Induced mutations of rust resistance genes in wheat

International Nuclear Information System (INIS)

McIntosh, R.A.

1983-01-01

Induced mutations are being used as a tool to study genes for resistance in wheat. It was found that Pm1 can be separated from Lr20 and Sr15, but these two react like a single pleiotropic gene. Mutants were further examined in crosses and backmutations have been attempted. (author)

The Lr34 adult plant rust resistance gene provides seedling resistance in durum wheat without senescence.

Science.gov (United States)

Rinaldo, Amy; Gilbert, Brian; Boni, Rainer; Krattinger, Simon G; Singh, Davinder; Park, Robert F; Lagudah, Evans; Ayliffe, Michael

2017-07-01

The hexaploid wheat (Triticum aestivum) adult plant resistance gene, Lr34/Yr18/Sr57/Pm38/Ltn1, provides broad-spectrum resistance to wheat leaf rust (Lr34), stripe rust (Yr18), stem rust (Sr57) and powdery mildew (Pm38) pathogens, and has remained effective in wheat crops for many decades. The partial resistance provided by this gene is only apparent in adult plants and not effective in field-grown seedlings. Lr34 also causes leaf tip necrosis (Ltn1) in mature adult plant leaves when grown under field conditions. This D genome-encoded bread wheat gene was transferred to tetraploid durum wheat (T. turgidum) cultivar Stewart by transformation. Transgenic durum lines were produced with elevated gene expression levels when compared with the endogenous hexaploid gene. Unlike nontransgenic hexaploid and durum control lines, these transgenic plants showed robust seedling resistance to pathogens causing wheat leaf rust, stripe rust and powdery mildew disease. The effectiveness of seedling resistance against each pathogen correlated with the level of transgene expression. No evidence of accelerated leaf necrosis or up-regulation of senescence gene markers was apparent in these seedlings, suggesting senescence is not required for Lr34 resistance, although leaf tip necrosis occurred in mature plant flag leaves. Several abiotic stress-response genes were up-regulated in these seedlings in the absence of rust infection as previously observed in adult plant flag leaves of hexaploid wheat. Increasing day length significantly increased Lr34 seedling resistance. These data demonstrate that expression of a highly durable, broad-spectrum adult plant resistance gene can be modified to provide seedling resistance in durum wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Enhanced resistance to stripe rust disease in transgenic wheat expressing the rice chitinase gene RC24.

Science.gov (United States)

Huang, Xuan; Wang, Jian; Du, Zhen; Zhang, Chen; Li, Lan; Xu, Ziqin

2013-10-01

Stripe rust is a devastating fungal disease of wheat worldwide which is primarily caused by Puccinia striiformis f. sp tritici. Transgenic wheat (Triticum aestivum L.) expressing rice class chitinase gene RC24 were developed by particle bombardment of immature embryos and tested for resistance to Puccinia striiformis f.sp tritici. under greenhouse and field conditions. Putative transformants were selected on kanamycin-containing media. Polymease chain reaction indicated that RC24 was transferred into 17 transformants obtained from bombardment of 1,684 immature embryos. Integration of RC24 was confirmed by Southern blot with a RC24-labeled probe and expression of RC24 was verified by RT-PCR. Nine transgenic T1 lines exhibited enhanced resistance to stripe rust infection with lines XN8 and BF4 showing the highest level of resistance. Southern blot hybridization confirmed the stable inheritance of RC24 in transgenic T1 plants. Resistance to stripe rust in transgenic T2 and T3 XN8 and BF4 plants was confirmed over two consecutive years in the field. Increased yield (27-36 %) was recorded for transgenic T2 and T3 XN8 and BF4 plants compared to controls. These results suggest that rice class I chitinase RC24 can be used to engineer stripe rust resistance in wheat.

Abscisic Acid (ABA) Regulation of Arabidopsis SR Protein Gene Expression

Science.gov (United States)

Cruz, Tiago M. D.; Carvalho, Raquel F.; Richardson, Dale N.; Duque, Paula

2014-01-01

Serine/arginine-rich (SR) proteins are major modulators of alternative splicing, a key generator of proteomic diversity and flexible means of regulating gene expression likely to be crucial in plant environmental responses. Indeed, mounting evidence implicates splicing factors in signal transduction of the abscisic acid (ABA) phytohormone, which plays pivotal roles in the response to various abiotic stresses. Using real-time RT-qPCR, we analyzed total steady-state transcript levels of the 18 SR and two SR-like genes from Arabidopsis thaliana in seedlings treated with ABA and in genetic backgrounds with altered expression of the ABA-biosynthesis ABA2 and the ABA-signaling ABI1 and ABI4 genes. We also searched for ABA-responsive cis elements in the upstream regions of the 20 genes. We found that members of the plant-specific SC35-Like (SCL) Arabidopsis SR protein subfamily are distinctively responsive to exogenous ABA, while the expression of seven SR and SR-related genes is affected by alterations in key components of the ABA pathway. Finally, despite pervasiveness of established ABA-responsive promoter elements in Arabidopsis SR and SR-like genes, their expression is likely governed by additional, yet unidentified cis-acting elements. Overall, this study pinpoints SR34, SR34b, SCL30a, SCL28, SCL33, RS40, SR45 and SR45a as promising candidates for involvement in ABA-mediated stress responses. PMID:25268622

Diversity, distribution and quantification of antibiotic resistance genes in goat and lamb slaughterhouse surfaces and meat products.

Directory of Open Access Journals (Sweden)

Leyre Lavilla Lerma

Full Text Available The distribution and quantification of tetracycline, sulfonamide and beta-lactam resistance genes were assessed in slaughterhouse zones throughout meat chain production and the meat products; this study represents the first to report quantitatively monitor antibiotic resistance genes (ARG in goat and lamb slaughterhouse using a culture independent approach, since most studies focused on individual bacterial species and their specific resistance types. Quantitative PCR (qPCR revealed a high prevalence of tetracycline resistance genes tetA and tetB in almost all slaughterhouse zones. Sulfonamide resistance genes were largely distributed, while beta-lactam resistance genes were less predominant. Statistical analysis revealed that resistant bacteria, in most cases, were spread by the same route in almost all slaughterhouse zones, except for tetB, blaCTX and blaTEM genes, which occurred in few zones as isolated 'hot spots.' The sum of all analyzed ARG indicated that slaughterhouse surfaces and end products act as reservoirs of ARG, mainly tet genes, which were more prevalent in slaughtering room (SR, cutting room (CR and commercial meat products (MP. Resistance gene patterns suggest they were disseminated throughout slaughterhouse zones being also detected in commercial meat products, with significant correlations between different sampling zones/end products and total resistance in SR, CR and white room (WR zones, and also refrigerator 4 (F4 and MP were observed. Strategically controlling key zones in slaughterhouse (SR, CR and WR by adequate disinfection methods could strategically reduce the risks of ARG transmission and minimize the issues of food safety and environment contamination.

Diversity, distribution and quantification of antibiotic resistance genes in goat and lamb slaughterhouse surfaces and meat products.

Science.gov (United States)

Lavilla Lerma, Leyre; Benomar, Nabil; Knapp, Charles W; Correa Galeote, David; Gálvez, Antonio; Abriouel, Hikmate

2014-01-01

The distribution and quantification of tetracycline, sulfonamide and beta-lactam resistance genes were assessed in slaughterhouse zones throughout meat chain production and the meat products; this study represents the first to report quantitatively monitor antibiotic resistance genes (ARG) in goat and lamb slaughterhouse using a culture independent approach, since most studies focused on individual bacterial species and their specific resistance types. Quantitative PCR (qPCR) revealed a high prevalence of tetracycline resistance genes tetA and tetB in almost all slaughterhouse zones. Sulfonamide resistance genes were largely distributed, while beta-lactam resistance genes were less predominant. Statistical analysis revealed that resistant bacteria, in most cases, were spread by the same route in almost all slaughterhouse zones, except for tetB, blaCTX and blaTEM genes, which occurred in few zones as isolated 'hot spots.' The sum of all analyzed ARG indicated that slaughterhouse surfaces and end products act as reservoirs of ARG, mainly tet genes, which were more prevalent in slaughtering room (SR), cutting room (CR) and commercial meat products (MP). Resistance gene patterns suggest they were disseminated throughout slaughterhouse zones being also detected in commercial meat products, with significant correlations between different sampling zones/end products and total resistance in SR, CR and white room (WR) zones, and also refrigerator 4 (F4) and MP were observed. Strategically controlling key zones in slaughterhouse (SR, CR and WR) by adequate disinfection methods could strategically reduce the risks of ARG transmission and minimize the issues of food safety and environment contamination.

Discovery of a Novel Stem Rust Resistance Allele in Durum Wheat that Exhibits Differential Reactions to Ug99 Isolates

Directory of Open Access Journals (Sweden)

Jayaveeramuthu Nirmala

2017-10-01

Full Text Available Wheat stem rust, caused by Puccinia graminis f. sp. tritici Eriks. & E. Henn, can incur yield losses in susceptible cultivars of durum wheat, Triticum turgidum ssp. durum (Desf. Husnot. Although several durum cultivars possess the stem rust resistance gene Sr13, additional genes in durum wheat effective against emerging virulent races have not been described. Durum line 8155-B1 confers resistance against the P. graminis f. sp. tritici race TTKST, the variant race of the Ug99 race group with additional virulence to wheat stem rust resistance gene Sr24. However, 8155-B1 does not confer resistance to the first-described race in the Ug99 race group: TTKSK. We mapped a single gene conferring resistance in 8155-B1 against race TTKST, Sr8155B1, to chromosome arm 6AS by utilizing Rusty/8155-B1 and Rusty*2/8155-B1 populations and the 90K Infinium iSelect Custom bead chip supplemented by KASP assays. One marker, KASP_6AS_IWB10558, cosegregated with Sr8155B1 in both populations and correctly predicted Sr8155B1 presence or absence in 11 durum cultivars tested. We confirmed the presence of Sr8155B1 in cultivar Mountrail by mapping in the population Choteau/Mountrail. The marker developed in this study could be used to predict the presence of resistance to race TTKST in uncharacterized durum breeding lines, and also to combine Sr8155B1 with resistance genes effective to Ug99 such as Sr13. The map location of Sr8155B1 cannot rule out the possibility that this gene is an allele at the Sr8 locus. However, race specificity indicates that Sr8155B1 is different from the known alleles Sr8a and Sr8b.

Sulfonamide-resistant bacteria and their resistance genes in soils fertilized with manures from Jiangsu Province, Southeastern China.

Science.gov (United States)

Wang, Na; Yang, Xiaohong; Jiao, Shaojun; Zhang, Jun; Ye, Boping; Gao, Shixiang

2014-01-01

Antibiotic-resistant bacteria and genes are recognized as new environmental pollutants that warrant special concern. There were few reports on veterinary antibiotic-resistant bacteria and genes in China. This work systematically analyzed the prevalence and distribution of sulfonamide resistance genes in soils from the environments around poultry and livestock farms in Jiangsu Province, Southeastern China. The results showed that the animal manure application made the spread and abundance of antibiotic resistance genes (ARGs) increasingly in the soil. The frequency of sulfonamide resistance genes was sul1 > sul2 > sul3 in pig-manured soil DNA and sul2 > sul1 > sul3 in chicken-manured soil DNA. Further analysis suggested that the frequency distribution of the sul genes in the genomic DNA and plasmids of the SR isolates from manured soil was sul2 > sul1 > sul3 overall (psulfonamide resistance genes. The present study also indicated that Bacillus, Pseudomonas and Shigella were the most prevalent sul-positive genera in the soil, suggesting a potential human health risk. The above results could be important in the evaluation of antibiotic-resistant bacteria and genes from manure as sources of agricultural soil pollution; the results also demonstrate the necessity and urgency of the regulation and supervision of veterinary antibiotics in China.

2C-Methyl- D- erythritol 2,4-cyclodiphosphate synthase from Stevia rebaudiana Bertoni is a functional gene.

Science.gov (United States)

Kumar, Hitesh; Singh, Kashmir; Kumar, Sanjay

2012-12-01

Stevia [Stevia rebaudiana (Bertoni)] is a perennial herb which accumulates sweet diterpenoid steviol glycosides (SGs) in its leaf tissue. SGs are synthesized by 2C-methyl-D-erythritol 4-phosphate (MEP) pathway. Of the various enzymes of the MEP pathway, 2C-methyl-D-erythritol 2,4-cyclodiphosphate synthase (MDS) (encoded by MDS) catalyzes the cyclization of 4-(cytidine 5' diphospho)-2C-methyl-D-erythritol 2-phosphate into 2C-methyl-D-erythritol 2,4-cyclodiphosphate. Complementation of the MDS knockout mutant strain of Escherichia coli, EB370 with putative MDS of stevia (SrMDS) rescued the lethal mutant, suggesting SrMDS to be a functional gene. Experiments conducted in plant growth chamber and in the field suggested SrMDS to be a light regulated gene. Indole 3-acetic acid (IAA; 50, 100 μM) down-regulated the expression of SrMDS at 4 h of the treatment, whereas, abscisic acid did not modulate its expression. A high expression of SrMDS was observed during the light hours of the day as compared to the dark hours. The present work established functionality of SrMDS and showed the role of light and IAA in regulating expression of SrMDS.

Thioridazine affects transcription of genes involved in cell wall biosynthesis in methicillin-resistant Staphylococcus aureus

DEFF Research Database (Denmark)

Bonde, Mette; Højland, Dorte Heidi; Kolmos, Hans Jørn

2011-01-01

have previously shown that the expression of some resistance genes is abolished after treatment with thioridazine and oxacillin. To further understand the mechanism underlying the reversal of resistance, we tested the expression of genes involved in antibiotic resistance and cell wall biosynthesis...... in response to thioridazine in combination with oxacillin. We observed that the oxacillin-induced expression of genes belonging to the VraSR regulon is reduced by the addition of thioridazine. The exclusion of such key factors involved in cell wall biosynthesis will most likely lead to a weakened cell wall...... reversal of resistance by thioridazine relies on decreased expression of specific genes involved in cell wall biosynthesis....

Resistance switching in epitaxial SrCoOx thin films

Science.gov (United States)

Tambunan, Octolia T.; Parwanta, Kadek J.; Acharya, Susant K.; Lee, Bo Wha; Jung, Chang Uk; Kim, Yeon Soo; Park, Bae Ho; Jeong, Huiseong; Park, Ji-Yong; Cho, Myung Rae; Park, Yun Daniel; Choi, Woo Seok; Kim, Dong-Wook; Jin, Hyunwoo; Lee, Suyoun; Song, Seul Ji; Kang, Sung-Jin; Kim, Miyoung; Hwang, Cheol Seong

2014-08-01

We observed bipolar switching behavior from an epitaxial strontium cobaltite film grown on a SrTiO3 (001) substrate. The crystal structure of strontium cobaltite has been known to undergo topotactic phase transformation between two distinct phases: insulating brownmillerite (SrCoO2.5) and conducting perovskite (SrCoO3-δ) depending on the oxygen content. The current-voltage characteristics of the strontium cobaltite film showed that it could have a reversible insulator-to-metal transition triggered by electrical bias voltage. We propose that the resistance switching in the SrCoOx thin film could be related to the topotactic phase transformation and the peculiar structure of SrCoO2.5.

Resistance switching in epitaxial SrCoOx thin films

International Nuclear Information System (INIS)

Tambunan, Octolia T.; Parwanta, Kadek J.; Acharya, Susant K.; Lee, Bo Wha; Jung, Chang Uk; Kim, Yeon Soo; Park, Bae Ho; Jeong, Huiseong; Park, Ji-Yong; Cho, Myung Rae; Park, Yun Daniel; Choi, Woo Seok; Kim, Dong-Wook; Jin, Hyunwoo; Lee, Suyoun; Song, Seul Ji; Kang, Sung-Jin; Kim, Miyoung; Hwang, Cheol Seong

2014-01-01

We observed bipolar switching behavior from an epitaxial strontium cobaltite film grown on a SrTiO 3 (001) substrate. The crystal structure of strontium cobaltite has been known to undergo topotactic phase transformation between two distinct phases: insulating brownmillerite (SrCoO 2.5 ) and conducting perovskite (SrCoO 3−δ ) depending on the oxygen content. The current–voltage characteristics of the strontium cobaltite film showed that it could have a reversible insulator-to-metal transition triggered by electrical bias voltage. We propose that the resistance switching in the SrCoO x thin film could be related to the topotactic phase transformation and the peculiar structure of SrCoO 2.5

Inheritance and bulked segregant analysis of leaf rust and stem rust resistance genes in eight durum wheat genotypes

Science.gov (United States)

Leaf rust, caused by Puccinia triticina (Pt) and stem rust caused by Puccinia graminis f. sp. tritici (Pgt) are important diseases of durum wheat. This study determined the inheritance and genomic locations of leaf rust resistance (Lr) genes to Pt-race BBBQJ and stem rust resistance (Sr) genes to Pg...

Cu-NMR study on disordered Sr14Cu24O41

International Nuclear Information System (INIS)

Ohsugi, S.; Matsumoto, S.; Kitaoka, Y.; Matsuda, M.; Uehara, M.; Akimitsu, J.; Nagata, T.

2002-01-01

The ladder-Cu NMR spectrum of a structural disordered single crystal Sr 14 Cu 24 O 41 (Sr14-B) under a magnetic field H∝11 T gradually splits into two spectra with Curie-like broadening as T decreases from T SP ∝150 K. Short-range (SR) staggered polarization (SP) on the ladder planes, originating from single-hole localization, occurs. The separation of the Sr14-B spectrum ΔH deviates from the Curie-like T dependence below 20 K. This assures that spontaneous moments appear below T N ∝20 K in H∝11 T. (orig.)

Sulfonamide-resistant bacteria and their resistance genes in soils fertilized with manures from Jiangsu Province, Southeastern China.

Directory of Open Access Journals (Sweden)

Na Wang

Full Text Available Antibiotic-resistant bacteria and genes are recognized as new environmental pollutants that warrant special concern. There were few reports on veterinary antibiotic-resistant bacteria and genes in China. This work systematically analyzed the prevalence and distribution of sulfonamide resistance genes in soils from the environments around poultry and livestock farms in Jiangsu Province, Southeastern China. The results showed that the animal manure application made the spread and abundance of antibiotic resistance genes (ARGs increasingly in the soil. The frequency of sulfonamide resistance genes was sul1 > sul2 > sul3 in pig-manured soil DNA and sul2 > sul1 > sul3 in chicken-manured soil DNA. Further analysis suggested that the frequency distribution of the sul genes in the genomic DNA and plasmids of the SR isolates from manured soil was sul2 > sul1 > sul3 overall (p<0.05. The combination of sul1 and sul2 was the most frequent, and the co-existence of sul1 and sul3 was not found either in the genomic DNA or plasmids. The sample type, animal type and sampling time can influence the prevalence and distribution pattern of sulfonamide resistance genes. The present study also indicated that Bacillus, Pseudomonas and Shigella were the most prevalent sul-positive genera in the soil, suggesting a potential human health risk. The above results could be important in the evaluation of antibiotic-resistant bacteria and genes from manure as sources of agricultural soil pollution; the results also demonstrate the necessity and urgency of the regulation and supervision of veterinary antibiotics in China.

Transcription factor CREB is involved in CaSR-mediated cytoskeleton gene expression.

Science.gov (United States)

Huang, Shuaishuai; Ren, Yu; Wang, Ping; Li, Yanyuan; Wang, Xue; Zhuang, Haihui; Fang, Rong; Wang, Yuduo; Liu, Ningsheng; Hehir, Michael; Zhou, Jeff X

2015-03-01

Our previous studies illustrated that a steady increase of intracellular calcium concentration ([Ca2+]i) was important for maintaining microtubules (MTs) rearrangement in apoptotic cells. However, little is known about the effect of calcium sensing receptor (CaSR)-mediated increase in [Ca2+]i on cytoskeleton gene expression. We examined the impact of taxol or CaSR agonist/antagonist on the regulation of [Ca2+]i concentration, cytoskeleton arrangement, phosphorylated CREB and cytoskeleton gene expressions in HeLa cells with dominant negative plasmid of CREB (PM). This study demonstrated that Gdcl3 (a specific CaSR agonist) evoked a rapid increase of [Ca2+]i, formed a rigid bundle of MTs which surrounded the nucleus and decreased the cytoskeleton gene expressions in HeLa cells. These effects were rescued by addition of NPS2390 (a specific CaSR antagonist). Moreover, CaSR activity affected cytoskeleton gene expression through transcription factor CREB. Histoscores of pCREB immunoreactivity in tissues of cervical adenocarcinoma, renal clear cell carcinoma, and diffuse large B-cell lymphoma were markedly increased compared with non malignant tissue. These data demonstrate, for the first time, that CaSR-mediated increase in [Ca2+]i probably modulate cytoskeleton organization and gene expression via transcription factor. © 2014 Wiley Periodicals, Inc.

Defect engineering of SrTiO3 thin films for resistive switching applications

International Nuclear Information System (INIS)

Wicklein, Sebastian

2013-01-01

As a matter of fact, the importance of (transition) metal oxides for modern applications in the field of energy and information technology (IT) for e.g. novel energy storage systems and solid state electronic devices is increasing. Previous studies discovered the importance of defects in an oxide for their functionality and emphasized the impact of stoichiometry on the oxide performance. A new field of interest of the memory technology sector is the so-called resistive switching phenomena where a voltage stimulus causes a thin oxide (≤10 nm) to change its resistance state from a high resistance state to a low resistance state and back. So called resistive RAM (ReRAM or RRAM) are deemed to be the future replacement (2015) for contemporary FLASH memory technology due to its extremely low energy consumption, its very fast read/write time (ns) and its possible node size 3 was used as an oxide model material and was deposited by pulsed laser deposition (PLD) onto doped and undoped SrTiO 3 single crystals to investigate the formation of defects as a function of the process parameters. By combining structural and chemical thin film analysis with detailed PLD plume diagnostics and modeling of the laser plume dynamics, it was possible to elucidate the different physical mechanisms determining the stoichiometry of SrTiO 3 during PLD. Deviations between thin film and target stoichiometry are basically a result of two effects, namely, incongruent ablation and preferential scattering of lighter ablated species during their motion towards the substrate in the O 2 background gas. It is shown that the SrTiO 3 system reacts to a non-stoichiometry with the systematic incorporation of titanium and strontium vacancies which could be detected by positron annihilation lifetime spectroscopy. The role of extrinsic dopands such as Fe is shown to have more complicated effects on the SrTiO 3 system than portrayed by theoretical considerations. The effect of defects on the resistive

The cellular cancer resistance of the SR/CR mouse

DEFF Research Database (Denmark)

Koch, Janne; Hau, Jann; Jensen, Henrik Elvang

2012-01-01

The SR/CR mouse phenotype, first described in 1999 in BALB/c and later bred into C57BL/6 mice, is resistant to cancer formation following high doses of cancer cells administered intraperitoneally. The tumor cell targeting and destruction mechanisms have not been identified. By fluorescence-activa...... controls. Importantly, this differentially regulated immune response of SR/CR mice could not be found in response to challenge with the lymphoma cell line EL-4....

The KL24 gene cluster and a genomic island encoding a Wzy polymerase contribute genes needed for synthesis of the K24 capsular polysaccharide by the multiply antibiotic resistant Acinetobacter baumannii isolate RCH51.

Science.gov (United States)

Kenyon, Johanna J; Kasimova, Anastasiya A; Shneider, Mikhail M; Shashkov, Alexander S; Arbatsky, Nikolay P; Popova, Anastasiya V; Miroshnikov, Konstantin A; Hall, Ruth M; Knirel, Yuriy A

2017-03-01

The whole-genome sequence of the multiply antibiotic resistant Acinetobacter baumannii isolate RCH51 belonging to sequence type ST103 (Institut Pasteur scheme) revealed that the set of genes at the capsule locus, KL24, includes four genes predicted to direct the synthesis of 3-acetamido-3,6-dideoxy-d-galactose (d-Fuc3NAc), and this sugar was found in the capsular polysaccharide (CPS). One of these genes, fdtE, encodes a novel bifunctional protein with an N-terminal FdtA 3,4-ketoisomerase domain and a C-terminal acetyltransferase domain. KL24 lacks a gene encoding a Wzy polymerase to link the oligosaccharide K units to form the CPS found associated with isolate RCH51, and a wzy gene was found in a small genomic island (GI) near the cpn60 gene. This GI is in precisely the same location as another GI carrying wzy and atr genes recently found in several A. baumannii isolates, but it does not otherwise resemble it. The CPS isolated from RCH51, studied by sugar analysis and 1D and 2D 1H and 13C NMR spectroscopy, revealed that the K unit has a branched pentasaccharide structure made up of Gal, GalNAc and GlcNAc residues with d-Fuc3NAc as a side branch, and the K units are linked via a β-d-GlcpNAc-(1→3)-β-d-Galp linkage formed by the Wzy encoded by the GI. The functions of the glycosyltransferases encoded by KL24 were assigned to formation of specific bonds. A correspondence between the order of the genes in KL24 and other KL and the order of the linkages they form was noted, and this may be useful in future predictions of glycosyltransferase specificities.

Templated Atom-Precise Galvanic Synthesis and Structure Elucidation of a [Ag 24 Au(SR) 18 ] − Nanocluster

KAUST Repository

Bootharaju, Megalamane Siddaramappa

2015-11-27

Synthesis of atom-precise alloy nanoclusters with uniform composition is challenging when the alloying atoms are similar in size (for example, Ag and Au). A galvanic exchange strategy has been devised to produce a compositionally uniform [Ag24Au(SR)18]- cluster (SR: thiolate) using a pure [Ag25(SR)18]- cluster as a template. Conversely, the direct synthesis of Ag24Au cluster leads to a mixture of [Ag25-xAux(SR)18]-, x=1-8. Mass spectrometry and crystallography of [Ag24Au(SR)18]- reveal the presence of the Au heteroatom at the Ag25 center, forming Ag24Au. The successful exchange of the central Ag of Ag25 with Au causes perturbations in the Ag25 crystal structure, which are reflected in the absorption, luminescence, and ambient stability of the particle. These properties are compared with those of Ag25 and Ag24Pd clusters with same ligand and structural framework, providing new insights into the modulation of cluster properties with dopants at the single-atom level.

The spectrum of resistance in SR/CR mice: the critical role of chemoattraction in the cancer/leukocyte interaction.

Science.gov (United States)

Riedlinger, Gregory; Adams, Jonathan; Stehle, John R; Blanks, Michael J; Sanders, Anne M; Hicks, Amy M; Willingham, Mark C; Cui, Zheng

2010-05-03

Spontaneous regression/complete resistance (SR/CR) mice are a unique colony of mice that possess an inheritable, natural cancer resistance mediated primarily by innate cellular immunity. This resistance is effective against sarcoma 180 (S180) at exceptionally high doses and these mice remain healthy. In this study, we challenged SR/CR mice with additional lethal transplantable mouse cancer cell lines to determine their resistance spectrum. The ability of these transplantable cancer cell lines to induce leukocyte infiltration was quantified and the percentage of different populations of responding immune cells was determined using flow cytometry. In comparison to wild type (WT) mice, SR/CR mice showed significantly higher resistance to all cancer cell lines tested. However, SR/CR mice were more sensitive to MethA sarcoma (MethA), B16 melanoma (B16), LL/2 lung carcinoma (LL/2) and J774 lymphoma (J774) than to sarcoma 180 (S180) and EL-4 lymphoma (EL-4). Further mechanistic studies revealed that this lower resistance to MethA and LL/2 was due to the inability of these cancer cells to attract SR/CR leukocytes, leading to tumor cell escape from resistance mechanism. This escape mechanism was overcome by co-injection with S180, which could attract SR/CR leukocytes allowing the mice to resist higher doses of MethA and LL/2. S180-induced cell-free ascites fluid (CFAF) co-injection recapitulated the results obtained with live S180 cells, suggesting that this chemoattraction by cancer cells is mediated by diffusible molecules. We also tested for the first time whether SR/CR mice were able to resist additional cancer cell lines prior to S180 exposure. We found that SR/CR mice had an innate resistance against EL-4 and J774. Our results suggest that the cancer resistance in SR/CR mice is based on at least two separate processes: leukocyte migration/infiltration to the site of cancer cells and recognition of common surface properties on cancer cells. The infiltration of SR

The spectrum of resistance in SR/CR mice: the critical role of chemoattraction in the cancer/leukocyte interaction

International Nuclear Information System (INIS)

Riedlinger, Gregory; Adams, Jonathan; Stehle, John R Jr; Blanks, Michael J; Sanders, Anne M; Hicks, Amy M; Willingham, Mark C; Cui, Zheng

2010-01-01

Spontaneous regression/complete resistance (SR/CR) mice are a unique colony of mice that possess an inheritable, natural cancer resistance mediated primarily by innate cellular immunity. This resistance is effective against sarcoma 180 (S180) at exceptionally high doses and these mice remain healthy. In this study, we challenged SR/CR mice with additional lethal transplantable mouse cancer cell lines to determine their resistance spectrum. The ability of these transplantable cancer cell lines to induce leukocyte infiltration was quantified and the percentage of different populations of responding immune cells was determined using flow cytometry. In comparison to wild type (WT) mice, SR/CR mice showed significantly higher resistance to all cancer cell lines tested. However, SR/CR mice were more sensitive to MethA sarcoma (MethA), B16 melanoma (B16), LL/2 lung carcinoma (LL/2) and J774 lymphoma (J774) than to sarcoma 180 (S180) and EL-4 lymphoma (EL-4). Further mechanistic studies revealed that this lower resistance to MethA and LL/2 was due to the inability of these cancer cells to attract SR/CR leukocytes, leading to tumor cell escape from resistance mechanism. This escape mechanism was overcome by co-injection with S180, which could attract SR/CR leukocytes allowing the mice to resist higher doses of MethA and LL/2. S180-induced cell-free ascites fluid (CFAF) co-injection recapitulated the results obtained with live S180 cells, suggesting that this chemoattraction by cancer cells is mediated by diffusible molecules. We also tested for the first time whether SR/CR mice were able to resist additional cancer cell lines prior to S180 exposure. We found that SR/CR mice had an innate resistance against EL-4 and J774. Our results suggest that the cancer resistance in SR/CR mice is based on at least two separate processes: leukocyte migration/infiltration to the site of cancer cells and recognition of common surface properties on cancer cells. The infiltration of SR

Resistance switching in epitaxial SrCoO{sub x} thin films

Energy Technology Data Exchange (ETDEWEB)

Tambunan, Octolia T.; Parwanta, Kadek J.; Acharya, Susant K.; Lee, Bo Wha; Jung, Chang Uk, E-mail: cu-jung@hufs.ac.kr [Department of Physics, Hankuk University of Foreign Studies, Yongin 449-791 (Korea, Republic of); Kim, Yeon Soo; Park, Bae Ho [Division of Quantum Phases and Devices, Department of Physics, Konkuk University, Seoul 143-791 (Korea, Republic of); Jeong, Huiseong; Park, Ji-Yong [Department of Physics and Division of Energy System Research, Ajou University, Suwon 443-749 (Korea, Republic of); Cho, Myung Rae; Park, Yun Daniel [Department of Physics and Astronomy and Center for Subwavelength Optics, Seoul National University, Seoul 151-747 (Korea, Republic of); Choi, Woo Seok [Department of Physics, Sungkyunkwan University, Suwon 440-746 (Korea, Republic of); Kim, Dong-Wook [Department of Physics, Ewha Womans University, Seoul 120-750 (Korea, Republic of); Jin, Hyunwoo; Lee, Suyoun [Electronic Materials Research Center, Korea Institute of Science and Technology, Seoul 136-791 (Korea, Republic of); Song, Seul Ji; Kang, Sung-Jin; Kim, Miyoung; Hwang, Cheol Seong [Department of Material Science and Engineering, Seoul National University, Seoul 151-747 (Korea, Republic of)

2014-08-11

We observed bipolar switching behavior from an epitaxial strontium cobaltite film grown on a SrTiO{sub 3} (001) substrate. The crystal structure of strontium cobaltite has been known to undergo topotactic phase transformation between two distinct phases: insulating brownmillerite (SrCoO{sub 2.5}) and conducting perovskite (SrCoO{sub 3−δ}) depending on the oxygen content. The current–voltage characteristics of the strontium cobaltite film showed that it could have a reversible insulator-to-metal transition triggered by electrical bias voltage. We propose that the resistance switching in the SrCoO{sub x} thin film could be related to the topotactic phase transformation and the peculiar structure of SrCoO{sub 2.5}.

Nonvolatile resistive switching in Pt/laALO3/srTiO3 heterostructures

KAUST Repository

Wu, S.

2013-12-12

Resistive switching heterojunctions, which are promising for nonvolatile memory applications, usually share a capacitorlike metal-oxide-metal configuration. Here, we report on the nonvolatile resistive switching in Pt/LaAlO3/SrTiO3 heterostructures, where the conducting layer near the LaAlO3/SrTiO3 interface serves as the "unconventional"bottom electrode although both oxides are band insulators. Interestingly, the switching between low-resistance and high-resistance states is accompanied by reversible transitions between tunneling and Ohmic characteristics in the current transport perpendicular to the planes of the heterojunctions. We propose that the observed resistive switching is likely caused by the electric-field-induced drift of charged oxygen vacancies across the LaAlO3/SrTiO3 interface and the creation of defect-induced gap states within the ultrathin LaAlO3 layer. These metal-oxide-oxide heterojunctions with atomically smooth interfaces and defect-controlled transport provide a platform for the development of nonvolatile oxide nanoelectronics that integrate logic and memory devices.

Mapping and characterization of wheat stem rust resistance genes SrTm5 and Sr60 from Triticum monococcum

Science.gov (United States)

The emergence and spread of new virulent races of the wheat stem rust pathogen (Puccinia graminis f. sp. tritici; Pgt), including the TTKSK (Ug99) race group, is a serious threat to global wheat production. In this study, we mapped and characterized two stem rust resistance genes from diploid wheat ...

Defect engineering of SrTiO{sub 3} thin films for resistive switching applications

Energy Technology Data Exchange (ETDEWEB)

Wicklein, Sebastian

2013-11-19

As a matter of fact, the importance of (transition) metal oxides for modern applications in the field of energy and information technology (IT) for e.g. novel energy storage systems and solid state electronic devices is increasing. Previous studies discovered the importance of defects in an oxide for their functionality and emphasized the impact of stoichiometry on the oxide performance. A new field of interest of the memory technology sector is the so-called resistive switching phenomena where a voltage stimulus causes a thin oxide (≤10 nm) to change its resistance state from a high resistance state to a low resistance state and back. So called resistive RAM (ReRAM or RRAM) are deemed to be the future replacement (2015) for contemporary FLASH memory technology due to its extremely low energy consumption, its very fast read/write time (ns) and its possible node size <10 nm. A key challenge for the investigation of oxides and their electronic properties is the management and controlled incorporation of defects in the thin film oxide. Within this work, SrTiO{sub 3} was used as an oxide model material and was deposited by pulsed laser deposition (PLD) onto doped and undoped SrTiO{sub 3} single crystals to investigate the formation of defects as a function of the process parameters. By combining structural and chemical thin film analysis with detailed PLD plume diagnostics and modeling of the laser plume dynamics, it was possible to elucidate the different physical mechanisms determining the stoichiometry of SrTiO{sub 3} during PLD. Deviations between thin film and target stoichiometry are basically a result of two effects, namely, incongruent ablation and preferential scattering of lighter ablated species during their motion towards the substrate in the O{sub 2} background gas. It is shown that the SrTiO{sub 3} system reacts to a non-stoichiometry with the systematic incorporation of titanium and strontium vacancies which could be detected by positron annihilation

Development of 25 near-isogenic lines (NILs) with ten BPH resistance genes in rice (Oryza sativa L.): production, resistance spectrum, and molecular analysis.

Science.gov (United States)

Jena, Kshirod K; Hechanova, Sherry Lou; Verdeprado, Holden; Prahalada, G D; Kim, Sung-Ryul

2017-11-01

A first set of 25 NILs carrying ten BPH resistance genes and their pyramids was developed in the background of indica variety IR24 for insect resistance breeding in rice. Brown planthopper (Nilaparvata lugens Stal.) is one of the most destructive insect pests in rice. Development of near-isogenic lines (NILs) is an important strategy for genetic analysis of brown planthopper (BPH) resistance (R) genes and their deployment against diverse BPH populations. A set of 25 NILs with 9 single R genes and 16 multiple R gene combinations consisting of 11 two-gene pyramids and 5 three-gene pyramids in the genetic background of the susceptible indica rice cultivar IR24 was developed through marker-assisted selection. The linked DNA markers for each of the R genes were used for foreground selection and confirming the introgressed regions of the BPH R genes. Modified seed box screening and feeding rate of BPH were used to evaluate the spectrum of resistance. BPH reaction of each of the NILs carrying different single genes was variable at the antibiosis level with the four BPH populations of the Philippines. The NILs with two- to three-pyramided genes showed a stronger level of antibiosis (49.3-99.0%) against BPH populations compared with NILs with a single R gene NILs (42.0-83.5%) and IR24 (10.0%). Background genotyping by high-density SNPs markers revealed that most of the chromosome regions of the NILs (BC 3 F 5 ) had IR24 genome recovery of 82.0-94.2%. Six major agronomic data of the NILs showed a phenotypically comparable agronomic performance with IR24. These newly developed NILs will be useful as new genetic resources for BPH resistance breeding and are valuable sources of genes in monitoring against the emerging BPH biotypes in different rice-growing countries.

Nonvolatile Resistive Switching in Pt/LaAlO_{3}/SrTiO_{3} Heterostructures

Directory of Open Access Journals (Sweden)

Shuxiang Wu

2013-12-01

Full Text Available Resistive switching heterojunctions, which are promising for nonvolatile memory applications, usually share a capacitorlike metal-oxide-metal configuration. Here, we report on the nonvolatile resistive switching in Pt/LaAlO_{3}/SrTiO_{3} heterostructures, where the conducting layer near the LaAlO_{3}/SrTiO_{3} interface serves as the “unconventional” bottom electrode although both oxides are band insulators. Interestingly, the switching between low-resistance and high-resistance states is accompanied by reversible transitions between tunneling and Ohmic characteristics in the current transport perpendicular to the planes of the heterojunctions. We propose that the observed resistive switching is likely caused by the electric-field-induced drift of charged oxygen vacancies across the LaAlO_{3}/SrTiO_{3} interface and the creation of defect-induced gap states within the ultrathin LaAlO_{3} layer. These metal-oxide-oxide heterojunctions with atomically smooth interfaces and defect-controlled transport provide a platform for the development of nonvolatile oxide nanoelectronics that integrate logic and memory devices.

Splicing factor SR34b mutation reduces cadmium tolerance in Arabidopsis by regulating iron-regulated transporter 1 gene

International Nuclear Information System (INIS)

Zhang, Wentao; Du, Bojing; Liu, Di; Qi, Xiaoting

2014-01-01

Highlights: • Arabidopsis splicing factor SR34b gene is cadmium-inducible. • SR34b T-DNA insertion mutant is sensitive to cadmium due to high cadmium uptake. • SR34b is a regulator of cadmium transporter IRT1 at the posttranscription level. • These results highlight the roles of splicing factors in cadmium tolerance of plant. - Abstract: Serine/arginine-rich (SR) proteins are important splicing factors. However, the biological functions of plant SR proteins remain unclear especially in abiotic stresses. Cadmium (Cd) is a non-essential element that negatively affects plant growth and development. In this study, we provided clear evidence for SR gene involved in Cd tolerance in planta. Systemic expression analysis of 17 Arabidopsis SR genes revealed that SR34b is the only SR gene upregulated by Cd, suggesting its potential roles in Arabidopsis Cd tolerance. Consistent with this, a SR34b T-DNA insertion mutant (sr34b) was moderately sensitive to Cd, which had higher Cd 2+ uptake rate and accumulated Cd in greater amounts than wild-type. This was due to the altered expression of iron-regulated transporter 1 (IRT1) gene in sr34b mutant. Under normal growth conditions, IRT1 mRNAs highly accumulated in sr34b mutant, which was a result of increased stability of IRT1 mRNA. Under Cd stress, however, sr34b mutant plants had a splicing defect in IRT1 gene, thus reducing the IRT1 mRNA accumulation. Despite of this, sr34b mutant plants still constitutively expressed IRT1 proteins under Cd stress, thereby resulting in Cd stress-sensitive phenotype. We therefore propose the essential roles of SR34b in posttranscriptional regulation of IRT1 expression and identify it as a regulator of Arabidopsis Cd tolerance

Splicing factor SR34b mutation reduces cadmium tolerance in Arabidopsis by regulating iron-regulated transporter 1 gene

Energy Technology Data Exchange (ETDEWEB)

Zhang, Wentao; Du, Bojing; Liu, Di; Qi, Xiaoting, E-mail: qixiaoting@cnu.edu.cn

2014-12-12

Highlights: • Arabidopsis splicing factor SR34b gene is cadmium-inducible. • SR34b T-DNA insertion mutant is sensitive to cadmium due to high cadmium uptake. • SR34b is a regulator of cadmium transporter IRT1 at the posttranscription level. • These results highlight the roles of splicing factors in cadmium tolerance of plant. - Abstract: Serine/arginine-rich (SR) proteins are important splicing factors. However, the biological functions of plant SR proteins remain unclear especially in abiotic stresses. Cadmium (Cd) is a non-essential element that negatively affects plant growth and development. In this study, we provided clear evidence for SR gene involved in Cd tolerance in planta. Systemic expression analysis of 17 Arabidopsis SR genes revealed that SR34b is the only SR gene upregulated by Cd, suggesting its potential roles in Arabidopsis Cd tolerance. Consistent with this, a SR34b T-DNA insertion mutant (sr34b) was moderately sensitive to Cd, which had higher Cd{sup 2+} uptake rate and accumulated Cd in greater amounts than wild-type. This was due to the altered expression of iron-regulated transporter 1 (IRT1) gene in sr34b mutant. Under normal growth conditions, IRT1 mRNAs highly accumulated in sr34b mutant, which was a result of increased stability of IRT1 mRNA. Under Cd stress, however, sr34b mutant plants had a splicing defect in IRT1 gene, thus reducing the IRT1 mRNA accumulation. Despite of this, sr34b mutant plants still constitutively expressed IRT1 proteins under Cd stress, thereby resulting in Cd stress-sensitive phenotype. We therefore propose the essential roles of SR34b in posttranscriptional regulation of IRT1 expression and identify it as a regulator of Arabidopsis Cd tolerance.

Resistance change effect in SrTiO3/Si (001) isotype heterojunction

Science.gov (United States)

Huang, Xiushi; Gao, Zhaomeng; Li, Pei; Wang, Longfei; Liu, Xiansheng; Zhang, Weifeng; Guo, Haizhong

2018-02-01

Resistance switching has been observed in double and multi-layer structures of ferroelectric films. The higher switching ratio opens up a vast path for emerging ferroelectric semiconductor devices. An n-n+ isotype heterojunction has been fabricated by depositing an oxide SrTiO3 layer on a conventional n-type Si (001) substrate (SrTiO3/Si) by pulsed laser disposition. Rectification and resistive switching behaviors in the n-n+ SrTiO3/Si heterojunction were observed by a conductive atomic force microscopy, and the n-n+ SrTiO3/Si heterojunction exhibits excellent endurance and retention characteristics. The possible mechanism was proposed based on the band structure of the n-n+ SrTiO3/Si heterojunction, and the observed electrical behaviors could be attributed to the modulation effect of the electric field reversal on the width of accumulation and the depletion region, as well as the height of potential of the n-n+ junction formed at the STO/Si interface. Moreover, oxygen vacancies are also indicated to play a crucial role in causing insulator to semiconductor transition. These results open the way to potential application in future microelectronic devices based on perovskite oxide layers on conventional semiconductors.

Synthesis and luminescence behavior of SrGd1.76Eu0.24O4 host for display and dosimetric applications

Science.gov (United States)

Singh, Jyoti; Manam, J.; Singh, Fouran

2018-05-01

Novel SrGd1.76Eu0.24O4 materials were synthesized by conventional high-temperature solid-state reaction method in air ambiance. The structural and luminescence properties of as-prepared phosphors were explored by XRD, FESEM, TEM, PL and TL techniques. The confirmation of orthorhombic phase formation was obtained by XRD studies. The agglomerated ginger-like morphology of as-synthesized SrGd1.76Eu0.24O4 samples was unfolded by FESEM and TEM studies. Upon 276 and 395 nm UV excitation, SrGd1.76Eu0.24O4 phosphors showed intense red emission. The TL glow curve of SrGd1.76Eu0.24O4 irradiated with γ-rays exhibits two well-resolved peaks at 393 K and 598 K having a shoulder at 537 K. Linearity in a wide dose range 500 Gy-3 kGy are observed in the as-formed SrGd1.76Eu0.24O4 samples. Intense red emission, linear dose response and high reproducibility of SrGd1.76Eu0.24O4 samples broadly indicated its suitability for display and TL dosimetry applications.

Doping effect on electronic transport properties of Sr14(Cu1-y M y )24O41 (M=Zn, Ni)

International Nuclear Information System (INIS)

Xie Hui; Hu Ni; Wang Lili; Lin Ying; Xiong Rui; Yu Zuxing; Tang Wufeng; Wang Ququan; Shi Jing

2006-01-01

Polycrystalline samples of Sr 14 (Cu 1- y M y ) 24 O 41 (M=Zn/Ni) were prepared by conventional solid-state reaction. The series of samples up to y≤0.05 are identified to be single phase and no regular shift of lattice parameters a, b, c is found. The measurements of electronic transport show that although the doping compounds are still semiconductive as the parent phase, Zn and Ni dopants induce a decrease of electrical resistivity. Furthermore, Zn doping depresses the resistivity more significantly than Ni doping. A crossover temperature T ρ that exhibits in the Arrhenius plot of the resistivity versus temperature is observed in all the samples and goes up with the increase of the dopants. The origin of the decrease in resistivity with doping and the conduction mechanisms both above T ρ and below T ρ are discussed

Major haplotype divergence including multiple germin-like protein genes, at the wheat Sr2 adult plant stem rust resistance locus

Czech Academy of Sciences Publication Activity Database

Mago, R.; Tabe, L.; Vautrin, S.; Šimková, Hana; Kubaláková, Marie; Upadhyaya, N.; Berges, H.; Kong, X.Y.; Breen, J.; Doležel, Jaroslav; Appels, R.; Ellis, J.G.; Spielmeyer, W.

2014-01-01

Roč. 14, č. 379 (2014) ISSN 1471-2229 R&D Projects: GA ČR GBP501/12/G090; GA MŠk(CZ) LO1204 Institutional support: RVO:61389030 Keywords : Adult plant resistance (APR) * Map-based cloning * Sr2 Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.813, year: 2014

Rust resistance evaluation of advanced wheat (triticum aestivum l.) genotypes using pcr-based dna markers

International Nuclear Information System (INIS)

Rahman, S.U.; Younis, M.; Iqbal, M.Z.; Nawaz, M.

2014-01-01

The most effective and environmental friendly approach for the control of wheat rust disease is the use of resistant genotypes. The present study was conducted to explore rust resistance potential of 85 elite wheat genotypes (36 varieties and 49 advanced lines) using various types of DNA markers like STS, SCAR and SSR. DNA markers linked with different genes conferring resistance to rusts (Leaf rust=Lr, Yellow rust=Yr and Stem rust=Sr) were employed in this study. A total of 18 genes, consisting of eleven Lr (lr1, lr10, lr19, lr21, lr28, lr34, lr39, lr46, lr47, lr51 and lr52), four Yr (yr5, yr18, yr26 and yr29) and three Sr genes (sr2, sr29, and sr36) were studied through linked DNA markers. Maximum number of Lr genes was found in 17 advanced lines and 9 varieties, Yr genes in 26 advanced lines and 20 wheat varieties, and Sr genes in 43 advanced lines and 27 varieties. Minimum number of Lr genes was found in advanced line D-97 and variety Kohinoor-83, Yr genes in wheat variety Bwp-97 and Sr genes in 6 advanced lines and 8 varieties. Molecular data revealed that genotypes having same origin, from a specified area showed resistance for similar type of genes. In this study, an average similarity of 84% was recorded among wheat genotypes. Out of 18 loci, 15 were found to be polymorphic. (author)

Nonvolatile resistive switching in Pt/laALO3/srTiO3 heterostructures

KAUST Repository

Wu, S.; Luo, X.; Turner, S.; Peng, H.; Lin, W.; Ding, J.; David, A.; Wang, B.; Van, Tendeloo, G.; Wang, J.; Wu, Tao

2013-01-01

Resistive switching heterojunctions, which are promising for nonvolatile memory applications, usually share a capacitorlike metal-oxide-metal configuration. Here, we report on the nonvolatile resistive switching in Pt/LaAlO3/SrTiO3 heterostructures

The wheat Lr34 multipathogen resistance gene confers resistance to anthracnose and rust in sorghum.

Science.gov (United States)

Schnippenkoetter, Wendelin; Lo, Clive; Liu, Guoquan; Dibley, Katherine; Chan, Wai Lung; White, Jodie; Milne, Ricky; Zwart, Alexander; Kwong, Eunjung; Keller, Beat; Godwin, Ian; Krattinger, Simon G; Lagudah, Evans

2017-11-01

The ability of the wheat Lr34 multipathogen resistance gene (Lr34res) to function across a wide taxonomic boundary was investigated in transgenic Sorghum bicolor. Increased resistance to sorghum rust and anthracnose disease symptoms following infection with the biotrophic pathogen Puccinia purpurea and the hemibiotroph Colletotrichum sublineolum, respectively, occurred in transgenic plants expressing the Lr34res ABC transporter. Transgenic sorghum lines that highly expressed the wheat Lr34res gene exhibited immunity to sorghum rust compared to the low-expressing single copy Lr34res genotype that conferred partial resistance. Pathogen-induced pigmentation mediated by flavonoid phytoalexins was evident on transgenic sorghum leaves following P. purpurea infection within 24-72 h, which paralleled Lr34res gene expression. Elevated expression of flavone synthase II, flavanone 4-reductase and dihydroflavonol reductase genes which control the biosynthesis of flavonoid phytoalexins characterized the highly expressing Lr34res transgenic lines 24-h post-inoculation with P. purpurea. Metabolite analysis of mesocotyls infected with C. sublineolum showed increased levels of 3-deoxyanthocyanidin metabolites were associated with Lr34res expression, concomitant with reduced symptoms of anthracnose. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

CD133+CD24lo defines a 5-Fluorouracil-resistant colon cancer stem cell-like phenotype

Science.gov (United States)

Paschall, Amy V.; Yang, Dafeng; Lu, Chunwan; Redd, Priscilla S.; Choi, Jeong-Hyeon; Heaton, Christopher M.; Lee, Jeffrey R.; Nayak-Kapoor, Asha; Liu, Kebin

2016-01-01

The chemotherapeutic agent 5-Fluorouracil (5-FU) is the most commonly used drug for patients with advanced colon cancer. However, development of resistance to 5-FU is inevitable in almost all patients. The mechanism by which colon cancer develops 5-FU resistance is still unclear. One recently proposed theory is that cancer stem-like cells underlie colon cancer 5-FU resistance, but the phenotypes of 5-FU-resistant colon cancer stem cells are still controversial. We report here that 5-FU treatment selectively enriches a subset of CD133+ colon cancer cells in vitro. 5-FU chemotherapy also increases CD133+ tumor cells in human colon cancer patients. However, sorted CD133+ colon cancer cells exhibit no increased resistance to 5-FU, and CD133 levels exhibit no correlation with colon cancer patient survival or cancer recurrence. Genome-wide analysis of gene expression between sorted CD133+ colon cancer cells and 5-FU-selected colon cancer cells identifies 207 differentially expressed genes. CD24 is one of the genes whose expression level is lower in the CD133+ and 5-FU-resistant colon cancer cells as compared to CD133+ and 5-FU-sensitive colon cancer cells. Consequently, CD133+CD24lo cells exhibit decreased sensitivity to 5-FU. Therefore, we determine that CD133+CD24lo phenotype defines 5-FU-resistant human colon cancer stem cell-like cells. PMID:27659530

Inheritance and Bulked Segregant Analysis of Leaf Rust and Stem Rust Resistance in Durum Wheat Genotypes.

Science.gov (United States)

Aoun, Meriem; Kolmer, James A; Rouse, Matthew N; Chao, Shiaoman; Bulbula, Worku Denbel; Elias, Elias M; Acevedo, Maricelis

2017-12-01

Leaf rust, caused by Puccinia triticina, and stem rust, caused by P. graminis f. sp. tritici, are important diseases of durum wheat. This study determined the inheritance and genomic locations of leaf rust resistance (Lr) genes to P. triticina race BBBQJ and stem rust resistance (Sr) genes to P. graminis f. sp. tritici race TTKSK in durum accessions. Eight leaf-rust-resistant genotypes were used to develop biparental populations. Accessions PI 192051 and PI 534304 were also resistant to P. graminis f. sp. tritici race TTKSK. The resulting progenies were phenotyped for leaf rust and stem rust response at seedling stage. The Lr and Sr genes were mapped in five populations using single-nucleotide polymorphisms and bulked segregant analysis. Five leaf-rust-resistant genotypes carried single dominant Lr genes whereas, in the remaining accessions, there was deviation from the expected segregation ratio of a single dominant Lr gene. Seven genotypes carried Lr genes different from those previously characterized in durum. The single dominant Lr genes in PI 209274, PI 244061, PI387263, and PI 313096 were mapped to chromosome arms 6BS, 2BS, 6BL, and 6BS, respectively. The Sr gene in PI 534304 mapped to 6AL and is most likely Sr13, while the Sr gene in PI 192051 could be uncharacterized in durum.

Cancer resistance of SR/CR mice in the genetic knockout backgrounds of leukocyte effector mechanisms: determinations for functional requirements.

Science.gov (United States)

Sanders, Anne M; Stehle, John R; Blanks, Michael J; Riedlinger, Gregory; Kim-Shapiro, Jung W; Monjazeb, Arta M; Adams, Jonathan M; Willingham, Mark C; Cui, Zheng

2010-03-31

Spontaneous Regression/Complete Resistant (SR/CR) mice are a colony of cancer-resistant mice that can detect and rapidly destroy malignant cells with innate cellular immunity, predominately mediated by granulocytes. Our previous studies suggest that several effector mechanisms, such as perforin, granzymes, or complements, may be involved in the killing of cancer cells. However, none of these effector mechanisms is known as critical for granulocytes. Additionally, it is unclear which effector mechanisms are required for the cancer killing activity of specific leukocyte populations and the survival of SR/CR mice against the challenges of lethal cancer cells. We hypothesized that if any of these effector mechanisms was required for the resistance to cancer cells, its functional knockout in SR/CR mice should render them sensitive to cancer challenges. This was tested by cross breeding SR/CR mice into the individual genetic knockout backgrounds of perforin (Prf-/-), superoxide (Cybb-/), or inducible nitric oxide (Nos2-/). SR/CR mice were bred into individual Prf-/-, Cybb-/-, or Nos2-/- genetic backgrounds and then challenged with sarcoma 180 (S180). Their overall survival was compared to controls. The cancer killing efficiency of purified populations of macrophages and neutrophils from these immunodeficient mice was also examined. When these genetically engineered mice were challenged with cancer cells, the knockout backgrounds of Prf-/-, Cybb-/-, or Nos2-/- did not completely abolish the SR/CR cancer resistant phenotype. However, the Nos2-/- background did appear to weaken the resistance. Incidentally, it was also observed that the male mice in these immunocompromised backgrounds tended to be less cancer-resistant than SR/CR controls. Despite the previously known roles of perforin, superoxide or nitric oxide in the effector mechanisms of innate immune responses, these effector mechanisms were not required for cancer-resistance in SR/CR mice. The resistance was

Targeted introgression of a wheat stem rust resistance gene by DNA marker-assisted chromosome engineering.

Science.gov (United States)

Niu, Zhixia; Klindworth, Daryl L; Friesen, Timothy L; Chao, Shiaoman; Jin, Yue; Cai, Xiwen; Xu, Steven S

2011-04-01

Chromosome engineering is a useful strategy for transfer of alien genes from wild relatives into modern crops. However, this strategy has not been extensively used for alien gene introgression in most crops due to low efficiency of conventional cytogenetic techniques. Here, we report an improved scheme of chromosome engineering for efficient elimination of a large amount of goatgrass (Aegilops speltoides) chromatin surrounding Sr39, a gene that provides resistance to multiple stem rust races, including Ug99 (TTKSK) in wheat. The wheat ph1b mutation, which promotes meiotic pairing between homoeologous chromosomes, was employed to induce recombination between wheat chromosome 2B and goatgrass 2S chromatin using a backcross scheme favorable for inducing and detecting the homoeologous recombinants with small goatgrass chromosome segments. Forty recombinants with Sr39 with reduced surrounding goatgrass chromatin were quickly identified from 1048 backcross progenies through disease screening and molecular marker analysis. Four of the recombinants carrying Sr39 with a minimal amount of goatgrass chromatin (2.87-9.15% of the translocated chromosomes) were verified using genomic in situ hybridization. Approximately 97% of the goatgrass chromatin was eliminated in one of the recombinants, in which a tiny goatgrass chromosome segment containing Sr39 was retained in the wheat genome. Localization of the goatgrass chromatin in the recombinants led to rapid development of three molecular markers tightly linked to Sr39. The new wheat lines and markers provide useful resources for the ongoing global effort to combat Ug99. This study has demonstrated great potential of chromosome engineering in genome manipulation for plant improvement.

Observation of field-induced long-range order in disordered Sr14Cu24O41

International Nuclear Information System (INIS)

Ohsugi, S.; Matsumoto, S.; Kitaoka, Y.; Matsuda, M.; Uehara, M.; Nagata, T.; Akimitsu, J.

2004-01-01

Field-induced magnetic order in a structural disordered single-crystal Sr 14 Cu 24 O 41 (Sr 14 -B) has been observed in the Cu-nuclear magnetic resonance (NMR) measurements for the ladder sites below 20 K under the magnetic field H∼11 T. For the Zhang Rice (ZR) sites in the chains, the spectrum splits below 20 K due to an appearance of the internal field, whereas that of less disordered Sr 14 -A does not. This gives an evidence of three-dimensional (3D) long-range (LR) ordering in Sr 14 -B below T N ∼20 K under H∼11 T

SR proteins in vertical integration of gene expression from transcription to RNA processing to translation.

Science.gov (United States)

Zhong, Xiang-Yang; Wang, Pingping; Han, Joonhee; Rosenfeld, Michael G; Fu, Xiang-Dong

2009-07-10

SR proteins have been studied extensively as a family of RNA-binding proteins that participate in both constitutive and regulated pre-mRNA splicing in mammalian cells. However, SR proteins were first discovered as factors that interact with transcriptionally active chromatin. Recent studies have now uncovered properties that connect these once apparently disparate functions, showing that a subset of SR proteins seem to bind directly to the histone 3 tail, play an active role in transcriptional elongation, and colocalize with genes that are engaged in specific intra- and interchromosome interactions for coordinated regulation of gene expression in the nucleus. These transcription-related activities are also coupled with a further expansion of putative functions of specific SR protein family members in RNA metabolism downstream of mRNA splicing, from RNA export to stability control to translation. These findings, therefore, highlight the broader roles of SR proteins in vertical integration of gene expression and provide mechanistic insights into their contributions to genome stability and proper cell-cycle progression in higher eukaryotic cells.

Resistance switching mechanism of La_0_._8Sr_0_._2MnO_3_−_δ thin films

International Nuclear Information System (INIS)

Luo, X.D.; Gao, R.L.; Fu, C.L.; Cai, W.; Chen, G.; Deng, X.L.; Zhang, H.R; Sun, J.R.

2016-01-01

Effects of oxygen vacancies on the electrical transport properties of oxygen stoichiometric La_0_._8Sr_0_._2MnO_3 and oxygen-deficient La_0_._8Sr_0_._2MnO_3_−_δ films have been investigated. The result presents that the oxygen-deficient films annealed in vacuum show obvious increase of resistance and lattice parameter. With the sweeping voltage or temperature increasing, the resistance exhibits obvious bipolar switching effect, no forming process was needed. Oxygen deficiency in the annealed film leads to the formation of a structural disorder in the Mn–O–Mn conduction channel due to the accumulation of oxygen vacancies under high external electric field or temperatures and hence is believed to be responsible for the bipolar resistance switching effect and the enhanced resistivity compared with oxygen stoichiometric La_0_._8Sr_0_._2MnO_3 film. These results may be important for practical applications in photoelectric or storage devices and point to a useful direction for other oxidizing materials.

Functional study of the novel multidrug resistance gene HA117 and its comparison to multidrug resistance gene 1

Directory of Open Access Journals (Sweden)

Chen Tingfu

2010-07-01

Full Text Available Abstract Background The novel gene HA117 is a multidrug resistance (MDR gene expressed by all-trans retinoic acid-resistant HL-60 cells. In the present study, we compared the multidrug resistance of the HA117 with that of the classical multidrug resistance gene 1 (MDR1 in breast cancer cell line 4T1. Methods Transduction of the breast cancer cell line 4T1 with adenoviral vectors encoding the HA117 gene and the green fluorescence protein gene (GFP (Ad-GFP-HA117, the MDR1 and GFP (Ad-GFP-MDR1 or GFP (Ad-GFP was respectively carried out. The transduction efficiency and the multiplicity of infection (MOI were detected by fluorescence microscope and flow cytometry. The transcription of HA117 gene and MDR1 gene were detected by reverse transcription polymerase chain reaction (RT-PCR. Western blotting analysis was used to detect the expression of P-glycoprotein (P-gp but the expression of HA117 could not be analyzed as it is a novel gene and its antibody has not yet been synthesized. The drug-excretion activity of HA117 and MDR1 were determined by daunorubicin (DNR efflux assay. The drug sensitivities of 4T1/HA117 and 4T1/MDR1 to chemotherapeutic agents were detected by Methyl-Thiazolyl-Tetrazolium (MTT assay. Results The transducted efficiency of Ad-GFP-HA117 and Ad-GFP-MDR1 were 75%-80% when MOI was equal to 50. The transduction of Ad-GFP-HA117 and Ad-GFP-MDR1 could increase the expression of HA117 and MDR1. The drug resistance index to Adriamycin (ADM, vincristine (VCR, paclitaxel (Taxol and bleomycin (BLM increased to19.8050, 9.0663, 9.7245, 3.5650 respectively for 4T1/HA117 and 24.2236, 11.0480, 11.3741, 0.9630 respectively for 4T1/MDR1 as compared to the control cells. There were no significant differences in drug sensitivity between 4T1/HA117 and 4T1/MDR1 for the P-gp substrates (ADM, VCR and Taxol (P Conclusions These results confirm that HA117 is a strong MDR gene in both HL-60 and 4T1 cells. Furthermore, our results indicate that the MDR

Rapid selection of Plasmodium falciparum chloroquine resistance transporter gene and multidrug resistance gene-1 haplotypes associated with past chloroquine and present artemether-lumefantrine use in Inhambane District, southern Mozambique

DEFF Research Database (Denmark)

Thomsen, Thomas T; Madsen, Laura B; Hansson, Helle H

2013-01-01

Chloroquine (CQ) use in Mozambique was stopped in 2002 and artemether-lumefantrine (AL) was implemented in 2008. In light of no use of CQ and extensive use of AL, we determined the frequency of molecular markers of Plasmodium falciparum drug resistance/tolerance to CQ and AL in persons living...... in Linga-Linga, an isolated peninsula and in Furvela village, which is located 8 km inland. The P. falciparum chloroquine resistance transporter gene CVMNK wild type increased in frequency from 43.9% in 2009 to 66.4% in 2010 (P = 0.001), and combined P. falciparum multidrug resistance gene 1 N86-184F-D1246...... haplotype increased significantly between years (P = 0.039). The combination of P. falciparum chloroquine resistance transporter gene CVMNK and P. falciparum multidrug resistance gene NFD increased from 24.3% (2009) to 45.3% in (2010, P = 0.017). The rapid changes observed may largely be caused by decreased...

Surveillance of multidrug resistance-associated genes in Acinetobacter baumannii isolates from elderly patients

Directory of Open Access Journals (Sweden)

Zhe DONG

2012-03-01

Full Text Available Objective　To understand the status of multidrug resistance-associated genes carried by Acinetobacter baumannii isolates from elderly patients in our hospital in order to provide a basis for surveillance of drug-resistance and inflection control. Methods　One hundred and twenty A. baumannii isolates were collected from elderly patients between 2008 and 2010. The mean age of the patients was 85 (65 to 95 years. Whonet 5.6 software was used to analyze the resistance rate of 16 antimicrobial agents. Polymerase chain reaction (PCR and the sequencing method were adopted to detect 10 kinds of resistance genes (blaOXA-51-like, blaOXA- 23-like, blaOXA-24-like, blaOXA-58-like, blaTEM, blaampC, armA, ISAba1, intI 1, and intI 2. The corresponding resistance gene profiling(RGP was analyzed and designated according to the status of resistance genes. Results　The resistance rates to the remaining 15 kinds of antibiotics varied between 70.8% and 97.5%, with the exception of the sensitivity rate to polymyxin B by up to more than 90%. The positivity rates of blaOXA-51-like, blaOXA-23-like, blaOXA-58-like, blaTEM, blaampC, armA, ISAba1 and intI 1 were 100%, 81.7%, 0.8%, 10.8%, 91.7%, 81.7%, 86.7%, and 83.3% respectively. A total of 18 kinds of drug-resistant gene maps were found, but blaOXA-24-like and intI 2 were not detected. Among these gene maps, the rate of RGP1 (blaOXA-23-like+blaampC+armA+ISAba1+ intI 1 was as high as 60.8%. Conclusions A. baumannii isolates from elderly patients have a higher carrying rate of drug-resistant genes, resulting in severe multidrugresistant conditions. Therefore, full-time infection control personnel and clinical physicians should actively participate in the surveillance, prevention, and control of infections caused by A. baumannii in the elderly.

Hole distribution in (Sr, Ca, Y, La)14Cu24O41 compounds studies by x-ray absorption and emission spectroscopy

International Nuclear Information System (INIS)

Kabasawa, Eiki; Nakamura, Jin; Yamada, Nobuyoshi; Kuroki, Kazuhiko; Yamazaki, Hisashi; Watanabe, Masamitsu; Denlinger, Jonathan D.; Shin, Shik; Perera, Rupert C.C.

2008-01-01

The polarization dependence of soft x-ray absorption spectroscopy (XAS) and x-ray emission spectroscopy (XES) near the O 1s absorption edge was measured on two-leg ladder single-crystalline samples of (Sr, Ca, Y, La) 14 Cu 24 O 41 (14-24-41). The hole distributions in 14-24-41 compounds are determined by polarization analysis. For samples with less than or equal to 5 holes/chemical formula (c.f.), all holes reside on the edge-shared chain layer. In the case of Sr 14-x Ca x Cu 24 O 41 (6 holes/c.f.), there is approximately one hole on the two-leg ladder layer, with about five holes remaining on the edge-shared chain layer. By Ca substitution for Sr in the Sr 14-x Ca x Cu 24 O 41 samples, 0.3 holes transfer from the edge-shared chain to the two-leg ladder layer. It is possible that some of the holes on the two-leg ladder layer move from the rung sites to the leg sites upon Ca substitution. (author)

Effector-mediated discovery of a novel resistance gene against Bremia lactucae in a nonhost lettuce species.

Science.gov (United States)

Giesbers, Anne K J; Pelgrom, Alexandra J E; Visser, Richard G F; Niks, Rients E; Van den Ackerveken, Guido; Jeuken, Marieke J W

2017-11-01

Candidate effectors from lettuce downy mildew (Bremia lactucae) enable high-throughput germplasm screening for the presence of resistance (R) genes. The nonhost species Lactuca saligna comprises a source of B. lactucae R genes that has hardly been exploited in lettuce breeding. Its cross-compatibility with the host species L. sativa enables the study of inheritance of nonhost resistance (NHR). We performed transient expression of candidate RXLR effector genes from B. lactucae in a diverse Lactuca germplasm set. Responses to two candidate effectors (BLR31 and BLN08) were genetically mapped and tested for co-segregation with disease resistance. BLN08 induced a hypersensitive response (HR) in 55% of the L. saligna accessions, but responsiveness did not co-segregate with resistance to Bl:24. BLR31 triggered an HR in 5% of the L. saligna accessions, and revealed a novel R gene providing complete B. lactucae race Bl:24 resistance. Resistant hybrid plants that were BLR31 nonresponsive indicated other unlinked R genes and/or nonhost QTLs. We have identified a candidate avirulence effector of B. lactucae (BLR31) and its cognate R gene in L. saligna. Concurrently, our results suggest that R genes are not required for NHR of L. saligna. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

Detection of antibiotic resistance genes in samples from acute and chronic endodontic infections and after treatment.

Science.gov (United States)

Rôças, Isabela N; Siqueira, José F

2013-09-01

The purpose of this study was twofold: survey samples from acute and chronic endodontic infections for the presence of genes encoding resistance to beta-lactams, tetracycline and erythromycin, and evaluate the ability of treatment to eliminate these genes from root canals. DNA extracts from samples of abscess aspirates (n=25) and root canals of teeth with asymptomatic apical periodontitis (n=24) were used as template for direct detection of the genes blaTEM, cfxA, tetM, tetQ, tetW, and ermC using real-time polymerase chain reaction (PCR). Bacterial presence was determined using PCR with universal bacterial primers. Root canals of the asymptomatic cases were also sampled and evaluated after chemomechanical procedures using NiTi instruments with 2.5% NaOCl irrigation. All abscess and initial root canal samples were positive for bacteria. At least one of the target resistance genes was found in 36% of the abscess samples and 67% of the asymptomatic cases. The most prevalent genes in abscesses were blaTEM (24%) and ermC (24%), while tetM (42%) and tetW (29%) prevailed in asymptomatic cases. The blaTEM gene was significantly associated with acute cases (p=0.02). Conversely, tetM was significantly more prevalent in asymptomatic cases (p=0.008). Treatment eliminated resistance genes from most cases. Acute and chronic endodontic infections harboured resistance genes for 3 classes of widely used antibiotics. In most cases, treatment was effective in eliminating these genes, but there were a few cases in which they persisted. The implications of persistence are unknown. Direct detection of resistance genes in abscesses may be a potential method for rapid diagnosis and establishment of proactive antimicrobial therapy. Copyright © 2013 Elsevier Ltd. All rights reserved.

Identification and characterization of antibiotic resistance genes in Lactobacillus reuteri and Lactobacillus plantarum.

Science.gov (United States)

Egervärn, M; Roos, S; Lindmark, H

2009-11-01

The study aimed to identify the resistance genes mediating atypical minimum inhibitory concentrations (MICs) for tetracycline, erythromycin, clindamycin and chloramphenicol within two sets of representative strains of the species Lactobacillus reuteri and Lactobacillus plantarum and to characterize identified genes by means of gene location and sequencing of flanking regions. A tet(W) gene was found in 24 of the 28 Lact. reuteri strains with atypical MIC for tetracycline, whereas four of the six strains with atypical MIC for erythromycin were positive for erm(B) and one strain each was positive for erm(C) and erm(T). The two Lact. plantarum strains with atypical MIC for tetracycline harboured a plasmid-encoded tet(M) gene. The majority of the tet(W)-positive Lact. reuteri strains and all erm-positive Lact. reuteri strains carried the genes on plasmids, as determined by Southern blot and a real-time PCR method developed in this study. Most of the antibiotic-resistant strains of Lact. reuteri and Lact. plantarum harboured known plasmid-encoded resistance genes. Examples of putative transfer machineries adjacent to both plasmid- and chromosome-located resistance genes were also demonstrated. These data provide some of the knowledge required for assessing the possible risk of using Lact. reuteri and Lact. plantarum strains carrying antibiotic resistance genes as starter cultures and probiotics.

Marker-assisted pyramiding of Thinopyrumderived leaf rust ...

Indian Academy of Sciences (India)

2017-03-20

Mar 20, 2017 ... resistance genes Lr19 and Lr24 using marker assisted foreground .... is linked with stem rust resistance gene Sr24(McIntosh et al. 1976). .... Received 29 July 2016, in final revised form 3 March 2017; accepted 16 March 2017.

Marker Assisted Transfer of Two Powdery Mildew Resistance Genes PmTb7A.1 and PmTb7A.2 from Triticum boeoticum (Boiss.) to Triticum aestivum (L.).

Science.gov (United States)

Elkot, Ahmed Fawzy Abdelnaby; Chhuneja, Parveen; Kaur, Satinder; Saluja, Manny; Keller, Beat; Singh, Kuldeep

2015-01-01

Powdery mildew (PM), caused by Blumeria graminis f. sp. tritici, is one of the important wheat diseases, worldwide. Two PM resistance genes, designated as PmTb7A.1 and PmTb7A.2, were identified in T. boeoticum acc. pau5088 and mapped on chromosome 7AL approximately 48cM apart. Two resistance gene analogue (RGA)-STS markers Ta7AL-4556232 and 7AL-4426363 were identified to be linked to the PmTb7A.1 and PmTb7A.2, at a distance of 0.6cM and 6.0cM, respectively. In the present study, following marker assisted selection (MAS), the two genes were transferred to T. aestivum using T. durum as bridging species. As many as 12,317 florets of F1 of the cross T. durum /T. boeoticum were pollinated with T. aestivum lines PBW343-IL and PBW621 to produce 61 and 65 seeds, respectively, of three-way F1. The resulting F1s of the cross T. durum/T. boeoticum//T. aestivum were screened with marker flanking both the PM resistance genes PmTb7A.1 and PmTb7A.2 (foreground selection) and the selected plants were backcrossed to generate BC1F1. Marker assisted selection was carried both in BC1F1 and the BC2F1 generations. Introgression of alien chromatin in BC2F1 plants varied from 15.4-62.9 percent. Out of more than 110 BC2F1 plants showing introgression for markers linked to the two PM resistance genes, 40 agronomically desirable plants were selected for background selection for the carrier chromosome to identify the plants with minimum of the alien introgression. Cytological analysis showed that most plants have chromosome number ranging from 40-42. The BC2F2 plants homozygous for the two genes have been identified. These will be crossed to generate lines combining both the PM resistance genes but with minimal of the alien introgression. The PM resistance gene PmTb7A.1 maps in a region very close to Sr22, a stem rust resistance gene effective against the race Ug99. Analysis of selected plants with markers linked to Sr22 showed introgression of Sr22 from T. boeoticum in several BC2F1 plants

Marker Assisted Transfer of Two Powdery Mildew Resistance Genes PmTb7A.1 and PmTb7A.2 from Triticum boeoticum (Boiss. to Triticum aestivum (L..

Directory of Open Access Journals (Sweden)

Ahmed Fawzy Abdelnaby Elkot

Full Text Available Powdery mildew (PM, caused by Blumeria graminis f. sp. tritici, is one of the important wheat diseases, worldwide. Two PM resistance genes, designated as PmTb7A.1 and PmTb7A.2, were identified in T. boeoticum acc. pau5088 and mapped on chromosome 7AL approximately 48cM apart. Two resistance gene analogue (RGA-STS markers Ta7AL-4556232 and 7AL-4426363 were identified to be linked to the PmTb7A.1 and PmTb7A.2, at a distance of 0.6cM and 6.0cM, respectively. In the present study, following marker assisted selection (MAS, the two genes were transferred to T. aestivum using T. durum as bridging species. As many as 12,317 florets of F1 of the cross T. durum /T. boeoticum were pollinated with T. aestivum lines PBW343-IL and PBW621 to produce 61 and 65 seeds, respectively, of three-way F1. The resulting F1s of the cross T. durum/T. boeoticum//T. aestivum were screened with marker flanking both the PM resistance genes PmTb7A.1 and PmTb7A.2 (foreground selection and the selected plants were backcrossed to generate BC1F1. Marker assisted selection was carried both in BC1F1 and the BC2F1 generations. Introgression of alien chromatin in BC2F1 plants varied from 15.4-62.9 percent. Out of more than 110 BC2F1 plants showing introgression for markers linked to the two PM resistance genes, 40 agronomically desirable plants were selected for background selection for the carrier chromosome to identify the plants with minimum of the alien introgression. Cytological analysis showed that most plants have chromosome number ranging from 40-42. The BC2F2 plants homozygous for the two genes have been identified. These will be crossed to generate lines combining both the PM resistance genes but with minimal of the alien introgression. The PM resistance gene PmTb7A.1 maps in a region very close to Sr22, a stem rust resistance gene effective against the race Ug99. Analysis of selected plants with markers linked to Sr22 showed introgression of Sr22 from T. boeoticum in

A novel resistance gene, lnu(H), conferring resistance to lincosamides in Riemerella anatipestifer CH-2.

Science.gov (United States)

Luo, Hong-Yan; Liu, Ma-Feng; Wang, Ming-Shu; Zhao, Xin-Xin; Jia, Ren-Yong; Chen, Shun; Sun, Kun-Feng; Yang, Qiao; Wu, Ying; Chen, Xiao-Yue; Biville, Francis; Zou, Yuan-Feng; Jing, Bo; Cheng, An-Chun; Zhu, De-Kang

2018-01-01

The Gram-negative bacterium Riemerella anatipestifer CH-2 is resistant to lincosamides, having a lincomycin (LCM) minimum inhibitory concentration (MIC) of 128 µg/mL. The G148_1775 gene of R. anatipestifer CH-2, designated lnu(H), encodes a 260-amino acid protein with ≤41% identity to other reported lincosamide nucleotidylyltransferases. Escherichia coli Rosetta TM (DE3) containing the pBAD24-lnu(H) plasmid showed four- and two-fold increases in the MICs of LCM and clindamycin (CLI), respectively. A kinetic assay of the purified Lnu(H) enzyme for LCM and CLI showed that the protein could inactive lincosamides. Mass spectrometry analysis demonstrated that the Lnu(H) enzyme catalysed adenylylation of lincosamides. In addition, an lnu(H) gene deletion strain exhibited 512- and 32-fold decreases in LCM and CLI MICs, respectively. The wild-type level of lincosamide resistance could be restored by complementation with a shuttle plasmid carrying the lnu(H) gene. The transformant R. anatipestifer ATCC 11845 [lnu(H)] acquired by natural transformation also exhibited high-level lincosamide resistance. Moreover, among 175 R. anatipestifer field isolates, 56 (32.0%) were positive for the lnu(H) gene by PCR. In conclusion, Lnu(H) is a novel lincosamide nucleotidylyltransferase that inactivates LCM and CLI by nucleotidylylation, thus conferring high-level lincosamide resistance to R. anatipestifer CH-2. Copyright © 2017. Published by Elsevier B.V.

Resistive switching behavior in single crystal SrTiO{sub 3} annealed by laser

Energy Technology Data Exchange (ETDEWEB)

Pan, Xinqiang [State Key Laboratory of Electronic Thin Films and Integrated Devices, University of Electronic Science and Technology of China, Chengdu 610054 (China); Shuai, Yao, E-mail: yshuai@uestc.edu.cn [State Key Laboratory of Electronic Thin Films and Integrated Devices, University of Electronic Science and Technology of China, Chengdu 610054 (China); Collaboration Innovation Center of Electronic Materials and Devices, University of Electronic Science and Technology of China, Chengdu 610054 (China); Wu, Chuangui, E-mail: cgwu@uestc.edu.cn [State Key Laboratory of Electronic Thin Films and Integrated Devices, University of Electronic Science and Technology of China, Chengdu 610054 (China); Collaboration Innovation Center of Electronic Materials and Devices, University of Electronic Science and Technology of China, Chengdu 610054 (China); Luo, Wenbo [State Key Laboratory of Electronic Thin Films and Integrated Devices, University of Electronic Science and Technology of China, Chengdu 610054 (China); Collaboration Innovation Center of Electronic Materials and Devices, University of Electronic Science and Technology of China, Chengdu 610054 (China); Sun, Xiangyu [State Key Laboratory of Electronic Thin Films and Integrated Devices, University of Electronic Science and Technology of China, Chengdu 610054 (China); Yuan, Ye; Zhou, Shengqiang [Helmholtz-Zentrum Dresden Rossendorf, Institute of Ion Beam Physics and Materials Research, Bautzner Landstrasse 400, D-01328 Dresden (Germany); Ou, Xin [State Key Laboratory of Functional Material for Informatics, Shanghai Institute of Microsystem and Information Technology, Chinese Academy of Sciences, Shanghai 200050 (China); Zhang, Wanli [State Key Laboratory of Electronic Thin Films and Integrated Devices, University of Electronic Science and Technology of China, Chengdu 610054 (China); Collaboration Innovation Center of Electronic Materials and Devices, University of Electronic Science and Technology of China, Chengdu 610054 (China)

2016-12-15

Highlights: • Laser annealing was used to introduce oxygen vacancies into the single crystal SrTiO{sub 3}. • The effect of laser annealing with different fluence on the single crystal SrTiO{sub 3} was systematically studied. • The concentration of oxygen vacancies can be tuned by changing the fluence of laser. • Resistive switching behavior was observed in the sample with relatively high laser fluence after an electro-forming process. - Abstract: Single crystal SrTiO{sub 3} (STO) wafers were annealed by XeCl laser (λ = 308 nm) with different fluences of 0.4 J/cm{sup 2}, 0.6 J/cm{sup 2} and 0.8 J/cm{sup 2}, respectively. Ti/Pt electrodes were sputtered on the surface of STO wafer to form co-planar capacitor-like structures of Pt/Ti/STO/Ti/Pt. Current-Voltage measurements show that the leakage current is enhanced by increasing laser fluence. Resistive switching behavior is only observed in the sample annealed by laser with relatively high fluence after an electro-forming process. The X-ray photoelectron spectroscopy measurements indicate that the amount of oxygen vacancies increases with the increase of laser fluence. This work indicates resistive switching appears when enough oxygen vacancies are generated by the laser, which form conductive filaments under an external electric field.

Temperature-dependent resistance switching in SrTiO{sub 3}

Energy Technology Data Exchange (ETDEWEB)

Li, Jian-kun [Institute of Physics, Chinese Academy of Sciences, Beijing 100190 (China); University of Chinese Academy of Sciences, Beijing 100049 (China); Ma, Chao; Ge, Chen, E-mail: kjjin@iphy.ac.cn, E-mail: gechen@iphy.ac.cn; Gu, Lin; He, Xu; Zhou, Wen-jia; Lu, Hui-bin [Institute of Physics, Chinese Academy of Sciences, Beijing 100190 (China); Jin, Kui-juan, E-mail: kjjin@iphy.ac.cn, E-mail: gechen@iphy.ac.cn [Institute of Physics, Chinese Academy of Sciences, Beijing 100190 (China); University of Chinese Academy of Sciences, Beijing 100049 (China); Collaborative Innovation Center of Quantum Matter, Beijing 100190 (China); Zhang, Qing-hua [School of Materials Science and Engineering, State Key Lab of New Ceramics and Fine Processing, Tsinghua University, Beijing 100084 (China); Yang, Guo-zhen [Institute of Physics, Chinese Academy of Sciences, Beijing 100190 (China); Collaborative Innovation Center of Quantum Matter, Beijing 100190 (China)

2016-06-13

Resistance switching phenomena were studied by varying temperature in SrTiO{sub 3} single crystal. The resistance hysteresis loops appear at a certain temperature ranging from 340 K to 520 K. With the assistance of 375 nm ultraviolet continuous laser, the sample resistance is greatly reduced, leading to a stable effect than that in dark. These resistance switching phenomena only exist in samples with enough oxygen vacancies, which is confirmed by spherical aberration-corrected scanning transmission electron microscopy measurements, demonstrating an important role played by oxygen vacancies. At temperatures above 340 K, positively charged oxygen vacancies become mobile triggered by external electric field, and the resistance switching effect emerges. Our theoretical results based on drift-diffusion model reveal that the built-in field caused by oxygen vacancies can be altered under external electric field. Therefore, two resistance states are produced under the cooperative effect of built-in field and external field. However, the increasing mobility of oxygen vacancies caused by higher temperature promotes internal electric field to reach equilibrium states quickly, and suppresses the hysteresis loops above 420 K.

Genetic pathway in acquisition and loss of vancomycin resistance in a methicillin resistant Staphylococcus aureus (MRSA strain of clonal type USA300.

Directory of Open Access Journals (Sweden)

Susana Gardete

2012-02-01

Full Text Available An isolate of the methicillin-resistant Staphylococcus aureus (MRSA clone USA300 with reduced susceptibility to vancomycin (SG-R (i.e, vancomycin-intermediate S. aureus, VISA and its susceptible "parental" strain (SG-S were recovered from a patient at the end and at the beginning of an unsuccessful vancomycin therapy. The VISA phenotype was unstable in vitro generating a susceptible revertant strain (SG-rev. The availability of these 3 isogenic strains allowed us to explore genetic correlates of antibiotic resistance as it emerged in vivo. Compared to the susceptible isolate, both the VISA and revertant strains carried the same point mutations in yycH, vraG, yvqF and lspA genes and a substantial deletion within an intergenic region. The revertant strain carried a single additional frameshift mutation in vraS which is part of two component regulatory system VraSR. VISA isolate SG-R showed complex alterations in phenotype: decreased susceptibility to other antibiotics, slow autolysis, abnormal cell division and increased thickness of cell wall. There was also altered expression of 239 genes including down-regulation of major virulence determinants. All phenotypic properties and gene expression profile returned to parental levels in the revertant strain. Introduction of wild type yvqF on a multicopy plasmid into the VISA strain caused loss of resistance along with loss of all the associated phenotypic changes. Introduction of the wild type vraSR into the revertant strain caused recovery of VISA type resistance. The yvqF/vraSR operon seems to function as an on/off switch: mutation in yvqF in strain SG-R turns on the vraSR system, which leads to increase in vancomycin resistance and down-regulation of virulence determinants. Mutation in vraS in the revertant strain turns off this regulatory system accompanied by loss of resistance and normal expression of virulence genes. Down-regulation of virulence genes may provide VISA strains with a "stealth

Dependence of temperature-dependent electrical resistivity of SrIrO3 on hydrostatic pressure to 9.1 kbar

International Nuclear Information System (INIS)

Foroozani, N.; Lim, J.; Li, L.; Cao, G.; Schilling, J.S.

2013-01-01

Non-Fermi-liquid behavior and close proximity to a quantum critical point in the 5d transition metal iridate SrIrO 3 at ambient pressure motivate our search for possible anomalous behavior in its transport properties under pressure. The electrical resistivity in the ab-plane of a single crystal of SrIrO 3 has been measured over the temperature range 1.35–285 K at both ambient and 9.1 kbar hydrostatic pressure. The resistivity decreases slightly over the entire temperature range, but no superconducting transition or changes in the non-Fermi-liquid behavior are observed under pressure. It is estimated that significantly higher pressures are likely required before sizable changes in the properties of SrIrO 3 will occur.

Identification of acquired antimicrobial resistance genes

DEFF Research Database (Denmark)

Zankari, Ea; Hasman, Henrik; Cosentino, Salvatore

2012-01-01

ObjectivesIdentification of antimicrobial resistance genes is important for understanding the underlying mechanisms and the epidemiology of antimicrobial resistance. As the costs of whole-genome sequencing (WGS) continue to decline, it becomes increasingly available in routine diagnostic laborato......ObjectivesIdentification of antimicrobial resistance genes is important for understanding the underlying mechanisms and the epidemiology of antimicrobial resistance. As the costs of whole-genome sequencing (WGS) continue to decline, it becomes increasingly available in routine diagnostic...... laboratories and is anticipated to substitute traditional methods for resistance gene identification. Thus, the current challenge is to extract the relevant information from the large amount of generated data.MethodsWe developed a web-based method, ResFinder that uses BLAST for identification of acquired...... antimicrobial resistance genes in whole-genome data. As input, the method can use both pre-assembled, complete or partial genomes, and short sequence reads from four different sequencing platforms. The method was evaluated on 1862 GenBank files containing 1411 different resistance genes, as well as on 23 de...

[Induced expression of Serratia marcescens ribonuclease III gene in transgenic Nicotiana tabacum L. cv. SR1 tobacco plants].

Science.gov (United States)

Zhirnov, I V; Trifonova, E A; Romanova, A V; Filipenko, E A; Sapotsky, M V; Malinovsky, V I; Kochetov, A V; Shumny, V K

2016-11-01

Transgenic Nicotiana tabacum L. cv. SR1 plants, characterized by an increase in the level of dsRNA-specific hydrolytic activity after induction by wounding, were obtained. The Solanum lycopersicum anionic peroxidase gene promoter (new for plant genetic engineering) was for the first time used for the induced expression of the target Serratia marcescens RNase III gene. Upon infection with the tobacco mosaic virus (TMV), the transgenic plants of the obtained lines did not differ significantly from the control group in the level of TMV capsid protein accumulation. In general, no delay in the development of the infection symptoms was observed in transgenic plants as compared with the control group. The obtained transgenic plants represent a new model for the study of the biological role of endoribonucleases from the RNase III family, including in molecular mechanisms of resistance to pathogens.

Thickness-dependent resistance switching in Cr-doped SrTiO3

Science.gov (United States)

Kim, TaeKwang; Du, Hyewon; Kim, Minchang; Seo, Sunae; Hwang, Inrok; Kim, Yeonsoo; Jeon, Jihoon; Lee, Sangik; Park, Baeho

2012-09-01

The thickness-dependent bipolar resistance-switching behavior was investigated for epitaxiallygrown Cr-doped SrTiO3 (Cr-STO). All the pristine devices of different thickness showed polarity-independent symmetric current-voltage characteristic and the same space-charge-limited conduction mechanism. However, after a forming process, the resultant conduction and switching phenomena were significantly different depending on the thickness of Cr-STO. The forming process itself was highly influenced by resistance value of each pristine device. Based on our results, we suggest that the resistance-switching mechanism in Cr-STO depends not only on the insulating material's composition or the contact metal as previously reported but also on the initial resistance level determined by the geometry and the quality of the insulating material. The bipolar resistance-switching behaviors in oxide materials of different thicknesses exhibit mixed bulk and interface switching. This indicates that efforts in resistance-based memory research should be focused on scalability or process method to control a given oxide material in addition to material type and device structure.

Blood-gene expression reveals reduced circadian rhythmicity in individuals resistant to sleep deprivation.

Science.gov (United States)

Arnardottir, Erna S; Nikonova, Elena V; Shockley, Keith R; Podtelezhnikov, Alexei A; Anafi, Ron C; Tanis, Keith Q; Maislin, Greg; Stone, David J; Renger, John J; Winrow, Christopher J; Pack, Allan I

2014-10-01

To address whether changes in gene expression in blood cells with sleep loss are different in individuals resistant and sensitive to sleep deprivation. Blood draws every 4 h during a 3-day study: 24-h normal baseline, 38 h of continuous wakefulness and subsequent recovery sleep, for a total of 19 time-points per subject, with every 2-h psychomotor vigilance task (PVT) assessment when awake. Sleep laboratory. Fourteen subjects who were previously identified as behaviorally resistant (n = 7) or sensitive (n = 7) to sleep deprivation by PVT. Thirty-eight hours of continuous wakefulness. We found 4,481 unique genes with a significant 24-h diurnal rhythm during a normal sleep-wake cycle in blood (false discovery rate [FDR] sleep. After accounting for circadian effects, two genes (SREBF1 and CPT1A, both involved in lipid metabolism) exhibited small, but significant, linear changes in expression with the duration of sleep deprivation (FDR sleep deprivation was a reduction in the amplitude of the diurnal rhythm of expression of normally cycling probe sets. This reduction was noticeably higher in behaviorally resistant subjects than sensitive subjects, at any given P value. Furthermore, blood cell type enrichment analysis showed that the expression pattern difference between sensitive and resistant subjects is mainly found in cells of myeloid origin, such as monocytes. Individual differences in behavioral effects of sleep deprivation are associated with differences in diurnal amplitude of gene expression for genes that show circadian rhythmicity. © 2014 Associated Professional Sleep Societies, LLC.

Lr67/Yr46 confers adult plant resistance to stem rust and powdery mildew in wheat.

Science.gov (United States)

Herrera-Foessel, Sybil A; Singh, Ravi P; Lillemo, Morten; Huerta-Espino, Julio; Bhavani, Sridhar; Singh, Sukhwinder; Lan, Caixia; Calvo-Salazar, Violeta; Lagudah, Evans S

2014-04-01

We demonstrate that Lr67/Yr46 has pleiotropic effect on stem rust and powdery mildew resistance and is associated with leaf tip necrosis. Genes are designated as Sr55, Pm46 and Ltn3 , respectively. Wheat (Triticum aestivum) accession RL6077, known to carry the pleiotropic slow rusting leaf and yellow rust resistance genes Lr67/Yr46 in Thatcher background, displayed significantly lower stem rust (P. graminis tritici; Pgt) and powdery mildew (Blumeria graminis tritici; Bgt) severities in Kenya and in Norway, respectively, compared to its recurrent parent Thatcher. We investigated the resistance of RL6077 to stem rust and powdery mildew using Avocet × RL6077 F6 recombinant inbred lines (RILs) derived from two photoperiod-insensitive F3 families segregating for Lr67/Yr46. Greenhouse seedling tests were conducted with Mexican Pgt race RTR. Field evaluations were conducted under artificially initiated stem rust epidemics with Pgt races RTR and TTKST (Ug99 + Sr24) at Ciudad Obregon (Mexico) and Njoro (Kenya) during 2010-2011; and under natural powdery mildew epiphytotic in Norway at Ås and Hamar during 2011 and 2012. In Mexico, a mean reduction of 41 % on stem rust severity was obtained for RILs carrying Lr67/Yr46, compared to RILs that lacked the gene, whereas in Kenya the difference was smaller (16 %) but significant. In Norway, leaf tip necrosis was associated with Lr67/Yr46 and RILs carrying Lr67/Yr46 showed a 20 % reduction in mean powdery mildew severity at both sites across the 2 years of evaluation. Our study demonstrates that Lr67/Yr46 confers partial resistance to stem rust and powdery mildew and is associated with leaf tip necrosis. The corresponding pleiotropic, or tightly linked, genes, designated as Sr55, Pm46, and Ltn3, can be utilized to provide broad-spectrum durable disease resistance in wheat.

GENE EXPRESSION DYNAMICS IN PATIENTS WITH SEVERE THERAPY-RESISTANT ASTHMA DURING TREATMENT PERIOD

Directory of Open Access Journals (Sweden)

Ye. S. Kulikov

2014-01-01

Full Text Available Introduction: The leading mechanisms and causes of severe therapy resistant asthma are poorly understood. The aim of this study was to define global patterns of gene expression in adults with severe therapy-resistant asthma in dynamic during treatment period.Methods: Performed 24-week prospective interventional study in parallel groups. Severe asthma patients was aposterior divided at therapy sensitive and resistant patients according to ATS criteria. Global transcriptome profile was characterized using the Affymetrix HuGene ST1.0 chip. Cluster analysis was performed.Results and conclusion: According to our data several mechanisms of therapy resistance may be considered: increased levels of nitric oxide and beta2-agonists nitration, dysregulation of endogenous steroids secretion and involvement in the pathogenesis of Staphylococcus aureus. Absence of suppression of gene expression KEGG-pathway “asthma" may reflect the low efficiency or long period of anti-inflammatory therapy effect realization.

Resistance to stem rust Ug99 in six bread wheat cultivars maps to chromosome 6DS.

Science.gov (United States)

Lopez-Vera, Eric E; Nelson, Sarah; Singh, Ravi P; Basnet, Bhoja R; Haley, Scott D; Bhavani, Sridhar; Huerta-Espino, Julio; Xoconostle-Cazares, Beatriz G; Ruiz-Medrano, Roberto; Rouse, Matthew N; Singh, Sukhwinder

2014-01-01

Identified SSR markers ( Xcfd49 and Xbarc183 ) linked with stem rust resistance for efficient use in marker-assisted selection and stacking of resistance genes in wheat breeding programs. More than 80 % of the worldwide wheat (Triticum aestivum L.) area is currently sown with varieties susceptible to the Ug99 race group of stem rust fungus. However, wheat lines Niini, Tinkio, Coni, Pfunye, Blouk, and Ripper have demonstrated Ug99 resistance at the seedling and adult plant stages. We mapped stem rust resistance in populations derived from crosses of a susceptible parent with each of the resistant lines. The segregation of resistance in each population indicated the presence of a single gene. The resistance gene in Niini mapped to short arm of chromosome 6D and was flanked by SSR markers Xcfd49 at distances of 3.9 cM proximal and Xbarc183 8.4 cM distal, respectively. The chromosome location of this resistance was validated in three other populations: PBW343/Coni, PBW343/Tinkio, and Cacuke/Pfunye. Resistance initially postulated to be conferred by the SrTmp gene in Blouk and Ripper was also linked to Xcfd49 and Xbarc183 on 6DS, but it was mapped proximal to Xbarc183 at a similar position to previously mapped genes Sr42 and SrCad. Based on the variation in diagnostic marker alleles, it is possible that Niini and Pfunye may carry different resistance genes/alleles. Further studies are needed to determine the allelic relationships between various genes located on chromosome arm 6DS. Our results provide valuable molecular marker and genetic information for developing Ug99 resistant wheat varieties in diverse germplasm and using these markers to tag the resistance genes in wheat breeding.

Identification of QTLs for resistance to sclerotinia stem rot and BnaC.IGMT5.a as a candidate gene of the major resistant QTL SRC6 in Brassica napus.

Directory of Open Access Journals (Sweden)

Jian Wu

Full Text Available Stem rot caused by Sclerotinia sclerotiorum in many important dicotyledonous crops, including oilseed rape (Brassica napus, is one of the most devastating fungal diseases and imposes huge yield loss each year worldwide. Currently, breeding for Sclerotinia resistance in B. napus, as in other crops, can only rely on germplasms with quantitative resistance genes. Thus, the identification of quantitative trait locus (QTL for S. sclerotiorum resistance/tolerance in this crop holds immediate promise for the genetic improvement of the disease resistance. In this study, ten QTLs for stem resistance (SR at the mature plant stage and three QTLs for leaf resistance (LR at the seedling stage in multiple environments were mapped on nine linkage groups (LGs of a whole genome map for B. napus constructed with SSR markers. Two major QTLs, LRA9 on LG A9 and SRC6 on LG C6, were repeatedly detected across all environments and explained 8.54-15.86% and 29.01%-32.61% of the phenotypic variations, respectively. Genotypes containing resistant SRC6 or LRA9 allele showed a significant reduction in disease lesion after pathogen infection. Comparative mapping with Arabidopsis and data mining from previous gene profiling experiments identified that the Arabidopsis homologous gene of IGMT5 (At1g76790 was related to the SRC6 locus. Four copies of the IGMT5 gene in B. napus were isolated through homologous cloning, among which, only BnaC.IGMT5.a showed a polymorphism between parental lines and can be associated with the SRC6. Furthermore, two parental lines exhibited a differential expression pattern of the BnaC.IGMT5.a gene in responding to pathogen inoculation. Thus, our data suggested that BnaC.IGMT5.a was very likely a candidate gene of this major resistance QTL.

The biofilm-specific antibiotic resistance gene ndvB is important for expression of ethanol oxidation genes in Pseudomonas aeruginosa biofilms.

Science.gov (United States)

Beaudoin, Trevor; Zhang, Li; Hinz, Aaron J; Parr, Christopher J; Mah, Thien-Fah

2012-06-01

Bacteria growing in biofilms are responsible for a large number of persistent infections and are often more resistant to antibiotics than are free-floating bacteria. In a previous study, we identified a Pseudomonas aeruginosa gene, ndvB, which is important for the formation of periplasmic glucans. We established that these glucans function in biofilm-specific antibiotic resistance by sequestering antibiotic molecules away from their cellular targets. In this study, we investigate another function of ndvB in biofilm-specific antibiotic resistance. DNA microarray analysis identified 24 genes that were responsive to the presence of ndvB. A subset of 20 genes, including 8 ethanol oxidation genes (ercS', erbR, exaA, exaB, eraR, pqqB, pqqC, and pqqE), was highly expressed in wild-type biofilm cells but not in ΔndvB biofilms, while 4 genes displayed the reciprocal expression pattern. Using quantitative real-time PCR, we confirmed the ndvB-dependent expression of the ethanol oxidation genes and additionally demonstrated that these genes were more highly expressed in biofilms than in planktonic cultures. Expression of erbR in ΔndvB biofilms was restored after the treatment of the biofilm with periplasmic extracts derived from wild-type biofilm cells. Inactivation of ethanol oxidation genes increased the sensitivity of biofilms to tobramycin. Together, these results reveal that ndvB affects the expression of multiple genes in biofilms and that ethanol oxidation genes are linked to biofilm-specific antibiotic resistance.

Investigation of the electroforming and resistive switching mechanisms in Fe-doped SrTiO3 thin films

International Nuclear Information System (INIS)

Menke, Tobias

2009-01-01

To overcome the physical limits of todays memory technologies new concepts are needed. The resistive random access memory (RRAM), which bases on a nonvolatile and repeatable change of the resistance by external electrical stimuli, seems to be one promising candidate. Within the scope of this work, the model system Strontium titanate (SrTiO 3 ) has been investigated to get a deeper understanding of the underlying physical mechanism related to the resistance change. The electrical properties of SrTiO 3 (STO) can be modulated from a band insulator to metallic conduction by a self-doping with oxygen vacancies which act as shallow donors. A local accumulation or depletion of oxygen vacancies at the vicinity of the surface will lead to a local redox process which is responsible for the resistance change. To study the influence of the interfaces on the switching properties of SrTiO 3 thin films, epitaxial films of Fe-doped SrTiO 3 were grown on different bottom electrodes (SrRuO 3 , LaNiO 3 und Nb:STO) by a ''Pulsed Laser Deposition'' technique. An atomic force microscope equipped with a conductive tip (LC-AFM) allowed studying the conductivity of the deposited films on the nanometer scale. Resistive switching of lateral structures smaller than ∝5 nm could be realized which represents the potential of this material for a further downscaling of RRAM devices. The deposition of top electrodes, made of Platinum or Titanium, allowed the electrical characterization of metal-insulator-metal (MIM) structures. An extensive investigation of pristine MIM-devices by impedance spectroscopy showed the big impact of the metal-insulator interface on the overall device resistance. Furthermore, a chemical polarization was studied by dynamical current sweeps and identified as a volatile resistance variation. Usually a forming procedure is needed to ''enable'' the resistive switching properties in MIM devices. The electroforming of these devices was extensively studied and could be

Resistance switching mechanism of La{sub 0.8}Sr{sub 0.2}MnO{sub 3−δ} thin films

Energy Technology Data Exchange (ETDEWEB)

Luo, X.D. [School of Metallurgy and Materials Engineering, Chongqing University of Science and Technology, Chongqing 401331 (China); Chongqing Key Laboratory of Nano/Micro Composite Materials and Devices, Chongqing 401331 (China); Gao, R.L., E-mail: gaorongli2008@163.com [School of Metallurgy and Materials Engineering, Chongqing University of Science and Technology, Chongqing 401331 (China); Chongqing Key Laboratory of Nano/Micro Composite Materials and Devices, Chongqing 401331 (China); Fu, C.L.; Cai, W.; Chen, G.; Deng, X.L. [School of Metallurgy and Materials Engineering, Chongqing University of Science and Technology, Chongqing 401331 (China); Chongqing Key Laboratory of Nano/Micro Composite Materials and Devices, Chongqing 401331 (China); Zhang, H.R; Sun, J.R. [Beijing National Laboratory for Condensed Matter Physics and Institute of Physics, Chinese Academy of Science, Beijing 100190 (China)

2016-02-15

Effects of oxygen vacancies on the electrical transport properties of oxygen stoichiometric La{sub 0.8}Sr{sub 0.2}MnO{sub 3} and oxygen-deficient La{sub 0.8}Sr{sub 0.2}MnO{sub 3−δ} films have been investigated. The result presents that the oxygen-deficient films annealed in vacuum show obvious increase of resistance and lattice parameter. With the sweeping voltage or temperature increasing, the resistance exhibits obvious bipolar switching effect, no forming process was needed. Oxygen deficiency in the annealed film leads to the formation of a structural disorder in the Mn–O–Mn conduction channel due to the accumulation of oxygen vacancies under high external electric field or temperatures and hence is believed to be responsible for the bipolar resistance switching effect and the enhanced resistivity compared with oxygen stoichiometric La{sub 0.8}Sr{sub 0.2}MnO{sub 3} film. These results may be important for practical applications in photoelectric or storage devices and point to a useful direction for other oxidizing materials.

Identification of molecular markers linked to rice bacterial blight resistance genes from Oryza meyeriana

Directory of Open Access Journals (Sweden)

Jing WANG,Chen CHENG,Yanru ZHOU,Yong YANG,Qiong MEI,Junmin LI,Ye CHENG,Chengqi YAN,Jianping CHEN

2015-09-01

Full Text Available Y73 is a progeny of asymmetric somatic hybridization between Oryza sativa cv. Dalixiang and the wild rice species Oryza meyeriana. Inoculation with a range of strains of Xanthomonas oryzae pv. oryzae showed that Y73 had inherited a high level of resistance to rice bacterial blight (BB from its wild parent. An F2 population of 7125 individuals was constructed from the cross between Y73 and a BB-susceptible cultivar IR24. After testing 615 SSR and STS markers covering the 12 rice chromosomes, 186 markers were selected that showed polymorphism between Y73 and IR24. Molecular markers linked to the BB resistance genes in Y73 were scanned using the F2 population and the polymorphic markers. The SSR marker RM128 on chromosome 1, the STS marker R03D159 on chromosome 3 and the STS marker R05D104 on chromosome 5 were found to be linked to the rice BB resistance genes in Y73.

Resistance gene candidates identified by PCR with degenerate oligonucleotide primers map to clusters of resistance genes in lettuce.

Science.gov (United States)

Shen, K A; Meyers, B C; Islam-Faridi, M N; Chin, D B; Stelly, D M; Michelmore, R W

1998-08-01

The recent cloning of genes for resistance against diverse pathogens from a variety of plants has revealed that many share conserved sequence motifs. This provides the possibility of isolating numerous additional resistance genes by polymerase chain reaction (PCR) with degenerate oligonucleotide primers. We amplified resistance gene candidates (RGCs) from lettuce with multiple combinations of primers with low degeneracy designed from motifs in the nucleotide binding sites (NBSs) of RPS2 of Arabidopsis thaliana and N of tobacco. Genomic DNA, cDNA, and bacterial artificial chromosome (BAC) clones were successfully used as templates. Four families of sequences were identified that had the same similarity to each other as to resistance genes from other species. The relationship of the amplified products to resistance genes was evaluated by several sequence and genetic criteria. The amplified products contained open reading frames with additional sequences characteristic of NBSs. Hybridization of RGCs to genomic DNA and to BAC clones revealed large numbers of related sequences. Genetic analysis demonstrated the existence of clustered multigene families for each of the four RGC sequences. This parallels classical genetic data on clustering of disease resistance genes. Two of the four families mapped to known clusters of resistance genes; these two families were therefore studied in greater detail. Additional evidence that these RGCs could be resistance genes was gained by the identification of leucine-rich repeat (LRR) regions in sequences adjoining the NBS similar to those in RPM1 and RPS2 of A. thaliana. Fluorescent in situ hybridization confirmed the clustered genomic distribution of these sequences. The use of PCR with degenerate oligonucleotide primers is therefore an efficient method to identify numerous RGCs in plants.

Oxide meets silicide. Synthesis and single-crystal structure of Ca{sub 21}SrSi{sub 24}O{sub 2}

Energy Technology Data Exchange (ETDEWEB)

Reckeweg, Olaf; DiSalvo, Francis J. [Cornell Univ., Ithaca, NY (United States). Dept. of Chemistry and Chemical Biology

2017-06-01

A few black, rectangular thin plates of Ca{sub 21}SrSi{sub 24}O{sub 2} were obtained by serendipity in a solid-state reaction of calcium metal, strontium chloride and silicon powder at 1200 K for 2 days designed to produce 'Ca{sub 2}SrCl{sub 2}[Si{sub 3}]'. The title compound forms next to some CaSi and some remaining educts. Ca{sub 21}SrSi{sub 24}O{sub 2} crystallizes in the monoclinic space group C2/m (no. 12) with unit cell parameters of a=1895.2(2), b=450.63(5) and c=1397.33(18) pm and β=112.008(7) (Z=1). The title compound shows planar, eight-membered, kinked Si{sub 8} chains with Si-Si distances between 241.4 and 245.0 pm indicating bonding interactions and kinked 'rope ladders' connecting the chains with interatomic Si-Si distances in the range 268.1-274.7 pm. Embedded in between these silicon substructures are columns of oxygen centered, apex sharing [(Ca{sub 1-x} Sr{sub x}){sub 6/2}O] octahedra and calcium ions.

UDP-galactose and acetyl-CoA transporters as Plasmodium multidrug resistance genes.

Science.gov (United States)

Lim, Michelle Yi-Xiu; LaMonte, Gregory; Lee, Marcus C S; Reimer, Christin; Tan, Bee Huat; Corey, Victoria; Tjahjadi, Bianca F; Chua, Adeline; Nachon, Marie; Wintjens, René; Gedeck, Peter; Malleret, Benoit; Renia, Laurent; Bonamy, Ghislain M C; Ho, Paul Chi-Lui; Yeung, Bryan K S; Chow, Eric D; Lim, Liting; Fidock, David A; Diagana, Thierry T; Winzeler, Elizabeth A; Bifani, Pablo

2016-09-19

A molecular understanding of drug resistance mechanisms enables surveillance of the effectiveness of new antimicrobial therapies during development and deployment in the field. We used conventional drug resistance selection as well as a regime of limiting dilution at early stages of drug treatment to probe two antimalarial imidazolopiperazines, KAF156 and GNF179. The latter approach permits the isolation of low-fitness mutants that might otherwise be out-competed during selection. Whole-genome sequencing of 24 independently derived resistant Plasmodium falciparum clones revealed four parasites with mutations in the known cyclic amine resistance locus (pfcarl) and a further 20 with mutations in two previously unreported P. falciparum drug resistance genes, an acetyl-CoA transporter (pfact) and a UDP-galactose transporter (pfugt). Mutations were validated both in vitro by CRISPR editing in P. falciparum and in vivo by evolution of resistant Plasmodium berghei mutants. Both PfACT and PfUGT were localized to the endoplasmic reticulum by fluorescence microscopy. As mutations in pfact and pfugt conveyed resistance against additional unrelated chemical scaffolds, these genes are probably involved in broad mechanisms of antimalarial drug resistance.

Occurrence of integrons and resistance genes among sulphonamide-resistant Shigella spp. from Brazil

DEFF Research Database (Denmark)

Peirano, G.; Agersø, Yvonne; Aarestrup, Frank Møller

2005-01-01

Objectives: To determine the occurrence of class 1 and 2 integrons and antimicrobial resistance genes among sulphonamide-resistant Shigella strains isolated in Brazil during 1999-2003. Methods: Sixty-two Shigella (Shigella flexneri, n = 47 and Shigella sonnei, n = 15) were tested against 21...... antimicrobial agents. The presence of integrons classes 1 and 2 and antimicrobial resistance genes was investigated by PCR using specific primers. Results: A total of eight antimicrobial resistance profiles were identified, with the profile of resistance to sulfamethoxazole, trimethoprim, spectinomycin...... of 2214 bp harbouring a gene cassette array conferring resistance to trimethoprim, streptothricin and spectinomycin/streptomycin. The genes coding for resistance to chloramphenicol (catA1), tetracycline [tet(A) and tet(B)] and ampicillin (bla(OXA) and bla(TEM)), were detected in resistant strains...

SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

Directory of Open Access Journals (Sweden)

Mehmet AYBEKE

2015-12-01

Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

Organization of a resistance gene cluster linked to rhizomania resistance in sugar beet

Science.gov (United States)

Genetic resistance to rhizomania has been in use for over 40 years. Characterization of the molecular basis for susceptibility and resistance has proved challenging. Nucleotide-binding leucine-rich-repeat-containing (NB-LRR) genes have been implicated in numerous gene-for-gene resistance interaction...

Resistance switching at the interface of LaAlO3/SrTiO3

DEFF Research Database (Denmark)

Chen, Yunzhong; Zhao, J.L.; Sun, J.R.

2010-01-01

At the interface of LaAlO3/SrTiO3 with film thickness of 3 unit cells or greater, a reproducible electric-field-induced bipolar resistance switching of the interfacial conduction is observed on nanometer scale by a biased conducting atomic force microscopy under vacuum environment. The switching ...

Investigation of the electroforming and resistive switching mechanisms in Fe-doped SrTiO{sub 3} thin films

Energy Technology Data Exchange (ETDEWEB)

Menke, Tobias

2009-11-27

To overcome the physical limits of todays memory technologies new concepts are needed. The resistive random access memory (RRAM), which bases on a nonvolatile and repeatable change of the resistance by external electrical stimuli, seems to be one promising candidate. Within the scope of this work, the model system Strontium titanate (SrTiO{sub 3}) has been investigated to get a deeper understanding of the underlying physical mechanism related to the resistance change. The electrical properties of SrTiO{sub 3} (STO) can be modulated from a band insulator to metallic conduction by a self-doping with oxygen vacancies which act as shallow donors. A local accumulation or depletion of oxygen vacancies at the vicinity of the surface will lead to a local redox process which is responsible for the resistance change. To study the influence of the interfaces on the switching properties of SrTiO{sub 3} thin films, epitaxial films of Fe-doped SrTiO{sub 3} were grown on different bottom electrodes (SrRuO{sub 3}, LaNiO{sub 3} und Nb:STO) by a ''Pulsed Laser Deposition'' technique. An atomic force microscope equipped with a conductive tip (LC-AFM) allowed studying the conductivity of the deposited films on the nanometer scale. Resistive switching of lateral structures smaller than {proportional_to}5 nm could be realized which represents the potential of this material for a further downscaling of RRAM devices. The deposition of top electrodes, made of Platinum or Titanium, allowed the electrical characterization of metal-insulator-metal (MIM) structures. An extensive investigation of pristine MIM-devices by impedance spectroscopy showed the big impact of the metal-insulator interface on the overall device resistance. Furthermore, a chemical polarization was studied by dynamical current sweeps and identified as a volatile resistance variation. Usually a forming procedure is needed to ''enable'' the resistive switching properties in MIM devices

Prevalence of antibiotic resistance genes from effluent of coastal aquaculture, South Korea.

Science.gov (United States)

Jang, Hyun Min; Kim, Young Beom; Choi, Sangki; Lee, Yunho; Shin, Seung Gu; Unno, Tatsuya; Kim, Young Mo

2018-02-01

The wide use of antibiotics in aquaculture for prophylactic and therapeutic purposes can potentially lead to the prevalence of antibiotic resistance genes (ARGs). This study reports for the first time the profile of ARGs from effluents of coastal aquaculture located in South Jeolla province and Jeju Island, South Korea. Using quantitative PCR (qPCR), twenty-two ARGs encoding tetracycline resistance (tetA, tetB, tetD, tetE, tetG, tetH, tetM, tetQ, tetX, tetZ, tetBP), sulfonamide resistance (sul1, sul2), quinolone resistance (qnrD, qnrS, aac(6')-Ib-cr), β-lactams resistance (bla TEM , bla CTX , bla SHV ), macrolide resistance (ermC), florfenicol resistance (floR) and multidrug resistance (oqxA) and a class 1 integrons-integrase gene (intI1) were quantified. In addition, Illumina Miseq sequencing was applied to investigate microbial community differences across fish farm effluents. Results from qPCR showed that the total number of detected ARGs ranged from 4.24 × 10 -3 to 1.46 × 10 -2 copies/16S rRNA gene. Among them, tetB and tetD were predominant, accounting for 74.8%-98.0% of the total ARGs. Furthermore, intI1 gene showed positive correlation with tetB, tetD, tetE, tetH, tetX, tetZ tetQ and sul1. Microbial community analysis revealed potential host bacteria for ARGs and intI1. Two genera, Vibrio and Marinomonas belonging to Gammaproteobacteria, showed significant correlation with tetB and tetD, the most dominant ARGs in all samples. Also, operational taxonomic units (OTUs)-based network analysis revealed that ten OTUs, classified into the phyla Proteobacteria, Cyanobacteria/Chloroplast, Bacteroidetes, Verrucomicrobia and an unclassified phylum, were potential hosts of tetracycline resistance genes (i.e., tetA, tetG, tetH, tetM, tetQ and tetZ). Further systematic monitoring of ARGs is warranted for risk assessment and management of antibacterial resistance from fish farm effluents. Copyright © 2017 Elsevier Ltd. All rights reserved.

Gene-gene combination effect and interactions among ABCA1, APOA1, SR-B1, and CETP polymorphisms for serum high-density lipoprotein-cholesterol in the Japanese population.

Directory of Open Access Journals (Sweden)

Akihiko Nakamura

Full Text Available BACKGROUND/OBJECTIVE: Gene-gene interactions in the reverse cholesterol transport system for high-density lipoprotein-cholesterol (HDL-C are poorly understood. The present study observed gene-gene combination effect and interactions between single nucleotide polymorphisms (SNPs in ABCA1, APOA1, SR-B1, and CETP in serum HDL-C from a cross-sectional study in the Japanese population. METHODS: The study population comprised 1,535 men and 1,515 women aged 35-69 years who were enrolled in the Japan Multi-Institutional Collaborative Cohort (J-MICC Study. We selected 13 SNPs in the ABCA1, APOA1, CETP, and SR-B1 genes in the reverse cholesterol transport system. The effects of genetic and environmental factors were assessed using general linear and logistic regression models after adjusting for age, sex, and region. PRINCIPAL FINDINGS: Alcohol consumption and daily activity were positively associated with HDL-C levels, whereas smoking had a negative relationship. The T allele of CETP, rs3764261, was correlated with higher HDL-C levels and had the highest coefficient (2.93 mg/dL/allele among the 13 SNPs, which was statistically significant after applying the Bonferroni correction (p<0.001. Gene-gene combination analysis revealed that CETP rs3764261 was associated with high HDL-C levels with any combination of SNPs from ABCA1, APOA1, and SR-B1, although no gene-gene interaction was apparent. An increasing trend for serum HDL-C was also observed with an increasing number of alleles (p<0.001. CONCLUSIONS: The present study identified a multiplier effect from a polymorphism in CETP with ABCA1, APOA1, and SR-B1, as well as a dose-dependence according to the number of alleles present.

Low-temperature resistivity anomaly in underdoped Pr0.8Sr0.2MnO3 manganite nanoparticles

International Nuclear Information System (INIS)

Das, Proloy T.; Giri, S.K.; Panda, J.; Taraphder, A.; Nath, T.K.; Nigam, A.K.

2013-01-01

High resolution electrical resistivity measurements were carried out of under-doped Pr 0.8 Sr 0.2 MnO 3 manganite nanoparticles with grain size modulation down to 40 nm in magnetic fields H, from 0 to 9 T in the low temperature regime down to a temperature of 4.2 K. In the temperature range below 80 K, a distinct resistivity minima is observed for all the samples with different particle sizes for all H. While trying to fit low temperature resistivity data with different models for the observed resistivity minima with negative temperature coefficient of resistance (TCR) for all H, it appears that all the data for different particle sizes, can be best described by electron-electron (e-e) interaction effect in comparison with other models, e.g., Kondo model, coulomb blockades etc. The low temperature data for all H have been fitted with an expression containing three terms, namely, residual resistivity, inelastic scattering, e-e interaction and Kondo effects. We conclude that the e-e interaction is the dominant transport mechanism at low temperatures for the observed negative TCR in this strongly disordered nanometric Pr 0.8 Sr 0.2 MnO 3 phase separated manganite system. (author)

High frequency of silver resistance genes in invasive isolates of Enterobacter and Klebsiella species.

Science.gov (United States)

Sütterlin, S; Dahlö, M; Tellgren-Roth, C; Schaal, W; Melhus, Å

2017-07-01

Silver-based products have been marketed as an alternative to antibiotics, and their consumption has increased. Bacteria may, however, develop resistance to silver. To study the presence of genes encoding silver resistance (silE, silP, silS) over time in three clinically important Enterobacteriaceae genera. Using polymerase chain reaction (PCR), 752 bloodstream isolates from the years 1990-2010 were investigated. Age, gender, and ward of patients were registered, and the susceptibility to antibiotics and silver nitrate was tested. Clonality and single nucleotide polymorphism were assessed with repetitive element sequence-based PCR, multi-locus sequence typing, and whole-genome sequencing. Genes encoding silver resistance were detected most frequently in Enterobacter spp. (48%), followed by Klebsiella spp. (41%) and Escherichia coli 4%. Phenotypical resistance to silver nitrate was found in Enterobacter (13%) and Klebsiella (3%) isolates. The lowest carriage rate of sil genes was observed in blood isolates from the neonatology ward (24%), and the highest in blood isolates from the oncology/haematology wards (66%). Presence of sil genes was observed in international high-risk clones. Sequences of the sil and pco clusters indicated that a single mutational event in the silS gene could have caused the phenotypic resistance. Despite a restricted consumption of silver-based products in Swedish health care, silver resistance genes are widely represented in clinical isolates of Enterobacter and Klebsiella species. To avoid further selection and spread of silver-resistant bacteria with a high potential for healthcare-associated infections, the use of silver-based products needs to be controlled and the silver resistance monitored. Copyright © 2017 The Healthcare Infection Society. Published by Elsevier Ltd. All rights reserved.

Associations between Antimicrobial Resistance Phenotypes, Antimicrobial Resistance Genes, and Virulence Genes of Fecal Escherichia coli Isolates from Healthy Grow-Finish Pigs ▿

OpenAIRE

Rosengren, Leigh B.; Waldner, Cheryl L.; Reid-Smith, Richard J.

2009-01-01

Escherichia coli often carries linked antimicrobial resistance genes on transmissible genetic elements. Through coselection, antimicrobial use may select for unrelated but linked resistance or virulence genes. This study used unconditional statistical associations to investigate the relationships between antimicrobial resistance phenotypes and antimicrobial resistance genes in 151 E. coli isolates from healthy pigs. Phenotypic resistance to each drug was significantly associated with phenotyp...

Transcriptomic Analysis and the Expression of Disease-Resistant Genes in Oryza meyeriana under Native Condition.

Directory of Open Access Journals (Sweden)

Bin He

Full Text Available Oryza meyeriana (O. meyeriana, with a GG genome type (2n = 24, accumulated plentiful excellent characteristics with respect to resistance to many diseases such as rice shade and blast, even immunity to bacterial blight. It is very important to know if the diseases-resistant genes exist and express in this wild rice under native conditions. However, limited genomic or transcriptomic data of O. meyeriana are currently available. In this study, we present the first comprehensive characterization of the O. meyeriana transcriptome using RNA-seq and obtained 185,323 contigs with an average length of 1,692 bp and an N50 of 2,391 bp. Through differential expression analysis, it was found that there were most tissue-specifically expressed genes in roots, and next to stems and leaves. By similarity search against protein databases, 146,450 had at least a significant alignment to existed gene models. Comparison with the Oryza sativa (japonica-type Nipponbare and indica-type 93-11 genomes revealed that 13% of the O. meyeriana contigs had not been detected in O. sativa. Many diseases-resistant genes, such as bacterial blight resistant, blast resistant, rust resistant, fusarium resistant, cyst nematode resistant and downy mildew gene, were mined from the transcriptomic database. There are two kinds of rice bacterial blight-resistant genes (Xa1 and Xa26 differentially or specifically expressed in O. meyeriana. The 4 Xa1 contigs were all only expressed in root, while three of Xa26 contigs have the highest expression level in leaves, two of Xa26 contigs have the highest expression profile in stems and one of Xa26 contigs was expressed dominantly in roots. The transcriptomic database of O. meyeriana has been constructed and many diseases-resistant genes were found to express under native condition, which provides a foundation for future discovery of a number of novel genes and provides a basis for studying the molecular mechanisms associated with disease

Fate of antibiotic resistant bacteria and genes during wastewater chlorination: implication for antibiotic resistance control.

Directory of Open Access Journals (Sweden)

Qing-Bin Yuan

Full Text Available This study investigated fates of nine antibiotic-resistant bacteria as well as two series of antibiotic resistance genes in wastewater treated by various doses of chlorine (0, 15, 30, 60, 150 and 300 mg Cl2 min/L. The results indicated that chlorination was effective in inactivating antibiotic-resistant bacteria. Most bacteria were inactivated completely at the lowest dose (15 mg Cl2 min/L. By comparison, sulfadiazine- and erythromycin-resistant bacteria exhibited tolerance to low chlorine dose (up to 60 mg Cl2 min/L. However, quantitative real-time PCRs revealed that chlorination decreased limited erythromycin or tetracycline resistance genes, with the removal levels of overall erythromycin and tetracycline resistance genes at 0.42 ± 0.12 log and 0.10 ± 0.02 log, respectively. About 40% of erythromycin-resistance genes and 80% of tetracycline resistance genes could not be removed by chlorination. Chlorination was considered not effective in controlling antimicrobial resistance. More concern needs to be paid to the potential risk of antibiotic resistance genes in the wastewater after chlorination.

Comparative mapping of powdery mildew resistance gene Pm21 and functional characterization of resistance-related genes in wheat.

Science.gov (United States)

He, Huagang; Zhu, Shanying; Jiang, Zhengning; Ji, Yaoyong; Wang, Feng; Zhao, Renhui; Bie, Tongde

2016-04-01

The powdery mildew resistance gene Pm21 was physically and comparatively mapped by newly developed markers. Seven candidate genes were verified to be required for Pm21 -mediated resistance to wheat powdery mildew. Pm21, a gene derived from wheat wild relative Dasypyrum villosum, has been transferred into common wheat and widely utilized in wheat resistance breeding for powdery mildew. Previously, Pm21 has been located to the bin FL0.45-0.58 of 6VS by using deletion stocks. However, its fine mapping is still a hard work. In the present study, 30 gene-derived 6VS-specific markers were obtained based on the collinearity among genomes of Brachypodium distachyon, Oryza and Triticeae, and then physically and comparatively mapped in the bin FL0.45-0.58 and its nearby chromosome region. According to the maps, the bin FL0.45-0.58 carrying Pm21 was closely flanked by the markers 6VS-03 and 6VS-23, which further narrowed the orthologous regions to 1.06 Mb in Brachypodium and 1.38 Mb in rice, respectively. Among the conserved genes shared by Brachypodium and rice, four serine/threonine protein kinase genes (DvMPK1, DvMLPK, DvUPK and DvPSYR1), one protein phosphatase gene (DvPP2C) and two transcription factor genes (DvGATA and DvWHY) were confirmed to be required for Pm21-mediated resistance to wheat powdery mildew by barley stripe mosaic virus-induced gene silencing (BSMV-VIGS) and transcriptional pattern analyses. In summary, this study gives new insights into the genetic basis of the Pm21 locus and the disease resistance pathways mediated by Pm21.

Analysis of the grape (Vitis vinifera L.) thaumatin-like protein (TLP) gene family and demonstration that TLP29 contributes to disease resistance.

Science.gov (United States)

Yan, Xiaoxiao; Qiao, Hengbo; Zhang, Xiuming; Guo, Chunlei; Wang, Mengnan; Wang, Yuejin; Wang, Xiping

2017-06-27

Thaumatin-like protein (TLP) is present as a large family in plants, and individual members play different roles in various responses to biotic and abiotic stresses. Here we studied the role of 33 putative grape (Vitis vinifera L.) TLP genes (VvTLP) in grape disease resistance. Heat maps analysis compared the expression profiles of 33 genes in disease resistant and susceptible grape species infected with anthracnose (Elsinoe ampelina), powdery mildew (Erysiphe necator) or Botrytis cinerea. Among these 33 genes, the expression level of TLP29 increased following the three pathogens inoculations, and its homolog from the disease resistant Chinese wild grape V. quinquangularis cv. 'Shang-24', was focused for functional studies. Over-expression of TLP29 from grape 'Shang-24' (VqTLP29) in Arabidopsis thaliana enhanced its resistance to powdery mildew and the bacterium Pseudomonas syringae pv. tomato DC3000, but decreased resistance to B. cinerea. Moreover, the stomatal closure immunity response to pathogen associated molecular patterns was strengthened in the transgenic lines. A comparison of the expression profiles of various resistance-related genes after infection with different pathogens indicated that VqTLP29 may be involved in the salicylic acid and jasmonic acid/ethylene signaling pathways.

Resistive switching phenomena of extended defects in Nb-doped SrTiO3 under influence of external gradients

International Nuclear Information System (INIS)

Rodenbuecher, Christian

2014-01-01

Redox-based memristive materials have attracted much attention in the last decade owing to their ability to change the resistance upon application of an electric field making them promising candidates for future non-volatile memories. However, a fundamental understanding of the nature of the resistive switching effect, which is indispensable for designing future technological applications,is still lacking. As a prototype material of a memristive oxide, strontium titanate (SrTiO 3 ) has been investigated intensively and it was revealed that the valence change of a Ti ''d'' electron plays an important role during resistive switching related to insulator-to-metal transition. Such a transition can be induced by electrical gradients, by chemical gradients, by a combination of these gradients or by donor doping. Hence, SrTiO 3 doped with the donor Nb should have metallic properties and is used commonly as a conducting substrate for the growth of functional oxide thin films. Nevertheless,the resistive switching effect has also be observed in Nb-doped SrTiO 3 . This paradoxical situation offers a unique opportunity to gain an insight into the processes during the insulator-to metal transition. In this thesis, a comprehensive study of the influence of external gradients on SrTiO 3 :Nb single crystals is presented. The focus is especially set on the investigation of the crystallographic structure, the chemical composition, the electronic structure, the lattice dynamics and the electronic transport phenomena using surface-sensitive methods on the macro- and nanoscale. On the as-received epi-polished single crystals, the evolution of a surface layer having a slight excess of strontium and - in contrast to the bulk of the material - semiconducting properties are observed. Hence, the key for understanding of the resistive switching effect is the knowledge of the nature of the surface layer. On the basis of systematic studies of the influence of external

Multi-level resistive switching behaviors and retention characteristics in ZnO/Nb:SrTiO3 heterojunction

Science.gov (United States)

Ren, Yong; Li, Jiachen; Zhang, Weifeng; Jia, Caihong

2017-10-01

Epitaxial ZnO thin films were grown on SrTiO3:Nb (NSTO) substrates by rf magnetron sputtering method. The multi-level resistance states were observed by applying different amplitudes and/or polarities of voltage pulses, which is supposed to be related to the drift of oxygen vacancies. Furthermore, the decay of retention is also corresponding to the migration of oxygen vacancies. The retention and cycle stability implies that the ZnO/Nb:SrTiO3 heterojunctions are promising for high density memory application.

Genome-wide association study for Identification and validation of novel SNP markers for Sr6 stem rust resistance gene in bread wheat

Science.gov (United States)

Stem rust (caused by Puccinia graminis f. sp. tritici Erikss. & E. Henn.), is a major disease in wheat (Triticum aestivium L.). However, in recent years it occurs rarely in Nebraska due to weather and the effective selection and gene pyramiding of resistance genes. To understand the genetic basis of...

The novel and taxonomically restricted Ah24 gene from grain amaranth (Amaranthus hypochondriacus has a dual role in development and defense

Directory of Open Access Journals (Sweden)

Julio Armando Massange-Sanchez

2015-08-01

Full Text Available Grain amaranths tolerate stress and produce highly nutritious seeds. We have identified several (abiotic stress-responsive genes of unknown function in Amaranthus hypochondriacus, including the so-called Ah24 gene. Ah24 was expressed in young or developing tissues; it was also strongly induced by mechanical damage, insect herbivory and methyl jasmonate and in meristems and newly emerging leaves of severely defoliated plants. Interestingly, an in silico analysis of its 1304 bp promoter region showed a predominance of regulatory boxes involved in development, but not in defense. The Ah24 cDNA encodes a predicted cytosolic protein of 164 amino acids, the localization of which was confirmed by confocal microscopy. Additional in silico analysis identified several other Ah24 homologs, present almost exclusively in plants belonging to the Caryophyllales. The possible function of this gene in planta was examined in transgenic Ah24 overexpressing Arabidopsis thaliana and Nicotiana tabacum plants. Transformed Arabidopsis showed enhanced vegetative growth and increased leaf number with no penalty in one fitness component, such as seed yield, in experimental conditions. Transgenic tobacco plants, which grew and reproduced normally, had increased insect herbivory resistance. Modified vegetative growth in transgenic Arabidopsis coincided with significant changes in the expression of genes controlling phytohormone synthesis or signaling, whereas increased resistance to insect herbivory in transgenic tobacco coincided with higher jasmonic acid and proteinase inhibitor activity levels, plus the accumulation of nicotine and several other putative defense-related metabolites. It is proposed that the primary role of the Ah24 gene in A. hypochondriacus is to contribute to a rapid recovery post-wounding or defoliation, although its participation in defense against insect herbivory is also plausible.

Identifying resistance gene analogs associated with resistances to different pathogens in common bean.

Science.gov (United States)

López, Camilo E; Acosta, Iván F; Jara, Carlos; Pedraza, Fabio; Gaitán-Solís, Eliana; Gallego, Gerardo; Beebe, Steve; Tohme, Joe

2003-01-01

ABSTRACT A polymerase chain reaction approach using degenerate primers that targeted the conserved domains of cloned plant disease resistance genes (R genes) was used to isolate a set of 15 resistance gene analogs (RGAs) from common bean (Phaseolus vulgaris). Eight different classes of RGAs were obtained from nucleotide binding site (NBS)-based primers and seven from not previously described Toll/Interleukin-1 receptor-like (TIR)-based primers. Putative amino acid sequences of RGAs were significantly similar to R genes and contained additional conserved motifs. The NBS-type RGAs were classified in two subgroups according to the expected final residue in the kinase-2 motif. Eleven RGAs were mapped at 19 loci on eight linkage groups of the common bean genetic map constructed at Centro Internacional de Agricultura Tropical. Genetic linkage was shown for eight RGAs with partial resistance to anthracnose, angular leaf spot (ALS) and Bean golden yellow mosaic virus (BGYMV). RGA1 and RGA2 were associated with resistance loci to anthracnose and BGYMV and were part of two clusters of R genes previously described. A new major cluster was detected by RGA7 and explained up to 63.9% of resistance to ALS and has a putative contribution to anthracnose resistance. These results show the usefulness of RGAs as candidate genes to detect and eventually isolate numerous R genes in common bean.

Co-ordinate loss of protein kinase C and multidrug resistance gene expression in revertant MCF-7/Adr breast carcinoma cells.

Science.gov (United States)

Budworth, J; Gant, T W; Gescher, A

1997-01-01

The aim of this study was to investigate the link between protein kinase C (PKC) and multidrug resistance (mdr) phenotype. The expression of both was studied in doxorubicin-resistant MCF-7/Adr cells as they reverted to the wild-type phenotype when cultured in the absence of drug. The following parameters were measured in cells 4, 10, 15, 20 and 24 weeks after removal of doxorubicin; (1) sensitivity of the cells towards doxorubicin; (2) levels of P-glycoprotein (P-gp) and MDR1 mRNA; (3) levels and cellular localization of PKC isoenzyme proteins alpha, theta and epsilon; and (4) gene copy number of PKC-alpha and MDR1 genes. Cells lost their resistance gradually with time, so that by week 24 they had almost completely regained the drug sensitivity seen in wild-type MCF-7 cells. P-gp levels measured by Western blot mirrored the change in doxorubicin sensitivity. By week 20, P-gp had decreased to 18% of P-gp protein levels at the outset, and P-gp was not detectable at week 24. Similarly, MDR1 mRNA levels had disappeared by week 24. MCF-7/Adr cells expressed more PKCs-alpha and -theta than wild-type cells and possessed a different cellular localization of PKC-epsilon. The expression and distribution pattern of these PKCs did not change for up to 20 weeks, but reverted back to that seen in wild-type cells by week 24. MDR1 gene amplification remained unchanged until week 20, but then was lost precipitously between weeks 20 and 24. The PKC-alpha gene was not amplified in MCF-7/Adr cells. The results suggest that MCF-7/Adr cells lose MDR1 gene expression and PKC activity in a co-ordinate fashion, consistent with the existence of a mechanistic link between MDR1 and certain PKC isoenzymes.

Identification of genes associated with cisplatin resistance in human oral squamous cell carcinoma cell line

International Nuclear Information System (INIS)

Zhang, Ping; Zhang, Zhiyuan; Zhou, Xiaojian; Qiu, Weiliu; Chen, Fangan; Chen, Wantao

2006-01-01

Cisplatin is widely used for chemotherapy of head and neck squamous cell carcinoma. However, details of the molecular mechanism responsible for cisplatin resistance are still unclear. The aim of this study was to identify the expression of genes related to cisplatin resistance in oral squamous cell carcinoma cells. A cisplatin-resistant cell line, Tca/cisplatin, was established from a cisplatin-sensitive cell line, Tca8113, which was derived from moderately-differentiated tongue squamous cell carcinoma. Global gene expression in this resistant cell line and its sensitive parent cell line was analyzed using Affymetrix HG-U95Av2 microarrays. Candidate genes involved in DNA repair, the MAP pathway and cell cycle regulation were chosen to validate the microarray analysis results. Cell cycle distribution and apoptosis following cisplatin exposure were also investigated. Cisplatin resistance in Tca/cisplatin cells was stable for two years in cisplatin-free culture medium. The IC50 for cisplatin in Tca/cisplatin was 6.5-fold higher than that in Tca8113. Microarray analysis identified 38 genes that were up-regulated and 25 that were down-regulated in this cell line. Some were novel candidates, while others are involved in well-characterized mechanisms that could be relevant to cisplatin resistance, such as RECQL for DNA repair and MAP2K6 in the MAP pathway; all the genes were further validated by Real-time PCR. The cell cycle-regulated genes CCND1 and CCND3 were involved in cisplatin resistance; 24-hour exposure to 10 μM cisplatin induced a marked S phase block in Tca/cisplatin cells but not in Tca8113 cells. The Tca8113 cell line and its stable drug-resistant variant Tca/cisplatin provided a useful model for identifying candidate genes responsible for the mechanism of cisplatin resistance in oral squamous cell carcinoma. Our data provide a useful basis for screening candidate targets for early diagnosis and further intervention in cisplatin resistance

Identification of genes associated with cisplatin resistance in human oral squamous cell carcinoma cell line

Directory of Open Access Journals (Sweden)

Zhang Ping

2006-09-01

Full Text Available Abstract Background Cisplatin is widely used for chemotherapy of head and neck squamous cell carcinoma. However, details of the molecular mechanism responsible for cisplatin resistance are still unclear. The aim of this study was to identify the expression of genes related to cisplatin resistance in oral squamous cell carcinoma cells. Methods A cisplatin-resistant cell line, Tca/cisplatin, was established from a cisplatin-sensitive cell line, Tca8113, which was derived from moderately-differentiated tongue squamous cell carcinoma. Global gene expression in this resistant cell line and its sensitive parent cell line was analyzed using Affymetrix HG-U95Av2 microarrays. Candidate genes involved in DNA repair, the MAP pathway and cell cycle regulation were chosen to validate the microarray analysis results. Cell cycle distribution and apoptosis following cisplatin exposure were also investigated. Results Cisplatin resistance in Tca/cisplatin cells was stable for two years in cisplatin-free culture medium. The IC50 for cisplatin in Tca/cisplatin was 6.5-fold higher than that in Tca8113. Microarray analysis identified 38 genes that were up-regulated and 25 that were down-regulated in this cell line. Some were novel candidates, while others are involved in well-characterized mechanisms that could be relevant to cisplatin resistance, such as RECQL for DNA repair and MAP2K6 in the MAP pathway; all the genes were further validated by Real-time PCR. The cell cycle-regulated genes CCND1 and CCND3 were involved in cisplatin resistance; 24-hour exposure to 10 μM cisplatin induced a marked S phase block in Tca/cisplatin cells but not in Tca8113 cells. Conclusion The Tca8113 cell line and its stable drug-resistant variant Tca/cisplatin provided a useful model for identifying candidate genes responsible for the mechanism of cisplatin resistance in oral squamous cell carcinoma. Our data provide a useful basis for screening candidate targets for early diagnosis

Resistance Genes in Global Crop Breeding Networks.

Science.gov (United States)

Garrett, K A; Andersen, K F; Asche, F; Bowden, R L; Forbes, G A; Kulakow, P A; Zhou, B

2017-10-01

Resistance genes are a major tool for managing crop diseases. The networks of crop breeders who exchange resistance genes and deploy them in varieties help to determine the global landscape of resistance and epidemics, an important system for maintaining food security. These networks function as a complex adaptive system, with associated strengths and vulnerabilities, and implications for policies to support resistance gene deployment strategies. Extensions of epidemic network analysis can be used to evaluate the multilayer agricultural networks that support and influence crop breeding networks. Here, we evaluate the general structure of crop breeding networks for cassava, potato, rice, and wheat. All four are clustered due to phytosanitary and intellectual property regulations, and linked through CGIAR hubs. Cassava networks primarily include public breeding groups, whereas others are more mixed. These systems must adapt to global change in climate and land use, the emergence of new diseases, and disruptive breeding technologies. Research priorities to support policy include how best to maintain both diversity and redundancy in the roles played by individual crop breeding groups (public versus private and global versus local), and how best to manage connectivity to optimize resistance gene deployment while avoiding risks to the useful life of resistance genes. [Formula: see text] Copyright © 2017 The Author(s). This is an open access article distributed under the CC BY 4.0 International license .

Current-induced nonuniform enhancement of sheet resistance in A r+ -irradiated SrTi O3

Science.gov (United States)

Roy, Debangsu; Frenkel, Yiftach; Davidovitch, Sagi; Persky, Eylon; Haham, Noam; Gabay, Marc; Kalisky, Beena; Klein, Lior

2017-06-01

The sheet resistance Rs of A r+ irradiated SrTi O3 in patterns with a length scale of several microns increases significantly below ˜40 K in connection with driving currents exceeding a certain threshold. The initial lower Rs is recovered upon warming with accelerated recovery around 70 and 160 K. Scanning superconducting quantum interference device microscopy shows local irreversible changes in the spatial distribution of the current with a length scale of several microns. We attribute the observed nonuniform enhancement of Rs to the attraction of the charged single-oxygen and dioxygen vacancies by the crystallographic domain boundaries in SrTi O3 . The boundaries, which are nearly ferroelectric below 40 K, are polarized by the local electrical field associated with the driven current and the clustered vacancies which suppress conductivity in their vicinity and yield a noticeable enhancement in the device resistance when the current path width is on the order of the boundary extension. The temperatures of accelerated conductivity recovery are associated with the energy barriers for the diffusion of the two types of vacancies.

Transcriptome analysis highlights defense and signaling pathways mediated by rice pi21 gene with partial resistance to Magnaporthe oryzae

Directory of Open Access Journals (Sweden)

Yu Zhang

2016-12-01

Full Text Available Rice blast disease is one of the most destructive rice diseases worldwide. The pi21 gene confers partial and durable resistance to Magnaporthe oryzae. However, little is known regarding the molecular mechanisms of resistance mediated by the loss-of-function of Pi21. In this study, comparative transcriptome profiling of the Pi21-RNAi transgenic rice line and Nipponbare with M. oryzae infection at different time points (0, 12, 24, 48, and 72 hpi were investigated using RNA sequencing. The results generated 43,222 unique genes mapped to the rice genome. In total, 1,109 differentially expressed genes (DEGs were identified between the Pi21-RNAi line and Nipponbare with M. oryzae infection, with 103, 281, 209, 69, and 678 DEGs at 0, 12, 24, 48, and 72 hpi, respectively. Functional analysis showed that most of the DEGs were involved in metabolism, transport, signaling, and defense. Among the genes assigned to plant–pathogen interaction, we identified 43 receptor kinase genes associated with pathogen-associated molecular pattern recognition and calcium ion influx. The expression levels of brassinolide-insensitive 1, flagellin sensitive 2 and elongation factor Tu receptor, ethylene (ET biosynthesis and signaling genes, were higher in the Pi21-RNAi line than Nipponbare. This suggested that there was a more robust PTI response in Pi21-RNAi plants and that ET signaling was important to rice blast resistance. We also identified 53 transcription factor genes, including WRKY, NAC, DOF, and ERF families that show differential expression between the two genotypes. This study highlights possible candidate genes that may serve a function in the partial rice blast resistance mediated by the loss-of-function of Pi21 and increase our understanding of the molecular mechanisms involved in partial resistance against M. oryzae.

Retail ready-to-eat food as a potential vehicle for Staphylococcus spp. harboring antibiotic resistance genes.

Science.gov (United States)

Chajęcka-Wierzchowska, Wioleta; Zadernowska, Anna; Nalepa, Beata; Sierpińska, Magda; Laniewska-Trokenheim, Lucja

2014-06-01

Ready-to-eat (RTE) food, which does not need thermal processing before consumption, could be a vehicle for the spread of antibiotic-resistant microorganisms. As part of general microbiological safety checks, staphylococci are routinely enumerated in these kinds of foods. However, the presence of antibiotic-resistant staphylococci in RTE food is not routinely investigated, and data are only available from a small number of studies. The present study evaluated the pheno- and genotypical antimicrobial resistance profile of Staphylococcus spp. isolated from 858 RTE foods (cheeses, cured meats, sausages, smoked fishes, salads). Of 113 strains isolated, S. aureus was the most prevalent species, followed by S. xylosus, S. saprophyticus, and S. epidermidis. More than half (54.9%) of the isolates were resistant to at least one class of tested antibiotic; of these, 35.4% of the strains were classified as multidrug resistant. Most of the isolates were resistant to cefoxitin (49.6%), followed by clindamycin (39.3%), tigecycline (27.4%), quinupristin-dalfopristin (22.2%), rifampin (20.5%), tetracycline (17.9%), and erythromycin (8.5%). All methicillin-resistant staphylococci harbored the mecA gene. Among the isolates resistant to at least one antibiotic, 38 harbored tetracycline resistance determinant tet (M), 24 harbored tet (L), and 9 harbored tet (K). Of the isolates positive for tet (M) genes, 34.2% were positive for the Tn916-Tn1545-like integrase family gene. Our results indicated that retail RTE food could be considered an important route for the transmission of antibiotic-resistant bacteria harboring multiple antibiotic resistance genes.

Antimicrobial resistance and prevalence of resistance genes of obligate anaerobes isolated from periodontal abscesses.

Science.gov (United States)

Xie, Yi; Chen, Jiazhen; He, Junlin; Miao, Xinyu; Xu, Meng; Wu, Xingwen; Xu, Beiyun; Yu, Liying; Zhang, Wenhong

2014-02-01

This study attempts to determine the antimicrobial resistance profiles of obligate anaerobic bacteria that were isolated from a periodontal abscess and to evaluate the prevalence of resistance genes in these bacteria. Forty-one periodontal abscess samples were cultivated on selective and non-selective culture media to isolate the oral anaerobes. Their antibiotic susceptibilities to clindamycin, doxycycline, amoxicillin, imipenem, cefradine, cefixime, roxithromycin, and metronidazole were determined using the agar dilution method, and polymerase chain reaction assays were performed to detect the presence of the ermF, tetQ, nim, and cfxA drug resistance genes. A total of 60 different bacterial colonies was isolated and identified. All of the isolates were sensitive to imipenem. Of the strains, 6.7%, 13.3%, 16.7%, and 25% were resistant to doxycycline, metronidazole, cefixime, and amoxicillin, respectively. The resistance rate for both clindamycin and roxithromycin was 31.7%. Approximately 60.7% of the strains had the ermF gene, and 53.3% of the amoxicillin-resistant strains were found to have the cfxA gene. Two nim genes that were found in eight metronidazole-resistant strains were identified as nimB. In the present study, the Prevotella species are the most frequently isolated obligate anaerobes from periodontal abscesses. The current results show their alarmingly high resistance rate against clindamycin and roxithromycin; thus, the use of these antibiotics is unacceptable for the empirical therapy of periodontal abscesses. A brief prevalence of four resistance genes in the anaerobic bacteria that were isolated was also demonstrated.

The diversity of antimicrobial resistance genes among staphylococci of animal origin.

Science.gov (United States)

Wendlandt, Sarah; Feßler, Andrea T; Monecke, Stefan; Ehricht, Ralf; Schwarz, Stefan; Kadlec, Kristina

2013-08-01

Staphylococci of animal origin harbor a wide variety of resistance genes. So far, more than 40 different resistance genes have been identified in staphylococci from animals. This includes genes that confer resistance to virtually all classes of antimicrobial agents approved for use in animals, such as penicillins, cephalosporins, tetracyclines, macrolides, lincosamides, phenicols, aminoglycosides, aminocyclitols, pleuromutilins, and diaminopyrimidines. The gene products of some of these resistance genes confer resistance to only specific members of a class of antimicrobial agents, whereas others confer resistance to the entire class or even to members of different classes of antimicrobial agents. The resistance mechanisms specified by the resistance genes fall into three major categories: (i) enzymatic inactivation, (ii) active efflux, or (iii) protection/modification/replacement of the cellular target sites of the antimicrobial agents. Mobile genetic elements, in particular plasmids and transposons, play a major role as carriers of antimicrobial resistance genes in animal staphylococci. They facilitate the exchange of resistance genes with staphylococci of human origin but also with other Gram-positive bacteria. Copyright © 2013 Elsevier GmbH. All rights reserved.

Analysis of metal and biocides resistance genes in drug resistance and susceptible Salmonella enterica from food animals

Science.gov (United States)

Background Generally drug resistant bacteria carry antibiotic resistance genes and heavy metal and biocide resistance genes on large conjugative plasmids. The presence of these metal and biocide resistance genes in susceptible bacteria are not assessed comprehensively. Hence, WGS data of susceptib...

Candidate genes for cross-resistance against DNA-damaging drugs

DEFF Research Database (Denmark)

Wittig, Rainer; Nessling, Michelle; Will, Rainer D

2002-01-01

Drug resistance of tumor cells leads to major drawbacks in the treatment of cancer. To identify candidate genes for drug resistance, we compared the expression patterns of the drug-sensitive human malignant melanoma cell line MeWo and three derived sublines with acquired resistance to the DNA...... as several apoptosis-related genes, in particular STK17A and CRYAB. As MPP1 and CRYAB are also among the 14 genes differentially expressed in all three of the drug-resistant sublines, they represent the strongest candidates for resistance against DNA-damaging drugs....

Environmental 90Sr measurements

Science.gov (United States)

Paul, M.; Berkovits, D.; Cecil, L.D.; Feldstein, H.; Hershkowitz, A.; Kashiv, Y.; Vogt, S.

1997-01-01

90Sr (T1/2 = 28.5 years) is a long-lived radionuclide produced in nuclear fission. Fast radiochemical detection of 90Sr in environmental samples is not feasible using current analytical methods. Accelerator Mass Spectrometry (AMS) measurements of 90Sr were made with the Rehovot 14UD Pelletron accelerator at a terminal voltage of 11 or 12 MV using our standard detection system. Injection of hydride ions (SrH3-) was chosen owing to high beam intensity and low Coulomb explosion effects. 90Sr ions were identified and discriminated from isobaric 90Zr by measuring time of flight, total energy and three independent energy-loss signals in an ionization chamber. A reference sample and a ground-water sample were successfully measured. The detection limit determined for a laboratory blank by the residual counts in the 90Sr region is 90Sr/Sr = 3 ?? 10-13, corresponding in practice to (2-4) ?? 10790Sr atoms or about 0.5-1 pCi/L in environmental water samples.

Molecular study on some antibiotic resistant genes in Salmonella spp. isolates

Science.gov (United States)

Nabi, Ari Q.

2017-09-01

Studying the genes related with antimicrobial resistance in Salmonella spp. is a crucial step toward a correct and faster treatment of infections caused by the pathogen. In this work Integron mediated antibiotic resistant gene IntI1 (Class I Integrase IntI1) and some plasmid mediated antibiotic resistance genes (Qnr) were scanned among the isolated non-Typhoid Salmonellae strains with known resistance to some important antimicrobial drugs using Sybr Green real time PCR. The aim of the study was to correlate the multiple antibiotics and antimicrobial resistance of Salmonella spp. with the presence of integrase (IntI1) gene and plasmid mediated quinolone resistant genes. Results revealed the presence of Class I Integrase gene in 76% of the isolates with confirmed multiple antibiotic resistances. Moreover, about 32% of the multiple antibiotic resistant serotypes showed a positive R-PCR for plasmid mediated qnrA gene encoding for nalidixic acid and ciprofloxacin resistance. No positive results could be revealed form R-PCRs targeting qnrB or qnrS. In light of these results we can conclude that the presence of at least one of the qnr genes and/or the presence of Integrase Class I gene were responsible for the multiple antibiotic resistance to for nalidixic acid and ciprofloxacin from the studied Salmonella spp. and further studies required to identify the genes related with multiple antibiotic resistance of the pathogen.

Molecular mapping of stripe rust resistance gene YrSE5756 in synthetic hexaploid wheat and its transfer to common wheat

International Nuclear Information System (INIS)

Wang, Y.J.; Wang, C.Y.; Zhang, H.

2015-01-01

Synthetic hexaploid wheat is an important germplasm resource for transfer of beneficial genes from alien species to common wheat (Triticum aestivum L.). Synthetic hexaploid wheat SE5756 confers a high level of resistance against a wide range of races of Puccinia striiformis West. f. sp. tritici Eriks. et Henn.(Pst). The objectives of this study were to determine the inheritance pattern, adjacent molecular markers, and chromosomal location of the stripe rust resistance gene in SE5756 and to develop new germplasm. We constructed a segregating population of 116 F2 plants and corresponding F2:3 families from a cross between SE5756 and Xinong979 with Pst races CYR32. Genetic analysis revealed that a single dominant gene, tentatively designated as YrSE5756, was responsible for seedling stage stripe rust resistance in SE5756. A genetic map, encompassing Xwmc626, Xwmc269, Xgwm11, Xbarx137, Xwmc419, Xwmc85, Xgpw5237, Xwmc134, WE173, Xwmc631, and YrSE5756, spanned 70.1 cM on chromosome 1BS. Xwmc419 and Xwmc85 were flanking markers tightly linked to YrSE5756 at genetic distances of 2.3 and 1.8 cM. Typical adult plant responses of the SE5756, varieties of the carrier Yr10 and Yr15, Chuanmai 42 (Yr24/Yr26), Yuanfeng 175 (Yr24/Yr26) and Huixianhong resistant to mixture Pst races (CYR32, CYR33 and V26) were experimented. The results showed that YrSE5756 was likely a new resistance stripe rust gene different from Yr24/Yr26, Yr10 and Yr15. From cross and backcross populations of SE5756/Xinong 979, we developed four new wheat lines with large seeds, stripe rust resistance, and improved agronomic traits: N07178-1, N07178-2, N08256-1, and N08256-2. These new germplasm lines could serve as sources of resistance to stripe rust in wheat breeding. SE5756 has the very vital significance in the development of breeding and expand our resistance germplasm resource gene pool. (author)

Use of a fragment of the tuf gene for phytoplasma 16Sr group/subgroup differentiation

DEFF Research Database (Denmark)

Contaldo, Nicoletta; Canel, Alessandro; Makarova, Olga

2011-01-01

The usefulness of RFLP analyses on a 435 bp fragment of the tuf gene for preliminary identification of phytoplasmas from a number of phytoplasma ribosomal groups and/or 'Candidatus. Phytoplasma' was verified. The strains employed belong to thirteen 16Sr DNA groups and 22 different subgroups...

High chlorpyrifos resistance in Culex pipiens mosquitoes: strong synergy between resistance genes

Science.gov (United States)

Alout, H; Labbé, P; Berthomieu, A; Makoundou, P; Fort, P; Pasteur, N; Weill, M

2016-01-01

We investigated the genetic determinism of high chlorpyrifos resistance (HCR), a phenotype first described in 1999 in Culex pipiens mosquitoes surviving chlorpyrifos doses ⩾1 mg l−1 and more recently found in field samples from Tunisia, Israel or Indian Ocean islands. Through chlorpyrifos selection, we selected several HCR strains that displayed over 10 000-fold resistance. All strains were homozygous for resistant alleles at two main loci: the ace-1 gene, with the resistant ace-1R allele expressing the insensitive G119S acetylcholinesterase, and a resistant allele of an unknown gene (named T) linked to the sex and ace-2 genes. We constructed a strain carrying only the T-resistant allele and studied its resistance characteristics. By crossing this strain with strains harboring different alleles at the ace-1 locus, we showed that the resistant ace-1R and the T alleles act in strong synergy, as they elicited a resistance 100 times higher than expected from a simple multiplicative effect. This effect was specific to chlorpyrifos and parathion and was not affected by synergists. We also examined how HCR was expressed in strains carrying other ace-1-resistant alleles, such as ace-1V or the duplicated ace-1D allele, currently spreading worldwide. We identified two major parameters that influenced the level of resistance: the number and the nature of the ace-1-resistant alleles and the number of T alleles. Our data fit a model that predicts that the T allele acts by decreasing chlorpyrifos concentration in the compartment targeted in insects. PMID:26463842

Synthesis, structure, and electrical behavior of Sr{sub 4}Bi{sub 4}Ti{sub 7}O{sub 24}.

Energy Technology Data Exchange (ETDEWEB)

Zurbuchen, M. A.; Sherman, V. O.; Tagantsev, A. K.; Schubert, J.; Hawley, M. E.; Fong, D. D.; Streiffer, S. K.; Jia, Y.; Tian, W.; Schlom, D. G.; The Aerospace Corp.; Ecole Polytechnique Federale de Lausanne; IBNI-IT and JARA-Fundamentals fo Future Information Technologies; LANL; Cornell Univ.

2010-01-25

An n = 7 Aurivillius phase, Sr{sub 4}Bi{sub 4}Ti{sub 7}O{sub 24}, with c = 6.44 nm, was synthesized as an epitaxial (001)-oriented film. This phase and its purity were confirmed by x-ray diffraction and transmission electron microscopy. The material is ferroelectric, with a P{sub r} = 5.3 {micro}C/cm{sup 2} oriented in the (001) plane and a paraelectric-to-ferroelectric transition temperature of T{sub C} = 324 K. Some indications of relaxorlike behavior are observed. Such behavior is out of character for Sr{sub n-1}Bi{sub 2}Ti{sub n}O{sub 3n+3} Aurivillius phases and is closer to the bulk behavior of doped SrTiO{sub 3}, implying a spatial limit to the elastic interlayer interactions in these layered oxides. A finite-element solution to the interpretation of data from interdigitated capacitors on thin films is also described.

Microarray-based apoptosis gene screening technique in trichostatin A-induced drug-resisted lung cancer A549/CDDP cells

Directory of Open Access Journals (Sweden)

Ya-jun WANG

2016-09-01

Full Text Available Objective 　To detect the expression profile changes of apoptosis-related genes in trichostatin A (TSA-induced drug-resisted lung cancer cells A549/CDDP by microarray, in order to screen the target genes in TSA treating cisplatin-resisted lung cancer. Methods 　A549/CDDP cells were treated by TSA for 24 hours. Total RNA was extracted and reversely transcribed into cDNA. Gene expression levels were detected by the NimbleGen whole genome microarray. Differences of expression profiles between TSA-treated and control group were measured by NimbleScan 2.5 software and GO analysis. Apoptosis and proliferation related genes were screened from the expression changed genes. Results 　Compared with the control group, 85 apoptosis-related genes were up-regulated and 43 growth or proliferation related genes were down-regulated in the TSA-treated group. GO analysis showed that the functions of these genes are mainly regulating apoptosis, cell resistance to chem ical stimuli protein, as well as regulating cell growth, proliferation and the biological process of maintaining the cell biological quality. TSA-activated not only the mitochondrial apoptotic pathways, but also the death receptor related apoptosis pathway, and down-regulated the drug resistance related genes BAG3 and ABCC2. Conclusion 　TSA may cause the expression changes of apoptotic and proliferation genes in A549/CDDP cells, these genes may play a role in TSA treating cisplatin-resisted lung cancer. DOI: 10.11855/j.issn.0577-7402.2016.08.07

The expression of antibiotic resistance genes in antibiotic-producing bacteria.

Science.gov (United States)

Mak, Stefanie; Xu, Ye; Nodwell, Justin R

2014-08-01

Antibiotic-producing bacteria encode antibiotic resistance genes that protect them from the biologically active molecules that they produce. The expression of these genes needs to occur in a timely manner: either in advance of or concomitantly with biosynthesis. It appears that there have been at least two general solutions to this problem. In many cases, the expression of resistance genes is tightly linked to that of antibiotic biosynthetic genes. In others, the resistance genes can be induced by their cognate antibiotics or by intermediate molecules from their biosynthetic pathways. The regulatory mechanisms that couple resistance to antibiotic biosynthesis are mechanistically diverse and potentially relevant to the origins of clinical antibiotic resistance. © 2014 John Wiley & Sons Ltd.

Resistivity and Hall-effect measurements on LaAlO{sub 3}/SrTiO{sub 3-δ} heterostructures

Energy Technology Data Exchange (ETDEWEB)

Sleem, Ahmed [Institut fuer Festkoerperphysik, Karlsruher Institut fuer Technologie, Karlsruhe (Germany); Fakultaet fuer Physik, Karlsruher Institut fuer Technologie, Karlsruhe (Germany); Fuchs, Dirk; Schneider, Rudolf [Institut fuer Festkoerperphysik, Karlsruher Institut fuer Technologie, Karlsruhe (Germany); Mueller, Philipp; Gerthsen, Dagmar [Laboratorium fuer Elektronenmikroskopie, Karlsruher Institut fuer Technologie, Karlsruhe (Germany); Loehneysen, Hilbert von [Institut fuer Festkoerperphysik, Karlsruher Institut fuer Technologie, Karlsruhe (Germany); Physikalisches Institut, Karlsruher Institut fuer Technologie, Karlsruhe (Germany)

2013-07-01

The influence of the oxygen partial pressure p(O{sub 2}) during film deposition on the transport properties of LaAlO{sub 3}/SrTiO{sub 3-δ} heterostructures was analyzed by resistivity and Hall-effect measurements. To this end, thin films of LaAlO{sub 3} were grown epitaxially by pulsed laser deposition on TiO{sub 2} terminated <001> oriented SrTiO{sub 3} substrates at different oxygen partial pressure p(O{sub 2}), i.e., 10{sup -3} mbar≥p(O{sub 2})≥10{sup -5} mbar. Electrical contacts to the interface were prepared by argon ion-etching and subsequent filling by sputtering of Pt pads. Resistivity measurements were carried out in Van-der-Pauw geometry for 4.2 K≤T≤300 K. The charge carrier concentration, n{sub e}, and mobility, μ{sub e}, were deduced from the Hall-constant, R{sub H}, and conductivity, σ, at room temperature and 4.2 K. With decreasing p(O{sub 2}) the resistivity changes from an insulating/semi-conductive to a metallic behavior. Experimental results with respect to the sheet resistance R{sub S}, n{sub e}, and μ{sub e} versus p(O{sub 2}) are presented and discussed.

Biodegradation of 2,4-dichlorophenoxyacetic acid by bacteria with highly antibiotic-resistant pattern isolated from wheat field soils in Kurdistan, Iran.

Science.gov (United States)

Karami, Solmaz; Maleki, Afshin; Karimi, Ebrahim; Poormazaheri, Helen; Zandi, Shiva; Davari, Behrooz; Salimi, Yahya Zand; Gharibi, Fardin; Kalantar, Enayatollah

2016-12-01

Recently, there has been increasing interest to clean up the soils contaminated with herbicide. Our aim was to determine the bioremediation of 2,4-dichlorophenoxyacetic acid (2,4-D) from wheat fields which have a long history of herbicide in Sanandaj. Based on our literature survey, this study is the first report to isolate and identify antimicrobial resistant bacteria from polluted wheat field soils in Sanandaj which has the capacity to degrade 2,4-D. From 150 2,4-D-exposed soil samples, five different bacteria were isolated and identified based on biochemical tests and 16S ribosomal RNA (rRNA). Pseudomonas has been the most frequently isolated genus. By sequencing the 16S rRNA gene of the isolated bacteria, the strains were detected and identified as a member of the genus Pseudomonas sp, Entrobacter sp, Bacillus sp, Seratia sp, and Staphylococcus sp. The sequence of Sanandaj 1 isolate displayed 87% similarity with the 16S rRNA gene of a Pseudomonas sp (HE995788). Similarly, all the isolates were compared to standard strains based on 16S rRNA. Small amounts of 2,4-D could be transmitted to a depth of 10-20 cm; however, in the depth of 20-40 cm, we could not detect the 2,4-D. The isolates were resistant to various antibiotics particularly, penicillin, ampicillin, and amoxicillin.

Contrasting pressure effects in Sr2VFeAsO3 and Sr2ScFePO3

International Nuclear Information System (INIS)

Kotegawa, Hisashi; Kawazoe, Takayuki; Tou, Hideki; Murata, Keizo; Ogino, Hiraku; Kishio, Kohji; Shimoyama, Jun-ichi

2009-01-01

We report the resistivity measurements under pressure of two Fe-based superconductors with a thick perovskite oxide layer, Sr 2 VFeAsO 3 and Sr 2 ScFePO 3 . The superconducting transition temperature T c of Sr 2 VFeAsO 3 markedly increases with increasing pressure. Its onset value, which was T c onset =36.4 K at ambient pressure, increases to T c onset =46.0 K at ∼4 GPa, ensuring the potential of the '21113' system as a high-T c material. However, the superconductivity of Sr 2 ScFePO 3 is strongly suppressed under pressure. The T c onset of ∼16 K decreases to ∼5 K at ∼4 GPa, and the zero-resistance state is almost lost. We discuss the factor that induces this contrasting pressure effect. (author)

Prevalence of Resistence to Activated Protein C (Apc-Resistance in Blood Donors in Kosovo

Directory of Open Access Journals (Sweden)

Ymer Mekaj

2009-11-01

Full Text Available AbstractOne of the most frequent hereditary causes of thrombophilia is, without a doubt, resistance to Activated Protein C (APC-resistance, which is a consequence of point mutation in gene coding for coagulation Factor V (Factor V Leiden in 90-95% of cases.The aim of this paper was to determine prevalence of APC-resistance in a group of healthy blood donors. The size of the group is quite representative of Kosovo Albanians.A total of 944 blood donors were examined (537 males and 407 females, for whom APC-resistance was determined by functional methods of coagulation using the kit ACTICLOT® Protein C Resistance. Method is based on the test of APTT determined twice: first in the presence and second in the absence of activated Protein C (APC. The ratio of these two values constitutes is called Activated Protein C - Sensitivity Ratio (APC-SR.From 944 examined donors, pathologic values of APC-SR (1,3-1,9 were found in 32 persons (3,4% of the total number. The distribution among sexes was 3,35% (18/537 in male and 3,43% (14/407 in female subjects. The mean values of APC-SR (1,64 in male and 1,71 in female subjects were not significantly different (P = 0,22.Based on these results, we conclude that the prevalence of APC resistance in Albanian population of Kosovo is within the lower limit of prevalence in general population in different countries of European countries, which, according to some authors ranges is from 3 to 7%.

Molecular Scree ning of Blast Resistance Genes in Rice Germplasms Resistant to Magnaporthe oryzae

Directory of Open Access Journals (Sweden)

Liang Yan

2017-01-01

Full Text Available Molecular screening of major rice blast resistance genes was determined with molecular markers, which showed close-set linkage to 11 major rice blast resistance genes (Pi-d2, Pi-z, Piz-t, Pi-9, Pi-36, Pi-37, Pi5, Pi-b, Pik-p, Pik-h and Pi-ta2, in a collection of 32 accessions resistant to Magnaporthe oryzae. Out of the 32 accessions, the Pi-d2 and Pi-z appeared to be omnipresent and gave positive express. As the second dominant, Pi-b and Piz-t gene frequencies were 96.9% and 87.5%. And Pik-h and Pik-p gene frequencies were 43.8% and 28.1%, respectively. The molecular marker linkage to Pi-ta2 produced positive bands in eleven accessions, while the molecular marker linkage to Pi-36 and Pi-37 in only three and four accessions, respectively. The natural field evaluation analysis showed that 30 of the 32 accessions were resistant, one was moderately resistant and one was susceptible. Infection types were negatively correlated with the genotype scores of Pi-9, Pi5, Pi-b, Pi-ta2 and Pik-p, although the correlation coefficients were very little. These results are useful in identification and incorporation of functional resistance genes from these germplasms into elite cultivars through marker-assisted selection for improved blast resistance in China and worldwide.

A Japanese powdery mildew isolate with exceptionally large infection efficience on Mlo-resistant barley

DEFF Research Database (Denmark)

Lyngkjær, M.F.; Jensen, H.P.; Østergård, Hanne

1995-01-01

A Japanese field isolate (Race I) of Erysiphe graminis f,sp. hordei was tested on 17 barley lines carrying the mlo powdery mildew resistance gene. Race I produced many successful infections with infection type larger than or equal to 2 on six lines (M66, MC20, SR1, SR7, Atem and Totem). On the re...

Recessive Resistance to Plant Viruses: Potential Resistance Genes Beyond Translation Initiation Factors

Directory of Open Access Journals (Sweden)

Masayoshi Hashimoto

2016-10-01

Full Text Available The ability of plant viruses to propagate their genomes in host cells depends on many host factors. In the absence of an agrochemical that specifically targets plant viral infection cycles, one of the most effective methods for controlling viral diseases in plants is taking advantage of the host plant’s resistance machinery. Recessive resistance is conferred by a recessive gene mutation that encodes a host factor critical for viral infection. It is a branch of the resistance machinery and, as an inherited characteristic, is very durable. Moreover, recessive resistance may be acquired by a deficiency in a negative regulator of plant defense responses, possibly due to the autoactivation of defense signaling. Eukaryotic translation initiation factor (eIF 4E and eIF4G and their isoforms are the most widely exploited recessive resistance genes in several crop species, and they are effective against a subset of viral species. However, the establishment of efficient, recessive resistance-type antiviral control strategies against a wider range of plant viral diseases requires genetic resources other than eIF4Es. In this review, we focus on recent advances related to antiviral recessive resistance genes evaluated in model plants and several crop species. We also address the roles of next-generation sequencing and genome editing technologies in improving plant genetic resources for recessive resistance-based antiviral breeding in various crop species.

Antibiotic resistance and resistance genes in Escherichia coli from poultry farms, southwest Nigeria.

Science.gov (United States)

Adelowo, Olawale O; Fagade, Obasola E; Agersø, Yvonne

2014-09-12

This study investigated the mechanisms of resistance in 36 E. coli isolated from waste, litter, soil and water samples collected from poultry farms in Southwestern Nigeria. Minimum inhibitory concentration (MIC) distributions of the isolates were determined using the methods of the Clinical and Laboratory Standard Institute and resistance genes detected by PCR. A total of 30 isolates (94%) showed resistance to more than one antimicrobial. Percentage resistance was: tetracycline 81%, sulphamethoxazole 67%, streptomycin 56%, trimethoprim 47 %, ciprofloxacin 42%, ampicillin 36%, spectinomycin 28%, nalidixic acid 25%, chloramphenicol 22%, neomycin 14%, gentamicin 8%, amoxicillin-clavulanate, ceftiofur, cefotaxime, colistin, florfenicol and apramycin 0%. Resistance genes found among the isolates include bla-TEM (85%), sul2 (67%), sul3 (17%), aadA (65%), strA (70%), strB (61%), catA1 (25%), cmlA1 (13%), tetA (21%) and tetB (17%). Class 1 and 2 integrons were found in five (14%) and six (17%) isolates, respectively, while one isolate was positive for both classes of integrons. Seven out of eight isolates with resistance to ciprofloxacin and MIC ≤ 32 mg/L to nalidixic acid contained qnrS genes. Our findings provided additional evidence that the poultry production environment in Nigeria represents an important reservoir of antibiotic resistance genes such as qnrS that may spread from livestock production farms to human populations via manure and water.

[Distribution of anaerobes in periodontal abscess and its resistance to antibiotics].

Science.gov (United States)

He, Jun-lin; Yu, Li-ying; Chen, Jia-zhen

2012-12-01

To isolate and culture the predominant anaerobes from the periodontal abscesses, and to test the antibiotic susceptibility and drug resistant genes of the strains. The isolated strains were identified by both API20A biochemical method and polymerase chain reaction (PCR) method. The antibiotic susceptibility test was performed by agar dilution method. The resistant genes of the drug-resistant strains obtained were screened by PCR. The anaerobes were detected in 48% (28/58) of the samples and Prevotella melaninogenica (Pm) was mostly identified in 43% (12/28). API20A biochemical method had 82% (23/28) agreement with the 16SrRNA method in identification rate. Anaerobes were resistant to metronidazole, clindamycin and cefmetazole. The erythromycin-resistant methylase genes F (ermF) gene was detected in three of eight clindamycin resistant strains. None of them was found coded on bacterial plasmids. However, no metronidazole resistant gene was detected on drug resistant strains. Pm was the predominant species dectected in the periodontal abscess of the patients. The antibiotic agents should be used based on the genotypes and general condition of the patients.

Fine mapping of the rice bacterial blight resistance gene Xa-4 and its co-segregation marker

Institute of Scientific and Technical Information of China (English)

无

2000-01-01

An F2 population developed from the Xa-4 near isogenic lines,IR24 and IRBB4,was used for fine mapping of the rice bacterial blight resistance gene,Xa-4.Some restriction fragment length polymorphism (RFLP) markers on the high-density map constructed by Harushima et al.and the amplified DNA fragments homologous to the conserved domains of plant disease resistance (R) genes were used to construct the genetic linkage map around the gene Xa-4 by scoring susceptible individuals in the population.Xa-4 was mapped between the RFLP marker G181 and the polymerase chain reaction (PCR) marker M55.The R gene homologous fragment marker RS13 was found co-segregating with Xa-4 by analyzing all the plants in the population.This result opened an approach to map-based cloning of this gene,and marker RS13 can be applied to molecular marker-assisted selection of Xa-4 in rice breeding programs.

Genetic mapping, marker assisted selection and allelic relationships for the Pu 6 gene conferring rust resistance in sunflower.

Science.gov (United States)

Bulos, Mariano; Vergani, Pablo Nicolas; Altieri, Emiliano

2014-09-01

Rust resistance in the sunflower line P386 is controlled by Pu 6 , a gene which was reported to segregate independently from other rust resistant genes, such as R 4 . The objectives of this work were to map Pu 6 , to provide and validate molecular tools for its identification, and to determine the linkage relationship of Pu 6 and R 4 . Genetic mapping of Pu 6 with six markers covered 24.8 cM of genetic distance on the lower end of linkage Group 13 of the sunflower consensus map. The marker most closely linked to Pu 6 was ORS316 at 2.5 cM in the distal position. ORS316 presented five alleles when was assayed with a representative set of resistant and susceptible lines. Allelism test between Pu 6 and R 4 indicated that both genes are linked at a genetic distance of 6.25 cM. This is the first confirmation based on an allelism test that at least two members of the R adv /R 4 /R 11 / R 13a /R 13b /Pu 6 cluster of genes are at different loci. A fine elucidation of the architecture of this complex locus will allow designing and constructing completely new genomic regions combining genes from different resistant sources and the elimination of the linkage drag around each resistant gene.

Gene expression analysis of two extensively drug-resistant tuberculosis isolates show that two-component response systems enhance drug resistance.

Science.gov (United States)

Yu, Guohua; Cui, Zhenling; Sun, Xian; Peng, Jinfu; Jiang, Jun; Wu, Wei; Huang, Wenhua; Chu, Kaili; Zhang, Lu; Ge, Baoxue; Li, Yao

2015-05-01

Global analysis of expression profiles using DNA microarrays was performed between a reference strain H37Rv and two clinical extensively drug-resistant isolates in response to three anti-tuberculosis drug exposures (isoniazid, capreomycin, and rifampicin). A deep analysis was then conducted using a combination of genome sequences of the resistant isolates, resistance information, and related public microarray data. Certain known resistance-associated gene sets were significantly overrepresented in upregulated genes in the resistant isolates relative to that observed in H37Rv, which suggested a link between resistance and expression levels of particular genes. In addition, isoniazid and capreomycin response genes, but not rifampicin, either obtained from published works or our data, were highly consistent with the differentially expressed genes of resistant isolates compared to those of H37Rv, indicating a strong association between drug resistance of the isolates and genes differentially regulated by isoniazid and capreomycin exposures. Based on these results, 92 genes of the studied isolates were identified as candidate resistance genes, 10 of which are known resistance-related genes. Regulatory network analysis of candidate resistance genes using published networks and literature mining showed that three two-component regulatory systems and regulator CRP play significant roles in the resistance of the isolates by mediating the production of essential envelope components. Finally, drug sensitivity testing indicated strong correlations between expression levels of these regulatory genes and sensitivity to multiple anti-tuberculosis drugs in Mycobacterium tuberculosis. These findings may provide novel insights into the mechanism underlying the emergence and development of drug resistance in resistant tuberculosis isolates and useful clues for further studies on this issue. Copyright © 2015 Elsevier Ltd. All rights reserved.

Effect of Sr on the bioactivity and corrosion resistance of nanoporous niobium oxide coating for orthopaedic applications

International Nuclear Information System (INIS)

Pauline, S. Anne; Rajendran, N.

2014-01-01

In this study, strontium incorporated Nb 2 O 5 was synthesized in two different proportions by sol–gel methodology and was deposited on 316L SS by spin coating method. The synthesis conditions were optimized to obtain a nanoporous morphology. The prepared Sr-incorporated Nb 2 O 5 coatings were uniform, smooth and well adherent on to the substrate 316L SS. The coatings were characterized by attenuated total reflectance-infrared spectroscopy (ATR-IR), X-ray diffraction analysis (XRD), scanning electron microscopy (SEM), energy dispersive X-ray analysis (EDX), atomic force microscopy (AFM) and transmission electron microscopy (TEM) and the formation of Sr-incorporated Nb 2 O 5 coatings with nanoporous morphology was confirmed. Static water contact angle measurements showed an enhancement in the wettability of the obtained coatings. In vitro bioactivity test of the coated substrates showed that 0.05 M Sr-incorporated Nb 2 O 5 coating had better bioactivity compared to 0.1 M Sr-incorporated coating. Solution analysis studies confirmed the controlled release of Sr ions from the coating, which aid and enhance hydroxyapatite (HAp) growth. Electrochemical studies confirmed that the coatings provided excellent corrosion protection to the base material as increased charge transfer resistance and decreased double layer capacitance was observed for the coated substrates. - Highlights: • Nanoporous Sr-incorporated Nb 2 O 5 coatings were deposited on 316L SS. • The coatings have excellent bond strength and high Vickers micro hardness value. • Nanoporous 0.05 M Sr-incorporated Nb 2 O 5 coating showed hydroxyapatite growth. • Slow release of strontium from the coating accelerated hydroxyapatite growth. • The nanoporous coatings offered excellent corrosion protection to 316L SS

Occurrence of the mcr-1 Colistin Resistance Gene and other Clinically Relevant Antibiotic Resistance Genes in Microbial Populations at Different Municipal Wastewater Treatment Plants in Germany

Directory of Open Access Journals (Sweden)

Norman Hembach

2017-07-01

Full Text Available Seven wastewater treatment plants (WWTPs with different population equivalents and catchment areas were screened for the prevalence of the colistin resistance gene mcr-1 mediating resistance against last resort antibiotic polymyxin E. The abundance of the plasmid-associated mcr-1 gene in total microbial populations during water treatment processes was quantitatively analyzed by qPCR analyses. The presence of the colistin resistance gene was documented for all of the influent wastewater samples of the seven WWTPs. In some cases the mcr-1 resistance gene was also detected in effluent samples of the WWTPs after conventional treatment reaching the aquatic environment. In addition to the occurrence of mcr-1 gene, CTX-M-32, blaTEM, CTX-M, tetM, CMY-2, and ermB genes coding for clinically relevant antibiotic resistances were quantified in higher abundances in all WWTPs effluents. In parallel, the abundances of Acinetobacter baumannii, Klebsiella pneumoniae, and Escherichia coli were quantified via qPCR using specific taxonomic gene markers which were detected in all influent and effluent wastewaters in significant densities. Hence, opportunistic pathogens and clinically relevant antibiotic resistance genes in wastewaters of the analyzed WWTPs bear a risk of dissemination to the aquatic environment. Since many of the antibiotic resistance gene are associated with mobile genetic elements horizontal gene transfer during wastewater treatment can't be excluded.

A Novel Phytophthora sojae Resistance Rps12 Gene Mapped to a Genomic Region That Contains Several Rps Genes.

Science.gov (United States)

Sahoo, Dipak K; Abeysekara, Nilwala S; Cianzio, Silvia R; Robertson, Alison E; Bhattacharyya, Madan K

2017-01-01

Phytophthora sojae Kaufmann and Gerdemann, which causes Phytophthora root rot, is a widespread pathogen that limits soybean production worldwide. Development of Phytophthora resistant cultivars carrying Phytophthora resistance Rps genes is a cost-effective approach in controlling this disease. For this mapping study of a novel Rps gene, 290 recombinant inbred lines (RILs) (F7 families) were developed by crossing the P. sojae resistant cultivar PI399036 with the P. sojae susceptible AR2 line, and were phenotyped for responses to a mixture of three P. sojae isolates that overcome most of the known Rps genes. Of these 290 RILs, 130 were homozygous resistant, 12 heterzygous and segregating for Phytophthora resistance, and 148 were recessive homozygous and susceptible. From this population, 59 RILs homozygous for Phytophthora sojae resistance and 61 susceptible to a mixture of P. sojae isolates R17 and Val12-11 or P7074 that overcome resistance encoded by known Rps genes mapped to Chromosome 18 were selected for mapping novel Rps gene. A single gene accounted for the 1:1 segregation of resistance and susceptibility among the RILs. The gene encoding the Phytophthora resistance mapped to a 5.8 cM interval between the SSR markers BARCSOYSSR_18_1840 and Sat_064 located in the lower arm of Chromosome 18. The gene is mapped 2.2 cM proximal to the NBSRps4/6-like sequence that was reported to co-segregate with the Phytophthora resistance genes Rps4 and Rps6. The gene is mapped to a highly recombinogenic, gene-rich genomic region carrying several nucleotide binding site-leucine rich repeat (NBS-LRR)-like genes. We named this novel gene as Rps12, which is expected to be an invaluable resource in breeding soybeans for Phytophthora resistance.

A Novel Phytophthora sojae Resistance Rps12 Gene Mapped to a Genomic Region That Contains Several Rps Genes.

Directory of Open Access Journals (Sweden)

Dipak K Sahoo

Full Text Available Phytophthora sojae Kaufmann and Gerdemann, which causes Phytophthora root rot, is a widespread pathogen that limits soybean production worldwide. Development of Phytophthora resistant cultivars carrying Phytophthora resistance Rps genes is a cost-effective approach in controlling this disease. For this mapping study of a novel Rps gene, 290 recombinant inbred lines (RILs (F7 families were developed by crossing the P. sojae resistant cultivar PI399036 with the P. sojae susceptible AR2 line, and were phenotyped for responses to a mixture of three P. sojae isolates that overcome most of the known Rps genes. Of these 290 RILs, 130 were homozygous resistant, 12 heterzygous and segregating for Phytophthora resistance, and 148 were recessive homozygous and susceptible. From this population, 59 RILs homozygous for Phytophthora sojae resistance and 61 susceptible to a mixture of P. sojae isolates R17 and Val12-11 or P7074 that overcome resistance encoded by known Rps genes mapped to Chromosome 18 were selected for mapping novel Rps gene. A single gene accounted for the 1:1 segregation of resistance and susceptibility among the RILs. The gene encoding the Phytophthora resistance mapped to a 5.8 cM interval between the SSR markers BARCSOYSSR_18_1840 and Sat_064 located in the lower arm of Chromosome 18. The gene is mapped 2.2 cM proximal to the NBSRps4/6-like sequence that was reported to co-segregate with the Phytophthora resistance genes Rps4 and Rps6. The gene is mapped to a highly recombinogenic, gene-rich genomic region carrying several nucleotide binding site-leucine rich repeat (NBS-LRR-like genes. We named this novel gene as Rps12, which is expected to be an invaluable resource in breeding soybeans for Phytophthora resistance.

miR-24-2 controls H2AFX expression regardless of gene copy number alteration and induces apoptosis by targeting antiapoptotic gene BCL-2: a potential for therapeutic intervention.

Science.gov (United States)

Srivastava, Niloo; Manvati, Siddharth; Srivastava, Archita; Pal, Ranjana; Kalaiarasan, Ponnusamy; Chattopadhyay, Shilpi; Gochhait, Sailesh; Dua, Raina; Bamezai, Rameshwar N K

2011-04-04

that miR-24-2 is more effective in controlling H2AX gene expression, regardless of the change in gene copy number. Further, the study indicates that combination therapy with miR-24-2 along with an anticancer drug such as cisplatin could provide a new avenue in cancer therapy for patients with tumors otherwise resistant to drugs.

Anisotropic Resistivities of Precisely Oxygen Controlled Single-Crystal Bi2Sr2CaCu2O8+δ: Systematic Study on ''Spin Gap'' Effect

International Nuclear Information System (INIS)

Watanabe, T.; Matsuda, A.; Fujii, T.; Matsuda, A.

1997-01-01

The in-plane resistivity ρ a (T) and the out-of-plane resistivity ρ c (T) have been systematically measured for Bi 2 Sr 2 CaCu 2 O 8+δ single crystals with their oxygen contents precisely controlled. In the underdoped region, deviation from T -linear in-plane resistivity, which evidences the opening of the spin gap, is clearly observed, while the out-of-plane resistivity is well reproduced by the activation-type phenomenological formula ρ c (T)=(a/T)exp (Δ/T)+c . In contrast to the YBa 2 Cu 3 O 7-δ system, we find that the onset of the semiconducting ρ c (T) does not coincide with the opening of the spin gap seen in the ρ a (T) in this Bi 2 Sr 2 CaCu 2 O 8+δ system. copyright 1997 The American Physical Society

Sponge microbiota are a reservoir of functional antibiotic resistance genes

Directory of Open Access Journals (Sweden)

Dennis Versluis

2016-11-01

Full Text Available Wide application of antibiotics has contributed to the evolution of multi-drug resistant human pathogens, resulting in poorer treatment outcomes for infections. In the marine environment, seawater samples have been investigated as a resistance reservoir; however, no studies have methodically examined sponges as a reservoir of antibiotic resistance. Sponges could be important in this respect because they often contain diverse microbial communities that have the capacity to produce bioactive metabolites. Here, we applied functional metagenomics to study the presence and diversity of functional resistance genes in the sponges Aplysina aerophoba, Petrosia ficiformis and Corticium candelabrum. We obtained 37 insert sequences facilitating resistance to D-cycloserine (n=6, gentamicin (n=1, amikacin (n=7, trimethoprim (n=17, chloramphenicol (n=1, rifampicin (n=2 and ampicillin (n=3. Fifteen of 37 inserts harboured resistance genes that shared <90% amino acid identity with known gene products, whereas on 13 inserts no resistance gene could be identified with high confidence, in which case we predicted resistance to be mainly mediated by antibiotic efflux. One marine-specific ampicillin-resistance-conferring β-lactamase was identified in the genus Pseudovibrio with 41% global amino acid identity to the closest β-lactamase with demonstrated functionality, and subsequently classified into a new family termed PSV. Taken together, our results show that sponge microbiota host diverse and novel resistance genes that may be harnessed by phylogenetically distinct bacteria.

Effect of Sr on the bioactivity and corrosion resistance of nanoporous niobium oxide coating for orthopaedic applications

Energy Technology Data Exchange (ETDEWEB)

Pauline, S. Anne; Rajendran, N., E-mail: nrajendran@annauniv.edu

2014-03-01

In this study, strontium incorporated Nb{sub 2}O{sub 5} was synthesized in two different proportions by sol–gel methodology and was deposited on 316L SS by spin coating method. The synthesis conditions were optimized to obtain a nanoporous morphology. The prepared Sr-incorporated Nb{sub 2}O{sub 5} coatings were uniform, smooth and well adherent on to the substrate 316L SS. The coatings were characterized by attenuated total reflectance-infrared spectroscopy (ATR-IR), X-ray diffraction analysis (XRD), scanning electron microscopy (SEM), energy dispersive X-ray analysis (EDX), atomic force microscopy (AFM) and transmission electron microscopy (TEM) and the formation of Sr-incorporated Nb{sub 2}O{sub 5} coatings with nanoporous morphology was confirmed. Static water contact angle measurements showed an enhancement in the wettability of the obtained coatings. In vitro bioactivity test of the coated substrates showed that 0.05 M Sr-incorporated Nb{sub 2}O{sub 5} coating had better bioactivity compared to 0.1 M Sr-incorporated coating. Solution analysis studies confirmed the controlled release of Sr ions from the coating, which aid and enhance hydroxyapatite (HAp) growth. Electrochemical studies confirmed that the coatings provided excellent corrosion protection to the base material as increased charge transfer resistance and decreased double layer capacitance was observed for the coated substrates. - Highlights: • Nanoporous Sr-incorporated Nb{sub 2}O{sub 5} coatings were deposited on 316L SS. • The coatings have excellent bond strength and high Vickers micro hardness value. • Nanoporous 0.05 M Sr-incorporated Nb{sub 2}O{sub 5} coating showed hydroxyapatite growth. • Slow release of strontium from the coating accelerated hydroxyapatite growth. • The nanoporous coatings offered excellent corrosion protection to 316L SS.

Hairpin RNA Targeting Multiple Viral Genes Confers Strong Resistance to Rice Black-Streaked Dwarf Virus

Directory of Open Access Journals (Sweden)

Fangquan Wang

2016-05-01

Full Text Available Rice black-streaked dwarf virus (RBSDV belongs to the genus Fijivirus in the family of Reoviridae and causes severe yield loss in rice-producing areas in Asia. RNA silencing, as a natural defence mechanism against plant viruses, has been successfully exploited for engineering virus resistance in plants, including rice. In this study, we generated transgenic rice lines harbouring a hairpin RNA (hpRNA construct targeting four RBSDV genes, S1, S2, S6 and S10, encoding the RNA-dependent RNA polymerase, the putative core protein, the RNA silencing suppressor and the outer capsid protein, respectively. Both field nursery and artificial inoculation assays of three generations of the transgenic lines showed that they had strong resistance to RBSDV infection. The RBSDV resistance in the segregating transgenic populations correlated perfectly with the presence of the hpRNA transgene. Furthermore, the hpRNA transgene was expressed in the highly resistant transgenic lines, giving rise to abundant levels of 21–24 nt small interfering RNA (siRNA. By small RNA deep sequencing, the RBSDV-resistant transgenic lines detected siRNAs from all four viral gene sequences in the hpRNA transgene, indicating that the whole chimeric fusion sequence can be efficiently processed by Dicer into siRNAs. Taken together, our results suggest that long hpRNA targeting multiple viral genes can be used to generate stable and durable virus resistance in rice, as well as other plant species.

Hairpin RNA Targeting Multiple Viral Genes Confers Strong Resistance to Rice Black-Streaked Dwarf Virus.

Science.gov (United States)

Wang, Fangquan; Li, Wenqi; Zhu, Jinyan; Fan, Fangjun; Wang, Jun; Zhong, Weigong; Wang, Ming-Bo; Liu, Qing; Zhu, Qian-Hao; Zhou, Tong; Lan, Ying; Zhou, Yijun; Yang, Jie

2016-05-11

Rice black-streaked dwarf virus (RBSDV) belongs to the genus Fijivirus in the family of Reoviridae and causes severe yield loss in rice-producing areas in Asia. RNA silencing, as a natural defence mechanism against plant viruses, has been successfully exploited for engineering virus resistance in plants, including rice. In this study, we generated transgenic rice lines harbouring a hairpin RNA (hpRNA) construct targeting four RBSDV genes, S1, S2, S6 and S10, encoding the RNA-dependent RNA polymerase, the putative core protein, the RNA silencing suppressor and the outer capsid protein, respectively. Both field nursery and artificial inoculation assays of three generations of the transgenic lines showed that they had strong resistance to RBSDV infection. The RBSDV resistance in the segregating transgenic populations correlated perfectly with the presence of the hpRNA transgene. Furthermore, the hpRNA transgene was expressed in the highly resistant transgenic lines, giving rise to abundant levels of 21-24 nt small interfering RNA (siRNA). By small RNA deep sequencing, the RBSDV-resistant transgenic lines detected siRNAs from all four viral gene sequences in the hpRNA transgene, indicating that the whole chimeric fusion sequence can be efficiently processed by Dicer into siRNAs. Taken together, our results suggest that long hpRNA targeting multiple viral genes can be used to generate stable and durable virus resistance in rice, as well as other plant species.

A Gene Homologous to rRNA Methylase Genes Confers Erythromycin and Clindamycin Resistance in Bifidobacterium breve.

Science.gov (United States)

Martínez, Noelia; Luque, Roberto; Milani, Christian; Ventura, Marco; Bañuelos, Oscar; Margolles, Abelardo

2018-05-15

Bifidobacteria are mutualistic intestinal bacteria, and their presence in the human gut has been associated with health-promoting activities. The presence of antibiotic resistance genes in this genus is controversial, since, although bifidobacteria are nonpathogenic microorganisms, they could serve as reservoirs of resistance determinants for intestinal pathogens. However, until now, few antibiotic resistance determinants have been functionally characterized in this genus. In this work, we show that Bifidobacterium breve CECT7263 displays atypical resistance to erythromycin and clindamycin. In order to delimit the genomic region responsible for the observed resistance phenotype, a library of genomic DNA was constructed and a fragment of 5.8 kb containing a gene homologous to rRNA methylase genes was able to confer erythromycin resistance in Escherichia coli This genomic region seems to be very uncommon, and homologs of the gene have been detected in only one strain of Bifidobacterium longum and two other strains of B. breve In this context, analysis of shotgun metagenomics data sets revealed that the gene is also uncommon in the microbiomes of adults and infants. The structural gene and its upstream region were cloned into a B. breve -sensitive strain, which became resistant after acquiring the genetic material. In vitro conjugation experiments did not allow us to detect gene transfer to other recipients. Nevertheless, prediction of genes potentially acquired through horizontal gene transfer events revealed that the gene is located in a putative genomic island. IMPORTANCE Bifidobacterium breve is a very common human intestinal bacterium. Often described as a pioneer microorganism in the establishment of early-life intestinal microbiota, its presence has been associated with several beneficial effects for the host, including immune stimulation and protection against infections. Therefore, some strains of this species are considered probiotics. In relation to this

Electrical properties of resistive switches based on Ba1-χSrχTiO3 thin films prepared by RF co-sputtering

International Nuclear Information System (INIS)

Marquez H, A.; Hernandez R, E.; Zapata T, M.; Guillen R, J.; Cruz, M. P.; Calzadilla A, O.; Melendez L, M.

2010-01-01

In this work, was proposed the use of Ba 1-χ Sr χ TiO 3 (0≤x≤1) thin films for the construction of metal-insulator-metal heterostructures; and their great potential for the development of non-volatile resistance memories (ReRAM) is shown. The deposition of Ba 1-χ Sr χ TiO 3 thin films was done by the RF co-sputtering technique using two magnetron sputtering cathodes with BaTiO 3 and SrTiO 3 targets. The chemical composition (x parameter) in the deposited Ba 1-χ Sr χ TiO 3 thin films was varied through the RF powder applied to the targets. The constructed metal-insulator-metal heterostructures were Al/Ba 1-χ Sr χ TiO 3 /nichrome. The I-V measurements of the heterostructures showed that their hysteretic characteristics change depending on the Ba/Sr ratio of the Ba 1-χ Sr χ TiO 3 thin films; the Ba/Sr ratio was determined by employing the energy dispersive spectroscopy; Sem micrographs showed that Ba 1-χ Sr χ TiO 3 thin films were uniform without cracks or pinholes. Additionally, the analysis of the X-ray diffraction results indicated the substitutional incorporation of Sr into the BaTiO 3 lattice and the obtainment of crystalline films for the entire range of the x values. (Author)

Alteration of gene expression and DNA methylation in drug-resistant gastric cancer.

Science.gov (United States)

Maeda, Osamu; Ando, Takafumi; Ohmiya, Naoki; Ishiguro, Kazuhiro; Watanabe, Osamu; Miyahara, Ryoji; Hibi, Yoko; Nagai, Taku; Yamada, Kiyofumi; Goto, Hidemi

2014-04-01

The mechanisms of drug resistance in cancer are not fully elucidated. To study the drug resistance of gastric cancer, we analyzed gene expression and DNA methylation profiles of 5-fluorouracil (5-FU)- and cisplatin (CDDP)-resistant gastric cancer cells and biopsy specimens. Drug-resistant gastric cancer cells were established with culture for >10 months in a medium containing 5-FU or CDDP. Endoscopic biopsy specimens were obtained from gastric cancer patients who underwent chemotherapy with oral fluoropyrimidine S-1 and CDDP. Gene expression and DNA methylation analyses were performed using microarray, and validated using real-time PCR and pyrosequencing, respectively. Out of 17,933 genes, 541 genes commonly increased and 569 genes decreased in both 5-FU- and CDDP-resistant AGS cells. Genes with expression changed by drugs were related to GO term 'extracellular region' and 'p53 signaling pathway' in both 5-FU- and CDDP-treated cells. Expression of 15 genes including KLK13 increased and 12 genes including ETV7 decreased, in both drug-resistant cells and biopsy specimens of two patients after chemotherapy. Out of 10,365 genes evaluated with both expression microarray and methylation microarray, 74 genes were hypermethylated and downregulated, or hypomethylated and upregulated in either 5-FU-resistant or CDDP-resistant cells. Of these genes, expression of 21 genes including FSCN1, CPT1C and NOTCH3, increased from treatment with a demethylating agent. There are alterations of gene expression and DNA methylation in drug-resistant gastric cancer; they may be related to mechanisms of drug resistance and may be useful as biomarkers of gastric cancer drug sensitivity.

Transfer patterns of integron-associated and antibiotic resistance genes in S. flexneri during different time intervals in Tianjin, China

Directory of Open Access Journals (Sweden)

J Wang

2014-01-01

Full Text Available Background: Shigella is one of the common genera of pathogens responsible for bacterial diarrhoea in humans. According to World Health Organisation (WHO, 800,000-1,700,000 patients in China were infected with Shigella spp. in 2000, and Shigella flexneri is the most common serotype (86%. Objectives: We investigated the transfer patterns of integron-associated and antibiotic resistance genes in S. flexneri during different time intervals in the city of Tianjin in the People′s Republic of China. Materials and Methods: The integrase-encoding and variable regions of the integrons of the bacterial strains were amplified by polymerase chain reaction (PCR, followed by gene sequencing. Fifty-six S. flexneri strains, 32 of which were stored in our laboratory and the other 24 were isolated from tertiary hospitals in Tianjin during different time intervals, were tested for their sensitivity to 12 antibiotics by using the Kirby-Bauer antibiotic testing method (K-B method. Results and Conclusion: Of the 32 strains of S. flexneri isolated from 1981 to 1983 and stored in our laboratory, class 1 integron was detected in 28 strains (87.50%, while 27 strains (84.37% harboured an aminoglycoside resistance gene, aadA, in the variable region of their integrons. Class 1 integron was identified in 22 (91.67% of the 24 S. flexneri strains isolated from 2009 to 2010, whereas the variable region and 3′-end amplification were not present in any of the strains. Class 2 integron was not found in the 1981-1983 group (group A of strains; although 19 (79.17% of the 24 strains in the 2009-2010 group (group B possessed class 2 integron, and the variable region of the integron harboured dfrA1 + sat1 + aadA1 genes, which, respectively, mediate antibiotic resistance to trimethoprim, streptothricin and streptomycin. Seventeen strains of the total 56 possessed both class 1 and 2 integrons. Strains belonging to group A were highly resistant to tetracycline, chloramphenicol and a

Antibiotic resistance and virulence genes in coliform water isolates.

Science.gov (United States)

Stange, C; Sidhu, J P S; Tiehm, A; Toze, S

2016-11-01

Widespread fecal pollution of surface water may present a major health risk and a significant pathway for dissemination of antibiotic resistance bacteria. The River Rhine is one of the longest and most important rivers in Europe and an important raw water source for drinking water production. A total of 100 coliform isolates obtained from River Rhine (Germany) were examined for their susceptibility to seven antimicrobial agents. Resistances against amoxicillin, trimethoprim/sulfamethoxazole and tetracycline were detected in 48%, 11% and 9% of isolates respectively. The antibiotic resistance could be traced back to the resistance genes bla TEM , bla SHV , ampC, sul1, sul2, dfrA1, tet(A) and tet(B). Whereby, the ampC gene represents a special case, because its presence is not inevitably linked to a phenotypic antibiotic resistance. Multiple antibiotics resistance was often accompanied by the occurrence of class 1 or 2 integrons. E. coli isolates belonging to phylogenetic groups A and B1 (commensal) were more predominant (57%) compared to B2 and D groups (43%) which are known to carry virulent genes. Additionally, six E. coli virulence genes were also detected. However, the prevalence of virulence genes in the E. coli isolates was low (not exceeding 4.3% per gene) and no diarrheagenic E. coli pathotypes were detected. This study demonstrates that surface water is an important reservoir of ARGs for a number of antibiotic classes such as sulfonamide, trimethoprim, beta-lactam-antibiotics and tetracycline. The occurrence of antibiotic resistance in coliform bacteria isolated from River Rhine provides evidence for the need to develop management strategies to limit the spread of antibiotic resistant bacteria in aquatic environment. Copyright © 2016 Elsevier GmbH. All rights reserved.

Role of NPR1 dependent and NPR1 independent genes in response to Salicylic acid

Directory of Open Access Journals (Sweden)

Neha Agarwal

2017-10-01

Full Text Available NPR1 (Nonexpressor of pathogenesis-related gene is a transcription coactivator and central regulator of systemic acquired resistance (SAR pathway. It controls wide range of pathogenesis related genes involved in various defense responses, acts by sensing SAR signal molecule, Salicylic acid (SA. Mutation in NPR1 results in increased susceptibility to pathogen infection and less expression of pathogenesis related genes. The present study aimed to identify the role of NPR1 in gene expression after the Salicylic acid induction. For this RNA-seq was performed in Arabidopsis thaliana Col-0 and npr1-1 in response to Salicylic acid. RNA-seq analysis revealed a total of 3811 differentially expressed gene in which 2109 genes are up-regulated and 1702 genes are down-regulated. We have divided these genes in 6 categories SA induced (SI, SA repressed (SR, NPR1 dependent SI (ND-SI, NPR1 dependent SR (ND-SR, NPR1 independent SI (NI-SI, NPR1 independent SR (NI-SR. Further, Gene ontology and MapMan pathway analysis of differentially expressed genes suggested variety of biological processes and metabolic pathways that are enriched during SAR defense pathway. These results contribute to shed light on importance of both NPR1-dependent (ND and NPR1-independent (NI gene acting downstream to Salicylic acid induction in SAR pathway. The present study aimed to identify the role of NPR1 in gene expression after the Salicylic acid induction.

Obesity genes and insulin resistance.

Science.gov (United States)

Belkina, Anna C; Denis, Gerald V

2010-10-01

The exploding prevalence of insulin resistance and Type 2 diabetes (T2D) linked to obesity has become an alarming public health concern. Worldwide, approximately 171 million people suffer from obesity-induced diabetes and public health authorities expect this situation to deteriorate rapidly. An interesting clinical population of 'metabolically healthy but obese' (MHO) cases is relatively protected from T2D and its associated cardiovascular risk. The molecular basis for this protection is not well understood but is likely to involve reduced inflammatory responses. The inflammatory cells and pathways that respond to overnutrition are the primary subject matter for this review. The chance discovery of a genetic mutation in the Brd2 gene, which is located in the class II major histocompatibility complex and makes mice enormously fat but protects them from diabetes, offers revolutionary new insights into the cellular mechanisms that link obesity to insulin resistance and T2D. These Brd2-hypomorphic mice have reduced inflammation in fat that is normally associated with insulin resistance, and resemble MHO patients, suggesting novel therapeutic pathways for obese patients at risk for T2D. Deeper understanding of the functional links between genes that control inflammatory responses to diet-induced obesity is crucial to the development of therapies for obese, insulin-resistant patients.

Presence of antiseptic resistance genes in porcine methicillin-resistant Staphylococcus aureus.

Science.gov (United States)

Wong, T Z; Zhang, M; O'Donoghue, M; Boost, M

2013-03-23

Numerous studies have documented the presence of methicillin-resistant Staphylococcus aureus (MRSA) in meat-producing animals, which has led to concern about its spread into the community. Disinfectants play an important role in reduction of contamination in both animal husbandry and food-preparation, helping control spread of organisms from foodstuffs, including raw meat. Plasmid-borne antiseptic resistance (AR) genes increasing tolerance to several disinfectants have been reported in S. aureus of human origin (qacA/B and smr) and from bovine, equine, and caprine staphylococcal isolates (qacG, qacH, and qacJ). This study investigated the presence of AR genes in porcine MRSA isolates. Plasmid DNA from 100 MRSA ST9 strains isolated from pig carcasses was amplified for the presence of AR genes. Minimum inhibitory concentrations (MICs) and minimum bactericidal concentrations (MBCs) to benzalkonium chloride (BC) and chlorhexidine gluconate (CHX) were determined in AR gene-positive isolates. qacG was present in 45 strains, eight of which also harbored smr. No strains carried qacA/B, qacH or qacJ. Presence of smr increased MICs to both BC and CHX and MBCs of CHX, but qacG presence only resulted in elevated MBC for CHX. This is the first report of AR genes from a porcine source. AR gene positivity has previously been associated with methicillin resistance and AR gene presence in these strains may increase their ability to persist in the environment. Improved implementation of hygiene measures during transportation and pre- and post-slaughter should be considered to prevent spread in the community. Copyright © 2012 Elsevier B.V. All rights reserved.

DNA tagging of blast resistant gene(s in three Brazilian rice cultivars

Directory of Open Access Journals (Sweden)

S.S. Sandhu

2003-12-01

Full Text Available Rice blast is the most important fungal disease of rice and is caused by Pyricularia oryzae Sacc. (Telomorph Magnoporthe grisea Barr.. Seven randomly amplified polymorphic DNA (RAPD markers OPA5, OPG17, OPG18, OPG19, OPF9, OPF17 and OPF19 showed very clear polymorphism in resistant cultivar lines which differed from susceptible lines. By comparing different susceptible lines, nine DNA amplifications of seven primers (OPA5(1000, OPA5(1200, OPG17(700, OPG18(850, OPG19(500, OPG19(600, OPF9(600, OPF17(1200 and OPF19(600 were identified as dominant markers for the blast resistant gene in resistant cultivar lines. These loci facilitate the indirect scoring of blast resistant and blast susceptible genotypes. The codomine RAPDs markers will facilitate marker-assisted selection of the blast resistant gene in two blast resistant genotypes of rice (Labelle and Line 11 and will be useful in rice breeding programs.

Study on drug resistance of mycobacterium tuberculosis in patients with pulmonary tuberculosis by drug resistance gene detecting

International Nuclear Information System (INIS)

Wang Wei; Li Hongmin; Wu Xueqiong; Wang Ansheng; Ye Yixiu; Wang Zhongyuan; Liu Jinwei; Chen Hongbing; Lin Minggui; Wang Jinhe; Li Sumei; Jiang Ping; Feng Bai; Chen Dongjing

2004-01-01

To investigate drug resistance of mycobacterium tuberculosis in different age group, compare detecting effect of two methods and evaluate their the clinical application value, all of the strains of mycobacterium tuberculosis were tested for resistance to RFP, INH SM PZA and EMB by the absolute concentration method on Lowenstein-Jensen medium and the mutation of the rpoB, katG, rpsL, pncA and embB resistance genes in M. tuberculosis was tested by PCR-SSCP. In youth, middle and old age group, the rate of acquired drug resistance was 89.2%, 85.3% and 67.6% respectively, the gene mutation rate was 76.2%, 81.3% and 63.2% respectively. The rate of acquired drug resistance and multiple drug resistance in youth group was much higher than those in other groups. The gene mutation was correlated with drug resistance level of mycobacterium tuberculosis. The gene mutation rate was higher in strains isolated from high concentration resistance than those in strains isolated from low concentration resistance. The more irregular treatment was longer, the rate of drug resistance was higher. Acquired drug resistance varies in different age group. It suggested that surveillance of drug resistence in different age group should be taken seriously, especially in youth group. PCR - SSCP is a sensitive and specific method for rapid detecting rpoB, katG, rpsL, pncA and embB genes mutations of MTB. (authors)

Rapid Detection of Staphylococcus aureus and Methicillin-Resistant S. aureus in Atopic Dermatitis by Using the BD Max StaphSR Assay.

Science.gov (United States)

Lee, Mi Kyung; Park, Kui Young; Jin, Taewon; Kim, Ju Hee; Seo, Seong Jun

2017-07-01

Eczematous lesions of atopic dermatitis (AD) patients are known to be a source of Staphylococcus aureus (SA) transmission and might be a reservoir for community-associated methicillin-resistant SA (MRSA). The BD Max StaphSR (BD-SR) is a fully automated, multiplex real-time PCR assay for the direct detection and differentiation of SA and MRSA from nasal swab samples. We evaluated the detection rates of SA and MRSA from skin lesions of outpatients with AD using the BD-SR assay, and determined the usefulness of the BD-SR assay. A total of 244 skin swab samples (skin lesions of 213 outpatients with AD and normal skin of 31 healthy controls) were tested directly by using the BD-SR assay. Of the 213 samples from patients with AD, 69 (32.4%) were positive for SA, 6 (8.7%) of which were positive for MRSA. Only 1 (3.2%) of 31 samples from healthy controls was positive for SA. The BD-SR assay is effective for the rapid detection of SA and MRSA from skin swab samples, which can provide important information for managing patients with AD and preventing the spread of MRSA. © The Korean Society for Laboratory Medicine.

Clusters of Antibiotic Resistance Genes Enriched Together Stay Together in Swine Agriculture.

Science.gov (United States)

Johnson, Timothy A; Stedtfeld, Robert D; Wang, Qiong; Cole, James R; Hashsham, Syed A; Looft, Torey; Zhu, Yong-Guan; Tiedje, James M

2016-04-12

Antibiotic resistance is a worldwide health risk, but the influence of animal agriculture on the genetic context and enrichment of individual antibiotic resistance alleles remains unclear. Using quantitative PCR followed by amplicon sequencing, we quantified and sequenced 44 genes related to antibiotic resistance, mobile genetic elements, and bacterial phylogeny in microbiomes from U.S. laboratory swine and from swine farms from three Chinese regions. We identified highly abundant resistance clusters: groups of resistance and mobile genetic element alleles that cooccur. For example, the abundance of genes conferring resistance to six classes of antibiotics together with class 1 integrase and the abundance of IS6100-type transposons in three Chinese regions are directly correlated. These resistance cluster genes likely colocalize in microbial genomes in the farms. Resistance cluster alleles were dramatically enriched (up to 1 to 10% as abundant as 16S rRNA) and indicate that multidrug-resistant bacteria are likely the norm rather than an exception in these communities. This enrichment largely occurred independently of phylogenetic composition; thus, resistance clusters are likely present in many bacterial taxa. Furthermore, resistance clusters contain resistance genes that confer resistance to antibiotics independently of their particular use on the farms. Selection for these clusters is likely due to the use of only a subset of the broad range of chemicals to which the clusters confer resistance. The scale of animal agriculture and its wastes, the enrichment and horizontal gene transfer potential of the clusters, and the vicinity of large human populations suggest that managing this resistance reservoir is important for minimizing human risk. Agricultural antibiotic use results in clusters of cooccurring resistance genes that together confer resistance to multiple antibiotics. The use of a single antibiotic could select for an entire suite of resistance genes if

Enhanced 2,4-D Metabolism in Two Resistant Papaver rhoeas Populations from Spain

Directory of Open Access Journals (Sweden)

Joel Torra

2017-09-01

Full Text Available Corn poppy (Papaver rhoeas, the most problematic broadleaf weed in winter cereals in Southern Europe, has developed resistance to the widely-used herbicide, 2,4-D. The first reported resistance mechanism in this species to 2,4-D was reduced translocation from treated leaves to the rest of the plant. However, the presence of other non-target site resistance (NTSR mechanisms has not been investigated up to date. Therefore, the main objective of this research was to reveal if enhanced 2,4-D metabolism is also present in two Spanish resistant (R populations to synthetic auxins. With this aim, HPLC experiments at two 2,4-D rates (600 and 2,400 g ai ha−1 were conducted to identify and quantify the metabolites produced and evaluate possible differences in 2,4-D degradation between resistant (R and susceptible (S plants. Secondarily, to determine the role of cytochrome P450 in the resistance response, dose-response experiments were performed using malathion as its inhibitor. Three populations were used: S, only 2,4-D R (R-703 and multiple R to 2,4-D and ALS inhibitors (R-213. HPLC studies indicated the presence of two hydroxy metabolites in these R populations in shoots and roots, which were not detected in S plants, at both rates. Therefore, enhanced metabolism becomes a new NTSR mechanism in these two P. rhoeas populations from Spain. Results from the dose-response experiments also showed that pre-treatment of R plants with the cytochrome P450 (P450 inhibitor malathion reversed the phenotype to 2,4-D from resistant to susceptible in both R populations. Therefore, it could be hypothesized that a malathion inhibited P450 is responsible of the formation of the hydroxy metabolites detected in the metabolism studies. This and previous research indicate that two resistant mechanisms to 2,4-D could be present in populations R-703 and R-213: reduced translocation and enhanced metabolism. Future experiments are required to confirm these hypotheses

Antimicrobial Resistance and Resistance Genes in Aerobic Bacteria Isolated from Pork at Slaughter.

Science.gov (United States)

Li, Lili; Heidemann Olsen, Rikke; Ye, Lei; Yan, He; Nie, Qing; Meng, Hecheng; Shi, Lei

2016-04-01

The aim of this study was to investigate the phenotypic and genotypic antimicrobial resistance, integrons, and transferability of resistance markers in 243 aerobic bacteria recovered from pork at slaughter in the People's Republic of China. The organisms belonged to 22 genera of gram-negative bacteria (92.2%) and gram-positive bacteria (7.8%). High levels of resistance were detected to tetracycline, trimethoprim-sulfamethoxazole, and ampicillin (36.2 to 54.3%), and lower levels were detected to nitrofurantoin, cefotaxime, gentamicin, ciprofloxacin, and chloramphenicol (7.8 to 29.2%). Across species, genes conferring antimicrobial resistance were observed with the following frequencies: blaTEM, 40.7%; blaCMY-2, 15.2%; blaCTX-M, 11.5%; sul2, 27.2%; sul1, 14.4%; tet(A), 5.4%; tet(L), 5.4%; tet(M), 5.0%; tet(E), 3.7%; tet(C), 3.3%; tet(S), 2.5%; and tet(K), 0.8%. Various antimicrobial resistance genes were found in new carriers: blaTEM in Lactococcus garvieae, Myroides odoratimimus, Aeromonas hydrophila, Staphylococcus sciuri, Raoultella terrigena, Macrococcus caseolyticus, Acinetobacter ursingii, Sphingobacterium sp., and Oceanobacillus sp.; blaCMY-2 in Lactococcus lactis, Klebsiella oxytoca, Serratia marcescens, Acinetobacter baumannii, and Myroides phaeus; tet(L) in M. caseolyticus; sul1 in Vibrio cincinnatiensis; sul2 in Acinetobacter bereziniae, Acinetobacter johnsonii, and V. cincinnatiensis; and the class 1 integron and gene cassette aadA2 in V. cincinnatiensis. Approximately 6.6% of isolates contained class 1 integrons, and one isolate harbored class 2 integrons. Plasmid associated intI1 and androgen receptor- encoding genes were transferred into Escherichia coli J53 and E. coli DH5α by conjugation and transformation experiments, respectively. Our study highlights the importance of aerobic bacteria from pork as reservoirs for antimicrobial resistance genes and mobile genetic elements that can readily be transferred intra- and interspecies.

A maize resistance gene functions against bacterial streak disease in rice.

Science.gov (United States)

Zhao, Bingyu; Lin, Xinghua; Poland, Jesse; Trick, Harold; Leach, Jan; Hulbert, Scot

2005-10-25

Although cereal crops all belong to the grass family (Poacea), most of their diseases are specific to a particular species. Thus, a given cereal species is typically resistant to diseases of other grasses, and this nonhost resistance is generally stable. To determine the feasibility of transferring nonhost resistance genes (R genes) between distantly related grasses to control specific diseases, we identified a maize R gene that recognizes a rice pathogen, Xanthomonas oryzae pv. oryzicola, which causes bacterial streak disease. Bacterial streak is an important disease of rice in Asia, and no simply inherited sources of resistance have been identified in rice. Although X. o. pv. oryzicola does not cause disease on maize, we identified a maize gene, Rxo1, that conditions a resistance reaction to a diverse collection of pathogen strains. Surprisingly, Rxo1 also controls resistance to the unrelated pathogen Burkholderia andropogonis, which causes bacterial stripe of sorghum and maize. The same gene thus controls resistance reactions to both pathogens and nonpathogens of maize. Rxo1 has a nucleotide-binding site-leucine-rich repeat structure, similar to many previously identified R genes. Most importantly, Rxo1 functions after transfer as a transgene to rice, demonstrating the feasibility of nonhost R gene transfer between cereals and providing a valuable tool for controlling bacterial streak disease.

Occurrence of antibiotic resistance and characterization of resistant genes and integrons in Enterobacteriaceae isolated from integrated fish farms south China

Science.gov (United States)

Su, Hao-Chang; Ying, Guang-Guo; Tao, Ran; Zhang, Rui-Quan; Fogarty, Lisa R.; Kolpin, Dana W.

2011-01-01

Antibiotics are still widely applied in animal husbandry to prevent diseases and used as feed additives to promote animal growth. This could result in antibiotic resistance to bacteria and antibiotic residues in animals. In this paper, Enterobacteriaceae isolated from four integrated fish farms in Zhongshan, South China were tested for antibiotic resistance, tetracycline resistance genes, sulfonamide resistance genes, and class 1 integrons. The Kirby-Bauer disk diffusion method and polymerase chain reaction (PCR) assays were carried out to test antibiotic susceptibility and resistance genes, respectively. Relatively high antibiotic resistance frequencies were found, especially for ampicillin (80%), tetracycline (52%), and trimethoprim (50%). Out of 203 Enterobacteriaceae isolates, 98.5% were resistant to one or more antibiotics tested. Multiple antibiotic resistance (MAR) was found highest in animal manures with a MAR index of 0.56. Tetracycline resistance genes (tet(A), tet(C)) and sulfonamide resistance genes (sul2) were detected in more than 50% of the isolates. The intI1 gene was found in 170 isolates (83.7%). Both classic and non-classic class 1 integrons were found. Four genes, aadA5, aadA22, dfr2, and dfrA17, were detected. To our knowledge, this is the first report for molecular characterization of antibiotic resistance genes in Enterobacteriaceae isolated from integrated fish farms in China and the first time that gene cassette array dfrA17-aadA5 has been detected in such fish farms. Results of this study indicated that fish farms may be a reservoir of highly diverse and abundant antibiotic resistant genes and gene cassettes. Integrons may play a key role in multiple antibiotic resistances posing potential health risks to the general public and aquaculture.

Identifying clinically relevant drug resistance genes in drug-induced resistant cancer cell lines and post-chemotherapy tissues.

Science.gov (United States)

Tong, Mengsha; Zheng, Weicheng; Lu, Xingrong; Ao, Lu; Li, Xiangyu; Guan, Qingzhou; Cai, Hao; Li, Mengyao; Yan, Haidan; Guo, You; Chi, Pan; Guo, Zheng

2015-12-01

Until recently, few molecular signatures of drug resistance identified in drug-induced resistant cancer cell models can be translated into clinical practice. Here, we defined differentially expressed genes (DEGs) between pre-chemotherapy colorectal cancer (CRC) tissue samples of non-responders and responders for 5-fluorouracil and oxaliplatin-based therapy as clinically relevant drug resistance genes (CRG5-FU/L-OHP). Taking CRG5-FU/L-OHP as reference, we evaluated the clinical relevance of several types of genes derived from HCT116 CRC cells with resistance to 5-fluorouracil and oxaliplatin, respectively. The results revealed that DEGs between parental and resistant cells, when both were treated with the corresponding drug for a certain time, were significantly consistent with the CRG5-FU/L-OHP as well as the DEGs between the post-chemotherapy CRC specimens of responders and non-responders. This study suggests a novel strategy to extract clinically relevant drug resistance genes from both drug-induced resistant cell models and post-chemotherapy cancer tissue specimens.

Pediatric fecal microbiota harbor diverse and novel antibiotic resistance genes.

Directory of Open Access Journals (Sweden)

Aimée M Moore

Full Text Available Emerging antibiotic resistance threatens human health. Gut microbes are an epidemiologically important reservoir of resistance genes (resistome, yet prior studies indicate that the true diversity of gut-associated resistomes has been underestimated. To deeply characterize the pediatric gut-associated resistome, we created metagenomic recombinant libraries in an Escherichia coli host using fecal DNA from 22 healthy infants and children (most without recent antibiotic exposure, and performed functional selections for resistance to 18 antibiotics from eight drug classes. Resistance-conferring DNA fragments were sequenced (Illumina HiSeq 2000, and reads assembled and annotated with the PARFuMS computational pipeline. Resistance to 14 of the 18 antibiotics was found in stools of infants and children. Recovered genes included chloramphenicol acetyltransferases, drug-resistant dihydrofolate reductases, rRNA methyltransferases, transcriptional regulators, multidrug efflux pumps, and every major class of beta-lactamase, aminoglycoside-modifying enzyme, and tetracycline resistance protein. Many resistance-conferring sequences were mobilizable; some had low identity to any known organism, emphasizing cryptic organisms as potentially important resistance reservoirs. We functionally confirmed three novel resistance genes, including a 16S rRNA methylase conferring aminoglycoside resistance, and two tetracycline-resistance proteins nearly identical to a bifidobacterial MFS transporter (B. longum s. longum JDM301. We provide the first report to our knowledge of resistance to folate-synthesis inhibitors conferred by a predicted Nudix hydrolase (part of the folate synthesis pathway. This functional metagenomic survey of gut-associated resistomes, the largest of its kind to date, demonstrates that fecal resistomes of healthy children are far more diverse than previously suspected, that clinically relevant resistance genes are present even without recent selective

Overexpression of antibiotic resistance genes in hospital effluents over time.

Science.gov (United States)

Rowe, Will P M; Baker-Austin, Craig; Verner-Jeffreys, David W; Ryan, Jim J; Micallef, Christianne; Maskell, Duncan J; Pearce, Gareth P

2017-06-01

Effluents contain a diverse abundance of antibiotic resistance genes that augment the resistome of receiving aquatic environments. However, uncertainty remains regarding their temporal persistence, transcription and response to anthropogenic factors, such as antibiotic usage. We present a spatiotemporal study within a river catchment (River Cam, UK) that aims to determine the contribution of antibiotic resistance gene-containing effluents originating from sites of varying antibiotic usage to the receiving environment. Gene abundance in effluents (municipal hospital and dairy farm) was compared against background samples of the receiving aquatic environment (i.e. the catchment source) to determine the resistome contribution of effluents. We used metagenomics and metatranscriptomics to correlate DNA and RNA abundance and identified differentially regulated gene transcripts. We found that mean antibiotic resistance gene and transcript abundances were correlated for both hospital ( ρ  = 0.9, two-tailed P  hospital effluent samples. High β-lactam resistance gene transcript abundance was related to hospital antibiotic usage over time and hospital effluents contained antibiotic residues. We conclude that effluents contribute high levels of antibiotic resistance genes to the aquatic environment; these genes are expressed at significant levels and are possibly related to the level of antibiotic usage at the effluent source. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy.

Bph32, a novel gene encoding an unknown SCR domain-containing protein, confers resistance against the brown planthopper in rice

Science.gov (United States)

Ren, Juansheng; Gao, Fangyuan; Wu, Xianting; Lu, Xianjun; Zeng, Lihua; Lv, Jianqun; Su, Xiangwen; Luo, Hong; Ren, Guangjun

2016-01-01

An urgent need exists to identify more brown planthopper (Nilaparvata lugens Stål, BPH) resistance genes, which will allow the development of rice varieties with resistance to BPH to counteract the increased incidence of this pest species. Here, using bioinformatics and DNA sequencing approaches, we identified a novel BPH resistance gene, LOC_Os06g03240 (MSU LOCUS ID), from the rice variety Ptb33 in the interval between the markers RM19291 and RM8072 on the short arm of chromosome 6, where a gene for resistance to BPH was mapped by Jirapong Jairin et al. and renamed as “Bph32”. This gene encodes a unique short consensus repeat (SCR) domain protein. Sequence comparison revealed that the Bph32 gene shares 100% sequence identity with its allele in Oryza latifolia. The transgenic introgression of Bph32 into a susceptible rice variety significantly improved resistance to BPH. Expression analysis revealed that Bph32 was highly expressed in the leaf sheaths, where BPH primarily settles and feeds, at 2 and 24 h after BPH infestation, suggesting that Bph32 may inhibit feeding in BPH. Western blotting revealed the presence of Pph (Ptb33) and Tph (TN1) proteins using a Penta-His antibody, and both proteins were insoluble. This study provides information regarding a valuable gene for rice defence against insect pests. PMID:27876888

Bph32, a novel gene encoding an unknown SCR domain-containing protein, confers resistance against the brown planthopper in rice.

Science.gov (United States)

Ren, Juansheng; Gao, Fangyuan; Wu, Xianting; Lu, Xianjun; Zeng, Lihua; Lv, Jianqun; Su, Xiangwen; Luo, Hong; Ren, Guangjun

2016-11-23

An urgent need exists to identify more brown planthopper (Nilaparvata lugens Stål, BPH) resistance genes, which will allow the development of rice varieties with resistance to BPH to counteract the increased incidence of this pest species. Here, using bioinformatics and DNA sequencing approaches, we identified a novel BPH resistance gene, LOC_Os06g03240 (MSU LOCUS ID), from the rice variety Ptb33 in the interval between the markers RM19291 and RM8072 on the short arm of chromosome 6, where a gene for resistance to BPH was mapped by Jirapong Jairin et al. and renamed as "Bph32". This gene encodes a unique short consensus repeat (SCR) domain protein. Sequence comparison revealed that the Bph32 gene shares 100% sequence identity with its allele in Oryza latifolia. The transgenic introgression of Bph32 into a susceptible rice variety significantly improved resistance to BPH. Expression analysis revealed that Bph32 was highly expressed in the leaf sheaths, where BPH primarily settles and feeds, at 2 and 24 h after BPH infestation, suggesting that Bph32 may inhibit feeding in BPH. Western blotting revealed the presence of Pph (Ptb33) and Tph (TN1) proteins using a Penta-His antibody, and both proteins were insoluble. This study provides information regarding a valuable gene for rice defence against insect pests.

Magneto-caloric and magneto-resistive properties of La{sub 0.67}Ca{sub 0.33-x}Sr{sub x}MnO{sub 3}

Energy Technology Data Exchange (ETDEWEB)

Reves Dinesen, Anders

2004-08-01

This thesis presents results of an experimental investigation of magneto-caloric and magneto-resistive properties of a series of polycrystalline Ca- and Sr-doped lanthanum manganites, La{sub 0.67}Ca{sub 0.33-x}Sr{sub x}MnO{sub 3} (0{<=} x {<=} 0.33), with the perovskite structure. The samples consisted of sintered oxide powders prepared the glycine-nitrate combustion technique. The compounds were ferromagnetic and showed a Curie transition in the temperature range 267370 K (T{sub C} increased with increasing x). An analysis of the structural properties was carried out by means of x-ray diffraction and the Rietveld technique. The variation of the Ca/Sr ratio was found to cause a transition from orthorhombic to rhombohedral symmetry in the composition range 0.110 < x < 0.165. The analysis suggested a strong correlation between structural properties and magnetism, for instance a relationship between the mean MnOMn bond angle and the Curie temperature. The MnOMn bonds mediate ferromagnetism and electrical transport in these materials via the double-exchange mechanism. The magnetocaloric effect of the La{sub 0.67}Ca{sub 0.33-x}Sr{sub x}MnO{sub 3} samples was measured directly and indirectly (by means of magnetization measurements). All the samples showed a magnetocaloric effect in the vicinity of T{sub C}. A model for the mag-netocaloric effect based on Weiss mean field theory and classical theories for heat capacities was developed. The model provided reasonable predictions of the magneto-caloric properties of the samples. The compounds with low Sr content showed a magnetocaloric effect comparable to that of Gadolinium, the prototypical working material for magnetic refrigeration at room temperature. A less comprehensive part of the investigation regarded the magneto-resistive properties of the La{sub 0.67}Ca{sub 0.33-x}Sr{sub x}MnO{sub 3} system. It was found that th polycrystalline nature of the compounds played a decisive role for the magnetotransport properties

Targeted introgression of stem rust Ug99 resistance from wheatgrasses into pasta and bread wheat

Science.gov (United States)

In the past 50 years, a number of stem rust resistance (Sr) genes have been transferred from several wheat-related grasses into durum (i.e. pasta) and bread wheat through chromosome translocations and additions. To utilize these genes for controlling the Ug99 races of the stem rust pathogen, we ini...

The Effect of Silybin Encapsulated in Nanoparticles on oprM Gene Expression in Drug Resistant Isolates of Pseudomonas Aeruginosa

Directory of Open Access Journals (Sweden)

Aref Mohammadipour

2017-08-01

Full Text Available Abstract Background: Pseudomonas aeruginosa is an opportunistic nosocomial pathogen that using several classes of antibiotics to treat has been led to the emergence of multiple drug resistance. One of the drug resistance mechanisms in Pseudomonas aeruginosa is overexpression of mexXY-oprM efflux pump system. Silybin as main flavonolignan of silymarin extracted from Silybum marianum is a hepatoprotective agent that its anti-bacterial properties was studied, recently. In this study, the effect of combination of silybin and ciprofloxacin on oprM gene expression in clinical isolates of Pseudomonas aeruginosa was evaluated. Materials and Methods: In this study, seven ciprofloxacin resistant isolates of Pseudomonas aeruginosa were treated by ciprofloxacin (1/2MIC only (control sample and in the combination with silybin-encapsulated micelle (nanoparticles (test sample. After 24h, RNA extraction and cDNA synthesis were performed in silybin treated and un-treated cells and oprM gene expression was quantitatively investigated by realtime PCR method. Results: Results of this study showed that a silybin encapsulated in nanoparticles (400µg/ml induces death up to 50% in resistant isolates treated by ciprofloxacin (1/2MIC during 24h. Also, quantitative Real-Time PCR analysis revealed that silybin encapsulated in nanoparticles decreases the expression of oprM gene compared to silybin untreated cells. Conclusion: It seems that Decrease of oprM expression in resistant isolates lead to decrease of mexAB-oprM and mexXY-oprM in cell surface, subsequently decrease of antibiotic withdrawal to extracellular environment and increase of sensitivity to antibiotics.

Identification and characterization of two novel bla(KLUC resistance genes through large-scale resistance plasmids sequencing.

Directory of Open Access Journals (Sweden)

Teng Xu

Full Text Available Plasmids are important antibiotic resistance determinant carriers that can disseminate various drug resistance genes among species or genera. By using a high throughput sequencing approach, two groups of plasmids of Escherichia coli (named E1 and E2, each consisting of 160 clinical E. coli strains isolated from different periods of time were sequenced and analyzed. A total of 20 million reads were obtained and mapped onto the known resistance gene sequences. As a result, a total of 9 classes, including 36 types of antibiotic resistant genes, were identified. Among these genes, 25 and 27 single nucleotide polymorphisms (SNPs appeared, of which 9 and 12 SNPs are nonsynonymous substitutions in the E1 and E2 samples. It is interesting to find that a novel genotype of bla(KLUC, whose close relatives, bla(KLUC-1 and bla(KLUC-2, have been previously reported as carried on the Kluyvera cryocrescens chromosome and Enterobacter cloacae plasmid, was identified. It shares 99% and 98% amino acid identities with Kluc-1 and Kluc-2, respectively. Further PCR screening of 608 Enterobacteriaceae family isolates yielded a second variant (named bla(KLUC-4. It was interesting to find that Kluc-3 showed resistance to several cephalosporins including cefotaxime, whereas bla(KLUC-4 did not show any resistance to the antibiotics tested. This may be due to a positively charged residue, Arg, replaced by a neutral residue, Leu, at position 167, which is located within an omega-loop. This work represents large-scale studies on resistance gene distribution, diversification and genetic variation in pooled multi-drug resistance plasmids, and provides insight into the use of high throughput sequencing technology for microbial resistance gene detection.

Molecular characterization of the CRa gene conferring clubroot resistance in Brassica rapa.

Science.gov (United States)

Ueno, Hiroki; Matsumoto, Etsuo; Aruga, Daisuke; Kitagawa, Satoshi; Matsumura, Hideo; Hayashida, Nobuaki

2012-12-01

Clubroot disease is one of the major diseases affecting Brassicaceae crops, and a number of these crops grown commercially, such as Chinese cabbage (Brassica rapa L. ssp. pekinensis), are known to be highly susceptible to clubroot disease. To provide protection from this disease, plant breeders have introduced genes for resistance to clubroot from the European turnip into susceptible lines. The CRa gene confers specific resistance to the clubroot pathogen Plasmodiophora brassicae isolate M85. Fine mapping of the CRa locus using synteny to the Arabidopsis thaliana genome and partial genome sequences of B. rapa revealed a candidate gene encoding a TIR-NBS-LRR protein. Several structural differences in this candidate gene were found between susceptible and resistant lines, and CRa expression was observed only in the resistant line. Four mutant lines lacking clubroot resistance were obtained by the UV irradiation of pollen from a resistant line, and all of these mutant lines carried independent mutations in the candidate TIR-NBS-LRR gene. This genetic and molecular evidence strongly suggests that the identified gene is CRa. This is the first report on the molecular characterization of a clubroot Resistance gene in Brassicaceae and of the disease resistance gene in B. rapa.

Gene Profiling in Late Blight Resistance in Potato Genotype SD20

Directory of Open Access Journals (Sweden)

Xiaohui Yang

2018-06-01

Full Text Available Late blight caused by the oomycete fungus Phytophthora infestans (Pi is the most serious obstacle to potato (Solanum tuberosum production in the world. A super race isolate, CN152, which was identified from Sichuan Province, China, could overcome nearly all known late blight resistance genes and caused serious damage in China. The potato genotype SD20 was verified to be highly resistant to CN152; however, the molecular regulation network underlying late blight resistance pathway remains unclear in SD20. Here, we performed a time-course experiment to systematically profile the late blight resistance response genes using RNA-sequencing in SD20. We identified 3354 differentially expressed genes (DEGs, which mainly encoded transcription factors and protein kinases, and also included four NBS-LRR genes. The late blight responsive genes showed time-point-specific induction/repression. Multi-signaling pathways of salicylic acid, jasmonic acid, and ethylene signaling pathways involved in resistance and defense against Pi in SD20. Gene Ontology and KEGG analyses indicated that the DEGs were significantly enriched in metabolic process, protein serine/threonine kinase activity, and biosynthesis of secondary metabolites. Forty-three DEGs were involved in immune response, of which 19 were enriched in hypersensitive response reaction, which could play an important role in broad-spectrum resistance to Pi infection. Experimental verification confirmed the induced expression of the responsive genes in the late blight resistance signaling pathway, such as WRKY, ERF, MAPK, and NBS-LRR family genes. Our results provided valuable information for understanding late blight resistance mechanism of potato.

Antibiotic resistance genes in anaerobic bacteria isolated from primary dental root canal infections.

Science.gov (United States)

Rôças, Isabela N; Siqueira, José F

2012-12-01

Fourty-one bacterial strains isolated from infected dental root canals and identified by 16S rRNA gene sequence were screened for the presence of 14 genes encoding resistance to beta-lactams, tetracycline and macrolides. Thirteen isolates (32%) were positive for at least one of the target antibiotic resistance genes. These strains carrying at least one antibiotic resistance gene belonged to 11 of the 26 (42%) infected root canals sampled. Two of these positive cases had two strains carrying resistance genes. Six out of 7 Fusobacterium strains harbored at least one of the target resistance genes. One Dialister invisus strain was positive for 3 resistance genes, and 4 other strains carried two of the target genes. Of the 6 antibiotic resistance genes detected in root canal strains, the most prevalent were blaTEM (17% of the strains), tetW (10%), and ermC (10%). Some as-yet-uncharacterized Fusobacterium and Prevotella isolates were positive for blaTEM, cfxA and tetM. Findings demonstrated that an unexpectedly large proportion of dental root canal isolates, including as-yet-uncharacterized strains previously regarded as uncultivated phylotypes, can carry antibiotic resistance genes. Copyright © 2012 Elsevier Ltd. All rights reserved.

Sulfonamide-Resistant Bacteria and Their Resistance Genes in Soils Fertilized with Manures from Jiangsu Province, Southeastern China

OpenAIRE

Wang, Na; Yang, Xiaohong; Jiao, Shaojun; Zhang, Jun; Ye, Boping; Gao, Shixiang

2014-01-01

Antibiotic-resistant bacteria and genes are recognized as new environmental pollutants that warrant special concern. There were few reports on veterinary antibiotic-resistant bacteria and genes in China. This work systematically analyzed the prevalence and distribution of sulfonamide resistance genes in soils from the environments around poultry and livestock farms in Jiangsu Province, Southeastern China. The results showed that the animal manure application made the spread and abundance of a...

Breast cancers radiation-resistance: key role of the cancer stem cells marker CD24

International Nuclear Information System (INIS)

Bensimon, Julie

2013-01-01

This work focuses on the characterization of radiation-resistant breast cancer cells, responsible for relapse after radiotherapy. The 'Cancer Stem Cells' (CSC) theory describes a radiation-resistant cellular sub-population, with enhanced capacity to induce tumors and proliferate. In this work, we show that only the CSC marker CD24-/low defines a radiation resistant cell population, able to transmit the 'memory' of irradiation, expressed as long term genomic instability in the progeny of irradiated cells. We show that CD24 is not only a marker, but is an actor of radiation-response. So, CD24 expression controls cell proliferation in vitro and in vivo, and ROS level before and after irradiation. As a result, CD24-/low cells display enhanced radiation-resistance and genomic stability. For the first time, our results attribute a role to CD24-/low CSCs in the transmission of genomic instability. Moreover, by providing informations on tumor intrinsic radiation-sensitivity, CD24- marker could help to design new radiotherapy protocols. (author)

AMINOGLYCOSIDE RESISTANCE GENES IN Pseudomonas aeruginosa ISOLATES FROM CUMANA, VENEZUELA

Directory of Open Access Journals (Sweden)

Bertinellys TEIXEIRA

2016-01-01

Full Text Available The enzymatic modification of aminoglycosides by aminoglycoside-acetyltransferases (AAC, aminoglycoside-adenyltransferases (AAD, and aminoglycoside-phosphotransferases (APH, is the most common resistance mechanism in P. aeruginosa and these enzymes can be coded on mobile genetic elements that contribute to their dispersion. One hundred and thirty seven P. aeruginosa isolates from the University Hospital, Cumana, Venezuela (HUAPA were evaluated. Antimicrobial susceptibility was determined by the disk diffusion method and theaac, aadB and aph genes were detected by PCR. Most of the P. aeruginosa isolates (33/137 were identified from the Intensive Care Unit (ICU, mainly from discharges (96/137. The frequency of resistant P. aeruginosaisolates was found to be higher for the aminoglycosides tobramycin and amikacin (30.7 and 29.9%, respectively. Phenotype VI, resistant to these antibiotics, was the most frequent (14/49, followed by phenotype I, resistant to all the aminoglycosides tested (12/49. The aac(6´-Ib,aphA1 and aadB genes were the most frequently detected, and the simultaneous presence of several resistance genes in the same isolate was demonstrated. Aminoglycoside resistance in isolates ofP. aeruginosa at the HUAPA is partly due to the presence of the aac(6´-Ib, aphA1 andaadB genes, but the high rates of antimicrobial resistance suggest the existence of several mechanisms acting together. This is the first report of aminoglycoside resistance genes in Venezuela and one of the few in Latin America.

AMINOGLYCOSIDE RESISTANCE GENES IN Pseudomonas aeruginosa ISOLATES FROM CUMANA, VENEZUELA.

Science.gov (United States)

Teixeira, Bertinellys; Rodulfo, Hectorina; Carreño, Numirin; Guzmán, Militza; Salazar, Elsa; De Donato, Marcos

2016-01-01

The enzymatic modification of aminoglycosides by aminoglycoside-acetyltransferases (AAC), aminoglycoside-adenyltransferases (AAD), and aminoglycoside-phosphotransferases (APH), is the most common resistance mechanism in P. aeruginosa and these enzymes can be coded on mobile genetic elements that contribute to their dispersion. One hundred and thirty seven P. aeruginosa isolates from the University Hospital, Cumana, Venezuela (HUAPA) were evaluated. Antimicrobial susceptibility was determined by the disk diffusion method and theaac, aadB and aph genes were detected by PCR. Most of the P. aeruginosa isolates (33/137) were identified from the Intensive Care Unit (ICU), mainly from discharges (96/137). The frequency of resistant P. aeruginosaisolates was found to be higher for the aminoglycosides tobramycin and amikacin (30.7 and 29.9%, respectively). Phenotype VI, resistant to these antibiotics, was the most frequent (14/49), followed by phenotype I, resistant to all the aminoglycosides tested (12/49). The aac(6´)-Ib,aphA1 and aadB genes were the most frequently detected, and the simultaneous presence of several resistance genes in the same isolate was demonstrated. Aminoglycoside resistance in isolates ofP. aeruginosa at the HUAPA is partly due to the presence of the aac(6´)-Ib, aphA1 andaadB genes, but the high rates of antimicrobial resistance suggest the existence of several mechanisms acting together. This is the first report of aminoglycoside resistance genes in Venezuela and one of the few in Latin America.

Survival of Antibiotic Resistant Bacteria and Horizontal Gene Transfer Control Antibiotic Resistance Gene Content in Anaerobic Digesters.

Science.gov (United States)

Miller, Jennifer H; Novak, John T; Knocke, William R; Pruden, Amy

2016-01-01

Understanding fate of antibiotic resistant bacteria (ARB) vs. their antibiotic resistance genes (ARGs) during wastewater sludge treatment is critical in order to reduce the spread of antibiotic resistance through process optimization. Here, we spiked high concentrations of tetracycline-resistant bacteria, isolated from mesophilic (Iso M1-1-a Pseudomonas sp.) and thermophilic (Iso T10-a Bacillus sp.) anaerobic digested sludge, into batch digesters and monitored their fate by plate counts and quantitative polymerase chain reaction (QPCR) of their corresponding tetracycline ARGs. In batch studies, spiked ARB plate counts returned to baseline (thermophilic) or 1-log above baseline (mesophilic) while levels of the ARG present in the spiked isolate [tet(G)] remained high in mesophilic batch reactors. To compare results under semi-continuous flow conditions with natural influent variation, tet(O), tet(W), and sul1 ARGs, along with the intI1 integrase gene, were monitored over a 9-month period in the raw feed sludge and effluent sludge of lab-scale thermophilic and mesophilic anaerobic digesters. sul1 and intI1 in mesophilic and thermophilic digesters correlated positively (Spearman rho = 0.457-0.829, P < 0.05) with the raw feed sludge. There was no correlation in tet(O) or tet(W) ratios in raw sludge and mesophilic digested sludge or thermophilic digested sludge (Spearman rho = 0.130-0.486, P = 0.075-0.612). However, in the thermophilic digester, the tet(O) and tet(W) ratios remained consistently low over the entire monitoring period. We conclude that the influent sludge microbial composition can influence the ARG content of a digester, apparently as a result of differential survival or death of ARBs or horizontal gene transfer of genes between raw sludge ARBs and the digester microbial community. Notably, mesophilic digestion was more susceptible to ARG intrusion than thermophilic digestion, which may be attributed to a higher rate of ARB survival and/or horizontal gene

Testing dependence of anomalous Hall effect on resistivity in SrRuO3 by its increase with electron irradiation

NARCIS (Netherlands)

Haham, N.; Konczykowski, M.; Kuiper, Bouwe; Koster, Gertjan; Klein, L.

2013-01-01

We measure the anomalous Hall effect (AHE) in several patterns of the itinerant ferromagnet SrRuO 3 before and after the patterns are irradiated with electrons. The irradiation increases the resistivity of the patterns due to the introduction of point defects and we find that the AHE coefficient R s

Molecular detection of disease resistance genes to powdery mildew ...

African Journals Online (AJOL)

A study was conducted to detect the presence of disease resistance genes to infection of wheat powdery mildew (Blumeria graminis f. sp. tritici) in selected wheat cultivars from China using molecular markers. Genomic DNA of sixty cultivars was extracted and tested for the presence of selected prominent resistance genes to ...

Gene Expression Analysis of Four Radiation-resistant Bacteria

OpenAIRE

Gao, Na; Ma, Bin-Guang; Zhang, Yu-Sheng; Song, Qin; Chen, Ling-Ling; Zhang, Hong-Yu

2009-01-01

To investigate the general radiation-resistant mechanisms of bacteria, bioinformatic method was employed to predict highly expressed genes for four radiation-resistant bacteria, i.e. Deinococcus geothermalis (D. geo), Deinococcus radiodurans (D. rad), Kineococcus radiotolerans (K. rad) and Rubrobacter xylanophilus (R. xyl). It is revealed that most of the three reference gene sets, i.e. ribosomal proteins, transcription factors and major chaperones, are generally highly expressed in the four ...

Tagging of resistance gene(s) to rhizomania disease in sugar beet ...

African Journals Online (AJOL)

SERVER

2008-02-19

Feb 19, 2008 ... plasmodiophoride-like fungus, Polymyxa betae Keskin. (1964) (Tamada and Richard, 1992). Source of resistance to rhizomania were found in Holly sugar beet company source (Lewellen, 1987). Resistance in Holly is simply inherited by a single dominant gene(Rz1). (Lewellen et al., 1987; Scholten et al., ...

Comparative genome analysis and resistance gene mapping in grain legumes

International Nuclear Information System (INIS)

Young, N.D.

1998-01-01

Using, DNA markers and genome organization, several important disease resistance genes have been analyzed in mungbean (Vigna radiata), cowpea (Vigna unguiculata), common bean (Phaseolus vulgaris), and soybean (Glycine max). In the process, medium-density linkage maps consisting of restriction fragment length polymorphism (RFLP) markers were constructed for both mungbean and cowpea. Comparisons between these maps, as well as the maps of soybean and common bean, indicate that there is significant conservation of DNA marker order, though the conserved blocks in soybean are much shorter than in the others. DNA mapping results also indicate that a gene for seed weight may be conserved between mungbean and cowpea. Using the linkage maps, genes that control bruchid (genus Callosobruchus) and powdery mildew (Erysiphe polygoni) resistance in mungbean, aphid resistance in cowpea (Aphis craccivora), and cyst nematode (Heterodera glycines) resistance in soybean have all been mapped and characterized. For some of these traits resistance was found to be oligogenic and DNA mapping uncovered multiple genes involved in the phenotype. (author)

Prevalence, antibiotic-resistance properties and enterotoxin gene ...

African Journals Online (AJOL)

Prevalence, antibiotic-resistance properties and enterotoxin gene profile of Bacillus cereus strains isolated from milk-based baby foods. ... Conclusion: Considerable prevalence of resistant and toxigenic B. cereus and high consumption of milk-based infant foods in Iran, represent an important public health issue which ...

Characterization of Antibiotic Resistance Genes from Lactobacillus Isolated from Traditional Dairy Products.

Science.gov (United States)

Guo, Huiling; Pan, Lin; Li, Lina; Lu, Jie; Kwok, Laiyu; Menghe, Bilige; Zhang, Heping; Zhang, Wenyi

2017-03-01

Lactobacilli are widely used as starter cultures or probiotics in yoghurt, cheese, beer, wine, pickles, preserved food, and silage. They are generally recognized as safe (GRAS). However, recent studies have shown that some lactic acid bacteria (LAB) strains carry antibiotic resistance genes and are resistant to antibiotics. Some of them may even transfer their intrinsic antibiotic resistance genes to other LAB or pathogens via horizontal gene transfer, thus threatening human health. A total of 33 Lactobacillus strains was isolated from fermented milk collected from different areas of China. We analyzed (1) their levels of antibiotic resistance using a standardized dilution method, (2) their antibiotic resistance gene profiles by polymerase chain reaction (PCR) using gene-specific primers, and (3) the transferability of some of the detected resistance markers by a filter mating assay. All Lactobacillus strains were found to be resistant to vancomycin, but susceptible to gentamicin, linezolid, neomycin, erythromycin, and clindamycin. Their susceptibilities to tetracycline, kanamycin, ciprofloxacin, streptomycin, quinupristin/dalfopristin, trimethoprim, ampicillin, rifampicin, and chloramphenicol was different. Results from our PCR analysis revealed 19 vancomycin, 10 ciprofloxacin, and 1 tetracycline-resistant bacteria that carried the van(X), van(E), gyr(A), and tet(M) genes, respectively. Finally, no transferal of the monitored antibiotic resistance genes was observed in the filter mating assay. Taken together, our study generated the antibiotic resistance profiles of some milk-originated lactobacilli isolates and preliminarily assessed their risk of transferring antibiotic gene to other bacteria. The study may provide important data concerning the safe use of LAB. © 2017 Institute of Food Technologists®.

Identification of Gene Resistance to Avian InfluenzaVirus (Mx Gene among Wild Waterbirds

Directory of Open Access Journals (Sweden)

Dewi Elfidasari

2013-04-01

Full Text Available The Mx gene is an antiviral gene used to determine the resistance or the susceptibility to different types of viruses, including the Avian Influenza (AI virus subtype H5N1. The AI virus subtype H5N1 infection in chickens causes Mx gene polymorphism. The Mx+ gene shows resistant to the AIvirus subtype H5N1, whereas the Mx-gene shows signs of susceptible. The objective of thisresearch was to detect the Mxgene in wild aquatic birds using the Polymerase Chain Reaction Restriction Fragment Length Polymorphism (PCR-RFLP method with the primer pairs F2 and NE-R2/R and the RsaI restriction enzyme. DNA samples were obtained from eight species of wild waterbirds with positive and negative exposure to the AI virus subtype H5N1. DNA amplification results showed that the Mxgene in wild aquatic birds is found in a 100 bp fragment, which is the same as the Mx gene found in chickens. However, unlike chickens, the Mxgene in wild aquatic birds did not show any polymorphism. This study proves that Mx- based resistance to AI virus subtype H5N1 in different in wild birds than in chickens.

Dissecting the organ specificity of insecticide resistance candidate genes in Anopheles gambiae: known and novel candidate genes.

Science.gov (United States)

Ingham, Victoria A; Jones, Christopher M; Pignatelli, Patricia; Balabanidou, Vasileia; Vontas, John; Wagstaff, Simon C; Moore, Jonathan D; Ranson, Hilary

2014-11-25

The elevated expression of enzymes with insecticide metabolism activity can lead to high levels of insecticide resistance in the malaria vector, Anopheles gambiae. In this study, adult female mosquitoes from an insecticide susceptible and resistant strain were dissected into four different body parts. RNA from each of these samples was used in microarray analysis to determine the enrichment patterns of the key detoxification gene families within the mosquito and to identify additional candidate insecticide resistance genes that may have been overlooked in previous experiments on whole organisms. A general enrichment in the transcription of genes from the four major detoxification gene families (carboxylesterases, glutathione transferases, UDP glucornyltransferases and cytochrome P450s) was observed in the midgut and malpighian tubules. Yet the subset of P450 genes that have previously been implicated in insecticide resistance in An gambiae, show a surprisingly varied profile of tissue enrichment, confirmed by qPCR and, for three candidates, by immunostaining. A stringent selection process was used to define a list of 105 genes that are significantly (p ≤0.001) over expressed in body parts from the resistant versus susceptible strain. Over half of these, including all the cytochrome P450s on this list, were identified in previous whole organism comparisons between the strains, but several new candidates were detected, notably from comparisons of the transcriptomes from dissected abdomen integuments. The use of RNA extracted from the whole organism to identify candidate insecticide resistance genes has a risk of missing candidates if key genes responsible for the phenotype have restricted expression within the body and/or are over expression only in certain tissues. However, as transcription of genes implicated in metabolic resistance to insecticides is not enriched in any one single organ, comparison of the transcriptome of individual dissected body parts cannot

Host range of antibiotic resistance genes in wastewater treatment plant influent and effluent.

Science.gov (United States)

Hultman, Jenni; Tamminen, Manu; Pärnänen, Katariina; Cairns, Johannes; Karkman, Antti; Virta, Marko

2018-04-01

Wastewater treatment plants (WWTPs) collect wastewater from various sources for a multi-step treatment process. By mixing a large variety of bacteria and promoting their proximity, WWTPs constitute potential hotspots for the emergence of antibiotic resistant bacteria. Concerns have been expressed regarding the potential of WWTPs to spread antibiotic resistance genes (ARGs) from environmental reservoirs to human pathogens. We utilized epicPCR (Emulsion, Paired Isolation and Concatenation PCR) to detect the bacterial hosts of ARGs in two WWTPs. We identified the host distribution of four resistance-associated genes (tetM, int1, qacEΔ1and blaOXA-58) in influent and effluent. The bacterial hosts of these resistance genes varied between the WWTP influent and effluent, with a generally decreasing host range in the effluent. Through 16S rRNA gene sequencing, it was determined that the resistance gene carrying bacteria include both abundant and rare taxa. Our results suggest that the studied WWTPs mostly succeed in decreasing the host range of the resistance genes during the treatment process. Still, there were instances where effluent contained resistance genes in bacterial groups not carrying these genes in the influent. By permitting exhaustive profiling of resistance-associated gene hosts in WWTP bacterial communities, the application of epicPCR provides a new level of precision to our resistance gene risk estimates.

Isolation of NBS-LRR class resistant gene (I2 gene) from tomato ...

African Journals Online (AJOL)

aghomotsegin

2013-10-16

Oct 16, 2013 ... type of F. oxysporum f. sp. lycopersici observed commonly which require presence of I1 gene in tomato plant for the incompatibility ... Key words: Fusarium wilt, race, R-gene, resistance, tomato. ... MATERIALS AND METHODS.

Autoradiography of 90Sr in developing rats

International Nuclear Information System (INIS)

Olsen, I.; Jonsen, J.

1979-01-01

The distribution patterns of 90 Sr in five littermate, 8-day-old Wistar rats were studied by whole body autoradiography. Rats were killed 15 min, 1, 4, 24, and 72 h after a single intraperitoneal injection of the isotope. Immediately after administration, 90 Sr was distributed throughout most of the soft tissues of the body. The soft tissue deposits had practically disappeared after 4 h. In the hard tissues of the body 90 Sr accumulated up to 24-72 h. Fifteen minutes after injection the uptake of 90 Sr in the enamel of the teeth was highest in the occlusal and incisal regions. 90 Sr gradually accumulated throughout the enamel and after 72 h its distribution in this layer was fairly uniform. Immediately after injection a narrow zone of radioactivity appeared in the dentin near the pulp. This zone broadened with time towards the dentinoenamel junction and included the intire dentin layer 72 h after injection. Initially, the uptake of 90 Sr was higher in the dentin than in the enamel, particularly in the cervical areas of the crown. This difference became less apparent with time. There was good correlation between the uptake in the teeth and bones, supporting the use of teeth as indicators of the 90 Sr body burden. (author)

Genome scanning for identification of resistance gene analogs (RGAs)

African Journals Online (AJOL)

Disease resistance in plants is a desirable economic trait. Many disease resistance genes from various plants have been cloned so far. The gene products of some of these can be distinguished by the presence of an N terminal nucleotide binding site and a C-terminal stretch of leucine-rich repeats. Oligonucleotides already ...

The antimicrobial resistance crisis: management through gene monitoring

Science.gov (United States)

2016-01-01

Antimicrobial resistance (AMR) is an acknowledged crisis for humanity. Its genetic origins and dire potential outcomes are increasingly well understood. However, diagnostic techniques for monitoring the crisis are currently largely limited to enumerating the increasing incidence of resistant pathogens. Being the end-stage of the evolutionary process that produces antimicrobial resistant pathogens, these measurements, while diagnostic, are not prognostic, and so are not optimal in managing this crisis. A better test is required. Here, using insights from an understanding of evolutionary processes ruling the changing abundance of genes under selective pressure, we suggest a predictive framework for the AMR crisis. We then discuss the likely progression of resistance for both existing and prospective antimicrobial therapies. Finally, we suggest that by the environmental monitoring of resistance gene frequency, resistance may be detected and tracked presumptively, and how this tool may be used to guide decision-making in the local and global use of antimicrobials. PMID:27831476

Molecular dynamics of detoxification and toxin-tolerance genes in brown planthopper (Nilaparvata lugens Stål., Homoptera: Delphacidae) feeding on resistant rice plants.

Science.gov (United States)

Yang, Zhifan; Zhang, Futie; He, Qing; He, Guangcun

2005-06-01

To investigate the molecular response of brown planthopper, Nilaparvata lugens (BPH) to BPH-resistant rice plants, we isolated cDNA fragments of the genes encoding for carboxylesterase (CAR), trypsin (TRY), cytochrome P450 monooxygenase (P450), NADH-quinone oxidoreductase (NQO), acetylcholinesterase (ACE), and Glutathione S-transferase (GST). Expression profiles of the genes were monitored on fourth instar nymphs feeding on rice varieties with different resistance levels. Northern blot hybridization showed that, compared with BPH reared on susceptible rice TN1, expression of the genes for P450 and CAR was apparently up-regulated and TRY mRNA decreased in BPH feeding on a highly resistant rice line B5 and a moderately resistant rice variety MH63, respectively. Two transcripts of GST increased in BPH feeding on B5; but in BPH feeding on MH63, this gene was inducible and its expression reached a maximum level at 24 h, and then decreased slightly. The expression of NQO gene was enhanced in BPH on B5 plants but showed a constant expression in BPH on MH63 plants. No difference in ACE gene expression among BPH on different rice plants was detected by the RT-PCR method. The results suggest these genes may play important roles in the defense response of BPH to resistant rice.

Mapping of novel powdery mildew resistance gene(s) from Agropyron cristatum chromosome 2P.

Science.gov (United States)

Li, Huanhuan; Jiang, Bo; Wang, Jingchang; Lu, Yuqing; Zhang, Jinpeng; Pan, Cuili; Yang, Xinming; Li, Xiuquan; Liu, Weihua; Li, Lihui

2017-01-01

A physical map of Agropyron cristatum 2P chromosome was constructed for the first time and the novel powdery mildew resistance gene(s) from chromosome 2P was(were) also mapped. Agropyron cristatum (L.) Gaertn. (2n = 28, PPPP), a wild relative of common wheat, is highly resistant to powdery mildew. Previous studies showed that wheat-A. cristatum 2P disomic addition line II-9-3 displayed high resistance to powdery mildew, and the resistance was attributable to A. cristatum chromosome 2P. To utilize and physically map the powdery mildew resistance gene(s), 15 wheat-A. cristatum 2P translocation lines and three A. cristatum 2P deletion lines with different chromosomal segment sizes, obtained from II-9-3 using 60 Co-γ ray irradiation, were characterized using cytogenetic and molecular marker analysis. A. cristatum 2P chromosomal segments in the translocations were translocated to different wheat chromosomes, including 1A, 4A, 5A, 6A, 7A, 1B, 2B, 3B, 7B, 3D, 4D, and 6D. A physical map of the 2P chromosome was constructed with 82 STS markers, consisting of nine bins with 34 markers on 2PS and eight bins with 48 markers on 2PL. The BC 1 F 2 populations of seven wheat-A. cristatum 2P translocation lines (2PT-3, 2PT-4, 2PT-5, 2PT-6, 2PT-8, 2PT-9, and 2PT-10) were developed by self-pollination, tested with powdery mildew and genotyped with 2P-specific STS markers. From these results, the gene(s) conferring powdery mildew resistance was(were) located on 2PL bin FL 0.66-0.86 and 19 2P-specific markers were identified in this bin. Moreover, two new powdery mildew-resistant translocation lines (2PT-4 and 2PT-5) with small 2PL chromosome segments were obtained. The newly developed wheat lines with powdery mildew resistance and the closely linked molecular markers will be valuable for wheat disease breeding in the future.

Identification of antimicrobial resistance genes in multidrug-resistant clinical Bacteroides fragilis isolates by whole genome shotgun sequencing

DEFF Research Database (Denmark)

Sydenham, Thomas Vognbjerg; Sóki, József; Hasman, Henrik

2015-01-01

Bacteroides fragilis constitutes the most frequent anaerobic bacterium causing bacteremia in humans. The genetic background for antimicrobial resistance in B. fragilis is diverse with some genes requiring insertion sequence (IS) elements inserted upstream for increased expression. To evaluate whole...... genome shotgun sequencing as a method for predicting antimicrobial resistance properties, one meropenem resistant and five multidrug-resistant blood culture isolates were sequenced and antimicrobial resistance genes and IS elements identified using ResFinder 2.1 (http...

SSTAR, a Stand-Alone Easy-To-Use Antimicrobial Resistance Gene Predictor.

Science.gov (United States)

de Man, Tom J B; Limbago, Brandi M

2016-01-01

We present the easy-to-use Sequence Search Tool for Antimicrobial Resistance, SSTAR. It combines a locally executed BLASTN search against a customizable database with an intuitive graphical user interface for identifying antimicrobial resistance (AR) genes from genomic data. Although the database is initially populated from a public repository of acquired resistance determinants (i.e., ARG-ANNOT), it can be customized for particular pathogen groups and resistance mechanisms. For instance, outer membrane porin sequences associated with carbapenem resistance phenotypes can be added, and known intrinsic mechanisms can be included. Unique about this tool is the ability to easily detect putative new alleles and truncated versions of existing AR genes. Variants and potential new alleles are brought to the attention of the user for further investigation. For instance, SSTAR is able to identify modified or truncated versions of porins, which may be of great importance in carbapenemase-negative carbapenem-resistant Enterobacteriaceae. SSTAR is written in Java and is therefore platform independent and compatible with both Windows and Unix operating systems. SSTAR and its manual, which includes a simple installation guide, are freely available from https://github.com/tomdeman-bio/Sequence-Search-Tool-for-Antimicrobial-Resistance-SSTAR-. IMPORTANCE Whole-genome sequencing (WGS) is quickly becoming a routine method for identifying genes associated with antimicrobial resistance (AR). However, for many microbiologists, the use and analysis of WGS data present a substantial challenge. We developed SSTAR, software with a graphical user interface that enables the identification of known AR genes from WGS and has the unique capacity to easily detect new variants of known AR genes, including truncated protein variants. Current software solutions do not notify the user when genes are truncated and, therefore, likely nonfunctional, which makes phenotype predictions less accurate. SSTAR

The Role of the Two-Component System BaeSR in Disposing Chemicals through Regulating Transporter Systems in Acinetobacter baumannii.

Directory of Open Access Journals (Sweden)

Ming-Feng Lin

Full Text Available Bacterial two-component regulatory systems (TCSs facilitate changes in gene expression in response to environmental stimuli. TCS BaeR regulons influence tigecycline susceptibility in Acinetobacter baumannii through positively regulating the pump genes adeA and adeB. In this study, we demonstrate that an additional two transport systems, AdeIJK and MacAB-TolC, are also regulated by BaeSR. In the wild type and clinical tigecycline-resistant A. baumannii strains, gene expression of AdeIJK and MacAB-TolC increased after tigecycline induction, implicating their importance to tigecycline resistance in addition to AdeABC. Phenotypic microarray results showed that A. baumannii is vulnerable to certain chemicals, especially tannic acid, after deleting baeR, which was confirmed using the spot assay. The wild-type strain of A. baumannii also exhibited 1.6-fold and 4.4-fold increase in gene expression of adeJ and macB in the medium with 100 μg/mL tannic acid, but the increase was fully inhibited by baeR deletion. An electrophoretic motility shift assay based on an interaction between His-BaeR and the adeA, adeI and macA promoter regions did not demonstrate direct binding. In conclusion, A. baumannii can use the TCS BaeSR in disposing chemicals, such as tannic acid and tigecycline, through regulating the efflux pumps.

Detection of antibiotic resistance and tetracycline resistance genes in Enterobacteriaceae isolated from the Pearl rivers in South China

International Nuclear Information System (INIS)

Tao Ran; Ying Guangguo; Su Haochang; Zhou Hongwei; Sidhu, Jatinder P.S.

2010-01-01

This study investigated antibiotic resistance profiles and tetracycline resistance genes in Enterobacteriaceae family isolates from the Pearl rivers. The Enterobacteriaceae isolates were tested for susceptibility to seven antibiotics ampicillin, chloramphenicol, ciprofloxacin, levofloxacin, sulphamethoxazole/trimethoprim, tetracycline and trimethoprim. In Liuxi reservoir, with an exception to ampicillin resistant strains (11%) no other antibiotic resistance bacterial strains were detected. However, multiple drug resistance in bacterial isolates from the other sites of Pearl rivers was observed which is possibly due to sewage discharge and input from other anthropogenic sources along the rivers. Four tetracycline resistance genes tet A, tet B, tet C and tet D were detected in the isolates from the rivers. The genes tet A and tet B were widely detected with the detection frequencies of 43% and 40% respectively. Ciprofloxacin and levofloxacin resistant enteric bacteria were also isolated from the pig and duck manures which suggest a wider distribution of human specific drugs in the environment. This investigation provided a baseline data on antibiotic resistance profiles and tetracycline resistance genes in the Pearl rivers delta. - High rates of antibiotic resistance in Enterobacteriaceae from river water are attributed to wastewater contamination.

Detection of antibiotic resistance and tetracycline resistance genes in Enterobacteriaceae isolated from the Pearl rivers in South China

Energy Technology Data Exchange (ETDEWEB)

Tao Ran [State Key Laboratory of Organic Geochemistry, Guangzhou Institute of Geochemistry, Chinese Academy of Sciences, 511 Kehua Street, Tianhe District, Guangzhou 510640 (China); Ying Guangguo, E-mail: guangguo.ying@gmail.co [State Key Laboratory of Organic Geochemistry, Guangzhou Institute of Geochemistry, Chinese Academy of Sciences, 511 Kehua Street, Tianhe District, Guangzhou 510640 (China); Su Haochang [State Key Laboratory of Organic Geochemistry, Guangzhou Institute of Geochemistry, Chinese Academy of Sciences, 511 Kehua Street, Tianhe District, Guangzhou 510640 (China); Zhou Hongwei [Department of Environmental Health, School of Public Health and Tropical Medicine, Southern Medical University, 1838 North Guangzhou Street, Baiyun District, Guangzhou 510515 (China); Sidhu, Jatinder P.S. [CSIRO Land and Water, Queensland Bioscience Precinct, 306 Carmody Road, St Lucia QLD 4067 (Australia)

2010-06-15

This study investigated antibiotic resistance profiles and tetracycline resistance genes in Enterobacteriaceae family isolates from the Pearl rivers. The Enterobacteriaceae isolates were tested for susceptibility to seven antibiotics ampicillin, chloramphenicol, ciprofloxacin, levofloxacin, sulphamethoxazole/trimethoprim, tetracycline and trimethoprim. In Liuxi reservoir, with an exception to ampicillin resistant strains (11%) no other antibiotic resistance bacterial strains were detected. However, multiple drug resistance in bacterial isolates from the other sites of Pearl rivers was observed which is possibly due to sewage discharge and input from other anthropogenic sources along the rivers. Four tetracycline resistance genes tet A, tet B, tet C and tet D were detected in the isolates from the rivers. The genes tet A and tet B were widely detected with the detection frequencies of 43% and 40% respectively. Ciprofloxacin and levofloxacin resistant enteric bacteria were also isolated from the pig and duck manures which suggest a wider distribution of human specific drugs in the environment. This investigation provided a baseline data on antibiotic resistance profiles and tetracycline resistance genes in the Pearl rivers delta. - High rates of antibiotic resistance in Enterobacteriaceae from river water are attributed to wastewater contamination.

Mutations inside rifampicin-resistance determining region of rpoB gene associated with rifampicin-resistance in Mycobacterium tuberculosis.

Science.gov (United States)

Zaw, Myo T; Emran, Nor A; Lin, Zaw

2018-04-26

Rifampicin (RIF) plays a pivotal role in the treatment of tuberculosis due to its bactericidal effects. Because the action of RIF is on rpoB gene encoding RNA polymerase β subunit, 95% of RIF resistant mutations are present in rpoB gene. The majority of the mutations in rpoB gene are found within an 81bp RIF-resistance determining region (RRDR). Literatures on RIF resistant mutations published between 2010 and 2016 were thoroughly reviewed. The most commonly mutated codons in RRDR of rpoB gene are 531, 526 and 516. The possibilities of absence of mutation in RRDR of rpoB gene in MDR-TB isolates in few studies was due to existence of other rare rpoB mutations outside RRDR or different mechanism of rifampicin resistance. Molecular methods which can identify extensive mutations associated with multiple anti-tuberculous drugs are in urgent need so that the research on drug resistant mutations should be extended. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

Deinococcus geothermalis: The Pool of Extreme Radiation Resistance Genes Shrinks

Energy Technology Data Exchange (ETDEWEB)

Makarova, Kira S.; Omelchenko, Marina V.; Gaidamakova, Elena K.; Matrosova, Vera Y.; Vasilenko, Alexander; Zhai, Min; Lapidus, Alla; Copeland, Alex; Kim, Edwin; Land, Miriam; Mavrommatis, Konstantinos; Pitluck, Samuel; Richardson, Paul M.; Detter, Chris; Brettin, Thomas; Saunders, Elizabeth; Lai, Barry; Ravel, Bruce; Kemner, Kenneth M.; Wolf, Yuri I.; Sorokin, Alexander; Gerasimova, Anna V.; Gelfand, Mikhail S.; Fredrickson, James K.; Koonin, Eugene V.; Daly, Michael J.

2007-07-24

Bacteria of the genus Deinococcus are extremely resistant to ionizing radiation (IR), ultraviolet light (UV) and desiccation. The mesophile Deinococcus radiodurans was the first member of this group whose genome was completely sequenced. Analysis of the genome sequence of D. radiodurans, however, failed to identify unique DNA repair systems. To further delineate the genes underlying the resistance phenotypes, we report the whole-genome sequence of a second Deinococcus species, the thermophile Deinococcus geothermalis, which at itsoptimal growth temperature is as resistant to IR, UV and desiccation as D. radiodurans, and a comparative analysis of the two Deinococcus genomes. Many D. radiodurans genes previously implicated in resistance, but for which no sensitive phenotype was observed upon disruption, are absent in D. geothermalis. In contrast, most D. radiodurans genes whose mutants displayed a radiation-sensitive phenotype in D. radiodurans are conserved in D. geothermalis. Supporting the existence of a Deinococcus radiation response regulon, a common palindromic DNA motif was identified in a conserved set of genes associated with resistance, and a dedicated transcriptional regulator was predicted. We present the case that these two species evolved essentially the same diverse set of gene families, and that the extreme stress-resistance phenotypes of the Deinococcus lineage emerged progressively by amassing cell-cleaning systems from different sources, but not by acquisition of novel DNA repair systems. Our reconstruction of the genomic evolution of the Deinococcus-Thermus phylum indicates that the corresponding set of enzymes proliferated mainly in the common ancestor of Deinococcus. Results of the comparative analysis weaken the arguments for a role of higher-order chromosome alignment structures in resistance; more clearly define and substantially revise downward the number of uncharacterized genes that might participate in DNA repair and contribute to

Melanoma differentiation associated gene-7/interleukin-24 (mda-7/IL-24): Novel gene therapeutic for metastatic melanoma

International Nuclear Information System (INIS)

Fisher, Paul B.; Sarkar, Devanand; Lebedeva, Irina V.; Emdad, Luni; Gupta, Pankaj; Sauane, Moira; Su Zaozhong; Grant, Steven; Dent, Paul; Curiel, David T.; Senzer, Neil; Nemunaitis, John

2007-01-01

A potentially less toxic approach for cancer therapy comprises induction of tumor cells to lose growth potential irreversibly and terminally differentiate. Combining this scheme termed 'differentiation therapy of cancer' with subtraction hybridization to human melanoma cells resulted in the cloning of melanoma differentiation associated (mda) genes displaying elevated expression as a consequence of induction of terminal differentiation. One originally novel gene, mda-7, was found to display elevated expression in normal melanocytes and nevi with progressive loss of expression as a consequence of melanoma development and progression to metastasis. Based on structure, biochemical properties and chromosomal location, mda-7 has now been reclassified as interleukin (IL)-24, a member of the expanding IL-10 family of cytokines. In vitro cell culture and in vivo animal studies indicate that mda-7/IL-24 selectively induces programmed cell death (apoptosis) in multiple human cancers (including melanomas), without harming normal cells, and promotes profound anti-tumor activity in nude mice containing human tumor xenografts. Based on these remarkable properties, a Phase I clinical trial was conducted to test the safety of administration of mda-7/IL-24 by a replication incompetent adenovirus (Ad.mda-7; INGN 241) in patients with advanced solid cancers including melanoma. mda-7/IL-24 was found to be safe and to promote significant clinical activity, particularly in the context of patients with metastatic melanoma. These results provide an impetus for further clinical studies and document a central paradigm of cancer therapy, namely translation of basic science from the 'bench to the bedside.'

Spread of tetracycline resistance genes at a conventional dairy farm

Directory of Open Access Journals (Sweden)

Martina eKyselkova

2015-05-01

Full Text Available The use of antibiotics in animal husbandry contributes to the worldwide problem of increasing antibiotic resistance in animal and human pathogens. Intensive animal production is considered an important source of antibiotic resistance genes released to the environment, while the contribution of smaller farms remains to be evaluated. Here we monitor the spread of tetracycline resistance (TC-r genes at a middle-size conventional dairy farm, where chlortetracycline (CTC, as intrauterine suppository is prophylactically used after each calving. Our study has shown that animals at the farm acquired the TC-r genes in their early age (1-2 weeks, likely due to colonization with TC-resistant bacteria from their mothers and/or the farm environment. The relative abundance of the TC-r genes tet(W, tet(Q and tet(M in fresh excrements of calves was about 1-2 orders of magnitude higher compared to heifers and dairy cows, possibly due to the presence of antibiotic residues in milk fed to calves. The occurrence and abundance of TC-r genes in fresh excrements of heifers and adult cows remained unaffected by intrauterine CTC applications, with tet(O, tet(Q and tet(W representing a ‘core TC-resistome’ of the farm, and tet(A, tet(M, tet(Y and tet(X occurring occasionally. The genes tet(A, tet(M, tet(Y and tet(X were shown to be respectively harbored by Shigella, Lactobacillus and Clostridium, Acinetobacter, and Wautersiella. Soil in the farm proximity, as well as field soil to which manure from the farm was applied, was contaminated with TC-r genes occurring in the farm, and some of the TC-r genes persisted in the field over 3 months following the manure application. Concluding, our study shows that antibiotic resistance genes may be a stable part of the intestinal metagenome of cattle even if antibiotics are not used for growth stimulation, and that smaller dairy farms may also contribute to environmental pollution with antibiotic resistance genes.

Occurrence and Distribution of Antibiotic-resistant Bacteria and Transfer of Resistance Genes in Lake Taihu

Science.gov (United States)

Yin, Qian; Yue, Dongmei; Peng, Yuke; Liu, Ying; Xiao, Lin

2013-01-01

The overuse of antibiotics has accelerated antibiotic resistance in the natural environment, especially fresh water, generating a potential risk for public health around the world. In this study, antibiotic resistance in Lake Taihu was investigated and this was the first thorough data obtained through culture-dependent methods. High percentages of resistance to streptomycin and ampicillin among bacterial isolates were detected, followed by tetracycline and chloramphenicol. Especially high levels of ampicillin resistance in the western and northern regions were illustrated. Bacterial identification of the isolates selected for further study indicated the prevalence of some opportunistic pathogens and 62.0% of the 78 isolates exhibited multiple antibiotic resistance. The presence of ESBLs genes was in the following sequence: blaTEM > blaSHV > blaCTMX and 38.5% of the isolates had a class I integrase gene. Of all tested strains, 80.8% were able to transfer antibiotic resistance through conjugation. We also concluded that some new families of human-associated ESBLs and AmpC genes can be found in natural environmental isolates. The prevalence of antibiotic resistance and the dissemination of transferable antibiotic resistance in bacterial isolates (especially in opportunistic pathogens) was alarming and clearly indicated the urgency of realizing the health risks of antibiotic resistance to human and animal populations who are dependent on Lake Taihu for water consumption. PMID:24240317

Antibiotic Resistance and Antibiotic Resistance Genes in Escherichia coli Isolates from Hospital Wastewater in Vietnam.

Science.gov (United States)

Lien, La Thi Quynh; Lan, Pham Thi; Chuc, Nguyen Thi Kim; Hoa, Nguyen Quynh; Nhung, Pham Hong; Thoa, Nguyen Thi Minh; Diwan, Vishal; Tamhankar, Ashok J; Stålsby Lundborg, Cecilia

2017-06-29

The environmental spread of antibiotic-resistant bacteria has been recognised as a growing public health threat for which hospitals play a significant role. The aims of this study were to investigate the prevalence of antibiotic resistance and antibiotic resistance genes (ARGs) in Escherichia coli isolates from hospital wastewater in Vietnam. Wastewater samples before and after treatment were collected using continuous sampling every month over a year. Standard disk diffusion and E-test were used for antibiotic susceptibility testing. Extended-spectrum beta-lactamase (ESBL) production was tested using combined disk diffusion. ARGs were detected by polymerase chain reactions. Resistance to at least one antibiotic was detected in 83% of isolates; multidrug resistance was found in 32%. The highest resistance prevalence was found for co-trimoxazole (70%) and the lowest for imipenem (1%). Forty-three percent of isolates were ESBL-producing, with the bla TEM gene being more common than bla CTX-M . Co-harbouring of the bla CTX-M , bla TEM and qepA genes was found in 46% of isolates resistant to ciprofloxacin. The large presence of antibiotic-resistant E. coli isolates combined with ARGs in hospital wastewater, even post-treatment, poses a threat to public health. It highlights the need to develop effective processes for hospital wastewater treatment plants to eliminate antibiotic resistant bacteria and ARGs.

Characterization of antimicrobial resistance genes in Haemophilus parasuis isolated from pigs in China.

Science.gov (United States)

Zhao, Yongda; Guo, Lili; Li, Jie; Huang, Xianhui; Fang, Binghu

2018-01-01

Haemophilus parasuis is a common porcine respiratory pathogen that causes high rates of morbidity and mortality in farmed swine. We performed a molecular characterization of antimicrobial resistance genes harbored by H. parasuis from pig farms in China. We screened 143 H. parasuis isolates for antimicrobial susceptibility against six fluoroquinolone antibiotics testing by the broth microdilution method, and the presence of 64 antimicrobial resistance genes by PCR amplification and DNA sequence analysis. We determined quinolone resistance determining region mutations of DNA gyrase ( gyrA and gyrB ) and topoisomerase IV ( parC and parE ). The genetic relatedness among the strains was analyzed by pulsed-field gel electrophoresis. Susceptibility test showed that all isolates were low resistance to lomefloxacin (28.67%), levofloxacin (20.28%), norfloxacin (22.38%), ciprofloxacin (23.78%), however, high resistance levels were found to nalidixic acid (82.52%) and enrofloxacin (55.94%). In addition, we found 14 antimicrobial resistance genes were present in these isolates, including bla TEM-1 , bla ROB-1 , ermB, ermA, flor, catl, tetB, tetC, rmtB, rmtD, aadA1, aac(3')-llc, sul1, and sul2 genes. Interestingly, one isolate carried five antibiotic resistance genes ( tetB, tetC, flor, rmtB, sul1 ). The genes tetB , rmtB, and flor were the most prevalent resistance genes in H. parasuis in China. Alterations in the gyrA gene (S83F/Y, D87Y/N/H/G) were detected in 81% of the strains and parC mutations were often accompanied by a gyrA mutation. Pulsed-field gel electrophoresis typing revealed 51 unique patterns in the isolates carrying high-level antibiotic resistance genes, indicating considerable genetic diversity and suggesting that the genes were spread horizontally. The current study demonstrated that the high antibiotic resistance of H. parasuis in piglets is a combination of transferable antibiotic resistance genes and multiple target gene mutations. These data provide novel

Two whitebacked planthopper resistance genes in rice share the same loci with those for brown planthopper resistance.

Science.gov (United States)

Tan, G X; Weng, Q M; Ren, X; Huang, Z; Zhu, L L; He, G C

2004-03-01

The whitebacked planthopper (WBPH), Sogatella furcifera, and brown planthopper (BPH) Nilaparvata lugens Stål are important sucking insects of rice (Oryza sativa L.) crops throughout the world. Rice 'B5', which has derived its resistance genes from the wild rice O. officinalis Wall ex Watt, is a line that is highly resistant to both WBPH and BPH. Previously, two resistance genes against BPH, Qbp1, and Qbp2 in 'B5' had been mapped onto chromosome 3 and chromosome 4, respectively. In this study, we employed a mapping population composed of 187 recombinant inbred lines (RILs), produced from a cross between 'B5' and susceptible variety 'Minghui63', to locate the WBPH and BPH resistance genes. A RFLP survey of the bulked extremes from the RIL population identified two genomic regions, one on chromosome 3 and the other on chromosome 4, likely containing the resistance genes to planthoppers. QTL analysis of the RILs further confirmed that two WBPH resistance genes were mapped on the same loci as Qbp1 and Qbp2, using a linkage map with 242 molecular markers distributed on 12 rice chromosomes. Of the two WBPH resistance genes, one designated Wbph7(t) was located within a 1.1-cM region between R1925 and G1318 on chromosome 3, the other designated Wbph8(t) was within a 0.3-cM region flanked by R288 and S11182 on chromosome 4. A two-way analysis of variance showed that two loci acted independently with each other in determining WBPH resistance. The results have significant implications in studying the interactions between sucking insects and plants and in breeding programs of resistance to rice planthoppers.

Antimicrobial-Resistant Bacterial Populations and Antimicrobial Resistance Genes Obtained from Environments Impacted by Livestock and Municipal Waste.

Directory of Open Access Journals (Sweden)

Getahun E Agga

Full Text Available This study compared the populations of antimicrobial-resistant bacteria and the repertoire of antimicrobial resistance genes in four environments: effluent of three municipal wastewater treatment facilities, three cattle feedlot runoff catchment ponds, three swine waste lagoons, and two "low impact" environments (an urban lake and a relict prairie. Multiple liquid and solid samples were collected from each environment. The prevalences and concentrations of antimicrobial-resistant (AMR Gram-negative (Escherichia coli and Salmonella enterica and Gram-positive (enterococci bacteria were determined from individual samples (n = 174. The prevalences of 84 antimicrobial resistance genes in metagenomic DNA isolated from samples pooled (n = 44 by collection date, location, and sample type were determined. The prevalences and concentrations of AMR E. coli and Salmonella were similar among the livestock and municipal sample sources. The levels of erythromycin-resistant enterococci were significantly higher in liquid samples from cattle catchment ponds and swine waste lagoons than in liquid samples from municipal wastewater treatment facilities, but solid samples from these environments did not differ significantly. Similarly, trimethoprim/sulfamethoxazole-resistant E. coli concentrations were significantly higher in swine liquid than in municipal liquid samples, but there was no difference in solid samples. Multivariate analysis of the distribution of antimicrobial resistance genes using principal coordinate analysis showed distinct clustering of samples with livestock (cattle and swine, low impact environment and municipal samples forming three separate clusters. The numbers of class A beta-lactamase, class C beta-lactamase, and fluoroquinolone resistance genes detected were significantly higher (P < 0.05 in municipal samples than in cattle runoff or swine lagoon samples. In conclusion, we report that AMR is a very widespread phenomenon and that similar

Tagging of blast resistance gene(s) to DNA markers and marker-assisted selection (MAS) in rice improvement

International Nuclear Information System (INIS)

Zhuang, J.Y.; Lu, J.; Qian, H.R.; Lin, H.X.; Zheng, K.L.

1998-01-01

This paper reports progress made on the tagging of blast resistance gene(s) to DNA markers and on the initiation of marker-assisted selection (MAS) for blast resistance in rice improvement. A pair of near isogenic lines, K8OR and K79S, were developed using a Chinese landrace Hong-jiao-zhan as the resistance donor. Ten putatively positive markers were identified by screening 177 mapped DNA markers. Using the F 2 population of 143 plants and the derived F 3 lines, three Restriction Fragment Length Polymorphism (RFLP) markers (RG81, RG869 and RZ397) on chromosome 12 of rice were identified to be closely linked to the blast resistance gene Pi-12(t). The genetic distance between Pi-12(t) and the closest marker RG869 was 5.1 cM. By employing the bulk segregant analysis (BSA) procedure, six of 199 arbitrary primers were found to produce positive Randomly Amplified Polymorphic DNA (RAPD) bands. Tight linkage between Pi-12(t) and three RAPD bands, each from a different primer, was confirmed after amplification of DNA of all F 2 individuals. Two fragments were cloned and sequenced, and two sequence characterised amplified re-ion (SCAR) markers were established. In two other F 3 populations, Xian-feng I/Tetep and Xian-feng, 1/Hong-jiao-zhan, the blast resistance was found to be controlled by interactions of two or more genes. One resistance gene was located in the vicinity of RG81 in both populations. Work to identify other gene(s) is currently under way. Marker assisted selection for blast resistance was initiated. Crosses were made between elite varieties and blast resistance donors to develop populations for DNA marker-assisted selection of blast resistance. In addition, 48 varieties widely used in current rice breeding programs were provided by rice breeders. DNA marker-based polymorphism among, these varieties and resistance donors were analysed to produce a database for future MAS program. (author)

Antimicrobial resistance and resistance genes in Salmonella strains isolated from broiler chickens along the slaughtering process in China.

Science.gov (United States)

Zhu, Yuanting; Lai, Haimei; Zou, Likou; Yin, Sheng; Wang, Chengtao; Han, Xinfeng; Xia, Xiaolong; Hu, Kaidi; He, Li; Zhou, Kang; Chen, Shujuan; Ao, Xiaolin; Liu, Shuliang

2017-10-16

A total of 189 Salmonella isolates were recovered from 627 samples which were collected from cecal contents of broilers, chicken carcasses, chicken meat after cutting step and frozen broiler chicken products along the slaughtering process at a slaughterhouse in Sichuan province of China. The Salmonella isolates were subjected to antimicrobial susceptibility testing to 10 categories of antimicrobial agents using the Kirby-Bauer disk diffusion method. Those antibiotics-resistant isolates were further investigated for the occurrence of resistance genes, the presence of class 1 integron as well as the associated gene cassettes, and the mutations within the gyrA and parC genes. Consequently, the prevalence of Salmonella was 30.14% (47.96% for cecal content, 18.78% for chicken carcasses, 31.33% for cutting meat and 14.00% for frozen meat, respectively). The predominant serotypes were S. Typhimurium (15.34%) and S. Enteritidis (69.84%). High resistance rates to the following drugs were observed: nalidixic acid (99.5%), ampicillin (87.8%), tetracycline (51.9%), ciprofloxacin (48.7%), trimethoprim/sulfamethoxazole (48.1%), and spectinomycin (34.4%). Antimicrobial resistance profiling showed that 60.8% of isolates were multidrug resistant (MDR), and MDR strains increased from 44.7% to 78.6% along the slaughtering line. 94.6% (n=157) of beta-lactam-resistant isolates harbored at least one resistance gene of bla TEM or bla CTX-M . The relatively low prevalence of aminoglycoside resistance genes (aac(3)-II, aac(3)-IV, and ant(2″)-I) was found in 49 (66.2%) of antibiotic-resistant isolates. The tetracycline resistance genes (tet(A), tet(B), tet(C), and tet(G) and sulfonamide resistance genes (sul1, sul2, and sul3) were identified in 84 (85.7%) and 89 (97.8%) antibiotic-resistant isolates respectively. floR was identified in 44 (97.8%) florfenicol-resistant isolates. Class 1 integron was detected in 37.4% (n=43) of the MDR isolates. Two different gene cassettes, bla OXA-30 -aad

Characterization of Antimicrobial Resistance Patterns and Detection of Virulence Genes in Campylobacter Isolates in Italy

Science.gov (United States)

Di Giannatale, Elisabetta; Di Serafino, Gabriella; Zilli, Katiuscia; Alessiani, Alessandra; Sacchini, Lorena; Garofolo, Giuliano; Aprea, Giuseppe; Marotta, Francesca

2014-01-01

Campylobacter has developed resistance to several antimicrobial agents over the years, including macrolides, quinolones and fluoroquinolones, becoming a significant public health hazard. A total of 145 strains derived from raw milk, chicken faeces, chicken carcasses, cattle faeces and human faeces collected from various Italian regions, were screened for antimicrobial susceptibility, molecular characterization (SmaI pulsed-field gel electrophoresis) and detection of virulence genes (sequencing and DNA microarray analysis). The prevalence of C. jejuni and C. coli was 62.75% and 37.24% respectively. Antimicrobial susceptibility revealed a high level of resistance for ciprofloxacin (62.76%), tetracycline (55.86%) and nalidixic acid (55.17%). Genotyping of Campylobacter isolates using PFGE revealed a total of 86 unique SmaI patterns. Virulence gene profiles were determined using a new microbial diagnostic microarray composed of 70-mer oligonucleotide probes targeting genes implicated in Campylobacter pathogenicity. Correspondence between PFGE and microarray clusters was observed. Comparisons of PFGE and virulence profiles reflected the high genetic diversity of the strains examined, leading us to speculate different degrees of pathogenicity inside Campylobacter populations. PMID:24556669

Tagging of resistance gene(s) to rhizomania disease in sugar beet ...

African Journals Online (AJOL)

The rhizomania disease is one of the most important diseases in Iran and some other parts of the world which potentially could play a role in decreasing sugar yield in fields. One approach to combat with this disease is the use of resistance varieties. This varieties have been identified which are having resistance genes to ...

Discovery of a novel stem rust resistance allele in durum wheat that exhibits differential reactions to Ug99 isolates

Science.gov (United States)

Wheat stem rust, caused by Puccinia graminis f. sp. tritici Erikss. & E. Henn, can incur yield losses on susceptible cultivars of durum wheat, Triticum turgidum ssp. durum (Desf.) Husnot. Though several durum cultivars possess the stem rust resistance gene Sr13, additional genes in durum wheat effec...

A maize resistance gene functions against bacterial streak disease in rice

OpenAIRE

Zhao, Bingyu; Lin, Xinghua; Poland, Jesse; Trick, Harold; Leach, Jan; Hulbert, Scot

2005-01-01

Although cereal crops all belong to the grass family (Poacea), most of their diseases are specific to a particular species. Thus, a given cereal species is typically resistant to diseases of other grasses, and this nonhost resistance is generally stable. To determine the feasibility of transferring nonhost resistance genes (R genes) between distantly related grasses to control specific diseases, we identified a maize R gene that recognizes a rice pathogen, Xanthomonas oryzae pv. oryzicola, wh...

BiCaSrCuO superconductors

International Nuclear Information System (INIS)

Polvi, V.M.; Niemi, K.J.

1989-01-01

BiCaSrCuO and BiPbCaSrCuO powders have been synthesized. Different research methods (SEM,EDS,XRF,SRD,DTA) have been used to characterize the bulk specimen and wires. Resistance and current density measured as a function of temperature are reported. The ceramic products contained several phases. Lead containing specimen gave the best results and the synthesis was easily reproducible

Putative resistance genes in the CitEST database

Directory of Open Access Journals (Sweden)

Simone Guidetti-Gonzalez

2007-01-01

Full Text Available Disease resistance in plants is usually associated with the activation of a wide variety of defense responses to prevent pathogen replication and/or movement. The ability of the host plant to recognize the pathogen and to activate defense responses is regulated by direct or indirect interaction between the products of plant resistance (R and pathogen avirulence (Avr genes. Attempted infection of plants by avirulent pathogens elicits a battery of defenses often followed by the collapse of the challenged host cells. Localized host cell death may help to prevent the pathogen from spreading to uninfected tissues, known as hypersensitive response (HR. When either the plant or the pathogen lacks its cognate gene, activation of the plant’s defense responses fails to occur or is delayed and does not prevent pathogen colonization. In the CitEST database, we identified 1,300 reads related to R genes in Citrus which have been reported in other plant species. These reads were translated in silico, and alignments of their amino acid sequences revealed the presence of characteristic domains and motifs that are specific to R gene classes. The description of the reads identified suggests that they function as resistance genes in citrus.

Pyramiding, alternating or mixing: comparative performances of deployment strategies of nematode resistance genes to promote plant resistance efficiency and durability.

Science.gov (United States)

Djian-Caporalino, Caroline; Palloix, Alain; Fazari, Ariane; Marteu, Nathalie; Barbary, Arnaud; Abad, Pierre; Sage-Palloix, Anne-Marie; Mateille, Thierry; Risso, Sabine; Lanza, Roger; Taussig, Catherine; Castagnone-Sereno, Philippe

2014-02-22

Resistant cultivars are key elements for pathogen control and pesticide reduction, but their repeated use may lead to the emergence of virulent pathogen populations, able to overcome the resistance. Increased research efforts, mainly based on theoretical studies, explore spatio-temporal deployment strategies of resistance genes in order to maximize their durability. We evaluated experimentally three of these strategies to control root-knot nematodes: cultivar mixtures, alternating and pyramiding resistance genes, under controlled and field conditions over a 3-years period, assessing the efficiency and the durability of resistance in a protected crop rotation system with pepper as summer crop and lettuce as winter crop. The choice of the resistance gene and the genetic background in which it is introgressed, affected the frequency of resistance breakdown. The pyramiding of two different resistance genes in one genotype suppressed the emergence of virulent isolates. Alternating different resistance genes in rotation was also efficient to decrease virulent populations in fields due to the specificity of the virulence and the trapping effect of resistant plants. Mixing resistant cultivars together appeared as a less efficient strategy to control nematodes. This work provides experimental evidence that, in a cropping system with seasonal sequences of vegetable species, pyramiding or alternating resistance genes benefit yields in the long-term by increasing the durability of resistant cultivars and improving the long-term control of a soil-borne pest. To our knowledge, this result is the first one obtained for a plant-nematode interaction, which helps demonstrate the general applicability of such strategies for breeding and sustainable management of resistant cultivars against pathogens.

[Mechanisms of endogenous drug resistance acquisition by spontaneous chromosomal gene mutation].

Science.gov (United States)

Fukuda, H; Hiramatsu, K

1997-05-01

Endogenous resistance in bacteria is caused by a change or loss of function and generally genetically recessive. However, this type of resistance acquisition are now prevalent in clinical setting. Chromosomal genes that afford endogenous resistance are the genes correlated with the target of the drug, the drug inactivating enzymes, and permeability of the molecules including the antibacterial agents. Endogenous alteration of the drug target are mediated by the spontaneous mutation of their structural gene. This mutation provides much lower affinity of the drugs for the target. Gene expression of the inactivating enzymes, such as class C beta-lactamase, is generally regulated by regulatory genes. Spontaneous mutations in the regulatory genes cause constitutive enzyme production and provides the resistant to the agent which is usually stable for such enzymes. Spontaneous mutation in the structural gene gives the enzyme extra-spectrum substrate specificity, like ESBL (Extra-Spectrum-beta-Lactamase). Expression of structural genes encoding the permeability systems are also regulated by some regulatory genes. The spontaneous mutation of the regulatory genes reduce an amount of porin protein. This mutation causes much lower influx of the drug in the cell. Spontaneous mutation in promoter region of the structural gene of efflux protein was observed. This mutation raised the gene transcription and overproduced efflux protein. This protein progresses the drug efflux from the cell.

Identification of antibiotic resistance genes in the multidrug-resistant Acinetobacter baumannii strain, MDR-SHH02, using whole-genome sequencing.

Science.gov (United States)

Wang, Hualiang; Wang, Jinghua; Yu, Peijuan; Ge, Ping; Jiang, Yanqun; Xu, Rong; Chen, Rong; Liu, Xuejie

2017-02-01

This study aimed to investigate antibiotic resistance genes in the multidrug-resistant (MDR) Acinetobacter baumannii (A. baumanii) strain, MDR-SHH02, using whole‑genome sequencing (WGS). The antibiotic resistance of MDR-SHH02 isolated from a patient with breast cancer to 19 types of antibiotics was determined using the Kirby‑Bauer method. WGS of MDR-SHH02 was then performed. Following quality control and transcriptome assembly, functional annotation of genes was conducted, and the phylogenetic tree of MDR-SHH02, along with another 5 A. baumanii species and 2 Acinetobacter species, was constructed using PHYLIP 3.695 and FigTree v1.4.2. Furthermore, pathogenicity islands (PAIs) were predicted by the pathogenicity island database. Potential antibiotic resistance genes in MDR-SHH02 were predicted based on the information in the Antibiotic Resistance Genes Database (ARDB). MDR-SHH02 was found to be resistant to all of the tested antibiotics. The total draft genome length of MDR-SHH02 was 4,003,808 bp. There were 74.25% of coding sequences to be annotated into 21 of the Clusters of Orthologous Groups (COGs) of protein terms, such as 'transcription' and 'amino acid transport and metabolism'. Furthermore, there were 45 PAIs homologous to the sequence MDRSHH02000806. Additionally, a total of 12 gene sequences in MDR-SHH02 were highly similar to the sequences of antibiotic resistance genes in ARDB, including genes encoding aminoglycoside‑modifying enzymes [e.g., aac(3)-Ia, ant(2'')‑Ia, aph33ib and aph(3')-Ia], β-lactamase genes (bl2b_tem and bl2b_tem1), sulfonamide-resistant dihydropteroate synthase genes (sul1 and sul2), catb3 and tetb. These results suggest that numerous genes mediate resistance to various antibiotics in MDR-SHH02, and provide a clinical guidance for the personalized therapy of A. baumannii-infected patients.

Prevalence of β-lactamase genes in domestic washing machines and dishwashers and the impact of laundering processes on antibiotic-resistant bacteria.

Science.gov (United States)

Rehberg, L; Frontzek, A; Melhus, Å; Bockmühl, D P

2017-12-01

To investigate the prevalence of β-lactamase genes in domestic washing machines and dishwashers, and the decontamination efficacy of laundering. For the first investigation, swab samples from washing machines (n = 29) and dishwashers (n = 24) were analysed by real-time quantitative PCR to detect genes encoding β-lactamases. To test the impact of laundering on resistant bacteria, cotton test swatches were artificially contaminated with susceptible and resistant strains of Pseudomonas aeruginosa, Klebsiella pneumoniae and Staphylococcus aureus within a second investigation. They were washed in a domestic washing machine with or without activated oxygen bleach (AOB)-containing detergent at 20-50°C. β-Lactamase genes (most commonly of the AmpC- and OXA-type) were detected in 79% of the washing machines and in 96% of the dishwashers and Pseudomonadaceae dominated the microbiota. The level of bacterial reduction after laundering was ≥80% for all Ps. aeruginosa and Kl. pneumoniae strains, while it was only 37-61% for the methicillin-resistant Staph. aureus outbreak strain. In general, the reduction was tendentially higher for susceptible bacteria than for the resistant outbreak strains, especially for Staph. aureus. β-Lactamase genes seem to be frequently present in domestic appliances and may pose a potential risk for cross-contamination and horizontal transfer of genes encoding resistance against clinically important β-lactams. In general, higher temperatures and the use of AOB can improve the reduction of antibiotic-resistant bacteria, including Staph. aureus which appears to be less susceptible to the decontamination effect of laundering. Data on the presence of antibiotic-resistant bacteria in the domestic environment are limited. This study suggests that β-lactamase genes in washing machines and dishwashers are frequent, and that antibiotic-resistant strains are generally more resistant to the used washing conditions. © 2017 The Society for

Gene Expression Profiling and Identification of Resistance Genes to Aspergillus flavus Infection in Peanut through EST and Microarray Strategies

Directory of Open Access Journals (Sweden)

Baozhu Guo

2011-06-01

Full Text Available Aspergillus flavus and A. parasiticus infect peanut seeds and produce aflatoxins, which are associated with various diseases in domestic animals and humans throughout the world. The most cost-effective strategy to minimize aflatoxin contamination involves the development of peanut cultivars that are resistant to fungal infection and/or aflatoxin production. To identify peanut Aspergillus-interactive and peanut Aspergillus-resistance genes, we carried out a large scale peanut Expressed Sequence Tag (EST project which we used to construct a peanut glass slide oligonucleotide microarray. The fabricated microarray represents over 40% of the protein coding genes in the peanut genome. For expression profiling, resistant and susceptible peanut cultivars were infected with a mixture of Aspergillus flavus and parasiticus spores. The subsequent microarray analysis identified 62 genes in resistant cultivars that were up-expressed in response to Aspergillus infection. In addition, we identified 22 putative Aspergillus-resistance genes that were constitutively up-expressed in the resistant cultivar in comparison to the susceptible cultivar. Some of these genes were homologous to peanut, corn, and soybean genes that were previously shown to confer resistance to fungal infection. This study is a first step towards a comprehensive genome-scale platform for developing Aspergillus-resistant peanut cultivars through targeted marker-assisted breeding and genetic engineering.

Spatially resolved resistivity near the vortex lattice phase transition in Bi 2Sr 2CaCu 2O 8+δ single crystals

Science.gov (United States)

Berseth, V.; Indenbom, M. V.; van der Beek, C. J.; D'Anna, G.; Benoit, W.

1997-08-01

Using a multiterminal contact configuration, we investigate the local variations of the resistivity drop near the vortex lattice first order phase transition in a very homogeneous Bi2Sr2CaCu2O8+δ (BSCCO) single crystal.

Resistant mechanisms and molecular epidemiology of imipenem-resistant Acinetobacter baumannii.

Science.gov (United States)

Xiao, Shu-Zhen; Chu, Hai-Qing; Han, Li-Zhong; Zhang, Zhe-Min; Li, Bing; Zhao, Lan; Xu, Liyun

2016-09-01

The aim of the study was to investigate the resistant mechanisms and homology of imipenem-resistant Acinetobacter baumannii (A. baumannii). A total of 46 non-duplicate imipenem‑resistant A. baumannii clinical isolates were collected from three tertiary hospitals between July, 2011 and June, 2012. The minimal inhibitory concentrations (MICs) of antimicrobial agents were determined using the agar dilution method. Phenylalanine‑arginine β-naphthylamide was used to detect the presence of the efflux pump-mediated resistant mechanism. Polymerase chain reaction was employed to amplify genes associated with drug resistance, including β‑lactamase genes, efflux pump genes and outer membrane protein gene CarO. A few amplicons were randomly selected and sequenced. Multilocus sequence analysis (MLST) was employed in typing A. baumanni. A. baumannii was resistant to imipenem, simultaneously showing resistance to several other antimicrobials. In addtition, 13 A. baumannii were found to mediate drug resistance through operation of the efflux pump. Of the various drug resistance genes tested, blaOXA‑51 was present in 46 isolates, blaOXA‑23 gene was present in 44 isolates and blaNDM gene was found in only one strain. Other drug resistant‑associated genes, including blaKPC, blaIMP, blaOXA-24, blaOXA‑58, blaSHV, blaGIM and blaVIM were not detected. Mutation of adeS and outer membrane protein gene CarO were found in a few of the imipenem‑resistant isolates. The MLST analysis revealed that all 46 clinical isolates were clustered into 11 genotypes and the most frequent genotype was ST208. In conclusion, β‑lactamase genes, genes involved in efflux pump and mutation of outer membrane protein encoding gene may be important in mediating imipenem resistance in A. baumannii. Of the 11 different genotypes, ST11 was shared by the majority of A. baumannii, which may be due to horizontal transfer of patients from hospitals.

Characterization of antimicrobial resistance genes in Haemophilus parasuis isolated from pigs in China

Directory of Open Access Journals (Sweden)

Yongda Zhao

2018-04-01

Full Text Available Background Haemophilus parasuis is a common porcine respiratory pathogen that causes high rates of morbidity and mortality in farmed swine. We performed a molecular characterization of antimicrobial resistance genes harbored by H. parasuis from pig farms in China. Methods We screened 143 H. parasuis isolates for antimicrobial susceptibility against six fluoroquinolone antibiotics testing by the broth microdilution method, and the presence of 64 antimicrobial resistance genes by PCR amplification and DNA sequence analysis. We determined quinolone resistance determining region mutations of DNA gyrase (gyrA and gyrB and topoisomerase IV (parC and parE. The genetic relatedness among the strains was analyzed by pulsed-field gel electrophoresis. Results Susceptibility test showed that all isolates were low resistance to lomefloxacin (28.67%, levofloxacin (20.28%, norfloxacin (22.38%, ciprofloxacin (23.78%, however, high resistance levels were found to nalidixic acid (82.52% and enrofloxacin (55.94%. In addition, we found 14 antimicrobial resistance genes were present in these isolates, including blaTEM-1, blaROB-1, ermB, ermA, flor, catl, tetB, tetC, rmtB, rmtD, aadA1, aac(3′-llc, sul1, and sul2 genes. Interestingly, one isolate carried five antibiotic resistance genes (tetB, tetC, flor, rmtB, sul1. The genes tetB, rmtB, and flor were the most prevalent resistance genes in H. parasuis in China. Alterations in the gyrA gene (S83F/Y, D87Y/N/H/G were detected in 81% of the strains and parC mutations were often accompanied by a gyrA mutation. Pulsed-field gel electrophoresis typing revealed 51 unique patterns in the isolates carrying high-level antibiotic resistance genes, indicating considerable genetic diversity and suggesting that the genes were spread horizontally. Discussion The current study demonstrated that the high antibiotic resistance of H. parasuis in piglets is a combination of transferable antibiotic resistance genes and multiple target

Are duplicated genes responsible for anthracnose resistance in common bean?

Science.gov (United States)

Costa, Larissa Carvalho; Nalin, Rafael Storto; Ramalho, Magno Antonio Patto; de Souza, Elaine Aparecida

2017-01-01

The race 65 of Colletotrichum lindemuthianum, etiologic agent of anthracnose in common bean, is distributed worldwide, having great importance in breeding programs for anthracnose resistance. Several resistance alleles have been identified promoting resistance to this race. However, the variability that has been detected within race has made it difficult to obtain cultivars with durable resistance, because cultivars may have different reactions to each strain of race 65. Thus, this work aimed at studying the resistance inheritance of common bean lines to different strains of C. lindemuthianum, race 65. We used six C. lindemuthianum strains previously characterized as belonging to the race 65 through the international set of differential cultivars of anthracnose and nine commercial cultivars, adapted to the Brazilian growing conditions and with potential ability to discriminate the variability within this race. To obtain information on the resistance inheritance related to nine commercial cultivars to six strains of race 65, these cultivars were crossed two by two in all possible combinations, resulting in 36 hybrids. Segregation in the F2 generations revealed that the resistance to each strain is conditioned by two independent genes with the same function, suggesting that they are duplicated genes, where the dominant allele promotes resistance. These results indicate that the specificity between host resistance genes and pathogen avirulence genes is not limited to races, it also occurs within strains of the same race. Further research may be carried out in order to establish if the alleles identified in these cultivars are different from those described in the literature.

A novel Capsicum gene inhibits host-specific disease resistance to Phytophthora capsici.

Science.gov (United States)

Reeves, Gregory; Monroy-Barbosa, Ariadna; Bosland, Paul W

2013-05-01

A novel disease resistance inhibitor gene (inhibitor of P. capsici resistance [Ipcr]), found in the chile pepper (Capsicum annuum) variety 'New Mexico Capsicum Accession 10399' (NMCA10399), inhibits resistance to Phytophthora capsici but not to other species of Phytophthora. When a highly P. capsici-resistant variety was hybridized with NMCA10399, the resultant F1 populations, when screened, were completely susceptible to P. capsici for root rot and foliar blight disease syndromes, despite the dominance inheritance of P. capsici resistance in chile pepper. The F2 population displayed a 3:13 resistant-to-susceptible (R:S) ratio. The testcross population displayed a 1:1 R:S ratio, and a backcross population to NMCA10399 displayed complete susceptibility. These results demonstrate the presence of a single dominant inhibitor gene affecting P. capsici resistance in chile pepper. Moreover, when lines carrying the Ipcr gene were challenged against six Phytophthora spp., the nonhost resistance was not overcome. Therefore, the Ipcr gene is interfering with host-specific resistance but not the pathogen- or microbe-associated molecular pattern nonhost responses.

Evolution of Regions Containing Antibiotic Resistance Genes in FII-2-FIB-1 ColV-Colla Virulence Plasmids.

Science.gov (United States)

Moran, Robert A; Hall, Ruth M

2018-05-01

Three ColV virulence plasmids carrying antibiotic resistance genes were assembled from draft genome sequences of commensal ST95, ST131, and ST2705 Escherichia coli isolates from healthy Australians. Plasmids pCERC4, pCERC5, and pCERC9 include almost identical backbones containing FII-2 and FIB-1 replicons and the conserved ColV virulence region with an additional ColIa determinant. Only pCERC5 includes a complete, uninterrupted F-like transfer region and was able to conjugate. pCERC5 and pCERC9 contain Tn1721, carrying the tet(A) tetracycline resistance determinant in the same location, with Tn2 (bla TEM ; ampicillin resistance) interrupting the Tn1721 in pCERC5. pCERC4 has a Tn1721/Tn21 hybrid transposon carrying dfrA5 (trimethoprim resistance) and sul1 (sulfamethoxazole resistance) in a class 1 integron. Four FII-2:FIB-1 ColV-ColIa plasmids in the GenBank nucleotide database have a related transposon in the same position, but an IS26 has reshaped the resistance gene region, deleting 2,069 bp of the integron 3'-CS, including sul1, and serving as a target for IS26 translocatable units containing bla TEM , sul2 and strAB (streptomycin resistance), or aphA1 (kanamycin/neomycin resistance). Another ColV-ColIa plasmid containing a related resistance gene region has lost the FII replicon and acquired a unique transfer region via recombination within the resistance region and at oriT. Eighteen further complete ColV plasmid sequences in GenBank contained FIB-1, but the FII replicons were of three types, FII-24, FII-18, and a variant of FII-36.

Mapping of stripe rust resistance gene in an Aegilops caudate introgression line in wheat and its genetic association with leaf rust resistance.

Science.gov (United States)

Toor, Puneet Inder; Kaur, Satinder; Bansal, Mitaly; Yadav, Bharat; Chhuneja, Parveen

2016-12-01

A pair of stripe rust and leaf rust resistance genes was introgressed from Aegilops caudata, a nonprogenitor diploid species with the CC genome, to cultivated wheat. Inheritance and genetic mapping of stripe rust resistance gene in backcrossrecombinant inbred line (BC-RIL) population derived from the cross of a wheat-Ae. caudata introgression line (IL) T291- 2(pau16060) with wheat cv. PBW343 is reported here. Segregation of BC-RILs for stripe rust resistance depicted a single major gene conditioning adult plant resistance (APR) with stripe rust reaction varying from TR-20MS in resistant RILs signifying the presence of some minor genes as well. Genetic association with leaf rust resistance revealed that two genes are located at a recombination distance of 13%. IL T291-2 had earlier been reported to carry introgressions on wheat chromosomes 2D, 3D, 4D, 5D, 6D and 7D. Genetic mapping indicated the introgression of stripe rust resistance gene on wheat chromosome 5DS in the region carrying leaf rust resistance gene LrAc, but as an independent introgression. Simple sequence repeat (SSR) and sequence-tagged site (STS) markers designed from the survey sequence data of 5DS enriched the target region harbouring stripe and leaf rust resistance genes. Stripe rust resistance locus, temporarily designated as YrAc, mapped at the distal most end of 5DS linked with a group of four colocated SSRs and two resistance gene analogue (RGA)-STS markers at a distance of 5.3 cM. LrAc mapped at a distance of 9.0 cM from the YrAc and at 2.8 cM from RGA-STS marker Ta5DS_2737450, YrAc and LrAc appear to be the candidate genes for marker-assisted enrichment of the wheat gene pool for rust resistance.

Environmental cycle of antibiotic resistance encoded genes: A systematic review

Directory of Open Access Journals (Sweden)

R. ghanbari

2017-12-01

Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.

Natural variation of rice blast resistance gene Pi-d2

Science.gov (United States)

Studying natural variation of rice resistance (R) genes in cultivated and wild rice relatives can predict resistance stability to rice blast fungus. In the present study, the protein coding regions of rice R gene Pi-d2 in 35 rice accessions of subgroups, aus (AUS), indica (IND), temperate japonica (...

The relationship between codon usage bias and cold resistant genes

International Nuclear Information System (INIS)

Barozai, M.Y.; Din, M.

2014-01-01

This research is based on synonymous codon usage which has been well-known as a feature that affects typical expression level of protein in an organism. Different organisms prefer different codons for same amino acid and this is called Codon Usage Bias (CUB). The codon usage directly affects the level or even direction of changes in protein expression in responses to environmental stimuli. Cold stress is a major abiotic factor that limits the agricultural productivity of plants. In the recent study CUB has been studied in Arabidopsis thaliana cold resistant and housekeeping genes and their homologs in rice (Oryza sativa) to understand the cold stress and housekeeping genes relation with CUB. Six cold resistant and three housekeeping genes in Arabidopsis thaliana and their homologs in rice, were subjected to CUB analysis. The three cold resistant genes (DREB1B, RCI and MYB15) showed more than 50% (52%, 61% and 66% respectively) similar codon usage bias for Arabidopsis thaliana and rice. On the other hand three cold resistant genes (MPK3, ICE1 and ZAT12) showed less than 50% (38%, 38% and 47% respectively) similar codon usage bias for Arabidopsis thaliana and rice. The three housekeeping genes (Actin, Tubulin and Ubiquitin) showed 76% similar codon usage bias for Arabidopsis thaliana and rice. This study will help to manage the plant gene expression through codon optimization under the cold stress. (author)

Distribution of different efflux pump genes in clinical isolates of multidrug-resistant Acinetobacter baumannii and their correlation with antimicrobial resistance.

Science.gov (United States)

Lin, Ming-Feng; Lin, Yun-You; Tu, Chi-Chao; Lan, Chung-Yu

2017-04-01

Efflux pumps are one of the major mechanisms of antimicrobial resistance in Acinetobacter baumannii. This study aimed to understand the distribution of different types of pump genes in clinical isolates of multidrug-resistant A. baumannii (MDRAB) and to reveal the relationship between their presence and expression with antimicrobial resistance. MDRAB isolates were collected from five hospitals in Taiwan. Different categories of pump genes, including adeB, adeJ, macB, abeM, abeS, emrA-like, emrB-like, and craA, were chosen, and their presence in the collected isolates was determined. Three induced resistant strains of A. baumannii ATCC 17978 to tigecycline, imipenem, and amikacin were also included. The expressions of the selected pump genes were determined using quantitative reverse transcription-polymerase chain reaction. Twenty-one MDRAB clinical isolates were obtained from five hospitals. All of the studied pump genes were present in the collected MDRAB isolates except one isolate that lacked the emrA-like gene. The gene expression of these efflux pumps was variable among the strains. The upregulation of the adeB, adeJ, and macB genes was responsible for tigecycline resistance, and the increased abeS expression was strongly related to amikacin resistance. Of all the antibiotics studied, tigecycline was the strongest inducer of gene expression for many efflux pumps in A. baumannii. Efflux pump genes are universally present in the collected clinical MDRAB isolates. The upregulation of the adeB, adeJ, macB and abeS genes is more related with antibiotic resistance. Copyright © 2015. Published by Elsevier B.V.

Characterizing the pathotype structure of barley powdery mildew and effectiveness of resistance genes to this pathogen in Kazakhstan.

Science.gov (United States)

Rsaliyev, Aralbek; Pahratdinova, Zhazira; Rsaliyev, Shynbolat

2017-11-14

Powdery mildew of barley is a wind-borne and obligate biotrophic pathogen, which ranks among the most widespread barley pathogens worldwide. However, purposeful research towards studying the structure of the barley powdery mildew populations, of their virulence and of effectiveness of certain resistance genes against the infection was not conducted in Kazakhstan till present time. This paper is the first to describe characteristics of the pathotype structure of Blumeria graminis f.sp. hordei (Bgh) population and effectiveness of resistance genes in two regions of barley cultivation in the republic. One hundred and seven isolates of Bgh were obtained from seven populations occurring on cultivated barley at two geographically locations in Kazakhstan during 2015 and 2016. Their virulence frequency was determined on 17 differential lines Pallas. All isolates were virulent on the resistance gene Mla8 and avirulent for the resistance genes Mla9, Mla1 + MlaAl2, Mla6 + Mla14, Mla13 + MlRu3, Mla7 + MlNo3, Mla10 + MlDu2, Mla13 + MlRu3 and Mlo-5. The frequencies of isolates overcoming the genes Mla3, Mla22, Mlat Mlg + MlCP and Mla12 + MlEm2 were 0.0-33.33%, and frequencies of isolates overcoming the genes Mlra, Mlk, MlLa and Mlh ranged from 10.0 to 78.6%. Based on reactions of differential lines possessing the genes Mla22, Mlra, Mlk, Mlat, MlLa and Mlh, pathotypes were identified. In total, 23 pathotypes with virulence complexity ranging from 1 to 6 were identified. During both years in all populations of South Kazakhstan and Zhambyl regions pathotypes 24 and 64 mainly prevailed. Obtained data suggest that low similarity of populations Bgh in Kazakhstan to European, African, Australian and South-East Asian populations. The present study provides a foundation for future studies on the pathogenic variability within of Bgh populations in Kazakhstan and addresses the knowledge gap on the virulence structure of Bgh in Central Asia. Complete effectiveness of the

Combination therapy and evaluation of therapeutic effect in hepatocellular carcinoma cell using triple reporter genes; containing for NIS, HSV1-sr39tk and GFP

Energy Technology Data Exchange (ETDEWEB)

Lee, You La; Lee, Yong Jin; Ahn, Sohn Joo; Ahn, Byeong Cheol; Lee, Sang Woo; Yoo, Jeong Soo; Lee, Jae Tae [Kyungpook National University, Daegu (Korea, Republic of)

2007-07-01

To identify therapeutic effect after combine Sodium Iodine Symporter (NIS) and Mutant Herpes-simplex virus type 1 sr39tk (HSV1-sr39tk) expression in hepatocellular carcinoma cell, we transfected triple gene and investigated the properties of these gene ability in hepatocellular carcinoma cell line. After making vector with gene encoding a fusion protein comprised of HSV1-sr39tk and green florescence protein (GFP), to make triple reporter genes NIS gene was further fused to the vector using IRES vector. The vector expressing triple reporter gene was transfected to the Huh-7 cell line using liposome. Functions of hNIS and HSV1-sr39tk expression were confirmed by radio iodine uptake with and without perchlorate and [3H]-penciclovir (3-H PCV) uptake, respectively. To evaluate therapeutic effect in vitro, GCV and I-131 was treated in Huh-7/NTG cell and dual therapy performed. An animal imaging acquired using Optix and microPET in vivo. I-125 uptake was increased up to 100-fold compare to that of non-transfected cells. The transfected cell accumulated H-3 PCV up to 53 times higher at 2 hour than that of non-transfected cells. With fluorescence microscopy, green fluorescence was detected in the transfected cell. In cytotoxic studies, the cell viability of Huh-7/NTG cell was decreased to 41 % of control cell at 10ug/ml GCV concentrations. The survival rate of the Huh-7/NTG cell treated with I-131 decreased up to 16%. In I-131 and GCV dual therapy, Huh-7/NTG cell survival rate decreased up to 4%. In animal studies, Huh-7/NTG tumors showed higher uptake of 18F-FHBG and I-124 than Huh-7 tumors. GFP signal is also higher in Huh-7/NTG tumor than control. We successfully constructed a vector with delivery two therapeutic genes and one reporter gene and transfected the vector to a Huh-7 cell. The hepatocellular carcinoma cell transfected with the vector can be treated with GCV and I-131. The effect of dual gene therapy could be easily assessed by the optical reporter gene imaging.

Search Engine for Antimicrobial Resistance: A Cloud Compatible Pipeline and Web Interface for Rapidly Detecting Antimicrobial Resistance Genes Directly from Sequence Data.

Science.gov (United States)

Rowe, Will; Baker, Kate S; Verner-Jeffreys, David; Baker-Austin, Craig; Ryan, Jim J; Maskell, Duncan; Pearce, Gareth

2015-01-01

Antimicrobial resistance remains a growing and significant concern in human and veterinary medicine. Current laboratory methods for the detection and surveillance of antimicrobial resistant bacteria are limited in their effectiveness and scope. With the rapidly developing field of whole genome sequencing beginning to be utilised in clinical practice, the ability to interrogate sequencing data quickly and easily for the presence of antimicrobial resistance genes will become increasingly important and useful for informing clinical decisions. Additionally, use of such tools will provide insight into the dynamics of antimicrobial resistance genes in metagenomic samples such as those used in environmental monitoring. Here we present the Search Engine for Antimicrobial Resistance (SEAR), a pipeline and web interface for detection of horizontally acquired antimicrobial resistance genes in raw sequencing data. The pipeline provides gene information, abundance estimation and the reconstructed sequence of antimicrobial resistance genes; it also provides web links to additional information on each gene. The pipeline utilises clustering and read mapping to annotate full-length genes relative to a user-defined database. It also uses local alignment of annotated genes to a range of online databases to provide additional information. We demonstrate SEAR's application in the detection and abundance estimation of antimicrobial resistance genes in two novel environmental metagenomes, 32 human faecal microbiome datasets and 126 clinical isolates of Shigella sonnei. We have developed a pipeline that contributes to the improved capacity for antimicrobial resistance detection afforded by next generation sequencing technologies, allowing for rapid detection of antimicrobial resistance genes directly from sequencing data. SEAR uses raw sequencing data via an intuitive interface so can be run rapidly without requiring advanced bioinformatic skills or resources. Finally, we show that SEAR

The cfr and cfr-like multiple resistance genes

DEFF Research Database (Denmark)

Vester, Birte

2018-01-01

. The cfr gene is found in various bacteria in many geographical locations and placed on plasmids or associated with transposons. Cfr-related genes providing similar resistance have been identified in Bacillales, and now also in the pathogens Clostridium difficile and Enterococcus faecium. In addition......, the presence of the cfr gene has been detected in harbours and food markets....

Transcriptome profiling and digital gene expression analysis of genes associated with salinity resistance in peanut

Directory of Open Access Journals (Sweden)

Jiongming Sui

2018-03-01

Full Text Available Background: Soil salinity can significantly reduce crop production, but the molecular mechanism of salinity tolerance in peanut is poorly understood. A mutant (S1 with higher salinity resistance than its mutagenic parent HY22 (S3 was obtained. Transcriptome sequencing and digital gene expression (DGE analysis were performed with leaves of S1 and S3 before and after plants were irrigated with 250 mM NaCl. Results: A total of 107,725 comprehensive transcripts were assembled into 67,738 unigenes using TIGR Gene Indices clustering tools (TGICL. All unigenes were searched against the euKaryotic Ortholog Groups (KOG, gene ontology (GO and Kyoto Encyclopedia of Genes and Genomes (KEGG databases, and these unigenes were assigned to 26 functional KOG categories, 56 GO terms, 32 KEGG groups, respectively. In total 112 differentially expressed genes (DEGs between S1 and S3 after salinity stress were screened, among them, 86 were responsive to salinity stress in S1 and/or S3. These 86 DEGs included genes that encoded the following kinds of proteins that are known to be involved in resistance to salinity stress: late embryogenesis abundant proteins (LEAs, major intrinsic proteins (MIPs or aquaporins, metallothioneins (MTs, lipid transfer protein (LTP, calcineurin B-like protein-interacting protein kinases (CIPKs, 9-cis-epoxycarotenoid dioxygenase (NCED and oleosins, etc. Of these 86 DEGs, 18 could not be matched with known proteins. Conclusion: The results from this study will be useful for further research on the mechanism of salinity resistance and will provide a useful gene resource for the variety breeding of salinity resistance in peanut. Keywords: Digital gene expression, Gene, Mutant, NaCl, Peanut (Arachis hypogaea L., RNA-seq, Salinity stress, Salinity tolerance, Soil salinity, Transcripts, Unigenes

Resistance to Plum Pox Virus (PPV) in apricot (Prunus armeniaca L.) is associated with down-regulation of two MATHd genes.

Science.gov (United States)

Zuriaga, Elena; Romero, Carlos; Blanca, Jose Miguel; Badenes, Maria Luisa

2018-01-27

Plum pox virus (PPV), causing Sharka disease, is one of the main limiting factors for Prunus production worldwide. In apricot (Prunus armeniaca L.) the major PPV resistance locus (PPVres), comprising ~ 196 kb, has been mapped to the upper part of linkage group 1. Within the PPVres, 68 genomic variants linked in coupling to PPV resistance were identified within 23 predicted transcripts according to peach genome annotation. Taking into account the predicted functions inferred from sequence homology, some members of a cluster of meprin and TRAF-C homology domain (MATHd)-containing genes were pointed as PPV resistance candidate genes. Here, we have characterized the global apricot transcriptome response to PPV-D infection identifying six PPVres locus genes (ParP-1 to ParP-6) differentially expressed in resistant/susceptible cultivars. Two of them (ParP-3 and ParP-4), that encode MATHd proteins, appear clearly down-regulated in resistant cultivars, as confirmed by qRT-PCR. Concurrently, variant calling was performed using whole-genome sequencing data of 24 apricot cultivars (10 PPV-resistant and 14 PPV-susceptible) and 2 wild relatives (PPV-susceptible). ParP-3 and ParP-4, named as Prunus armeniaca PPVres MATHd-containing genes (ParPMC), are the only 2 genes having allelic variants linked in coupling to PPV resistance. ParPMC1 has 1 nsSNP, while ParPMC2 has 15 variants, including a 5-bp deletion within the second exon that produces a frameshift mutation. ParPMC1 and ParPMC2 are adjacent and highly homologous (87.5% identity) suggesting they are paralogs originated from a tandem duplication. Cultivars carrying the ParPMC2 resistant (mutated) allele show lack of expression in both ParPMC2 and especially ParPMC1. Accordingly, we hypothesize that ParPMC2 is a pseudogene that mediates down-regulation of its functional paralog ParPMC1 by silencing. As a whole, results strongly support ParPMC1 and/or ParPMC2 as host susceptibility genes required for PPV infection which

Spin-on Bi4Sr3Ca3Cu4O16μ/sub x/ superconducting thin films from citrate precursors

International Nuclear Information System (INIS)

Furcone, S.L.; Chiang, Y.

1988-01-01

Thin films in the Bi-Sr-Ca-Cu-O system have been synthesized from homogeneous liquid citrate precursors by a spin-coating and pyrolysis method. Films prepared on SrTiO 3 substrates of [100] orientation show strongly textured orientations with the c axis of the predominant Bi 4 Sr 3 Ca 3 Cu 4 O 16 μ/sub x/ phase normal to the film plane. In a single coating and firing, crack-free films of 0.2--0.5 μm thickness are obtained. For films fired to peak temperatures of 850--875 0 C, linearly decreasing resistance with temperature is observed, with rho (300 K)∼460 μΩ cm and rho (300 K)rho (100 K)∼2.4. Clear onsets of superconductivity are observed at 90--100 K, with occasional films showing smaller resistant drops at 110--120 K. For all films, T/sub c/ (R = 0) occurs in the range 70--75 K. High critical current densities at 4.2 K of 5--8 x 10 5 Acm 2 are measured by direct transport

Antibiotic resistance and resistance genes in Escherichia coli from poultry farms, southwest Nigeria

OpenAIRE

Adelowo, Olawale O.; Fagade, Obasola E.; Agersø, Yvonne

2014-01-01

Introduction: This study investigated the mechanisms of resistance in 36 E. coli isolated from waste, litter, soil and water samples collected from poultry farms in Southwestern Nigeria. Methodology: Minimum inhibitory concentration (MIC) distributions of the isolates were determined using the methods of the Clinical and Laboratory Standard Institute and resistance genes detected by PCR. Results: A total of 30 isolates (94%) showed resistance to more than one antimicrobial. Percentage resista...

TaEDS1 genes positively regulate resistance to powdery mildew in wheat.

Science.gov (United States)

Chen, Guiping; Wei, Bo; Li, Guoliang; Gong, Caiyan; Fan, Renchun; Zhang, Xiangqi

2018-04-01

Three EDS1 genes were cloned from common wheat and were demonstrated to positively regulate resistance to powdery mildew in wheat. The EDS1 proteins play important roles in plant basal resistance and TIR-NB-LRR protein-triggered resistance in dicots. Until now, there have been very few studies on EDS1 in monocots, and none in wheat. Here, we report on three common wheat orthologous genes of EDS1 family (TaEDS1-5A, 5B and 5D) and their function in powdery mildew resistance. Comparisons of these genes with their orthologs in diploid ancestors revealed that EDS1 is a conserved gene family in Triticeae. The cDNA sequence similarity among the three TaEDS1 genes was greater than 96.5%, and they shared sequence similarities of more than 99.6% with the respective orthologs from diploid ancestors. The phylogenetic analysis revealed that the EDS1 family originated prior to the differentiation of monocots and dicots, and EDS1 members have since undergone clear structural differentiation. The transcriptional levels of TaEDS1 genes in the leaves were obviously higher than those of the other organs, and they were induced by Blumeria graminis f. sp. tritici (Bgt) infection and salicylic acid (SA) treatment. The BSMV-VIGS experiments indicated that knock-down the transcriptional levels of the TaEDS1 genes in a powdery mildew-resistant variety of common wheat compromised resistance. Contrarily, transient overexpression of TaEDS1 genes in a susceptible common wheat variety significantly reduced the haustorium index and attenuated the growth of Bgt. Furthermore, the expression of TaEDS1 genes in the Arabidopsis mutant eds1-1 complemented its susceptible phenotype to powdery mildew. The above evidences strongly suggest that TaEDS1 acts as a positive regulator and confers resistance against powdery mildew in common wheat.

Class 1 and 2 integrons, sul resistance genes and antibiotic resistance in Escherichia coli isolated from Dongjiang River, South China

International Nuclear Information System (INIS)

Su Haochang; Ying Guangguo; Tao Ran; Zhang Ruiquan; Zhao Jianliang; Liu Yousheng

2012-01-01

Antibiotic susceptibility, detection of sul gene types and presence of class 1, 2 and 3 integrons and gene cassettes using PCR assays were investigated in 3456 Escherichia coli isolates obtained from 38 sampling sites of the Dongjiang River catchment in the dry and wet seasons. 89.1% of the isolates were resistant and 87.5% showed resistance to at least three antibiotics. sul2 was detected most frequently in 89.2% of 1403 SXT-resistant isolates. The presence of integrons (class 1 and 2) was frequently observed (82.3%) while no class 3 integron was found. In these integrons, 21 resistance genes of 14 gene cassette arrays and 10 different families of resistance genes were identified. Three gene cassette arrays, aac(6')-Ib-cr-aar-3-dfrA27-aadA16, aacA4-catB3-dfrA1 and aadA2-lnuF, were detected for the first time in surface water. The results showed that bacterial resistance in the catchment was seriously influenced by human activities, especially discharge of wastewater. Highlights: ► Antibiotic resistance was investigated for a river catchment of southern China. ► 87.5% of E coli isolates showed resistance to at least three antibiotics. ► The presence of integrons (class 1 and 2) was frequently observed (82.3%). ► Bacterial resistance in the catchment was seriously influenced by human activities. - Bacterial resistance to antibiotics in a catchment is related to the discharge of wastewater into the aquatic environment.

A novel gene of Kalanchoe daigremontiana confers plant drought resistance.

Science.gov (United States)

Wang, Li; Zhu, Chen; Jin, Lin; Xiao, Aihua; Duan, Jie; Ma, Luyi

2018-02-07

Kalanchoe (K.) daigremontiana is important for studying asexual reproduction under different environmental conditions. Here, we describe a novel KdNOVEL41 (KdN41) gene that may confer drought resistance and could thereby affect K. daigremontiana development. The detected subcellular localization of a KdN41/Yellow Fluorescent Protein (YFP) fusion protein was in the nucleus and cell membrane. Drought, salt, and heat stress treatment in tobacco plants containing the KdN41 gene promoter driving β-glucuronidase (GUS) gene transcription revealed that only drought stress triggered strong GUS staining in the vascular tissues. Overexpression (OE) of the KdN41 gene conferred improved drought resistance in tobacco plants compared to wild-type and transformed with empty vector plants by inducing higher antioxidant enzyme activities, decreasing cell membrane damage, increasing abscisic acid (ABA) content, causing reinforced drought resistance related gene expression profiles. The 3,3'-diaminobenzidine (DAB) and nitroblue tetrazolium (NBT) staining results also showed less relative oxygen species (ROS) content in KdN41-overexpressing tobacco leaf during drought stress. Surprisingly, by re-watering after drought stress, KdN41-overexpressing tobacco showed earlier flowering. Overall, the KdN41 gene plays roles in ROS scavenging and osmotic damage reduction to improve tobacco drought resistance, which may increase our understanding of the molecular network involved in developmental manipulation under drought stress in K. daigremontiana.

Long time relaxation of resistance in La0.8Sr0.2MnO3 ceramics and La0.65Ca0.35 MnO3 films on ferroelectric substrates

International Nuclear Information System (INIS)

Medvedev, Yu.V.; Mezin, N.I.; Nikolaenko, Yu.M.; Pigur, A.E.; Shishkova, N.V.; Ishchuk, V.M.; Chukanova, I.N.

2004-01-01

Galvanomagnetic properties of La 0.65 Ca 0.35 MnO 3 films with a thickness of 0.2 μm on Pb 2.9 Ba 0.05 Sr 0.05 (Zr 0.4 Ti 0.6 )O 3 ferroelectric ceramics substrates have been investigated. We have discovered the monotonic irreversible increase of the film resistance by 3-5 time of value during several hours after multiple inversion of substrate polarization. The long-time relaxation (LTR) of film resistance is explained by dielecrtrization of film intercrystallite boundaries as a result of oxygen redistribution under action of inhomogeneous mechanical stress. In addition, the LTR of resistance of La 0.8 Sr 0.2 MnO 3 and La 0.6 Sr 0.2 Mn 1.2 O 3 ceramic samples has been investigated under action of different kind of mechanical stress: stretch, compression and hydrostatic press. Time dependence of resistance is described by R 0 +ΔRexp(-t/τ). The magnitude of LTR is 5-10 time greater then fast variation of resistance under action of stress. The sign of ΔR is dependent on the kind of stress. The time constant (τ) has the value of 3-9 hours. (copyright 2004 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

Analysis of differentially expressed genes related to resistance in spinosad- and neonicotinoid-resistant Musca domestica L. (Diptera: Muscidae) strains

DEFF Research Database (Denmark)

Castberg, Dorte Heidi Højland; Kristensen, Michael

2017-01-01

strains differing significantly in their response to insecticides. High differential expression of P450s and genes coding for cuticle protein indicates a combination of factors involved in metabolic neonicotinoid and spinosad resistance. Conclusion Resistance in these strains is apparently not linked...... interesting in terms of neonicotinoid resistance, while cyp4d9 was overexpressed in 791spin compared to spinosad-susceptible strains. GSTs, ESTs and UGTs were mostly overexpressed, but not to the same degree as P450s. We present a comprehensive and comparative picture of gene expression in three housefly......Background The housefly is a global pest that has developed resistance to most insecticides applied against it. Resistance of the spinosad-resistant strain 791spin and the neonicotinoid-resistant 766b strain is believed to be due to metabolism. We investigate differentially expressed genes...

8q24 allelic imbalance and MYC gene copy number in primary prostate cancer.

Science.gov (United States)

Chen, H; Liu, W; Roberts, W; Hooker, S; Fedor, H; DeMarzo, A; Isaacs, W; Kittles, R A

2010-09-01

Four independent regions within 8q24 near the MYC gene are associated with risk for prostate cancer (Pca). Here, we investigated allelic imbalance (AI) at 8q24 risk variants and MYC gene DNA copy number (CN) in 27 primary Pcas. Heterozygotes were observed in 24 of 27 patients at one or more 8q24 markers and 27% of the loci exhibited AI in tumor DNA. The 8q24 risk alleles were preferentially favored in the tumors. Increased MYC gene CN was observed in 33% of tumors, and the co-existence of increased MYC gene CN with AI at risk loci was observed in 86% (P<0.004 exact binomial test) of the informative tumors. No AI was observed in tumors, which did not reveal increased MYC gene CN. Higher Gleason score was associated with tumors exhibiting AI (P=0.04) and also with increased MYC gene CN (P=0.02). Our results suggest that AI at 8q24 and increased MYC gene CN may both be related to high Gleason score in Pca. Our findings also suggest that these two somatic alterations may be due to the same preferential chromosomal duplication event during prostate tumorigenesis.

RNA-Seq analysis reveals candidate genes for ontogenic resistance in Malus-Venturia pathosystem.

Directory of Open Access Journals (Sweden)

Michele Gusberti

Full Text Available Ontogenic scab resistance in apple leaves and fruits is a horizontal resistance against the plant pathogen Venturia inaequalis and is expressed as a decrease in disease symptoms and incidence with the ageing of the leaves. Several studies at the biochemical level tried to unveil the nature of this resistance; however, no conclusive results were reported. We decided therefore to investigate the genetic origin of this phenomenon by performing a full quantitative transcriptome sequencing and comparison of young (susceptible and old (ontogenic resistant leaves, infected or not with the pathogen. Two time points at 72 and 96 hours post-inoculation were chosen for RNA sampling and sequencing. Comparison between the different conditions (young and old leaves, inoculated or not should allow the identification of differentially expressed genes which may represent different induced plant defence reactions leading to ontogenic resistance or may be the cause of a constitutive (uninoculated with the pathogen shift toward resistance in old leaves. Differentially expressed genes were then characterised for their function by homology to A. thaliana and other plant genes, particularly looking for genes involved in pathways already suspected of appertaining to ontogenic resistance in apple or other hosts, or to plant defence mechanisms in general. IN THIS WORK, FIVE CANDIDATE GENES PUTATIVELY INVOLVED IN THE ONTOGENIC RESISTANCE OF APPLE WERE IDENTIFIED: a gene encoding an "enhanced disease susceptibility 1 protein" was found to be down-regulated in both uninoculated and inoculated old leaves at 96 hpi, while the other four genes encoding proteins (metallothionein3-like protein, lipoxygenase, lipid transfer protein, and a peroxidase 3 were found to be constitutively up-regulated in inoculated and uninoculated old leaves. The modulation of the five candidate genes has been validated using the real-time quantitative PCR. Thus, ontogenic resistance may be the result

Genetic mapping of the rice resistance-breaking gene of the brown planthopper Nilaparvata lugens.

Science.gov (United States)

Kobayashi, Tetsuya; Yamamoto, Kimiko; Suetsugu, Yoshitaka; Kuwazaki, Seigo; Hattori, Makoto; Jairin, Jirapong; Sanada-Morimura, Sachiyo; Matsumura, Masaya

2014-07-22

Host plant resistance has been widely used for controlling the major rice pest brown planthopper (BPH, Nilaparvata lugens). However, adaptation of the wild BPH population to resistance limits the effective use of resistant rice varieties. Quantitative trait locus (QTL) analysis was conducted to identify resistance-breaking genes against the anti-feeding mechanism mediated by the rice resistance gene Bph1. QTL analysis in iso-female BPH lines with single-nucleotide polymorphism (SNP) markers detected a single region on the 10th linkage group responsible for the virulence. The QTL explained from 57 to 84% of the total phenotypic variation. Bulked segregant analysis with next-generation sequencing in F2 progenies identified five SNPs genetically linked to the virulence. These analyses showed that virulence to Bph1 was controlled by a single recessive gene. In contrast to previous studies, the gene-for-gene relationship between the major resistance gene Bph1 and virulence gene of BPH was confirmed. Identified markers are available for map-based cloning of the major gene controlling BPH virulence to rice resistance. © 2014 The Author(s) Published by the Royal Society. All rights reserved.

Using SNP genetic markers to elucidate the linkage of the Co-34/Phg-3 anthracnose and angular leaf spot resistance gene cluster with the Ur-14 resistance gene

Science.gov (United States)

The Ouro Negro common bean cultivar contains the Co-34/Phg-3 gene cluster that confers resistance to the anthracnose (ANT) and angular leaf spot (ALS) pathogens. These genes are tightly linked on chromosome 4. Ouro Negro also has the Ur-14 rust resistance gene, reportedly in the vicinity of Co- 34; ...

Prevalence of enterotoxin-encoding genes and antimicrobial resistance in coagulase-negative and coagulase-positive Staphylococcus isolates from black pudding

Directory of Open Access Journals (Sweden)

Tiane Martin de Moura

2012-10-01

Full Text Available INTRODUCTION: Staphylococcal species are pathogens that are responsible for outbreaks of foodborne diseases. The aim of this study was to investigate the prevalence of enterotoxin-genes and the antimicrobial resistance profile in staphylococcus coagulase-negative (CoNS and coagulasepositive (CoPS isolates from black pudding in southern Brazil. METHODS: Two hundred typical and atypical colonies from Baird-Parker agar were inoculated on mannitol salt agar. Eighty-two mannitol-positive staphylococci were submitted to conventional biochemical tests and antimicrobial susceptibility profiling. The presence of coagulase (coa and enterotoxin (se genes was investigated by polymerase chain reaction. RESULTS: The isolates were divided into 2 groups: 75.6% (62/82 were CoNS and 24.4% (20/82 were CoPS. The biochemical tests identified 9 species, of which Staphylococcus saprophyticus (37.8% and Staphylococcus carnosus (15.9% were the most prevalent. Antimicrobial susceptibility tests showed resistance phenotypes to antibiotics widely administered in humans, such as gentamicin, tetracycline, chloramphenicol, and erythromycin. The coa gene was detected in 19.5% (16/82 of the strains and 4 polymorphic DNA fragments were observed. Five CoNS isolates carrying the coa gene were submitted for 16S rRNA sequencing and 3 showed similarity with CoNS. Forty strains were positive for at least 1 enterotoxin-encoding gene, the genes most frequently detected were sea (28.6% and seb (27.5%. CONCLUSIONS: The presence of antimicrobial resistant and enterotoxin-encoding genes in staphylococci isolates from black pudding indicated that this fermented food may represent a potential health risk, since staphylococci present in food could cause foodborne diseases or be a possible route for the transfer of antimicrobial resistance to humans.

Cloning and occurrence of czrC, a gene conferring cadmium and zinc resistance in MRSA CC398 Isolates

DEFF Research Database (Denmark)

Cavaco, Lina; Hasman, Henrik; Stegger, Marc

2010-01-01

the genetic determinant causing zinc resistance in CC398 and examine its prevalence in isolates of animal and human origin. Based on the sequence of the staphylococcal cassette chromosome mec (SCCmec) element from methicillin-resistant S. aureus (MRSA) CC398 strain SO385, a putative metal resistance gene......-four percent (n = 23) of the animal isolates and 48% (n = 24) of the human MRSA isolates of CC398 were resistant to zinc chloride and positive for czrC. All 48 MSSA strains from both human and pig origins were found to be susceptible to zinc chloride and negative for czrC. Our findings showed that czr......C is encoding zinc and cadmium resistance in CC398 MRSA isolates, and that it is widespread both in humans and animals. Thus, resistance to heavy metals such as zinc and cadmium may play a role in the coselection of methicillin resistance in S. aureus....

Genetic Regulation of Virulence and Antibiotic Resistance in Acinetobacter baumannii

Science.gov (United States)

Kröger, Carsten; Kary, Stefani C.; Schauer, Kristina; Cameron, Andrew D. S.

2016-01-01

Multidrug resistant microorganisms are forecast to become the single biggest challenge to medical care in the 21st century. Over the last decades, members of the genus Acinetobacter have emerged as bacterial opportunistic pathogens, in particular as challenging nosocomial pathogens because of the rapid evolution of antimicrobial resistances. Although we lack fundamental biological insight into virulence mechanisms, an increasing number of researchers are working to identify virulence factors and to study antibiotic resistance. Here, we review current knowledge regarding the regulation of virulence genes and antibiotic resistance in Acinetobacter baumannii. A survey of the two-component systems AdeRS, BaeSR, GacSA and PmrAB explains how each contributes to antibiotic resistance and virulence gene expression, while BfmRS regulates cell envelope structures important for pathogen persistence. A. baumannii uses the transcription factors Fur and Zur to sense iron or zinc depletion and upregulate genes for metal scavenging as a critical survival tool in an animal host. Quorum sensing, nucleoid-associated proteins, and non-classical transcription factors such as AtfA and small regulatory RNAs are discussed in the context of virulence and antibiotic resistance. PMID:28036056

Diversity of interferon inducible Mx gene in horses and association of variations with susceptibility vis-à-vis resistance against equine influenza infection.

Science.gov (United States)

Manuja, Balvinder K; Manuja, Anju; Dahiya, Rajni; Singh, Sandeep; Sharma, R C; Gahlot, S K

2014-10-01

Equine influenza (EI) is primarily an infection of the upper respiratory tract and is one of the major infectious respiratory diseases of economic importance in equines. Re-emergence of the disease, species jumping by H3N8 virus in canines and possible threat of human pandemic due to the unpredictable nature of the virus have necessitated research on devising strategies for preventing the disease. The myxovirus resistance protein (Mx) has been reported to confer resistance to Orthomyxo virus infection by modifying cellular functions needed along the viral replication pathway. Polymorphisms and differential antiviral activities of Mx gene have been reported in pigs and chicken. Here we report the diversity of Mx gene, its expression in response to stimulation with interferon (IFN) α/β and their association with EI resistance and susceptibility in Marwari horses. Blood samples were collected from horses declared positive for equine influenza and in contact animals with a history of no clinical signs. Mx gene was amplified by reverse transcription from total RNA isolated from peripheral blood mononuclear cells (PBMCs) stimulated with IFN α/β using gene specific primers. The amplified gene products from representative samples were cloned and sequenced. Nucleotide sequences and deduced amino acid sequences were analyzed. Out of a total 24 amino acids substitutions sorting intolerant from tolerant (SIFT) analysis predicted 13 substitutions with functional consequences. Five substitutions (V67A, W123L, E346Y, N347Y, S689N) were observed only in resistant animals. Evolutionary distances based on nucleotide sequences with in equines ranged between 0.3-2.0% and 20-24% with other species. On phylogenetic analysis all equine sequences clustered together while other species formed separate clades. Copyright © 2014 Elsevier B.V. All rights reserved.

Fine mapping and identification of a candidate gene for the barley Un8 true loose smut resistance gene.

Science.gov (United States)

Zang, Wen; Eckstein, Peter E; Colin, Mark; Voth, Doug; Himmelbach, Axel; Beier, Sebastian; Stein, Nils; Scoles, Graham J; Beattie, Aaron D

2015-07-01

The candidate gene for the barley Un8 true loose smut resistance gene encodes a deduced protein containing two tandem protein kinase domains. In North America, durable resistance against all known isolates of barley true loose smut, caused by the basidiomycete pathogen Ustilago nuda (Jens.) Rostr. (U. nuda), is under the control of the Un8 resistance gene. Previous genetic studies mapped Un8 to the long arm of chromosome 5 (1HL). Here, a population of 4625 lines segregating for Un8 was used to delimit the Un8 gene to a 0.108 cM interval on chromosome arm 1HL, and assign it to fingerprinted contig 546 of the barley physical map. The minimal tilling path was identified for the Un8 locus using two flanking markers and consisted of two overlapping bacterial artificial chromosomes. One gene located close to a marker co-segregating with Un8 showed high sequence identity to a disease resistance gene containing two kinase domains. Sequence of the candidate gene from the parents of the segregating population, and in an additional 19 barley lines representing a broader spectrum of diversity, showed there was no intron in alleles present in either resistant or susceptible lines, and fifteen amino acid variations unique to the deduced protein sequence in resistant lines differentiated it from the deduced protein sequences in susceptible lines. Some of these variations were present within putative functional domains which may cause a loss of function in the deduced protein sequences within susceptible lines.

Candidate genes revealed by a genome scan for mosquito resistance to a bacterial insecticide: sequence and gene expression variations

Directory of Open Access Journals (Sweden)

David Jean-Philippe

2009-11-01

Full Text Available Abstract Background Genome scans are becoming an increasingly popular approach to study the genetic basis of adaptation and speciation, but on their own, they are often helpless at identifying the specific gene(s or mutation(s targeted by selection. This shortcoming is hopefully bound to disappear in the near future, thanks to the wealth of new genomic resources that are currently being developed for many species. In this article, we provide a foretaste of this exciting new era by conducting a genome scan in the mosquito Aedes aegypti with the aim to look for candidate genes involved in resistance to Bacillus thuringiensis subsp. israelensis (Bti insecticidal toxins. Results The genome of a Bti-resistant and a Bti-susceptible strains was surveyed using about 500 MITE-based molecular markers, and the loci showing the highest inter-strain genetic differentiation were sequenced and mapped on the Aedes aegypti genome sequence. Several good candidate genes for Bti-resistance were identified in the vicinity of these highly differentiated markers. Two of them, coding for a cadherin and a leucine aminopeptidase, were further examined at the sequence and gene expression levels. In the resistant strain, the cadherin gene displayed patterns of nucleotide polymorphisms consistent with the action of positive selection (e.g. an excess of high compared to intermediate frequency mutations, as well as a significant under-expression compared to the susceptible strain. Conclusion Both sequence and gene expression analyses agree to suggest a role for positive selection in the evolution of this cadherin gene in the resistant strain. However, it is unlikely that resistance to Bti is conferred by this gene alone, and further investigation will be needed to characterize other genes significantly associated with Bti resistance in Ae. aegypti. Beyond these results, this article illustrates how genome scans can build on the body of new genomic information (here, full

Characterization of resistance to tetracyclines and aminoglycosides of sheep mastitis pathogens: study of the effect of gene content on resistance.

Science.gov (United States)

Lollai, S A; Ziccheddu, M; Duprè, I; Piras, D

2016-10-01

Mastitis causes economic losses and antimicrobials are frequently used for mastitis treatment. Antimicrobial resistance surveys are still rare in the ovine field and characterization of strains is important in order to acquire information about resistance and for optimization of therapy. Bacterial pathogens recovered in milk samples from mastitis-affected ewes were characterized for resistance to tetracyclines and aminoglycosides, members of which are frequently used antimicrobials in small ruminants. A total of 185 strains of staphylococci, streptococci, and enterococci, common mastitis pathogens, were tested for minimal inhibitory concentration (MIC) to tetracycline, doxycycline, minocycline, gentamicin, kanamycin, streptomycin, and for resistance genes by PCR. Effects of different tet genes arrangements on MICs were also investigated. Staphylococci expressed the lowest MIC for tetracycline and tet(K) was the most common gene recovered; tet(M) and tet(O) were also found. Gene content was shown to influence the tetracycline MIC values. Enterococci and streptococci showed higher MICs to tetracyclines and nonsusceptible strains always harboured at least one ribosomal protection gene (MIC above 8 μg ml(-1) ). Streptococci often harboured two or more tet determinants. As regards the resistance to aminoglycosides, staphylococci showed the lowest gentamicin and kanamycin median MIC along with streptomycin high level resistant (HLR) strains (MIC >1024 μg ml(-1) ) all harbouring str gene. The resistance determinant aac(6')-Ie-aph(2″)-Ia was present in few strains. Streptococci were basically nonsusceptible to aminoglycosides but neither HLR isolates nor resistance genes were detected. Enterococci revealed the highest MICs for gentamicin; two str harbouring isolates were shown to be HLR to streptomycin. Evidence was obtained for the circulation of antimicrobial-resistant strains and genes in sheep dairy farming. Tetracycline MIC of 64 μg ml(-1) and high

The role of Cercospora zeae-maydis homologs of Rhodobacter sphaeroides 1O2-resistance genes in resistance to the photoactivated toxin cercosporin.

Science.gov (United States)

Beseli, Aydin; Goulart da Silva, Marilia; Daub, Margaret E

2015-01-01

The photosynthetic bacterium Rhodobacter sphaeroides and plant pathogenic fungus Cercospora nicotianae have been used as models for understanding resistance to singlet oxygen ((1)O(2)), a highly toxic reactive oxygen species. In Rhodobacter and Cercospora, (1)O(2) is derived, respectively, from photosynthesis and from the (1)O(2)-generating toxin cercosporin which the fungus produces to parasitize plants. We identified common genes recovered in transcriptome studies of putative (1)O(2)-resistance genes in these two systems, suggesting common (1)O(2)-resistance mechanisms. To determine if the Cercospora homologs of R. sphaeroides (1)O(2)-resistance genes are involved in resistance to cercosporin, we expressed the genes in the cercosporin-sensitive fungus Neurospora crassa and assayed for increases in cercosporin resistance. Neurospora crassa transformants expressing genes encoding aldo/keto reductase, succinyl-CoA ligase, O-acetylhomoserine (thiol) lyase, peptide methionine sulphoxide reductase and glutathione S-transferase did not have elevated levels of cercosporin resistance. Several transformants expressing aldehyde dehydrogenase were significantly more resistant to cercosporin. Expression of the transgene and enzyme activity did not correlate with resistance, however. We conclude that although the genes tested in this study are important in (1)O(2) resistance in R. sphaeroides, their Cercospora homologs are not involved in resistance to (1)O(2) generated from cercosporin. © FEMS 2014. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Structural and thermal characterization of La5Ca9Cu24O41 thin films grown by pulsed laser deposition on (1 1 0) SrTiO3 substrates

International Nuclear Information System (INIS)

Svoukis, E.; Athanasopoulos, G.I.; Altantzis, Th.; Lioutas, Ch.; Martin, R.S.; Revcolevschi, A.; Giapintzakis, J.

2012-01-01

In the present study stoichiometric, b-axis oriented La 5 Ca 9 Cu 24 O 41 thin films were grown by pulsed laser deposition on (1 1 0) SrTiO 3 substrates in the temperature range 600–750 °C. High resolution transmission electron microscopy was employed to investigate the growth mechanism and the epitaxial relationship between the SrTiO 3 substrates and the La 5 Ca 9 Cu 24 O 41 films grown at 700 °C. The 3-ω method was used to measure the cross-plane thermal conductivity of La 5 Ca 9 Cu 24 O 41 films in the temperature range 50–350 K. The observed glass-like behavior is attributed to atomic-scale defects, grain boundaries and an interfacial layer formed between film and substrate.

Porcine E. coli: virulence-associated genes, resistance genes and adhesion and probiotic activity tested by a new screening method.

Science.gov (United States)

Schierack, Peter; Rödiger, Stefan; Kuhl, Christoph; Hiemann, Rico; Roggenbuck, Dirk; Li, Ganwu; Weinreich, Jörg; Berger, Enrico; Nolan, Lisa K; Nicholson, Bryon; Römer, Antje; Frömmel, Ulrike; Wieler, Lothar H; Schröder, Christian

2013-01-01

We established an automated screening method to characterize adhesion of Escherichia coli to intestinal porcine epithelial cells (IPEC-J2) and their probiotic activity against infection by enteropathogenic E. coli (EPEC). 104 intestinal E. coli isolates from domestic pigs were tested by PCR for the occurrence of virulence-associated genes, genes coding for resistances to antimicrobial agents and metals, and for phylogenetic origin by PCR. Adhesion rates and probiotic activity were examined for correlation with the presence of these genes. Finally, data were compared with those from 93 E. coli isolates from wild boars. Isolates from domestic pigs carried a broad variety of all tested genes and showed great diversity in gene patterns. Adhesions varied with a maximum of 18.3 or 24.2 mean bacteria adherence per epithelial cell after 2 or 6 hours respectively. Most isolates from domestic pigs and wild boars showed low adherence, with no correlation between adhesion/probiotic activity and E. coli genes or gene clusters. The gene sfa/foc, encoding for a subunit of F1C fimbriae did show a positive correlative association with adherence and probiotic activity; however E. coli isolates from wild boars with the sfa/foc gene showed less adhesion and probiotic activity than E. coli with the sfa/foc gene isolated from domestic pigs after 6 hour incubation. In conclusion, screening porcine E. coli for virulence associated genes genes, adhesion to intestinal epithelial cells, and probiotic activity revealed a single important adhesion factor, several probiotic candidates, and showed important differences between E. coli of domestic pigs and wild boars.

Porcine E. coli: virulence-associated genes, resistance genes and adhesion and probiotic activity tested by a new screening method.

Directory of Open Access Journals (Sweden)

Peter Schierack

Full Text Available We established an automated screening method to characterize adhesion of Escherichia coli to intestinal porcine epithelial cells (IPEC-J2 and their probiotic activity against infection by enteropathogenic E. coli (EPEC. 104 intestinal E. coli isolates from domestic pigs were tested by PCR for the occurrence of virulence-associated genes, genes coding for resistances to antimicrobial agents and metals, and for phylogenetic origin by PCR. Adhesion rates and probiotic activity were examined for correlation with the presence of these genes. Finally, data were compared with those from 93 E. coli isolates from wild boars. Isolates from domestic pigs carried a broad variety of all tested genes and showed great diversity in gene patterns. Adhesions varied with a maximum of 18.3 or 24.2 mean bacteria adherence per epithelial cell after 2 or 6 hours respectively. Most isolates from domestic pigs and wild boars showed low adherence, with no correlation between adhesion/probiotic activity and E. coli genes or gene clusters. The gene sfa/foc, encoding for a subunit of F1C fimbriae did show a positive correlative association with adherence and probiotic activity; however E. coli isolates from wild boars with the sfa/foc gene showed less adhesion and probiotic activity than E. coli with the sfa/foc gene isolated from domestic pigs after 6 hour incubation. In conclusion, screening porcine E. coli for virulence associated genes genes, adhesion to intestinal epithelial cells, and probiotic activity revealed a single important adhesion factor, several probiotic candidates, and showed important differences between E. coli of domestic pigs and wild boars.

Mapping fusiform rust resistance genes within a complex mating design of loblolly pine

Science.gov (United States)

Tania Quesada; Marcio F.R. Resende Jr.; Patricio Munoz; Jill L. Wegrzyn; David B. Neale; Matias Kirst; Gary F. Peter; Salvador A. Gezan; C.Dana Nelson; John M. Davis

2014-01-01

Fusiform rust resistance can involve gene-for-gene interactions where resistance (Fr) genes in the host interact with corresponding avirulence genes in the pathogen, Cronartium quercuum f.sp. fusiforme (Cqf). Here, we identify trees with Fr genes in a loblolly pine population derived from a complex mating design challenged with two Cqf inocula (one gall and 10 gall...

Characterization of Soybean WRKY Gene Family and Identification of Soybean WRKY Genes that Promote Resistance to Soybean Cyst Nematode.

Science.gov (United States)

Yang, Yan; Zhou, Yuan; Chi, Yingjun; Fan, Baofang; Chen, Zhixiang

2017-12-19

WRKY proteins are a superfamily of plant transcription factors with important roles in plants. WRKY proteins have been extensively analyzed in plant species including Arabidopsis and rice. Here we report characterization of soybean WRKY gene family and their functional analysis in resistance to soybean cyst nematode (SCN), the most important soybean pathogen. Through search of the soybean genome, we identified 174 genes encoding WRKY proteins that can be classified into seven groups as established in other plants. WRKY variants including a WRKY-related protein unique to legumes have also been identified. Expression analysis reveals both diverse expression patterns in different soybean tissues and preferential expression of specific WRKY groups in certain tissues. Furthermore, a large number of soybean WRKY genes were responsive to salicylic acid. To identify soybean WRKY genes that promote soybean resistance to SCN, we first screened soybean WRKY genes for enhancing SCN resistance when over-expressed in transgenic soybean hairy roots. To confirm the results, we transformed five WRKY genes into a SCN-susceptible soybean cultivar and generated transgenic soybean lines. Transgenic soybean lines overexpressing three WRKY transgenes displayed increased resistance to SCN. Thus, WRKY genes could be explored to develop new soybean cultivars with enhanced resistance to SCN.

Antibiotic-resistant genes and antibiotic-resistant bacteria in the effluent of urban residential areas, hospitals, and a municipal wastewater treatment plant system.

Science.gov (United States)

Li, Jianan; Cheng, Weixiao; Xu, Like; Strong, P J; Chen, Hong

2015-03-01

In this study, we determined the abundance of 8 antibiotics (3 tetracyclines, 4 sulfonamides, and 1 trimethoprim), 12 antibiotic-resistant genes (10 tet, 2 sul), 4 antibiotic-resistant bacteria (tetracycline, sulfamethoxazole, and combined resistance), and class 1 integron integrase gene (intI1) in the effluent of residential areas, hospitals, and municipal wastewater treatment plant (WWTP) systems. The concentrations of total/individual targets (antibiotics, genes, and bacteria) varied remarkably among different samples, but the hospital samples generally had a lower abundance than the residential area samples. The WWTP demonstrated removal efficiencies of 50.8% tetracyclines, 66.8% sulfonamides, 0.5 logs to 2.5 logs tet genes, and less than 1 log of sul and intI1 genes, as well as 0.5 log to 1 log removal for target bacteria. Except for the total tetracycline concentration and the proportion of tetracycline-resistant bacteria (R (2) = 0.330, P antibiotics and the corresponding resistant bacteria (P > 0.05). In contrast, various relationships were identified between antibiotics and antibiotic resistance genes (P antibiotic-resistant bacteria (P < 0.01).

The NB-LRR gene Pm60 confers powdery mildew resistance in wheat.

Science.gov (United States)

Zou, Shenghao; Wang, Huan; Li, Yiwen; Kong, Zhaosheng; Tang, Dingzhong

2018-04-01

Powdery mildew is one of the most devastating diseases of wheat. To date, few powdery mildew resistance genes have been cloned from wheat due to the size and complexity of the wheat genome. Triticum urartu is the progenitor of the A genome of wheat and is an important source for powdery mildew resistance genes. Using molecular markers designed from scaffolds of the sequenced T. urartu accession and standard map-based cloning, a powdery mildew resistance locus was mapped to a 356-kb region, which contains two nucleotide-binding and leucine-rich repeat domain (NB-LRR) protein-encoding genes. Virus-induced gene silencing, single-cell transient expression, and stable transformation assays demonstrated that one of these two genes, designated Pm60, confers resistance to powdery mildew. Overexpression of full-length Pm60 and two allelic variants in Nicotiana benthamiana leaves induced hypersensitive cell death response, but expression of the coiled-coil domain alone was insufficient to induce hypersensitive response. Yeast two-hybrid, bimolecular fluorescence complementation and luciferase complementation imaging assays showed that Pm60 protein interacts with its neighboring NB-containing protein, suggesting that they might be functionally related. The identification and cloning of this novel wheat powdery mildew resistance gene will facilitate breeding for disease resistance in wheat. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

Expression Analysis of Genes Related to Rice Resistance Against Brown Planthopper, Nilaparvata lugens

Directory of Open Access Journals (Sweden)

Panatda Jannoey

2017-05-01

Full Text Available Brown planthopper (BPH is an insect species that feeds on the vascular system of rice plants. To examine the defence mechanism of rice plants against BPH, the pathogenesis-related genes (PR1a, PR2, PR3, PR4, PR6, PR9, PR10a, PR13, PR15 and PRpha, signaling molecule synthesis genes (AOS, AXR, ACO and LOX, antioxidant-related genes (CAT, TRX, GST and SOD and lignin biosynthesis-related genes (CHS, CHI and C4H were investigated in a resistant rice variety. AOS, PR6, PR9 and PR15 genes showed significantly increased relative expression levels at 24.38-, 19.17-, 14.71-, and 12.74-fold compared to the control. Moderate increased relative expression levels of lignin biosynthesis-related gene (C4H, pathogenesis-related genes (PR4, PR10a and PRpha, and antioxidant-related gene (GST were found, while CHI, LOX, SOD, TRX1 and AXR showed decreased relative expression levels. It was thus clearly shown that wound-induced response genes were activated in rice plants after BPH attacks through AOS activation. Jasmonic acid signaling molecule may activate PR6, PR15, GST and CAT subsequently increasing their expression for H2O2 detoxification. PR6 were expressed at the highest relative level among the PR genes. These genes therefore have also a considerable synergistic role with the other genes against BPH by interfered their digestion tract system.

Antimicrobial susceptibility and occurrence of resistance genes among Salmonella enterica serovar Weltevreden from different countries

DEFF Research Database (Denmark)

Aarestrup, Frank Møller; Lertworapreecha, M.; Evans, M.C.

2003-01-01

and gentamicin. All nine ampicillin-resistant isolates contained a sequence similar to the bla(TEM-1b) gene, one of the eight chloramphenicol-resistant isolates a sequence similar to the catA1 gene, all three neomycin-resistant isolates a sequence similar to the aphA-2 gene, 16 (73%) of the 22 streptomycin...... isolates were examined for susceptibility to antimicrobial agents, and resistant isolates were examined for the presence of selected resistance genes by PCR. Results: Only 48 (9.5%) of the isolates were resistant to one or more of the antimicrobial agents tested. A low frequency of resistance was found...

Paradoxical DNA repair and peroxide resistance gene conservation in Bacillus pumilus SAFR-032.

Directory of Open Access Journals (Sweden)

Jason Gioia

Full Text Available BACKGROUND: Bacillus spores are notoriously resistant to unfavorable conditions such as UV radiation, gamma-radiation, H2O2, desiccation, chemical disinfection, or starvation. Bacillus pumilus SAFR-032 survives standard decontamination procedures of the Jet Propulsion Lab spacecraft assembly facility, and both spores and vegetative cells of this strain exhibit elevated resistance to UV radiation and H2O2 compared to other Bacillus species. PRINCIPAL FINDINGS: The genome of B. pumilus SAFR-032 was sequenced and annotated. Lists of genes relevant to DNA repair and the oxidative stress response were generated and compared to B. subtilis and B. licheniformis. Differences in conservation of genes, gene order, and protein sequences are highlighted because they potentially explain the extreme resistance phenotype of B. pumilus. The B. pumilus genome includes genes not found in B. subtilis or B. licheniformis and conserved genes with sequence divergence, but paradoxically lacks several genes that function in UV or H2O2 resistance in other Bacillus species. SIGNIFICANCE: This study identifies several candidate genes for further research into UV and H2O2 resistance. These findings will help explain the resistance of B. pumilus and are applicable to understanding sterilization survival strategies of microbes.

Effective genes for resistance to stripe rust and virulence of Puccinia ...

African Journals Online (AJOL)

The results revealed that stripe rust resistance genes Yr3, Yr5, Yr10, Yr15, Yr26, YrSP and YrCV were resistant, while Yr18 showed moderate susceptibility at all locations. Genes YrA-, Yr2, Yr6, Yr7, Yr8, Yr9, Yr17, Yr27 and gene combinations Opata (Yr27+Yr18) and Super Kauz (Yr9, Yr27, Yr18) were found susceptible.

High prevalence of multidrug-resistant tuberculosis among patients with rifampicin resistance using GeneXpert Mycobacterium tuberculosis/rifampicin in Ghana.

Science.gov (United States)

Boakye-Appiah, Justice K; Steinmetz, Alexis R; Pupulampu, Peter; Ofori-Yirenkyi, Stephen; Tetteh, Ishmael; Frimpong, Michael; Oppong, Patrick; Opare-Sem, Ohene; Norman, Betty R; Stienstra, Ymkje; van der Werf, Tjip S; Wansbrough-Jones, Mark; Bonsu, Frank; Obeng-Baah, Joseph; Phillips, Richard O

2016-06-01

Drug-resistant strains of tuberculosis (TB) represent a major threat to global TB control. In low- and middle-income countries, resource constraints make it difficult to identify and monitor cases of resistance using drug susceptibility testing and culture. Molecular assays such as the GeneXpert Mycobacterium tuberculosis/rifampicin may prove to be a cost-effective solution to this problem in these settings. The objective of this study is to evaluate the use of GeneXpert in the diagnosis of pulmonary TB since it was introduced into two tertiary hospitals in Ghana in 2013. A 2-year retrospective audit of clinical cases involving patients who presented with clinically suspected TB or documented TB not improving on standard therapy and had samples sent for GeneXpert testing. GeneXpert identified 169 cases of TB, including 17 cases of rifampicin-resistant TB. Of the seven cases with final culture and drug susceptibility testing results, six demonstrated further drug resistance and five of these were multidrug-resistant TB. These findings call for a scale-up of TB control in Ghana and provide evidence that the expansion of GeneXpert may be an optimal means to improve case finding and guide treatment of drug-resistant TB in this setting. Copyright © 2016. Published by Elsevier Ltd.

Resistance genes in barley (Hordeum vulgare L.) and their identification with molecular markers.

Science.gov (United States)

Chełkowski, Jerzy; Tyrka, Mirosław; Sobkiewicz, Andrzej

2003-01-01

Current information on barley resistance genes available from scientific papers and on-line databases is summarised. The recent literature contains information on 107 major resistance genes (R genes) against fungal pathogens (excluding powdery mildew), pathogenic viruses and aphids identified in Hordeum vulgare accessions. The highest number of resistance genes was identified against Puccinia hordei, Rhynchosporium secalis, and the viruses BaYMV and BaMMV, with 17, 14 and 13 genes respectively. There is still a lot of confusion regarding symbols for R genes against powdery mildew. Among the 23 loci described to date, two regions Mla and Mlo comprise approximately 31 and 25 alleles. Over 50 R genes have already been localised and over 30 mapped on 7 barley chromosomes. Four barley R genes have been cloned recently: Mlo, Rpg1, Mla1 and Mla6, and their structures (sequences) are available. The paper presents a catalogue of barley resistance gene symbols, their chromosomalocation and the list of available DNA markers useful in characterising cultivars and breeding accessions.

Mapping and pyramiding of two major genes for resistance to the brown planthopper (Nilaparvata lugens [St?l]) in the rice cultivar ADR52

OpenAIRE

Myint, Khin Khin Marlar; Fujita, Daisuke; Matsumura, Masaya; Sonoda, Tomohiro; Yoshimura, Atsushi; Yasui, Hideshi

2011-01-01

The brown planthopper (BPH), Nilaparvata lugens (St?l), is one of the most serious and destructive pests of rice, and can be found throughout the rice-growing areas of Asia. To date, more than 24 major BPH-resistance genes have been reported in several Oryza sativa ssp. indica cultivars and wild relatives. Here, we report the genetic basis of the high level of BPH resistance derived from an Indian rice cultivar, ADR52, which was previously identified as resistant to the whitebacked planthoppe...

Identification and characterization of potential NBS-encoding resistance genes and induction kinetics of a putative candidate gene associated with downy mildew resistance in Cucumis

Directory of Open Access Journals (Sweden)

Wan Hongjian

2010-08-01

Full Text Available Abstract Background Due to the variation and mutation of the races of Pseudoperonospora cubensis, downy mildew has in recent years become the most devastating leaf disease of cucumber worldwide. Novel resistance to downy mildew has been identified in the wild Cucumis species, C. hystrix Chakr. After the successful hybridization between C. hystrix and cultivated cucumber (C. sativus L., an introgression line (IL5211S was identified as highly resistant to downy mildew. Nucleotide-binding site and leucine-rich repeat (NBS-LRR genes are the largest class of disease resistance genes cloned from plant with highly conserved domains, which can be used to facilitate the isolation of candidate genes associated with downy mildew resistance in IL5211S. Results Degenerate primers that were designed based on the conserved motifs in the NBS domain of resistance (R proteins were used to isolate NBS-type sequences from IL5211S. A total of 28 sequences were identified and named as cucumber (C. sativus = CS resistance gene analogs as CSRGAs. Polygenetic analyses separated these sequences into four different classes. Quantitative real-time polymerase chain reaction (qRT-PCR analysis showed that these CSRGAs expressed at different levels in leaves, roots, and stems. In addition, introgression from C. hystrix induced expression of the partial CSRGAs in cultivated cucumber, especially CSRGA23, increased four-fold when compared to the backcross parent CC3. Furthermore, the expression of CSRGA23 under P. cubensis infection and abiotic stresses was also analyzed at different time points. Results showed that the P. cubensis treatment and four tested abiotic stimuli, MeJA, SA, ABA, and H2O2, triggered a significant induction of CSRGA23 within 72 h of inoculation. The results indicate that CSRGA23 may play a critical role in protecting cucumber against P. cubensis through a signaling the pathway triggered by these molecules. Conclusions Four classes of NBS-type RGAs were

Skeletal muscle gene expression in response to resistance exercise: sex specific regulation

Directory of Open Access Journals (Sweden)

Burant Charles F

2010-11-01

Full Text Available Abstract Background The molecular mechanisms underlying the sex differences in human muscle morphology and function remain to be elucidated. The sex differences in the skeletal muscle transcriptome in both the resting state and following anabolic stimuli, such as resistance exercise (RE, might provide insight to the contributors of sexual dimorphism of muscle phenotypes. We used microarrays to profile the transcriptome of the biceps brachii of young men and women who underwent an acute unilateral RE session following 12 weeks of progressive training. Bilateral muscle biopsies were obtained either at an early (4 h post-exercise or late recovery (24 h post-exercise time point. Muscle transcription profiles were compared in the resting state between men (n = 6 and women (n = 8, and in response to acute RE in trained exercised vs. untrained non-exercised control muscle for each sex and time point separately (4 h post-exercise, n = 3 males, n = 4 females; 24 h post-exercise, n = 3 males, n = 4 females. A logistic regression-based method (LRpath, following Bayesian moderated t-statistic (IMBT, was used to test gene functional groups and biological pathways enriched with differentially expressed genes. Results This investigation identified extensive sex differences present in the muscle transcriptome at baseline and following acute RE. In the resting state, female muscle had a greater transcript abundance of genes involved in fatty acid oxidation and gene transcription/translation processes. After strenuous RE at the same relative intensity, the time course of the transcriptional modulation was sex-dependent. Males experienced prolonged changes while females exhibited a rapid restoration. Most of the biological processes involved in the RE-induced transcriptional regulation were observed in both males and females, but sex specificity was suggested for several signaling pathways including activation of notch signaling and TGF-beta signaling in females

Functional markers based molecular characterization and cloning of resistance gene analogs encoding NBS-LRR disease resistance proteins in finger millet (Eleusine coracana).

Science.gov (United States)

Panwar, Preety; Jha, Anand Kumar; Pandey, P K; Gupta, Arun K; Kumar, Anil

2011-06-01

Magnaporthe grisea, the blast fungus is one of the main pathological threats to finger millet crop worldwide. A systematic search for the blast resistance gene analogs was carried out, using functional molecular markers. Three-fourths of the recognition-dependent disease resistance genes (R-genes) identified in plants encodes nucleotide binding site (NBS) leucine-rich repeat (LRR) proteins. NBS-LRR homologs have only been isolated on a limited scale from Eleusine coracana. Genomic DNA sequences sharing homology with NBS region of resistance gene analogs were isolated and characterized from resistant genotypes of finger millet using PCR based approach with primers designed from conserved regions of NBS domain. Attempts were made to identify molecular markers linked to the resistance gene and to differentiate the resistant bulk from the susceptible bulk. A total of 9 NBS-LRR and 11 EST-SSR markers generated 75.6 and 73.5% polymorphism respectively amongst 73 finger millet genotypes. NBS-5, NBS-9, NBS-3 and EST-SSR-04 markers showed a clear polymorphism which differentiated resistant genotypes from susceptible genotypes. By comparing the banding pattern of different resistant and susceptible genotypes, five DNA amplifications of NBS and EST-SSR primers (NBS-05(504,) NBS-09(711), NBS-07(688), NBS-03(509) and EST-SSR-04(241)) were identified as markers for the blast resistance in resistant genotypes. Principal coordinate plot and UPGMA analysis formed similar groups of the genotypes and placed most of the resistant genotypes together showing a high level of genetic relatedness and the susceptible genotypes were placed in different groups on the basis of differential disease score. Our results provided a clue for the cloning of finger millet blast resistance gene analogs which not only facilitate the process of plant breeding but also molecular characterization of blast resistance gene analogs from Eleusine coracana.

Overexpression of antibiotic resistance genes in hospital effluents over time

OpenAIRE

Rowe, Will P. M.; Baker-Austin, Craig; Verner-Jeffreys, David W.; Ryan, Jim J.; Micallef, Christianne; Maskell, Duncan J.; Pearce, Gareth P.

2017-01-01

$\\textbf{Objectives}$: Effluents contain a diverse abundance of antibiotic resistance genes that augment the resistome of receiving aquatic environments. However, uncertainty remains regarding their temporal persistence, transcription and response to anthropogenic factors, such as antibiotic usage. We present a spatiotemporal study within a river catchment (River Cam, UK) that aims to determine the contribution of antibiotic resistance gene-containing effluents originating from sites of varyi...

Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants

Science.gov (United States)

Somerville, Chris R [Portola Valley, CA; Scheible, Wolf [Golm, DE

2007-07-10

Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

QTL mapping and transcriptome analysis of cowpea reveals candidate genes for root-knot nematode resistance.

Science.gov (United States)

Santos, Jansen Rodrigo Pereira; Ndeve, Arsenio Daniel; Huynh, Bao-Lam; Matthews, William Charles; Roberts, Philip Alan

2018-01-01

Cowpea is one of the most important food and forage legumes in drier regions of the tropics and subtropics. However, cowpea yield worldwide is markedly below the known potential due to abiotic and biotic stresses, including parasitism by root-knot nematodes (Meloidogyne spp., RKN). Two resistance genes with dominant effect, Rk and Rk2, have been reported to provide resistance against RKN in cowpea. Despite their description and use in breeding for resistance to RKN and particularly genetic mapping of the Rk locus, the exact genes conferring resistance to RKN remain unknown. In the present work, QTL mapping using recombinant inbred line (RIL) population 524B x IT84S-2049 segregating for a newly mapped locus and analysis of the transcriptome changes in two cowpea near-isogenic lines (NIL) were used to identify candidate genes for Rk and the newly mapped locus. A major QTL, designated QRk-vu9.1, associated with resistance to Meloidogyne javanica reproduction, was detected and mapped on linkage group LG9 at position 13.37 cM using egg production data. Transcriptome analysis on resistant and susceptible NILs 3 and 9 days after inoculation revealed up-regulation of 109 and 98 genes and down-regulation of 110 and 89 genes, respectively, out of 19,922 unique genes mapped to the common bean reference genome. Among the differentially expressed genes, four and nine genes were found within the QRk-vu9.1 and QRk-vu11.1 QTL intervals, respectively. Six of these genes belong to the TIR-NBS-LRR family of resistance genes and three were upregulated at one or more time-points. Quantitative RT-PCR validated gene expression to be positively correlated with RNA-seq expression pattern for eight genes. Future functional analysis of these cowpea genes will enhance our understanding of Rk-mediated resistance and identify the specific gene responsible for the resistance.

SolRgene: an online database to explore disease resistance genes in tuber-bearing Solanum species

Directory of Open Access Journals (Sweden)

Vleeshouwers Vivianne GAA

2011-08-01

Full Text Available Abstract Background The cultivated potato (Solanum tuberosum L. is an important food crop, but highly susceptible to many pathogens. The major threat to potato production is the Irish famine pathogen Phytophthora infestans, which causes the devastating late blight disease. Potato breeding makes use of germplasm from wild relatives (wild germplasm to introduce resistances into cultivated potato. The Solanum section Petota comprises tuber-bearing species that are potential donors of new disease resistance genes. The aim of this study was to explore Solanum section Petota for resistance genes and generate a widely accessible resource that is useful for studying and implementing disease resistance in potato. Description The SolRgene database contains data on resistance to P. infestans and presence of R genes and R gene homologues in Solanum section Petota. We have explored Solanum section Petota for resistance to late blight in high throughput disease tests under various laboratory conditions and in field trials. From resistant wild germplasm, segregating populations were generated and assessed for the presence of resistance genes. All these data have been entered into the SolRgene database. To facilitate genetic and resistance gene evolution studies, phylogenetic data of the entire SolRgene collection are included, as well as a tool for generating phylogenetic trees of selected groups of germplasm. Data from resistance gene allele-mining studies are incorporated, which enables detection of R gene homologs in related germplasm. Using these resources, various resistance genes have been detected and some of these have been cloned, whereas others are in the cloning pipeline. All this information is stored in the online SolRgene database, which allows users to query resistance data, sequences, passport data of the accessions, and phylogenic classifications. Conclusion Solanum section Petota forms the basis of the SolRgene database, which contains a

Mapping resistance to the Ug99 race group of the stem rust pathogen in a spring wheat landrace.

Science.gov (United States)

Babiker, E M; Gordon, T C; Chao, S; Newcomb, M; Rouse, M N; Jin, Y; Wanyera, R; Acevedo, M; Brown-Guedira, G; Williamson, S; Bonman, J M

2015-04-01

A new gene for Ug99 resistance from wheat landrace PI 374670 was detected on the long arm of chromosome 7A. Wheat landrace PI 374670 has seedling and field resistance to stem rust caused by Puccinia graminis f. sp tritici Eriks. & E. Henn (Pgt) race TTKSK. To elucidate the inheritance of resistance, 216 BC1F2 families, 192 double haploid (DH) lines, and 185 recombinant inbred lines (RILs) were developed by crossing PI 374670 and the susceptible line LMPG-6. The parents and progeny were evaluated for seedling resistance to Pgt races TTKSK, MCCFC, and TPMKC. The DH lines were tested in field stem rust nurseries in Kenya and Ethiopia. The DH lines were genotyped with the 90K wheat iSelect SNP genotyping platform. Goodness-of-fit tests indicated that a single dominant gene in PI 374670 conditioned seedling resistance to the three Pgt races. The seedling resistance locus mapped to the long arm of chromosome 7A and this result was verified in the RIL population screened with the flanking SNP markers using KASP assays. In the same region, a major QTL for field resistance was detected in a 7.7 cM interval and explained 34-54 and 29-36% of the variation in Kenya and Ethiopia, respectively. Results from tests with specific Pgt races and the csIH81 marker showed that the resistance was not due to Sr22. Thus, a new stem rust resistance gene or allele, either closely linked or allelic to Sr15, is responsible for the seedling and field resistance of PI 374670 to Ug99.

Antimicrobial resistance and virulence genes in enterococci from wild game meat in Spain.

Science.gov (United States)

Guerrero-Ramos, Emilia; Cordero, Jorge; Molina-González, Diana; Poeta, Patrícia; Igrejas, Gilberto; Alonso-Calleja, Carlos; Capita, Rosa

2016-02-01

A total of 55 enterococci (45 Enterococcus faecium, 7 Enterococcus faecalis, and three Enterococcus durans) isolated from the meat of wild game animals (roe deer, boar, rabbit, pheasant, and pigeon) in North-Western Spain were tested for susceptibility to 14 antimicrobials by the disc diffusion method. All strains showed a multi-resistant phenotype (resistance to between three and 10 antimicrobials). The strains exhibited high percentages of resistance to erythromycin (89.1%), tetracycline (67.3%), ciprofloxacin (92.7%), nitrofurantoin (67.3%), and quinupristin-dalfopristin (81.8%). The lowest values (9.1%) were observed for high-level resistance to gentamicin, kanamycin, and streptomycin. The average number of resistances per strain was 5.8 for E. faecium isolates, 7.9 for E. faecalis, and 5.7 for E. durans. Genes encoding antimicrobial resistance and virulence were studied by polymerase chain reaction. A total of 15 (57.7%) of the 26 vancomycin-resistant isolates harboured the vanA gene. Other resistance genes detected included vanB, erm(B) and/or erm(C), tet(L) and/or tet(M), acc(6')-aph(2″), and aph(3')-IIIa in strains resistant to vancomycin, erythromycin, tetracycline, gentamicin, and kanamycin, respectively. Specific genes of the Tn5397 transposon were detected in 54.8% of the tet(M)-positive enterococci. Nine virulence factors (gelE, agg, ace, cpd, frs, esp, hyl, efaAfs and efaAfm) were studied. All virulence genes, with the exception of the frs gene, were found to be present in the enterococcal isolates. At least one virulence gene was detected in 20.0% of E. faecium, 71.4% of E. faecalis and 33.3% of E. durans isolates, with ace and cpd being the most frequently detected genes (6 isolates each). This suggests that wild game meat might play a role in the spreading through the food chain of enterococci with antimicrobial resistance and virulence determinants to humans. Copyright © 2015 Elsevier Ltd. All rights reserved.

Bipolar and unipolar resistive switching behaviors of sol–gel-derived SrTiO3 thin films with different compliance currents

International Nuclear Information System (INIS)

Tang, M H; Wang, Z P; Zeng, Z Q; Xu, X L; Wang, G Y; Zhang, L B; Xiao, Y G; Yang, S B; Jiang, B; Li, J C; He, J

2011-01-01

The SrTiO 3 (STO) thin films on a Pt/Ti/SiO 2 /Si substrate were synthesized using a sol–gel method to form a metal–insulator–metal structure. This device shows the bipolar resistance switching (BRS) behavior for a compliance current I cc of less than 0.1 mA but exhibits soft breakdown at a higher level of compliance current. A transition from the BRS behavior to the stable unipolar resistive switching behavior (URS) was also observed. We found that the BRS behavior may be controlled by the structure interface while the URS behavior is likely bulk controlled. Our study indicates that the external compliance current is a key factor in resistance switching phenomenon of STO thin films

Subsolidus Phase Relations of the CoOx-CuO-SrO System  

DEFF Research Database (Denmark)

Grivel, Jean-Claude

2017-01-01

The subsolidus phase relations of the CoOx-CuO-SrO system were investigated in air. The samples were equilibrated at 900 °C. The pseudo-ternary section contains three stoichiometric binary oxide phases (Sr2CuO3, SrCuO2 and Sr14Cu24O41−δ) and a binary oxide solid solution: Sr6+xCo5O15+δ (0 ≤ x ≤ 0.......36). Two binary phases extend into the ternary system forming solid solutions, i.e., Sr14Cu24−xCoxO41−δ (0 ≤ x ≤ 5) and Sr6+xCo5−yCuyO15+δ (0 ≤ x ≤ 0.36, 0 ≤ y ≤ 1.0). The Sr6+xCo5O15+δ solid solution was found to undergo a phase separation into a mixture of Sr6Co5O15−δ and Sr14Co11O33 upon annealing...

Functional analysis of U1-70K interacting SR proteins in pre-mRNA splicing in Arabidopsis

International Nuclear Information System (INIS)

Reddy, A.S.N.

2008-01-01

Proteins of a serine/arginine-rich (SR) family are part of the spliceosome and are implicated in both constitutive and alternative splicing of pre-mRNAs. With the funding from DOE we have been studying alternative of splicing of genes encoding serine/arginine-rich (SR) proteins and the roles of SR proteins that interact with U1-70K in regulating basic and alternative splicing. Alternative splicing of pre-mRNAs of Arabidopsis serine/arginine-rich proteins and its regulation by hormones and stresses: We analyzed the splicing of all 19 Arabidopsis genes in different tissues, during different seedling stages and in response to various hormonal and stress treatments. Remarkably, about 90 different transcripts are produced from 15 SR genes, thereby increasing the transcriptome complexity of SR genes by about five fold. Using the RNA isolated from polysomes we have shown that most of the splice variants are recruited for translation. Alternative splicing of some SR genes is controlled in a developmental and tissue-specific manner (Palusa et al., 2007). Interestingly, among the various hormones and abiotic stresses tested, temperature stress (cold and heat) and ultraviolet light dramatically altered alternative splicing of pre-mRNAs of several SR genes whereas hormones altered the splicing of only two SR genes (Palusa et al., 2007). Localization and dynamics of a novel serine/arginine-rich protein that interacts with U1-70K: We analyzed the intranuclear movement of SR45 fused to GFP by fluorescence recovery after photobleaching (FRAP) and fluorescence loss in photobleaching (FLIP). We demonstrate that the movement of GFP-SR45 is ATP-dependent. Interestingly, inhibition of transcription or phosphorylation slowed the mobility of GFP-SR45 (Ali et al., 2006). Our studies have revealed that the nuclear localization signals are located in arg/ser-rich domains (RS) 1 and 2, whereas the speckle targeting signals are exclusively present in RS2 (Ali et al., 2006). The regulation of

Presence of superantigen genes and antimicrobial resistance in Staphylococcus isolates obtained from the uteri of dairy cows with clinical endometritis.

Science.gov (United States)

Zhao, J-L; Ding, Y-X; Zhao, H-X; He, X-L; Li, P-F; Li, Z-F; Guan, H; Guo, X

2014-10-11

Clinical endometritis is an important disease of dairy cattle and results in decreased reproductive performance. This disease is caused by contamination of the uterus with a broad spectrum of microorganisms after calving. In this study, staphylococcal isolates from the uterus of dairy cows with clinical endometritis were tested for their distribution of superantigen (SAg) genes and antimicrobial resistance. Between the 127 staphylococcal isolates collected in this study, 10 species were identified. The predominant strain identified was Staphylococcus aureus (n=53), followed by Staphylococcus saprophyticus (n=38) and Staphylococcus chromogenes (n=22). PCR analysis demonstrated that most isolates (63.0 per cent) harboured at least one SAg gene. The most commonly observed SAg gene and genotype was selj (38.6 per cent) and sec-selj-seln (24.0 per cent), respectively. Most isolates were resistant to penicillin (79.5 per cent), ampicillin (71.7 per cent), erythromycin (56.7 per cent), and tetracycline (52.0 per cent). PCR analysis demonstrated that the antimicrobial resistance determinants ermA, ermB, ermC, tetK, tetM and blaZ were detected in 0 per cent, 44.4 per cent, 51.4 per cent, 68.2 per cent, 13.6 per cent and 86.1 per cent of the erythromycin, tetracycline and β-lactam resistant isolates, respectively. There were 22 (17.3 per cent of all isolates) coagulase-negative staphylococci shown to be methicillin resistant. In the methicillin-resistant isolates, significant resistances to ampicillin, erythromycin and penicillin were observed (P<0.01). The results of this study demonstrate that staphylococci recovered from dairy cows with clinical endometritis contain an extensive and complex prevalence of SAg genes. Significant resistances to antibiotics were also seen, highlighting the need for the rational appliance of antibiotics in veterinary medicine. British Veterinary Association.

Herbicide resistance-endowing ACCase gene mutations in hexaploid wild oat (Avena fatua): insights into resistance evolution in a hexaploid species

Science.gov (United States)

Yu, Q; Ahmad-Hamdani, M S; Han, H; Christoffers, M J; Powles, S B

2013-01-01

Many herbicide-resistant weed species are polyploids, but far too little about the evolution of resistance mutations in polyploids is understood. Hexaploid wild oat (Avena fatua) is a global crop weed and many populations have evolved herbicide resistance. We studied plastidic acetyl-coenzyme A carboxylase (ACCase)-inhibiting herbicide resistance in hexaploid wild oat and revealed that resistant individuals can express one, two or three different plastidic ACCase gene resistance mutations (Ile-1781-Leu, Asp-2078-Gly and Cys-2088-Arg). Using ACCase resistance mutations as molecular markers, combined with genetic, molecular and biochemical approaches, we found in individual resistant wild-oat plants that (1) up to three unlinked ACCase gene loci assort independently following Mendelian laws for disomic inheritance, (2) all three of these homoeologous ACCase genes were transcribed, with each able to carry its own mutation and (3) in a hexaploid background, each individual ACCase resistance mutation confers relatively low-level herbicide resistance, in contrast to high-level resistance conferred by the same mutations in unrelated diploid weed species of the Poaceae (grass) family. Low resistance conferred by individual ACCase resistance mutations is likely due to a dilution effect by susceptible ACCase expressed by homoeologs in hexaploid wild oat and/or differential expression of homoeologous ACCase gene copies. Thus, polyploidy in hexaploid wild oat may slow resistance evolution. Evidence of coexisting non-target-site resistance mechanisms among wild-oat populations was also revealed. In all, these results demonstrate that herbicide resistance and its evolution can be more complex in hexaploid wild oat than in unrelated diploid grass weeds. Our data provide a starting point for the daunting task of understanding resistance evolution in polyploids. PMID:23047200

Role of G-protein-coupled receptor-related genes in insecticide resistance of the mosquito, Culex quinquefasciatus.

Science.gov (United States)

Li, Ting; Liu, Lena; Zhang, Lee; Liu, Nannan

2014-09-29

G-protein-coupled receptors regulate signal transduction pathways and play diverse and pivotal roles in the physiology of insects, however, the precise function of GPCRs in insecticide resistance remains unclear. Using quantitative RT-PCR and functional genomic methods, we, for the first time, explored the function of GPCRs and GPCR-related genes in insecticide resistance of mosquitoes, Culex quinquefasciatus. A comparison of the expression of 115 GPCR-related genes at a whole genome level between resistant and susceptible Culex mosquitoes identified one and three GPCR-related genes that were up-regulated in highly resistant Culex mosquito strains, HAmCq(G8) and MAmCq(G6), respectively. To characterize the function of these up-regulated GPCR-related genes in resistance, the up-regulated GPCR-related genes were knockdown in HAmCq(G8) and MAmCq(G6) using RNAi technique. Knockdown of these four GPCR-related genes not only decreased resistance of the mosquitoes to permethrin but also repressed the expression of four insecticide resistance-related P450 genes, suggesting the role of GPCR-related genes in resistance is involved in the regulation of resistance P450 gene expression. This results help in understanding of molecular regulation of resistance development in Cx. quinquefasciatus.

In-plane dissipation maxima and vortex-line distortions in the resistive transitions of oxygen-doped Bi2Sr2CaCu2O(8+delta) single crystals

Science.gov (United States)

Hsu, J. W. P.; Mitzi, D. B.; Kapitulnik, A.; Lee, Mark

1991-10-01

Measurements of the in-plane resistive transition of Bi2Sr2CaCu2O(8+delta) single crystals in perpendicular magnetic fields reveal that in oxygen-reduced samples a giant resistance maximum evolves with field. This is not seen in oxygenated samples with similar metallic normal resistivities. As the peak resistivity may exceed the normal resistivity, it cannot arise from ordinary vortex-motion dissipation. A model is proposed where the excess resistance results from nonrigid vortex motion coupling the out-of-plane dissipation to the in-plane resistance at temperatures where pinning effects are negligible.

Identification of leaf rust resistant gene Lr10 in Pakistani wheat ...

African Journals Online (AJOL)

Leaf (brown) rust is the major disease of wheat in Pakistan and other countries. The disease is more effectively controlled when several rust resistance genes are pyramided into a single line. Molecular survey was conducted to screen 25 Pakistan wheat germplasm for the presence of leaf rust resistance gene Lr10 using ...

In Silico Assigned Resistance Genes Confer Bifidobacterium with Partial Resistance to Aminoglycosides but Not to Β-Lactams

Science.gov (United States)

Fouhy, Fiona; O’Connell Motherway, Mary; Fitzgerald, Gerald F.; Ross, R. Paul; Stanton, Catherine; van Sinderen, Douwe; Cotter, Paul D.

2013-01-01

Bifidobacteria have received significant attention due to their contribution to human gut health and the use of specific strains as probiotics. It is thus not surprising that there has also been significant interest with respect to their antibiotic resistance profile. Numerous culture-based studies have demonstrated that bifidobacteria are resistant to the majority of aminoglycosides, but are sensitive to β-lactams. However, limited research exists with respect to the genetic basis for the resistance of bifidobacteria to aminoglycosides. Here we performed an in-depth in silico analysis of putative Bifidobacterium-encoded aminoglycoside resistance proteins and β-lactamases and assess the contribution of these proteins to antibiotic resistance. The in silico-based screen detected putative aminoglycoside and β-lactam resistance proteins across the Bifidobacterium genus. Laboratory-based investigations of a number of representative bifidobacteria strains confirmed that despite containing putative β-lactamases, these strains were sensitive to β-lactams. In contrast, all strains were resistant to the aminoglycosides tested. To assess the contribution of genes encoding putative aminoglycoside resistance proteins in Bifidobacterium sp. two genes, namely Bbr_0651 and Bbr_1586, were targeted for insertional inactivation in B. breve UCC2003. As compared to the wild-type, the UCC2003 insertion mutant strains exhibited decreased resistance to gentamycin, kanamycin and streptomycin. This study highlights the associated risks of relying on the in silico assignment of gene function. Although several putative β-lactam resistance proteins are located in bifidobacteria, their presence does not coincide with resistance to these antibiotics. In contrast however, this approach has resulted in the identification of two loci that contribute to the aminoglycoside resistance of B. breve UCC2003 and, potentially, many other bifidobacteria. PMID:24324818

In silico assigned resistance genes confer Bifidobacterium with partial resistance to aminoglycosides but not to β-lactams.

Directory of Open Access Journals (Sweden)

Fiona Fouhy

Full Text Available Bifidobacteria have received significant attention due to their contribution to human gut health and the use of specific strains as probiotics. It is thus not surprising that there has also been significant interest with respect to their antibiotic resistance profile. Numerous culture-based studies have demonstrated that bifidobacteria are resistant to the majority of aminoglycosides, but are sensitive to β-lactams. However, limited research exists with respect to the genetic basis for the resistance of bifidobacteria to aminoglycosides. Here we performed an in-depth in silico analysis of putative Bifidobacterium-encoded aminoglycoside resistance proteins and β-lactamases and assess the contribution of these proteins to antibiotic resistance. The in silico-based screen detected putative aminoglycoside and β-lactam resistance proteins across the Bifidobacterium genus. Laboratory-based investigations of a number of representative bifidobacteria strains confirmed that despite containing putative β-lactamases, these strains were sensitive to β-lactams. In contrast, all strains were resistant to the aminoglycosides tested. To assess the contribution of genes encoding putative aminoglycoside resistance proteins in Bifidobacterium sp. two genes, namely Bbr_0651 and Bbr_1586, were targeted for insertional inactivation in B. breve UCC2003. As compared to the wild-type, the UCC2003 insertion mutant strains exhibited decreased resistance to gentamycin, kanamycin and streptomycin. This study highlights the associated risks of relying on the in silico assignment of gene function. Although several putative β-lactam resistance proteins are located in bifidobacteria, their presence does not coincide with resistance to these antibiotics. In contrast however, this approach has resulted in the identification of two loci that contribute to the aminoglycoside resistance of B. breve UCC2003 and, potentially, many other bifidobacteria.

Bacterial metal resistance genes and metal bioavailability in contaminated sediments

International Nuclear Information System (INIS)

Roosa, Stéphanie; Wattiez, Ruddy; Prygiel, Emilie; Lesven, Ludovic; Billon, Gabriel; Gillan, David C.

2014-01-01

In bacteria a metal may be defined as bioavailable if it crosses the cytoplasmic membrane to reach the cytoplasm. Once inside the cell, specific metal resistance systems may be triggered. In this research, specific metal resistance genes were used to estimate metal bioavailability in sediment microbial communities. Gene levels were measured by quantitative PCR and correlated to metals in sediments using five different protocols to estimate dissolved, particle-adsorbed and occluded metals. The best correlations were obtained with czcA (a Cd/Zn/Co efflux pump) and Cd/Zn adsorbed or occluded in particles. Only adsorbed Co was correlated to czcA levels. We concluded that the measurement of czcA gene levels by quantitative PCR is a promising tool which may complement the classical approaches used to estimate Cd/Zn/Co bioavailability in sediment compartments. - Highlights: • Metal resistance genes were used to estimate metal bioavailability in sediments. • Gene levels were correlated to metals using 5 different metal extraction protocols. • CzcA gene levels determined by quantitative PCR is a promising tool for Cd/Zn/Co. - Capsule Bacterial czcA is a potential biomarker of Cd, Zn and Co bioavailability in aquatic sediments as shown by quantitative PCR and sequential metal extraction

The LBP Gene and Its Association with Resistance to Aeromonas hydrophila in Tilapia

Directory of Open Access Journals (Sweden)

Gui Hong Fu

2014-12-01

Full Text Available Resistance to pathogens is important for the sustainability and profitability of food fish production. In immune-related genes, the lipopolysaccharide-binding protein (LBP gene is an important mediator of the inflammatory reaction. We analyzed the cDNA and genomic structure of the LBP gene in tilapia. The full-length cDNA (1901 bp of the gene contained a 1416 bp open reading frame, encoding 471 amino acid residues. Its genomic sequence was 5577 bp, comprising 15 exons and 14 introns. Under normal conditions, the gene was constitutively expressed in all examined tissues. The highest expression was detected in intestine and kidney. We examined the responses of the gene to challenges with two bacterial pathogens Streptcoccus agalactiae and Aeromonas hydrophila. The gene was significantly upregulated in kidney and spleen post-infection with S. agalactiae and A. hydrophila, respectively. However, the expression profiles of the gene after the challenge with the two pathogens were different. Furthermore, we identified three SNPs in the gene. There were significant associations (p < 0.05 of two of the three SNPs with the resistance to A. hydrophila, but not with the resistance to S. agalactiae or growth performance. These results suggest that the LBP gene is involved in the acute-phase immunologic response to the bacterial infections, and the responses to the two bacterial pathogens are different. The two SNPs associated with the resistance to A. hydrophila may be useful in the selection of tilapia resistant to A. hydrophila.

Pollen Killer Gene S35 Function Requires Interaction with an Activator That Maps Close to S24, Another Pollen Killer Gene in Rice

Directory of Open Access Journals (Sweden)

Takahiko Kubo

2016-05-01

Full Text Available Pollen killer genes disable noncarrier pollens, and are responsible for male sterility and segregation distortion in hybrid populations of distantly related plant species. The genetic networks and the molecular mechanisms underlying the pollen killer system remain largely unknown. Two pollen killer genes, S24 and S35, have been found in an intersubspecific cross of Oryza sativa ssp. indica and japonica. The effect of S24 is counteracted by an unlinked locus EFS. Additionally, S35 has been proposed to interact with S24 to induce pollen sterility. These genetic interactions are suggestive of a single S24-centric genetic pathway (EFS–S24–S35 for the pollen killer system. To examine this hypothetical genetic pathway, the S35 and the S24 regions were further characterized and genetically dissected in this study. Our results indicated that S35 causes pollen sterility independently of both the EFS and S24 genes, but is dependent on a novel gene close to the S24 locus, named incentive for killing pollen (INK. We confirmed the phenotypic effect of the INK gene separately from the S24 gene, and identified the INK locus within an interval of less than 0.6 Mb on rice chromosome 5. This study characterized the genetic effect of the two independent genetic pathways of INK–S35 and EFS–S24 in indica–japonica hybrid progeny. Our results provide clear evidence that hybrid male sterility in rice is caused by several pollen killer networks with multiple factors positively and negatively regulating pollen killer genes.

Pollen Killer Gene S35 Function Requires Interaction with an Activator That Maps Close to S24, Another Pollen Killer Gene in Rice.

Science.gov (United States)

Kubo, Takahiko; Yoshimura, Atsushi; Kurata, Nori

2016-05-03

Pollen killer genes disable noncarrier pollens, and are responsible for male sterility and segregation distortion in hybrid populations of distantly related plant species. The genetic networks and the molecular mechanisms underlying the pollen killer system remain largely unknown. Two pollen killer genes, S24 and S35, have been found in an intersubspecific cross of Oryza sativa ssp. indica and japonica The effect of S24 is counteracted by an unlinked locus EFS Additionally, S35 has been proposed to interact with S24 to induce pollen sterility. These genetic interactions are suggestive of a single S24-centric genetic pathway (EFS-S24-S35) for the pollen killer system. To examine this hypothetical genetic pathway, the S35 and the S24 regions were further characterized and genetically dissected in this study. Our results indicated that S35 causes pollen sterility independently of both the EFS and S24 genes, but is dependent on a novel gene close to the S24 locus, named incentive for killing pollen (INK). We confirmed the phenotypic effect of the INK gene separately from the S24 gene, and identified the INK locus within an interval of less than 0.6 Mb on rice chromosome 5. This study characterized the genetic effect of the two independent genetic pathways of INK-S35 and EFS-S24 in indica-japonica hybrid progeny. Our results provide clear evidence that hybrid male sterility in rice is caused by several pollen killer networks with multiple factors positively and negatively regulating pollen killer genes. Copyright © 2016 Kubo et al.

Ordered perovskites with cationic vacancies. 9. Compounds of the type Sr/sub 2/Srsub(1/4)Bsub(1/2)sup(III)vacantsub(1/4)WO/sub 6/ equivalent to Sr/sub 8/SrB/sub 2/sup(III)vacantW/sub 4/O/sub 24/ (Bsup(III) = La, Pr, Nd, Sm - Tm, Y)

Energy Technology Data Exchange (ETDEWEB)

Kemmler-Sack, S; Ehmann, A [Tuebingen Univ. (Germany, F.R.). Lehrstuhl fuer Anorganische Chemie 2

1981-08-01

The compounds Sr/sub 2/Srsub(1/4)Bsub(1/2)sup(III)vacantsub(1/4)WO/sub 6/ equivalent to Sr/sub 8/SrB/sub 2/sup(III)vacantW/sub 4/O/sub 24/ belong to the group of perovskites with octahedral cationic vacancies (cation/vacancy ratio (CN 6) = 7:1). For the larger Bsup(III) ions (La, Pr, Nd, Sm-Dy) different ordering effects are observed. The perovskites with Bsup(III) = Sm, Eu, Gd are polymorphic too (HT modification: higher ordered cubic perovskite (Bsup(III) = Gd: a = 2 x 8.23/sub 4/ A); LT modification: hexagonal perovskite stacking polytype (Bsup(III) = Gd: a = 9.95/sub 4/ A; c = 19.0/sub 4/ A)). With the smaller Bsup(III) ions (Ho, Er, Tm and Y) a cubic, 1:1 ordered perovskite type is observed.

Relationship between Psidium species (Myrtaceae) by resistance gene analog markers: focus on nematode resistance.

Science.gov (United States)

Noia, L R; Tuler, A C; Ferreira, A; Ferreira, M F S

2017-03-16

Guava (Psidium guajava L.) crop is severely affected by the nematode Meloidogyne enterolobii. Native Psidium species have been reported as sources of resistance against this nematode. Knowledge on the molecular relationship between Psidium species based on plant resistance gene analogs (RGA) can be useful in the genetic breeding of guava for resistance to M. enterolobii. In this study, RGA markers from conserved domains, and structural features of plant R genes, were employed to characterize Psidium species and establish genetic proximity, with a focus on nematode resistance. SSR markers were also applied owing to their neutral nature, thus differing from RGA markers. For this, species reported as sources of resistance to M. enterolobii, such as P. cattleianum and P. friedrichsthalianum, as well as species occurring in the Atlantic Rainforest and susceptible genotypes, were investigated. In 10 evaluated Psidium species, high interspecific genetic variability was verified through RGA and SSR markers, with intraspecific variation in P. guajava higher with SSR, as was expected. Resistant species were clustered by RGA markers, and differential amplicons among genotypes resistant and susceptible to M. enterolobii were identified. Knowledge on the molecular relationships between Psidium species constitutes useful information for breeding of the guava tree, providing direction for hybridization and material for rootstocks. Additionally, the genetic relationship between native species, which have been little studied, and P. guajava were estimated by RGAs, which were confirmed as important markers for genetic diversity related to pathogen resistance.

Genetics and mapping of a new leaf rust resistance gene in Triticum ...

Indian Academy of Sciences (India)

Genetic analysis in F1, F2 and F2.3 families at the seedling stage revealed that leaf rust resistance in Selection G12 is conditioned by a single incompletely dominant gene. The leaf rust resistance gene was mapped to chromosome 3BL with SSR markers Xgwm114 and Xgwm547 flanking the gene at a distance of 28.3 cM ...

Identification of a novel cytochrome P450 gene, CYP321E1 from the diamondback moth, Plutella xylostella (L.) and RNA interference to evaluate its role in chlorantraniliprole resistance.

Science.gov (United States)

Hu, Z; Lin, Q; Chen, H; Li, Z; Yin, F; Feng, X

2014-12-01

Insect cytochrome P450 monooxygenases (P450s) play an important role in catalysis of many reactions leading to insecticides resistance. Our previous studies on transcriptome analysis of chlorantraniliprole-resistant development in the diamondback moth, Plutella xylostella revealed that up-regulation of cytochrome P450s are one of the main factors leading to the development of chlorantraniliprole resistance. Here, we report for the first time a novel cytochrome P450 gene CYP321E1, which belongs to the cytochrome P450 gene family CYP321. Real-time quantitative PCR (RT-qPCR) analyses indicated that CYP321E1 was expressed at all developmental stages of P. xylostella but was highest in the fourth-instar larvae; furthermore, the relatively high expression was observed in the midgut of the fourth-instar larvae, followed by fat bodies and epidermis. The expression of CYP321E1 in P. xylostella was differentially affected by three representative insecticides, including alphamethrin, abamectin and chlorantraniliprole. Among them, the exposure to chlorantraniliprole resulted in the largest transcript level of this cytochrome P450 gene. The findings suggested potential involvement of CYP321E1 in chlorantraniliprole resistance of P. xylostella. To assess the functional link of CYP321E1 to chlorantraniliprole resistance, RNA interference (RNAi)-mediated gene silencing by double stranded RNA (dsRNA) injecting was used. Results revealed that injection delivery of dsRNA can greatly reduce gene expression after 24 h. As a consequence of RNAi, a significant increment in mortality of larvae injected CYP321E1 dsRNA was observed after 24 h of exposure to chlorantraniliprole. These results strongly support our notion that this novel cytochrome P450 gene plays an important role in chlorantraniliprole detoxification in the diamondback moth and is partly responsible for its resistance.

Bioinformatics Analysis of NBS-LRR Encoding Resistance Genes in Setaria italica.

Science.gov (United States)

Zhao, Yan; Weng, Qiaoyun; Song, Jinhui; Ma, Hailian; Yuan, Jincheng; Dong, Zhiping; Liu, Yinghui

2016-06-01

In plants, resistance (R) genes are involved in pathogen recognition and subsequent activation of innate immune responses. The nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes family forms the largest R-gene family among plant genomes and play an important role in plant disease resistance. In this paper, comprehensive analysis of NBS-encoding genes is performed in the whole Setaria italica genome. A total of 96 NBS-LRR genes are identified, and comprehensive overview of the NBS-LRR genes is undertaken, including phylogenetic analysis, chromosome locations, conserved motifs of proteins, and gene expression. Based on the domain, these genes are divided into two groups and distributed in all Setaria italica chromosomes. Most NBS-LRR genes are located at the distal tip of the long arms of the chromosomes. Setaria italica NBS-LRR proteins share at least one nucleotide-biding domain and one leucine-rich repeat domain. Our results also show the duplication of NBS-LRR genes in Setaria italica is related to their gene structure.

Transfer of the Fusarium resistant gene from Solanum integrifolium into S. melongena by asymmetric fusion

International Nuclear Information System (INIS)

Akamatsu, T.; Yoshida, M.; Shiga, T.

1990-01-01

Full text: In order to transfer the Fusarium resistant gene from the wild species into eggplants, asymmetric fusions were done between Solanum integrifolium and S. melongena. Protoplasts of S. melongena were isolated from hypocotyIes, and protoplasts of S. integrifolium were isolated from young leaves. Protoplasts of S. integrifolium were irradiated by soft x-rays (40-60kR), and fused with protoplasts of S. melongena by electric pulses. Fused protoplasts were cultured using TM-2 basal medium supplemented with 2,4-D (0.5 mg/l), NAA (0.35mg/l), and BA (2mg/l). After 30 days, calli of 1-2 mm in diameter were subcultured on agar medium supplemented with IAA (0.2mg/l) and Zeatin (4mg/l). After 15-30 days, shoots were regenerated from green calli. Regenerated plants were transplanted to the greenhouse and 382 plants were inoculated with Fusarium oxysporum. Thirty-two plants were resistant or tolerant, their chromosome numbers varied in the range of 35-42 (S. integrifolium, S. melongena 2n=2x=24). (author)

Integrated Metabolo-Transcriptomics Reveals Fusarium Head Blight Candidate Resistance Genes in Wheat QTL-Fhb2.

Directory of Open Access Journals (Sweden)

Dhananjay Dhokane

Full Text Available Fusarium head blight (FHB caused by Fusarium graminearum not only causes severe losses in yield, but also reduces quality of wheat grain by accumulating mycotoxins. Breeding for host plant resistance is considered as the best strategy to manage FHB. Resistance in wheat to FHB is quantitative in nature, involving cumulative effects of many genes governing resistance. The poor understanding of genetics and lack of precise phenotyping has hindered the development of FHB resistant cultivars. Though more than 100 QTLs imparting FHB resistance have been reported, none discovered the specific genes localized within the QTL region, nor the underlying mechanisms of resistance.In our study recombinant inbred lines (RILs carrying resistant (R-RIL and susceptible (S-RIL alleles of QTL-Fhb2 were subjected to metabolome and transcriptome profiling to discover the candidate genes. Metabolome profiling detected a higher abundance of metabolites belonging to phenylpropanoid, lignin, glycerophospholipid, flavonoid, fatty acid, and terpenoid biosynthetic pathways in R-RIL than in S-RIL. Transcriptome analysis revealed up-regulation of several receptor kinases, transcription factors, signaling, mycotoxin detoxification and resistance related genes. The dissection of QTL-Fhb2 using flanking marker sequences, integrating metabolomic and transcriptomic datasets, identified 4-Coumarate: CoA ligase (4CL, callose synthase (CS, basic Helix Loop Helix (bHLH041 transcription factor, glutathione S-transferase (GST, ABC transporter-4 (ABC4 and cinnamyl alcohol dehydrogenase (CAD as putative resistance genes localized within the QTL-Fhb2 region.Some of the identified genes within the QTL region are associated with structural resistance through cell wall reinforcement, reducing the spread of pathogen through rachis within a spike and few other genes that detoxify DON, the virulence factor, thus eventually reducing disease severity. In conclusion, we report that the wheat

Members of the genera Paenibacillus and Rhodococcus harbor genes homologous to enterococcal glycopeptide resistance genes vanA and vanB

DEFF Research Database (Denmark)

Guardabassi, L.; Christensen, H.; Hasman, Henrik

2004-01-01

Genes homologous to enterococcal glycopeptide resistance genes vanA and vanB were found in glycopeptide-resistant Paenibacillus and Rhodococcus strains from soil. The putative D-Ala:D-Lac ligase genes in Paenibacillus thiaminolyticus PT-2B1 and Paenibacillus apiarius PA-B2B were closely related...

Remapping of the stripe rust resistance gene Yr10 in common wheat.

Science.gov (United States)

Yuan, Cuiling; Wu, Jingzheng; Yan, Baiqiang; Hao, Qunqun; Zhang, Chaozhong; Lyu, Bo; Ni, Fei; Caplan, Allan; Wu, Jiajie; Fu, Daolin

2018-02-23

Yr10 is an important gene to control wheat stripe rust, and the search for Yr10 needs to be continued. Wheat stripe rust or yellow rust is a devastating fungal disease caused by Puccinia striiformis f. sp. tritici (Pst). Host disease resistance offers a primary source for controlling wheat stripe rust. The stripe rust resistance gene Yr10 confers the race-specific resistance to most tested Pst races in China including CYR29. Early studies proposed that Yr10 was a nucleotide-binding site, leucine-rich repeat gene archived as GenBank accession AF149112 (hereafter designated the Yr10 candidate gene or Yr10 CG ). In this study, we revealed that 15 Chinese wheat cultivars positive for Yr10 CG are susceptible to CYR29. We then expressed the Yr10 CG cDNA in the common wheat 'Bobwhite'. The Yr10 CG -cDNA positive transgenic plants were also susceptible to CYR29. Thus, it is highly unlikely that Yr10 CG corresponds to the Yr10 resistance gene. Using the Yr10 donor 'Moro' and the Pst-susceptible wheat 'Huixianhong', we generated two F 3 populations that displayed a single Mendelian segregation on the Yr10 gene, and used them to remap the Yr10 gene. Six markers were placed in the Yr10 region, with the Yr10 CG gene now mapping about 1.2-cM proximal to the Yr10 locus and the Xsdauw79 marker is completely linked to the Yr10 locus. Apparently, the Yr10 gene has not yet been identified. Fine mapping and positional cloning of Yr10 is important for gene pyramiding for stripe rust resistance in wheat.

Detection and Characterizations of Genes Resistant to Tetracycline and Sulfa among the Bacteria in Mariculture Water

Science.gov (United States)

Qu, L.; Li, Y.; Zhu, P.

2013-12-01

One hundred and thirty-five bacteria from maricultural environments were tested for sensitivity to tetracycline and sulfa. Result show that 72% of the bacteria were sulfa-resistant, 36% of the bacteria were tetracycline-resistant, and 16.5% of bacteria showed resistance to both tetracyclines and sulfa ,indicating that the proportion of sulfa and tetracycline resistance bacteria isvery large in the maricultural environments. PCR methods were used to detect if these resistant bacteria carry tetracycline and sulfa resistance genes. Out of the 33 tetracycline-resistant bacteria screened, 3 were positive for tetA, 6 were positive for tetB and no isolate wasboth positive for tetA and tetB. Of the 97 sulfa-resistant bacteria screened, 9 were positive for sul2, 6 were positive for sul1, 1 isolate was positive for bothsul1 and sul2. The minimum inhibitory concentration (MIC) of tetracycline for tetA-carrying isolates were higher than those tetB-carrying isolates.while The MIC of sulfa for sul2-carrying isolates were higher than those sul1-carrying isolates. Indicating that tetA and sul2 gene may play ubknown roles in resisting tetracycline and sulfa than tetB and sul1 genes. The results showed the 4 kinds of genes (tetA,tetB,sul1,sul2) has no host specificity. All these 16S sequence are from the isolates which are positive for the above genes, it indicated the above antibiotic resistance genes are widespread in the environment regardless of the host. While the DNA sequence of these four genes showed tetA, sul1, sul2 genes are conservative in different bacteria , etB gene conserved poorly. The research aim is to get a preliminary understanding of resistance mechanism related to the resistant bacteria and the resistance genes in marine aquaculture environment through the analysis of resistant genes, providing research base for the prevention and treatment of drug-resistant bacteria so as to reduce the threat to the ecological environment, aquaculture and human health.

Cloning and characterization of NBS-LRR resistance gene ...

African Journals Online (AJOL)

biotech

2013-07-03

Jul 3, 2013 ... Rose using degernate primers designed from the conserved motifs of different plant resistance genes. A total of 40 sequences were hit with various R genes, of which 20 .... absorption ratio OD260 nm/OD280 nm between 1.80 and ..... status and outlook for small-holders agriculture in C S Gold and B.

Biokinetic Analysis and Metabolic Fate of 2,4-D in 2,4-D-Resistant Soybean (Glycine max).

Science.gov (United States)

Skelton, Joshua J; Simpson, David M; Peterson, Mark A; Riechers, Dean E

2017-07-26

The Enlist weed control system allows the use of 2,4-D in soybean but slight necrosis in treated leaves may be observed in the field. The objectives of this research were to measure and compare uptake, translocation, and metabolism of 2,4-D in Enlist (E, resistant) and non-AAD-12 transformed (NT, sensitive) soybeans. The adjuvant from the Enlist Duo herbicide formulation (ADJ) increased 2,4-D uptake (36%) and displayed the fastest rate of uptake (U 50 = 0.2 h) among treatments. E soybean demonstrated a faster rate of 2,4-D metabolism (M 50 = 0.2 h) compared to NT soybean, but glyphosate did not affect 2,4-D metabolism. Metabolites of 2,4-D in E soybean were qualitatively different than NT. Applying 2,4-D-ethylhexyl ester instead of 2,4-D choline (a quaternary ammonium salt) eliminated visual injury to E soybean, likely due to the time required for initial de-esterification and bioactivation. Excessive 2,4-D acid concentrations in E soybean resulting from ADJ-increased uptake may significantly contribute to foliar injury.

PCR detection of oxytetracycline resistance genes otr(A) and otr(B) in tetracycline-resistant streptomycete isolates from diverse habitats

NARCIS (Netherlands)

Nikolakopoulou, T; Egan, S; van Overbeek, L; Guillaume, G; Heuer, H; Wellington, EMH; van Elsas, JD; Collard, JM; Smalla, K; Karagouni, A

2005-01-01

A range of European habitats was screened by PCR for detection of the oxytetracycline resistance genes otr(A) and otr(B), found in the oxytetracycline-producing strain Streptomyces rimosus. Primers were developed to detect these otr genes in tetracycline-resistant (Tc-R) streptomycete isolates from

Identification and mapping of two powdery mildew resistance genes in Triticum boeoticum L.

Science.gov (United States)

Chhuneja, Parveen; Kumar, Krishan; Stirnweis, Daniel; Hurni, Severine; Keller, Beat; Dhaliwal, Harcharan S; Singh, Kuldeep

2012-04-01

Powdery mildew (PM) caused by Blumeria graminis f. sp. tritici (Bgt), is one of the important foliar diseases of wheat that can cause serious yield losses. Breeding for cultivars with diverse resources of resistance is the most promising approach for combating this disease. The diploid A genome progenitor species of wheat are an important resource for new variability for disease resistance genes. An accession of Triticum boeoticum (A(b)A(b)) showed resistance against a number of Bgt isolates, when tested using detached leaf segments. Inheritance studies in a recombinant inbred line population (RIL), developed from crosses of PM resistant T. boeoticum acc. pau5088 with a PM susceptible T. monococcum acc. pau14087, indicated the presence of two powdery mildew resistance genes in T. boeoticum acc. pau5088. Analysis of powdery mildew infection and molecular marker data of the RIL population revealed that both powdery mildew resistance genes are located on the long arm of chromosome 7A. Mapping was conducted using an integrated linkage map of 7A consisting of SSR, RFLP, STS, and DArT markers. These powdery mildew resistance genes are tentatively designated as PmTb7A.1 and PmTb7A.2. The PmTb7A.2 is closely linked to STS markers MAG2185 and MAG1759 derived from RFLP probes which are linked to powdery mildew resistance gene Pm1. This indicated that PmTb7A.2 might be allelic to Pm1. The PmTb7A.1, flanked by a DArT marker wPt4553 and an SSR marker Xcfa2019 in a 4.3 cM interval, maps proximal to PmT7A.2. PmTb7A.1 is putatively a new powdery mildew resistance gene. The powdery mildew resistance genes from T. boeoticum are currently being transferred to cultivated wheat background through marker-assisted backcrossing, using T. durum as bridging species.