42% were non-MDR-TB and 39% being INH resistance. Conclusions: In conclusion, one third of the retreatment pulmonary TB cases attending a tertiary care institute for TB will be MDR-TB at the initiation of treatment and there is a need to include ethambutol in the continuation phase of new TB case treatment in view of high INH resistance.

Genetic polymorphisms in MDR1 and CYP3A4 genes in Asians and the influence of MDR1 haplotypes on cyclosporin disposition in heart transplant recipients.

Science.gov (United States)

Chowbay, Balram; Cumaraswamy, Sivathasan; Cheung, Yin Bun; Zhou, Qingyu; Lee, Edmund J D

2003-02-01

Intestinal cytochrome P450 3A4 (CYP3A4) and P-glycoprotein (P-gp) both play a vital role in the metabolism of oral cyclosporine (CsA). We investigated the genetic polymorphisms in CYP3A4(promoter region and exons 5, 7 and 9) and MDR1 (exons 12, 21 and 26) genes and the impact of these polymorphisms on the pharmacokinetics of oral CsA in stable heart transplant patients (n = 14). CYP3A4 polymorphisms were rare in the Asian population and transplant patients. Haplotype analysis revealed 12 haplotypes in the Chinese, eight in the Malays and 10 in the Indians. T-T-T was the most common haplotype in all ethnic groups. The frequency of the homozygous mutant genotype at all three loci (TT-TT-TT) was highest in the Indians (31%) compared to 19% and 15% in the Chinese and Malays, respectively. In heart transplant patients, CsA exposure (AUC(0-4 h), AUC(0-12 h) and C(max)) was high in patients with the T-T-T haplotypes compared to those with C-G-C haplotypes. These findings suggest that haplotypes rather than genotypes influence CsA disposition in transplant patients.

APC loss in breast cancer leads to doxorubicin resistance via STAT3 activation.

Science.gov (United States)

VanKlompenberg, Monica K; Leyden, Emily; Arnason, Anne H; Zhang, Jian-Ting; Stefanski, Casey D; Prosperi, Jenifer R

2017-11-28

Resistance to chemotherapy is one of the leading causes of death from breast cancer. We recently established that loss of Adenomatous Polyposis Coli (APC) in the Mouse Mammary Tumor Virus - Polyoma middle T (MMTV-PyMT) transgenic mouse model results in resistance to cisplatin or doxorubicin-induced apoptosis. Herein, we aim to establish the mechanism that is responsible for APC-mediated chemotherapeutic resistance. Our data demonstrate that MMTV-PyMT; Apc Min/+ cells have increased signal transducer and activator of transcription 3 (STAT3) activation. STAT3 can be constitutively activated in breast cancer, maintains the tumor initiating cell (TIC) population, and upregulates multidrug resistance protein 1 (MDR1). The activation of STAT3 in the MMTV-PyMT; Apc Min/+ model is independent of interleukin 6 (IL-6); however, enhanced EGFR expression in the MMTV-PyMT; Apc Min/+ cells may be responsible for the increased STAT3 activation. Inhibiting STAT3 with a small molecule inhibitor A69 in combination with doxorubicin, but not cisplatin, restores drug sensitivity. A69 also decreases doxorubicin enhanced MDR1 gene expression and the TIC population enhanced by loss of APC. In summary, these results have revealed the molecular mechanisms of APC loss in breast cancer that can guide future treatment plans to counteract chemotherapeutic resistance.

20(S)-Protopanaxadiol (PPD) analogues chemosensitize multidrug-resistant cancer cells to clinical anticancer drugs.

Science.gov (United States)

Liu, Junhua; Wang, Xu; Liu, Peng; Deng, Rongxin; Lei, Min; Chen, Wantao; Hu, Lihong

2013-07-15

Novel 20(S)-protopanoxadiol (PPD) analogues were designed, synthesized, and evaluated for the chemosensitizing activity against a multidrug resistant (MDR) cell line (KBvcr) overexpressing P-glycoprotein (P-gp). Structure-activity relationship analysis showed that aromatic substituted aliphatic amine at the 24-positions (groups V) effectively and significantly sensitized P-gp overexpressing multidrug resistant (MDR) cells to anticancer drugs, such as docetaxel (DOC), vincristine (VCR), and adriamycin (ADM). PPD derivatives 12 and 18 showed 1.3-2.6 times more effective reversal ability than verapamil (VER) for DOC and VCR. Importantly, no cytotoxicity was observed by the active PPD analogues (5μM) against both non-MDR and MDR cells, suggesting that PPD analogues serve as novel lead compounds toward a potent and safe resistance modulator. Moreover, a preliminary mechanism study demonstrated that the chemosensitizing activity of PPD analogues results from inhibition of P-glycoprotein (P-gp) overexpressed in MDR cancer cells. Copyright © 2013 The Authors. Published by Elsevier Ltd.. All rights reserved.

Factors influencing survival in patients with multidrug-resistant Acinetobacter baumannii infection

Directory of Open Access Journals (Sweden)

Mariana Lima Prata-Rocha

Full Text Available Multidrug-resistant (MDR Acinetobacter baumannii (Acb is a rapidly emerging pathogen in healthcare settings. The aim of this study was to evaluate the predictors of poor outcome in patients with MDR Acb. This is the first report documenting factors influencing survival in patients with MDR Acb in this tertiary hospital. This study is a prospective of the hospital epidemiology database. A total of 73 patients with 84 Acb isolates were obtained between August 2009 and October 2010 in this hospital. In the present study, the 30-day mortality rate was 39.7%. Of 84 Acb isolates, 50 (59% were MDR, nine (11% were pan-resistant, and 25 (30% were non-MDR. The non-MDR isolates were used as the control group. The factors significantly associated with multidrug resistance included previous surgeries, presence of comorbidity (renal disease, use of more than two devices, parenteral nutrition, and inappropriate antimicrobial therapy. Significant predictors of 30-day mortality in the univariate analysis included pneumonia, diabetes mellitus, renal disease, use of more than two devices, and inappropriate antimicrobial therapy administered within two days of the onset of infection. The factors associated with mortality in patients with MDR Acb infection in this study were: age > 60 years, pneumonia, diabetes mellitus, renal disease, use of more than two invasive procedures, and inappropriate antimicrobial therapy. Vigilance is needed to prevent outbreaks of this opportunistic and deadly pathogen.

Efficacy, safety and tolerability of linezolid containing regimens in treating MDR-TB and XDR-TB : systematic review and meta-analysis

NARCIS (Netherlands)

Sotgiu, Giovanni; Centis, Rosella; D'Ambrosio, Lia; Alffenaar, Jan-William C.; Anger, Holly A.; Caminero, Jose A.; Castiglia, Paolo; De Lorenzo, Saverio; Ferrara, Giovanni; Koh, Won-Jung; Schecter, Giesela F.; Shim, Tae S.; Singla, Rupak; Skrahina, Alena; Spanevello, Antonio; Udwadia, Zarir F.; Villar, Miquel; Zampogna, Elisabetta; Zellweger, Jean-Pierre; Zumla, Alimuddin; Migliori, Giovanni Battista

2012-01-01

Linezolid is used off-label to treat multidrug-resistant tuberculosis (MDR-TB) in absence of systematic evidence. We performed a systematic review and meta-analysis on efficacy, safety and tolerability of linezolid-containing regimes based on individual data analysis. 12 studies (11 countries from

A study of multidrug-resistant tuberculosis in risk groups in the city of Santos, São Paulo, Brazil

Directory of Open Access Journals (Sweden)

Andréa Gobetti Vieira Coelho

2012-09-01

Full Text Available Monitoring the extent of and trends in multidrug-resistant tuberculosis (MDR-TB is a priority of the Brazilian National Tuberculosis Control Programme. The current study aimed to estimate the incidence of MDR-TB, describe the profile of TB drug resistance in risk groups and examine whether screening for MDR-TB adhered to the recommended guidelines. A descriptive study that examined diagnosed cases of pulmonary TB was conducted in the city of Santos, Brazil, between 2000-2004. Of the 2,176 pulmonary TB cases studied, 671 (30.8% met the criteria for drug sensitivity testing and, of these cases, 31.7% (213/671 were tested. Among the tested cases, 9.4% were resistant to one anti-TB drug and 15% were MDR. MDR was observed in 11.6% of 86 new TB cases and 17.3% of 127 previously treated cases. The average annual incidence of MDR-TB was 1.9 per 100,000 inhabitants-years. The extent of known MDR-TB in the city of Santos is high, though likely to be underestimated. Our study therefore indicates an inadequate adherence to the guidelines for MDR-TB screening and suggests the necessity of alternative strategies of MDR-TB surveillance.

Promising therapy of XDR-TB/MDR-TB with thioridazine an inhibitor of bacterial efflux pumps

DEFF Research Database (Denmark)

Amaral, L; Martins, M; Viveiros, M

2008-01-01

-TB) - a M. tuberculosis organism that is resistant to the most effective second line drugs available for the treatment of TB. This review provides detailed, significant evidence that supports the use of an old neuroleptic compound, thioridazine (TZ), for the management of MDR-TB and XDR-TB infections...... therapy predictably ineffective and death is inevitable, compassionate therapy with TZ should be contemplated. The risks are small and the rewards great....

Effect of methylxanthines derived from pentoxifylline on P-glycoprotein mediated multidrug resistance

International Nuclear Information System (INIS)

Kupsakova, I.; Drobna, Z.; Breier, A.

2001-01-01

In this paper study of multidrug resistance (MDR) antitumor agents - P-glycoprotein (PGP) is presented. The ability of pentoxifylline (PTX) to depress resistance mediated by overexpression of PGP in mouse leukemic cell line L 121 ONCR resistant to vincristine (VCR) was described earlier. PTX depressed the resistance of these cells in a dose and time dependent manner. This effect was accompanied by increased level of [ 3 H]-vincristine accumulation by these cells. The methylxanthines with different length of this aliphatic side chain were synthesized and their capability to depress MDR was tested. The results indicated that the position of carbonyl group plays a crucial role for the ability of the derivative to depress MDR of L 121 ONCR cells. (authors)

E-health systems for management of MDR-TB in resource-poor environments: a decade of experience and recommendations for future work.

Science.gov (United States)

Fraser, Hamish S F; Habib, Ali; Goodrich, Mark; Thomas, David; Blaya, Joaquin A; Fils-Aime, Joseph Reginald; Jazayeri, Darius; Seaton, Michael; Khan, Aamir J; Choi, Sharon S; Kerrison, Foster; Falzon, Dennis; Becerra, Mercedes C

2013-01-01

Multi-drug resistant TB (MDR-TB) is a complex infectious disease that is a growing threat to global health. It requires lengthy treatment with multiple drugs and specialized laboratory testing. To effectively scale up treatment to thousands of patients requires good information systems to support clinical care, reporting, drug forecasting, supply chain management and monitoring. Over the last decade we have developed the PIH-EMR electronic medical record system, and subsequently OpenMRS-TB, to support the treatment of MDR-TB in Peru, Haiti, Pakistan, and other resource-poor environments. We describe here the experience with implementing these systems and evaluating many aspects of their performance, and review other systems for MDR-TB management. We recommend a new approach to information systems to address the barriers to scale up MDR-TB treatment, particularly access to the appropriate drugs and lab data. We propose moving away from fragmented, vertical systems to focus on common platforms, addressing all stages of TB care, support for open data standards and interoperability, care for a wide range of diseases including HIV, integration with mHealth applications, and ability to function in resource-poor environments.

Multidrug-resistant tuberculosis: The problem and some priorities in controlling it

Directory of Open Access Journals (Sweden)

Sven Hoffner

2016-01-01

Full Text Available Multidrug-resistant tuberculosis (MDR-TB, and even more severe forms of drug resistance, cause significant problems and costs for national TB control programs and constitutes an increasing public health concern globally. In parts of the former Soviet Union, the prevalence of MDR-TB is as high as 50% and one third of all newly detected TB patients are infected with MDR strains. Such strains transmit and certain MDR-TB clones constitute an important part of the problem, especially in high MDR-TB burden areas. There are several actions that should be given priority to control this situation. A first important step is timely detection of all patients infected with resistant strains, which makes possible prompt change of standard TB chemotherapy to more effective combinations of drugs. This is important both from the public health and clinical perspectives, since it renders the individual patient noninfectious and subsequently cured. Early detection of MDR-TB also allows infection control to be focused where it is most needed. Strengthened infection control measures are crucial for limiting the ongoing spread of resistant TB in hospitals and elsewhere. In addition, a sustainable drug supply must be ensured to guarantee that all patients are initiated on effective treatment and can avoid interruptions due to drug shortages. An extra focus should be put on vulnerable cases, such as immunosuppressed individuals, prisoners, drug addicts, and migrants, in whom TB is generally more frequent and difficult to control than in the normal population. Finally, political support is needed to ensure necessary infrastructures, human and financial resources to effectively control drug resistant TB.

Multidrug-resistant tuberculosis: The problem and some priorities in controlling it.

Science.gov (United States)

Hoffner, Sven

2016-12-01

Multidrug-resistant tuberculosis (MDR-TB), and even more severe forms of drug resistance, cause significant problems and costs for national TB control programs and constitutes an increasing public health concern globally. In parts of the former Soviet Union, the prevalence of MDR-TB is as high as 50% and one third of all newly detected TB patients are infected with MDR strains. Such strains transmit and certain MDR-TB clones constitute an important part of the problem, especially in high MDR-TB burden areas. There are several actions that should be given priority to control this situation. A first important step is timely detection of all patients infected with resistant strains, which makes possible prompt change of standard TB chemotherapy to more effective combinations of drugs. This is important both from the public health and clinical perspectives, since it renders the individual patient noninfectious and subsequently cured. Early detection of MDR-TB also allows infection control to be focused where it is most needed. Strengthened infection control measures are crucial for limiting the ongoing spread of resistant TB in hospitals and elsewhere. In addition, a sustainable drug supply must be ensured to guarantee that all patients are initiated on effective treatment and can avoid interruptions due to drug shortages. An extra focus should be put on vulnerable cases, such as immunosuppressed individuals, prisoners, drug addicts, and migrants, in whom TB is generally more frequent and difficult to control than in the normal population. Finally, political support is needed to ensure necessary infrastructures, human and financial resources to effectively control drug resistant TB. Copyright © 2016.

Folate decorated dual drug loaded nanoparticle: role of curcumin in enhancing therapeutic potential of nutlin-3a by reversing multidrug resistance.

Directory of Open Access Journals (Sweden)

Manasi Das

Full Text Available Retinoblastoma is the most common intraocular tumor in children. Malfunctioning of many signaling pathways regulating cell survival or apoptosis, make the disease more vulnerable. Notably, resistance to chemotherapy mediated by MRP-1, lung-resistance protein (LRP is the most challenging aspect to treat this disease. Presently, much attention has been given to the recently developed anticancer drug nutlin-3a because of its non-genotoxic nature and potency to activate tumor suppressor protein p53. However, being a substrate of multidrug resistance protein MRP1 and Pgp its application has become limited. Currently, research has step towards reversing Multi drug resistance (MDR by using curcumin, however its clinical relevance is restricted by plasma instability and poor bioavailability. In the present investigation we tried to encapsulate nutlin-3a and curcumin in PLGA nanoparticle (NPs surface functionalized with folate to enhance therapeutic potential of nutlin-3a by modulating MDR. We document that curcumin can inhibit the expression of MRP-1 and LRP gene/protein in a concentration dependent manner in Y79 cells. In vitro cellular cytotoxicity, cell cycle analysis and apoptosis studies were done to compare the effectiveness of native drugs (single or combined and single or dual drug loaded nanoparticles (unconjugated/folate conjugated. The result demonstrated an augmented therapeutic efficacy of targeted dual drug loaded NPs (Fol-Nut-Cur-NPs over other formulation. Enhanced expression or down regulation of proapoptotic/antiapoptotic proteins respectively and down-regulation of bcl2 and NFκB gene/protein by Fol-Nut-Cur-NPs substantiate the above findings. This is the first investigation exploring the role of curcumin as MDR modulator to enhance the therapeutic potentiality of nutlin-3a, which may opens new direction for targeting cancer with multidrug resistance phenotype.

A mutation within the extended X loop abolished substrate-induced ATPase activity of the human liver ATP-binding cassette (ABC) transporter MDR3.

Science.gov (United States)

Kluth, Marianne; Stindt, Jan; Dröge, Carola; Linnemann, Doris; Kubitz, Ralf; Schmitt, Lutz

2015-02-20

The human multidrug resistance protein 3 (MDR3/ABCB4) belongs to the ubiquitous family of ATP-binding cassette (ABC) transporters and is located in the canalicular membrane of hepatocytes. There it flops the phospholipids of the phosphatidylcholine (PC) family from the inner to the outer leaflet. Here, we report the characterization of wild type MDR3 and the Q1174E mutant, which was identified previously in a patient with progressive familial intrahepatic cholestasis type 3 (PFIC-3). We expressed different variants of MDR3 in the yeast Pichia pastoris, purified the proteins via tandem affinity chromatography, and determined MDR3-specific ATPase activity in the presence or absence of phospholipids. The ATPase activity of wild type MDR3 was stimulated 2-fold by liver PC or 1,2-dioleoyl-sn-glycero-3-phosphatidylethanolamine lipids. Furthermore, the cross-linking of MDR3 with a thiol-reactive fluorophore blocked ATP hydrolysis and exhibited no PC stimulation. Similarly, phosphatidylethanolamine, phosphatidylserine, and sphingomyelin lipids did not induce an increase of wild type MDR3 ATPase activity. The phosphate analogues beryllium fluoride and aluminum fluoride led to complete inhibition of ATPase activity, whereas orthovanadate inhibited exclusively the PC-stimulated ATPase activity of MDR3. The Q1174E mutation is located in the nucleotide-binding domain in direct proximity of the leucine of the ABC signature motif and extended the X loop, which is found in ABC exporters. Our data on the Q1174E mutant demonstrated basal ATPase activity, but PC lipids were incapable of stimulating ATPase activity highlighting the role of the extended X loop in the cross-talk of the nucleotide-binding domain and the transmembrane domain. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Prevalence of Multidrug-Resistant Pathogens and Their Antibiotic Susceptibility Pattern from Late-Onset Ventilator-Associated Pneumonia Patients from a Tertiary-Care Hospital in North India

Directory of Open Access Journals (Sweden)

Varsha Gupta

2018-01-01

Full Text Available Background: Ventilator-associated pneumonia (VAP is seen as being most common in critically ill patients in intensive care units. Diagnostic protocol is challenging and the treatment is often difficult. Incorrectly selected antibiotic therapy further leads to the emergence of multidrug-resistant (MDR organisms. Materials and Methods: The present prospective study was conducted to study patients of VAP with the aim of determining the aerobic bacterial etiological agents, antimicrobial susceptibility patterns, and molecular detection of MBL (metallo beta lactamase genes. The antimicrobial susceptibility of the isolates by the disc diffusion method and the detection of various drug-resistance mechanisms was done. The minimum inhibitory concentration (MIC based on E-test was determined along with the molecular analysis by polymerase chain reaction for detection of MBL genes (IMP and VIM. Results: Out of a total of 372 patients admitted in intensive care unit during the time period (March 2010 to February 2013, 40 patients were finally diagnosed as having late-onset VAP. Among the study isolates (69, due to polymicrobial infection, the maximum isolates were Acinetobacter spp. (32 followed by Pseudomonas aeruginosa (18, Klebsiella pneumoniae (8, and others. MDR was high with 34% of Acinetobacter and 50% of Pseudomonas strains being MBL producers. Among Staphylococcus aureus, 50% strains were methicillin resistant. On molecular analysis, eight of the Acinetobacter and six of the Pseudomonas isolates came out to be positive for VIM 2 gene, whereas IMP was not detected in any of the isolates. Conclusion: The present study emphasizes the threat of MDR in VAP patients from ICU as the treatment options are limited. The knowledge of prevailing organisms, resistance mechanisms, and their antibiotic profile can go a long way in deciding appropriate empirical therapy.

Localization and activity of multidrug resistance protein 1 in the secretory pathway of Leishmania parasites.

Science.gov (United States)

Dodge, Matthew A; Waller, Ross F; Chow, Larry M C; Zaman, Muhammad M; Cotton, Leanne M; McConville, Malcolm J; Wirth, Dyann F

2004-03-01

Upregulation of the multidrug resistance protein 1 (LeMDR1) in the protozoan parasite, Leishmania enriettii, confers resistance to hydrophobic drugs such as vinblastine, but increases the sensitivity of these parasites to the mitochondrial drug, rhodamine 123. In order to investigate the mechanism of action of LeMDR1, the subcellular localization of green fluorescent protein (GFP)-tagged versions of LeMDR1 and the fate of the traceable-fluorescent LeMDR1 substrate calcein AM were examined in both Leishmania mexicana and L. enriettii LeMDR1 -/- and overexpressing cell lines. The LeMDR1-GFP chimera was localized by fluorescence microscopy to a number of secretory and endocytic compartments, including the Golgi apparatus, endoplasmic reticulum (ER) and a multivesicular tubule (MVT)-lysosome. Pulse-chase labelling experiments with calcein AM suggested that the Golgi and ER pools, but not the MVT-lysosome pool, of LeMDR1 were active in pumping calcein AM out of the cell. Cells labelled with calcein AM under conditions that slow vesicular transport (low temperature and stationary growth) inhibited export and resulted in the accumulation of fluorescent calcein in both the Golgi and the mitochondria. We propose that LeMDR1 substrates are pumped into secretory compartments and exported from the parasite by exocytosis. Accumulation of MDR substrates in the ER can result in alternative transport to the mitochondrion, explaining the reciprocal sensitivity of drug-resistant Leishmania to vinblastine and rhodamine 123.

Detection of Class I and II integrons for the assessment of antibiotic and multidrug resistance among Escherichia coli isolates from agricultural irrigation waters in Bulacan, Philippines.

Science.gov (United States)

Paraoan, Cielo Emar M; Rivera, Windell L; Vital, Pierangeli G

2017-05-04

Contaminated irrigation water may greatly affect not only the quality of produce but also the people exposed to it. In this study, agricultural irrigation waters in Bulacan, Philippines were assessed and found to be contaminated with Escherichia coli (E. coli) ranging from 0.58 to 4.51 log 10 CFU/mL. A total of 79 isolates of E. coli were confirmed through polymerase chain reaction (PCR) amplifying the uidA gene and were tested for phenotypic resistance using 10 antimicrobials through the Kirby-Bauer disc diffusion method. Forty-six isolates (58.22%) were noted to be multidrug resistant (MDR) with high resistance rate to cephalothin, tetracycline, streptomycin, ampicillin, trimethoprim, nalidixic acid, and chloramphenicol. Moreover, this study also examined the prevalence of Class I and II integrons accounting to 67.39% and 17.39%, respectively, of the MDR E. coli strains using multiplex PCR. The results imply that the agricultural water used in Bulacan is contaminated with the fecal material of man or other animals present in the area, and the presence of MDR bacteria, which pose a potential threat to individuals in these areas, is alarming. In addition, detection of integrons could be a good marker for the identification of MDR isolates. Lastly, this study could develop strategies for the proper management of farming sites leading to the detection of food-borne pathogens and prevention of infectious diseases.

Use of Lot Quality Assurance Sampling to Ascertain Levels of Drug Resistant Tuberculosis in Western Kenya.

Directory of Open Access Journals (Sweden)

Julia Jezmir

Full Text Available To classify the prevalence of multi-drug resistant tuberculosis (MDR-TB in two different geographic settings in western Kenya using the Lot Quality Assurance Sampling (LQAS methodology.The prevalence of drug resistance was classified among treatment-naïve smear positive TB patients in two settings, one rural and one urban. These regions were classified as having high or low prevalence of MDR-TB according to a static, two-way LQAS sampling plan selected to classify high resistance regions at greater than 5% resistance and low resistance regions at less than 1% resistance.This study classified both the urban and rural settings as having low levels of TB drug resistance. Out of the 105 patients screened in each setting, two patients were diagnosed with MDR-TB in the urban setting and one patient was diagnosed with MDR-TB in the rural setting. An additional 27 patients were diagnosed with a variety of mono- and poly- resistant strains.Further drug resistance surveillance using LQAS may help identify the levels and geographical distribution of drug resistance in Kenya and may have applications in other countries in the African Region facing similar resource constraints.

Use of Lot Quality Assurance Sampling to Ascertain Levels of Drug Resistant Tuberculosis in Western Kenya.

Science.gov (United States)

Jezmir, Julia; Cohen, Ted; Zignol, Matteo; Nyakan, Edwin; Hedt-Gauthier, Bethany L; Gardner, Adrian; Kamle, Lydia; Injera, Wilfred; Carter, E Jane

2016-01-01

To classify the prevalence of multi-drug resistant tuberculosis (MDR-TB) in two different geographic settings in western Kenya using the Lot Quality Assurance Sampling (LQAS) methodology. The prevalence of drug resistance was classified among treatment-naïve smear positive TB patients in two settings, one rural and one urban. These regions were classified as having high or low prevalence of MDR-TB according to a static, two-way LQAS sampling plan selected to classify high resistance regions at greater than 5% resistance and low resistance regions at less than 1% resistance. This study classified both the urban and rural settings as having low levels of TB drug resistance. Out of the 105 patients screened in each setting, two patients were diagnosed with MDR-TB in the urban setting and one patient was diagnosed with MDR-TB in the rural setting. An additional 27 patients were diagnosed with a variety of mono- and poly- resistant strains. Further drug resistance surveillance using LQAS may help identify the levels and geographical distribution of drug resistance in Kenya and may have applications in other countries in the African Region facing similar resource constraints.

Associations between Antimicrobial Resistance Phenotypes, Antimicrobial Resistance Genes, and Virulence Genes of Fecal Escherichia coli Isolates from Healthy Grow-Finish Pigs ▿

OpenAIRE

Rosengren, Leigh B.; Waldner, Cheryl L.; Reid-Smith, Richard J.

2009-01-01

Escherichia coli often carries linked antimicrobial resistance genes on transmissible genetic elements. Through coselection, antimicrobial use may select for unrelated but linked resistance or virulence genes. This study used unconditional statistical associations to investigate the relationships between antimicrobial resistance phenotypes and antimicrobial resistance genes in 151 E. coli isolates from healthy pigs. Phenotypic resistance to each drug was significantly associated with phenotyp...

Characterization of CTX-M enzymes, quinolone resistance determinants, and antimicrobial residues from hospital sewage, wastewater treatment plant, and river water.

Science.gov (United States)

Conte, Danieli; Palmeiro, Jussara Kasuko; da Silva Nogueira, Keite; de Lima, Thiago Marenda Rosa; Cardoso, Marco André; Pontarolo, Roberto; Degaut Pontes, Flávia Lada; Dalla-Costa, Libera Maria

2017-02-01

Multidrug-resistant (MDR) bacteria are widespread in hospitals and have been increasingly isolated from aquatic environments. The aim of the present study was to characterize extended-spectrum β-lactamase (ESBL) and quinolone-resistant Enterobacteriaceae from a hospital effluent, sanitary effluent, inflow sewage, aeration tank, and outflow sewage within a wastewater treatment plant (WWTP), as well as river water upstream and downstream (URW and DRW, respectively), of the point where the WWTP treated effluent was discharged. β-lactamase (bla) genes, plasmid-mediated quinolone resistance (PMQR), and quinolone resistance-determining regions (QRDRs) were assessed by amplification and sequencing in 55 ESBL-positive and/or quinolone-resistant isolates. Ciprofloxacin residue was evaluated by high performance liquid chromatography. ESBL-producing isolates were identified in both raw (n=29) and treated (n=26) water; they included Escherichia coli (32), Klebsiella pneumoniae (22) and Klebsiella oxytoca (1). Resistance to both cephalosporins and quinolone was observed in 34.4% of E. coli and 27.3% of K. pneumoniae. Resistance to carbapenems was found in 5.4% of K. pneumoniae and in K. oxytoca. Results indicate the presence of bla CTX-M (51/55, 92.7%) and bla SHV (8/55, 14.5%) ESBLs, and bla GES (2/55, 3.6%) carbapenemase-encoding resistance determinants. Genes conferring quinolone resistance were detected at all sites, except in the inflow sewage and aeration tanks. Quinolone resistance was primarily attributed to amino acid substitutions in the QRDR of GyrA (47%) or to the presence of PMQR (aac-(6')-Ib-cr, oqxAB, qnrS, and/or qnrB; 52.9%) determinants. Ciprofloxacin residue was absent only from URW. Our results have shown strains carrying ESBL genes, PMQR determinants, and mutations in the gyrA QRDR genes mainly in hospital effluent, URW, and DRW samples. Antimicrobial use, and the inefficient removal of MDR bacteria and antibiotic residue during sewage treatment, may

Malnutrition associated with unfavorable outcome and death among South African MDR-TB and HIV co-infected children.

Science.gov (United States)

Hicks, R M; Padayatchi, N; Shah, N S; Wolf, A; Werner, L; Sunkari, V B; O'Donnell, M R

2014-09-01

Pediatric multidrug-resistant tuberculosis (MDR-TB) is complicated by difficult diagnosis, complex treatment, and high mortality. In South Africa, these challenges are amplified by human immunodeficiency virus (HIV) co-infection; however, evidence on treatment outcomes among co-infected children is limited. Using conventional and new pediatric definitions, to describe treatment outcomes and identify risk factors for unfavorable outcome and mortality in children aged children (median age 8 years, IQR 4-12) with MDR-TB (n = 78) or XDR-TB (n = 6) initiated treatment. Sixty-four (77%) were HIV-positive and 62 (97%) received antiretroviral therapy. Sixty-six (79%) achieved favorable treatment outcomes. Overall mortality was 11% (n = 9) at 18 months after initiation of treatment. Malnutrition (aOR 27.4, 95%CI 2.7-278.7) and severe radiographic findings (aOR 4.68, 95%CI 1.01-21.9) were associated with unfavorable outcome. New pediatric outcome definitions increased the proportion classified as cured. It is possible to successfully treat pediatric MDR-TB-HIV even in resource-poor settings. Malnutrition is a marker for severe TB-HIV disease, and is a potential target for future interventions in these patients.

Direct nitrate reductase assay versus microscopic observation drug susceptibility test for rapid detection of MDR-TB in Uganda.

Directory of Open Access Journals (Sweden)

Freddie Bwanga

Full Text Available The most common method for detection of drug resistant (DR TB in resource-limited settings (RLSs is indirect susceptibility testing on Lowenstein-Jensen medium (LJ which is very time consuming with results available only after 2-3 months. Effective therapy of DR TB is therefore markedly delayed and patients can transmit resistant strains. Rapid and accurate tests suitable for RLSs in the diagnosis of DR TB are thus highly needed. In this study we compared two direct techniques--Nitrate Reductase Assay (NRA and Microscopic Observation Drug Susceptibility (MODS for rapid detection of MDR-TB in a high burden RLS. The sensitivity, specificity, and proportion of interpretable results were studied. Smear positive sputum was collected from 245 consecutive re-treatment TB patients attending a TB clinic in Kampala, Uganda. Samples were processed at the national reference laboratory and tested for susceptibility to rifampicin and isoniazid with direct NRA, direct MODS and the indirect LJ proportion method as reference. A total of 229 specimens were confirmed as M. tuberculosis, of these interpretable results were obtained in 217 (95% with either the NRA or MODS. Sensitivity, specificity and kappa agreement for MDR-TB diagnosis was 97%, 98% and 0.93 with the NRA; and 87%, 95% and 0.78 with the MODS, respectively. The median time to results was 10, 7 and 64 days with NRA, MODS and the reference technique, respectively. The cost of laboratory supplies per sample was low, around 5 USD, for the rapid tests. The direct NRA and MODS offered rapid detection of resistance almost eight weeks earlier than with the reference method. In the study settings, the direct NRA was highly sensitive and specific. We consider it to have a strong potential for timely detection of MDR-TB in RLS.

Emerging biocide resistance among multidrug-resistant bacteria: Myth or reality? A pilot study

Directory of Open Access Journals (Sweden)

Priyanka Gupta

2018-01-01

Full Text Available Context: Possible linkage between biocide and antibiotic resistance in bacteria is a major area of concern. Aim: To evaluate the susceptibility of multidrug-resistant (MDR bacteria to four commonly used biocides. Settings and Design: A pilot study was conducted in a tertiary care hospital from April to November 2017. Materials and Methods: Fifty-four MDR bacterial isolates, namely Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, and Staphylococcus aureus, were obtained from various clinical samples of inpatients. These isolates were subjected to tube dilution method for determining minimum inhibitory concentration (MIC of four commonly used biocides in our hospital, namely 5% w/v povidone iodine, absolute ethanol (99.9%, sodium hypochlorite (4% available chlorine, and quaternary ammonium compounds (QACs (3.39%. Minimum bactericidal concentration (MBC of these biocides was determined as per standard guidelines. Similar tests were also performed on corresponding American Type Culture Collection (ATCC bacterial strains. Statistical Analysis: The Fisher exact test. Results: Twenty-two MDR bacterial isolates had higher MIC values for QACs than their corresponding ATCC strains. Statistically significant difference in proportion of test isolates exhibiting higher MIC values for QACs and absolute ethanol was observed (P-value = 0.02. Twenty-four MDR bacterial isolates exhibited higher MBC values for sodium hypochlorite than their corresponding ATCC strains. The difference in proportion of test isolates exhibiting higher MBC values for sodium hypochlorite and absolute ethanol, respectively, was statistically significant (P-value <0.0001. The difference in proportion of test isolates exhibiting higher MBC values for absolute ethanol versus QACs and povidone iodine, respectively, was statistically significant (P-values = 0.0003 and 0.0076. Statistically significant differences in susceptibility to biocides among test isolates were also

The risk of global epidemic replacement with drug-resistant Mycobacterium tuberculosis strains

Directory of Open Access Journals (Sweden)

Emma S. McBryde

2017-03-01

Results and conclusions: The ability of MDR-TB to dominate DS-TB was highly sensitive to the relative transmissibility of the resistant strain; however, MDR-TB could dominate even when its transmissibility was modestly reduced (to between 50% and 100% as transmissible as the DS-TB strain. This model suggests that it may take decades or more for strain replacement to occur. It was also found that while the amplification of resistance is the early cause of MDR-TB, this will rapidly give way to person-to-person transmission.

CHANGES IN THE PREVALENCE OF DRUG RESISTANT TUBERCULOSIS

Directory of Open Access Journals (Sweden)

V. B. Galkin

2017-01-01

Full Text Available The tendency of tuberculosis prevalence reduction observed in the Russian Federation is mostly related to the cases without multiple drug resistance (MDR. In general the number of MDR TB cases still tends to be increasing in the Russian Federation. Confident long-term reduction is registered only in the Central and North-Western Districts with relatively low level of MDR TB prevalence. From 2017 MDR TB patients are expected to prevail in the structure of the sputum positive cases which surely provides negative impact on the treatment efficiency and epidemic trends. The system of dispensary follow-up allows evaluating the annual number of MDT TB cases and following the ways of its increase and reduction. Taking MDR TB sources on and off the register is less intensive compared to the same flows of non-MDR infectious cases. The number of MDR TB sources is increasing mostly due new tuberculosis cases however acquired MDR TB makes significant contribution to the growth of MDR TB sources number. The increase in the ratio of respiratory MDR TB patients with sputum conversion to those died reflects the success in the improvement of the treatment strategy of MDR TB patients.

Multidrug Resistance Among New Tuberculosis Cases Detecting Local Variation Through Lot Quality-assurance Sampling

NARCIS (Netherlands)