WorldWideScience

Sample records for resistance genes present

  1. Rapid selection of Plasmodium falciparum chloroquine resistance transporter gene and multidrug resistance gene-1 haplotypes associated with past chloroquine and present artemether-lumefantrine use in Inhambane District, southern Mozambique

    DEFF Research Database (Denmark)

    Thomsen, Thomas T; Madsen, Laura B; Hansson, Helle H

    2013-01-01

    haplotype increased significantly between years (P = 0.039). The combination of P. falciparum chloroquine resistance transporter gene CVMNK and P. falciparum multidrug resistance gene NFD increased from 24.3% (2009) to 45.3% in (2010, P = 0.017). The rapid changes observed may largely be caused by decreased......Chloroquine (CQ) use in Mozambique was stopped in 2002 and artemether-lumefantrine (AL) was implemented in 2008. In light of no use of CQ and extensive use of AL, we determined the frequency of molecular markers of Plasmodium falciparum drug resistance/tolerance to CQ and AL in persons living...... in Linga-Linga, an isolated peninsula and in Furvela village, which is located 8 km inland. The P. falciparum chloroquine resistance transporter gene CVMNK wild type increased in frequency from 43.9% in 2009 to 66.4% in 2010 (P = 0.001), and combined P. falciparum multidrug resistance gene 1 N86-184F-D1246...

  2. Functional characterization of novel chitinase genes present in the sheath blight resistance QTL: qSBR11-1 in rice line Tetep

    Directory of Open Access Journals (Sweden)

    Richa eK

    2016-03-01

    Full Text Available Rice sheath blight disease caused by Rhizoctonia solani is one of the most devastating diseases in rice leading to heavy yield losses. Due to the polygenic nature of resistance, no major resistance gene with complete host resistance against R. solani has been reported. In this study, we have performed molecular and functional analysis of the genes associated with the major R. solani-resistance QTL qSBR11-1 in the indica rice line Tetep. Sequence analysis revealed the presence of a set of 11 tandem repeats containing genes with a high degree of homology to class III chitinase defense response genes. Real-time quantitative PCR analysis showed that all the genes are strongly induced 36 hours after R. solani infection. Comparison between the resistant Tetep and the susceptible HP2216 lines shows that the induction of the chitinase genes is much higher in the Tetep line. Recombinant protein produced in vitro for six of the eleven genes showed chitinolytic activity in gel assays but we did not detect any xylanase inhibitory activity. All the six in vitro expressed proteins show antifungal activity with a clear inhibitory effect on the growth of the R. solani mycelium. The characterized chitinase genes can provide an important resource for the genetic improvement of R. solani susceptible rice lines for sheath blight resistance breeding.

  3. Obesity genes and insulin resistance.

    Science.gov (United States)

    Belkina, Anna C; Denis, Gerald V

    2010-10-01

    The exploding prevalence of insulin resistance and Type 2 diabetes (T2D) linked to obesity has become an alarming public health concern. Worldwide, approximately 171 million people suffer from obesity-induced diabetes and public health authorities expect this situation to deteriorate rapidly. An interesting clinical population of 'metabolically healthy but obese' (MHO) cases is relatively protected from T2D and its associated cardiovascular risk. The molecular basis for this protection is not well understood but is likely to involve reduced inflammatory responses. The inflammatory cells and pathways that respond to overnutrition are the primary subject matter for this review. The chance discovery of a genetic mutation in the Brd2 gene, which is located in the class II major histocompatibility complex and makes mice enormously fat but protects them from diabetes, offers revolutionary new insights into the cellular mechanisms that link obesity to insulin resistance and T2D. These Brd2-hypomorphic mice have reduced inflammation in fat that is normally associated with insulin resistance, and resemble MHO patients, suggesting novel therapeutic pathways for obese patients at risk for T2D. Deeper understanding of the functional links between genes that control inflammatory responses to diet-induced obesity is crucial to the development of therapies for obese, insulin-resistant patients.

  4. The effect of metal ions commonly present in food on gene expression of sporulating Bacillus subtilis cells in relation to spore wet heat resistance.

    NARCIS (Netherlands)

    Oomes, S.J.C.M.; Brul, S.

    2004-01-01

    Bacillus subtilis is a food spoilage spore-forming bacterium. The spores can be very heat-resistant and may cause problems in the production of foods. Varying the metal concentration in the sporulation media is known to influence the heat resistance of the spores. The effect of changing the metal

  5. Microarray-based Detection of Antibiotic Resisteance Genes in Salmonella

    NARCIS (Netherlands)

    Hoek, van A.H.A.M.; Aarts, H.J.M.

    2008-01-01

    In the presented study, 143 Salmonella isolates belonging to 26 different serovars were screened for the presence of antibiotic resistance genes by microarray analysis. The microarray contained a total of 223 oligonucleotides representing genes encoding for resistance to the following antibiotic

  6. Bacterial Enzymes and Antibiotic Resistance- Oral Presentation

    Energy Technology Data Exchange (ETDEWEB)

    Maltz, Lauren [SLAC National Accelerator Lab., Menlo Park, CA (United States)

    2015-08-25

    By using protein crystallography and X-ray diffraction, structures of bacterial enzymes were solved to gain a better understanding of how enzymatic modification acts as an antibacterial resistance mechanism. Aminoglycoside phosphotransferases (APHs) are one of three aminoglycoside modifying enzymes that confer resistance to the aminoglycoside antibiotics via enzymatic modification, rendering many drugs obsolete. Specifically, the APH(2”) family vary in their substrate specificities and also in their preference for the phosphate donor (ADP versus GDP). By solving the structures of members of the APH(2”) family of enzymes, we can see how domain movements are important to their substrate specificity. Our structure of the ternary complex of APH(2”)-IIIa with GDP and kanamycin, when compared to the known structures of APH(2”)-IVa, reveals that there are real physical differences between these two enzymes, a structural finding that explains why the two enzymes differ in their preferences for certain aminoglycosides. Another important group of bacterial resistance enzymes are the Class D β-lactamases. Oxacillinase carbapenemases (OXAs) are part of this enzyme class and have begun to confer resistance to ‘last resort’ drugs, most notably carbapenems. Our structure of OXA-143 shows that the conformational flexibility of a conserved hydrophobic residue in the active site (Val130) serves to control the entry of a transient water molecule responsible for a key step in the enzyme’s mechanism. Our results provide insight into the structural mechanisms of these two different enzymes.

  7. Mutations in the Determining Region of Quinolone Resistance (QRDR of the gyrA gene of Neisseria gonorrhoeae present in clinical samples of men who have sex with men

    Directory of Open Access Journals (Sweden)

    Liz Sánchez Palencia

    2017-10-01

    Full Text Available Neisseria gonorrhoeae resistant to quinolones (QRNG becomes a very important problem in public health due to the development of rapid resistance to quinolones, which is why the WHO recommends reinforcing antimicrobial resistance monitoring to guide treatment. In Peru there are few reports on QRNG surveillance and still less work related to mutation patterns. This study aims to find mutations in the Determinant Region of Quinolone Resistance (QRDR of the gyrA gene of N. gonorrhoeae from 1096 clinical samples of urine and swabs from 367 men who have sex with men (MSM collected during the period 2012-2013. We detected 58 N. gonorrhoeae positive samples in 45 MSM by means of the APTIMA Combo 2 assay, and 11 QRNG positive samples of 11 MSM by Real Time PCR. The quinolone-resistant bacteria were analyzed by sequencing and we identified that the frequent mutation pattern was the double mutation of Ser-91 to Phe and Asp-95 to Gly in the QRDR of the gyrA gene. In conclusion, these double mutations in the QRDR sequence of the gyrA gene would indicate the presence of N. gonorrhoeae with quinolone resistant phenotype in clinical samples of MSM from Lima-Peru, noting that this is the first study done in Peru on this high population risk.

  8. Overexpression of antibiotic resistance genes in hospital effluents over time.

    Science.gov (United States)

    Rowe, Will P M; Baker-Austin, Craig; Verner-Jeffreys, David W; Ryan, Jim J; Micallef, Christianne; Maskell, Duncan J; Pearce, Gareth P

    2017-06-01

    Effluents contain a diverse abundance of antibiotic resistance genes that augment the resistome of receiving aquatic environments. However, uncertainty remains regarding their temporal persistence, transcription and response to anthropogenic factors, such as antibiotic usage. We present a spatiotemporal study within a river catchment (River Cam, UK) that aims to determine the contribution of antibiotic resistance gene-containing effluents originating from sites of varying antibiotic usage to the receiving environment. Gene abundance in effluents (municipal hospital and dairy farm) was compared against background samples of the receiving aquatic environment (i.e. the catchment source) to determine the resistome contribution of effluents. We used metagenomics and metatranscriptomics to correlate DNA and RNA abundance and identified differentially regulated gene transcripts. We found that mean antibiotic resistance gene and transcript abundances were correlated for both hospital ( ρ  = 0.9, two-tailed P  resistance genes ( bla GES and bla OXA ) were overexpressed in all hospital effluent samples. High β-lactam resistance gene transcript abundance was related to hospital antibiotic usage over time and hospital effluents contained antibiotic residues. We conclude that effluents contribute high levels of antibiotic resistance genes to the aquatic environment; these genes are expressed at significant levels and are possibly related to the level of antibiotic usage at the effluent source. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy.

  9. Plasmids carrying antimicrobial resistance genes in Enterobacteriaceae

    NARCIS (Netherlands)

    Rozwandowicz, M.; Brouwer, M.S.M.; Fischer, J.; Wagenaar, J.A.; Gonzalez-Zorn, B.; Guerra, B.; Mevius, D.J.; Hordijk, J.

    2018-01-01

    Bacterial antimicrobial resistance (AMR) is constantly evolving and horizontal gene transfer through plasmids plays a major role. The identification of plasmid characteristics and their association with different bacterial hosts provides crucial knowledge that is essential to understand the

  10. Identification of acquired antimicrobial resistance genes

    DEFF Research Database (Denmark)

    Zankari, Ea; Hasman, Henrik; Cosentino, Salvatore

    2012-01-01

    ObjectivesIdentification of antimicrobial resistance genes is important for understanding the underlying mechanisms and the epidemiology of antimicrobial resistance. As the costs of whole-genome sequencing (WGS) continue to decline, it becomes increasingly available in routine diagnostic laborato......ObjectivesIdentification of antimicrobial resistance genes is important for understanding the underlying mechanisms and the epidemiology of antimicrobial resistance. As the costs of whole-genome sequencing (WGS) continue to decline, it becomes increasingly available in routine diagnostic...... laboratories and is anticipated to substitute traditional methods for resistance gene identification. Thus, the current challenge is to extract the relevant information from the large amount of generated data.MethodsWe developed a web-based method, ResFinder that uses BLAST for identification of acquired...... antimicrobial resistance genes in whole-genome data. As input, the method can use both pre-assembled, complete or partial genomes, and short sequence reads from four different sequencing platforms. The method was evaluated on 1862 GenBank files containing 1411 different resistance genes, as well as on 23 de...

  11. Antibiotic-resistant gonococci — past, present and future

    African Journals Online (AJOL)

    key changes in recommended therapy for gonorrhoea over past decades. The recent emergence of .... Table I. Some of the key effects of mutations in the penA, penB, mtr and pem genes resulting in chromosomal resistance to penicillin. Gene Effect of mutation ... Health Organization (WHO). The presence of a self-mobile.

  12. Exploring Antibiotic Resistance Genes and Metal Resistance Genes in Plasmid Metagenomes from Wastewater Treatment Plants

    Directory of Open Access Journals (Sweden)

    An-Dong eLi

    2015-09-01

    Full Text Available Plasmids operate as independent genetic elements in microorganism communities. Through horizontal gene transfer, they can provide their host microorganisms with important functions such as antibiotic resistance and heavy metal resistance. In this study, six metagenomic libraries were constructed with plasmid DNA extracted from influent, activated sludge and digested sludge of two wastewater treatment plants. Compared with the metagenomes of the total DNA extracted from the same sectors of the wastewater treatment plant, the plasmid metagenomes had significantly higher annotation rates, indicating that the functional genes on plasmids are commonly shared by those studied microorganisms. Meanwhile, the plasmid metagenomes also encoded many more genes related to defense mechanisms, including ARGs. Searching against an antibiotic resistance genes (ARGs database and a metal resistance genes (MRGs database revealed a broad-spectrum of antibiotic (323 out of a total 618 subtypes and metal resistance genes (23 out of a total 23 types on these plasmid metagenomes. The influent plasmid metagenomes contained many more resistance genes (both ARGs and MRGs than the activated sludge and the digested sludge metagenomes. Sixteen novel plasmids with a complete circular structure that carried these resistance genes were assembled from the plasmid metagenomes. The results of this study demonstrated that the plasmids in wastewater treatment plants could be important reservoirs for resistance genes, and may play a significant role in the horizontal transfer of these genes.

  13. Resistance Genes in Global Crop Breeding Networks.

    Science.gov (United States)

    Garrett, K A; Andersen, K F; Asche, F; Bowden, R L; Forbes, G A; Kulakow, P A; Zhou, B

    2017-10-01

    Resistance genes are a major tool for managing crop diseases. The networks of crop breeders who exchange resistance genes and deploy them in varieties help to determine the global landscape of resistance and epidemics, an important system for maintaining food security. These networks function as a complex adaptive system, with associated strengths and vulnerabilities, and implications for policies to support resistance gene deployment strategies. Extensions of epidemic network analysis can be used to evaluate the multilayer agricultural networks that support and influence crop breeding networks. Here, we evaluate the general structure of crop breeding networks for cassava, potato, rice, and wheat. All four are clustered due to phytosanitary and intellectual property regulations, and linked through CGIAR hubs. Cassava networks primarily include public breeding groups, whereas others are more mixed. These systems must adapt to global change in climate and land use, the emergence of new diseases, and disruptive breeding technologies. Research priorities to support policy include how best to maintain both diversity and redundancy in the roles played by individual crop breeding groups (public versus private and global versus local), and how best to manage connectivity to optimize resistance gene deployment while avoiding risks to the useful life of resistance genes. [Formula: see text] Copyright © 2017 The Author(s). This is an open access article distributed under the CC BY 4.0 International license .

  14. Distribution of Florfenicol Resistance Genes fexA and cfr among Chloramphenicol-Resistant Staphylococcus Isolates

    Science.gov (United States)

    Kehrenberg, Corinna; Schwarz, Stefan

    2006-01-01

    A total of 302 chloramphenicol-resistant Staphylococcus isolates were screened for the presence of the florfenicol/chloramphenicol resistance genes fexA and cfr and their localization on mobile genetic elements. Of the 114 isolates from humans, only a single Staphylococcus aureus isolate showed an elevated MIC to florfenicol, but did not carry either of the known resistance genes, cfr or fexA. In contrast, 11 of the 188 staphylococci from animal sources were considered florfenicol resistant and carried either cfr (one isolate), fexA (five isolates), or both resistance genes (five isolates). In nine cases we confirmed that these genes were carried on a plasmid. Five different types of plasmids could be differentiated on the basis of their sizes, restriction patterns, and resistance genes. The gene fexA, which has previously been shown to be part of the nonconjugative transposon Tn558, was identified in 10 of the 11 resistant isolates from animals. PCR assays were developed to detect different parts of this transposon as well as their physical linkage. Complete copies of Tn558 were found in five different isolates and shown by inverse PCR to be functionally active. Truncated copies of Tn558, in which the tnpA-tnpB area was in part deleted by the integration of a 4,674-bp segment including the gene cfr and a novel 2,446-bp IS21-like insertion sequence, were seen in a plasmid present in three staphylococcal isolates. PMID:16569824

  15. Interspecies gene transfer provides soybean resistance to a fungal pathogen.

    Science.gov (United States)

    Langenbach, Caspar; Schultheiss, Holger; Rosendahl, Martin; Tresch, Nadine; Conrath, Uwe; Goellner, Katharina

    2016-02-01

    Fungal pathogens pose a major challenge to global crop production. Crop varieties that resist disease present the best defence and offer an alternative to chemical fungicides. Exploiting durable nonhost resistance (NHR) for crop protection often requires identification and transfer of NHR-linked genes to the target crop. Here, we identify genes associated with NHR of Arabidopsis thaliana to Phakopsora pachyrhizi, the causative agent of the devastating fungal disease called Asian soybean rust. We transfer selected Arabidopsis NHR-linked genes to the soybean host and discover enhanced resistance to rust disease in some transgenic soybean lines in the greenhouse. Interspecies NHR gene transfer thus presents a promising strategy for genetically engineered control of crop diseases. © 2015 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  16. Antimicrobial Peptide Resistance Genes in the Plant Pathogen Dickeya dadantii.

    Science.gov (United States)

    Pandin, Caroline; Caroff, Martine; Condemine, Guy

    2016-11-01

    Modification of teichoic acid through the incorporation of d-alanine confers resistance in Gram-positive bacteria to antimicrobial peptides (AMPs). This process involves the products of the dltXABCD genes. These genes are widespread in Gram-positive bacteria, and they are also found in a few Gram-negative bacteria. Notably, these genes are present in all soft-rot enterobacteria (Pectobacterium and Dickeya) whose dltDXBAC operons have been sequenced. We studied the function and regulation of these genes in Dickeya dadantii dltB expression was induced in the presence of the AMP polymyxin. It was not regulated by PhoP, which controls the expression of some genes involved in AMP resistance, but was regulated by ArcA, which has been identified as an activator of genes involved in AMP resistance. However, arcA was not the regulator responsible for polymyxin induction of these genes in this bacterium, which underlines the complexity of the mechanisms controlling AMP resistance in D. dadantii Two other genes involved in resistance to AMPs have also been characterized, phoS and phoH dltB, phoS, phoH, and arcA but not dltD mutants were more sensitive to polymyxin than the wild-type strain. Decreased fitness of the dltB, phoS, and phoH mutants in chicory leaves indicates that their products are important for resistance to plant AMPs. Gram-negative bacteria can modify their lipopolysaccharides (LPSs) to resist antimicrobial peptides (AMPs). Soft-rot enterobacteria (Dickeya and Pectobacterium spp.) possess homologues of the dlt genes in their genomes which, in Gram-positive bacteria, are involved in resistance to AMPs. In this study, we show that these genes confer resistance to AMPs, probably by modifying LPSs, and that they are required for the fitness of the bacteria during plant infection. Two other new genes involved in resistance were also analyzed. These results show that bacterial resistance to AMPs can occur in bacteria through many different mechanisms that need to be

  17. Yr32 for resistance to stripe (yellow) rust present in the wheat cultivar Carstens V

    DEFF Research Database (Denmark)

    Eriksen, L.; Afshari, F.; Christiansen, M.J.

    2004-01-01

    Stripe or yellow rust of wheat, caused by Puccinia striiformis f. sp. tritici, is an important disease in many wheat-growing regions of the world. A number of major genes providing resistance to stripe rust have been used in breeding, including one gene that is present in the differential tester...... Carstens V. The objective of this study was to locate and map a stripe rust resistance gene transferred from Carstens V to Avocet S and to use molecular tools to locate a number of genes segregating in the cross Savannah/Senat. One of the genes present in Senat was predicted to be a gene that is present...... in Carstens V. For this latter purpose, stripe rust response data from both seedling and field tests on a doubled haploid population consisting of 77 lines were compared to an available molecular map for the same lines using a non-parametric quantitative trait loci (QTL) analysis. Results obtained in Denmark...

  18. Novel streptomycin and spectinomycin resistance gene as a gene cassette within a class 1 integron isolated from Escherichia coli

    DEFF Research Database (Denmark)

    Sandvang, D.

    1999-01-01

    The aadA genes, encoding resistance to streptomycin and spectinomycin, have been found as gene cassettes in different gram-negative and gram-positive bacterial species. The present study has revealed the sequence of a new gene, aadA5, integrated as a gene cassette together with the trimethoprim...... resistance gene dfr7 in a class 1 integron. The integron was located on a plasmid and was identified in a pathogenic porcine Escherichia coli isolate....

  19. Novel Streptomycin and Spectinomycin Resistance Gene as a Gene Cassette within a Class 1 Integron Isolated from Escherichia coli

    Science.gov (United States)

    Sandvang, Dorthe

    1999-01-01

    The aadA genes, encoding resistance to streptomycin and spectinomycin, have been found as gene cassettes in different gram-negative and gram-positive bacterial species. The present study has revealed the sequence of a new gene, aadA5, integrated as a gene cassette together with the trimethoprim resistance gene dfr7 in a class 1 integron. The integron was located on a plasmid and was identified in a pathogenic porcine Escherichia coli isolate. PMID:10582907

  20. Expression Study of Banana Pathogenic Resistance Genes

    Directory of Open Access Journals (Sweden)

    Fenny M. Dwivany

    2016-10-01

    Full Text Available Banana is one of the world's most important trade commodities. However, infection of banana pathogenic fungi (Fusarium oxysporum race 4 is one of the major causes of decreasing production in Indonesia. Genetic engineering has become an alternative way to control this problem by isolating genes that involved in plant defense mechanism against pathogens. Two of the important genes are API5 and ChiI1, each gene encodes apoptosis inhibitory protein and chitinase enzymes. The purpose of this study was to study the expression of API5 and ChiI1 genes as candidate pathogenic resistance genes. The amplified fragments were then cloned, sequenced, and confirmed with in silico studies. Based on sequence analysis, it is showed that partial API5 gene has putative transactivation domain and ChiI1 has 9 chitinase family GH19 protein motifs. Data obtained from this study will contribute in banana genetic improvement.

  1. Mapping of stripe rust resistance gene in an Aegilops caudata ...

    Indian Academy of Sciences (India)

    ... rust resistance depicted a single major gene conditioning adult plant resistance (APR) with stripe rust reaction varying from TR-20MS in resistant RILs signifying the presence of some minor genes as well. Genetic association with leaf rust resistance revealed that two genes are located at a recombination distance of 13%.

  2. Influence of Soil Use on Prevalence of Tetracycline, Streptomycin, and Erythromycin Resistance and Associated Resistance Genes

    Science.gov (United States)

    Rzeczycka, Marzenna; Miernik, Antoni; Krawczyk-Balska, Agata; Walsh, Fiona; Duffy, Brion

    2012-01-01

    This study examined differences in antibiotic-resistant soil bacteria and the presence and quantity of resistance genes in soils with a range of management histories. We analyzed four soils from agricultural systems that were amended with manure from animals treated with erythromycin and exposed to streptomycin and/or oxytetracycline, as well as non-manure-amended compost and forest soil. Low concentrations of certain antibiotic resistance genes were detected using multiplex quantitative real-time PCR (qPCR), with tet(B), aad(A), and str(A) each present in only one soil and tet(M) and tet(W) detected in all soils. The most frequently detected resistance genes were tet(B), tet(D), tet(O), tet(T), and tet(W) for tetracycline resistance, str(A), str(B), and aac for streptomycin resistance, and erm(C), erm(V), erm(X), msr(A), ole(B), and vga for erythromycin resistance. Transposon genes specific for Tn916, Tn1549, TnB1230, Tn4451, and Tn5397 were detected in soil bacterial isolates. The MIC ranges of isolated bacteria for tetracycline, streptomycin, and erythromycin were 8 to >256 μg/ml, 6 to >1,024 μg/ml, and 0.094 to >256 μg/ml, respectively. Based on 16S rRNA gene similarity, isolated bacteria showed high sequence identity to genera typical of soil communities. Bacteria with the highest MICs were detected in manure-amended soils or soils from agricultural systems with a history of antibiotic use. Non-manure-amended soils yielded larger proportions of antibiotic-resistant bacteria, but these had lower MICs, carried fewer antibiotic resistance genes, and did not display multidrug resistance (MDR). PMID:22203596

  3. Influence of soil use on prevalence of tetracycline, streptomycin, and erythromycin resistance and associated resistance genes.

    Science.gov (United States)

    Popowska, Magdalena; Rzeczycka, Marzenna; Miernik, Antoni; Krawczyk-Balska, Agata; Walsh, Fiona; Duffy, Brion

    2012-03-01

    This study examined differences in antibiotic-resistant soil bacteria and the presence and quantity of resistance genes in soils with a range of management histories. We analyzed four soils from agricultural systems that were amended with manure from animals treated with erythromycin and exposed to streptomycin and/or oxytetracycline, as well as non-manure-amended compost and forest soil. Low concentrations of certain antibiotic resistance genes were detected using multiplex quantitative real-time PCR (qPCR), with tet(B), aad(A), and str(A) each present in only one soil and tet(M) and tet(W) detected in all soils. The most frequently detected resistance genes were tet(B), tet(D), tet(O), tet(T), and tet(W) for tetracycline resistance, str(A), str(B), and aac for streptomycin resistance, and erm(C), erm(V), erm(X), msr(A), ole(B), and vga for erythromycin resistance. Transposon genes specific for Tn916, Tn1549, TnB1230, Tn4451, and Tn5397 were detected in soil bacterial isolates. The MIC ranges of isolated bacteria for tetracycline, streptomycin, and erythromycin were 8 to >256 μg/ml, 6 to >1,024 μg/ml, and 0.094 to >256 μg/ml, respectively. Based on 16S rRNA gene similarity, isolated bacteria showed high sequence identity to genera typical of soil communities. Bacteria with the highest MICs were detected in manure-amended soils or soils from agricultural systems with a history of antibiotic use. Non-manure-amended soils yielded larger proportions of antibiotic-resistant bacteria, but these had lower MICs, carried fewer antibiotic resistance genes, and did not display multidrug resistance (MDR).

  4. Deinococcus geothermalis: The Pool of Extreme Radiation Resistance Genes Shrinks

    Energy Technology Data Exchange (ETDEWEB)

    Makarova, Kira S. [National Center for Biotechnology Information; Omelchenko, Marina [National Center for Biotechnology Information; Gaidamakova, Elena [Uniformed Services University of the Health Sciences (USUHS); Matrosova, Vera [Uniformed Services University of the Health Sciences (USUHS); Vasilenko, Alexander [Uniformed Services University of the Health Sciences (USUHS); Zhai, Min [Uniformed Services University of the Health Sciences (USUHS); Lapidus, Alla L. [U.S. Department of Energy, Joint Genome Institute; Copeland, A [U.S. Department of Energy, Joint Genome Institute; Kim, Edwin [U.S. Department of Energy, Joint Genome Institute; Land, Miriam L [ORNL; Mavromatis, K [U.S. Department of Energy, Joint Genome Institute; Pitluck, Samual [U.S. Department of Energy, Joint Genome Institute; Richardson, P M [U.S. Department of Energy, Joint Genome Institute; Detter, J. Chris [U.S. Department of Energy, Joint Genome Institute; Brettin, Tom [Los Alamos National Laboratory (LANL); Saunders, Elizabeth H [Los Alamos National Laboratory (LANL); Lai, Barry [Argonne National Laboratory (ANL); Ravel, Bruce [Argonne National Laboratory (ANL); Kemner, Kenneth M [Argonne National Laboratory (ANL); Wolf, Yuri [National Center for Biotechnology Information; Sorokin, Alexei [Genetique Microbienne; Gerasimova, Anna [Research Institute of Genetics and Selection of Industrial Microorganisms, Mosco; Gelfand, Mikhail [Moscow State University; Fredrickson, James K [Pacific Northwest National Laboratory (PNNL); Koonin, Eugene [National Center for Biotechnology Information; Daly, Michael [Uniformed Services University of the Health Sciences (USUHS)

    2007-01-01

    Bacteria of the genus Deinococcus are extremely resistant to ionizing radiation (IR), ultraviolet light (UV) and desiccation. The mesophile Deinococcus radiodurans was the first member of this group whose genome was completely sequenced. Analysis of the genome sequence of D. radiodurans, however, failed to identify unique DNA repair systems. To further delineate the genes underlying the resistance phenotypes, we report the whole-genome sequence of a second Deinococcus species, the thermophile Deinococcus geothermalis, which at its optimal growth temperature is as resistant to IR, UV and desiccation as D. radiodurans, and a comparative analysis of the two Deinococcus genomes. Many D. radiodurans genes previously implicated in resistance, but for which no sensitive phenotype was observed upon disruption, are absent in D. geothermalis. In contrast, most D. radiodurans genes whose mutants displayed a radiation-sensitive phenotype in D. radiodurans are conserved in D. geothermalis. Supporting the existence of a Deinococcus radiation response regulon, a common palindromic DNA motif was identified in a conserved set of genes associated with resistance, and a dedicated transcriptional regulator was predicted. We present the case that these two species evolved essentially the same diverse set of gene families, and that the extreme stress-resistance phenotypes of the Deinococcus lineage emerged progressively by amassing cell-cleaning systems from different sources, but not by acquisition of novel DNA repair systems. Our reconstruction of the genomic evolution of the Deinococcus-Thermus phylum indicates that the corresponding set of enzymes proliferated mainly in the common ancestor of Deinococcus. Results of the comparative analysis weaken the arguments for a role of higher-order chromosome alignment structures in resistance; more clearly define and substantially revise downward the number of uncharacterized genes that might participate in DNA repair and contribute to

  5. Deinococcus geothermalis: The Pool of Extreme Radiation Resistance Genes Shrinks

    Energy Technology Data Exchange (ETDEWEB)

    Makarova, Kira S.; Omelchenko, Marina V.; Gaidamakova, Elena K.; Matrosova, Vera Y.; Vasilenko, Alexander; Zhai, Min; Lapidus, Alla; Copeland, Alex; Kim, Edwin; Land, Miriam; Mavrommatis, Konstantinos; Pitluck, Samuel; Richardson, Paul M.; Detter, Chris; Brettin, Thomas; Saunders, Elizabeth; Lai, Barry; Ravel, Bruce; Kemner, Kenneth M.; Wolf, Yuri I.; Sorokin, Alexander; Gerasimova, Anna V.; Gelfand, Mikhail S.; Fredrickson, James K.; Koonin, Eugene V.; Daly, Michael J.

    2007-07-24

    Bacteria of the genus Deinococcus are extremely resistant to ionizing radiation (IR), ultraviolet light (UV) and desiccation. The mesophile Deinococcus radiodurans was the first member of this group whose genome was completely sequenced. Analysis of the genome sequence of D. radiodurans, however, failed to identify unique DNA repair systems. To further delineate the genes underlying the resistance phenotypes, we report the whole-genome sequence of a second Deinococcus species, the thermophile Deinococcus geothermalis, which at itsoptimal growth temperature is as resistant to IR, UV and desiccation as D. radiodurans, and a comparative analysis of the two Deinococcus genomes. Many D. radiodurans genes previously implicated in resistance, but for which no sensitive phenotype was observed upon disruption, are absent in D. geothermalis. In contrast, most D. radiodurans genes whose mutants displayed a radiation-sensitive phenotype in D. radiodurans are conserved in D. geothermalis. Supporting the existence of a Deinococcus radiation response regulon, a common palindromic DNA motif was identified in a conserved set of genes associated with resistance, and a dedicated transcriptional regulator was predicted. We present the case that these two species evolved essentially the same diverse set of gene families, and that the extreme stress-resistance phenotypes of the Deinococcus lineage emerged progressively by amassing cell-cleaning systems from different sources, but not by acquisition of novel DNA repair systems. Our reconstruction of the genomic evolution of the Deinococcus-Thermus phylum indicates that the corresponding set of enzymes proliferated mainly in the common ancestor of Deinococcus. Results of the comparative analysis weaken the arguments for a role of higher-order chromosome alignment structures in resistance; more clearly define and substantially revise downward the number of uncharacterized genes that might participate in DNA repair and contribute to

  6. Antibiotic resistance and virulence genes in coliform water isolates.

    Science.gov (United States)

    Stange, C; Sidhu, J P S; Tiehm, A; Toze, S

    2016-11-01

    Widespread fecal pollution of surface water may present a major health risk and a significant pathway for dissemination of antibiotic resistance bacteria. The River Rhine is one of the longest and most important rivers in Europe and an important raw water source for drinking water production. A total of 100 coliform isolates obtained from River Rhine (Germany) were examined for their susceptibility to seven antimicrobial agents. Resistances against amoxicillin, trimethoprim/sulfamethoxazole and tetracycline were detected in 48%, 11% and 9% of isolates respectively. The antibiotic resistance could be traced back to the resistance genes bla TEM , bla SHV , ampC, sul1, sul2, dfrA1, tet(A) and tet(B). Whereby, the ampC gene represents a special case, because its presence is not inevitably linked to a phenotypic antibiotic resistance. Multiple antibiotics resistance was often accompanied by the occurrence of class 1 or 2 integrons. E. coli isolates belonging to phylogenetic groups A and B1 (commensal) were more predominant (57%) compared to B2 and D groups (43%) which are known to carry virulent genes. Additionally, six E. coli virulence genes were also detected. However, the prevalence of virulence genes in the E. coli isolates was low (not exceeding 4.3% per gene) and no diarrheagenic E. coli pathotypes were detected. This study demonstrates that surface water is an important reservoir of ARGs for a number of antibiotic classes such as sulfonamide, trimethoprim, beta-lactam-antibiotics and tetracycline. The occurrence of antibiotic resistance in coliform bacteria isolated from River Rhine provides evidence for the need to develop management strategies to limit the spread of antibiotic resistant bacteria in aquatic environment. Copyright © 2016 Elsevier GmbH. All rights reserved.

  7. Deinococcus geothermalis: the pool of extreme radiation resistance genes shrinks.

    Directory of Open Access Journals (Sweden)

    Kira S Makarova

    2007-09-01

    Full Text Available Bacteria of the genus Deinococcus are extremely resistant to ionizing radiation (IR, ultraviolet light (UV and desiccation. The mesophile Deinococcus radiodurans was the first member of this group whose genome was completely sequenced. Analysis of the genome sequence of D. radiodurans, however, failed to identify unique DNA repair systems. To further delineate the genes underlying the resistance phenotypes, we report the whole-genome sequence of a second Deinococcus species, the thermophile Deinococcus geothermalis, which at its optimal growth temperature is as resistant to IR, UV and desiccation as D. radiodurans, and a comparative analysis of the two Deinococcus genomes. Many D. radiodurans genes previously implicated in resistance, but for which no sensitive phenotype was observed upon disruption, are absent in D. geothermalis. In contrast, most D. radiodurans genes whose mutants displayed a radiation-sensitive phenotype in D. radiodurans are conserved in D. geothermalis. Supporting the existence of a Deinococcus radiation response regulon, a common palindromic DNA motif was identified in a conserved set of genes associated with resistance, and a dedicated transcriptional regulator was predicted. We present the case that these two species evolved essentially the same diverse set of gene families, and that the extreme stress-resistance phenotypes of the Deinococcus lineage emerged progressively by amassing cell-cleaning systems from different sources, but not by acquisition of novel DNA repair systems. Our reconstruction of the genomic evolution of the Deinococcus-Thermus phylum indicates that the corresponding set of enzymes proliferated mainly in the common ancestor of Deinococcus. Results of the comparative analysis weaken the arguments for a role of higher-order chromosome alignment structures in resistance; more clearly define and substantially revise downward the number of uncharacterized genes that might participate in DNA repair and

  8. Antibiotic-Resistance Genes in Waste Water.

    Science.gov (United States)

    Karkman, Antti; Do, Thi Thuy; Walsh, Fiona; Virta, Marko P J

    2018-03-01

    Waste water and waste water treatment plants can act as reservoirs and environmental suppliers of antibiotic resistance. They have also been proposed to be hotspots for horizontal gene transfer, enabling the spread of antibiotic resistance genes between different bacterial species. Waste water contains antibiotics, disinfectants, and metals which can form a selection pressure for antibiotic resistance, even in low concentrations. Our knowledge of antibiotic resistance in waste water has increased tremendously in the past few years with advances in the molecular methods available. However, there are still some gaps in our knowledge on the subject, such as how active is horizontal gene transfer in waste water and what is the role of the waste water treatment plant in the environmental resistome? The purpose of this review is to briefly describe some of the main methods for studying antibiotic resistance in waste waters and the latest research and main knowledge gaps on the issue. In addition, some future research directions are proposed. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Antimicrobial resistance and resistance gene determinants in clinical Escherichia coli from different animal species in Switzerland.

    Science.gov (United States)

    Lanz, Roland; Kuhnert, Peter; Boerlin, Patrick

    2003-01-02

    Antimicrobial susceptibility testing was performed on a total of 581 clinical Escherichia coli isolates from diarrhea and edema disease in pigs, from acute mastitis in dairy cattle, from urinary tract infections in dogs and cats, and from septicemia in laying hens collected in Switzerland between 1999 and 2001. Among the 16 antimicrobial agents tested, resistance was most frequent for sulfonamides, tetracycline, and streptomycin. Isolates from swine presented significantly more resistance than those from the other animal species. The distribution of the resistance determinants for sulfonamides, tetracycline, and streptomycin was assessed by hybridization and PCR in resistant isolates. Significant differences in the distribution of resistance determinants for tetracycline (tetA, tetB) and sulfonamides (sulII) were observed between the isolates from swine and those from the other species. Resistance to sulfonamides could not be explained by known resistance mechanisms in more than a quarter of the sulfonamide-resistant and sulfonamide-intermediate isolates from swine, dogs and cats. This finding suggests that one or several new resistance mechanisms for sulfonamides may be widespread among E. coli isolates from these animal species. The integrase gene (intI) from class I integrons was detected in a large proportion of resistant isolates in association with the sulI and aadA genes, thus demonstrating the importance of integrons in the epidemiology of resistance in clinical E. coli isolates from animals.

  10. Vancomycin-resistance phenotypes, vancomycin-resistance genes, and resistance to antibiotics of enterococci isolated from food of animal origin.

    Science.gov (United States)

    Gousia, Panagiota; Economou, Vangelis; Bozidis, Petros; Papadopoulou, Chrissanthy

    2015-03-01

    In the present study, 500 raw beef, pork, and chicken meat samples and 100 pooled egg samples were analyzed for the presence of vancomycin-resistant enterococci, vancomycin-resistance phenotypes, and resistance genes. Of 141 isolates of enterococci, 88 strains of Enterococcus faecium and 53 strains of E. faecalis were identified. The most prevalent species was E. faecium. Resistance to ampicillin (n = 93, 66%), ciprofloxacin (n = 74, 52.5%), erythromycin (n = 73, 51.8%), penicillin (n = 59, 41.8%) and tetracycline (n = 52, 36.9%) was observed, while 53.2% (n = 75) of the isolates were multiresistant and 15.6% (n = 22) were susceptible to all antibiotics. Resistance to vancomycin was exhibited in 34.1% (n = 30) of the E. faecium isolates (n = 88) and 1.9% (n = 1) of the E. faecalis isolates (n = 53) using the disc-diffusion test and the E-test. All isolates were tested for vanA and vanB using real-time polymerase chain reaction (PCR) and multiplex PCR, and for vanC, vanD, vanE, vanG genes using multiplex PCR only. Among E. faecalis isolates, no resistance genes were identified. Among the E. faecium isolates, 28 carried the vanA gene when tested by multiplex PCR and 29 when tested with real-time PCR. No isolate carrying the vanC, vanD, vanE, or vanG genes was identified. Melting-curve analysis of the positive real-time PCR E. faecium isolates showed that 22 isolates carried the vanA gene only, 2 isolates the vanB2,3 genes only, and seven isolates carried both the vanA and vanB2,3 genes. Enterococci should be considered a significant zoonotic pathogen and a possible reservoir of genes encoding resistance potentially transferred to other bacterial species.

  11. Fate of antibiotic resistance genes and metal resistance genes during thermophilic aerobic digestion of sewage sludge.

    Science.gov (United States)

    Jang, Hyun Min; Lee, Jangwoo; Kim, Young Beom; Jeon, Jong Hun; Shin, Jingyeong; Park, Mee-Rye; Kim, Young Mo

    2018-02-01

    This study examines the fate of twenty-three representative antibiotic resistance genes (ARGs) encoding tetracyclines, sulfonamides, quinolones, β-lactam antibiotics, macrolides, florfenicol and multidrug resistance during thermophilic aerobic digestion (TAD) of sewage sludge. The bacterial community, class 1 integrons (intI1) and four metal resistance genes (MRGs) were also quantified to determine the key drivers of changes in ARGs during TAD. At the end of digestion, significant decreases in the quantities of ARGs, MRGs and intI1 as well as 16S rRNA genes were observed. Partial redundancy analysis (RDA) showed that shifts in temperature were the key factors affecting a decrease in ARGs. Shifts in temperature led to decreased amounts of ARGs by reducing resistome and bacterial diversity, rather than by lowering horizontal transfer potential via intI1 or co-resistance via MRGs. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Plant resistance genes : their structure, function and evolution

    NARCIS (Netherlands)

    Takken, F.L.W.; Joosten, M.H.A.J.

    2000-01-01

    Plants have developed efficient mechanisms to avoid infection or to mount responses that render them resistant upon attack by a pathogen. One of the best-studied defence mechanisms is based on gene-for-gene resistance through which plants, harbouring specific resistance (R) genes, specifically

  13. Incidence of antimicrobial-resistance genes and integrons in antibiotic-resistant bacteria isolated from eels and aquaculture ponds.

    Science.gov (United States)

    Lin, Mao; Wu, Xiaomei; Yan, Qingpi; Ma, Ying; Huang, Lixing; Qin, Yingxue; Xu, Xiaojin

    2016-07-07

    The overuse of antimicrobials in aquaculture has promoted the selection of antimicrobial-resistant bacteria. Here we investigated the abundance of antimicrobial-resistance genes and integrons in 108 strains of antibiotic-resistant bacteria isolated from eels and aquaculture ponds in China. Conventional PCR was implemented to examine common antibiotic-resistance genes, integrons, and their gene cassette arrays. The results showed that the antibiotic-resistance genes blaTEM, tetC, sulI, aadA, floR, and qnrB were detected at high percentages, as were a number of other resistance genes. Class I integrons were present in 79.63% of the strains, and 10 out of 108 isolates carried class II integrons. Class III integrons were not detected. Three strains carried both class I and class II integrons, and 73.26% of the class I integron-positive isolates contained the qacEΔ1/sul1 gene. Fourteen types of integron cassette arrays were found among class I integron-positive isolates. A new array, dfrB4-catB3-blaOXA-10-aadA1, was discovered in this study. The gene cassette array dfrA12-orfF-aadA2 was the most widely distributed. In summary, 23 different gene cassettes encoding resistance to 8 classes of antibiotics were identified in the class I integrons, and the main cassettes contained genes encoding resistance to aminoglycosides (aad) and trimethoprim (dfr). All class II integron-positive strains had only a single gene cassette array, viz. dfrA1-catB2-sat2-aadA1. High levels of antimicrobial-resistance genes and integrons in eels and auqauculture ponds suggest that the overuse of antimicrobials should be strictly controlled and that the levels of bacterial antimicrobial-resistance genes in aquaculture should be monitored.

  14. Multi drug resistant tuberculosis presenting as anterior mediastinal mass

    Directory of Open Access Journals (Sweden)

    Parmarth Chandane

    2016-01-01

    Full Text Available Enlargement of the mediastinal lymphatic glands is a common presentation of intrathoracic tuberculosis (TB in children. However, usually, the mediastinal TB nodes enlarge to 2.8 ± 1.0 cm. In this report, we describe a case of anterior mediastinal lymphnode TB seen as huge mass (7 cm on computed tomography (CT thorax without respiratory or food pipe compromise despite anterior mediastinum being an enclosed space. CT guided biopsy of the mass cultured Mycobacterium TB complex which was resistant to isoniazide, rifampicin, streptomycin ofloxacin, moxifloxacin, and pyrazinamide. Hence, we report primary multi drug resistant TB presenting as anterior mediastinal mass as a rare case report.

  15. Anthropogenic antibiotic resistance genes mobilization to the polar regions.

    Science.gov (United States)

    Hernández, Jorge; González-Acuña, Daniel

    2016-01-01

    Anthropogenic influences in the southern polar region have been rare, but lately microorganisms associated with humans have reached Antarctica, possibly from military bases, fishing boats, scientific expeditions, and/or ship-borne tourism. Studies of seawater in areas of human intervention and proximal to fresh penguin feces revealed the presence of Escherichia coli strains least resistant to antibiotics in penguins, whereas E. coli from seawater elsewhere showed resistance to one or more of the following antibiotics: ampicillin, tetracycline, streptomycin, and trim-sulfa. In seawater samples, bacteria were found carrying extended-spectrum β-lactamase (ESBL)-type CTX-M genes in which multilocus sequencing typing (MLST) showed different sequence types (STs), previously reported in humans. In the Arctic, on the contrary, people have been present for a long time, and the presence of antibiotic resistance genes (ARGs) appears to be much more wide-spread than was previously reported. Studies of E coli from Arctic birds (Bering Strait) revealed reduced susceptibility to antibiotics, but one globally spreading clone of E. coli genotype O25b-ST131, carrying genes of ESBL-type CTX-M, was identified. In the few years between sample collections in the same area, differences in resistance pattern were observed, with E. coli from birds showing resistance to a maximum of five different antibiotics. Presence of resistance-type ESBLs (TEM, SHV, and CTX-M) in E. coli and Klebsiella pneumoniae was also confirmed by specified PCR methods. MLST revealed that those bacteria carried STs that connect them to previously described strains in humans. In conclusion, bacteria previously related to humans could be found in relatively pristine environments, and presently human-associated, antibiotic-resistant bacteria have reached a high global level of distribution that they are now found even in the polar regions.

  16. Anthropogenic antibiotic resistance genes mobilization to the polar regions

    Directory of Open Access Journals (Sweden)

    Jorge Hernández

    2016-12-01

    Full Text Available Anthropogenic influences in the southern polar region have been rare, but lately microorganisms associated with humans have reached Antarctica, possibly from military bases, fishing boats, scientific expeditions, and/or ship-borne tourism. Studies of seawater in areas of human intervention and proximal to fresh penguin feces revealed the presence of Escherichia coli strains least resistant to antibiotics in penguins, whereas E. coli from seawater elsewhere showed resistance to one or more of the following antibiotics: ampicillin, tetracycline, streptomycin, and trim-sulfa. In seawater samples, bacteria were found carrying extended-spectrum β-lactamase (ESBL-type CTX-M genes in which multilocus sequencing typing (MLST showed different sequence types (STs, previously reported in humans. In the Arctic, on the contrary, people have been present for a long time, and the presence of antibiotic resistance genes (ARGs appears to be much more wide-spread than was previously reported. Studies of E coli from Arctic birds (Bering Strait revealed reduced susceptibility to antibiotics, but one globally spreading clone of E. coli genotype O25b-ST131, carrying genes of ESBL-type CTX-M, was identified. In the few years between sample collections in the same area, differences in resistance pattern were observed, with E. coli from birds showing resistance to a maximum of five different antibiotics. Presence of resistance-type ESBLs (TEM, SHV, and CTX-M in E. coli and Klebsiella pneumoniae was also confirmed by specified PCR methods. MLST revealed that those bacteria carried STs that connect them to previously described strains in humans. In conclusion, bacteria previously related to humans could be found in relatively pristine environments, and presently human-associated, antibiotic-resistant bacteria have reached a high global level of distribution that they are now found even in the polar regions.

  17. Exploring antibiotic resistance genes and metal resistance genes in plasmid metagenomes from wastewater treatment plants

    OpenAIRE

    Li, An-Dong; Li, Li-Guan; Zhang, Tong

    2015-01-01

    Plasmids operate as independent genetic elements in microorganism communities. Through horizontal gene transfer, they can provide their host microorganisms with important functions such as antibiotic resistance and heavy metal resistance. In this study, six metagenomic libraries were constructed with plasmid DNA extracted from influent, activated sludge and digested sludge of two wastewater treatment plants. Compared with the metagenomes of the total DNA extracted from the same sectors of the...

  18. Analysis of differentially expressed genes related to resistance in spinosad- and neonicotinoid-resistant Musca domestica L. (Diptera: Muscidae) strains

    DEFF Research Database (Denmark)

    Castberg, Dorte Heidi Højland; Kristensen, Michael

    2017-01-01

    interesting in terms of neonicotinoid resistance, while cyp4d9 was overexpressed in 791spin compared to spinosad-susceptible strains. GSTs, ESTs and UGTs were mostly overexpressed, but not to the same degree as P450s. We present a comprehensive and comparative picture of gene expression in three housefly......Background The housefly is a global pest that has developed resistance to most insecticides applied against it. Resistance of the spinosad-resistant strain 791spin and the neonicotinoid-resistant 766b strain is believed to be due to metabolism. We investigate differentially expressed genes...... strains differing significantly in their response to insecticides. High differential expression of P450s and genes coding for cuticle protein indicates a combination of factors involved in metabolic neonicotinoid and spinosad resistance. Conclusion Resistance in these strains is apparently not linked...

  19. Multi-Drug Resistant Bacteria Isolated From Dogs Presented with ...

    African Journals Online (AJOL)

    Abstract. This investigation documents antibiotic resistant bacteria observed in dogs with otitis externa encountered at Veterinary Teaching Hospital, University of Ibadan, Nigeria. Four Alsatian dogs were presented to the Veterinary Clinic after over a year of treatment failures following a prolonged misuse of antibiotics.

  20. Plant agricultural streptomycin formulations do not carry antibiotic resistance genes.

    Science.gov (United States)

    Rezzonico, Fabio; Stockwell, Virginia O; Duffy, Brion

    2009-07-01

    Streptomycin is used in plant agriculture for bacterial disease control, particularly against fire blight in pome fruit orchards. Concerns that this may increase environmental antibiotic resistance have led to bans or restrictions on use. Experience with antibiotic use in animal feeds raises the possible influence of formulation-delivered resistance genes. We demonstrate that agricultural streptomycin formulations do not carry producer organism resistance genes. By using an optimized extraction procedure, Streptomyces 16S rRNA genes and the streptomycin resistance gene strA were not detected in agricultural streptomycin formulations. This diminishes the likelihood for one potential factor in resistance development due to streptomycin use.

  1. Marker mapping and resistance gene associations in soybean

    OpenAIRE

    2011-01-01

    The invention provides novel molecular genetic markers in soybean, where the markers are useful, for example, in the marker-assisted selection of gene alleles that impart disease-resistance, thereby allowing the identification and selection of a disease-resistant plant. The markers also find use in positional cloning of disease-resistance genes.

  2. Functional study of the novel multidrug resistance gene HA117 and its comparison to multidrug resistance gene 1

    Directory of Open Access Journals (Sweden)

    Chen Tingfu

    2010-07-01

    Full Text Available Abstract Background The novel gene HA117 is a multidrug resistance (MDR gene expressed by all-trans retinoic acid-resistant HL-60 cells. In the present study, we compared the multidrug resistance of the HA117 with that of the classical multidrug resistance gene 1 (MDR1 in breast cancer cell line 4T1. Methods Transduction of the breast cancer cell line 4T1 with adenoviral vectors encoding the HA117 gene and the green fluorescence protein gene (GFP (Ad-GFP-HA117, the MDR1 and GFP (Ad-GFP-MDR1 or GFP (Ad-GFP was respectively carried out. The transduction efficiency and the multiplicity of infection (MOI were detected by fluorescence microscope and flow cytometry. The transcription of HA117 gene and MDR1 gene were detected by reverse transcription polymerase chain reaction (RT-PCR. Western blotting analysis was used to detect the expression of P-glycoprotein (P-gp but the expression of HA117 could not be analyzed as it is a novel gene and its antibody has not yet been synthesized. The drug-excretion activity of HA117 and MDR1 were determined by daunorubicin (DNR efflux assay. The drug sensitivities of 4T1/HA117 and 4T1/MDR1 to chemotherapeutic agents were detected by Methyl-Thiazolyl-Tetrazolium (MTT assay. Results The transducted efficiency of Ad-GFP-HA117 and Ad-GFP-MDR1 were 75%-80% when MOI was equal to 50. The transduction of Ad-GFP-HA117 and Ad-GFP-MDR1 could increase the expression of HA117 and MDR1. The drug resistance index to Adriamycin (ADM, vincristine (VCR, paclitaxel (Taxol and bleomycin (BLM increased to19.8050, 9.0663, 9.7245, 3.5650 respectively for 4T1/HA117 and 24.2236, 11.0480, 11.3741, 0.9630 respectively for 4T1/MDR1 as compared to the control cells. There were no significant differences in drug sensitivity between 4T1/HA117 and 4T1/MDR1 for the P-gp substrates (ADM, VCR and Taxol (P Conclusions These results confirm that HA117 is a strong MDR gene in both HL-60 and 4T1 cells. Furthermore, our results indicate that the MDR

  3. Clusters of Antibiotic Resistance Genes Enriched Together Stay Together in Swine Agriculture.

    Science.gov (United States)

    Johnson, Timothy A; Stedtfeld, Robert D; Wang, Qiong; Cole, James R; Hashsham, Syed A; Looft, Torey; Zhu, Yong-Guan; Tiedje, James M

    2016-04-12

    Antibiotic resistance is a worldwide health risk, but the influence of animal agriculture on the genetic context and enrichment of individual antibiotic resistance alleles remains unclear. Using quantitative PCR followed by amplicon sequencing, we quantified and sequenced 44 genes related to antibiotic resistance, mobile genetic elements, and bacterial phylogeny in microbiomes from U.S. laboratory swine and from swine farms from three Chinese regions. We identified highly abundant resistance clusters: groups of resistance and mobile genetic element alleles that cooccur. For example, the abundance of genes conferring resistance to six classes of antibiotics together with class 1 integrase and the abundance of IS6100-type transposons in three Chinese regions are directly correlated. These resistance cluster genes likely colocalize in microbial genomes in the farms. Resistance cluster alleles were dramatically enriched (up to 1 to 10% as abundant as 16S rRNA) and indicate that multidrug-resistant bacteria are likely the norm rather than an exception in these communities. This enrichment largely occurred independently of phylogenetic composition; thus, resistance clusters are likely present in many bacterial taxa. Furthermore, resistance clusters contain resistance genes that confer resistance to antibiotics independently of their particular use on the farms. Selection for these clusters is likely due to the use of only a subset of the broad range of chemicals to which the clusters confer resistance. The scale of animal agriculture and its wastes, the enrichment and horizontal gene transfer potential of the clusters, and the vicinity of large human populations suggest that managing this resistance reservoir is important for minimizing human risk. Agricultural antibiotic use results in clusters of cooccurring resistance genes that together confer resistance to multiple antibiotics. The use of a single antibiotic could select for an entire suite of resistance genes if

  4. Sulfonamide-Resistant Bacteria and Their Resistance Genes in Soils Fertilized with Manures from Jiangsu Province, Southeastern China

    Science.gov (United States)

    Jiao, Shaojun; Zhang, Jun; Ye, Boping; Gao, Shixiang

    2014-01-01

    Antibiotic-resistant bacteria and genes are recognized as new environmental pollutants that warrant special concern. There were few reports on veterinary antibiotic-resistant bacteria and genes in China. This work systematically analyzed the prevalence and distribution of sulfonamide resistance genes in soils from the environments around poultry and livestock farms in Jiangsu Province, Southeastern China. The results showed that the animal manure application made the spread and abundance of antibiotic resistance genes (ARGs) increasingly in the soil. The frequency of sulfonamide resistance genes was sul1 > sul2 > sul3 in pig-manured soil DNA and sul2 > sul1 > sul3 in chicken-manured soil DNA. Further analysis suggested that the frequency distribution of the sul genes in the genomic DNA and plasmids of the SR isolates from manured soil was sul2 > sul1 > sul3 overall (panimal type and sampling time can influence the prevalence and distribution pattern of sulfonamide resistance genes. The present study also indicated that Bacillus, Pseudomonas and Shigella were the most prevalent sul-positive genera in the soil, suggesting a potential human health risk. The above results could be important in the evaluation of antibiotic-resistant bacteria and genes from manure as sources of agricultural soil pollution; the results also demonstrate the necessity and urgency of the regulation and supervision of veterinary antibiotics in China. PMID:25405870

  5. Novel Genes Related to Ceftriaxone Resistance Found among Ceftriaxone-Resistant Neisseria gonorrhoeae Strains Selected In Vitro.

    Science.gov (United States)

    Gong, Zijian; Lai, Wei; Liu, Min; Hua, Zhengshuang; Sun, Yayin; Xu, Qingfang; Xia, Yue; Zhao, Yue; Xie, Xiaoyuan

    2016-04-01

    The emergence of ceftriaxone-resistantNeisseria gonorrhoeaeis currently a global public health concern. However, the mechanism of ceftriaxone resistance is not yet fully understood. To investigate the potential genes related to ceftriaxone resistance inNeisseria gonorrhoeae, we subcultured six gonococcal strains with increasing concentrations of ceftriaxone and isolated the strains that became resistant. After analyzing several frequently reported genes involved in ceftriaxone resistance, we found only a single mutation inpenA(A501V). However, differential analysis of the genomes and transcriptomes between pre- and postselection strains revealed many other mutated genes as well as up- and downregulated genes. Transformation of the mutatedpenAgene into nonresistant strains increased the MIC between 2.0- and 5.3-fold, and transformation of mutatedftsXincreased the MIC between 3.3- and 13.3-fold. Genes encoding the ABC transporters FarB, Tfq, Hfq, and ExbB were overexpressed, whilepilM,pilN, andpilQwere downregulated. Furthermore, the resistant strain developed cross-resistance to penicillin and cefuroxime, had an increased biochemical metabolic rate, and presented fitness defects such as prolonged growth time and downregulated PilMNQ. In conclusion, antimicrobial pressure could result in the emergence of ceftriaxone resistance, and the evolution of resistance ofNeisseria gonorrhoeaeto ceftriaxone is a complicated process at both the pretranscriptional and posttranscriptional levels, involving several resistance mechanisms of increased efflux and decreased entry. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  6. Gene pyramiding enhances durable blast disease resistance in rice.

    Science.gov (United States)

    Fukuoka, Shuichi; Saka, Norikuni; Mizukami, Yuko; Koga, Hironori; Yamanouchi, Utako; Yoshioka, Yosuke; Hayashi, Nagao; Ebana, Kaworu; Mizobuchi, Ritsuko; Yano, Masahiro

    2015-01-14

    Effective control of blast, a devastating fungal disease of rice, would increase and stabilize worldwide food production. Resistance mediated by quantitative trait loci (QTLs), which usually have smaller individual effects than R-genes but confer broad-spectrum or non-race-specific resistance, is a promising alternative to less durable race-specific resistance for crop improvement, yet evidence that validates the impact of QTL combinations (pyramids) on the durability of plant disease resistance has been lacking. Here, we developed near-isogenic experimental lines representing all possible combinations of four QTL alleles from a durably resistant cultivar. These lines enabled us to evaluate the QTLs singly and in combination in a homogeneous genetic background. We present evidence that pyramiding QTL alleles, each controlling a different response to M. oryzae, confers strong, non-race-specific, environmentally stable resistance to blast disease. Our results suggest that this robust defence system provides durable resistance, thus avoiding an evolutionary "arms race" between a crop and its pathogen.

  7. Mining microbial metatranscriptomes for expression of antibiotic resistance genes under natural conditions

    NARCIS (Netherlands)

    Versluis, D.; Andrea, D' M.M.; Ramiro Garcia, J.; Leimena, M.M.; Hugenholtz, F.; Zhang, J.; Öztürk, B.; Nylund, L.; Sipkema, D.; Schaik, van W.; Vos, de W.M.; Kleerebezem, M.; Smidt, H.; Passel, van M.W.J.

    2015-01-01

    Antibiotic resistance genes are found in a broad range of ecological niches associated with complex microbiota. Here we investigated if resistance genes are not only present, but also transcribed under natural conditions. Furthermore, we examined the potential for antibiotic production by assessing

  8. Environmental and Public Health Implications of Water Reuse: Antibiotics, Antibiotic Resistant Bacteria, and Antibiotic Resistance Genes

    KAUST Repository

    Hong, Pei-Ying

    2013-07-31

    Water scarcity is a global problem, and is particularly acute in certain regions like Africa, the Middle East, as well as the western states of America. A breakdown on water usage revealed that 70% of freshwater supplies are used for agricultural irrigation. The use of reclaimed water as an alternative water source for agricultural irrigation would greatly alleviate the demand on freshwater sources. This paradigm shift is gaining momentum in several water scarce countries like Saudi Arabia. However, microbial problems associated with reclaimed water may hinder the use of reclaimed water for agricultural irrigation. Of particular concern is that the occurrence of antibiotic residues in the reclaimed water can select for antibiotic resistance genes among the microbial community. Antibiotic resistance genes can be associated with mobile genetic elements, which in turn allow a promiscuous transfer of resistance traits from one bacterium to another. Together with the pathogens that are present in the reclaimed water, antibiotic resistant bacteria can potentially exchange mobile genetic elements to create the “perfect microbial storm”. Given the significance of this issue, a deeper understanding of the occurrence of antibiotics in reclaimed water, and their potential influence on the selection of resistant microorganisms would be essential. In this review paper, we collated literature over the past two decades to determine the occurrence of antibiotics in municipal wastewater and livestock manure. We then discuss how these antibiotic resistant bacteria may impose a potential microbial risk to the environment and public health, and the knowledge gaps that would have to be addressed in future studies. Overall, the collation of the literature in wastewater treatment and agriculture serves to frame and identify potential concerns with respect to antibiotics, antibiotic resistant bacteria, and antibiotic resistance genes in reclaimed water.

  9. Mining microbial metatranscriptomes for expression of antibiotic resistance genes under natural conditions

    Science.gov (United States)

    Versluis, Dennis; D'Andrea, Marco Maria; Ramiro Garcia, Javier; Leimena, Milkha M.; Hugenholtz, Floor; Zhang, Jing; Öztürk, Başak; Nylund, Lotta; Sipkema, Detmer; Schaik, Willem Van; de Vos, Willem M.; Kleerebezem, Michiel; Smidt, Hauke; Passel, Mark W. J. Van

    2015-07-01

    Antibiotic resistance genes are found in a broad range of ecological niches associated with complex microbiota. Here we investigated if resistance genes are not only present, but also transcribed under natural conditions. Furthermore, we examined the potential for antibiotic production by assessing the expression of associated secondary metabolite biosynthesis gene clusters. Metatranscriptome datasets from intestinal microbiota of four human adults, one human infant, 15 mice and six pigs, of which only the latter have received antibiotics prior to the study, as well as from sea bacterioplankton, a marine sponge, forest soil and sub-seafloor sediment, were investigated. We found that resistance genes are expressed in all studied ecological niches, albeit with niche-specific differences in relative expression levels and diversity of transcripts. For example, in mice and human infant microbiota predominantly tetracycline resistance genes were expressed while in human adult microbiota the spectrum of expressed genes was more diverse, and also included β-lactam, aminoglycoside and macrolide resistance genes. Resistance gene expression could result from the presence of natural antibiotics in the environment, although we could not link it to expression of corresponding secondary metabolites biosynthesis clusters. Alternatively, resistance gene expression could be constitutive, or these genes serve alternative roles besides antibiotic resistance.

  10. Abundant rifampin resistance genes and significant correlations of antibiotic resistance genes and plasmids in various environments revealed by metagenomic analysis.

    Science.gov (United States)

    Ma, Liping; Li, Bing; Zhang, Tong

    2014-06-01

    In the present study, a newly developed metagenomic analysis approach was applied to investigate the abundance and diversity of antibiotic resistance genes (ARGs) and mobile genetic elements (MGEs) in aquaculture farm sediments, activated sludge, biofilm, anaerobic digestion sludge, and river water. BLASTX analysis against the Comprehensive Antibiotic Resistance Database was conducted for the metagenomic sequence data of each sample and then the ARG-like sequences were sorted based on structured sub-database using customized scripts. The results showed that freshwater fishpond sediment had the highest abundance (196 ppm), and anaerobic digestion sludge possessed the highest diversity (133 subtypes) of ARGs among the samples in this study. Significantly, rifampin resistance genes were universal in all the diverse samples and consistently accounted for 26.9~38.6 % of the total annotated ARG sequences. Furthermore, a significant linear correlation (R (2) = 0.924) was found between diversities (number of subtypes) of ARGs and diversities of plasmids in diverse samples. This work provided a wide spectrum scan of ARGs and MGEs in different environments and revealed the prevalence of rifampin resistance genes and the strong correlation between ARG diversity and plasmid diversity for the first time.

  11. Expression levels of resistant genes affect cervical cancer prognosis.

    Science.gov (United States)

    Yang, Fengmei; Gao, Bo; Li, Rui; Li, Wencui; Chen, Wei; Yu, Zongtao; Zhang, Jicai

    2017-05-01

    Tumor cells may develop multidrug resistance (MDR) to various chemotherapy regimens. Such resistance reduces the sensitivity of cells to chemotherapy drugs, leading to the failure of cervical cancer (CC) treatment and disease progression. The present study aimed to investigate the role of MDR1, lung resistance protein (LRP) and placental glutathione S‑transferase π 1 (GSTP1) in CC and MDR, and the prognostic value of these genes. The mRNA expression levels of these resistance‑associated genes were determined in 47 CC and 20 healthy cervical tissue samples. Subsequently, the data was analyzed alongside clinicopathological parameters. The mRNA expression levels of MDR1, LRP and GSTP1 in CC were 0.57±0.32, 0.58±0.29 and 0.44±0.24, respectively, whereas those in healthy cervical tissues were 0.19±0.10, 0.17±0.14 and 0.18±0.10, respectively. Therefore, the expression levels of these genes were significantly greater in CC compared with healthy cervical tissue (PMRD1 were increased in the well differentiated group (0.68±0.27) compared with the poorly differentiated group (0.38±0.33; P0.05). Multivariate logistic regression indicated that the degree of differentiation and the MDR1 gene expression levels were predictors of CC prognosis (P<0.05). The survival rate of patients in the MDR1‑negative group was significantly greater compared with the MDR1‑positive group (P<0.05). The results of the present study therefore suggested that MDR1 gene expression is a predictor of poor survival in CC.

  12. Survival of Antibiotic Resistant Bacteria and Horizontal Gene Transfer Control Antibiotic Resistance Gene Content in Anaerobic Digesters

    Science.gov (United States)

    Miller, Jennifer H.; Novak, John T.; Knocke, William R.; Pruden, Amy

    2016-01-01

    Understanding fate of antibiotic resistant bacteria (ARB) vs. their antibiotic resistance genes (ARGs) during wastewater sludge treatment is critical in order to reduce the spread of antibiotic resistance through process optimization. Here, we spiked high concentrations of tetracycline-resistant bacteria, isolated from mesophilic (Iso M1-1—a Pseudomonas sp.) and thermophilic (Iso T10—a Bacillus sp.) anaerobic digested sludge, into batch digesters and monitored their fate by plate counts and quantitative polymerase chain reaction (QPCR) of their corresponding tetracycline ARGs. In batch studies, spiked ARB plate counts returned to baseline (thermophilic) or 1-log above baseline (mesophilic) while levels of the ARG present in the spiked isolate [tet(G)] remained high in mesophilic batch reactors. To compare results under semi-continuous flow conditions with natural influent variation, tet(O), tet(W), and sul1 ARGs, along with the intI1 integrase gene, were monitored over a 9-month period in the raw feed sludge and effluent sludge of lab-scale thermophilic and mesophilic anaerobic digesters. sul1 and intI1 in mesophilic and thermophilic digesters correlated positively (Spearman rho = 0.457–0.829, P digested sludge or thermophilic digested sludge (Spearman rho = 0.130–0.486, P = 0.075–0.612). However, in the thermophilic digester, the tet(O) and tet(W) ratios remained consistently low over the entire monitoring period. We conclude that the influent sludge microbial composition can influence the ARG content of a digester, apparently as a result of differential survival or death of ARBs or horizontal gene transfer of genes between raw sludge ARBs and the digester microbial community. Notably, mesophilic digestion was more susceptible to ARG intrusion than thermophilic digestion, which may be attributed to a higher rate of ARB survival and/or horizontal gene transfer between raw sludge bacteria and the digester microbial community. PMID:27014196

  13. Role and prevalence of antibiosis and the related resistance genes in the environment

    DEFF Research Database (Denmark)

    Nazaret, Sylvie; Aminov, Rustam

    2014-01-01

    It becomes increasingly clear that the basis of antibiotic resistance problem among bacterial pathogens is not confined to the borders of clinical microbiology but has broader ecological and evolutionary associations. This Research Topic “Role and prevalence of antibiosis and the related resistance...... genes in the environment” in Frontiers in Microbiology: Antimicrobials, Resistance, and Chemotherapy presents the examples of occurrence and diversity of antibiotic resistance genes (ARGs) in the wide range of environments, from the grasslands of the Colombian Andes, to the dairy farms and small animal...... approach to access the probability of rare horizontal gene transfer (HGT) events in bacterial populations....

  14. [Establishment of 5 resistant ovarian cancer cell strains and expression of resistance-related genes].

    Science.gov (United States)

    Luan, Ying-zi; Li, Li; Li, Dang-rong; Zhang, Wei; Tang, Bu-jian

    2004-06-01

    To investigate expression difference of several drug resistance related genes between sensitive and resistant ovarian carcinoma cells. Cell lines resistant to cisplatin, carboplatin and taxol were established from ovarian carcinoma cell lines of SKOV3 and A2780, and their biological features were detected. The expressions of several genes related to drug resistance were measured by RT-PCR method. (1) The values of resistance index (RI) of resistant cells to relevant drugs were elevated 3 times or more, with different degrees of cross-resistance to several other drugs (RI 2 approximately 20). They grew more slowly than primary cells (Td elongated 1.4 approximately 2.4 times, P 0.05). Intracellular concentrations of relevant drugs were reduced 2.0 approximately 8.5 times in resistant cells (P p53, lung resistance protein-1 (LRP-1), multiple drug resistance related protein-1 (MRP-1) genes were expressed at lower levels in resistant cells than in sensitive cells; while protein kinase C (PKC), topoisomerase (topo) I, and topo II beta were expressed higher, no obvious alterations were found concerning glutathione S transferase-pi (GST-pi), and topo II alpha. Expression of multiple drug resistance-1 (MDR-1) gene was either elevated or reduced in different cells. The expressions of resistance related genes were widely different in different kinds of resistant cells, suggesting more than one pathway leading to resistance transformation. This adds more difficulties for clinical management.

  15. Inactivation Effect of Antibiotic-Resistant Gene Using Chlorine Disinfection

    Directory of Open Access Journals (Sweden)

    Takashi Furukawa

    2017-07-01

    Full Text Available The aim of this study was to elucidate the inactivation effects on the antibiotic-resistance gene (vanA of vancomycin-resistant enterococci (VRE using chlorination, a disinfection method widely used in various water treatment facilities. Suspensions of VRE were prepared by adding VRE to phosphate-buffered saline, or the sterilized secondary effluent of a wastewater treatment plant. The inactivation experiments were carried out at several chlorine concentrations and stirring time. Enterococci concentration and presence of vanA were determined. The enterococci concentration decreased as chlorine concentrations and stirring times increased, with more than 7.0 log reduction occurring under the following conditions: 40 min stirring at 0.5 mg Cl2/L, 20 min stirring at 1.0 mg Cl2/L, and 3 min stirring at 3.0 mg Cl2/L. In the inactivation experiment using VRE suspended in secondary effluent, the culturable enterococci required much higher chlorine concentration and longer treatment time for complete disinfection than the cases of suspension of VRE. However, vanA was detected in all chlorinated suspensions of VRE, even in samples where no enterococcal colonies were present on the medium agar plate. The chlorine disinfection was not able to destroy antibiotic-resistance genes, though it can inactivate and decrease bacterial counts of antibiotic-resistant bacteria (ARB. Therefore, it was suggested that remaining ARB and/or antibiotic-resistance gene in inactivated bacterial cells after chlorine disinfection tank could be discharged into water environments.

  16. Gene interactions and genetics of blast resistance and yield ...

    Indian Academy of Sciences (India)

    2016-08-26

    Oryza sativa L.) ... four blast resistance genes Pi1, Pi2, Pi33 and Pi54 in combination were used to study the nature and magnitude of gene action for disease resistance and yield attributes. ... Please take note of this change.

  17. Molecular detection of disease resistance genes to powdery mildew ...

    African Journals Online (AJOL)

    A study was conducted to detect the presence of disease resistance genes to infection of wheat powdery mildew (Blumeria graminis f. sp. tritici) in selected wheat cultivars from China using molecular markers. Genomic DNA of sixty cultivars was extracted and tested for the presence of selected prominent resistance genes to ...

  18. Codon-optimized antibiotic resistance gene improves efficiency of ...

    Indian Academy of Sciences (India)

    Success rate of transient transformation and cell growth in selective culture were significantly increased by use of fgmR instead of a native gentamicin resistance gene, suggesting that codon optimization improved translation efficiency of the marker gene and increased antibiotic resistance. Our result shows that similarity in ...

  19. Mapping of stripe rust resistance gene in an Aegilops caudata ...

    Indian Academy of Sciences (India)

    Genetic mapping indicated the introgression of stripe rust resistance gene on wheat chromosome. 5DS in the region carrying leaf rust resistance gene LrAc, but as an independent introgression. Simple sequence repeat (SSR) and sequence-tagged site (STS) markers designed from the survey sequence data of 5DS ...

  20. Genome scanning for identification of resistance gene analogs (RGAs)

    African Journals Online (AJOL)

    Disease resistance in plants is a desirable economic trait. Many disease resistance genes from various plants have been cloned so far. The gene products of some of these can be distinguished by the presence of an N terminal nucleotide binding site and a C-terminal stretch of leucine-rich repeats. Oligonucleotides already ...

  1. New resistance genes in the Zea mays: exserohilum turcicum pathosystem

    Directory of Open Access Journals (Sweden)

    Juliana Bernardi Ogliari

    2005-09-01

    Full Text Available The use of monogenic race-specific resistance is widespread for the control of maize (Zea mays L. helminthosporiosis caused by Exserohilum turcicum. Inoculation of 18 Brazilian isolates of E. turcicum onto elite maize lines containing previously identified resistance genes and onto differential near-isogenic lines allowed the identification of new qualitative resistance genes. The inoculation of one selected isolate on differential near-isogenic lines, F1 generations and a BC1F1 population from the referred elite lines enabled the characterization of the resistance spectrum of three new genes, one dominant (HtP, one recessive (rt and a third with non-identified genetic action. Three physiological races of the pathogen were also identified including two with new virulence factors capable of overcoming the resistance of one of the resistance genes identified here (rt.

  2. Antimicrobial-Resistant Bacterial Populations and Antimicrobial Resistance Genes Obtained from Environments Impacted by Livestock and Municipal Waste.

    Science.gov (United States)

    Agga, Getahun E; Arthur, Terrance M; Durso, Lisa M; Harhay, Dayna M; Schmidt, John W

    2015-01-01

    This study compared the populations of antimicrobial-resistant bacteria and the repertoire of antimicrobial resistance genes in four environments: effluent of three municipal wastewater treatment facilities, three cattle feedlot runoff catchment ponds, three swine waste lagoons, and two "low impact" environments (an urban lake and a relict prairie). Multiple liquid and solid samples were collected from each environment. The prevalences and concentrations of antimicrobial-resistant (AMR) Gram-negative (Escherichia coli and Salmonella enterica) and Gram-positive (enterococci) bacteria were determined from individual samples (n = 174). The prevalences of 84 antimicrobial resistance genes in metagenomic DNA isolated from samples pooled (n = 44) by collection date, location, and sample type were determined. The prevalences and concentrations of AMR E. coli and Salmonella were similar among the livestock and municipal sample sources. The levels of erythromycin-resistant enterococci were significantly higher in liquid samples from cattle catchment ponds and swine waste lagoons than in liquid samples from municipal wastewater treatment facilities, but solid samples from these environments did not differ significantly. Similarly, trimethoprim/sulfamethoxazole-resistant E. coli concentrations were significantly higher in swine liquid than in municipal liquid samples, but there was no difference in solid samples. Multivariate analysis of the distribution of antimicrobial resistance genes using principal coordinate analysis showed distinct clustering of samples with livestock (cattle and swine), low impact environment and municipal samples forming three separate clusters. The numbers of class A beta-lactamase, class C beta-lactamase, and fluoroquinolone resistance genes detected were significantly higher (P resistant bacteria and antimicrobial resistance genes exist in cattle, human, and swine waste streams, but a higher diversity of antimicrobial resistance genes are present

  3. Occurrence of integrons and resistance genes among sulphonamide-resistant Shigella spp. from Brazil

    DEFF Research Database (Denmark)

    Peirano, G.; Agersø, Yvonne; Aarestrup, Frank Møller

    2005-01-01

    Objectives: To determine the occurrence of class 1 and 2 integrons and antimicrobial resistance genes among sulphonamide-resistant Shigella strains isolated in Brazil during 1999-2003. Methods: Sixty-two Shigella (Shigella flexneri, n = 47 and Shigella sonnei, n = 15) were tested against 21....... Conclusions: The detection of class 1 and 2 integrons and additional antimicrobial resistance genes allowed us to identify the most frequent antimicrobial resistance patterns of Shigella spp. isolated in Brazil....

  4. Barley Stem Rust Resistance Genes: Structure and Function

    Directory of Open Access Journals (Sweden)

    Andris Kleinhofs

    2009-07-01

    Full Text Available Rusts are biotrophic pathogens that attack many plant species but are particularly destructive on cereal crops. The stem rusts (caused by have historically caused severe crop losses and continue to threaten production today. Barley ( L. breeders have controlled major stem rust epidemics since the 1940s with a single durable resistance gene . As new epidemics have threatened, additional resistance genes were identified to counter new rust races, such as the complex locus against races QCCJ and TTKSK. To understand how these genes work, we initiated research to clone and characterize them. The gene encodes a unique protein kinase with dual kinase domains, an active kinase, and a pseudokinase. Function of both domains is essential to confer resistance. The and genes are closely linked and function coordinately to confer resistance to several wheat ( L. stem rust races, including the race TTKSK (also called Ug99 that threatens the world's barley and wheat crops. The gene encodes typical resistance gene domains NBS, LRR, and protein kinase but is unique in that all three domains reside in a single gene, a previously unknown structure among plant disease resistance genes. The gene encodes an actin depolymerizing factor that functions in cytoskeleton rearrangement.

  5. Transfer of tetracycline resistance gene (tetr) between replicons in ...

    African Journals Online (AJOL)

    Antimicrobial susceptibility testing among the isolates showed resistance to amoxicillin (92%), amoxicillin-clavulanic acid (84.4%), tetracycline (71.4%), gentamycin (43.5%), nalidixic acid (38.3%) and nitrofurantoin (7.9%). E. coli showed the highest resistance to most of the antibiotics. Tetracycline resistance gene was ...

  6. Complex Interactions between Fungal Avirulence Genes and Their Corresponding Plant Resistance Genes and Consequences for Disease Resistance Management

    Directory of Open Access Journals (Sweden)

    Yohann Petit-Houdenot

    2017-06-01

    Full Text Available During infection, pathogens secrete an arsenal of molecules, collectively called effectors, key elements of pathogenesis which modulate innate immunity of the plant and facilitate infection. Some of these effectors can be recognized directly or indirectly by resistance (R proteins from the plant and are then called avirulence (AVR proteins. This recognition usually triggers defense responses including the hypersensitive response and results in resistance of the plant. R—AVR gene interactions are frequently exploited in the field to control diseases. Recently, the availability of fungal genomes has accelerated the identification of AVR genes in plant pathogenic fungi, including in fungi infecting agronomically important crops. While single AVR genes recognized by their corresponding R gene were identified, more and more complex interactions between AVR and R genes are reported (e.g., AVR genes recognized by several R genes, R genes recognizing several AVR genes in distinct organisms, one AVR gene suppressing recognition of another AVR gene by its corresponding R gene, two cooperating R genes both necessary to recognize an AVR gene. These complex interactions were particularly reported in pathosystems showing a long co-evolution with their host plant but could also result from the way agronomic crops were obtained and improved (e.g., through interspecific hybridization or introgression of resistance genes from wild related species into cultivated crops. In this review, we describe some complex R—AVR interactions between plants and fungi that were recently reported and discuss their implications for AVR gene evolution and R gene management.

  7. Mapping of stripe rust resistance gene in an Aegilops caudata ...

    Indian Academy of Sciences (India)

    PUNEET INDER TOOR

    end of 5DS linked with a group of four colocated SSRs and two resistance gene analogue (RGA)-STS markers at a distance of 5.3 cM. ... and LrAc appear to be the candidate genes for marker-assisted enrichment of the wheat gene pool for rust resistance. [Toor P. I., Kaur S., Bansal ..... stocks with reduced alien chromatin.

  8. Generation of novel resistance genes using mutation and targeted gene editing

    Science.gov (United States)

    Classical breeding for virus resistance is a lengthy process and is restricted by the availability of resistance genes. Precise genome editing is a "dream technology" to improve plants for virus resistance and these tools have opened new and very promising ways to generate virus resistant plants by ...

  9. Associations between Antimicrobial Resistance Phenotypes, Antimicrobial Resistance Genes, and Virulence Genes of Fecal Escherichia coli Isolates from Healthy Grow-Finish Pigs ▿

    OpenAIRE

    Rosengren, Leigh B.; Waldner, Cheryl L.; Reid-Smith, Richard J.

    2009-01-01

    Escherichia coli often carries linked antimicrobial resistance genes on transmissible genetic elements. Through coselection, antimicrobial use may select for unrelated but linked resistance or virulence genes. This study used unconditional statistical associations to investigate the relationships between antimicrobial resistance phenotypes and antimicrobial resistance genes in 151 E. coli isolates from healthy pigs. Phenotypic resistance to each drug was significantly associated with phenotyp...

  10. Stacking of blast resistance orthologue genes in susceptible indica rice line improves resistance againstMagnaporthe oryzae.

    Science.gov (United States)

    Kumari, Mandeep; Devanna, B N; Singh, Pankaj Kumar; Rajashekara, H; Sharma, Vinay; Sharma, Tilak Raj

    2018-01-01

    The emergence of new strains of Magnaporthe oryzae ( M. oryzae ) is associated with recurrent failure of resistance response mediated by single resistance ( R ) gene in rice. Therefore, stacking or combining of multiple R genes could improve the durability of resistance against multiple strains of M. oryzae . To achieve this, in the present study, intragenic stacking of rice blast resistance orthologue genes Pi54 and Pi54rh was performed through co-transformation approach. Both these genes were expressed under the control of independent promoters and blast susceptible indica rice line IET17021 was used for transformation. The highly virulent M. oryzae strain Mo-ei-ger1 that could knock down most of the major single blast R genes including Pi54 and exhibiting 89% virulence spectrum was used for phenotypic analysis. The stacked transgenic IET17021 lines ( Pi54  +  Pi54rh ) have shown complete resistance to Mo-ei-ger1 strain in comparison to non-transgenic lines. These two R gene stacked indica transgenic lines could serves as a novel germplasm for rice blast resistance breeding programmes.

  11. Codon-optimized antibiotic resistance gene improves efficiency of ...

    Indian Academy of Sciences (India)

    2013-10-01

    Oct 1, 2013 ... native gentamicin resistance gene, suggesting that codon optimization improved translation efficiency of the marker gene and ... to be taken into account when exogenous transgenes are expressed in Frankia cells. [Kucho K, Kakoi K, ..... gene coding for the green fluorescent protein (GFP) is a versatile ...

  12. The cfr and cfr-like multiple resistance genes

    DEFF Research Database (Denmark)

    Vester, Birte

    2018-01-01

    . The cfr gene is found in various bacteria in many geographical locations and placed on plasmids or associated with transposons. Cfr-related genes providing similar resistance have been identified in Bacillales, and now also in the pathogens Clostridium difficile and Enterococcus faecium. In addition......, the presence of the cfr gene has been detected in harbours and food markets....

  13. Linking microbial community structure and function to characterize antibiotic resistant bacteria and antibiotic resistant genes from cattle feces

    Science.gov (United States)

    There is widespread interest in monitoring the development of antibiotic resistant bacteria and antibiotic resistance genes in agriculturally impacted environments, however little is known about the relationships between bacterial community structure, and antibiotic resistance gene profiles. Cattl...

  14. Mobile antibiotic resistance – the spread of genes determining the resistance of bacteria through food products

    Directory of Open Access Journals (Sweden)

    Jolanta Godziszewska

    2016-07-01

    Full Text Available In recent years, more and more antibiotics have become ineffective in the treatment of bacterial nfections. The acquisition of antibiotic resistance by bacteria is associated with circulation of genes in the environment. Determinants of antibiotic resistance may be transferred to pathogenic bacteria. It has been shown that conjugation is one of the key mechanisms responsible for spread of antibiotic resistance genes, which is highly efficient and allows the barrier to restrictions and modifications to be avoided. Some conjugative modules enable the transfer of plasmids even between phylogenetically distant bacterial species. Many scientific reports indicate that food is one of the main reservoirs of these genes. Antibiotic resistance genes have been identified in meat products, milk, fruits and vegetables. The reason for such a wide spread of antibiotic resistance genes is the overuse of antibiotics by breeders of plants and animals, as well as by horizontal gene transfer. It was shown, that resistance determinants located on mobile genetic elements, which are isolated from food products, can easily be transferred to another niche. The antibiotic resistance genes have been in the environment for 30 000 years. Their removal from food products is not possible, but the risks associated with the emergence of multiresistant pathogenic strains are very large. The only option is to control the emergence, selection and spread of these genes. Therefore measures are sought to prevent horizontal transfer of genes. Promising concepts involve the combination of developmental biology, evolution and ecology in the fight against the spread of antibiotic resistance.

  15. Mobile antibiotic resistance - the spread of genes determining the resistance of bacteria through food products.

    Science.gov (United States)

    Godziszewska, Jolanta; Guzek, Dominika; Głąbski, Krzysztof; Wierzbicka, Agnieszka

    2016-07-07

    In recent years, more and more antibiotics have become ineffective in the treatment of bacterial nfections. The acquisition of antibiotic resistance by bacteria is associated with circulation of genes in the environment. Determinants of antibiotic resistance may be transferred to pathogenic bacteria. It has been shown that conjugation is one of the key mechanisms responsible for spread of antibiotic resistance genes, which is highly efficient and allows the barrier to restrictions and modifications to be avoided. Some conjugative modules enable the transfer of plasmids even between phylogenetically distant bacterial species. Many scientific reports indicate that food is one of the main reservoirs of these genes. Antibiotic resistance genes have been identified in meat products, milk, fruits and vegetables. The reason for such a wide spread of antibiotic resistance genes is the overuse of antibiotics by breeders of plants and animals, as well as by horizontal gene transfer. It was shown, that resistance determinants located on mobile genetic elements, which are isolated from food products, can easily be transferred to another niche. The antibiotic resistance genes have been in the environment for 30 000 years. Their removal from food products is not possible, but the risks associated with the emergence of multiresistant pathogenic strains are very large. The only option is to control the emergence, selection and spread of these genes. Therefore measures are sought to prevent horizontal transfer of genes. Promising concepts involve the combination of developmental biology, evolution and ecology in the fight against the spread of antibiotic resistance.

  16. Risk assessment for Helicoverpa zea (Lepidoptera: Noctuidae) resistance on dual-gene versus single-gene corn.

    Science.gov (United States)

    Edwards, Kristine T; Caprio, Michael A; Allen, K Clint; Musser, Fred R

    2013-02-01

    Recent Environmental Protection Agency (EPA) decisions regarding resistance management in Bt-cropping systems have prompted concern in some experts that dual-gene Bt-corn (CrylA.105 and Cry2Ab2 toxins) may result in more rapid selection for resistance in Helicoverpa zea (Boddie) than single-gene Bacillus thuringiensis (Bt)-corn (CrylAb toxin). The concern is that Bt-toxin longevity could be significantly reduced with recent adoption of a natural refuge for dual-gene Bt-cotton (CrylAc and Cry2Ab2 toxins) and concurrent reduction in dual-gene corn refuge from 50 to 20%. A population genetics framework that simulates complex landscapes was applied to risk assessment. Expert opinions on effectiveness of several transgenic corn and cotton varieties were captured and used to assign probabilities to different scenarios in the assessment. At least 350 replicate simulations with randomly drawn parameters were completed for each of four risk assessments. Resistance evolved within 30 yr in 22.5% of simulations with single-gene corn and cotton with no volunteer corn. When volunteer corn was added to this assessment, risk of resistance evolving within 30 yr declined to 13.8%. When dual-gene Bt-cotton planted with a natural refuge and single-gene corn planted with a 50% structured refuge was simulated, simultaneous resistance to both toxins never occurred within 30 yr, but in 38.5% of simulations, resistance evolved to toxin present in single-gene Bt-corn (CrylAb). When both corn and cotton were simulated as dual-gene products, cotton with a natural refuge and corn with a 20% refuge, 3% of simulations evolved resistance to both toxins simultaneously within 30 yr, while 10.4% of simulations evolved resistance to CrylAb/c toxin.

  17. sugE: A gene involved in tributyltin (TBT) resistance of Aeromonas molluscorum Av27.

    Science.gov (United States)

    Cruz, Andreia; Micaelo, Nuno; Félix, Vitor; Song, Jun-Young; Kitamura, Shin-Ichi; Suzuki, Satoru; Mendo, Sónia

    2013-01-01

    The mechanism of bacterial resistance to tributyltin (TBT) is still unclear. The results herein presented contribute to clarify that mechanism in the TBT-resistant bacterium Aeromonas molluscorum Av27. We have identified and cloned a new gene that is involved in TBT resistance in this strain. The gene is highly homologous (84%) to the Aeromonas hydrophila-sugE gene belonging to the small multidrug resistance gene family (SMR), which includes genes involved in the transport of lipophilic drugs. In Av27, expression of the Av27-sugE was observed at the early logarithmic growth phase in the presence of a high TBT concentration (500 μM), thus suggesting the contribution of this gene for TBT resistance. E. coli cells transformed with Av27-sugE become resistant to ethidium bromide (EtBr), chloramphenicol (CP) and tetracycline (TE), besides TBT. According to the Moriguchi logP (miLogP) values, EtBr, CP and TE have similar properties and are substrates for the sugE-efflux system. Despite the different miLogP of TBT, E. coli cells transformed with Av27-sugE become resistant to this compound. So it seems that TBT is also a substrate for the SugE protein. The modelling studies performed also support this hypothesis. The data herein presented clearly indicate that sugE is involved in TBT resistance of this bacterium.

  18. Determination of rust resistance genes in pakistani bread wheats

    International Nuclear Information System (INIS)

    Qamar, M.; Ahmad, S.D.; Rabbani, M.A.; Shinwari, Z.K.

    2014-01-01

    Stripe and leaf rusts are the major constraints to bread wheat production in Pakistan. Molecular markers were used to investigate the presence of leaf rust and stripe rust resistance gene cluster Lr34/Yr18 and stem rust resistance gene Sr2 in 52 Pakistani bread wheat cultivars/lines. PCR amplification of DNA fragments using DNA marker csLV-34 showed that 13 of the studied cultivars/lines, namely 03FJ26, NR 337, NR 339, NR 347, NR 350, Manthar, Margalla 99, Iqbal 2000, Saleem 2000, Wafaq 2001, Marwat 2001, Pirsabak 2004 and Fareed 2006 carry leaf rust and stripe rust resistance genes Lr34/Yr18. Stem rust resistance gene Sr2 was observed in 36 Pakistani spring wheat cultivars/lines using stm560.3tgag marker. The slow rusting gene Sr2 needs to be combined with additional stem rust resistance genes to establish durable resistance against Ug99 in modern wheat cultivars. Low frequency of Lr34/Yr18 was found in Pakistani wheats. This gene cluster needs to be incorporated into Pakistani wheats for durable rust resistance. (author)

  19. Characterization of the Maize Chitinase Genes and Their Effect on Aspergillus flavus and Aflatoxin Accumulation Resistance

    Science.gov (United States)

    Hawkins, Leigh K.; Mylroie, J. Erik; Oliveira, Dafne A.; Smith, J. Spencer; Ozkan, Seval; Windham, Gary L.; Williams, W. Paul; Warburton, Marilyn L.

    2015-01-01

    Maize (Zea mays L.) is a crop of global importance, but prone to contamination by aflatoxins produced by fungi in the genus Aspergillus. The development of resistant germplasm and the identification of genes contributing to resistance would aid in the reduction of the problem with a minimal need for intervention by farmers. Chitinolytic enzymes respond to attack by potential pathogens and have been demonstrated to increase insect and fungal resistance in plants. Here, all chitinase genes in the maize genome were characterized via sequence diversity and expression patterns. Recent evolution within this gene family was noted. Markers from within each gene were developed and used to map the phenotypic effect on resistance of each gene in up to four QTL mapping populations and one association panel. Seven chitinase genes were identified that had alleles associated with increased resistance to aflatoxin accumulation and A. flavus infection in field grown maize. The chitinase in bin 1.05 identified a new and highly significant QTL, while chitinase genes in bins 2.04 and 5.03 fell directly beneath the peaks of previously published QTL. The expression patterns of these genes corroborate possible grain resistance mechanisms. Markers from within the gene sequences or very closely linked to them are presented to aid in the use of marker assisted selection to improve this trait. PMID:26090679

  20. Fate of antibiotic resistant cultivable heterotrophic bacteria and antibiotic resistance genes in wastewater treatment processes.

    Science.gov (United States)

    Zhang, Songhe; Han, Bing; Gu, Ju; Wang, Chao; Wang, Peifang; Ma, Yanyan; Cao, Jiashun; He, Zhenli

    2015-09-01

    Antibiotic resistant bacteria (ARB) and antibiotic resistance genes (ARGs) are emerging contaminants of environmental concern. Heterotrophic bacteria in activated sludge have an important role in wastewater treatment plants (WWTPs). However, the fate of cultivable heterotrophic ARB and ARGs in WWPTs process remains unclear. In the present study, we investigated the antibiotic-resistant phenotypes of cultivable heterotrophic bacteria from influent and effluent water of three WWTPs and analysed thirteen ARGs in ARB and in activated sludge from anoxic, anaerobic and aerobic compartments. From each influent or effluent sample of the three plants, 200 isolates were randomly tested for susceptibility to 12 antibiotics. In these samples, between 5% and 64% isolates showed resistance to >9 antibiotics and the proportion of >9-drug-resistant bacteria was lower in isolates from effluent than from influent. Eighteen genera were identified in 188 isolates from influent (n=94) and effluent (n=94) of one WWTP. Six genera (Aeromonas, Bacillus, Lysinibacillus, Microbacterium, Providencia, and Staphylococcus) were detected in both influent and effluent samples. Gram-negative and -positive isolates dominated in influent and effluent, respectively. The 13 tetracycline-, sulphonamide-, streptomycin- and β-lactam-resistance genes were detected at a higher frequency in ARB from influent than from effluent, except for sulA and CTX-M, while in general, the abundances of ARGs in activated sludge from two of the three plants were higher in aerobic compartments than in anoxic ones, indicating abundant ARGs exit in the excess sledges and/or in uncultivable bacteria. These findings may be useful for elucidating the effect of WWTP on ARB and ARGs. Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. Fate of antibiotic resistant bacteria and genes during wastewater chlorination: implication for antibiotic resistance control.

    Directory of Open Access Journals (Sweden)

    Qing-Bin Yuan

    Full Text Available This study investigated fates of nine antibiotic-resistant bacteria as well as two series of antibiotic resistance genes in wastewater treated by various doses of chlorine (0, 15, 30, 60, 150 and 300 mg Cl2 min/L. The results indicated that chlorination was effective in inactivating antibiotic-resistant bacteria. Most bacteria were inactivated completely at the lowest dose (15 mg Cl2 min/L. By comparison, sulfadiazine- and erythromycin-resistant bacteria exhibited tolerance to low chlorine dose (up to 60 mg Cl2 min/L. However, quantitative real-time PCRs revealed that chlorination decreased limited erythromycin or tetracycline resistance genes, with the removal levels of overall erythromycin and tetracycline resistance genes at 0.42 ± 0.12 log and 0.10 ± 0.02 log, respectively. About 40% of erythromycin-resistance genes and 80% of tetracycline resistance genes could not be removed by chlorination. Chlorination was considered not effective in controlling antimicrobial resistance. More concern needs to be paid to the potential risk of antibiotic resistance genes in the wastewater after chlorination.

  2. Fate of antibiotic resistant bacteria and genes during wastewater chlorination: implication for antibiotic resistance control.

    Science.gov (United States)

    Yuan, Qing-Bin; Guo, Mei-Ting; Yang, Jian

    2015-01-01

    This study investigated fates of nine antibiotic-resistant bacteria as well as two series of antibiotic resistance genes in wastewater treated by various doses of chlorine (0, 15, 30, 60, 150 and 300 mg Cl2 min/L). The results indicated that chlorination was effective in inactivating antibiotic-resistant bacteria. Most bacteria were inactivated completely at the lowest dose (15 mg Cl2 min/L). By comparison, sulfadiazine- and erythromycin-resistant bacteria exhibited tolerance to low chlorine dose (up to 60 mg Cl2 min/L). However, quantitative real-time PCRs revealed that chlorination decreased limited erythromycin or tetracycline resistance genes, with the removal levels of overall erythromycin and tetracycline resistance genes at 0.42 ± 0.12 log and 0.10 ± 0.02 log, respectively. About 40% of erythromycin-resistance genes and 80% of tetracycline resistance genes could not be removed by chlorination. Chlorination was considered not effective in controlling antimicrobial resistance. More concern needs to be paid to the potential risk of antibiotic resistance genes in the wastewater after chlorination.

  3. Survival of Antibiotic Resistant Bacteria and Horizontal Gene Transfer Control Antibiotic Resistance Gene Content in Anaerobic Digesters

    OpenAIRE

    Miller, Jennifer H.; Novak, John T.; Knocke, William R.; Pruden, Amy

    2016-01-01

    Understanding fate of antibiotic resistant bacteria (ARB) versus their antibiotic resistance genes (ARGs) during wastewater sludge treatment is critical in order to reduce the spread of antibiotic resistance through process optimization. Here, we spiked high concentrations of tetracycline-resistant bacteria, isolated from mesophilic (Iso M1-1- a Pseudomonas sp.) and thermophilic (Iso T10- a Bacillus sp.) anaerobic digested sludge, into batch digesters and monitored their fate by plate counts ...

  4. Sponge Microbiota are a Reservoir of Functional Antibiotic Resistance Genes

    DEFF Research Database (Denmark)

    Versluis, Dennis; de Evgrafov, Mari Cristina Rodriguez; Sommer, Morten Otto Alexander

    2016-01-01

    Wide application of antibiotics has contributed to the evolution of multi-drug resistant human pathogens, resulting in poorer treatment outcomes for infections. In the marine environment, seawater samples have been investigated as a resistance reservoir; however, no studies have methodically...... examined sponges as a reservoir of antibiotic resistance. Sponges could be important in this respect because they often contain diverse microbial communities that have the capacity to produce bioactive metabolites. Here, we applied functional metagenomics to study the presence and diversity of functional......). Fifteen of 37 inserts harbored resistance genes that shared resistance gene could be identified with high confidence, in which case we predicted resistance to be mainly mediated by antibiotic efflux. One marine-specific ampicillin-resistance...

  5. Sulfonamide-resistant bacteria and their resistance genes in soils fertilized with manures from Jiangsu Province, Southeastern China.

    Directory of Open Access Journals (Sweden)

    Na Wang

    Full Text Available Antibiotic-resistant bacteria and genes are recognized as new environmental pollutants that warrant special concern. There were few reports on veterinary antibiotic-resistant bacteria and genes in China. This work systematically analyzed the prevalence and distribution of sulfonamide resistance genes in soils from the environments around poultry and livestock farms in Jiangsu Province, Southeastern China. The results showed that the animal manure application made the spread and abundance of antibiotic resistance genes (ARGs increasingly in the soil. The frequency of sulfonamide resistance genes was sul1 > sul2 > sul3 in pig-manured soil DNA and sul2 > sul1 > sul3 in chicken-manured soil DNA. Further analysis suggested that the frequency distribution of the sul genes in the genomic DNA and plasmids of the SR isolates from manured soil was sul2 > sul1 > sul3 overall (p<0.05. The combination of sul1 and sul2 was the most frequent, and the co-existence of sul1 and sul3 was not found either in the genomic DNA or plasmids. The sample type, animal type and sampling time can influence the prevalence and distribution pattern of sulfonamide resistance genes. The present study also indicated that Bacillus, Pseudomonas and Shigella were the most prevalent sul-positive genera in the soil, suggesting a potential human health risk. The above results could be important in the evaluation of antibiotic-resistant bacteria and genes from manure as sources of agricultural soil pollution; the results also demonstrate the necessity and urgency of the regulation and supervision of veterinary antibiotics in China.

  6. AMINOGLYCOSIDE RESISTANCE GENES IN Pseudomonas aeruginosa ISOLATES FROM CUMANA, VENEZUELA.

    Science.gov (United States)

    Teixeira, Bertinellys; Rodulfo, Hectorina; Carreño, Numirin; Guzmán, Militza; Salazar, Elsa; De Donato, Marcos

    2016-01-01

    The enzymatic modification of aminoglycosides by aminoglycoside-acetyltransferases (AAC), aminoglycoside-adenyltransferases (AAD), and aminoglycoside-phosphotransferases (APH), is the most common resistance mechanism in P. aeruginosa and these enzymes can be coded on mobile genetic elements that contribute to their dispersion. One hundred and thirty seven P. aeruginosa isolates from the University Hospital, Cumana, Venezuela (HUAPA) were evaluated. Antimicrobial susceptibility was determined by the disk diffusion method and theaac, aadB and aph genes were detected by PCR. Most of the P. aeruginosa isolates (33/137) were identified from the Intensive Care Unit (ICU), mainly from discharges (96/137). The frequency of resistant P. aeruginosaisolates was found to be higher for the aminoglycosides tobramycin and amikacin (30.7 and 29.9%, respectively). Phenotype VI, resistant to these antibiotics, was the most frequent (14/49), followed by phenotype I, resistant to all the aminoglycosides tested (12/49). The aac(6´)-Ib,aphA1 and aadB genes were the most frequently detected, and the simultaneous presence of several resistance genes in the same isolate was demonstrated. Aminoglycoside resistance in isolates ofP. aeruginosa at the HUAPA is partly due to the presence of the aac(6´)-Ib, aphA1 andaadB genes, but the high rates of antimicrobial resistance suggest the existence of several mechanisms acting together. This is the first report of aminoglycoside resistance genes in Venezuela and one of the few in Latin America.

  7. Detection of bacterial blight resistance genes in basmati rice landraces.

    Science.gov (United States)

    Ullah, I; Jamil, S; Iqbal, M Z; Shaheen, H L; Hasni, S M; Jabeen, S; Mehmood, A; Akhter, M

    2012-07-20

    Aromatic basmati rice is vulnerable to bacterial blight disease. Genes conferring resistance to bacterial blight have been identified in coarse rice; however, their incorporation into basmati varieties compromises the prized basmati aroma. We identified bacterial blight resistance genes Xa4, xa5, Xa7, and xa13 in 52 basmati landraces and five basmati cultivars using PCR markers. The Xa7 gene was found to be the most prevalent among the cultivars and landraces. The cultivars Basmati-385 and Basmati-2000 also contained the Xa4 gene; however, xa5 and xa13 were confined to landraces only. Ten landraces were found to have multiple resistance genes. Landraces Basmati-106, Basmati-189 and Basmati-208 contained Xa4 and Xa7 genes. Whereas, landraces Basmati-122, Basmati-427, Basmati-433 were observed to have xa5 and Xa7 genes. Landraces Basmati-48, Basmati-51A, Basmati-334, and Basmati-370A possessed Xa7 and xa13 genes. The use of landraces containing recessive genes xa5 and xa13 as donor parents in hybridization with cultivars Basmati-385 and Basmati-2000, which contain the genes Xa4 and Xa7, will expedite efforts to develop bacterial blight-resistant basmati rice cultivars through marker assisted selection, based on a pyramiding approach, without compromising aroma and grain quality.

  8. Role and prevalence of antibiosis and the related resistance genes in the environment

    DEFF Research Database (Denmark)

    It becomes increasingly clear that the basis of antibiotic resistance problem among bacterial pathogens is not confined to the borders of clinical microbiology but has broader ecological and evolutionary associations. This Research Topic “Role and prevalence of antibiosis and the related resistance...... genes in the environment” in Frontiers in Microbiology, section Antimicrobials, Resistance and Chemotherapy, presents the examples of occurrence and diversity of antibiotic resistance genes in the wide range of environments, from the grasslands of the Colombian Andes, to the dairy farms and small animal...... veterinary hospitals in the United Stated, and to the various environments of Continental Europe and Indochina. Besides, various genetic mechanisms and selection/co-selection factors contributing to the dissemination and maintenance of antibiotic resistance genes are presented. The topic is finalized...

  9. Fine mapping of the Asian soybean rust resistance gene Rpp2 from soybean PI 230970.

    Science.gov (United States)

    Yu, Neil; Kim, Myungsik; King, Zachary R; Harris, Donna K; Buck, James W; Li, Zenglu; Diers, Brian W

    2015-03-01

    Asian soybean rust (ASR) resistance gene Rpp2 has been fine mapped into a 188.1 kb interval on Glyma.Wm82.a2, which contains a series of plant resistance ( R ) genes. Asian soybean rust (ASR), caused by the fungus Phakopsora pachyrihizi Syd. & P. Syd., is a serious disease in major soybean [Glycine max (L.) Merr.] production countries worldwide and causes yield losses up to 75 %. Defining the exact chromosomal position of ASR resistance genes is critical for improving the effectiveness of marker-assisted selection (MAS) for resistance and for cloning these genes. The objective of this study was to fine map the ASR resistance gene Rpp2 from the plant introduction (PI) 230970. Rpp2 was previously mapped within a 12.9-cM interval on soybean chromosome 16. The fine mapping was initiated by identifying recombination events in F2 and F3 plants using simple sequence repeat (SSR) and single nucleotide polymorphism (SNP) markers that flank the gene. Seventeen recombinant plants were identified and then tested with additional genetic markers saturating the gene region to localize the positions of each recombination. The progeny of these selected plants were tested for resistance to ASR and with SSR markers resulting in the mapping of Rpp2 to a 188.1 kb interval on the Williams 82 reference genome (Glyma.Wm82.a2). Twelve genes including ten toll/interleukin-1 receptor (TIR)-nucleotide-binding site (NBS)-leucine-rich repeat (LRR) genes were predicted to exist in this interval on the Glyma.Wm82.a2.v1 gene model map. Eight of these ten genes were homologous to the Arabidopsis TIR-NBS-LRR gene AT5G17680.1. The identified SSR and SNP markers close to Rpp2 and the candidate gene information presented in this study will be significant resources for MAS and gene cloning research.

  10. Stormwater loadings of antibiotic resistance genes in an urban stream.

    Science.gov (United States)

    Garner, Emily; Benitez, Romina; von Wagoner, Emily; Sawyer, Richard; Schaberg, Erin; Hession, W Cully; Krometis, Leigh-Anne H; Badgley, Brian D; Pruden, Amy

    2017-10-15

    Antibiotic resistance presents a critical public health challenge and the transmission of antibiotic resistance via environmental pathways continues to gain attention. Factors driving the spread of antibiotic resistance genes (ARGs) in surface water and sources of ARGs in urban stormwater have not been well-characterized. In this study, five ARGs (sul1, sul2, tet(O), tet(W), and erm(F)) were quantified throughout the duration of three storm runoff events in an urban inland stream. Storm loads of all five ARGs were significantly greater than during equivalent background periods. Neither fecal indicator bacteria measured (E. coli or enterococci) was significantly correlated with sul1, sul2, or erm(F), regardless of whether ARG concentration was absolute or normalized to 16S rRNA levels. Both E. coli and enterococci were correlated with the tetracycline resistance genes, tet(O) and tet(W). Next-generation shotgun metagenomic sequencing was conducted to more thoroughly characterize the resistome (i.e., full complement of ARGs) and profile the occurrence of all ARGs described in current databases in storm runoff in order to inform future watershed monitoring and management. Between 37 and 121 different ARGs were detected in each stream sample, though the ARG profiles differed among storms. This study establishes that storm-driven transport of ARGs comprises a considerable fraction of overall downstream loadings and broadly characterizes the urban stormwater resistome to identify potential marker ARGs indicative of impact. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Engineering resistance to plant viruses: Present status and future prospects

    Science.gov (United States)

    Plant viruses cause severe crop losses across the globe. Resistant cultivars together with pesticide application are commonly used to avoid the losses caused by plant viruses. However, very limited success has been achieved at diminishing the impact of plant viruses. Use of virus resistant plant is ...

  12. Survival of Antibiotic Resistant Bacteria and Horizontal Gene Transfer Control Antibiotic Resistance Gene Content in Anaerobic Digesters.

    Science.gov (United States)

    Miller, Jennifer H; Novak, John T; Knocke, William R; Pruden, Amy

    2016-01-01

    Understanding fate of antibiotic resistant bacteria (ARB) vs. their antibiotic resistance genes (ARGs) during wastewater sludge treatment is critical in order to reduce the spread of antibiotic resistance through process optimization. Here, we spiked high concentrations of tetracycline-resistant bacteria, isolated from mesophilic (Iso M1-1-a Pseudomonas sp.) and thermophilic (Iso T10-a Bacillus sp.) anaerobic digested sludge, into batch digesters and monitored their fate by plate counts and quantitative polymerase chain reaction (QPCR) of their corresponding tetracycline ARGs. In batch studies, spiked ARB plate counts returned to baseline (thermophilic) or 1-log above baseline (mesophilic) while levels of the ARG present in the spiked isolate [tet(G)] remained high in mesophilic batch reactors. To compare results under semi-continuous flow conditions with natural influent variation, tet(O), tet(W), and sul1 ARGs, along with the intI1 integrase gene, were monitored over a 9-month period in the raw feed sludge and effluent sludge of lab-scale thermophilic and mesophilic anaerobic digesters. sul1 and intI1 in mesophilic and thermophilic digesters correlated positively (Spearman rho = 0.457-0.829, P < 0.05) with the raw feed sludge. There was no correlation in tet(O) or tet(W) ratios in raw sludge and mesophilic digested sludge or thermophilic digested sludge (Spearman rho = 0.130-0.486, P = 0.075-0.612). However, in the thermophilic digester, the tet(O) and tet(W) ratios remained consistently low over the entire monitoring period. We conclude that the influent sludge microbial composition can influence the ARG content of a digester, apparently as a result of differential survival or death of ARBs or horizontal gene transfer of genes between raw sludge ARBs and the digester microbial community. Notably, mesophilic digestion was more susceptible to ARG intrusion than thermophilic digestion, which may be attributed to a higher rate of ARB survival and/or horizontal gene

  13. Survival of antibiotic resistant bacteria and horizontal gene transfer control antibiotic resistance gene content in anaerobic digesters

    Directory of Open Access Journals (Sweden)

    Jennifer Hafer Miller

    2016-03-01

    Full Text Available Understanding fate of antibiotic resistant bacteria (ARB versus their antibiotic resistance genes (ARGs during wastewater sludge treatment is critical in order to reduce the spread of antibiotic resistance through process optimization. Here, we spiked high concentrations of tetracycline-resistant bacteria, isolated from mesophilic (Iso M1-1- a Pseudomonas sp. and thermophilic (Iso T10- a Bacillus sp. anaerobic digested sludge, into batch digesters and monitored their fate by plate counts and quantitative polymerase chain reaction (QPCR of their corresponding tetracycline ARGs. In batch studies, spiked ARB plate counts returned to baseline (thermophilic or 1-log above baseline (mesophilic while levels of the ARG present in the spiked isolate (tet(G remained high in mesophilic batch reactors. To compare results under semi-continuous flow conditions with natural influent variation, tet(O, tet(W, and sul1 ARGs, along with the intI1 integrase gene, were monitored over a 9-month period in the raw feed sludge and effluent sludge of lab-scale thermophilic and mesophilic anaerobic digesters. sul1 and intI1 in mesophilic and thermophilic digesters correlated positively (Spearman rho = 0.457 to 0.829, P<0.05 with the raw feed sludge. There was no correlation in tet(O or tet(W ratios in raw sludge and mesophilic digested sludge or thermophilic digested sludge (Spearman rho = 0.130 to 0.486, P = 0.075 to 0.612. However, in the thermophilic digester, the tet(O and tet(W ratios remained consistently low over the entire monitoring period. We conclude that the influent sludge microbial composition can influence the ARG content of a digester, apparently as a result of differential survival or death of ARBs or horizontal gene transfer of genes between raw sludge ARBs and the digester microbial community. Notably, mesophilic digestion was more susceptible to ARG intrusion than thermophilic digestion, which may be attributed to a higher rate of ARB survival and

  14. Resistance gene management: concepts and practice

    Science.gov (United States)

    Christopher C. Mundt

    2012-01-01

    There is now a very long history of genetics/breeding for disease resistance in annual crops. These efforts have resulted in conceptual advances and frustrations, as well as practical successes and failures. This talk will review this history and its relevance to the genetics of resistance in forest species. All plant breeders and pathologists are familiar with boom-...

  15. Analysis of metal and biocides resistance genes in drug resistance and susceptible Salmonella enterica from food animals

    Science.gov (United States)

    Background Generally drug resistant bacteria carry antibiotic resistance genes and heavy metal and biocide resistance genes on large conjugative plasmids. The presence of these metal and biocide resistance genes in susceptible bacteria are not assessed comprehensively. Hence, WGS data of susceptib...

  16. Evolutionary meta-analysis of solanaceous resistance gene and solanum resistance gene analog sequences and a practical framework for cross-species comparisons.

    Science.gov (United States)

    Quirin, Edmund A; Mann, Harpartap; Meyer, Rachel S; Traini, Alessandra; Chiusano, Maria Luisa; Litt, Amy; Bradeen, James M

    2012-05-01

    Cross-species comparative genomics approaches have been employed to map and clone many important disease resistance (R) genes from Solanum species-especially wild relatives of potato and tomato. These efforts will increase with the recent release of potato genome sequence and the impending release of tomato genome sequence. Most R genes belong to the prominent nucleotide binding site-leucine rich repeat (NBS-LRR) class and conserved NBS-LRR protein motifs enable survey of the R gene space of a plant genome by generation of resistance gene analogs (RGA), polymerase chain reaction fragments derived from R genes. We generated a collection of 97 RGA from the disease-resistant wild potato S. bulbocastanum, complementing smaller collections from other Solanum species. To further comparative genomics approaches, we combined all known Solanum RGA and cloned solanaceous NBS-LRR gene sequences, nearly 800 sequences in total, into a single meta-analysis. We defined R gene diversity bins that reflect both evolutionary relationships and DNA cross-hybridization results. The resulting framework is amendable and expandable, providing the research community with a common vocabulary for present and future study of R gene lineages. Through a series of sequence and hybridization experiments, we demonstrate that all tested R gene lineages are of ancient origin, are shared between Solanum species, and can be successfully accessed via comparative genomics approaches.

  17. The antimicrobial resistance crisis: management through gene monitoring

    Science.gov (United States)

    2016-01-01

    Antimicrobial resistance (AMR) is an acknowledged crisis for humanity. Its genetic origins and dire potential outcomes are increasingly well understood. However, diagnostic techniques for monitoring the crisis are currently largely limited to enumerating the increasing incidence of resistant pathogens. Being the end-stage of the evolutionary process that produces antimicrobial resistant pathogens, these measurements, while diagnostic, are not prognostic, and so are not optimal in managing this crisis. A better test is required. Here, using insights from an understanding of evolutionary processes ruling the changing abundance of genes under selective pressure, we suggest a predictive framework for the AMR crisis. We then discuss the likely progression of resistance for both existing and prospective antimicrobial therapies. Finally, we suggest that by the environmental monitoring of resistance gene frequency, resistance may be detected and tracked presumptively, and how this tool may be used to guide decision-making in the local and global use of antimicrobials. PMID:27831476

  18. The Number of Genes Controlling Resistance in Beans to Common ...

    African Journals Online (AJOL)

    Ten crosses were made between resistant (R), susceptible (S), RxS susceptible and Intermediate (I), SxI and RxR bean lines to common bacterial blight. The F1 were advanced to F2 and in each cross over 250 F2 plants were used to evaluate for the number of genes controlling resistance using Mendelian genetics and ...

  19. Prevalence, antibiotic-resistance properties and enterotoxin gene ...

    African Journals Online (AJOL)

    Prevalence, antibiotic-resistance properties and enterotoxin gene profile of Bacillus cereus strains isolated from milk-based baby foods. ... Conclusion: Considerable prevalence of resistant and toxigenic B. cereus and high consumption of milk-based infant foods in Iran, represent an important public health issue which ...

  20. Occurrence and reservoirs of antibiotic resistance genes in the environment

    NARCIS (Netherlands)

    Seveno, N.; Kallifidas, D.; Smalla, K.; Elsas, van J.D.; Collard, J.M.; Karagouni, A.; Wellington, E.M.H.

    2002-01-01

    Antibiotic resistance genes have become highly mobile since the development of antibiotic chemotherapy. A considerable body of evidence exists proving the link between antibiotic use and the significant increase in drug-resistant human bacterial pathogens. The application of molecular detection and

  1. Identification of bacterial blight resistance genes Xa4 in Pakistani ...

    African Journals Online (AJOL)

    Identification of bacterial blight resistance genes Xa4 in Pakistani rice germplasm using PCR. M Arif, M Jaffar, M Babar, MA Sheikh, S Kousar, A Arif, Y Zafar. Abstract. Bacterial blight (BB) caused by Xanthomonas oryzae pv oryzae (Xoo) is a major biotic constraint in the irrigated rice belts. Genetic resistance is the most ...

  2. Spread of tetracycline resistance genes at a conventional dairy farm

    NARCIS (Netherlands)

    Kyselková, Martina; Jirout, Jiří; Vrchotová, Naděžda; Schmitt, Heike; Elhottová, Dana

    2015-01-01

    The use of antibiotics in animal husbandry contributes to the worldwide problem of increasing antibiotic resistance in animal and human pathogens. Intensive animal production is considered an important source of antibiotic resistance genes released to the environment, while the contribution of

  3. gene effects for resistance to groundnut rossette disease in exotic ...

    African Journals Online (AJOL)

    ACSS

    2016-02-25

    Feb 25, 2016 ... Opposite and significant signs of dominance [d] and dominance × dominance [l] components indicated the importance of duplicate epitasis in the latter crosses in the control of GRD resistance, which revealed a complex nature of inheritance of GRD resistance. Key Words: Arachis hypogaea, gene effects, ...

  4. Progress on introduction of rust resistance genes into confection sunflower

    Science.gov (United States)

    Sunflower rust (Puccinia helianthi) emerged as a serious disease in the last few years. Confection sunflower is particularly vulnerable to the disease due to the lack of resistance sources. The objectives of this project are to transfer rust resistance genes from oil sunflower to confectionery sunfl...

  5. Isolation and characterization of a candidate gene for resistance to ...

    African Journals Online (AJOL)

    ARC) domain, and a leucine-rich repeat (LRR) domain, all of which are typical characteristics of resistance genes. We proposed the resistance mechanism of CreV8 based on functional analysis and predictions from its conserved domains and ...

  6. Gene pyramiding enhances durable blast disease resistance in rice

    OpenAIRE

    Fukuoka, Shuichi; Saka, Norikuni; Mizukami, Yuko; Koga, Hironori; Yamanouchi, Utako; Yoshioka, Yosuke; Hayashi, Nagao; Ebana, Kaworu; Mizobuchi, Ritsuko; Yano, Masahiro

    2015-01-01

    Effective control of blast, a devastating fungal disease of rice, would increase and stabilize worldwide food production. Resistance mediated by quantitative trait loci (QTLs), which usually have smaller individual effects than R-genes but confer broad-spectrum or non-race-specific resistance, is a promising alternative to less durable race-specific resistance for crop improvement, yet evidence that validates the impact of QTL combinations (pyramids) on the durability of plant disease resista...

  7. Identification of virus and nematode resistance genes in the Chilota Potato Genebank of the Universidad Austral de Chile

    Directory of Open Access Journals (Sweden)

    Marlon López

    2015-09-01

    Full Text Available Potato Genebank of the Universidad Austral de Chile (UACh is an important gene bank in Chile. The accessions collected all over the country possess high genetic diversity, present interesting agronomic and cooking traits, and show resistance to biotic and abiotic stress. A particularly interesting subgroup of the gene bank includes the accessions collected in the South of Chile, the Chilota Potato Genebank. The focus of this study is the identification of virus and nematode resistant genes in potatoes (Solatium tuberosum L., using the RYSC3 and YES3-3B molecular markers. The Potato virus Y(PVY resistance genes Ry adg and Ry sto were identified. Furthermore, the CP60 marker was used to assess the Rx resistance gene that confers resistance to Potato virus X (PVX. In addition, the HC and GRO1-4 markers were utilized to identify the GpaVvrn_QTL and Gro1-4, resistance genes of Globodera pallida and Globodera rostochiensis, respectively. Both G. pallida and G. rostochiensis are Potato Cyst Nematodes (PCN. The plant material used in this study included leaves from 271 accessions of the gene bank. These samples were collected in the field where natural pathogen pressure of potential viruses and diseases exists. ELISA assays were run for field detection of PVY and PVX. However, there have been no previous reports of nematode presence in the plant material. The results herein presented indicate presence of virus and nematode resistance genes in accessions of the Chilota Potato Genebank. In terms of virus resistance, 99 accessions out of the 271 tested possess the Ry adg resistance gene and 17 accessions of these 271 tested have the Ry sto resistance gene. Also, 10 accessions showed positive amplification of the Rxl resistant gene marker. As to nematode resistance, 99 accessions have possible resistance to G. pallida and 54 accessions show potential resistance to G. rostochiensis as detected using the available molecular markers.

  8. Impact of pre-application treatment on municipal sludge composition, soil dynamics of antibiotic resistance genes, and abundance of antibiotic-resistance genes on vegetables at harvest.

    Science.gov (United States)

    Lau, Calvin Ho-Fung; Li, Bing; Zhang, Tong; Tien, Yuan-Ching; Scott, Andrew; Murray, Roger; Sabourin, Lyne; Lapen, David R; Duenk, Peter; Topp, Edward

    2017-06-01

    In many jurisdictions sludge recovered from the sewage treatment process is a valued fertilizer for crop production. Pre-treatment of sewage sludge prior to land application offers the potential to abate enteric microorganisms that carry genes conferring resistance to antibiotics. Pre-treatment practices that accomplish this should have the desirable effect of reducing the risk of contamination of crops or adjacent water with antibiotic resistance genes carried in these materials. In the present study, we obtained municipal sludge that had been subjected to one of five treatments. There were, anaerobic-digestion or aerobic-digestion, in both instances with and without dewatering; and heat-treatment and pelletization. Each of the five types of biosolids was applied to an agricultural field at commercial rates, following which lettuce, carrots and radishes were planted. Based on qPCR, the estimated antibiotic gene loading rates were comparable with each of the five biosolids. However, the gene abundance in soil following application of the pelletized biosolids was anomalously lower than expected. Following application, the abundance of antibiotic resistance genes decreased in a generally coherent fashion, except sul1 which increased in abundance during the growing season in the soil fertilized with pelletized biosolids. Based on qPCR and high throughput sequencing evidence for transfer of antibiotic resistance genes from the biosolids to the vegetables at harvest was weak. Clostridia were more abundant in soils receiving any of the biosolids except the pelletized. Overall, the behavior of antibiotic resistance genes in soils receiving aerobically or anaerobically-digested biosolids was consistent and coherent with previous studies. However, dynamics of antibiotic resistance genes in soils receiving the heat treated pelletized biosolids were very different, and the underlying mechanisms merit investigation. Crown Copyright © 2017. Published by Elsevier B.V. All

  9. Characterization of antimicrobial resistance genes in Haemophilus parasuis isolated from pigs in China.

    Science.gov (United States)

    Zhao, Yongda; Guo, Lili; Li, Jie; Huang, Xianhui; Fang, Binghu

    2018-01-01

    Haemophilus parasuis is a common porcine respiratory pathogen that causes high rates of morbidity and mortality in farmed swine. We performed a molecular characterization of antimicrobial resistance genes harbored by H. parasuis from pig farms in China. We screened 143 H. parasuis isolates for antimicrobial susceptibility against six fluoroquinolone antibiotics testing by the broth microdilution method, and the presence of 64 antimicrobial resistance genes by PCR amplification and DNA sequence analysis. We determined quinolone resistance determining region mutations of DNA gyrase ( gyrA and gyrB ) and topoisomerase IV ( parC and parE ). The genetic relatedness among the strains was analyzed by pulsed-field gel electrophoresis. Susceptibility test showed that all isolates were low resistance to lomefloxacin (28.67%), levofloxacin (20.28%), norfloxacin (22.38%), ciprofloxacin (23.78%), however, high resistance levels were found to nalidixic acid (82.52%) and enrofloxacin (55.94%). In addition, we found 14 antimicrobial resistance genes were present in these isolates, including bla TEM-1 , bla ROB-1 , ermB, ermA, flor, catl, tetB, tetC, rmtB, rmtD, aadA1, aac(3')-llc, sul1, and sul2 genes. Interestingly, one isolate carried five antibiotic resistance genes ( tetB, tetC, flor, rmtB, sul1 ). The genes tetB , rmtB, and flor were the most prevalent resistance genes in H. parasuis in China. Alterations in the gyrA gene (S83F/Y, D87Y/N/H/G) were detected in 81% of the strains and parC mutations were often accompanied by a gyrA mutation. Pulsed-field gel electrophoresis typing revealed 51 unique patterns in the isolates carrying high-level antibiotic resistance genes, indicating considerable genetic diversity and suggesting that the genes were spread horizontally. The current study demonstrated that the high antibiotic resistance of H. parasuis in piglets is a combination of transferable antibiotic resistance genes and multiple target gene mutations. These data provide novel

  10. Induced mutations of rust resistance genes in wheat

    International Nuclear Information System (INIS)

    McIntosh, R.A.

    1983-01-01

    Induced mutations are being used as a tool to study genes for resistance in wheat. It was found that Pm1 can be separated from Lr20 and Sr15, but these two react like a single pleiotropic gene. Mutants were further examined in crosses and backmutations have been attempted. (author)

  11. Characterization of genomic sequence of a drought-resistant gene ...

    Indian Academy of Sciences (India)

    Characterization of genomic sequence of a drought-resistant gene. TaSnRK2.7 in wheat species. HONG YING ZHANG1,2, WEI LI3, XIN GUO MAO1 and RUI LIAN JING1∗. 1The National Key Facility for Crop Gene Resources and Genetic Improvement, Institute of Crop Science,. Chinese Academy of Agricultural Sciences, ...

  12. Testing of disease-resistance of pokeweed antiviral protein gene ...

    African Journals Online (AJOL)

    Transformation of pokeweed antiviral protein gene (PAP) into plants was shown to improve plant resistance to several viruses or fungi pathogens with no much negative effect on plant growth. The non-virulent defective PAP inhibits only the virus but does not interfere with the host. A non-virulent defective PAP gene ...

  13. Isolation and characterization of a candidate gene for resistance to ...

    African Journals Online (AJOL)

    xudelin

    2012-05-17

    May 17, 2012 ... Cereal cyst nematode (CCN) (Heterodera avenae Woll.) is one of the most economically damaging endoparasite pests of wheat worldwide. We isolated and characterized a novel cereal CCN resistance candidate gene, CreV8, from Aegilops variabilis (2n = 28, UUSvSv). The gene was 3,568 bp long and.

  14. Nucleotide diversity and linkage disequilibrium in 11 expressed resistance candidate genes in Lolium perenne

    Directory of Open Access Journals (Sweden)

    Asp Torben

    2007-08-01

    Full Text Available Abstract Background Association analysis is an alternative way for QTL mapping in ryegrass. So far, knowledge on nucleotide diversity and linkage disequilibrium in ryegrass is lacking, which is essential for the efficiency of association analyses. Results 11 expressed disease resistance candidate (R genes including 6 nucleotide binding site and leucine rich repeat (NBS-LRR like genes and 5 non-NBS-LRR genes were analyzed for nucleotide diversity. For each of the genes about 1 kb genomic fragments were isolated from 20 heterozygous genotypes in ryegrass. The number of haplotypes per gene ranged from 9 to 27. On average, one single nucleotide polymorphism (SNP was present per 33 bp between two randomly sampled sequences for the 11 genes. NBS-LRR like gene fragments showed a high degree of nucleotide diversity, with one SNP every 22 bp between two randomly sampled sequences. NBS-LRR like gene fragments showed very high non-synonymous mutation rates, leading to altered amino acid sequences. Particularly LRR regions showed very high diversity with on average one SNP every 10 bp between two sequences. In contrast, non-NBS LRR resistance candidate genes showed a lower degree of nucleotide diversity, with one SNP every 112 bp. 78% of haplotypes occurred at low frequency ( Conclusion Substantial LD decay was found within a distance of 500 bp for most resistance candidate genes in this study. Hence, LD based association analysis is feasible and promising for QTL fine mapping of resistance traits in ryegrass.

  15. Deep sequence analysis reveals the ovine rumen as a reservoir of antibiotic resistance genes.

    Science.gov (United States)

    Hitch, Thomas C A; Thomas, Ben J; Friedersdorff, Jessica C A; Ougham, Helen; Creevey, Christopher J

    2018-04-01

    Antibiotic resistance is an increasingly important environmental pollutant with direct consequences for human health. Identification of environmental sources of antibiotic resistance genes (ARGs) makes it possible to follow their evolution and prevent their entry into the clinical setting. ARGs have been found in environmental sources exogenous to the original source and previous studies have shown that these genes are capable of being transferred from livestock to humans. Due to the nature of farming and the slaughter of ruminants for food, humans interact with these animals in close proximity, and for this reason it is important to consider the risks to human health. In this study, we characterised the ARG populations in the ovine rumen, termed the resistome. This was done using the Comprehensive Antibiotic Resistance Database (CARD) to identify the presence of genes conferring resistance to antibiotics within the rumen. Genes were successfully mapped to those that confer resistance to a total of 30 different antibiotics. Daptomycin was identified as the most common antibiotic for which resistance is present, suggesting that ruminants may be a source of daptomycin ARGs. Colistin resistance, conferred by the gene pmrE, was also found to be present within all samples, with an average abundance of 800 counts. Due to the high abundance of some ARGs (against daptomycin) and the presence of rare ARGs (against colistin), we suggest further study and monitoring of the rumen resistome as a possible source of clinically relevant ARGs. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  16. Gene Expression Profiling of Cecropin B-Resistant Haemophilus parasuis

    NARCIS (Netherlands)

    Wang, Chunmei; Chen, Fangzhou; Hu, Han; Li, Wentao; Wang, Yang; Chen, Pin; Liu, Yingyu; Ku, Xugang; He, Qigai; Chen, Huanchun; Xue, Feiqun

    2014-01-01

    Synthetically designed antimicrobial peptides (AMPs) present the potential of replacing antibiotics in the treatment of bacterial infections. However, microbial resistance to AMPs has been reported and little is known regarding the underlying mechanism of such resistance. The naturally occurring AMP

  17. Evaluation of resistance gene transfer from heat-treated Escherichia coli.

    Science.gov (United States)

    Le Devendec, Laëtitia; Jouy, Eric; Kempf, Isabelle

    2018-04-02

    Antimicrobial-resistant Escherichia coli may be present in various foods. The aim of this study was to evaluate the impact of heat treatment, simulating food preparation, on the possibility of antimicrobial resistance genes being transferred from E. coli cells. The study was performed on antimicrobial-resistant E. coli cells in suspension in a sterile saline solution. The stability of resistance genes and the possibility of their transfer by transformation or conjugation were analyzed. Results showed that antimicrobial-resistant E. coli cells managing to survive after a few minutes at 60 °C retained their antimicrobial resistance. No plasmid could be transferred by conjugation from antimicrobial-resistant E. coli cells heated to 60 °C for ten or more minutes. Twelve electroporation experiments were performed using a bacterial suspension heated to 70 °C for 30 min. Genes coding for resistance to extended-spectrum cephalosporins, tetracycline or sulfonamides were transferred to an E. coli DH5α recipient on two occasions. In conclusion we showed that heat-treated E. coli may occasionally transfer resistance genes. Copyright © 2018 Elsevier B.V. All rights reserved.

  18. Mutations inside rifampicin-resistance determining region of rpoB gene associated with rifampicin-resistance in Mycobacterium tuberculosis.

    Science.gov (United States)

    Zaw, Myo T; Emran, Nor A; Lin, Zaw

    2018-04-26

    Rifampicin (RIF) plays a pivotal role in the treatment of tuberculosis due to its bactericidal effects. Because the action of RIF is on rpoB gene encoding RNA polymerase β subunit, 95% of RIF resistant mutations are present in rpoB gene. The majority of the mutations in rpoB gene are found within an 81bp RIF-resistance determining region (RRDR). Literatures on RIF resistant mutations published between 2010 and 2016 were thoroughly reviewed. The most commonly mutated codons in RRDR of rpoB gene are 531, 526 and 516. The possibilities of absence of mutation in RRDR of rpoB gene in MDR-TB isolates in few studies was due to existence of other rare rpoB mutations outside RRDR or different mechanism of rifampicin resistance. Molecular methods which can identify extensive mutations associated with multiple anti-tuberculous drugs are in urgent need so that the research on drug resistant mutations should be extended. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  19. Environmental cycle of antibiotic resistance encoded genes: A systematic review

    Directory of Open Access Journals (Sweden)

    R. ghanbari

    2017-12-01

    Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.

  20. The Lr34 adult plant rust resistance gene provides seedling resistance in durum wheat without senescence.

    Science.gov (United States)

    Rinaldo, Amy; Gilbert, Brian; Boni, Rainer; Krattinger, Simon G; Singh, Davinder; Park, Robert F; Lagudah, Evans; Ayliffe, Michael

    2017-07-01

    The hexaploid wheat (Triticum aestivum) adult plant resistance gene, Lr34/Yr18/Sr57/Pm38/Ltn1, provides broad-spectrum resistance to wheat leaf rust (Lr34), stripe rust (Yr18), stem rust (Sr57) and powdery mildew (Pm38) pathogens, and has remained effective in wheat crops for many decades. The partial resistance provided by this gene is only apparent in adult plants and not effective in field-grown seedlings. Lr34 also causes leaf tip necrosis (Ltn1) in mature adult plant leaves when grown under field conditions. This D genome-encoded bread wheat gene was transferred to tetraploid durum wheat (T. turgidum) cultivar Stewart by transformation. Transgenic durum lines were produced with elevated gene expression levels when compared with the endogenous hexaploid gene. Unlike nontransgenic hexaploid and durum control lines, these transgenic plants showed robust seedling resistance to pathogens causing wheat leaf rust, stripe rust and powdery mildew disease. The effectiveness of seedling resistance against each pathogen correlated with the level of transgene expression. No evidence of accelerated leaf necrosis or up-regulation of senescence gene markers was apparent in these seedlings, suggesting senescence is not required for Lr34 resistance, although leaf tip necrosis occurred in mature plant flag leaves. Several abiotic stress-response genes were up-regulated in these seedlings in the absence of rust infection as previously observed in adult plant flag leaves of hexaploid wheat. Increasing day length significantly increased Lr34 seedling resistance. These data demonstrate that expression of a highly durable, broad-spectrum adult plant resistance gene can be modified to provide seedling resistance in durum wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  1. Gene expression in response to glyphosate treatment in fleabane (Conyza bonariensis) - glyphosate death response and candidate resistance genes.

    Science.gov (United States)

    Hereward, James P; Werth, Jeff A; Thornby, David F; Keenan, Michelle; Chauhan, Bhagirath Singh; Walter, Gimme H

    2017-11-28

    This study takes a whole-transcriptome approach to assess gene expression changes in response to glyphosate treatment in glyphosate-resistant fleabane. We assessed gene expression changes in both susceptible and resistant lines so that the glyphosate death response could be quantified, and constitutively expressed candidate resistance genes identified. There are three copies of the glyphosate target site (5-enolpyruvylshikimate-3-phosphate; EPSPS) gene in Conyza and because Conyza bonariensis is allohexaploid, there is a baseline nine copies of the gene in any individual. Many genes were differentially expressed in response to glyphosate treatment. Known resistance mutations are present in EPSPS2 but they are present in a glyphosate-susceptible line as well as resistant lines and therefore not sufficient to confer resistance. EPSPS1 is expressed four times more than EPSPS2, further reducing the overall contribution of these mutations. We demonstrate that glyphosate resistance in C. bonariensis is not the result of EPSPS mutations or overexpression, but due to a non-target-site mechanism. A large number of genes are affected by glyphosate treatment. We present a list of candidate non-target-site-resistance (NTSR) genes in fleabane for future studies into these mechanisms. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  2. Genes involved in barley yellow dwarf virus resistance of maize.

    Science.gov (United States)

    Horn, Frederike; Habekuß, Antje; Stich, Benjamin

    2014-12-01

    The results of our study suggest that genes involved in general resistance mechanisms of plants contribute to variation of BYDV resistance in maize. With increasing winter temperatures in Europe, Barley yellow dwarf virus (BYDV) is expected to become a prominent problem in maize cultivation. Breeding for resistance is the best strategy to control the disease and break the transmission cycle of the virus. The objectives of our study were (1) to determine genetic variation with respect to BYDV resistance in a broad germplasm set and (2) to identify single nucleotide polymorphism (SNP) markers linked to genes that are involved in BYDV resistance. An association mapping population with 267 genotypes representing the world's maize gene pool was grown in the greenhouse. Plants were inoculated with BYDV-PAV using viruliferous Rhopalosiphum padi. In the association mapping population, we observed considerable genotypic variance for the trait virus extinction as measured by double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) and the infection rate. In a genome-wide association study, we observed three SNPs significantly [false discovery rate (FDR) = 0.05] associated with the virus extinction on chromosome 10 explaining together 25 % of the phenotypic variance and five SNPs for the infection rate on chromosomes 4 and 10 explaining together 33 % of the phenotypic variance. The SNPs significantly associated with BYDV resistance can be used in marker assisted selection and will accelerate the breeding process for the development of BYDV resistant maize genotypes. Furthermore, these SNPs were located within genes which were in other organisms described to play a role in general resistance mechanisms. This suggests that these genes contribute to variation of BYDV resistance in maize.

  3. Identifying resistance gene analogs associated with resistances to different pathogens in common bean.

    Science.gov (United States)

    López, Camilo E; Acosta, Iván F; Jara, Carlos; Pedraza, Fabio; Gaitán-Solís, Eliana; Gallego, Gerardo; Beebe, Steve; Tohme, Joe

    2003-01-01

    ABSTRACT A polymerase chain reaction approach using degenerate primers that targeted the conserved domains of cloned plant disease resistance genes (R genes) was used to isolate a set of 15 resistance gene analogs (RGAs) from common bean (Phaseolus vulgaris). Eight different classes of RGAs were obtained from nucleotide binding site (NBS)-based primers and seven from not previously described Toll/Interleukin-1 receptor-like (TIR)-based primers. Putative amino acid sequences of RGAs were significantly similar to R genes and contained additional conserved motifs. The NBS-type RGAs were classified in two subgroups according to the expected final residue in the kinase-2 motif. Eleven RGAs were mapped at 19 loci on eight linkage groups of the common bean genetic map constructed at Centro Internacional de Agricultura Tropical. Genetic linkage was shown for eight RGAs with partial resistance to anthracnose, angular leaf spot (ALS) and Bean golden yellow mosaic virus (BGYMV). RGA1 and RGA2 were associated with resistance loci to anthracnose and BGYMV and were part of two clusters of R genes previously described. A new major cluster was detected by RGA7 and explained up to 63.9% of resistance to ALS and has a putative contribution to anthracnose resistance. These results show the usefulness of RGAs as candidate genes to detect and eventually isolate numerous R genes in common bean.

  4. The relationship between codon usage bias and cold resistant genes

    International Nuclear Information System (INIS)

    Barozai, M.Y.; Din, M.

    2014-01-01

    This research is based on synonymous codon usage which has been well-known as a feature that affects typical expression level of protein in an organism. Different organisms prefer different codons for same amino acid and this is called Codon Usage Bias (CUB). The codon usage directly affects the level or even direction of changes in protein expression in responses to environmental stimuli. Cold stress is a major abiotic factor that limits the agricultural productivity of plants. In the recent study CUB has been studied in Arabidopsis thaliana cold resistant and housekeeping genes and their homologs in rice (Oryza sativa) to understand the cold stress and housekeeping genes relation with CUB. Six cold resistant and three housekeeping genes in Arabidopsis thaliana and their homologs in rice, were subjected to CUB analysis. The three cold resistant genes (DREB1B, RCI and MYB15) showed more than 50% (52%, 61% and 66% respectively) similar codon usage bias for Arabidopsis thaliana and rice. On the other hand three cold resistant genes (MPK3, ICE1 and ZAT12) showed less than 50% (38%, 38% and 47% respectively) similar codon usage bias for Arabidopsis thaliana and rice. The three housekeeping genes (Actin, Tubulin and Ubiquitin) showed 76% similar codon usage bias for Arabidopsis thaliana and rice. This study will help to manage the plant gene expression through codon optimization under the cold stress. (author)

  5. Sofa dermatitis presenting as a chronic treatment resistant dermatitis.

    LENUS (Irish Health Repository)

    Lynch, M

    2010-04-01

    There is now a well publicised increase in cases of sofa dermatitis since 2007. These have been linked to allergic contact sensitization to dimethlylfumarate, a novel contact allergen. We report on a case associated with a two year history of a treatment resistant dermatitis.

  6. Shotgun metagenomics reveals a wide array of antibiotic resistance genes and mobile elements in a polluted lake in India

    Directory of Open Access Journals (Sweden)

    Johan eBengtsson-Palme

    2014-12-01

    Full Text Available There is increasing evidence for an environmental origin of many antibiotic resistance genes. Consequently, it is important to identify environments of particular risk for selecting and maintaining such resistance factors. In this study, we described the diversity of antibiotic resistance genes in an Indian lake subjected to industrial pollution with fluoroquinolone antibiotics. We also assessed the genetic context of the identified resistance genes, to try to predict their genetic transferability. The lake harbored a wide range of resistance genes (81 identified gene types against essentially every major class of antibiotics, as well as genes responsible for mobilization of genetic material. Resistance genes were estimated to be 7000 times more abundant than in a Swedish lake included for comparison, where only eight resistance genes were found. The sul2 and qnrD genes were the most common resistance genes in the Indian lake. Twenty-six known and twenty-one putative novel plasmids were recovered in the Indian lake metagenome, which, together with the genes found, indicate a large potential for horizontal gene transfer through conjugation. Interestingly, the microbial community of the lake still included a wide range of taxa, suggesting that, across most phyla, bacteria has adapted relatively well to this highly polluted environment. Based on the wide range and high abundance of known resistance factors we have detected, it is plausible that yet unrecognized resistance genes are also present in the lake. Thus, we conclude that environments polluted with waste from antibiotic manufacturing could be important reservoirs for mobile antibiotic resistance genes.

  7. Search Engine for Antimicrobial Resistance: A Cloud Compatible Pipeline and Web Interface for Rapidly Detecting Antimicrobial Resistance Genes Directly from Sequence Data.

    Science.gov (United States)

    Rowe, Will; Baker, Kate S; Verner-Jeffreys, David; Baker-Austin, Craig; Ryan, Jim J; Maskell, Duncan; Pearce, Gareth

    2015-01-01

    Antimicrobial resistance remains a growing and significant concern in human and veterinary medicine. Current laboratory methods for the detection and surveillance of antimicrobial resistant bacteria are limited in their effectiveness and scope. With the rapidly developing field of whole genome sequencing beginning to be utilised in clinical practice, the ability to interrogate sequencing data quickly and easily for the presence of antimicrobial resistance genes will become increasingly important and useful for informing clinical decisions. Additionally, use of such tools will provide insight into the dynamics of antimicrobial resistance genes in metagenomic samples such as those used in environmental monitoring. Here we present the Search Engine for Antimicrobial Resistance (SEAR), a pipeline and web interface for detection of horizontally acquired antimicrobial resistance genes in raw sequencing data. The pipeline provides gene information, abundance estimation and the reconstructed sequence of antimicrobial resistance genes; it also provides web links to additional information on each gene. The pipeline utilises clustering and read mapping to annotate full-length genes relative to a user-defined database. It also uses local alignment of annotated genes to a range of online databases to provide additional information. We demonstrate SEAR's application in the detection and abundance estimation of antimicrobial resistance genes in two novel environmental metagenomes, 32 human faecal microbiome datasets and 126 clinical isolates of Shigella sonnei. We have developed a pipeline that contributes to the improved capacity for antimicrobial resistance detection afforded by next generation sequencing technologies, allowing for rapid detection of antimicrobial resistance genes directly from sequencing data. SEAR uses raw sequencing data via an intuitive interface so can be run rapidly without requiring advanced bioinformatic skills or resources. Finally, we show that SEAR

  8. Search Engine for Antimicrobial Resistance: A Cloud Compatible Pipeline and Web Interface for Rapidly Detecting Antimicrobial Resistance Genes Directly from Sequence Data.

    Directory of Open Access Journals (Sweden)

    Will Rowe

    Full Text Available Antimicrobial resistance remains a growing and significant concern in human and veterinary medicine. Current laboratory methods for the detection and surveillance of antimicrobial resistant bacteria are limited in their effectiveness and scope. With the rapidly developing field of whole genome sequencing beginning to be utilised in clinical practice, the ability to interrogate sequencing data quickly and easily for the presence of antimicrobial resistance genes will become increasingly important and useful for informing clinical decisions. Additionally, use of such tools will provide insight into the dynamics of antimicrobial resistance genes in metagenomic samples such as those used in environmental monitoring.Here we present the Search Engine for Antimicrobial Resistance (SEAR, a pipeline and web interface for detection of horizontally acquired antimicrobial resistance genes in raw sequencing data. The pipeline provides gene information, abundance estimation and the reconstructed sequence of antimicrobial resistance genes; it also provides web links to additional information on each gene. The pipeline utilises clustering and read mapping to annotate full-length genes relative to a user-defined database. It also uses local alignment of annotated genes to a range of online databases to provide additional information. We demonstrate SEAR's application in the detection and abundance estimation of antimicrobial resistance genes in two novel environmental metagenomes, 32 human faecal microbiome datasets and 126 clinical isolates of Shigella sonnei.We have developed a pipeline that contributes to the improved capacity for antimicrobial resistance detection afforded by next generation sequencing technologies, allowing for rapid detection of antimicrobial resistance genes directly from sequencing data. SEAR uses raw sequencing data via an intuitive interface so can be run rapidly without requiring advanced bioinformatic skills or resources. Finally, we

  9. Cloning of Bacteroides fragilis plasmid genes affecting metronidazole resistance and ultraviolet survival in Escherichia coli

    International Nuclear Information System (INIS)

    Wehnert, G.U.; Abratt, V.R.; Goodman, H.J.; Woods, D.R.

    1990-01-01

    Since reduced metronidazole causes DNA damage, resistance to metronidazole was used as a selection method for the cloning of Bacteroides fragilis genes affecting DNA repair mechanisms in Escherichia coli. Genes from B. fragilis Bf-2 were cloned on a recombinant plasmid pMT100 which made E. coli AB1157 and uvrA, B, and C mutant strains more resistant to metronidazole, but more sensitive to far uv irradiation under aerobic conditions. The loci affecting metronidazole resistance and uv sensitivity were linked and located on a 5-kb DNA fragment which originated from the small 6-kb cryptic plasmid pBFC1 present in B. fragilis Bf-2 cells

  10. AMINOGLYCOSIDE RESISTANCE GENES IN Pseudomonas aeruginosa ISOLATES FROM CUMANA, VENEZUELA

    Directory of Open Access Journals (Sweden)

    Bertinellys TEIXEIRA

    2016-01-01

    Full Text Available The enzymatic modification of aminoglycosides by aminoglycoside-acetyltransferases (AAC, aminoglycoside-adenyltransferases (AAD, and aminoglycoside-phosphotransferases (APH, is the most common resistance mechanism in P. aeruginosa and these enzymes can be coded on mobile genetic elements that contribute to their dispersion. One hundred and thirty seven P. aeruginosa isolates from the University Hospital, Cumana, Venezuela (HUAPA were evaluated. Antimicrobial susceptibility was determined by the disk diffusion method and theaac, aadB and aph genes were detected by PCR. Most of the P. aeruginosa isolates (33/137 were identified from the Intensive Care Unit (ICU, mainly from discharges (96/137. The frequency of resistant P. aeruginosaisolates was found to be higher for the aminoglycosides tobramycin and amikacin (30.7 and 29.9%, respectively. Phenotype VI, resistant to these antibiotics, was the most frequent (14/49, followed by phenotype I, resistant to all the aminoglycosides tested (12/49. The aac(6´-Ib,aphA1 and aadB genes were the most frequently detected, and the simultaneous presence of several resistance genes in the same isolate was demonstrated. Aminoglycoside resistance in isolates ofP. aeruginosa at the HUAPA is partly due to the presence of the aac(6´-Ib, aphA1 andaadB genes, but the high rates of antimicrobial resistance suggest the existence of several mechanisms acting together. This is the first report of aminoglycoside resistance genes in Venezuela and one of the few in Latin America.

  11. Molecular Scree ning of Blast Resistance Genes in Rice Germplasms Resistant to Magnaporthe oryzae

    Directory of Open Access Journals (Sweden)

    Liang Yan

    2017-01-01

    Full Text Available Molecular screening of major rice blast resistance genes was determined with molecular markers, which showed close-set linkage to 11 major rice blast resistance genes (Pi-d2, Pi-z, Piz-t, Pi-9, Pi-36, Pi-37, Pi5, Pi-b, Pik-p, Pik-h and Pi-ta2, in a collection of 32 accessions resistant to Magnaporthe oryzae. Out of the 32 accessions, the Pi-d2 and Pi-z appeared to be omnipresent and gave positive express. As the second dominant, Pi-b and Piz-t gene frequencies were 96.9% and 87.5%. And Pik-h and Pik-p gene frequencies were 43.8% and 28.1%, respectively. The molecular marker linkage to Pi-ta2 produced positive bands in eleven accessions, while the molecular marker linkage to Pi-36 and Pi-37 in only three and four accessions, respectively. The natural field evaluation analysis showed that 30 of the 32 accessions were resistant, one was moderately resistant and one was susceptible. Infection types were negatively correlated with the genotype scores of Pi-9, Pi5, Pi-b, Pi-ta2 and Pik-p, although the correlation coefficients were very little. These results are useful in identification and incorporation of functional resistance genes from these germplasms into elite cultivars through marker-assisted selection for improved blast resistance in China and worldwide.

  12. HIV-1 Drug Resistance Mutations Are Present in Six Percent of Persons Initiating Antiretroviral Therapy in Lusaka, Zambia

    NARCIS (Netherlands)

    Hamers, Raph L.; Siwale, Margaret; Wallis, Carole L.; Labib, Moheb; van Hasselt, Robbert; Stevens, Wendy S.; Schuurman, Rob; Wensing, Annemarie M. J.; van Vugt, Michèle; Rinke de Wit, Tobias F.

    2010-01-01

    Objective: To assess the mutational patterns and factors associated with baseline drug-resistant HIV-1 present at initiation of first-line antiretroviral therapy (ART) at 3 sites in Lusaka, Zambia, in 2007-2008. Methods: Population sequencing of the HIV-1 pol gene was performed in the PharmAccess

  13. The rpg4/Rpg5 stem rust resistance locus in barley: resistance genes and cytoskeleton dynamics.

    Science.gov (United States)

    Brueggeman, Robert; Steffenson, Brian J; Kleinhofs, Andris

    2009-04-01

    Two closely linked resistance genes, rpg4 and Rpg5, conferring resistance to several races of Puccinia graminis, were cloned and characterized. The Rpg5 gene confers resistance to an isolate of Puccinia graminis f. sp. secalis (Pgs), while rpg4 confers resistance to Puccinia graminis f. sp. tritici (Pgt). Rpg5 is a novel gene containing nucleotide binding site-leucine rich repeat domains in combination with a serine threonine protein kinase domain. High-resolution mapping plus allele and recombinant sequencing identified the rpg4 gene, which encodes an actin depolymerizing factor-like protein (ADF2). Resistance against the Pgt races QCCJ, MCCF, TTKSK (aka Ug99) and RCRS requires both Rpg5 and rpg4, while Rpg5 alone confers resistance to Pgs isolate 92-MN-90. The dependency on the actin modifying protein ADF2 indicates cytoskeleton reorganization or redirection plays a role in pathogen-host interactions. Rpg5 may interact with ADF2 to activate or deactivate its function in the resistance response. Alternatively, Rpg5 could initiate signal transduction leading to resistance in response to detecting ADF2 protein modification. Pgt may redirect the actin cytoskeleton by inducing modifications of ADF2. The redirection of actin could possibly enable the pathogen to develop a haustoria-plant cell cytoskeleton interface for acquisition of nutrients.

  14. A novel gene of Kalanchoe daigremontiana confers plant drought resistance.

    Science.gov (United States)

    Wang, Li; Zhu, Chen; Jin, Lin; Xiao, Aihua; Duan, Jie; Ma, Luyi

    2018-02-07

    Kalanchoe (K.) daigremontiana is important for studying asexual reproduction under different environmental conditions. Here, we describe a novel KdNOVEL41 (KdN41) gene that may confer drought resistance and could thereby affect K. daigremontiana development. The detected subcellular localization of a KdN41/Yellow Fluorescent Protein (YFP) fusion protein was in the nucleus and cell membrane. Drought, salt, and heat stress treatment in tobacco plants containing the KdN41 gene promoter driving β-glucuronidase (GUS) gene transcription revealed that only drought stress triggered strong GUS staining in the vascular tissues. Overexpression (OE) of the KdN41 gene conferred improved drought resistance in tobacco plants compared to wild-type and transformed with empty vector plants by inducing higher antioxidant enzyme activities, decreasing cell membrane damage, increasing abscisic acid (ABA) content, causing reinforced drought resistance related gene expression profiles. The 3,3'-diaminobenzidine (DAB) and nitroblue tetrazolium (NBT) staining results also showed less relative oxygen species (ROS) content in KdN41-overexpressing tobacco leaf during drought stress. Surprisingly, by re-watering after drought stress, KdN41-overexpressing tobacco showed earlier flowering. Overall, the KdN41 gene plays roles in ROS scavenging and osmotic damage reduction to improve tobacco drought resistance, which may increase our understanding of the molecular network involved in developmental manipulation under drought stress in K. daigremontiana.

  15. Antibiotic resistance and resistance genes in Escherichia coli from poultry farms, southwest Nigeria

    OpenAIRE

    Adelowo, Olawale O.; Fagade, Obasola E.; Agersø, Yvonne

    2014-01-01

    Introduction: This study investigated the mechanisms of resistance in 36 E. coli isolated from waste, litter, soil and water samples collected from poultry farms in Southwestern Nigeria. Methodology: Minimum inhibitory concentration (MIC) distributions of the isolates were determined using the methods of the Clinical and Laboratory Standard Institute and resistance genes detected by PCR. Results: A total of 30 isolates (94%) showed resistance to more than one antimicrobial. Percentage resista...

  16. Effect of swine manure application timing on the persistence and transport of antibiotic-resistant Enterococcus and resistance genes

    Science.gov (United States)

    Swine manure applied to agricultural fields may lead to the transport of antibiotic resistant bacteria and antibiotic resistance genes to freshwater systems. Enterococci were studied because they are fecal indicator bacteria associated with manure. Resistance genes include genes from live cells, dea...

  17. Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.

    1995-01-01

    Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...

  18. Confirmation of root-knot nematode resistant gene Rmi1 using SSR markers

    Directory of Open Access Journals (Sweden)

    Musarrat Ramzan

    2017-02-01

    Full Text Available Background: The Root Knot Nematode (RKN is a serious economic threat to various cultivated crops worldwide. It is a devastating pest of soybean and responsible to cause severe yield loss in Pakistan. The cultivation of resistant soybean varieties against this pest is the sustainable strategy to manage the heavy loss and increase yield. There is an utmost need to identify RKN resistant varieties of soybean against cultivated in Pakistan. The presented study is an attempt to identify and confirm the presence of resistant gene Rmi1 in soybean. Method: Molecular studies have been done using Simple Sequence Repeat (SSR marker system to identify resistant soybean varieties against Root Knot Nematode (RKN using fifteen (15 indigenous cultivars and four (4 US cultivars. DNA was isolated, purified, quantified and then used to employ various SSR markers. The amplified product is observed using gel documentation system after electrophoresis. Results: Diagnostic SSR markers Satt-358 and Satt-492 have shown the presence of Rmi1 gene in all resistance carrying genotypes. Satt-358 amplified the fragment of 200 bp and Satt-492 generated 232 bp bands in all resistant genotypes. This study confirmed the Rmi gene locus (G248A-1 in all internationally confirmed resistant including six (6 native varieties. Conclusion: These investigations have identified six (6 resistant cultivars revealing the effective and informative sources that can be utilized in breeding programs for the selection of RKN resistance soybean genotypes in Pakistan.

  19. Antibiotic Resistance and Antibiotic Resistance Genes in Escherichia coli Isolates from Hospital Wastewater in Vietnam

    Science.gov (United States)

    Lan, Pham Thi; Chuc, Nguyen Thi Kim; Hoa, Nguyen Quynh; Nhung, Pham Hong; Thoa, Nguyen Thi Minh; Diwan, Vishal; Tamhankar, Ashok J.; Stålsby Lundborg, Cecilia

    2017-01-01

    The environmental spread of antibiotic-resistant bacteria has been recognised as a growing public health threat for which hospitals play a significant role. The aims of this study were to investigate the prevalence of antibiotic resistance and antibiotic resistance genes (ARGs) in Escherichia coli isolates from hospital wastewater in Vietnam. Wastewater samples before and after treatment were collected using continuous sampling every month over a year. Standard disk diffusion and E-test were used for antibiotic susceptibility testing. Extended-spectrum beta-lactamase (ESBL) production was tested using combined disk diffusion. ARGs were detected by polymerase chain reactions. Resistance to at least one antibiotic was detected in 83% of isolates; multidrug resistance was found in 32%. The highest resistance prevalence was found for co-trimoxazole (70%) and the lowest for imipenem (1%). Forty-three percent of isolates were ESBL-producing, with the blaTEM gene being more common than blaCTX-M. Co-harbouring of the blaCTX-M, blaTEM and qepA genes was found in 46% of isolates resistant to ciprofloxacin. The large presence of antibiotic-resistant E. coli isolates combined with ARGs in hospital wastewater, even post-treatment, poses a threat to public health. It highlights the need to develop effective processes for hospital wastewater treatment plants to eliminate antibiotic resistant bacteria and ARGs. PMID:28661465

  20. Antibiotic Resistance and Antibiotic Resistance Genes in Escherichia coli Isolates from Hospital Wastewater in Vietnam.

    Science.gov (United States)

    Lien, La Thi Quynh; Lan, Pham Thi; Chuc, Nguyen Thi Kim; Hoa, Nguyen Quynh; Nhung, Pham Hong; Thoa, Nguyen Thi Minh; Diwan, Vishal; Tamhankar, Ashok J; Stålsby Lundborg, Cecilia

    2017-06-29

    The environmental spread of antibiotic-resistant bacteria has been recognised as a growing public health threat for which hospitals play a significant role. The aims of this study were to investigate the prevalence of antibiotic resistance and antibiotic resistance genes (ARGs) in Escherichia coli isolates from hospital wastewater in Vietnam. Wastewater samples before and after treatment were collected using continuous sampling every month over a year. Standard disk diffusion and E-test were used for antibiotic susceptibility testing. Extended-spectrum beta-lactamase (ESBL) production was tested using combined disk diffusion. ARGs were detected by polymerase chain reactions. Resistance to at least one antibiotic was detected in 83% of isolates; multidrug resistance was found in 32%. The highest resistance prevalence was found for co-trimoxazole (70%) and the lowest for imipenem (1%). Forty-three percent of isolates were ESBL-producing, with the bla TEM gene being more common than bla CTX-M . Co-harbouring of the bla CTX-M , bla TEM and qepA genes was found in 46% of isolates resistant to ciprofloxacin. The large presence of antibiotic-resistant E. coli isolates combined with ARGs in hospital wastewater, even post-treatment, poses a threat to public health. It highlights the need to develop effective processes for hospital wastewater treatment plants to eliminate antibiotic resistant bacteria and ARGs.

  1. Differential expression of TIR-like genes embedded in the M1-1 gene cluster in nematode-resistant and -susceptible tomato roots

    NARCIS (Netherlands)

    Seifi Abdolabad, A.R.; Visser, R.G.F.; Bai, Y.

    2011-01-01

    Transport inhibitor 1 (TIR1) is an auxin receptor that plays a pivotal role in auxin signaling. It has been reported that TIR-like genes are present in a gene cluster carrying the Mi-1 gene which confers resistance to nematodes, aphids and whiteflies. Since auxin is involved in the pathogenicity of

  2. Molecular marker assisted gene stacking for biotic and abiotic stress resistance genes in an elite rice cultivar

    Science.gov (United States)

    Das, Gitishree; Rao, G. J. N.

    2015-01-01

    Severe yield loss due to various biotic stresses like bacterial blight (BB), gall midge (insect) and Blast (disease) and abiotic stresses like submergence and salinity are a serious constraint to the rice productivity throughout the world. The most effective and reliable method of management of the stresses is the enhancement of host resistance, through an economical and environmentally friendly approach. Through the application of marker assisted selection (MAS) technique, the present study reports a successful pyramidization of genes/QTLs to confer resistance/tolerance to blast (Pi2, Pi9), gall Midge (Gm1, Gm4), submergence (Sub1), and salinity (Saltol) in a released rice variety CRMAS2621-7-1 as Improved Lalat which had already incorporated with three BB resistance genes xa5, xa13, and Xa21 to supplement the Xa4 gene present in Improved Lalat. The molecular analysis revealed clear polymorphism between the donor and recipient parents for all the markers that are tagged to the target traits. The conventional backcross breeding approach was followed till BC3F1 generation and starting from BC1F1 onwards, marker assisted selection was employed at each step to monitor the transfer of the target alleles with molecular markers. The different BC3F1s having the target genes/QTLs were inter crossed to generate hybrids with all 10 stress resistance/tolerance genes/QTLs into a single plant/line. Homozygous plants for resistance/tolerance genes in different combinations were recovered. The BC3F3 lines were characterized for their agronomic and quality traits and promising progeny lines were selected. The SSR based background selection was done. Most of the gene pyramid lines showed a high degree of similarity to the recurrent parent for both morphological, grain quality traits and in SSR based background selection. Out of all the gene pyramids tested, two lines had all the 10 resistance/tolerance genes and showed adequate levels of resistance/tolerance against the five target

  3. Skin Commensal Staphylococci May Act as Reservoir for Fusidic Acid Resistance Genes.

    Science.gov (United States)

    Hung, Wei-Chun; Chen, Hsiao-Jan; Lin, Yu-Tzu; Tsai, Jui-Chang; Chen, Chiao-Wei; Lu, Hsiao-Hung; Tseng, Sung-Pin; Jheng, Yao-Yu; Leong, Kin Hong; Teng, Lee-Jene

    2015-01-01

    We analyzed the occurrence and mechanisms of fusidic acid resistance present in staphylococci isolated from 59 healthy volunteers. The fingers of the volunteers were screened for the presence of staphylococci, and the collected isolates were tested for resistance to fusidic acid. A total of 34 fusidic acid resistant staphylococcal strains (all were coagulase-negative) were isolated from 22 individuals (22/59, 37.3%). Examination of the resistance genes revealed that acquired fusB or fusC was present in Staphylococcus epidermidis, Staphylococcus capitis subsp. urealyticus, Staphylococcus hominis subsp. hominis, Staphylococcus warneri and Staphylococcus haemolyticus. Resistance islands (RIs) carrying fusB were found in S. epidermidis and S. capitis subsp. urealyticus, while staphylococcal chromosome cassette (SCC)-related structures harboring fusC were found in S. hominis subsp. hominis. Genotypic analysis of S. epidermidis and S. hominis subsp. hominis indicated that the fus elements were disseminated in diverse genetic strain backgrounds. The fusC elements in S. hominis subsp. hominis strains were highly homologous to SCCfusC in the epidemic sequence type (ST) 239/SCCmecIII methicillin-resistant S. aureus (MRSA) or the pseudo SCCmec in ST779 MRSA. The presence of acquired fusidic acid resistance genes and their genetic environment in commensal staphylococci suggested that the skin commensal staphylococci may act as reservoir for fusidic acid resistance genes.

  4. Skin Commensal Staphylococci May Act as Reservoir for Fusidic Acid Resistance Genes.

    Directory of Open Access Journals (Sweden)

    Wei-Chun Hung

    Full Text Available We analyzed the occurrence and mechanisms of fusidic acid resistance present in staphylococci isolated from 59 healthy volunteers. The fingers of the volunteers were screened for the presence of staphylococci, and the collected isolates were tested for resistance to fusidic acid. A total of 34 fusidic acid resistant staphylococcal strains (all were coagulase-negative were isolated from 22 individuals (22/59, 37.3%. Examination of the resistance genes revealed that acquired fusB or fusC was present in Staphylococcus epidermidis, Staphylococcus capitis subsp. urealyticus, Staphylococcus hominis subsp. hominis, Staphylococcus warneri and Staphylococcus haemolyticus. Resistance islands (RIs carrying fusB were found in S. epidermidis and S. capitis subsp. urealyticus, while staphylococcal chromosome cassette (SCC-related structures harboring fusC were found in S. hominis subsp. hominis. Genotypic analysis of S. epidermidis and S. hominis subsp. hominis indicated that the fus elements were disseminated in diverse genetic strain backgrounds. The fusC elements in S. hominis subsp. hominis strains were highly homologous to SCCfusC in the epidemic sequence type (ST 239/SCCmecIII methicillin-resistant S. aureus (MRSA or the pseudo SCCmec in ST779 MRSA. The presence of acquired fusidic acid resistance genes and their genetic environment in commensal staphylococci suggested that the skin commensal staphylococci may act as reservoir for fusidic acid resistance genes.

  5. The Lr34 adult plant rust resistance gene provides seedling resistance in durum wheat without senescence

    OpenAIRE

    Rinaldo, Amy; Gilbert, Brian; Boni, Rainer; Krattinger, Simon G.; Singh, Davinder; Park, Robert F.; Lagudah, Evans; Ayliffe, Michael

    2017-01-01

    Summary The hexaploid wheat (Triticum aestivum) adult plant resistance gene, Lr34/Yr18/Sr57/Pm38/Ltn1, provides broad?spectrum resistance to wheat leaf rust (Lr34), stripe rust (Yr18), stem rust (Sr57) and powdery mildew (Pm38) pathogens, and has remained effective in wheat crops for many decades. The partial resistance provided by this gene is only apparent in adult plants and not effective in field?grown seedlings. Lr34 also causes leaf tip necrosis (Ltn1) in mature adult plant leaves when ...

  6. Gene interactions and genetics of blast resistance and yield

    Indian Academy of Sciences (India)

    Blast disease caused by the pathogen Pyricularia oryzae is a serious threat to rice production. Six generations viz., P1, P2, F1, F2, B1 and B2 of a cross between blast susceptible high-yielding rice cultivar ADT 43 and resistant near isogenic line (NIL) CT13432-3R, carrying four blast resistance genes Pi1, Pi2, Pi33 and Pi54 ...

  7. Comparative genome analysis and resistance gene mapping in grain legumes

    International Nuclear Information System (INIS)

    Young, N.D.

    1998-01-01

    Using, DNA markers and genome organization, several important disease resistance genes have been analyzed in mungbean (Vigna radiata), cowpea (Vigna unguiculata), common bean (Phaseolus vulgaris), and soybean (Glycine max). In the process, medium-density linkage maps consisting of restriction fragment length polymorphism (RFLP) markers were constructed for both mungbean and cowpea. Comparisons between these maps, as well as the maps of soybean and common bean, indicate that there is significant conservation of DNA marker order, though the conserved blocks in soybean are much shorter than in the others. DNA mapping results also indicate that a gene for seed weight may be conserved between mungbean and cowpea. Using the linkage maps, genes that control bruchid (genus Callosobruchus) and powdery mildew (Erysiphe polygoni) resistance in mungbean, aphid resistance in cowpea (Aphis craccivora), and cyst nematode (Heterodera glycines) resistance in soybean have all been mapped and characterized. For some of these traits resistance was found to be oligogenic and DNA mapping uncovered multiple genes involved in the phenotype. (author)

  8. Dissemination of antibiotic resistance genes from antibiotic producers to pathogens

    DEFF Research Database (Denmark)

    Jiang, Xinglin; Ellabaan, Mostafa M Hashim; Charusanti, Pep

    2017-01-01

    It has been hypothesized that some antibiotic resistance genes (ARGs) found in pathogenic bacteria derive from antibiotic-producing actinobacteria. Here we provide bioinformatic and experimental evidence supporting this hypothesis. We identify genes in proteobacteria, including some pathogens......, that appear to be closely related to actinobacterial ARGs known to confer resistance against clinically important antibiotics. Furthermore, we identify two potential examples of recent horizontal transfer of actinobacterial ARGs to proteobacterial pathogens. Based on this bioinformatic evidence, we propose...... results support the existence of ancient and, possibly, recent transfers of ARGs from antibiotic-producing actinobacteria to proteobacteria, and provide evidence for a defined mechanism....

  9. Antibiotic resistance and resistance genes in Escherichia coli from poultry farms, southwest Nigeria.

    Science.gov (United States)

    Adelowo, Olawale O; Fagade, Obasola E; Agersø, Yvonne

    2014-09-12

    This study investigated the mechanisms of resistance in 36 E. coli isolated from waste, litter, soil and water samples collected from poultry farms in Southwestern Nigeria. Minimum inhibitory concentration (MIC) distributions of the isolates were determined using the methods of the Clinical and Laboratory Standard Institute and resistance genes detected by PCR. A total of 30 isolates (94%) showed resistance to more than one antimicrobial. Percentage resistance was: tetracycline 81%, sulphamethoxazole 67%, streptomycin 56%, trimethoprim 47 %, ciprofloxacin 42%, ampicillin 36%, spectinomycin 28%, nalidixic acid 25%, chloramphenicol 22%, neomycin 14%, gentamicin 8%, amoxicillin-clavulanate, ceftiofur, cefotaxime, colistin, florfenicol and apramycin 0%. Resistance genes found among the isolates include bla-TEM (85%), sul2 (67%), sul3 (17%), aadA (65%), strA (70%), strB (61%), catA1 (25%), cmlA1 (13%), tetA (21%) and tetB (17%). Class 1 and 2 integrons were found in five (14%) and six (17%) isolates, respectively, while one isolate was positive for both classes of integrons. Seven out of eight isolates with resistance to ciprofloxacin and MIC ≤ 32 mg/L to nalidixic acid contained qnrS genes. Our findings provided additional evidence that the poultry production environment in Nigeria represents an important reservoir of antibiotic resistance genes such as qnrS that may spread from livestock production farms to human populations via manure and water.

  10. Virulence and antibiotic resistance genes in Campylobacter spp. in the Czech Republic.

    Science.gov (United States)

    Bardoň, J; Pudová, V; Koláčková, I; Karpíšková, R; Röderová, M; Kolář, M

    2017-01-01

    Thermotolerant species of the genus Campy-lobacter are the important agents causing human foodborne infections throughout the world. The aims of this study were to evaluate the presence of nine putative virulence genes in Campylobacter spp. isolated from patients and from foods (poultry meat, pork liver), to determine the resistance of Campylobacter isolates to eight antibiotic agents and to detect four resistance genes.Matherial and methods: The presence of the virulence genes cdtA, cdtB, cdtC, virB11, ciaB, wlaN, iam, dnaJ and racR was detected by polymerase chain reaction (PCR) in 94 Campylobacter spp. isolates from humans and 123 campylobacters from foods. The phenotypic resistance to selected antimicrobial agents was tested with microdilution method in 82 human isolates and 91 food isolates. The isolates with antibiograms were tested for the presence of blaOXA-61, tet(O), aph-3-1 and cmeB genes by PCR with specific primers. In both human and food C. jejuni isolates the preva-lence of the studied virulence genes, especially dnaJ, racR, ciaB genes and the toxigenic genes cdtA, cdtB, cdtC, was considerably higher than in C. coli isolates. The only exception was the iam gene identified in only C. coli. The tested isolates of both C. jejuni and C. coli were highly resistant to quinolone antibiotics. Additionally, C. coli was also more resistant to erythromycin, streptomycin and, in case of isolates from pork liver, to tetracycline. High prevalence rates of genes encoding antibiotic resistance was noted for the blaOXA-61 and tet(O) genes in both Campylobacter species. The presented study is the first to assess the presence of genes for virulence and resistance to antibiotics in thermotolerant Campylobacter spp. isolated from humans and foods in the Czech Republic. The resistance of Campylobacter isolates to eight antibiotic agents was also assessed. The prevalence of genes responsible for virulence and resistance is rather varied in thermotolerant Campylobacter spp.

  11. High chlorpyrifos resistance in Culex pipiens mosquitoes: strong synergy between resistance genes.

    Science.gov (United States)

    Alout, H; Labbé, P; Berthomieu, A; Makoundou, P; Fort, P; Pasteur, N; Weill, M

    2016-02-01

    We investigated the genetic determinism of high chlorpyrifos resistance (HCR), a phenotype first described in 1999 in Culex pipiens mosquitoes surviving chlorpyrifos doses ⩾1 mg l(-1) and more recently found in field samples from Tunisia, Israel or Indian Ocean islands. Through chlorpyrifos selection, we selected several HCR strains that displayed over 10 000-fold resistance. All strains were homozygous for resistant alleles at two main loci: the ace-1 gene, with the resistant ace-1(R) allele expressing the insensitive G119S acetylcholinesterase, and a resistant allele of an unknown gene (named T) linked to the sex and ace-2 genes. We constructed a strain carrying only the T-resistant allele and studied its resistance characteristics. By crossing this strain with strains harboring different alleles at the ace-1 locus, we showed that the resistant ace-1(R) and the T alleles act in strong synergy, as they elicited a resistance 100 times higher than expected from a simple multiplicative effect. This effect was specific to chlorpyrifos and parathion and was not affected by synergists. We also examined how HCR was expressed in strains carrying other ace-1-resistant alleles, such as ace-1(V) or the duplicated ace-1(D) allele, currently spreading worldwide. We identified two major parameters that influenced the level of resistance: the number and the nature of the ace-1-resistant alleles and the number of T alleles. Our data fit a model that predicts that the T allele acts by decreasing chlorpyrifos concentration in the compartment targeted in insects.

  12. Recessive Resistance to Plant Viruses: Potential Resistance Genes Beyond Translation Initiation Factors

    Directory of Open Access Journals (Sweden)

    Masayoshi Hashimoto

    2016-10-01

    Full Text Available The ability of plant viruses to propagate their genomes in host cells depends on many host factors. In the absence of an agrochemical that specifically targets plant viral infection cycles, one of the most effective methods for controlling viral diseases in plants is taking advantage of the host plant’s resistance machinery. Recessive resistance is conferred by a recessive gene mutation that encodes a host factor critical for viral infection. It is a branch of the resistance machinery and, as an inherited characteristic, is very durable. Moreover, recessive resistance may be acquired by a deficiency in a negative regulator of plant defense responses, possibly due to the autoactivation of defense signaling. Eukaryotic translation initiation factor (eIF 4E and eIF4G and their isoforms are the most widely exploited recessive resistance genes in several crop species, and they are effective against a subset of viral species. However, the establishment of efficient, recessive resistance-type antiviral control strategies against a wider range of plant viral diseases requires genetic resources other than eIF4Es. In this review, we focus on recent advances related to antiviral recessive resistance genes evaluated in model plants and several crop species. We also address the roles of next-generation sequencing and genome editing technologies in improving plant genetic resources for recessive resistance-based antiviral breeding in various crop species.

  13. Spread of tetracycline resistance genes at a conventional dairy farm

    Directory of Open Access Journals (Sweden)

    Martina eKyselkova

    2015-05-01

    Full Text Available The use of antibiotics in animal husbandry contributes to the worldwide problem of increasing antibiotic resistance in animal and human pathogens. Intensive animal production is considered an important source of antibiotic resistance genes released to the environment, while the contribution of smaller farms remains to be evaluated. Here we monitor the spread of tetracycline resistance (TC-r genes at a middle-size conventional dairy farm, where chlortetracycline (CTC, as intrauterine suppository is prophylactically used after each calving. Our study has shown that animals at the farm acquired the TC-r genes in their early age (1-2 weeks, likely due to colonization with TC-resistant bacteria from their mothers and/or the farm environment. The relative abundance of the TC-r genes tet(W, tet(Q and tet(M in fresh excrements of calves was about 1-2 orders of magnitude higher compared to heifers and dairy cows, possibly due to the presence of antibiotic residues in milk fed to calves. The occurrence and abundance of TC-r genes in fresh excrements of heifers and adult cows remained unaffected by intrauterine CTC applications, with tet(O, tet(Q and tet(W representing a ‘core TC-resistome’ of the farm, and tet(A, tet(M, tet(Y and tet(X occurring occasionally. The genes tet(A, tet(M, tet(Y and tet(X were shown to be respectively harbored by Shigella, Lactobacillus and Clostridium, Acinetobacter, and Wautersiella. Soil in the farm proximity, as well as field soil to which manure from the farm was applied, was contaminated with TC-r genes occurring in the farm, and some of the TC-r genes persisted in the field over 3 months following the manure application. Concluding, our study shows that antibiotic resistance genes may be a stable part of the intestinal metagenome of cattle even if antibiotics are not used for growth stimulation, and that smaller dairy farms may also contribute to environmental pollution with antibiotic resistance genes.

  14. Antibiotic resistance and resistance genes in Escherichia coli from poultry farms, southwest Nigeria

    DEFF Research Database (Denmark)

    Adelowo, Olawale O.; Fagade, Obasola E.; Agersø, Yvonne

    2014-01-01

    Introduction: This study investigated the mechanisms of resistance in 36 E. coli isolated from waste, litter, soil and water samples collected from poultry farms in Southwestern Nigeria. Methodology: Minimum inhibitory concentration (MIC) distributions of the isolates were determined using...... the methods of the Clinical and Laboratory Standard Institute and resistance genes detected by PCR. Results: A total of 30 isolates (94%) showed resistance to more than one antimicrobial. Percentage resistance was: tetracycline 81%, sulphamethoxazole 67%, streptomycin 56%, trimethoprim 47 %, ciprofloxacin 42......%, ampicillin 36%, spectinomycin 28%, nalidixic acid 25%, chloramphenicol 22%, neomycin 14%, gentamicin 8%, amoxicillin-clavulanate, ceftiofur, cefotaxime, colistin, florfenicol and apramycin 0%. Resistance genes found among the isolates include bla-TEM (85%), sul2 (67%), sul3 (17%), aadA (65%), strA (70%), str...

  15. Dissemination of metal resistance genes among animal methicillin-resistant coagulase-negative Staphylococci.

    Science.gov (United States)

    Argudín, M Angeles; Butaye, Patrick

    2016-04-01

    The use of metals as feed supplement has been recognized as a potential driver for co-selection of methicillin-resistant Staphylococcus aureus in pigs. However, the prevalence of these determinants in methicillin-resistant coagulase-negative staphylococci (MRCoNS) is largely unknown. In this study, a collection of 130 MRCoNS from pigs and veal calves were investigated for the presence of metal-resistance genes (czrC, copB, cadD, arsA) associated to SCCmec. Near half of the isolates carried metal resistance genes (czrC 5.4%, copB 38.5%, cadD 7.7%, arsA 26.2%) regardless of their SCCmec type. The increased use of metals in livestock animals, especially zinc in pigs in several European countries may co-select for methicillin-resistance in several staphylococcal species. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Antibiotic and antiseptic resistance genes are linked on a novel mobile genetic element: Tn6087

    Science.gov (United States)

    Ciric, Lena; Mullany, Peter; Roberts, Adam P.

    2011-01-01

    Objectives Tn916-like elements are one of the most common types of integrative and conjugative element (ICE). In this study we aimed to determine whether novel accessory genes, i.e. genes whose products are not involved in mobility or regulation, were present on a Tn916-like element (Tn6087) isolated from Streptococcus oralis from the human oral cavity. Methods A minocycline-resistant isolate was analysed using restriction fragment length polymorphism (RFLP) analysis on amplicons derived from Tn916 and DNA sequencing to determine whether there were genetic differences in Tn6087 compared with Tn916. Mutational analysis was used to determine whether the novel accessory gene found was responsible for an observed extra phenotype. Results A novel Tn916-like element, Tn6087, is described that encodes both antibiotic and antiseptic resistance. The antiseptic resistance protein is encoded by a novel small multidrug resistance gene, designated qrg, that was shown to encode resistance to cetyltrimethylammonium bromide (CTAB), also known as cetrimide bromide. Conclusions This is the first Tn916-like element described that confers both antibiotic and antiseptic resistance, suggesting that selection of either antibiotic or antiseptic resistance will also select for the other and further highlights the need for prudent use of both types of compound. PMID:21816764

  17. Tagging of resistance gene(s) to rhizomania disease in sugar beet ...

    African Journals Online (AJOL)

    SERVER

    2008-02-19

    Feb 19, 2008 ... plasmodiophoride-like fungus, Polymyxa betae Keskin. (1964) (Tamada and Richard, 1992). Source of resistance to rhizomania were found in Holly sugar beet company source (Lewellen, 1987). Resistance in Holly is simply inherited by a single dominant gene(Rz1). (Lewellen et al., 1987; Scholten et al., ...

  18. Tagging of resistance gene(s) to rhizomania disease in sugar beet ...

    African Journals Online (AJOL)

    The rhizomania disease is one of the most important diseases in Iran and some other parts of the world which potentially could play a role in decreasing sugar yield in fields. One approach to combat with this disease is the use of resistance varieties. This varieties have been identified which are having resistance genes to ...

  19. Major Gene for Field Stem Rust Resistance Co-Locates with Resistance Gene Sr12 in 'Thatcher' Wheat.

    Directory of Open Access Journals (Sweden)

    Colin W Hiebert

    Full Text Available Stem rust, caused by Puccinia graminis (Pgt, is a damaging disease of wheat that can be controlled by utilizing effective stem rust resistance genes. 'Thatcher' wheat carries complex resistance to stem rust that is enhanced in the presence of the resistance gene Lr34. The purpose of this study was to examine APR in 'Thatcher' and look for genetic interactions with Lr34. A RIL population was tested for stem rust resistance in field nurseries in Canada, USA, and Kenya. BSA was used to find SNP markers associated with reduced stem rust severity. A major QTL was identified on chromosome 3BL near the centromere in all environments. Seedling testing showed that Sr12 mapped to the same region as the QTL for APR. The SNP markers were physically mapped and the region carrying the resistance was searched for sequences with homology to members of the NB-LRR resistance gene family. SNP marker from one NB-LRR-like sequence, NB-LRR3 co-segregated with Sr12. Two additional populations, including one that lacked Lr34, were tested in field nurseries. NB-LRR3 mapped near the maximum LOD for reduction in stem rust severity in both populations. Lines from a population that segregated for Sr12 and Lr34 were tested for seedling Pgt biomass and infection type, as well as APR to field stem rust which showed an interaction between the genes. We concluded that Sr12, or a gene closely linked to Sr12, was responsible for 'Thatcher'-derived APR in several environments and this resistance was enhanced in the presence of Lr34.

  20. Major Gene for Field Stem Rust Resistance Co-Locates with Resistance Gene Sr12 in 'Thatcher' Wheat.

    Science.gov (United States)

    Hiebert, Colin W; Kolmer, James A; McCartney, Curt A; Briggs, Jordan; Fetch, Tom; Bariana, Harbans; Choulet, Frederic; Rouse, Matthew N; Spielmeyer, Wolfgang

    2016-01-01

    Stem rust, caused by Puccinia graminis (Pgt), is a damaging disease of wheat that can be controlled by utilizing effective stem rust resistance genes. 'Thatcher' wheat carries complex resistance to stem rust that is enhanced in the presence of the resistance gene Lr34. The purpose of this study was to examine APR in 'Thatcher' and look for genetic interactions with Lr34. A RIL population was tested for stem rust resistance in field nurseries in Canada, USA, and Kenya. BSA was used to find SNP markers associated with reduced stem rust severity. A major QTL was identified on chromosome 3BL near the centromere in all environments. Seedling testing showed that Sr12 mapped to the same region as the QTL for APR. The SNP markers were physically mapped and the region carrying the resistance was searched for sequences with homology to members of the NB-LRR resistance gene family. SNP marker from one NB-LRR-like sequence, NB-LRR3 co-segregated with Sr12. Two additional populations, including one that lacked Lr34, were tested in field nurseries. NB-LRR3 mapped near the maximum LOD for reduction in stem rust severity in both populations. Lines from a population that segregated for Sr12 and Lr34 were tested for seedling Pgt biomass and infection type, as well as APR to field stem rust which showed an interaction between the genes. We concluded that Sr12, or a gene closely linked to Sr12, was responsible for 'Thatcher'-derived APR in several environments and this resistance was enhanced in the presence of Lr34.

  1. Major Gene for Field Stem Rust Resistance Co-Locates with Resistance Gene Sr12 in ‘Thatcher’ Wheat

    Science.gov (United States)

    Hiebert, Colin W.; Kolmer, James A.; McCartney, Curt A.; Briggs, Jordan; Fetch, Tom; Bariana, Harbans; Choulet, Frederic; Rouse, Matthew N.; Spielmeyer, Wolfgang

    2016-01-01

    Stem rust, caused by Puccinia graminis (Pgt), is a damaging disease of wheat that can be controlled by utilizing effective stem rust resistance genes. ‘Thatcher’ wheat carries complex resistance to stem rust that is enhanced in the presence of the resistance gene Lr34. The purpose of this study was to examine APR in ‘Thatcher’ and look for genetic interactions with Lr34. A RIL population was tested for stem rust resistance in field nurseries in Canada, USA, and Kenya. BSA was used to find SNP markers associated with reduced stem rust severity. A major QTL was identified on chromosome 3BL near the centromere in all environments. Seedling testing showed that Sr12 mapped to the same region as the QTL for APR. The SNP markers were physically mapped and the region carrying the resistance was searched for sequences with homology to members of the NB-LRR resistance gene family. SNP marker from one NB-LRR-like sequence, NB-LRR3 co-segregated with Sr12. Two additional populations, including one that lacked Lr34, were tested in field nurseries. NB-LRR3 mapped near the maximum LOD for reduction in stem rust severity in both populations. Lines from a population that segregated for Sr12 and Lr34 were tested for seedling Pgt biomass and infection type, as well as APR to field stem rust which showed an interaction between the genes. We concluded that Sr12, or a gene closely linked to Sr12, was responsible for ‘Thatcher’-derived APR in several environments and this resistance was enhanced in the presence of Lr34. PMID:27309724

  2. Presence of disinfectant resistance genes in Escherichia coli isolated from retail meats in the USA.

    Science.gov (United States)

    Zou, Likou; Meng, Jianghong; McDermott, Patrick F; Wang, Fei; Yang, Qianru; Cao, Guojie; Hoffmann, Maria; Zhao, Shaohua

    2014-10-01

    To examine the distribution of all genes known to be responsible for resistance to quaternary ammonium compounds (QACs), and their association with resistance to QACs and other antimicrobials, in Escherichia coli recovered from retail meats. A total of 570 strains of E. coli isolated from US retail meats in 2006 were screened for the presence of 10 QAC resistance genes [qacE, qacEΔ1, qacF, qacG, emrE, sugE(c), sugE(p), mdfA and ydgE/ydgF]. The MICs of six common disinfectants were determined using an agar dilution method. Possible associations between the presence of the gene and bacterial resistance to QACs and antimicrobials were investigated. emrE, sugE(c), mdfA and ydgE/ydgF were commonly present (77.2%-100%) in the E. coli isolates, but qac and sugE(p) were less prevalent (0.4%-22.3%). emrE-mdfA-sugE(c)-ydgE/F was the most common QAC resistance gene profile. A significant association was found between antimicrobial resistance and the presence of sugE(p) and qacEΔ1 (P resistant E. coli isolates tended to contain more diverse combinations of disinfectant resistance genes than susceptible ones. All isolates showed reduced susceptibility to five of six disinfectants compared with the control strains. Higher MICs were generally associated with the presence of qac and sugE(p) genes. The QAC resistance genes were commonly present among E. coli isolated from retail meats, and the qac and sugE(p) genes were highly associated with multidrug resistance phenotypes. Using QACs in the food industry may not be as effective as expected and could provide selection pressure for strains with acquired resistance to other antimicrobials. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy 2014. This work is written by US Government employees and is in the public domain in the US.

  3. In Silico Analysis of Antibiotic Resistance Genes in the Gut Microflora of Individuals from Diverse Geographies and Age-Groups

    Science.gov (United States)

    Ghosh, Tarini Shankar; Gupta, Sourav Sen; Nair, Gopinath Balakrish; Mande, Sharmila S.

    2013-01-01

    The spread of antibiotic resistance, originating from the rampant and unrestrictive use of antibiotics in humans and livestock over the past few decades has emerged as a global health problem. This problem has been further compounded by recent reports implicating the gut microbial communities to act as reservoirs of antibiotic resistance. We have profiled the presence of probable antibiotic resistance genes in the gut flora of 275 individuals from eight different nationalities. For this purpose, available metagenomic data sets corresponding to 275 gut microbiomes were analyzed. Sequence similarity searches of the genomic fragments constituting each of these metagenomes were performed against genes conferring resistance to around 240 antibiotics. Potential antibiotic resistance genes conferring resistance against 53 different antibiotics were detected in the human gut microflora analysed in this study. In addition to several geography/country-specific patterns, four distinct clusters of gut microbiomes, referred to as ‘Resistotypes’, exhibiting similarities in their antibiotic resistance profiles, were identified. Groups of antibiotics having similarities in their resistance patterns within each of these clusters were also detected. Apart from this, mobile multi-drug resistance gene operons were detected in certain gut microbiomes. The study highlighted an alarmingly high abundance of antibiotic resistance genes in two infant gut microbiomes. The results obtained in the present study presents a holistic ‘big picture’ on the spectra of antibiotic resistance within our gut microbiota across different geographies. Such insights may help in implementation of new regulations and stringency on the existing ones. PMID:24391833

  4. Loci and candidate genes conferring resistance to soybean cyst nematode HG type 2.5.7.

    Science.gov (United States)

    Zhao, Xue; Teng, Weili; Li, Yinghui; Liu, Dongyuan; Cao, Guanglu; Li, Dongmei; Qiu, Lijuan; Zheng, Hongkun; Han, Yingpeng; Li, Wenbin

    2017-06-14

    Soybean (Glycine max L. Merr.) cyst nematode (SCN, Heterodera glycines I,) is a major pest of soybean worldwide. The most effective strategy to control this pest involves the use of resistant cultivars. The aim of the present study was to investigate the genome-wide genetic architecture of resistance to SCN HG Type 2.5.7 (race 1) in landrace and elite cultivated soybeans. A total of 200 diverse soybean accessions were screened for resistance to SCN HG Type 2.5.7 and genotyped through sequencing using the Specific Locus Amplified Fragment Sequencing (SLAF-seq) approach with a 6.14-fold average sequencing depth. A total of 33,194 SNPs were identified with minor allele frequencies (MAF) over 4%, covering 97% of all the genotypes. Genome-wide association mapping (GWAS) revealed thirteen SNPs associated with resistance to SCN HG Type 2.5.7. These SNPs were distributed on five chromosomes (Chr), including Chr7, 8, 14, 15 and 18. Four SNPs were novel resistance loci and nine SNPs were located near known QTL. A total of 30 genes were identified as candidate genes underlying SCN resistance. A total of sixteen novel soybean accessions were identified with significant resistance to HG Type 2.5.7. The beneficial alleles and candidate genes identified by GWAS might be valuable for improving marker-assisted breeding efficiency and exploring the molecular mechanisms underlying SCN resistance.

  5. Association mapping and gene-gene interaction for stem rust resistance in CIMMYT spring wheat germplasm.

    Science.gov (United States)

    Yu, Long-Xi; Lorenz, Aaron; Rutkoski, Jessica; Singh, Ravi P; Bhavani, Sridhar; Huerta-Espino, Julio; Sorrells, Mark E

    2011-12-01

    The recent emergence of wheat stem rust Ug99 and evolution of new races within the lineage threatens global wheat production because they overcome widely deployed stem rust resistance (Sr) genes that had been effective for many years. To identify loci conferring adult plant resistance to races of Ug99 in wheat, we employed an association mapping approach for 276 current spring wheat breeding lines from the International Maize and Wheat Improvement Center (CIMMYT). Breeding lines were genotyped with Diversity Array Technology (DArT) and microsatellite markers. Phenotypic data was collected on these lines for stem rust race Ug99 resistance at the adult plant stage in the stem rust resistance screening nursery in Njoro, Kenya in seasons 2008, 2009 and 2010. Fifteen marker loci were found to be significantly associated with stem rust resistance. Several markers appeared to be linked to known Sr genes, while other significant markers were located in chromosome regions where no Sr genes have been previously reported. Most of these new loci colocalized with QTLs identified recently in different biparental populations. Using the same data and Q + K covariate matrices, we investigated the interactions among marker loci using linear regression models to calculate P values for pairwise marker interactions. Resistance marker loci including the Sr2 locus on 3BS and the wPt1859 locus on 7DL had significant interaction effects with other loci in the same chromosome arm and with markers on chromosome 6B. Other resistance marker loci had significant pairwise interactions with markers on different chromosomes. Based on these results, we propose that a complex network of gene-gene interactions is, in part, responsible for resistance to Ug99. Further investigation may provide insight for understanding mechanisms that contribute to this resistance gene network.

  6. Thioridazine affects transcription of genes involved in cell wall biosynthesis in methicillin-resistant Staphylococcus aureus

    DEFF Research Database (Denmark)

    Bonde, Mette; Højland, Dorte Heidi; Kolmos, Hans Jørn

    2011-01-01

    have previously shown that the expression of some resistance genes is abolished after treatment with thioridazine and oxacillin. To further understand the mechanism underlying the reversal of resistance, we tested the expression of genes involved in antibiotic resistance and cell wall biosynthesis...... reversal of resistance by thioridazine relies on decreased expression of specific genes involved in cell wall biosynthesis....

  7. Isolation of NBS-LRR class resistant gene (I2 gene) from tomato ...

    African Journals Online (AJOL)

    aghomotsegin

    2013-10-16

    Oct 16, 2013 ... Isolation of NBS-LRR class resistant gene (I2 gene) from tomato cultivar Heamsona ... avirulence protein or effector protein secreted by fungal pathogen during the host colonization in tomato. These effector proteins .... and efficient method for isolation of genomic DNA from plant tissue. J. Cell Tissue Res.

  8. High-throughput quantification of antibiotic resistance genes from an urban wastewater treatment plant.

    Science.gov (United States)

    Karkman, Antti; Johnson, Timothy A; Lyra, Christina; Stedtfeld, Robert D; Tamminen, Manu; Tiedje, James M; Virta, Marko

    2016-03-01

    Antibiotic resistance among bacteria is a growing problem worldwide, and wastewater treatment plants have been considered as one of the major contributors to the dissemination of antibiotic resistance to the environment. There is a lack of comprehensive quantitative molecular data on extensive numbers of antibiotic resistance genes (ARGs) in different seasons with a sampling strategy that would cover both incoming and outgoing water together with the excess sludge that is removed from the process. In order to fill that gap we present a highly parallel quantitative analysis of ARGs and horizontal gene transfer potential over four seasons at an urban wastewater treatment plant using a high-throughput qPCR array. All analysed transposases and two-thirds of primer sets targeting ARGs were detected in the wastewater. The relative abundance of most of the genes was highest in influent and lower in effluent water and sludge. The resistance profiles of the samples cluster by sample location with a shift from raw influent through the final effluents and dried sludge to the sediments. Wastewater discharge enriched only a few genes, namely Tn25 type transposase gene and clinical class 1 integrons, in the sediment near the discharge pipe, but those enriched genes may indicate a potential for horizontal gene transfer. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  9. Multiple herbicide resistance in Lolium multiflorum and identification of conserved regulatory elements of herbicide resistance genes

    Directory of Open Access Journals (Sweden)

    Khalid Mahmood

    2016-08-01

    Full Text Available Herbicide resistance is a ubiquitous challenge to herbicide sustainability and a looming threat to control weeds in crops. Recently four genes were found constituently over-expressed in herbicide resistant individuals of Lolium rigidum, a close relative of L. multiflorum. These include two cytochrome P450s, one nitronate monooxygenase and one glycosyl-transferase. Higher expressions of these four herbicide metabolism related (HMR genes were also observed after herbicides exposure in the gene expression databases, indicating them a reliable marker. In order to get an overview of herbicidal resistance status of Lolium multiflorum L, 19 field populations were collected. Among these populations, four populations were found to be resistant to acetolactate synthase (ALS inhibitors while three exhibited resistance to acetyl-CoA carboxylase (ACCase inhibitors in our initial screening and dose response study. The genotyping showed the presence of mutations Trp-574-Leu and Ile-2041-Asn in ALS and ACCase, respectively and qPCR experiments revealed the enhanced expression of HMR genes in individuals of certain resistant populations. Moreover, co-expression networks and promoter analyses of HMR genes in O.sativa and A.thaliana resulted in the identification of a cis-regulatory motif and zinc finger transcription factors. The identified transcription factors were highly expressed similar to HMR genes in response to xenobiotics whereas the identified motif known to play a vital role in coping with environmental stresses and maintaining genome stability. Overall, our findings provide an important step forward towards a better understanding of metabolism-based herbicide resistance that can be utilized to devise novel strategies of weed management.

  10. Antibiotic resistance and ndvB gene expression among biofilm ...

    African Journals Online (AJOL)

    A novel antibiotic resistant mechanism among biofilms is glucan-mediated sequestration in which ndvB gene encodes a glucosyltransferase involved in the formation of this glucans. We studied the biofilm formation and antibiotic susceptibility pattern of P. aeruginosa isolated from clinical samples, and measured the ...

  11. Gene pyramiding as a Bt resistance management strategy: How ...

    African Journals Online (AJOL)

    Reports on the emergence of insect resistance to Bacillus thuringiensis delta endotoxins have raised doubts on the sustainability of Bt-toxin based pest management technologies. Corporate industry has responded to this challenge with innovations that include gene pyramiding among others. Pyramiding entails stacking ...

  12. Determination and expression of genes for resistance to blast ...

    African Journals Online (AJOL)

    Determination and expression of genes for resistance to blast (Magnaporthe oryza) in Basmati and non-Basmati indica rices (Oryza sativa L.) Naveen Kumar, D Singh, S Gupta, A Sirohi, B Ramesh, Preeti Sirohi, Parul Sirohi, Atar Singh, N Kumar, A Kumar, Rajendra Kumar, R Kumar, J Singh, P. Kumar, P. Chauhan, ...

  13. Gene interactions and genetics of blast resistance and yield ...

    Indian Academy of Sciences (India)

    2014-08-11

    Aug 11, 2014 ... Keywords. blast; gene action; generation mean analysis; resistance; yield. Journal of Genetics, Vol. 93, No. .... Utilizing the variance of different generations, the variances of A, B, C and D scales were ...... Jia Y. 2003 Marker assisted selection for the control of rice blast disease. Pesticide Outlook 14 ...

  14. Evaluating antibiotic resistance genes in soils with applied manures

    Science.gov (United States)

    Antibiotics are commonly used in livestock production to promote growth and combat disease. Recent studies have shown the potential for spread of antibiotic resistance genes (ARG) to the environment following application of livestock manures. In this study, concentrations of bacteria with ARG in soi...

  15. Absence of meca gene in methicillin-resistant staphylococcus ...

    African Journals Online (AJOL)

    Methicillin-resistant Staphylococcus aureus has emerged as a serious threat to public health, causing both hospital and community-associated infections. The gold standard for MRSA detection is the amplification of the mecA gene that codes for the production of the altered penicillin-binding protein (PBP2a) responsible for ...

  16. Molecular Detection of Virulence Genes and Antibiotic Resistance ...

    African Journals Online (AJOL)

    Escherichia coli O157:H7 is an important food-borne pathogen that can cause diarrhea, haemorrhagic colitis and haemolytic uremic syndrome. This study was conducted to investigate the prevalence, virulence genes and antibiotic resistance patterns of E. coli O157:H7 in raw beef meat sold in Abeokuta, South west Nigeria ...

  17. Molecular detection of disease resistance genes to powdery mildew ...

    African Journals Online (AJOL)

    Tuoyo Aghomotsegin

    2017-01-04

    Jan 4, 2017 ... 2. State Key Laboratory of Biology for Plant Diseases and Insect Pests, Institute of Plant Protection, Chinese Academy of. Agricultural Sciences, Beijing 100193, China. Received 10 October, 2016; Accepted 14 December, 2016. A study was conducted to detect the presence of disease resistance genes to ...

  18. Cloning of a carbendazim-resistant gene from Colletotrichum ...

    African Journals Online (AJOL)

    Cloning of a carbendazim-resistant gene from Colletotrichum gloeosporioides of mango in South China. ... Abstract. Mango anthracnose caused by Colletotrichum gloeosporioides is an important disease and prevalent in tropical regions of China. High carbendazim ... employed to further test the above results. It involved an ...

  19. Cloning and characterization of NBS-LRR resistance gene ...

    African Journals Online (AJOL)

    biotech

    2013-07-03

    Jul 3, 2013 ... Resistance genes honologues I theobroma cacao as useful genetic markers. Theor. Appl. Gent. 107:191-202. Kumar S, Tamura K, Nei M (2004). MEGA3: integrated software for molecular evolutionary genetics analysis and sequence alignment. Brief Bioinform. 5:150-163. Lacock L, Niekerk CV, Loots S, ...

  20. Cloning and characterization of NBS-LRR resistance gene ...

    African Journals Online (AJOL)

    biotech

    2013-07-03

    Jul 3, 2013 ... Full Length Research Paper. Cloning and characterization of NBS-LRR resistance gene analogues of Musa spp. and their expression profiling studies against Pratylenchus coffeae. S. Backiyarani*, S. Uma, G. Arunkumar, M. S. Saraswathi and P. Sundararaju. National Research Centre for Banana (ICAR), ...

  1. Prevalence, antibiotic-resistance properties and enterotoxin gene ...

    African Journals Online (AJOL)

    milk-based infant foods in Iran, represent an important public health issue which should be considered ... Keywords: Prevalence, Bacillus cereus, Antibiotic resistance, Enterotoxigenic genes, Milk-based infant food. Tropical Journal of Pharmaceutical Research is indexed by Science ..... and cereals collected in Korea.

  2. Codon-optimized antibiotic resistance gene improves efficiency of ...

    Indian Academy of Sciences (India)

    We generated a synthetic gentamicin resistance gene whose codon usage is optimized to Frankia (fgmR) and evaluated its usefulness as a selection marker using a transient transformation system. Success rate of transient transformation and cell growth in selective culture were significantly increased by use of fgmR ...

  3. Resistance-related gene transcription and antioxidant enzyme ...

    African Journals Online (AJOL)

    The two tobacco relatives of Nicotiana alata and Nicotiana longiflora display a high level of resistance against Colletotrichum nicotianae and the two genes NTF6 and NtPAL related to pathogen defense transcription were higher in N. alata and N. longiflora than the commercial cv. K326. Inoculation with C. nicotianae ...

  4. Genetic analysis and location of a resistance gene to Puccinia ...

    Indian Academy of Sciences (India)

    Administrator

    Electrophoresis was carried out at 1400. V for 1.0 - 1.5 h. Gel staining and visualization was done as previously described (Chen et al. 1998). Polymorphic markers were used to genotype the F2 population. Genotype data were used to construct a genetic map and locate the resistance gene. Mapping and Data analysis.

  5. Functional screening of antibiotic resistance genes from human gut microbiota reveals a novel gene fusion.

    Science.gov (United States)

    Cheng, Gong; Hu, Yongfei; Yin, Yeshi; Yang, Xi; Xiang, Chunsheng; Wang, Baohong; Chen, Yanfei; Yang, Fengling; Lei, Fang; Wu, Na; Lu, Na; Li, Jing; Chen, Quanze; Li, Lanjuan; Zhu, Baoli

    2012-11-01

    The human gut microbiota has a high density of bacteria that are considered a reservoir for antibiotic resistance genes (ARGs). In this study, one fosmid metagenomic library generated from the gut microbiota of four healthy humans was used to screen for ARGs against seven antibiotics. Eight new ARGs were obtained: one against amoxicillin, six against d-cycloserine, and one against kanamycin. The new amoxicillin resistance gene encodes a protein with 53% identity to a class D β-lactamase from Riemerella anatipestifer RA-GD. The six new d-cycloserine resistance genes encode proteins with 73-81% identity to known d-alanine-d-alanine ligases. The new kanamycin resistance gene encodes a protein of 274 amino acids with an N-terminus (amino acids 1-189) that has 42% identity to the 6'-aminoglycoside acetyltransferase [AAC(6')] from Enterococcus hirae and a C-terminus (amino acids 190-274) with 35% identity to a hypothetical protein from Clostridiales sp. SSC/2. A functional study on the novel kanamycin resistance gene showed that only the N-terminus conferred kanamycin resistance. Our results showed that functional metagenomics is a useful tool for the identification of new ARGs. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  6. Diversity of Antibiotic Resistance Genes in Enterococcus Strains Isolated from Ready-to-Eat Meat Products.

    Science.gov (United States)

    Chajęcka-Wierzchowska, Wioleta; Zadernowska, Anna; Łaniewska-Trokenheim, Łucja

    2016-10-25

    The objective of the study was to answer the question of whether the ready-to-eat meat products can pose indirect hazard for consumer health serving as reservoir of Enterococcus strains harboring tetracyclines, aminoglycosides, and macrolides resistance genes. A total of 390 samples of ready-to-eat meat products were investigated. Enterococcus strains were found in 74.1% of the samples. A total of 302 strains were classified as: Enterococcus faecalis (48.7%), Enterococcus faecium (39.7%), Enterococcus casseliflavus (4.3%), Enterococcus durans (3.0%), Enterococcus hirae (2.6%), and other Enterococcus spp. (1.7%). A high percentage of isolates were resistant to streptomycin high level (45%) followed by erythromycin (42.7%), fosfomycin (27.2%), rifampicin (19.2%), tetracycline (36.4%), tigecycline (19.9%). The ant(6')-Ia gene was the most frequently found gene (79.6%). Among the other genes that encode aminoglycosides-modifying enzymes, the highest portion of the strains had the aac(6')-Ie-aph(2'')-Ia (18.5%) and aph(3'')-IIIa (16.6%), but resistance of isolates from food is also an effect of the presence of aph(2'')-Ib, aph(2'')-Ic, aph(2'')-Id genes. Resistance to tetracyclines was associated with the presence of tetM (43.7%), tetL (32.1%), tetK (14.6%), tetW (0.7%), and tetO (0.3%) genes. The ermB and ermA genes were found in 33.8% and 18.9% of isolates, respectively. Nearly half of the isolates contained a conjugative transposon of the Tn916/Tn1545 family. Enterococci are widely present in retail ready-to-eat meat products. Many isolated strains (including such species as E. casseliflavus, E. durans, E. hirae, and Enterococcus gallinarum) are antibiotic resistant and carry transferable resistance genes. © 2016 Institute of Food Technologists®.

  7. Transcriptomic Analysis and the Expression of Disease-Resistant Genes in Oryza meyeriana under Native Condition.

    Directory of Open Access Journals (Sweden)

    Bin He

    Full Text Available Oryza meyeriana (O. meyeriana, with a GG genome type (2n = 24, accumulated plentiful excellent characteristics with respect to resistance to many diseases such as rice shade and blast, even immunity to bacterial blight. It is very important to know if the diseases-resistant genes exist and express in this wild rice under native conditions. However, limited genomic or transcriptomic data of O. meyeriana are currently available. In this study, we present the first comprehensive characterization of the O. meyeriana transcriptome using RNA-seq and obtained 185,323 contigs with an average length of 1,692 bp and an N50 of 2,391 bp. Through differential expression analysis, it was found that there were most tissue-specifically expressed genes in roots, and next to stems and leaves. By similarity search against protein databases, 146,450 had at least a significant alignment to existed gene models. Comparison with the Oryza sativa (japonica-type Nipponbare and indica-type 93-11 genomes revealed that 13% of the O. meyeriana contigs had not been detected in O. sativa. Many diseases-resistant genes, such as bacterial blight resistant, blast resistant, rust resistant, fusarium resistant, cyst nematode resistant and downy mildew gene, were mined from the transcriptomic database. There are two kinds of rice bacterial blight-resistant genes (Xa1 and Xa26 differentially or specifically expressed in O. meyeriana. The 4 Xa1 contigs were all only expressed in root, while three of Xa26 contigs have the highest expression level in leaves, two of Xa26 contigs have the highest expression profile in stems and one of Xa26 contigs was expressed dominantly in roots. The transcriptomic database of O. meyeriana has been constructed and many diseases-resistant genes were found to express under native condition, which provides a foundation for future discovery of a number of novel genes and provides a basis for studying the molecular mechanisms associated with disease

  8. Streptomycin Resistance and Lineage-Specific Polymorphisms in Mycobacterium tuberculosis gidB Gene

    Science.gov (United States)

    Spies, Fernanda S.; Ribeiro, Andrezza W.; Ramos, Daniela F.; Ribeiro, Marta O.; Martin, Anandi; Palomino, Juan Carlos; Rossetti, Maria Lucia R.; da Silva, Pedro Eduardo A.; Zaha, Arnaldo

    2011-01-01

    Mutations related to streptomycin resistance in the rpsL and rrs genes are well known and can explain about 70% of this phenotypic resistance. Recently, the gidB gene was found to be associated with low-level streptomycin resistance in Mycobacterium tuberculosis. Mutations in gidB have been reported with high frequency, and this gene appears to be very polymorphic, with frameshift and point mutations occurring in streptomycin-susceptible and streptomycin-resistant strains. In this study, mutations in gidB appeared in 27% of streptomycin-resistant strains that contained no mutations in the rpsL or rrs genes, and they were associated with low-level streptomycin resistance. However, the association of certain mutations in gidB with streptomycin resistance needs to be further investigated, as we also found mutations in gidB in streptomycin-susceptible strains. This occurred only when the strain was resistant to rifampin and isoniazid. Two specific mutations appeared very frequently in this and other studies of streptomycin-susceptible and -resistant strains; these mutations were not considered related to streptomycin resistance, but as a polymorphism. We stratified the strains according to the different phylogenetic lineages and showed that the gidB16 polymorphism (16G allele) was exclusively present in the Latin American-Mediterranean (LAM) genotype, while the gidB92 polymorphism (92C allele) was associated with the Beijing lineage in another population. In the sample studied, the two characterized single-nucleotide polymorphisms could distinguish LAM and Beijing lineages from the other lineages. PMID:21593257

  9. Streptomycin resistance and lineage-specific polymorphisms in Mycobacterium tuberculosis gidB gene.

    Science.gov (United States)

    Spies, Fernanda S; Ribeiro, Andrezza W; Ramos, Daniela F; Ribeiro, Marta O; Martin, Anandi; Palomino, Juan Carlos; Rossetti, Maria Lucia R; da Silva, Pedro Eduardo A; Zaha, Arnaldo

    2011-07-01

    Mutations related to streptomycin resistance in the rpsL and rrs genes are well known and can explain about 70% of this phenotypic resistance. Recently, the gidB gene was found to be associated with low-level streptomycin resistance in Mycobacterium tuberculosis. Mutations in gidB have been reported with high frequency, and this gene appears to be very polymorphic, with frameshift and point mutations occurring in streptomycin-susceptible and streptomycin-resistant strains. In this study, mutations in gidB appeared in 27% of streptomycin-resistant strains that contained no mutations in the rpsL or rrs genes, and they were associated with low-level streptomycin resistance. However, the association of certain mutations in gidB with streptomycin resistance needs to be further investigated, as we also found mutations in gidB in streptomycin-susceptible strains. This occurred only when the strain was resistant to rifampin and isoniazid. Two specific mutations appeared very frequently in this and other studies of streptomycin-susceptible and -resistant strains; these mutations were not considered related to streptomycin resistance, but as a polymorphism. We stratified the strains according to the different phylogenetic lineages and showed that the gidB(16) polymorphism (16G allele) was exclusively present in the Latin American-Mediterranean (LAM) genotype, while the gidB(92) polymorphism (92C allele) was associated with the Beijing lineage in another population. In the sample studied, the two characterized single-nucleotide polymorphisms could distinguish LAM and Beijing lineages from the other lineages.

  10. Dissection of the multigenic wheat stem rust resistance present in the Montenegrin spring wheat accession PI 362698.

    Science.gov (United States)

    Zurn, Jason D; Rouse, Matthew N; Chao, Shiaoman; Aoun, Meriem; Macharia, Godwin; Hiebert, Colin W; Pretorius, Zacharias A; Bonman, J Michael; Acevedo, Maricelis

    2018-01-22

    Research to identify and characterize stem rust resistance genes in common wheat, Triticum aestivum, has been stimulated by the emergence of Ug99-lineage races of the wheat stem rust pathogen, Puccinia graminis f. sp. tritici (Pgt), in Eastern Africa. The Montenegrin spring wheat landrace PI 362698 was identified as a source of Pgt resistance. This accession exhibits resistance to multiple Ug99-lineage and North American Pgt races at seedling and adult-plant stages. A recombinant inbred population was developed by crossing the susceptible line LMPG-6 with a single plant selection of PI 362698. A genetic map was constructed using the Illumina iSelect 90 K wheat assay and the markers csLv34, NB-LRR3, and wMAS000003 and quantitative trait locus (QTL) analysis was performed. QTL analysis identified five significant QTLs (α = 0.05) on chromosomes 2B, 3B, 6A, 6D, and 7A associated with wheat stem rust resistance. The QTL on chromosome 3B was identified using both field data from Kenya (Pgt Ug99-lineage races) and seedling data from Pgt race MCCF. This QTL potentially corresponds to Sr12 or a new allele of Sr12. The multi-pathogen resistance gene Sr57 located on chromosome 7D is present in PI 362698 according to the diagnostic markers csLv34 and wMAS000003, however a significant QTL was not detected at this locus. The QTLs on chromosomes 2B, 6A, and 6D were identified during seedling trials and are thought to correspond to Sr16, Sr8a, and Sr5, respectively. The QTL identified on chromosome 7A was detected using MCCF seedling data and may be Sr15 or a potentially novel allele of recently detected Ug99 resistance QTLs. The combination of resistance QTLs found in PI 362698 is like the resistance gene combination present in the broadly resistant cultivar Thatcher. As such, PI 362698 may not be a landrace as previously thought. PI 362698 has been crossed with North Dakota wheat germplasm for future breeding efforts. Additional work is needed to fully understand why the

  11. Putative resistance genes in the CitEST database

    Directory of Open Access Journals (Sweden)

    Simone Guidetti-Gonzalez

    2007-01-01

    Full Text Available Disease resistance in plants is usually associated with the activation of a wide variety of defense responses to prevent pathogen replication and/or movement. The ability of the host plant to recognize the pathogen and to activate defense responses is regulated by direct or indirect interaction between the products of plant resistance (R and pathogen avirulence (Avr genes. Attempted infection of plants by avirulent pathogens elicits a battery of defenses often followed by the collapse of the challenged host cells. Localized host cell death may help to prevent the pathogen from spreading to uninfected tissues, known as hypersensitive response (HR. When either the plant or the pathogen lacks its cognate gene, activation of the plant’s defense responses fails to occur or is delayed and does not prevent pathogen colonization. In the CitEST database, we identified 1,300 reads related to R genes in Citrus which have been reported in other plant species. These reads were translated in silico, and alignments of their amino acid sequences revealed the presence of characteristic domains and motifs that are specific to R gene classes. The description of the reads identified suggests that they function as resistance genes in citrus.

  12. Identification of antimicrobial resistance genes in multidrug-resistant clinical Bacteroides fragilis isolates by whole genome shotgun sequencing

    DEFF Research Database (Denmark)

    Sydenham, Thomas Vognbjerg; Sóki, József; Hasman, Henrik

    2015-01-01

    Bacteroides fragilis constitutes the most frequent anaerobic bacterium causing bacteremia in humans. The genetic background for antimicrobial resistance in B. fragilis is diverse with some genes requiring insertion sequence (IS) elements inserted upstream for increased expression. To evaluate whole...... genome shotgun sequencing as a method for predicting antimicrobial resistance properties, one meropenem resistant and five multidrug-resistant blood culture isolates were sequenced and antimicrobial resistance genes and IS elements identified using ResFinder 2.1 (http...

  13. Methicillin-resistant Staphylococcus aureus in minas frescal cheese: evaluation of classic enterotoxin genes, antimicrobial resistance and clonal diversity.

    Science.gov (United States)

    Gonzalez, Alice Gonçalves Martins; Marques, Leila Márcia Peres; Gomes, Marcel da Silva Amorim; Beltrão, Jhonathan Campos do Couto; Pinheiro, Marcos Gabriel; Esper, Luciana Maria Ramires; Paula, Geraldo Renato de; Teixeira, Lenise Arneiro; Aguiar-Alves, Fábio

    2017-12-15

    This study aimed to investigate classical enterotoxin (sea to see) and mecA genes, by polymerase chain reaction and anitimicrobial susceptibility, by disk diffusion test of Staphylococcus aureus isolated from minas frescal cheese (MFC). All methicillin-resistant S. aureus (MRSA) isolates were investigated for the presence of Panton-Valentine leukocidin (PVL) genes and clonal diversity. Thirty-one S. aureus were isolated from four MFC samples. Seven (22.6%) S. aureus carried mecA gene and two of them carried enterotoxin genes seb/sec and sea/seb. Five (16.1%) S. aureus isolates showed induced resistance to clindamycin and nine (29%) were resistant to multiple -antibiotics (MDR), among these, six were MRSA. No MRSA isolates presented the PVL genes. Four MRSA were grouped into three clones and three isolates were not typable by pulsed field gel electrophoresis. MRSA isolates showed, by multilocus sequence typing, sequence types ST1, ST5, ST72 and ST4304 (new ST) and S. aureus protein A (spa type) t127, t568 and t2703. These data suggest that MFC may constitute a risk to the consumer because of its potential for staphylococcal food poisoning; however it might, also, become one of MRSA and MDR strains disseminator, including clones usually found in the hospital environment. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  14. Effects of ultraviolet disinfection on antibiotic-resistant Escherichia coli from wastewater: inactivation, antibiotic resistance profiles and antibiotic resistance genes.

    Science.gov (United States)

    Zhang, Chong-Miao; Xu, Li-Mei; Wang, Xiaochang C; Zhuang, Kai; Liu, Qiang-Qiang

    2017-04-29

    To evaluate the effect of ultraviolet (UV) disinfection on antibiotic-resistant Escherichia coli (E. coli). Antibiotic-resistant E. coli strains were isolated from a wastewater treatment plant and subjected to UV disinfection. The effect of UV disinfection on the antibiotic resistance profiles and the antibiotic resistance genes (ARGs) of antibiotic-resistant E. coli was evaluated by a combination of antibiotic susceptibility analysis and molecular methods. Results indicated that multiple-antibiotic-resistant (MAR) E. coli were more resistant at low UV doses and required a higher UV dose (20 mJ cm -2 ) to enter the tailing phase compared with those of antibiotic-sensitive E. coli (8 mJ cm -2 ). UV disinfection caused a selective change in the inhibition zone diameters of surviving antibiotic-resistant E. coli and a slight damage to ARGs. The inhibition zone diameters of the strains resistant to antibiotics were more difficult to alter than those susceptible to antibiotics because of the existence and persistence of corresponding ARGs. The resistance of MAR bacteria to UV disinfection at low UV doses and the changes in inhibition zone diameters could potentially contribute to the selection of ARB in wastewater treatment after UV disinfection. The risk of spread of antibiotic resistance still exists owing to the persistence of ARGs. Our study highlights the acquisition of other methods to control the spread of ARGs. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  15. Multidrug-resistant Nocardia pseudobrasiliensis presenting as multiple muscle abscesses.

    Science.gov (United States)

    Veerappan Kandasamy, Vimalkumar; Nagabandi, Arun; Horowitz, Edward A; Vivekanandan, Renuga

    2015-05-06

    A 79-year-old Caucasian man presented with multiple leg abscesses due to Nocardia pseudobrasiliensis. He was on chronic steroid therapy for myasthenia gravis. We present the difficulties in diagnosis and treatment of this rare organism. N. pseudobrasiliensis is a new emerging species that was previously thought to belong to the N. brasiliensis species. The distinction between the two species is extremely important given the different antibiotic susceptibility pattern and association of N. pseudobrasiliensis with more invasive and disseminated disease. 2015 BMJ Publishing Group Ltd.

  16. Bacteria from Animals as a Pool of Antimicrobial Resistance Genes

    Science.gov (United States)

    Argudín, Maria Angeles; Deplano, Ariane; Meghraoui, Alaeddine; Dodémont, Magali; Heinrichs, Amelie; Denis, Olivier; Nonhoff, Claire; Roisin, Sandrine

    2017-01-01

    Antimicrobial agents are used in both veterinary and human medicine. The intensive use of antimicrobials in animals may promote the fixation of antimicrobial resistance genes in bacteria, which may be zoonotic or capable to transfer these genes to human-adapted pathogens or to human gut microbiota via direct contact, food or the environment. This review summarizes the current knowledge of the use of antimicrobial agents in animal health and explores the role of bacteria from animals as a pool of antimicrobial resistance genes for human bacteria. This review focused in relevant examples within the ESC(K)APE (Enterococcus faecium, Staphylococcus aureus, Clostridium difficile (Klebsiella pneumoniae), Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacteriaceae) group of bacterial pathogens that are the leading cause of nosocomial infections throughout the world. PMID:28587316

  17. Occurrence of antibiotic resistant bacteria in dogs presented with ...

    African Journals Online (AJOL)

    Bacteriological examinations of swab samples from the affected ears were done using standard methods, followed by invitro antibiotic sensitivity test by agar disk diffusion method using the Oxoid® antibiotic discs of the commonly used antibiotics in Nigeria. Results were presented in percentages, pie chart and tables.

  18. Relationship between Psidium species (Myrtaceae) by resistance gene analog markers: focus on nematode resistance.

    Science.gov (United States)

    Noia, L R; Tuler, A C; Ferreira, A; Ferreira, M F S

    2017-03-16

    Guava (Psidium guajava L.) crop is severely affected by the nematode Meloidogyne enterolobii. Native Psidium species have been reported as sources of resistance against this nematode. Knowledge on the molecular relationship between Psidium species based on plant resistance gene analogs (RGA) can be useful in the genetic breeding of guava for resistance to M. enterolobii. In this study, RGA markers from conserved domains, and structural features of plant R genes, were employed to characterize Psidium species and establish genetic proximity, with a focus on nematode resistance. SSR markers were also applied owing to their neutral nature, thus differing from RGA markers. For this, species reported as sources of resistance to M. enterolobii, such as P. cattleianum and P. friedrichsthalianum, as well as species occurring in the Atlantic Rainforest and susceptible genotypes, were investigated. In 10 evaluated Psidium species, high interspecific genetic variability was verified through RGA and SSR markers, with intraspecific variation in P. guajava higher with SSR, as was expected. Resistant species were clustered by RGA markers, and differential amplicons among genotypes resistant and susceptible to M. enterolobii were identified. Knowledge on the molecular relationships between Psidium species constitutes useful information for breeding of the guava tree, providing direction for hybridization and material for rootstocks. Additionally, the genetic relationship between native species, which have been little studied, and P. guajava were estimated by RGAs, which were confirmed as important markers for genetic diversity related to pathogen resistance.

  19. Functional genomics in Campylobacter coli identified a novel streptomycin resistance gene located in a hypervariable genomic region.

    Science.gov (United States)

    Olkkola, Satu; Culebro, Alejandra; Juntunen, Pekka; Hänninen, Marja-Liisa; Rossi, Mirko

    2016-07-01

    Numerous aminoglycoside resistance genes have been reported in Campylobacter spp. often resembling those from Gram-positive bacterial species and located in transferable genetic elements with other resistance genes. We discovered a new streptomycin (STR) resistance gene in Campylobactercoli showing 27-34 % amino acid identity to aminoglycoside 6-nucleotidyl-transferases described previously in Campylobacter. STR resistance was verified by gene expression and insertional inactivation. This ant-like gene differs from the previously described aminoglycoside resistance genes in Campylobacter spp. in several aspects. It does not appear to originate from Gram-positive bacteria and is located in a region corresponding to a previously described hypervariable region 14 of C. jejuni with no other known resistance genes detected in close proximity. Finally, it does not belong to a multiple drug resistance plasmid or transposon. This novel ant-like gene appears widely spread among C. coli as it is found in strains originating both from Europe and the United States and from several, apparently unrelated, hosts and environmental sources. The closest homologue (60 % amino acid identity) was found in certain C. jejuni and C. coli strains in a similar genomic location, but an association with STR resistance was not detected. Based on the findings presented here, we hypothesize that Campylobacter ant-like gene A has originated from a common ancestral proto-resistance element in Campylobacter spp., possibly encoding a protein with a different function. In conclusion, whole genome sequencing allowed us to fill in a knowledge gap concerning STR resistance in C. coli by revealing a novel STR resistance gene possibly inherent to Campylobacter.

  20. Molecular mapping of soybean rust (Phakopsora pachyrhizi) resistance genes: discovery of a novel locus and alleles.

    Science.gov (United States)

    Garcia, Alexandre; Calvo, Eberson Sanches; de Souza Kiihl, Romeu Afonso; Harada, Arlindo; Hiromoto, Dario Minoru; Vieira, Luiz Gonzaga Esteves

    2008-08-01

    Soybean production in South and North America has recently been threatened by the widespread dissemination of soybean rust (SBR) caused by the fungus Phakopsora pachyrhizi. Currently, chemical spray containing fungicides is the only effective method to control the disease. This strategy increases production costs and exposes the environment to higher levels of fungicides. As a first step towards the development of SBR resistant cultivars, we studied the genetic basis of SBR resistance in five F2 populations derived from crossing the Brazilian-adapted susceptible cultivar CD 208 to each of five different plant introductions (PI 200487, PI 200526, PI 230970, PI 459025, PI 471904) carrying SBR-resistant genes (Rpp). Molecular mapping of SBR-resistance genes was performed in three of these PIs (PI 459025, PI 200526, PI 471904), and also in two other PIs (PI 200456 and 224270). The strategy mapped two genes present in PI 230970 and PI 459025, the original sources of Rpp2 and Rpp4, to linkage groups (LG) J and G, respectively. A new SBR resistance locus, rpp5 was mapped in the LG-N. Together, the genetic and molecular analysis suggested multiple alleles or closely linked genes that govern SBR resistance in soybean.

  1. Prevalence and characterization of plasmids carrying sulfonamide resistance genes among Escherichia coli from pigs, pig carcasses and human

    DEFF Research Database (Denmark)

    Shuyu, Wu; Dalsgaard, A.; Hammerum, A. M.

    2010-01-01

    involved in the mobility of sul genes. Methods A total of 501 E. coli isolates from pig feces, pig carcasses and human stools were tested for their susceptibility to selected antimicrobial. Multiplex PCR was conducted to detect the presence of three sul genes among the sulfonamide-resistant E. coli......Background Sulfonamide resistance is very common in Escherichia coli. The aim of this study was to characterize plasmids carrying sulfonamide resistance genes (sul1, sul2 and sul3) in E. coli isolated from pigs and humans with a specific objective to assess the genetic diversity of plasmids...... carrying sul genes were characterized by PCR-based replicon typing to allow a comparison of the types of sul genes, the reservoir and plasmid present. Results A total of 109/501 isolates exhibited sulfonamide resistance. The relative prevalences of sul genes from the three reservoirs (pigs, pig carcasses...

  2. Polymorphisms in Plasmodium falciparum chloroquine resistance transporter and multidrug resistance 1 genes

    DEFF Research Database (Denmark)

    Venkatesan, Meera; Gadalla, Nahla B; Stepniewska, Kasia

    2014-01-01

    Adequate clinical and parasitologic cure by artemisinin combination therapies relies on the artemisinin component and the partner drug. Polymorphisms in the Plasmodium falciparum chloroquine resistance transporter (pfcrt) and P. falciparum multidrug resistance 1 (pfmdr1) genes are associated...... with decreased sensitivity to amodiaquine and lumefantrine, but effects of these polymorphisms on therapeutic responses to artesunate-amodiaquine (ASAQ) and artemether-lumefantrine (AL) have not been clearly defined. Individual patient data from 31 clinical trials were harmonized and pooled by using standardized...

  3. Comparative Transcriptomics Reveals Differential Gene Expression Related to Colletotrichum gloeosporioides Resistance in the Octoploid Strawberry

    Directory of Open Access Journals (Sweden)

    Feng Wang

    2017-05-01

    Full Text Available The strawberry is an important fruit worldwide; however, the development of the strawberry industry is limited by fungal disease. Anthracnose is caused by the pathogen Colletotrichum gloeosporioides and leads to large-scale losses in strawberry quality and production. However, the transcriptional response of strawberry to infection with C. gloeosporioides is poorly understood. In the present study, the strawberry leaf transcriptome of the ‘Yanli’ and ‘Benihoppe’ cultivars were deep sequenced via an RNA-seq analysis to study C. gloeosporioides resistance in strawberry. Among the sequences, differentially expressed genes were annotated with Gene Ontology terms and subjected to pathway enrichment analysis. Significant categories included defense, plant–pathogen interactions and flavonoid biosynthesis were identified. The comprehensive transcriptome data set provides molecular insight into C. gloeosporioides resistance genes in resistant and susceptible strawberry cultivars. Our findings can enhance breeding efforts in strawberry.

  4. Recombination Rate Heterogeneity within Arabidopsis Disease Resistance Genes.

    Science.gov (United States)

    Choi, Kyuha; Reinhard, Carsten; Serra, Heïdi; Ziolkowski, Piotr A; Underwood, Charles J; Zhao, Xiaohui; Hardcastle, Thomas J; Yelina, Nataliya E; Griffin, Catherine; Jackson, Matthew; Mézard, Christine; McVean, Gil; Copenhaver, Gregory P; Henderson, Ian R

    2016-07-01

    Meiotic crossover frequency varies extensively along chromosomes and is typically concentrated in hotspots. As recombination increases genetic diversity, hotspots are predicted to occur at immunity genes, where variation may be beneficial. A major component of plant immunity is recognition of pathogen Avirulence (Avr) effectors by resistance (R) genes that encode NBS-LRR domain proteins. Therefore, we sought to test whether NBS-LRR genes would overlap with meiotic crossover hotspots using experimental genetics in Arabidopsis thaliana. NBS-LRR genes tend to physically cluster in plant genomes; for example, in Arabidopsis most are located in large clusters on the south arms of chromosomes 1 and 5. We experimentally mapped 1,439 crossovers within these clusters and observed NBS-LRR gene associated hotspots, which were also detected as historical hotspots via analysis of linkage disequilibrium. However, we also observed NBS-LRR gene coldspots, which in some cases correlate with structural heterozygosity. To study recombination at the fine-scale we used high-throughput sequencing to analyze ~1,000 crossovers within the RESISTANCE TO ALBUGO CANDIDA1 (RAC1) R gene hotspot. This revealed elevated intragenic crossovers, overlapping nucleosome-occupied exons that encode the TIR, NBS and LRR domains. The highest RAC1 recombination frequency was promoter-proximal and overlapped CTT-repeat DNA sequence motifs, which have previously been associated with plant crossover hotspots. Additionally, we show a significant influence of natural genetic variation on NBS-LRR cluster recombination rates, using crosses between Arabidopsis ecotypes. In conclusion, we show that a subset of NBS-LRR genes are strong hotspots, whereas others are coldspots. This reveals a complex recombination landscape in Arabidopsis NBS-LRR genes, which we propose results from varying coevolutionary pressures exerted by host-pathogen relationships, and is influenced by structural heterozygosity.

  5. The rph2 gene is responsible for high level resistance to phosphine in independent field strains of Rhyzopertha dominica.

    Directory of Open Access Journals (Sweden)

    Yosep S Mau

    Full Text Available The lesser grain borer Rhyzopertha dominica (F. is one of the most destructive insect pests of stored grain. This pest has been controlled successfully by fumigation with phosphine for the last several decades, though strong resistance to phosphine in many countries has raised concern about the long term usefulness of this control method. Previous genetic analysis of strongly resistant (SR R. dominica from three widely geographically dispersed regions of Australia, Queensland (SR(QLD, New South Wales (SR(NSW and South Australia (SR(SA, revealed a resistance allele in the rph1 gene in all three strains. The present study confirms that the rph1 gene contributes to resistance in a fourth strongly resistant strain, SR2(QLD, also from Queensland. The previously described rph2 gene, which interacts synergistically with rph1 gene, confers strong resistance on SR(QLD and SR(NSW. We now provide strong circumstantial evidence that weak alleles of rph2, together with rph1, contribute to the strong resistance phenotypes of SR(SA and SR2(QLD. To test the notion that rph1 and rph2 are solely responsible for the strong resistance phenotype of all resistant R. dominica, we created a strain derived by hybridising the four strongly resistant lines. Following repeated selection for survival at extreme rates of phosphine exposure, we found only slightly enhanced resistance. This suggests that a single sequence of genetic changes was responsible for the development of resistance in these insects.

  6. Molecular tagging of a novel rust resistance gene R(12) in sunflower (Helianthus annuus L.).

    Science.gov (United States)

    Gong, L; Hulke, B S; Gulya, T J; Markell, S G; Qi, L L

    2013-01-01

    Sunflower production in North America has recently suffered economic losses in yield and seed quality from sunflower rust (Puccinia helianthi Schwein.) because of the increasing incidence and lack of resistance to new rust races. RHA 464, a newly released sunflower male fertility restorer line, is resistant to both of the most predominant and most virulent rust races identified in the Northern Great Plains of the USA. The gene conditioning rust resistance in RHA 464 originated from wild Helianthus annuus L., but has not been molecularly marked or determined to be independent from other rust loci. The objectives of this study are to identify molecular markers linked to the rust resistance gene and to investigate the allelism of this gene with the unmapped rust resistance genes present in HA-R6, HA-R8 and RHA 397. Virulence phenotypes of seedlings for the F(2) population and F(2:3) families suggested that a single dominant gene confers rust resistance in RHA 464, and this gene was designated as R(12). Bulked segregant analysis identified ten markers polymorphic between resistant and susceptible bulks. In subsequent genetic mapping, the ten markers covered 33.4 cM of genetic distance on linkage group 11 of sunflower. A co-dominant marker CRT275-11 is the closest marker distal to R(12) with a genetic distance of 1.0 cM, while ZVG53, a dominant marker linked in the repulsion phase, is proximal to R(12) with a genetic distance of 9.6 cM. The allelism test demonstrated that R(12) is not allelic to the rust resistance genes in HA-R6, HA-R8 and RHA 397, and it is also not linked to any previously mapped rust resistance genes. Discovery of the R(12) novel rust resistance locus in sunflower and associated markers will potentially support the molecular marker-assisted introgression and pyramiding of R(12) into sunflower breeding lines.

  7. Peripheral IV Insulin Infusion Infiltration Presenting as "Insulin Resistance".

    Science.gov (United States)

    Kim, Tiffany Y; Woeber, Kenneth A; MacMaster, Heidimarie Windham; Rushakoff, Robert J

    2016-11-01

    We present the case of a 66-year-old woman who developed hypoglycemia following the prolonged infiltration of a high dose continuous peripheral IV insulin infusion. Case report. PubMed was searched for relevant literature on exogenous hyperinsulinemic hypoglycemia. The patient was postlung transplantation and was receiving high doses of glucocorticoids. Despite increasing the peripheral IV insulin rate, hyperglycemia persisted. We discovered that the IV insulin infusion line infiltrated, resulting in a large subcutaneous insulin depot, estimated to be 450 units of regular insulin. She subsequently experienced prolonged hypoglycemia that was managed with concentrated dextrose containing fluids. In our literature search, there were no similar case reports. The literature on insulin overdose, usually from suicide attempts, can help guide the management of iatrogenic hyperinsulinemic hypoglycemia. Important management considerations include anticipated duration of hypoglycemia, supplemental glucose, fluid management, and electrolyte monitoring. Peripheral IV insulin infusion infiltration should be considered when patients do not respond to increasing rates of insulin infusion.

  8. Persistence of antimicrobial resistance genes from sows to finisher pigs

    DEFF Research Database (Denmark)

    Birkegård, Anna Camilla; Halasa, Tariq; Folkesson, Anders

    2018-01-01

    Antimicrobial resistance in pigs has been under scrutiny for many years. However, many questions remain unanswered, including whether the initial antimicrobial resistance level of a pig will influence the antimicrobial resistance found at slaughter. Faecal samples from finishers pigs from 681 farms...... and from sows from 82 farms were collected, and levels of seven antimicrobial resistance genes, ermB, ermF, sulI, sulII, tet(M), tet(O), and tet(W), were quantified by high-capacity qPCR. There were 40 pairs of observations where the finishers were born in the farms of the sows. The objective of this study...... was to evaluate whether the levels of AMR genes found in finisher pigs at slaughter were associated with the levels in the farm where the finishers were born, and whether the levels of the AMR genes were equal in the sow and finisher pig populations. We found a significant positive correlation between the levels...

  9. Mapping fusiform rust resistance genes within a complex mating design of loblolly pine

    Science.gov (United States)

    Tania Quesada; Marcio F.R. Resende Jr.; Patricio Munoz; Jill L. Wegrzyn; David B. Neale; Matias Kirst; Gary F. Peter; Salvador A. Gezan; C.Dana Nelson; John M. Davis

    2014-01-01

    Fusiform rust resistance can involve gene-for-gene interactions where resistance (Fr) genes in the host interact with corresponding avirulence genes in the pathogen, Cronartium quercuum f.sp. fusiforme (Cqf). Here, we identify trees with Fr genes in a loblolly pine population derived from a complex mating design challenged with two Cqf inocula (one gall and 10 gall...

  10. Postulation of rust resistance genes in Nordic spring wheat genotypes and identification of widely effective sources of resistance against the Australian rust flora.

    Science.gov (United States)

    Randhawa, Mandeep; Bansal, Urmil; Lillemo, Morten; Miah, Hanif; Bariana, Harbans

    2016-11-01

    Wild relatives, landraces and cultivars from different geographical regions have been demonstrated as the sources of genetic variation for resistance to rust diseases. This study involved assessment of diversity for resistance to three rust diseases among a set of Nordic spring wheat cultivars. These cultivars were tested at the seedling stage against several pathotypes of three rust pathogens in the greenhouse. All stage stem rust resistance genes Sr7b, Sr8a, Sr12, Sr15, Sr17, Sr23 and Sr30, and leaf rust resistance genes Lr1, Lr3a, Lr13, Lr14a, Lr16 and Lr20 were postulated either singly or in different combinations among these cultivars. A high proportion of cultivars were identified to carry linked rust resistance genes Sr15 and Lr20. Although 51 cultivars showed variation against Puccinia striiformis f. sp. tritici (Pst) pathotypes used in this study, results were not clearly contrasting to enable postulation of stripe rust resistance genes in these genotypes. Stripe rust resistance gene Yr27 was postulated in four cultivars and Yr1 was present in cultivar Zebra. Cultivar Tjalve produced low stripe rust response against all Pst pathotypes indicating the presence either of a widely effective resistance gene or combination of genes with compensating pathogenic specificities. Several cultivars carried moderate to high level of APR to leaf rust and stripe rust. Seedling stem rust susceptible cultivar Aston exhibited moderately resistant to moderately susceptible response, whereas other cultivars belonging to this class were rated moderately susceptible or higher. Molecular markers linked with APR genes Yr48, Lr34/Yr18/Sr57, Lr68 and Sr2 detected the presence of these genes in some genotypes.

  11. A novel method to discover fluoroquinolone antibiotic resistance (qnr genes in fragmented nucleotide sequences

    Directory of Open Access Journals (Sweden)

    Boulund Fredrik

    2012-12-01

    Full Text Available Abstract Background Broad-spectrum fluoroquinolone antibiotics are central in modern health care and are used to treat and prevent a wide range of bacterial infections. The recently discovered qnr genes provide a mechanism of resistance with the potential to rapidly spread between bacteria using horizontal gene transfer. As for many antibiotic resistance genes present in pathogens today, qnr genes are hypothesized to originate from environmental bacteria. The vast amount of data generated by shotgun metagenomics can therefore be used to explore the diversity of qnr genes in more detail. Results In this paper we describe a new method to identify qnr genes in nucleotide sequence data. We show, using cross-validation, that the method has a high statistical power of correctly classifying sequences from novel classes of qnr genes, even for fragments as short as 100 nucleotides. Based on sequences from public repositories, the method was able to identify all previously reported plasmid-mediated qnr genes. In addition, several fragments from novel putative qnr genes were identified in metagenomes. The method was also able to annotate 39 chromosomal variants of which 11 have previously not been reported in literature. Conclusions The method described in this paper significantly improves the sensitivity and specificity of identification and annotation of qnr genes in nucleotide sequence data. The predicted novel putative qnr genes in the metagenomic data support the hypothesis of a large and uncharacterized diversity within this family of resistance genes in environmental bacterial communities. An implementation of the method is freely available at http://bioinformatics.math.chalmers.se/qnr/.

  12. Resistance-Gene Cassettes Associated With Salmonella enterica Genotypes.

    Science.gov (United States)

    Bakhshi, Bita; Ghafari, Mohsen; Pourshafie, Mohammad R; Zarbakhsh, Behnaz; Katouli, Mohammad; Rahbar, Mohammad; Hajia, Masoud; Hosseini-Aliabad, Neda; Boustanshenas, Mina

    2015-01-01

    The epidemiology of salmonellosis is complex because of the diversity and different serotypes of Salmonella enterica (S. enterica) that occur in different reservoirs and geographic incidences. To determine the genotype distribution and resistance-gene content of 2 classes of integron among S. enterica isolates. Thirty-six S. enterica species were isolated and tested for their serological distribution and the resistance-gene contents of 2 classes of integron, as well as for their genetic diversity, using the pulsed-field gel electrophoresis (PFGE) genotyping method. Serogroups E (36.1%) and D (30.5%) were dominant among the isolates. All of the isolates in serogroup D belonged to the serovar enteritidis. The aadA1 gene was found within all resistance-gene cassettes. We observed 4 common and 26 single pulsotypes among the isolates, which indicated a high degree of genetic diversity among the isolates. Using the PulseNet International standard protocol, it was found that these isolates were different from those reported previously in Iran. The presence of a few common and new pulsotypes among the isolates suggests the emergence and spread of new clones of S. enterica in Iran. Copyright© by the American Society for Clinical Pathology (ASCP).

  13. Continental-scale pollution of estuaries with antibiotic resistance genes.

    Science.gov (United States)

    Zhu, Yong-Guan; Zhao, Yi; Li, Bing; Huang, Chu-Long; Zhang, Si-Yu; Yu, Shen; Chen, Yong-Shan; Zhang, Tong; Gillings, Michael R; Su, Jian-Qiang

    2017-01-30

    Antibiotic resistance genes (ARGs) have moved from the environmental resistome into human commensals and pathogens, driven by human selection with antimicrobial agents. These genes have increased in abundance in humans and domestic animals, to become common components of waste streams. Estuarine habitats lie between terrestrial/freshwater and marine ecosystems, acting as natural filtering points for pollutants. Here, we have profiled ARGs in sediments from 18 estuaries over 4,000 km of coastal China using high-throughput quantitative polymerase chain reaction, and investigated their relationship with bacterial communities, antibiotic residues and socio-economic factors. ARGs in estuarine sediments were diverse and abundant, with over 200 different resistance genes being detected, 18 of which were found in all 90 sediment samples. The strong correlations of identified resistance genes with known mobile elements, network analyses and partial redundancy analysis all led to the conclusion that human activity is responsible for the abundance and dissemination of these ARGs. Such widespread pollution with xenogenetic elements has environmental, agricultural and medical consequences.

  14. Detection of antibiotic resistance genes in wastewater treatment plant – molecular and classical approach

    Directory of Open Access Journals (Sweden)

    Ziembińska-Buczyńska Aleksandra

    2015-12-01

    Full Text Available Antibiotics are a group of substances potentially harmful to the environment. They can play a role in bacterial resistance transfer among pathogenic and non-pathogenic bacteria. In this experiment three representatives of medically important chemotherapeutics, confirmed to be present in high concentrations in wastewater treatment plants with HPLC analysis were used: erythromycin, sulfamethoxazole and trimethoprim. Erythromycin concentration in activated sludge was not higher than 20 ng L−1. N-acetylo-sulfamethoxazole concentration was 3349 ± 719 in winter and 2933 ± 429 ng L−1 in summer. Trimethoprim was present in wastewater at concentrations 400 ± 22 and 364 ± 60 ng L−1, respectively in winter and summer. Due to a wide variety of PCR-detectable resistance mechanisms towards these substances, the most common found in literature was chosen. For erythromycin: erm and mef genes, for sulfamethoxazole: sul1, sul2, sul3 genes, in the case of trimethoprim resistance dhfrA1 and dhfr14 were used in this study. The presence of resistance genes were analyzed in pure strains isolated from activated sludge and in the activated sludge sample itself. The research revealed that the value of minimal inhibitory concentration (MIC did not correspond with the expected presence of more than one resistance mechanisms. Most of the isolates possessed only one of the genes responsible for a particular chemotherapeutic resistance. It was confirmed that it is possible to monitor the presence of resistance genes directly in activated sludge using PCR. Due to the limited isolates number used in the experiment these results should be regarded as preliminary.

  15. Resistance gene transfer during treatments for experimental avian colibacillosis.

    Science.gov (United States)

    Dheilly, Alexandra; Le Devendec, Laëtitia; Mourand, Gwenaëlle; Bouder, Axelle; Jouy, Eric; Kempf, Isabelle

    2012-01-01

    An experiment was conducted in animal facilities to compare the impacts of four avian colibacillosis treatments-oxytetracycline (OTC), trimethoprim-sulfadimethoxine (SXT), amoxicillin (AMX), or enrofloxacin (ENR)-on the susceptibility of Escherichia coli in broiler intestinal tracts. Birds were first orally inoculated with rifampin-resistant E. coli strains bearing plasmid genes conferring resistance to fluoroquinolones (qnr), cephalosporins (bla(CTX-M) or bla(FOX)), trimethoprim-sulfonamides, aminoglycosides, or tetracyclines. Feces samples were collected before, during, and after antimicrobial treatments. The susceptibilities of E. coli strains were studied, and resistance gene transfer was analyzed. An increase in the tetracycline-resistant E. coli population was observed only in OTC-treated birds, whereas multiresistant E. coli was detected in the dominant E. coli populations of SXT-, AMX-, or ENR-treated birds. Most multiresistant E. coli strains were susceptible to rifampin and exhibited various pulsed-field gel electrophoresis profiles, suggesting the transfer of one of the multiresistance plasmids from the inoculated strains to other E. coli strains in the intestinal tract. In conclusion, this study clearly illustrates how, in E. coli, "old" antimicrobials may coselect antimicrobial resistance to recent and critical molecules.

  16. Characterization and transfer studies of macrolide resistance genes in Streptococcus pneumoniae from Denmark

    DEFF Research Database (Denmark)

    Nielsen, Karen L; Hammerum, Anette M; Lambertsen, Lotte M

    2010-01-01

    Over the last decade, erythromycin resistance has been increasing in frequency in Streptococcus pneumoniae in Denmark. In the present study, 49 non-related erythromycin-resistant S. pneumoniae isolates from invasive sites and 20 isolates from non-invasive sites were collected; antimicrobial...... influence on the protein. Transformation was detectable in 5 out of 13 isolates and transfer of erm(B), mef(I) and mef(E) was detected. To our knowledge, this is the first time mef(I) has been proved transformable. Gene transfer by conjugation was not detectable. Erythromycin resistance in pneumococcal...

  17. Gene Prioritization of Resistant Rice Gene against Xanthomas oryzae pv. oryzae by Using Text Mining Technologies

    Directory of Open Access Journals (Sweden)

    Jingbo Xia

    2013-01-01

    Full Text Available To effectively assess the possibility of the unknown rice protein resistant to Xanthomonas oryzae pv. oryzae, a hybrid strategy is proposed to enhance gene prioritization by combining text mining technologies with a sequence-based approach. The text mining technique of term frequency inverse document frequency is used to measure the importance of distinguished terms which reflect biomedical activity in rice before candidate genes are screened and vital terms are produced. Afterwards, a built-in classifier under the chaos games representation algorithm is used to sieve the best possible candidate gene. Our experiment results show that the combination of these two methods achieves enhanced gene prioritization.

  18. Allele characterization of genes required for rpg4-mediated wheat stem rust resistance identifies Rpg5 as the R gene.

    Science.gov (United States)

    Arora, D; Gross, T; Brueggeman, R

    2013-11-01

    A highly virulent form of the wheat stem rust pathogen Puccinia graminis f. sp. tritici race TTKSK is virulent on both wheat and barley, presenting a major threat to world food security. The recessive and temperature-sensitive rpg4 gene is the only effective source of resistance identified in barley (Hordeum vulgare) against P. graminis f. sp. tritici race TTKSK. Efforts to position clone rpg4 localized resistance to a small interval on barley chromosome 5HL, tightly linked to the rye stem rust (P. graminis f. sp. secalis) resistance (R) gene Rpg5. High-resolution genetic analysis and post-transcriptional gene silencing of the genes at the rpg4/Rpg5 locus determined that three tightly linked genes (Rpg5, HvRga1, and HvAdf3) are required together for rpg4-mediated wheat stem rust resistance. Alleles of the three genes were analyzed from a diverse set of 14 domesticated barley lines (H. vulgare) and 8 wild barley accessions (H. vulgare subsp. spontaneum) to characterize diversity that may determine incompatibility (resistance). The analysis determined that HvAdf3 and HvRga1 code for predicted functional proteins that do not appear to contain polymorphisms determining the compatible (susceptible) interactions with the wheat stem rust pathogen and were expressed at the transcriptional level from both resistant and susceptible barley lines. The HvAdf3 alleles shared 100% amino acid identity among all 22 genotypes examined. The P. graminis f. sp. tritici race QCCJ-susceptible barley lines with HvRga1 alleles containing the limited amino acid substitutions unique to the susceptible varieties also contained predicted nonfunctional rpg5 alleles. Thus, susceptibility in these lines is likely due to the nonfunctional RPG5 proteins. The Rpg5 allele analysis determined that 9 of the 13 P. graminis f. sp. tritici race QCCJ-susceptible barley lines contain alleles that either code for predicted truncated proteins as the result of a single nucleotide substitution, resulting in a

  19. Spread of tetracycline resistance genes at a conventional dairy farm

    Czech Academy of Sciences Publication Activity Database

    Kyselková, Martina; Jirout, Jiří; Vrchotová, Naděžda; Schmitt, H.; Elhottová, Dana

    2015-01-01

    Roč. 6, may (2015), s. 536 ISSN 1664-302X R&D Projects: GA ČR GAP504/10/2077; GA MŠk(CZ) EE2.3.30.0032; GA MŠk(CZ) LO1415 Institutional support: RVO:67179843 ; RVO:60077344 Keywords : antibiotic resistance spread * animal manure * cattle intestinal microflora * chlortetracycline * dairy cattle * dairy farm * heavy metals * tetracycline resistance genes Subject RIV: EI - Biotechnology ; Bionics; EE - Microbiology, Virology (BC-A) Impact factor: 4.165, year: 2015

  20. Antimicrobial resistance and antimicrobial resistance genes in marine bacteria from salmon aquaculture and non-aquaculture sites.

    Science.gov (United States)

    Shah, Syed Q A; Cabello, Felipe C; L'abée-Lund, Trine M; Tomova, Alexandra; Godfrey, Henry P; Buschmann, Alejandro H; Sørum, Henning

    2014-05-01

    Antimicrobial resistance (AR) detected by disc diffusion and antimicrobial resistance genes detected by DNA hybridization and polymerase chain reaction with amplicon sequencing were studied in 124 marine bacterial isolates from a Chilean salmon aquaculture site and 76 from a site without aquaculture 8 km distant. Resistance to one or more antimicrobials was present in 81% of the isolates regardless of site. Resistance to tetracycline was most commonly encoded by tetA and tetG; to trimethoprim, by dfrA1, dfrA5 and dfrA12; to sulfamethizole, by sul1 and sul2; to amoxicillin, by blaTEM ; and to streptomycin, by strA-strB. Integron integrase intl1 was detected in 14 sul1-positive isolates, associated with aad9 gene cassettes in two from the aquaculture site. intl2 Integrase was only detected in three dfrA1-positive isolates from the aquaculture site and was not associated with gene cassettes in any. Of nine isolates tested for conjugation, two from the aquaculture site transferred AR determinants to Escherichia coli. High levels of AR in marine sediments from aquaculture and non-aquaculture sites suggest that dispersion of the large amounts of antimicrobials used in Chilean salmon aquaculture has created selective pressure in areas of the marine environment far removed from the initial site of use of these agents. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

  1. Multiple-Insecticide Resistance and Classic Gene Mutations to Japanese Encephalitis Vector Culex tritaeniorhynchus from China.

    Science.gov (United States)

    Wu, Zhi-Ming; Chu, Hong-Liang; Wang, Gang; Zhu, Xiao-Juan; Guo, Xiao-Xia; Zhang, Ying-Mei; Xing, Dan; Yan, Ting; Zhao, Ming-Hui; Dong, Yan-De; Li, Chun-Xiao; Zhao, Tong-Yan

    2016-06-01

    Widespread resistance of insect pests to insecticides has been widely reported in China and there is consequently an urgent need to adjust pest management strategies appropriately. This requires detailed information on the extent and causes of resistance. The aim of the present study was to investigate levels of resistance to 5 insecticides among 12 strains of Culex tritaeniorhynchus, a major vector of Japanese encephalitis in China. Resistance to deltamethrin, beta-cypermethrin, permethrin, dichlorvos, and propoxur were measured using larval bioassays. The allelic frequency of knockdown resistance (kdr) and acetylcholinesterase (AChE) mutations were determined in all strains. Larval bioassay results indicated that the field strains collected from different sites were resistant to deltamethrin, beta-cypermethrin, permethrin, dichlorvos, and propoxur, with resistance ratio values ranging from 1.70- to 71.98-fold, 7.83- to 43.07-fold, 3.54- to 40.03-fold, 291.85- to 530.89-fold, and 51.32- to 108.83-fold, respectively. A polymerase chain reaction amplification of specific alleles method for individual was developed to detect genotypes of the AChE gene mutation F455W in Cx. tritaeniorhynchus. The frequency of the AChE gene mutation F455W was 100.00% in all strains, making this mutation of no value as a marker of resistance to organophosphorous and carbamate pesticides in Cx. tritaeniorhynchus in China. The kdr allele was present in all strains at frequencies of 10.00-29.55%. Regression analysis indicated a significant correlation between kdr allele frequencies and levels of resistance to deltamethrin, beta-cypermethrin, and permethrin. These results highlight the need to monitor and map insecticide resistance in Cx. tritaeniorhynchus and to adjust pesticide use to minimize the development of resistance in these mosquitoes.

  2. Using SNP genetic markers to elucidate the linkage of the Co-34/Phg-3 anthracnose and angular leaf spot resistance gene cluster with the Ur-14 resistance gene

    Science.gov (United States)

    The Ouro Negro common bean cultivar contains the Co-34/Phg-3 gene cluster that confers resistance to the anthracnose (ANT) and angular leaf spot (ALS) pathogens. These genes are tightly linked on chromosome 4. Ouro Negro also has the Ur-14 rust resistance gene, reportedly in the vicinity of Co- 34; ...

  3. Distribution of different efflux pump genes in clinical isolates of multidrug-resistant Acinetobacter baumannii and their correlation with antimicrobial resistance.

    Science.gov (United States)

    Lin, Ming-Feng; Lin, Yun-You; Tu, Chi-Chao; Lan, Chung-Yu

    2017-04-01

    Efflux pumps are one of the major mechanisms of antimicrobial resistance in Acinetobacter baumannii. This study aimed to understand the distribution of different types of pump genes in clinical isolates of multidrug-resistant A. baumannii (MDRAB) and to reveal the relationship between their presence and expression with antimicrobial resistance. MDRAB isolates were collected from five hospitals in Taiwan. Different categories of pump genes, including adeB, adeJ, macB, abeM, abeS, emrA-like, emrB-like, and craA, were chosen, and their presence in the collected isolates was determined. Three induced resistant strains of A. baumannii ATCC 17978 to tigecycline, imipenem, and amikacin were also included. The expressions of the selected pump genes were determined using quantitative reverse transcription-polymerase chain reaction. Twenty-one MDRAB clinical isolates were obtained from five hospitals. All of the studied pump genes were present in the collected MDRAB isolates except one isolate that lacked the emrA-like gene. The gene expression of these efflux pumps was variable among the strains. The upregulation of the adeB, adeJ, and macB genes was responsible for tigecycline resistance, and the increased abeS expression was strongly related to amikacin resistance. Of all the antibiotics studied, tigecycline was the strongest inducer of gene expression for many efflux pumps in A. baumannii. Efflux pump genes are universally present in the collected clinical MDRAB isolates. The upregulation of the adeB, adeJ, macB and abeS genes is more related with antibiotic resistance. Copyright © 2015. Published by Elsevier B.V.

  4. Plasmodium falciparum parasite population structure and gene flow associated to anti-malarial drugs resistance in Cambodia.

    Science.gov (United States)

    Dwivedi, Ankit; Khim, Nimol; Reynes, Christelle; Ravel, Patrice; Ma, Laurence; Tichit, Magali; Bourchier, Christiane; Kim, Saorin; Dourng, Dany; Khean, Chanra; Chim, Pheaktra; Siv, Sovannaroth; Frutos, Roger; Lek, Dysoley; Mercereau-Puijalon, Odile; Ariey, Frédéric; Menard, Didier; Cornillot, Emmanuel

    2016-06-14

    Western Cambodia is recognized as the epicentre of emergence of Plasmodium falciparum multi-drug resistance. The emergence of artemisinin resistance has been observed in this area since 2008-2009 and molecular signatures associated to artemisinin resistance have been characterized in k13 gene. At present, one of the major threats faced, is the possible spread of Asian artemisinin resistant parasites over the world threatening millions of people and jeopardizing malaria elimination programme efforts. To anticipate the diffusion of artemisinin resistance, the identification of the P. falciparum population structure and the gene flow among the parasite population in Cambodia are essential. To this end, a mid-throughput PCR-LDR-FMA approach based on LUMINEX technology was developed to screen for genetic barcode in 533 blood samples collected in 2010-2011 from 16 health centres in malaria endemics areas in Cambodia. Based on successful typing of 282 samples, subpopulations were characterized along the borders of the country. Each 11-loci barcode provides evidence supporting allele distribution gradient related to subpopulations and gene flow. The 11-loci barcode successfully identifies recently emerging parasite subpopulations in western Cambodia that are associated with the C580Y dominant allele for artemisinin resistance in k13 gene. A subpopulation was identified in northern Cambodia that was associated to artemisinin (R539T resistant allele of k13 gene) and mefloquine resistance. The gene flow between these subpopulations might have driven the spread of artemisinin resistance over Cambodia.

  5. Identification of genes differentially expressed in a resistant reaction to Mycosphaerella pinodes in pea using microarray technology

    Directory of Open Access Journals (Sweden)

    Cubero José I

    2011-01-01

    Full Text Available Abstract Background Ascochyta blight, caused by Mycosphaerella pinodes is one of the most important pea pathogens. However, little is known about the genes and mechanisms of resistance acting against M. pinodes in pea. Resistance identified so far to this pathogen is incomplete, polygenic and scarce in pea, being most common in Pisum relatives. The identification of the genes underlying resistance would increase our knowledge about M. pinodes-pea interaction and would facilitate the introgression of resistance into pea varieties. In the present study differentially expressed genes in the resistant P. sativum ssp. syriacum accession P665 comparing to the susceptible pea cv. Messire after inoculation with M. pinodes have been identified using a M. truncatula microarray. Results Of the 16,470 sequences analysed, 346 were differentially regulated. Differentially regulated genes belonged to almost all functional categories and included genes involved in defense such as genes involved in cell wall reinforcement, phenylpropanoid and phytoalexins metabolism, pathogenesis- related (PR proteins and detoxification processes. Genes associated with jasmonic acid (JA and ethylene signal transduction pathways were induced suggesting that the response to M. pinodes in pea is regulated via JA and ET pathways. Expression levels of ten differentially regulated genes were validated in inoculated and control plants using qRT-PCR showing that the P665 accession shows constitutively an increased expression of the defense related genes as peroxidases, disease resistance response protein 39 (DRR230-b, glutathione S-transferase (GST and 6a-hydroxymaackiain methyltransferase. Conclusions Through this study a global view of genes expressed during resistance to M. pinodes has been obtained, giving relevant information about the mechanisms and pathways conferring resistance to this important disease. In addition, the M. truncatula microarray represents an efficient tool to

  6. Identification of genes differentially expressed in a resistant reaction to Mycosphaerella pinodes in pea using microarray technology.

    Science.gov (United States)

    Fondevilla, Sara; Küster, Helge; Krajinski, Franziska; Cubero, José I; Rubiales, Diego

    2011-01-13

    Ascochyta blight, caused by Mycosphaerella pinodes is one of the most important pea pathogens. However, little is known about the genes and mechanisms of resistance acting against M. pinodes in pea. Resistance identified so far to this pathogen is incomplete, polygenic and scarce in pea, being most common in Pisum relatives. The identification of the genes underlying resistance would increase our knowledge about M. pinodes-pea interaction and would facilitate the introgression of resistance into pea varieties. In the present study differentially expressed genes in the resistant P. sativum ssp. syriacum accession P665 comparing to the susceptible pea cv. Messire after inoculation with M. pinodes have been identified using a M. truncatula microarray. Of the 16,470 sequences analysed, 346 were differentially regulated. Differentially regulated genes belonged to almost all functional categories and included genes involved in defense such as genes involved in cell wall reinforcement, phenylpropanoid and phytoalexins metabolism, pathogenesis- related (PR) proteins and detoxification processes. Genes associated with jasmonic acid (JA) and ethylene signal transduction pathways were induced suggesting that the response to M. pinodes in pea is regulated via JA and ET pathways. Expression levels of ten differentially regulated genes were validated in inoculated and control plants using qRT-PCR showing that the P665 accession shows constitutively an increased expression of the defense related genes as peroxidases, disease resistance response protein 39 (DRR230-b), glutathione S-transferase (GST) and 6a-hydroxymaackiain methyltransferase. Through this study a global view of genes expressed during resistance to M. pinodes has been obtained, giving relevant information about the mechanisms and pathways conferring resistance to this important disease. In addition, the M. truncatula microarray represents an efficient tool to identify candidate genes controlling resistance to M

  7. Multiple antibiotic resistance genes distribution in ten large-scale membrane bioreactors for municipal wastewater treatment.

    Science.gov (United States)

    Sun, Yanmei; Shen, Yue-Xiao; Liang, Peng; Zhou, Jizhong; Yang, Yunfeng; Huang, Xia

    2016-12-01

    Wastewater treatment plants are thought to be potential reservoirs of antibiotic resistance genes. In this study, GeoChip was used for analyzing multiple antibiotic resistance genes, including four multidrug efflux system gene groups and three β-lactamase genes in ten large-scale membrane bioreactors (MBRs) for municipal wastewater treatment. Results revealed that the diversity of antibiotic genes varied a lot among MBRs, but about 40% common antibiotic resistance genes were existent. The average signal intensity of each antibiotic resistance group was similar among MBRs, nevertheless the total abundance of each group varied remarkably and the dominant resistance gene groups were different in individual MBR. The antibiotic resistance genes majorly derived from Proteobacteria and Actinobacteria. Further study indicated that TN, TP and COD of influent, temperature and conductivity of mixed liquor were significant (Pantibiotic resistance genes distribution in MBRs. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. Emergence of Plasmid-Borne dfrA14 Trimethoprim Resistance Gene in Shigella sonnei

    Directory of Open Access Journals (Sweden)

    ALFONSO MIRANDA

    2016-07-01

    Full Text Available The most common mechanism of trimethoprim (TMP-resistance is the acquisition of dihydrofolate reductase enzyme resistant to this drug. Previous molecular characterization of TMP-genes resistance in Chilean isolates of S. sonnei searching for dfrA1 and dfrA8, showed solely the presence of dfrA8 (formerly dhfrIIIc. However, these genetic markers were absent in S. sonnei strains further isolated during an outbreak in 2009. To identify the TMP-resistance gene in these strains, a genomic DNA library from a TMP-resistant (TMPR S. sonnei representative strain for the outbreak was used to clone, select and identify a TMP-resistance marker. The TMPR clone was sequenced by primer walking, identifying the presence of the dfrA14 gene in the sul2-strA’-dfrA14-‘strA-strB gene arrangement, harbored in a native 6,779-bp plasmid. The same plasmid was isolated by transforming with a ~4.2 MDa plasmid extracted from several TMPR S. sonnei strains into E. coli. This plasmid, named pABC-3, was present only in dfrA14-positive strains and was homologous to a previously described pCERC-1, but different due to the absence of an 11-bp repetitive unit. The distribution of dfrA1, dfrA8 and dfrA14 TMP-resistance genes was determined in 126 TMPR S. sonnei isolates. Most of the strains (96 % carried only one of the three TMP-resistance genes assessed. Thus, all strains obtained during the 2009-outbreak harbored only dfrA14, whereas, dfrA8 was the most abundant gene marker before outbreak and, after the outbreak dfrA1 seems have appeared in circulating strains. According to PFGE, dfrA14-positive strains were clustered in a genetically related group including some dfrA1- and dfrA8-positive strains; meanwhile other genetic group included most of the dfrA8-positive strains. This distribution also correlated with the isolation period, showing a dynamics of trimethoprim genetic markers prevalent in Chilean S. sonnei strains. To our knowledge, dfrA14 gene associated to a small

  9. Transcriptome analyses and virus induced gene silencing identify genes in the Rpp4-mediated Asian soybean rust resistance pathway

    Science.gov (United States)

    Rpp4 (Resistance to Phakopsora pachyrhizi 4) confers resistance to P. pachyrhizi, the causal agent of Asian soybean rust (ASR). By combining expression profiling and virus induced gene silencing (VIGS), we are developing a genetic framework for Rpp4-mediated resistance. We measured gene expression i...

  10. Fate and transport of antibiotic resistant bacteria and resistance genes in artificially drained agricultural fields receiving swine manure application

    Science.gov (United States)

    While previous studies have examined the occurrence of antibiotic resistant bacteria and antibiotic resistant genes around confined swine feeding operations, little information is known about their release and transport from artificially drained fields receiving swine manure application. Much of the...

  11. A novel resistance gene, lnu(H), conferring resistance to lincosamides in Riemerella anatipestifer CH-2.

    Science.gov (United States)

    Luo, Hong-Yan; Liu, Ma-Feng; Wang, Ming-Shu; Zhao, Xin-Xin; Jia, Ren-Yong; Chen, Shun; Sun, Kun-Feng; Yang, Qiao; Wu, Ying; Chen, Xiao-Yue; Biville, Francis; Zou, Yuan-Feng; Jing, Bo; Cheng, An-Chun; Zhu, De-Kang

    2018-01-01

    The Gram-negative bacterium Riemerella anatipestifer CH-2 is resistant to lincosamides, having a lincomycin (LCM) minimum inhibitory concentration (MIC) of 128 µg/mL. The G148_1775 gene of R. anatipestifer CH-2, designated lnu(H), encodes a 260-amino acid protein with ≤41% identity to other reported lincosamide nucleotidylyltransferases. Escherichia coli Rosetta TM (DE3) containing the pBAD24-lnu(H) plasmid showed four- and two-fold increases in the MICs of LCM and clindamycin (CLI), respectively. A kinetic assay of the purified Lnu(H) enzyme for LCM and CLI showed that the protein could inactive lincosamides. Mass spectrometry analysis demonstrated that the Lnu(H) enzyme catalysed adenylylation of lincosamides. In addition, an lnu(H) gene deletion strain exhibited 512- and 32-fold decreases in LCM and CLI MICs, respectively. The wild-type level of lincosamide resistance could be restored by complementation with a shuttle plasmid carrying the lnu(H) gene. The transformant R. anatipestifer ATCC 11845 [lnu(H)] acquired by natural transformation also exhibited high-level lincosamide resistance. Moreover, among 175 R. anatipestifer field isolates, 56 (32.0%) were positive for the lnu(H) gene by PCR. In conclusion, Lnu(H) is a novel lincosamide nucleotidylyltransferase that inactivates LCM and CLI by nucleotidylylation, thus conferring high-level lincosamide resistance to R. anatipestifer CH-2. Copyright © 2017. Published by Elsevier B.V.

  12. Spectrum of Resistance Conferred by ml-o Powdery Mildew Resistance Genes in Barley

    DEFF Research Database (Denmark)

    Jørgensen, Jørgen Helms

    1977-01-01

    /(4) in all tests. They were also resistant to field populations of the pathogen when scored in disease nurseries at more than 78 locations in 29 countries in Europe, the Near East, North and South America. New Zealand, and Japan. This indicates that the 11 genes confer the same, world-wide spectrum...

  13. Occurrence of antibiotic resistance and characterization of resistant genes and integrons in Enterobacteriaceae isolated from integrated fish farms south China

    Science.gov (United States)

    Su, Hao-Chang; Ying, Guang-Guo; Tao, Ran; Zhang, Rui-Quan; Fogarty, Lisa R.; Kolpin, Dana W.

    2011-01-01

    Antibiotics are still widely applied in animal husbandry to prevent diseases and used as feed additives to promote animal growth. This could result in antibiotic resistance to bacteria and antibiotic residues in animals. In this paper, Enterobacteriaceae isolated from four integrated fish farms in Zhongshan, South China were tested for antibiotic resistance, tetracycline resistance genes, sulfonamide resistance genes, and class 1 integrons. The Kirby-Bauer disk diffusion method and polymerase chain reaction (PCR) assays were carried out to test antibiotic susceptibility and resistance genes, respectively. Relatively high antibiotic resistance frequencies were found, especially for ampicillin (80%), tetracycline (52%), and trimethoprim (50%). Out of 203 Enterobacteriaceae isolates, 98.5% were resistant to one or more antibiotics tested. Multiple antibiotic resistance (MAR) was found highest in animal manures with a MAR index of 0.56. Tetracycline resistance genes (tet(A), tet(C)) and sulfonamide resistance genes (sul2) were detected in more than 50% of the isolates. The intI1 gene was found in 170 isolates (83.7%). Both classic and non-classic class 1 integrons were found. Four genes, aadA5, aadA22, dfr2, and dfrA17, were detected. To our knowledge, this is the first report for molecular characterization of antibiotic resistance genes in Enterobacteriaceae isolated from integrated fish farms in China and the first time that gene cassette array dfrA17-aadA5 has been detected in such fish farms. Results of this study indicated that fish farms may be a reservoir of highly diverse and abundant antibiotic resistant genes and gene cassettes. Integrons may play a key role in multiple antibiotic resistances posing potential health risks to the general public and aquaculture.

  14. Antibiotic resistance genes and residual antimicrobials in cattle feedlot surface soil

    Science.gov (United States)

    Antibiotic residues and resistant bacteria in cattle feedlot manure may impact antibiotic resistance in the environment. This study investigated common antimicrobials (tetracyclines and monensin) and associated resistance genes in cattle feedlot soils over time. Animal diets and other feedlot soil...

  15. Characterization of Aminoglycoside Resistance and Virulence Genes among Enterococcus spp. Isolated from a Hospital in China

    Directory of Open Access Journals (Sweden)

    Wanxiang Li

    2015-03-01

    Full Text Available This study investigated the aminoglycoside resistance phenotypes and genotypes, as well as the prevalence of virulence genes, in Enterococcus species isolated from clinical patients in China. A total of 160 enterococcal isolates from various clinical samples collected from September 2013 to July 2014 were identified to the species level using the VITEK-2 COMPACT system. The antimicrobial susceptibilities of the identified Enterococcus strains were determined by the Kirby-Bauer (K-B disc diffusion method. PCR-based assays were used to detect the aminoglycoside resistance and virulence genes in all enterococcal isolates. Of 160 Enterococcus isolates, 105 were identified as E. faecium, 35 as E. faecalis, and 20 isolates were classified as “other” Enterococcus species. High-level aminoglycoside resistance (HLAR for gentamicin, streptomycin, and both antibiotics was identified in 58.8, 50, and 34.4% of strains, respectively. The most common virulence gene (50.6% of isolates was efaA, followed by asa1 (28.8%. The most prevalent aminoglycoside resistance genes were aac(6'-Ie-aph(2'', aph(2'-Id, aph(3'-IIIa, and ant(6'-Ia, present in 49.4%, 1.3%, 48.8% and 31.3% of strains, respectively. Overall, E. faecium and E. faecalis were most frequently associated with hospital-acquired enterococcal infections in Zhejiang Province. All aminoglycoside resistance genes, except aph(2''-Id, were significantly more prevalent in HLAR strains than amongst high level aminoglycoside susceptible (HLAS strains, while there was no significant difference between HLAR and HLAS strains in regard to the prevalence of virulence genes, apart from esp, therefore, measures should be taken to manage infections caused by multi-drug resistant Enterococcus species.

  16. Characterization of Aminoglycoside Resistance and Virulence Genes among Enterococcus spp. Isolated from a Hospital in China

    Science.gov (United States)

    Li, Wanxiang; Li, Jing; Wei, Quhao; Hu, Qingfeng; Lin, Xiaowei; Chen, Mengquan; Ye, Renji; Lv, Huoyang

    2015-01-01

    This study investigated the aminoglycoside resistance phenotypes and genotypes, as well as the prevalence of virulence genes, in Enterococcus species isolated from clinical patients in China. A total of 160 enterococcal isolates from various clinical samples collected from September 2013 to July 2014 were identified to the species level using the VITEK-2 COMPACT system. The antimicrobial susceptibilities of the identified Enterococcus strains were determined by the Kirby-Bauer (K-B) disc diffusion method. PCR-based assays were used to detect the aminoglycoside resistance and virulence genes in all enterococcal isolates. Of 160 Enterococcus isolates, 105 were identified as E. faecium, 35 as E. faecalis, and 20 isolates were classified as “other” Enterococcus species. High-level aminoglycoside resistance (HLAR) for gentamicin, streptomycin, and both antibiotics was identified in 58.8, 50, and 34.4% of strains, respectively. The most common virulence gene (50.6% of isolates) was efaA, followed by asa1 (28.8%). The most prevalent aminoglycoside resistance genes were aac(6')-Ie-aph(2''), aph(2')-Id, aph(3')-IIIa, and ant(6')-Ia, present in 49.4%, 1.3%, 48.8% and 31.3% of strains, respectively. Overall, E. faecium and E. faecalis were most frequently associated with hospital-acquired enterococcal infections in Zhejiang Province. All aminoglycoside resistance genes, except aph(2'')-Id, were significantly more prevalent in HLAR strains than amongst high level aminoglycoside susceptible (HLAS) strains, while there was no significant difference between HLAR and HLAS strains in regard to the prevalence of virulence genes, apart from esp, therefore, measures should be taken to manage infections caused by multi-drug resistant Enterococcus species. PMID:25768240

  17. Transport of tylosin and tylosin-resistance genes in subsurface drainage water from manured fields

    Science.gov (United States)

    Animal agriculture appears to contribute to the spread of antibiotic resistance genes, but few studies have quantified gene transport in agricultural fields. The transport of tylosin, tylosin-resistance genes (erm B, F, A) and tylosin-resistant Enterococcus were measured in tile drainage water from ...

  18. Antimicrobial susceptibility and occurrence of resistance genes among Salmonella enterica serovar Weltevreden from different countries

    DEFF Research Database (Denmark)

    Aarestrup, Frank Møller; Lertworapreecha, M.; Evans, M.C.

    2003-01-01

    and gentamicin. All nine ampicillin-resistant isolates contained a sequence similar to the bla(TEM-1b) gene, one of the eight chloramphenicol-resistant isolates a sequence similar to the catA1 gene, all three neomycin-resistant isolates a sequence similar to the aphA-2 gene, 16 (73%) of the 22 streptomycin...

  19. Heavy metal and disinfectant resistance genes among livestock-associated methicillin-resistant Staphylococcus aureus isolates

    DEFF Research Database (Denmark)

    Argudin, Maria Angeles; Lauzat, Birgit; Kraushaar, Britta

    2016-01-01

    substances with antimicrobial activity applied in animal feed, including metal-containing compounds might contribute to their selection. Some of these genes have been found in various novel SCCmec cassettes. The aim of this study was to assess the occurrence of metal-resistance genes among a LA-S. aureus...... collection [n = 554, including 542 MRSA and 12 methicillin-susceptible S. aureus (MSSA)] isolated from livestock and food thereof. Most LA-MRSA isolates (76%) carried at least one metal-resistance gene. Among the LA-MRSA CC398 isolates (n = 456), 4.8%, 0.2%, 24.3% and 71.5% were positive for arsA (arsenic......, 72% carried one metal-resistance gene, and the remaining harboured two or more in different combinations. Differences between LA-MRSA CC398 and non-CC398 were statistically significant for arsA and czrC. The czrC gene was almost exclusively found (98%) in the presence of SCCmec V in both CC398...

  20. Resistance of Antimicrobial Peptide Gene Transgenic Rice to Bacterial Blight

    Directory of Open Access Journals (Sweden)

    Wei WANG

    2011-03-01

    Full Text Available Antimicrobial peptide is a polypeptide with antimicrobial activity. Antimicrobial peptide genes Np3 and Np5 from Chinese shrimp (Fenneropenaeus Chinensis were integrated into Oryza sativa L. subsp. japonica cv. Aichi ashahi by Agrobacterium mediated transformation system. PCR analysis showed that the positive ratios of Np3 and Np5 were 36% and 45% in T0 generation, respectively. RT-PCR analysis showed that the antimicrobial peptide genes were expressed in T1 generation, and there was no obvious difference in agronomic traits between transgenic plants and non-transgenic plants. Four Np3 and Np5 transgenic lines in T1 generation were inoculated with Xanthomonas oryzae pv. oryzae strain CR4, and all the four transgenic lines had significantly enhanced resistance to bacterial blight caused by the strain CR4. The Np5 transgenic lines also showed higher resistance to bacterial blight caused by strains JS97-2, Zhe 173 and OS-225. It is suggested that transgenic lines with Np5 gene might possess broad spectrum resistance to rice bacterial blight.

  1. Genotypes, Virulence Factors and Antimicrobial Resistance Genes of Staphylococcus aureus Isolated in Bovine Subclinical Mastitis from Eastern China

    Directory of Open Access Journals (Sweden)

    Javed Memon§, Yongchun Yang§, Jam Kashifa, Muhammad Yaqoob, Rehana Buriroa, Jamila Soomroa, Wang Liping and Fan Hongjie*

    2013-11-01

    Full Text Available This study was carried out to determine the genotypes, virulence factors and antimicrobial resistance traits of 34 Staphylococcus aureus isolated from subclinical mastitis in Eastern China. Minimal inhibitory concentration (MIC results showed resistance to erythromycin in all isolates. A high frequency of Methicillin resistant S. aureus (MRSA; 29% was observed and these isolates were also highly resistant to penicillin, oxacillin, oxytetracycline and chloramphenicol than methicillin sensitive S. aureus (MSSA isolates. Thirteen pathogenic factors and seven resistance genes including mecA and blaZ gene were checked through PCR. The spaX gene was found in all isolates, whereas cna, spaIg, nuc, clfA, fnbpB, hlA, hlB and seA were present in 35, 79, 85, 59, 35, 85, 71 and 38% isolates, respectively. Nine isolates carried a group of 8 different virulence genes. Moreover, macrolide resistance genes ermB and ermC were present in all isolates. High resistance rate against methicillin was found but no isolate was positive for mecA gene, whereas blaZ and tetK were detected in 82 and 56% isolates, respectively. Genes; fnbpA, seB, seC, seD, dfrK and tetM were not found in any isolate. The statistical association between phenotypic resistance and virulence genes showed, clfA, fnbpB, hlB and seA, were potentially associated with penicillin G, ciprofloxacin, methicillin, chloramphenicol, trimethoprim and oxytetracycline resistance (P≤0.05. REP-PCR based genotyping showed seven distinct genotypes (A-G prevalent in this region. This study reports the presence of multidrug resistant S. aureus in sub-clinical mastitis which were also highly virulent that could be a major obstacle in the treatment of mastitis in this region of China.

  2. Identification of Gene Resistance to Avian InfluenzaVirus (Mx Gene among Wild Waterbirds

    Directory of Open Access Journals (Sweden)

    Dewi Elfidasari

    2013-04-01

    Full Text Available The Mx gene is an antiviral gene used to determine the resistance or the susceptibility to different types of viruses, including the Avian Influenza (AI virus subtype H5N1. The AI virus subtype H5N1 infection in chickens causes Mx gene polymorphism. The Mx+ gene shows resistant to the AIvirus subtype H5N1, whereas the Mx-gene shows signs of susceptible. The objective of thisresearch was to detect the Mxgene in wild aquatic birds using the Polymerase Chain Reaction Restriction Fragment Length Polymorphism (PCR-RFLP method with the primer pairs F2 and NE-R2/R and the RsaI restriction enzyme. DNA samples were obtained from eight species of wild waterbirds with positive and negative exposure to the AI virus subtype H5N1. DNA amplification results showed that the Mxgene in wild aquatic birds is found in a 100 bp fragment, which is the same as the Mx gene found in chickens. However, unlike chickens, the Mxgene in wild aquatic birds did not show any polymorphism. This study proves that Mx- based resistance to AI virus subtype H5N1 in different in wild birds than in chickens.

  3. Antibiotic treatments of a methicillin-resistant Staphylococcus pseudintermedius infection in a dog: a case presentation.

    Science.gov (United States)

    Decristophoris, P; Mauri, F; Albanese, F; Carnelli, A; Vanzetti, T; Zinsstag, J

    2011-09-01

    We report the antibiotic treatments administered to a female dog with mastitis and successive pyoderma. Microbiological investigations allowed the identification of Staphylococcus pseudintermedius after 54 days of various antibiotic treatments. The isolate carried the mecA gene and was resistant to 9 of 15 tested antibiotics. Consistent antibiotic treatment of the infection was possible only after accurate microbiological diagnosis.

  4. Evolutionarily Dynamic, but Robust, Targeting of Resistance Genes by the miR482/2118 Gene Family in the Solanaceae.

    Science.gov (United States)

    de Vries, Sophie; Kloesges, Thorsten; Rose, Laura E

    2015-11-19

    Plants are exposed to pathogens around the clock. A common resistance response in plants upon pathogen detection is localized cell death. Given the irreversible nature of this response, multiple layers of negative regulation are present to prevent the untimely or misexpression of resistance genes. One layer of negative regulation is provided by a recently discovered microRNA (miRNA) gene family, miR482/2118. This family targets the transcripts of resistance genes in plants. We investigated the evolutionary history and specificity of this miRNA gene family within the Solanaceae. This plant family includes many important crop species, providing a set of well-defined resistance gene repertoires. Across 14 species from the Solanaceae, we identified eight distinct miR482/2118 gene family members. Our studies show conservation of miRNA type and number in the group of wild tomatoes and, to a lesser extent, throughout the Solanaceae. The eight orthologous miRNA gene clusters evolved under different evolutionary constraints, allowing for individual subfunctionalization of the miRNAs. Despite differences in the predicted targeting behavior of each miRNA, the miRNA-R-gene network is robust due to its high degree of interconnectivity and redundant targeting. Our data suggest that the miR482/2118 gene family acts as an evolutionary buffer for R-gene sequence diversity. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  5. The Occurrence of the Colistin Resistance Gene mcr-1 in the Haihe River (China

    Directory of Open Access Journals (Sweden)

    Dong Yang

    2017-05-01

    Full Text Available Antibiotic failure is occurring worldwide. In a routine surveillance study on antibioticresistance genes (ARGs in natural water bodies, we noted the detection of colistin-resistance gene mcr-1, previously identified in Escherichia coli and Klebsiella pneumoniae isolates from human beings and animals in several countries. The mcr-1 gene might be present in water environments, because aquatic ecosystems are recognized as reservoirs for antibiotic resistant bacteria (ARB and ARGs. In this study, a qPCR assay was developed to monitor and quantify the mcr-1 gene in the Haihe River, China. The results showed that all 18 samples collected from different locations over 6 months along the Haihe River were positive for the mcr-1 gene, and the highest level of mcr-1 reached 3.81 × 105 gene copies (GC per liter of water. This is the first study to quantify mcr-1 in a natural water system by qPCR. Our findings highlight the potential for this antibiotic resistance determinant to spread extensively, suggesting a significant health and ecological impact.

  6. Targeted next-generation sequencing identification of mutations in disease resistance gene anologs (RGAs) in wild and cultivated beets

    Science.gov (United States)

    Resistance gene analogs (RGAs) were searched bioinformatically in the sugar beet (Beta vulgaris L.) genome as potential candidates for improving resistance against different diseases. In the present study, Ion Torrent sequencing technology was used to identify mutations in 21 RGAs. The DNA samples o...

  7. A double EPSPS gene mutation endowing glyphosate resistance shows a remarkably high resistance cost.

    Science.gov (United States)

    Han, Heping; Vila-Aiub, Martin M; Jalaludin, Adam; Yu, Qin; Powles, Stephen B

    2017-12-01

    A novel glyphosate resistance double point mutation (T102I/P106S, TIPS) in the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene has been recently identified for the first time only in the weed species Eleusine indica. Quantification of plant resistance cost associated with the TIPS and the often reported glyphosate resistance single P106S mutation was performed. A significant resistance cost (50% in seed number currency) associated with the homozygous TIPS but not the homozygous P106S EPSPS variant was identified in E. indica plants. The resistance cost associated with the TIPS mutation escalated to 85% in plants under resource competition with rice crops. The resistance cost was not detected in nonhomozygous TIPS plants denoting the recessive nature of the cost associated with the TIPS allele. An excess of 11-fold more shikimate and sixfold more quinate in the shikimate pathway was detected in TIPS plants in the absence of glyphosate treatment compared to wild type, whereas no changes in these compounds were observed in P106S plants when compared to wild type. TIPS plants show altered metabolite levels in several other metabolic pathways that may account for the expression of the observed resistance cost. © 2017 John Wiley & Sons Ltd.

  8. Resistance gene homologues in melon are linked to genetic loci conferring disease and pest resistance.

    Science.gov (United States)

    Brotman, Y.; Silberstein, L.; Kovalski, I.; Perin, C.; Dogimont, C.; Pitrat, M.; Klingler, J.; Thompson, A.; Perl-Treves, R.

    2002-05-01

    Genomic and cDNA fragments with homology to known disease resistance genes (RGH fragments) were cloned from Cucumis melo using degenerate-primer PCR. Fifteen homologues of the NBS-LRR gene family have been isolated. The NBS-LRR homologues show high divergence and, based on the partial NBS-fragment sequences, appear to include members of the two major subfamilies that have been described in dicot plants, one that possesses a TIR-protein element and one that lacks such a domain. Genomic organization of these sequences was explored by DNA gel-blot analysis, and conservation among other Cucurbitaceae was assessed. Two mapping populations that segregate for several disease and pest resistance loci were used to map the RGH probes onto the melon genetic map. Several NBS-LRR related sequences mapped to the vicinity of genetic loci that control resistance to papaya ringspot virus, Fusarium oxysporum race 1, F. oxysporum race 2 and to the insect pest Aphis gossypii. The utility of such markers for breeding resistant melon cultivars and for cloning the respective R-genes is discussed.

  9. The occurrence of antibiotic resistance genes in tap water - a review

    Science.gov (United States)

    Siedlecka, Agata

    2018-02-01

    The study presents a review of the occurrence of genetic determinants of antibiotic resistance in tap water. The aim of this study was also to compare the applied methods for antibiotic resistance genes (ARGs) investigations in tap water. As the concentration of ARGs in treated, drinking water is expected to be very low and may cause problems in a standard isolation procedure, the special emphasis is placed on the applied procedures of DNA extraction and their efficiency. The study presents the first attempts to obtain DNA directly from tap water. Further efforts must be put to determine the final amount of obtained DNA and the presence of chosen ARGs among the molecules.

  10. Controversy Associated With the Common Component of Most Transgenic Plants – Kanamycin Resistance Marker Gene

    Directory of Open Access Journals (Sweden)

    Srećko Jelenić

    2003-01-01

    Full Text Available Plant genetic engineering is a powerful tool for producing crops resistant to pests, diseases and abiotic stress or crops with improved nutritional value or better quality products. Currently over 70 genetically modified (GM crops have been approved for use in different countries. These cover a wide range of plant species with significant number of different modified traits. However, beside the technology used for their improvement, the common component of most GM crops is the neomycin phosphotransferase II gene (nptII, which confers resistance to the antibiotics kanamycin and neomycin. The nptII gene is present in GM crops as a marker gene to select transformed plant cells during the first steps of the transformation process. The use of antibiotic-resistance genes is subject to controversy and intense debate, because of the likelihood that clinical therapy could be compromised due to inactivation of the oral dose of the antibiotic from consumption of food derived from the transgenic plant, and because of the risk of gene transfer from plants to gut and soil microorganisms or to consumer’s cells. The present article discusses these possibilities in the light of current scientific knowledge.

  11. A Novel Phytophthora sojae Resistance Rps12 Gene Mapped to a Genomic Region That Contains Several Rps Genes.

    Science.gov (United States)

    Sahoo, Dipak K; Abeysekara, Nilwala S; Cianzio, Silvia R; Robertson, Alison E; Bhattacharyya, Madan K

    2017-01-01

    Phytophthora sojae Kaufmann and Gerdemann, which causes Phytophthora root rot, is a widespread pathogen that limits soybean production worldwide. Development of Phytophthora resistant cultivars carrying Phytophthora resistance Rps genes is a cost-effective approach in controlling this disease. For this mapping study of a novel Rps gene, 290 recombinant inbred lines (RILs) (F7 families) were developed by crossing the P. sojae resistant cultivar PI399036 with the P. sojae susceptible AR2 line, and were phenotyped for responses to a mixture of three P. sojae isolates that overcome most of the known Rps genes. Of these 290 RILs, 130 were homozygous resistant, 12 heterzygous and segregating for Phytophthora resistance, and 148 were recessive homozygous and susceptible. From this population, 59 RILs homozygous for Phytophthora sojae resistance and 61 susceptible to a mixture of P. sojae isolates R17 and Val12-11 or P7074 that overcome resistance encoded by known Rps genes mapped to Chromosome 18 were selected for mapping novel Rps gene. A single gene accounted for the 1:1 segregation of resistance and susceptibility among the RILs. The gene encoding the Phytophthora resistance mapped to a 5.8 cM interval between the SSR markers BARCSOYSSR_18_1840 and Sat_064 located in the lower arm of Chromosome 18. The gene is mapped 2.2 cM proximal to the NBSRps4/6-like sequence that was reported to co-segregate with the Phytophthora resistance genes Rps4 and Rps6. The gene is mapped to a highly recombinogenic, gene-rich genomic region carrying several nucleotide binding site-leucine rich repeat (NBS-LRR)-like genes. We named this novel gene as Rps12, which is expected to be an invaluable resource in breeding soybeans for Phytophthora resistance.

  12. A Novel Phytophthora sojae Resistance Rps12 Gene Mapped to a Genomic Region That Contains Several Rps Genes.

    Directory of Open Access Journals (Sweden)

    Dipak K Sahoo

    Full Text Available Phytophthora sojae Kaufmann and Gerdemann, which causes Phytophthora root rot, is a widespread pathogen that limits soybean production worldwide. Development of Phytophthora resistant cultivars carrying Phytophthora resistance Rps genes is a cost-effective approach in controlling this disease. For this mapping study of a novel Rps gene, 290 recombinant inbred lines (RILs (F7 families were developed by crossing the P. sojae resistant cultivar PI399036 with the P. sojae susceptible AR2 line, and were phenotyped for responses to a mixture of three P. sojae isolates that overcome most of the known Rps genes. Of these 290 RILs, 130 were homozygous resistant, 12 heterzygous and segregating for Phytophthora resistance, and 148 were recessive homozygous and susceptible. From this population, 59 RILs homozygous for Phytophthora sojae resistance and 61 susceptible to a mixture of P. sojae isolates R17 and Val12-11 or P7074 that overcome resistance encoded by known Rps genes mapped to Chromosome 18 were selected for mapping novel Rps gene. A single gene accounted for the 1:1 segregation of resistance and susceptibility among the RILs. The gene encoding the Phytophthora resistance mapped to a 5.8 cM interval between the SSR markers BARCSOYSSR_18_1840 and Sat_064 located in the lower arm of Chromosome 18. The gene is mapped 2.2 cM proximal to the NBSRps4/6-like sequence that was reported to co-segregate with the Phytophthora resistance genes Rps4 and Rps6. The gene is mapped to a highly recombinogenic, gene-rich genomic region carrying several nucleotide binding site-leucine rich repeat (NBS-LRR-like genes. We named this novel gene as Rps12, which is expected to be an invaluable resource in breeding soybeans for Phytophthora resistance.

  13. [State-of-the-art status on airborne antibiotic resistant bacteria and antibiotic resistance genes].

    Science.gov (United States)

    Li, J; Yao, M S

    2018-04-06

    The world is facing more deaths due to increasing antibiotic-resistant bacterial infections and the shortage of new highly effective antibiotics, however the air media as its important transmission route has not been adequately studied. Based on the latest literature acquired in this work, we have discussed the state-of-the-art research progress of the concentration, distribution and spread of antibiotic resistant bacteria (ARB) and antibiotic resistance genes (ARGs) in different environmental air media, and also analyzed some future prevention and control measures. The large use of antibiotics in the medical settings and animal husbandry places has resulted in higher abundances of ARB and ARGs in the relevant and surrounding atmosphere than in urban and general indoor air environments. ARGs can be spread by adhering to airborne particles, and researchers have also found that air media contain more abundant ARGs than other environmental media such as soil, water and sediment. It was suggested in this review that strengthening the monitoring, study on spreading factors and biological toxicity, and also research and development on pathogen accurate diagnosis and new green antibiotic are expected to help effectively monitor, prevent and control of the impacts of airborne resistant bacteria and resistance genes on both human and ecologies.

  14. Study on drug resistance of mycobacterium tuberculosis in patients with pulmonary tuberculosis by drug resistance gene detecting

    International Nuclear Information System (INIS)

    Wang Wei; Li Hongmin; Wu Xueqiong; Wang Ansheng; Ye Yixiu; Wang Zhongyuan; Liu Jinwei; Chen Hongbing; Lin Minggui; Wang Jinhe; Li Sumei; Jiang Ping; Feng Bai; Chen Dongjing

    2004-01-01

    To investigate drug resistance of mycobacterium tuberculosis in different age group, compare detecting effect of two methods and evaluate their the clinical application value, all of the strains of mycobacterium tuberculosis were tested for resistance to RFP, INH SM PZA and EMB by the absolute concentration method on Lowenstein-Jensen medium and the mutation of the rpoB, katG, rpsL, pncA and embB resistance genes in M. tuberculosis was tested by PCR-SSCP. In youth, middle and old age group, the rate of acquired drug resistance was 89.2%, 85.3% and 67.6% respectively, the gene mutation rate was 76.2%, 81.3% and 63.2% respectively. The rate of acquired drug resistance and multiple drug resistance in youth group was much higher than those in other groups. The gene mutation was correlated with drug resistance level of mycobacterium tuberculosis. The gene mutation rate was higher in strains isolated from high concentration resistance than those in strains isolated from low concentration resistance. The more irregular treatment was longer, the rate of drug resistance was higher. Acquired drug resistance varies in different age group. It suggested that surveillance of drug resistence in different age group should be taken seriously, especially in youth group. PCR - SSCP is a sensitive and specific method for rapid detecting rpoB, katG, rpsL, pncA and embB genes mutations of MTB. (authors)

  15. Evolution by Pervasive Gene Fusion in Antibiotic Resistance and Antibiotic Synthesizing Genes

    Directory of Open Access Journals (Sweden)

    Orla Coleman

    2015-03-01

    Full Text Available Phylogenetic (tree-based approaches to understanding evolutionary history are unable to incorporate convergent evolutionary events where two genes merge into one. In this study, as exemplars of what can be achieved when a tree is not assumed a priori, we have analysed the evolutionary histories of polyketide synthase genes and antibiotic resistance genes and have shown that their history is replete with convergent events as well as divergent events. We demonstrate that the overall histories of these genes more closely resembles the remodelling that might be seen with the children’s toy Lego, than the standard model of the phylogenetic tree. This work demonstrates further that genes can act as public goods, available for re-use and incorporation into other genetic goods.

  16. Overexpression of a Chitinase Gene from Trichoderma asperellum Increases Disease Resistance in Transgenic Soybean.

    Science.gov (United States)

    Zhang, Fuli; Ruan, Xianle; Wang, Xian; Liu, Zhihua; Hu, Lizong; Li, Chengwei

    2016-12-01

    In the present study, a chi gene from Trichoderma asperellum, designated Tachi, was cloned and functionally characterized in soybean. Firstly, the effects of sodium thiosulfate on soybean Agrobacterium-mediated genetic transformation with embryonic tip regeneration system were investigated. The transformation frequency was improved by adding sodium thiosulfate in co-culture medium for three soybean genotypes. Transgenic soybean plants with constitutive expression of Tachi showed increased resistance to Sclerotinia sclerotiorum compared to WT plants. Meanwhile, overexpression of Tachi in soybean exhibited increased reactive oxygen species (ROS) level as well as peroxidase (POD) and catalase (SOD) activities, decreased malondialdehyde (MDA) content, along with diminished electrolytic leakage rate after S. sclerotiorum inoculation. These results suggest that Tachi can improve disease resistance in plants by enhancing ROS accumulation and activities of ROS scavenging enzymes and then diminishing cell death. Therefore, Tachi represents a candidate gene with potential application for increasing disease resistance in plants.

  17. DNA tagging of blast resistant gene(s in three Brazilian rice cultivars

    Directory of Open Access Journals (Sweden)

    S.S. Sandhu

    2003-12-01

    Full Text Available Rice blast is the most important fungal disease of rice and is caused by Pyricularia oryzae Sacc. (Telomorph Magnoporthe grisea Barr.. Seven randomly amplified polymorphic DNA (RAPD markers OPA5, OPG17, OPG18, OPG19, OPF9, OPF17 and OPF19 showed very clear polymorphism in resistant cultivar lines which differed from susceptible lines. By comparing different susceptible lines, nine DNA amplifications of seven primers (OPA5(1000, OPA5(1200, OPG17(700, OPG18(850, OPG19(500, OPG19(600, OPF9(600, OPF17(1200 and OPF19(600 were identified as dominant markers for the blast resistant gene in resistant cultivar lines. These loci facilitate the indirect scoring of blast resistant and blast susceptible genotypes. The codomine RAPDs markers will facilitate marker-assisted selection of the blast resistant gene in two blast resistant genotypes of rice (Labelle and Line 11 and will be useful in rice breeding programs.

  18. Development of Gene-Pyramid Lines of the Elite Restorer Line, RPHR-1005 Possessing Durable Bacterial Blight and Blast Resistance.

    Science.gov (United States)

    Abhilash Kumar, V; Balachiranjeevi, C H; Bhaskar Naik, S; Rambabu, R; Rekha, G; Harika, G; Hajira, S K; Pranathi, K; Anila, M; Kousik, M; Vijay Kumar, S; Yugander, A; Aruna, J; Dilip Kumar, T; Vijaya Sudhakara Rao, K; Hari Prasad, A S; Madhav, M S; Laha, G S; Balachandran, S M; Prasad, M S; Viraktamath, B C; Ravindra Babu, V; Sundaram, R M

    2016-01-01

    RPHR-1005, the stable restorer line of the popular medium slender (MS) grain type rice hybrid, DRRH-3 was improved in this study for resistance against bacterial blight (BB) and blast diseases through marker-assisted backcross breeding (MABB). In this study, four major resistance genes (i.e., Xa21 and Xa33 for BB resistance and Pi2 and Pi54 for blast resistance) have been transferred to RPHR-1005 using RPBio Patho-1 (possessing Xa21 + Pi2), RPBio Patho-2 (possessing Xa21 + Pi54) and FBR1-15EM (possessing Xa33) as the donors. Foreground selection was carried out using PCR-based molecular markers specific for the target resistance genes and the major fertility restorer genes, Rf3 and Rf4, while background selection was carried out using a set of parental polymorphic rice SSR markers and backcrossing was continued uptoBC2 generation. At BC2F2, plants possessing the gene combination- Xa21 + Pi2, Xa21 + Pi54 and Xa33 in homozygous condition and with >92% recovery of the recurrent parent genome (RPG) were identified and intercrossed to combine all the four resistance genes. Twenty-two homozygous, pyramid lines of RPHR-1005 comprising of three single-gene containing lines, six 2-gene containing lines, eight 3-gene containing lines, and five 4-gene containing lines were identified among the double intercross lines at F3 generation (DICF3). They were then evaluated for their resistance against BB and blast, fertility restoration ability and for key agro-morphological traits. While single gene containing lines were resistant to either BB or blast, the 2-gene, 3-gene, and 4-gene pyramid lines showed good level of resistance against both and/or either of the two diseases. Most of the 2-gene, 3-gene, and 4-gene containing pyramid lines showed yield levels and other key agro-morphological and grain quality traits comparable to the original recurrent parent and showed complete fertility restoration ability, with a few showing higher yield as compared to RPHR-1005. Further, the

  19. vanA Gene Harboring Enterococcal and Non-enterococcal Isolates Expressing High Level Vancomycin and Teicoplanin Resistance Reservoired in Surface Waters.

    Science.gov (United States)

    Nakipoğlu, Mustafa; Yilmaz, Fadime; Icgen, Bulent

    2017-05-01

    Untreated wastewaters and treated effluents even after final disinfection contain antibiotic resistant bacteria and resistance genes before they are released into surface waters. A correlation between resistant bacteria and antibiotics in surface waters has been found, as have antibiotic resistance genes. Of particular interest are vancomycin-resistant enterococci harboring vanA gene that confers high level of resistance to glycopeptide antibiotics including teicoplanin. Therefore, in this study, river water samples were analysed to investigate vancomycin- and teicoplanin-resistant bacterial isolates harboring vanA gene. Out of 290, 15 surface water isolates displayed resistance to both antibiotics. These glycopeptide resistant enterococcal and non-enterococcal isolates, identified by 16S rRNA sequencing, were found to harbor vanA gene with sequence similarities of 50 % to 100 %. The presence of D-alanine-D-lactate ligase encoded by vanA gene was also shown for all vancomycin- and teicoplanin-resistant isolates through western blot analysis. Due to reuse of treated wastewater and release of untreated wastewaters to water bodies, antibiotic resistant bacteria and resistance genes are being introduced into surface waters and present human health risks. Therefore, surface waters are not only hot spots for vanA harboring enterococcal isolates but also non-enterococcal isolates due to gene dissemination and require special scientific consideration.

  20. Occurrence of the mcr-1 Colistin Resistance Gene and other Clinically Relevant Antibiotic Resistance Genes in Microbial Populations at Different Municipal Wastewater Treatment Plants in Germany

    Directory of Open Access Journals (Sweden)

    Norman Hembach

    2017-07-01

    Full Text Available Seven wastewater treatment plants (WWTPs with different population equivalents and catchment areas were screened for the prevalence of the colistin resistance gene mcr-1 mediating resistance against last resort antibiotic polymyxin E. The abundance of the plasmid-associated mcr-1 gene in total microbial populations during water treatment processes was quantitatively analyzed by qPCR analyses. The presence of the colistin resistance gene was documented for all of the influent wastewater samples of the seven WWTPs. In some cases the mcr-1 resistance gene was also detected in effluent samples of the WWTPs after conventional treatment reaching the aquatic environment. In addition to the occurrence of mcr-1 gene, CTX-M-32, blaTEM, CTX-M, tetM, CMY-2, and ermB genes coding for clinically relevant antibiotic resistances were quantified in higher abundances in all WWTPs effluents. In parallel, the abundances of Acinetobacter baumannii, Klebsiella pneumoniae, and Escherichia coli were quantified via qPCR using specific taxonomic gene markers which were detected in all influent and effluent wastewaters in significant densities. Hence, opportunistic pathogens and clinically relevant antibiotic resistance genes in wastewaters of the analyzed WWTPs bear a risk of dissemination to the aquatic environment. Since many of the antibiotic resistance gene are associated with mobile genetic elements horizontal gene transfer during wastewater treatment can't be excluded.

  1. Conservation and Dispersion of Genes Conferring Resistance to Tomato Begomoviruses between Tomato and Pepper Genomes

    Directory of Open Access Journals (Sweden)

    Manisha Mangal

    2017-11-01

    Full Text Available In the present climate change scenario, controlling plant disease through exploitation of host plant resistance could contribute toward the sustainable crop production and global food security. In this respect, the identification of new sources of resistance and utilization of genetic diversity within the species may help in the generation of cultivars with improved disease resistance. Begomoviruses namely, Tomato yellow leaf curl virus (TYLCV and Chilli leaf curl virus (ChLCV are known to cause major yield losses in several economically important crop plants of the family Solanaceae. Though co-occurrence, association and synergistic interactions among these viruses in the host plants is reported, whether orthologous genetic loci in related host plants could be responsible for conferring resistance to these viruses has not been investigated yet. Several loci including Ty1, Ty2, Ty3, Ty4, and ty5 have been reported to confer resistance to leaf curl viruses in tomato. Here, we examined the pepper orthologous markers, corresponding to these QTL regions, for polymorphism between ChLCV susceptible and resistant genotypes of pepper. Further, to examine if the polymorphic markers are segregating with the disease resistance, Bulk Segregant Analysis (BSA was performed on F2 population derived from crosses between resistant and susceptible lines. However, none of the markers showed polymorphism in BSA suggesting that the tested markers are not linked to genes/QTLs responsible for conferring resistance to ChLCV in the selected genotypes. In silico analysis was performed to study the synteny and collinearity of genes located within these QTL regions in tomato and pepper genomes, which revealed that more than 60% genes located in Ty2 and Ty4, 13.71% genes in Ty1, 23.07% in Ty3, and 44.77% genes located within ty5 QTL region in tomato are conserved in pepper genome. However, despite such a high conservation in gene content, the linkage relationship in these

  2. Unique Structural Modifications Are Present in the Lipopolysaccharide from Colistin-Resistant Strains of Acinetobacter baumannii

    Science.gov (United States)

    2013-10-01

    SECURITY CLASSIFICATION OF: Acinetobacter baumannii is a nosocomial opportunistic pathogen that can cause severe infections, including hospital-acquired...distribution is unlimited. Unique Structural Modifications Are Present in the Lipopolysaccharide from Colistin-Resistant Strains of Acinetobacter baumannii ...from Colistin-Resistant Strains of Acinetobacter baumannii Report Title Acinetobacter baumannii is a nosocomial opportunistic pathogen that can cause

  3. Characterization of resistance genes to rice blast fungus Magnaporthe oryzae in a “Green Revolution” rice variety

    Science.gov (United States)

    The indica rice variety Dee Geo Woo Gen (DGWG) was the source of the semi-dwarf gene (SD1) which played an important role in the Green Revolution. In the present study, resistance (R) genes to the U.S. race (isolate) IB54 of Magnaporthe oryzae, causal agent of rice blast disease, was investigated. T...

  4. Functional Analysis of Genes Comprising the Locus of Heat Resistance in Escherichia coli.

    Science.gov (United States)

    Mercer, Ryan; Nguyen, Oanh; Ou, Qixing; McMullen, Lynn; Gänzle, Michael G

    2017-10-15

    The locus of heat resistance (LHR) is a 15- to 19-kb genomic island conferring exceptional heat resistance to organisms in the family Enterobacteriaceae , including pathogenic strains of Salmonella enterica and Escherichia coli The complement of LHR-comprising genes that is necessary for heat resistance and the stress-induced or growth-phase-induced expression of LHR-comprising genes are unknown. This study determined the contribution of the seven LHR-comprising genes yfdX1 GI , yfdX2 , hdeD GI , orf11 , trx GI , kefB , and psiE GI by comparing the heat resistances of E. coli strains harboring plasmid-encoded derivatives of the different LHRs in these genes. (Genes carry a subscript "GI" [genomic island] if an ortholog of the same gene is present in genomes of E. coli ) LHR-encoded heat shock proteins sHSP20, ClpK GI , and sHSP GI are not sufficient for the heat resistance phenotype; YfdX1, YfdX2, and HdeD are necessary to complement the LHR heat shock proteins and to impart a high level of resistance. Deletion of trx GI , kefB , and psiE GI from plasmid-encoded copies of the LHR did not significantly affect heat resistance. The effect of the growth phase and the NaCl concentration on expression from the putative LHR promoter p2 was determined by quantitative reverse transcription-PCR and by a plasmid-encoded p2:GFP promoter fusion. The expression levels of exponential- and stationary-phase E. coli cells were not significantly different, but the addition of 1% NaCl significantly increased LHR expression. Remarkably, LHR expression in E. coli was dependent on a chromosomal copy of evgA In conclusion, this study improved our understanding of the genes required for exceptional heat resistance in E. coli and factors that increase their expression in food. IMPORTANCE The locus of heat resistance (LHR) is a genomic island conferring exceptional heat resistance to several foodborne pathogens. The exceptional level of heat resistance provided by the LHR questions the

  5. Transcriptome profiling identifies genes/pathways associated with experimental resistance to paromomycin in Leishmania donovani

    Directory of Open Access Journals (Sweden)

    Aditya Verma

    2017-12-01

    Full Text Available Widespread resistance towards antimony and reports of relapses following miltefosine treatment has severely affected the management of visceral leishmaniasis (VL in the Indian subcontinent. Paromomycin (PMM, an aminoglycoside antibiotic, has been licensed for VL treatment in India in 2007. Although its use is still restricted in the field, unraveling the molecular mechanism of resistance towards PMM is the key to preserve the drug. In this study, PMM resistant lines were selected up to 100 μM of PMM in three distinct field isolates of Leishmania donovani at promastigote stage. The resistance induced at promastigote level was also evident in amastigotes which showed 6 fold decreases in PMM susceptibility. Comparative transcriptome profiling of PMM resistant (PMM-R and the corresponding PMM sensitive (PMM-S parasites revealed modulated expression of 500 genes (1.5 fold cut off in PMM-R parasites. Selected genes were validated for their modulated expression by quantitative real-time PCR. Functional classification and pathway analysis of modulated genes indicated probable adaptations in drug resistant lines which included a reduced oxidative phosphorylation; b increased glycosomal succinate fermentation and substrate level phosphorylation; c dependency on lipids and amino acids for energy generation; d reduced DNA synthesis and increased DNA damage repair and e decreased protein synthesis and degradation. Interestingly, PMM-R parasites showed a marked increase in PMM susceptibility in presence of verapamil and amlodipine, antagonists of Ca2+ channel that are also modulators of ABC transporters. Moreover, infection of macrophages by PMM-R parasites led to modulated nitric oxide (NO levels while reactive oxygen species (ROS level remained unaltered. The present study highlights the putative mechanisms of PMM resistance in Leishmania. Keywords: Leishmania donovani, Drug resistance, Paromomycin, Transcriptome, ABC transporters, Nitric oxide

  6. Dissemination of antimicrobial resistance in microbial ecosystems through horizontal gene transfer

    Directory of Open Access Journals (Sweden)

    Christian Johannes Hendrik Von Wintersdorff

    2016-02-01

    Full Text Available The emergence and spread of antibiotic resistance among pathogenic bacteria has been a rising problem for public health in recent decades. It is becoming increasingly recognized that not only antibiotic resistance genes (ARGs encountered in clinical pathogens are of relevance, but rather, all pathogenic, commensal as well as environmental bacteria – and also mobile genetic elements and bacteriophages – form a reservoir of ARGs (the resistome from which pathogenic bacteria can acquire resistance via horizontal gene transfer (HGT. HGT has caused antibiotic resistance to spread from commensal and environmental species to pathogenic ones, as has been shown for some clinically important ARGs. Of the three canonical mechanisms of HGT, conjugation is thought to have the greatest influence on the dissemination of ARGs. While transformation and transduction are deemed less important, recent discoveries suggest their role may be larger than previously thought. Understanding the extent of the resistome and how its mobilization to pathogenic bacteria takes place is essential for efforts to control the dissemination of these genes. Here, we will discuss the concept of the resistome, provide examples of HGT of clinically relevant ARGs and present an overview of the current knowledge of the contributions the various HGT mechanisms make to the spread of antibiotic resistance.

  7. Expression Changes in Metal-Resistance Genes in Microbacterium liquefaciens Under Nickel and Vanadium Exposure.

    Science.gov (United States)

    Fierros-Romero, Grisel; Wrosek-Cabrera, José A; Gómez-Ramírez, Marlenne; Pless, Reynaldo C; Rivas-Castillo, A M; Rojas-Avelizapa, Norma G

    2017-07-01

    Microbacterium liquefaciens MNSH2-PHGII-2 is a nickel-vanadium-resistant bacterium isolated from mine tailings located in Guanajuato, Mexico. In PHGII liquid media, M. liquefaciens has the ability to remove 29.5 ppm of Ni and 168.3 ppm of V. The present study reports, for the first time in M. liquefaciens, the presence of the genes nccA (Ni-Co-Cd resistance), hant (high-affinity nickel transporter), smtA, a metal-binding protein gene, and VAN2 (V resistance), which showed an increased expression under exposure to 200 ppm of Ni and 200 ppm of V during the logarithmic growth phase of the microorganism in PHGII liquid media. Data about the expression profile of genes conferring metal resistance to M. liquefaciens can improve the knowledge of those mechanisms involved in the processes of Ni-V resistance and probably in Ni-V removal processes. Based on our data, we can suggest that M. liquefaciens has the potential to be used in the biological treatment of toxic wastes with high Ni and V content.

  8. Identification and characterization of novel NBS-LRR resistance gene analogues from the pea.

    Science.gov (United States)

    Djebbi, S; Bouktila, D; Makni, H; Makni, M; Mezghani-Khemakhem, M

    2015-06-11

    Pea (Pisum sativum) is one of the most cultivated le-gumes in the world, and its yield and seed quality are affected by a variety of pathogens. In plants, NBS-LRR (nucleotide binding site-leucine-rich repeat) is the main class of disease resistance genes. Using degenerate primers deduced from conserved motifs in the NBS domain of known resistance genes, we identified 10 NBS sequences in three varieties of P. sativum. The deduced amino acid sequences of the iden-tified resistance gene analogues (RGAs) exhibited the typical motifs of the NBS domain (P-loop, kinase-2, kinase-3a, and the hydrophobic domain, GLPL) present in the majority of plant proteins belonging to the NBS-LRR class. Phylogenetic analysis showed that seven RGAs belonged to the non-TIR-NBS-LRR subclass and three to the TIR-NBS-LRR subclass. The results of this study provide insights into the structure of this class of resistance genes in the pea, and their evolution-ary relationships with those of other plant species.

  9. Bacterial plasmid-mediated quinolone resistance genes in aquatic environments in China

    OpenAIRE

    Yan, Lei; Liu, Dan; Wang, Xin-Hua; Wang, Yunkun; Zhang, Bo; Wang, Mingyu; Xu, Hai

    2017-01-01

    Emerging antimicrobial resistance is a major threat to human?s health in the 21st century. Understanding and combating this issue requires a full and unbiased assessment of the current status on the prevalence of antimicrobial resistance genes and their correlation with each other and bacterial groups. In aquatic environments that are known reservoirs for antimicrobial resistance genes, we were able to reach this goal on plasmid-mediated quinolone resistance (PMQR) genes that lead to resistan...

  10. A set of vectors for introduction of antibiotic resistance genes by in vitro Cre-mediated recombination

    Directory of Open Access Journals (Sweden)

    Vassetzky Yegor S

    2008-12-01

    Full Text Available Abstract Background Introduction of new antibiotic resistance genes in the plasmids of interest is a frequent task in molecular cloning practice. Classical approaches involving digestion with restriction endonucleases and ligation are time-consuming. Findings We have created a set of insertion vectors (pINS carrying genes that provide resistance to various antibiotics (puromycin, blasticidin and G418 and containing a loxP site. Each vector (pINS-Puro, pINS-Blast or pINS-Neo contains either a chloramphenicol or a kanamycin resistance gene and is unable to replicate in most E. coli strains as it contains a conditional R6Kγ replication origin. Introduction of the antibiotic resistance genes into the vector of interest is achieved by Cre-mediated recombination between the replication-incompetent pINS and a replication-competent target vector. The recombination mix is then transformed into E. coli and selected by the resistance marker (kanamycin or chloramphenicol present in pINS, which allows to recover the recombinant plasmids with 100% efficiency. Conclusion Here we propose a simple strategy that allows to introduce various antibiotic-resistance genes into any plasmid containing a replication origin, an ampicillin resistance gene and a loxP site.

  11. Sequence variation in the CYP51 gene of Blumeria graminis associated with resistance to sterol demethylase inhibiting fungicides.

    Science.gov (United States)

    Wyand, R A; Brown, J K M

    2005-08-01

    Resistance to sterol 14alpha-demethylase inhibiting fungicides (DMIs) has been correlated with mutations in the CYP51 gene, which encodes the target enzyme eburicol 14alpha-demethylase. To test the hypothesis that variation in the CYP51 gene explains variation for DMI sensitivity in barley and wheat powdery mildew species, this gene was sequenced from isolates of Blumeria graminis f.sp. hordei (Bgh) and f.sp. tritici (Bgt), respectively, which differed in their responses to DMIs in agricultural populations in the UK. Two single-nucleotide mutations in the CYP51 gene, which resulted in the amino acid substitutions Y136F and K147Q, were detected. K147Q is a novel mutation present only in Bgh isolates expressing very high levels of resistance. Sequence analysis of the CYP51 gene from the progeny of a cross between DMI-sensitive and resistant Bgh isolates showed that both mutations segregate with resistance, which is consistent with CYP51 controlling a major portion of DMI resistance. However, genetic analysis of resistance to the DMI triadimenol indicates that mutation of the CYP51 gene is not the only mechanism of resistance operating in B. graminis.

  12. Prevalence of antibiotic resistance genes in the bacterial flora of integrated fish farming environments of Pakistan and Tanzania.

    Science.gov (United States)

    Shah, Syed Q A; Colquhoun, Duncan J; Nikuli, Hamisi L; Sørum, Henning

    2012-08-21

    The use of a wide variety of antimicrobials in human and veterinary medicine, including aquaculture, has led to the emergence of antibiotic resistant pathogens. In the present study, bacteria from water, sediments, and fish were collected from fish farms in Pakistan and Tanzania with no recorded history of antibiotic use. The isolates were screened for the presence of resistance genes against various antimicrobials used in aquaculture and animal husbandry. Resistant isolates selected by disk diffusion and genotyped by Southern hybridization were further screened by polymerase chain reaction (PCR) and amplicon sequencing. The prominent resistance genes identified encoded tetracycline [tetA(A) and tetA(G)], trimethoprim [dfrA1, dfrA5, dfrA7, dfrA12, and dfrA15], amoxicillin [bla(TEM)], streptomycin [strA-strB], chloramphenicol [cat-1], and erythromycin resistance [mefA]. The int1 gene was found in more than 30% of the bacterial isolates in association with gene cassettes. MAR indices ranged from 0.2 to 1. The bla(NDM-1) gene was not identified in ertapenem resistant isolates. It is hypothesized that integrated fish farming practices utilizing domestic farm and poultry waste along with antibiotic residues from animal husbandry may have contributed to a pool of resistance genes in the aquaculture systems studied.

  13. Comparative and functional triatomine genomics reveals reductions and expansions in insecticide resistance-related gene families.

    Directory of Open Access Journals (Sweden)

    Lucila Traverso

    2017-02-01

    Full Text Available Triatomine insects are vectors of Trypanosoma cruzi, a protozoan parasite that is the causative agent of Chagas' disease. This is a neglected disease affecting approximately 8 million people in Latin America. The existence of diverse pyrethroid resistant populations of at least two species demonstrates the potential of triatomines to develop high levels of insecticide resistance. Therefore, the incorporation of strategies for resistance management is a main concern for vector control programs. Three enzymatic superfamilies are thought to mediate xenobiotic detoxification and resistance: Glutathione Transferases (GSTs, Cytochromes P450 (CYPs and Carboxyl/Cholinesterases (CCEs. Improving our knowledge of key triatomine detoxification enzymes will strengthen our understanding of insecticide resistance processes in vectors of Chagas' disease.The discovery and description of detoxification gene superfamilies in normalized transcriptomes of three triatomine species: Triatoma dimidiata, Triatoma infestans and Triatoma pallidipennis is presented. Furthermore, a comparative analysis of these superfamilies among the triatomine transcriptomes and the genome of Rhodnius prolixus, also a triatomine vector of Chagas' disease, and other well-studied insect genomes was performed. The expression pattern of detoxification genes in R. prolixus transcriptomes from key organs was analyzed. The comparisons reveal gene expansions in Sigma class GSTs, CYP3 in CYP superfamily and clade E in CCE superfamily. Moreover, several CYP families identified in these triatomines have not yet been described in other insects. Conversely, several groups of insecticide resistance related enzymes within each enzyme superfamily are reduced or lacking in triatomines. Furthermore, our qRT-PCR results showed an increase in the expression of a CYP4 gene in a T. infestans population resistant to pyrethroids. These results could point to an involvement of metabolic detoxification mechanisms

  14. Identification of powdery mildew resistance genes in Polish common oat (Avena sativa L. cultivars using host-pathogen tests

    Directory of Open Access Journals (Sweden)

    Sylwia Okoń

    2012-10-01

    Full Text Available The aim of the present study was to characterize and identify powdery mildew resistance genes in Polish common oat cultivars using host-pathogen tests. A differential set of six Blumeria graminis f.sp. avenae isolates virulent or avirulent to four cultivars and one line that has known resistance to powdery mildew were used. Among the investigated cultivars, only four of them (13.3% had resistance patterns similar to genotypes belonging to the differential set. The resistance of OMR group 1 was found in the cultivar ‘Dragon’, while that of OMR2 in the cultivar ‘Skrzat’. The cultivars ‘Deresz’ and ‘Hetman’ showed a resistance pattern that corresponded with OMR group 3. The resistance corresponding to OMR4 was not found, which suggests that until now this gene has not been used in Polish oat breeding programmes. The cultivar ‘Canyon’ had a different pat- tern of resistance than the genotypes that have already known OMR genes, which indicates that the resistance of this cultivar is determined by a new gene or a combination of known genes.

  15. Antimicrobial Resistance and Resistance Genes in Aerobic Bacteria Isolated from Pork at Slaughter.

    Science.gov (United States)

    Li, Lili; Heidemann Olsen, Rikke; Ye, Lei; Yan, He; Nie, Qing; Meng, Hecheng; Shi, Lei

    2016-04-01

    The aim of this study was to investigate the phenotypic and genotypic antimicrobial resistance, integrons, and transferability of resistance markers in 243 aerobic bacteria recovered from pork at slaughter in the People's Republic of China. The organisms belonged to 22 genera of gram-negative bacteria (92.2%) and gram-positive bacteria (7.8%). High levels of resistance were detected to tetracycline, trimethoprim-sulfamethoxazole, and ampicillin (36.2 to 54.3%), and lower levels were detected to nitrofurantoin, cefotaxime, gentamicin, ciprofloxacin, and chloramphenicol (7.8 to 29.2%). Across species, genes conferring antimicrobial resistance were observed with the following frequencies: blaTEM, 40.7%; blaCMY-2, 15.2%; blaCTX-M, 11.5%; sul2, 27.2%; sul1, 14.4%; tet(A), 5.4%; tet(L), 5.4%; tet(M), 5.0%; tet(E), 3.7%; tet(C), 3.3%; tet(S), 2.5%; and tet(K), 0.8%. Various antimicrobial resistance genes were found in new carriers: blaTEM in Lactococcus garvieae, Myroides odoratimimus, Aeromonas hydrophila, Staphylococcus sciuri, Raoultella terrigena, Macrococcus caseolyticus, Acinetobacter ursingii, Sphingobacterium sp., and Oceanobacillus sp.; blaCMY-2 in Lactococcus lactis, Klebsiella oxytoca, Serratia marcescens, Acinetobacter baumannii, and Myroides phaeus; tet(L) in M. caseolyticus; sul1 in Vibrio cincinnatiensis; sul2 in Acinetobacter bereziniae, Acinetobacter johnsonii, and V. cincinnatiensis; and the class 1 integron and gene cassette aadA2 in V. cincinnatiensis. Approximately 6.6% of isolates contained class 1 integrons, and one isolate harbored class 2 integrons. Plasmid associated intI1 and androgen receptor- encoding genes were transferred into Escherichia coli J53 and E. coli DH5α by conjugation and transformation experiments, respectively. Our study highlights the importance of aerobic bacteria from pork as reservoirs for antimicrobial resistance genes and mobile genetic elements that can readily be transferred intra- and interspecies.

  16. Diversity of Integron- and Culture-Associated Antibiotic Resistance Genes in Freshwater Floc

    OpenAIRE

    Drudge, Christopher N.; Elliott, Amy V. C.; Plach, Janina M.; Ejim, Linda J.; Wright, Gerard D.; Droppo, Ian G.; Warren, Lesley A.

    2012-01-01

    Clinically important antibiotic resistance genes were detected in culturable bacteria and class 1 integron gene cassettes recovered from suspended floc, a significant aquatic repository for microorganisms and trace elements, across freshwater systems variably impacted by anthropogenic activities. Antibiotic resistance gene cassettes in floc total community DNA differed appreciably in number and type from genes detected in bacteria cultured from floc. The number of floc antibiotic resistance g...

  17. Cereal cyst nematode resistance conferred by the Cre7 gene from Aegilops triuncialis and its relationship with Cre genes from Australian wheat cultivars

    OpenAIRE

    Montes, Maria Jesus; Andrés, María Fe; Sin, E.; Lopez Braña, Isidoro; Martín-Sánchez, J.A.; Romero, M.D.; Delibes Castro, Angeles

    2008-01-01

    Cereal cyst nematode (CCN; Heterodera avenae Woll.) is a root pathogen of cereal crops that can cause severe yield losses in wheat (Triticum aestivum). Differential host–nematode interactions occur in wheat cultivars carrying different CCN resistance (Cre) genes. The objective of this study was to determine the CCN resistance conferred by the Cre7 gene from Aegilops triuncialis in a 42-chromosome introgression line and to assess the effects of the Cre1, Cre3, Cre4, and Cre8 genes present in A...

  18. Molecular study on some antibiotic resistant genes in Salmonella spp. isolates

    Science.gov (United States)

    Nabi, Ari Q.

    2017-09-01

    Studying the genes related with antimicrobial resistance in Salmonella spp. is a crucial step toward a correct and faster treatment of infections caused by the pathogen. In this work Integron mediated antibiotic resistant gene IntI1 (Class I Integrase IntI1) and some plasmid mediated antibiotic resistance genes (Qnr) were scanned among the isolated non-Typhoid Salmonellae strains with known resistance to some important antimicrobial drugs using Sybr Green real time PCR. The aim of the study was to correlate the multiple antibiotics and antimicrobial resistance of Salmonella spp. with the presence of integrase (IntI1) gene and plasmid mediated quinolone resistant genes. Results revealed the presence of Class I Integrase gene in 76% of the isolates with confirmed multiple antibiotic resistances. Moreover, about 32% of the multiple antibiotic resistant serotypes showed a positive R-PCR for plasmid mediated qnrA gene encoding for nalidixic acid and ciprofloxacin resistance. No positive results could be revealed form R-PCRs targeting qnrB or qnrS. In light of these results we can conclude that the presence of at least one of the qnr genes and/or the presence of Integrase Class I gene were responsible for the multiple antibiotic resistance to for nalidixic acid and ciprofloxacin from the studied Salmonella spp. and further studies required to identify the genes related with multiple antibiotic resistance of the pathogen.

  19. Detection and Genetic Environment of Pleuromutilin-Lincosamide-Streptogramin A Resistance Genes in Staphylococci Isolated from Pets.

    Science.gov (United States)

    Deng, Fengru; Wang, Huiwen; Liao, Yifei; Li, Jun; Feßler, Andrea T; Michael, Geovana B; Schwarz, Stefan; Wang, Yang

    2017-01-01

    Increasing emergence of staphylococci resistant to pleuromutilins, lincosamides, and streptogramin A (PLS A ) and isolated from humans and pets is a growing public health concern worldwide. Currently, there was only one published study regarding one of the PLS A genes, vga (A) detected in staphylococci isolated from cat. In this study, eleven pleuromutilin-resistant staphylococci from pets and two from their owners were isolated and further characterized for their antimicrobial susceptibilities, plasmid profiles, genotypes, and genetic context of the PLS A resistance genes. The gene sal (A) identified in 11 staphylococcal isolates was found for the first time in Staphylococcus haemolyticus, Staphylococcus epidermidis , and Staphylococcus xylosus . Moreover, these 11 isolates shared the identical regions flanking the sal (A) gene located in the chromosomal DNA. Two S. haemolyticus isolates from a cat and its owner carried similar vga (A) LC plasmids and displayed indistinguishable PFGE patterns. A novel chromosomal multidrug resistance genomic island (MDRGI) containing 13 resistance genes, including lsa (E), was firstly identified in S. epidermidis . In addition, vga (A) LC , sal (A), and lsa (E) were for the first time identified in staphylococcal isolates originating from pet animals. The plasmids, chromosomal DNA region, and MDRGI associated with the PLS A resistance genes vga (A), vga (A) LC , sal (A), and lsa (E) are present in staphylococci isolated from pets and humans and present significant challenges for the clinical management of infections by limiting therapeutic options.

  20. Involvement of outer membrane proteins and peroxide-sensor genes in Burkholderia cepacia resistance to isothiazolone.

    Science.gov (United States)

    Zhou, Gang; Shi, Qing-shan; Ouyang, You-sheng; Chen, Yi-ben

    2014-04-01

    Isothiazolones are used as preservatives in various modern industrial products. Although microorganisms that exhibit resistance towards these biocides have been identified, the underlying resistance mechanisms are still unclear. Therefore, we investigated the resistance properties of the following Burkholderia cepacia strains to Kathon (a representative of isothiazolones): a wild-type (WT) strain; a laboratory resistance strain (BC-IR) induced from WT; and an isolated strain (BC-327) screened from industrial contamination samples. The bacterial cell structure was disrupted by 50 μg ml⁻¹ Kathon treatment. BC-IR and BC-327 did not display resistance in the presence of 1 ml L⁻¹ Tween 80, 1 ml L⁻¹ Triton X-100, 0.1 % sodium dodecyl sulfate or 1 mmol L⁻¹ EDTA-2Na. Additionally, BC-IR and BC-327 exhibited lower relative conductivity from 10 to 180 min. The types as well as the levels of outer-membrane proteins (OMPs) were altered among WT, BC-IR and BC-327. Finally, the two Kathon-resistance strains BC-IR and BC-327 presented higher resistance capacity to H₂O₂. We measured the levels of peroxide-sensor genes and observed that the transcriptional activator oxyR, superoxide dismutase sod1, sod2, catalase cat1 and cat3 were all up-regulated under oxidative conditions for all strains. Taken together, OMPs and peroxide-sensor genes in B. cepacia contributed to isothiazolone resistance; However, the laboratory strain BC-IR exhibited a different resistance mechanism and properties compared to the isolated strain BC-327.

  1. A review of the influence of treatment strategies on antibiotic resistant bacteria and antibiotic resistance genes.

    Science.gov (United States)

    Sharma, Virender K; Johnson, Natalie; Cizmas, Leslie; McDonald, Thomas J; Kim, Hyunook

    2016-05-01

    Antibiotic resistant bacteria (ARB) and antibiotic resistance genes (ARG) in the aquatic environment have become an emerging contaminant issue, which has implications for human and ecological health. This review begins with an introduction to the occurrence of ARB and ARG in different environmental systems such as natural environments and drinking water resources. For example, ARG or ARB with resistance to ciprofloxacin, sulfamethoxazole, trimethoprim, quinolone, vancomycin, or tetracycline (e.g., tet(A), tet(B), tet(C), tet(G), tet(O), tet(M), tet(W), sul I, and sul II) have been detected in the environment. The development of resistance may be intrinsic, may be acquired through spontaneous mutations (de novo), or may occur due to horizontal gene transfer from donor bacteria, phages, or free DNA to recipient bacteria. An overview is also provided of the current knowledge regarding inactivation of ARB and ARG, and the mechanism of the effects of different disinfection processes in water and wastewater (chlorination, UV irradiation, Fenton reaction, ozonation, and photocatalytic oxidation). The effects of constructed wetlands and nanotechnology on ARB and ARG are also summarized. Copyright © 2015 Elsevier Ltd. All rights reserved.

  2. A Comprehensive Insight into Tetracycline Resistant Bacteria and Antibiotic Resistance Genes in Activated Sludge Using Next-Generation Sequencing

    OpenAIRE

    Huang, Kailong; Tang, Junying; Zhang, Xu-Xiang; Xu, Ke; Ren, Hongqiang

    2014-01-01

    In order to comprehensively investigate tetracycline resistance in activated sludge of sewage treatment plants, 454 pyrosequencing and Illumina high-throughput sequencing were used to detect potential tetracycline resistant bacteria (TRB) and antibiotic resistance genes (ARGs) in sludge cultured with different concentrations of tetracycline. Pyrosequencing of 16S rRNA gene revealed that tetracycline treatment greatly affected the bacterial community structure of the sludge. Nine genera cons...

  3. Increased levels of multiresistant bacteria and resistance genes after wastewater treatment and their dissemination into Lake Geneva, Switzerland

    Directory of Open Access Journals (Sweden)

    Nadine eCzekalski

    2012-03-01

    Full Text Available At present, very little is known about the fate and perseverance of multiresistant bacteria and their resistance genes in natural aquatic environments. Treated, but partly also untreated sewage of the city of Lausanne, Switzerland is discharged into Vidy bay (Lake Geneva resulting in high levels of contamination in this part of the lake. In the present work we have studied the prevalence of multiresistant bacteria and resistance genes in the wastewater stream of Lausanne. Samples from hospital and municipal raw sewage, treated effluent from Lausanne’s wastewater treatment plant (WTP as well as lake water and sediment samples obtained close to the WTP outlet pipe and a remote site close to a drinking water pump were evaluated for the prevalence of multiresistant bacteria. Selected isolates were identified (16S rRNA gene fragment sequencing and characterized with regards to further resistances, resistance genes, and plasmids. Mostly, studies investigating this issue have relied on cultivation-based approaches. However, the limitations of these tools are well known, in particular for environmental microbial communities, and cultivation-independent molecular tools should be applied in parallel in order to take non-culturable organisms into account. Here we directly quantified the sulfonamide resistance genes sul1 and sul2 from environmental DNA extracts using TaqMan real-time quantitative PCR. Hospital sewage contained the highest load of multiresistant bacteria and antibiotic resistance genes. Wastewater treatment reduced the total bacterial load but evidence for selection of extremely multiresistant strains and accumulation of resistance genes was observed. Our data clearly indicated pollution of sediments with antibiotic resistance genes in the vicinity of the WTP outlet. The potential of lakes as reservoirs of multiresistant bacteria and potential risks are discussed.

  4. Allelic relationships of anthracnose (Colletotrichum lindemuthianum resistance in the common bean (Phaseolus vulgaris L. cultivar Michelite and the proposal of a new anthracnose resistance gene, Co-11

    Directory of Open Access Journals (Sweden)

    Maria Celeste Gonçalves-Vidigal

    2007-01-01

    Full Text Available The genetic resistance of Phaseolus vulgaris L. cultivar Michelite to races 8 and 64 of Colletotrichum lindemuthianum, causal agent of bean anthracnose, was characterized. Crosses were made between Michelite and Mexico 222 cultivars and the F2 population was inoculated with race 64 in order to study the inheritance of resistance to anthracnose in Michelite. The segregation of F2 population fitted in a ratio of 3R:1S, showing the presence of a dominant gene in Michelite gene conditioning resistance to race 64. Allelism tests were conducted with F2 populations derived from crosses between Michelite and AB 136, AND 277, BAT 93, Cornell 49-242, G 2333, Kaboon, Mexico 222, Michigan Dark Red Kidney (MRDK, Ouro Negro, Perry Marrow, PI 207262, TO, TU, and Widusa. All the cultivars (except Mexico 222 were resistant to race 64. While F2 derived from the Michelite x Mexico 222 was inoculated with race 8. Additionally, allelism tests indicated that the gene present in Michelite is independent from Co-1, Co-2, Co-3, Co-4, Co-5, Co-6, Co-7, Co-9 and Co-10 genes. The monogenic inheritance observed in Michelite and the independence of this gene from those previously characterized allow the authors to propose that the anthracnose resistant gene in Michelite should be named Co-11.

  5. Survey of Candidate Genes for Maize Resistance to Infection by Aspergillus flavus and/or Aflatoxin Contamination

    Science.gov (United States)

    Hawkins, Leigh K.; Tang, Juliet D.; Tomashek, John; Alves Oliveira, Dafne; Ogunola, Oluwaseun F.; Smith, J. Spencer; Williams, W. Paul

    2018-01-01

    Many projects have identified candidate genes for resistance to aflatoxin accumulation or Aspergillus flavus infection and growth in maize using genetic mapping, genomics, transcriptomics and/or proteomics studies. However, only a small percentage of these candidates have been validated in field conditions, and their relative contribution to resistance, if any, is unknown. This study presents a consolidated list of candidate genes identified in past studies or in-house studies, with descriptive data including genetic location, gene annotation, known protein identifiers, and associated pathway information, if known. A candidate gene pipeline to test the phenotypic effect of any maize DNA sequence on aflatoxin accumulation resistance was used in this study to determine any measurable effect on polymorphisms within or linked to the candidate gene sequences, and the results are published here. PMID:29385107

  6. Novel mutations in penicillin-binding protein genes in clinical Staphylococcus aureus isolates that are methicillin resistant on susceptibility testing, but lack the mec gene.

    Science.gov (United States)

    Ba, Xiaoliang; Harrison, Ewan M; Edwards, Giles F; Holden, Matthew T G; Larsen, Anders Rhod; Petersen, Andreas; Skov, Robert L; Peacock, Sharon J; Parkhill, Julian; Paterson, Gavin K; Holmes, Mark A

    2014-03-01

    Methicillin-resistant Staphylococcus aureus (MRSA) is an important global health problem. MRSA resistance to β-lactam antibiotics is mediated by the mecA or mecC genes, which encode an alternative penicillin-binding protein (PBP) 2a that has a low affinity to β-lactam antibiotics. Detection of mec genes or PBP2a is regarded as the gold standard for the diagnosis of MRSA. We identified four MRSA isolates that lacked mecA or mecC genes, but were still phenotypically resistant to pencillinase-resistant β-lactam antibiotics. The four human S. aureus isolates were investigated by whole genome sequencing and a range of phenotypic assays. We identified a number of amino acid substitutions present in the endogenous PBPs 1, 2 and 3 that were found in the resistant isolates but were absent in closely related susceptible isolates and which may be the basis of resistance. Of particular interest are three identical amino acid substitutions in PBPs 1, 2 and 3, occurring independently in isolates from at least two separate multilocus sequence types. Two different non-conservative substitutions were also present in the same amino acid of PBP1 in two isolates from two different sequence types. This work suggests that phenotypically resistant MRSA could be misdiagnosed using molecular methods alone and provides evidence of alternative mechanisms for β-lactam resistance in MRSA that may need to be considered by diagnostic laboratories.

  7. Localization of powdery mildew resistance gene Ml-ra on barley chromosome 5

    DEFF Research Database (Denmark)

    Doll, Hans; Jensen, Hans Peter

    1986-01-01

    Evidence is presented that the powdery mildew resistance gene called Ml-(41/145) represents a unique, unnamed locus, which we suggest to be designated Ml-ra with reference to variety 'Ragusa b' [Hordeum vulgare]. Ml-ra is located on the short arm of chormosome 5 near powdery mildew resistance loc...... Ml-a and the seed storage protein loci Hor1 and Hor2. The most likely order of the loci is Hor1, Ml-a, Ml-ra, and Hor2....

  8. Epidemiology, Clinical Presentation, Laboratory Diagnosis, Antimicrobial Resistance, and Antimicrobial Management of Invasive Salmonella Infections

    Science.gov (United States)

    Sjölund-Karlsson, Maria; Gordon, Melita A.; Parry, Christopher M.

    2015-01-01

    SUMMARY Salmonella enterica infections are common causes of bloodstream infection in low-resource areas, where they may be difficult to distinguish from other febrile illnesses and may be associated with a high case fatality ratio. Microbiologic culture of blood or bone marrow remains the mainstay of laboratory diagnosis. Antimicrobial resistance has emerged in Salmonella enterica, initially to the traditional first-line drugs chloramphenicol, ampicillin, and trimethoprim-sulfamethoxazole. Decreased fluoroquinolone susceptibility and then fluoroquinolone resistance have developed in association with chromosomal mutations in the quinolone resistance-determining region of genes encoding DNA gyrase and topoisomerase IV and also by plasmid-mediated resistance mechanisms. Resistance to extended-spectrum cephalosporins has occurred more often in nontyphoidal than in typhoidal Salmonella strains. Azithromycin is effective for the management of uncomplicated typhoid fever and may serve as an alternative oral drug in areas where fluoroquinolone resistance is common. In 2013, CLSI lowered the ciprofloxacin susceptibility breakpoints to account for accumulating clinical, microbiologic, and pharmacokinetic-pharmacodynamic data suggesting that revision was needed for contemporary invasive Salmonella infections. Newly established CLSI guidelines for azithromycin and Salmonella enterica serovar Typhi were published in CLSI document M100 in 2015. PMID:26180063

  9. Genetics and mapping of a new leaf rust resistance gene in Triticum ...

    Indian Academy of Sciences (India)

    AMIT KUMAR SINGH

    Selection G12 showed resistance at both seedling and adult plant stages. Genetic analysis in F1, F2 and F2:3 families at the seedling stage revealed that leaf rust resistance in Selection G12 is conditioned by a single incompletely dominant gene. The leaf rust resistance gene was mapped to chromosome 3BL with SSR ...

  10. Characterization of resistance genes to Cladosporium fulvum on the short arm of chromosome 1 of tomato

    NARCIS (Netherlands)

    Haanstra, J.

    2000-01-01

    Plant breeders generally use qualitative resistance that is associated with a hypersensitive reaction (HR) to obtain cultivars that are resistant to pathogens and pests. The genetics of this resistance is based on the gene-for-gene relationship, which involves the product of a plant

  11. Distribution and quantification of antibiotic resistance genes and bacteria across agricultural and non-agricultural metagenomes

    Science.gov (United States)

    There is concern that antibiotic resistance can potentially be transferred from animals to humans through the food chain. The relationship between specific antibiotic resistant bacteria and the genes they carry remains to be described and few details are known about how antibiotic resistance genes i...

  12. Rapid identification of rice blast resistance gene by specific length amplified fragment sequencing

    Directory of Open Access Journals (Sweden)

    Shen Chen

    2016-05-01

    Full Text Available Excavation of resistance genes is one of the most effective and environment-friendly measures to control the devastating rice disease caused by Magnaporthe oryzae. Many resistance genes have been mapped and characterized in the last century. Nevertheless, only a few of the total resistance genes could be really applied in the rice breeding program. Huazhan (HZ is a new native rice restorer line developed in China and widely used in hybrid rice in recent years. HZ and its crossed combinations usually show a broad spectrum of resistance against rice blast in different rice ecosystems in China. Dissection of the genetic background of HZ is very useful for its further application. In this study, a combined method based on bulked segregation analysis (BSA and specific length amplified fragment sequencing (SLAF-seq was used to identify blast resistance gene(s in HZ. A total of 56,187 SLAFs labels were captured and 9051 polymorphic SLAFs markers were analysed and procured in this study. One trait associated with candidate resistance genes region on chromosome 12 overlapping 10.2–17.6 Mb has been identified, in which 10 NBS-LRR (nucleotide-binding site-leucine-rich repeat coding genes were used as resistance gene candidates. Our result indicated that SLAF-seq with BSA is a rapid and effective method for initial identification of blast resistance genes. The identification of resistance gene in HZ will improve its molecular breeding and resistance variety application.

  13. Genes for resistance to wheat powdery mildew in derivatives of Triticum Timopheevi and T. Carthlicum

    DEFF Research Database (Denmark)

    Jørgensen, Jørgen Helms; Jensen, C. J.

    1972-01-01

    and/or Ml designated genes; a temporary designation, Ml f ,is proposed for this gene. Gene Ml f is closely associated with a gene conditioning resistance to the stem rust fungus (Puccinia graminis f. sp. tritici), probably gene Sr9c. The winter wheat line TP 229 derived from Triticum carthlicum has...

  14. Prevalence of Antibiotic Resistance Genes among Human Gut-Derived Bifidobacteria.

    Science.gov (United States)

    Duranti, Sabrina; Lugli, Gabriele Andrea; Mancabelli, Leonardo; Turroni, Francesca; Milani, Christian; Mangifesta, Marta; Ferrario, Chiara; Anzalone, Rosaria; Viappiani, Alice; van Sinderen, Douwe; Ventura, Marco

    2017-02-01

    The microbiota of the human gastrointestinal tract (GIT) may regularly be exposed to antibiotics, which are used to prevent and treat infectious diseases caused by bacteria and fungi. Bacterial communities of the gut retain a reservoir of antibiotic resistance (AR) genes, and antibiotic therapy thus positively selects for those microorganisms that harbor such genetic features, causing microbiota modulation. During the first months following birth, bifidobacteria represent some of the most dominant components of the human gut microbiota, although little is known about their AR gene complement (or resistome). In the current study, we assessed the resistome of the Bifidobacterium genus based on phenotypic and genotypic data of members that represent all currently recognized bifidobacterial (sub)species. Moreover, a comparison between the bifidobacterial resistome and gut metagenome data sets from adults and infants shows that the bifidobacterial community present at the first week following birth possesses a reduced AR arsenal compared to that present in the infant bifidobacterial population in subsequent weeks of the first year of life. Our findings reinforce the concept that the early infant gut microbiota is more susceptible to disturbances by antibiotic treatment than the gut microbiota developed at a later life stage. The spread of resistance to antibiotics among bacterial communities has represented a major concern since their discovery in the last century. The risk of genetic transfer of resistance genes between microorganisms has been extensively investigated due to its relevance to human health. In contrast, there is only limited information available on antibiotic resistance among human gut commensal microorganisms such as bifidobacteria, which are widely exploited by the food industry as health-promoting microorganisms or probiotic ingredients. In the current study, we explored the occurrence of antibiotic resistance genes in the genomes of bifidobacteria

  15. Effect of wastewater colloids on membrane removal of microconstituent antibiotic resistance genes

    OpenAIRE

    Riquelme Breazeal, Maria Virginia

    2011-01-01

    Anthropogenically generated antibiotic resistance genes (ARGs) are considered emerging contaminants, as they are associated with a critical human health challenge, are persist independent of a bacterial host, are subject to transfer between bacteria, and are present at amplified levels in human-impacted environments. Given the gravity of the problem, there is growing interest in advancing water treatment processes capable of limiting ARG dissemination. This study examined the potential for m...

  16. Mapping and Cloning of Late Blight Resistance Genes from Solanum venturii Using an Interspecific Candidate Gene Approach

    NARCIS (Netherlands)

    Pel, M.; Foster, S.J.; Park, T.H.; Rietman, H.; Arkel, van G.; Jones, J.D.G.; Eck, van H.J.; Jacobsen, E.; Visser, R.G.F.; Vossen, van der E.A.G.

    2009-01-01

    Late blight, caused by the oomycete Phytophthora infestans, is one of the most devastating diseases of potato. Resistance (R) genes from the wild species Solanum demissum have been used by breeders to generate late-blight-resistant cultivars but resistance was soon overcome by the pathogen. A more

  17. Widespread Fosfomycin Resistance in Gram-Negative Bacteria Attributable to the Chromosomal fosA Gene

    Directory of Open Access Journals (Sweden)

    Ryota Ito

    2017-08-01

    Full Text Available Fosfomycin is a decades-old antibiotic which is being revisited because of its perceived activity against many extensively drug-resistant Gram-negative pathogens. FosA proteins are Mn2+ and K+-dependent glutathione S-transferases which confer fosfomycin resistance in Gram-negative bacteria by conjugation of glutathione to the antibiotic. Plasmid-borne fosA variants have been reported in fosfomycin-resistant Escherichia coli strains. However, the prevalence and distribution of fosA in other Gram-negative bacteria are not known. We systematically surveyed the presence of fosA in Gram-negative bacteria in over 18,000 published genomes from 18 Gram-negative species and investigated their contribution to fosfomycin resistance. We show that FosA homologues are present in the majority of genomes in some species (e.g., Klebsiella spp., Enterobacter spp., Serratia marcescens, and Pseudomonas aeruginosa, whereas they are largely absent in others (e.g., E. coli, Acinetobacter baumannii, and Burkholderia cepacia. FosA proteins in different bacterial pathogens are highly divergent, but key amino acid residues in the active site are conserved. Chromosomal fosA genes conferred high-level fosfomycin resistance when expressed in E. coli, and deletion of chromosomal fosA in S. marcescens eliminated fosfomycin resistance. Our results indicate that FosA is encoded by clinically relevant Gram-negative species and contributes to intrinsic fosfomycin resistance.

  18. Antimicrobial susceptibility and presence of resistance genes in staphylococci from poultry

    DEFF Research Database (Denmark)

    Aarestrup, Frank Møller; Agersø, Yvonne; Ahrens, Peter

    2000-01-01

    to ciprofloxacin. Only six (7%) S. aureus isolates and one Staphylococcus saprophyticus were penicillin resistant. Resistance to sulphamethoxazole was observed among 16 (19%) of S. aureus isolates and two coagulase negative staphylococci (CNS). Twenty (24%) of the S. aureus isolates were resistant to erythromycin...... study showed a frequent occurrence of resistance to fluoroquinolones, tetracycline and macrolides among staphylococci isolated from broilers in Denmark, whereas the occurrence of resistance to other antimicrobial agents remains low. Similar genes, encoding resistance to erythromycin, tetracycline...

  19. Staphylococci isolated from ready-to-eat meat - Identification, antibiotic resistance and toxin gene profile.

    Science.gov (United States)

    Fijałkowski, Karol; Peitler, Dorota; Karakulska, Jolanta

    2016-12-05

    The aim of this study was to analyse the staphylococci isolated from ready-to-eat meat products, including pork ham, chicken cold cuts, pork sausage, salami and pork luncheon meat, sliced in the store to the consumer's specifications, along with species identification and determination of antibiotic resistance. Genes encoding staphylococcal enterotoxins, staphylococcal enterotoxin-like proteins, exfoliative toxins, and toxic shock syndrome toxin 1 were also investigated. From the 41 samples, 75 different staphylococcal isolates were obtained. Based on PCR-RFLP analysis of the gap gene using AluI and HpyCH4V restriction enzymes, the isolates were identified as Staphylococcus equorum (28%), S. vitulinus (16%), S. carnosus (14%), S. succinus (11%), S. xylosus (11%), S. saprophyticus (9%), S. warneri (9%), S. haemolyticus (1%) and S. pasteuri (1%). The incidence and number of resistances to antimicrobials was found to be species but not source of isolation dependent. All S. xylosus, S. saprophyticus, S. haemolyticus and S. pasteuri isolates showed antibiotic resistance. A lower percentage of resistance was recorded for S. warneri (71%) and S. vitulinus (58%), followed by S. equorum (57%), S. carnosus (50%) and S. succinus (50%). The most frequent resistance was observed to fusidic acid (43%). The mecA gene was amplified in 4% of the staphylococci. However, phenotypic resistance to methicillin was not confirmed in any of these isolates. On the other hand, the mecA gene was not detected in any of 9% of the isolates resistant to cefoxitin. It was also found that among 75 isolates, 60 (80%) harbored from 1 to 10 out of 21 analyzed superantigenic toxin genes. The most prevalent genes were: sei (36% isolates) among enterotoxins, seln (32% isolates) among enterotoxin-like proteins and eta encoding exfoliative toxin A (37% isolates). The findings of this study further extend previous observations that, when present in food, not only S. aureus but also other species of

  20. Isolation of Resistance Gene Candidates (RGCs) and characterization of an RGC cluster in cassava.

    Science.gov (United States)

    López, C E; Zuluaga, A P; Cooke, R; Delseny, M; Tohme, J; Verdier, V

    2003-08-01

    Plant disease resistance genes (R genes) show significant similarity amongst themselves in terms of both their DNA sequences and structural motifs present in their protein products. Oligonucleotide primers designed from NBS (Nucleotide Binding Site) domains encoded by several R-genes have been used to amplify NBS sequences from the genomic DNA of various plant species, which have been called Resistance Gene Analogues (RGAs) or Resistance Gene Candidates (RGCs). Using specific primers from the NBS and TIR (Toll/Interleukin-1 Receptor) regions, we identified twelve classes of RGCs in cassava (Manihot esculenta Crantz). Two classes were obtained from the PCR-amplification of the TIR domain. The other 10 classes correspond to the NBS sequences and were grouped into two subfamilies. Classes RCa1 to RCa5 are part of the first subfamily and were linked to a TIR domain in the N terminus. Classes RCa6 to RCa10 corresponded to non-TIR NBS-LRR encoding sequences. BAC library screening with the 12 RGC classes as probes allowed the identification of 42 BAC clones that were assembled into 10 contigs and 19 singletons. Members of the two TIR and non-TIR NBS-LRR subfamilies occurred together within individual BAC clones. The BAC screening and Southern hybridization analyses showed that all RGCs were single copy sequences except RCa6 that represented a large and diverse gene family. One BAC contained five NBS sequences and sequence analysis allowed the identification of two complete RGCs encoding two highly similar proteins. This BAC was located on linkage group J with three other RGC-containing BACs. At least one of these genes, RGC2, is expressed constitutively in cassava tissues.

  1. Isolation and characterization of resistance and defense gene analogs in cotton (Gossypium barbadense L.).

    Science.gov (United States)

    Gao, Yulong; Guo, Wangzhen; Wang, Lei; Zhang, Tianzhen

    2006-12-01

    Plant disease resistance gene (R gene) and defense response gene encode some conserved motifs. In the present work, a PCR strategy was used to clone resistance gene analogs (RGAs) and defense gene analogs (DGAs) from Sea-island cotton variety Hai7124 using oligonucleotide primers based on the nucleotide-binding site (NBS) and serine/threonine kinase (STK) in the R-gene and pathogenesis-related proteins of class 2 (PR2) of defense response gene. 79 NBS sequences, 21 STK sequences and 11 DGAs were cloned from disease-resistance cotton. Phylogenic analysis of 79 NBS-RGAs and NBS-RGAs nucleotide sequences of cotton already deposited in GenBank identified one new sub-cluster. The deduced amino acid sequences of NBS-RGAs and STK-RGAs were divided into two distinct groups respectively: Toll/Interleukin-1 receptor (TIR) group and non-TIR group, A group and B group. The expression of RGAs and DGAs having consecutive open reading frame (ORF) was also investigated and it was found that 6 NBS-RGAs and 1 STK-RGA were induced, and 1 DGA was up-regulated by infection of Verticillium dahliae strain VD8. 4 TIR-NBS-RGAs and 4 non-TIR-NBS-RGAs were arbitrarily used as probes for Southern-blotting. There existed 2-10 blotted bands. In addition, since three non-TIR-NBS-RGAs have the same hybridization pattern, we conjecture that these three RGAs form a cluster distribution in the genome.

  2. The Identification of Intrinsic Chloramphenicol and Tetracycline Resistance Genes in Members of the Bacillus cereus Group (sensu lato)

    Science.gov (United States)

    Glenwright, Helen; Pohl, Susanne; Navarro, Ferran; Miro, Elisenda; Jiménez, Guillermo; Blanch, Anicet R.; Harwood, Colin R.

    2017-01-01

    Bacillus toyonensis strain BCT-7112T (NCIMB 14858T) has been widely used as an additive in animal nutrition for more than 30 years without reports of adverse toxigenic effects. However, this strain is resistant to chloramphenicol and tetracycline and it is generally considered inadvisable to introduce into the food chain resistance determinants capable of being transferred to other bacterial strains, thereby adding to the pool of such determinants in the gastro-enteric systems of livestock species. We therefore characterized the resistance phenotypes of this strain and its close relatives to determine whether they were of recent origin, and therefore likely to be transmissible. To this end we identified the genes responsible for chloramphenicol (catQ) and tetracycline (tetM) resistance and confirmed the presence of homologs in other members of the B. toyonensis taxonomic unit. Unexpectedly, closely related strains encoding these genes did not exhibit chloramphenicol and tetracycline resistance phenotypes. To understand the differences in the behaviors, we cloned and expressed the genes, together with their upstream regulatory regions, into Bacillus subtilis. The data showed that the genes encoded functional proteins, but were expressed inefficiently from their native promoters. B. toyonensis is a taxonomic unit member of the Bacillus cereus group (sensu lato). We therefore extended the analysis to determine the extent to which homologous chloramphenicol and tetracycline resistance genes were present in other species within this group. This analysis revealed that homologous genes were present in nearly all representative species within the B. cereus group (sensu lato). The absence of known transposition elements and the observations that they are found at the same genomic locations, indicates that these chloramphenicol and tetracycline resistance genes are of ancient origin and intrinsic to this taxonomic group, rather than recent acquisitions. In this context we

  3. Host range of antibiotic resistance genes in wastewater treatment plant influent and effluent.

    Science.gov (United States)

    Hultman, Jenni; Tamminen, Manu; Pärnänen, Katariina; Cairns, Johannes; Karkman, Antti; Virta, Marko

    2018-04-01

    Wastewater treatment plants (WWTPs) collect wastewater from various sources for a multi-step treatment process. By mixing a large variety of bacteria and promoting their proximity, WWTPs constitute potential hotspots for the emergence of antibiotic resistant bacteria. Concerns have been expressed regarding the potential of WWTPs to spread antibiotic resistance genes (ARGs) from environmental reservoirs to human pathogens. We utilized epicPCR (Emulsion, Paired Isolation and Concatenation PCR) to detect the bacterial hosts of ARGs in two WWTPs. We identified the host distribution of four resistance-associated genes (tetM, int1, qacEΔ1and blaOXA-58) in influent and effluent. The bacterial hosts of these resistance genes varied between the WWTP influent and effluent, with a generally decreasing host range in the effluent. Through 16S rRNA gene sequencing, it was determined that the resistance gene carrying bacteria include both abundant and rare taxa. Our results suggest that the studied WWTPs mostly succeed in decreasing the host range of the resistance genes during the treatment process. Still, there were instances where effluent contained resistance genes in bacterial groups not carrying these genes in the influent. By permitting exhaustive profiling of resistance-associated gene hosts in WWTP bacterial communities, the application of epicPCR provides a new level of precision to our resistance gene risk estimates.

  4. Analytical Performance of Multiplexed Screening Test for 10 Antibiotic Resistance Genes from Perianal Swab Samples.

    Science.gov (United States)

    Walker, G Terrance; Rockweiler, Tony J; Kersey, Rossio K; Frye, Kelly L; Mitchner, Susan R; Toal, Douglas R; Quan, Julia

    2016-02-01

    Multiantibiotic-resistant bacteria pose a threat to patients and place an economic burden on health care systems. Carbapenem-resistant bacilli and extended-spectrum β-lactamase (ESBL) producers drive the need to screen infected and colonized patients for patient management and infection control. We describe a multiplex microfluidic PCR test for perianal swab samples (Acuitas(®) MDRO Gene Test, OpGen) that detects the vancomycin-resistance gene vanA plus hundreds of gene subtypes from the carbapenemase and ESBL families Klebsiella pneumoniae carbapenemase (KPC), New Delhi metallo-β-lactamase (NDM), Verona integron-mediated metallo-β-lactamase (VIM), imipenemase metallo-β-lactamase (IMP), OXA-23, OXA-48, OXA-51, CTX-M-1, and CTX-M-2, regardless of the bacterial species harboring the antibiotic resistance. Analytical test sensitivity per perianal swab is 11-250 CFU of bacteria harboring the antibiotic resistance genes. Test throughput is 182 samples per test run (1820 antibiotic resistance gene family results). We demonstrate reproducible test performance and 100% gene specificity for 265 clinical bacterial organisms harboring a variety of antibiotic resistance genes. The Acuitas MDRO Gene Test is a sensitive, specific, and high-throughput test to screen colonized patients and diagnose infections for several antibiotic resistance genes directly from perianal swab samples, regardless of the bacterial species harboring the resistance genes. © 2015 American Association for Clinical Chemistry.

  5. Characterization of Stripe Rust Resistance Genes in the Wheat Cultivar Chuanmai45

    Directory of Open Access Journals (Sweden)

    Ennian Yang

    2016-04-01

    Full Text Available The objective of this research was to characterize the high level of resistance to stripe that has been observed in the released wheat cultivar, Chuanmai45. A combination of classic genetic analysis, molecular and cytogenetic methods were used to characterize resistance in an F2 population derived from Chuanmai45 and the susceptible Chuanmai42. Inheritance of resistance was shown to be conferred by two genes in Chuanmai45. Fluorescence in situ hybridization (FISH was used along with segregation studies to show that one gene was located on a 1RS.1BL translocation. Molecular markers were employed to show that the other locus was located on chromosome 4B. The defeated gene, Yr24/26, on chromosome 1BL was present in the susceptible parent and lines that recombined this gene with the 1RS.1BL translocation were identified. The germplasm, loci, and associated markers identified in this study will be useful for application in breeding programs utilizing marker-assisted selection.

  6. Pyramiding of three bacterial blight resistance genes for broad-spectrum resistance in deepwater rice variety, Jalmagna.

    Science.gov (United States)

    Pradhan, Sharat Kumar; Nayak, Deepak Kumar; Mohanty, Soumya; Behera, Lambodar; Barik, Saumya Ranjan; Pandit, Elssa; Lenka, Srikanta; Anandan, Annamalai

    2015-12-01

    Jalmagna is a popular deepwater rice variety with farmers of India because of its good yield under waterlogged condition. However, the variety is highly susceptible to bacterial blight (BB) disease. The development of resistant cultivars has been the most effective and economical strategy to control the disease under deepwater situation. Three resistance genes (xa5 + xa13 + Xa21) were transferred from Swarna BB pyramid line, using a marker-assisted backcrossing (MAB) breeding strategy, into the BB-susceptible elite deepwater cultivar, Jalmagna. Molecular marker integrated backcross breeding program has been employed to transfer three major BB resistance genes (Xa21, xa13 and xa5) into Jalmagna variety. During backcross generations, markers closely linked to the three genes were used to select plants possessing these resistance genes and markers polymorphic between donor and recurrent parent were used to select plants that have maximum contribution from the recurrent parent genome. A selected BC3F1 plant was selfed to generate homozygous BC3F2 plants with different combinations of BB resistance genes. The three-gene pyramid and two gene pyramid lines exhibited high levels of resistance against the BB pathogen. Under conditions of BB infection, the three-gene pyramided lines exhibited a significant yield advantage over Jalmagna. The selected pyramided lines showed all agro-morphologic traits of Jalmagna without compromising the yield. The three major BB resistance genes pyramided lines exhibited high level of resistance and are expected to provide durable resistance under deep water situation where control through chemicals is less effective. High similarity in agro-morphologic traits and absence of antagonistic effects for yield and other characters were observed in the best pyramided lines.

  7. Tagging microsatellite marker to a blast resistance gene in the irrigated rice cultivar Cica-8

    Directory of Open Access Journals (Sweden)

    Thiago Martins Pinheiro

    2012-09-01

    Full Text Available The rice cultivar Cica-8 exhibit differential reaction to several pathotypes of Magnaporthe oryzae. The objective of the present investigation was to determine the number of alleles involved in the expression of resistance to leaf blast and identify microsatellite markers linked to these alleles. A cross between cultivar Metica-1 and Cica-8 susceptible and resistant, respectively, to pathotype IB-1 (Py1049 was made to obtain F1, F2, BC1:1 and BC1:2 progenies. Greenhouse tests for leaf blast reaction showed that resistance is controlled by a monogenic dominant gene. For testing microsatellite markers, DNA of both resistant and susceptible parents and F1 and F2 populations was extracted. As expected for single dominant gene the F2 populations segregated at a ratio of 3:1. Of the 11 microsatellite markers tested, one marker RM 7102 was found to be closely linked to the resistant allele at a distance of 2.7 cM, in the cultivar Cica-8 to pathotype IB-1.

  8. Virulence Genes Profile of Multidrug Resistant Pseudomonas aeruginosa Isolated from Iranian Children with UTIs

    Directory of Open Access Journals (Sweden)

    Zohreh Heidary

    2016-04-01

    Full Text Available Virulent and resistant strains Pseudomonas aeruginosa (P. aeruginosa is one of the most important cause of UTIs in pediatrics. The present study was carried to investigate the frequency of virulence factors in the multi-drug resistant strains of P. aeruginosa isolated from pediatrics hospitalized due to the UTIs. One - hundred and forty three urine samples were collected from pediatric patients suffered from UTIs. Samples were cultured and those that were P. aeruginosa positive were analyzed for the presence of putative virulence genes. Seventy one out of 143 samples (49.65% were positive for P. aeruginosa. Monthly, sex and age-dependent prevalence were seen for P. aeruginosa. Bacterial strains had the highest levels of resistance against ampicillin (95.77%, gentamicin (92.95% and ciprofloxacin (81.69%. Of 71 P. aeruginosa isolates, 12 strains were resistant to more than 9 antibiotics (16.90%. The most commonly detected virulence factors in the cases of urethral infections were exoU and plcH while those of pyelonephritis and cystitis were were exoS and lasB. Our findings should raise awareness about antibiotic resistance in hospitalized pediatrics with UTIs in Iran. Clinicians should exercise caution in prescribing antibiotics, especially in cases of UTIs. Such information can help in identifying these virulence genes as useful diagnostic markers for clinical P. aeruginosa strains isolated from UTIs.

  9. Molecular mapping of a sunflower rust resistance gene from HAR6.

    Science.gov (United States)

    Bulos, Mariano; Ramos, María L; Altieri, Emiliano; Sala, Carlos A

    2013-03-01

    Sunflower rust, caused by Puccinia helianthi Schw., can result in significant yield losses in cultivated sunflower (Helianthus annuus L. var. macrocarpus Ckll.). HAR6 is a germplasm population resistant to most predominant rust races. The objectives of this study were to map the resistance factor present in HAR6 (R HAR6 ), and to provide and validate molecular tools for the identification of this gene for marker assisted selection purposes. Virulence reaction of seedlings for the F2 population and F2:3 families suggested that a single dominant gene confers rust resistance in HAR6-1, a selected rust resistance line from the original population. Genetic mapping with eight markers covered 97.4 cM of genetic distance on linkage group 13 of the sunflower consensus map. A co-dominant marker ZVG61 is the closest marker distal to R HAR6 at a genetic distance of 0.7 cM, while ORS581, a dominant marker linked in the coupling phase, is proximal to R HAR6 at a genetic distance of 1.5 cM. Validation of these markers was assessed by converting a susceptible line into a rust resistant isoline by means of marker assisted backcrossing. The application of these results to assist the breeding process and to design new strategies for rust control in sunflower is discussed.

  10. Detection of antibiotic resistance and tetracycline resistance genes in Enterobacteriaceae isolated from the Pearl rivers in South China

    Energy Technology Data Exchange (ETDEWEB)

    Tao Ran [State Key Laboratory of Organic Geochemistry, Guangzhou Institute of Geochemistry, Chinese Academy of Sciences, 511 Kehua Street, Tianhe District, Guangzhou 510640 (China); Ying Guangguo, E-mail: guangguo.ying@gmail.co [State Key Laboratory of Organic Geochemistry, Guangzhou Institute of Geochemistry, Chinese Academy of Sciences, 511 Kehua Street, Tianhe District, Guangzhou 510640 (China); Su Haochang [State Key Laboratory of Organic Geochemistry, Guangzhou Institute of Geochemistry, Chinese Academy of Sciences, 511 Kehua Street, Tianhe District, Guangzhou 510640 (China); Zhou Hongwei [Department of Environmental Health, School of Public Health and Tropical Medicine, Southern Medical University, 1838 North Guangzhou Street, Baiyun District, Guangzhou 510515 (China); Sidhu, Jatinder P.S. [CSIRO Land and Water, Queensland Bioscience Precinct, 306 Carmody Road, St Lucia QLD 4067 (Australia)

    2010-06-15

    This study investigated antibiotic resistance profiles and tetracycline resistance genes in Enterobacteriaceae family isolates from the Pearl rivers. The Enterobacteriaceae isolates were tested for susceptibility to seven antibiotics ampicillin, chloramphenicol, ciprofloxacin, levofloxacin, sulphamethoxazole/trimethoprim, tetracycline and trimethoprim. In Liuxi reservoir, with an exception to ampicillin resistant strains (11%) no other antibiotic resistance bacterial strains were detected. However, multiple drug resistance in bacterial isolates from the other sites of Pearl rivers was observed which is possibly due to sewage discharge and input from other anthropogenic sources along the rivers. Four tetracycline resistance genes tet A, tet B, tet C and tet D were detected in the isolates from the rivers. The genes tet A and tet B were widely detected with the detection frequencies of 43% and 40% respectively. Ciprofloxacin and levofloxacin resistant enteric bacteria were also isolated from the pig and duck manures which suggest a wider distribution of human specific drugs in the environment. This investigation provided a baseline data on antibiotic resistance profiles and tetracycline resistance genes in the Pearl rivers delta. - High rates of antibiotic resistance in Enterobacteriaceae from river water are attributed to wastewater contamination.

  11. Detection of antibiotic resistance and tetracycline resistance genes in Enterobacteriaceae isolated from the Pearl rivers in South China

    International Nuclear Information System (INIS)

    Tao Ran; Ying Guangguo; Su Haochang; Zhou Hongwei; Sidhu, Jatinder P.S.

    2010-01-01

    This study investigated antibiotic resistance profiles and tetracycline resistance genes in Enterobacteriaceae family isolates from the Pearl rivers. The Enterobacteriaceae isolates were tested for susceptibility to seven antibiotics ampicillin, chloramphenicol, ciprofloxacin, levofloxacin, sulphamethoxazole/trimethoprim, tetracycline and trimethoprim. In Liuxi reservoir, with an exception to ampicillin resistant strains (11%) no other antibiotic resistance bacterial strains were detected. However, multiple drug resistance in bacterial isolates from the other sites of Pearl rivers was observed which is possibly due to sewage discharge and input from other anthropogenic sources along the rivers. Four tetracycline resistance genes tet A, tet B, tet C and tet D were detected in the isolates from the rivers. The genes tet A and tet B were widely detected with the detection frequencies of 43% and 40% respectively. Ciprofloxacin and levofloxacin resistant enteric bacteria were also isolated from the pig and duck manures which suggest a wider distribution of human specific drugs in the environment. This investigation provided a baseline data on antibiotic resistance profiles and tetracycline resistance genes in the Pearl rivers delta. - High rates of antibiotic resistance in Enterobacteriaceae from river water are attributed to wastewater contamination.

  12. Plasmid metagenomics reveals multiple antibiotic resistance gene classes among the gut microbiomes of hospitalised patients

    DEFF Research Database (Denmark)

    Jitwasinkul, Tossawan; Suriyaphol, Prapat; Tangphatsornruang, Sithichoke

    2016-01-01

    Antibiotic resistance genes are rapidly spread between pathogens and the normal flora, with plasmids playing an important role in their circulation. This study aimed to investigate antibiotic resistance plasmids in the gut microbiome of hospitalised patients. Stool samples were collected from seven...... sequences (using >80% alignment length as the cut-off), and ResFinder was used to classify the antibiotic resistance gene pools. Plasmid replicon modules were used for plasmid typing. Forty-six genes conferring resistance to several classes of antibiotics were identified in the stool samples. Several...... antibiotic resistance genes were shared by the patients; interestingly, most were reported previously in food animals and healthy humans. Four antibiotic resistance genes were found in the healthy subject. One gene (aph3-III) was identified in the patients and the healthy subject and was related...

  13. The Co-Selection of Fluoroquinolone Resistance Genes in the Gut Flora of Vietnamese Children

    NARCIS (Netherlands)

    Vien, Le Thi Minh; Minh, Ngo Ngoc Quang; Thuong, Tang Chi; Khuong, Huynh Duy; Nga, Tran Vu Thieu; Thompson, Corinne; Campbell, James I.; de Jong, Menno; Farrar, Jeremy J.; Schultsz, Constance; van Doorn, H. Rogier; Baker, Stephen

    2012-01-01

    Antimicrobial consumption is one of the major contributing factors facilitating the development and maintenance of bacteria exhibiting antimicrobial resistance. Plasmid-mediated quinolone resistance (PMQR) genes, such as the qnr family, can be horizontally transferred and contribute to reduced

  14. Current Status and Challenges in Identifying Disease Resistance Genes in Brassica napus

    Directory of Open Access Journals (Sweden)

    Ting Xiang Neik

    2017-11-01

    Full Text Available Brassica napus is an economically important crop across different continents including temperate and subtropical regions in Europe, Canada, South Asia, China and Australia. Its widespread cultivation also brings setbacks as it plays host to fungal, oomycete and chytrid pathogens that can lead to serious yield loss. For sustainable crop production, identification of resistance (R genes in B. napus has become of critical importance. In this review, we discuss four key pathogens affecting Brassica crops: Clubroot (Plasmodiophora brassicae, Blackleg (Leptosphaeria maculans and L. biglobosa, Sclerotinia Stem Rot (Sclerotinia sclerotiorum, and Downy Mildew (Hyaloperonospora parasitica. We first review current studies covering prevalence of these pathogens on Brassica crops and highlight the R genes and QTL that have been identified from Brassica species against these pathogens. Insights into the relationships between the pathogen and its Brassica host, the unique host resistance mechanisms and how these affect resistance outcomes is also presented. We discuss challenges in identification and deployment of R genes in B. napus in relation to highly specific genetic interactions between host subpopulations and pathogen pathotypes and emphasize the need for common or shared techniques and research materials or tighter collaboration between researchers to reconcile the inconsistencies in the research outcomes. Using current genomics tools, we provide examples of how characterization and cloning of R genes in B. napus can be carried out more effectively. Lastly, we put forward strategies to breed resistant cultivars through introgressions supported by genomic approaches and suggest prospects that can be implemented in the future for a better, pathogen-resistant B. napus.

  15. Current Status and Challenges in Identifying Disease Resistance Genes in Brassica napus

    Science.gov (United States)

    Neik, Ting Xiang; Barbetti, Martin J.; Batley, Jacqueline

    2017-01-01

    Brassica napus is an economically important crop across different continents including temperate and subtropical regions in Europe, Canada, South Asia, China and Australia. Its widespread cultivation also brings setbacks as it plays host to fungal, oomycete and chytrid pathogens that can lead to serious yield loss. For sustainable crop production, identification of resistance (R) genes in B. napus has become of critical importance. In this review, we discuss four key pathogens affecting Brassica crops: Clubroot (Plasmodiophora brassicae), Blackleg (Leptosphaeria maculans and L. biglobosa), Sclerotinia Stem Rot (Sclerotinia sclerotiorum), and Downy Mildew (Hyaloperonospora parasitica). We first review current studies covering prevalence of these pathogens on Brassica crops and highlight the R genes and QTL that have been identified from Brassica species against these pathogens. Insights into the relationships between the pathogen and its Brassica host, the unique host resistance mechanisms and how these affect resistance outcomes is also presented. We discuss challenges in identification and deployment of R genes in B. napus in relation to highly specific genetic interactions between host subpopulations and pathogen pathotypes and emphasize the need for common or shared techniques and research materials or tighter collaboration between researchers to reconcile the inconsistencies in the research outcomes. Using current genomics tools, we provide examples of how characterization and cloning of R genes in B. napus can be carried out more effectively. Lastly, we put forward strategies to breed resistant cultivars through introgressions supported by genomic approaches and suggest prospects that can be implemented in the future for a better, pathogen-resistant B. napus. PMID:29163558

  16. Strategy of gene silencing in cassava for validation of resistance genes

    International Nuclear Information System (INIS)

    Cortes, Simon; Lopez, Camilo

    2010-01-01

    Cassava (Manihot esculenta) is a major source of food for more than 1000 million people in the world and constitutes an important staple crop. Cassava bacterial blight, caused by the gram negative bacterium Xanthomonas axonopodis pv. manihotis, is one of the most important constraints for this crop. A candidate resistance gene against cassava bacterial blight, named RXam1, has been identified previously. In this work, we employed the gene silencing approach using the African cassava mosaic virus (ACMV) to validate the function of the RXam1 gene. We used as positive control the su gen, which produce photo blanching in leaves when is silenced. Plants from the SG10735 variety were bombardment with the ACMV-A-SU+ACMV-B y ACMV-A-RXam1+ACMV-B constructions. The silencing efficiency employing the su gene was low, only one of seven plants showed photo blanching. In the putative silenced plants for the RXam1 gene, no presence of siRNAs corresponding to RXam1 was observed; although a low diminution of the RXam1 gene expression was obtained. The growth curves for the Xam strain CIO136 in cassava plants inoculated showing a little but no significance difference in the susceptibility in the silenced plants compared to not silenced

  17. Characterization of microbiota composition and presence of selected antibiotic resistance genes in carriage water of ornamental fish.

    Science.gov (United States)

    Gerzova, Lenka; Videnska, Petra; Faldynova, Marcela; Sedlar, Karel; Provaznik, Ivo; Cizek, Alois; Rychlik, Ivan

    2014-01-01

    International trade with ornamental fish is gradually recognized as an important source of a wide range of different antibiotic resistant bacteria. In this study we therefore characterized the prevalence of selected antibiotic resistance genes in the microbiota found in the carriage water of ornamental fish originating from 3 different continents. Real-time PCR quantification showed that the sul1 gene was present in 11 out of 100 bacteria. tet(A) was present in 6 out of 100 bacteria and strA, tet(G), sul2 and aadA were present in 1-2 copies per 100 bacteria. Class I integrons were quite common in carriage water microbiota, however, pyrosequencing showed that only 12 different antibiotic gene cassettes were present in class I integrons. The microbiota characterized by pyrosequencing of the V3/V4 variable region of 16S rRNA genes consisted of Proteobacteria (48%), Bacteroidetes (29.5%), Firmicutes (17.8%), Actinobacteria (2.1%) and Fusobacteria (1.6%). Correlation analysis between antibiotic resistance gene prevalence and microbiota composition verified by bacterial culture showed that major reservoirs of sul1 sul2, tet(A), tet(B) tet(G), cat, cml, bla, strA, aacA, aph and aadA could be found among Alpha-, Beta- and Gammaproteobacteria with representatives of Enterobacteriaceae, Pseudomonadaceae, Rhizobiaceae and Comamonadaceae being those most positively associated with the tested antibiotic resistance genes.

  18. [Investigation of plasmid-mediated quinolone resistance genes in quinolone-resistant Escherichia coli and Klebsiella spp. isolates from bloodstream infections].

    Science.gov (United States)

    Buruk, Celal Kurtuluş; Öztel Ocak, Hikmet; Bayramoğlu, Gülçin; Aydın, Faruk

    2016-04-01

    .2% and 61.5%; qnrS, 1.4% and 7.7%; qepA, 1.4% (only E.coli); aac(6')-1b-cr, 38.9% and 92.3%; and oqxAB, 1.4% and 84.6%, respectively. qnrC and qnrD genes were not detected. Carriage of multiple resistance genes were observed more frequently among resistant Klebsiella isolates than E.coli strains. As a result, in this study investigating the contribution of transferrable genes to quinolone resistance, prevalence of PMQR genes in quinolone-resistant and blood isolates of E.coli and Klebsiella in our university hospital serving the region were found to be higher than the current data reported from the other studies in our country. Furthermore, this study presented the initial data for the first time in our country on the prevalence of qnrD which was undetected, and the frequency of oqxAB gene in clinical samples. However, location of oqxAB gene needs to be confirmed by conjugation or hybridization methods.

  19. Antimicrobial Resistance and Resistance Genes in Aerobic Bacteria Isolated from Pork at Slaughter

    DEFF Research Database (Denmark)

    Li, Lili; Olsen, Rikke Heidemann; Ye, Lei

    2016-01-01

    The aim of this study was to investigate the phenotypic and genotypic antimicrobial resistance, integrons, and transferability of resistance markers in 243 aerobic bacteria recovered from pork at slaughter in the People's Republic of China. The organisms belonged to 22 genera of gram......-negative bacteria (92.2%) and gram-positive bacteria (7.8%). High levels of resistance were detected to tetracycline, trimethoprim-sulfamethoxazole, and ampicillin (36.2 to 54.3%), and lower levels were detected to nitrofurantoin, cefotaxime, gentamicin, ciprofloxacin, and chloramphenicol (7.8 to 29.2%). Across...... species, genes conferring antimicrobial resistance were observed with the following frequencies: bla TEM, 40.7%; bla CMY-2, 15.2%; bla CTX-M, 11.5%; sul2, 27.2%; sul1, 14.4%; tet(A), 5.4%;tet(L), 5.4%; tet(M), 5.0%; tet(E), 3.7%; tet(C), 3.3%; tet(S), 2.5%; and tet(K), 0.8%. Various antimicrobial...

  20. Evaluation of an expanded microarray for detecting antibiotic resistance genes in a broad range of gram-negative bacterial pathogens.

    Science.gov (United States)

    Card, Roderick; Zhang, Jiancheng; Das, Priya; Cook, Charlotte; Woodford, Neil; Anjum, Muna F

    2013-01-01

    A microarray capable of detecting genes for resistance to 75 clinically relevant antibiotics encompassing 19 different antimicrobial classes was tested on 132 Gram-negative bacteria. Microarray-positive results correlated >91% with antimicrobial resistance phenotypes, assessed using British Society for Antimicrobial Chemotherapy clinical breakpoints; the overall test specificity was >83%. Microarray-positive results without a corresponding resistance phenotype matched 94% with PCR results, indicating accurate detection of genes present in the respective bacteria by microarray when expression was low or absent and, hence, undetectable by susceptibility testing. The low sensitivity and negative predictive values of the microarray results for identifying resistance to some antimicrobial resistance classes are likely due to the limited number of resistance genes present on the current microarray for those antimicrobial agents or to mutation-based resistance mechanisms. With regular updates, this microarray can be used for clinical diagnostics to help accurate therapeutic options to be taken following infection with multiple-antibiotic-resistant Gram-negative bacteria and prevent treatment failure.

  1. Genome-Wide Distribution, Organisation and Functional Characterization of Disease Resistance and Defence Response Genes across Rice Species

    Science.gov (United States)

    Singh, Sangeeta; Chand, Suresh; Singh, N. K.; Sharma, Tilak Raj

    2015-01-01

    The resistance (R) genes and defense response (DR) genes have become very important resources for the development of disease resistant cultivars. In the present investigation, genome-wide identification, expression, phylogenetic and synteny analysis was done for R and DR-genes across three species of rice viz: Oryza sativa ssp indica cv 93-11, Oryza sativa ssp japonica and wild rice species, Oryza brachyantha. We used the in silico approach to identify and map 786 R -genes and 167 DR-genes, 672 R-genes and 142 DR-genes, 251 R-genes and 86 DR-genes in the japonica, indica and O. brachyanth a genomes, respectively. Our analysis showed that 60.5% and 55.6% of the R-genes are tandemly repeated within clusters and distributed over all the rice chromosomes in indica and japonica genomes, respectively. The phylogenetic analysis along with motif distribution shows high degree of conservation of R- and DR-genes in clusters. In silico expression analysis of R-genes and DR-genes showed more than 85% were expressed genes showing corresponding EST matches in the databases. This study gave special emphasis on mechanisms of gene evolution and duplication for R and DR genes across species. Analysis of paralogs across rice species indicated 17% and 4.38% R-genes, 29% and 11.63% DR-genes duplication in indica and Oryza brachyantha, as compared to 20% and 26% duplication of R-genes and DR-genes in japonica respectively. We found that during the course of duplication only 9.5% of R- and DR-genes changed their function and rest of the genes have maintained their identity. Syntenic relationship across three genomes inferred that more orthology is shared between indica and japonica genomes as compared to brachyantha genome. Genome wide identification of R-genes and DR-genes in the rice genome will help in allele mining and functional validation of these genes, and to understand molecular mechanism of disease resistance and their evolution in rice and related species. PMID:25902056

  2. Candidate genes for cross-resistance against DNA-damaging drugs

    DEFF Research Database (Denmark)

    Wittig, Rainer; Nessling, Michelle; Will, Rainer D

    2002-01-01

    Drug resistance of tumor cells leads to major drawbacks in the treatment of cancer. To identify candidate genes for drug resistance, we compared the expression patterns of the drug-sensitive human malignant melanoma cell line MeWo and three derived sublines with acquired resistance to the DNA...... as several apoptosis-related genes, in particular STK17A and CRYAB. As MPP1 and CRYAB are also among the 14 genes differentially expressed in all three of the drug-resistant sublines, they represent the strongest candidates for resistance against DNA-damaging drugs....

  3. Bacterial plasmid-mediated quinolone resistance genes in aquatic environments in China.

    Science.gov (United States)

    Yan, Lei; Liu, Dan; Wang, Xin-Hua; Wang, Yunkun; Zhang, Bo; Wang, Mingyu; Xu, Hai

    2017-01-17

    Emerging antimicrobial resistance is a major threat to human's health in the 21 st century. Understanding and combating this issue requires a full and unbiased assessment of the current status on the prevalence of antimicrobial resistance genes and their correlation with each other and bacterial groups. In aquatic environments that are known reservoirs for antimicrobial resistance genes, we were able to reach this goal on plasmid-mediated quinolone resistance (PMQR) genes that lead to resistance to quinolones and possibly also to the co-emergence of resistance to β-lactams. Novel findings were made that qepA and aac-(6')-Ib genes that were previously regarded as similarly abundant with qnr genes are now dominant among PMQR genes in aquatic environments. Further statistical analysis suggested that the correlation between PMQR and β-lactam resistance genes in the environment is still weak, that the correlations between antimicrobial resistance genes could be weakened by sufficient wastewater treatment, and that the prevalence of PMQR has been implicated in environmental, pathogenic, predatory, anaerobic, and more importantly, human symbiotic bacteria. This work provides a comprehensive analysis of PMQR genes in aquatic environments in Jinan, China, and provides information with which combat with the antimicrobial resistance problem may be fought.

  4. The tandem repeated organization of NB-LRR genes in the clubroot-resistant CRb locus in Brassica rapa L.

    Science.gov (United States)

    Hatakeyama, Katsunori; Niwa, Tomohisa; Kato, Takeyuki; Ohara, Takayoshi; Kakizaki, Tomohiro; Matsumoto, Satoru

    2017-04-01

    To facilitate prevention of clubroot disease, a major threat to the successful cultivation of Chinese cabbage (Brassica rapa L.), we bred clubroot-resistant (CR) cultivars by introducing resistance genes from CR turnips via conventional breeding. Among 11 CR loci found in B. rapa, we identified CRb in Chinese cabbage cultivar 'CR Shinki' as a single dominant gene for resistance against Plasmodiophora brassicae pathotype group 3, against which the stacking of Crr1 and Crr2 loci was not effective. However, the precise location and pathotype specificity of CRb have been controversial, because CRa and Rcr1 also map near this locus. Previously, our fine-mapping study revealed that CRb is located in a 140-kb genomic region on chromosome A03. Here, we determined the nucleotide sequence of an approximately 64-kb candidate region in the resistant line; this region contains six open reading frames (ORFs) similar to NB-LRR encoding genes that are predicted to occur in tandem with the same orientation. Among the six ORFs present, only four on the genome of the resistant line showed a strong DNA sequence identity with each other, and only one of those four could confer resistance to P. brassicae isolate No. 14 of the pathotype group 3. These results suggest that these genes evolved through recent gene duplication and uneven crossover events that could lead to the acquisition of clubroot resistance. The DNA sequence of the functional ORF was identical to that of the previously cloned CRa gene; thus, we showed that the independently identified CRb and CRa are one and the same clubroot-resistance gene.

  5. Mutations in the rpsL gene are involved in streptomycin resistance in Campylobacter coli.

    Science.gov (United States)

    Olkkola, Satu; Juntunen, Pekka; Heiska, Helmi; Hyytiäinen, Heidi; Hänninen, Marja-Liisa

    2010-06-01

    To characterize the mechanisms of streptomycin (STR) resistance in Campylobacter coli, we chose 17 isolates that were resistant to STR, erythromycin (ERY), or both, and the putative STR resistance target genes rpsL, rrs, and gidB were analyzed for mutations. The presence of the aadE gene encoding aminoglycoside 6-adenylyltransferase was also evaluated. To reveal putative connection between ERY and STR resistance mechanisms, 13 C. coli isolates initially susceptible to STR and ERY were exposed to STR, and resistant variants were characterized. We also assessed the development of ERY resistance with a similar method. Finally, the effect of the putative CmeABC efflux pump inhibitor phenyl-arginine-beta-naphthylamine on STR resistance was tested. Our studies showed an association between mutations in the rpsL gene and STR resistance in C. coli. Further, mutations obtained in vitro were more diverse than those occurring in vivo. However, we observed no resistance associated mutations in the other genes studied, and selection with STR did not result in variants resistant to ERY and vice versa. None of the isolates harbored the aadE gene, and no differences in STR minimum inhibitory concentration levels were detected in the presence or absence of phenyl-arginine-beta-naphthylamine. In conclusion, we found that STR resistance was associated with mutations in the rpsL gene, but no obvious association between STR and ERY resistance mechanisms was found in C. coli.

  6. Resistance Genes and Genetic Elements Associated with Antibiotic Resistance in Clinical and Commensal Isolates of Streptococcus salivarius.

    Science.gov (United States)

    Chaffanel, Fanny; Charron-Bourgoin, Florence; Libante, Virginie; Leblond-Bourget, Nathalie; Payot, Sophie

    2015-06-15

    The diversity of clinical (n = 92) and oral and digestive commensal (n = 120) isolates of Streptococcus salivarius was analyzed by multilocus sequence typing (MLST). No clustering of clinical or commensal strains can be observed in the phylogenetic tree. Selected strains (92 clinical and 46 commensal strains) were then examined for their susceptibilities to tetracyclines, macrolides, lincosamides, aminoglycosides, and phenicol antibiotics. The presence of resistance genes tet(M), tet(O), erm(A), erm(B), mef(A/E), and catQ and associated genetic elements was investigated by PCR, as was the genetic linkage of resistance genes. High rates of erythromycin and tetracycline resistance were observed among the strains. Clinical strains displayed either the erm(B) (macrolide-lincosamide-streptogramin B [MLSB] phenotype) or mef(A/E) (M phenotype) resistance determinant, whereas almost all the commensal strains harbored the mef(A/E) resistance gene, carried by a macrolide efflux genetic assembly (MEGA) element. A genetic linkage between a macrolide resistance gene and genes of Tn916 was detected in 23 clinical strains and 5 commensal strains, with a predominance of Tn3872 elements (n = 13), followed by Tn6002 (n = 11) and Tn2009 (n = 4) elements. Four strains harboring a mef(A/E) gene were also resistant to chloramphenicol and carried a catQ gene. Sequencing of the genome of one of these strains revealed that these genes colocalized on an IQ-like element, as already described for other viridans group streptococci. ICESt3-related elements were also detected in half of the isolates. This work highlights the potential role of S. salivarius in the spread of antibiotic resistance genes both in the oral sphere and in the gut. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  7. Abundance of antibiotic resistance genes in environmental bacteriophages.

    Science.gov (United States)

    Anand, Taruna; Bera, Bidhan Ch; Vaid, Rajesh K; Barua, Sanjay; Riyesh, Thachamvally; Virmani, Nitin; Hussain, Mubarik; Singh, Raj K; Tripathi, Bhupendra N

    2016-12-01

    The ecosystem is continuously exposed to a wide variety of antimicrobials through waste effluents, agricultural run-offs and animal-related and anthropogenic activities, which contribute to the spread of antibiotic resistance genes (ARGs). The contamination of ecosystems with ARGs may create increased opportunities for their transfer to naive microbes and eventually lead to entry into the human food chain. Transduction is a significant mechanism of horizontal gene transfer in natural environments, which has traditionally been underestimated as compared to transformation. We explored the presence of ARGs in environmental bacteriophages in order to recognize their contribution in the spread of ARGs in environmental settings. Bacteriophages were isolated against environmental bacterial isolates, purified and bulk cultured. They were characterized, and detection of ARG and intI genes including blaTEM, blaOXA-2, intI1, intI2, intI3, tetA and tetW was carried out by PCR. This study revealed the presence of various genes [tetA (12.7 %), intI1 (10.9 %), intI2 (10.9 %), intI3 (9.1 %), tetW (9.1 %) and blaOXA-2 (3.6 %)] and blaTEM in a significantly higher proportion (30.9 %). blaSHV, blaOXA-1, tetO, tetB, tetG, tetM and tetS were not detected in any of the phages. Soil phages were the most versatile in terms of ARG carriage. Also, the relative abundance of tetA differed significantly vis-à-vis source. The phages from organized farms showed varied ARGs as compared to the unorganized sector, although blaTEM ARG incidences did not differ significantly. The study reflects on the role of phages in dissemination of ARGs in environmental reservoirs, which may provide an early warning system for future clinically relevant resistance mechanisms.

  8. [Advances in molecular mechanisms of bacterial resistance caused by stress-induced transfer of resistance genes--a review].

    Science.gov (United States)

    Sun, Dongchang; Wang, Bing; Zhu, Lihong

    2013-07-04

    The transfer of resistance gene is one of the most important causes of bacterial resistance. Recent studies reveal that stresses induce the transfer of antibiotic resistance gene through multiple mechanisms. DNA damage stresses trigger bacterial SOS response and induce the transfer of resistance gene mediated by conjugative DNA. Antibiotic stresses induce natural bacterial competence for transformation in some bacteria which lack the SOS system. In addition, our latest studies show that the general stress response regulator RpoS regulates a novel type of resistance gene transfer which is mediated by double-stranded plasmid DNA and occurs exclusively on the solid surface. In this review, we summarized recent advances in SOS dependent and independent stress-induced DNA transfer which is mediated by conjugation and transformation respectively, and the transfer of double-stranded plasmid DNA on the solid surface which is regulated by RpoS. We propose that future work should address how stresses activate the key regulators and how these regulators control the expression of gene transfer related genes. Answers to the above questions would pave the way for searching for candidate targets for controlling bacterial resistance resulted from the transfer of antibiotic genes.

  9. Antibiotic resistance genes in anaerobic bacteria isolated from primary dental root canal infections.

    Science.gov (United States)

    Rôças, Isabela N; Siqueira, José F

    2012-12-01

    Fourty-one bacterial strains isolated from infected dental root canals and identified by 16S rRNA gene sequence were screened for the presence of 14 genes encoding resistance to beta-lactams, tetracycline and macrolides. Thirteen isolates (32%) were positive for at least one of the target antibiotic resistance genes. These strains carrying at least one antibiotic resistance gene belonged to 11 of the 26 (42%) infected root canals sampled. Two of these positive cases had two strains carrying resistance genes. Six out of 7 Fusobacterium strains harbored at least one of the target resistance genes. One Dialister invisus strain was positive for 3 resistance genes, and 4 other strains carried two of the target genes. Of the 6 antibiotic resistance genes detected in root canal strains, the most prevalent were blaTEM (17% of the strains), tetW (10%), and ermC (10%). Some as-yet-uncharacterized Fusobacterium and Prevotella isolates were positive for blaTEM, cfxA and tetM. Findings demonstrated that an unexpectedly large proportion of dental root canal isolates, including as-yet-uncharacterized strains previously regarded as uncultivated phylotypes, can carry antibiotic resistance genes. Copyright © 2012 Elsevier Ltd. All rights reserved.

  10. Occurrence and persistence of antibiotic resistance genes in river biofilms after wastewater inputs in small rivers

    International Nuclear Information System (INIS)

    Proia, Lorenzo; Schiller, Daniel von; Sànchez-Melsió, Alexandre; Sabater, Sergi; Borrego, Carles M.; Rodríguez-Mozaz, Sara; Balcázar, José Luis

    2016-01-01

    The extensive use of antibiotics in human and veterinary medicine and their subsequent release into the environment may have direct consequences for autochthonous bacterial communities, especially in freshwater ecosystems. In small streams and rivers, local inputs of wastewater treatment plants (WWTPs) may become important sources of organic matter, nutrients and emerging pollutants, such as antibiotic resistance genes (ARGs). In this study, we evaluated the effect of WWTP effluents as a source of ARGs in river biofilms. The prevalence of genes conferring resistance to main antibiotic families, such as beta-lactams (bla CTX-M ), fluoroquinolones (qnrS), sulfonamides (sul I), and macrolides (ermB), was determined using quantitative PCR (qPCR) in biofilm samples collected upstream and downstream WWTPs discharge points in four low-order streams. Our results showed that the WWTP effluents strongly modified the hydrology, physico-chemistry and biological characteristics of the receiving streams and favoured the persistence and spread of antibiotic resistance in microbial benthic communities. It was also shown that the magnitude of effects depended on the relative contribution of each WWTP to the receiving system. Specifically, low concentrations of ARGs were detected at sites located upstream of the WWTPs, while a significant increase of their concentrations was observed in biofilms collected downstream of the WWTP discharge points (particularly ermB and sul I genes). These findings suggest that WWTP discharges may favour the increase and spread of antibiotic resistance among streambed biofilms. The present study also showed that the presence of ARGs in biofilms was noticeable far downstream of the WWTP discharge (up to 1 km). It is therefore reasonable to assume that biofilms may represent an ideal setting for the acquisition and spread of antibiotic resistance determinants and thus be considered suitable biological indicators of anthropogenic pollution by active

  11. Spatial patterns of Antimicrobial Resistance Genes in Danish Pig Farms

    DEFF Research Database (Denmark)

    Birkegård, Anna Camilla; Ersbøll, A. K.; Hisham Beshara Halasa, Tariq

    2016-01-01

    antimicrobial resistance genes, ermB, ermF, sulI, sulII, tet(M), tet(O) and tet(W), was quantified by a high-throughput qPCR. It was evaluated whether the sample method resulted in a study population representative of Danish pig farms with finishers where it was found that the study population was biased......Samples from 687 Danish pig farms were collected at five finisher slaughterhouses in February and March 2015. Faecal samples from five pigs per farm were collected randomly at the slaughter line and pooled into one sample per farm. DNA was extracted from the pooled samples and the level of seven...

  12. Modulation of human multidrug-resistance MDR-1 gene by natural curcuminoids

    International Nuclear Information System (INIS)

    Limtrakul, Pornngarm; Anuchapreeda, Songyot; Buddhasukh, Duang

    2004-01-01

    Multidrug resistance (MDR) is a phenomenon that is often associated with decreased intracellular drug accumulation in patient's tumor cells resulting from enhanced drug efflux. It is related to the overexpression of a membrane protein, P-glycoprotein (Pgp-170), thereby reducing drug cytotoxicity. A variety of studies have tried to find MDR modulators which increase drug accumulation in cancer cells. In this study, natural curcuminoids, pure curcumin, demethoxycurcumin and bisdemethoxycurcumin, isolated from turmeric (Curcuma longa Linn), were compared for their potential ability to modulate the human MDR-1 gene expression in multidrug resistant human cervical carcinoma cell line, KB-V1 by Western blot analysis and RT-PCR. Western blot analysis and RT-PCR showed that all the three curcuminoids inhibited MDR-1 gene expression, and bisdemethoxycurcumin produced maximum effect. In additional studies we found that commercial grade curcuminoid (approximately 77% curcumin, 17% demethoxycurcumin and 3% bisdemthoxycurcumin) decreased MDR-1 gene expression in a dose dependent manner and had about the same potent inhibitory effect on MDR-1 gene expression as our natural curcuminoid mixtures. These results indicate that bisdemethoxycurcumin is the most active of the curcuminoids present in turmeric for modulation of MDR-1 gene. Treatment of drug resistant KB-V1 cells with curcumin increased their sensitivity to vinblastine, which was consistent with a decreased MDR-1 gene product, a P-glycoprotein, on the cell plasma membrane. Although many drugs that prevent the P-glycoprotein function have been reported, this report describes the inhibition of MDR-1 expression by a phytochemical. The modulation of MDR-1 expression may be an attractive target for new chemosensitizing agents

  13. Saliva, supragingival biofilm and root canals can harbor gene associated with resistance to lactamic agents

    Directory of Open Access Journals (Sweden)

    Ludmila Coutinho MORAES

    2015-01-01

    Full Text Available This study aimed to determine the presence of Prevotella strains and genes associated with resistance to lactamics in different oral niches from patients with/without primary endodontic infections. Saliva (S and supragingival biofilm (SB were collected from three patient groups: Group I – no endodontic infection (n = 15; Group II – acute endodontic infection (n = 12; and Group III – chronic endodontic infection (n = 15. Root canal (RC samples were collected from Groups II and III. The presence of P. intermedia, P nigrescens, P. tannerae and cfxA/cfxA2 gene was assessed by PCR. The cfxA/cfxA2 gene was not detected in all environments within the same patient. The cfxA/cfxA2 gene was present in 23.81% of S samples, 28.57% of SB samples, and 7.41% of RC samples. Prevotella species were detected in 53.97%, 47.62% and 34.56% of the S, SB, and RC samples, respectively. P. intermedia had a high frequency in saliva samples from Group 3. Saliva samples from Group 1 had higher detection rates of P. nigrescens than did Groups 2 and 3. Patients without endodontic disease had high frequencies of P. nigrescens in the SB samples. The presence or absence of spontaneous symptoms was not related to the detection rates for resistance genes in the RC samples. Saliva, supragingival biofilm and root canals can harbor resistant bacteria. The presence of symptomatology did not increase the presence of the cfxA/cfxA2 gene in the supragingival biofilm and inside root canals.

  14. Mutations in Streptomycin Resistance Genes and Their Relationship to Streptomycin Resistance and Lineage ofMycobacterium tuberculosisThai Isolates.

    Science.gov (United States)

    Hlaing, Yin Moe; Tongtawe, Pongsri; Tapchaisri, Pramuan; Thanongsaksrikul, Jeeraphong; Thawornwan, Unchana; Archanachan, Buppa; Srimanote, Potjanee

    2017-04-01

    Streptomycin (SM) is recommended by the World Health Organization (WHO) as a part of standard regimens for retreating multidrug-resistant tuberculosis (MDR-TB) cases. The incidence of MDR-TB in retreatment cases was 19% in Thailand. To date, information on SM resistance (SMR) gene mutations correlated to the SMR of Mycobacterium tuberculosis Thai isolates is limited. In this study, the mutations in rpsL , rrs , gidB , and whiB7 were investigated and their association to SMR and the lineage of M. tuberculosis were explored. The lineages of 287 M. tuberculosis collected from 2007 to 2011 were identified by spoligotyping. Drug susceptibility profiles were evaluated by the absolute concentration method. Mutations in SMR genes of 46 SM-resistant and 55 SM-susceptible isolates were examined by DNA sequencing. Three rpsL (Lys43Arg, Lys88Arg, and Lys88Thr) and two gidB (Trp45Ter and Gly69Asp) mutations were present exclusively in the SM resistant M. tuberculosis . Lys43Arg rpsL was the most predominant SMR mutations (69.6%) and prevailed among Beijing isolates (presistant isolates lacking rpsL and rrs mutations. The significance of the three gidB mutations, 276A>C, 615A>G, and 330G>T, as lineage signatures for Beijing and EAI were underscored. This study identified 423G>A gidB as a novel sub-lineage marker for EAI6-BGD1. Our study suggested that the majority of SMR in M. tuberculosis Thai isolates were responsible by rpsL and gidB polymorphisms constantly providing the novel lineage specific makers.

  15. Effect of tetracycline residues in pig manure slurry on tetracycline-resistant bacteria and resistance gene tet(M) in soil microcosms

    DEFF Research Database (Denmark)

    Agersø, Yvonne; Wulff, Gitte; Vaclavik, Elvira

    2006-01-01

    Effects of tetracycline residues from pig manure slurry on the prevalence of tetracycline-resistant bacteria and the tetracycline resistance gene, tet(M), were studied in soil microcosms. Four types of soil microcosms were established for a period of 152 days, supplemented with combinations of pig...... and oxytetracycline were almost stable through out the experimental period, but the tetracycline concentrations had no effect on prevalence of tetracycline-resistant bacteria. The presented microcosm approach simulated natural farmland conditions well and supported results from previous field studies. (c) 2006...

  16. Molecular characterization of the hexose transporter gene in benznidazole resistant and susceptible populations of Trypanosoma cruzi

    Directory of Open Access Journals (Sweden)

    dos Santos Paula F

    2012-08-01

    Full Text Available Abstract Background Hexose transporters (HT are membrane proteins involved in the uptake of energy-supplying glucose and other hexoses into the cell. Previous studies employing the Differential Display technique have shown that the transcription level of the HT gene from T. cruzi (TcrHT is higher in an in vitro-induced benznidazole (BZ-resistant population of the parasite (17 LER than in its susceptible counterpart (17 WTS. Methods In the present study, TcrHT has been characterized in populations and strains of T. cruzi that are resistant or susceptible to BZ. We investigated the copy number and chromosomal location of the gene, the levels of TcrHT mRNA and of TcrHT activity, and the phylogenetic relationship between TcrHT and HTs from other organisms. Results In silico analyses revealed that 15 sequences of the TcrHT gene are present in the T. cruzi genome, considering both CL Brener haplotypes. Southern blot analyses confirmed that the gene is present as a multicopy tandem array and indicated a nucleotide sequence polymorphism associated to T. cruzi group I or II. Karyotype analyses revealed that TcrHT is located in two chromosomal bands varying in size from 1.85 to 2.6 Mb depending on the strain of T. cruzi. The sequence of amino acids in the HT from T. cruzi is closely related to the HT sequences of Leishmania species according to phylogenetic analysis. Northern blot and quantitative real-time reverse transcriptase polymerase chain reaction analyses revealed that TcrHT transcripts are 2.6-fold higher in the resistant 17 LER population than in the susceptible 17 WTS. Interestingly, the hexose transporter activity was 40% lower in the 17 LER population than in all other T. cruzi samples analyzed. This phenotype was detected only in the in vitro-induced BZ resistant population, but not in the in vivo-selected or naturally BZ resistant T. cruzi samples. Sequencing analysis revealed that the amino acid sequences of the TcrHT from 17WTS and 17

  17. Paraquat resistance in a Lolium rigidum population is governed by one major nuclear gene.

    Science.gov (United States)

    Yu, Qin; Han, Heping; Nguyen, Linh; Forster, John W; Powles, Stephen B

    2009-05-01

    Paraquat resistance in an annual ryegrass (Lolium rigidum Gaud.) population (AFLR1) has been attributed to reduced paraquat translocation. Genetic inheritance of paraquat resistance in this population was investigated in the present study. The paraquat dose response of progeny from 8 F(1) families was more similar to that of the resistant than the susceptible parent, while the equivalent data for a further three families were intermediate compared to those of the parental populations. No significant differences in dose response were observed between reciprocal crosses of specific F(1) families. These results suggest that paraquat resistance in AFLR1 is inherited as a dominant or partially dominant nuclear-encoded trait. Pseudo-F(2) (psi-F(2)) generation seedlings were treated with multiple dose rates sufficient to control the susceptible parental population, and observed segregation ratios in all instances conformed to a 3:1 (resistant:susceptible) segregation ratio, and this ratio was further confirmed by individual phenotyping of cloned plant genotypes. A single major nuclear gene is hence apparently responsible for evolved paraquat resistance in AFLR1.

  18. Distribution of genes encoding resistance to streptogramin A and related compounds among staphylococci resistant to these antibiotics.

    Science.gov (United States)

    Allignet, J; Aubert, S; Morvan, A; el Solh, N

    1996-01-01

    The levels of resistance to pristinamycin (Pt) and to its major constituents, pristinamycin IIA and IB (PIIA and PIB, respectively; classified as streptogramins A and B, respectively) were determined for 126 staphylococcal isolates. The results suggest tentative susceptibility breakpoints of or = 4 micrograms of PIIA per ml were investigated for the presence of staphylococcal genes encoding resistance to PIIA (vga, vat, and vatB) and PIB (vgb). None of these genes was found in the 4 isolates inhibited by 4 micrograms of PIIA per ml or in 4 of the other 52 isolates tested. The remaining 48 isolates harbored plasmids carrying vatB and vga or combinations of genes (vga-vat-vgb or vga-vat). The absence of any known PIIA resistance gene from the four Staphylococcus aureus isolates inhibited by > or = 8 micrograms of PIIA per ml suggests that there is at least one PIIA resistance mechanism in staphylococci that has not yet been characterized. PMID:8913457

  19. Analysis of antibiotic multi-resistant bacteria and resistance genes in the effluent of an intensive shrimp farm (Long An, Vietnam).

    Science.gov (United States)

    Pham, Thi Thu Hang; Rossi, Pierre; Dinh, Hoang Dang Khoa; Pham, Ngoc Tu Anh; Tran, Phuong Anh; Ho, To Thi Khai Mui; Dinh, Quoc Tuc; De Alencastro, Luiz Felippe

    2018-05-15

    In Vietnam, intensive shrimp farms heavily rely on a wide variety of antibiotics (ABs) to treat animals or prevent disease outbreak. Potential for the emergence of multi-resistant bacteria is high, with the concomitant contamination of adjacent natural aquatic habitats used for irrigation and drinking water, impairing in turn human health system. In the present study, quantification of AB multi-resistant bacteria was carried out in water and sediment samples from effluent channels connecting a shrimp farming area to the Vam Co River (Long An Province, Vietnam). Bacterial strains, e.g. Klebsiella pneumoniae and Aeromonas hydrophila, showing multi-resistance traits were isolated. Molecular biology analysis showed that these strains possessed from four to seven different AB resistance genes (ARGs) (e.g. sul1, sul2, qnrA, ermB, tetA, aac(6)lb, dfrA1, dfr12, dfrA5), conferring multidrug resistance capacity. Sequencing of plasmids present within these multi-resistant strains led to the identification of a total of forty-one resistance genes, targeting nine AB groups. qPCR analysis on the sul2 gene revealed the presence of high copy numbers in the effluent channel connecting to the Vam Co River. The results of the present study clearly indicated that multi-resistant bacteria present in intensive shrimp cultures may disseminate in the natural environment. This study offered a first insight in the impact of plasmid-born ARGs and the related pathogenic bacteria that could emerged due to inappropriate antibiotic utilization in South Vietnam. Copyright © 2018 Elsevier Ltd. All rights reserved.

  20. Molecular Cloning and Characterization of a Wild Eggplant Solanum aculeatissimum NBS-LRR Gene, Involved in Plant Resistance to Meloidogyne incognita

    OpenAIRE

    Xiaohui Zhou; Jun Liu; Shengyou Bao; Yan Yang; Yong Zhuang

    2018-01-01

    Root-knot nematodes, Meloidogyne spp., cause considerable damage in eggplant production. Transferring of resistance genes from wild relatives would be valuable for the continued improvement of eggplant. Solanum aculeatissimum, a wild relative of eggplant possessing resistance to Meloidogyne incognita, is potentially useful for genetically enhancing eggplant. In the present study, we have isolated and characterized a nucleotide-binding site leucine-rich repeat (NBS-LRR) resistance gene, design...

  1. Salt resistance genes revealed by functional metagenomics from brines and moderate-salinity rhizosphere within a hypersaline environment

    Directory of Open Access Journals (Sweden)

    Salvador eMirete

    2015-10-01

    Full Text Available Hypersaline environments are considered one of the most extreme habitats on earth and microorganisms have developed diverse molecular mechanisms of adaptation to withstand these conditions. The present study was aimed at identifying novel genes involved in salt resistance from the microbial communities of brines and the rhizosphere from the Es Trenc saltern (Mallorca, Spain. The microbial diversity assessed by pyrosequencing of 16S rRNA gene libraries revealed the presence of communities that are typical in such environments. Metagenomic libraries from brine and rhizosphere samples, were transferred to the osmosensitive strain Escherichia coli MKH13, and screened for salt resistance. As a result, eleven genes that conferred salt resistance were identified, some encoding for well known proteins previously related to osmoadaptation as a glycerol and a proton pump, whereas others encoded for proteins not previously related to this function in microorganisms as DNA/RNA helicases, an endonuclease III (Nth and hypothetical proteins of unknown function. Furthermore, four of the retrieved genes were cloned and expressed in Bacillus subtilis and they also exhibited salt resistance in this bacterium, broadening the spectrum of bacterial species where these genes can operate. This is the first report of salt resistance genes recovered from metagenomes of a hypersaline environment.

  2. Genetic mapping, marker assisted selection and allelic relationships for the Pu 6 gene conferring rust resistance in sunflower.

    Science.gov (United States)

    Bulos, Mariano; Vergani, Pablo Nicolas; Altieri, Emiliano

    2014-09-01

    Rust resistance in the sunflower line P386 is controlled by Pu 6 , a gene which was reported to segregate independently from other rust resistant genes, such as R 4 . The objectives of this work were to map Pu 6 , to provide and validate molecular tools for its identification, and to determine the linkage relationship of Pu 6 and R 4 . Genetic mapping of Pu 6 with six markers covered 24.8 cM of genetic distance on the lower end of linkage Group 13 of the sunflower consensus map. The marker most closely linked to Pu 6 was ORS316 at 2.5 cM in the distal position. ORS316 presented five alleles when was assayed with a representative set of resistant and susceptible lines. Allelism test between Pu 6 and R 4 indicated that both genes are linked at a genetic distance of 6.25 cM. This is the first confirmation based on an allelism test that at least two members of the R adv /R 4 /R 11 / R 13a /R 13b /Pu 6 cluster of genes are at different loci. A fine elucidation of the architecture of this complex locus will allow designing and constructing completely new genomic regions combining genes from different resistant sources and the elimination of the linkage drag around each resistant gene.

  3. Screening of antibiotic resistant gram negative bacteria and plasmid profiling of multi-drug resistant isolates present in sewage associated with health care centers

    OpenAIRE

    Khan Md. Anik Ashfaq, Sutradhar Pijush, Islam Mohammad Majharul, Ojha Ravi Kant, Biswas Gokul Chandra

    2013-01-01

    Background: Healthcare effluent acts as the store house of harmful infectious agents such as the pathogens and microorganisms possessing multiple drug resistant genes. Potential health risk includes spreading of diseases by these pathogens and wide dissemination of antimicrobial resistance genes. Gram-negative bacteria are particularly important for causing most of the hospital and community acquired infections. Aim: This study was carried out to highlight the incidence of antibiotic resistan...

  4. Class 1 and 2 integrons, sul resistance genes and antibiotic resistance in Escherichia coli isolated from Dongjiang River, South China

    International Nuclear Information System (INIS)

    Su Haochang; Ying Guangguo; Tao Ran; Zhang Ruiquan; Zhao Jianliang; Liu Yousheng

    2012-01-01

    Antibiotic susceptibility, detection of sul gene types and presence of class 1, 2 and 3 integrons and gene cassettes using PCR assays were investigated in 3456 Escherichia coli isolates obtained from 38 sampling sites of the Dongjiang River catchment in the dry and wet seasons. 89.1% of the isolates were resistant and 87.5% showed resistance to at least three antibiotics. sul2 was detected most frequently in 89.2% of 1403 SXT-resistant isolates. The presence of integrons (class 1 and 2) was frequently observed (82.3%) while no class 3 integron was found. In these integrons, 21 resistance genes of 14 gene cassette arrays and 10 different families of resistance genes were identified. Three gene cassette arrays, aac(6')-Ib-cr-aar-3-dfrA27-aadA16, aacA4-catB3-dfrA1 and aadA2-lnuF, were detected for the first time in surface water. The results showed that bacterial resistance in the catchment was seriously influenced by human activities, especially discharge of wastewater. Highlights: ► Antibiotic resistance was investigated for a river catchment of southern China. ► 87.5% of E coli isolates showed resistance to at least three antibiotics. ► The presence of integrons (class 1 and 2) was frequently observed (82.3%). ► Bacterial resistance in the catchment was seriously influenced by human activities. - Bacterial resistance to antibiotics in a catchment is related to the discharge of wastewater into the aquatic environment.

  5. Gene flow from single and stacked herbicide-resistant rice (Oryza sativa): modeling occurrence of multiple herbicide-resistant weedy rice.

    Science.gov (United States)

    Dauer, Joseph; Hulting, Andrew; Carlson, Dale; Mankin, Luke; Harden, John; Mallory-Smith, Carol

    2018-02-01

    Provisia™ rice (PV), a non-genetically engineered (GE) quizalofop-resistant rice, will provide growers with an additional option for weed management to use in conjunction with Clearfield ® rice (CL) production. Modeling compared the impact of stacking resistance traits versus single traits in rice on introgression of the resistance trait to weedy rice (also called red rice). Common weed management practices were applied to 2-, 3- and 4-year crop rotations, and resistant and multiple-resistant weedy rice seeds, seedlings and mature plants were tracked for 15 years. Two-year crop rotations resulted in resistant weedy rice after 2 years with abundant populations (exceeding 0.4 weedy rice plants m -2 ) occurring after 7 years. When stacked trait rice was rotated with soybeans in a 3-year rotation and with soybeans and CL in a 4-year rotation, multiple-resistance occurred after 2-5 years with abundant populations present in 4-9 years. When CL rice, PV rice, and soybeans were used in 3- and 4-year rotations, the median time of first appearance of multiple-resistance was 7-11 years and reached abundant levels in 10-15 years. Maintaining separate CL and PV rice systems, in rotation with other crops and herbicides, minimized the evolution of multiple herbicide-resistant weedy rice through gene flow compared to stacking herbicide resistance traits. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  6. Listeria monocytogenes isolates from food and food environment harbouring tetM and ermB resistance genes.

    Science.gov (United States)

    Haubert, L; Mendonça, M; Lopes, G V; de Itapema Cardoso, M R; da Silva, W P

    2016-01-01

    Listeria monocytogenes is a foodborne pathogen that has become an important cause of human and animal diseases worldwide. The purpose of this study was to evaluate the serotypes, virulence potential, antimicrobial resistance profile, and genetic relationships of 50 L. monocytogenes isolates from food and food environment in southern Brazil. In this study, the majority of L. monocytogenes isolates belonged to the serotypes 1/2b (42%) and 4b (26%), which are the main serotypes associated with human listeriosis. In addition, all isolates harboured internalin genes (inlA, inlC, inlJ), indicating a virulence potential. The isolates were sensitive to most of the antimicrobial compounds analysed, and five isolates (10%) were multi-resistant. Two isolates harboured antimicrobial resistance genes (tetM and ermB) and in one of them, the gene was present in the plasmid. Moreover, according to the pulsed field gel electrophoresis assay, two multi-resistant isolates were a single clone isolated from food and the processing plant. The isolates were susceptible to the most frequently used antibiotics for listeriosis treatment. However, the presence of multidrug-resistant isolates and antimicrobial resistance genes including in the plasmid could even be transferred between bacterial species, suggesting a potential health risk to consumers and a potential risk of spreading multi-resistance genes to other bacteria. Listeria monocytogenes is an important agent of foodborne diseases. The results of this study suggest a potential capacity of L. monocytogenes isolates from food and food environment to cause human infections. Antimicrobial multi-resistance profiles were detected in 10%, and two isolates harboured tetM and ermB resistance genes. Moreover, the present research can help to build up a better knowledge about antimicrobial resistance of L. monocytogenes. Additionally, we found one isolate carrying tetM resistance gene in a plasmid, that suggests a possible transmission

  7. Streptomycin and chloramphenicol resistance genes in Escherichia coli isolates from cattle, pigs, and chicken in Kenya.

    Science.gov (United States)

    Kikuvi, G M; Schwarz, S; Ombui, J N; Mitema, E S; Kehrenberg, C

    2007-01-01

    The aims of this study were to determine the genetic basis of streptomycin and chloramphenicol resistance in 30 Escherichia coli isolates from food animals in Kenya and the role of plasmids in the spread of the resistance. Seven of the 29 streptomycin-resistant isolates harbored both the strA and strB genes. Twenty-one of isolates had the strA, strB, and aadA1 genes. The strA gene was disrupted by a functional trimethoprim gene, dfrA14 in 10 of the 21 isolates harboring the three streptomycin resistance genes. Physical linkage of intact strA and sul2 genes was found in two different plasmids from four isolates. Linkage of cassette-borne aadA1 and dfrA1 genes in class 1 integrons was found in two of the isolates. Chloramphenicol resistance was due to the gene catA1 in all the chloramphenicol resistant isolates. The strB, strA, and catA1 genes were transferable by conjugation and this points to the significance of conjugative resistance plasmids in the spread and persistence of streptomycin and chloramphenicol resistance in food animals in Kenya.

  8. Who possesses drug resistance genes in the aquatic environment?: sulfamethoxazole (SMX) resistance genes among the bacterial community in water environment of Metro-Manila, Philippines

    OpenAIRE

    Suzuki, Satoru; Ogo, Mitsuko; Miller, Todd W.; Shimizu, Akiko; Takada, Hideshige; Siringan, Maria Auxilia T.

    2013-01-01

    Recent evidence has shown that antibiotic resistant bacteria (ARB) and antibiotic resistance genes (ARGs) are ubiquitous in natural environments, including sites considered pristine. To understand the origin of ARGs and their dynamics, we must first define their actual presence in the natural bacterial assemblage. Here we found varying distribution profiles of sul genes in “colony forming bacterial assemblages” and “natural bacterial assemblages.” Our monitoring for antibiotic contamination r...

  9. Resistance (R) Genes: Applications and Prospects for Plant Biotechnology and Breeding.

    Science.gov (United States)

    Pandolfi, Valesca; Neto, Jose Ribamar Costa Ferreira; da Silva, Manasses Daniel; Amorim, Lidiane Lindinalva Barbosa; Wanderley-Nogueira, Ana Carolina; de Oliveira Silva, Roberta Lane; Kido, Ederson Akio; Crovella, Sergio; Iseppon, Ana Maria Benko

    2017-01-01

    The discovery of novel plant resistance (R) genes (including their homologs and analogs) opened interesting possibilities for controlling plant diseases caused by several pathogens. However, due to environmental pressure and high selection operated by pathogens, several crop plants have lost specificity, broad-spectrum or durability of resistance. On the other hand, the advances in plant genome sequencing and biotechnological approaches, combined with the increasing knowledge on Rgenes have provided new insights on their applications for plant genetic breeding, allowing the identification and implementation of novel and efficient strategies that enhance or optimize their use for efficiently controlling plant diseases. The present review focuses on main perspectives of application of R-genes and its co-players for the acquisition of resistance to pathogens in cultivated plants, with emphasis on biotechnological inferences, including transgenesis, cisgenesis, directed mutagenesis and gene editing, with examples of success and challenges to be faced. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  10. Antibiotic Resistant Bacteria And Their Associated Resistance Genes in a Conventional Municipal Wastewater Treatment Plant

    KAUST Repository

    Aljassim, Nada I.

    2013-12-01

    With water scarcity as a pressing issue in Saudi Arabia and other Middle Eastern countries, the treatment and reuse of municipal wastewater is increasingly being used as an alternative water source to supplement country water needs. Standards are in place to ensure a safe treated wastewater quality, however they do not regulate pathogenic bacteria and emerging contaminants. Information is lacking on the levels of risk to public health associated with these factors, the efficiency of conventional treatment strategies in removing them, and on wastewater treatment in Saudi Arabia in general. In this study, a municipal wastewater treatment plant in Saudi Arabia is investigated to assess the efficiency of conventional treatment in meeting regulations and removing pathogens and emerging contaminants. The study found pathogenic bacterial genera, antibiotic resistance genes and antibiotic resistant bacteria, many of which were multi-resistant in plant discharges. It was found that although the treatments are able to meet traditional quality guidelines, there remains a risk from the discussed contaminants with wastewater reuse. A deeper understanding of this risk, and suggestions for more thorough guidelines and monitoring are needed.

  11. Occurrence and persistence of antibiotic resistance genes in river biofilms after wastewater inputs in small rivers.

    Science.gov (United States)

    Proia, Lorenzo; von Schiller, Daniel; Sànchez-Melsió, Alexandre; Sabater, Sergi; Borrego, Carles M; Rodríguez-Mozaz, Sara; Balcázar, José Luis

    2016-03-01

    The extensive use of antibiotics in human and veterinary medicine and their subsequent release into the environment may have direct consequences for autochthonous bacterial communities, especially in freshwater ecosystems. In small streams and rivers, local inputs of wastewater treatment plants (WWTPs) may become important sources of organic matter, nutrients and emerging pollutants, such as antibiotic resistance genes (ARGs). In this study, we evaluated the effect of WWTP effluents as a source of ARGs in river biofilms. The prevalence of genes conferring resistance to main antibiotic families, such as beta-lactams (blaCTX-M), fluoroquinolones (qnrS), sulfonamides (sul I), and macrolides (ermB), was determined using quantitative PCR (qPCR) in biofilm samples collected upstream and downstream WWTPs discharge points in four low-order streams. Our results showed that the WWTP effluents strongly modified the hydrology, physico-chemistry and biological characteristics of the receiving streams and favoured the persistence and spread of antibiotic resistance in microbial benthic communities. It was also shown that the magnitude of effects depended on the relative contribution of each WWTP to the receiving system. Specifically, low concentrations of ARGs were detected at sites located upstream of the WWTPs, while a significant increase of their concentrations was observed in biofilms collected downstream of the WWTP discharge points (particularly ermB and sul I genes). These findings suggest that WWTP discharges may favour the increase and spread of antibiotic resistance among streambed biofilms. The present study also showed that the presence of ARGs in biofilms was noticeable far downstream of the WWTP discharge (up to 1 km). It is therefore reasonable to assume that biofilms may represent an ideal setting for the acquisition and spread of antibiotic resistance determinants and thus be considered suitable biological indicators of anthropogenic pollution by active

  12. Functional Metagenomics as a Tool for Identification of New Antibiotic Resistance Genes from Natural Environments.

    Science.gov (United States)

    Dos Santos, Débora Farage Knupp; Istvan, Paula; Quirino, Betania Ferraz; Kruger, Ricardo Henrique

    2017-02-01

    Antibiotic resistance has become a major concern for human and animal health, as therapeutic alternatives to treat multidrug-resistant microorganisms are rapidly dwindling. The problem is compounded by low investment in antibiotic research and lack of new effective antimicrobial drugs on the market. Exploring environmental antibiotic resistance genes (ARGs) will help us to better understand bacterial resistance mechanisms, which may be the key to identifying new drug targets. Because most environment-associated microorganisms are not yet cultivable, culture-independent techniques are essential to determine which organisms are present in a given environmental sample and allow the assessment and utilization of the genetic wealth they represent. Metagenomics represents a powerful tool to achieve these goals using sequence-based and functional-based approaches. Functional metagenomic approaches are particularly well suited to the identification new ARGs from natural environments because, unlike sequence-based approaches, they do not require previous knowledge of these genes. This review discusses functional metagenomics-based ARG research and describes new possibilities for surveying the resistome in environmental samples.

  13. Revisiting Vitis vinifera subtilase gene family: a possible role in grapevine resistance against Plasmopara viticola

    Directory of Open Access Journals (Sweden)

    Joana Figueiredo

    2016-11-01

    Full Text Available Subtilisin-like proteases, also known as subtilases, are a very diverse family of serine peptidases present in many organisms. In grapevine, there are hints of the involvement of subtilases in defence mechanisms, but their role is not yet understood. The first characterization of the subtilase gene family was performed in 2014. However, simultaneously, the grapevine genome was re-annotated and several sequences were re-annotated or retrieved. We have performed a re-characterization of this family in grapevine and identified 82 genes coding for 97 putative proteins, as result of alternative splicing. All the subtilases identified present the characteristic S8 peptidase domain and the majority of them also have a pro-domain I9 inhibitor, a protease-associated (PA domain and a signal peptide for targeting to the secretory pathway. Phylogenetic studies revealed six subtilase groups denominated VvSBT1 to VvSBT6. As several evidences have highlighted the participation of plant subtilases in response to biotic stimulus, we have investigated subtilase participation in grapevine resistance to Plasmopara viticola, the causative agent of downy mildew. Fourteen grapevine subtilases presenting either high homology to P69C from tomato, SBT3.3 from Arabidopsis thaliana or located near the Resistance to Plasmopara viticola (RPV locus were selected. Expression studies were conducted in the grapevine-P. viticola pathosystem with resistant and susceptible cultivars. Our results may indicate that some of grapevine subtilisins are potentially participating in the defence response against this biotrophic oomycete.

  14. Seawater is a reservoir of multi-resistant Escherichia coli, including strains hosting plasmid-mediated quinolones resistance and extended-spectrum beta-lactamases genes

    Directory of Open Access Journals (Sweden)

    Marta S. Alves

    2014-08-01

    Full Text Available The aim of this study was to examine antibiotic resistance (AR dissemination in coastal water, considering the contribution of different sources of faecal contamination. Samples were collected in Berlenga, an uninhabited island classified as Natural Reserve and visited by tourists for aquatic recreational activities. To achieve our aim, AR in Escherichia coli isolates from coastal water was compared to AR in isolates from two sources of faecal contamination: human-derived sewage and seagull faeces. Isolation of E. coli was done on Chromocult agar. Based on genetic typing 414 strains were established. Distribution of E. coli phylogenetic groups was similar among isolates of all sources. Resistances to streptomycin, tetracycline, cephalothin and amoxicillin were the most frequent. Higher rates of AR were found among seawater and faeces isolates, except for last-line antibiotics used in human medicine. Multi-resistance rates in isolates from sewage and seagull faeces (29% and 32% were lower than in isolates from seawater (39%. Seawater AR profiles were similar to those from seagull faeces and differed significantly from sewage AR profiles. Nucleotide sequences matching resistance genes blaTEM, sul1, sul2, tet(A and tet(B, were present in isolates of all sources. Genes conferring resistance to 3rd generation cephalosporins were detected in seawater (blaCTX-M-1 and blaSHV-12 and seagull faeces (blaCMY-2. Plasmid-mediated determinants of resistance to quinolones were found: qnrS1 in all sources and qnrB19 in seawater and seagull faeces. Our results show that seawater is a relevant reservoir of AR and that seagulls are an efficient vehicle to spread human-associated bacteria and resistance genes. The E. coli resistome recaptured from Berlenga coastal water was mainly modulated by seagulls-derived faecal pollution. The repertoire of resistance genes covers antibiotics critically important for humans, a potential risk for human health.

  15. Could bacteriophages transfer antibiotic resistance genes from environmental bacteria to human-body associated bacterial populations?

    Science.gov (United States)

    Muniesa, Maite; Colomer-Lluch, Marta; Jofre, Juan

    2013-07-01

    Environments without any contact with anthropogenic antibiotics show a great abundance of antibiotic resistance genes that use to be chromosomal and are part of the core genes of the species that harbor them. Some of these genes are shared with human pathogens where they appear in mobile genetic elements. Diversity of antibiotic resistance genes in non-contaminated environments is much greater than in human and animal pathogens, and in environments contaminated with antibiotic from anthropogenic activities. This suggests the existence of some bottleneck effect for the mobilization of antibiotic resistance genes among different biomes. Bacteriophages have characteristics that make them suitable vectors between different biomes, and as well for transferring genes from biome to biome. Recent metagenomic studies and detection of bacterial genes by genomic techniques in the bacteriophage fraction of different microbiota provide indirect evidences that the mobilization of genes mediated by phages, including antibiotic resistance genes, is far more relevant than previously thought. Our hypothesis is that bacteriophages might be of critical importance for evading one of the bottlenecks, the lack of ecological connectivity that modulates the pass of antibiotic resistance genes from natural environments such as waters and soils, to animal and human microbiomes. This commentary concentrates on the potential importance of bacteriophages in transferring resistance genes from the environment to human and animal body microbiomes, but there is no doubt that transduction occurs also in body microbiomes.

  16. Nucleotide diversity analysis of three major bacterial blight resistance genes in rice.

    Directory of Open Access Journals (Sweden)

    Waikhom Bimolata

    Full Text Available Nucleotide sequence polymorphisms among R gene alleles influence the process of co-evolutionary interaction between host and pathogen by shaping the response of host plants towards invading pathogens. Here, we present the DNA sequence polymorphisms and diversities present among natural alleles of three rice bacterial blight resistance genes, Xa21, Xa26 and xa5. The diversity was examined across different wild relatives and cultivars of Oryza species. Functional significance of selected alleles was evaluated through semi-quantitative reverse transcription polymerase chain reaction and real time PCR. The greatest nucleotide diversity and singleton variable sites (SVS were present in Xa26 (π = 0.01958; SVS = 182 followed by xa5 and Xa21 alleles. The highest frequency of single nucleotide polymorphisms were observed in Xa21 alleles and least in xa5. Transition bias was observed in all the genes and 'G' to 'A' transitions were more favored than other form of transitions. Neutrality tests failed to show the presence of selection at these loci, though negative Tajima's D values indicate the presence of a rare form of polymorphisms. At the interspecies level, O. nivara exhibited more diversity than O. sativa. We have also identified two nearly identical resistant alleles of xa5 and two sequentially identical alleles of Xa21. The alleles of xa5 showed basal levels of expression while Xa21 alleles were functionally not expressed.

  17. Dissection of Resistance Genes to Pseudomonas syringae pv. phaseolicola in UI3 Common Bean Cultivar.

    Science.gov (United States)

    González, Ana M; Godoy, Luís; Santalla, Marta

    2017-11-23

    Few quantitative trait loci have been mapped for resistance to Pseudomonas syringae pv. phaseolicola in common bean. Two F₂ populations were developed from the host differential UI3 cultivar. The objective of this study was to further characterize the resistance to races 1, 5, 7 and 9 of Psp included in UI3. Using a QTL mapping approach, 16 and 11 main-effect QTLs for pod and primary leaf resistance were located on LG10, explaining up to 90% and 26% of the phenotypic variation, respectively. The homologous genomic region corresponding to primary leaf resistance QTLs detected tested positive for the presence of resistance-associated gene cluster encoding nucleotide-binding and leucine-rich repeat (NL), Natural Resistance Associated Macrophage (NRAMP) and Pentatricopeptide Repeat family (PPR) proteins. It is worth noting that the main effect QTLs for resistance in pod were located inside a 3.5 Mb genomic region that included the Phvul.010G021200 gene, which encodes a protein that has the highest sequence similarity to the RIN4 gene of Arabidopsis, and can be considered an important candidate gene for the organ-specific QTLs identified here. These results support that resistance to Psp from UI3 might result from the immune response activated by combinations of R proteins, and suggest the guard model as an important mechanism in pod resistance to halo blight. The candidate genes identified here warrant functional studies that will help in characterizing the actual defense gene(s) in UI3 genotype.

  18. SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

    Directory of Open Access Journals (Sweden)

    Mehmet AYBEKE

    2015-12-01

    Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

  19. Identification of a RAPD marker linked to the Co-6 anthracnose resistant gene in common bean cultivar AB 136

    Directory of Open Access Journals (Sweden)

    Alzate-Marin Ana Lilia

    2000-01-01

    Full Text Available The pathogenic variability of the fungus Colletotrichum lindemuthianum represents an obstacle for the creation of resistant common bean (Phaseolus vulgaris L. varieties. Gene pyramiding is an alternative strategy for the development of varieties with durable resistance. RAPD markers have been proposed as a means to facilitate pyramiding of resistance genes without the need for multiple inoculations of the pathogens. The main aims of this work were to define the inheritance pattern of resistance present in common bean cultivar AB 136 in segregating populations derived from crosses with cultivar Rudá (susceptible to most C. lindemuthianum races and to identify RAPD markers linked to anthracnose resistance. The two progenitors, populations F1 and F2, F2:3 families and backcross-derived plants were inoculated with race 89 of C. lindemuthianum under environmentally controlled greenhouse conditions. The results indicate that a single dominant gene, Co-6, controls common bean resistance to this race, giving a segregation ratio between resistant and susceptible plants of 3:1 in the F2, 1:0 in the backcrosses to AB 136 and 1:1 in the backcross to Rudá. The segregation ratio of F2:3 families derived from F2 resistant plants was 1:2 (homozygous to heterozygous resistant. Molecular marker analyses in the F2 population identified a DNA band of approximately 940 base pairs (OPAZ20(940, linked in coupling phase at 7.1 cM of the Co-6 gene. This marker is being used in our backcross breeding program to develop Rudá-derived common bean cultivars resistant to anthracnose and adapted to central Brazil.

  20. Transport and transformation of genetic information in the critical zone: The case of antibiotic resistance genes

    Science.gov (United States)

    Zhu, Y. G.

    2015-12-01

    In addition to material and energy flows, the dynamics and functions of the Earth's critical zone are intensively mediated by biological actions performed by diverse organisms. These biological actions are modulated by the expression of functional genes and their translation into enzymes that catalyze geochemical reactions, such as nutrient turnover and pollutant biodegradation. Although geobiology, as an interdisciplinary research area, is playing and vital role in linking biological and geochemical processes at different temporal and spatial scales, the distribution and transport of functional genes have rarely been investigated from the Earth's critical zone perspectives. To illustrate the framework of studies on the transport and transformation of genetic information in the critical zone, antibiotic resistance is taken as an example. Antibiotic resistance genes are considered as a group of emerging contaminants, and their emergence and spread within the critical zone on one hand are induced by anthropogenic activities, and on other hand are threatening human health worldwide. The transport and transformation of antibiotic resistance genes are controlled by both horizontal gene transfer between bacterial cells and the movement of bacteria harboring antibiotic resistance genes. In this paper, the fate and behavior of antibiotic resistance genes will be discussed in the following aspects: 1) general overview of environmental antibiotic resistance; 2) high through quantification of the resistome in various environmental media; 3) pathways of resistance gene flow within the critical zone; and 4) potential strategies in mitigating antibiotic resistance, particularly from the critical zone perspectives.

  1. Identification of leaf rust resistant gene Lr10 in Pakistani wheat ...

    African Journals Online (AJOL)

    Jane

    2011-08-10

    Aug 10, 2011 ... survey was conducted to screen 25 Pakistan wheat germplasm for the presence of leaf rust resistance gene Lr10 using specific STS primer. ... conducted on the life cycles of rust pathogens and their management. Due to airborne nature .... To date, more than 45 stem rust resistance Sr (genes) (McIntosh et ...

  2. Presence of tetracycline resistance genes in ecosystems with distinct levels of human impact

    OpenAIRE

    STEHLÍKOVÁ, Zuzana

    2011-01-01

    The incidence of tetracycline resistance genes in the environments with different levels of human impact were compared in this work. The experimental part included detection of eight tetracycline resistance genes in soils from manured and non-manured farms (representing man-affected environment) and soils from national parks (representing non-affected environment).

  3. Identification of leaf rust resistant gene Lr10 in Pakistani wheat ...

    African Journals Online (AJOL)

    Leaf (brown) rust is the major disease of wheat in Pakistan and other countries. The disease is more effectively controlled when several rust resistance genes are pyramided into a single line. Molecular survey was conducted to screen 25 Pakistan wheat germplasm for the presence of leaf rust resistance gene Lr10 using ...

  4. Characterization of the psoRPM1 gene for resistance to root-knot ...

    African Journals Online (AJOL)

    Several root-knot nematode (Meloidogyne spp.) resistance genes have been discovered in different stone fruit crops. However, none of them has yet been cloned and they were only located on the chromosomes. In this study, a candidate root-knot nematode resistance gene (designated as psoRPM1) was isolated from the ...

  5. An AFLP marker linked to turnip mosaic virus resistance gene in pak ...

    African Journals Online (AJOL)

    An AFLP marker linked to turnip mosaic virus resistance gene in pak-choi. W Xinhua, C Huoying, Z Yuying, H Ruixian. Abstract. Pak-choi is one of the most important vegetable crops in China. Turnip mosaic virus (TuMV) is one of its main pathogen. Screening the molecular marker linked to the TuMV resistance gene is an ...

  6. PREVALENCE OF SULFONAMIDE AND FLORFENICOL RESISTANCE GENES IN ESCHERICHIA COLI ISOLATED FROM YAKS (BOS GRUNNIENS) AND HERDSMEN IN THE TIBETAN PASTURE.

    Science.gov (United States)

    Zhang, Anyun; Yang, Yunfei; Wang, Hongning; Lei, Changwei; Xu, Changwen; Guan, Zhongbin; Liu, Bihui; Huang, Xi; Peng, Linyao

    2015-07-01

    To determine the antimicrobial susceptibility profiles and prevalence of resistance genes in Escherichia coli isolated from yaks (Bos grunniens) and herdsmen in nine plateau pastures in Tibet, we isolated 184 nonidentical strains of E. coli from yaks and herdsmen. Antimicrobial susceptibility testing of 15 antimicrobials was conducted and the prevalence of sulfonamide resistance genes (sul1, sul2, and sul3) and florfenicol resistance genes (floR, cfr, cmlA, fexA, pexA, and estDL136) was determined. Escherichia coli isolated from yaks had a high resistance rate to sulfamethoxazole (44%), sulphafurazole (40.4%), and florfenicol (11.4%). Escherichia coli isolated from herdsmen had a high resistance rate to sulfamethoxazole (57%) and sulphafurazole (51%). In addition, sul genes were present in 93% of sulfonamide-resistant isolates (84/90), and 17 floR genes and four cmlA genes were found in 19 florfenicol-resistant isolates. Even though florfenicol is prohibited from use in humans, three floR genes were detected in strains isolated from herdsmen. The three floR-positive isolates from herdsmen had pulsed-field gel electrophoresis patterns similar to isolates from yaks. In addition to documenting the sul and floR genes in E. coli isolated from yaks and herdsmen in the Tibetan pasture, we demonstrated the potential risk that antimicrobial-resistant E. coli could spread among herdsmen and yaks.

  7. The occurrence of antibiotic resistance genes in tap water – a review

    Directory of Open Access Journals (Sweden)

    Siedlecka Agata

    2018-01-01

    Full Text Available The study presents a review of the occurrence of genetic determinants of antibiotic resistance in tap water. The aim of this study was also to compare the applied methods for antibiotic resistance genes (ARGs investigations in tap water. As the concentration of ARGs in treated, drinking water is expected to be very low and may cause problems in a standard isolation procedure, the special emphasis is placed on the applied procedures of DNA extraction and their efficiency. The study presents the first attempts to obtain DNA directly from tap water. Further efforts must be put to determine the final amount of obtained DNA and the presence of chosen ARGs among the molecules.

  8. Isolation and characterization of resistance gene analogues from Psilanthus species that represent wild relatives of cultivated coffee endemic to India.

    Science.gov (United States)

    Hendre, Prasad S; Bhat, Prasanna R; Krishnakumar, V; Aggarwal, Ramesh K

    2011-05-01

    Biotic or abiotic stress can cause considerable damage to crop plants that can be managed by building disease resistance in the cultivated gene pool through breeding for disease resistance genes (R-genes). R-genes, conferring resistance to diverse pathogens or pests share a high level of similarity at the DNA and protein levels in different plant species. This property of R-genes has been successfully employed to isolate putative resistance gene analogues (RGAs) using a PCR-based approach from new plant sources. Using a similar approach, in the present study, we have successfully amplified putative RGAs having nucleotide-binding-site leucine-rich repeats (NBS-LRR-type RGAs) from seven different sources: two cultivated coffee species (Coffea arabica L. and Coffea canephora Pierre ex. A. Froehner), four related taxa endemic to India (wild tree coffee species: Psilanthus bengalensis (Roem. & Schuttles) J.-F. Leroy, Psilanthus khasiana , Psilanthus travencorensis (Wight & Arn.) J.-F. Leroy, Psilanthus weightiana (Wall. ex Wight & Arn.) J.-F. Leroy), and a cDNA pool originally prepared from light- and drought-stressed Coffea arabica L. leaves. The total PCR amplicons obtained using NBS-LRR-specific primers from each source were cloned and transformed to construct seven independent libraries, from which 434 randomly picked clones were sequenced. In silico analysis of the sequenced clones revealed 27 sequences that contained characteristic RGA motifs, of which 24 had complete uninterrupted open reading frames. Comparisons of these with published RGAs showed several of these to be novel RGA sequences. Interestingly, most of such novel RGAs belonged to the related wild Psilanthus species. The data thus suggest the potential of the secondary gene pool as possible untapped donors of resistance genes to the present day cultivated species of coffee.

  9. Presentation

    OpenAIRE

    Meléndez Dobles, Silvia

    2016-01-01

    Las más de las veces, la historia y la geografía han transitado juntas un mismo camino. Los orígenes de la humanidad en el África, su expansión por toda la superfcie terrestre y la conversión de una simple especie de primates en civilización son procesos inequívocamente históricos y geográfcos. Estas y otras muchas razones hacen entendible que ambas disciplinas hayan interactuado en un espacio/tiempo aparentemente inseparable. Las más de las veces, la historia y la geografía han transitado...

  10. Candidate gene approach for parasite resistance in sheep--variation in immune pathway genes and association with fecal egg count.

    Directory of Open Access Journals (Sweden)

    Kathiravan Periasamy

    Full Text Available Sheep chromosome 3 (Oar3 has the largest number of QTLs reported to be significantly associated with resistance to gastro-intestinal nematodes. This study aimed to identify single nucleotide polymorphisms (SNPs within candidate genes located in sheep chromosome 3 as well as genes involved in major immune pathways. A total of 41 SNPs were identified across 38 candidate genes in a panel of unrelated sheep and genotyped in 713 animals belonging to 22 breeds across Asia, Europe and South America. The variations and evolution of immune pathway genes were assessed in sheep populations across these macro-environmental regions that significantly differ in the diversity and load of pathogens. The mean minor allele frequency (MAF did not vary between Asian and European sheep reflecting the absence of ascertainment bias. Phylogenetic analysis revealed two major clusters with most of South Asian, South East Asian and South West Asian breeds clustering together while European and South American sheep breeds clustered together distinctly. Analysis of molecular variance revealed strong phylogeographic structure at loci located in immune pathway genes, unlike microsatellite and genome wide SNP markers. To understand the influence of natural selection processes, SNP loci located in chromosome 3 were utilized to reconstruct haplotypes, the diversity of which showed significant deviations from selective neutrality. Reduced Median network of reconstructed haplotypes showed balancing selection in force at these loci. Preliminary association of SNP genotypes with phenotypes recorded 42 days post challenge revealed significant differences (P<0.05 in fecal egg count, body weight change and packed cell volume at two, four and six SNP loci respectively. In conclusion, the present study reports strong phylogeographic structure and balancing selection operating at SNP loci located within immune pathway genes. Further, SNP loci identified in the study were found to have

  11. Isolation and characterization of NBS-LRR- resistance gene candidates in turmeric (Curcuma longa cv. surama).

    Science.gov (United States)

    Joshi, R K; Mohanty, S; Subudhi, E; Nayak, S

    2010-09-08

    Turmeric (Curcuma longa), an important asexually reproducing spice crop of the family Zingiberaceae is highly susceptible to bacterial and fungal pathogens. The identification of resistance gene analogs holds great promise for development of resistant turmeric cultivars. Degenerate primers designed based on known resistance genes (R-genes) were used in combinations to elucidate resistance gene analogs from Curcuma longa cultivar surama. The three primers resulted in amplicons with expected sizes of 450-600 bp. The nucleotide sequence of these amplicons was obtained through sequencing; their predicted amino acid sequences compared to each other and to the amino acid sequences of known R-genes revealed significant sequence similarity. The finding of conserved domains, viz., kinase-1a, kinase-2 and hydrophobic motif, provided evidence that the sequences belong to the NBS-LRR class gene family. The presence of tryptophan as the last residue of kinase-2 motif further qualified them to be in the non-TIR-NBS-LRR subfamily of resistance genes. A cluster analysis based on the neighbor-joining method was carried out using Curcuma NBS analogs together with several resistance gene analogs and known R-genes, which classified them into two distinct subclasses, corresponding to clades N3 and N4 of non-TIR-NBS sequences described in plants. The NBS analogs that we isolated can be used as guidelines to eventually isolate numerous R-genes in turmeric.

  12. Characterisation of penA and tetM resistance genes of Neisseria ...

    African Journals Online (AJOL)

    This gene block, which was found in all the southern African areas studied, appears to predispose isolates to increased penicillin resistance. The 25,2 MDa conjugative plasmid carrying the tetM resistance determinant was readily demonstrated in 11 Botswana Namibia isolates exhibiting high-level resistance to tetracycline ...

  13. Characterisation of penA and tetM resistance genes of Neisseria ...

    African Journals Online (AJOL)

    appears to predispose isolates to increased penicillin resistance. The 25,2 MDa conjugative plasmid carrying the. tetM resistance determinant was readily demonstrated in. 11 Botswana! Namibia isolates exhibiting high-level resistance to tetracycline (MICs ? 16 IJg/ml). The tetM gene was shown to be of the American type.

  14. Chromosomal location and molecular mapping of tan spot resistance genes in common wheat (T. aestivum L.)

    OpenAIRE

    Tadesse, Wuletaw

    2008-01-01

    In this study, 75 cultivars highly resistant to tan spot were identified. A positive correlation (r = 0.864; P = 0.001) was found between seedling resistance and adult plant resistance. Inheritance of tan spot resistance was found to be qualitative goverened by single major genes. Three novel resistance genes: tsn3, tsn4 and tsn5 were identified and located on chromosomes 3D, 3A and 3B, respectively. Linkage analysis using SSR markers showed that both the tsn3 (tsn3a, Tsn3b and tsn3c) and ts...

  15. Genetic engineering of crop plants for fungal resistance: role of antifungal genes.

    Science.gov (United States)

    Ceasar, S Antony; Ignacimuthu, S

    2012-06-01

    Fungal diseases damage crop plants and affect agricultural production. Transgenic plants have been produced by inserting antifungal genes to confer resistance against fungal pathogens. Genes of fungal cell wall-degrading enzymes, such as chitinase and glucanase, are frequently used to produce fungal-resistant transgenic crop plants. In this review, we summarize the details of various transformation studies to develop fungal resistance in crop plants.

  16. Presentations

    International Nuclear Information System (INIS)

    2007-01-01

    The presented materials consist of presentations of international workshop which held in Warsaw from 4 to 5 October 2007. Main subject of the meeting was progress in manufacturing as well as research program development for neutron detector which is planned to be placed at GANIL laboratory and will be used in nuclear spectroscopy research

  17. Antibiotic Resistance Genes and Correlations with Microbial Community and Metal Resistance Genes in Full-Scale Biogas Reactors As Revealed by Metagenomic Analysis

    DEFF Research Database (Denmark)

    Luo, Gang; Li, Bing; Li, Li-Guan

    2017-01-01

    resistance genes (MRGs). The total abundance of ARGs in all the samples varied from 7 × 10-3 to 1.08 × 10-1 copy of ARG/copy of 16S-rRNA gene, and the samples obtained from thermophilic biogas reactors had a lower total abundance of ARGs, indicating the superiority of thermophilic anaerobic digestion......Digested residues from biogas plants are often used as biofertilizers for agricultural crops cultivation. The antibiotic resistance genes (ARGs) in digested residues pose a high risk to public health due to their potential spread to the disease-causing microorganisms and thus reduce...

  18. Mechanisms of Streptomycin Resistance: Selection of Mutations in the 16S rRNA Gene Conferring Resistance

    Science.gov (United States)

    Springer, Burkhard; Kidan, Yishak G.; Prammananan, Therdsak; Ellrott, Kerstin; Böttger, Erik C.; Sander, Peter

    2001-01-01

    Chromosomally acquired streptomycin resistance is frequently due to mutations in the gene encoding the ribosomal protein S12, rpsL. The presence of several rRNA operons (rrn) and a single rpsL gene in most bacterial genomes prohibits the isolation of streptomycin-resistant mutants in which resistance is mediated by mutations in the 16S rRNA gene (rrs). Three strains were constructed in this investigation: Mycobacterium smegmatis rrnB, M. smegmatis rpsL3+, and M. smegmatis rrnB rpsL3+. M. smegmatis rrnB carries a single functional rrn operon, i.e., rrnA (comprised of 16S, 23S, and 5S rRNA genes) and a single rpsL+ gene; M. smegmatis rpsL3+ is characterized by the presence of two rrn operons (rrnA and rrnB) and three rpsL+ genes; and M. smegmatis rrnB rpsL3+ carries a single functional rrn operon (rrnA) and three rpsL+ genes. By genetically altering the number of rpsL and rrs alleles in the bacterial genome, mutations in rrs conferring streptomycin resistance could be selected, as revealed by analysis of streptomycin-resistant derivatives of M. smegmatis rrnB rpsL3+. Besides mutations well known to confer streptomycin resistance, novel streptomycin resistance conferring mutations were isolated. Most of the mutations were found to map to a functional pseudoknot structure within the 530 loop region of the 16S rRNA. One of the mutations observed, i.e., 524G→C, severely distorts the interaction between nucleotides 524G and 507C, a Watson-Crick interaction which has been thought to be essential for ribosome function. The use of the single rRNA allelic M. smegmatis strain should help to elucidate the principles of ribosome-drug interactions. PMID:11557484

  19. Trueperella pyogenes isolated from dairy cows with endometritis in Inner Mongolia, China: Tetracycline susceptibility and tetracycline-resistance gene distribution.

    Science.gov (United States)

    Zhang, Dexian; Zhao, Jingcui; Wang, Qiuxia; Liu, Yaochuan; Tian, Chunlian; Zhao, Yujun; Yu, Lihui; Liu, Mingchun

    2017-04-01

    Trueperella pyogenes plays a crucial role in endometritis pathogenesis and is also associated with many infections, including metritis, mastitis, arthritis and liver abscessation, in many domestic animals. In this study, we investigated the prevalence of tetracycline resistance in T. pyogenes isolated from dairy cows with endometritis in Inner Mongolia, China, and we assessed tetracycline-resistance gene distribution among the isolates. Our results indicated that 68.7% and 62.5% of the isolates were resistant to tetracycline and doxycycline, respectively, and the rate of resistance to metacycline was 18.8%. The tetracycline resistance gene tetK was present in all isolates (n = 32), whereas the tetM gene was identified in 12.5% and 9.4% of the isolates, in the chromosome and plasmid, respectively. Strains carrying tetW were also common in the chromosome and plasmid, with abundances of 53.1% and 46.9%, respectively. However, tetO and otrA were absent in all isolates. The resistance phenotype analysis indicated that 6.3% of strains were susceptible to all tetracyclines, while 3.1% showed resistance to all tetracyclines. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Genetic analysis and molecular mapping of resistance gene to Phakopsora pachyrhizi in soybean germplasm SX6907.

    Science.gov (United States)

    Chen, Haifeng; Zhao, Sheng; Yang, Zhonglu; Sha, Aihua; Wan, Qiao; Zhang, Chanjuan; Chen, Limiao; Yuan, Songli; Qiu, Dezhen; Chen, Shuilian; Shan, Zhihui; Zhou, Xin-an

    2015-04-01

    In this study, Rpp6907, a novel resistance gene/allele to Phakopsora pachyrhizi in soybean, was mapped in a 111.9-kb region, including three NBS-LRR type predicted genes, on chromosome 18. Soybean rust caused by Phakopsora pachyrhizi Sydow has been reported in numerous soybean-growing regions worldwide. The development of rust-resistant varieties is the most economical and environmentally safe method to control the disease. The Chinese soybean germplasm SX6907 is resistant to P. pachyrhizi and exhibits immune reaction compared with the known Rpp genes. These characteristics suggest that SX6907 may carry at least one novel Rpp gene/allele. Three F2 populations from the crosses of SX6907 (resistant) and Tianlong 1, Zhongdou40, and Pudou11 (susceptible) were used to map the Rpp gene. Three resistance responses (immune, red-brown, and tan-colored lesion) were observed from the F2 individuals. The segregation follows a ratio of 1(resistance):2(heterozygous):1(susceptible), indicating that the resistance in SX6907 is controlled by a single incomplete dominant gene (designated as Rpp6907). Results showed that Rpp6907 was mapped on soybean chromosome 18 (molecular linkage group G, MLG G) flanked by simple sequence repeat (SSR) markers SSR24 and SSR40 at a distance of 111.9 kb. Among the ten genes marked within this 111.9-kb region between the two markers, three genes (Glyma18g51930, Glyma18g51950, and Glyma18g51960) are nucleotide-binding site and leucine-rich repeat-type genes. These genes may be involved in recognizing the presence of pathogens and ultimately conferring resistance. Based on resistance spectrum analysis and mapping results, we inferred that Rpp6907 is a novel gene different from Rpp1 in PI 200492, PI 561356, PI 587880A, PI 587886, and PI 594538A, or a new Rpp1-b allele.

  1. Pollen-mediated gene flow from glyphosate-resistant common waterhemp (Amaranthus rudis Sauer): consequences for the dispersal of resistance genes.

    Science.gov (United States)

    Sarangi, Debalin; Tyre, Andrew J; Patterson, Eric L; Gaines, Todd A; Irmak, Suat; Knezevic, Stevan Z; Lindquist, John L; Jhala, Amit J

    2017-03-22

    Gene flow is an important component in evolutionary biology; however, the role of gene flow in dispersal of herbicide-resistant alleles among weed populations is poorly understood. Field experiments were conducted at the University of Nebraska-Lincoln to quantify pollen-mediated gene flow (PMGF) from glyphosate-resistant (GR) to -susceptible (GS) common waterhemp using a concentric donor-receptor design. More than 130,000 common waterhemp plants were screened and 26,199 plants were confirmed resistant to glyphosate. Frequency of gene flow from all distances, directions, and years was estimated with a double exponential decay model using Generalized Nonlinear Model (package gnm) in R. PMGF declined by 50% at <3 m distance from the pollen source, whereas 90% reduction was found at 88 m (maximum) depending on the direction of the pollen-receptor blocks. Amplification of the target site gene, 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS), was identified as the mechanism of glyphosate resistance in parent biotype. The EPSPS gene amplification was heritable in common waterhemp and can be transferred via PMGF, and also correlated with glyphosate resistance in pseudo-F 2 progeny. This is the first report of PMGF in GR common waterhemp and the results are critical in explaining the rapid dispersal of GR common waterhemp in Midwestern United States.

  2. Incorporation of Bacterial Blight Resistance Genes Into Lowland Rice Cultivar Through Marker-Assisted Backcross Breeding.

    Science.gov (United States)

    Pradhan, Sharat Kumar; Nayak, Deepak Kumar; Pandit, Elssa; Behera, Lambodar; Anandan, Annamalai; Mukherjee, Arup Kumar; Lenka, Srikanta; Barik, Durga Prasad

    2016-07-01

    Bacterial blight (BB) of rice caused by Xanthomonas oryzae pv. oryzae is a major disease of rice in many rice growing countries. Pyramided lines carrying two BB resistance gene combinations (Xa21+xa13 and Xa21+xa5) were developed in a lowland cultivar Jalmagna background through backcross breeding by integrating molecular markers. In each backcross generation, markers closely linked to the disease resistance genes were used to select plants possessing the target genes. Background selection was continued in those plants carrying resistant genes until BC(3) generation. Plants having the maximum contribution from the recurrent parent genome were selected in each generation and hybridized with the recipient parent. The BB-pyramided line having the maximum recipient parent genome recovery of 95% was selected among BC3F1 plants and selfed to isolate homozygous BC(3)F(2) plants with different combinations of BB resistance genes. Twenty pyramided lines with two resistance gene combinations exhibited high levels of tolerance against the BB pathogen. In order to confirm the resistance, the pyramided lines were inoculated with different X. oryzae pv. oryzae strains of Odisha for bioassay. The genotypes with combination of two BB resistance genes conferred high levels of resistance to the predominant X. oryzae pv. oryzae isolates prevalent in the region. The pyramided lines showed similarity with the recipient parent with respect to major agro-morphologic traits.

  3. Genes Expressed Differentially in Hessian Fly Larvae Feeding in Resistant and Susceptible Plants

    Directory of Open Access Journals (Sweden)

    Ming-Shun Chen

    2016-08-01

    Full Text Available The Hessian fly, Mayetiola destructor, is a destructive pest of wheat worldwide and mainly controlled by deploying resistant cultivars. In this study, we investigated the genes that were expressed differentially between larvae in resistant plants and those in susceptible plants through RNA sequencing on the Illumina platform. Informative genes were 11,832, 14,861, 15,708, and 15,071 for the comparisons between larvae in resistant versus susceptible plants for 0.5, 1, 3, and 5 days, respectively, after larvae had reached the feeding site. The transcript abundance corresponding to 5401, 6902, 8457, and 5202 of the informative genes exhibited significant differences (p ≤ 0.05 in the respective paired comparisons. Overall, genes involved in nutrient metabolism, RNA and protein synthesis exhibited lower transcript abundance in larvae from resistant plants, indicating that resistant plants inhibited nutrient metabolism and protein production in larvae. Interestingly, the numbers of cytochrome P450 genes with higher transcript abundance in larvae from resistant plants were comparable to, or higher than those with lower transcript abundance, indicating that toxic chemicals from resistant plants may have played important roles in Hessian fly larval death. Our study also identified several families of genes encoding secreted salivary gland proteins (SSGPs that were expressed at early stage of 1st instar larvae and with more genes with higher transcript abundance in larvae from resistant plants. Those SSGPs are candidate effectors with important roles in plant manipulation.

  4. Effective genes for resistance to stripe rust and virulence of Puccinia ...

    African Journals Online (AJOL)

    The results revealed that stripe rust resistance genes Yr3, Yr5, Yr10, Yr15, Yr26, YrSP and YrCV were resistant, while Yr18 showed moderate susceptibility at all locations. Genes YrA-, Yr2, Yr6, Yr7, Yr8, Yr9, Yr17, Yr27 and gene combinations Opata (Yr27+Yr18) and Super Kauz (Yr9, Yr27, Yr18) were found susceptible.

  5. Genetics and mapping of a new leaf rust resistance gene in Triticum ...

    Indian Academy of Sciences (India)

    Genetic analysis in F1, F2 and F2.3 families at the seedling stage revealed that leaf rust resistance in Selection G12 is conditioned by a single incompletely dominant gene. The leaf rust resistance gene was mapped to chromosome 3BL with SSR markers Xgwm114 and Xgwm547 flanking the gene at a distance of 28.3 cM ...

  6. Emergence of methicillin-resistant coagulase-negative staphylococci resistant to linezolid with rRNA gene C2190T and G2603T mutations.

    Science.gov (United States)

    Cidral, Thiago André; Carvalho, Maria Cícera; Figueiredo, Agnes Marie Sá; de Melo, Maria Celeste Nunes

    2015-10-01

    The aim of this article were to determinate the mechanism of linezolid resistance in coagulase-negative methicillin-resistant staphylococci from hospitals in the northeast of Brazil. We identified the isolates using VITEK(®) 2 and MALDI-TOF. Susceptibility to antibiotics was measured by the disk-diffusion method and by Etest(®) . Extraction of the whole genome DNA was performed, followed by screening of all the strains for the presence of mecA and cfr genes. The domain V region of 23S rRNA gene was sequenced and then aligned with a linezolid-susceptible reference strain. Pulsed-field gel electrophoresis (PFGE) macro-restriction analysis was performed. Three linezolid-resistant Staphylococcus hominis and two linezolid-resistant Staphylococcus epidermidis strains were analyzed. The isolates showed two point mutations in the V region of the 23S rRNA gene (C2190T and G2603T). We did not detect the cfr gene in any isolate by PCR. The S. hominis showed the same pulsotype, while the S. epidermidis did not present any genetic relation to each other. In conclusion, this study revealed three S. hominis and two S. epidermidis strains with resistance to linezolid due to a double mutation (C2190T and G2603T) in the domain V of the 23S rRNA gene. For the first time, the mutation of C2190T in S. epidermidis is described. This study also revealed the clonal spread of a S. hominis pulsotype between three public hospitals in the city of Natal, Brazil. These findings highlight the importance of continued vigilance of linezolid resistance in staphylococci. © 2015 APMIS. Published by John Wiley & Sons Ltd.

  7. Pyramiding B genes in cotton achieves broader but not always higher resistance to bacterial blight.

    Science.gov (United States)

    Essenberg, Margaret; Bayles, Melanie B; Pierce, Margaret L; Verhalen, Laval M

    2014-10-01

    Near-isogenic lines of upland cotton (Gossypium hirsutum) carrying single, race-specific genes B4, BIn, and b7 for resistance to bacterial blight were used to develop a pyramid of lines with all possible combinations of two and three genes to learn whether the pyramid could achieve broad and high resistance approaching that of L. A. Brinkerhoff's exceptional line Im216. Isogenic strains of Xanthomonas axonopodis pv. malvacearum carrying single avirulence (avr) genes were used to identify plants carrying specific resistance (B) genes. Under field conditions in north-central Oklahoma, pyramid lines exhibited broader resistance to individual races and, consequently, higher resistance to a race mixture. It was predicted that lines carrying two or three B genes would also exhibit higher resistance to race 1, which possesses many avr genes. Although some enhancements were observed, they did not approach the level of resistance of Im216. In a growth chamber, bacterial populations attained by race 1 in and on leaves of the pyramid lines decreased significantly with increasing number of B genes in only one of four experiments. The older lines, Im216 and AcHR, exhibited considerably lower bacterial populations than any of the one-, two-, or three-B-gene lines. A spreading collapse of spray-inoculated AcBIn and AcBInb7 leaves appears to be a defense response (conditioned by BIn) that is out of control.

  8. Antibiotic Resistance Genes and Correlations with Microbial Community and Metal Resistance Genes in Full-Scale Biogas Reactors As Revealed by Metagenomic Analysis.

    Science.gov (United States)

    Luo, Gang; Li, Bing; Li, Li-Guan; Zhang, Tong; Angelidaki, Irini

    2017-04-04

    Digested residues from biogas plants are often used as biofertilizers for agricultural crops cultivation. The antibiotic resistance genes (ARGs) in digested residues pose a high risk to public health due to their potential spread to the disease-causing microorganisms and thus reduce the susceptibility of disease-causing microorganisms to antibiotics in medical treatment. A high-throughput sequencing (HTS)-based metagenomic approach was used in the present study to investigate the variations of ARGs in full-scale biogas reactors and the correlations of ARGs with microbial communities and metal resistance genes (MRGs). The total abundance of ARGs in all the samples varied from 7 × 10 -3 to 1.08 × 10 -1 copy of ARG/copy of 16S-rRNA gene, and the samples obtained from thermophilic biogas reactors had a lower total abundance of ARGs, indicating the superiority of thermophilic anaerobic digestion for ARGs removal. ARGs in all the samples were composed of 175 ARG subtypes; however, only 7 ARG subtypes were shared by all the samples. Principal component analysis and canonical correspondence analysis clustered the samples into three groups (samples from manure-based mesophilic reactors, manure-based thermophilic reactors, and sludge-based mesophilic reactors), and substrate, temperature, and hydraulic retention time (HRT) as well as volatile fatty acids (VFAs) were identified as crucial environmental variables affecting the ARGs compositions. Procrustes analysis revealed microbial community composition was the determinant of ARGs composition in biogas reactors, and there was also a significant correlation between ARGs composition and MRGs composition. Network analysis further revealed the co-occurrence of ARGs with specific microorganisms and MRGs.

  9. Prevalence and characterization of plasmids carrying sulfonamide resistance genes among Escherichia coli from pigs, pig carcasses and human.

    Science.gov (United States)

    Wu, Shuyu; Dalsgaard, Anders; Hammerum, Anette M; Porsbo, Lone J; Jensen, Lars B

    2010-07-30

    Sulfonamide resistance is very common in Escherichia coli. The aim of this study was to characterize plasmids carrying sulfonamide resistance genes (sul1, sul2 and sul3) in E. coli isolated from pigs and humans with a specific objective to assess the genetic diversity of plasmids involved in the mobility of sul genes. A total of 501 E. coli isolates from pig feces, pig carcasses and human stools were tested for their susceptibility to selected antimicrobial. Multiplex PCR was conducted to detect the presence of three sul genes among the sulfonamide-resistant E. coli isolates. Fifty-seven sulfonamide-resistant E. coli were selected based on presence of sul resistance genes and subjected to conjugation and/or transformation experiments. S1 nuclease digestion followed by pulsed-field gel electrophoresis was used to visualize and determine the size of plasmids. Plasmids carrying sul genes were characterized by PCR-based replicon typing to allow a comparison of the types of sul genes, the reservoir and plasmid present. A total of 109/501 isolates exhibited sulfonamide resistance. The relative prevalences of sul genes from the three reservoirs (pigs, pig carcasses and humans) were 65%, 45% and 12% for sul2, sul1, and sul3, respectively. Transfer of resistance through conjugation was observed in 42/57 isolates. Resistances to streptomycin, ampicillin and trimethoprim were co-transferred in most strains. Class 1 integrons were present in 80% of sul1-carrying plasmids and 100% of sul3-carrying plasmids, but only in 5% of sul2-carrying plasmids. The sul plasmids ranged from 33 to 160-kb in size and belonged to nine different incompatibility (Inc) groups: FII, FIB, I1, FIA, B/O, FIC, N, HI1 and X1. IncFII was the dominant type in sul2-carrying plasmids (52%), while IncI1 was the most common type in sul1 and sul3-carrying plasmids (33% and 45%, respectively). Multireplicons were found associated with all three sul genes. Sul genes were distributed widely in E. coli isolated

  10. Prevalence and characterization of plasmids carrying sulfonamide resistance genes among Escherichia coli from pigs, pig carcasses and human

    Directory of Open Access Journals (Sweden)

    Hammerum Anette M

    2010-07-01

    Full Text Available Abstract Background Sulfonamide resistance is very common in Escherichia coli. The aim of this study was to characterize plasmids carrying sulfonamide resistance genes (sul1, sul2 and sul3 in E. coli isolated from pigs and humans with a specific objective to assess the genetic diversity of plasmids involved in the mobility of sul genes. Methods A total of 501 E. coli isolates from pig feces, pig carcasses and human stools were tested for their susceptibility to selected antimicrobial. Multiplex PCR was conducted to detect the presence of three sul genes among the sulfonamide-resistant E. coli isolates. Fifty-seven sulfonamide-resistant E. coli were selected based on presence of sul resistance genes and subjected to conjugation and/or transformation experiments. S1 nuclease digestion followed by pulsed-field gel electrophoresis was used to visualize and determine the size of plasmids. Plasmids carrying sul genes were characterized by PCR-based replicon typing to allow a comparison of the types of sul genes, the reservoir and plasmid present. Results A total of 109/501 isolates exhibited sulfonamide resistance. The relative prevalences of sul genes from the three reservoirs (pigs, pig carcasses and humans were 65%, 45% and 12% for sul2, sul1, and sul3, respectively. Transfer of resistance through conjugation was observed in 42/57 isolates. Resistances to streptomycin, ampicillin and trimethoprim were co-transferred in most strains. Class 1 integrons were present in 80% of sul1-carrying plasmids and 100% of sul3-carrying plasmids, but only in 5% of sul2-carrying plasmids. The sul plasmids ranged from 33 to 160-kb in size and belonged to nine different incompatibility (Inc groups: FII, FIB, I1, FIA, B/O, FIC, N, HI1 and X1. IncFII was the dominant type in sul2-carrying plasmids (52%, while IncI1 was the most common type in sul1 and sul3-carrying plasmids (33% and 45%, respectively. Multireplicons were found associated with all three sul genes

  11. Common variation in oxidative phosphorylation genes is not a major cause of insulin resistance or type 2 diabetes

    DEFF Research Database (Denmark)

    Snogdal, Lena Sønder; Wod, Mette; Grarup, Niels

    2012-01-01

    There is substantial evidence that mitochondrial dysfunction is linked to insulin resistance and is present in several tissues relevant to the pathogenesis of type 2 diabetes. Here, we examined whether common variation in genes involved in oxidative phosphorylation (OxPhos) contributes to type 2...

  12. Detection of antibiotic resistance genes β-lactamics in bacterial strains isolated from Umbilical Cord Blood Units for transplant

    Directory of Open Access Journals (Sweden)

    J.M. Bello-López

    2017-01-01

    Conclusions: The genotype detection encoding antibiotic resistance in isolates of UCBU clearly indicates the potential risk of sepsis difficult to eradicate in the patient, if present in a UCBU available for transplant. Additionally, the existence of these genes reveals horizontal transfer events of genetic material between bacteria. So the importance to realize this studies before transplant.

  13. Transcriptome analysis of resistant and susceptible genotypes of Glycine tomentella during Phakopsora pachyrhizi infection reveals novel rust resistance genes.

    Science.gov (United States)

    Soria-Guerra, Ruth Elena; Rosales-Mendoza, Sergio; Chang, Sungyul; Haudenshield, James S; Padmanaban, Annamalai; Rodriguez-Zas, Sandra; Hartman, Glen L; Ghabrial, Said A; Korban, Schuyler S

    2010-05-01

    Soybean rust, caused by Phakopsora pachyrhizi, is a destructive foliar disease in nearly all soybean-producing countries. To identify genes controlling resistance to soybean rust, transcriptome profiling was conducted in resistant and susceptible Glycine tomentella genotypes triggered by P. pachyrhizi infection. Among 38,400 genes monitored using a soybean microarray, at 5% false discovery rate, 1,342 genes were identified exhibiting significant differential expression between uninfected and P. pachyrhizi-infected leaves at 12, 24, 48, and 72 h post-inoculation (hpi) in both rust-susceptible and rust-resistant genotypes. Differentially expressed genes were grouped into 12 functional categories, and among those, large numbers relate to basic plant metabolism. Transcripts for genes involved in the phenylpropanoid pathway were up-regulated early during rust infection. Similarly, genes coding for proteins related to stress and defense responses such as glutathione-S-transferases, peroxidases, heat shock proteins, and lipoxygenases were consistently up-regulated following infection at all four time points. Whereas, subsets of genes involved in cellular transport, cellular communication, cell cycle, and DNA processing were down-regulated. Quantitative real-time reverse-transcription polymerase chain reaction (qRT-PCR) on randomly selected genes from the different categories confirmed these findings. Of differentially expressed genes, those associated with the flavonoid biosynthesis pathway as well as those coding for peroxidases and lipoxygenases were likely to be involved in rust resistance in soybean, and would serve as good candidates for functional studies. These findings provided insights into mechanisms underlying resistance and general activation of plant defense pathways in response to rust infection.

  14. A pigeonpea gene confers resistance to Asian soybean rust in soybean.

    Science.gov (United States)

    Kawashima, Cintia G; Guimarães, Gustavo Augusto; Nogueira, Sônia Regina; MacLean, Dan; Cook, Doug R; Steuernagel, Burkhard; Baek, Jongmin; Bouyioukos, Costas; Melo, Bernardo do V A; Tristão, Gustavo; de Oliveira, Jamile Camargos; Rauscher, Gilda; Mittal, Shipra; Panichelli, Lisa; Bacot, Karen; Johnson, Ebony; Iyer, Geeta; Tabor, Girma; Wulff, Brande B H; Ward, Eric; Rairdan, Gregory J; Broglie, Karen E; Wu, Gusui; van Esse, H Peter; Jones, Jonathan D G; Brommonschenkel, Sérgio H

    2016-06-01

    Asian soybean rust (ASR), caused by the fungus Phakopsora pachyrhizi, is one of the most economically important crop diseases, but is only treatable with fungicides, which are becoming less effective owing to the emergence of fungicide resistance. There are no commercial soybean cultivars with durable resistance to P. pachyrhizi, and although soybean resistance loci have been mapped, no resistance genes have been cloned. We report the cloning of a P. pachyrhizi resistance gene CcRpp1 (Cajanus cajan Resistance against Phakopsora pachyrhizi 1) from pigeonpea (Cajanus cajan) and show that CcRpp1 confers full resistance to P. pachyrhizi in soybean. Our findings show that legume species related to soybean such as pigeonpea, cowpea, common bean and others could provide a valuable and diverse pool of resistance traits for crop improvement.

  15. Detection and Characterizations of Genes Resistant to Tetracycline and Sulfa among the Bacteria in Mariculture Water

    Science.gov (United States)

    Qu, L.; Li, Y.; Zhu, P.

    2013-12-01

    One hundred and thirty-five bacteria from maricultural environments were tested for sensitivity to tetracycline and sulfa. Result show that 72% of the bacteria were sulfa-resistant, 36% of the bacteria were tetracycline-resistant, and 16.5% of bacteria showed resistance to both tetracyclines and sulfa ,indicating that the proportion of sulfa and tetracycline resistance bacteria isvery large in the maricultural environments. PCR methods were used to detect if these resistant bacteria carry tetracycline and sulfa resistance genes. Out of the 33 tetracycline-resistant bacteria screened, 3 were positive for tetA, 6 were positive for tetB and no isolate wasboth positive for tetA and tetB. Of the 97 sulfa-resistant bacteria screened, 9 were positive for sul2, 6 were positive for sul1, 1 isolate was positive for bothsul1 and sul2. The minimum inhibitory concentration (MIC) of tetracycline for tetA-carrying isolates were higher than those tetB-carrying isolates.while The MIC of sulfa for sul2-carrying isolates were higher than those sul1-carrying isolates. Indicating that tetA and sul2 gene may play ubknown roles in resisting tetracycline and sulfa than tetB and sul1 genes. The results showed the 4 kinds of genes (tetA,tetB,sul1,sul2) has no host specificity. All these 16S sequence are from the isolates which are positive for the above genes, it indicated the above antibiotic resistance genes are widespread in the environment regardless of the host. While the DNA sequence of these four genes showed tetA, sul1, sul2 genes are conservative in different bacteria , etB gene conserved poorly. The research aim is to get a preliminary understanding of resistance mechanism related to the resistant bacteria and the resistance genes in marine aquaculture environment through the analysis of resistant genes, providing research base for the prevention and treatment of drug-resistant bacteria so as to reduce the threat to the ecological environment, aquaculture and human health.

  16. Similaridade de seqüência entre o gene cp do vírus e do transgene presente em mamoeiros transgênicos

    OpenAIRE

    Souza Júnior, Manoel Teixeira; Gonsalves, Dennis

    2005-01-01

    The Papaya ringspot virus (PRSV) coat protein transgene present in 'Rainbow' and 'SunUp' papayas disclose high sequence similarity (>89%) to the cp gene from PRSV BR and TH. Despite this, both isolates are able to break down the resistance in 'Rainbow', while only the latter is able to do so in 'SunUp'. The objective of this work was to evaluate the degree of sequence similarity between the cp gene in the challenge isolate and the cp transgene in transgenic papayas resistant to PRSV. The prod...

  17. RNAi validation of resistance genes and their interactions in the highly DDT-resistant 91-R strain of Drosophila melanogaster.

    Science.gov (United States)

    Gellatly, Kyle J; Yoon, Kyong Sup; Doherty, Jeffery J; Sun, Weilin; Pittendrigh, Barry R; Clark, J Marshall

    2015-06-01

    4,4'-dichlorodiphenyltrichloroethane (DDT) has been re-recommended by the World Health Organization for malaria mosquito control. Previous DDT use has resulted in resistance, and with continued use resistance will increase in terms of level and extent. Drosophila melanogaster is a model dipteran that has many available genetic tools, numerous studies done on insecticide resistance mechanisms, and is related to malaria mosquitoes allowing for extrapolation. The 91-R strain of D. melanogaster is highly resistant to DDT (>1500-fold), however, there is no mechanistic scheme that accounts for this level of resistance. Recently, reduced penetration, increased detoxification, and direct excretion have been identified as resistance mechanisms in the 91-R strain. Their interactions, however, remain unclear. Use of UAS-RNAi transgenic lines of D. melanogaster allowed for the targeted knockdown of genes putatively involved in DDT resistance and has validated the role of several cuticular proteins (Cyp4g1 and Lcp1), cytochrome P450 monooxygenases (Cyp6g1 and Cyp12d1), and ATP binding cassette transporters (Mdr50, Mdr65, and Mrp1) involved in DDT resistance. Further, increased sensitivity to DDT in the 91-R strain after intra-abdominal dsRNA injection for Mdr50, Mdr65, and Mrp1 was determined by a DDT contact bioassay, directly implicating these genes in DDT efflux and resistance. Copyright © 2015 Elsevier Inc. All rights reserved.

  18. Whole-Genome Sequence Analysis of Antimicrobial Resistance Genes in Streptococcus uberis and Streptococcus dysgalactiae Isolates from Canadian Dairy Herds

    Science.gov (United States)

    Vélez, Julián Reyes; Cameron, Marguerite; Rodríguez-Lecompte, Juan Carlos; Xia, Fangfang; Heider, Luke C.; Saab, Matthew; McClure, J. Trenton; Sánchez, Javier

    2017-01-01

    The objectives of this study are to determine the occurrence of antimicrobial resistance (AMR) genes using whole-genome sequence (WGS) of Streptococcus uberis (S. uberis) and Streptococcus dysgalactiae (S. dysgalactiae) isolates, recovered from dairy cows in the Canadian Maritime Provinces. A secondary objective included the exploration of the association between phenotypic AMR and the genomic characteristics (genome size, guanine–cytosine content, and occurrence of unique gene sequences). Initially, 91 isolates were sequenced, and of these isolates, 89 were assembled. Furthermore, 16 isolates were excluded due to larger than expected genomic sizes (>2.3 bp × 1,000 bp). In the final analysis, 73 were used with complete WGS and minimum inhibitory concentration records, which were part of the previous phenotypic AMR study, representing 18 dairy herds from the Maritime region of Canada (1). A total of 23 unique AMR gene sequences were found in the bacterial genomes, with a mean number of 8.1 (minimum: 5; maximum: 13) per genome. Overall, there were 10 AMR genes [ANT(6), TEM-127, TEM-163, TEM-89, TEM-95, Linb, Lnub, Ermb, Ermc, and TetS] present only in S. uberis genomes and 2 genes unique (EF-TU and TEM-71) to the S. dysgalactiae genomes; 11 AMR genes [APH(3′), TEM-1, TEM-136, TEM-157, TEM-47, TetM, bl2b, gyrA, parE, phoP, and rpoB] were found in both bacterial species. Two-way tabulations showed association between the phenotypic susceptibility to lincosamides and the presence of linB (P = 0.002) and lnuB (P genes and the between the presence of tetM (P = 0.015) and tetS (P = 0.064) genes and phenotypic resistance to tetracyclines only for the S. uberis isolates. The logistic model showed that the odds of resistance (to any of the phenotypically tested antimicrobials) was 4.35 times higher when there were >11 AMR genes present in the genome, compared with genes (P resistance was lower for S. dysgalactiae than S. uberis (P = 0

  19. High-throughput profiling of antibiotic resistance genes in drinking water treatment plants and distribution systems.

    Science.gov (United States)

    Xu, Like; Ouyang, Weiying; Qian, Yanyun; Su, Chao; Su, Jianqiang; Chen, Hong

    2016-06-01

    Antibiotic resistance genes (ARGs) are present in surface water and often cannot be completely eliminated by drinking water treatment plants (DWTPs). Improper elimination of the ARG-harboring microorganisms contaminates the water supply and would lead to animal and human disease. Therefore, it is of utmost importance to determine the most effective ways by which DWTPs can eliminate ARGs. Here, we tested water samples from two DWTPs and distribution systems and detected the presence of 285 ARGs, 8 transposases, and intI-1 by utilizing high-throughput qPCR. The prevalence of ARGs differed in the two DWTPs, one of which employed conventional water treatments while the other had advanced treatment processes. The relative abundance of ARGs increased significantly after the treatment with biological activated carbon (BAC), raising the number of detected ARGs from 76 to 150. Furthermore, the final chlorination step enhanced the relative abundance of ARGs in the finished water generated from both DWTPs. The total enrichment of ARGs varied from 6.4-to 109.2-fold in tap water compared to finished water, among which beta-lactam resistance genes displayed the highest enrichment. Six transposase genes were detected in tap water samples, with the transposase gene TnpA-04 showing the greatest enrichment (up to 124.9-fold). We observed significant positive correlations between ARGs and mobile genetic elements (MGEs) during the distribution systems, indicating that transposases and intI-1 may contribute to antibiotic resistance in drinking water. To our knowledge, this is the first study to investigate the diversity and abundance of ARGs in drinking water treatment systems utilizing high-throughput qPCR techniques in China. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. Bovine mastitis Staphylococcus aureus: antibiotic susceptibility profile, resistance genes and molecular typing of methicillin-resistant and methicillin-sensitive strains in China.

    Science.gov (United States)

    Wang, Dengfeng; Wang, Zhicai; Yan, Zuoting; Wu, Jianyong; Ali, Tariq; Li, Jianjun; Lv, Yanli; Han, Bo

    2015-04-01

    The emergence of methicillin-resistant Staphylococcus aureus (MRSA) infection in dairy animals is of great concern for livestock and public health. The aim of present study was to detect new trends of methicillin-resistant Staphylococcus aureus (MRSA) and methicillin-sensitive Staphylococcus aureus (MSSA) towards antibiotic susceptibility, resistance genes and molecular typing by methods of disc diffusion, multiplex PCR assay and multilocus sequence typing (MLST). A total of 219 S. aureus strains were isolated from bovine mastitis cases from six provinces of China, including 34 MRSA strains. The results revealed that more than 70% isolated strains showed resistance to various antibiotics, and multiple-drugs resistance to more than five categories of antibiotics was found more common. The ermC was the most prevalent resistance gene, followed by other genes; however, ermA was the least frequently detected gene. Twenty-eight mecA-negative MRSA and six mecA-positive MRSA strains were detected, and in which three strains were ST97-MRSA-IV, others were ST965-MRSA-IV, ST6-MRSA-IV and ST9-MRSA-SCCmec-NT. The mecA-negative MRSA strains were found resistant to most of the antibiotics, and harbored aac(6')/aph(2''), aph(3')-III and tetM genes higher than MSSA strains. The resistance to most of the antibiotics was significantly higher in MRSA than in MSSA strains. The MLST profiles showed that these strains mainly belonged to CC5, CC398, CC121 and CC50 lineage, especially within ST97 and ST398, while some novel sequence types (ST2154, ST2165 and ST2166) were identified and deposited in the MLST database. This indicates that the resistance of S. aureus is becoming more complicated by changes in multi-drug resistance mechanism and appearance of mecA-negative MRSA isolates, and importantly, MRSA-IV strains in different MLST types are emerging. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Genetics and mapping of a new leaf rust resistance gene in Triticum ...

    Indian Academy of Sciences (India)

    AMIT KUMAR SINGH

    friendly method. Wild relatives of wheat are reservoir of useful genes, including genes for rust resis- tance. To date, 74 leaf rust resistance genes have been des- ignated and about half of them have originated from various closely or distantly related ...

  2. Molecular detection of methicillin resistant Staphylococcus aureus harbouring β- lactamase resistance genes isolated from different sources of infections

    Directory of Open Access Journals (Sweden)

    Amir Hani Raziq

    2017-12-01

    Full Text Available Background and objective: The detection and investigation of methicillin resistance staphylococci specifically S. aureus in clinical microbiology setting is very helpful both for informing the appropriate treatment of individual patients and also for the surveillance of these organisms. This study aimed at the rapid molecular detection of methicillin resistant staphylococci harbouring β-lactamase gene and determination of the efficiency of m-PCR through comparison with uniplex PCR. Methods: Standard microbiological techniques were applied for the determination of the presence of methicillin resistant S. aureus in samples recovered from different body sites of patients who attended Al-Kadhumyhia Teaching and Baghdad Teaching Hospitals. The resulting methicillin resistant S. aureus (MRSA isolates were subjected to uni and multiplex PCR amplifications for detecting the existence of mec A gene and β-lactamase (TEM resistance gene. Results: Half of the cases involved were found to be caused by MRSA. All the tested isolates showed positive amplification bands for the presence of mec A gene and only 48.8% of these harbored TEM gene. The obtained results revealed high sensitivity of universal bacterial and TEM primers expressed as 97.6% and 100% respectively, while the sensitivity of mec A primer was limited to 60%. Conclusion: The phenotypic identification of MRSA revealed a higher incidence rate and that different molecular techniques can yield conflicting results and it can also be concluded that resistant due to beta- lactamase production can be a crucial factor added to the previously settled methicillin resistant due to mec A gene.

  3. Detection and coexistence of six categories of resistance genes in Escherichia coli strains from chickens in Anhui Province, China

    Directory of Open Access Journals (Sweden)

    Lin Li

    2015-12-01

    Full Text Available The aim of this study was to characterise the prevalence of class 1 integrons and gene cassettes, tetracycline-resistance genes, phenicol-resistance genes, 16S rRNA methylase genes, extended-spectrum β-lactamase genes and plasmid-mediated fluoroquinolone resistance determinants in 184 Escherichia coli isolates from chickens in Anhui Province, China. Susceptibility to 15 antimicrobials was determined using broth micro-dilution. Polymerase chain reaction and DNA sequencing were used to characterise the molecular basis of the antibiotic resistance. High rates of antimicrobial resistance were observed; 131 out of the 184 (72.3% isolates were resistant to at least six antimicrobial agents. The prevalences of class 1 integrons, tetracycline-resistance genes, phenicol-resistance genes, 16S rRNA methylase genes, extended-spectrum β-lactamase genes and plasmid-mediated fluoroquinolone resistance determinants were 49.5, 17.4, 15.8, 0.5, 57.6 and 46.2%, respectively. In 82 isolates, 48 different kinds of coexistence of the different genes were identified. Statistical (χ2 analysis showed that the resistance to amoxicillin, doxycycline, florfenicol, ofloxacin and gentamicin had significant differences (P<0.01 or 0.01resistance genes, which showed a certain correlation between antimicrobial resistance and the presence of resistance genes.

  4. The gene Sr33, an ortholog of barley Mla genes, encodes resistance to wheat stem rust race Ug99.

    Science.gov (United States)

    Periyannan, Sambasivam; Moore, John; Ayliffe, Michael; Bansal, Urmil; Wang, Xiaojing; Huang, Li; Deal, Karin; Luo, Mingcheng; Kong, Xiuying; Bariana, Harbans; Mago, Rohit; McIntosh, Robert; Dodds, Peter; Dvorak, Jan; Lagudah, Evans

    2013-08-16

    Wheat stem rust, caused by the fungus Puccinia graminis f. sp. tritici, afflicts bread wheat (Triticum aestivum). New virulent races collectively referred to as "Ug99" have emerged, which threaten global wheat production. The wheat gene Sr33, introgressed from the wild relative Aegilops tauschii into bread wheat, confers resistance to diverse stem rust races, including the Ug99 race group. We cloned Sr33, which encodes a coiled-coil, nucleotide-binding, leucine-rich repeat protein. Sr33 is orthologous to the barley (Hordeum vulgare) Mla mildew resistance genes that confer resistance to Blumeria graminis f. sp. hordei. The wheat Sr33 gene functions independently of RAR1, SGT1, and HSP90 chaperones. Haplotype analysis from diverse collections of Ae. tauschii placed the origin of Sr33 resistance near the southern coast of the Caspian Sea.

  5. The LBP Gene and Its Association with Resistance to Aeromonas hydrophila in Tilapia

    Directory of Open Access Journals (Sweden)

    Gui Hong Fu

    2014-12-01

    Full Text Available Resistance to pathogens is important for the sustainability and profitability of food fish production. In immune-related genes, the lipopolysaccharide-binding protein (LBP gene is an important mediator of the inflammatory reaction. We analyzed the cDNA and genomic structure of the LBP gene in tilapia. The full-length cDNA (1901 bp of the gene contained a 1416 bp open reading frame, encoding 471 amino acid residues. Its genomic sequence was 5577 bp, comprising 15 exons and 14 introns. Under normal conditions, the gene was constitutively expressed in all examined tissues. The highest expression was detected in intestine and kidney. We examined the responses of the gene to challenges with two bacterial pathogens Streptcoccus agalactiae and Aeromonas hydrophila. The gene was significantly upregulated in kidney and spleen post-infection with S. agalactiae and A. hydrophila, respectively. However, the expression profiles of the gene after the challenge with the two pathogens were different. Furthermore, we identified three SNPs in the gene. There were significant associations (p < 0.05 of two of the three SNPs with the resistance to A. hydrophila, but not with the resistance to S. agalactiae or growth performance. These results suggest that the LBP gene is involved in the acute-phase immunologic response to the bacterial infections, and the responses to the two bacterial pathogens are different. The two SNPs associated with the resistance to A. hydrophila may be useful in the selection of tilapia resistant to A. hydrophila.

  6. PCR detection of indicator genes in methicillin-resistant ...

    African Journals Online (AJOL)

    MRSA) isolated from three Saudi hospitals. ... Resistance towards eight antimicrobial agents revealed that most of the tested strains of Staphylococcus aureus showed resistance to the tested antimicrobials in the following order; Oxacillin 100% ...

  7. A Public Platform for the Verification of the Phenotypic Effect of Candidate Genes for Resistance to Aflatoxin Accumulation and Aspergillus flavus Infection in Maize

    Directory of Open Access Journals (Sweden)

    Xueyan Shan

    2011-06-01

    Full Text Available A public candidate gene testing pipeline for resistance to aflatoxin accumulation or Aspergillus flavus infection in maize is presented here. The pipeline consists of steps for identifying, testing, and verifying the association of selected maize gene sequences with resistance under field conditions. Resources include a database of genetic and protein sequences associated with the reduction in aflatoxin contamination from previous studies; eight diverse inbred maize lines for polymorphism identification within any maize gene sequence; four Quantitative Trait Loci (QTL mapping populations and one association mapping panel, all phenotyped for aflatoxin accumulation resistance and associated phenotypes; and capacity for Insertion/Deletion (InDel and SNP genotyping in the population(s for mapping. To date, ten genes have been identified as possible candidate genes and put through the candidate gene testing pipeline, and results are presented here to demonstrate the utility of the pipeline.

  8. Transcriptomic analysis of colistin-susceptible and colistin-resistant isolates identifies genes associated with colistin resistance in Acinetobacter baumannii.

    Science.gov (United States)

    Park, Y K; Lee, J-Y; Ko, K S

    2015-08-01

    The emergence of colistin-resistant Acinetobacter baumannii is concerning, as colistin is often regarded as the last option for treating multidrug-resistant (MDR) A. baumannii infections. Using mRNA sequencing, we compared whole transcriptomes of colistin-susceptible and colistin-resistant A. baumannii strains, with the aim of identifying genes involved in colistin resistance. A clinical colistin-susceptible strain (06AC-179) and a colistin-resistant strain (07AC-052) were analysed in this study. In addition, a colistin-resistant mutant (06AC-179-R1) derived from 06AC-179 was also included in this study. High throughput mRNA sequencing was performed with an Illumina HiSeq TM 2000. In total, six genes were identified as associated with colistin resistance in A. baumannii. These six genes encode PmrAB two-component regulatory enzymes, PmrC (a lipid A phosphoethanolamine transferase), a glycosyltransferase, a poly-β-1,6-N-acetylglucosamine deacetylase, and a putative membrane protein. Matrix-assisted laser desorption/ionization time of flight mass spectrometry revealed that all three colistin-resistant strains used in this study had modified lipid A structure by addition of phosphoethanolamine. As genes found in our results are all associated with either lipopolysaccharide biosynthesis or electrostatic changes in the bacterial cell membrane, lipopolysaccharide modification might be one of the principal modes of acquisition of colistin resistance in some A. baumannii strains. Copyright © 2015 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  9. Virulence gene profiling and antibiotic resistance pattern of Indian isolates of Pasteurella multocida of small ruminant origin.

    Science.gov (United States)

    Sarangi, Laxmi N; Thomas, P; Gupta, S K; Priyadarshini, A; Kumar, S; Nagaleekar, Viswas Konasagara; Kumar, A; Singh, Vijendra P

    2015-02-01

    Pasteurellosis in small ruminants affects the livelihood of small and marginal farmers of India. The present study was undertaken to understand the trends in gene carriage and antibiotic resistance pattern of Pasteurella multocida isolates recovered from small ruminants over a period of 10 years in India. A total of 88 P. multocida isolates of small ruminant origin were subjected to virulence gene profiling for 19 genes by PCR and antibiogram study employing 17 different antibiotics. Virulence genes like exbB, exbD, tonB, oma87, sodA, sodC, nanB and plpB (100% prevalence) and ptfA and hsf-2 (>90% prevalence) were found to be uniformly distributed among isolates. Unexpectedly, a very high prevalence (95.45%) of pfhA gene was observed in the present study. Dermonecrotoxin gene (toxA) was observed in 48.9% of isolates with highest occurrence among serotype A isolates and interestingly, one of each isolate of serotype B and F were found to carry this gene. Antimicrobial susceptibility testing revealed 17.04% isolates to be multidrug resistant. Amongst all the antibiotics tested, most of the P. multocida isolates were found to be susceptible to enrofloxacin and chloramphenicol. This study highlights novel epidemiological information on frequency and occurrence of virulence genes among Indian isolates from small ruminants. Copyright © 2014 Elsevier Ltd. All rights reserved.

  10. Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants

    Science.gov (United States)

    Somerville, Chris R [Portola Valley, CA; Scheible, Wolf [Golm, DE

    2007-07-10

    Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  11. Sewage treatment effluents in Delhi: A key contributor of β-lactam resistant bacteria and genes to the environment.

    Science.gov (United States)

    Lamba, Manisha; Ahammad, Shaikh Ziauddin

    2017-12-01

    Rapid emergence of antibiotic resistance (AR) in developing countries is posing a greater health risk and increasing the global disease burden. Lack of access to safe drinking water, poor sanitation and inadequate sewage treatment facilities in these countries are fueling the problem associated with emergence of AR. Rapid proliferation of AR mediated by treated and untreated discharges from sewage treatment plants (STPs) is a prime public health concern. This study aims to understand the occurrence, fate, and routes of proliferation of carbapenem (KPC) and extended spectrum β-lactam (ESBL) resistant bacteria, and selected resistant genes in the samples collected from different unit operations in 12 STPs in New Delhi over two seasons. Strong correlation observed between faecal coliform levels and KPC (R = 0.95, p = 0.005, n = 60) and ESBL (R = 0.94, p = 0.004, n = 60) resistant bacteria levels indicates possible association of resistant bacteria with faecal matter. Different unit operations in STPs proved inefficient in treating resistant bacteria and genes present in the wastewater. However, inclusion of tertiary treatment (chlorination) unit and anaerobic digester in the present STPs resulted in better removal of AR. Significant correlations between antibiotic resistant genes (ARGs) and integron levels indicates a potential for higher rate of AR proliferation in the environment. Microbial culturing indicated the presence of clinically significant drug-resistant pathogens such as Escherichia coli, Pseudomonas putida, Pseudomonas aeruginosa, Enterobacter cloacae, Klebsiella pneumoniae, Klebsiella oxytoca, Acinetobacter baumannii, Shigella dysentery and Aeromonas caviae in the STP effluents. The emergence and spread of resistant bacteria through STP effluents poses exposure risk for the residents of the city. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Characterization of blaCTX gene and Cross-resistance in Klebsiella pneumoniae Isolated from Hospitalized Patients

    Directory of Open Access Journals (Sweden)

    Gholamreza Pourali Sheshblouki

    2016-04-01

    Full Text Available Background and Aim: Klebsiella pneumoniae is a member of the Enterobacteriaceae family. There is a global emergence of multidrug-resistant (MDR strains of K. pneumoniae, a Gram-negative enteric bacterium that causes nosocomial and urinary tract infections. The aims of the present study were to identify the Klebsiella pneumoniae infections in hospitalized patients, characterization of blaCTX gene, detection cross-resistance and cefepime susceptible-dose dependent (SDD in isolates. Materials and Methods: In present study, 111 strains of Klebsiella pneumoniae were isolated from patients hospitalized in Ghotbadden, Faghihi and Nemazee hospitals (Shiraz, Iran. The isolates were identified as K.pneumoniae, based on biochemical tests embedded in the API-20E system. Susceptibility testing (disc diffusion was performed according clinical and laboratory standards institute (CLSI guidelines. Detection cefepime susceptible-dose dependent (SDD was performed. The detection of AmpC β-lactamases producing strains was done based on cefoxitin and cefepime disk tests. The blaCTX gene was detected in the isolates by PCR molecular method. Results: Total 111 Klebsiella pneumoniae isolates were studied. The less effective drug was ceftazidime (37.8% isolates were sensitive. All SDD strains were susceptible to colistin and imipenem. Colistin (96.4% and imipenem (88.3% were the most effective antibiotics against isolates. Respectively, 41.4% and 35.1% isolates displayed resistance to gentamicin and amikacin. All colistin resistant isolates were imipenem sensitive. The results of PCR on blaCTX gene showed that 70.3% of the isolates possess the gene. Conclusion: Carbapenem drugs are effective against Klebsieella pneumoniae infections. These results indicate that multidrug-resistant (MDR and extensively drug resistant (XDR strains of K.pneumoniae are rising, and fewer antibiotics may be useful for treating infections caused by these strains. Routine investigation and

  13. Antimicrobial resistance and resistance genes in Salmonella strains isolated from broiler chickens along the slaughtering process in China.

    Science.gov (United States)

    Zhu, Yuanting; Lai, Haimei; Zou, Likou; Yin, Sheng; Wang, Chengtao; Han, Xinfeng; Xia, Xiaolong; Hu, Kaidi; He, Li; Zhou, Kang; Chen, Shujuan; Ao, Xiaolin; Liu, Shuliang

    2017-10-16

    A total of 189 Salmonella isolates were recovered from 627 samples which were collected from cecal contents of broilers, chicken carcasses, chicken meat after cutting step and frozen broiler chicken products along the slaughtering process at a slaughterhouse in Sichuan province of China. The Salmonella isolates were subjected to antimicrobial susceptibility testing to 10 categories of antimicrobial agents using the Kirby-Bauer disk diffusion method. Those antibiotics-resistant isolates were further investigated for the occurrence of resistance genes, the presence of class 1 integron as well as the associated gene cassettes, and the mutations within the gyrA and parC genes. Consequently, the prevalence of Salmonella was 30.14% (47.96% for cecal content, 18.78% for chicken carcasses, 31.33% for cutting meat and 14.00% for frozen meat, respectively). The predominant serotypes were S. Typhimurium (15.34%) and S. Enteritidis (69.84%). High resistance rates to the following drugs were observed: nalidixic acid (99.5%), ampicillin (87.8%), tetracycline (51.9%), ciprofloxacin (48.7%), trimethoprim/sulfamethoxazole (48.1%), and spectinomycin (34.4%). Antimicrobial resistance profiling showed that 60.8% of isolates were multidrug resistant (MDR), and MDR strains increased from 44.7% to 78.6% along the slaughtering line. 94.6% (n=157) of beta-lactam-resistant isolates harbored at least one resistance gene of bla TEM or bla CTX-M . The relatively low prevalence of aminoglycoside resistance genes (aac(3)-II, aac(3)-IV, and ant(2″)-I) was found in 49 (66.2%) of antibiotic-resistant isolates. The tetracycline resistance genes (tet(A), tet(B), tet(C), and tet(G) and sulfonamide resistance genes (sul1, sul2, and sul3) were identified in 84 (85.7%) and 89 (97.8%) antibiotic-resistant isolates respectively. floR was identified in 44 (97.8%) florfenicol-resistant isolates. Class 1 integron was detected in 37.4% (n=43) of the MDR isolates. Two different gene cassettes, bla OXA-30 -aad

  14. Epidemiologic evaluation of Vancomycin Resistant genes in Enterococcus spp. isolated from clinical samples

    Directory of Open Access Journals (Sweden)

    Omid Teymournejad

    2011-09-01

    Full Text Available Background & Objectives: Isolation of vancomycin resistant Enterococcus from clinical samples is very important. The aim of this study was evaluation of phenotype and genotype of van genes in vancomycine resistant Enterococcus. Materials and Methods: 411 Enterococcus isolates were collected from selected Tehran’s hospitals between March 2004 and December 2007. The enterococcal isolates were identified by biochemical confirmation tests. Resistance of each isolate to vancomycin determined by disk diffusion and agar dilution test. The presence of the vanA, B, C, D, E resistance gene was assessed by PCR. Results: 185(45% and 23(5.6% with disc-diffusion method and agar-dilution method were resistant to vancomucin (VRE and all of VREs were Enterococcus faecium. 12 (52.2%, 7(30.4% of the VRE isolates had vanA, vanB and 3(13% had both of vanA and vanB gene. Conclusion: Most important mechanism for high level resistance to vancomycin is presence of van genes and these genes can transfer between Enterococci. Significance of investigation in molecular level of resistance to vancomycin was due to relation between phenotypic resistant and presence of van genes.

  15. Cloning and characterization of NBS-LRR resistance gene ...

    African Journals Online (AJOL)

    Nendran) cultivar. C6 was expressed only in resistant cultivar not in susceptible one. But there was no change in the expression of C2 and C3 in both resistant and susceptible cultivars. These results indicate that in depth study on C1, and C5 RGAs will be helpful for further improvement of P. coffeae resistance in banana.

  16. The transport of antibiotic resistance genes and residues in groundwater near swine production facilities

    Science.gov (United States)

    Lin, Y. F.; Yannarell, A. C.; Mackie, R. I.; Krapac, I. G.; Chee-Sanford, J. S.; Koike, S.

    2008-12-01

    The use of antibiotics at concentrated animal feeding operations (CAFOs) for disease prevention, disease treatment, and growth promotion can contribute to the spread of antibiotic compounds, their breakdown products, and antibiotic resistant bacteria and/or the genes that confer resistance. In addition, constitutive use of antibiotics at sub-therapeutic levels can select for antibiotic resistance among the bacteria that inhabit animal intestinal tracts, onsite manure treatment facilities, and any environments receiving significant inputs of manure (e.g. through waste lagoon leakage or fertilizer amendments to farm soils). If the antibiotic resistant organisms persist in these new environments, or if they participate in genetic exchanges with the native microflora, then CAFOs may constitute a significant reservoir for the spread of antibiotic resistance to the environment at large. Our results have demonstrated that leakage from waste treatment lagoons can influence the presence and persistence of tetracycline resistance genes in the shallow aquifer adjacent to swine CAFOs, and molecular phylogeny allowed us to distinguish "native" tetracycline resistance genes in control groundwater wells from manure-associated genes introduced from the lagoon. We have also been able to detect the presence of erythromycin resistance genes in CAFO surface and groundwater even though erythromycin is strictly reserved for use in humans and thus is not utilized at any of these sites. Ongoing research, including modeling of particle transport in groundwater, will help to determine the potential spatial and temporal extent of CAFO-derived antibiotic resistance.

  17. Emergence of macrolide resistance gene mph(B) in Streptococcus uberis and cooperative effects with rdmC-like gene.

    Science.gov (United States)

    Achard, Adeline; Guérin-Faublée, Véronique; Pichereau, Vianney; Villers, Corinne; Leclercq, Roland

    2008-08-01

    Streptococcus uberis UCN60 was resistant to spiramycin (MIC = 8 microg/ml) but susceptible to erythromycin (MIC = 0.06 microg/ml), azithromycin (MIC = 0.12 microg/ml), josamycin (MIC = 0.25 microg/ml), and tylosin (MIC = 0.5 microg/ml). A 2.5-kb HindIII fragment was cloned from S. uberis UCN60 DNA on plasmid pUC18 and introduced into Escherichia coli AG100A, where it conferred resistance to spiramycin by inactivation. The sequence analysis of the fragment showed the presence of an rdmC-like gene that putatively encoded a protein belonging to the alpha/beta hydrolase family and of the first 196 nucleotides of the mph(B) gene putatively encoding a phosphotransferase known to inactivate 14-, 15-, and 16-membered macrolides in E. coli. The entire mph(B) gene was then identified in S. uberis UCN60. The two genes were expressed alone or in combination in E. coli, Staphylococcus aureus, and Enterococcus faecalis. Analysis of MICs revealed that rdmC-like alone did not confer resistance to erythromycin, tylosin, and josamycin in those three hosts. It conferred resistance to spiramycin in E. coli and E. faecalis but not in S. aureus. mph(B) conferred resistance in E. coli to erythromycin, tylosin, josamycin, and spiramycin but only low levels of resistance in E. faecalis and S. aureus to spiramycin (MIC = 8 microg/ml). The combination of mph(B) and rdmC-like genes resulted in a resistance to spiramycin and tylosin in the three hosts that significantly exceeded the mere addition of the resistance levels conferred by each resistance mechanism alone.

  18. Presentations

    International Nuclear Information System (INIS)

    2007-01-01

    The PARIS meeting held in Cracow, Poland from 14 to 15 May 2007. The main subjects discussed during this meeting were the status of international project dedicated to gamma spectroscopy research. The scientific research program includes investigations of giant dipole resonance, probe of hot nuclei induced in heavy reactions, Jacobi shape transitions, isospin mixing and nuclear multifragmentation. The mentioned programme needs Rand D development such as new scintillations materials as lanthanum chlorides and bromides as well as new photo detection sensors as avalanche photodiodes - such subjects are also subjects of discussion. Additionally results of computerized simulations of scintillation detectors properties by means of GEANT- 4 code are presented

  19. Antimicrobial resistance genes in Actinobacillus pleuropneumoniae, Haemophilus parasuis and Pasteurella multocida isolated from Australian pigs.

    Science.gov (United States)

    Dayao, Dae; Gibson, J S; Blackall, P J; Turni, C

    2016-07-01

    To identify genes associated with the observed antimicrobial resistance in Actinobacillus pleuropneumoniae, Haemophilus parasuis and Pasteurella multocida isolated from Australian pigs. Isolates with known phenotypic resistance to β-lactams, macrolides and tetracycline were screened for the presence of antimicrobial resistance genes. A total of 68 A. pleuropneumoniae, 62 H. parasuis and 20 P. multocida isolates exhibiting phenotypic antimicrobial resistance (A. pleuropneumoniae and P. multocida) or elevated minimal inhibitory concentrations (MICs) (H. parasuis) to any of the following antimicrobial agents - ampicillin, erythromycin, penicillin, tetracycline, tilmicosin and tulathromycin - were screened for a total of 19 associated antimicrobial resistance genes (ARGs) by PCR. The gene bla ROB-1 was found in all ampicillin- and penicillin-resistant isolates, but none harboured the bla TEM-1 gene. The tetB gene was found in 76% (74/97) of tetracycline-resistant isolates, 49/53 A. pleuropneumoniae, 17/30 H. parasuis and 8/14 P. multocida. One A. pleuropneumoniae isolate harboured the tetH gene, but none of the 97 isolates had tetA, tetC, tetD, tetE, tetL, tetM or tetO. A total of 92 isolates were screened for the presence of macrolide resistance genes. None was found to have ermA, ermB, ermC, erm42, mphE, mefA, msrA or msrE. The current study has provided a genetic explanation for the resistance or elevated MIC of the majority of isolates of Australian porcine respiratory pathogens to ampicillin, penicillin and tetracycline. However, the macrolide resistance observed by phenotypic testing remains genetically unexplained and further studies are required. © 2016 Australian Veterinary Association.

  20. Characterization of Antibiotic Resistance Genes from Lactobacillus Isolated from Traditional Dairy Products.

    Science.gov (United States)

    Guo, Huiling; Pan, Lin; Li, Lina; Lu, Jie; Kwok, Laiyu; Menghe, Bilige; Zhang, Heping; Zhang, Wenyi

    2017-03-01

    Lactobacilli are widely used as starter cultures or probiotics in yoghurt, cheese, beer, wine, pickles, preserved food, and silage. They are generally recognized as safe (GRAS). However, recent studies have shown that some lactic acid bacteria (LAB) strains carry antibiotic resistance genes and are resistant to antibiotics. Some of them may even transfer their intrinsic antibiotic resistance genes to other LAB or pathogens via horizontal gene transfer, thus threatening human health. A total of 33 Lactobacillus strains was isolated from fermented milk collected from different areas of China. We analyzed (1) their levels of antibiotic resistance using a standardized dilution method, (2) their antibiotic resistance gene profiles by polymerase chain reaction (PCR) using gene-specific primers, and (3) the transferability of some of the detected resistance markers by a filter mating assay. All Lactobacillus strains were found to be resistant to vancomycin, but susceptible to gentamicin, linezolid, neomycin, erythromycin, and clindamycin. Their susceptibilities to tetracycline, kanamycin, ciprofloxacin, streptomycin, quinupristin/dalfopristin, trimethoprim, ampicillin, rifampicin, and chloramphenicol was different. Results from our PCR analysis revealed 19 vancomycin, 10 ciprofloxacin, and 1 tetracycline-resistant bacteria that carried the van(X), van(E), gyr(A), and tet(M) genes, respectively. Finally, no transferal of the monitored antibiotic resistance genes was observed in the filter mating assay. Taken together, our study generated the antibiotic resistance profiles of some milk-originated lactobacilli isolates and preliminarily assessed their risk of transferring antibiotic gene to other bacteria. The study may provide important data concerning the safe use of LAB. © 2017 Institute of Food Technologists®.

  1. [Resistance to therapy in primary nephrotic syndrome: effect of MDR1 gene activity].

    Science.gov (United States)

    Stachowski, J; Zanker, C B; Runowski, D; Zaniew, M; Peszko, A; Medyńska, A; Zwolińska, D; Rogowska-Kalisz, A; Hyla-Klekot, L; Szprygner, K; Weglarska, J; Sieniawska, M; Musiał, W; Maciejewski, J; Baldamus, C A

    2000-04-01

    MDR1 gene encodes for a transmembranous glycoprotein, gp-170, which acts as a drug export pump and is also a cyclosporine(CsA)-binding protein. This study aimed at evaluating MDR1 expression in NS sensitive(S) and resistant(R) to therapy (steroids/S/, cyclophosphamide/C/, CsA) patients. Twenty six boys, 13 girls aged 3-8 years were included to the study. MDR1 was analysed using: 1) evaluation of gp-170 activity according to DiC2/3/ [3,3-Diethyloxa-carbocyanine Iodide] by means of flow cytometry and as 2) mRNA expression of MDR1 determined by RT-PCR. The analysis was performed in the lymphocyte subset CD4/CD45RA presenting suppressor-inducer activity. Negative control, Jurkat-T-cell line, not expressing the MDR1 phenotype, was transfected with viral expression vector containing a full-length cDNA for the human MDR1 gene. We found that: in SR-NS the high expression of MDR1 was associated mainly with the suppressor-inducer T-cells (CD45RA+CD4+) and was subsequently enhanced during an ineffective treatment with C and/or CsA. C-R-NS and CsA-R-NS were partially reversible by S- and R-Verapamil; this was in vitro confirmed by inhibition of export pump activity, gp-170. SS-NS, C-S-NS and CsA-S-NS presented the low expression and activity of MDR1 comparing to R-children (p gene and subsequent high activity of export pump P-gp-170. Calcium channel blockers may reverse the MRD1-related resistance in the therapy of NS. Analysis of MDR1 may help to detect of suspected therapy resistance in NS.

  2. Occurrence of antibiotics and antibiotic resistance genes in a sewage treatment plant and its effluent-receiving river.

    Science.gov (United States)

    Xu, Jian; Xu, Yan; Wang, Hongmei; Guo, Changsheng; Qiu, Huiyun; He, Yan; Zhang, Yuan; Li, Xiaochen; Meng, Wei

    2015-01-01

    The extensive use of antibiotics has caused the contamination of both antibiotics and antibiotic resistance genes (ARGs) in the environment. In this study, the abundance and distribution of antibiotics and ARGs from a sewage treatment plant (STP) and its effluent-receiving river in Beijing China were characterized. Three classes of antibiotics including tetracycline, sulfonamide and quinolone were quantified by LC-MS/MS. In the secondary effluent they were detected at 195, 2001 and 3866 ng L(-1), respectively, which were higher than in the receiving river water. A total of 13 ARGs (6 tet genes: tetA, tetB, tetE, tetW, tetM and tetZ, 3 sulfonamide genes: sul1, sul2 and sul3, and 4 quinolone genes: gryA, parC, qnrC and qnrD) were determined by quantitative PCR. For all ARGs, sulfonamide resistance genes were present at relatively high concentrations in all samples, with the highest ARG concentration above 10(-1). ARGs remained relatively stable along each sewage treatment process. The abundances of detected ARGs from the STP were also higher than its receiving river. Bivariate correlation analysis showed that relative tet gene copies (tetB/16S-rRNA and tetW/16S-rRNA) were strongly correlated with the concentrations of tetracycline residues (r(2)>0.8, presistance gene (qnrC/16S-rRNA) and the concentrations of enrofloxacin (ENR) was also determined. The difference of ARGs levels in the raw influent and secondary effluent suggested that the STP treatment process may induce to increase the abundance of resistance genes. The results showed that the sewage was an important repository of the resistance genes, which need to be effectively treated before discharge into the natural water body. Copyright © 2014 Elsevier Ltd. All rights reserved.

  3. Inducible clindamycin resistance in clinical isolates of Staphylococcus aureus due to erm genes, Iran.

    Science.gov (United States)

    Moosavian, Mojtaba; Shoja, Saeed; Rostami, Soodabeh; Torabipour, Maryam; Farshadzadeh, Zahra

    2014-12-01

    Resistance to macrolide can be mediated by erm and msrA genes in Staphylococcus aureus. There are the evidences that show erm genes may be causative agent of inducible or constitutive resistance. The aim of this study was to investigate the incidence of inducible clindamycin resistance and determine the most frequency of erm and msrA genes among S. aureus isolates. In this study a total of 124 non duplicated clinical isolates of S. aureus were tested with disk diffusion method. All isolates were tested by PCR for mecA, ermA, ermB, ermC and msrA genes. According to PCR results, 48.4% had mecA gene and 51.6% were mecA negative. By phenotypic D-test method, 32.3% revealed inducible resistance and recorded as D and D(+). Sensitive and constitutive phenotypes were found in 54.8% and 12.9% of isolates respectively. Inducible clindamycin resistance was more prevalent in MRSA (29%) than MSSA isolates (2.4%). Among studied erm genes, the most frequency genes were ermA and ermC with 41.1% and 17.7% respectively. Three isolates of them had D phenotype, while the PCR results of erm genes were negative. All isolates were negative for ermB or msrA genes. Since S. aureus isolates with inducible resistance may mutate and change to constitutive resistance, to prevent treatment failure, we suggest that inducible resistance test be performed on erythromycin resistant/clindamycin sensitive isolates.

  4. RNA-Seq analysis reveals candidate genes for ontogenic resistance in Malus-Venturia pathosystem.

    Directory of Open Access Journals (Sweden)

    Michele Gusberti

    Full Text Available Ontogenic scab resistance in apple leaves and fruits is a horizontal resistance against the plant pathogen Venturia inaequalis and is expressed as a decrease in disease symptoms and incidence with the ageing of the leaves. Several studies at the biochemical level tried to unveil the nature of this resistance; however, no conclusive results were reported. We decided therefore to investigate the genetic origin of this phenomenon by performing a full quantitative transcriptome sequencing and comparison of young (susceptible and old (ontogenic resistant leaves, infected or not with the pathogen. Two time points at 72 and 96 hours post-inoculation were chosen for RNA sampling and sequencing. Comparison between the different conditions (young and old leaves, inoculated or not should allow the identification of differentially expressed genes which may represent different induced plant defence reactions leading to ontogenic resistance or may be the cause of a constitutive (uninoculated with the pathogen shift toward resistance in old leaves. Differentially expressed genes were then characterised for their function by homology to A. thaliana and other plant genes, particularly looking for genes involved in pathways already suspected of appertaining to ontogenic resistance in apple or other hosts, or to plant defence mechanisms in general. IN THIS WORK, FIVE CANDIDATE GENES PUTATIVELY INVOLVED IN THE ONTOGENIC RESISTANCE OF APPLE WERE IDENTIFIED: a gene encoding an "enhanced disease susceptibility 1 protein" was found to be down-regulated in both uninoculated and inoculated old leaves at 96 hpi, while the other four genes encoding proteins (metallothionein3-like protein, lipoxygenase, lipid transfer protein, and a peroxidase 3 were found to be constitutively up-regulated in inoculated and uninoculated old leaves. The modulation of the five candidate genes has been validated using the real-time quantitative PCR. Thus, ontogenic resistance may be the result

  5. Gene Expression Analysis of Plum pox virus (Sharka Susceptibility/Resistance in Apricot (Prunus armeniaca L..

    Directory of Open Access Journals (Sweden)

    Manuel Rubio

    Full Text Available RNA-Seq has proven to be a very powerful tool in the analysis of the Plum pox virus (PPV, sharka disease/Prunus interaction. This technique is an important complementary tool to other means of studying genomics. In this work an analysis of gene expression of resistance/susceptibility to PPV in apricot is performed. RNA-Seq has been applied to analyse the gene expression changes induced by PPV infection in leaves from two full-sib apricot genotypes, "Rojo Pasión" and "Z506-7", resistant and susceptible to PPV, respectively. Transcriptomic analyses revealed the existence of more than 2,000 genes related to the pathogen response and resistance to PPV in apricot. These results showed that the response to infection by the virus in the susceptible genotype is associated with an induction of genes involved in pathogen resistance such as the allene oxide synthase, S-adenosylmethionine synthetase 2 and the major MLP-like protein 423. Over-expression of the Dicer protein 2a may indicate the suppression of a gene silencing mechanism of the plant by PPV HCPro and P1 PPV proteins. On the other hand, there were 164 genes involved in resistance mechanisms that have been identified in apricot, 49 of which are located in the PPVres region (scaffold 1 positions from 8,050,804 to 8,244,925, which is responsible for PPV resistance in apricot. Among these genes in apricot there are several MATH domain-containing genes, although other genes inside (Pleiotropic drug resistance 9 gene or outside (CAP, Cysteine-rich secretory proteins, Antigen 5 and Pathogenesis-related 1 protein; and LEA, Late embryogenesis abundant protein PPVres region could also be involved in the resistance.

  6. THE ASPECTS OF INVESTIGATION OF MICROORGANISM ANTIBIOTIC RESISTANCE AT THE PRESENT STAGE

    Directory of Open Access Journals (Sweden)

    Andreeva I.A.

    2015-05-01

    Full Text Available Introduction. At the present stage for ensuring epidemic safety and prevention of nosocomial infections the complex of analytical study and managerial procedure to improve the epidemiological supervision over nosocomial infections through the introduction of infection control in health care practice are using. The microbiological monitoring is part of the infectious control and allows supervising circulation of microorganisms and their antimicrobial resistance by dynamic observation over structure and level of resistance to antibiotics that are used in the given particular hospital. Materials and methods. For the dynamic observation of the structure and the level of resistance of microorganisms to antimicrobial agents the computer software WHONET recommended by WHO has been used. With using WHONET in Dnepropetrovsk Children's Hospital № 3 the computer database has been created. In this database the information about each patient, hospital department, samples under test and the date of its excretion, the data about the detected microorganism and its sensitivity/resistance to antimicrobial agents have been stored. The examination and analysis of antibiotic resistance of microorganisms has been provided for 2010- 2014 years, in total the data on 6168 isolates from 3876 patients have been analyzed. Results and discussion. By the total data the isolates belong to a wide spectrum of microorganisms (more than 40 different types. By means of the analysis of isolating of clinically significant microorganisms it has been established that one of the most frequent isolated were Escherichia coli (1-20 %, Klebsiella pneumoniae (4-18 %, Staphylococcus epidermidis (1-12 %, S. aureus (1-10 %, Enterobacter cloacae (2-9 %, Pseudomonas aeruginosa (1-8 %. Detection of other microorganisms was irregular and its frequency is varied from 0 % to 10 %. As a result of examining the sensitivity of microorganisms it has been shown that tested strains of bacteria were

  7. Integron types, gene cassettes and antimicrobial resistance profile of Acinetobacter baumannii isolated from BAL samples in Babol, north of Iran.

    Science.gov (United States)

    Akrami, Fariba; Shahandashti, Elaheh Ferdosi; Yahyapour, Yousef; Sadeghi, Mohsen; Khafri, Soraya; Pournajaf, Abazar; Rajabnia, Ramazan

    2017-08-01

    Multi-drug resistant isolates of Acinetobacter baumannii have created therapeutic problems worldwide. This current study was intended to determine the Integron types, gene cassettes and antimicrobial resistance profile of A. baumannii isolated from BAL samples in Babol, north of Iran. During a 15-month period, 35 A. baumannii isolates were studied. Different classes of antimicrobial agents were used to determine the resistance ratios. Multiplex-PCR was used to detect different types of integrons and associated gene cassettes. The resistance rates to GM, FEP, AK, TOB, CP, PIP, SAM, IPM, SXT, CTX, CAZ, CL, TIM, MEM, and TZP were 85.7%, 100%, 91.4%, 68.5%, 94.3%, 88.5%, 97.1%, 94.3%, 100%, 100%, 100%, 0.0%, 91.4%, 94.3% and 91.4%, respectively. The distribution analysis of int genes showed that 25.7%, 88.6% and 28.6% of isolates carried the intI, intII and intIII genes, respectively. The prevalence of aadB, dfrA1, bla-OXA 30 and aadA1 genes were 94.3%, 77.1%, 40% and 5.7%, respectively. The current study showed that a high level of A. baumannii isolates harbor integrons in our therapeutic center, which may lead to distribution of multiple antimicrobial resistance. The different types of gene cassette arrays in the present study highlight the important role of geographical features in MDR isolates dissemination which could be credited to different profiles of drug consumption in different areas. The findings emphasized that the need for continuous surveillance to prevent distribution of multidrug resistance among A. baumannii strains in Iran. Copyright © 2017. Published by Elsevier Ltd.

  8. Trends of drug-resistance-associated mutations in the reverse transcriptase gene of HIV type 1 isolates from North India.

    Science.gov (United States)

    Azam, Mohd; Malik, Abida; Rizvi, Meher; Rai, Arvind

    2014-04-01

    A major cause of failure of antiretroviral therapy (ART) is the presence of drug-resistance-associated mutations in the polymerase gene of HIV-1. The paucity of data regarding potential drug resistance to reverse transcriptase inhibitors (RTIs) prompted us to carry out this study. This information will shed light on the extent of drug resistance already present in HIV strains and will give future directions in patient treatment and in drug design. Drug resistance genotyping of a partial reverse transcriptase gene was done in 103 HIV-1-infected patients, including the ART-naive and ART-experienced population. The drug resistance pattern was analyzed using the Stanford HIV-DR database, the IAS-USA mutation list and the REGA algorithm-v8.0. Subtyping was done using the REGA HIV-1 subtyping tool-v2.01. The majority of our sequences (96 %) were found to be subtype C, and four (3.8 %) were subtype A1. Significant prevalence of DR mutations (28 %) was observed in the RT gene. Major amino acid substitutions were seen at positions 41, 90, 98, 103, 106, 108, 138, 181, 184, 190, 215, and 219, which confer high/intermediate levels of resistance to most RTIs, independently or together. Our results show that there is an urgent need to tailor ART drug regimens to the individual to achieve optimum therapeutic outcome in North India.

  9. A Genome-Wide Knockout Screen to Identify Genes Involved in Acquired Carboplatin Resistance

    Science.gov (United States)

    2016-07-01

    result in resistance is demonstrated by the fact that mutations in the DNA mismatch repair genes MLH1 or MSH2 produce resistance due to failure of the...cancer. Genes Dev 2010;24(8):837-52. 18. Fink D, Nebel S, Aebi S, Zheng H, Cenni B, Nehme A, et al. The role of DNA mismatch repair in platinum drug...CBDCA and cDDP, but it remains uncertain whether increased DNA repair capacity is the basis for resistance (17). That the loss of a single gene can

  10. SNP assay to detect the ‘Hyuuga’ red-brown lesion resistance gene for Asian soybean rust

    Science.gov (United States)

    Ha, Bo-Keun; Phillips, Daniel V.; Boerma, H. Roger

    2010-01-01

    Asian soybean rust (ASR), caused by Phakopsora pachyrhizi Syd., has the potential to become a serious threat to soybean, Glycine max L. Merr., production in the USA. A novel rust resistance gene, Rpp?(Hyuuga), from the Japanese soybean cultivar Hyuuga has been identified and mapped to soybean chromosome 6 (Gm06). Our objectives were to fine-map the Rpp?(Hyuuga) gene and develop a high-throughput single nucleotide polymorphism (SNP) assay to detect this ASR resistance gene. The integration of recombination events from two different soybean populations and the ASR reaction data indicates that the Rpp?(Hyuuga) locus is located in a region of approximately 371 kb between STS70887 and STS70923 on chromosome Gm06. A set of 32 ancestral genotypes which is predicted to contain 95% of the alleles present in current elite North American breeding populations and the sources of the previously reported ASR resistance genes (Rpp1, Rpp2, Rpp3, Rpp4, Rpp5, and rpp5) were genotyped with five SNP markers. We developed a SimpleProbe assay based on melting curve analysis for SNP06-44058 which is tighly linked to the Rpp?(Hyuuga) gene. This SNP assay can differentiate plants/lines that are homozygous/homogeneous or heterozygous/heterogeneous for the resistant and susceptible alleles at the Rpp?(Hyuuga) locus. PMID:20532750

  11. Identification and characterization of antibiotic resistance genes in Lactobacillus reuteri and Lactobacillus plantarum.

    Science.gov (United States)

    Egervärn, M; Roos, S; Lindmark, H

    2009-11-01

    The study aimed to identify the resistance genes mediating atypical minimum inhibitory concentrations (MICs) for tetracycline, erythromycin, clindamycin and chloramphenicol within two sets of representative strains of the species Lactobacillus reuteri and Lactobacillus plantarum and to characterize identified genes by means of gene location and sequencing of flanking regions. A tet(W) gene was found in 24 of the 28 Lact. reuteri strains with atypical MIC for tetracycline, whereas four of the six strains with atypical MIC for erythromycin were positive for erm(B) and one strain each was positive for erm(C) and erm(T). The two Lact. plantarum strains with atypical MIC for tetracycline harboured a plasmid-encoded tet(M) gene. The majority of the tet(W)-positive Lact. reuteri strains and all erm-positive Lact. reuteri strains carried the genes on plasmids, as determined by Southern blot and a real-time PCR method developed in this study. Most of the antibiotic-resistant strains of Lact. reuteri and Lact. plantarum harboured known plasmid-encoded resistance genes. Examples of putative transfer machineries adjacent to both plasmid- and chromosome-located resistance genes were also demonstrated. These data provide some of the knowledge required for assessing the possible risk of using Lact. reuteri and Lact. plantarum strains carrying antibiotic resistance genes as starter cultures and probiotics.

  12. Multidrug resistance genes, including bla(KPC) and bla(CTX)-M-2, among Klebsiella pneumoniae isolated in Recife, Brazil.

    Science.gov (United States)

    Cabral, Adriane Borges; Melo, Rita de Cássia de Andrade; Maciel, Maria Amélia Vieira; Lopes, Ana Catarina Souza

    2012-10-01

    The prevalence of cephalosporins and carbapenem-resistant Klebsiella pneumoniae strains is rising in Brazil, with potential serious consequences in terms of patients' outcomes and general care. This study characterized 24 clinical isolates of K. pneumoniae from two hospitals in Recife, Brazil, through the antimicrobial susceptibility profile, analyses of β-lactamase genes (bla(TEM), bla(SHV),bla(CTX-M), bla(KPC), bla(VIM), bla(IMP), and bla(SPM), plasmidial profile and ERIC-PCR (Enterobacterial repetitive intergenic consensus-polymerase chain reaction). ERIC-PCR and plasmidial analysis grouped the isolates in 17 and 19 patterns, respectively. Six isolates from one hospital presented the same pattern by ERIC-PCR, indicating clonal dissemination. All isolates presented bla(SHV), 62.5% presented bla(CTX)-M-2, 29% bla(TEM), and 41.7% bla(KPC). Metallo-β-lactamase genes bla(VIM), bla(IMP), and bla(SPM) not detected. Eleven isolates were identified carrying at least 3 β-lactamase studied genes, and 2 isolates carried bla(SHV), bla(TEM), bla (CTX-M-2) and bla(KPC) simultaneously. The accumulation of resistance genes in some strains, observed in this study, imposes limitations in the therapeutic options available for the treatment of infections caused by K. pneumoniae in Recife, Brazil. These results should alert the Brazilian medical authorities to establish rigorous methods for more efficiently control the dissemination of antimicrobial resistance genes in the hospital environment.

  13. PCR-based detection of resistance genes in anaerobic bacteria isolated from intra-abdominal infections.

    Science.gov (United States)

    Tran, Chau Minh; Tanaka, Kaori; Watanabe, Kunitomo

    2013-04-01

    Little information is available on the distribution of antimicrobial resistance genes in anaerobes in Japan. To understand the background of antimicrobial resistance in anaerobes involved in intra-abdominal infections, we investigated the distribution of eight antimicrobial resistance genes (cepA, cfiA, cfxA, ermF, ermB, mefA, tetQ, and nim) and a mutation in the gyrA gene in a total of 152 organisms (Bacteroides spp., Prevotella spp., Fusobacterium spp., Porphyromonas spp., Bilophila wadsworthia, Desulfovibrio desulfuricans, Veillonella spp., gram-positive cocci, and non-spore-forming gram-positive bacilli) isolated between 2003 and 2004 in Japan. The cepA gene was distributed primarily in Bacteroides fragilis. Gene cfxA was detected in about 9 % of the Bacteroides isolates and 75 % of the Prevotella spp. isolates and did not appear to contribute to cephamycin resistance. Two strains of B. fragilis contained the metallo-β-lactamase gene cfiA, but they did not produce the protein product. Gene tetQ was detected in about 81, 44, and 63 % of B. fragilis isolates, other Bacteroides spp., and Prevotella spp. isolates, respectively. The ermF gene was detected in 25, 13, 56, 64, and 16 % of Bacteroides spp., Prevotella spp., Fusobacterium spp., B. wadsworthia, and anaerobic cocci, respectively. Gene mefA was found in only 10 % of the B. fragilis strains and 3 % of the non-B. fragilis strains. Genes nim and ermB were not detected in any isolate. Substitution at position 82 (Ser to Phe) in gyrA was detected in B. fragilis isolates that were less susceptible or resistant to moxifloxacin. This study is the first report on the distribution of resistance genes in anaerobes isolated from intra-abdominal infections in Japan. We expect that the results might help in understanding the resistance mechanisms of specific anaerobes.

  14. Mutations of the Helicobacter pylori Genes rdxA and pbp1 Cause Resistance against Metronidazole and Amoxicillin

    OpenAIRE

    Paul, Ralf; Postius, Stefan; Melchers, Klaus; Schäfer, Klaus P.

    2001-01-01

    To investigate amoxicillin and metronidazole resistance of Helicobacter pylori, we compared putative resistance genes between resistant strains obtained in vitro and their sensitive parent strain. All metronidazole-resistant strains had rdxA mutations, and an amoxicillin-resistant strain had pbp1 and pbp2 mutations. By transforming PCR products of these mutated genes into antibiotic-sensitive strains, we showed that rdxA null mutations were sufficient for metronidazole resistance, while pbp1 ...

  15. Knockdown resistance (kdr) of the voltage-gated sodium channel gene of Aedes aegypti population in Denpasar, Bali, Indonesia.

    Science.gov (United States)

    Hamid, Penny Humaidah; Prastowo, Joko; Widyasari, Anis; Taubert, Anja; Hermosilla, Carlos

    2017-06-05

    Aedes aegypti is the main vector of several arthropod-borne viral infections in the tropics profoundly affecting humans, such as dengue fever (DF), West Nile (WN), chikungunya and more recently Zika. Eradication of Aedes still largely depends on insecticides, which is the most cost-effective strategy, and often inefficient due to resistance development in exposed Aedes populations. We here conducted a study of Ae. aegypti resistance towards several insecticides regularly used in the city of Denpasar, Bali, Indonesia. Aedes aegypti egg samples were collected with ovitraps and thereafter hatched in the insectary of the Gadjah Mada University. The F0 generation was used for all bioassay-related experiments and knockdown resistance (kdr) assays. Results clearly showed resistance development of Ae. aegypti against tested insecticides. Mortalities of Ae. aegypti were less than 90% with highest resistance observed against 0.75% permethrin. Mosquitoes from the southern parts of Denpasar presented high level of resistance pattern in comparison to those from the western and northern parts of Denpasar. Kdr analysis of voltage-gated sodium channel (Vgsc) gene showed significant association to S989P and V1016G mutations linked to resistance phenotypes against 0.75% permethrin. Conversely, Ae. aegypti F1534C gene mutation did not result in any significant correlation to resistance development. Periodically surveillance of insecticide resistances in Ae. aegypti mosquitoes will help local public health authorities to set better goals and allow proper evaluation of on-going mosquito control strategies. Initial detection of insecticide resistance will contribute to conduct proper actions in delaying mosquito resistance development such as insecticide rotation or combination of compounds in order to prolong chemical efficacy in combating Ae. aegypti vectors in Indonesia.

  16. Presentation

    Directory of Open Access Journals (Sweden)

    Eduardo Vicente

    2013-06-01

    Full Text Available In the present edition of Significação – Scientific Journal for Audiovisual Culture and in the others to follow something new is brought: the presence of thematic dossiers which are to be organized by invited scholars. The appointed subject for the very first one of them was Radio and the invited scholar, Eduardo Vicente, professor at the Graduate Course in Audiovisual and at the Postgraduate Program in Audiovisual Media and Processes of the School of Communication and Arts of the University of São Paulo (ECA-USP. Entitled Radio Beyond Borders the dossier gathers six articles and the intention of reuniting works on the perspectives of usage of such media as much as on the new possibilities of aesthetical experimenting being build up for it, especially considering the new digital technologies and technological convergences. It also intends to present works with original theoretical approach and original reflections able to reset the way we look at what is today already a centennial media. Having broadened the meaning of “beyond borders”, four foreign authors were invited to join the dossier. This is the first time they are being published in this country and so, in all cases, the articles where either written or translated into Portuguese.The dossier begins with “Radio is dead…Long live to the sound”, which is the transcription of a thought provoking lecture given by Armand Balsebre (Autonomous University of Barcelona – one of the most influential authors in the world on the Radio study field. It addresses the challenges such media is to face so that it can become “a new sound media, in the context of a new soundscape or sound-sphere, for the new listeners”. Andrew Dubber (Birmingham City University regarding the challenges posed by a Digital Era argues for a theoretical approach in radio studies which can consider a Media Ecology. The author understands the form and discourse of radio as a negotiation of affordances and

  17. Distribution of Putative Virulence Genes and Antimicrobial Drug Resistance in Vibrio harveyi

    OpenAIRE

    Parvathi, Ammini; Mendez, Dafini; Anto, Ciana

    2011-01-01

    The marine-estuarine bacterium Vibrio harveyi is an important pathogen of invertebrates, most significantly, the larvae of commercially important shrimp Penaeus monodon. In this study, we analyzed V. harveyi isolated from shrimp hatchery environments for understanding the distribution of putative virulence genes and antimicrobial drug resistance. The putative genes targeted for PCR detection included four reversible toxin (Rtx)/hemolysin genes, a gene encoding homologue of Vibriocholerae zonu...

  18. Associations between anti-microbial resistance phenotypes, anti-microbial resistance genotypes and virulence genes of Escherichia coli isolates from Pakistan and China.

    Science.gov (United States)

    Yaqoob, M; Wang, L P; Wang, S; Hussain, S; Memon, J; Kashif, J; Lu, C-P

    2013-10-01

    The objective of this study was to determine the association between phenotypic resistance, genotypic resistance and virulence genes of Escherichia coli isolates in Jiangsu province, China and Punjab province Pakistan. A total of 62 E. coli isolates were characterized for phenotypic resistance, genotypic resistance and virulence factor genes. The anti-microbial resistance phenotype and genotypes in relation to virulence factor genes were assessed by statistical analysis. Of 20 tested virulence genes, twelve were found and eight were not found in any isolates. sitA and TspE4C2 were the most prevalent virulence genes. Of the 13 anti-microbial agents tested, resistance to ampicillin, sulphonamide and tetracycline was the most frequent. All isolates were multiresistant, and 74% were resistant to trimethoprim and sulphamethaxazole. Phenotypically, tetracycline-, cefotaxime- and trimethoprim-resistant isolates had increased virulence factors as compared with susceptible isolates. Genotypically, resistant genes Tem, ctx-M, Tet, Sul 1, dhfr1, Cat2 and flo-R showed the association with the virulence genes. Almost all classes of anti-microbial-resistant genes have a high association with virulence. Resistant isolates have more virulent genes than the susceptible isolates. © 2012 Blackwell Verlag GmbH.

  19. A bacterial antibiotic-resistance gene that complements the human multidrug-resistance P-glycoprotein gene

    NARCIS (Netherlands)

    van Veen, HW; Callaghan, R; Soceneantu, L; Sardini, A; Konings, WN; Higgins, CF

    1998-01-01

    Bacteria have developed many fascinating antibiotic-resistance mechanisms(1,2). A protein in Lactococcus lactis, LmrA, mediates antibiotic resistance by extruding amphiphilic compounds from the inner leaflet of the cytoplasmic membrane(3,4). Unlike other known bacterial multidrug-resistance

  20. Identification of a soybean rust resistance gene in PI 567104B.

    Science.gov (United States)

    Liu, Min; Li, Shuxian; Swaminathan, Sivakumar; Sahu, Binod B; Leandro, Leonor F; Cardinal, Andrea J; Bhattacharyya, Madan K; Song, Qijian; Walker, David R; Cianzio, Silvia R

    2016-05-01

    Using a combination of phenotypic screening and molecular, statistical, and linkage analyses, we have mapped a dominant soybean rust resistance gene in soybean PI 567104B. Asian soybean rust (SBR), caused by the fungus Phakopsora pachyrhizi Syd. and P. Syd., is one of the most economically important diseases that affect soybean production worldwide. A long-term strategy for minimizing the effects of SBR is the development of genetically resistant cultivars. The objectives of the study were to identify the location of a rust-resistance (Rpp) gene(s) in plant introduction (PI) 567104B, and to determine if the gene(s) in PI 567104B was different from previously mapped Rpp loci. The progeny of the cross of 'IAR 2001 BSR' × PI 567104B was phenotyped from field assays of the F 2:3 and F 4:5 generations and from a growth chamber assay of 253 F 5:6 recombinant inbred lines (RILs). For the growth chamber, the phenotyping was conducted by inoculation with a purified 2006 fungal isolate from Mississippi. A resistance gene locus on PI 567104B was mapped to a region containing the Rpp6 locus on chromosome 18. The high level of resistance of F 1 plants from two other crosses with PI 567104B as one of the parents indicated that the gene from PI 567104B was dominant. The interval containing the gene is flanked by the simple sequence repeat (SSR) markers Satt131 and Satt394, and includes the SSR markers BARCSOYSSR_18_0331 and BARCSOYSSR_18_0380. The results also indicated that the resistance gene from PI 567104B is different from the Rpp1 to the Rpp4 genes previously identified. To determine if the gene from PI 567104B is different from the Rpp6 gene from PI 567102B, additional research will be required.

  1. Diversity of Integron- and Culture-Associated Antibiotic Resistance Genes in Freshwater Floc

    Science.gov (United States)

    Drudge, Christopher N.; Elliott, Amy V. C.; Plach, Janina M.; Ejim, Linda J.; Wright, Gerard D.; Droppo, Ian G.

    2012-01-01

    Clinically important antibiotic resistance genes were detected in culturable bacteria and class 1 integron gene cassettes recovered from suspended floc, a significant aquatic repository for microorganisms and trace elements, across freshwater systems variably impacted by anthropogenic activities. Antibiotic resistance gene cassettes in floc total community DNA differed appreciably in number and type from genes detected in bacteria cultured from floc. The number of floc antibiotic resistance gene cassette types detected across sites was positively correlated with total (the sum of Ag, As, Cu, and Pb) trace element concentrations in aqueous solution and in a component of floc readily accessible to bacteria. In particular, concentrations of Cu and Pb in the floc component were positively correlated with floc resistance gene cassette diversity. Collectively, these results identify suspended floc as an important reservoir, distinct from bulk water and bed sediment, for antibiotic resistance in aquatic environments ranging from heavily impacted urban sites to remote areas of nature reserves and indicate that trace elements, particularly Cu and Pb, are geochemical markers of resistance diversity in this environmental reservoir. The increase in contamination of global water supplies suggests that aquatic environments will become an even more important reservoir of clinically important antibiotic resistance in the future. PMID:22467502

  2. Diversity of Plasmids and Antimicrobial Resistance Genes in Multidrug-Resistant Escherichia coli Isolated from Healthy Companion Animals.

    Science.gov (United States)

    Jackson, C R; Davis, J A; Frye, J G; Barrett, J B; Hiott, L M

    2015-09-01

    The presence and transfer of antimicrobial resistance genes from commensal bacteria in companion animals to more pathogenic bacteria may contribute to dissemination of antimicrobial resistance. The purpose of this study was to determine antimicrobial resistance gene content and the presence of genetic elements in antimicrobial resistant Escherichia coli from healthy companion animals. In our previous study, from May to August, 2007, healthy companion animals (155 dogs and 121 cats) from three veterinary clinics in the Athens, GA, USA area were sampled and multidrug-resistant E. coli (n = 36; MDR, resistance to ≥ 2 antimicrobial classes) were obtained. Of the 25 different plasmid replicon types tested by PCR, at least one plasmid replicon type was detected in 94% (34/36) of the MDR E. coli; four isolates contained as many as five different plasmid replicons. Nine replicon types (FIA, FIB, FII, I2, A/C, U, P, I1 and HI2) were identified with FIB, FII, I2 as the most common pattern. The presence of class I integrons (intI) was detected in 61% (22/36) of the isolates with eight isolates containing aminoglycoside- and/or trimethoprim-resistance genes in the variable cassette region of intI. Microarray analysis of a subset of the MDR E. coli (n = 9) identified the presence of genes conferring resistance to aminoglycosides (aac, aad, aph and strA/B), β-lactams (ampC, cmy, tem and vim), chloramphenicol (cat), sulfonamides (sulI and sulII), tetracycline [tet(A), tet(B), tet(C), tet(D) and regulator, tetR] and trimethoprim (dfrA). Antimicrobial resistance to eight antimicrobials (ampicillin, cefoxitin, ceftiofur, amoxicillin/clavulanic acid, streptomycin, gentamicin, sulfisoxazole and trimethoprim-sulfamethoxazole) and five plasmid replicons (FIA, FIB, FII, I1 and I2) were transferred via conjugation. The presence of antimicrobial resistance genes, intI and transferable plasmid replicons indicate that E. coli from companion animals may play an important role in the

  3. Resistance to Downy Mildew in Lettuce 'La Brillante' is Conferred by Dm50 Gene and Multiple QTL.

    Science.gov (United States)

    Simko, Ivan; Ochoa, Oswaldo E; Pel, Mathieu A; Tsuchida, Cayla; Font I Forcada, Carolina; Hayes, Ryan J; Truco, Maria-Jose; Antonise, Rudie; Galeano, Carlos H; Michelmore, Richard W

    2015-09-01

    Many cultivars of lettuce (Lactuca sativa L.) are susceptible to downy mildew, a nearly globally ubiquitous disease caused by Bremia lactucae. We previously determined that Batavia type cultivar 'La Brillante' has a high level of field resistance to the disease in California. Testing of a mapping population developed from a cross between 'Salinas 88' and La Brillante in multiple field and laboratory experiments revealed that at least five loci conferred resistance in La Brillante. The presence of a new dominant resistance gene (designated Dm50) that confers complete resistance to specific isolates was detected in laboratory tests of seedlings inoculated with multiple diverse isolates. Dm50 is located in the major resistance cluster on linkage group 2 that contains at least eight major, dominant Dm genes conferring resistance to downy mildew. However, this Dm gene is ineffective against the isolates of B. lactucae prevalent in the field in California and the Netherlands. A quantitative trait locus (QTL) located at the Dm50 chromosomal region (qDM2.2) was detected, though, when the amount of disease was evaluated a month before plants reached harvest maturity. Four additional QTL for resistance to B. lactucae were identified on linkage groups 4 (qDM4.1 and qDM4.2), 7 (qDM7.1), and 9 (qDM9.2). The largest effect was associated with qDM7.1 (up to 32.9% of the total phenotypic variance) that determined resistance in multiple field experiments. Markers identified in the present study will facilitate introduction of these resistance loci into commercial cultivars of lettuce.

  4. Characterization of novel antibiotic resistance genes identified by functional metagenomics on soil samples.

    Science.gov (United States)

    Torres-Cortés, Gloria; Millán, Vicenta; Ramírez-Saad, Hugo C; Nisa-Martínez, Rafael; Toro, Nicolás; Martínez-Abarca, Francisco

    2011-04-01

    The soil microbial community is highly complex and contains a high density of antibiotic-producing bacteria, making it a likely source of diverse antibiotic resistance determinants. We used functional metagenomics to search for antibiotic resistance genes in libraries generated from three different soil samples, containing 3.6 Gb of DNA in total. We identified 11 new antibiotic resistance genes: 3 conferring resistance to ampicillin, 2 to gentamicin, 2 to chloramphenicol and 4 to trimethoprim. One of the clones identified was a new trimethoprim resistance gene encoding a 26.8 kDa protein closely resembling unassigned reductases of the dihydrofolate reductase group. This protein, Tm8-3, conferred trimethoprim resistance in Escherichia coli and Sinorhizobium meliloti (γ- and α-proteobacteria respectively). We demonstrated that this gene encoded an enzyme with dihydrofolate reductase activity, with kinetic constants similar to other type I and II dihydrofolate reductases (K(m) of 8.9 µM for NADPH and 3.7 µM for dihydrofolate and IC(50) of 20 µM for trimethoprim). This is the first description of a new type of reductase conferring resistance to trimethoprim. Our results indicate that soil bacteria display a high level of genetic diversity and are a reservoir of antibiotic resistance genes, supporting the use of this approach for the discovery of novel enzymes with unexpected activities unpredictable from their amino acid sequences. © 2011 Society for Applied Microbiology and Blackwell Publishing Ltd.

  5. Genetic mapping of a major dominant gene for resistance to Ralstonia solanacearum in eggplant.

    Science.gov (United States)

    Lebeau, A; Gouy, M; Daunay, M C; Wicker, E; Chiroleu, F; Prior, P; Frary, A; Dintinger, J

    2013-01-01

    Resistance of eggplant against Ralstonia solanacearum phylotype I strains was assessed in a F(6) population of recombinant inbred lines (RILs) derived from a intra-specific cross between S. melongena MM738 (susceptible) and AG91-25 (resistant). Resistance traits were determined as disease score, percentage of wilted plants, and stem-based bacterial colonization index, as assessed in greenhouse experiments conducted in Réunion Island, France. The AG91-25 resistance was highly efficient toward strains CMR134, PSS366 and GMI1000, but only partial toward the highly virulent strain PSS4. The partial resistance found against PSS4 was overcome under high inoculation pressure, with heritability estimates from 0.28 to 0.53, depending on the traits and season. A genetic map was built with 119 AFLP, SSR and SRAP markers positioned on 18 linkage groups (LG), for a total length of 884 cM, and used for quantitative trait loci (QTL) analysis. A major dominant gene, named ERs1, controlled the resistance to strains CMR134, PSS366, and GMI1000. Against strain PSS4, this gene was not detected, but a significant QTL involved in delay of disease progress was detected on another LG. The possible use of the major resistance gene ERs1 in marker-assisted selection and the prospects offered for academic studies of a possible gene for gene system controlling resistance to bacterial wilt in solanaceous plants are discussed.

  6. Comparison of antimicrobial resistant genes in chicken gut microbiome grown on organic and conventional diet

    Directory of Open Access Journals (Sweden)

    Narasimha V. Hegde

    2016-12-01

    Full Text Available Antibiotics are widely used in chicken production for therapeutic purposes, disease prevention and growth promotion, and this may select for drug resistant microorganisms known to spread to humans through consumption of contaminated food. Raising chickens on an organic feed regimen, without the use of antibiotics, is increasingly popular with the consumers. In order to determine the effects of diet regimen on antibiotic resistant genes in the gut microbiome, we analyzed the phylotypes and identified the antimicrobial resistant genes in chicken, grown under conventional and organic dietary regimens. Phylotypes were analyzed from DNA extracted from fecal samples from chickens grown under these dietary conditions. While gut microbiota of chicken raised in both conventional and organic diet exhibited the presence of DNA from members of Proteobacteria and Bacteroidetes, organic diet favored the growth of members of Fusobacteria. Antimicrobial resistance genes were identified from metagenomic libraries following cloning and sequencing of DNA fragments from fecal samples and selecting for the resistant clones (n=340 on media containing different concentrations of eight antibiotics. The antimicrobial resistant genes exhibited diversity in their host distribution among the microbial population and expressed more in samples from chicken grown on a conventional diet at higher concentrations of certain antimicrobials than samples from chicken grown on organic diet. Further studies will elucidate if this phenomena is widespread and whether the antimicrobial resistance is indeed modulated by diet. This may potentially assist in defining strategies for intervention to reduce the prevalence and dissemination of antibiotic resistance genes in the production environment.

  7. Candidate genes revealed by a genome scan for mosquito resistance to a bacterial insecticide: sequence and gene expression variations

    Directory of Open Access Journals (Sweden)

    David Jean-Philippe

    2009-11-01

    Full Text Available Abstract Background Genome scans are becoming an increasingly popular approach to study the genetic basis of adaptation and speciation, but on their own, they are often helpless at identifying the specific gene(s or mutation(s targeted by selection. This shortcoming is hopefully bound to disappear in the near future, thanks to the wealth of new genomic resources that are currently being developed for many species. In this article, we provide a foretaste of this exciting new era by conducting a genome scan in the mosquito Aedes aegypti with the aim to look for candidate genes involved in resistance to Bacillus thuringiensis subsp. israelensis (Bti insecticidal toxins. Results The genome of a Bti-resistant and a Bti-susceptible strains was surveyed using about 500 MITE-based molecular markers, and the loci showing the highest inter-strain genetic differentiation were sequenced and mapped on the Aedes aegypti genome sequence. Several good candidate genes for Bti-resistance were identified in the vicinity of these highly differentiated markers. Two of them, coding for a cadherin and a leucine aminopeptidase, were further examined at the sequence and gene expression levels. In the resistant strain, the cadherin gene displayed patterns of nucleotide polymorphisms consistent with the action of positive selection (e.g. an excess of high compared to intermediate frequency mutations, as well as a significant under-expression compared to the susceptible strain. Conclusion Both sequence and gene expression analyses agree to suggest a role for positive selection in the evolution of this cadherin gene in the resistant strain. However, it is unlikely that resistance to Bti is conferred by this gene alone, and further investigation will be needed to characterize other genes significantly associated with Bti resistance in Ae. aegypti. Beyond these results, this article illustrates how genome scans can build on the body of new genomic information (here, full

  8. Paradoxical DNA repair and peroxide resistance gene conservation in Bacillus pumilus SAFR-032.

    Directory of Open Access Journals (Sweden)

    Jason Gioia

    Full Text Available BACKGROUND: Bacillus spores are notoriously resistant to unfavorable conditions such as UV radiation, gamma-radiation, H2O2, desiccation, chemical disinfection, or starvation. Bacillus pumilus SAFR-032 survives standard decontamination procedures of the Jet Propulsion Lab spacecraft assembly facility, and both spores and vegetative cells of this strain exhibit elevated resistance to UV radiation and H2O2 compared to other Bacillus species. PRINCIPAL FINDINGS: The genome of B. pumilus SAFR-032 was sequenced and annotated. Lists of genes relevant to DNA repair and the oxidative stress response were generated and compared to B. subtilis and B. licheniformis. Differences in conservation of genes, gene order, and protein sequences are highlighted because they potentially explain the extreme resistance phenotype of B. pumilus. The B. pumilus genome includes genes not found in B. subtilis or B. licheniformis and conserved genes with sequence divergence, but paradoxically lacks several genes that function in UV or H2O2 resistance in other Bacillus species. SIGNIFICANCE: This study identifies several candidate genes for further research into UV and H2O2 resistance. These findings will help explain the resistance of B. pumilus and are applicable to understanding sterilization survival strategies of microbes.

  9. PCR Screening of Antibiotic Resistance Genes in Faecal Samples from Australian and Chinese Children.

    Science.gov (United States)

    Ravensdale, Joshua T; Xian, Darren Ten Wei; Wei, Chooi Ming; Lv, Quanjun; Wen, Xiajian; Guo, Jing; Coorey, Ranil; LeSouëf, Peter; Lu, Fengmin; Zhang, Brad; Dykes, Gary A

    2018-03-31

    Recent public awareness campaigns on the risk of antibiotic resistance in pathogenic microbes has placed pressure on governments to enforce stricter antimicrobial stewardship policies on the hospital and agricultural industry. This study aimed to screen faecal samples from Australian and Chinese children for the presence of antibiotic resistance genes to identify demographics at risk of carriage of these genes and examine antimicrobial stewardship policies from the two countries which may influence carriage. Faecal samples from 46 Australian and 53 Chinese children were screened for the presence of six clinically relevant antibiotic resistance genes using PCR. Clinical and demographic data was also collected from each patient. Over 90% of faecal samples from Chinese children tested positive for β-lactam, macrolide, tetracycline, and aminoglycoside resistance genes, which was substantially higher than Australian samples. Besides country of origin, no clear trend could be seen to predict carriage of resistance genes. The exception to this was Chinese born children who immigrated to Australia having higher rates of carriage for bla TEM and tetM genes than children born and still living in Australia. These data indicated that Chinese children were more likely to carry certain antibiotic resistance genes than Australian children. The Chinese government has recently implemented strict policies to control the overuse of antibiotics in hospitals. However, many of these policies do not extend to the agricultural industry which could explain the differences seen in this study. Copyright © 2018. Published by Elsevier Ltd.

  10. Diversity of arsenate reductase genes (arsC Genes) from arsenic-resistant environmental isolates of E. coli.

    Science.gov (United States)

    Kaur, Sukhvinder; Kamli, Majid Rasool; Ali, Arif

    2009-09-01

    A polymerase chain reaction (PCR) approach was used to assess the occurrence and diversity of arsenate reductase gene (arsC gene) in arsenic-resistant environmental E. coli strains. For this purpose, two different sets of primers were designed for the specific amplification of approximately 370-bp fragments from the arsC gene. These primers were used to screen a collection of 25 environmental arsenic-resistant strains isolated from different geographical regions of India, as well as Bangladesh. The PCR results showed that 17 out of the 25 environmental isolates (68%) contained a gene related to the arsC family. Phylogenetic analysis of the protein sequences deduced from the amplicons indicated a prevalence of arsC genes in the isolated strains. A significant divergence in the DNA sequence was found in the arsC genes among As-resistant environmental E. coli strains from this study, and arsenic resistance, a genetic character, arose from a common ancestral background.

  11. A large conjugative Acinetobacter baumannii plasmid carrying the sul2 sulphonamide and strAB streptomycin resistance genes.

    Science.gov (United States)

    Hamidian, Mohammad; Ambrose, Stephanie J; Hall, Ruth M

    Acinetobacter baumannii is an important nosocomial pathogen that often complicates treatment because of its high level of resistance to antibiotics. Though plasmids can potentially introduce various genes into bacterial strains, compared to other Gram-negative bacteria, information about the unique A. baumannii plasmid repertoire is limited. Here, whole genome sequence data was used to determine the plasmid content of strain A297 (RUH875), the reference strain for the globally disseminated multiply resistant A. baumannii clone, global clone 1(GC1). A297 contains three plasmids. Two known plasmids were present; one, pA297-1 (pRAY*), carries the aadB gentamicin, kanamycin and tobramycin resistance gene and another is an 8.7kb cryptic plasmid often found in GC1 isolates. The third plasmid, pA297-3, is 200kb and carries the sul2 sulphonamide resistance gene and strAB streptomycin resistance gene within Tn6172 and a mer mercuric ion resistance module elsewhere. pA297-3 transferred sulphonamide, streptomycin and mercuric ion resistance at high frequency to a susceptible A. baumannii recipient, and contains several genes potentially involved in conjugative transfer. However, a relaxase gene was not found. It also includes several genes encoding proteins involved in DNA metabolism such as partitioning. However, a gene encoding a replication initiation protein could not be found. pA297-3 includes two copies of a Miniature Inverted-Repeat Transposable Element (MITE), named MITE-297, bracketing a 77.5kb fragment, which contains several IS and the mer module. Several plasmids related to but smaller than pA297-3 were found in the GenBank nucleotide database. They were found in different A. baumannii clones and are wide spread. They all contain either Tn6172 or a variant in the same position in the backbone as Tn6172 in pA297-3. Some related plasmids have lost the segment between the MITE-297 copies and retain only one MITE-297. Others have segments of various lengths between

  12. A Critical Dose of Doxorubicin Is Required to Alter the Gene Expression Profiles in MCF-7 Cells Acquiring Multidrug Resistance

    Science.gov (United States)

    Tsou, Shang-Hsun; Chen, Tzer-Ming; Hsiao, Hui-Ting; Chen, Yen-Hui

    2015-01-01

    Cellular mechanisms of multidrug resistance (MDR) are related to ABC transporters, apoptosis, antioxidation, drug metabolism, DNA repair and cell proliferation. It remains unclear whether the process of resistance development is programmable. We aimed to study gene expression profiling circumstances in MCF-7 during MDR development. Eleven MCF-7 sublines with incremental doxorubicin resistance were established as a valued tool to study resistance progression. MDR marker P-gp was overexpressed only in cells termed MCF-7/ADR-1024 under the selection dose approaching 1024 nM. MCF-7/ADR-1024 and authentic MCF-7/ADR shared common features in cell morphology and DNA ploidy status. MCF-7/ADR-1024 and authentic MCF-7/ADR down regulated repair genes BRCA1/2 and wild type p53, apoptosis-related gene Bcl-2 and epithelial-mesenchymal transition (EMT) epithelial marker gene E-cadherin. While detoxifying enzymes glutathione-S transferase-π and protein kinase C-α were up-regulated. The genes involving in EMT mesenchymal formation were also overexpressed, including N-cadherin, vimentin and the E-cadherin transcription reppressors Slug, Twist and ZEB1/2. PI3K/AKT inhibitor wortmannin suppressed expression of Slug, Twist and mdr1. Mutant p53 with a deletion at codons 127-133 markedly appeared in MCF-7/ADR-1024 and authentic MCF-7/ADR as well. In addition, MCF-7/ADR-1024 cells exerted CSC-like cell surface marker CD44 high/CD24 low and form mammospheres. Overall, results suggest that resistance marker P-gp arises owing to turn on/off or mutation of the genes involved in DNA repair, apoptosis, detoxifying enzymes, EMT and ABC transporters at a turning point (1.024 μM doxorubicin challenge). Behind this point, no obvious alterations were found in most tested genes. Selection for CSC-like cells under this dose may importantly attribute to propagation of the population presenting invasive properties and drug resistance. We thereby suggest two models in the induction of drug resistance

  13. A novel Capsicum gene inhibits host-specific disease resistance to Phytophthora capsici.

    Science.gov (United States)

    Reeves, Gregory; Monroy-Barbosa, Ariadna; Bosland, Paul W

    2013-05-01

    A novel disease resistance inhibitor gene (inhibitor of P. capsici resistance [Ipcr]), found in the chile pepper (Capsicum annuum) variety 'New Mexico Capsicum Accession 10399' (NMCA10399), inhibits resistance to Phytophthora capsici but not to other species of Phytophthora. When a highly P. capsici-resistant variety was hybridized with NMCA10399, the resultant F1 populations, when screened, were completely susceptible to P. capsici for root rot and foliar blight disease syndromes, despite the dominance inheritance of P. capsici resistance in chile pepper. The F2 population displayed a 3:13 resistant-to-susceptible (R:S) ratio. The testcross population displayed a 1:1 R:S ratio, and a backcross population to NMCA10399 displayed complete susceptibility. These results demonstrate the presence of a single dominant inhibitor gene affecting P. capsici resistance in chile pepper. Moreover, when lines carrying the Ipcr gene were challenged against six Phytophthora spp., the nonhost resistance was not overcome. Therefore, the Ipcr gene is interfering with host-specific resistance but not the pathogen- or microbe-associated molecular pattern nonhost responses.

  14. Characterization and cloning of TMV resistance gene N homologues ...

    African Journals Online (AJOL)

    Tobacco cultivars Nicotiana tabacum cv. Samsun NN plants carrying the N gene contain a multitude of N-related genes. We cloned a few N homologues and isolated two full-length cDNAs of NL-C26 and NL-B69 genes from N. tabacum cv. Samsun NN. Nucleotide sequence analysis showed that the coding regions of ...

  15. Identification of Differentially Expressed Genes In Deltamethrin-Resistant Culex pipiens quinquefasciatus.

    Science.gov (United States)

    Liu, Qin-Mei; Li, Chun-Xiao; Wu, Qun; Shi, Qing-Ming; Sun, Ai-Juan; Zhang, Heng-Duan; Guo, Xiao-Xia; Dong, Yan-De; Xing, Dan; Zhang, Ying-Mei; Han, Qian; Diao, Xiao-Ping; Zhao, Tong-Yan

    2017-12-01

    Culex quinquefasciatus is one of China's major house-dwelling mosquito species and an important vector of filariasis and encephalitis. Chemical treatments represent one of the most successful approaches for comprehensive mosquito prevention and control. However, the widespread use of chemical pesticides has led to the occurrence and development of insecticide resistance. Therefore, in-depth studies of resistance to insecticides are of vital importance. In this study, we performed a gene expression analysis to investigate genes from Cx. quinquefasciatus that may confer pyrethroid resistance. We aimed to understand the mechanisms of Cx. quinquefasciatus resistance to pyrethroid insecticides and provide insights into insect resistance management. Using a resistance bioassay, we determined the deltamethrin LC 50 values (lethal concentration required to kill 50% of the population) for Cx. quinquefasciatus larvae in the F 21 , F 23 , F 24 , F 26 , F 27 , and F 30 generations. The 7 tested strains exhibited pesticide resistance that was 25.25 to 87.83 times higher than that of the SanYa strain. Moreover, the expression of the OBPjj7a (odorant-binding protein OBPjj7a), OBP28 (odorant-binding protein OBP28), and E2 (ubiquitin-conjugating enzyme) genes was positively correlated with deltamethrin resistance ( R 2 = 0.836, P = 0.011; R 2 = 0.788, P = 0.018; and R 2 = 0.850, P = 0.009, respectively) in Cx. quinquefasciatus. The expression of 4 additional genes, H/ACA, S19, SAR2, and PGRP, was not correlated with deltamethrin resistance. In summary, this study identified 3 Cx. quinquefasciatus genes with potential involvement in deltamethrin resistance, and these results may provide a theoretical basis for the control of mosquito resistance and insights into resistance detection.

  16. Overexpression of multiple detoxification genes in deltamethrin resistant Laodelphax striatellus (Hemiptera: Delphacidae in China.

    Directory of Open Access Journals (Sweden)

    Lu Xu

    Full Text Available BACKGROUND: The small brown planthopper (SBPH, Laodelphax striatellus (Fallén, is one of the major rice pests in Asia and has developed resistance to multiple classes of insecticides. Understanding resistance mechanisms is essential to the management of this pest. Biochemical and molecular assays were performed in this study to systematically characterize deltamethrin resistance mechanisms with laboratory-selected resistant and susceptible strains of SBPH. METHODOLOGY/PRINCIPAL FINDINGS: Deltamethrin resistant strains of SBPH (JH-del were derived from a field population by continuously selections (up to 30 generations in the laboratory, while a susceptible strain (JHS was obtained from the same population by removing insecticide pressure for 30 generations. The role of detoxification enzymes in the resistance was investigated using synergism and enzyme activity assays with strains of different resistant levels. Furthermore, 71 cytochrome P450, 93 esterases and 12 glutathione-S-transferases cDNAs were cloned based on transcriptome data of a field collected population. Semi-quantitative RT-PCR screening analysis of 176 identified detoxification genes demonstrated that multiple P450 and esterase genes were overexpressed (>2-fold in JH-del strains (G4 and G30 when compared to that in JHS, and the results of quantitative PCR coincided with the semi-quantitative RT-PCR results. Target mutation at IIS3-IIS6 regions encoded by the voltage-gated sodium channel gene was ruled out for conferring the observed resistance. CONCLUSION/SIGNIFICANCE: As the first attempt to discover genes potentially involved in SBPH pyrethroid resistance, this study putatively identified several candidate genes of detoxification enzymes that were significantly overexpressed in the resistant strain, which matched the synergism and enzyme activity testing. The biochemical and molecular evidences suggest that the high level pyrethroid resistance in L. striatellus could be due to

  17. Reversing Bacterial Resistance to Antibiotics by Phage-Mediated Delivery of Dominant Sensitive Genes

    Science.gov (United States)

    Edgar, Rotem; Friedman, Nir; Molshanski-Mor, Shahar

    2012-01-01

    Pathogen resistance to antibiotics is a rapidly growing problem, leading to an urgent need for novel antimicrobial agents. Unfortunately, development of new antibiotics faces numerous obstacles, and a method that resensitizes pathogens to approved antibiotics therefore holds key advantages. We present a proof of principle for a system that restores antibiotic efficiency by reversing pathogen resistance. This system uses temperate phages to introduce, by lysogenization, the genes rpsL and gyrA conferring sensitivity in a dominant fashion to two antibiotics, streptomycin and nalidixic acid, respectively. Unique selective pressure is generated to enrich for bacteria that harbor the phages carrying the sensitizing constructs. This selection pressure is based on a toxic compound, tellurite, and therefore does not forfeit any antibiotic for the sensitization procedure. We further demonstrate a possible way of reducing undesirable recombination events by synthesizing dominant sensitive genes with major barriers to homologous recombination. Such synthesis does not significantly reduce the gene's sensitization ability. Unlike conventional bacteriophage therapy, the system does not rely on the phage's ability to kill pathogens in the infected host, but instead, on its ability to deliver genetic constructs into the bacteria and thus render them sensitive to antibiotics prior to host infection. We believe that transfer of the sensitizing cassette by the constructed phage will significantly enrich for antibiotic-treatable pathogens on hospital surfaces. Broad usage of the proposed system, in contrast to antibiotics and phage therapy, will potentially change the nature of nosocomial infections toward being more susceptible to antibiotics rather than more resistant. PMID:22113912

  18. Tagging of blast resistance gene(s) to DNA markers and marker-assisted selection (MAS) in rice improvement

    International Nuclear Information System (INIS)

    Zhuang, J.Y.; Lu, J.; Qian, H.R.; Lin, H.X.; Zheng, K.L.

    1998-01-01

    This paper reports progress made on the tagging of blast resistance gene(s) to DNA markers and on the initiation of marker-assisted selection (MAS) for blast resistance in rice improvement. A pair of near isogenic lines, K8OR and K79S, were developed using a Chinese landrace Hong-jiao-zhan as the resistance donor. Ten putatively positive markers were identified by screening 177 mapped DNA markers. Using the F 2 population of 143 plants and the derived F 3 lines, three Restriction Fragment Length Polymorphism (RFLP) markers (RG81, RG869 and RZ397) on chromosome 12 of rice were identified to be closely linked to the blast resistance gene Pi-12(t). The genetic distance between Pi-12(t) and the closest marker RG869 was 5.1 cM. By employing the bulk segregant analysis (BSA) procedure, six of 199 arbitrary primers were found to produce positive Randomly Amplified Polymorphic DNA (RAPD) bands. Tight linkage between Pi-12(t) and three RAPD bands, each from a different primer, was confirmed after amplification of DNA of all F 2 individuals. Two fragments were cloned and sequenced, and two sequence characterised amplified re-ion (SCAR) markers were established. In two other F 3 populations, Xian-feng I/Tetep and Xian-feng, 1/Hong-jiao-zhan, the blast resistance was found to be controlled by interactions of two or more genes. One resistance gene was located in the vicinity of RG81 in both populations. Work to identify other gene(s) is currently under way. Marker assisted selection for blast resistance was initiated. Crosses were made between elite varieties and blast resistance donors to develop populations for DNA marker-assisted selection of blast resistance. In addition, 48 varieties widely used in current rice breeding programs were provided by rice breeders. DNA marker-based polymorphism among, these varieties and resistance donors were analysed to produce a database for future MAS program. (author)

  19. Novel mutations in the antifolate drug resistance marker genes among Plasmodium vivax isolates exhibiting severe manifestations.

    Science.gov (United States)

    Garg, Shilpi; Saxena, Vishal; Lumb, Vanshika; Pakalapati, Deepak; Boopathi, P A; Subudhi, Amit Kumar; Chowdhury, Shibasish; Kochar, Sanjay K; Kochar, Dhanpat K; Sharma, Y D; Das, Ashis

    2012-12-01

    Plasmodium vivax is the predominant species of the human malaria parasite present in the Indian subcontinent. There have been recent reports on Chloroquine (CQ) resistance and severe manifestations shown by P. vivax from different regions of the world including India. This study focuses on Bikaner, India where during the last few years there have been continuous reports of severe manifestations by both Plasmodium falciparum and P. vivax. This region has a widespread use of Chloroquine and Sulfadoxine-Pyrimethamine for the treatment of malaria, but the resistance profiles of these drugs are not available. We report here the profile of mutations in marker genes associated with Chloroquine and antifolate drug resistance among the P. vivax parasites obtained from patients with severe (n=30) and non-severe (n=48) manifestations from this region. Most isolates showed the wild type alleles for both the Chloroquine and antifolate resistance markers (Presistance has been reported from this region. However, the single isolate with a mutation in Pvmdr-1 may suggest the beginning of the trend towards decreased susceptibility to Chloroquine. The frequency of PvDHFR-PvDHPS two locus mutations was higher among the patients showing severe manifestations than the patient group with non-severe (uncomplicated) malaria (Pexhibiting severe complications. Preliminary homology modeling and molecular docking studies predicted that these mutations apparently do not have any effect on the binding of the drug molecule to the enzyme. However, the presence of novel mutations in the PvDHPS gene indicate a degree of polymorphism of this molecule which is in contrast to available published information. Copyright © 2012 Elsevier Inc. All rights reserved.

  20. Prevalence of antimicrobial resistance and the cfiA resistance gene in Danish Bacteroides fragilis group isolates since 1973

    DEFF Research Database (Denmark)

    Ferløv-Schwensen, Simon Andreas; Sydenham, Thomas Vognbjerg; Hansen, Kia Cirkeline Møller

    2017-01-01

    .0%) B. fragilis strains as division II, of which 4 strains, isolated be