
Sample records for resistance genes present

  1. Inheritance and molecular mapping of anthracnose resistance gene present in the differential line PI533918 (United States)

    Anthracnose (Collectrotichum sublineolum) is considered one of the most destructive diseases of sorghum (Sorghum bicolor L. Moench) because it infects all aerial tissues of the plant. The best strategy to control the disease is the incorporation of resistance genes. At present, eighteen sorghum line...

  2. Inheritance and molecular mapping of anthracnose resistance genes present in sorghum line SC112-14 (United States)

    Anthracnose (Colletotrichum sublineolum) is one of the most destructive diseases of sorghum (Sorghum bicolor L. Moench) affecting all aerial tissues of the plant. The most effective strategy for its control is the incorporation of resistance genes. Therefore, the anthracnose resistance response pr...

  3. The Present and Future of Whole Genome Sequencing (WGS and Whole Metagenome Sequencing (WMS for Surveillance of Antimicrobial Resistant Microorganisms and Antimicrobial Resistance Genes across the Food Chain

    Directory of Open Access Journals (Sweden)

    Elena A. Oniciuc


    Full Text Available Antimicrobial resistance (AMR surveillance is a critical step within risk assessment schemes, as it is the basis for informing global strategies, monitoring the effectiveness of public health interventions, and detecting new trends and emerging threats linked to food. Surveillance of AMR is currently based on the isolation of indicator microorganisms and the phenotypic characterization of clinical, environmental and food strains isolated. However, this approach provides very limited information on the mechanisms driving AMR or on the presence or spread of AMR genes throughout the food chain. Whole-genome sequencing (WGS of bacterial pathogens has shown potential for epidemiological surveillance, outbreak detection, and infection control. In addition, whole metagenome sequencing (WMS allows for the culture-independent analysis of complex microbial communities, providing useful information on AMR genes occurrence. Both technologies can assist the tracking of AMR genes and mobile genetic elements, providing the necessary information for the implementation of quantitative risk assessments and allowing for the identification of hotspots and routes of transmission of AMR across the food chain. This review article summarizes the information currently available on the use of WGS and WMS for surveillance of AMR in foodborne pathogenic bacteria and food-related samples and discusses future needs that will have to be considered for the routine implementation of these next-generation sequencing methodologies with this aim. In particular, methodological constraints that impede the use at a global scale of these high-throughput sequencing (HTS technologies are identified, and the standardization of methods and protocols is suggested as a measure to upgrade HTS-based AMR surveillance schemes.

  4. Rapid selection of Plasmodium falciparum chloroquine resistance transporter gene and multidrug resistance gene-1 haplotypes associated with past chloroquine and present artemether-lumefantrine use in Inhambane District, southern Mozambique

    DEFF Research Database (Denmark)

    Thomsen, Thomas T; Madsen, Laura B; Hansson, Helle H


    Chloroquine (CQ) use in Mozambique was stopped in 2002 and artemether-lumefantrine (AL) was implemented in 2008. In light of no use of CQ and extensive use of AL, we determined the frequency of molecular markers of Plasmodium falciparum drug resistance/tolerance to CQ and AL in persons living...... in Linga-Linga, an isolated peninsula and in Furvela village, which is located 8 km inland. The P. falciparum chloroquine resistance transporter gene CVMNK wild type increased in frequency from 43.9% in 2009 to 66.4% in 2010 (P = 0.001), and combined P. falciparum multidrug resistance gene 1 N86-184F-D1246...... haplotype increased significantly between years (P = 0.039). The combination of P. falciparum chloroquine resistance transporter gene CVMNK and P. falciparum multidrug resistance gene NFD increased from 24.3% (2009) to 45.3% in (2010, P = 0.017). The rapid changes observed may largely be caused by decreased...

  5. Obesity genes and insulin resistance. (United States)

    Belkina, Anna C; Denis, Gerald V


    The exploding prevalence of insulin resistance and Type 2 diabetes (T2D) linked to obesity has become an alarming public health concern. Worldwide, approximately 171 million people suffer from obesity-induced diabetes and public health authorities expect this situation to deteriorate rapidly. An interesting clinical population of 'metabolically healthy but obese' (MHO) cases is relatively protected from T2D and its associated cardiovascular risk. The molecular basis for this protection is not well understood but is likely to involve reduced inflammatory responses. The inflammatory cells and pathways that respond to overnutrition are the primary subject matter for this review. The chance discovery of a genetic mutation in the Brd2 gene, which is located in the class II major histocompatibility complex and makes mice enormously fat but protects them from diabetes, offers revolutionary new insights into the cellular mechanisms that link obesity to insulin resistance and T2D. These Brd2-hypomorphic mice have reduced inflammation in fat that is normally associated with insulin resistance, and resemble MHO patients, suggesting novel therapeutic pathways for obese patients at risk for T2D. Deeper understanding of the functional links between genes that control inflammatory responses to diet-induced obesity is crucial to the development of therapies for obese, insulin-resistant patients.

  6. Antigen Presentation Keeps Trending in Immunotherapy Resistance. (United States)

    Kalbasi, Anusha; Ribas, Antoni


    Through a gain-of-function kinome screen, MEX3B was identified as a mediator of resistance to T-cell immunotherapy not previously identified using CRISPR-based screens. MEX3B is a posttranscriptional regulator of HLA-A, validating the critical role of tumor-intrinsic antigen presentation in T-cell immunotherapy and indicating a new putative molecular target. Clin Cancer Res; 24(14); 1-3. ©2018 AACR. See related article by Huang et al., p. xxxx . ©2018 American Association for Cancer Research.

  7. Bacterial Enzymes and Antibiotic Resistance- Oral Presentation

    Energy Technology Data Exchange (ETDEWEB)

    Maltz, Lauren [SLAC National Accelerator Lab., Menlo Park, CA (United States)


    By using protein crystallography and X-ray diffraction, structures of bacterial enzymes were solved to gain a better understanding of how enzymatic modification acts as an antibacterial resistance mechanism. Aminoglycoside phosphotransferases (APHs) are one of three aminoglycoside modifying enzymes that confer resistance to the aminoglycoside antibiotics via enzymatic modification, rendering many drugs obsolete. Specifically, the APH(2”) family vary in their substrate specificities and also in their preference for the phosphate donor (ADP versus GDP). By solving the structures of members of the APH(2”) family of enzymes, we can see how domain movements are important to their substrate specificity. Our structure of the ternary complex of APH(2”)-IIIa with GDP and kanamycin, when compared to the known structures of APH(2”)-IVa, reveals that there are real physical differences between these two enzymes, a structural finding that explains why the two enzymes differ in their preferences for certain aminoglycosides. Another important group of bacterial resistance enzymes are the Class D β-lactamases. Oxacillinase carbapenemases (OXAs) are part of this enzyme class and have begun to confer resistance to ‘last resort’ drugs, most notably carbapenems. Our structure of OXA-143 shows that the conformational flexibility of a conserved hydrophobic residue in the active site (Val130) serves to control the entry of a transient water molecule responsible for a key step in the enzyme’s mechanism. Our results provide insight into the structural mechanisms of these two different enzymes.

  8. Identification of acquired antimicrobial resistance genes

    DEFF Research Database (Denmark)

    Zankari, Ea; Hasman, Henrik; Cosentino, Salvatore


    ObjectivesIdentification of antimicrobial resistance genes is important for understanding the underlying mechanisms and the epidemiology of antimicrobial resistance. As the costs of whole-genome sequencing (WGS) continue to decline, it becomes increasingly available in routine diagnostic laborato......ObjectivesIdentification of antimicrobial resistance genes is important for understanding the underlying mechanisms and the epidemiology of antimicrobial resistance. As the costs of whole-genome sequencing (WGS) continue to decline, it becomes increasingly available in routine diagnostic...... laboratories and is anticipated to substitute traditional methods for resistance gene identification. Thus, the current challenge is to extract the relevant information from the large amount of generated data.MethodsWe developed a web-based method, ResFinder that uses BLAST for identification of acquired...... antimicrobial resistance genes in whole-genome data. As input, the method can use both pre-assembled, complete or partial genomes, and short sequence reads from four different sequencing platforms. The method was evaluated on 1862 GenBank files containing 1411 different resistance genes, as well as on 23 de...

  9. Overexpression of antibiotic resistance genes in hospital effluents over time


    Rowe, Will P. M.; Baker-Austin, Craig; Verner-Jeffreys, David W.; Ryan, Jim J.; Micallef, Christianne; Maskell, Duncan J.; Pearce, Gareth P.


    $\\textbf{Objectives}$: Effluents contain a diverse abundance of antibiotic resistance genes that augment the resistome of receiving aquatic environments. However, uncertainty remains regarding their temporal persistence, transcription and response to anthropogenic factors, such as antibiotic usage. We present a spatiotemporal study within a river catchment (River Cam, UK) that aims to determine the contribution of antibiotic resistance gene-containing effluents originating from sites of varyi...

  10. Resistance Genes in Global Crop Breeding Networks. (United States)

    Garrett, K A; Andersen, K F; Asche, F; Bowden, R L; Forbes, G A; Kulakow, P A; Zhou, B


    Resistance genes are a major tool for managing crop diseases. The networks of crop breeders who exchange resistance genes and deploy them in varieties help to determine the global landscape of resistance and epidemics, an important system for maintaining food security. These networks function as a complex adaptive system, with associated strengths and vulnerabilities, and implications for policies to support resistance gene deployment strategies. Extensions of epidemic network analysis can be used to evaluate the multilayer agricultural networks that support and influence crop breeding networks. Here, we evaluate the general structure of crop breeding networks for cassava, potato, rice, and wheat. All four are clustered due to phytosanitary and intellectual property regulations, and linked through CGIAR hubs. Cassava networks primarily include public breeding groups, whereas others are more mixed. These systems must adapt to global change in climate and land use, the emergence of new diseases, and disruptive breeding technologies. Research priorities to support policy include how best to maintain both diversity and redundancy in the roles played by individual crop breeding groups (public versus private and global versus local), and how best to manage connectivity to optimize resistance gene deployment while avoiding risks to the useful life of resistance genes. [Formula: see text] Copyright © 2017 The Author(s). This is an open access article distributed under the CC BY 4.0 International license .

  11. Overexpression of antibiotic resistance genes in hospital effluents over time. (United States)

    Rowe, Will P M; Baker-Austin, Craig; Verner-Jeffreys, David W; Ryan, Jim J; Micallef, Christianne; Maskell, Duncan J; Pearce, Gareth P


    Effluents contain a diverse abundance of antibiotic resistance genes that augment the resistome of receiving aquatic environments. However, uncertainty remains regarding their temporal persistence, transcription and response to anthropogenic factors, such as antibiotic usage. We present a spatiotemporal study within a river catchment (River Cam, UK) that aims to determine the contribution of antibiotic resistance gene-containing effluents originating from sites of varying antibiotic usage to the receiving environment. Gene abundance in effluents (municipal hospital and dairy farm) was compared against background samples of the receiving aquatic environment (i.e. the catchment source) to determine the resistome contribution of effluents. We used metagenomics and metatranscriptomics to correlate DNA and RNA abundance and identified differentially regulated gene transcripts. We found that mean antibiotic resistance gene and transcript abundances were correlated for both hospital ( ρ  = 0.9, two-tailed P  hospital effluent samples. High β-lactam resistance gene transcript abundance was related to hospital antibiotic usage over time and hospital effluents contained antibiotic residues. We conclude that effluents contribute high levels of antibiotic resistance genes to the aquatic environment; these genes are expressed at significant levels and are possibly related to the level of antibiotic usage at the effluent source. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy.

  12. Expression Study of Banana Pathogenic Resistance Genes

    Directory of Open Access Journals (Sweden)

    Fenny M. Dwivany


    Full Text Available Banana is one of the world's most important trade commodities. However, infection of banana pathogenic fungi (Fusarium oxysporum race 4 is one of the major causes of decreasing production in Indonesia. Genetic engineering has become an alternative way to control this problem by isolating genes that involved in plant defense mechanism against pathogens. Two of the important genes are API5 and ChiI1, each gene encodes apoptosis inhibitory protein and chitinase enzymes. The purpose of this study was to study the expression of API5 and ChiI1 genes as candidate pathogenic resistance genes. The amplified fragments were then cloned, sequenced, and confirmed with in silico studies. Based on sequence analysis, it is showed that partial API5 gene has putative transactivation domain and ChiI1 has 9 chitinase family GH19 protein motifs. Data obtained from this study will contribute in banana genetic improvement.

  13. Pediatric fecal microbiota harbor diverse and novel antibiotic resistance genes.

    Directory of Open Access Journals (Sweden)

    Aimée M Moore

    Full Text Available Emerging antibiotic resistance threatens human health. Gut microbes are an epidemiologically important reservoir of resistance genes (resistome, yet prior studies indicate that the true diversity of gut-associated resistomes has been underestimated. To deeply characterize the pediatric gut-associated resistome, we created metagenomic recombinant libraries in an Escherichia coli host using fecal DNA from 22 healthy infants and children (most without recent antibiotic exposure, and performed functional selections for resistance to 18 antibiotics from eight drug classes. Resistance-conferring DNA fragments were sequenced (Illumina HiSeq 2000, and reads assembled and annotated with the PARFuMS computational pipeline. Resistance to 14 of the 18 antibiotics was found in stools of infants and children. Recovered genes included chloramphenicol acetyltransferases, drug-resistant dihydrofolate reductases, rRNA methyltransferases, transcriptional regulators, multidrug efflux pumps, and every major class of beta-lactamase, aminoglycoside-modifying enzyme, and tetracycline resistance protein. Many resistance-conferring sequences were mobilizable; some had low identity to any known organism, emphasizing cryptic organisms as potentially important resistance reservoirs. We functionally confirmed three novel resistance genes, including a 16S rRNA methylase conferring aminoglycoside resistance, and two tetracycline-resistance proteins nearly identical to a bifidobacterial MFS transporter (B. longum s. longum JDM301. We provide the first report to our knowledge of resistance to folate-synthesis inhibitors conferred by a predicted Nudix hydrolase (part of the folate synthesis pathway. This functional metagenomic survey of gut-associated resistomes, the largest of its kind to date, demonstrates that fecal resistomes of healthy children are far more diverse than previously suspected, that clinically relevant resistance genes are present even without recent selective

  14. Antibiotic resistance and virulence genes in coliform water isolates. (United States)

    Stange, C; Sidhu, J P S; Tiehm, A; Toze, S


    Widespread fecal pollution of surface water may present a major health risk and a significant pathway for dissemination of antibiotic resistance bacteria. The River Rhine is one of the longest and most important rivers in Europe and an important raw water source for drinking water production. A total of 100 coliform isolates obtained from River Rhine (Germany) were examined for their susceptibility to seven antimicrobial agents. Resistances against amoxicillin, trimethoprim/sulfamethoxazole and tetracycline were detected in 48%, 11% and 9% of isolates respectively. The antibiotic resistance could be traced back to the resistance genes bla TEM , bla SHV , ampC, sul1, sul2, dfrA1, tet(A) and tet(B). Whereby, the ampC gene represents a special case, because its presence is not inevitably linked to a phenotypic antibiotic resistance. Multiple antibiotics resistance was often accompanied by the occurrence of class 1 or 2 integrons. E. coli isolates belonging to phylogenetic groups A and B1 (commensal) were more predominant (57%) compared to B2 and D groups (43%) which are known to carry virulent genes. Additionally, six E. coli virulence genes were also detected. However, the prevalence of virulence genes in the E. coli isolates was low (not exceeding 4.3% per gene) and no diarrheagenic E. coli pathotypes were detected. This study demonstrates that surface water is an important reservoir of ARGs for a number of antibiotic classes such as sulfonamide, trimethoprim, beta-lactam-antibiotics and tetracycline. The occurrence of antibiotic resistance in coliform bacteria isolated from River Rhine provides evidence for the need to develop management strategies to limit the spread of antibiotic resistant bacteria in aquatic environment. Copyright © 2016 Elsevier GmbH. All rights reserved.

  15. Deinococcus geothermalis: The Pool of Extreme Radiation Resistance Genes Shrinks

    Energy Technology Data Exchange (ETDEWEB)

    Makarova, Kira S.; Omelchenko, Marina V.; Gaidamakova, Elena K.; Matrosova, Vera Y.; Vasilenko, Alexander; Zhai, Min; Lapidus, Alla; Copeland, Alex; Kim, Edwin; Land, Miriam; Mavrommatis, Konstantinos; Pitluck, Samuel; Richardson, Paul M.; Detter, Chris; Brettin, Thomas; Saunders, Elizabeth; Lai, Barry; Ravel, Bruce; Kemner, Kenneth M.; Wolf, Yuri I.; Sorokin, Alexander; Gerasimova, Anna V.; Gelfand, Mikhail S.; Fredrickson, James K.; Koonin, Eugene V.; Daly, Michael J.


    Bacteria of the genus Deinococcus are extremely resistant to ionizing radiation (IR), ultraviolet light (UV) and desiccation. The mesophile Deinococcus radiodurans was the first member of this group whose genome was completely sequenced. Analysis of the genome sequence of D. radiodurans, however, failed to identify unique DNA repair systems. To further delineate the genes underlying the resistance phenotypes, we report the whole-genome sequence of a second Deinococcus species, the thermophile Deinococcus geothermalis, which at itsoptimal growth temperature is as resistant to IR, UV and desiccation as D. radiodurans, and a comparative analysis of the two Deinococcus genomes. Many D. radiodurans genes previously implicated in resistance, but for which no sensitive phenotype was observed upon disruption, are absent in D. geothermalis. In contrast, most D. radiodurans genes whose mutants displayed a radiation-sensitive phenotype in D. radiodurans are conserved in D. geothermalis. Supporting the existence of a Deinococcus radiation response regulon, a common palindromic DNA motif was identified in a conserved set of genes associated with resistance, and a dedicated transcriptional regulator was predicted. We present the case that these two species evolved essentially the same diverse set of gene families, and that the extreme stress-resistance phenotypes of the Deinococcus lineage emerged progressively by amassing cell-cleaning systems from different sources, but not by acquisition of novel DNA repair systems. Our reconstruction of the genomic evolution of the Deinococcus-Thermus phylum indicates that the corresponding set of enzymes proliferated mainly in the common ancestor of Deinococcus. Results of the comparative analysis weaken the arguments for a role of higher-order chromosome alignment structures in resistance; more clearly define and substantially revise downward the number of uncharacterized genes that might participate in DNA repair and contribute to

  16. Antimicrobial resistance and resistance gene determinants in clinical Escherichia coli from different animal species in Switzerland. (United States)

    Lanz, Roland; Kuhnert, Peter; Boerlin, Patrick


    Antimicrobial susceptibility testing was performed on a total of 581 clinical Escherichia coli isolates from diarrhea and edema disease in pigs, from acute mastitis in dairy cattle, from urinary tract infections in dogs and cats, and from septicemia in laying hens collected in Switzerland between 1999 and 2001. Among the 16 antimicrobial agents tested, resistance was most frequent for sulfonamides, tetracycline, and streptomycin. Isolates from swine presented significantly more resistance than those from the other animal species. The distribution of the resistance determinants for sulfonamides, tetracycline, and streptomycin was assessed by hybridization and PCR in resistant isolates. Significant differences in the distribution of resistance determinants for tetracycline (tetA, tetB) and sulfonamides (sulII) were observed between the isolates from swine and those from the other species. Resistance to sulfonamides could not be explained by known resistance mechanisms in more than a quarter of the sulfonamide-resistant and sulfonamide-intermediate isolates from swine, dogs and cats. This finding suggests that one or several new resistance mechanisms for sulfonamides may be widespread among E. coli isolates from these animal species. The integrase gene (intI) from class I integrons was detected in a large proportion of resistant isolates in association with the sulI and aadA genes, thus demonstrating the importance of integrons in the epidemiology of resistance in clinical E. coli isolates from animals.

  17. Antimicrobial resistance and prevalence of resistance genes of obligate anaerobes isolated from periodontal abscesses. (United States)

    Xie, Yi; Chen, Jiazhen; He, Junlin; Miao, Xinyu; Xu, Meng; Wu, Xingwen; Xu, Beiyun; Yu, Liying; Zhang, Wenhong


    This study attempts to determine the antimicrobial resistance profiles of obligate anaerobic bacteria that were isolated from a periodontal abscess and to evaluate the prevalence of resistance genes in these bacteria. Forty-one periodontal abscess samples were cultivated on selective and non-selective culture media to isolate the oral anaerobes. Their antibiotic susceptibilities to clindamycin, doxycycline, amoxicillin, imipenem, cefradine, cefixime, roxithromycin, and metronidazole were determined using the agar dilution method, and polymerase chain reaction assays were performed to detect the presence of the ermF, tetQ, nim, and cfxA drug resistance genes. A total of 60 different bacterial colonies was isolated and identified. All of the isolates were sensitive to imipenem. Of the strains, 6.7%, 13.3%, 16.7%, and 25% were resistant to doxycycline, metronidazole, cefixime, and amoxicillin, respectively. The resistance rate for both clindamycin and roxithromycin was 31.7%. Approximately 60.7% of the strains had the ermF gene, and 53.3% of the amoxicillin-resistant strains were found to have the cfxA gene. Two nim genes that were found in eight metronidazole-resistant strains were identified as nimB. In the present study, the Prevotella species are the most frequently isolated obligate anaerobes from periodontal abscesses. The current results show their alarmingly high resistance rate against clindamycin and roxithromycin; thus, the use of these antibiotics is unacceptable for the empirical therapy of periodontal abscesses. A brief prevalence of four resistance genes in the anaerobic bacteria that were isolated was also demonstrated.

  18. Comparative mapping of powdery mildew resistance gene Pm21 and functional characterization of resistance-related genes in wheat. (United States)

    He, Huagang; Zhu, Shanying; Jiang, Zhengning; Ji, Yaoyong; Wang, Feng; Zhao, Renhui; Bie, Tongde


    The powdery mildew resistance gene Pm21 was physically and comparatively mapped by newly developed markers. Seven candidate genes were verified to be required for Pm21 -mediated resistance to wheat powdery mildew. Pm21, a gene derived from wheat wild relative Dasypyrum villosum, has been transferred into common wheat and widely utilized in wheat resistance breeding for powdery mildew. Previously, Pm21 has been located to the bin FL0.45-0.58 of 6VS by using deletion stocks. However, its fine mapping is still a hard work. In the present study, 30 gene-derived 6VS-specific markers were obtained based on the collinearity among genomes of Brachypodium distachyon, Oryza and Triticeae, and then physically and comparatively mapped in the bin FL0.45-0.58 and its nearby chromosome region. According to the maps, the bin FL0.45-0.58 carrying Pm21 was closely flanked by the markers 6VS-03 and 6VS-23, which further narrowed the orthologous regions to 1.06 Mb in Brachypodium and 1.38 Mb in rice, respectively. Among the conserved genes shared by Brachypodium and rice, four serine/threonine protein kinase genes (DvMPK1, DvMLPK, DvUPK and DvPSYR1), one protein phosphatase gene (DvPP2C) and two transcription factor genes (DvGATA and DvWHY) were confirmed to be required for Pm21-mediated resistance to wheat powdery mildew by barley stripe mosaic virus-induced gene silencing (BSMV-VIGS) and transcriptional pattern analyses. In summary, this study gives new insights into the genetic basis of the Pm21 locus and the disease resistance pathways mediated by Pm21.

  19. Anthropogenic antibiotic resistance genes mobilization to the polar regions. (United States)

    Hernández, Jorge; González-Acuña, Daniel


    Anthropogenic influences in the southern polar region have been rare, but lately microorganisms associated with humans have reached Antarctica, possibly from military bases, fishing boats, scientific expeditions, and/or ship-borne tourism. Studies of seawater in areas of human intervention and proximal to fresh penguin feces revealed the presence of Escherichia coli strains least resistant to antibiotics in penguins, whereas E. coli from seawater elsewhere showed resistance to one or more of the following antibiotics: ampicillin, tetracycline, streptomycin, and trim-sulfa. In seawater samples, bacteria were found carrying extended-spectrum β-lactamase (ESBL)-type CTX-M genes in which multilocus sequencing typing (MLST) showed different sequence types (STs), previously reported in humans. In the Arctic, on the contrary, people have been present for a long time, and the presence of antibiotic resistance genes (ARGs) appears to be much more wide-spread than was previously reported. Studies of E coli from Arctic birds (Bering Strait) revealed reduced susceptibility to antibiotics, but one globally spreading clone of E. coli genotype O25b-ST131, carrying genes of ESBL-type CTX-M, was identified. In the few years between sample collections in the same area, differences in resistance pattern were observed, with E. coli from birds showing resistance to a maximum of five different antibiotics. Presence of resistance-type ESBLs (TEM, SHV, and CTX-M) in E. coli and Klebsiella pneumoniae was also confirmed by specified PCR methods. MLST revealed that those bacteria carried STs that connect them to previously described strains in humans. In conclusion, bacteria previously related to humans could be found in relatively pristine environments, and presently human-associated, antibiotic-resistant bacteria have reached a high global level of distribution that they are now found even in the polar regions.

  20. Organization of a resistance gene cluster linked to rhizomania resistance in sugar beet (United States)

    Genetic resistance to rhizomania has been in use for over 40 years. Characterization of the molecular basis for susceptibility and resistance has proved challenging. Nucleotide-binding leucine-rich-repeat-containing (NB-LRR) genes have been implicated in numerous gene-for-gene resistance interaction...

  1. Analysis of differentially expressed genes related to resistance in spinosad- and neonicotinoid-resistant Musca domestica L. (Diptera: Muscidae) strains

    DEFF Research Database (Denmark)

    Castberg, Dorte Heidi Højland; Kristensen, Michael


    strains differing significantly in their response to insecticides. High differential expression of P450s and genes coding for cuticle protein indicates a combination of factors involved in metabolic neonicotinoid and spinosad resistance. Conclusion Resistance in these strains is apparently not linked...... interesting in terms of neonicotinoid resistance, while cyp4d9 was overexpressed in 791spin compared to spinosad-susceptible strains. GSTs, ESTs and UGTs were mostly overexpressed, but not to the same degree as P450s. We present a comprehensive and comparative picture of gene expression in three housefly......Background The housefly is a global pest that has developed resistance to most insecticides applied against it. Resistance of the spinosad-resistant strain 791spin and the neonicotinoid-resistant 766b strain is believed to be due to metabolism. We investigate differentially expressed genes...

  2. Multi drug resistant tuberculosis presenting as anterior mediastinal mass

    Directory of Open Access Journals (Sweden)

    Parmarth Chandane


    Full Text Available Enlargement of the mediastinal lymphatic glands is a common presentation of intrathoracic tuberculosis (TB in children. However, usually, the mediastinal TB nodes enlarge to 2.8 ± 1.0 cm. In this report, we describe a case of anterior mediastinal lymphnode TB seen as huge mass (7 cm on computed tomography (CT thorax without respiratory or food pipe compromise despite anterior mediastinum being an enclosed space. CT guided biopsy of the mass cultured Mycobacterium TB complex which was resistant to isoniazide, rifampicin, streptomycin ofloxacin, moxifloxacin, and pyrazinamide. Hence, we report primary multi drug resistant TB presenting as anterior mediastinal mass as a rare case report.

  3. Functional study of the novel multidrug resistance gene HA117 and its comparison to multidrug resistance gene 1

    Directory of Open Access Journals (Sweden)

    Chen Tingfu


    Full Text Available Abstract Background The novel gene HA117 is a multidrug resistance (MDR gene expressed by all-trans retinoic acid-resistant HL-60 cells. In the present study, we compared the multidrug resistance of the HA117 with that of the classical multidrug resistance gene 1 (MDR1 in breast cancer cell line 4T1. Methods Transduction of the breast cancer cell line 4T1 with adenoviral vectors encoding the HA117 gene and the green fluorescence protein gene (GFP (Ad-GFP-HA117, the MDR1 and GFP (Ad-GFP-MDR1 or GFP (Ad-GFP was respectively carried out. The transduction efficiency and the multiplicity of infection (MOI were detected by fluorescence microscope and flow cytometry. The transcription of HA117 gene and MDR1 gene were detected by reverse transcription polymerase chain reaction (RT-PCR. Western blotting analysis was used to detect the expression of P-glycoprotein (P-gp but the expression of HA117 could not be analyzed as it is a novel gene and its antibody has not yet been synthesized. The drug-excretion activity of HA117 and MDR1 were determined by daunorubicin (DNR efflux assay. The drug sensitivities of 4T1/HA117 and 4T1/MDR1 to chemotherapeutic agents were detected by Methyl-Thiazolyl-Tetrazolium (MTT assay. Results The transducted efficiency of Ad-GFP-HA117 and Ad-GFP-MDR1 were 75%-80% when MOI was equal to 50. The transduction of Ad-GFP-HA117 and Ad-GFP-MDR1 could increase the expression of HA117 and MDR1. The drug resistance index to Adriamycin (ADM, vincristine (VCR, paclitaxel (Taxol and bleomycin (BLM increased to19.8050, 9.0663, 9.7245, 3.5650 respectively for 4T1/HA117 and 24.2236, 11.0480, 11.3741, 0.9630 respectively for 4T1/MDR1 as compared to the control cells. There were no significant differences in drug sensitivity between 4T1/HA117 and 4T1/MDR1 for the P-gp substrates (ADM, VCR and Taxol (P Conclusions These results confirm that HA117 is a strong MDR gene in both HL-60 and 4T1 cells. Furthermore, our results indicate that the MDR

  4. Sulfonamide-resistant bacteria and their resistance genes in soils fertilized with manures from Jiangsu Province, Southeastern China. (United States)

    Wang, Na; Yang, Xiaohong; Jiao, Shaojun; Zhang, Jun; Ye, Boping; Gao, Shixiang


    Antibiotic-resistant bacteria and genes are recognized as new environmental pollutants that warrant special concern. There were few reports on veterinary antibiotic-resistant bacteria and genes in China. This work systematically analyzed the prevalence and distribution of sulfonamide resistance genes in soils from the environments around poultry and livestock farms in Jiangsu Province, Southeastern China. The results showed that the animal manure application made the spread and abundance of antibiotic resistance genes (ARGs) increasingly in the soil. The frequency of sulfonamide resistance genes was sul1 > sul2 > sul3 in pig-manured soil DNA and sul2 > sul1 > sul3 in chicken-manured soil DNA. Further analysis suggested that the frequency distribution of the sul genes in the genomic DNA and plasmids of the SR isolates from manured soil was sul2 > sul1 > sul3 overall (psulfonamide resistance genes. The present study also indicated that Bacillus, Pseudomonas and Shigella were the most prevalent sul-positive genera in the soil, suggesting a potential human health risk. The above results could be important in the evaluation of antibiotic-resistant bacteria and genes from manure as sources of agricultural soil pollution; the results also demonstrate the necessity and urgency of the regulation and supervision of veterinary antibiotics in China.

  5. Clusters of Antibiotic Resistance Genes Enriched Together Stay Together in Swine Agriculture. (United States)

    Johnson, Timothy A; Stedtfeld, Robert D; Wang, Qiong; Cole, James R; Hashsham, Syed A; Looft, Torey; Zhu, Yong-Guan; Tiedje, James M


    Antibiotic resistance is a worldwide health risk, but the influence of animal agriculture on the genetic context and enrichment of individual antibiotic resistance alleles remains unclear. Using quantitative PCR followed by amplicon sequencing, we quantified and sequenced 44 genes related to antibiotic resistance, mobile genetic elements, and bacterial phylogeny in microbiomes from U.S. laboratory swine and from swine farms from three Chinese regions. We identified highly abundant resistance clusters: groups of resistance and mobile genetic element alleles that cooccur. For example, the abundance of genes conferring resistance to six classes of antibiotics together with class 1 integrase and the abundance of IS6100-type transposons in three Chinese regions are directly correlated. These resistance cluster genes likely colocalize in microbial genomes in the farms. Resistance cluster alleles were dramatically enriched (up to 1 to 10% as abundant as 16S rRNA) and indicate that multidrug-resistant bacteria are likely the norm rather than an exception in these communities. This enrichment largely occurred independently of phylogenetic composition; thus, resistance clusters are likely present in many bacterial taxa. Furthermore, resistance clusters contain resistance genes that confer resistance to antibiotics independently of their particular use on the farms. Selection for these clusters is likely due to the use of only a subset of the broad range of chemicals to which the clusters confer resistance. The scale of animal agriculture and its wastes, the enrichment and horizontal gene transfer potential of the clusters, and the vicinity of large human populations suggest that managing this resistance reservoir is important for minimizing human risk. Agricultural antibiotic use results in clusters of cooccurring resistance genes that together confer resistance to multiple antibiotics. The use of a single antibiotic could select for an entire suite of resistance genes if

  6. Natural variation of rice blast resistance gene Pi-d2 (United States)

    Studying natural variation of rice resistance (R) genes in cultivated and wild rice relatives can predict resistance stability to rice blast fungus. In the present study, the protein coding regions of rice R gene Pi-d2 in 35 rice accessions of subgroups, aus (AUS), indica (IND), temperate japonica (...

  7. Environmental and Public Health Implications of Water Reuse: Antibiotics, Antibiotic Resistant Bacteria, and Antibiotic Resistance Genes (United States)

    Hong, Pei-Ying; Al-Jassim, Nada; Ansari, Mohd Ikram; Mackie, Roderick I.


    Water scarcity is a global problem, and is particularly acute in certain regions like Africa, the Middle East, as well as the western states of America. A breakdown on water usage revealed that 70% of freshwater supplies are used for agricultural irrigation. The use of reclaimed water as an alternative water source for agricultural irrigation would greatly alleviate the demand on freshwater sources. This paradigm shift is gaining momentum in several water scarce countries like Saudi Arabia. However, microbial problems associated with reclaimed water may hinder the use of reclaimed water for agricultural irrigation. Of particular concern is that the occurrence of antibiotic residues in the reclaimed water can select for antibiotic resistance genes among the microbial community. Antibiotic resistance genes can be associated with mobile genetic elements, which in turn allow a promiscuous transfer of resistance traits from one bacterium to another. Together with the pathogens that are present in the reclaimed water, antibiotic resistant bacteria can potentially exchange mobile genetic elements to create the “perfect microbial storm”. Given the significance of this issue, a deeper understanding of the occurrence of antibiotics in reclaimed water, and their potential influence on the selection of resistant microorganisms would be essential. In this review paper, we collated literature over the past two decades to determine the occurrence of antibiotics in municipal wastewater and livestock manure. We then discuss how these antibiotic resistant bacteria may impose a potential microbial risk to the environment and public health, and the knowledge gaps that would have to be addressed in future studies. Overall, the collation of the literature in wastewater treatment and agriculture serves to frame and identify potential concerns with respect to antibiotics, antibiotic resistant bacteria, and antibiotic resistance genes in reclaimed water. PMID:27029309

  8. Environmental and Public Health Implications of Water Reuse: Antibiotics, Antibiotic Resistant Bacteria, and Antibiotic Resistance Genes

    KAUST Repository

    Hong, Pei-Ying; Aljassim, Nada I.; Ansari, Mohd Ikram; Mackie, Roderick


    Water scarcity is a global problem, and is particularly acute in certain regions like Africa, the Middle East, as well as the western states of America. A breakdown on water usage revealed that 70% of freshwater supplies are used for agricultural irrigation. The use of reclaimed water as an alternative water source for agricultural irrigation would greatly alleviate the demand on freshwater sources. This paradigm shift is gaining momentum in several water scarce countries like Saudi Arabia. However, microbial problems associated with reclaimed water may hinder the use of reclaimed water for agricultural irrigation. Of particular concern is that the occurrence of antibiotic residues in the reclaimed water can select for antibiotic resistance genes among the microbial community. Antibiotic resistance genes can be associated with mobile genetic elements, which in turn allow a promiscuous transfer of resistance traits from one bacterium to another. Together with the pathogens that are present in the reclaimed water, antibiotic resistant bacteria can potentially exchange mobile genetic elements to create the “perfect microbial storm”. Given the significance of this issue, a deeper understanding of the occurrence of antibiotics in reclaimed water, and their potential influence on the selection of resistant microorganisms would be essential. In this review paper, we collated literature over the past two decades to determine the occurrence of antibiotics in municipal wastewater and livestock manure. We then discuss how these antibiotic resistant bacteria may impose a potential microbial risk to the environment and public health, and the knowledge gaps that would have to be addressed in future studies. Overall, the collation of the literature in wastewater treatment and agriculture serves to frame and identify potential concerns with respect to antibiotics, antibiotic resistant bacteria, and antibiotic resistance genes in reclaimed water.

  9. Environmental and Public Health Implications of Water Reuse: Antibiotics, Antibiotic Resistant Bacteria, and Antibiotic Resistance Genes

    Directory of Open Access Journals (Sweden)

    Roderick I. Mackie


    Full Text Available Water scarcity is a global problem, and is particularly acute in certain regions like Africa, the Middle East, as well as the western states of America. A breakdown on water usage revealed that 70% of freshwater supplies are used for agricultural irrigation. The use of reclaimed water as an alternative water source for agricultural irrigation would greatly alleviate the demand on freshwater sources. This paradigm shift is gaining momentum in several water scarce countries like Saudi Arabia. However, microbial problems associated with reclaimed water may hinder the use of reclaimed water for agricultural irrigation. Of particular concern is that the occurrence of antibiotic residues in the reclaimed water can select for antibiotic resistance genes among the microbial community. Antibiotic resistance genes can be associated with mobile genetic elements, which in turn allow a promiscuous transfer of resistance traits from one bacterium to another. Together with the pathogens that are present in the reclaimed water, antibiotic resistant bacteria can potentially exchange mobile genetic elements to create the “perfect microbial storm”. Given the significance of this issue, a deeper understanding of the occurrence of antibiotics in reclaimed water, and their potential influence on the selection of resistant microorganisms would be essential. In this review paper, we collated literature over the past two decades to determine the occurrence of antibiotics in municipal wastewater and livestock manure. We then discuss how these antibiotic resistant bacteria may impose a potential microbial risk to the environment and public health, and the knowledge gaps that would have to be addressed in future studies. Overall, the collation of the literature in wastewater treatment and agriculture serves to frame and identify potential concerns with respect to antibiotics, antibiotic resistant bacteria, and antibiotic resistance genes in reclaimed water.

  10. Environmental and Public Health Implications of Water Reuse: Antibiotics, Antibiotic Resistant Bacteria, and Antibiotic Resistance Genes

    KAUST Repository

    Hong, Pei-Ying


    Water scarcity is a global problem, and is particularly acute in certain regions like Africa, the Middle East, as well as the western states of America. A breakdown on water usage revealed that 70% of freshwater supplies are used for agricultural irrigation. The use of reclaimed water as an alternative water source for agricultural irrigation would greatly alleviate the demand on freshwater sources. This paradigm shift is gaining momentum in several water scarce countries like Saudi Arabia. However, microbial problems associated with reclaimed water may hinder the use of reclaimed water for agricultural irrigation. Of particular concern is that the occurrence of antibiotic residues in the reclaimed water can select for antibiotic resistance genes among the microbial community. Antibiotic resistance genes can be associated with mobile genetic elements, which in turn allow a promiscuous transfer of resistance traits from one bacterium to another. Together with the pathogens that are present in the reclaimed water, antibiotic resistant bacteria can potentially exchange mobile genetic elements to create the “perfect microbial storm”. Given the significance of this issue, a deeper understanding of the occurrence of antibiotics in reclaimed water, and their potential influence on the selection of resistant microorganisms would be essential. In this review paper, we collated literature over the past two decades to determine the occurrence of antibiotics in municipal wastewater and livestock manure. We then discuss how these antibiotic resistant bacteria may impose a potential microbial risk to the environment and public health, and the knowledge gaps that would have to be addressed in future studies. Overall, the collation of the literature in wastewater treatment and agriculture serves to frame and identify potential concerns with respect to antibiotics, antibiotic resistant bacteria, and antibiotic resistance genes in reclaimed water.

  11. QTL mapping and transcriptome analysis of cowpea reveals candidate genes for root-knot nematode resistance. (United States)

    Santos, Jansen Rodrigo Pereira; Ndeve, Arsenio Daniel; Huynh, Bao-Lam; Matthews, William Charles; Roberts, Philip Alan


    Cowpea is one of the most important food and forage legumes in drier regions of the tropics and subtropics. However, cowpea yield worldwide is markedly below the known potential due to abiotic and biotic stresses, including parasitism by root-knot nematodes (Meloidogyne spp., RKN). Two resistance genes with dominant effect, Rk and Rk2, have been reported to provide resistance against RKN in cowpea. Despite their description and use in breeding for resistance to RKN and particularly genetic mapping of the Rk locus, the exact genes conferring resistance to RKN remain unknown. In the present work, QTL mapping using recombinant inbred line (RIL) population 524B x IT84S-2049 segregating for a newly mapped locus and analysis of the transcriptome changes in two cowpea near-isogenic lines (NIL) were used to identify candidate genes for Rk and the newly mapped locus. A major QTL, designated QRk-vu9.1, associated with resistance to Meloidogyne javanica reproduction, was detected and mapped on linkage group LG9 at position 13.37 cM using egg production data. Transcriptome analysis on resistant and susceptible NILs 3 and 9 days after inoculation revealed up-regulation of 109 and 98 genes and down-regulation of 110 and 89 genes, respectively, out of 19,922 unique genes mapped to the common bean reference genome. Among the differentially expressed genes, four and nine genes were found within the QRk-vu9.1 and QRk-vu11.1 QTL intervals, respectively. Six of these genes belong to the TIR-NBS-LRR family of resistance genes and three were upregulated at one or more time-points. Quantitative RT-PCR validated gene expression to be positively correlated with RNA-seq expression pattern for eight genes. Future functional analysis of these cowpea genes will enhance our understanding of Rk-mediated resistance and identify the specific gene responsible for the resistance.

  12. QTL mapping and transcriptome analysis of cowpea reveals candidate genes for root-knot nematode resistance.

    Directory of Open Access Journals (Sweden)

    Jansen Rodrigo Pereira Santos

    Full Text Available Cowpea is one of the most important food and forage legumes in drier regions of the tropics and subtropics. However, cowpea yield worldwide is markedly below the known potential due to abiotic and biotic stresses, including parasitism by root-knot nematodes (Meloidogyne spp., RKN. Two resistance genes with dominant effect, Rk and Rk2, have been reported to provide resistance against RKN in cowpea. Despite their description and use in breeding for resistance to RKN and particularly genetic mapping of the Rk locus, the exact genes conferring resistance to RKN remain unknown. In the present work, QTL mapping using recombinant inbred line (RIL population 524B x IT84S-2049 segregating for a newly mapped locus and analysis of the transcriptome changes in two cowpea near-isogenic lines (NIL were used to identify candidate genes for Rk and the newly mapped locus. A major QTL, designated QRk-vu9.1, associated with resistance to Meloidogyne javanica reproduction, was detected and mapped on linkage group LG9 at position 13.37 cM using egg production data. Transcriptome analysis on resistant and susceptible NILs 3 and 9 days after inoculation revealed up-regulation of 109 and 98 genes and down-regulation of 110 and 89 genes, respectively, out of 19,922 unique genes mapped to the common bean reference genome. Among the differentially expressed genes, four and nine genes were found within the QRk-vu9.1 and QRk-vu11.1 QTL intervals, respectively. Six of these genes belong to the TIR-NBS-LRR family of resistance genes and three were upregulated at one or more time-points. Quantitative RT-PCR validated gene expression to be positively correlated with RNA-seq expression pattern for eight genes. Future functional analysis of these cowpea genes will enhance our understanding of Rk-mediated resistance and identify the specific gene responsible for the resistance.

  13. Inactivation Effect of Antibiotic-Resistant Gene Using Chlorine Disinfection

    Directory of Open Access Journals (Sweden)

    Takashi Furukawa


    Full Text Available The aim of this study was to elucidate the inactivation effects on the antibiotic-resistance gene (vanA of vancomycin-resistant enterococci (VRE using chlorination, a disinfection method widely used in various water treatment facilities. Suspensions of VRE were prepared by adding VRE to phosphate-buffered saline, or the sterilized secondary effluent of a wastewater treatment plant. The inactivation experiments were carried out at several chlorine concentrations and stirring time. Enterococci concentration and presence of vanA were determined. The enterococci concentration decreased as chlorine concentrations and stirring times increased, with more than 7.0 log reduction occurring under the following conditions: 40 min stirring at 0.5 mg Cl2/L, 20 min stirring at 1.0 mg Cl2/L, and 3 min stirring at 3.0 mg Cl2/L. In the inactivation experiment using VRE suspended in secondary effluent, the culturable enterococci required much higher chlorine concentration and longer treatment time for complete disinfection than the cases of suspension of VRE. However, vanA was detected in all chlorinated suspensions of VRE, even in samples where no enterococcal colonies were present on the medium agar plate. The chlorine disinfection was not able to destroy antibiotic-resistance genes, though it can inactivate and decrease bacterial counts of antibiotic-resistant bacteria (ARB. Therefore, it was suggested that remaining ARB and/or antibiotic-resistance gene in inactivated bacterial cells after chlorine disinfection tank could be discharged into water environments.

  14. Presence of antiseptic resistance genes in porcine methicillin-resistant Staphylococcus aureus. (United States)

    Wong, T Z; Zhang, M; O'Donoghue, M; Boost, M


    Numerous studies have documented the presence of methicillin-resistant Staphylococcus aureus (MRSA) in meat-producing animals, which has led to concern about its spread into the community. Disinfectants play an important role in reduction of contamination in both animal husbandry and food-preparation, helping control spread of organisms from foodstuffs, including raw meat. Plasmid-borne antiseptic resistance (AR) genes increasing tolerance to several disinfectants have been reported in S. aureus of human origin (qacA/B and smr) and from bovine, equine, and caprine staphylococcal isolates (qacG, qacH, and qacJ). This study investigated the presence of AR genes in porcine MRSA isolates. Plasmid DNA from 100 MRSA ST9 strains isolated from pig carcasses was amplified for the presence of AR genes. Minimum inhibitory concentrations (MICs) and minimum bactericidal concentrations (MBCs) to benzalkonium chloride (BC) and chlorhexidine gluconate (CHX) were determined in AR gene-positive isolates. qacG was present in 45 strains, eight of which also harbored smr. No strains carried qacA/B, qacH or qacJ. Presence of smr increased MICs to both BC and CHX and MBCs of CHX, but qacG presence only resulted in elevated MBC for CHX. This is the first report of AR genes from a porcine source. AR gene positivity has previously been associated with methicillin resistance and AR gene presence in these strains may increase their ability to persist in the environment. Improved implementation of hygiene measures during transportation and pre- and post-slaughter should be considered to prevent spread in the community. Copyright © 2012 Elsevier B.V. All rights reserved.

  15. Molecular detection of disease resistance genes to powdery mildew ...

    African Journals Online (AJOL)

    A study was conducted to detect the presence of disease resistance genes to infection of wheat powdery mildew (Blumeria graminis f. sp. tritici) in selected wheat cultivars from China using molecular markers. Genomic DNA of sixty cultivars was extracted and tested for the presence of selected prominent resistance genes to ...

  16. Genome scanning for identification of resistance gene analogs (RGAs)

    African Journals Online (AJOL)

    Disease resistance in plants is a desirable economic trait. Many disease resistance genes from various plants have been cloned so far. The gene products of some of these can be distinguished by the presence of an N terminal nucleotide binding site and a C-terminal stretch of leucine-rich repeats. Oligonucleotides already ...

  17. Occurrence of integrons and resistance genes among sulphonamide-resistant Shigella spp. from Brazil

    DEFF Research Database (Denmark)

    Peirano, G.; Agersø, Yvonne; Aarestrup, Frank Møller


    Objectives: To determine the occurrence of class 1 and 2 integrons and antimicrobial resistance genes among sulphonamide-resistant Shigella strains isolated in Brazil during 1999-2003. Methods: Sixty-two Shigella (Shigella flexneri, n = 47 and Shigella sonnei, n = 15) were tested against 21...... antimicrobial agents. The presence of integrons classes 1 and 2 and antimicrobial resistance genes was investigated by PCR using specific primers. Results: A total of eight antimicrobial resistance profiles were identified, with the profile of resistance to sulfamethoxazole, trimethoprim, spectinomycin...... of 2214 bp harbouring a gene cassette array conferring resistance to trimethoprim, streptothricin and spectinomycin/streptomycin. The genes coding for resistance to chloramphenicol (catA1), tetracycline [tet(A) and tet(B)] and ampicillin (bla(OXA) and bla(TEM)), were detected in resistant strains...

  18. Fine mapping and identification of a candidate gene for the barley Un8 true loose smut resistance gene. (United States)

    Zang, Wen; Eckstein, Peter E; Colin, Mark; Voth, Doug; Himmelbach, Axel; Beier, Sebastian; Stein, Nils; Scoles, Graham J; Beattie, Aaron D


    The candidate gene for the barley Un8 true loose smut resistance gene encodes a deduced protein containing two tandem protein kinase domains. In North America, durable resistance against all known isolates of barley true loose smut, caused by the basidiomycete pathogen Ustilago nuda (Jens.) Rostr. (U. nuda), is under the control of the Un8 resistance gene. Previous genetic studies mapped Un8 to the long arm of chromosome 5 (1HL). Here, a population of 4625 lines segregating for Un8 was used to delimit the Un8 gene to a 0.108 cM interval on chromosome arm 1HL, and assign it to fingerprinted contig 546 of the barley physical map. The minimal tilling path was identified for the Un8 locus using two flanking markers and consisted of two overlapping bacterial artificial chromosomes. One gene located close to a marker co-segregating with Un8 showed high sequence identity to a disease resistance gene containing two kinase domains. Sequence of the candidate gene from the parents of the segregating population, and in an additional 19 barley lines representing a broader spectrum of diversity, showed there was no intron in alleles present in either resistant or susceptible lines, and fifteen amino acid variations unique to the deduced protein sequence in resistant lines differentiated it from the deduced protein sequences in susceptible lines. Some of these variations were present within putative functional domains which may cause a loss of function in the deduced protein sequences within susceptible lines.

  19. Antimicrobial-Resistant Bacterial Populations and Antimicrobial Resistance Genes Obtained from Environments Impacted by Livestock and Municipal Waste.

    Directory of Open Access Journals (Sweden)

    Getahun E Agga

    prevalences and concentrations of antimicrobial-resistant bacteria and antimicrobial resistance genes exist in cattle, human, and swine waste streams, but a higher diversity of antimicrobial resistance genes are present in treated human waste discharged from municipal wastewater treatment plants than in livestock environments.

  20. Sponge microbiota are a reservoir of functional antibiotic resistance genes

    Directory of Open Access Journals (Sweden)

    Dennis Versluis


    Full Text Available Wide application of antibiotics has contributed to the evolution of multi-drug resistant human pathogens, resulting in poorer treatment outcomes for infections. In the marine environment, seawater samples have been investigated as a resistance reservoir; however, no studies have methodically examined sponges as a reservoir of antibiotic resistance. Sponges could be important in this respect because they often contain diverse microbial communities that have the capacity to produce bioactive metabolites. Here, we applied functional metagenomics to study the presence and diversity of functional resistance genes in the sponges Aplysina aerophoba, Petrosia ficiformis and Corticium candelabrum. We obtained 37 insert sequences facilitating resistance to D-cycloserine (n=6, gentamicin (n=1, amikacin (n=7, trimethoprim (n=17, chloramphenicol (n=1, rifampicin (n=2 and ampicillin (n=3. Fifteen of 37 inserts harboured resistance genes that shared <90% amino acid identity with known gene products, whereas on 13 inserts no resistance gene could be identified with high confidence, in which case we predicted resistance to be mainly mediated by antibiotic efflux. One marine-specific ampicillin-resistance-conferring β-lactamase was identified in the genus Pseudovibrio with 41% global amino acid identity to the closest β-lactamase with demonstrated functionality, and subsequently classified into a new family termed PSV. Taken together, our results show that sponge microbiota host diverse and novel resistance genes that may be harnessed by phylogenetically distinct bacteria.

  1. The cfr and cfr-like multiple resistance genes

    DEFF Research Database (Denmark)

    Vester, Birte


    . The cfr gene is found in various bacteria in many geographical locations and placed on plasmids or associated with transposons. Cfr-related genes providing similar resistance have been identified in Bacillales, and now also in the pathogens Clostridium difficile and Enterococcus faecium. In addition......, the presence of the cfr gene has been detected in harbours and food markets....

  2. Associations between Antimicrobial Resistance Phenotypes, Antimicrobial Resistance Genes, and Virulence Genes of Fecal Escherichia coli Isolates from Healthy Grow-Finish Pigs ▿


    Rosengren, Leigh B.; Waldner, Cheryl L.; Reid-Smith, Richard J.


    Escherichia coli often carries linked antimicrobial resistance genes on transmissible genetic elements. Through coselection, antimicrobial use may select for unrelated but linked resistance or virulence genes. This study used unconditional statistical associations to investigate the relationships between antimicrobial resistance phenotypes and antimicrobial resistance genes in 151 E. coli isolates from healthy pigs. Phenotypic resistance to each drug was significantly associated with phenotyp...

  3. Determination of rust resistance genes in pakistani bread wheats

    International Nuclear Information System (INIS)

    Qamar, M.; Ahmad, S.D.; Rabbani, M.A.; Shinwari, Z.K.


    Stripe and leaf rusts are the major constraints to bread wheat production in Pakistan. Molecular markers were used to investigate the presence of leaf rust and stripe rust resistance gene cluster Lr34/Yr18 and stem rust resistance gene Sr2 in 52 Pakistani bread wheat cultivars/lines. PCR amplification of DNA fragments using DNA marker csLV-34 showed that 13 of the studied cultivars/lines, namely 03FJ26, NR 337, NR 339, NR 347, NR 350, Manthar, Margalla 99, Iqbal 2000, Saleem 2000, Wafaq 2001, Marwat 2001, Pirsabak 2004 and Fareed 2006 carry leaf rust and stripe rust resistance genes Lr34/Yr18. Stem rust resistance gene Sr2 was observed in 36 Pakistani spring wheat cultivars/lines using stm560.3tgag marker. The slow rusting gene Sr2 needs to be combined with additional stem rust resistance genes to establish durable resistance against Ug99 in modern wheat cultivars. Low frequency of Lr34/Yr18 was found in Pakistani wheats. This gene cluster needs to be incorporated into Pakistani wheats for durable rust resistance. (author)

  4. sugE: A gene involved in tributyltin (TBT) resistance of Aeromonas molluscorum Av27. (United States)

    Cruz, Andreia; Micaelo, Nuno; Félix, Vitor; Song, Jun-Young; Kitamura, Shin-Ichi; Suzuki, Satoru; Mendo, Sónia


    The mechanism of bacterial resistance to tributyltin (TBT) is still unclear. The results herein presented contribute to clarify that mechanism in the TBT-resistant bacterium Aeromonas molluscorum Av27. We have identified and cloned a new gene that is involved in TBT resistance in this strain. The gene is highly homologous (84%) to the Aeromonas hydrophila-sugE gene belonging to the small multidrug resistance gene family (SMR), which includes genes involved in the transport of lipophilic drugs. In Av27, expression of the Av27-sugE was observed at the early logarithmic growth phase in the presence of a high TBT concentration (500 μM), thus suggesting the contribution of this gene for TBT resistance. E. coli cells transformed with Av27-sugE become resistant to ethidium bromide (EtBr), chloramphenicol (CP) and tetracycline (TE), besides TBT. According to the Moriguchi logP (miLogP) values, EtBr, CP and TE have similar properties and are substrates for the sugE-efflux system. Despite the different miLogP of TBT, E. coli cells transformed with Av27-sugE become resistant to this compound. So it seems that TBT is also a substrate for the SugE protein. The modelling studies performed also support this hypothesis. The data herein presented clearly indicate that sugE is involved in TBT resistance of this bacterium.

  5. Isolation of NBS-LRR class resistant gene (I2 gene) from tomato ...

    African Journals Online (AJOL)



    Oct 16, 2013 ... type of F. oxysporum f. sp. lycopersici observed commonly which require presence of I1 gene in tomato plant for the incompatibility ... Key words: Fusarium wilt, race, R-gene, resistance, tomato. ... MATERIALS AND METHODS.

  6. Fate of antibiotic resistant bacteria and genes during wastewater chlorination: implication for antibiotic resistance control.

    Directory of Open Access Journals (Sweden)

    Qing-Bin Yuan

    Full Text Available This study investigated fates of nine antibiotic-resistant bacteria as well as two series of antibiotic resistance genes in wastewater treated by various doses of chlorine (0, 15, 30, 60, 150 and 300 mg Cl2 min/L. The results indicated that chlorination was effective in inactivating antibiotic-resistant bacteria. Most bacteria were inactivated completely at the lowest dose (15 mg Cl2 min/L. By comparison, sulfadiazine- and erythromycin-resistant bacteria exhibited tolerance to low chlorine dose (up to 60 mg Cl2 min/L. However, quantitative real-time PCRs revealed that chlorination decreased limited erythromycin or tetracycline resistance genes, with the removal levels of overall erythromycin and tetracycline resistance genes at 0.42 ± 0.12 log and 0.10 ± 0.02 log, respectively. About 40% of erythromycin-resistance genes and 80% of tetracycline resistance genes could not be removed by chlorination. Chlorination was considered not effective in controlling antimicrobial resistance. More concern needs to be paid to the potential risk of antibiotic resistance genes in the wastewater after chlorination.

  7. Resistance to checkpoint blockade therapy through inactivation of antigen presentation. (United States)

    Sade-Feldman, Moshe; Jiao, Yunxin J; Chen, Jonathan H; Rooney, Michael S; Barzily-Rokni, Michal; Eliane, Jean-Pierre; Bjorgaard, Stacey L; Hammond, Marc R; Vitzthum, Hans; Blackmon, Shauna M; Frederick, Dennie T; Hazar-Rethinam, Mehlika; Nadres, Brandon A; Van Seventer, Emily E; Shukla, Sachet A; Yizhak, Keren; Ray, John P; Rosebrock, Daniel; Livitz, Dimitri; Adalsteinsson, Viktor; Getz, Gad; Duncan, Lyn M; Li, Bo; Corcoran, Ryan B; Lawrence, Donald P; Stemmer-Rachamimov, Anat; Boland, Genevieve M; Landau, Dan A; Flaherty, Keith T; Sullivan, Ryan J; Hacohen, Nir


    Treatment with immune checkpoint blockade (CPB) therapies often leads to prolonged responses in patients with metastatic melanoma, but the common mechanisms of primary and acquired resistance to these agents remain incompletely characterized and have yet to be validated in large cohorts. By analyzing longitudinal tumor biopsies from 17 metastatic melanoma patients treated with CPB therapies, we observed point mutations, deletions or loss of heterozygosity (LOH) in beta-2-microglobulin (B2M), an essential component of MHC class I antigen presentation, in 29.4% of patients with progressing disease. In two independent cohorts of melanoma patients treated with anti-CTLA4 and anti-PD1, respectively, we find that B2M LOH is enriched threefold in non-responders (~30%) compared to responders (~10%) and associated with poorer overall survival. Loss of both copies of B2M is found only in non-responders. B2M loss is likely a common mechanism of resistance to therapies targeting CTLA4 or PD1.


    Teixeira, Bertinellys; Rodulfo, Hectorina; Carreño, Numirin; Guzmán, Militza; Salazar, Elsa; De Donato, Marcos


    The enzymatic modification of aminoglycosides by aminoglycoside-acetyltransferases (AAC), aminoglycoside-adenyltransferases (AAD), and aminoglycoside-phosphotransferases (APH), is the most common resistance mechanism in P. aeruginosa and these enzymes can be coded on mobile genetic elements that contribute to their dispersion. One hundred and thirty seven P. aeruginosa isolates from the University Hospital, Cumana, Venezuela (HUAPA) were evaluated. Antimicrobial susceptibility was determined by the disk diffusion method and theaac, aadB and aph genes were detected by PCR. Most of the P. aeruginosa isolates (33/137) were identified from the Intensive Care Unit (ICU), mainly from discharges (96/137). The frequency of resistant P. aeruginosaisolates was found to be higher for the aminoglycosides tobramycin and amikacin (30.7 and 29.9%, respectively). Phenotype VI, resistant to these antibiotics, was the most frequent (14/49), followed by phenotype I, resistant to all the aminoglycosides tested (12/49). The aac(6´)-Ib,aphA1 and aadB genes were the most frequently detected, and the simultaneous presence of several resistance genes in the same isolate was demonstrated. Aminoglycoside resistance in isolates ofP. aeruginosa at the HUAPA is partly due to the presence of the aac(6´)-Ib, aphA1 andaadB genes, but the high rates of antimicrobial resistance suggest the existence of several mechanisms acting together. This is the first report of aminoglycoside resistance genes in Venezuela and one of the few in Latin America.

  9. SSTAR, a Stand-Alone Easy-To-Use Antimicrobial Resistance Gene Predictor. (United States)

    de Man, Tom J B; Limbago, Brandi M


    We present the easy-to-use Sequence Search Tool for Antimicrobial Resistance, SSTAR. It combines a locally executed BLASTN search against a customizable database with an intuitive graphical user interface for identifying antimicrobial resistance (AR) genes from genomic data. Although the database is initially populated from a public repository of acquired resistance determinants (i.e., ARG-ANNOT), it can be customized for particular pathogen groups and resistance mechanisms. For instance, outer membrane porin sequences associated with carbapenem resistance phenotypes can be added, and known intrinsic mechanisms can be included. Unique about this tool is the ability to easily detect putative new alleles and truncated versions of existing AR genes. Variants and potential new alleles are brought to the attention of the user for further investigation. For instance, SSTAR is able to identify modified or truncated versions of porins, which may be of great importance in carbapenemase-negative carbapenem-resistant Enterobacteriaceae. SSTAR is written in Java and is therefore platform independent and compatible with both Windows and Unix operating systems. SSTAR and its manual, which includes a simple installation guide, are freely available from IMPORTANCE Whole-genome sequencing (WGS) is quickly becoming a routine method for identifying genes associated with antimicrobial resistance (AR). However, for many microbiologists, the use and analysis of WGS data present a substantial challenge. We developed SSTAR, software with a graphical user interface that enables the identification of known AR genes from WGS and has the unique capacity to easily detect new variants of known AR genes, including truncated protein variants. Current software solutions do not notify the user when genes are truncated and, therefore, likely nonfunctional, which makes phenotype predictions less accurate. SSTAR

  10. Sulfonamide-resistant bacteria and their resistance genes in soils fertilized with manures from Jiangsu Province, Southeastern China.

    Directory of Open Access Journals (Sweden)

    Na Wang

    Full Text Available Antibiotic-resistant bacteria and genes are recognized as new environmental pollutants that warrant special concern. There were few reports on veterinary antibiotic-resistant bacteria and genes in China. This work systematically analyzed the prevalence and distribution of sulfonamide resistance genes in soils from the environments around poultry and livestock farms in Jiangsu Province, Southeastern China. The results showed that the animal manure application made the spread and abundance of antibiotic resistance genes (ARGs increasingly in the soil. The frequency of sulfonamide resistance genes was sul1 > sul2 > sul3 in pig-manured soil DNA and sul2 > sul1 > sul3 in chicken-manured soil DNA. Further analysis suggested that the frequency distribution of the sul genes in the genomic DNA and plasmids of the SR isolates from manured soil was sul2 > sul1 > sul3 overall (p<0.05. The combination of sul1 and sul2 was the most frequent, and the co-existence of sul1 and sul3 was not found either in the genomic DNA or plasmids. The sample type, animal type and sampling time can influence the prevalence and distribution pattern of sulfonamide resistance genes. The present study also indicated that Bacillus, Pseudomonas and Shigella were the most prevalent sul-positive genera in the soil, suggesting a potential human health risk. The above results could be important in the evaluation of antibiotic-resistant bacteria and genes from manure as sources of agricultural soil pollution; the results also demonstrate the necessity and urgency of the regulation and supervision of veterinary antibiotics in China.

  11. Are duplicated genes responsible for anthracnose resistance in common bean? (United States)

    Costa, Larissa Carvalho; Nalin, Rafael Storto; Ramalho, Magno Antonio Patto; de Souza, Elaine Aparecida


    The race 65 of Colletotrichum lindemuthianum, etiologic agent of anthracnose in common bean, is distributed worldwide, having great importance in breeding programs for anthracnose resistance. Several resistance alleles have been identified promoting resistance to this race. However, the variability that has been detected within race has made it difficult to obtain cultivars with durable resistance, because cultivars may have different reactions to each strain of race 65. Thus, this work aimed at studying the resistance inheritance of common bean lines to different strains of C. lindemuthianum, race 65. We used six C. lindemuthianum strains previously characterized as belonging to the race 65 through the international set of differential cultivars of anthracnose and nine commercial cultivars, adapted to the Brazilian growing conditions and with potential ability to discriminate the variability within this race. To obtain information on the resistance inheritance related to nine commercial cultivars to six strains of race 65, these cultivars were crossed two by two in all possible combinations, resulting in 36 hybrids. Segregation in the F2 generations revealed that the resistance to each strain is conditioned by two independent genes with the same function, suggesting that they are duplicated genes, where the dominant allele promotes resistance. These results indicate that the specificity between host resistance genes and pathogen avirulence genes is not limited to races, it also occurs within strains of the same race. Further research may be carried out in order to establish if the alleles identified in these cultivars are different from those described in the literature.

  12. Induced resistance and gene expression in wheat against leaf rust ...

    African Journals Online (AJOL)



    May 15, 2013 ... 2Department of Soil, Crop and Climate Sciences, University of the Free State, P.O Box ... Key words: Wheat leaf rust, induced resistance, priming, gene ..... transformation: susceptibility of transgenic Nicotiana sylvestris plants.

  13. Molecular Detection of Virulence Genes and Antibiotic Resistance ...

    African Journals Online (AJOL)

    Pathogen, E. coli O157:H7, virulence genes, antibiotic-resistance, beef meat. Correspondence: ... box to the laboratory for further processing. Isolation and identification of ... Technologies (IDT) Inc, U.S.A. The sequences and annealing ...

  14. Mapping of stripe rust resistance gene in an Aegilops caudata ...

    Indian Academy of Sciences (India)


    A pair of stripe rust and leaf rust resistance genes was introgressed from Aegilops caudata, a nonprogenitor diploid species with the CC genome, to cultivated .... infector rows and experimental material with the mixture of uredinospores of Pst ...

  15. Survival of Antibiotic Resistant Bacteria and Horizontal Gene Transfer Control Antibiotic Resistance Gene Content in Anaerobic Digesters. (United States)

    Miller, Jennifer H; Novak, John T; Knocke, William R; Pruden, Amy


    Understanding fate of antibiotic resistant bacteria (ARB) vs. their antibiotic resistance genes (ARGs) during wastewater sludge treatment is critical in order to reduce the spread of antibiotic resistance through process optimization. Here, we spiked high concentrations of tetracycline-resistant bacteria, isolated from mesophilic (Iso M1-1-a Pseudomonas sp.) and thermophilic (Iso T10-a Bacillus sp.) anaerobic digested sludge, into batch digesters and monitored their fate by plate counts and quantitative polymerase chain reaction (QPCR) of their corresponding tetracycline ARGs. In batch studies, spiked ARB plate counts returned to baseline (thermophilic) or 1-log above baseline (mesophilic) while levels of the ARG present in the spiked isolate [tet(G)] remained high in mesophilic batch reactors. To compare results under semi-continuous flow conditions with natural influent variation, tet(O), tet(W), and sul1 ARGs, along with the intI1 integrase gene, were monitored over a 9-month period in the raw feed sludge and effluent sludge of lab-scale thermophilic and mesophilic anaerobic digesters. sul1 and intI1 in mesophilic and thermophilic digesters correlated positively (Spearman rho = 0.457-0.829, P < 0.05) with the raw feed sludge. There was no correlation in tet(O) or tet(W) ratios in raw sludge and mesophilic digested sludge or thermophilic digested sludge (Spearman rho = 0.130-0.486, P = 0.075-0.612). However, in the thermophilic digester, the tet(O) and tet(W) ratios remained consistently low over the entire monitoring period. We conclude that the influent sludge microbial composition can influence the ARG content of a digester, apparently as a result of differential survival or death of ARBs or horizontal gene transfer of genes between raw sludge ARBs and the digester microbial community. Notably, mesophilic digestion was more susceptible to ARG intrusion than thermophilic digestion, which may be attributed to a higher rate of ARB survival and/or horizontal gene

  16. Resistance gene management: concepts and practice (United States)

    Christopher C. Mundt


    There is now a very long history of genetics/breeding for disease resistance in annual crops. These efforts have resulted in conceptual advances and frustrations, as well as practical successes and failures. This talk will review this history and its relevance to the genetics of resistance in forest species. All plant breeders and pathologists are familiar with boom-...

  17. Gene Expression Analysis of Four Radiation-resistant Bacteria


    Gao, Na; Ma, Bin-Guang; Zhang, Yu-Sheng; Song, Qin; Chen, Ling-Ling; Zhang, Hong-Yu


    To investigate the general radiation-resistant mechanisms of bacteria, bioinformatic method was employed to predict highly expressed genes for four radiation-resistant bacteria, i.e. Deinococcus geothermalis (D. geo), Deinococcus radiodurans (D. rad), Kineococcus radiotolerans (K. rad) and Rubrobacter xylanophilus (R. xyl). It is revealed that most of the three reference gene sets, i.e. ribosomal proteins, transcription factors and major chaperones, are generally highly expressed in the four ...

  18. Analysis of metal and biocides resistance genes in drug resistance and susceptible Salmonella enterica from food animals (United States)

    Background Generally drug resistant bacteria carry antibiotic resistance genes and heavy metal and biocide resistance genes on large conjugative plasmids. The presence of these metal and biocide resistance genes in susceptible bacteria are not assessed comprehensively. Hence, WGS data of susceptib...

  19. The antimicrobial resistance crisis: management through gene monitoring (United States)


    Antimicrobial resistance (AMR) is an acknowledged crisis for humanity. Its genetic origins and dire potential outcomes are increasingly well understood. However, diagnostic techniques for monitoring the crisis are currently largely limited to enumerating the increasing incidence of resistant pathogens. Being the end-stage of the evolutionary process that produces antimicrobial resistant pathogens, these measurements, while diagnostic, are not prognostic, and so are not optimal in managing this crisis. A better test is required. Here, using insights from an understanding of evolutionary processes ruling the changing abundance of genes under selective pressure, we suggest a predictive framework for the AMR crisis. We then discuss the likely progression of resistance for both existing and prospective antimicrobial therapies. Finally, we suggest that by the environmental monitoring of resistance gene frequency, resistance may be detected and tracked presumptively, and how this tool may be used to guide decision-making in the local and global use of antimicrobials. PMID:27831476

  20. The Number of Genes Controlling Resistance in Beans to Common ...

    African Journals Online (AJOL)

    Ten crosses were made between resistant (R), susceptible (S), RxS susceptible and Intermediate (I), SxI and RxR bean lines to common bacterial blight. The F1 were advanced to F2 and in each cross over 250 F2 plants were used to evaluate for the number of genes controlling resistance using Mendelian genetics and ...

  1. Prevalence, antibiotic-resistance properties and enterotoxin gene ...

    African Journals Online (AJOL)

    Prevalence, antibiotic-resistance properties and enterotoxin gene profile of Bacillus cereus strains isolated from milk-based baby foods. ... Conclusion: Considerable prevalence of resistant and toxigenic B. cereus and high consumption of milk-based infant foods in Iran, represent an important public health issue which ...

  2. Spread of tetracycline resistance genes at a conventional dairy farm

    NARCIS (Netherlands)

    Kyselková, Martina; Jirout, Jiří; Vrchotová, Naděžda; Schmitt, Heike; Elhottová, Dana


    The use of antibiotics in animal husbandry contributes to the worldwide problem of increasing antibiotic resistance in animal and human pathogens. Intensive animal production is considered an important source of antibiotic resistance genes released to the environment, while the contribution of

  3. Isolation and characterization of a candidate gene for resistance to ...

    African Journals Online (AJOL)

    ARC) domain, and a leucine-rich repeat (LRR) domain, all of which are typical characteristics of resistance genes. We proposed the resistance mechanism of CreV8 based on functional analysis and predictions from its conserved domains and ...

  4. Cloning and characterization of NBS-LRR resistance gene ...

    African Journals Online (AJOL)



    Jul 3, 2013 ... Rose using degernate primers designed from the conserved motifs of different plant resistance genes. A total of 40 sequences were hit with various R genes, of which 20 .... absorption ratio OD260 nm/OD280 nm between 1.80 and ..... status and outlook for small-holders agriculture in C S Gold and B.

  5. Induced mutations of rust resistance genes in wheat

    International Nuclear Information System (INIS)

    McIntosh, R.A.


    Induced mutations are being used as a tool to study genes for resistance in wheat. It was found that Pm1 can be separated from Lr20 and Sr15, but these two react like a single pleiotropic gene. Mutants were further examined in crosses and backmutations have been attempted. (author)

  6. Dihydropteroate synthase gene mutations in Pneumocystis and sulfa resistance

    DEFF Research Database (Denmark)

    Huang, Laurence; Crothers, Kristina; Atzori, Chiara


    in the dihydropteroate synthase (DHPS) gene. Similar mutations have been observed in P. jirovecii. Studies have consistently demonstrated a significant association between the use of sulfa drugs for PCP prophylaxis and DHPS gene mutations. Whether these mutations confer resistance to TMP-SMX or dapsone plus trimethoprim...

  7. Testing of disease-resistance of pokeweed antiviral protein gene ...

    African Journals Online (AJOL)

    Transformation of pokeweed antiviral protein gene (PAP) into plants was shown to improve plant resistance to several viruses or fungi pathogens with no much negative effect on plant growth. The non-virulent defective PAP inhibits only the virus but does not interfere with the host. A non-virulent defective PAP gene ...

  8. Resistance gene candidates identified by PCR with degenerate oligonucleotide primers map to clusters of resistance genes in lettuce. (United States)

    Shen, K A; Meyers, B C; Islam-Faridi, M N; Chin, D B; Stelly, D M; Michelmore, R W


    The recent cloning of genes for resistance against diverse pathogens from a variety of plants has revealed that many share conserved sequence motifs. This provides the possibility of isolating numerous additional resistance genes by polymerase chain reaction (PCR) with degenerate oligonucleotide primers. We amplified resistance gene candidates (RGCs) from lettuce with multiple combinations of primers with low degeneracy designed from motifs in the nucleotide binding sites (NBSs) of RPS2 of Arabidopsis thaliana and N of tobacco. Genomic DNA, cDNA, and bacterial artificial chromosome (BAC) clones were successfully used as templates. Four families of sequences were identified that had the same similarity to each other as to resistance genes from other species. The relationship of the amplified products to resistance genes was evaluated by several sequence and genetic criteria. The amplified products contained open reading frames with additional sequences characteristic of NBSs. Hybridization of RGCs to genomic DNA and to BAC clones revealed large numbers of related sequences. Genetic analysis demonstrated the existence of clustered multigene families for each of the four RGC sequences. This parallels classical genetic data on clustering of disease resistance genes. Two of the four families mapped to known clusters of resistance genes; these two families were therefore studied in greater detail. Additional evidence that these RGCs could be resistance genes was gained by the identification of leucine-rich repeat (LRR) regions in sequences adjoining the NBS similar to those in RPM1 and RPS2 of A. thaliana. Fluorescent in situ hybridization confirmed the clustered genomic distribution of these sequences. The use of PCR with degenerate oligonucleotide primers is therefore an efficient method to identify numerous RGCs in plants.

  9. Engineering resistance to plant viruses: Present status and future prospects (United States)

    Plant viruses cause severe crop losses across the globe. Resistant cultivars together with pesticide application are commonly used to avoid the losses caused by plant viruses. However, very limited success has been achieved at diminishing the impact of plant viruses. Use of virus resistant plant is ...

  10. Occurrence of antibiotic resistant bacteria in dogs presented with ...

    African Journals Online (AJOL)

    Otitis is one of the most common infections in dogs. This has been associated with misuse of antibiotics thereby promoting the emergence of multi-resistant micro-organisms. This study was conducted to determine the occurrence and the antibiotic resistance pattern of bacterial pathogens associated with otitis in dogs ...

  11. Identification of virus and nematode resistance genes in the Chilota Potato Genebank of the Universidad Austral de Chile

    Directory of Open Access Journals (Sweden)

    Marlon López


    Full Text Available Potato Genebank of the Universidad Austral de Chile (UACh is an important gene bank in Chile. The accessions collected all over the country possess high genetic diversity, present interesting agronomic and cooking traits, and show resistance to biotic and abiotic stress. A particularly interesting subgroup of the gene bank includes the accessions collected in the South of Chile, the Chilota Potato Genebank. The focus of this study is the identification of virus and nematode resistant genes in potatoes (Solatium tuberosum L., using the RYSC3 and YES3-3B molecular markers. The Potato virus Y(PVY resistance genes Ry adg and Ry sto were identified. Furthermore, the CP60 marker was used to assess the Rx resistance gene that confers resistance to Potato virus X (PVX. In addition, the HC and GRO1-4 markers were utilized to identify the GpaVvrn_QTL and Gro1-4, resistance genes of Globodera pallida and Globodera rostochiensis, respectively. Both G. pallida and G. rostochiensis are Potato Cyst Nematodes (PCN. The plant material used in this study included leaves from 271 accessions of the gene bank. These samples were collected in the field where natural pathogen pressure of potential viruses and diseases exists. ELISA assays were run for field detection of PVY and PVX. However, there have been no previous reports of nematode presence in the plant material. The results herein presented indicate presence of virus and nematode resistance genes in accessions of the Chilota Potato Genebank. In terms of virus resistance, 99 accessions out of the 271 tested possess the Ry adg resistance gene and 17 accessions of these 271 tested have the Ry sto resistance gene. Also, 10 accessions showed positive amplification of the Rxl resistant gene marker. As to nematode resistance, 99 accessions have possible resistance to G. pallida and 54 accessions show potential resistance to G. rostochiensis as detected using the available molecular markers.

  12. Characterization of antimicrobial resistance genes in Haemophilus parasuis isolated from pigs in China

    Directory of Open Access Journals (Sweden)

    Yongda Zhao


    Full Text Available Background Haemophilus parasuis is a common porcine respiratory pathogen that causes high rates of morbidity and mortality in farmed swine. We performed a molecular characterization of antimicrobial resistance genes harbored by H. parasuis from pig farms in China. Methods We screened 143 H. parasuis isolates for antimicrobial susceptibility against six fluoroquinolone antibiotics testing by the broth microdilution method, and the presence of 64 antimicrobial resistance genes by PCR amplification and DNA sequence analysis. We determined quinolone resistance determining region mutations of DNA gyrase (gyrA and gyrB and topoisomerase IV (parC and parE. The genetic relatedness among the strains was analyzed by pulsed-field gel electrophoresis. Results Susceptibility test showed that all isolates were low resistance to lomefloxacin (28.67%, levofloxacin (20.28%, norfloxacin (22.38%, ciprofloxacin (23.78%, however, high resistance levels were found to nalidixic acid (82.52% and enrofloxacin (55.94%. In addition, we found 14 antimicrobial resistance genes were present in these isolates, including blaTEM-1, blaROB-1, ermB, ermA, flor, catl, tetB, tetC, rmtB, rmtD, aadA1, aac(3′-llc, sul1, and sul2 genes. Interestingly, one isolate carried five antibiotic resistance genes (tetB, tetC, flor, rmtB, sul1. The genes tetB, rmtB, and flor were the most prevalent resistance genes in H. parasuis in China. Alterations in the gyrA gene (S83F/Y, D87Y/N/H/G were detected in 81% of the strains and parC mutations were often accompanied by a gyrA mutation. Pulsed-field gel electrophoresis typing revealed 51 unique patterns in the isolates carrying high-level antibiotic resistance genes, indicating considerable genetic diversity and suggesting that the genes were spread horizontally. Discussion The current study demonstrated that the high antibiotic resistance of H. parasuis in piglets is a combination of transferable antibiotic resistance genes and multiple target

  13. Characterization of antimicrobial resistance genes in Haemophilus parasuis isolated from pigs in China. (United States)

    Zhao, Yongda; Guo, Lili; Li, Jie; Huang, Xianhui; Fang, Binghu


    Haemophilus parasuis is a common porcine respiratory pathogen that causes high rates of morbidity and mortality in farmed swine. We performed a molecular characterization of antimicrobial resistance genes harbored by H. parasuis from pig farms in China. We screened 143 H. parasuis isolates for antimicrobial susceptibility against six fluoroquinolone antibiotics testing by the broth microdilution method, and the presence of 64 antimicrobial resistance genes by PCR amplification and DNA sequence analysis. We determined quinolone resistance determining region mutations of DNA gyrase ( gyrA and gyrB ) and topoisomerase IV ( parC and parE ). The genetic relatedness among the strains was analyzed by pulsed-field gel electrophoresis. Susceptibility test showed that all isolates were low resistance to lomefloxacin (28.67%), levofloxacin (20.28%), norfloxacin (22.38%), ciprofloxacin (23.78%), however, high resistance levels were found to nalidixic acid (82.52%) and enrofloxacin (55.94%). In addition, we found 14 antimicrobial resistance genes were present in these isolates, including bla TEM-1 , bla ROB-1 , ermB, ermA, flor, catl, tetB, tetC, rmtB, rmtD, aadA1, aac(3')-llc, sul1, and sul2 genes. Interestingly, one isolate carried five antibiotic resistance genes ( tetB, tetC, flor, rmtB, sul1 ). The genes tetB , rmtB, and flor were the most prevalent resistance genes in H. parasuis in China. Alterations in the gyrA gene (S83F/Y, D87Y/N/H/G) were detected in 81% of the strains and parC mutations were often accompanied by a gyrA mutation. Pulsed-field gel electrophoresis typing revealed 51 unique patterns in the isolates carrying high-level antibiotic resistance genes, indicating considerable genetic diversity and suggesting that the genes were spread horizontally. The current study demonstrated that the high antibiotic resistance of H. parasuis in piglets is a combination of transferable antibiotic resistance genes and multiple target gene mutations. These data provide novel

  14. Mutations inside rifampicin-resistance determining region of rpoB gene associated with rifampicin-resistance in Mycobacterium tuberculosis. (United States)

    Zaw, Myo T; Emran, Nor A; Lin, Zaw


    Rifampicin (RIF) plays a pivotal role in the treatment of tuberculosis due to its bactericidal effects. Because the action of RIF is on rpoB gene encoding RNA polymerase β subunit, 95% of RIF resistant mutations are present in rpoB gene. The majority of the mutations in rpoB gene are found within an 81bp RIF-resistance determining region (RRDR). Literatures on RIF resistant mutations published between 2010 and 2016 were thoroughly reviewed. The most commonly mutated codons in RRDR of rpoB gene are 531, 526 and 516. The possibilities of absence of mutation in RRDR of rpoB gene in MDR-TB isolates in few studies was due to existence of other rare rpoB mutations outside RRDR or different mechanism of rifampicin resistance. Molecular methods which can identify extensive mutations associated with multiple anti-tuberculous drugs are in urgent need so that the research on drug resistant mutations should be extended. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  15. Environmental cycle of antibiotic resistance encoded genes: A systematic review

    Directory of Open Access Journals (Sweden)

    R. ghanbari


    Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.


    African Journals Online (AJOL)



    Feb 5, 2014 ... By 72 hpi, the pathogen switched to necrotrophic growth to avoid contact with the increasing ... A better understanding of the gene network underlying ... 5.0 software under default parameters and were custom-ordered.

  17. The Lr34 adult plant rust resistance gene provides seedling resistance in durum wheat without senescence. (United States)

    Rinaldo, Amy; Gilbert, Brian; Boni, Rainer; Krattinger, Simon G; Singh, Davinder; Park, Robert F; Lagudah, Evans; Ayliffe, Michael


    The hexaploid wheat (Triticum aestivum) adult plant resistance gene, Lr34/Yr18/Sr57/Pm38/Ltn1, provides broad-spectrum resistance to wheat leaf rust (Lr34), stripe rust (Yr18), stem rust (Sr57) and powdery mildew (Pm38) pathogens, and has remained effective in wheat crops for many decades. The partial resistance provided by this gene is only apparent in adult plants and not effective in field-grown seedlings. Lr34 also causes leaf tip necrosis (Ltn1) in mature adult plant leaves when grown under field conditions. This D genome-encoded bread wheat gene was transferred to tetraploid durum wheat (T. turgidum) cultivar Stewart by transformation. Transgenic durum lines were produced with elevated gene expression levels when compared with the endogenous hexaploid gene. Unlike nontransgenic hexaploid and durum control lines, these transgenic plants showed robust seedling resistance to pathogens causing wheat leaf rust, stripe rust and powdery mildew disease. The effectiveness of seedling resistance against each pathogen correlated with the level of transgene expression. No evidence of accelerated leaf necrosis or up-regulation of senescence gene markers was apparent in these seedlings, suggesting senescence is not required for Lr34 resistance, although leaf tip necrosis occurred in mature plant flag leaves. Several abiotic stress-response genes were up-regulated in these seedlings in the absence of rust infection as previously observed in adult plant flag leaves of hexaploid wheat. Increasing day length significantly increased Lr34 seedling resistance. These data demonstrate that expression of a highly durable, broad-spectrum adult plant resistance gene can be modified to provide seedling resistance in durum wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  18. Gene Expression Profiling of Cecropin B-Resistant Haemophilus parasuis

    NARCIS (Netherlands)

    Wang, Chunmei; Chen, Fangzhou; Hu, Han; Li, Wentao; Wang, Yang; Chen, Pin; Liu, Yingyu; Ku, Xugang; He, Qigai; Chen, Huanchun; Xue, Feiqun


    Synthetically designed antimicrobial peptides (AMPs) present the potential of replacing antibiotics in the treatment of bacterial infections. However, microbial resistance to AMPs has been reported and little is known regarding the underlying mechanism of such resistance. The naturally occurring AMP

  19. Deep sequence analysis reveals the ovine rumen as a reservoir of antibiotic resistance genes. (United States)

    Hitch, Thomas C A; Thomas, Ben J; Friedersdorff, Jessica C A; Ougham, Helen; Creevey, Christopher J


    Antibiotic resistance is an increasingly important environmental pollutant with direct consequences for human health. Identification of environmental sources of antibiotic resistance genes (ARGs) makes it possible to follow their evolution and prevent their entry into the clinical setting. ARGs have been found in environmental sources exogenous to the original source and previous studies have shown that these genes are capable of being transferred from livestock to humans. Due to the nature of farming and the slaughter of ruminants for food, humans interact with these animals in close proximity, and for this reason it is important to consider the risks to human health. In this study, we characterised the ARG populations in the ovine rumen, termed the resistome. This was done using the Comprehensive Antibiotic Resistance Database (CARD) to identify the presence of genes conferring resistance to antibiotics within the rumen. Genes were successfully mapped to those that confer resistance to a total of 30 different antibiotics. Daptomycin was identified as the most common antibiotic for which resistance is present, suggesting that ruminants may be a source of daptomycin ARGs. Colistin resistance, conferred by the gene pmrE, was also found to be present within all samples, with an average abundance of 800 counts. Due to the high abundance of some ARGs (against daptomycin) and the presence of rare ARGs (against colistin), we suggest further study and monitoring of the rumen resistome as a possible source of clinically relevant ARGs. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  20. Identifying resistance gene analogs associated with resistances to different pathogens in common bean. (United States)

    López, Camilo E; Acosta, Iván F; Jara, Carlos; Pedraza, Fabio; Gaitán-Solís, Eliana; Gallego, Gerardo; Beebe, Steve; Tohme, Joe


    ABSTRACT A polymerase chain reaction approach using degenerate primers that targeted the conserved domains of cloned plant disease resistance genes (R genes) was used to isolate a set of 15 resistance gene analogs (RGAs) from common bean (Phaseolus vulgaris). Eight different classes of RGAs were obtained from nucleotide binding site (NBS)-based primers and seven from not previously described Toll/Interleukin-1 receptor-like (TIR)-based primers. Putative amino acid sequences of RGAs were significantly similar to R genes and contained additional conserved motifs. The NBS-type RGAs were classified in two subgroups according to the expected final residue in the kinase-2 motif. Eleven RGAs were mapped at 19 loci on eight linkage groups of the common bean genetic map constructed at Centro Internacional de Agricultura Tropical. Genetic linkage was shown for eight RGAs with partial resistance to anthracnose, angular leaf spot (ALS) and Bean golden yellow mosaic virus (BGYMV). RGA1 and RGA2 were associated with resistance loci to anthracnose and BGYMV and were part of two clusters of R genes previously described. A new major cluster was detected by RGA7 and explained up to 63.9% of resistance to ALS and has a putative contribution to anthracnose resistance. These results show the usefulness of RGAs as candidate genes to detect and eventually isolate numerous R genes in common bean.

  1. The relationship between codon usage bias and cold resistant genes

    International Nuclear Information System (INIS)

    Barozai, M.Y.; Din, M.


    This research is based on synonymous codon usage which has been well-known as a feature that affects typical expression level of protein in an organism. Different organisms prefer different codons for same amino acid and this is called Codon Usage Bias (CUB). The codon usage directly affects the level or even direction of changes in protein expression in responses to environmental stimuli. Cold stress is a major abiotic factor that limits the agricultural productivity of plants. In the recent study CUB has been studied in Arabidopsis thaliana cold resistant and housekeeping genes and their homologs in rice (Oryza sativa) to understand the cold stress and housekeeping genes relation with CUB. Six cold resistant and three housekeeping genes in Arabidopsis thaliana and their homologs in rice, were subjected to CUB analysis. The three cold resistant genes (DREB1B, RCI and MYB15) showed more than 50% (52%, 61% and 66% respectively) similar codon usage bias for Arabidopsis thaliana and rice. On the other hand three cold resistant genes (MPK3, ICE1 and ZAT12) showed less than 50% (38%, 38% and 47% respectively) similar codon usage bias for Arabidopsis thaliana and rice. The three housekeeping genes (Actin, Tubulin and Ubiquitin) showed 76% similar codon usage bias for Arabidopsis thaliana and rice. This study will help to manage the plant gene expression through codon optimization under the cold stress. (author)

  2. Characterization of resistance to tetracyclines and aminoglycosides of sheep mastitis pathogens: study of the effect of gene content on resistance. (United States)

    Lollai, S A; Ziccheddu, M; Duprè, I; Piras, D


    Mastitis causes economic losses and antimicrobials are frequently used for mastitis treatment. Antimicrobial resistance surveys are still rare in the ovine field and characterization of strains is important in order to acquire information about resistance and for optimization of therapy. Bacterial pathogens recovered in milk samples from mastitis-affected ewes were characterized for resistance to tetracyclines and aminoglycosides, members of which are frequently used antimicrobials in small ruminants. A total of 185 strains of staphylococci, streptococci, and enterococci, common mastitis pathogens, were tested for minimal inhibitory concentration (MIC) to tetracycline, doxycycline, minocycline, gentamicin, kanamycin, streptomycin, and for resistance genes by PCR. Effects of different tet genes arrangements on MICs were also investigated. Staphylococci expressed the lowest MIC for tetracycline and tet(K) was the most common gene recovered; tet(M) and tet(O) were also found. Gene content was shown to influence the tetracycline MIC values. Enterococci and streptococci showed higher MICs to tetracyclines and nonsusceptible strains always harboured at least one ribosomal protection gene (MIC above 8 μg ml(-1) ). Streptococci often harboured two or more tet determinants. As regards the resistance to aminoglycosides, staphylococci showed the lowest gentamicin and kanamycin median MIC along with streptomycin high level resistant (HLR) strains (MIC >1024 μg ml(-1) ) all harbouring str gene. The resistance determinant aac(6')-Ie-aph(2″)-Ia was present in few strains. Streptococci were basically nonsusceptible to aminoglycosides but neither HLR isolates nor resistance genes were detected. Enterococci revealed the highest MICs for gentamicin; two str harbouring isolates were shown to be HLR to streptomycin. Evidence was obtained for the circulation of antimicrobial-resistant strains and genes in sheep dairy farming. Tetracycline MIC of 64 μg ml(-1) and high

  3. Persistence of antimicrobial resistance genes from sows to finisher pigs

    DEFF Research Database (Denmark)

    Birkegård, Anna Camilla; Halasa, Tariq; Folkesson, Anders


    Antimicrobial resistance in pigs has been under scrutiny for many years. However, many questions remain unanswered, including whether the initial antimicrobial resistance level of a pig will influence the antimicrobial resistance found at slaughter. Faecal samples from finishers pigs from 681 farms...... and from sows from 82 farms were collected, and levels of seven antimicrobial resistance genes, ermB, ermF, sulI, sulII, tet(M), tet(O), and tet(W), were quantified by high-capacity qPCR. There were 40 pairs of observations where the finishers were born in the farms of the sows. The objective of this study...

  4. Molecular screening for erythromycin resistance genes in ...

    African Journals Online (AJOL)



    Jul 15, 2015 ... in Streptococcus pyogenes isolated from Iraqi patients with tonsilo-pharyngites. Hassan .... is an automated colorimetric method used for identification of bacteria and for .... counter medicines in private pharmacies against the regulations. ... Effect of telithromycin on erythromycin resistant S. pyogenes. In this ...

  5. Search Engine for Antimicrobial Resistance: A Cloud Compatible Pipeline and Web Interface for Rapidly Detecting Antimicrobial Resistance Genes Directly from Sequence Data. (United States)

    Rowe, Will; Baker, Kate S; Verner-Jeffreys, David; Baker-Austin, Craig; Ryan, Jim J; Maskell, Duncan; Pearce, Gareth


    Antimicrobial resistance remains a growing and significant concern in human and veterinary medicine. Current laboratory methods for the detection and surveillance of antimicrobial resistant bacteria are limited in their effectiveness and scope. With the rapidly developing field of whole genome sequencing beginning to be utilised in clinical practice, the ability to interrogate sequencing data quickly and easily for the presence of antimicrobial resistance genes will become increasingly important and useful for informing clinical decisions. Additionally, use of such tools will provide insight into the dynamics of antimicrobial resistance genes in metagenomic samples such as those used in environmental monitoring. Here we present the Search Engine for Antimicrobial Resistance (SEAR), a pipeline and web interface for detection of horizontally acquired antimicrobial resistance genes in raw sequencing data. The pipeline provides gene information, abundance estimation and the reconstructed sequence of antimicrobial resistance genes; it also provides web links to additional information on each gene. The pipeline utilises clustering and read mapping to annotate full-length genes relative to a user-defined database. It also uses local alignment of annotated genes to a range of online databases to provide additional information. We demonstrate SEAR's application in the detection and abundance estimation of antimicrobial resistance genes in two novel environmental metagenomes, 32 human faecal microbiome datasets and 126 clinical isolates of Shigella sonnei. We have developed a pipeline that contributes to the improved capacity for antimicrobial resistance detection afforded by next generation sequencing technologies, allowing for rapid detection of antimicrobial resistance genes directly from sequencing data. SEAR uses raw sequencing data via an intuitive interface so can be run rapidly without requiring advanced bioinformatic skills or resources. Finally, we show that SEAR

  6. Resistance genes in barley (Hordeum vulgare L.) and their identification with molecular markers. (United States)

    Chełkowski, Jerzy; Tyrka, Mirosław; Sobkiewicz, Andrzej


    Current information on barley resistance genes available from scientific papers and on-line databases is summarised. The recent literature contains information on 107 major resistance genes (R genes) against fungal pathogens (excluding powdery mildew), pathogenic viruses and aphids identified in Hordeum vulgare accessions. The highest number of resistance genes was identified against Puccinia hordei, Rhynchosporium secalis, and the viruses BaYMV and BaMMV, with 17, 14 and 13 genes respectively. There is still a lot of confusion regarding symbols for R genes against powdery mildew. Among the 23 loci described to date, two regions Mla and Mlo comprise approximately 31 and 25 alleles. Over 50 R genes have already been localised and over 30 mapped on 7 barley chromosomes. Four barley R genes have been cloned recently: Mlo, Rpg1, Mla1 and Mla6, and their structures (sequences) are available. The paper presents a catalogue of barley resistance gene symbols, their chromosomalocation and the list of available DNA markers useful in characterising cultivars and breeding accessions.

  7. Cloning of Bacteroides fragilis plasmid genes affecting metronidazole resistance and ultraviolet survival in Escherichia coli

    International Nuclear Information System (INIS)

    Wehnert, G.U.; Abratt, V.R.; Goodman, H.J.; Woods, D.R.


    Since reduced metronidazole causes DNA damage, resistance to metronidazole was used as a selection method for the cloning of Bacteroides fragilis genes affecting DNA repair mechanisms in Escherichia coli. Genes from B. fragilis Bf-2 were cloned on a recombinant plasmid pMT100 which made E. coli AB1157 and uvrA, B, and C mutant strains more resistant to metronidazole, but more sensitive to far uv irradiation under aerobic conditions. The loci affecting metronidazole resistance and uv sensitivity were linked and located on a 5-kb DNA fragment which originated from the small 6-kb cryptic plasmid pBFC1 present in B. fragilis Bf-2 cells


    Directory of Open Access Journals (Sweden)

    Bertinellys TEIXEIRA


    Full Text Available The enzymatic modification of aminoglycosides by aminoglycoside-acetyltransferases (AAC, aminoglycoside-adenyltransferases (AAD, and aminoglycoside-phosphotransferases (APH, is the most common resistance mechanism in P. aeruginosa and these enzymes can be coded on mobile genetic elements that contribute to their dispersion. One hundred and thirty seven P. aeruginosa isolates from the University Hospital, Cumana, Venezuela (HUAPA were evaluated. Antimicrobial susceptibility was determined by the disk diffusion method and theaac, aadB and aph genes were detected by PCR. Most of the P. aeruginosa isolates (33/137 were identified from the Intensive Care Unit (ICU, mainly from discharges (96/137. The frequency of resistant P. aeruginosaisolates was found to be higher for the aminoglycosides tobramycin and amikacin (30.7 and 29.9%, respectively. Phenotype VI, resistant to these antibiotics, was the most frequent (14/49, followed by phenotype I, resistant to all the aminoglycosides tested (12/49. The aac(6´-Ib,aphA1 and aadB genes were the most frequently detected, and the simultaneous presence of several resistance genes in the same isolate was demonstrated. Aminoglycoside resistance in isolates ofP. aeruginosa at the HUAPA is partly due to the presence of the aac(6´-Ib, aphA1 andaadB genes, but the high rates of antimicrobial resistance suggest the existence of several mechanisms acting together. This is the first report of aminoglycoside resistance genes in Venezuela and one of the few in Latin America.

  9. Molecular Scree ning of Blast Resistance Genes in Rice Germplasms Resistant to Magnaporthe oryzae

    Directory of Open Access Journals (Sweden)

    Liang Yan


    Full Text Available Molecular screening of major rice blast resistance genes was determined with molecular markers, which showed close-set linkage to 11 major rice blast resistance genes (Pi-d2, Pi-z, Piz-t, Pi-9, Pi-36, Pi-37, Pi5, Pi-b, Pik-p, Pik-h and Pi-ta2, in a collection of 32 accessions resistant to Magnaporthe oryzae. Out of the 32 accessions, the Pi-d2 and Pi-z appeared to be omnipresent and gave positive express. As the second dominant, Pi-b and Piz-t gene frequencies were 96.9% and 87.5%. And Pik-h and Pik-p gene frequencies were 43.8% and 28.1%, respectively. The molecular marker linkage to Pi-ta2 produced positive bands in eleven accessions, while the molecular marker linkage to Pi-36 and Pi-37 in only three and four accessions, respectively. The natural field evaluation analysis showed that 30 of the 32 accessions were resistant, one was moderately resistant and one was susceptible. Infection types were negatively correlated with the genotype scores of Pi-9, Pi5, Pi-b, Pi-ta2 and Pik-p, although the correlation coefficients were very little. These results are useful in identification and incorporation of functional resistance genes from these germplasms into elite cultivars through marker-assisted selection for improved blast resistance in China and worldwide.

  10. A novel gene of Kalanchoe daigremontiana confers plant drought resistance. (United States)

    Wang, Li; Zhu, Chen; Jin, Lin; Xiao, Aihua; Duan, Jie; Ma, Luyi


    Kalanchoe (K.) daigremontiana is important for studying asexual reproduction under different environmental conditions. Here, we describe a novel KdNOVEL41 (KdN41) gene that may confer drought resistance and could thereby affect K. daigremontiana development. The detected subcellular localization of a KdN41/Yellow Fluorescent Protein (YFP) fusion protein was in the nucleus and cell membrane. Drought, salt, and heat stress treatment in tobacco plants containing the KdN41 gene promoter driving β-glucuronidase (GUS) gene transcription revealed that only drought stress triggered strong GUS staining in the vascular tissues. Overexpression (OE) of the KdN41 gene conferred improved drought resistance in tobacco plants compared to wild-type and transformed with empty vector plants by inducing higher antioxidant enzyme activities, decreasing cell membrane damage, increasing abscisic acid (ABA) content, causing reinforced drought resistance related gene expression profiles. The 3,3'-diaminobenzidine (DAB) and nitroblue tetrazolium (NBT) staining results also showed less relative oxygen species (ROS) content in KdN41-overexpressing tobacco leaf during drought stress. Surprisingly, by re-watering after drought stress, KdN41-overexpressing tobacco showed earlier flowering. Overall, the KdN41 gene plays roles in ROS scavenging and osmotic damage reduction to improve tobacco drought resistance, which may increase our understanding of the molecular network involved in developmental manipulation under drought stress in K. daigremontiana.

  11. Antibiotic resistance and resistance genes in Escherichia coli from poultry farms, southwest Nigeria


    Adelowo, Olawale O.; Fagade, Obasola E.; Agersø, Yvonne


    Introduction: This study investigated the mechanisms of resistance in 36 E. coli isolated from waste, litter, soil and water samples collected from poultry farms in Southwestern Nigeria. Methodology: Minimum inhibitory concentration (MIC) distributions of the isolates were determined using the methods of the Clinical and Laboratory Standard Institute and resistance genes detected by PCR. Results: A total of 30 isolates (94%) showed resistance to more than one antimicrobial. Percentage resista...

  12. Occurrence and Distribution of Antibiotic-resistant Bacteria and Transfer of Resistance Genes in Lake Taihu (United States)

    Yin, Qian; Yue, Dongmei; Peng, Yuke; Liu, Ying; Xiao, Lin


    The overuse of antibiotics has accelerated antibiotic resistance in the natural environment, especially fresh water, generating a potential risk for public health around the world. In this study, antibiotic resistance in Lake Taihu was investigated and this was the first thorough data obtained through culture-dependent methods. High percentages of resistance to streptomycin and ampicillin among bacterial isolates were detected, followed by tetracycline and chloramphenicol. Especially high levels of ampicillin resistance in the western and northern regions were illustrated. Bacterial identification of the isolates selected for further study indicated the prevalence of some opportunistic pathogens and 62.0% of the 78 isolates exhibited multiple antibiotic resistance. The presence of ESBLs genes was in the following sequence: blaTEM > blaSHV > blaCTMX and 38.5% of the isolates had a class I integrase gene. Of all tested strains, 80.8% were able to transfer antibiotic resistance through conjugation. We also concluded that some new families of human-associated ESBLs and AmpC genes can be found in natural environmental isolates. The prevalence of antibiotic resistance and the dissemination of transferable antibiotic resistance in bacterial isolates (especially in opportunistic pathogens) was alarming and clearly indicated the urgency of realizing the health risks of antibiotic resistance to human and animal populations who are dependent on Lake Taihu for water consumption. PMID:24240317

  13. Antibiotic Resistance and Antibiotic Resistance Genes in Escherichia coli Isolates from Hospital Wastewater in Vietnam. (United States)

    Lien, La Thi Quynh; Lan, Pham Thi; Chuc, Nguyen Thi Kim; Hoa, Nguyen Quynh; Nhung, Pham Hong; Thoa, Nguyen Thi Minh; Diwan, Vishal; Tamhankar, Ashok J; Stålsby Lundborg, Cecilia


    The environmental spread of antibiotic-resistant bacteria has been recognised as a growing public health threat for which hospitals play a significant role. The aims of this study were to investigate the prevalence of antibiotic resistance and antibiotic resistance genes (ARGs) in Escherichia coli isolates from hospital wastewater in Vietnam. Wastewater samples before and after treatment were collected using continuous sampling every month over a year. Standard disk diffusion and E-test were used for antibiotic susceptibility testing. Extended-spectrum beta-lactamase (ESBL) production was tested using combined disk diffusion. ARGs were detected by polymerase chain reactions. Resistance to at least one antibiotic was detected in 83% of isolates; multidrug resistance was found in 32%. The highest resistance prevalence was found for co-trimoxazole (70%) and the lowest for imipenem (1%). Forty-three percent of isolates were ESBL-producing, with the bla TEM gene being more common than bla CTX-M . Co-harbouring of the bla CTX-M , bla TEM and qepA genes was found in 46% of isolates resistant to ciprofloxacin. The large presence of antibiotic-resistant E. coli isolates combined with ARGs in hospital wastewater, even post-treatment, poses a threat to public health. It highlights the need to develop effective processes for hospital wastewater treatment plants to eliminate antibiotic resistant bacteria and ARGs.

  14. Sofa dermatitis presenting as a chronic treatment resistant dermatitis.

    LENUS (Irish Health Repository)

    Lynch, M


    There is now a well publicised increase in cases of sofa dermatitis since 2007. These have been linked to allergic contact sensitization to dimethlylfumarate, a novel contact allergen. We report on a case associated with a two year history of a treatment resistant dermatitis.

  15. Comparative genome analysis and resistance gene mapping in grain legumes

    International Nuclear Information System (INIS)

    Young, N.D.


    Using, DNA markers and genome organization, several important disease resistance genes have been analyzed in mungbean (Vigna radiata), cowpea (Vigna unguiculata), common bean (Phaseolus vulgaris), and soybean (Glycine max). In the process, medium-density linkage maps consisting of restriction fragment length polymorphism (RFLP) markers were constructed for both mungbean and cowpea. Comparisons between these maps, as well as the maps of soybean and common bean, indicate that there is significant conservation of DNA marker order, though the conserved blocks in soybean are much shorter than in the others. DNA mapping results also indicate that a gene for seed weight may be conserved between mungbean and cowpea. Using the linkage maps, genes that control bruchid (genus Callosobruchus) and powdery mildew (Erysiphe polygoni) resistance in mungbean, aphid resistance in cowpea (Aphis craccivora), and cyst nematode (Heterodera glycines) resistance in soybean have all been mapped and characterized. For some of these traits resistance was found to be oligogenic and DNA mapping uncovered multiple genes involved in the phenotype. (author)

  16. Host-Induced Silencing of Pathogenicity Genes Enhances Resistance to Fusarium oxysporum Wilt in Tomato. (United States)

    Bharti, Poonam; Jyoti, Poonam; Kapoor, Priya; Sharma, Vandana; Shanmugam, V; Yadav, Sudesh Kumar


    This study presents a novel approach of controlling vascular wilt in tomato by RNAi expression directed to pathogenicity genes of Fusarium oxysporum f. sp. lycopersici. Vascular wilt of tomato caused by Fusarium oxysporum f. sp. lycopersici leads to qualitative and quantitative loss of the crop. Limitation in the existing control measures necessitates the development of alternative strategies to increase resistance in the plants against pathogens. Recent findings paved way to RNAi, as a promising method for silencing of pathogenicity genes in fungus and provided effective resistance against fungal pathogens. Here, two important pathogenicity genes FOW2, a Zn(II)2Cys6 family putative transcription regulator, and chsV, a putative myosin motor and a chitin synthase domain, were used for host-induced gene silencing through hairpinRNA cassettes of these genes against Fusarium oxysporum f. sp. lycopersici. HairpinRNAs were assembled in appropriate binary vectors and transformed into tomato plant targeting FOW2 and chsV genes, for two highly pathogenic strains of Fusarium oxysporum viz. TOFOL-IHBT and TOFOL-IVRI. Transgenic tomatoes were analyzed for possible attainment of resistance in transgenic lines against fungal infection. Eight transgenic lines expressing hairpinRNA cassettes showed trivial disease symptoms after 6-8 weeks of infection. Hence, the host-induced posttranscriptional gene silencing of pathogenicity genes in transgenic tomato plants has enhanced their resistance to vascular wilt disease caused by Fusarium oxysporum.

  17. Antibiotic resistance and resistance genes in Escherichia coli from poultry farms, southwest Nigeria. (United States)

    Adelowo, Olawale O; Fagade, Obasola E; Agersø, Yvonne


    This study investigated the mechanisms of resistance in 36 E. coli isolated from waste, litter, soil and water samples collected from poultry farms in Southwestern Nigeria. Minimum inhibitory concentration (MIC) distributions of the isolates were determined using the methods of the Clinical and Laboratory Standard Institute and resistance genes detected by PCR. A total of 30 isolates (94%) showed resistance to more than one antimicrobial. Percentage resistance was: tetracycline 81%, sulphamethoxazole 67%, streptomycin 56%, trimethoprim 47 %, ciprofloxacin 42%, ampicillin 36%, spectinomycin 28%, nalidixic acid 25%, chloramphenicol 22%, neomycin 14%, gentamicin 8%, amoxicillin-clavulanate, ceftiofur, cefotaxime, colistin, florfenicol and apramycin 0%. Resistance genes found among the isolates include bla-TEM (85%), sul2 (67%), sul3 (17%), aadA (65%), strA (70%), strB (61%), catA1 (25%), cmlA1 (13%), tetA (21%) and tetB (17%). Class 1 and 2 integrons were found in five (14%) and six (17%) isolates, respectively, while one isolate was positive for both classes of integrons. Seven out of eight isolates with resistance to ciprofloxacin and MIC ≤ 32 mg/L to nalidixic acid contained qnrS genes. Our findings provided additional evidence that the poultry production environment in Nigeria represents an important reservoir of antibiotic resistance genes such as qnrS that may spread from livestock production farms to human populations via manure and water.

  18. High chlorpyrifos resistance in Culex pipiens mosquitoes: strong synergy between resistance genes (United States)

    Alout, H; Labbé, P; Berthomieu, A; Makoundou, P; Fort, P; Pasteur, N; Weill, M


    We investigated the genetic determinism of high chlorpyrifos resistance (HCR), a phenotype first described in 1999 in Culex pipiens mosquitoes surviving chlorpyrifos doses ⩾1 mg l−1 and more recently found in field samples from Tunisia, Israel or Indian Ocean islands. Through chlorpyrifos selection, we selected several HCR strains that displayed over 10 000-fold resistance. All strains were homozygous for resistant alleles at two main loci: the ace-1 gene, with the resistant ace-1R allele expressing the insensitive G119S acetylcholinesterase, and a resistant allele of an unknown gene (named T) linked to the sex and ace-2 genes. We constructed a strain carrying only the T-resistant allele and studied its resistance characteristics. By crossing this strain with strains harboring different alleles at the ace-1 locus, we showed that the resistant ace-1R and the T alleles act in strong synergy, as they elicited a resistance 100 times higher than expected from a simple multiplicative effect. This effect was specific to chlorpyrifos and parathion and was not affected by synergists. We also examined how HCR was expressed in strains carrying other ace-1-resistant alleles, such as ace-1V or the duplicated ace-1D allele, currently spreading worldwide. We identified two major parameters that influenced the level of resistance: the number and the nature of the ace-1-resistant alleles and the number of T alleles. Our data fit a model that predicts that the T allele acts by decreasing chlorpyrifos concentration in the compartment targeted in insects. PMID:26463842

  19. Spread of tetracycline resistance genes at a conventional dairy farm

    Directory of Open Access Journals (Sweden)

    Martina eKyselkova


    Full Text Available The use of antibiotics in animal husbandry contributes to the worldwide problem of increasing antibiotic resistance in animal and human pathogens. Intensive animal production is considered an important source of antibiotic resistance genes released to the environment, while the contribution of smaller farms remains to be evaluated. Here we monitor the spread of tetracycline resistance (TC-r genes at a middle-size conventional dairy farm, where chlortetracycline (CTC, as intrauterine suppository is prophylactically used after each calving. Our study has shown that animals at the farm acquired the TC-r genes in their early age (1-2 weeks, likely due to colonization with TC-resistant bacteria from their mothers and/or the farm environment. The relative abundance of the TC-r genes tet(W, tet(Q and tet(M in fresh excrements of calves was about 1-2 orders of magnitude higher compared to heifers and dairy cows, possibly due to the presence of antibiotic residues in milk fed to calves. The occurrence and abundance of TC-r genes in fresh excrements of heifers and adult cows remained unaffected by intrauterine CTC applications, with tet(O, tet(Q and tet(W representing a ‘core TC-resistome’ of the farm, and tet(A, tet(M, tet(Y and tet(X occurring occasionally. The genes tet(A, tet(M, tet(Y and tet(X were shown to be respectively harbored by Shigella, Lactobacillus and Clostridium, Acinetobacter, and Wautersiella. Soil in the farm proximity, as well as field soil to which manure from the farm was applied, was contaminated with TC-r genes occurring in the farm, and some of the TC-r genes persisted in the field over 3 months following the manure application. Concluding, our study shows that antibiotic resistance genes may be a stable part of the intestinal metagenome of cattle even if antibiotics are not used for growth stimulation, and that smaller dairy farms may also contribute to environmental pollution with antibiotic resistance genes.

  20. Recessive Resistance to Plant Viruses: Potential Resistance Genes Beyond Translation Initiation Factors

    Directory of Open Access Journals (Sweden)

    Masayoshi Hashimoto


    Full Text Available The ability of plant viruses to propagate their genomes in host cells depends on many host factors. In the absence of an agrochemical that specifically targets plant viral infection cycles, one of the most effective methods for controlling viral diseases in plants is taking advantage of the host plant’s resistance machinery. Recessive resistance is conferred by a recessive gene mutation that encodes a host factor critical for viral infection. It is a branch of the resistance machinery and, as an inherited characteristic, is very durable. Moreover, recessive resistance may be acquired by a deficiency in a negative regulator of plant defense responses, possibly due to the autoactivation of defense signaling. Eukaryotic translation initiation factor (eIF 4E and eIF4G and their isoforms are the most widely exploited recessive resistance genes in several crop species, and they are effective against a subset of viral species. However, the establishment of efficient, recessive resistance-type antiviral control strategies against a wider range of plant viral diseases requires genetic resources other than eIF4Es. In this review, we focus on recent advances related to antiviral recessive resistance genes evaluated in model plants and several crop species. We also address the roles of next-generation sequencing and genome editing technologies in improving plant genetic resources for recessive resistance-based antiviral breeding in various crop species.

  1. Bacterial metal resistance genes and metal bioavailability in contaminated sediments

    International Nuclear Information System (INIS)

    Roosa, Stéphanie; Wattiez, Ruddy; Prygiel, Emilie; Lesven, Ludovic; Billon, Gabriel; Gillan, David C.


    In bacteria a metal may be defined as bioavailable if it crosses the cytoplasmic membrane to reach the cytoplasm. Once inside the cell, specific metal resistance systems may be triggered. In this research, specific metal resistance genes were used to estimate metal bioavailability in sediment microbial communities. Gene levels were measured by quantitative PCR and correlated to metals in sediments using five different protocols to estimate dissolved, particle-adsorbed and occluded metals. The best correlations were obtained with czcA (a Cd/Zn/Co efflux pump) and Cd/Zn adsorbed or occluded in particles. Only adsorbed Co was correlated to czcA levels. We concluded that the measurement of czcA gene levels by quantitative PCR is a promising tool which may complement the classical approaches used to estimate Cd/Zn/Co bioavailability in sediment compartments. - Highlights: • Metal resistance genes were used to estimate metal bioavailability in sediments. • Gene levels were correlated to metals using 5 different metal extraction protocols. • CzcA gene levels determined by quantitative PCR is a promising tool for Cd/Zn/Co. - Capsule Bacterial czcA is a potential biomarker of Cd, Zn and Co bioavailability in aquatic sediments as shown by quantitative PCR and sequential metal extraction

  2. Sponge Microbiota are a Reservoir of Functional Antibiotic Resistance Genes

    DEFF Research Database (Denmark)

    Versluis, Dennis; de Evgrafov, Mari Cristina Rodriguez; Sommer, Morten Otto Alexander


    examined sponges as a reservoir of antibiotic resistance. Sponges could be important in this respect because they often contain diverse microbial communities that have the capacity to produce bioactive metabolites. Here, we applied functional metagenomics to study the presence and diversity of functional...... resistance genes in the sponges Aplysina aerophoba, Petrosia ficiformis, and Corticium candelabrum. We obtained 37 insert sequences facilitating resistance to D-cycloserine (n = 6), gentamicin (n = 1), amikacin (n = 7), trimethoprim (n = 17), chloramphenicol (n = 1), rifampicin (n = 2) and ampicillin (n = 3......-resistance-conferring β-lactamase was identified in the genus Pseudovibrio with 41% global amino acid identity to the closest β-lactamase with demonstrated functionality, and subsequently classified into a new family termed PSV. Taken together, our results show that sponge microbiota host diverse and novel resistance...

  3. Tagging of resistance gene(s) to rhizomania disease in sugar beet ...

    African Journals Online (AJOL)



    Feb 19, 2008 ... plasmodiophoride-like fungus, Polymyxa betae Keskin. (1964) (Tamada and Richard, 1992). Source of resistance to rhizomania were found in Holly sugar beet company source (Lewellen, 1987). Resistance in Holly is simply inherited by a single dominant gene(Rz1). (Lewellen et al., 1987; Scholten et al., ...

  4. Tagging of resistance gene(s) to rhizomania disease in sugar beet ...

    African Journals Online (AJOL)

    The rhizomania disease is one of the most important diseases in Iran and some other parts of the world which potentially could play a role in decreasing sugar yield in fields. One approach to combat with this disease is the use of resistance varieties. This varieties have been identified which are having resistance genes to ...

  5. Major Gene for Field Stem Rust Resistance Co-Locates with Resistance Gene Sr12 in 'Thatcher' Wheat. (United States)

    Hiebert, Colin W; Kolmer, James A; McCartney, Curt A; Briggs, Jordan; Fetch, Tom; Bariana, Harbans; Choulet, Frederic; Rouse, Matthew N; Spielmeyer, Wolfgang


    Stem rust, caused by Puccinia graminis (Pgt), is a damaging disease of wheat that can be controlled by utilizing effective stem rust resistance genes. 'Thatcher' wheat carries complex resistance to stem rust that is enhanced in the presence of the resistance gene Lr34. The purpose of this study was to examine APR in 'Thatcher' and look for genetic interactions with Lr34. A RIL population was tested for stem rust resistance in field nurseries in Canada, USA, and Kenya. BSA was used to find SNP markers associated with reduced stem rust severity. A major QTL was identified on chromosome 3BL near the centromere in all environments. Seedling testing showed that Sr12 mapped to the same region as the QTL for APR. The SNP markers were physically mapped and the region carrying the resistance was searched for sequences with homology to members of the NB-LRR resistance gene family. SNP marker from one NB-LRR-like sequence, NB-LRR3 co-segregated with Sr12. Two additional populations, including one that lacked Lr34, were tested in field nurseries. NB-LRR3 mapped near the maximum LOD for reduction in stem rust severity in both populations. Lines from a population that segregated for Sr12 and Lr34 were tested for seedling Pgt biomass and infection type, as well as APR to field stem rust which showed an interaction between the genes. We concluded that Sr12, or a gene closely linked to Sr12, was responsible for 'Thatcher'-derived APR in several environments and this resistance was enhanced in the presence of Lr34.

  6. Major Gene for Field Stem Rust Resistance Co-Locates with Resistance Gene Sr12 in ‘Thatcher’ Wheat (United States)

    Hiebert, Colin W.; Kolmer, James A.; McCartney, Curt A.; Briggs, Jordan; Fetch, Tom; Bariana, Harbans; Choulet, Frederic; Rouse, Matthew N.; Spielmeyer, Wolfgang


    Stem rust, caused by Puccinia graminis (Pgt), is a damaging disease of wheat that can be controlled by utilizing effective stem rust resistance genes. ‘Thatcher’ wheat carries complex resistance to stem rust that is enhanced in the presence of the resistance gene Lr34. The purpose of this study was to examine APR in ‘Thatcher’ and look for genetic interactions with Lr34. A RIL population was tested for stem rust resistance in field nurseries in Canada, USA, and Kenya. BSA was used to find SNP markers associated with reduced stem rust severity. A major QTL was identified on chromosome 3BL near the centromere in all environments. Seedling testing showed that Sr12 mapped to the same region as the QTL for APR. The SNP markers were physically mapped and the region carrying the resistance was searched for sequences with homology to members of the NB-LRR resistance gene family. SNP marker from one NB-LRR-like sequence, NB-LRR3 co-segregated with Sr12. Two additional populations, including one that lacked Lr34, were tested in field nurseries. NB-LRR3 mapped near the maximum LOD for reduction in stem rust severity in both populations. Lines from a population that segregated for Sr12 and Lr34 were tested for seedling Pgt biomass and infection type, as well as APR to field stem rust which showed an interaction between the genes. We concluded that Sr12, or a gene closely linked to Sr12, was responsible for ‘Thatcher’-derived APR in several environments and this resistance was enhanced in the presence of Lr34. PMID:27309724

  7. Antibiotic and antiseptic resistance genes are linked on a novel mobile genetic element: Tn6087 (United States)

    Ciric, Lena; Mullany, Peter; Roberts, Adam P.


    Objectives Tn916-like elements are one of the most common types of integrative and conjugative element (ICE). In this study we aimed to determine whether novel accessory genes, i.e. genes whose products are not involved in mobility or regulation, were present on a Tn916-like element (Tn6087) isolated from Streptococcus oralis from the human oral cavity. Methods A minocycline-resistant isolate was analysed using restriction fragment length polymorphism (RFLP) analysis on amplicons derived from Tn916 and DNA sequencing to determine whether there were genetic differences in Tn6087 compared with Tn916. Mutational analysis was used to determine whether the novel accessory gene found was responsible for an observed extra phenotype. Results A novel Tn916-like element, Tn6087, is described that encodes both antibiotic and antiseptic resistance. The antiseptic resistance protein is encoded by a novel small multidrug resistance gene, designated qrg, that was shown to encode resistance to cetyltrimethylammonium bromide (CTAB), also known as cetrimide bromide. Conclusions This is the first Tn916-like element described that confers both antibiotic and antiseptic resistance, suggesting that selection of either antibiotic or antiseptic resistance will also select for the other and further highlights the need for prudent use of both types of compound. PMID:21816764

  8. Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.


    Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...

  9. Resistance-related gene transcription and antioxidant enzyme ...

    African Journals Online (AJOL)

    The two tobacco relatives of Nicotiana alata and Nicotiana longiflora display a high level of resistance against Colletotrichum nicotianae and the two genes NTF6 and NtPAL related to pathogen defense transcription were higher in N. alata and N. longiflora than the commercial cv. K326. Inoculation with C. nicotianae ...

  10. Antibiotic resistance and ndvB gene expression among biofilm ...

    African Journals Online (AJOL)

    A novel antibiotic resistant mechanism among biofilms is glucan-mediated sequestration in which ndvB gene encodes a glucosyltransferase involved in the formation of this glucans. We studied the biofilm formation and antibiotic susceptibility pattern of P. aeruginosa isolated from clinical samples, and measured the ...

  11. Gene pyramiding as a Bt resistance management strategy: How ...

    African Journals Online (AJOL)

    Reports on the emergence of insect resistance to Bacillus thuringiensis delta endotoxins have raised doubts on the sustainability of Bt-toxin based pest management technologies. Corporate industry has responded to this challenge with innovations that include gene pyramiding among others. Pyramiding entails stacking ...

  12. Prevalence, antibiotic-resistance properties and enterotoxin gene ...

    African Journals Online (AJOL)

    milk-based infant foods in Iran, represent an important public health issue which should be considered ... Keywords: Prevalence, Bacillus cereus, Antibiotic resistance, Enterotoxigenic genes, Milk-based infant food. Tropical Journal of Pharmaceutical Research is indexed by Science ..... and cereals collected in Korea.

  13. Spatial patterns of Antimicrobial Resistance Genes in Danish Pig Farms

    DEFF Research Database (Denmark)

    Birkegård, Anna Camilla; Ersbøll, A. K.; Hisham Beshara Halasa, Tariq


    antimicrobial resistance genes, ermB, ermF, sulI, sulII, tet(M), tet(O) and tet(W), was quantified by a high-throughput qPCR. It was evaluated whether the sample method resulted in a study population representative of Danish pig farms with finishers where it was found that the study population was biased...

  14. Molecular Detection of Virulence Genes and Antibiotic Resistance ...

    African Journals Online (AJOL)

    Escherichia coli O157:H7 is an important food-borne pathogen that can cause diarrhea, haemorrhagic colitis and haemolytic uremic syndrome. This study was conducted to investigate the prevalence, virulence genes and antibiotic resistance patterns of E. coli O157:H7 in raw beef meat sold in Abeokuta, South west Nigeria ...

  15. Loci and candidate genes conferring resistance to soybean cyst nematode HG type 2.5.7. (United States)

    Zhao, Xue; Teng, Weili; Li, Yinghui; Liu, Dongyuan; Cao, Guanglu; Li, Dongmei; Qiu, Lijuan; Zheng, Hongkun; Han, Yingpeng; Li, Wenbin


    Soybean (Glycine max L. Merr.) cyst nematode (SCN, Heterodera glycines I,) is a major pest of soybean worldwide. The most effective strategy to control this pest involves the use of resistant cultivars. The aim of the present study was to investigate the genome-wide genetic architecture of resistance to SCN HG Type 2.5.7 (race 1) in landrace and elite cultivated soybeans. A total of 200 diverse soybean accessions were screened for resistance to SCN HG Type 2.5.7 and genotyped through sequencing using the Specific Locus Amplified Fragment Sequencing (SLAF-seq) approach with a 6.14-fold average sequencing depth. A total of 33,194 SNPs were identified with minor allele frequencies (MAF) over 4%, covering 97% of all the genotypes. Genome-wide association mapping (GWAS) revealed thirteen SNPs associated with resistance to SCN HG Type 2.5.7. These SNPs were distributed on five chromosomes (Chr), including Chr7, 8, 14, 15 and 18. Four SNPs were novel resistance loci and nine SNPs were located near known QTL. A total of 30 genes were identified as candidate genes underlying SCN resistance. A total of sixteen novel soybean accessions were identified with significant resistance to HG Type 2.5.7. The beneficial alleles and candidate genes identified by GWAS might be valuable for improving marker-assisted breeding efficiency and exploring the molecular mechanisms underlying SCN resistance.

  16. Putative resistance genes in the CitEST database

    Directory of Open Access Journals (Sweden)

    Simone Guidetti-Gonzalez


    Full Text Available Disease resistance in plants is usually associated with the activation of a wide variety of defense responses to prevent pathogen replication and/or movement. The ability of the host plant to recognize the pathogen and to activate defense responses is regulated by direct or indirect interaction between the products of plant resistance (R and pathogen avirulence (Avr genes. Attempted infection of plants by avirulent pathogens elicits a battery of defenses often followed by the collapse of the challenged host cells. Localized host cell death may help to prevent the pathogen from spreading to uninfected tissues, known as hypersensitive response (HR. When either the plant or the pathogen lacks its cognate gene, activation of the plant’s defense responses fails to occur or is delayed and does not prevent pathogen colonization. In the CitEST database, we identified 1,300 reads related to R genes in Citrus which have been reported in other plant species. These reads were translated in silico, and alignments of their amino acid sequences revealed the presence of characteristic domains and motifs that are specific to R gene classes. The description of the reads identified suggests that they function as resistance genes in citrus.

  17. Antibiotic Resistance Genes and Correlations with Microbial Community and Metal Resistance Genes in Full-Scale Biogas Reactors As Revealed by Metagenomic Analysis

    DEFF Research Database (Denmark)

    Luo, Gang; Li, Bing; Li, Li-Guan


    resistance genes (MRGs). The total abundance of ARGs in all the samples varied from 7 × 10-3 to 1.08 × 10-1 copy of ARG/copy of 16S-rRNA gene, and the samples obtained from thermophilic biogas reactors had a lower total abundance of ARGs, indicating the superiority of thermophilic anaerobic digestion......Digested residues from biogas plants are often used as biofertilizers for agricultural crops cultivation. The antibiotic resistance genes (ARGs) in digested residues pose a high risk to public health due to their potential spread to the disease-causing microorganisms and thus reduce...... the susceptibility of disease-causing microorganisms to antibiotics in medical treatment. A high-throughput sequencing (HTS)-based metagenomic approach was used in the present study to investigate the variations of ARGs in full-scale biogas reactors and the correlations of ARGs with microbial communities and metal...

  18. Identification of antimicrobial resistance genes in multidrug-resistant clinical Bacteroides fragilis isolates by whole genome shotgun sequencing

    DEFF Research Database (Denmark)

    Sydenham, Thomas Vognbjerg; Sóki, József; Hasman, Henrik


    Bacteroides fragilis constitutes the most frequent anaerobic bacterium causing bacteremia in humans. The genetic background for antimicrobial resistance in B. fragilis is diverse with some genes requiring insertion sequence (IS) elements inserted upstream for increased expression. To evaluate whole...... genome shotgun sequencing as a method for predicting antimicrobial resistance properties, one meropenem resistant and five multidrug-resistant blood culture isolates were sequenced and antimicrobial resistance genes and IS elements identified using ResFinder 2.1 (http...

  19. Reversing Bacterial Resistance to Antibiotics by Phage-Mediated Delivery of Dominant Sensitive Genes


    Edgar, Rotem; Friedman, Nir; Molshanski-Mor, Shahar; Qimron, Udi


    Pathogen resistance to antibiotics is a rapidly growing problem, leading to an urgent need for novel antimicrobial agents. Unfortunately, development of new antibiotics faces numerous obstacles, and a method that resensitizes pathogens to approved antibiotics therefore holds key advantages. We present a proof of principle for a system that restores antibiotic efficiency by reversing pathogen resistance. This system uses temperate phages to introduce, by lysogenization, the genes rpsL and gyrA...

  20. Relationship between Psidium species (Myrtaceae) by resistance gene analog markers: focus on nematode resistance. (United States)

    Noia, L R; Tuler, A C; Ferreira, A; Ferreira, M F S


    Guava (Psidium guajava L.) crop is severely affected by the nematode Meloidogyne enterolobii. Native Psidium species have been reported as sources of resistance against this nematode. Knowledge on the molecular relationship between Psidium species based on plant resistance gene analogs (RGA) can be useful in the genetic breeding of guava for resistance to M. enterolobii. In this study, RGA markers from conserved domains, and structural features of plant R genes, were employed to characterize Psidium species and establish genetic proximity, with a focus on nematode resistance. SSR markers were also applied owing to their neutral nature, thus differing from RGA markers. For this, species reported as sources of resistance to M. enterolobii, such as P. cattleianum and P. friedrichsthalianum, as well as species occurring in the Atlantic Rainforest and susceptible genotypes, were investigated. In 10 evaluated Psidium species, high interspecific genetic variability was verified through RGA and SSR markers, with intraspecific variation in P. guajava higher with SSR, as was expected. Resistant species were clustered by RGA markers, and differential amplicons among genotypes resistant and susceptible to M. enterolobii were identified. Knowledge on the molecular relationships between Psidium species constitutes useful information for breeding of the guava tree, providing direction for hybridization and material for rootstocks. Additionally, the genetic relationship between native species, which have been little studied, and P. guajava were estimated by RGAs, which were confirmed as important markers for genetic diversity related to pathogen resistance.

  1. Transcriptomic Analysis and the Expression of Disease-Resistant Genes in Oryza meyeriana under Native Condition.

    Directory of Open Access Journals (Sweden)

    Bin He

    Full Text Available Oryza meyeriana (O. meyeriana, with a GG genome type (2n = 24, accumulated plentiful excellent characteristics with respect to resistance to many diseases such as rice shade and blast, even immunity to bacterial blight. It is very important to know if the diseases-resistant genes exist and express in this wild rice under native conditions. However, limited genomic or transcriptomic data of O. meyeriana are currently available. In this study, we present the first comprehensive characterization of the O. meyeriana transcriptome using RNA-seq and obtained 185,323 contigs with an average length of 1,692 bp and an N50 of 2,391 bp. Through differential expression analysis, it was found that there were most tissue-specifically expressed genes in roots, and next to stems and leaves. By similarity search against protein databases, 146,450 had at least a significant alignment to existed gene models. Comparison with the Oryza sativa (japonica-type Nipponbare and indica-type 93-11 genomes revealed that 13% of the O. meyeriana contigs had not been detected in O. sativa. Many diseases-resistant genes, such as bacterial blight resistant, blast resistant, rust resistant, fusarium resistant, cyst nematode resistant and downy mildew gene, were mined from the transcriptomic database. There are two kinds of rice bacterial blight-resistant genes (Xa1 and Xa26 differentially or specifically expressed in O. meyeriana. The 4 Xa1 contigs were all only expressed in root, while three of Xa26 contigs have the highest expression level in leaves, two of Xa26 contigs have the highest expression profile in stems and one of Xa26 contigs was expressed dominantly in roots. The transcriptomic database of O. meyeriana has been constructed and many diseases-resistant genes were found to express under native condition, which provides a foundation for future discovery of a number of novel genes and provides a basis for studying the molecular mechanisms associated with disease

  2. Polymorphisms in Plasmodium falciparum chloroquine resistance transporter and multidrug resistance 1 genes

    DEFF Research Database (Denmark)

    Venkatesan, Meera; Gadalla, Nahla B; Stepniewska, Kasia


    Adequate clinical and parasitologic cure by artemisinin combination therapies relies on the artemisinin component and the partner drug. Polymorphisms in the Plasmodium falciparum chloroquine resistance transporter (pfcrt) and P. falciparum multidrug resistance 1 (pfmdr1) genes are associated...... with decreased sensitivity to amodiaquine and lumefantrine, but effects of these polymorphisms on therapeutic responses to artesunate-amodiaquine (ASAQ) and artemether-lumefantrine (AL) have not been clearly defined. Individual patient data from 31 clinical trials were harmonized and pooled by using standardized...

  3. Recombination Rate Heterogeneity within Arabidopsis Disease Resistance Genes. (United States)

    Choi, Kyuha; Reinhard, Carsten; Serra, Heïdi; Ziolkowski, Piotr A; Underwood, Charles J; Zhao, Xiaohui; Hardcastle, Thomas J; Yelina, Nataliya E; Griffin, Catherine; Jackson, Matthew; Mézard, Christine; McVean, Gil; Copenhaver, Gregory P; Henderson, Ian R


    Meiotic crossover frequency varies extensively along chromosomes and is typically concentrated in hotspots. As recombination increases genetic diversity, hotspots are predicted to occur at immunity genes, where variation may be beneficial. A major component of plant immunity is recognition of pathogen Avirulence (Avr) effectors by resistance (R) genes that encode NBS-LRR domain proteins. Therefore, we sought to test whether NBS-LRR genes would overlap with meiotic crossover hotspots using experimental genetics in Arabidopsis thaliana. NBS-LRR genes tend to physically cluster in plant genomes; for example, in Arabidopsis most are located in large clusters on the south arms of chromosomes 1 and 5. We experimentally mapped 1,439 crossovers within these clusters and observed NBS-LRR gene associated hotspots, which were also detected as historical hotspots via analysis of linkage disequilibrium. However, we also observed NBS-LRR gene coldspots, which in some cases correlate with structural heterozygosity. To study recombination at the fine-scale we used high-throughput sequencing to analyze ~1,000 crossovers within the RESISTANCE TO ALBUGO CANDIDA1 (RAC1) R gene hotspot. This revealed elevated intragenic crossovers, overlapping nucleosome-occupied exons that encode the TIR, NBS and LRR domains. The highest RAC1 recombination frequency was promoter-proximal and overlapped CTT-repeat DNA sequence motifs, which have previously been associated with plant crossover hotspots. Additionally, we show a significant influence of natural genetic variation on NBS-LRR cluster recombination rates, using crosses between Arabidopsis ecotypes. In conclusion, we show that a subset of NBS-LRR genes are strong hotspots, whereas others are coldspots. This reveals a complex recombination landscape in Arabidopsis NBS-LRR genes, which we propose results from varying coevolutionary pressures exerted by host-pathogen relationships, and is influenced by structural heterozygosity.

  4. Multi drug resistance to cancer chemotherapy: Genes involved and blockers

    International Nuclear Information System (INIS)

    Sayed-Ahmed, Mohamed M.


    During the last three decades, important and considerable research efforts had been performed to investigate the mechanism through which cancer cells overcome the cytotoxic effects of a variety of chemotherapeutic drugs. Most of the previously published work has been focused on the resistance of tumor cells to those anticancer drugs of natural source. Multidrug resistance (MDR) is a cellular cross-resistance to a broad spectrum of natural products used in cancer chemotherapy and is believed to be the major cause of the therapeutic failures of the drugs belonging to different naturally obtained or semisynthetic groups including vinca alkaloids, taxans, epipodophyllotoxins and certain antibiotics. This phenomenon results from overexpression of four MDR genes and their corresponding proteins that act as membrane-bound ATP consuming pumps. These proteins mediate the efflux of many structurally and functionally unrelated anticancer drugs of natural source. MDR may be intrinsic or acquired following exposure to chemotherapy. The existence of intrinsically resistant tumor cell clone before and following chemotherapeutic treatment has been associated with a worse final outcome because of increased incidence of distant metasis. In view of irreplaceability of natural product anticancer drugs as effective chemotherapeutic agents, and in view of MDR as a major obstacle to successful chemotherapy, this review is aimed to highlight the genes involved in MDR, classical MDR blockers and gene therapy approaches to overcome MDR. (author)

  5. Staphylococcus aureus nasal carriage in Ukraine: antibacterial resistance and virulence factor encoding genes. (United States)

    Netsvyetayeva, Irina; Fraczek, Mariusz; Piskorska, Katarzyna; Golas, Marlena; Sikora, Magdalena; Mlynarczyk, Andrzej; Swoboda-Kopec, Ewa; Marusza, Wojciech; Palmieri, Beniamino; Iannitti, Tommaso


    The number of studies regarding the incidence of multidrug resistant strains and distribution of genes encoding virulence factors, which have colonized the post-Soviet states, is considerably limited. The aim of the study was (1) to assess the Staphylococcus (S.) aureus nasal carriage rate, including Methicillin Resistant S. aureus (MRSA) strains in adult Ukrainian population, (2) to determine antibiotic resistant pattern and (3) the occurrence of Panton Valentine Leukocidine (PVL)-, Fibronectin-Binding Protein A (FnBPA)- and Exfoliative Toxin (ET)-encoding genes. Nasal samples for S. aureus culture were obtained from 245 adults. The susceptibility pattern for several classes of antibiotics was determined by disk diffusion method according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines. The virulence factor encoding genes, mecA, lukS-lukF, eta, etb, etd, fnbA, were detected by Polymerase Chain Reaction (PCR). The S. aureus nasal carriage rate was 40%. The prevalence of nasal MRSA carriage in adults was 3.7%. LukS-lukF genes were detected in over 58% of the strains. ET-encoding genes were detected in over 39% of the strains and the most prevalent was etd. The fnbA gene was detected in over 59% of the strains. All MRSA isolates tested were positive for the mecA gene. LukS-lukF genes and the etd gene were commonly co-present in MRSA, while lukS-lukF genes and the fnbA gene were commonly co-present in Methicillin Sensitive S. aureus (MSSA) isolates. No significant difference was detected between the occurrence of lukS-lukF genes (P > 0.05) and the etd gene (P > 0.05) when comparing MRSA and MSSA. The occurrence of the fnbA gene was significantly more frequent in MSSA strains (P aureus is a common cause of infection. The prevalence of S. aureus nasal carriage in our cohort of patients from Ukraine was 40.4%. We found that 9.1% of the strains were classified as MRSA and all MRSA isolates tested positive for the mecA gene

  6. Mapping fusiform rust resistance genes within a complex mating design of loblolly pine (United States)

    Tania Quesada; Marcio F.R. Resende Jr.; Patricio Munoz; Jill L. Wegrzyn; David B. Neale; Matias Kirst; Gary F. Peter; Salvador A. Gezan; C.Dana Nelson; John M. Davis


    Fusiform rust resistance can involve gene-for-gene interactions where resistance (Fr) genes in the host interact with corresponding avirulence genes in the pathogen, Cronartium quercuum f.sp. fusiforme (Cqf). Here, we identify trees with Fr genes in a loblolly pine population derived from a complex mating design challenged with two Cqf inocula (one gall and 10 gall...

  7. Bacterial viruses enable their host to acquire antibiotic resistance genes from neighbouring cells

    DEFF Research Database (Denmark)

    Haaber, Jakob Krause; Leisner, Jørgen; Cohn, Marianne Thorup


    Prophages are quiescent viruses located in the chromosomes of bacteria. In the human pathogen, Staphylococcus aureus, prophages are omnipresent and are believed to be responsible for the spread of some antibiotic resistance genes. Here we demonstrate that release of phages from a subpopulation of S....... aureus cells enables the intact, prophage-containing population to acquire beneficial genes from competing, phage-susceptible strains present in the same environment. Phage infection kills competitor cells and bits of their DNA are occasionally captured in viral transducing particles. Return...... of such particles to the prophage-containing population can drive the transfer of genes encoding potentially useful traits such as antibiotic resistance. This process, which can be viewed as ‘auto-transduction’, allows S. aureus to efficiently acquire antibiotic resistance both in vitro and in an in vivo virulence...

  8. Comparative Transcriptomics Reveals Differential Gene Expression Related to Colletotrichum gloeosporioides Resistance in the Octoploid Strawberry

    Directory of Open Access Journals (Sweden)

    Feng Wang


    Full Text Available The strawberry is an important fruit worldwide; however, the development of the strawberry industry is limited by fungal disease. Anthracnose is caused by the pathogen Colletotrichum gloeosporioides and leads to large-scale losses in strawberry quality and production. However, the transcriptional response of strawberry to infection with C. gloeosporioides is poorly understood. In the present study, the strawberry leaf transcriptome of the ‘Yanli’ and ‘Benihoppe’ cultivars were deep sequenced via an RNA-seq analysis to study C. gloeosporioides resistance in strawberry. Among the sequences, differentially expressed genes were annotated with Gene Ontology terms and subjected to pathway enrichment analysis. Significant categories included defense, plant–pathogen interactions and flavonoid biosynthesis were identified. The comprehensive transcriptome data set provides molecular insight into C. gloeosporioides resistance genes in resistant and susceptible strawberry cultivars. Our findings can enhance breeding efforts in strawberry.

  9. A novel method to discover fluoroquinolone antibiotic resistance (qnr genes in fragmented nucleotide sequences

    Directory of Open Access Journals (Sweden)

    Boulund Fredrik


    Full Text Available Abstract Background Broad-spectrum fluoroquinolone antibiotics are central in modern health care and are used to treat and prevent a wide range of bacterial infections. The recently discovered qnr genes provide a mechanism of resistance with the potential to rapidly spread between bacteria using horizontal gene transfer. As for many antibiotic resistance genes present in pathogens today, qnr genes are hypothesized to originate from environmental bacteria. The vast amount of data generated by shotgun metagenomics can therefore be used to explore the diversity of qnr genes in more detail. Results In this paper we describe a new method to identify qnr genes in nucleotide sequence data. We show, using cross-validation, that the method has a high statistical power of correctly classifying sequences from novel classes of qnr genes, even for fragments as short as 100 nucleotides. Based on sequences from public repositories, the method was able to identify all previously reported plasmid-mediated qnr genes. In addition, several fragments from novel putative qnr genes were identified in metagenomes. The method was also able to annotate 39 chromosomal variants of which 11 have previously not been reported in literature. Conclusions The method described in this paper significantly improves the sensitivity and specificity of identification and annotation of qnr genes in nucleotide sequence data. The predicted novel putative qnr genes in the metagenomic data support the hypothesis of a large and uncharacterized diversity within this family of resistance genes in environmental bacterial communities. An implementation of the method is freely available at

  10. Antimicrobial resistance and virulence genes in enterococci from wild game meat in Spain. (United States)

    Guerrero-Ramos, Emilia; Cordero, Jorge; Molina-González, Diana; Poeta, Patrícia; Igrejas, Gilberto; Alonso-Calleja, Carlos; Capita, Rosa


    A total of 55 enterococci (45 Enterococcus faecium, 7 Enterococcus faecalis, and three Enterococcus durans) isolated from the meat of wild game animals (roe deer, boar, rabbit, pheasant, and pigeon) in North-Western Spain were tested for susceptibility to 14 antimicrobials by the disc diffusion method. All strains showed a multi-resistant phenotype (resistance to between three and 10 antimicrobials). The strains exhibited high percentages of resistance to erythromycin (89.1%), tetracycline (67.3%), ciprofloxacin (92.7%), nitrofurantoin (67.3%), and quinupristin-dalfopristin (81.8%). The lowest values (9.1%) were observed for high-level resistance to gentamicin, kanamycin, and streptomycin. The average number of resistances per strain was 5.8 for E. faecium isolates, 7.9 for E. faecalis, and 5.7 for E. durans. Genes encoding antimicrobial resistance and virulence were studied by polymerase chain reaction. A total of 15 (57.7%) of the 26 vancomycin-resistant isolates harboured the vanA gene. Other resistance genes detected included vanB, erm(B) and/or erm(C), tet(L) and/or tet(M), acc(6')-aph(2″), and aph(3')-IIIa in strains resistant to vancomycin, erythromycin, tetracycline, gentamicin, and kanamycin, respectively. Specific genes of the Tn5397 transposon were detected in 54.8% of the tet(M)-positive enterococci. Nine virulence factors (gelE, agg, ace, cpd, frs, esp, hyl, efaAfs and efaAfm) were studied. All virulence genes, with the exception of the frs gene, were found to be present in the enterococcal isolates. At least one virulence gene was detected in 20.0% of E. faecium, 71.4% of E. faecalis and 33.3% of E. durans isolates, with ace and cpd being the most frequently detected genes (6 isolates each). This suggests that wild game meat might play a role in the spreading through the food chain of enterococci with antimicrobial resistance and virulence determinants to humans. Copyright © 2015 Elsevier Ltd. All rights reserved.

  11. Molecular tagging of a novel rust resistance gene R(12) in sunflower (Helianthus annuus L.). (United States)

    Gong, L; Hulke, B S; Gulya, T J; Markell, S G; Qi, L L


    Sunflower production in North America has recently suffered economic losses in yield and seed quality from sunflower rust (Puccinia helianthi Schwein.) because of the increasing incidence and lack of resistance to new rust races. RHA 464, a newly released sunflower male fertility restorer line, is resistant to both of the most predominant and most virulent rust races identified in the Northern Great Plains of the USA. The gene conditioning rust resistance in RHA 464 originated from wild Helianthus annuus L., but has not been molecularly marked or determined to be independent from other rust loci. The objectives of this study are to identify molecular markers linked to the rust resistance gene and to investigate the allelism of this gene with the unmapped rust resistance genes present in HA-R6, HA-R8 and RHA 397. Virulence phenotypes of seedlings for the F(2) population and F(2:3) families suggested that a single dominant gene confers rust resistance in RHA 464, and this gene was designated as R(12). Bulked segregant analysis identified ten markers polymorphic between resistant and susceptible bulks. In subsequent genetic mapping, the ten markers covered 33.4 cM of genetic distance on linkage group 11 of sunflower. A co-dominant marker CRT275-11 is the closest marker distal to R(12) with a genetic distance of 1.0 cM, while ZVG53, a dominant marker linked in the repulsion phase, is proximal to R(12) with a genetic distance of 9.6 cM. The allelism test demonstrated that R(12) is not allelic to the rust resistance genes in HA-R6, HA-R8 and RHA 397, and it is also not linked to any previously mapped rust resistance genes. Discovery of the R(12) novel rust resistance locus in sunflower and associated markers will potentially support the molecular marker-assisted introgression and pyramiding of R(12) into sunflower breeding lines.

  12. Postulation of rust resistance genes in Nordic spring wheat genotypes and identification of widely effective sources of resistance against the Australian rust flora. (United States)

    Randhawa, Mandeep; Bansal, Urmil; Lillemo, Morten; Miah, Hanif; Bariana, Harbans


    Wild relatives, landraces and cultivars from different geographical regions have been demonstrated as the sources of genetic variation for resistance to rust diseases. This study involved assessment of diversity for resistance to three rust diseases among a set of Nordic spring wheat cultivars. These cultivars were tested at the seedling stage against several pathotypes of three rust pathogens in the greenhouse. All stage stem rust resistance genes Sr7b, Sr8a, Sr12, Sr15, Sr17, Sr23 and Sr30, and leaf rust resistance genes Lr1, Lr3a, Lr13, Lr14a, Lr16 and Lr20 were postulated either singly or in different combinations among these cultivars. A high proportion of cultivars were identified to carry linked rust resistance genes Sr15 and Lr20. Although 51 cultivars showed variation against Puccinia striiformis f. sp. tritici (Pst) pathotypes used in this study, results were not clearly contrasting to enable postulation of stripe rust resistance genes in these genotypes. Stripe rust resistance gene Yr27 was postulated in four cultivars and Yr1 was present in cultivar Zebra. Cultivar Tjalve produced low stripe rust response against all Pst pathotypes indicating the presence either of a widely effective resistance gene or combination of genes with compensating pathogenic specificities. Several cultivars carried moderate to high level of APR to leaf rust and stripe rust. Seedling stem rust susceptible cultivar Aston exhibited moderately resistant to moderately susceptible response, whereas other cultivars belonging to this class were rated moderately susceptible or higher. Molecular markers linked with APR genes Yr48, Lr34/Yr18/Sr57, Lr68 and Sr2 detected the presence of these genes in some genotypes.

  13. Spread of tetracycline resistance genes at a conventional dairy farm

    Czech Academy of Sciences Publication Activity Database

    Kyselková, Martina; Jirout, Jiří; Vrchotová, Naděžda; Schmitt, H.; Elhottová, Dana


    Roč. 6, may (2015), s. 536 ISSN 1664-302X R&D Projects: GA ČR GAP504/10/2077; GA MŠk(CZ) EE2.3.30.0032; GA MŠk(CZ) LO1415 Institutional support: RVO:67179843 ; RVO:60077344 Keywords : antibiotic resistance spread * animal manure * cattle intestinal microflora * chlortetracycline * dairy cattle * dairy farm * heavy metals * tetracycline resistance genes Subject RIV: EI - Biotechnology ; Bionics; EE - Microbiology, Virology (BC-A) Impact factor: 4.165, year: 2015

  14. Multidrug-resistant Nocardia pseudobrasiliensis presenting as multiple muscle abscesses. (United States)

    Veerappan Kandasamy, Vimalkumar; Nagabandi, Arun; Horowitz, Edward A; Vivekanandan, Renuga


    A 79-year-old Caucasian man presented with multiple leg abscesses due to Nocardia pseudobrasiliensis. He was on chronic steroid therapy for myasthenia gravis. We present the difficulties in diagnosis and treatment of this rare organism. N. pseudobrasiliensis is a new emerging species that was previously thought to belong to the N. brasiliensis species. The distinction between the two species is extremely important given the different antibiotic susceptibility pattern and association of N. pseudobrasiliensis with more invasive and disseminated disease. 2015 BMJ Publishing Group Ltd.

  15. Using SNP genetic markers to elucidate the linkage of the Co-34/Phg-3 anthracnose and angular leaf spot resistance gene cluster with the Ur-14 resistance gene (United States)

    The Ouro Negro common bean cultivar contains the Co-34/Phg-3 gene cluster that confers resistance to the anthracnose (ANT) and angular leaf spot (ALS) pathogens. These genes are tightly linked on chromosome 4. Ouro Negro also has the Ur-14 rust resistance gene, reportedly in the vicinity of Co- 34; ...

  16. Overexpression of SOS genes in ciprofloxacin resistant Escherichia coli mutants. (United States)

    Pourahmad Jaktaji, Razieh; Pasand, Shirin


    Fluoroquinolones are important antibiotics for the treatment of urinary tract infections caused by Escherichia coli. Mutational studies have shown that ciprofloxacin, a member of fluoroquinolones induces SOS response and mutagenesis in pathogenic bacteria which in turn develop antibiotic resistance. However, inhibition of SOS response can increase recombination activity which in turn leads to genetic variation. The aim of this study was to measure 5 SOS genes expressions in nine E. coli mutants with different MICs for ciprofloxacin following exposure to ciprofloxacin. Gene expression was assessed by quantitative real time PCR. Gene alteration assessment was conducted by PCR amplification and DNA sequencing. Results showed that the expression of recA was increased in 5 mutants. This overexpression is not related to gene alteration, and enhances the expression of polB and umuCD genes encoding nonmutagenic and mutagenic polymerases, respectively. The direct relationship between the level of SOS expression and the level of resistance to ciprofloxacin was also indicated. It was concluded that novel therapeutic strategy that inhibits RecA activity would enhance the efficiency of common antibiotics against pathogenic bacteria. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. Antimicrobial resistance and antimicrobial resistance genes in marine bacteria from salmon aquaculture and non-aquaculture sites. (United States)

    Shah, Syed Q A; Cabello, Felipe C; L'abée-Lund, Trine M; Tomova, Alexandra; Godfrey, Henry P; Buschmann, Alejandro H; Sørum, Henning


    Antimicrobial resistance (AR) detected by disc diffusion and antimicrobial resistance genes detected by DNA hybridization and polymerase chain reaction with amplicon sequencing were studied in 124 marine bacterial isolates from a Chilean salmon aquaculture site and 76 from a site without aquaculture 8 km distant. Resistance to one or more antimicrobials was present in 81% of the isolates regardless of site. Resistance to tetracycline was most commonly encoded by tetA and tetG; to trimethoprim, by dfrA1, dfrA5 and dfrA12; to sulfamethizole, by sul1 and sul2; to amoxicillin, by blaTEM ; and to streptomycin, by strA-strB. Integron integrase intl1 was detected in 14 sul1-positive isolates, associated with aad9 gene cassettes in two from the aquaculture site. intl2 Integrase was only detected in three dfrA1-positive isolates from the aquaculture site and was not associated with gene cassettes in any. Of nine isolates tested for conjugation, two from the aquaculture site transferred AR determinants to Escherichia coli. High levels of AR in marine sediments from aquaculture and non-aquaculture sites suggest that dispersion of the large amounts of antimicrobials used in Chilean salmon aquaculture has created selective pressure in areas of the marine environment far removed from the initial site of use of these agents. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

  18. Dissemination of antibiotic resistance genes from antibiotic producers to pathogens

    DEFF Research Database (Denmark)

    Jiang, Xinglin; Ellabaan, Mostafa M Hashim; Charusanti, Pep


    It has been hypothesized that some antibiotic resistance genes (ARGs) found in pathogenic bacteria derive from antibiotic-producing actinobacteria. Here we provide bioinformatic and experimental evidence supporting this hypothesis. We identify genes in proteobacteria, including some pathogens...... and experimentally test a 'carry-back' mechanism for the transfer, involving conjugative transfer of a carrier sequence from proteobacteria to actinobacteria, recombination of the carrier sequence with the actinobacterial ARG, followed by natural transformation of proteobacteria with the carrier-sandwiched ARG. Our...... results support the existence of ancient and, possibly, recent transfers of ARGs from antibiotic-producing actinobacteria to proteobacteria, and provide evidence for a defined mechanism....

  19. Transcriptome profiling and digital gene expression analysis of genes associated with salinity resistance in peanut

    Directory of Open Access Journals (Sweden)

    Jiongming Sui


    Full Text Available Background: Soil salinity can significantly reduce crop production, but the molecular mechanism of salinity tolerance in peanut is poorly understood. A mutant (S1 with higher salinity resistance than its mutagenic parent HY22 (S3 was obtained. Transcriptome sequencing and digital gene expression (DGE analysis were performed with leaves of S1 and S3 before and after plants were irrigated with 250 mM NaCl. Results: A total of 107,725 comprehensive transcripts were assembled into 67,738 unigenes using TIGR Gene Indices clustering tools (TGICL. All unigenes were searched against the euKaryotic Ortholog Groups (KOG, gene ontology (GO and Kyoto Encyclopedia of Genes and Genomes (KEGG databases, and these unigenes were assigned to 26 functional KOG categories, 56 GO terms, 32 KEGG groups, respectively. In total 112 differentially expressed genes (DEGs between S1 and S3 after salinity stress were screened, among them, 86 were responsive to salinity stress in S1 and/or S3. These 86 DEGs included genes that encoded the following kinds of proteins that are known to be involved in resistance to salinity stress: late embryogenesis abundant proteins (LEAs, major intrinsic proteins (MIPs or aquaporins, metallothioneins (MTs, lipid transfer protein (LTP, calcineurin B-like protein-interacting protein kinases (CIPKs, 9-cis-epoxycarotenoid dioxygenase (NCED and oleosins, etc. Of these 86 DEGs, 18 could not be matched with known proteins. Conclusion: The results from this study will be useful for further research on the mechanism of salinity resistance and will provide a useful gene resource for the variety breeding of salinity resistance in peanut. Keywords: Digital gene expression, Gene, Mutant, NaCl, Peanut (Arachis hypogaea L., RNA-seq, Salinity stress, Salinity tolerance, Soil salinity, Transcripts, Unigenes

  20. Distribution of different efflux pump genes in clinical isolates of multidrug-resistant Acinetobacter baumannii and their correlation with antimicrobial resistance. (United States)

    Lin, Ming-Feng; Lin, Yun-You; Tu, Chi-Chao; Lan, Chung-Yu


    Efflux pumps are one of the major mechanisms of antimicrobial resistance in Acinetobacter baumannii. This study aimed to understand the distribution of different types of pump genes in clinical isolates of multidrug-resistant A. baumannii (MDRAB) and to reveal the relationship between their presence and expression with antimicrobial resistance. MDRAB isolates were collected from five hospitals in Taiwan. Different categories of pump genes, including adeB, adeJ, macB, abeM, abeS, emrA-like, emrB-like, and craA, were chosen, and their presence in the collected isolates was determined. Three induced resistant strains of A. baumannii ATCC 17978 to tigecycline, imipenem, and amikacin were also included. The expressions of the selected pump genes were determined using quantitative reverse transcription-polymerase chain reaction. Twenty-one MDRAB clinical isolates were obtained from five hospitals. All of the studied pump genes were present in the collected MDRAB isolates except one isolate that lacked the emrA-like gene. The gene expression of these efflux pumps was variable among the strains. The upregulation of the adeB, adeJ, and macB genes was responsible for tigecycline resistance, and the increased abeS expression was strongly related to amikacin resistance. Of all the antibiotics studied, tigecycline was the strongest inducer of gene expression for many efflux pumps in A. baumannii. Efflux pump genes are universally present in the collected clinical MDRAB isolates. The upregulation of the adeB, adeJ, macB and abeS genes is more related with antibiotic resistance. Copyright © 2015. Published by Elsevier B.V.

  1. A novel resistance gene, lnu(H), conferring resistance to lincosamides in Riemerella anatipestifer CH-2. (United States)

    Luo, Hong-Yan; Liu, Ma-Feng; Wang, Ming-Shu; Zhao, Xin-Xin; Jia, Ren-Yong; Chen, Shun; Sun, Kun-Feng; Yang, Qiao; Wu, Ying; Chen, Xiao-Yue; Biville, Francis; Zou, Yuan-Feng; Jing, Bo; Cheng, An-Chun; Zhu, De-Kang


    The Gram-negative bacterium Riemerella anatipestifer CH-2 is resistant to lincosamides, having a lincomycin (LCM) minimum inhibitory concentration (MIC) of 128 µg/mL. The G148_1775 gene of R. anatipestifer CH-2, designated lnu(H), encodes a 260-amino acid protein with ≤41% identity to other reported lincosamide nucleotidylyltransferases. Escherichia coli Rosetta TM (DE3) containing the pBAD24-lnu(H) plasmid showed four- and two-fold increases in the MICs of LCM and clindamycin (CLI), respectively. A kinetic assay of the purified Lnu(H) enzyme for LCM and CLI showed that the protein could inactive lincosamides. Mass spectrometry analysis demonstrated that the Lnu(H) enzyme catalysed adenylylation of lincosamides. In addition, an lnu(H) gene deletion strain exhibited 512- and 32-fold decreases in LCM and CLI MICs, respectively. The wild-type level of lincosamide resistance could be restored by complementation with a shuttle plasmid carrying the lnu(H) gene. The transformant R. anatipestifer ATCC 11845 [lnu(H)] acquired by natural transformation also exhibited high-level lincosamide resistance. Moreover, among 175 R. anatipestifer field isolates, 56 (32.0%) were positive for the lnu(H) gene by PCR. In conclusion, Lnu(H) is a novel lincosamide nucleotidylyltransferase that inactivates LCM and CLI by nucleotidylylation, thus conferring high-level lincosamide resistance to R. anatipestifer CH-2. Copyright © 2017. Published by Elsevier B.V.

  2. Antibiotic resistance and resistance genes in Escherichia coli from poultry farms, southwest Nigeria

    DEFF Research Database (Denmark)

    Adelowo, Olawale O.; Fagade, Obasola E.; Agersø, Yvonne


    %, ampicillin 36%, spectinomycin 28%, nalidixic acid 25%, chloramphenicol 22%, neomycin 14%, gentamicin 8%, amoxicillin-clavulanate, ceftiofur, cefotaxime, colistin, florfenicol and apramycin 0%. Resistance genes found among the isolates include bla-TEM (85%), sul2 (67%), sul3 (17%), aadA (65%), strA (70%), str...

  3. Antimicrobial susceptibility and occurrence of resistance genes among Salmonella enterica serovar Weltevreden from different countries

    DEFF Research Database (Denmark)

    Aarestrup, Frank Møller; Lertworapreecha, M.; Evans, M.C.


    and gentamicin. All nine ampicillin-resistant isolates contained a sequence similar to the bla(TEM-1b) gene, one of the eight chloramphenicol-resistant isolates a sequence similar to the catA1 gene, all three neomycin-resistant isolates a sequence similar to the aphA-2 gene, 16 (73%) of the 22 streptomycin...... isolates were examined for susceptibility to antimicrobial agents, and resistant isolates were examined for the presence of selected resistance genes by PCR. Results: Only 48 (9.5%) of the isolates were resistant to one or more of the antimicrobial agents tested. A low frequency of resistance was found...

  4. Evolution of resistance against CRISPR/Cas9 gene drive


    Clark, Andrew; Unckless, Robert; Messer, Philipp


    CRISPR/Cas9 gene drive (CGD) promises to be a highly adaptable approach for spreading genetically engineered alleles throughout a species, even if those alleles impair reproductive success. CGD has been shown to be effective in laboratory crosses of insects, yet it remains unclear to what extent potential resistance mechanisms will affect the dynamics of this process in large natural populations. Here we develop a comprehensive population genetic framework for modeling CGD dynamics, which inc...

  5. Occurrence of antibiotic resistance and characterization of resistant genes and integrons in Enterobacteriaceae isolated from integrated fish farms south China (United States)

    Su, Hao-Chang; Ying, Guang-Guo; Tao, Ran; Zhang, Rui-Quan; Fogarty, Lisa R.; Kolpin, Dana W.


    Antibiotics are still widely applied in animal husbandry to prevent diseases and used as feed additives to promote animal growth. This could result in antibiotic resistance to bacteria and antibiotic residues in animals. In this paper, Enterobacteriaceae isolated from four integrated fish farms in Zhongshan, South China were tested for antibiotic resistance, tetracycline resistance genes, sulfonamide resistance genes, and class 1 integrons. The Kirby-Bauer disk diffusion method and polymerase chain reaction (PCR) assays were carried out to test antibiotic susceptibility and resistance genes, respectively. Relatively high antibiotic resistance frequencies were found, especially for ampicillin (80%), tetracycline (52%), and trimethoprim (50%). Out of 203 Enterobacteriaceae isolates, 98.5% were resistant to one or more antibiotics tested. Multiple antibiotic resistance (MAR) was found highest in animal manures with a MAR index of 0.56. Tetracycline resistance genes (tet(A), tet(C)) and sulfonamide resistance genes (sul2) were detected in more than 50% of the isolates. The intI1 gene was found in 170 isolates (83.7%). Both classic and non-classic class 1 integrons were found. Four genes, aadA5, aadA22, dfr2, and dfrA17, were detected. To our knowledge, this is the first report for molecular characterization of antibiotic resistance genes in Enterobacteriaceae isolated from integrated fish farms in China and the first time that gene cassette array dfrA17-aadA5 has been detected in such fish farms. Results of this study indicated that fish farms may be a reservoir of highly diverse and abundant antibiotic resistant genes and gene cassettes. Integrons may play a key role in multiple antibiotic resistances posing potential health risks to the general public and aquaculture.

  6. Sulfonamide-Resistant Bacteria and Their Resistance Genes in Soils Fertilized with Manures from Jiangsu Province, Southeastern China


    Wang, Na; Yang, Xiaohong; Jiao, Shaojun; Zhang, Jun; Ye, Boping; Gao, Shixiang


    Antibiotic-resistant bacteria and genes are recognized as new environmental pollutants that warrant special concern. There were few reports on veterinary antibiotic-resistant bacteria and genes in China. This work systematically analyzed the prevalence and distribution of sulfonamide resistance genes in soils from the environments around poultry and livestock farms in Jiangsu Province, Southeastern China. The results showed that the animal manure application made the spread and abundance of a...

  7. Identification of Gene Resistance to Avian InfluenzaVirus (Mx Gene among Wild Waterbirds

    Directory of Open Access Journals (Sweden)

    Dewi Elfidasari


    Full Text Available The Mx gene is an antiviral gene used to determine the resistance or the susceptibility to different types of viruses, including the Avian Influenza (AI virus subtype H5N1. The AI virus subtype H5N1 infection in chickens causes Mx gene polymorphism. The Mx+ gene shows resistant to the AIvirus subtype H5N1, whereas the Mx-gene shows signs of susceptible. The objective of thisresearch was to detect the Mxgene in wild aquatic birds using the Polymerase Chain Reaction Restriction Fragment Length Polymorphism (PCR-RFLP method with the primer pairs F2 and NE-R2/R and the RsaI restriction enzyme. DNA samples were obtained from eight species of wild waterbirds with positive and negative exposure to the AI virus subtype H5N1. DNA amplification results showed that the Mxgene in wild aquatic birds is found in a 100 bp fragment, which is the same as the Mx gene found in chickens. However, unlike chickens, the Mxgene in wild aquatic birds did not show any polymorphism. This study proves that Mx- based resistance to AI virus subtype H5N1 in different in wild birds than in chickens.

  8. Genotypes, Virulence Factors and Antimicrobial Resistance Genes of Staphylococcus aureus Isolated in Bovine Subclinical Mastitis from Eastern China

    Directory of Open Access Journals (Sweden)

    Javed Memon§, Yongchun Yang§, Jam Kashifa, Muhammad Yaqoob, Rehana Buriroa, Jamila Soomroa, Wang Liping and Fan Hongjie*


    Full Text Available This study was carried out to determine the genotypes, virulence factors and antimicrobial resistance traits of 34 Staphylococcus aureus isolated from subclinical mastitis in Eastern China. Minimal inhibitory concentration (MIC results showed resistance to erythromycin in all isolates. A high frequency of Methicillin resistant S. aureus (MRSA; 29% was observed and these isolates were also highly resistant to penicillin, oxacillin, oxytetracycline and chloramphenicol than methicillin sensitive S. aureus (MSSA isolates. Thirteen pathogenic factors and seven resistance genes including mecA and blaZ gene were checked through PCR. The spaX gene was found in all isolates, whereas cna, spaIg, nuc, clfA, fnbpB, hlA, hlB and seA were present in 35, 79, 85, 59, 35, 85, 71 and 38% isolates, respectively. Nine isolates carried a group of 8 different virulence genes. Moreover, macrolide resistance genes ermB and ermC were present in all isolates. High resistance rate against methicillin was found but no isolate was positive for mecA gene, whereas blaZ and tetK were detected in 82 and 56% isolates, respectively. Genes; fnbpA, seB, seC, seD, dfrK and tetM were not found in any isolate. The statistical association between phenotypic resistance and virulence genes showed, clfA, fnbpB, hlB and seA, were potentially associated with penicillin G, ciprofloxacin, methicillin, chloramphenicol, trimethoprim and oxytetracycline resistance (P≤0.05. REP-PCR based genotyping showed seven distinct genotypes (A-G prevalent in this region. This study reports the presence of multidrug resistant S. aureus in sub-clinical mastitis which were also highly virulent that could be a major obstacle in the treatment of mastitis in this region of China.

  9. Molecular characterization of antimicrobial resistance genes against Staphylococcus aureus isolates from Trinidad and Tobago. (United States)

    Akpaka, Patrick E; Roberts, Rashida; Monecke, Stefan

    Staphylococcus aureus continues to pose major public health challenges in many areas because of antibiotic resistance problems. In the Caribbean, especially Trinidad and Tobago, the challenge is not different. This study was performed to evaluate the antimicrobial resistance gene prevalence among S. aureus isolates in Trinidad and Tobago. Standard and molecular microbiological methods, including the Microscan automated system, DNA microarray and multi locus sequence typing (MLST) analysis, were performed on 309 clinical S. aureus isolates recovered from patients who were treated at three of the country's main health institutions. S. aureus exhibited susceptibilities ≥80% to eleven of the 19 antimicrobials tested against it, and these belong to the most commonly used and available antibiotics in the country. While the antibiotic to which it was most susceptible of the commonly used antibiotics was trimethoprim/sulfamethoxazole, the antibiotics to which it was least susceptible or most resistant to were ampicillin and penicillin. S. aureus isolates from the pediatric ward produced the greatest rate of susceptibility among the isolates recovered from patients admitted into hospitals, while isolates from Accident and Emergency rooms displayed the greatest susceptibilities among patients from the community. S. aureus isolates from the country did not harbor acquired resistant genes targeting clindamycin/macrolides (ermB), linezolid (cfr) or vancomycin (vanA). The blaZ gene, which is the most common beta lactam (Penicillinase) resistance mechanism for S. aureus, was observed in 88.7% of the methicillin susceptible S. aureus, while methicillin resistance mediated by the mec gene was present in 13.6%. Most of the resistance markers found in MRSA isolates were significantly associated with the ST239-MRSA-III strain in this study, and all isolates that belonged to the USA300 strain, which additionally encoded both the PVL gene and ACME cluster, belonged to CC8. Several

  10. Molecular characterization of antimicrobial resistance genes against Staphylococcus aureus isolates from Trinidad and Tobago

    Directory of Open Access Journals (Sweden)

    Patrick E. Akpaka


    Full Text Available Summary: Staphylococcus aureus continues to pose major public health challenges in many areas because of antibiotic resistance problems. In the Caribbean, especially Trinidad and Tobago, the challenge is not different. This study was performed to evaluate the antimicrobial resistance gene prevalence among S. aureus isolates in Trinidad and Tobago.Standard and molecular microbiological methods, including the Microscan automated system, DNA microarray and multi locus sequence typing (MLST analysis, were performed on 309 clinical S. aureus isolates recovered from patients who were treated at three of the country's main health institutions.S. aureus exhibited susceptibilities ≥80% to eleven of the 19 antimicrobials tested against it, and these belong to the most commonly used and available antibiotics in the country. While the antibiotic to which it was most susceptible of the commonly used antibiotics was trimethoprim/sulfamethoxazole, the antibiotics to which it was least susceptible or most resistant to were ampicillin and penicillin. S. aureus isolates from the pediatric ward produced the greatest rate of susceptibility among the isolates recovered from patients admitted into hospitals, while isolates from Accident and Emergency rooms displayed the greatest susceptibilities among patients from the community.S. aureus isolates from the country did not harbor acquired resistant genes targeting clindamycin/macrolides (ermB, linezolid (cfr or vancomycin (vanA. The blaZ gene, which is the most common beta lactam (Penicillinase resistance mechanism for S. aureus, was observed in 88.7% of the methicillin susceptible S. aureus, while methicillin resistance mediated by the mec gene was present in 13.6%. Most of the resistance markers found in MRSA isolates were significantly associated with the ST239-MRSA-III strain in this study, and all isolates that belonged to the USA300 strain, which additionally encoded both the PVL gene and ACME cluster

  11. A double EPSPS gene mutation endowing glyphosate resistance shows a remarkably high resistance cost. (United States)

    Han, Heping; Vila-Aiub, Martin M; Jalaludin, Adam; Yu, Qin; Powles, Stephen B


    A novel glyphosate resistance double point mutation (T102I/P106S, TIPS) in the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene has been recently identified for the first time only in the weed species Eleusine indica. Quantification of plant resistance cost associated with the TIPS and the often reported glyphosate resistance single P106S mutation was performed. A significant resistance cost (50% in seed number currency) associated with the homozygous TIPS but not the homozygous P106S EPSPS variant was identified in E. indica plants. The resistance cost associated with the TIPS mutation escalated to 85% in plants under resource competition with rice crops. The resistance cost was not detected in nonhomozygous TIPS plants denoting the recessive nature of the cost associated with the TIPS allele. An excess of 11-fold more shikimate and sixfold more quinate in the shikimate pathway was detected in TIPS plants in the absence of glyphosate treatment compared to wild type, whereas no changes in these compounds were observed in P106S plants when compared to wild type. TIPS plants show altered metabolite levels in several other metabolic pathways that may account for the expression of the observed resistance cost. © 2017 John Wiley & Sons Ltd.

  12. The Occurrence of the Colistin Resistance Gene mcr-1 in the Haihe River (China

    Directory of Open Access Journals (Sweden)

    Dong Yang


    Full Text Available Antibiotic failure is occurring worldwide. In a routine surveillance study on antibioticresistance genes (ARGs in natural water bodies, we noted the detection of colistin-resistance gene mcr-1, previously identified in Escherichia coli and Klebsiella pneumoniae isolates from human beings and animals in several countries. The mcr-1 gene might be present in water environments, because aquatic ecosystems are recognized as reservoirs for antibiotic resistant bacteria (ARB and ARGs. In this study, a qPCR assay was developed to monitor and quantify the mcr-1 gene in the Haihe River, China. The results showed that all 18 samples collected from different locations over 6 months along the Haihe River were positive for the mcr-1 gene, and the highest level of mcr-1 reached 3.81 × 105 gene copies (GC per liter of water. This is the first study to quantify mcr-1 in a natural water system by qPCR. Our findings highlight the potential for this antibiotic resistance determinant to spread extensively, suggesting a significant health and ecological impact.

  13. The wheat Lr34 multipathogen resistance gene confers resistance to anthracnose and rust in sorghum. (United States)

    Schnippenkoetter, Wendelin; Lo, Clive; Liu, Guoquan; Dibley, Katherine; Chan, Wai Lung; White, Jodie; Milne, Ricky; Zwart, Alexander; Kwong, Eunjung; Keller, Beat; Godwin, Ian; Krattinger, Simon G; Lagudah, Evans


    The ability of the wheat Lr34 multipathogen resistance gene (Lr34res) to function across a wide taxonomic boundary was investigated in transgenic Sorghum bicolor. Increased resistance to sorghum rust and anthracnose disease symptoms following infection with the biotrophic pathogen Puccinia purpurea and the hemibiotroph Colletotrichum sublineolum, respectively, occurred in transgenic plants expressing the Lr34res ABC transporter. Transgenic sorghum lines that highly expressed the wheat Lr34res gene exhibited immunity to sorghum rust compared to the low-expressing single copy Lr34res genotype that conferred partial resistance. Pathogen-induced pigmentation mediated by flavonoid phytoalexins was evident on transgenic sorghum leaves following P. purpurea infection within 24-72 h, which paralleled Lr34res gene expression. Elevated expression of flavone synthase II, flavanone 4-reductase and dihydroflavonol reductase genes which control the biosynthesis of flavonoid phytoalexins characterized the highly expressing Lr34res transgenic lines 24-h post-inoculation with P. purpurea. Metabolite analysis of mesocotyls infected with C. sublineolum showed increased levels of 3-deoxyanthocyanidin metabolites were associated with Lr34res expression, concomitant with reduced symptoms of anthracnose. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  14. Data mining and influential analysis of gene expression data for plant resistance gene identification in tomato (Solanum lycopersicum

    Directory of Open Access Journals (Sweden)

    Francisco Torres-Avilés


    Conclusion: Application of different statistical analyses to detect potential resistance genes reliably has shown to conduct interesting results that improve knowledge on molecular mechanisms of plant resistance to pathogens.

  15. Strategies to be used in the struggle between resistance and virulence genes

    International Nuclear Information System (INIS)

    Zitelli, G.; Vallega, V.


    The cultivation of wheat varieties resistant to diseases such as stem and leaf rusts, mildew and septoria plays an important role in modern agriculture. However, the problem of how to keep varieties resistant for a long period has not yet been solved. Whatever type of resistance (specific, non-specific, tolerance etc.) the breeder chooses to use in his breeding work, the resistance stability will depend very much on the strategy used. There are many different approaches: (i) To introduce single specific factors into the cultivated varieties; (ii) To introduce the maximum number of factors in the same variety; (iii) To create multiline varieties; (iv) To cultivate different varieties carrying different resistant factors. Such a ''mosaic'' artificially creates, as in the case of multiline varieties, conditions similar to those which we find in wild populations. The use of multiline varieties and of ''mosaic'' varieties stresses the need for finding a greater number of different genes for resistance. At present we know that a large number of genes for resistance to rusts and to mildew is available in bread and durum wheats and in related species. (author)

  16. Transcriptome Profiling to Identify Genes Involved in Mesosulfuron-Methyl Resistance in Alopecurus aequalis

    Directory of Open Access Journals (Sweden)

    Ning Zhao


    they deserve further functional study. This is the first large-scale transcriptome-sequencing study to identify NTSR genes in A. aequalis that uses the Illumina platform. This work demonstrates that NTSR is likely driven by the differences in the expression patterns of a set of genes. The assembled transcriptome data presented here provide a valuable resource for A. aequalis biology, and should facilitate the study of herbicide resistance at the molecular level in this and other weed species.

  17. [State-of-the-art status on airborne antibiotic resistant bacteria and antibiotic resistance genes]. (United States)

    Li, J; Yao, M S


    The world is facing more deaths due to increasing antibiotic-resistant bacterial infections and the shortage of new highly effective antibiotics, however the air media as its important transmission route has not been adequately studied. Based on the latest literature acquired in this work, we have discussed the state-of-the-art research progress of the concentration, distribution and spread of antibiotic resistant bacteria (ARB) and antibiotic resistance genes (ARGs) in different environmental air media, and also analyzed some future prevention and control measures. The large use of antibiotics in the medical settings and animal husbandry places has resulted in higher abundances of ARB and ARGs in the relevant and surrounding atmosphere than in urban and general indoor air environments. ARGs can be spread by adhering to airborne particles, and researchers have also found that air media contain more abundant ARGs than other environmental media such as soil, water and sediment. It was suggested in this review that strengthening the monitoring, study on spreading factors and biological toxicity, and also research and development on pathogen accurate diagnosis and new green antibiotic are expected to help effectively monitor, prevent and control of the impacts of airborne resistant bacteria and resistance genes on both human and ecologies.

  18. Mapping of novel powdery mildew resistance gene(s) from Agropyron cristatum chromosome 2P. (United States)

    Li, Huanhuan; Jiang, Bo; Wang, Jingchang; Lu, Yuqing; Zhang, Jinpeng; Pan, Cuili; Yang, Xinming; Li, Xiuquan; Liu, Weihua; Li, Lihui


    A physical map of Agropyron cristatum 2P chromosome was constructed for the first time and the novel powdery mildew resistance gene(s) from chromosome 2P was(were) also mapped. Agropyron cristatum (L.) Gaertn. (2n = 28, PPPP), a wild relative of common wheat, is highly resistant to powdery mildew. Previous studies showed that wheat-A. cristatum 2P disomic addition line II-9-3 displayed high resistance to powdery mildew, and the resistance was attributable to A. cristatum chromosome 2P. To utilize and physically map the powdery mildew resistance gene(s), 15 wheat-A. cristatum 2P translocation lines and three A. cristatum 2P deletion lines with different chromosomal segment sizes, obtained from II-9-3 using 60 Co-γ ray irradiation, were characterized using cytogenetic and molecular marker analysis. A. cristatum 2P chromosomal segments in the translocations were translocated to different wheat chromosomes, including 1A, 4A, 5A, 6A, 7A, 1B, 2B, 3B, 7B, 3D, 4D, and 6D. A physical map of the 2P chromosome was constructed with 82 STS markers, consisting of nine bins with 34 markers on 2PS and eight bins with 48 markers on 2PL. The BC 1 F 2 populations of seven wheat-A. cristatum 2P translocation lines (2PT-3, 2PT-4, 2PT-5, 2PT-6, 2PT-8, 2PT-9, and 2PT-10) were developed by self-pollination, tested with powdery mildew and genotyped with 2P-specific STS markers. From these results, the gene(s) conferring powdery mildew resistance was(were) located on 2PL bin FL 0.66-0.86 and 19 2P-specific markers were identified in this bin. Moreover, two new powdery mildew-resistant translocation lines (2PT-4 and 2PT-5) with small 2PL chromosome segments were obtained. The newly developed wheat lines with powdery mildew resistance and the closely linked molecular markers will be valuable for wheat disease breeding in the future.

  19. Evolution by Pervasive Gene Fusion in Antibiotic Resistance and Antibiotic Synthesizing Genes

    Directory of Open Access Journals (Sweden)

    Orla Coleman


    Full Text Available Phylogenetic (tree-based approaches to understanding evolutionary history are unable to incorporate convergent evolutionary events where two genes merge into one. In this study, as exemplars of what can be achieved when a tree is not assumed a priori, we have analysed the evolutionary histories of polyketide synthase genes and antibiotic resistance genes and have shown that their history is replete with convergent events as well as divergent events. We demonstrate that the overall histories of these genes more closely resembles the remodelling that might be seen with the children’s toy Lego, than the standard model of the phylogenetic tree. This work demonstrates further that genes can act as public goods, available for re-use and incorporation into other genetic goods.

  20. A Novel Phytophthora sojae Resistance Rps12 Gene Mapped to a Genomic Region That Contains Several Rps Genes. (United States)

    Sahoo, Dipak K; Abeysekara, Nilwala S; Cianzio, Silvia R; Robertson, Alison E; Bhattacharyya, Madan K


    Phytophthora sojae Kaufmann and Gerdemann, which causes Phytophthora root rot, is a widespread pathogen that limits soybean production worldwide. Development of Phytophthora resistant cultivars carrying Phytophthora resistance Rps genes is a cost-effective approach in controlling this disease. For this mapping study of a novel Rps gene, 290 recombinant inbred lines (RILs) (F7 families) were developed by crossing the P. sojae resistant cultivar PI399036 with the P. sojae susceptible AR2 line, and were phenotyped for responses to a mixture of three P. sojae isolates that overcome most of the known Rps genes. Of these 290 RILs, 130 were homozygous resistant, 12 heterzygous and segregating for Phytophthora resistance, and 148 were recessive homozygous and susceptible. From this population, 59 RILs homozygous for Phytophthora sojae resistance and 61 susceptible to a mixture of P. sojae isolates R17 and Val12-11 or P7074 that overcome resistance encoded by known Rps genes mapped to Chromosome 18 were selected for mapping novel Rps gene. A single gene accounted for the 1:1 segregation of resistance and susceptibility among the RILs. The gene encoding the Phytophthora resistance mapped to a 5.8 cM interval between the SSR markers BARCSOYSSR_18_1840 and Sat_064 located in the lower arm of Chromosome 18. The gene is mapped 2.2 cM proximal to the NBSRps4/6-like sequence that was reported to co-segregate with the Phytophthora resistance genes Rps4 and Rps6. The gene is mapped to a highly recombinogenic, gene-rich genomic region carrying several nucleotide binding site-leucine rich repeat (NBS-LRR)-like genes. We named this novel gene as Rps12, which is expected to be an invaluable resource in breeding soybeans for Phytophthora resistance.

  1. A Novel Phytophthora sojae Resistance Rps12 Gene Mapped to a Genomic Region That Contains Several Rps Genes.

    Directory of Open Access Journals (Sweden)

    Dipak K Sahoo

    Full Text Available Phytophthora sojae Kaufmann and Gerdemann, which causes Phytophthora root rot, is a widespread pathogen that limits soybean production worldwide. Development of Phytophthora resistant cultivars carrying Phytophthora resistance Rps genes is a cost-effective approach in controlling this disease. For this mapping study of a novel Rps gene, 290 recombinant inbred lines (RILs (F7 families were developed by crossing the P. sojae resistant cultivar PI399036 with the P. sojae susceptible AR2 line, and were phenotyped for responses to a mixture of three P. sojae isolates that overcome most of the known Rps genes. Of these 290 RILs, 130 were homozygous resistant, 12 heterzygous and segregating for Phytophthora resistance, and 148 were recessive homozygous and susceptible. From this population, 59 RILs homozygous for Phytophthora sojae resistance and 61 susceptible to a mixture of P. sojae isolates R17 and Val12-11 or P7074 that overcome resistance encoded by known Rps genes mapped to Chromosome 18 were selected for mapping novel Rps gene. A single gene accounted for the 1:1 segregation of resistance and susceptibility among the RILs. The gene encoding the Phytophthora resistance mapped to a 5.8 cM interval between the SSR markers BARCSOYSSR_18_1840 and Sat_064 located in the lower arm of Chromosome 18. The gene is mapped 2.2 cM proximal to the NBSRps4/6-like sequence that was reported to co-segregate with the Phytophthora resistance genes Rps4 and Rps6. The gene is mapped to a highly recombinogenic, gene-rich genomic region carrying several nucleotide binding site-leucine rich repeat (NBS-LRR-like genes. We named this novel gene as Rps12, which is expected to be an invaluable resource in breeding soybeans for Phytophthora resistance.

  2. Controversy Associated With the Common Component of Most Transgenic Plants – Kanamycin Resistance Marker Gene

    Directory of Open Access Journals (Sweden)

    Srećko Jelenić


    Full Text Available Plant genetic engineering is a powerful tool for producing crops resistant to pests, diseases and abiotic stress or crops with improved nutritional value or better quality products. Currently over 70 genetically modified (GM crops have been approved for use in different countries. These cover a wide range of plant species with significant number of different modified traits. However, beside the technology used for their improvement, the common component of most GM crops is the neomycin phosphotransferase II gene (nptII, which confers resistance to the antibiotics kanamycin and neomycin. The nptII gene is present in GM crops as a marker gene to select transformed plant cells during the first steps of the transformation process. The use of antibiotic-resistance genes is subject to controversy and intense debate, because of the likelihood that clinical therapy could be compromised due to inactivation of the oral dose of the antibiotic from consumption of food derived from the transgenic plant, and because of the risk of gene transfer from plants to gut and soil microorganisms or to consumer’s cells. The present article discusses these possibilities in the light of current scientific knowledge.

  3. Study on drug resistance of mycobacterium tuberculosis in patients with pulmonary tuberculosis by drug resistance gene detecting

    International Nuclear Information System (INIS)

    Wang Wei; Li Hongmin; Wu Xueqiong; Wang Ansheng; Ye Yixiu; Wang Zhongyuan; Liu Jinwei; Chen Hongbing; Lin Minggui; Wang Jinhe; Li Sumei; Jiang Ping; Feng Bai; Chen Dongjing


    To investigate drug resistance of mycobacterium tuberculosis in different age group, compare detecting effect of two methods and evaluate their the clinical application value, all of the strains of mycobacterium tuberculosis were tested for resistance to RFP, INH SM PZA and EMB by the absolute concentration method on Lowenstein-Jensen medium and the mutation of the rpoB, katG, rpsL, pncA and embB resistance genes in M. tuberculosis was tested by PCR-SSCP. In youth, middle and old age group, the rate of acquired drug resistance was 89.2%, 85.3% and 67.6% respectively, the gene mutation rate was 76.2%, 81.3% and 63.2% respectively. The rate of acquired drug resistance and multiple drug resistance in youth group was much higher than those in other groups. The gene mutation was correlated with drug resistance level of mycobacterium tuberculosis. The gene mutation rate was higher in strains isolated from high concentration resistance than those in strains isolated from low concentration resistance. The more irregular treatment was longer, the rate of drug resistance was higher. Acquired drug resistance varies in different age group. It suggested that surveillance of drug resistence in different age group should be taken seriously, especially in youth group. PCR - SSCP is a sensitive and specific method for rapid detecting rpoB, katG, rpsL, pncA and embB genes mutations of MTB. (authors)

  4. DNA tagging of blast resistant gene(s in three Brazilian rice cultivars

    Directory of Open Access Journals (Sweden)

    S.S. Sandhu


    Full Text Available Rice blast is the most important fungal disease of rice and is caused by Pyricularia oryzae Sacc. (Telomorph Magnoporthe grisea Barr.. Seven randomly amplified polymorphic DNA (RAPD markers OPA5, OPG17, OPG18, OPG19, OPF9, OPF17 and OPF19 showed very clear polymorphism in resistant cultivar lines which differed from susceptible lines. By comparing different susceptible lines, nine DNA amplifications of seven primers (OPA5(1000, OPA5(1200, OPG17(700, OPG18(850, OPG19(500, OPG19(600, OPF9(600, OPF17(1200 and OPF19(600 were identified as dominant markers for the blast resistant gene in resistant cultivar lines. These loci facilitate the indirect scoring of blast resistant and blast susceptible genotypes. The codomine RAPDs markers will facilitate marker-assisted selection of the blast resistant gene in two blast resistant genotypes of rice (Labelle and Line 11 and will be useful in rice breeding programs.

  5. The occurrence of antibiotic resistance genes in tap water - a review (United States)

    Siedlecka, Agata


    The study presents a review of the occurrence of genetic determinants of antibiotic resistance in tap water. The aim of this study was also to compare the applied methods for antibiotic resistance genes (ARGs) investigations in tap water. As the concentration of ARGs in treated, drinking water is expected to be very low and may cause problems in a standard isolation procedure, the special emphasis is placed on the applied procedures of DNA extraction and their efficiency. The study presents the first attempts to obtain DNA directly from tap water. Further efforts must be put to determine the final amount of obtained DNA and the presence of chosen ARGs among the molecules.

  6. Effects of Copper Addition on Copper Resistance, Antibiotic Resistance Genes, and intl1 during Swine Manure Composting (United States)

    Yin, Yanan; Gu, Jie; Wang, Xiaojuan; Song, Wen; Zhang, Kaiyu; Sun, Wei; Zhang, Xin; Zhang, Yajun; Li, Haichao


    Copper is one of the most abundant heavy metals present in swine manure. In this study, a laboratory-scale aerobic composting system was amended with Cu at three levels (0, 200, and 2000 mg kg-1, i.e., control, Cu200, and Cu2000 treatments, respectively) to determine its effect on the fate of copper resistance genes [copper resistance genes (CRGs): pcoA, cusA, copA, and tcrB], antibiotic resistance genes [antibiotic resistance genes (ARGs): erm(A) and erm(B)], and intl1. The results showed that the absolute abundances of pcoA, tcrB, erm(A), erm(B), and intl1 were reduced, whereas those of copA and cusA increased after swine manure composting. Redundancy analysis showed that temperature significantly affected the variations in CRGs, ARGs, and intl1. The decreases in CRGs, ARGs, and intI1 were positively correlated with the exchangeable Cu levels. The bacterial community could be grouped according to the composting time under different treatments, where the high concentration of copper had a more persistent effect on the bacterial community. Network analysis determined that the co-occurrence of CRGs, ARGs, and intI1, and the bacterial community were the main contributors to the changes in CRGs, ARG, and intl1. Thus, temperature, copper, and changes in the bacterial community composition had important effects on the variations in CRGs, ARGs, and intl1 during manure composting in the presence of added copper. PMID:28316595

  7. Occurrence of the mcr-1 Colistin Resistance Gene and other Clinically Relevant Antibiotic Resistance Genes in Microbial Populations at Different Municipal Wastewater Treatment Plants in Germany

    Directory of Open Access Journals (Sweden)

    Norman Hembach


    Full Text Available Seven wastewater treatment plants (WWTPs with different population equivalents and catchment areas were screened for the prevalence of the colistin resistance gene mcr-1 mediating resistance against last resort antibiotic polymyxin E. The abundance of the plasmid-associated mcr-1 gene in total microbial populations during water treatment processes was quantitatively analyzed by qPCR analyses. The presence of the colistin resistance gene was documented for all of the influent wastewater samples of the seven WWTPs. In some cases the mcr-1 resistance gene was also detected in effluent samples of the WWTPs after conventional treatment reaching the aquatic environment. In addition to the occurrence of mcr-1 gene, CTX-M-32, blaTEM, CTX-M, tetM, CMY-2, and ermB genes coding for clinically relevant antibiotic resistances were quantified in higher abundances in all WWTPs effluents. In parallel, the abundances of Acinetobacter baumannii, Klebsiella pneumoniae, and Escherichia coli were quantified via qPCR using specific taxonomic gene markers which were detected in all influent and effluent wastewaters in significant densities. Hence, opportunistic pathogens and clinically relevant antibiotic resistance genes in wastewaters of the analyzed WWTPs bear a risk of dissemination to the aquatic environment. Since many of the antibiotic resistance gene are associated with mobile genetic elements horizontal gene transfer during wastewater treatment can't be excluded.

  8. Introgression of ivermectin resistance genes into a susceptible Haemonchus contortus strain by multiple backcrossing.

    Directory of Open Access Journals (Sweden)

    Elizabeth Redman


    Full Text Available Anthelmintic drug resistance in livestock parasites is already widespread and in recent years there has been an increasing level of anthelmintic drug selection pressure applied to parasitic nematode populations in humans leading to concerns regarding the emergence of resistance. However, most parasitic nematodes, particularly those of humans, are difficult experimental subjects making mechanistic studies of drug resistance extremely difficult. The small ruminant parasitic nematode Haemonchus contortus is a more amenable model system to study many aspects of parasite biology and investigate the basic mechanisms and genetics of anthelmintic drug resistance. Here we report the successful introgression of ivermectin resistance genes from two independent ivermectin resistant strains, MHco4(WRS and MHco10(CAVR, into the susceptible genome reference strain MHco3(ISE using a backcrossing approach. A panel of microsatellite markers were used to monitor the procedure. We demonstrated that after four rounds of backcrossing, worms that were phenotypically resistant to ivermectin had a similar genetic background to the susceptible reference strain based on the bulk genotyping with 18 microsatellite loci and individual genotyping with a sub-panel of 9 microsatellite loci. In addition, a single marker, Hcms8a20, showed evidence of genetic linkage to an ivermectin resistance-conferring locus providing a starting point for more detailed studies of this genomic region to identify the causal mutation(s. This work presents a novel genetic approach to study anthelmintic resistance and provides a "proof-of-concept" of the use of forward genetics in an important model strongylid parasite of relevance to human hookworms. The resulting strains provide valuable resources for candidate gene studies, whole genome approaches and for further genetic analysis to identify ivermectin resistance loci.

  9. Design of magnetic gene complexes as effective and serum resistant gene delivery systems for mesenchymal stem cells. (United States)

    Zhang, Tian-Yuan; Wu, Jia-He; Xu, Qian-Hao; Wang, Xia-Rong; Lu, Jingxiong; Hu, Ying; Jo, Jun-Ichiro; Yamamoto, Masaya; Ling, Daishun; Tabata, Yasuhiko; Gao, Jian-Qing


    Gene engineered mesenchymal stem cells (MSCs) have been proposed as promising tools for their various applications in biomedicine. Nevertheless, the lack of an effective and safe way to genetically modify these stem cells is still a major obstacle in the current studies. Herein, we designed novel magnetic complexes by assembling cationized pullulan derivatives with magnetic iron oxide nanoparticles for delivering target genes to MSCs. Results showed that this complexes achieved effective gene expression with the assistance of external magnetic field, and resisted the adverse effect induced by serum proteins on the gene delivery. Moreover, neither significant cytotoxicity nor the interference on the osteogenic differentiation to MSCs were observed after magnetofection. Further studies revealed that this effective and serum resistant gene transfection was partly due to the accelerated and enhanced intracellular uptake process driven by external magnetic field. To conclude, the current study presented a novel option for genetic modification of MSCs in an effective, relatively safe and serum compatible way. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Antibiotic treatments of a methicillin-resistant Staphylococcus pseudintermedius infection in a dog: a case presentation. (United States)

    Decristophoris, P; Mauri, F; Albanese, F; Carnelli, A; Vanzetti, T; Zinsstag, J


    We report the antibiotic treatments administered to a female dog with mastitis and successive pyoderma. Microbiological investigations allowed the identification of Staphylococcus pseudintermedius after 54 days of various antibiotic treatments. The isolate carried the mecA gene and was resistant to 9 of 15 tested antibiotics. Consistent antibiotic treatment of the infection was possible only after accurate microbiological diagnosis.

  11. Functional Analysis of Genes Comprising the Locus of Heat Resistance in Escherichia coli. (United States)

    Mercer, Ryan; Nguyen, Oanh; Ou, Qixing; McMullen, Lynn; Gänzle, Michael G


    The locus of heat resistance (LHR) is a 15- to 19-kb genomic island conferring exceptional heat resistance to organisms in the family Enterobacteriaceae , including pathogenic strains of Salmonella enterica and Escherichia coli The complement of LHR-comprising genes that is necessary for heat resistance and the stress-induced or growth-phase-induced expression of LHR-comprising genes are unknown. This study determined the contribution of the seven LHR-comprising genes yfdX1 GI , yfdX2 , hdeD GI , orf11 , trx GI , kefB , and psiE GI by comparing the heat resistances of E. coli strains harboring plasmid-encoded derivatives of the different LHRs in these genes. (Genes carry a subscript "GI" [genomic island] if an ortholog of the same gene is present in genomes of E. coli ) LHR-encoded heat shock proteins sHSP20, ClpK GI , and sHSP GI are not sufficient for the heat resistance phenotype; YfdX1, YfdX2, and HdeD are necessary to complement the LHR heat shock proteins and to impart a high level of resistance. Deletion of trx GI , kefB , and psiE GI from plasmid-encoded copies of the LHR did not significantly affect heat resistance. The effect of the growth phase and the NaCl concentration on expression from the putative LHR promoter p2 was determined by quantitative reverse transcription-PCR and by a plasmid-encoded p2:GFP promoter fusion. The expression levels of exponential- and stationary-phase E. coli cells were not significantly different, but the addition of 1% NaCl significantly increased LHR expression. Remarkably, LHR expression in E. coli was dependent on a chromosomal copy of evgA In conclusion, this study improved our understanding of the genes required for exceptional heat resistance in E. coli and factors that increase their expression in food. IMPORTANCE The locus of heat resistance (LHR) is a genomic island conferring exceptional heat resistance to several foodborne pathogens. The exceptional level of heat resistance provided by the LHR questions the

  12. Antimicrobial Resistance and Resistance Genes in Aerobic Bacteria Isolated from Pork at Slaughter. (United States)

    Li, Lili; Heidemann Olsen, Rikke; Ye, Lei; Yan, He; Nie, Qing; Meng, Hecheng; Shi, Lei


    The aim of this study was to investigate the phenotypic and genotypic antimicrobial resistance, integrons, and transferability of resistance markers in 243 aerobic bacteria recovered from pork at slaughter in the People's Republic of China. The organisms belonged to 22 genera of gram-negative bacteria (92.2%) and gram-positive bacteria (7.8%). High levels of resistance were detected to tetracycline, trimethoprim-sulfamethoxazole, and ampicillin (36.2 to 54.3%), and lower levels were detected to nitrofurantoin, cefotaxime, gentamicin, ciprofloxacin, and chloramphenicol (7.8 to 29.2%). Across species, genes conferring antimicrobial resistance were observed with the following frequencies: blaTEM, 40.7%; blaCMY-2, 15.2%; blaCTX-M, 11.5%; sul2, 27.2%; sul1, 14.4%; tet(A), 5.4%; tet(L), 5.4%; tet(M), 5.0%; tet(E), 3.7%; tet(C), 3.3%; tet(S), 2.5%; and tet(K), 0.8%. Various antimicrobial resistance genes were found in new carriers: blaTEM in Lactococcus garvieae, Myroides odoratimimus, Aeromonas hydrophila, Staphylococcus sciuri, Raoultella terrigena, Macrococcus caseolyticus, Acinetobacter ursingii, Sphingobacterium sp., and Oceanobacillus sp.; blaCMY-2 in Lactococcus lactis, Klebsiella oxytoca, Serratia marcescens, Acinetobacter baumannii, and Myroides phaeus; tet(L) in M. caseolyticus; sul1 in Vibrio cincinnatiensis; sul2 in Acinetobacter bereziniae, Acinetobacter johnsonii, and V. cincinnatiensis; and the class 1 integron and gene cassette aadA2 in V. cincinnatiensis. Approximately 6.6% of isolates contained class 1 integrons, and one isolate harbored class 2 integrons. Plasmid associated intI1 and androgen receptor- encoding genes were transferred into Escherichia coli J53 and E. coli DH5α by conjugation and transformation experiments, respectively. Our study highlights the importance of aerobic bacteria from pork as reservoirs for antimicrobial resistance genes and mobile genetic elements that can readily be transferred intra- and interspecies.

  13. Transcriptome profiling identifies genes/pathways associated with experimental resistance to paromomycin in Leishmania donovani

    Directory of Open Access Journals (Sweden)

    Aditya Verma


    Full Text Available Widespread resistance towards antimony and reports of relapses following miltefosine treatment has severely affected the management of visceral leishmaniasis (VL in the Indian subcontinent. Paromomycin (PMM, an aminoglycoside antibiotic, has been licensed for VL treatment in India in 2007. Although its use is still restricted in the field, unraveling the molecular mechanism of resistance towards PMM is the key to preserve the drug. In this study, PMM resistant lines were selected up to 100 μM of PMM in three distinct field isolates of Leishmania donovani at promastigote stage. The resistance induced at promastigote level was also evident in amastigotes which showed 6 fold decreases in PMM susceptibility. Comparative transcriptome profiling of PMM resistant (PMM-R and the corresponding PMM sensitive (PMM-S parasites revealed modulated expression of 500 genes (1.5 fold cut off in PMM-R parasites. Selected genes were validated for their modulated expression by quantitative real-time PCR. Functional classification and pathway analysis of modulated genes indicated probable adaptations in drug resistant lines which included a reduced oxidative phosphorylation; b increased glycosomal succinate fermentation and substrate level phosphorylation; c dependency on lipids and amino acids for energy generation; d reduced DNA synthesis and increased DNA damage repair and e decreased protein synthesis and degradation. Interestingly, PMM-R parasites showed a marked increase in PMM susceptibility in presence of verapamil and amlodipine, antagonists of Ca2+ channel that are also modulators of ABC transporters. Moreover, infection of macrophages by PMM-R parasites led to modulated nitric oxide (NO levels while reactive oxygen species (ROS level remained unaltered. The present study highlights the putative mechanisms of PMM resistance in Leishmania. Keywords: Leishmania donovani, Drug resistance, Paromomycin, Transcriptome, ABC transporters, Nitric oxide, Visceral

  14. Expression Changes in Metal-Resistance Genes in Microbacterium liquefaciens Under Nickel and Vanadium Exposure. (United States)

    Fierros-Romero, Grisel; Wrosek-Cabrera, José A; Gómez-Ramírez, Marlenne; Pless, Reynaldo C; Rivas-Castillo, A M; Rojas-Avelizapa, Norma G


    Microbacterium liquefaciens MNSH2-PHGII-2 is a nickel-vanadium-resistant bacterium isolated from mine tailings located in Guanajuato, Mexico. In PHGII liquid media, M. liquefaciens has the ability to remove 29.5 ppm of Ni and 168.3 ppm of V. The present study reports, for the first time in M. liquefaciens, the presence of the genes nccA (Ni-Co-Cd resistance), hant (high-affinity nickel transporter), smtA, a metal-binding protein gene, and VAN2 (V resistance), which showed an increased expression under exposure to 200 ppm of Ni and 200 ppm of V during the logarithmic growth phase of the microorganism in PHGII liquid media. Data about the expression profile of genes conferring metal resistance to M. liquefaciens can improve the knowledge of those mechanisms involved in the processes of Ni-V resistance and probably in Ni-V removal processes. Based on our data, we can suggest that M. liquefaciens has the potential to be used in the biological treatment of toxic wastes with high Ni and V content.

  15. Dissemination of antimicrobial resistance in microbial ecosystems through horizontal gene transfer

    Directory of Open Access Journals (Sweden)

    Christian Johannes Hendrik Von Wintersdorff


    Full Text Available The emergence and spread of antibiotic resistance among pathogenic bacteria has been a rising problem for public health in recent decades. It is becoming increasingly recognized that not only antibiotic resistance genes (ARGs encountered in clinical pathogens are of relevance, but rather, all pathogenic, commensal as well as environmental bacteria – and also mobile genetic elements and bacteriophages – form a reservoir of ARGs (the resistome from which pathogenic bacteria can acquire resistance via horizontal gene transfer (HGT. HGT has caused antibiotic resistance to spread from commensal and environmental species to pathogenic ones, as has been shown for some clinically important ARGs. Of the three canonical mechanisms of HGT, conjugation is thought to have the greatest influence on the dissemination of ARGs. While transformation and transduction are deemed less important, recent discoveries suggest their role may be larger than previously thought. Understanding the extent of the resistome and how its mobilization to pathogenic bacteria takes place is essential for efforts to control the dissemination of these genes. Here, we will discuss the concept of the resistome, provide examples of HGT of clinically relevant ARGs and present an overview of the current knowledge of the contributions the various HGT mechanisms make to the spread of antibiotic resistance.

  16. Candidate gene association analyses for ketosis resistance in Holsteins. (United States)

    Kroezen, V; Schenkel, F S; Miglior, F; Baes, C F; Squires, E J


    High-yielding dairy cattle are susceptible to ketosis, a metabolic disease that negatively affects the health, fertility, and milk production of the cow. Interest in breeding for more robust dairy cattle with improved resistance to disease is global; however, genetic evaluations for ketosis would benefit from the additional information provided by genetic markers. Candidate genes that are proposed to have a biological role in the pathogenesis of ketosis were investigated in silico and a custom panel of 998 putative single nucleotide polymorphism (SNP) markers was developed. The objective of this study was to test the associations of these new markers with deregressed estimated breeding values (EBV) for ketosis. A sample of 653 Canadian Holstein cows that had been previously genotyped with a medium-density SNP chip were regenotyped with the custom panel. The EBV for ketosis in first and later lactations were obtained for each animal and deregressed for use as pseudo-phenotypes for association analyses. Results of the mixed inheritance model for single SNP association analyses suggested 15 markers in 6 unique candidate genes were associated with the studied trait. Genes encoding proteins involved in metabolic processes, including the synthesis and degradation of fatty acids and ketone bodies, gluconeogenesis, lipid mobilization, and the citric acid cycle, were identified to contain SNP associated with ketosis resistance. This work confirmed the presence of previously described quantitative trait loci for dairy cattle, suggested novel markers for ketosis-resistance, and provided insight into the underlying biology of this disease. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  17. Molecular study on some antibiotic resistant genes in Salmonella spp. isolates (United States)

    Nabi, Ari Q.


    Studying the genes related with antimicrobial resistance in Salmonella spp. is a crucial step toward a correct and faster treatment of infections caused by the pathogen. In this work Integron mediated antibiotic resistant gene IntI1 (Class I Integrase IntI1) and some plasmid mediated antibiotic resistance genes (Qnr) were scanned among the isolated non-Typhoid Salmonellae strains with known resistance to some important antimicrobial drugs using Sybr Green real time PCR. The aim of the study was to correlate the multiple antibiotics and antimicrobial resistance of Salmonella spp. with the presence of integrase (IntI1) gene and plasmid mediated quinolone resistant genes. Results revealed the presence of Class I Integrase gene in 76% of the isolates with confirmed multiple antibiotic resistances. Moreover, about 32% of the multiple antibiotic resistant serotypes showed a positive R-PCR for plasmid mediated qnrA gene encoding for nalidixic acid and ciprofloxacin resistance. No positive results could be revealed form R-PCRs targeting qnrB or qnrS. In light of these results we can conclude that the presence of at least one of the qnr genes and/or the presence of Integrase Class I gene were responsible for the multiple antibiotic resistance to for nalidixic acid and ciprofloxacin from the studied Salmonella spp. and further studies required to identify the genes related with multiple antibiotic resistance of the pathogen.

  18. Comparative and functional triatomine genomics reveals reductions and expansions in insecticide resistance-related gene families. (United States)

    Traverso, Lucila; Lavore, Andrés; Sierra, Ivana; Palacio, Victorio; Martinez-Barnetche, Jesús; Latorre-Estivalis, José Manuel; Mougabure-Cueto, Gaston; Francini, Flavio; Lorenzo, Marcelo G; Rodríguez, Mario Henry; Ons, Sheila; Rivera-Pomar, Rolando V


    Triatomine insects are vectors of Trypanosoma cruzi, a protozoan parasite that is the causative agent of Chagas' disease. This is a neglected disease affecting approximately 8 million people in Latin America. The existence of diverse pyrethroid resistant populations of at least two species demonstrates the potential of triatomines to develop high levels of insecticide resistance. Therefore, the incorporation of strategies for resistance management is a main concern for vector control programs. Three enzymatic superfamilies are thought to mediate xenobiotic detoxification and resistance: Glutathione Transferases (GSTs), Cytochromes P450 (CYPs) and Carboxyl/Cholinesterases (CCEs). Improving our knowledge of key triatomine detoxification enzymes will strengthen our understanding of insecticide resistance processes in vectors of Chagas' disease. The discovery and description of detoxification gene superfamilies in normalized transcriptomes of three triatomine species: Triatoma dimidiata, Triatoma infestans and Triatoma pallidipennis is presented. Furthermore, a comparative analysis of these superfamilies among the triatomine transcriptomes and the genome of Rhodnius prolixus, also a triatomine vector of Chagas' disease, and other well-studied insect genomes was performed. The expression pattern of detoxification genes in R. prolixus transcriptomes from key organs was analyzed. The comparisons reveal gene expansions in Sigma class GSTs, CYP3 in CYP superfamily and clade E in CCE superfamily. Moreover, several CYP families identified in these triatomines have not yet been described in other insects. Conversely, several groups of insecticide resistance related enzymes within each enzyme superfamily are reduced or lacking in triatomines. Furthermore, our qRT-PCR results showed an increase in the expression of a CYP4 gene in a T. infestans population resistant to pyrethroids. These results could point to an involvement of metabolic detoxification mechanisms on the high

  19. Comparative and functional triatomine genomics reveals reductions and expansions in insecticide resistance-related gene families.

    Directory of Open Access Journals (Sweden)

    Lucila Traverso


    Full Text Available Triatomine insects are vectors of Trypanosoma cruzi, a protozoan parasite that is the causative agent of Chagas' disease. This is a neglected disease affecting approximately 8 million people in Latin America. The existence of diverse pyrethroid resistant populations of at least two species demonstrates the potential of triatomines to develop high levels of insecticide resistance. Therefore, the incorporation of strategies for resistance management is a main concern for vector control programs. Three enzymatic superfamilies are thought to mediate xenobiotic detoxification and resistance: Glutathione Transferases (GSTs, Cytochromes P450 (CYPs and Carboxyl/Cholinesterases (CCEs. Improving our knowledge of key triatomine detoxification enzymes will strengthen our understanding of insecticide resistance processes in vectors of Chagas' disease.The discovery and description of detoxification gene superfamilies in normalized transcriptomes of three triatomine species: Triatoma dimidiata, Triatoma infestans and Triatoma pallidipennis is presented. Furthermore, a comparative analysis of these superfamilies among the triatomine transcriptomes and the genome of Rhodnius prolixus, also a triatomine vector of Chagas' disease, and other well-studied insect genomes was performed. The expression pattern of detoxification genes in R. prolixus transcriptomes from key organs was analyzed. The comparisons reveal gene expansions in Sigma class GSTs, CYP3 in CYP superfamily and clade E in CCE superfamily. Moreover, several CYP families identified in these triatomines have not yet been described in other insects. Conversely, several groups of insecticide resistance related enzymes within each enzyme superfamily are reduced or lacking in triatomines. Furthermore, our qRT-PCR results showed an increase in the expression of a CYP4 gene in a T. infestans population resistant to pyrethroids. These results could point to an involvement of metabolic detoxification mechanisms

  20. A set of vectors for introduction of antibiotic resistance genes by in vitro Cre-mediated recombination

    Directory of Open Access Journals (Sweden)

    Vassetzky Yegor S


    Full Text Available Abstract Background Introduction of new antibiotic resistance genes in the plasmids of interest is a frequent task in molecular cloning practice. Classical approaches involving digestion with restriction endonucleases and ligation are time-consuming. Findings We have created a set of insertion vectors (pINS carrying genes that provide resistance to various antibiotics (puromycin, blasticidin and G418 and containing a loxP site. Each vector (pINS-Puro, pINS-Blast or pINS-Neo contains either a chloramphenicol or a kanamycin resistance gene and is unable to replicate in most E. coli strains as it contains a conditional R6Kγ replication origin. Introduction of the antibiotic resistance genes into the vector of interest is achieved by Cre-mediated recombination between the replication-incompetent pINS and a replication-competent target vector. The recombination mix is then transformed into E. coli and selected by the resistance marker (kanamycin or chloramphenicol present in pINS, which allows to recover the recombinant plasmids with 100% efficiency. Conclusion Here we propose a simple strategy that allows to introduce various antibiotic-resistance genes into any plasmid containing a replication origin, an ampicillin resistance gene and a loxP site.

  1. Prevalence of antibiotic resistance genes in the bacterial flora of integrated fish farming environments of Pakistan and Tanzania. (United States)

    Shah, Syed Q A; Colquhoun, Duncan J; Nikuli, Hamisi L; Sørum, Henning


    The use of a wide variety of antimicrobials in human and veterinary medicine, including aquaculture, has led to the emergence of antibiotic resistant pathogens. In the present study, bacteria from water, sediments, and fish were collected from fish farms in Pakistan and Tanzania with no recorded history of antibiotic use. The isolates were screened for the presence of resistance genes against various antimicrobials used in aquaculture and animal husbandry. Resistant isolates selected by disk diffusion and genotyped by Southern hybridization were further screened by polymerase chain reaction (PCR) and amplicon sequencing. The prominent resistance genes identified encoded tetracycline [tetA(A) and tetA(G)], trimethoprim [dfrA1, dfrA5, dfrA7, dfrA12, and dfrA15], amoxicillin [bla(TEM)], streptomycin [strA-strB], chloramphenicol [cat-1], and erythromycin resistance [mefA]. The int1 gene was found in more than 30% of the bacterial isolates in association with gene cassettes. MAR indices ranged from 0.2 to 1. The bla(NDM-1) gene was not identified in ertapenem resistant isolates. It is hypothesized that integrated fish farming practices utilizing domestic farm and poultry waste along with antibiotic residues from animal husbandry may have contributed to a pool of resistance genes in the aquaculture systems studied.

  2. Genetic mapping of the rice resistance-breaking gene of the brown planthopper Nilaparvata lugens


    Kobayashi, Tetsuya; Yamamoto, Kimiko; Suetsugu, Yoshitaka; Kuwazaki, Seigo; Hattori, Makoto; Jairin, Jirapong; Sanada-Morimura, Sachiyo; Matsumura, Masaya


    Host plant resistance has been widely used for controlling the major rice pest brown planthopper (BPH, Nilaparvata lugens). However, adaptation of the wild BPH population to resistance limits the effective use of resistant rice varieties. Quantitative trait locus (QTL) analysis was conducted to identify resistance-breaking genes against the anti-feeding mechanism mediated by the rice resistance gene Bph1. QTL analysis in iso-female BPH lines with single-nucleotide polymorphism (SNP) markers d...

  3. Identification of powdery mildew resistance genes in Polish common oat (Avena sativa L. cultivars using host-pathogen tests

    Directory of Open Access Journals (Sweden)

    Sylwia Okoń


    Full Text Available The aim of the present study was to characterize and identify powdery mildew resistance genes in Polish common oat cultivars using host-pathogen tests. A differential set of six Blumeria graminis f.sp. avenae isolates virulent or avirulent to four cultivars and one line that has known resistance to powdery mildew were used. Among the investigated cultivars, only four of them (13.3% had resistance patterns similar to genotypes belonging to the differential set. The resistance of OMR group 1 was found in the cultivar ‘Dragon’, while that of OMR2 in the cultivar ‘Skrzat’. The cultivars ‘Deresz’ and ‘Hetman’ showed a resistance pattern that corresponded with OMR group 3. The resistance corresponding to OMR4 was not found, which suggests that until now this gene has not been used in Polish oat breeding programmes. The cultivar ‘Canyon’ had a different pat- tern of resistance than the genotypes that have already known OMR genes, which indicates that the resistance of this cultivar is determined by a new gene or a combination of known genes.

  4. Cereal cyst nematode resistance conferred by the Cre7 gene from Aegilops triuncialis and its relationship with Cre genes from Australian wheat cultivars


    Montes, Maria Jesus; Andrés, María Fe; Sin, E.; Lopez Braña, Isidoro; Martín-Sánchez, J.A.; Romero, M.D.; Delibes Castro, Angeles


    Cereal cyst nematode (CCN; Heterodera avenae Woll.) is a root pathogen of cereal crops that can cause severe yield losses in wheat (Triticum aestivum). Differential host–nematode interactions occur in wheat cultivars carrying different CCN resistance (Cre) genes. The objective of this study was to determine the CCN resistance conferred by the Cre7 gene from Aegilops triuncialis in a 42-chromosome introgression line and to assess the effects of the Cre1, Cre3, Cre4, and Cre8 genes present in A...

  5. Comparative genomics and association mapping approaches for blast resistant genes in finger millet using SSRs.

    Directory of Open Access Journals (Sweden)

    B Kalyana Babu

    Full Text Available The major limiting factor for production and productivity of finger millet crop is blast disease caused by Magnaporthe grisea. Since, the genome sequence information available in finger millet crop is scarce, comparative genomics plays a very important role in identification of genes/QTLs linked to the blast resistance genes using SSR markers. In the present study, a total of 58 genic SSRs were developed for use in genetic analysis of a global collection of 190 finger millet genotypes. The 58 SSRs yielded ninety five scorable alleles and the polymorphism information content varied from 0.186 to 0.677 at an average of 0.385. The gene diversity was in the range of 0.208 to 0.726 with an average of 0.487. Association mapping for blast resistance was done using 104 SSR markers which identified four QTLs for finger blast and one QTL for neck blast resistance. The genomic marker RM262 and genic marker FMBLEST32 were linked to finger blast disease at a P value of 0.007 and explained phenotypic variance (R² of 10% and 8% respectively. The genomic marker UGEP81 was associated to finger blast at a P value of 0.009 and explained 7.5% of R². The QTLs for neck blast was associated with the genomic SSR marker UGEP18 at a P value of 0.01, which explained 11% of R². Three QTLs for blast resistance were found common by using both GLM and MLM approaches. The resistant alleles were found to be present mostly in the exotic genotypes. Among the genotypes of NW Himalayan region of India, VHC3997, VHC3996 and VHC3930 were found highly resistant, which may be effectively used as parents for developing blast resistant cultivars in the NW Himalayan region of India. The markers linked to the QTLs for blast resistance in the present study can be further used for cloning of the full length gene, fine mapping and their further use in the marker assisted breeding programmes for introgression of blast resistant alleles into locally adapted cultivars.

  6. Comparative genomics and association mapping approaches for blast resistant genes in finger millet using SSRs. (United States)

    Babu, B Kalyana; Dinesh, Pandey; Agrawal, Pawan K; Sood, S; Chandrashekara, C; Bhatt, Jagadish C; Kumar, Anil


    The major limiting factor for production and productivity of finger millet crop is blast disease caused by Magnaporthe grisea. Since, the genome sequence information available in finger millet crop is scarce, comparative genomics plays a very important role in identification of genes/QTLs linked to the blast resistance genes using SSR markers. In the present study, a total of 58 genic SSRs were developed for use in genetic analysis of a global collection of 190 finger millet genotypes. The 58 SSRs yielded ninety five scorable alleles and the polymorphism information content varied from 0.186 to 0.677 at an average of 0.385. The gene diversity was in the range of 0.208 to 0.726 with an average of 0.487. Association mapping for blast resistance was done using 104 SSR markers which identified four QTLs for finger blast and one QTL for neck blast resistance. The genomic marker RM262 and genic marker FMBLEST32 were linked to finger blast disease at a P value of 0.007 and explained phenotypic variance (R²) of 10% and 8% respectively. The genomic marker UGEP81 was associated to finger blast at a P value of 0.009 and explained 7.5% of R². The QTLs for neck blast was associated with the genomic SSR marker UGEP18 at a P value of 0.01, which explained 11% of R². Three QTLs for blast resistance were found common by using both GLM and MLM approaches. The resistant alleles were found to be present mostly in the exotic genotypes. Among the genotypes of NW Himalayan region of India, VHC3997, VHC3996 and VHC3930 were found highly resistant, which may be effectively used as parents for developing blast resistant cultivars in the NW Himalayan region of India. The markers linked to the QTLs for blast resistance in the present study can be further used for cloning of the full length gene, fine mapping and their further use in the marker assisted breeding programmes for introgression of blast resistant alleles into locally adapted cultivars.

  7. Pyramiding, alternating or mixing: comparative performances of deployment strategies of nematode resistance genes to promote plant resistance efficiency and durability. (United States)

    Djian-Caporalino, Caroline; Palloix, Alain; Fazari, Ariane; Marteu, Nathalie; Barbary, Arnaud; Abad, Pierre; Sage-Palloix, Anne-Marie; Mateille, Thierry; Risso, Sabine; Lanza, Roger; Taussig, Catherine; Castagnone-Sereno, Philippe


    Resistant cultivars are key elements for pathogen control and pesticide reduction, but their repeated use may lead to the emergence of virulent pathogen populations, able to overcome the resistance. Increased research efforts, mainly based on theoretical studies, explore spatio-temporal deployment strategies of resistance genes in order to maximize their durability. We evaluated experimentally three of these strategies to control root-knot nematodes: cultivar mixtures, alternating and pyramiding resistance genes, under controlled and field conditions over a 3-years period, assessing the efficiency and the durability of resistance in a protected crop rotation system with pepper as summer crop and lettuce as winter crop. The choice of the resistance gene and the genetic background in which it is introgressed, affected the frequency of resistance breakdown. The pyramiding of two different resistance genes in one genotype suppressed the emergence of virulent isolates. Alternating different resistance genes in rotation was also efficient to decrease virulent populations in fields due to the specificity of the virulence and the trapping effect of resistant plants. Mixing resistant cultivars together appeared as a less efficient strategy to control nematodes. This work provides experimental evidence that, in a cropping system with seasonal sequences of vegetable species, pyramiding or alternating resistance genes benefit yields in the long-term by increasing the durability of resistant cultivars and improving the long-term control of a soil-borne pest. To our knowledge, this result is the first one obtained for a plant-nematode interaction, which helps demonstrate the general applicability of such strategies for breeding and sustainable management of resistant cultivars against pathogens.

  8. High prevalence of multidrug-resistant tuberculosis among patients with rifampicin resistance using GeneXpert Mycobacterium tuberculosis/rifampicin in Ghana. (United States)

    Boakye-Appiah, Justice K; Steinmetz, Alexis R; Pupulampu, Peter; Ofori-Yirenkyi, Stephen; Tetteh, Ishmael; Frimpong, Michael; Oppong, Patrick; Opare-Sem, Ohene; Norman, Betty R; Stienstra, Ymkje; van der Werf, Tjip S; Wansbrough-Jones, Mark; Bonsu, Frank; Obeng-Baah, Joseph; Phillips, Richard O


    Drug-resistant strains of tuberculosis (TB) represent a major threat to global TB control. In low- and middle-income countries, resource constraints make it difficult to identify and monitor cases of resistance using drug susceptibility testing and culture. Molecular assays such as the GeneXpert Mycobacterium tuberculosis/rifampicin may prove to be a cost-effective solution to this problem in these settings. The objective of this study is to evaluate the use of GeneXpert in the diagnosis of pulmonary TB since it was introduced into two tertiary hospitals in Ghana in 2013. A 2-year retrospective audit of clinical cases involving patients who presented with clinically suspected TB or documented TB not improving on standard therapy and had samples sent for GeneXpert testing. GeneXpert identified 169 cases of TB, including 17 cases of rifampicin-resistant TB. Of the seven cases with final culture and drug susceptibility testing results, six demonstrated further drug resistance and five of these were multidrug-resistant TB. These findings call for a scale-up of TB control in Ghana and provide evidence that the expansion of GeneXpert may be an optimal means to improve case finding and guide treatment of drug-resistant TB in this setting. Copyright © 2016. Published by Elsevier Ltd.

  9. Antimicrobial Resistance and Resistance Genes in Aerobic Bacteria Isolated from Pork at Slaughter

    DEFF Research Database (Denmark)

    Li, Lili; Olsen, Rikke Heidemann; Ye, Lei


    The aim of this study was to investigate the phenotypic and genotypic antimicrobial resistance, integrons, and transferability of resistance markers in 243 aerobic bacteria recovered from pork at slaughter in the People's Republic of China. The organisms belonged to 22 genera of gram-negative bac......The aim of this study was to investigate the phenotypic and genotypic antimicrobial resistance, integrons, and transferability of resistance markers in 243 aerobic bacteria recovered from pork at slaughter in the People's Republic of China. The organisms belonged to 22 genera of gram......-negative bacteria (92.2%) and gram-positive bacteria (7.8%). High levels of resistance were detected to tetracycline, trimethoprim-sulfamethoxazole, and ampicillin (36.2 to 54.3%), and lower levels were detected to nitrofurantoin, cefotaxime, gentamicin, ciprofloxacin, and chloramphenicol (7.8 to 29.2%). Across.......6% of isolates contained class 1 integrons, and one isolate harbored class 2 integrons. Plasmid associated intI1 and androgen receptor– encoding genes were transferred into Escherichia coli J53 and E. coli DH5α by conjugation and transformation experiments, respectively. Our study highlights the importance...

  10. Survey of Candidate Genes for Maize Resistance to Infection by Aspergillus flavus and/or Aflatoxin Contamination (United States)

    Hawkins, Leigh K.; Tang, Juliet D.; Tomashek, John; Alves Oliveira, Dafne; Ogunola, Oluwaseun F.; Smith, J. Spencer; Williams, W. Paul


    Many projects have identified candidate genes for resistance to aflatoxin accumulation or Aspergillus flavus infection and growth in maize using genetic mapping, genomics, transcriptomics and/or proteomics studies. However, only a small percentage of these candidates have been validated in field conditions, and their relative contribution to resistance, if any, is unknown. This study presents a consolidated list of candidate genes identified in past studies or in-house studies, with descriptive data including genetic location, gene annotation, known protein identifiers, and associated pathway information, if known. A candidate gene pipeline to test the phenotypic effect of any maize DNA sequence on aflatoxin accumulation resistance was used in this study to determine any measurable effect on polymorphisms within or linked to the candidate gene sequences, and the results are published here. PMID:29385107

  11. Survey of Candidate Genes for Maize Resistance to Infection by Aspergillus flavus and/or Aflatoxin Contamination

    Directory of Open Access Journals (Sweden)

    Leigh K. Hawkins


    Full Text Available Many projects have identified candidate genes for resistance to aflatoxin accumulation or Aspergillus flavus infection and growth in maize using genetic mapping, genomics, transcriptomics and/or proteomics studies. However, only a small percentage of these candidates have been validated in field conditions, and their relative contribution to resistance, if any, is unknown. This study presents a consolidated list of candidate genes identified in past studies or in-house studies, with descriptive data including genetic location, gene annotation, known protein identifiers, and associated pathway information, if known. A candidate gene pipeline to test the phenotypic effect of any maize DNA sequence on aflatoxin accumulation resistance was used in this study to determine any measurable effect on polymorphisms within or linked to the candidate gene sequences, and the results are published here.

  12. Prevalence of Antibiotic Resistance Genes among Human Gut-Derived Bifidobacteria. (United States)

    Duranti, Sabrina; Lugli, Gabriele Andrea; Mancabelli, Leonardo; Turroni, Francesca; Milani, Christian; Mangifesta, Marta; Ferrario, Chiara; Anzalone, Rosaria; Viappiani, Alice; van Sinderen, Douwe; Ventura, Marco


    The microbiota of the human gastrointestinal tract (GIT) may regularly be exposed to antibiotics, which are used to prevent and treat infectious diseases caused by bacteria and fungi. Bacterial communities of the gut retain a reservoir of antibiotic resistance (AR) genes, and antibiotic therapy thus positively selects for those microorganisms that harbor such genetic features, causing microbiota modulation. During the first months following birth, bifidobacteria represent some of the most dominant components of the human gut microbiota, although little is known about their AR gene complement (or resistome). In the current study, we assessed the resistome of the Bifidobacterium genus based on phenotypic and genotypic data of members that represent all currently recognized bifidobacterial (sub)species. Moreover, a comparison between the bifidobacterial resistome and gut metagenome data sets from adults and infants shows that the bifidobacterial community present at the first week following birth possesses a reduced AR arsenal compared to that present in the infant bifidobacterial population in subsequent weeks of the first year of life. Our findings reinforce the concept that the early infant gut microbiota is more susceptible to disturbances by antibiotic treatment than the gut microbiota developed at a later life stage. The spread of resistance to antibiotics among bacterial communities has represented a major concern since their discovery in the last century. The risk of genetic transfer of resistance genes between microorganisms has been extensively investigated due to its relevance to human health. In contrast, there is only limited information available on antibiotic resistance among human gut commensal microorganisms such as bifidobacteria, which are widely exploited by the food industry as health-promoting microorganisms or probiotic ingredients. In the current study, we explored the occurrence of antibiotic resistance genes in the genomes of bifidobacteria

  13. Prevalence, Virulence Genes and Antimicrobial Resistance Profiles of Salmonella Serovars from Retail Beef in Selangor, Malaysia

    Directory of Open Access Journals (Sweden)

    Tze Y. Thung


    Full Text Available The aim of the present study was to investigate the prevalence of Salmonella spp., Salmonella Enteritidis and Salmonella Typhimurium in retail beef from different retail markets of Selangor area, as well as, to assess their pathogenic potential and antimicrobial resistance. A total of 240 retail beef meat samples (chuck = 60; rib = 60; round = 60; sirloin = 60 were randomly collected. The multiplex polymerase chain reaction (mPCR in combination with the most probable number (MPN method was employed to detect Salmonella spp., S. Enteritidis and S. Typhimurium in the meat samples. The prevalence of Salmonella spp., S. Enteritidis and S. Typhimurium in 240 beef meat samples were 7.50, 1.25, and 0.83%, respectively. The microbial loads of total Salmonella was found in the range of <3 to 15 MPN/g. Eight different serovars of Salmonella were identified among the 23 isolates, and S. Agona was the predominant serovar (26.09%. Interestingly, all the Salmonella isolates were resistant to penicillin, erythromycin and vancomycin, but the sensitivity was observed for tetracycline, gentamicin and amoxicillin/clavulanic acid. All 23 isolates were resistant to at least three antibiotics. Two S. Typhimurium isolates (8.70% exhibited the highest multiple antibiotic resistance (MAR index value of 0.56 which shown resistance to nine antibiotics. PCR analysis of virulence genes showed that all Salmonella isolates (100% were positive for the invA gene. Meanwhile, pefA was only identified in S. Enteritidis and S. Typhimurium. The findings in this study indicate that retail beef products tested were widely contaminated with multi-drug resistant (MDR Salmonella and various virulence genes are present among the isolated Salmonella serovars.

  14. Isolation of Resistance Gene Candidates (RGCs) and characterization of an RGC cluster in cassava. (United States)

    López, C E; Zuluaga, A P; Cooke, R; Delseny, M; Tohme, J; Verdier, V


    Plant disease resistance genes (R genes) show significant similarity amongst themselves in terms of both their DNA sequences and structural motifs present in their protein products. Oligonucleotide primers designed from NBS (Nucleotide Binding Site) domains encoded by several R-genes have been used to amplify NBS sequences from the genomic DNA of various plant species, which have been called Resistance Gene Analogues (RGAs) or Resistance Gene Candidates (RGCs). Using specific primers from the NBS and TIR (Toll/Interleukin-1 Receptor) regions, we identified twelve classes of RGCs in cassava (Manihot esculenta Crantz). Two classes were obtained from the PCR-amplification of the TIR domain. The other 10 classes correspond to the NBS sequences and were grouped into two subfamilies. Classes RCa1 to RCa5 are part of the first subfamily and were linked to a TIR domain in the N terminus. Classes RCa6 to RCa10 corresponded to non-TIR NBS-LRR encoding sequences. BAC library screening with the 12 RGC classes as probes allowed the identification of 42 BAC clones that were assembled into 10 contigs and 19 singletons. Members of the two TIR and non-TIR NBS-LRR subfamilies occurred together within individual BAC clones. The BAC screening and Southern hybridization analyses showed that all RGCs were single copy sequences except RCa6 that represented a large and diverse gene family. One BAC contained five NBS sequences and sequence analysis allowed the identification of two complete RGCs encoding two highly similar proteins. This BAC was located on linkage group J with three other RGC-containing BACs. At least one of these genes, RGC2, is expressed constitutively in cassava tissues.

  15. Widespread Fosfomycin Resistance in Gram-Negative Bacteria Attributable to the Chromosomal fosA Gene

    Directory of Open Access Journals (Sweden)

    Ryota Ito


    Full Text Available Fosfomycin is a decades-old antibiotic which is being revisited because of its perceived activity against many extensively drug-resistant Gram-negative pathogens. FosA proteins are Mn2+ and K+-dependent glutathione S-transferases which confer fosfomycin resistance in Gram-negative bacteria by conjugation of glutathione to the antibiotic. Plasmid-borne fosA variants have been reported in fosfomycin-resistant Escherichia coli strains. However, the prevalence and distribution of fosA in other Gram-negative bacteria are not known. We systematically surveyed the presence of fosA in Gram-negative bacteria in over 18,000 published genomes from 18 Gram-negative species and investigated their contribution to fosfomycin resistance. We show that FosA homologues are present in the majority of genomes in some species (e.g., Klebsiella spp., Enterobacter spp., Serratia marcescens, and Pseudomonas aeruginosa, whereas they are largely absent in others (e.g., E. coli, Acinetobacter baumannii, and Burkholderia cepacia. FosA proteins in different bacterial pathogens are highly divergent, but key amino acid residues in the active site are conserved. Chromosomal fosA genes conferred high-level fosfomycin resistance when expressed in E. coli, and deletion of chromosomal fosA in S. marcescens eliminated fosfomycin resistance. Our results indicate that FosA is encoded by clinically relevant Gram-negative species and contributes to intrinsic fosfomycin resistance.

  16. Up-regulation of HOXB cluster genes are epigenetically regulated in tamoxifen-resistant MCF7 breast cancer cells. (United States)

    Yang, Seoyeon; Lee, Ji-Yeon; Hur, Ho; Oh, Ji Hoon; Kim, Myoung Hee


    Tamoxifen (TAM) is commonly used to treat estrogen receptor (ER)-positive breast cancer. Despite the remarkable benefits, resistance to TAM presents a serious therapeutic challenge. Since several HOX transcription factors have been proposed as strong candidates in the development of resistance to TAM therapy in breast cancer, we generated an in vitro model of acquired TAM resistance using ER-positive MCF7 breast cancer cells (MCF7-TAMR), and analyzed the expression pattern and epigenetic states of HOX genes. HOXB cluster genes were uniquely up-regulated in MCF7-TAMR cells. Survival analysis of in slico data showed the correlation of high expression of HOXB genes with poor response to TAM in ER-positive breast cancer patients treated with TAM. Gain- and loss-of-function experiments showed that the overexpression of multi HOXB genes in MCF7 renders cancer cells more resistant to TAM, whereas the knockdown restores TAM sensitivity. Furthermore, activation of HOXB genes in MCF7-TAMR was associated with histone modifications, particularly the gain of H3K9ac. These findings imply that the activation of HOXB genes mediate the development of TAM resistance, and represent a target for development of new strategies to prevent or reverse TAM resistance.

  17. Host range of antibiotic resistance genes in wastewater treatment plant influent and effluent. (United States)

    Hultman, Jenni; Tamminen, Manu; Pärnänen, Katariina; Cairns, Johannes; Karkman, Antti; Virta, Marko


    Wastewater treatment plants (WWTPs) collect wastewater from various sources for a multi-step treatment process. By mixing a large variety of bacteria and promoting their proximity, WWTPs constitute potential hotspots for the emergence of antibiotic resistant bacteria. Concerns have been expressed regarding the potential of WWTPs to spread antibiotic resistance genes (ARGs) from environmental reservoirs to human pathogens. We utilized epicPCR (Emulsion, Paired Isolation and Concatenation PCR) to detect the bacterial hosts of ARGs in two WWTPs. We identified the host distribution of four resistance-associated genes (tetM, int1, qacEΔ1and blaOXA-58) in influent and effluent. The bacterial hosts of these resistance genes varied between the WWTP influent and effluent, with a generally decreasing host range in the effluent. Through 16S rRNA gene sequencing, it was determined that the resistance gene carrying bacteria include both abundant and rare taxa. Our results suggest that the studied WWTPs mostly succeed in decreasing the host range of the resistance genes during the treatment process. Still, there were instances where effluent contained resistance genes in bacterial groups not carrying these genes in the influent. By permitting exhaustive profiling of resistance-associated gene hosts in WWTP bacterial communities, the application of epicPCR provides a new level of precision to our resistance gene risk estimates.

  18. Detection of antibiotic resistance and tetracycline resistance genes in Enterobacteriaceae isolated from the Pearl rivers in South China

    International Nuclear Information System (INIS)

    Tao Ran; Ying Guangguo; Su Haochang; Zhou Hongwei; Sidhu, Jatinder P.S.


    This study investigated antibiotic resistance profiles and tetracycline resistance genes in Enterobacteriaceae family isolates from the Pearl rivers. The Enterobacteriaceae isolates were tested for susceptibility to seven antibiotics ampicillin, chloramphenicol, ciprofloxacin, levofloxacin, sulphamethoxazole/trimethoprim, tetracycline and trimethoprim. In Liuxi reservoir, with an exception to ampicillin resistant strains (11%) no other antibiotic resistance bacterial strains were detected. However, multiple drug resistance in bacterial isolates from the other sites of Pearl rivers was observed which is possibly due to sewage discharge and input from other anthropogenic sources along the rivers. Four tetracycline resistance genes tet A, tet B, tet C and tet D were detected in the isolates from the rivers. The genes tet A and tet B were widely detected with the detection frequencies of 43% and 40% respectively. Ciprofloxacin and levofloxacin resistant enteric bacteria were also isolated from the pig and duck manures which suggest a wider distribution of human specific drugs in the environment. This investigation provided a baseline data on antibiotic resistance profiles and tetracycline resistance genes in the Pearl rivers delta. - High rates of antibiotic resistance in Enterobacteriaceae from river water are attributed to wastewater contamination.

  19. Detection of antibiotic resistance and tetracycline resistance genes in Enterobacteriaceae isolated from the Pearl rivers in South China

    Energy Technology Data Exchange (ETDEWEB)

    Tao Ran [State Key Laboratory of Organic Geochemistry, Guangzhou Institute of Geochemistry, Chinese Academy of Sciences, 511 Kehua Street, Tianhe District, Guangzhou 510640 (China); Ying Guangguo, E-mail: [State Key Laboratory of Organic Geochemistry, Guangzhou Institute of Geochemistry, Chinese Academy of Sciences, 511 Kehua Street, Tianhe District, Guangzhou 510640 (China); Su Haochang [State Key Laboratory of Organic Geochemistry, Guangzhou Institute of Geochemistry, Chinese Academy of Sciences, 511 Kehua Street, Tianhe District, Guangzhou 510640 (China); Zhou Hongwei [Department of Environmental Health, School of Public Health and Tropical Medicine, Southern Medical University, 1838 North Guangzhou Street, Baiyun District, Guangzhou 510515 (China); Sidhu, Jatinder P.S. [CSIRO Land and Water, Queensland Bioscience Precinct, 306 Carmody Road, St Lucia QLD 4067 (Australia)


    This study investigated antibiotic resistance profiles and tetracycline resistance genes in Enterobacteriaceae family isolates from the Pearl rivers. The Enterobacteriaceae isolates were tested for susceptibility to seven antibiotics ampicillin, chloramphenicol, ciprofloxacin, levofloxacin, sulphamethoxazole/trimethoprim, tetracycline and trimethoprim. In Liuxi reservoir, with an exception to ampicillin resistant strains (11%) no other antibiotic resistance bacterial strains were detected. However, multiple drug resistance in bacterial isolates from the other sites of Pearl rivers was observed which is possibly due to sewage discharge and input from other anthropogenic sources along the rivers. Four tetracycline resistance genes tet A, tet B, tet C and tet D were detected in the isolates from the rivers. The genes tet A and tet B were widely detected with the detection frequencies of 43% and 40% respectively. Ciprofloxacin and levofloxacin resistant enteric bacteria were also isolated from the pig and duck manures which suggest a wider distribution of human specific drugs in the environment. This investigation provided a baseline data on antibiotic resistance profiles and tetracycline resistance genes in the Pearl rivers delta. - High rates of antibiotic resistance in Enterobacteriaceae from river water are attributed to wastewater contamination.

  20. Epidemiology, Clinical Presentation, Laboratory Diagnosis, Antimicrobial Resistance, and Antimicrobial Management of Invasive Salmonella Infections (United States)

    Sjölund-Karlsson, Maria; Gordon, Melita A.; Parry, Christopher M.


    SUMMARY Salmonella enterica infections are common causes of bloodstream infection in low-resource areas, where they may be difficult to distinguish from other febrile illnesses and may be associated with a high case fatality ratio. Microbiologic culture of blood or bone marrow remains the mainstay of laboratory diagnosis. Antimicrobial resistance has emerged in Salmonella enterica, initially to the traditional first-line drugs chloramphenicol, ampicillin, and trimethoprim-sulfamethoxazole. Decreased fluoroquinolone susceptibility and then fluoroquinolone resistance have developed in association with chromosomal mutations in the quinolone resistance-determining region of genes encoding DNA gyrase and topoisomerase IV and also by plasmid-mediated resistance mechanisms. Resistance to extended-spectrum cephalosporins has occurred more often in nontyphoidal than in typhoidal Salmonella strains. Azithromycin is effective for the management of uncomplicated typhoid fever and may serve as an alternative oral drug in areas where fluoroquinolone resistance is common. In 2013, CLSI lowered the ciprofloxacin susceptibility breakpoints to account for accumulating clinical, microbiologic, and pharmacokinetic-pharmacodynamic data suggesting that revision was needed for contemporary invasive Salmonella infections. Newly established CLSI guidelines for azithromycin and Salmonella enterica serovar Typhi were published in CLSI document M100 in 2015. PMID:26180063

  1. Strategy of gene silencing in cassava for validation of resistance genes

    International Nuclear Information System (INIS)

    Cortes, Simon; Lopez, Camilo


    Cassava (Manihot esculenta) is a major source of food for more than 1000 million people in the world and constitutes an important staple crop. Cassava bacterial blight, caused by the gram negative bacterium Xanthomonas axonopodis pv. manihotis, is one of the most important constraints for this crop. A candidate resistance gene against cassava bacterial blight, named RXam1, has been identified previously. In this work, we employed the gene silencing approach using the African cassava mosaic virus (ACMV) to validate the function of the RXam1 gene. We used as positive control the su gen, which produce photo blanching in leaves when is silenced. Plants from the SG10735 variety were bombardment with the ACMV-A-SU+ACMV-B y ACMV-A-RXam1+ACMV-B constructions. The silencing efficiency employing the su gene was low, only one of seven plants showed photo blanching. In the putative silenced plants for the RXam1 gene, no presence of siRNAs corresponding to RXam1 was observed; although a low diminution of the RXam1 gene expression was obtained. The growth curves for the Xam strain CIO136 in cassava plants inoculated showing a little but no significance difference in the susceptibility in the silenced plants compared to not silenced

  2. Virulence Genes Profile of Multidrug Resistant Pseudomonas aeruginosa Isolated from Iranian Children with UTIs

    Directory of Open Access Journals (Sweden)

    Zohreh Heidary


    Full Text Available Virulent and resistant strains Pseudomonas aeruginosa (P. aeruginosa is one of the most important cause of UTIs in pediatrics. The present study was carried to investigate the frequency of virulence factors in the multi-drug resistant strains of P. aeruginosa isolated from pediatrics hospitalized due to the UTIs. One - hundred and forty three urine samples were collected from pediatric patients suffered from UTIs. Samples were cultured and those that were P. aeruginosa positive were analyzed for the presence of putative virulence genes. Seventy one out of 143 samples (49.65% were positive for P. aeruginosa. Monthly, sex and age-dependent prevalence were seen for P. aeruginosa. Bacterial strains had the highest levels of resistance against ampicillin (95.77%, gentamicin (92.95% and ciprofloxacin (81.69%. Of 71 P. aeruginosa isolates, 12 strains were resistant to more than 9 antibiotics (16.90%. The most commonly detected virulence factors in the cases of urethral infections were exoU and plcH while those of pyelonephritis and cystitis were were exoS and lasB. Our findings should raise awareness about antibiotic resistance in hospitalized pediatrics with UTIs in Iran. Clinicians should exercise caution in prescribing antibiotics, especially in cases of UTIs. Such information can help in identifying these virulence genes as useful diagnostic markers for clinical P. aeruginosa strains isolated from UTIs.

  3. Identification of genes differentially expressed in association with acquired cisplatin resistance (United States)

    Johnsson, A; Zeelenberg, I; Min, Y; Hilinski, J; Berry, C; Howell, S B; Los, G


    The goal of this study was to identify genes whose mRNA levels are differentially expressed in human cells with acquired cisplatin (cDDP) resistance. Using the parental UMSCC10b head and neck carcinoma cell line and the 5.9-fold cDDP-resistant subline, UMSCC10b/Pt-S15, two suppressive subtraction hybridization (SSH) cDNA libraries were prepared. One library represented mRNAs whose levels were increased in the cDDP resistant variant (the UP library), the other one represented mRNAs whose levels were decreased in the resistant cells (the DOWN library). Arrays constructed with inserts recovered from these libraries were hybridized with SSH products to identify truly differentially expressed elements. A total of 51 cDNA fragments present in the UP library and 16 in the DOWN library met the criteria established for differential expression. The sequences of 87% of these cDNA fragments were identified in Genbank. Among the mRNAs in the UP library that were frequently isolated and that showed high levels of differential expression were cytochrome oxidase I, ribosomal protein 28S, elongation factor 1α, α-enolase, stathmin, and HSP70. The approach taken in this study permitted identification of many genes never before linked to the cDDP-resistant phenotype. © 2000 Cancer Research Campaign PMID:10993653

  4. Tagging microsatellite marker to a blast resistance gene in the irrigated rice cultivar Cica-8

    Directory of Open Access Journals (Sweden)

    Thiago Martins Pinheiro


    Full Text Available The rice cultivar Cica-8 exhibit differential reaction to several pathotypes of Magnaporthe oryzae. The objective of the present investigation was to determine the number of alleles involved in the expression of resistance to leaf blast and identify microsatellite markers linked to these alleles. A cross between cultivar Metica-1 and Cica-8 susceptible and resistant, respectively, to pathotype IB-1 (Py1049 was made to obtain F1, F2, BC1:1 and BC1:2 progenies. Greenhouse tests for leaf blast reaction showed that resistance is controlled by a monogenic dominant gene. For testing microsatellite markers, DNA of both resistant and susceptible parents and F1 and F2 populations was extracted. As expected for single dominant gene the F2 populations segregated at a ratio of 3:1. Of the 11 microsatellite markers tested, one marker RM 7102 was found to be closely linked to the resistant allele at a distance of 2.7 cM, in the cultivar Cica-8 to pathotype IB-1.

  5. Molecular mapping of a sunflower rust resistance gene from HAR6. (United States)

    Bulos, Mariano; Ramos, María L; Altieri, Emiliano; Sala, Carlos A


    Sunflower rust, caused by Puccinia helianthi Schw., can result in significant yield losses in cultivated sunflower (Helianthus annuus L. var. macrocarpus Ckll.). HAR6 is a germplasm population resistant to most predominant rust races. The objectives of this study were to map the resistance factor present in HAR6 (R HAR6 ), and to provide and validate molecular tools for the identification of this gene for marker assisted selection purposes. Virulence reaction of seedlings for the F2 population and F2:3 families suggested that a single dominant gene confers rust resistance in HAR6-1, a selected rust resistance line from the original population. Genetic mapping with eight markers covered 97.4 cM of genetic distance on linkage group 13 of the sunflower consensus map. A co-dominant marker ZVG61 is the closest marker distal to R HAR6 at a genetic distance of 0.7 cM, while ORS581, a dominant marker linked in the coupling phase, is proximal to R HAR6 at a genetic distance of 1.5 cM. Validation of these markers was assessed by converting a susceptible line into a rust resistant isoline by means of marker assisted backcrossing. The application of these results to assist the breeding process and to design new strategies for rust control in sunflower is discussed.

  6. Functional screen for genes responsible for tamoxifen resistance in human breast cancer cells

    NARCIS (Netherlands)

    Meijer, Danielle; van Agthoven, Ton; Bosma, Peter T.; Nooter, Kees; Dorssers, Lambert C. J.


    Antiestrogens, such as tamoxifen, are widely used for endocrine treatment of estrogen receptor-positive breast cancer. However, as breast cancer progresses, development of tamoxifen resistance is inevitable. The mechanisms underlying this resistance are not well understood. To identify genes

  7. A maize resistance gene functions against bacterial streak disease in rice


    Zhao, Bingyu; Lin, Xinghua; Poland, Jesse; Trick, Harold; Leach, Jan; Hulbert, Scot


    Although cereal crops all belong to the grass family (Poacea), most of their diseases are specific to a particular species. Thus, a given cereal species is typically resistant to diseases of other grasses, and this nonhost resistance is generally stable. To determine the feasibility of transferring nonhost resistance genes (R genes) between distantly related grasses to control specific diseases, we identified a maize R gene that recognizes a rice pathogen, Xanthomonas oryzae pv. oryzicola, wh...

  8. Current Status and Challenges in Identifying Disease Resistance Genes in Brassica napus (United States)

    Neik, Ting Xiang; Barbetti, Martin J.; Batley, Jacqueline


    Brassica napus is an economically important crop across different continents including temperate and subtropical regions in Europe, Canada, South Asia, China and Australia. Its widespread cultivation also brings setbacks as it plays host to fungal, oomycete and chytrid pathogens that can lead to serious yield loss. For sustainable crop production, identification of resistance (R) genes in B. napus has become of critical importance. In this review, we discuss four key pathogens affecting Brassica crops: Clubroot (Plasmodiophora brassicae), Blackleg (Leptosphaeria maculans and L. biglobosa), Sclerotinia Stem Rot (Sclerotinia sclerotiorum), and Downy Mildew (Hyaloperonospora parasitica). We first review current studies covering prevalence of these pathogens on Brassica crops and highlight the R genes and QTL that have been identified from Brassica species against these pathogens. Insights into the relationships between the pathogen and its Brassica host, the unique host resistance mechanisms and how these affect resistance outcomes is also presented. We discuss challenges in identification and deployment of R genes in B. napus in relation to highly specific genetic interactions between host subpopulations and pathogen pathotypes and emphasize the need for common or shared techniques and research materials or tighter collaboration between researchers to reconcile the inconsistencies in the research outcomes. Using current genomics tools, we provide examples of how characterization and cloning of R genes in B. napus can be carried out more effectively. Lastly, we put forward strategies to breed resistant cultivars through introgressions supported by genomic approaches and suggest prospects that can be implemented in the future for a better, pathogen-resistant B. napus. PMID:29163558

  9. Current Status and Challenges in Identifying Disease Resistance Genes in Brassica napus

    Directory of Open Access Journals (Sweden)

    Ting Xiang Neik


    Full Text Available Brassica napus is an economically important crop across different continents including temperate and subtropical regions in Europe, Canada, South Asia, China and Australia. Its widespread cultivation also brings setbacks as it plays host to fungal, oomycete and chytrid pathogens that can lead to serious yield loss. For sustainable crop production, identification of resistance (R genes in B. napus has become of critical importance. In this review, we discuss four key pathogens affecting Brassica crops: Clubroot (Plasmodiophora brassicae, Blackleg (Leptosphaeria maculans and L. biglobosa, Sclerotinia Stem Rot (Sclerotinia sclerotiorum, and Downy Mildew (Hyaloperonospora parasitica. We first review current studies covering prevalence of these pathogens on Brassica crops and highlight the R genes and QTL that have been identified from Brassica species against these pathogens. Insights into the relationships between the pathogen and its Brassica host, the unique host resistance mechanisms and how these affect resistance outcomes is also presented. We discuss challenges in identification and deployment of R genes in B. napus in relation to highly specific genetic interactions between host subpopulations and pathogen pathotypes and emphasize the need for common or shared techniques and research materials or tighter collaboration between researchers to reconcile the inconsistencies in the research outcomes. Using current genomics tools, we provide examples of how characterization and cloning of R genes in B. napus can be carried out more effectively. Lastly, we put forward strategies to breed resistant cultivars through introgressions supported by genomic approaches and suggest prospects that can be implemented in the future for a better, pathogen-resistant B. napus.

  10. Genome-Wide Distribution, Organisation and Functional Characterization of Disease Resistance and Defence Response Genes across Rice Species (United States)

    Singh, Sangeeta; Chand, Suresh; Singh, N. K.; Sharma, Tilak Raj


    The resistance (R) genes and defense response (DR) genes have become very important resources for the development of disease resistant cultivars. In the present investigation, genome-wide identification, expression, phylogenetic and synteny analysis was done for R and DR-genes across three species of rice viz: Oryza sativa ssp indica cv 93-11, Oryza sativa ssp japonica and wild rice species, Oryza brachyantha. We used the in silico approach to identify and map 786 R -genes and 167 DR-genes, 672 R-genes and 142 DR-genes, 251 R-genes and 86 DR-genes in the japonica, indica and O. brachyanth a genomes, respectively. Our analysis showed that 60.5% and 55.6% of the R-genes are tandemly repeated within clusters and distributed over all the rice chromosomes in indica and japonica genomes, respectively. The phylogenetic analysis along with motif distribution shows high degree of conservation of R- and DR-genes in clusters. In silico expression analysis of R-genes and DR-genes showed more than 85% were expressed genes showing corresponding EST matches in the databases. This study gave special emphasis on mechanisms of gene evolution and duplication for R and DR genes across species. Analysis of paralogs across rice species indicated 17% and 4.38% R-genes, 29% and 11.63% DR-genes duplication in indica and Oryza brachyantha, as compared to 20% and 26% duplication of R-genes and DR-genes in japonica respectively. We found that during the course of duplication only 9.5% of R- and DR-genes changed their function and rest of the genes have maintained their identity. Syntenic relationship across three genomes inferred that more orthology is shared between indica and japonica genomes as compared to brachyantha genome. Genome wide identification of R-genes and DR-genes in the rice genome will help in allele mining and functional validation of these genes, and to understand molecular mechanism of disease resistance and their evolution in rice and related species. PMID:25902056

  11. Comparative genomic and transcriptomic analysis of selected fatty acid biosynthesis genes and CNL disease resistance genes in oil palm (United States)

    Rosli, Rozana; Amiruddin, Nadzirah; Ab Halim, Mohd Amin; Chan, Pek-Lan; Chan, Kuang-Lim; Azizi, Norazah; Morris, Priscilla E.; Leslie Low, Eng-Ti; Ong-Abdullah, Meilina; Sambanthamurthi, Ravigadevi; Singh, Rajinder


    Comparative genomics and transcriptomic analyses were performed on two agronomically important groups of genes from oil palm versus other major crop species and the model organism, Arabidopsis thaliana. The first analysis was of two gene families with key roles in regulation of oil quality and in particular the accumulation of oleic acid, namely stearoyl ACP desaturases (SAD) and acyl-acyl carrier protein (ACP) thioesterases (FAT). In both cases, these were found to be large gene families with complex expression profiles across a wide range of tissue types and developmental stages. The detailed classification of the oil palm SAD and FAT genes has enabled the updating of the latest version of the oil palm gene model. The second analysis focused on disease resistance (R) genes in order to elucidate possible candidates for breeding of pathogen tolerance/resistance. Ortholog analysis showed that 141 out of the 210 putative oil palm R genes had homologs in banana and rice. These genes formed 37 clusters with 634 orthologous genes. Classification of the 141 oil palm R genes showed that the genes belong to the Kinase (7), CNL (95), MLO-like (8), RLK (3) and Others (28) categories. The CNL R genes formed eight clusters. Expression data for selected R genes also identified potential candidates for breeding of disease resistance traits. Furthermore, these findings can provide information about the species evolution as well as the identification of agronomically important genes in oil palm and other major crops. PMID:29672525

  12. Comparative genomic and transcriptomic analysis of selected fatty acid biosynthesis genes and CNL disease resistance genes in oil palm. (United States)

    Rosli, Rozana; Amiruddin, Nadzirah; Ab Halim, Mohd Amin; Chan, Pek-Lan; Chan, Kuang-Lim; Azizi, Norazah; Morris, Priscilla E; Leslie Low, Eng-Ti; Ong-Abdullah, Meilina; Sambanthamurthi, Ravigadevi; Singh, Rajinder; Murphy, Denis J


    Comparative genomics and transcriptomic analyses were performed on two agronomically important groups of genes from oil palm versus other major crop species and the model organism, Arabidopsis thaliana. The first analysis was of two gene families with key roles in regulation of oil quality and in particular the accumulation of oleic acid, namely stearoyl ACP desaturases (SAD) and acyl-acyl carrier protein (ACP) thioesterases (FAT). In both cases, these were found to be large gene families with complex expression profiles across a wide range of tissue types and developmental stages. The detailed classification of the oil palm SAD and FAT genes has enabled the updating of the latest version of the oil palm gene model. The second analysis focused on disease resistance (R) genes in order to elucidate possible candidates for breeding of pathogen tolerance/resistance. Ortholog analysis showed that 141 out of the 210 putative oil palm R genes had homologs in banana and rice. These genes formed 37 clusters with 634 orthologous genes. Classification of the 141 oil palm R genes showed that the genes belong to the Kinase (7), CNL (95), MLO-like (8), RLK (3) and Others (28) categories. The CNL R genes formed eight clusters. Expression data for selected R genes also identified potential candidates for breeding of disease resistance traits. Furthermore, these findings can provide information about the species evolution as well as the identification of agronomically important genes in oil palm and other major crops.

  13. The diversity of antimicrobial resistance genes among staphylococci of animal origin. (United States)

    Wendlandt, Sarah; Feßler, Andrea T; Monecke, Stefan; Ehricht, Ralf; Schwarz, Stefan; Kadlec, Kristina


    Staphylococci of animal origin harbor a wide variety of resistance genes. So far, more than 40 different resistance genes have been identified in staphylococci from animals. This includes genes that confer resistance to virtually all classes of antimicrobial agents approved for use in animals, such as penicillins, cephalosporins, tetracyclines, macrolides, lincosamides, phenicols, aminoglycosides, aminocyclitols, pleuromutilins, and diaminopyrimidines. The gene products of some of these resistance genes confer resistance to only specific members of a class of antimicrobial agents, whereas others confer resistance to the entire class or even to members of different classes of antimicrobial agents. The resistance mechanisms specified by the resistance genes fall into three major categories: (i) enzymatic inactivation, (ii) active efflux, or (iii) protection/modification/replacement of the cellular target sites of the antimicrobial agents. Mobile genetic elements, in particular plasmids and transposons, play a major role as carriers of antimicrobial resistance genes in animal staphylococci. They facilitate the exchange of resistance genes with staphylococci of human origin but also with other Gram-positive bacteria. Copyright © 2013 Elsevier GmbH. All rights reserved.

  14. Thioridazine affects transcription of genes involved in cell wall biosynthesis in methicillin-resistant Staphylococcus aureus

    DEFF Research Database (Denmark)

    Bonde, Mette; Højland, Dorte Heidi; Kolmos, Hans Jørn


    have previously shown that the expression of some resistance genes is abolished after treatment with thioridazine and oxacillin. To further understand the mechanism underlying the reversal of resistance, we tested the expression of genes involved in antibiotic resistance and cell wall biosynthesis...... in response to thioridazine in combination with oxacillin. We observed that the oxacillin-induced expression of genes belonging to the VraSR regulon is reduced by the addition of thioridazine. The exclusion of such key factors involved in cell wall biosynthesis will most likely lead to a weakened cell wall...... reversal of resistance by thioridazine relies on decreased expression of specific genes involved in cell wall biosynthesis....

  15. Candidate genes for cross-resistance against DNA-damaging drugs

    DEFF Research Database (Denmark)

    Wittig, Rainer; Nessling, Michelle; Will, Rainer D


    Drug resistance of tumor cells leads to major drawbacks in the treatment of cancer. To identify candidate genes for drug resistance, we compared the expression patterns of the drug-sensitive human malignant melanoma cell line MeWo and three derived sublines with acquired resistance to the DNA...... as several apoptosis-related genes, in particular STK17A and CRYAB. As MPP1 and CRYAB are also among the 14 genes differentially expressed in all three of the drug-resistant sublines, they represent the strongest candidates for resistance against DNA-damaging drugs....

  16. Antibiotic resistance genes in anaerobic bacteria isolated from primary dental root canal infections. (United States)

    Rôças, Isabela N; Siqueira, José F


    Fourty-one bacterial strains isolated from infected dental root canals and identified by 16S rRNA gene sequence were screened for the presence of 14 genes encoding resistance to beta-lactams, tetracycline and macrolides. Thirteen isolates (32%) were positive for at least one of the target antibiotic resistance genes. These strains carrying at least one antibiotic resistance gene belonged to 11 of the 26 (42%) infected root canals sampled. Two of these positive cases had two strains carrying resistance genes. Six out of 7 Fusobacterium strains harbored at least one of the target resistance genes. One Dialister invisus strain was positive for 3 resistance genes, and 4 other strains carried two of the target genes. Of the 6 antibiotic resistance genes detected in root canal strains, the most prevalent were blaTEM (17% of the strains), tetW (10%), and ermC (10%). Some as-yet-uncharacterized Fusobacterium and Prevotella isolates were positive for blaTEM, cfxA and tetM. Findings demonstrated that an unexpectedly large proportion of dental root canal isolates, including as-yet-uncharacterized strains previously regarded as uncultivated phylotypes, can carry antibiotic resistance genes. Copyright © 2012 Elsevier Ltd. All rights reserved.

  17. Evaluation of an expanded microarray for detecting antibiotic resistance genes in a broad range of gram-negative bacterial pathogens. (United States)

    Card, Roderick; Zhang, Jiancheng; Das, Priya; Cook, Charlotte; Woodford, Neil; Anjum, Muna F


    A microarray capable of detecting genes for resistance to 75 clinically relevant antibiotics encompassing 19 different antimicrobial classes was tested on 132 Gram-negative bacteria. Microarray-positive results correlated >91% with antimicrobial resistance phenotypes, assessed using British Society for Antimicrobial Chemotherapy clinical breakpoints; the overall test specificity was >83%. Microarray-positive results without a corresponding resistance phenotype matched 94% with PCR results, indicating accurate detection of genes present in the respective bacteria by microarray when expression was low or absent and, hence, undetectable by susceptibility testing. The low sensitivity and negative predictive values of the microarray results for identifying resistance to some antimicrobial resistance classes are likely due to the limited number of resistance genes present on the current microarray for those antimicrobial agents or to mutation-based resistance mechanisms. With regular updates, this microarray can be used for clinical diagnostics to help accurate therapeutic options to be taken following infection with multiple-antibiotic-resistant Gram-negative bacteria and prevent treatment failure.

  18. Prevalence and characterization of plasmids carrying sulfonamide resistance genes among Escherichia coli from pigs, pig carcasses and human

    DEFF Research Database (Denmark)

    Shuyu, Wu; Dalsgaard, A.; Hammerum, A. M.


    isolates. Fifty-seven sulfonamide-resistant E. coli were selected based on presence of sul resistance genes and subjected to conjugation and/or transformation experiments. S1 nuclease digestion followed by pulsed-field gel electrophoresis was used to visualize and determine the size of plasmids. Plasmids...... and humans) were 65%, 45% and 12% for sul2, sul1, and sul3, respectively. Transfer of resistance through conjugation was observed in 42/57 isolates. Resistances to streptomycin, ampicillin and trimethoprim were co-transferred in most strains. Class 1 integrons were present in 80% of sul1-carrying plasmids...

  19. The CAPN10 Gene Is Associated with Insulin Resistance Phenotypes in the Spanish Population (United States)

    Sáez, María E.; González-Sánchez, José L.; Ramírez-Lorca, Reposo; Martínez-Larrad, María T.; Zabena, Carina; González, Alejandro; Morón, Francisco J.; Ruiz, Agustín; Serrano-Ríos, Manuel


    Cardiovascular disease is the leading cause of morbidity and mortality in the industrialized world. Familial aggregation of cardiovascular risk factors is a frequent finding, but genetic factors affecting its presentation are still poorly understood. The calpain 10 gene (CAPN10) has been associated with type 2 diabetes (T2DM), a complex metabolic disorder with increased risk of cardiovascular disease. Moreover, the CAPN10 gene has been associated with the presence of metabolic syndrome (MS) in T2DM and in polycystic ovary syndrome (PCOS). In this work, we have analysed whether the polymorphisms UCSNP44, -43, -19 and -63 are related to several cardiovascular risk factors in the context of MS. Molecular analysis of CAPN10 gene was performed in 899 individuals randomly chosen from a cross-sectional population-based epidemiological survey. We have found that CAPN10 gene in our population is mainly associated with two indicators of the presence of insulin resistance: glucose levels two hours after a 75-g oral glucose tolerance test (OGTT) and HOMA values, although cholesterol levels and blood pressure values are also influenced by CAPN10 variants. In addition, the 1221/1121 haplogenotype is under-represented in individuals that fulfil the International Diabetes Federation (IDF) diagnostic criteria for MS. Our results suggest that CAPN10 gene is associated with insulin resistance phenotypes in the Spanish population. PMID:18698425

  20. The CAPN10 gene is associated with insulin resistance phenotypes in the Spanish population.

    Directory of Open Access Journals (Sweden)

    María E Sáez

    Full Text Available Cardiovascular disease is the leading cause of morbidity and mortality in the industrialized world. Familial aggregation of cardiovascular risk factors is a frequent finding, but genetic factors affecting its presentation are still poorly understood. The calpain 10 gene (CAPN10 has been associated with type 2 diabetes (T2DM, a complex metabolic disorder with increased risk of cardiovascular disease. Moreover, the CAPN10 gene has been associated with the presence of metabolic syndrome (MS in T2DM and in polycystic ovary syndrome (PCOS. In this work, we have analysed whether the polymorphisms UCSNP44, -43, -19 and -63 are related to several cardiovascular risk factors in the context of MS. Molecular analysis of CAPN10 gene was performed in 899 individuals randomly chosen from a cross-sectional population-based epidemiological survey. We have found that CAPN10 gene in our population is mainly associated with two indicators of the presence of insulin resistance: glucose levels two hours after a 75-g oral glucose tolerance test (OGTT and HOMA values, although cholesterol levels and blood pressure values are also influenced by CAPN10 variants. In addition, the 1221/1121 haplogenotype is under-represented in individuals that fulfil the International Diabetes Federation (IDF diagnostic criteria for MS. Our results suggest that CAPN10 gene is associated with insulin resistance phenotypes in the Spanish population.

  1. Gene Expression Profiling and Identification of Resistance Genes to Aspergillus flavus Infection in Peanut through EST and Microarray Strategies

    Directory of Open Access Journals (Sweden)

    Baozhu Guo


    Full Text Available Aspergillus flavus and A. parasiticus infect peanut seeds and produce aflatoxins, which are associated with various diseases in domestic animals and humans throughout the world. The most cost-effective strategy to minimize aflatoxin contamination involves the development of peanut cultivars that are resistant to fungal infection and/or aflatoxin production. To identify peanut Aspergillus-interactive and peanut Aspergillus-resistance genes, we carried out a large scale peanut Expressed Sequence Tag (EST project which we used to construct a peanut glass slide oligonucleotide microarray. The fabricated microarray represents over 40% of the protein coding genes in the peanut genome. For expression profiling, resistant and susceptible peanut cultivars were infected with a mixture of Aspergillus flavus and parasiticus spores. The subsequent microarray analysis identified 62 genes in resistant cultivars that were up-expressed in response to Aspergillus infection. In addition, we identified 22 putative Aspergillus-resistance genes that were constitutively up-expressed in the resistant cultivar in comparison to the susceptible cultivar. Some of these genes were homologous to peanut, corn, and soybean genes that were previously shown to confer resistance to fungal infection. This study is a first step towards a comprehensive genome-scale platform for developing Aspergillus-resistant peanut cultivars through targeted marker-assisted breeding and genetic engineering.

  2. Occurrence and persistence of antibiotic resistance genes in river biofilms after wastewater inputs in small rivers

    International Nuclear Information System (INIS)

    Proia, Lorenzo; Schiller, Daniel von; Sànchez-Melsió, Alexandre; Sabater, Sergi; Borrego, Carles M.; Rodríguez-Mozaz, Sara; Balcázar, José Luis


    The extensive use of antibiotics in human and veterinary medicine and their subsequent release into the environment may have direct consequences for autochthonous bacterial communities, especially in freshwater ecosystems. In small streams and rivers, local inputs of wastewater treatment plants (WWTPs) may become important sources of organic matter, nutrients and emerging pollutants, such as antibiotic resistance genes (ARGs). In this study, we evaluated the effect of WWTP effluents as a source of ARGs in river biofilms. The prevalence of genes conferring resistance to main antibiotic families, such as beta-lactams (bla_C_T_X_-_M), fluoroquinolones (qnrS), sulfonamides (sul I), and macrolides (ermB), was determined using quantitative PCR (qPCR) in biofilm samples collected upstream and downstream WWTPs discharge points in four low-order streams. Our results showed that the WWTP effluents strongly modified the hydrology, physico-chemistry and biological characteristics of the receiving streams and favoured the persistence and spread of antibiotic resistance in microbial benthic communities. It was also shown that the magnitude of effects depended on the relative contribution of each WWTP to the receiving system. Specifically, low concentrations of ARGs were detected at sites located upstream of the WWTPs, while a significant increase of their concentrations was observed in biofilms collected downstream of the WWTP discharge points (particularly ermB and sul I genes). These findings suggest that WWTP discharges may favour the increase and spread of antibiotic resistance among streambed biofilms. The present study also showed that the presence of ARGs in biofilms was noticeable far downstream of the WWTP discharge (up to 1 km). It is therefore reasonable to assume that biofilms may represent an ideal setting for the acquisition and spread of antibiotic resistance determinants and thus be considered suitable biological indicators of anthropogenic pollution by active

  3. Modulation of human multidrug-resistance MDR-1 gene by natural curcuminoids

    Directory of Open Access Journals (Sweden)

    Buddhasukh Duang


    Full Text Available Abstract Background Multidrug resistance (MDR is a phenomenon that is often associated with decreased intracellular drug accumulation in patient's tumor cells resulting from enhanced drug efflux. It is related to the overexpression of a membrane protein, P-glycoprotein (Pgp-170, thereby reducing drug cytotoxicity. A variety of studies have tried to find MDR modulators which increase drug accumulation in cancer cells. Methods In this study, natural curcuminoids, pure curcumin, demethoxycurcumin and bisdemethoxycurcumin, isolated from turmeric (Curcuma longa Linn, were compared for their potential ability to modulate the human MDR-1 gene expression in multidrug resistant human cervical carcinoma cell line, KB-V1 by Western blot analysis and RT-PCR. Results Western blot analysis and RT-PCR showed that all the three curcuminoids inhibited MDR-1 gene expression, and bisdemethoxycurcumin produced maximum effect. In additional studies we found that commercial grade curcuminoid (approximately 77% curcumin, 17% demethoxycurcumin and 3% bisdemthoxycurcumin decreased MDR-1 gene expression in a dose dependent manner and had about the same potent inhibitory effect on MDR-1 gene expression as our natural curcuminoid mixtures. Conclusion These results indicate that bisdemethoxycurcumin is the most active of the curcuminoids present in turmeric for modulation of MDR-1 gene. Treatment of drug resistant KB-V1 cells with curcumin increased their sensitivity to vinblastine, which was consistent with a decreased MDR-1 gene product, a P-glycoprotein, on the cell plasma membrane. Although many drugs that prevent the P-glycoprotein function have been reported, this report describes the inhibition of MDR-1 expression by a phytochemical. The modulation of MDR-1 expression may be an attractive target for new chemosensitizing agents.

  4. Modulation of human multidrug-resistance MDR-1 gene by natural curcuminoids

    International Nuclear Information System (INIS)

    Limtrakul, Pornngarm; Anuchapreeda, Songyot; Buddhasukh, Duang


    Multidrug resistance (MDR) is a phenomenon that is often associated with decreased intracellular drug accumulation in patient's tumor cells resulting from enhanced drug efflux. It is related to the overexpression of a membrane protein, P-glycoprotein (Pgp-170), thereby reducing drug cytotoxicity. A variety of studies have tried to find MDR modulators which increase drug accumulation in cancer cells. In this study, natural curcuminoids, pure curcumin, demethoxycurcumin and bisdemethoxycurcumin, isolated from turmeric (Curcuma longa Linn), were compared for their potential ability to modulate the human MDR-1 gene expression in multidrug resistant human cervical carcinoma cell line, KB-V1 by Western blot analysis and RT-PCR. Western blot analysis and RT-PCR showed that all the three curcuminoids inhibited MDR-1 gene expression, and bisdemethoxycurcumin produced maximum effect. In additional studies we found that commercial grade curcuminoid (approximately 77% curcumin, 17% demethoxycurcumin and 3% bisdemthoxycurcumin) decreased MDR-1 gene expression in a dose dependent manner and had about the same potent inhibitory effect on MDR-1 gene expression as our natural curcuminoid mixtures. These results indicate that bisdemethoxycurcumin is the most active of the curcuminoids present in turmeric for modulation of MDR-1 gene. Treatment of drug resistant KB-V1 cells with curcumin increased their sensitivity to vinblastine, which was consistent with a decreased MDR-1 gene product, a P-glycoprotein, on the cell plasma membrane. Although many drugs that prevent the P-glycoprotein function have been reported, this report describes the inhibition of MDR-1 expression by a phytochemical. The modulation of MDR-1 expression may be an attractive target for new chemosensitizing agents

  5. Alteration of gene expression and DNA methylation in drug-resistant gastric cancer. (United States)

    Maeda, Osamu; Ando, Takafumi; Ohmiya, Naoki; Ishiguro, Kazuhiro; Watanabe, Osamu; Miyahara, Ryoji; Hibi, Yoko; Nagai, Taku; Yamada, Kiyofumi; Goto, Hidemi


    The mechanisms of drug resistance in cancer are not fully elucidated. To study the drug resistance of gastric cancer, we analyzed gene expression and DNA methylation profiles of 5-fluorouracil (5-FU)- and cisplatin (CDDP)-resistant gastric cancer cells and biopsy specimens. Drug-resistant gastric cancer cells were established with culture for >10 months in a medium containing 5-FU or CDDP. Endoscopic biopsy specimens were obtained from gastric cancer patients who underwent chemotherapy with oral fluoropyrimidine S-1 and CDDP. Gene expression and DNA methylation analyses were performed using microarray, and validated using real-time PCR and pyrosequencing, respectively. Out of 17,933 genes, 541 genes commonly increased and 569 genes decreased in both 5-FU- and CDDP-resistant AGS cells. Genes with expression changed by drugs were related to GO term 'extracellular region' and 'p53 signaling pathway' in both 5-FU- and CDDP-treated cells. Expression of 15 genes including KLK13 increased and 12 genes including ETV7 decreased, in both drug-resistant cells and biopsy specimens of two patients after chemotherapy. Out of 10,365 genes evaluated with both expression microarray and methylation microarray, 74 genes were hypermethylated and downregulated, or hypomethylated and upregulated in either 5-FU-resistant or CDDP-resistant cells. Of these genes, expression of 21 genes including FSCN1, CPT1C and NOTCH3, increased from treatment with a demethylating agent. There are alterations of gene expression and DNA methylation in drug-resistant gastric cancer; they may be related to mechanisms of drug resistance and may be useful as biomarkers of gastric cancer drug sensitivity.

  6. An ace-1 gene duplication resorbs the fitness cost associated with resistance in Anopheles gambiae, the main malaria mosquito. (United States)

    Assogba, Benoît S; Djogbénou, Luc S; Milesi, Pascal; Berthomieu, Arnaud; Perez, Julie; Ayala, Diego; Chandre, Fabrice; Makoutodé, Michel; Labbé, Pierrick; Weill, Mylène


    Widespread resistance to pyrethroids threatens malaria control in Africa. Consequently, several countries switched to carbamates and organophophates insecticides for indoor residual spraying. However, a mutation in the ace-1 gene conferring resistance to these compounds (ace-1(R) allele), is already present. Furthermore, a duplicated allele (ace-1(D)) recently appeared; characterizing its selective advantage is mandatory to evaluate the threat. Our data revealed that a unique duplication event, pairing a susceptible and a resistant copy of the ace-1 gene spread through West Africa. Further investigations revealed that, while ace-1(D) confers less resistance than ace-1(R), the high fitness cost associated with ace-1(R) is almost completely suppressed by the duplication for all traits studied. ace-1 duplication thus represents a permanent heterozygote phenotype, selected, and thus spreading, due to the mosaic nature of mosquito control. It provides malaria mosquito with a new evolutionary path that could hamper resistance management.

  7. Nalidixic acid-resistant Salmonella enteric serotype typhi infection presenting with sub-intestinal obstruction and mesenteric adenitis

    International Nuclear Information System (INIS)

    Al-Khuwaitir, Tarig S.; Al-Zuhair, Amin A.; Al-Ghamdi, Ali G.; Khan, A.


    Nalidixic acid-resistant Salmonella typhi NARST infections increase minimal inhibitory concentrations of fluoroquinolones, due to chromosomal mutations in the gene encoding DNA gyrase, and can lead to a delayed treatment response. This in turn alters the course of the disease allowing for a protracted period of illness and the occurrence of complications. In this case report, we present a patient from the Indian sub-continent, who was diagnosed with NARST complicated by sub-intestinal obstruction, her diagnosis, treatment and subsequent recovery. (author)

  8. Class 1 and 2 integrons, sul resistance genes and antibiotic resistance in Escherichia coli isolated from Dongjiang River, South China

    International Nuclear Information System (INIS)

    Su Haochang; Ying Guangguo; Tao Ran; Zhang Ruiquan; Zhao Jianliang; Liu Yousheng


    Antibiotic susceptibility, detection of sul gene types and presence of class 1, 2 and 3 integrons and gene cassettes using PCR assays were investigated in 3456 Escherichia coli isolates obtained from 38 sampling sites of the Dongjiang River catchment in the dry and wet seasons. 89.1% of the isolates were resistant and 87.5% showed resistance to at least three antibiotics. sul2 was detected most frequently in 89.2% of 1403 SXT-resistant isolates. The presence of integrons (class 1 and 2) was frequently observed (82.3%) while no class 3 integron was found. In these integrons, 21 resistance genes of 14 gene cassette arrays and 10 different families of resistance genes were identified. Three gene cassette arrays, aac(6')-Ib-cr-aar-3-dfrA27-aadA16, aacA4-catB3-dfrA1 and aadA2-lnuF, were detected for the first time in surface water. The results showed that bacterial resistance in the catchment was seriously influenced by human activities, especially discharge of wastewater. Highlights: ► Antibiotic resistance was investigated for a river catchment of southern China. ► 87.5% of E coli isolates showed resistance to at least three antibiotics. ► The presence of integrons (class 1 and 2) was frequently observed (82.3%). ► Bacterial resistance in the catchment was seriously influenced by human activities. - Bacterial resistance to antibiotics in a catchment is related to the discharge of wastewater into the aquatic environment.

  9. Phylogenetic relatedness determined between antibiotic resistance and 16S rRNA genes in actinobacteria. (United States)

    Sagova-Mareckova, Marketa; Ulanova, Dana; Sanderova, Petra; Omelka, Marek; Kamenik, Zdenek; Olsovska, Jana; Kopecky, Jan


    Distribution and evolutionary history of resistance genes in environmental actinobacteria provide information on intensity of antibiosis and evolution of specific secondary metabolic pathways at a given site. To this day, actinobacteria producing biologically active compounds were isolated mostly from soil but only a limited range of soil environments were commonly sampled. Consequently, soil remains an unexplored environment in search for novel producers and related evolutionary questions. Ninety actinobacteria strains isolated at contrasting soil sites were characterized phylogenetically by 16S rRNA gene, for presence of erm and ABC transporter resistance genes and antibiotic production. An analogous analysis was performed in silico with 246 and 31 strains from Integrated Microbial Genomes (JGI_IMG) database selected by the presence of ABC transporter genes and erm genes, respectively. In the isolates, distances of erm gene sequences were significantly correlated to phylogenetic distances based on 16S rRNA genes, while ABC transporter gene distances were not. The phylogenetic distance of isolates was significantly correlated to soil pH and organic matter content of isolation sites. In the analysis of JGI_IMG datasets the correlation between phylogeny of resistance genes and the strain phylogeny based on 16S rRNA genes or five housekeeping genes was observed for both the erm genes and ABC transporter genes in both actinobacteria and streptomycetes. However, in the analysis of sequences from genomes where both resistance genes occurred together the correlation was observed for both ABC transporter and erm genes in actinobacteria but in streptomycetes only in the erm gene. The type of erm resistance gene sequences was influenced by linkage to 16S rRNA gene sequences and site characteristics. The phylogeny of ABC transporter gene was correlated to 16S rRNA genes mainly above the genus level. The results support the concept of new specific secondary metabolite

  10. Salt resistance genes revealed by functional metagenomics from brines and moderate-salinity rhizosphere within a hypersaline environment

    Directory of Open Access Journals (Sweden)

    Salvador eMirete


    Full Text Available Hypersaline environments are considered one of the most extreme habitats on earth and microorganisms have developed diverse molecular mechanisms of adaptation to withstand these conditions. The present study was aimed at identifying novel genes involved in salt resistance from the microbial communities of brines and the rhizosphere from the Es Trenc saltern (Mallorca, Spain. The microbial diversity assessed by pyrosequencing of 16S rRNA gene libraries revealed the presence of communities that are typical in such environments. Metagenomic libraries from brine and rhizosphere samples, were transferred to the osmosensitive strain Escherichia coli MKH13, and screened for salt resistance. As a result, eleven genes that conferred salt resistance were identified, some encoding for well known proteins previously related to osmoadaptation as a glycerol and a proton pump, whereas others encoded for proteins not previously related to this function in microorganisms as DNA/RNA helicases, an endonuclease III (Nth and hypothetical proteins of unknown function. Furthermore, four of the retrieved genes were cloned and expressed in Bacillus subtilis and they also exhibited salt resistance in this bacterium, broadening the spectrum of bacterial species where these genes can operate. This is the first report of salt resistance genes recovered from metagenomes of a hypersaline environment.

  11. Genetic mapping, marker assisted selection and allelic relationships for the Pu 6 gene conferring rust resistance in sunflower. (United States)

    Bulos, Mariano; Vergani, Pablo Nicolas; Altieri, Emiliano


    Rust resistance in the sunflower line P386 is controlled by Pu 6 , a gene which was reported to segregate independently from other rust resistant genes, such as R 4 . The objectives of this work were to map Pu 6 , to provide and validate molecular tools for its identification, and to determine the linkage relationship of Pu 6 and R 4 . Genetic mapping of Pu 6 with six markers covered 24.8 cM of genetic distance on the lower end of linkage Group 13 of the sunflower consensus map. The marker most closely linked to Pu 6 was ORS316 at 2.5 cM in the distal position. ORS316 presented five alleles when was assayed with a representative set of resistant and susceptible lines. Allelism test between Pu 6 and R 4 indicated that both genes are linked at a genetic distance of 6.25 cM. This is the first confirmation based on an allelism test that at least two members of the R adv /R 4 /R 11 / R 13a /R 13b /Pu 6 cluster of genes are at different loci. A fine elucidation of the architecture of this complex locus will allow designing and constructing completely new genomic regions combining genes from different resistant sources and the elimination of the linkage drag around each resistant gene.

  12. Retail ready-to-eat food as a potential vehicle for Staphylococcus spp. harboring antibiotic resistance genes. (United States)

    Chajęcka-Wierzchowska, Wioleta; Zadernowska, Anna; Nalepa, Beata; Sierpińska, Magda; Laniewska-Trokenheim, Lucja


    Ready-to-eat (RTE) food, which does not need thermal processing before consumption, could be a vehicle for the spread of antibiotic-resistant microorganisms. As part of general microbiological safety checks, staphylococci are routinely enumerated in these kinds of foods. However, the presence of antibiotic-resistant staphylococci in RTE food is not routinely investigated, and data are only available from a small number of studies. The present study evaluated the pheno- and genotypical antimicrobial resistance profile of Staphylococcus spp. isolated from 858 RTE foods (cheeses, cured meats, sausages, smoked fishes, salads). Of 113 strains isolated, S. aureus was the most prevalent species, followed by S. xylosus, S. saprophyticus, and S. epidermidis. More than half (54.9%) of the isolates were resistant to at least one class of tested antibiotic; of these, 35.4% of the strains were classified as multidrug resistant. Most of the isolates were resistant to cefoxitin (49.6%), followed by clindamycin (39.3%), tigecycline (27.4%), quinupristin-dalfopristin (22.2%), rifampin (20.5%), tetracycline (17.9%), and erythromycin (8.5%). All methicillin-resistant staphylococci harbored the mecA gene. Among the isolates resistant to at least one antibiotic, 38 harbored tetracycline resistance determinant tet (M), 24 harbored tet (L), and 9 harbored tet (K). Of the isolates positive for tet (M) genes, 34.2% were positive for the Tn916-Tn1545-like integrase family gene. Our results indicated that retail RTE food could be considered an important route for the transmission of antibiotic-resistant bacteria harboring multiple antibiotic resistance genes.

  13. Prevalence of the Antibiotic Resistance Genes in Coagulase-Positive-and Negative-Staphylococcus in Chicken Meat Retailed to Consumers. (United States)

    Osman, Kamelia; Badr, Jihan; Al-Maary, Khalid S; Moussa, Ihab M I; Hessain, Ashgan M; Girah, Zeinab M S Amin; Abo-Shama, Usama H; Orabi, Ahmed; Saad, Aalaa


    The use of antibiotics in farm management (growing crops and raising animals) has become a major area of concern. Its implications is the consequent emergence of antibiotic resistant bacteria (ARB) and accordingly their access into the human food chain with passage of antibiotic resistance genes (ARG) to the normal human intestinal microbiota and hence to other pathogenic bacteria causative human disease. Therefore, we pursued in this study to unravel the frequency and the quinolone resistance determining region, mec A and cfr genes of methicillin-susceptible Staphylococcus aureus (MSSA), methicillin-resistant S. aureus (MRSA), methicillin-resistant coagulase-negative staphylococci (MRCNS) and methicillin-susceptible coagulase-negative staphylococci (MSCNS) isolated from the retail trade of ready-to-eat raw chicken meat samples collected during 1 year and sold across the Great Cairo area. The 50 Staphylococcus isolated from retail raw chicken meat were analyzed for their antibiotic resistance phenotypic profile on 12 antibiotics (penicillin, oxacillin, methicillin, ampicillin-sulbactam, erythromycin, tetracycline, clindamycin, gentamicin, ciprofloxacin, chloramphenicol, sulfamethoxazole-trimethoprim, and vancomycin) and their endorsement of the quinolone resistance determining region, mec A and cfr genes. The isolation results revealed 50 isolates, CPS (14) and CNS (36), representing ten species ( S. aureus, S. hyicus, S. epidermedius, S. lugdunensis, S. haemolyticus, S. hominus, S. schleiferi, S. cohnii, S. intermedius , and S. lentus ). Twenty seven isolates were methicillin-resistant. Out of the characterized 50 staphylococcal isolates, three were MRSA but only 2/3 carried the mec A gene. The ARG that bestows resistance to quinolones, β-lactams, macrolides, lincosamides, and streptogramin B [MLS( B )] in MRSA and MR-CNS were perceived. According to the available literature, the present investigation was a unique endeavor into the identification of the quinolone-resistance

  14. Antibiotic Resistant Bacteria And Their Associated Resistance Genes in a Conventional Municipal Wastewater Treatment Plant

    KAUST Repository

    Aljassim, Nada I.


    With water scarcity as a pressing issue in Saudi Arabia and other Middle Eastern countries, the treatment and reuse of municipal wastewater is increasingly being used as an alternative water source to supplement country water needs. Standards are in place to ensure a safe treated wastewater quality, however they do not regulate pathogenic bacteria and emerging contaminants. Information is lacking on the levels of risk to public health associated with these factors, the efficiency of conventional treatment strategies in removing them, and on wastewater treatment in Saudi Arabia in general. In this study, a municipal wastewater treatment plant in Saudi Arabia is investigated to assess the efficiency of conventional treatment in meeting regulations and removing pathogens and emerging contaminants. The study found pathogenic bacterial genera, antibiotic resistance genes and antibiotic resistant bacteria, many of which were multi-resistant in plant discharges. It was found that although the treatments are able to meet traditional quality guidelines, there remains a risk from the discussed contaminants with wastewater reuse. A deeper understanding of this risk, and suggestions for more thorough guidelines and monitoring are needed.

  15. A Gene Homologous to rRNA Methylase Genes Confers Erythromycin and Clindamycin Resistance in Bifidobacterium breve. (United States)

    Martínez, Noelia; Luque, Roberto; Milani, Christian; Ventura, Marco; Bañuelos, Oscar; Margolles, Abelardo


    Bifidobacteria are mutualistic intestinal bacteria, and their presence in the human gut has been associated with health-promoting activities. The presence of antibiotic resistance genes in this genus is controversial, since, although bifidobacteria are nonpathogenic microorganisms, they could serve as reservoirs of resistance determinants for intestinal pathogens. However, until now, few antibiotic resistance determinants have been functionally characterized in this genus. In this work, we show that Bifidobacterium breve CECT7263 displays atypical resistance to erythromycin and clindamycin. In order to delimit the genomic region responsible for the observed resistance phenotype, a library of genomic DNA was constructed and a fragment of 5.8 kb containing a gene homologous to rRNA methylase genes was able to confer erythromycin resistance in Escherichia coli This genomic region seems to be very uncommon, and homologs of the gene have been detected in only one strain of Bifidobacterium longum and two other strains of B. breve In this context, analysis of shotgun metagenomics data sets revealed that the gene is also uncommon in the microbiomes of adults and infants. The structural gene and its upstream region were cloned into a B. breve -sensitive strain, which became resistant after acquiring the genetic material. In vitro conjugation experiments did not allow us to detect gene transfer to other recipients. Nevertheless, prediction of genes potentially acquired through horizontal gene transfer events revealed that the gene is located in a putative genomic island. IMPORTANCE Bifidobacterium breve is a very common human intestinal bacterium. Often described as a pioneer microorganism in the establishment of early-life intestinal microbiota, its presence has been associated with several beneficial effects for the host, including immune stimulation and protection against infections. Therefore, some strains of this species are considered probiotics. In relation to this

  16. Defended to the Nines: 25 Years of Resistance Gene Cloning Identifies Nine Mechanisms for R Protein Function[OPEN (United States)


    Plants have many, highly variable resistance (R) gene loci, which provide resistance to a variety of pathogens. The first R gene to be cloned, maize (Zea mays) Hm1, was published over 25 years ago, and since then, many different R genes have been identified and isolated. The encoded proteins have provided clues to the diverse molecular mechanisms underlying immunity. Here, we present a meta-analysis of 314 cloned R genes. The majority of R genes encode cell surface or intracellular receptors, and we distinguish nine molecular mechanisms by which R proteins can elevate or trigger disease resistance: direct (1) or indirect (2) perception of pathogen-derived molecules on the cell surface by receptor-like proteins and receptor-like kinases; direct (3) or indirect (4) intracellular detection of pathogen-derived molecules by nucleotide binding, leucine-rich repeat receptors, or detection through integrated domains (5); perception of transcription activator-like effectors through activation of executor genes (6); and active (7), passive (8), or host reprogramming-mediated (9) loss of susceptibility. Although the molecular mechanisms underlying the functions of R genes are only understood for a small proportion of known R genes, a clearer understanding of mechanisms is emerging and will be crucial for rational engineering and deployment of novel R genes. PMID:29382771

  17. Defended to the Nines: 25 Years of Resistance Gene Cloning Identifies Nine Mechanisms for R Protein Function. (United States)

    Kourelis, Jiorgos; van der Hoorn, Renier A L


    Plants have many, highly variable resistance ( R ) gene loci, which provide resistance to a variety of pathogens. The first R gene to be cloned, maize ( Zea mays ) Hm1 , was published over 25 years ago, and since then, many different R genes have been identified and isolated. The encoded proteins have provided clues to the diverse molecular mechanisms underlying immunity. Here, we present a meta-analysis of 314 cloned R genes. The majority of R genes encode cell surface or intracellular receptors, and we distinguish nine molecular mechanisms by which R proteins can elevate or trigger disease resistance: direct (1) or indirect (2) perception of pathogen-derived molecules on the cell surface by receptor-like proteins and receptor-like kinases; direct (3) or indirect (4) intracellular detection of pathogen-derived molecules by nucleotide binding, leucine-rich repeat receptors, or detection through integrated domains (5); perception of transcription activator-like effectors through activation of executor genes (6); and active (7), passive (8), or host reprogramming-mediated (9) loss of susceptibility. Although the molecular mechanisms underlying the functions of R genes are only understood for a small proportion of known R genes, a clearer understanding of mechanisms is emerging and will be crucial for rational engineering and deployment of novel R genes. © 2018 American Society of Plant Biologists. All rights reserved.

  18. Listeria monocytogenes isolates from food and food environment harbouring tetM and ermB resistance genes. (United States)

    Haubert, L; Mendonça, M; Lopes, G V; de Itapema Cardoso, M R; da Silva, W P


    Listeria monocytogenes is a foodborne pathogen that has become an important cause of human and animal diseases worldwide. The purpose of this study was to evaluate the serotypes, virulence potential, antimicrobial resistance profile, and genetic relationships of 50 L. monocytogenes isolates from food and food environment in southern Brazil. In this study, the majority of L. monocytogenes isolates belonged to the serotypes 1/2b (42%) and 4b (26%), which are the main serotypes associated with human listeriosis. In addition, all isolates harboured internalin genes (inlA, inlC, inlJ), indicating a virulence potential. The isolates were sensitive to most of the antimicrobial compounds analysed, and five isolates (10%) were multi-resistant. Two isolates harboured antimicrobial resistance genes (tetM and ermB) and in one of them, the gene was present in the plasmid. Moreover, according to the pulsed field gel electrophoresis assay, two multi-resistant isolates were a single clone isolated from food and the processing plant. The isolates were susceptible to the most frequently used antibiotics for listeriosis treatment. However, the presence of multidrug-resistant isolates and antimicrobial resistance genes including in the plasmid could even be transferred between bacterial species, suggesting a potential health risk to consumers and a potential risk of spreading multi-resistance genes to other bacteria. Listeria monocytogenes is an important agent of foodborne diseases. The results of this study suggest a potential capacity of L. monocytogenes isolates from food and food environment to cause human infections. Antimicrobial multi-resistance profiles were detected in 10%, and two isolates harboured tetM and ermB resistance genes. Moreover, the present research can help to build up a better knowledge about antimicrobial resistance of L. monocytogenes. Additionally, we found one isolate carrying tetM resistance gene in a plasmid, that suggests a possible transmission

  19. Reversing bacterial resistance to antibiotics by phage-mediated delivery of dominant sensitive genes. (United States)

    Edgar, Rotem; Friedman, Nir; Molshanski-Mor, Shahar; Qimron, Udi


    Pathogen resistance to antibiotics is a rapidly growing problem, leading to an urgent need for novel antimicrobial agents. Unfortunately, development of new antibiotics faces numerous obstacles, and a method that resensitizes pathogens to approved antibiotics therefore holds key advantages. We present a proof of principle for a system that restores antibiotic efficiency by reversing pathogen resistance. This system uses temperate phages to introduce, by lysogenization, the genes rpsL and gyrA conferring sensitivity in a dominant fashion to two antibiotics, streptomycin and nalidixic acid, respectively. Unique selective pressure is generated to enrich for bacteria that harbor the phages carrying the sensitizing constructs. This selection pressure is based on a toxic compound, tellurite, and therefore does not forfeit any antibiotic for the sensitization procedure. We further demonstrate a possible way of reducing undesirable recombination events by synthesizing dominant sensitive genes with major barriers to homologous recombination. Such synthesis does not significantly reduce the gene's sensitization ability. Unlike conventional bacteriophage therapy, the system does not rely on the phage's ability to kill pathogens in the infected host, but instead, on its ability to deliver genetic constructs into the bacteria and thus render them sensitive to antibiotics prior to host infection. We believe that transfer of the sensitizing cassette by the constructed phage will significantly enrich for antibiotic-treatable pathogens on hospital surfaces. Broad usage of the proposed system, in contrast to antibiotics and phage therapy, will potentially change the nature of nosocomial infections toward being more susceptible to antibiotics rather than more resistant.

  20. Primary drug-resistant tuberculosis in Hanoi, Viet Nam: present status and risk factors.

    Directory of Open Access Journals (Sweden)

    Nguyen Thi Le Hang

    Full Text Available INTRODUCTION: Resistance of Mycobacterium tuberculosis (MTB to anti-tuberculosis (TB drugs presents a serious challenge to TB control worldwide. We investigated the status of drug resistance, including multidrug-resistant (MDR TB, and possible risk factors among newly diagnosed TB patients in Hanoi, the capital of Viet Nam. METHODS: Clinical and epidemiological information was collected from 506 newly diagnosed patients with sputum smear- and culture-positive TB, and 489 (96.6% MTB isolates were subjected to conventional drug susceptibility testing, spoligotyping, and 15-locus variable numbers of tandem repeats typing. Adjusted odds ratios (aORs were calculated to analyze the risk factors for primary drug resistance. RESULTS: Of 489 isolates, 298 (60.9% were sensitive to all drugs tested. Resistance to isoniazid, rifampicin, streptomycin, ethambutol, and MDR accounted for 28.2%, 4.9%, 28.2%, 2.9%, and 4.5%, respectively. Of 24 isolates with rifampicin resistance, 22 (91.7% were MDR and also resistant to streptomycin, except one case. Factors associated with isoniazid resistance included living in old urban areas, presence of the Beijing genotype, and clustered strains [aOR = 2.23, 95% confidence interval (CI 1.15-4.35; 1.91, 1.18-3.10; and 1.69, 1.06-2.69, respectively. The Beijing genotype was also associated with streptomycin resistance (aOR = 2.10, 95% CI 1.29-3.40. Human immunodeficiency virus (HIV coinfection was associated with rifampicin resistance and MDR (aOR = 5.42, 95% CI 2.07-14.14; 6.23, 2.34-16.58, respectively. CONCLUSION: Isoniazid and streptomycin resistance was observed in more than a quarter of TB patients without treatment history in Hanoi. Transmission of isoniazid-resistant TB among younger people should be carefully monitored in urban areas, where Beijing strains and HIV coinfection are prevalent. Choosing an optimal treatment regimen on the basis of the results of drug susceptibility tests and monitoring of treatment

  1. [Severe type A insulin resistance syndrome due to a mutation in the insulin receptor gene]. (United States)

    Ros, P; Colino-Alcol, E; Grasso, V; Barbetti, F; Argente, J


    Insulin resistance syndromes without lipodystrophy are an infrequent and heterogeneous group of disorders with variable clinical phenotypes, associated with hyperglycemia and hyperinsulinemia. The three conditions related to mutations in the insulin receptor gene are leprechaunism or Donohue syndrome, Rabson-Mendenhall syndrome, and Type A syndrome. A case is presented on a patient diagnosed with type A insulin resistance, defined by the triad of extreme insulin resistance, acanthosis nigricans, and hyperandrogenism, carrying a heterozygous mutation in exon 19 of the insulin receptor gene coding for its tyrosine kinase domain that is crucial for the catalytic activity of the receptor. The molecular basis of the syndrome is reviewed, focusing on the structure-function relationships of the insulin receptor, knowing that the criteria for survival are linked to residual insulin receptor function. It is also pointed out that, although type A insulin resistance appears to represent a somewhat less severe condition, these patients have a high morbidity and their treatment is still unsatisfactory. Copyright © 2014 Asociación Española de Pediatría. Published by Elsevier Espana. All rights reserved.

  2. Identification and characterization of two novel bla(KLUC resistance genes through large-scale resistance plasmids sequencing.

    Directory of Open Access Journals (Sweden)

    Teng Xu

    Full Text Available Plasmids are important antibiotic resistance determinant carriers that can disseminate various drug resistance genes among species or genera. By using a high throughput sequencing approach, two groups of plasmids of Escherichia coli (named E1 and E2, each consisting of 160 clinical E. coli strains isolated from different periods of time were sequenced and analyzed. A total of 20 million reads were obtained and mapped onto the known resistance gene sequences. As a result, a total of 9 classes, including 36 types of antibiotic resistant genes, were identified. Among these genes, 25 and 27 single nucleotide polymorphisms (SNPs appeared, of which 9 and 12 SNPs are nonsynonymous substitutions in the E1 and E2 samples. It is interesting to find that a novel genotype of bla(KLUC, whose close relatives, bla(KLUC-1 and bla(KLUC-2, have been previously reported as carried on the Kluyvera cryocrescens chromosome and Enterobacter cloacae plasmid, was identified. It shares 99% and 98% amino acid identities with Kluc-1 and Kluc-2, respectively. Further PCR screening of 608 Enterobacteriaceae family isolates yielded a second variant (named bla(KLUC-4. It was interesting to find that Kluc-3 showed resistance to several cephalosporins including cefotaxime, whereas bla(KLUC-4 did not show any resistance to the antibiotics tested. This may be due to a positively charged residue, Arg, replaced by a neutral residue, Leu, at position 167, which is located within an omega-loop. This work represents large-scale studies on resistance gene distribution, diversification and genetic variation in pooled multi-drug resistance plasmids, and provides insight into the use of high throughput sequencing technology for microbial resistance gene detection.

  3. Two whitebacked planthopper resistance genes in rice share the same loci with those for brown planthopper resistance. (United States)

    Tan, G X; Weng, Q M; Ren, X; Huang, Z; Zhu, L L; He, G C


    The whitebacked planthopper (WBPH), Sogatella furcifera, and brown planthopper (BPH) Nilaparvata lugens Stål are important sucking insects of rice (Oryza sativa L.) crops throughout the world. Rice 'B5', which has derived its resistance genes from the wild rice O. officinalis Wall ex Watt, is a line that is highly resistant to both WBPH and BPH. Previously, two resistance genes against BPH, Qbp1, and Qbp2 in 'B5' had been mapped onto chromosome 3 and chromosome 4, respectively. In this study, we employed a mapping population composed of 187 recombinant inbred lines (RILs), produced from a cross between 'B5' and susceptible variety 'Minghui63', to locate the WBPH and BPH resistance genes. A RFLP survey of the bulked extremes from the RIL population identified two genomic regions, one on chromosome 3 and the other on chromosome 4, likely containing the resistance genes to planthoppers. QTL analysis of the RILs further confirmed that two WBPH resistance genes were mapped on the same loci as Qbp1 and Qbp2, using a linkage map with 242 molecular markers distributed on 12 rice chromosomes. Of the two WBPH resistance genes, one designated Wbph7(t) was located within a 1.1-cM region between R1925 and G1318 on chromosome 3, the other designated Wbph8(t) was within a 0.3-cM region flanked by R288 and S11182 on chromosome 4. A two-way analysis of variance showed that two loci acted independently with each other in determining WBPH resistance. The results have significant implications in studying the interactions between sucking insects and plants and in breeding programs of resistance to rice planthoppers.

  4. Seawater is a reservoir of multi-resistant Escherichia coli, including strains hosting plasmid-mediated quinolones resistance and extended-spectrum beta-lactamases genes. (United States)

    Alves, Marta S; Pereira, Anabela; Araújo, Susana M; Castro, Bruno B; Correia, António C M; Henriques, Isabel


    The aim of this study was to examine antibiotic resistance (AR) dissemination in coastal water, considering the contribution of different sources of fecal contamination. Samples were collected in Berlenga, an uninhabited island classified as Natural Reserve and visited by tourists for aquatic recreational activities. To achieve our aim, AR in Escherichia coli isolates from coastal water was compared to AR in isolates from two sources of fecal contamination: human-derived sewage and seagull feces. Isolation of E. coli was done on Chromocult agar. Based on genetic typing 414 strains were established. Distribution of E. coli phylogenetic groups was similar among isolates of all sources. Resistances to streptomycin, tetracycline, cephalothin, and amoxicillin were the most frequent. Higher rates of AR were found among seawater and feces isolates, except for last-line antibiotics used in human medicine. Multi-resistance rates in isolates from sewage and seagull feces (29 and 32%) were lower than in isolates from seawater (39%). Seawater AR profiles were similar to those from seagull feces and differed significantly from sewage AR profiles. Nucleotide sequences matching resistance genes bla TEM, sul1, sul2, tet(A), and tet(B), were present in isolates of all sources. Genes conferring resistance to 3rd generation cephalosporins were detected in seawater (bla CTX-M-1 and bla SHV-12) and seagull feces (bla CMY-2). Plasmid-mediated determinants of resistance to quinolones were found: qnrS1 in all sources and qnrB19 in seawater and seagull feces. Our results show that seawater is a relevant reservoir of AR and that seagulls are an efficient vehicle to spread human-associated bacteria and resistance genes. The E. coli resistome recaptured from Berlenga coastal water was mainly modulated by seagulls-derived fecal pollution. The repertoire of resistance genes covers antibiotics critically important for humans, a potential risk for human health.

  5. Seawater is a reservoir of multi-resistant Escherichia coli, including strains hosting plasmid-mediated quinolones resistance and extended-spectrum beta-lactamases genes

    Directory of Open Access Journals (Sweden)

    Marta S. Alves


    Full Text Available The aim of this study was to examine antibiotic resistance (AR dissemination in coastal water, considering the contribution of different sources of faecal contamination. Samples were collected in Berlenga, an uninhabited island classified as Natural Reserve and visited by tourists for aquatic recreational activities. To achieve our aim, AR in Escherichia coli isolates from coastal water was compared to AR in isolates from two sources of faecal contamination: human-derived sewage and seagull faeces. Isolation of E. coli was done on Chromocult agar. Based on genetic typing 414 strains were established. Distribution of E. coli phylogenetic groups was similar among isolates of all sources. Resistances to streptomycin, tetracycline, cephalothin and amoxicillin were the most frequent. Higher rates of AR were found among seawater and faeces isolates, except for last-line antibiotics used in human medicine. Multi-resistance rates in isolates from sewage and seagull faeces (29% and 32% were lower than in isolates from seawater (39%. Seawater AR profiles were similar to those from seagull faeces and differed significantly from sewage AR profiles. Nucleotide sequences matching resistance genes blaTEM, sul1, sul2, tet(A and tet(B, were present in isolates of all sources. Genes conferring resistance to 3rd generation cephalosporins were detected in seawater (blaCTX-M-1 and blaSHV-12 and seagull faeces (blaCMY-2. Plasmid-mediated determinants of resistance to quinolones were found: qnrS1 in all sources and qnrB19 in seawater and seagull faeces. Our results show that seawater is a relevant reservoir of AR and that seagulls are an efficient vehicle to spread human-associated bacteria and resistance genes. The E. coli resistome recaptured from Berlenga coastal water was mainly modulated by seagulls-derived faecal pollution. The repertoire of resistance genes covers antibiotics critically important for humans, a potential risk for human health.

  6. Dissection of Resistance Genes to Pseudomonas syringae pv. phaseolicola in UI3 Common Bean Cultivar. (United States)

    González, Ana M; Godoy, Luís; Santalla, Marta


    Few quantitative trait loci have been mapped for resistance to Pseudomonas syringae pv. phaseolicola in common bean. Two F₂ populations were developed from the host differential UI3 cultivar. The objective of this study was to further characterize the resistance to races 1, 5, 7 and 9 of Psp included in UI3. Using a QTL mapping approach, 16 and 11 main-effect QTLs for pod and primary leaf resistance were located on LG10, explaining up to 90% and 26% of the phenotypic variation, respectively. The homologous genomic region corresponding to primary leaf resistance QTLs detected tested positive for the presence of resistance-associated gene cluster encoding nucleotide-binding and leucine-rich repeat (NL), Natural Resistance Associated Macrophage (NRAMP) and Pentatricopeptide Repeat family (PPR) proteins. It is worth noting that the main effect QTLs for resistance in pod were located inside a 3.5 Mb genomic region that included the Phvul.010G021200 gene, which encodes a protein that has the highest sequence similarity to the RIN4 gene of Arabidopsis, and can be considered an important candidate gene for the organ-specific QTLs identified here. These results support that resistance to Psp from UI3 might result from the immune response activated by combinations of R proteins, and suggest the guard model as an important mechanism in pod resistance to halo blight. The candidate genes identified here warrant functional studies that will help in characterizing the actual defense gene(s) in UI3 genotype.


    Directory of Open Access Journals (Sweden)

    Mehmet AYBEKE


    Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

  8. Inheritance and Gene Mapping of Resistance to Soybean Mosaic Virus Strain SC14 in Soybean

    Institute of Scientific and Technical Information of China (English)

    Hai-Chao Li; Hai-Jian Zhi; Jun-Yi Gai; Dong-Quan Guo; Yan-Wei Wang; Kai Li; Li Bai; Hua Yang


    Soybean mosaic virus (SMV) is one of the most broadly distributed diseases worldwide. It causes severe yield loss and seed quality deficiency in soybean (Glycine max (L.) Merr.). SMV Strain SC14 isolated from Shanxi Province, China, was a newly identified virulent strain and can infect Kefeng No. 1, a source with wide spectrum resistance. In the present study, soybean accessions, PI96983, Qihuang No. 1 and Qihuang No. 22 were identified to be resistant (R) and Nannong 1138-2, Pixianchadou susceptible (S) to SC14. Segregation analysis of PI96983 × Nannong 1138-2 indicated that a single dominant gene (designated as Rsc14) controlled the resistance to SC14 at both V2 and R1 developmental stages. The same results were obtained for the crosses of Qihuang No. 1 × Nannong 1138-2 and Qihuang No. 22 × Nannong 1138-2 as in PI96983 × Nannong 1138-2 at V2 stage, but at R1 stage,the F1 performed as necrosis (a susceptible symptom other than mosaic), F2 segregated in a ratio of 1R:2N:1S,and the progenies of necrotic (N) F2 individuals segregated also in R, N and S. It indicated that a single gene (designated as Rsc14o, to be different from that of PI96983) controlled the resistance to SC14, its dominance was the same as in PI96983 × Nannong 1138-2 (without symptoms) at V2 stage and not the same at R1 stage. The tightly linked co-dominant simple sequence repeat (SSR) marker Satt334 indicated that all the heterozygous bands were completely corresponding to the necrotic F2 individuals, or all the necrotic F2 individuals were heterozygotes.It was inferred that necrosis might be due to the interaction among SMV strains, resistance genes, genetic background of the resistance genes, and plant development stage. Furthermore, the bulked segregant analysis (BSA) of SSR markers was conducted to map the resistance genes. In F2 of PI96983 × Nannong 1138-2, five SSR markers, Sat_297, Sat_234, Sat_154, Sct_033 and Sat_120, were found closely linked to Rsc14, with genetic distances of 14

  9. Transport and transformation of genetic information in the critical zone: The case of antibiotic resistance genes (United States)

    Zhu, Y. G.


    In addition to material and energy flows, the dynamics and functions of the Earth's critical zone are intensively mediated by biological actions performed by diverse organisms. These biological actions are modulated by the expression of functional genes and their translation into enzymes that catalyze geochemical reactions, such as nutrient turnover and pollutant biodegradation. Although geobiology, as an interdisciplinary research area, is playing and vital role in linking biological and geochemical processes at different temporal and spatial scales, the distribution and transport of functional genes have rarely been investigated from the Earth's critical zone perspectives. To illustrate the framework of studies on the transport and transformation of genetic information in the critical zone, antibiotic resistance is taken as an example. Antibiotic resistance genes are considered as a group of emerging contaminants, and their emergence and spread within the critical zone on one hand are induced by anthropogenic activities, and on other hand are threatening human health worldwide. The transport and transformation of antibiotic resistance genes are controlled by both horizontal gene transfer between bacterial cells and the movement of bacteria harboring antibiotic resistance genes. In this paper, the fate and behavior of antibiotic resistance genes will be discussed in the following aspects: 1) general overview of environmental antibiotic resistance; 2) high through quantification of the resistome in various environmental media; 3) pathways of resistance gene flow within the critical zone; and 4) potential strategies in mitigating antibiotic resistance, particularly from the critical zone perspectives.

  10. Molecular characterization of the CRa gene conferring clubroot resistance in Brassica rapa. (United States)

    Ueno, Hiroki; Matsumoto, Etsuo; Aruga, Daisuke; Kitagawa, Satoshi; Matsumura, Hideo; Hayashida, Nobuaki


    Clubroot disease is one of the major diseases affecting Brassicaceae crops, and a number of these crops grown commercially, such as Chinese cabbage (Brassica rapa L. ssp. pekinensis), are known to be highly susceptible to clubroot disease. To provide protection from this disease, plant breeders have introduced genes for resistance to clubroot from the European turnip into susceptible lines. The CRa gene confers specific resistance to the clubroot pathogen Plasmodiophora brassicae isolate M85. Fine mapping of the CRa locus using synteny to the Arabidopsis thaliana genome and partial genome sequences of B. rapa revealed a candidate gene encoding a TIR-NBS-LRR protein. Several structural differences in this candidate gene were found between susceptible and resistant lines, and CRa expression was observed only in the resistant line. Four mutant lines lacking clubroot resistance were obtained by the UV irradiation of pollen from a resistant line, and all of these mutant lines carried independent mutations in the candidate TIR-NBS-LRR gene. This genetic and molecular evidence strongly suggests that the identified gene is CRa. This is the first report on the molecular characterization of a clubroot Resistance gene in Brassicaceae and of the disease resistance gene in B. rapa.

  11. An AFLP marker linked to turnip mosaic virus resistance gene in pak ...

    African Journals Online (AJOL)

    An AFLP marker linked to turnip mosaic virus resistance gene in pak-choi. W Xinhua, C Huoying, Z Yuying, H Ruixian. Abstract. Pak-choi is one of the most important vegetable crops in China. Turnip mosaic virus (TuMV) is one of its main pathogen. Screening the molecular marker linked to the TuMV resistance gene is an ...

  12. Identification of leaf rust resistant gene Lr10 in Pakistani wheat ...

    African Journals Online (AJOL)

    Leaf (brown) rust is the major disease of wheat in Pakistan and other countries. The disease is more effectively controlled when several rust resistance genes are pyramided into a single line. Molecular survey was conducted to screen 25 Pakistan wheat germplasm for the presence of leaf rust resistance gene Lr10 using ...

  13. Characterization of the psoRPM1 gene for resistance to root-knot ...

    African Journals Online (AJOL)

    Several root-knot nematode (Meloidogyne spp.) resistance genes have been discovered in different stone fruit crops. However, none of them has yet been cloned and they were only located on the chromosomes. In this study, a candidate root-knot nematode resistance gene (designated as psoRPM1) was isolated from the ...

  14. Nucleotide diversity analysis of three major bacterial blight resistance genes in rice.

    Directory of Open Access Journals (Sweden)

    Waikhom Bimolata

    Full Text Available Nucleotide sequence polymorphisms among R gene alleles influence the process of co-evolutionary interaction between host and pathogen by shaping the response of host plants towards invading pathogens. Here, we present the DNA sequence polymorphisms and diversities present among natural alleles of three rice bacterial blight resistance genes, Xa21, Xa26 and xa5. The diversity was examined across different wild relatives and cultivars of Oryza species. Functional significance of selected alleles was evaluated through semi-quantitative reverse transcription polymerase chain reaction and real time PCR. The greatest nucleotide diversity and singleton variable sites (SVS were present in Xa26 (π = 0.01958; SVS = 182 followed by xa5 and Xa21 alleles. The highest frequency of single nucleotide polymorphisms were observed in Xa21 alleles and least in xa5. Transition bias was observed in all the genes and 'G' to 'A' transitions were more favored than other form of transitions. Neutrality tests failed to show the presence of selection at these loci, though negative Tajima's D values indicate the presence of a rare form of polymorphisms. At the interspecies level, O. nivara exhibited more diversity than O. sativa. We have also identified two nearly identical resistant alleles of xa5 and two sequentially identical alleles of Xa21. The alleles of xa5 showed basal levels of expression while Xa21 alleles were functionally not expressed.

  15. Identification of a RAPD marker linked to the Co-6 anthracnose resistant gene in common bean cultivar AB 136

    Directory of Open Access Journals (Sweden)

    Alzate-Marin Ana Lilia


    Full Text Available The pathogenic variability of the fungus Colletotrichum lindemuthianum represents an obstacle for the creation of resistant common bean (Phaseolus vulgaris L. varieties. Gene pyramiding is an alternative strategy for the development of varieties with durable resistance. RAPD markers have been proposed as a means to facilitate pyramiding of resistance genes without the need for multiple inoculations of the pathogens. The main aims of this work were to define the inheritance pattern of resistance present in common bean cultivar AB 136 in segregating populations derived from crosses with cultivar Rudá (susceptible to most C. lindemuthianum races and to identify RAPD markers linked to anthracnose resistance. The two progenitors, populations F1 and F2, F2:3 families and backcross-derived plants were inoculated with race 89 of C. lindemuthianum under environmentally controlled greenhouse conditions. The results indicate that a single dominant gene, Co-6, controls common bean resistance to this race, giving a segregation ratio between resistant and susceptible plants of 3:1 in the F2, 1:0 in the backcrosses to AB 136 and 1:1 in the backcross to Rudá. The segregation ratio of F2:3 families derived from F2 resistant plants was 1:2 (homozygous to heterozygous resistant. Molecular marker analyses in the F2 population identified a DNA band of approximately 940 base pairs (OPAZ20(940, linked in coupling phase at 7.1 cM of the Co-6 gene. This marker is being used in our backcross breeding program to develop Rudá-derived common bean cultivars resistant to anthracnose and adapted to central Brazil.

  16. Identifying clinically relevant drug resistance genes in drug-induced resistant cancer cell lines and post-chemotherapy tissues. (United States)

    Tong, Mengsha; Zheng, Weicheng; Lu, Xingrong; Ao, Lu; Li, Xiangyu; Guan, Qingzhou; Cai, Hao; Li, Mengyao; Yan, Haidan; Guo, You; Chi, Pan; Guo, Zheng


    Until recently, few molecular signatures of drug resistance identified in drug-induced resistant cancer cell models can be translated into clinical practice. Here, we defined differentially expressed genes (DEGs) between pre-chemotherapy colorectal cancer (CRC) tissue samples of non-responders and responders for 5-fluorouracil and oxaliplatin-based therapy as clinically relevant drug resistance genes (CRG5-FU/L-OHP). Taking CRG5-FU/L-OHP as reference, we evaluated the clinical relevance of several types of genes derived from HCT116 CRC cells with resistance to 5-fluorouracil and oxaliplatin, respectively. The results revealed that DEGs between parental and resistant cells, when both were treated with the corresponding drug for a certain time, were significantly consistent with the CRG5-FU/L-OHP as well as the DEGs between the post-chemotherapy CRC specimens of responders and non-responders. This study suggests a novel strategy to extract clinically relevant drug resistance genes from both drug-induced resistant cell models and post-chemotherapy cancer tissue specimens.

  17. The expression of antibiotic resistance genes in antibiotic-producing bacteria. (United States)

    Mak, Stefanie; Xu, Ye; Nodwell, Justin R


    Antibiotic-producing bacteria encode antibiotic resistance genes that protect them from the biologically active molecules that they produce. The expression of these genes needs to occur in a timely manner: either in advance of or concomitantly with biosynthesis. It appears that there have been at least two general solutions to this problem. In many cases, the expression of resistance genes is tightly linked to that of antibiotic biosynthetic genes. In others, the resistance genes can be induced by their cognate antibiotics or by intermediate molecules from their biosynthetic pathways. The regulatory mechanisms that couple resistance to antibiotic biosynthesis are mechanistically diverse and potentially relevant to the origins of clinical antibiotic resistance. © 2014 John Wiley & Sons Ltd.

  18. Isolation and characterization of NBS-LRR- resistance gene candidates in turmeric (Curcuma longa cv. surama). (United States)

    Joshi, R K; Mohanty, S; Subudhi, E; Nayak, S


    Turmeric (Curcuma longa), an important asexually reproducing spice crop of the family Zingiberaceae is highly susceptible to bacterial and fungal pathogens. The identification of resistance gene analogs holds great promise for development of resistant turmeric cultivars. Degenerate primers designed based on known resistance genes (R-genes) were used in combinations to elucidate resistance gene analogs from Curcuma longa cultivar surama. The three primers resulted in amplicons with expected sizes of 450-600 bp. The nucleotide sequence of these amplicons was obtained through sequencing; their predicted amino acid sequences compared to each other and to the amino acid sequences of known R-genes revealed significant sequence similarity. The finding of conserved domains, viz., kinase-1a, kinase-2 and hydrophobic motif, provided evidence that the sequences belong to the NBS-LRR class gene family. The presence of tryptophan as the last residue of kinase-2 motif further qualified them to be in the non-TIR-NBS-LRR subfamily of resistance genes. A cluster analysis based on the neighbor-joining method was carried out using Curcuma NBS analogs together with several resistance gene analogs and known R-genes, which classified them into two distinct subclasses, corresponding to clades N3 and N4 of non-TIR-NBS sequences described in plants. The NBS analogs that we isolated can be used as guidelines to eventually isolate numerous R-genes in turmeric.

  19. Candidate gene approach for parasite resistance in sheep--variation in immune pathway genes and association with fecal egg count.

    Directory of Open Access Journals (Sweden)

    Kathiravan Periasamy

    Full Text Available Sheep chromosome 3 (Oar3 has the largest number of QTLs reported to be significantly associated with resistance to gastro-intestinal nematodes. This study aimed to identify single nucleotide polymorphisms (SNPs within candidate genes located in sheep chromosome 3 as well as genes involved in major immune pathways. A total of 41 SNPs were identified across 38 candidate genes in a panel of unrelated sheep and genotyped in 713 animals belonging to 22 breeds across Asia, Europe and South America. The variations and evolution of immune pathway genes were assessed in sheep populations across these macro-environmental regions that significantly differ in the diversity and load of pathogens. The mean minor allele frequency (MAF did not vary between Asian and European sheep reflecting the absence of ascertainment bias. Phylogenetic analysis revealed two major clusters with most of South Asian, South East Asian and South West Asian breeds clustering together while European and South American sheep breeds clustered together distinctly. Analysis of molecular variance revealed strong phylogeographic structure at loci located in immune pathway genes, unlike microsatellite and genome wide SNP markers. To understand the influence of natural selection processes, SNP loci located in chromosome 3 were utilized to reconstruct haplotypes, the diversity of which showed significant deviations from selective neutrality. Reduced Median network of reconstructed haplotypes showed balancing selection in force at these loci. Preliminary association of SNP genotypes with phenotypes recorded 42 days post challenge revealed significant differences (P<0.05 in fecal egg count, body weight change and packed cell volume at two, four and six SNP loci respectively. In conclusion, the present study reports strong phylogeographic structure and balancing selection operating at SNP loci located within immune pathway genes. Further, SNP loci identified in the study were found to have

  20. Occurrence of antibiotics and antibiotic resistance genes in a sewage treatment plant and its effluent-receiving river. (United States)

    Xu, Jian; Xu, Yan; Wang, Hongmei; Guo, Changsheng; Qiu, Huiyun; He, Yan; Zhang, Yuan; Li, Xiaochen; Meng, Wei


    The extensive use of antibiotics has caused the contamination of both antibiotics and antibiotic resistance genes (ARGs) in the environment. In this study, the abundance and distribution of antibiotics and ARGs from a sewage treatment plant (STP) and its effluent-receiving river in Beijing China were characterized. Three classes of antibiotics including tetracycline, sulfonamide and quinolone were quantified by LC-MS/MS. In the secondary effluent they were detected at 195, 2001 and 3866 ng L(-1), respectively, which were higher than in the receiving river water. A total of 13 ARGs (6 tet genes: tetA, tetB, tetE, tetW, tetM and tetZ, 3 sulfonamide genes: sul1, sul2 and sul3, and 4 quinolone genes: gryA, parC, qnrC and qnrD) were determined by quantitative PCR. For all ARGs, sulfonamide resistance genes were present at relatively high concentrations in all samples, with the highest ARG concentration above 10(-1). ARGs remained relatively stable along each sewage treatment process. The abundances of detected ARGs from the STP were also higher than its receiving river. Bivariate correlation analysis showed that relative tet gene copies (tetB/16S-rRNA and tetW/16S-rRNA) were strongly correlated with the concentrations of tetracycline residues (r(2)>0.8, pgenes. A negative correlation between the relative abundance of quinolone resistance gene (qnrC/16S-rRNA) and the concentrations of enrofloxacin (ENR) was also determined. The difference of ARGs levels in the raw influent and secondary effluent suggested that the STP treatment process may induce to increase the abundance of resistance genes. The results showed that the sewage was an important repository of the resistance genes, which need to be effectively treated before discharge into the natural water body. Copyright © 2014 Elsevier Ltd. All rights reserved.

  1. Prevalence, Virulence Genes and Antimicrobial Resistance Profiles of Salmonella Serovars from Retail Beef in Selangor, Malaysia. (United States)

    Thung, Tze Y; Radu, Son; Mahyudin, Nor A; Rukayadi, Yaya; Zakaria, Zunita; Mazlan, Nurzafirah; Tan, Boon H; Lee, Epeng; Yeoh, Soo L; Chin, Yih Z; Tan, Chia W; Kuan, Chee H; Basri, Dayang F; Wan Mohamed Radzi, Che W J


    The aim of the present study was to investigate the prevalence of Salmonella spp., Salmonella Enteritidis and Salmonella Typhimurium in retail beef from different retail markets of Selangor area, as well as, to assess their pathogenic potential and antimicrobial resistance. A total of 240 retail beef meat samples (chuck = 60; rib = 60; round = 60; sirloin = 60) were randomly collected. The multiplex polymerase chain reaction (mPCR) in combination with the most probable number (MPN) method was employed to detect Salmonella spp., S . Enteritidis and S . Typhimurium in the meat samples. The prevalence of Salmonella spp., S . Enteritidis and S . Typhimurium in 240 beef meat samples were 7.50, 1.25, and 0.83%, respectively. The microbial loads of total Salmonella was found in the range of retail beef products tested were widely contaminated with multi-drug resistant (MDR) Salmonella and various virulence genes are present among the isolated Salmonella serovars.

  2. Mapping, isolation and characterization of genes responsible for late blight resistance in potato

    NARCIS (Netherlands)

    Pel, M.


    Late blight (LB), caused by the oomycete Phytophthora infestans, is one of the most
    devastating diseases on potato. Resistance (R) genes from the wild species Solanum demissum
    have been used by breeders to generate late blight resistant cultivars, but resistance was soon

  3. In Silico Assigned Resistance Genes Confer Bifidobacterium with Partial Resistance to Aminoglycosides but Not to Β-Lactams (United States)

    Fouhy, Fiona; O’Connell Motherway, Mary; Fitzgerald, Gerald F.; Ross, R. Paul; Stanton, Catherine; van Sinderen, Douwe; Cotter, Paul D.


    Bifidobacteria have received significant attention due to their contribution to human gut health and the use of specific strains as probiotics. It is thus not surprising that there has also been significant interest with respect to their antibiotic resistance profile. Numerous culture-based studies have demonstrated that bifidobacteria are resistant to the majority of aminoglycosides, but are sensitive to β-lactams. However, limited research exists with respect to the genetic basis for the resistance of bifidobacteria to aminoglycosides. Here we performed an in-depth in silico analysis of putative Bifidobacterium-encoded aminoglycoside resistance proteins and β-lactamases and assess the contribution of these proteins to antibiotic resistance. The in silico-based screen detected putative aminoglycoside and β-lactam resistance proteins across the Bifidobacterium genus. Laboratory-based investigations of a number of representative bifidobacteria strains confirmed that despite containing putative β-lactamases, these strains were sensitive to β-lactams. In contrast, all strains were resistant to the aminoglycosides tested. To assess the contribution of genes encoding putative aminoglycoside resistance proteins in Bifidobacterium sp. two genes, namely Bbr_0651 and Bbr_1586, were targeted for insertional inactivation in B. breve UCC2003. As compared to the wild-type, the UCC2003 insertion mutant strains exhibited decreased resistance to gentamycin, kanamycin and streptomycin. This study highlights the associated risks of relying on the in silico assignment of gene function. Although several putative β-lactam resistance proteins are located in bifidobacteria, their presence does not coincide with resistance to these antibiotics. In contrast however, this approach has resulted in the identification of two loci that contribute to the aminoglycoside resistance of B. breve UCC2003 and, potentially, many other bifidobacteria. PMID:24324818

  4. In silico assigned resistance genes confer Bifidobacterium with partial resistance to aminoglycosides but not to β-lactams.

    Directory of Open Access Journals (Sweden)

    Fiona Fouhy

    Full Text Available Bifidobacteria have received significant attention due to their contribution to human gut health and the use of specific strains as probiotics. It is thus not surprising that there has also been significant interest with respect to their antibiotic resistance profile. Numerous culture-based studies have demonstrated that bifidobacteria are resistant to the majority of aminoglycosides, but are sensitive to β-lactams. However, limited research exists with respect to the genetic basis for the resistance of bifidobacteria to aminoglycosides. Here we performed an in-depth in silico analysis of putative Bifidobacterium-encoded aminoglycoside resistance proteins and β-lactamases and assess the contribution of these proteins to antibiotic resistance. The in silico-based screen detected putative aminoglycoside and β-lactam resistance proteins across the Bifidobacterium genus. Laboratory-based investigations of a number of representative bifidobacteria strains confirmed that despite containing putative β-lactamases, these strains were sensitive to β-lactams. In contrast, all strains were resistant to the aminoglycosides tested. To assess the contribution of genes encoding putative aminoglycoside resistance proteins in Bifidobacterium sp. two genes, namely Bbr_0651 and Bbr_1586, were targeted for insertional inactivation in B. breve UCC2003. As compared to the wild-type, the UCC2003 insertion mutant strains exhibited decreased resistance to gentamycin, kanamycin and streptomycin. This study highlights the associated risks of relying on the in silico assignment of gene function. Although several putative β-lactam resistance proteins are located in bifidobacteria, their presence does not coincide with resistance to these antibiotics. In contrast however, this approach has resulted in the identification of two loci that contribute to the aminoglycoside resistance of B. breve UCC2003 and, potentially, many other bifidobacteria.

  5. Characterization of Soybean WRKY Gene Family and Identification of Soybean WRKY Genes that Promote Resistance to Soybean Cyst Nematode. (United States)

    Yang, Yan; Zhou, Yuan; Chi, Yingjun; Fan, Baofang; Chen, Zhixiang


    WRKY proteins are a superfamily of plant transcription factors with important roles in plants. WRKY proteins have been extensively analyzed in plant species including Arabidopsis and rice. Here we report characterization of soybean WRKY gene family and their functional analysis in resistance to soybean cyst nematode (SCN), the most important soybean pathogen. Through search of the soybean genome, we identified 174 genes encoding WRKY proteins that can be classified into seven groups as established in other plants. WRKY variants including a WRKY-related protein unique to legumes have also been identified. Expression analysis reveals both diverse expression patterns in different soybean tissues and preferential expression of specific WRKY groups in certain tissues. Furthermore, a large number of soybean WRKY genes were responsive to salicylic acid. To identify soybean WRKY genes that promote soybean resistance to SCN, we first screened soybean WRKY genes for enhancing SCN resistance when over-expressed in transgenic soybean hairy roots. To confirm the results, we transformed five WRKY genes into a SCN-susceptible soybean cultivar and generated transgenic soybean lines. Transgenic soybean lines overexpressing three WRKY transgenes displayed increased resistance to SCN. Thus, WRKY genes could be explored to develop new soybean cultivars with enhanced resistance to SCN.

  6. The tetracycline resistance determinant Tet 39 and the sulphonamide resistance gene sulII are common among resistant Acinetobacter spp. isolated from integrated fish farms in Thailand

    DEFF Research Database (Denmark)

    Agersø, Yvonne; Petersen, Andreas


    Objectives: To determine the genetic basis for tetracycline and sulphonamide resistance and the prevalence of class I and II integrons in oxytetracycline-resistant Acinetobacter spp. from integrated fish farms in Thailand. Methods: A total of 222 isolates were screened for tetracycline resistance...... and Southern blots with sulII and tet(39) probes were performed on selected isolates. Results: The recently identified tetracycline resistance gene tet(39) was demonstrated in 75% (166/222) of oxytetracycline-resistant Acinetobacter spp. from integrated fish farms in Thailand. Isolates that were also...

  7. Incorporation of Bacterial Blight Resistance Genes Into Lowland Rice Cultivar Through Marker-Assisted Backcross Breeding. (United States)

    Pradhan, Sharat Kumar; Nayak, Deepak Kumar; Pandit, Elssa; Behera, Lambodar; Anandan, Annamalai; Mukherjee, Arup Kumar; Lenka, Srikanta; Barik, Durga Prasad


    Bacterial blight (BB) of rice caused by Xanthomonas oryzae pv. oryzae is a major disease of rice in many rice growing countries. Pyramided lines carrying two BB resistance gene combinations (Xa21+xa13 and Xa21+xa5) were developed in a lowland cultivar Jalmagna background through backcross breeding by integrating molecular markers. In each backcross generation, markers closely linked to the disease resistance genes were used to select plants possessing the target genes. Background selection was continued in those plants carrying resistant genes until BC(3) generation. Plants having the maximum contribution from the recurrent parent genome were selected in each generation and hybridized with the recipient parent. The BB-pyramided line having the maximum recipient parent genome recovery of 95% was selected among BC3F1 plants and selfed to isolate homozygous BC(3)F(2) plants with different combinations of BB resistance genes. Twenty pyramided lines with two resistance gene combinations exhibited high levels of tolerance against the BB pathogen. In order to confirm the resistance, the pyramided lines were inoculated with different X. oryzae pv. oryzae strains of Odisha for bioassay. The genotypes with combination of two BB resistance genes conferred high levels of resistance to the predominant X. oryzae pv. oryzae isolates prevalent in the region. The pyramided lines showed similarity with the recipient parent with respect to major agro-morphologic traits.

  8. Molecular Identification and Quantification of Tetracycline and Erythromycin Resistance Genes in Spanish and Italian Retail Cheeses

    Directory of Open Access Journals (Sweden)

    Ana Belén Flórez


    Full Text Available Large antibiotic resistance gene pools in the microbiota of foods may ultimately pose a risk for human health. This study reports the identification and quantification of tetracycline- and erythromycin-resistant populations, resistance genes, and gene diversity in traditional Spanish and Italian cheeses, via culturing, conventional PCR, real-time quantitative PCR (qPCR, and denaturing gradient gel electrophoresis (DGGE. The numbers of resistant bacteria varied widely among the antibiotics and the different cheese varieties; in some cheeses, all the bacterial populations seemed to be resistant. Up to eight antibiotic resistance genes were sought by gene-specific PCR, six with respect to tetracycline, that is, tet(K, tet(L, tet(M, tet(O, tet(S, and tet(W, and two with respect to erythromycin, that is, erm(B and erm(F. The most common resistance genes in the analysed cheeses were tet(S, tet(W, tet(M, and erm(B. The copy numbers of these genes, as quantified by qPCR, ranged widely between cheeses (from 4.94 to 10.18log⁡10/g. DGGE analysis revealed distinct banding profiles and two polymorphic nucleotide positions for tet(W-carrying cheeses, though the similarity of the sequences suggests this tet(W to have a monophyletic origin. Traditional cheeses would therefore appear to act as reservoirs for large numbers of many types of antibiotic resistance determinants.

  9. Effective genes for resistance to stripe rust and virulence of Puccinia ...

    African Journals Online (AJOL)

    The results revealed that stripe rust resistance genes Yr3, Yr5, Yr10, Yr15, Yr26, YrSP and YrCV were resistant, while Yr18 showed moderate susceptibility at all locations. Genes YrA-, Yr2, Yr6, Yr7, Yr8, Yr9, Yr17, Yr27 and gene combinations Opata (Yr27+Yr18) and Super Kauz (Yr9, Yr27, Yr18) were found susceptible.

  10. Genetics and mapping of a new leaf rust resistance gene in Triticum ...

    Indian Academy of Sciences (India)

    Genetic analysis in F1, F2 and F2.3 families at the seedling stage revealed that leaf rust resistance in Selection G12 is conditioned by a single incompletely dominant gene. The leaf rust resistance gene was mapped to chromosome 3BL with SSR markers Xgwm114 and Xgwm547 flanking the gene at a distance of 28.3 cM ...

  11. Avirulence (AVR) Gene-Based Diagnosis Complements Existing Pathogen Surveillance Tools for Effective Deployment of Resistance (R) Genes Against Rice Blast Disease. (United States)

    Selisana, S M; Yanoria, M J; Quime, B; Chaipanya, C; Lu, G; Opulencia, R; Wang, G-L; Mitchell, T; Correll, J; Talbot, N J; Leung, H; Zhou, B


    Avirulence (AVR) genes in Magnaporthe oryzae, the fungal pathogen that causes the devastating rice blast disease, have been documented to be major targets subject to mutations to avoid recognition by resistance (R) genes. In this study, an AVR-gene-based diagnosis tool for determining the virulence spectrum of a rice blast pathogen population was developed and validated. A set of 77 single-spore field isolates was subjected to pathotype analysis using differential lines, each containing a single R gene, and classified into 20 virulent pathotypes, except for 4 isolates that lost pathogenicity. In all, 10 differential lines showed low frequency (95%), inferring the effectiveness of R genes present in the respective differential lines. In addition, the haplotypes of seven AVR genes were determined by polymerase chain reaction amplification and sequencing, if applicable. The calculated frequency of different AVR genes displayed significant variations in the population. AVRPiz-t and AVR-Pii were detected in 100 and 84.9% of the isolates, respectively. Five AVR genes such as AVR-Pik-D (20.5%) and AVR-Pik-E (1.4%), AVRPiz-t (2.7%), AVR-Pita (0%), AVR-Pia (0%), and AVR1-CO39 (0%) displayed low or even zero frequency. The frequency of AVR genes correlated almost perfectly with the resistance frequency of the cognate R genes in differential lines, except for International Rice Research Institute-bred blast-resistant lines IRBLzt-T, IRBLta-K1, and IRBLkp-K60. Both genetic analysis and molecular marker validation revealed an additional R gene, most likely Pi19 or its allele, in these three differential lines. This can explain the spuriously higher resistance frequency of each target R gene based on conventional pathotyping. This study demonstrates that AVR-gene-based diagnosis provides a precise, R-gene-specific, and differential line-free assessment method that can be used for determining the virulence spectrum of a rice blast pathogen population and for predicting the

  12. Genetic mapping of the rice resistance-breaking gene of the brown planthopper Nilaparvata lugens. (United States)

    Kobayashi, Tetsuya; Yamamoto, Kimiko; Suetsugu, Yoshitaka; Kuwazaki, Seigo; Hattori, Makoto; Jairin, Jirapong; Sanada-Morimura, Sachiyo; Matsumura, Masaya


    Host plant resistance has been widely used for controlling the major rice pest brown planthopper (BPH, Nilaparvata lugens). However, adaptation of the wild BPH population to resistance limits the effective use of resistant rice varieties. Quantitative trait locus (QTL) analysis was conducted to identify resistance-breaking genes against the anti-feeding mechanism mediated by the rice resistance gene Bph1. QTL analysis in iso-female BPH lines with single-nucleotide polymorphism (SNP) markers detected a single region on the 10th linkage group responsible for the virulence. The QTL explained from 57 to 84% of the total phenotypic variation. Bulked segregant analysis with next-generation sequencing in F2 progenies identified five SNPs genetically linked to the virulence. These analyses showed that virulence to Bph1 was controlled by a single recessive gene. In contrast to previous studies, the gene-for-gene relationship between the major resistance gene Bph1 and virulence gene of BPH was confirmed. Identified markers are available for map-based cloning of the major gene controlling BPH virulence to rice resistance. © 2014 The Author(s) Published by the Royal Society. All rights reserved.

  13. Trueperella pyogenes isolated from dairy cows with endometritis in Inner Mongolia, China: Tetracycline susceptibility and tetracycline-resistance gene distribution. (United States)

    Zhang, Dexian; Zhao, Jingcui; Wang, Qiuxia; Liu, Yaochuan; Tian, Chunlian; Zhao, Yujun; Yu, Lihui; Liu, Mingchun


    Trueperella pyogenes plays a crucial role in endometritis pathogenesis and is also associated with many infections, including metritis, mastitis, arthritis and liver abscessation, in many domestic animals. In this study, we investigated the prevalence of tetracycline resistance in T. pyogenes isolated from dairy cows with endometritis in Inner Mongolia, China, and we assessed tetracycline-resistance gene distribution among the isolates. Our results indicated that 68.7% and 62.5% of the isolates were resistant to tetracycline and doxycycline, respectively, and the rate of resistance to metacycline was 18.8%. The tetracycline resistance gene tetK was present in all isolates (n = 32), whereas the tetM gene was identified in 12.5% and 9.4% of the isolates, in the chromosome and plasmid, respectively. Strains carrying tetW were also common in the chromosome and plasmid, with abundances of 53.1% and 46.9%, respectively. However, tetO and otrA were absent in all isolates. The resistance phenotype analysis indicated that 6.3% of strains were susceptible to all tetracyclines, while 3.1% showed resistance to all tetracyclines. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. The gene bap, involved in biofilm production, is present in Staphylococcus spp. strains from nosocomial infections. (United States)

    Potter, Amina; Ceotto, Hilana; Giambiagi-Demarval, Marcia; dos Santos, Kátia Regina Netto; Nes, Ingolf F; Bastos, Maria do Carmo de Freire


    This study analyzed ten strains of coagulase-negative staphylococci (CNS) involved in nosocomial infections in three Brazilian hospitals. Their antibiotic susceptibility profile showed that most strains exhibited multiple antibiotic resistance and possessed the mecA gene. The ability of these strains to adhere to polystyrene microtiter plates was also tested and nine of them proved to be biofilm producers at least in one of the three conditions tested: growth in TSB, in TSB supplemented with NaCl, or in TSB supplemented with glucose. The presence of the bap gene, which codes for the biofilm-associated protein (Bap), was investigated in all ten strains by PCR. AU strains were bop-positive and DNA sequencing experiments confirmed that the fragments amplified were indeed part of a bap gene. The presence of the icaA gene, one of the genes involved in polysaccharide intercellular adhesin (PIA) formation, was also detected by PCR in eight of the ten strains tested. The two icaA-negative strains were either weak biofilm producer or no biofilm producer, although they were bop-positive. To our knowledge, this is the first report demonstrating the presence of the bap gene in nosocomial isolates of CNS, being also the first report on the presence of this gene in Staphylococcus haemolyticus and S. cohnii.

  15. Emergence of methicillin-resistant coagulase-negative staphylococci resistant to linezolid with rRNA gene C2190T and G2603T mutations. (United States)

    Cidral, Thiago André; Carvalho, Maria Cícera; Figueiredo, Agnes Marie Sá; de Melo, Maria Celeste Nunes


    The aim of this article were to determinate the mechanism of linezolid resistance in coagulase-negative methicillin-resistant staphylococci from hospitals in the northeast of Brazil. We identified the isolates using VITEK(®) 2 and MALDI-TOF. Susceptibility to antibiotics was measured by the disk-diffusion method and by Etest(®) . Extraction of the whole genome DNA was performed, followed by screening of all the strains for the presence of mecA and cfr genes. The domain V region of 23S rRNA gene was sequenced and then aligned with a linezolid-susceptible reference strain. Pulsed-field gel electrophoresis (PFGE) macro-restriction analysis was performed. Three linezolid-resistant Staphylococcus hominis and two linezolid-resistant Staphylococcus epidermidis strains were analyzed. The isolates showed two point mutations in the V region of the 23S rRNA gene (C2190T and G2603T). We did not detect the cfr gene in any isolate by PCR. The S. hominis showed the same pulsotype, while the S. epidermidis did not present any genetic relation to each other. In conclusion, this study revealed three S. hominis and two S. epidermidis strains with resistance to linezolid due to a double mutation (C2190T and G2603T) in the domain V of the 23S rRNA gene. For the first time, the mutation of C2190T in S. epidermidis is described. This study also revealed the clonal spread of a S. hominis pulsotype between three public hospitals in the city of Natal, Brazil. These findings highlight the importance of continued vigilance of linezolid resistance in staphylococci. © 2015 APMIS. Published by John Wiley & Sons Ltd.

  16. RNAi validation of resistance genes and their interactions in the highly DDT-resistant 91-R strain of Drosophila melanogaster. (United States)

    Gellatly, Kyle J; Yoon, Kyong Sup; Doherty, Jeffery J; Sun, Weilin; Pittendrigh, Barry R; Clark, J Marshall


    4,4'-dichlorodiphenyltrichloroethane (DDT) has been re-recommended by the World Health Organization for malaria mosquito control. Previous DDT use has resulted in resistance, and with continued use resistance will increase in terms of level and extent. Drosophila melanogaster is a model dipteran that has many available genetic tools, numerous studies done on insecticide resistance mechanisms, and is related to malaria mosquitoes allowing for extrapolation. The 91-R strain of D. melanogaster is highly resistant to DDT (>1500-fold), however, there is no mechanistic scheme that accounts for this level of resistance. Recently, reduced penetration, increased detoxification, and direct excretion have been identified as resistance mechanisms in the 91-R strain. Their interactions, however, remain unclear. Use of UAS-RNAi transgenic lines of D. melanogaster allowed for the targeted knockdown of genes putatively involved in DDT resistance and has validated the role of several cuticular proteins (Cyp4g1 and Lcp1), cytochrome P450 monooxygenases (Cyp6g1 and Cyp12d1), and ATP binding cassette transporters (Mdr50, Mdr65, and Mrp1) involved in DDT resistance. Further, increased sensitivity to DDT in the 91-R strain after intra-abdominal dsRNA injection for Mdr50, Mdr65, and Mrp1 was determined by a DDT contact bioassay, directly implicating these genes in DDT efflux and resistance. Copyright © 2015 Elsevier Inc. All rights reserved.

  17. Detection and Characterizations of Genes Resistant to Tetracycline and Sulfa among the Bacteria in Mariculture Water (United States)

    Qu, L.; Li, Y.; Zhu, P.


    One hundred and thirty-five bacteria from maricultural environments were tested for sensitivity to tetracycline and sulfa. Result show that 72% of the bacteria were sulfa-resistant, 36% of the bacteria were tetracycline-resistant, and 16.5% of bacteria showed resistance to both tetracyclines and sulfa ,indicating that the proportion of sulfa and tetracycline resistance bacteria isvery large in the maricultural environments. PCR methods were used to detect if these resistant bacteria carry tetracycline and sulfa resistance genes. Out of the 33 tetracycline-resistant bacteria screened, 3 were positive for tetA, 6 were positive for tetB and no isolate wasboth positive for tetA and tetB. Of the 97 sulfa-resistant bacteria screened, 9 were positive for sul2, 6 were positive for sul1, 1 isolate was positive for bothsul1 and sul2. The minimum inhibitory concentration (MIC) of tetracycline for tetA-carrying isolates were higher than those tetB-carrying isolates.while The MIC of sulfa for sul2-carrying isolates were higher than those sul1-carrying isolates. Indicating that tetA and sul2 gene may play ubknown roles in resisting tetracycline and sulfa than tetB and sul1 genes. The results showed the 4 kinds of genes (tetA,tetB,sul1,sul2) has no host specificity. All these 16S sequence are from the isolates which are positive for the above genes, it indicated the above antibiotic resistance genes are widespread in the environment regardless of the host. While the DNA sequence of these four genes showed tetA, sul1, sul2 genes are conservative in different bacteria , etB gene conserved poorly. The research aim is to get a preliminary understanding of resistance mechanism related to the resistant bacteria and the resistance genes in marine aquaculture environment through the analysis of resistant genes, providing research base for the prevention and treatment of drug-resistant bacteria so as to reduce the threat to the ecological environment, aquaculture and human health.

  18. Genetic basis of qualitative and quantitative resistance to powdery mildew in wheat: from consensus regions to candidate genes. (United States)

    Marone, Daniela; Russo, Maria A; Laidò, Giovanni; De Vita, Pasquale; Papa, Roberto; Blanco, Antonio; Gadaleta, Agata; Rubiales, Diego; Mastrangelo, Anna M


    Powdery mildew (Blumeria graminis f. sp. tritici) is one of the most damaging diseases of wheat. The objective of this study was to identify the wheat genomic regions that are involved in the control of powdery mildew resistance through a quantitative trait loci (QTL) meta-analysis approach. This meta-analysis allows the use of collected QTL data from different published studies to obtain consensus QTL across different genetic backgrounds, thus providing a better definition of the regions responsible for the trait, and the possibility to obtain molecular markers that will be suitable for marker-assisted selection. Five QTL for resistance to powdery mildew were identified under field conditions in the durum-wheat segregating population Creso × Pedroso. An integrated map was developed for the projection of resistance genes/ alleles and the QTL from the present study and the literature, and to investigate their distribution in the wheat genome. Molecular markers that correspond to candidate genes for plant responses to pathogens were also projected onto the map, particularly considering NBS-LRR and receptor-like protein kinases. More than 80 independent QTL and 51 resistance genes from 62 different mapping populations were projected onto the consensus map using the Biomercator statistical software. Twenty-four MQTL that comprised 2-6 initial QTL that had widely varying confidence intervals were found on 15 chromosomes. The co-location of the resistance QTL and genes was investigated. Moreover, from analysis of the sequences of DArT markers, 28 DArT clones mapped on wheat chromosomes have been shown to be associated with the NBS-LRR genes and positioned in the same regions as the MQTL for powdery mildew resistance. The results from the present study provide a detailed analysis of the genetic basis of resistance to powdery mildew in wheat. The study of the Creso × Pedroso durum-wheat population has revealed some QTL that had not been previously identified. Furthermore

  19. Prevalence and characterization of plasmids carrying sulfonamide resistance genes among Escherichia coli from pigs, pig carcasses and human. (United States)

    Wu, Shuyu; Dalsgaard, Anders; Hammerum, Anette M; Porsbo, Lone J; Jensen, Lars B


    Sulfonamide resistance is very common in Escherichia coli. The aim of this study was to characterize plasmids carrying sulfonamide resistance genes (sul1, sul2 and sul3) in E. coli isolated from pigs and humans with a specific objective to assess the genetic diversity of plasmids involved in the mobility of sul genes. A total of 501 E. coli isolates from pig feces, pig carcasses and human stools were tested for their susceptibility to selected antimicrobial. Multiplex PCR was conducted to detect the presence of three sul genes among the sulfonamide-resistant E. coli isolates. Fifty-seven sulfonamide-resistant E. coli were selected based on presence of sul resistance genes and subjected to conjugation and/or transformation experiments. S1 nuclease digestion followed by pulsed-field gel electrophoresis was used to visualize and determine the size of plasmids. Plasmids carrying sul genes were characterized by PCR-based replicon typing to allow a comparison of the types of sul genes, the reservoir and plasmid present. A total of 109/501 isolates exhibited sulfonamide resistance. The relative prevalences of sul genes from the three reservoirs (pigs, pig carcasses and humans) were 65%, 45% and 12% for sul2, sul1, and sul3, respectively. Transfer of resistance through conjugation was observed in 42/57 isolates. Resistances to streptomycin, ampicillin and trimethoprim were co-transferred in most strains. Class 1 integrons were present in 80% of sul1-carrying plasmids and 100% of sul3-carrying plasmids, but only in 5% of sul2-carrying plasmids. The sul plasmids ranged from 33 to 160-kb in size and belonged to nine different incompatibility (Inc) groups: FII, FIB, I1, FIA, B/O, FIC, N, HI1 and X1. IncFII was the dominant type in sul2-carrying plasmids (52%), while IncI1 was the most common type in sul1 and sul3-carrying plasmids (33% and 45%, respectively). Multireplicons were found associated with all three sul genes. Sul genes were distributed widely in E. coli isolated

  20. Prevalence and characterization of plasmids carrying sulfonamide resistance genes among Escherichia coli from pigs, pig carcasses and human

    Directory of Open Access Journals (Sweden)

    Hammerum Anette M


    Full Text Available Abstract Background Sulfonamide resistance is very common in Escherichia coli. The aim of this study was to characterize plasmids carrying sulfonamide resistance genes (sul1, sul2 and sul3 in E. coli isolated from pigs and humans with a specific objective to assess the genetic diversity of plasmids involved in the mobility of sul genes. Methods A total of 501 E. coli isolates from pig feces, pig carcasses and human stools were tested for their susceptibility to selected antimicrobial. Multiplex PCR was conducted to detect the presence of three sul genes among the sulfonamide-resistant E. coli isolates. Fifty-seven sulfonamide-resistant E. coli were selected based on presence of sul resistance genes and subjected to conjugation and/or transformation experiments. S1 nuclease digestion followed by pulsed-field gel electrophoresis was used to visualize and determine the size of plasmids. Plasmids carrying sul genes were characterized by PCR-based replicon typing to allow a comparison of the types of sul genes, the reservoir and plasmid present. Results A total of 109/501 isolates exhibited sulfonamide resistance. The relative prevalences of sul genes from the three reservoirs (pigs, pig carcasses and humans were 65%, 45% and 12% for sul2, sul1, and sul3, respectively. Transfer of resistance through conjugation was observed in 42/57 isolates. Resistances to streptomycin, ampicillin and trimethoprim were co-transferred in most strains. Class 1 integrons were present in 80% of sul1-carrying plasmids and 100% of sul3-carrying plasmids, but only in 5% of sul2-carrying plasmids. The sul plasmids ranged from 33 to 160-kb in size and belonged to nine different incompatibility (Inc groups: FII, FIB, I1, FIA, B/O, FIC, N, HI1 and X1. IncFII was the dominant type in sul2-carrying plasmids (52%, while IncI1 was the most common type in sul1 and sul3-carrying plasmids (33% and 45%, respectively. Multireplicons were found associated with all three sul genes

  1. Impact of manure fertilization on the abundance of antibiotic-resistant bacteria and frequency of detection of antibiotic resistance genes in soil and on vegetables at harvest. (United States)

    Marti, Romain; Scott, Andrew; Tien, Yuan-Ching; Murray, Roger; Sabourin, Lyne; Zhang, Yun; Topp, Edward


    Consumption of vegetables represents a route of direct human exposure to bacteria found in soil. The present study evaluated the complement of bacteria resistant to various antibiotics on vegetables often eaten raw (tomato, cucumber, pepper, carrot, radish, lettuce) and how this might vary with growth in soil fertilized inorganically or with dairy or swine manure. Vegetables were sown into field plots immediately following fertilization and harvested when of marketable quality. Vegetable and soil samples were evaluated for viable antibiotic-resistant bacteria by plate count on Chromocult medium supplemented with antibiotics at clinical breakpoint concentrations. DNA was extracted from soil and vegetables and evaluated by PCR for the presence of 46 gene targets associated with plasmid incompatibility groups, integrons, or antibiotic resistance genes. Soil receiving manure was enriched in antibiotic-resistant bacteria and various antibiotic resistance determinants. There was no coherent corresponding increase in the abundance of antibiotic-resistant bacteria enumerated from any vegetable grown in manure-fertilized soil. Numerous antibiotic resistance determinants were detected in DNA extracted from vegetables grown in unmanured soil. A smaller number of determinants were additionally detected on vegetables grown only in manured and not in unmanured soil. Overall, consumption of raw vegetables represents a route of human exposure to antibiotic-resistant bacteria and resistance determinants naturally present in soil. However, the detection of some determinants on vegetables grown only in freshly manured soil reinforces the advisability of pretreating manure through composting or other stabilization processes or mandating offset times between manuring and harvesting vegetables for human consumption.

  2. [Mechanisms of endogenous drug resistance acquisition by spontaneous chromosomal gene mutation]. (United States)

    Fukuda, H; Hiramatsu, K


    Endogenous resistance in bacteria is caused by a change or loss of function and generally genetically recessive. However, this type of resistance acquisition are now prevalent in clinical setting. Chromosomal genes that afford endogenous resistance are the genes correlated with the target of the drug, the drug inactivating enzymes, and permeability of the molecules including the antibacterial agents. Endogenous alteration of the drug target are mediated by the spontaneous mutation of their structural gene. This mutation provides much lower affinity of the drugs for the target. Gene expression of the inactivating enzymes, such as class C beta-lactamase, is generally regulated by regulatory genes. Spontaneous mutations in the regulatory genes cause constitutive enzyme production and provides the resistant to the agent which is usually stable for such enzymes. Spontaneous mutation in the structural gene gives the enzyme extra-spectrum substrate specificity, like ESBL (Extra-Spectrum-beta-Lactamase). Expression of structural genes encoding the permeability systems are also regulated by some regulatory genes. The spontaneous mutation of the regulatory genes reduce an amount of porin protein. This mutation causes much lower influx of the drug in the cell. Spontaneous mutation in promoter region of the structural gene of efflux protein was observed. This mutation raised the gene transcription and overproduced efflux protein. This protein progresses the drug efflux from the cell.

  3. Levofloxacin-resistant-Streptococcus mitis endophthalmitis: a unique presentation of bacterial endocarditis. (United States)

    Dinani, Amreen; Ktaich, Nessrine; Urban, Carl; Rubin, David


    Endogenous endophthalmitis is a rare complication of infective endocarditis and has been decreasing due to the availability of effective antibiotics. We highlight a case of endogenous endophthalmitis due to levofloxacin-resistant Streptococcus mitis presenting as infective endocarditis. Endogenous endophthalmitis should be considered as a manifestation of an underlying systemic disease, especially in patients who present with non-specific signs and symptoms with no obvious source of precipitating infection.

  4. High-throughput profiling of antibiotic resistance genes in drinking water treatment plants and distribution systems. (United States)

    Xu, Like; Ouyang, Weiying; Qian, Yanyun; Su, Chao; Su, Jianqiang; Chen, Hong


    Antibiotic resistance genes (ARGs) are present in surface water and often cannot be completely eliminated by drinking water treatment plants (DWTPs). Improper elimination of the ARG-harboring microorganisms contaminates the water supply and would lead to animal and human disease. Therefore, it is of utmost importance to determine the most effective ways by which DWTPs can eliminate ARGs. Here, we tested water samples from two DWTPs and distribution systems and detected the presence of 285 ARGs, 8 transposases, and intI-1 by utilizing high-throughput qPCR. The prevalence of ARGs differed in the two DWTPs, one of which employed conventional water treatments while the other had advanced treatment processes. The relative abundance of ARGs increased significantly after the treatment with biological activated carbon (BAC), raising the number of detected ARGs from 76 to 150. Furthermore, the final chlorination step enhanced the relative abundance of ARGs in the finished water generated from both DWTPs. The total enrichment of ARGs varied from 6.4-to 109.2-fold in tap water compared to finished water, among which beta-lactam resistance genes displayed the highest enrichment. Six transposase genes were detected in tap water samples, with the transposase gene TnpA-04 showing the greatest enrichment (up to 124.9-fold). We observed significant positive correlations between ARGs and mobile genetic elements (MGEs) during the distribution systems, indicating that transposases and intI-1 may contribute to antibiotic resistance in drinking water. To our knowledge, this is the first study to investigate the diversity and abundance of ARGs in drinking water treatment systems utilizing high-throughput qPCR techniques in China. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. PCR detection of indicator genes in methicillin-resistant ...

    African Journals Online (AJOL)

    MRSA) isolated from three Saudi hospitals. ... Resistance towards eight antimicrobial agents revealed that most of the tested strains of Staphylococcus aureus showed resistance to the tested antimicrobials in the following order; Oxacillin 100% ...

  6. The LBP Gene and Its Association with Resistance to Aeromonas hydrophila in Tilapia

    Directory of Open Access Journals (Sweden)

    Gui Hong Fu


    Full Text Available Resistance to pathogens is important for the sustainability and profitability of food fish production. In immune-related genes, the lipopolysaccharide-binding protein (LBP gene is an important mediator of the inflammatory reaction. We analyzed the cDNA and genomic structure of the LBP gene in tilapia. The full-length cDNA (1901 bp of the gene contained a 1416 bp open reading frame, encoding 471 amino acid residues. Its genomic sequence was 5577 bp, comprising 15 exons and 14 introns. Under normal conditions, the gene was constitutively expressed in all examined tissues. The highest expression was detected in intestine and kidney. We examined the responses of the gene to challenges with two bacterial pathogens Streptcoccus agalactiae and Aeromonas hydrophila. The gene was significantly upregulated in kidney and spleen post-infection with S. agalactiae and A. hydrophila, respectively. However, the expression profiles of the gene after the challenge with the two pathogens were different. Furthermore, we identified three SNPs in the gene. There were significant associations (p < 0.05 of two of the three SNPs with the resistance to A. hydrophila, but not with the resistance to S. agalactiae or growth performance. These results suggest that the LBP gene is involved in the acute-phase immunologic response to the bacterial infections, and the responses to the two bacterial pathogens are different. The two SNPs associated with the resistance to A. hydrophila may be useful in the selection of tilapia resistant to A. hydrophila.

  7. Virulence-associated and antibiotic resistance genes of microbial populations in cattle feces analyzed using a metagenomic approach. (United States)

    Durso, Lisa M; Harhay, Gregory P; Bono, James L; Smith, Timothy P L


    The bovine fecal microbiota impacts human food safety as well as animal health. Although the bacteria of cattle feces have been well characterized using culture-based and culture-independent methods, techniques have been lacking to correlate total community composition with community function. We used high throughput sequencing of total DNA extracted from fecal material to characterize general community composition and examine the repertoire of microbial genes present in beef cattle feces, including genes associated with antibiotic resistance and bacterial virulence. Results suggest that traditional 16S sequencing using "universal" primers to generate full-length sequence may under represent Acitinobacteria and Proteobacteria. Over eight percent (8.4%) of the sequences from our beef cattle fecal pool sample could be categorized as virulence genes, including a suite of genes associated with resistance to antibiotic and toxic compounds (RATC). This is a higher proportion of virulence genes found in Sargasso sea, chicken cecum, and cow rumen samples, but comparable to the proportion found in Antarctic marine derived lake, human fecal, and farm soil samples. The quantitative nature of metagenomic data, combined with the large number of RATC classes represented in samples from widely different habitats indicates that metagenomic data can be used to track relative amounts of antibiotic resistance genes in individual animals over time. Consequently, these data can be used to generate sample-specific and temporal antibiotic resistance gene profiles to facilitate an understanding of the ecology of the microbial communities in each habitat as well as the epidemiology of antibiotic resistant gene transport between and among habitats. Published by Elsevier B.V.

  8. Detection and coexistence of six categories of resistance genes in Escherichia coli strains from chickens in Anhui Province, China

    Directory of Open Access Journals (Sweden)

    Lin Li


    Full Text Available The aim of this study was to characterise the prevalence of class 1 integrons and gene cassettes, tetracycline-resistance genes, phenicol-resistance genes, 16S rRNA methylase genes, extended-spectrum β-lactamase genes and plasmid-mediated fluoroquinolone resistance determinants in 184 Escherichia coli isolates from chickens in Anhui Province, China. Susceptibility to 15 antimicrobials was determined using broth micro-dilution. Polymerase chain reaction and DNA sequencing were used to characterise the molecular basis of the antibiotic resistance. High rates of antimicrobial resistance were observed; 131 out of the 184 (72.3% isolates were resistant to at least six antimicrobial agents. The prevalences of class 1 integrons, tetracycline-resistance genes, phenicol-resistance genes, 16S rRNA methylase genes, extended-spectrum β-lactamase genes and plasmid-mediated fluoroquinolone resistance determinants were 49.5, 17.4, 15.8, 0.5, 57.6 and 46.2%, respectively. In 82 isolates, 48 different kinds of coexistence of the different genes were identified. Statistical (χ2 analysis showed that the resistance to amoxicillin, doxycycline, florfenicol, ofloxacin and gentamicin had significant differences (P<0.01 or 0.01resistance genes, which showed a certain correlation between antimicrobial resistance and the presence of resistance genes.

  9. Antimicrobial resistance and resistance genes in Salmonella strains isolated from broiler chickens along the slaughtering process in China. (United States)

    Zhu, Yuanting; Lai, Haimei; Zou, Likou; Yin, Sheng; Wang, Chengtao; Han, Xinfeng; Xia, Xiaolong; Hu, Kaidi; He, Li; Zhou, Kang; Chen, Shujuan; Ao, Xiaolin; Liu, Shuliang


    A total of 189 Salmonella isolates were recovered from 627 samples which were collected from cecal contents of broilers, chicken carcasses, chicken meat after cutting step and frozen broiler chicken products along the slaughtering process at a slaughterhouse in Sichuan province of China. The Salmonella isolates were subjected to antimicrobial susceptibility testing to 10 categories of antimicrobial agents using the Kirby-Bauer disk diffusion method. Those antibiotics-resistant isolates were further investigated for the occurrence of resistance genes, the presence of class 1 integron as well as the associated gene cassettes, and the mutations within the gyrA and parC genes. Consequently, the prevalence of Salmonella was 30.14% (47.96% for cecal content, 18.78% for chicken carcasses, 31.33% for cutting meat and 14.00% for frozen meat, respectively). The predominant serotypes were S. Typhimurium (15.34%) and S. Enteritidis (69.84%). High resistance rates to the following drugs were observed: nalidixic acid (99.5%), ampicillin (87.8%), tetracycline (51.9%), ciprofloxacin (48.7%), trimethoprim/sulfamethoxazole (48.1%), and spectinomycin (34.4%). Antimicrobial resistance profiling showed that 60.8% of isolates were multidrug resistant (MDR), and MDR strains increased from 44.7% to 78.6% along the slaughtering line. 94.6% (n=157) of beta-lactam-resistant isolates harbored at least one resistance gene of bla TEM or bla CTX-M . The relatively low prevalence of aminoglycoside resistance genes (aac(3)-II, aac(3)-IV, and ant(2″)-I) was found in 49 (66.2%) of antibiotic-resistant isolates. The tetracycline resistance genes (tet(A), tet(B), tet(C), and tet(G) and sulfonamide resistance genes (sul1, sul2, and sul3) were identified in 84 (85.7%) and 89 (97.8%) antibiotic-resistant isolates respectively. floR was identified in 44 (97.8%) florfenicol-resistant isolates. Class 1 integron was detected in 37.4% (n=43) of the MDR isolates. Two different gene cassettes, bla OXA-30 -aad

  10. Cloning and characterization of NBS-LRR resistance gene ...

    African Journals Online (AJOL)

    Nendran) cultivar. C6 was expressed only in resistant cultivar not in susceptible one. But there was no change in the expression of C2 and C3 in both resistant and susceptible cultivars. These results indicate that in depth study on C1, and C5 RGAs will be helpful for further improvement of P. coffeae resistance in banana.

  11. Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants (United States)

    Somerville, Chris R [Portola Valley, CA; Scheible, Wolf [Golm, DE


    Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  12. Application of microarray and functional-based screening methods for the detection of antimicrobial resistance genes in the microbiomes of healthy humans.

    Directory of Open Access Journals (Sweden)

    Roderick M Card

    Full Text Available The aim of this study was to screen for the presence of antimicrobial resistance genes within the saliva and faecal microbiomes of healthy adult human volunteers from five European countries. Two non-culture based approaches were employed to obviate potential bias associated with difficult to culture members of the microbiota. In a gene target-based approach, a microarray was employed to screen for the presence of over 70 clinically important resistance genes in the saliva and faecal microbiomes. A total of 14 different resistance genes were detected encoding resistances to six antibiotic classes (aminoglycosides, β-lactams, macrolides, sulphonamides, tetracyclines and trimethoprim. The most commonly detected genes were erm(B, blaTEM, and sul2. In a functional-based approach, DNA prepared from pooled saliva samples was cloned into Escherichia coli and screened for expression of resistance to ampicillin or sulphonamide, two of the most common resistances found by array. The functional ampicillin resistance screen recovered genes encoding components of a predicted AcrRAB efflux pump. In the functional sulphonamide resistance screen, folP genes were recovered encoding mutant dihydropteroate synthase, the target of sulphonamide action. The genes recovered from the functional screens were from the chromosomes of commensal species that are opportunistically pathogenic and capable of exchanging DNA with related pathogenic species. Genes identified by microarray were not recovered in the activity-based screen, indicating that these two methods can be complementary in facilitating the identification of a range of resistance mechanisms present within the human microbiome. It also provides further evidence of the diverse reservoir of resistance mechanisms present in bacterial populations in the human gut and saliva. In future the methods described in this study can be used to monitor changes in the resistome in response to antibiotic therapy.

  13. A maize resistance gene functions against bacterial streak disease in rice. (United States)

    Zhao, Bingyu; Lin, Xinghua; Poland, Jesse; Trick, Harold; Leach, Jan; Hulbert, Scot


    Although cereal crops all belong to the grass family (Poacea), most of their diseases are specific to a particular species. Thus, a given cereal species is typically resistant to diseases of other grasses, and this nonhost resistance is generally stable. To determine the feasibility of transferring nonhost resistance genes (R genes) between distantly related grasses to control specific diseases, we identified a maize R gene that recognizes a rice pathogen, Xanthomonas oryzae pv. oryzicola, which causes bacterial streak disease. Bacterial streak is an important disease of rice in Asia, and no simply inherited sources of resistance have been identified in rice. Although X. o. pv. oryzicola does not cause disease on maize, we identified a maize gene, Rxo1, that conditions a resistance reaction to a diverse collection of pathogen strains. Surprisingly, Rxo1 also controls resistance to the unrelated pathogen Burkholderia andropogonis, which causes bacterial stripe of sorghum and maize. The same gene thus controls resistance reactions to both pathogens and nonpathogens of maize. Rxo1 has a nucleotide-binding site-leucine-rich repeat structure, similar to many previously identified R genes. Most importantly, Rxo1 functions after transfer as a transgene to rice, demonstrating the feasibility of nonhost R gene transfer between cereals and providing a valuable tool for controlling bacterial streak disease.

  14. The midgut cadherin-like gene is not associated with resistance to Bacillus thuringiensis toxin Cry1Ac in Plutella xylostella (L.). (United States)

    Guo, Zhaojiang; Kang, Shi; Zhu, Xun; Wu, Qingjun; Wang, Shaoli; Xie, Wen; Zhang, Youjun


    The Gram-positive bacterium Bacillus thuringiensis (Bt) produces Cry toxins that have been used to control important agricultural pests. Evolution of resistance in target pests threatens the effectiveness of these toxins when used either in sprayed biopesticides or in Bt transgenic crops. Although alterations of the midgut cadherin-like receptor can lead to Bt Cry toxin resistance in many insects, whether the cadherin gene is involved in Cry1Ac resistance of Plutella xylostella (L.) remains unclear. Here, we present experimental evidence that resistance to Cry1Ac or Bt var. kurstaki (Btk) in P. xylostella is not due to alterations of the cadherin gene. The bona fide P. xylostella cadherin cDNA sequence was cloned and analyzed, and comparisons of the cadherin cDNA sequence among susceptible and resistant P. xylostella strains confirmed that Cry1Ac resistance was independent of mutations in this gene. In addition, real-time quantitative PCR (qPCR) indicated that cadherin transcript levels did not significantly differ among susceptible and resistant P. xylostella strains. RNA interference (RNAi)-mediated suppression of cadherin gene expression did not affect larval susceptibility to Cry1Ac toxin. Furthermore, genetic linkage assays using four cadherin gDNA allelic biomarkers confirmed that the cadherin gene is not linked to resistance against Cry1Ac in P. xylostella. Taken together, our findings demonstrate that Cry1Ac resistance of P. xylostella is independent of the cadherin gene. Copyright © 2015 Elsevier Inc. All rights reserved.

  15. The transport of antibiotic resistance genes and residues in groundwater near swine production facilities (United States)

    Lin, Y. F.; Yannarell, A. C.; Mackie, R. I.; Krapac, I. G.; Chee-Sanford, J. S.; Koike, S.


    The use of antibiotics at concentrated animal feeding operations (CAFOs) for disease prevention, disease treatment, and growth promotion can contribute to the spread of antibiotic compounds, their breakdown products, and antibiotic resistant bacteria and/or the genes that confer resistance. In addition, constitutive use of antibiotics at sub-therapeutic levels can select for antibiotic resistance among the bacteria that inhabit animal intestinal tracts, onsite manure treatment facilities, and any environments receiving significant inputs of manure (e.g. through waste lagoon leakage or fertilizer amendments to farm soils). If the antibiotic resistant organisms persist in these new environments, or if they participate in genetic exchanges with the native microflora, then CAFOs may constitute a significant reservoir for the spread of antibiotic resistance to the environment at large. Our results have demonstrated that leakage from waste treatment lagoons can influence the presence and persistence of tetracycline resistance genes in the shallow aquifer adjacent to swine CAFOs, and molecular phylogeny allowed us to distinguish "native" tetracycline resistance genes in control groundwater wells from manure-associated genes introduced from the lagoon. We have also been able to detect the presence of erythromycin resistance genes in CAFO surface and groundwater even though erythromycin is strictly reserved for use in humans and thus is not utilized at any of these sites. Ongoing research, including modeling of particle transport in groundwater, will help to determine the potential spatial and temporal extent of CAFO-derived antibiotic resistance.

  16. Characterization of Antibiotic Resistance Genes from Lactobacillus Isolated from Traditional Dairy Products. (United States)

    Guo, Huiling; Pan, Lin; Li, Lina; Lu, Jie; Kwok, Laiyu; Menghe, Bilige; Zhang, Heping; Zhang, Wenyi


    Lactobacilli are widely used as starter cultures or probiotics in yoghurt, cheese, beer, wine, pickles, preserved food, and silage. They are generally recognized as safe (GRAS). However, recent studies have shown that some lactic acid bacteria (LAB) strains carry antibiotic resistance genes and are resistant to antibiotics. Some of them may even transfer their intrinsic antibiotic resistance genes to other LAB or pathogens via horizontal gene transfer, thus threatening human health. A total of 33 Lactobacillus strains was isolated from fermented milk collected from different areas of China. We analyzed (1) their levels of antibiotic resistance using a standardized dilution method, (2) their antibiotic resistance gene profiles by polymerase chain reaction (PCR) using gene-specific primers, and (3) the transferability of some of the detected resistance markers by a filter mating assay. All Lactobacillus strains were found to be resistant to vancomycin, but susceptible to gentamicin, linezolid, neomycin, erythromycin, and clindamycin. Their susceptibilities to tetracycline, kanamycin, ciprofloxacin, streptomycin, quinupristin/dalfopristin, trimethoprim, ampicillin, rifampicin, and chloramphenicol was different. Results from our PCR analysis revealed 19 vancomycin, 10 ciprofloxacin, and 1 tetracycline-resistant bacteria that carried the van(X), van(E), gyr(A), and tet(M) genes, respectively. Finally, no transferal of the monitored antibiotic resistance genes was observed in the filter mating assay. Taken together, our study generated the antibiotic resistance profiles of some milk-originated lactobacilli isolates and preliminarily assessed their risk of transferring antibiotic gene to other bacteria. The study may provide important data concerning the safe use of LAB. © 2017 Institute of Food Technologists®.

  17. A Public Platform for the Verification of the Phenotypic Effect of Candidate Genes for Resistance to Aflatoxin Accumulation and Aspergillus flavus Infection in Maize

    Directory of Open Access Journals (Sweden)

    Xueyan Shan


    Full Text Available A public candidate gene testing pipeline for resistance to aflatoxin accumulation or Aspergillus flavus infection in maize is presented here. The pipeline consists of steps for identifying, testing, and verifying the association of selected maize gene sequences with resistance under field conditions. Resources include a database of genetic and protein sequences associated with the reduction in aflatoxin contamination from previous studies; eight diverse inbred maize lines for polymorphism identification within any maize gene sequence; four Quantitative Trait Loci (QTL mapping populations and one association mapping panel, all phenotyped for aflatoxin accumulation resistance and associated phenotypes; and capacity for Insertion/Deletion (InDel and SNP genotyping in the population(s for mapping. To date, ten genes have been identified as possible candidate genes and put through the candidate gene testing pipeline, and results are presented here to demonstrate the utility of the pipeline.

  18. RNA-Seq analysis reveals candidate genes for ontogenic resistance in Malus-Venturia pathosystem.

    Directory of Open Access Journals (Sweden)

    Michele Gusberti

    Full Text Available Ontogenic scab resistance in apple leaves and fruits is a horizontal resistance against the plant pathogen Venturia inaequalis and is expressed as a decrease in disease symptoms and incidence with the ageing of the leaves. Several studies at the biochemical level tried to unveil the nature of this resistance; however, no conclusive results were reported. We decided therefore to investigate the genetic origin of this phenomenon by performing a full quantitative transcriptome sequencing and comparison of young (susceptible and old (ontogenic resistant leaves, infected or not with the pathogen. Two time points at 72 and 96 hours post-inoculation were chosen for RNA sampling and sequencing. Comparison between the different conditions (young and old leaves, inoculated or not should allow the identification of differentially expressed genes which may represent different induced plant defence reactions leading to ontogenic resistance or may be the cause of a constitutive (uninoculated with the pathogen shift toward resistance in old leaves. Differentially expressed genes were then characterised for their function by homology to A. thaliana and other plant genes, particularly looking for genes involved in pathways already suspected of appertaining to ontogenic resistance in apple or other hosts, or to plant defence mechanisms in general. IN THIS WORK, FIVE CANDIDATE GENES PUTATIVELY INVOLVED IN THE ONTOGENIC RESISTANCE OF APPLE WERE IDENTIFIED: a gene encoding an "enhanced disease susceptibility 1 protein" was found to be down-regulated in both uninoculated and inoculated old leaves at 96 hpi, while the other four genes encoding proteins (metallothionein3-like protein, lipoxygenase, lipid transfer protein, and a peroxidase 3 were found to be constitutively up-regulated in inoculated and uninoculated old leaves. The modulation of the five candidate genes has been validated using the real-time quantitative PCR. Thus, ontogenic resistance may be the result

  19. Differential gene expression by RamA in ciprofloxacin-resistant Salmonella Typhimurium.

    Directory of Open Access Journals (Sweden)

    Jie Zheng

    Full Text Available Overexpression of ramA has been implicated in resistance to multiple drugs in several enterobacterial pathogens. In the present study, Salmonella Typhimurium strain LTL with constitutive expression of ramA was compared to its ramA-deletion mutant by employing both DNA microarrays and phenotype microarrays (PM. The mutant strain with the disruption of ramA showed differential expression of at least 33 genes involved in 11 functional groups. The study confirmed at the transcriptional level that the constitutive expression of ramA was directly associated with increased expression of multidrug efflux pump AcrAB-TolC and decreased expression of porin protein OmpF, thereby conferring multiple drug resistance phenotype. Compared to the parent strain constitutively expressing ramA, the ramA mutant had increased susceptibility to over 70 antimicrobials and toxic compounds. The PM analysis also uncovered that the ramA mutant was better in utilization of 10 carbon sources and 5 phosphorus sources. This study suggested that the constitutive expression of ramA locus regulate not only multidrug efflux pump and accessory genes but also genes involved in carbon metabolic pathways.

  20. Efficient transformation and regeneration of transgenic cassava using the neomycin phosphotransferase gene as aminoglycoside resistance marker gene. (United States)

    Niklaus, Michael; Gruissem, Wilhelm; Vanderschuren, Hervé


    Cassava is one of the most important crops in the tropics. Its industrial use for starch and biofuel production is also increasing its importance for agricultural production in tropical countries. In the last decade cassava biotechnology has emerged as a valuable alternative to the breeding constraints of this highly heterozygous crop for improved trait development of cassava germplasm. Cassava transformation remains difficult and time-consuming because of limitations in selecting transgenic tissues and regeneration of transgenic plantlets. We have recently reported an efficient and robust cassava transformation protocol using the hygromycin phosphotransferase II (hptII) gene as selection marker and the aminoglycoside hygromycin at optimal concentrations to maximize the regeneration of transgenic plantlets. In the present work, we expanded the transformation protocol to the use of the neomycin phosphotransferase II (nptII) gene as selection marker. Several aminoglycosides compatible with the use of nptII were tested and optimal concentrations for cassava transformation were determined. Given its efficiency equivalent to hptII as selection marker with the described protocol, the use of nptII opens new possibilities to engineer transgenic cassava lines with multiple T-DNA insertions and to produce transgenic cassava with a resistance marker gene that is already deregulated in several commercial transgenic crops.

  1. Gene Expression Analysis of Plum pox virus (Sharka Susceptibility/Resistance in Apricot (Prunus armeniaca L..

    Directory of Open Access Journals (Sweden)

    Manuel Rubio

    Full Text Available RNA-Seq has proven to be a very powerful tool in the analysis of the Plum pox virus (PPV, sharka disease/Prunus interaction. This technique is an important complementary tool to other means of studying genomics. In this work an analysis of gene expression of resistance/susceptibility to PPV in apricot is performed. RNA-Seq has been applied to analyse the gene expression changes induced by PPV infection in leaves from two full-sib apricot genotypes, "Rojo Pasión" and "Z506-7", resistant and susceptible to PPV, respectively. Transcriptomic analyses revealed the existence of more than 2,000 genes related to the pathogen response and resistance to PPV in apricot. These results showed that the response to infection by the virus in the susceptible genotype is associated with an induction of genes involved in pathogen resistance such as the allene oxide synthase, S-adenosylmethionine synthetase 2 and the major MLP-like protein 423. Over-expression of the Dicer protein 2a may indicate the suppression of a gene silencing mechanism of the plant by PPV HCPro and P1 PPV proteins. On the other hand, there were 164 genes involved in resistance mechanisms that have been identified in apricot, 49 of which are located in the PPVres region (scaffold 1 positions from 8,050,804 to 8,244,925, which is responsible for PPV resistance in apricot. Among these genes in apricot there are several MATH domain-containing genes, although other genes inside (Pleiotropic drug resistance 9 gene or outside (CAP, Cysteine-rich secretory proteins, Antigen 5 and Pathogenesis-related 1 protein; and LEA, Late embryogenesis abundant protein PPVres region could also be involved in the resistance.

  2. Gene Expression Analysis of Plum pox virus (Sharka) Susceptibility/Resistance in Apricot (Prunus armeniaca L.). (United States)

    Rubio, Manuel; Ballester, Ana Rosa; Olivares, Pedro Manuel; Castro de Moura, Manuel; Dicenta, Federico; Martínez-Gómez, Pedro


    RNA-Seq has proven to be a very powerful tool in the analysis of the Plum pox virus (PPV, sharka disease)/Prunus interaction. This technique is an important complementary tool to other means of studying genomics. In this work an analysis of gene expression of resistance/susceptibility to PPV in apricot is performed. RNA-Seq has been applied to analyse the gene expression changes induced by PPV infection in leaves from two full-sib apricot genotypes, "Rojo Pasión" and "Z506-7", resistant and susceptible to PPV, respectively. Transcriptomic analyses revealed the existence of more than 2,000 genes related to the pathogen response and resistance to PPV in apricot. These results showed that the response to infection by the virus in the susceptible genotype is associated with an induction of genes involved in pathogen resistance such as the allene oxide synthase, S-adenosylmethionine synthetase 2 and the major MLP-like protein 423. Over-expression of the Dicer protein 2a may indicate the suppression of a gene silencing mechanism of the plant by PPV HCPro and P1 PPV proteins. On the other hand, there were 164 genes involved in resistance mechanisms that have been identified in apricot, 49 of which are located in the PPVres region (scaffold 1 positions from 8,050,804 to 8,244,925), which is responsible for PPV resistance in apricot. Among these genes in apricot there are several MATH domain-containing genes, although other genes inside (Pleiotropic drug resistance 9 gene) or outside (CAP, Cysteine-rich secretory proteins, Antigen 5 and Pathogenesis-related 1 protein; and LEA, Late embryogenesis abundant protein) PPVres region could also be involved in the resistance.

  3. Prevalence of antimicrobial resistance and the cfiA resistance gene in Danish Bacteroides fragilis group isolates since 1973

    DEFF Research Database (Denmark)

    Ferløv-Schwensen, Simon Andreas; Sydenham, Thomas Vognbjerg; Hansen, Kia Cirkeline Møller


    Desorption/Ionization Time-Of-Flight Mass Spectrometry (MALDI-TOF MS) on the Biotyper platform. Antimicrobial resistance was determined using a disk diffusion screening method and commercial antibiotic gradient strips. Division I (cfiA-negative) and division II (cfiA-positive) B. fragilis strains were...... differentiated using MALDI-TOF MS and real-time polymerase chain reaction (PCR). RESULTS: From 1973-1980 to 2010-2015 the prevalence of antimicrobial resistance rose from 0% to 21.2%, 2.5%, and 1% for clindamycin, meropenem, and metronidazole, respectively. MALDI-TOF MS and real-time PCR identified 16 of 266 (6...... established in the recent decades in Europe. Resistance to meropenem, facilitated by expression of the cfiA resistance gene, seems to be increasing; therefore, it is imperative to monitor the occurrence of this gene, e.g. using MALDI-TOF MS....

  4. Analysis of cold resistance and identification of SSR markers linked to cold resistance genes in Brassica rapa L. (United States)

    Huang, Zhen; Zhang, Xuexian; Jiang, Shouhua; Qin, Mengfan; Zhao, Na; Lang, Lina; Liu, Yaping; Tian, Zhengshu; Liu, Xia; Wang, Yang; Zhang, Binbin; Xu, Aixia


    Currently, cold temperatures are one of the main factors threatening rapeseed production worldwide; thus, it is imperative to identify cold-resistant germplasm and to cultivate cold-resistant rapeseed varieties. In this study, the cold resistance of four Brassica rapa varieties was analyzed. The cold resistance of Longyou6 and Longyou7 was better than that of Tianyou2 and Tianyou4. Thus, an F 2 population derived from Longyou6 and Tianyou4 was used to study the correlation of cold resistance and physiological indexes. Our results showed that the degree of frost damage was related to the relative conductivity and MDA content (r1 = 0.558 and r2 = 0.447, respectively). In order to identify the markers related to cold resistance, 504 pairs of SSR (simple sequence repeats) primers were used to screen the two parents and F 2 population. Four and five SSR markers had highly significant positive correlation to relative conductivity and MDA, respectively. In addition, three of these SSR markers had a highly significant positive correlation to both of these two indexes. These three SSR markers were subsequently confirmed to be used to distinguish between cold-resistant and non-cold-resistant varieties. The results of this study will lay a solid foundation for the mapping of cold-resistant genes and molecular markers assisted selection for the cold-resistance.

  5. Identification and characterization of antibiotic resistance genes in Lactobacillus reuteri and Lactobacillus plantarum. (United States)

    Egervärn, M; Roos, S; Lindmark, H


    The study aimed to identify the resistance genes mediating atypical minimum inhibitory concentrations (MICs) for tetracycline, erythromycin, clindamycin and chloramphenicol within two sets of representative strains of the species Lactobacillus reuteri and Lactobacillus plantarum and to characterize identified genes by means of gene location and sequencing of flanking regions. A tet(W) gene was found in 24 of the 28 Lact. reuteri strains with atypical MIC for tetracycline, whereas four of the six strains with atypical MIC for erythromycin were positive for erm(B) and one strain each was positive for erm(C) and erm(T). The two Lact. plantarum strains with atypical MIC for tetracycline harboured a plasmid-encoded tet(M) gene. The majority of the tet(W)-positive Lact. reuteri strains and all erm-positive Lact. reuteri strains carried the genes on plasmids, as determined by Southern blot and a real-time PCR method developed in this study. Most of the antibiotic-resistant strains of Lact. reuteri and Lact. plantarum harboured known plasmid-encoded resistance genes. Examples of putative transfer machineries adjacent to both plasmid- and chromosome-located resistance genes were also demonstrated. These data provide some of the knowledge required for assessing the possible risk of using Lact. reuteri and Lact. plantarum strains carrying antibiotic resistance genes as starter cultures and probiotics.

  6. PCR-based detection of resistance genes in anaerobic bacteria isolated from intra-abdominal infections. (United States)

    Tran, Chau Minh; Tanaka, Kaori; Watanabe, Kunitomo


    Little information is available on the distribution of antimicrobial resistance genes in anaerobes in Japan. To understand the background of antimicrobial resistance in anaerobes involved in intra-abdominal infections, we investigated the distribution of eight antimicrobial resistance genes (cepA, cfiA, cfxA, ermF, ermB, mefA, tetQ, and nim) and a mutation in the gyrA gene in a total of 152 organisms (Bacteroides spp., Prevotella spp., Fusobacterium spp., Porphyromonas spp., Bilophila wadsworthia, Desulfovibrio desulfuricans, Veillonella spp., gram-positive cocci, and non-spore-forming gram-positive bacilli) isolated between 2003 and 2004 in Japan. The cepA gene was distributed primarily in Bacteroides fragilis. Gene cfxA was detected in about 9 % of the Bacteroides isolates and 75 % of the Prevotella spp. isolates and did not appear to contribute to cephamycin resistance. Two strains of B. fragilis contained the metallo-β-lactamase gene cfiA, but they did not produce the protein product. Gene tetQ was detected in about 81, 44, and 63 % of B. fragilis isolates, other Bacteroides spp., and Prevotella spp. isolates, respectively. The ermF gene was detected in 25, 13, 56, 64, and 16 % of Bacteroides spp., Prevotella spp., Fusobacterium spp., B. wadsworthia, and anaerobic cocci, respectively. Gene mefA was found in only 10 % of the B. fragilis strains and 3 % of the non-B. fragilis strains. Genes nim and ermB were not detected in any isolate. Substitution at position 82 (Ser to Phe) in gyrA was detected in B. fragilis isolates that were less susceptible or resistant to moxifloxacin. This study is the first report on the distribution of resistance genes in anaerobes isolated from intra-abdominal infections in Japan. We expect that the results might help in understanding the resistance mechanisms of specific anaerobes.

  7. Microbiological characterization of aquatic microbiomes targeting taxonomical marker genes and antibiotic resistance genes of opportunistic bacteria. (United States)

    Alexander, Johannes; Bollmann, Anna; Seitz, Wolfram; Schwartz, Thomas


    The dissemination of medically relevant antibiotic resistance genes (ARGs) (blaVIM-1, vanA, ampC, ermB, and mecA) and opportunistic bacteria (Enterococcus faecium/faecalis, Pseudomonas aeruginosa, Enterobacteriaceae, Staphylococcus aureus, and CNS) was determined in different anthropogenically influenced aquatic habitats in a selected region of Germany. Over a period of two years, four differently sized wastewater treatment plants (WWTPs) with and without clinical influence, three surface waters, four rain overflow basins, and three groundwater sites were analyzed by quantitative Polymerase Chain Reaction (qPCR). Results were calculated in cell equivalents per 100 ng of total DNA extracted from water samples and per 100 mL sample volume, which seems to underestimate the abundance of antibiotic resistance and opportunistic bacteria. High abundances of opportunistic bacteria and ARG were quantified in clinical wastewaters and influents of the adjacent WWTP. The removal capacities of WWTP were up to 99% for some, but not all investigated bacteria. The abundances of most ARG targets were found to be increased in the bacterial population after conventional wastewater treatment. As a consequence, downstream surface water and also some groundwater compartments displayed high abundances of all four ARGs. It became obvious that the dynamics of the ARG differed from the fate of the opportunistic bacteria. This underlines the necessity of an advanced microbial characterization of anthropogenically influenced environments. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Integron types, gene cassettes and antimicrobial resistance profile of Acinetobacter baumannii isolated from BAL samples in Babol, north of Iran. (United States)

    Akrami, Fariba; Shahandashti, Elaheh Ferdosi; Yahyapour, Yousef; Sadeghi, Mohsen; Khafri, Soraya; Pournajaf, Abazar; Rajabnia, Ramazan


    Multi-drug resistant isolates of Acinetobacter baumannii have created therapeutic problems worldwide. This current study was intended to determine the Integron types, gene cassettes and antimicrobial resistance profile of A. baumannii isolated from BAL samples in Babol, north of Iran. During a 15-month period, 35 A. baumannii isolates were studied. Different classes of antimicrobial agents were used to determine the resistance ratios. Multiplex-PCR was used to detect different types of integrons and associated gene cassettes. The resistance rates to GM, FEP, AK, TOB, CP, PIP, SAM, IPM, SXT, CTX, CAZ, CL, TIM, MEM, and TZP were 85.7%, 100%, 91.4%, 68.5%, 94.3%, 88.5%, 97.1%, 94.3%, 100%, 100%, 100%, 0.0%, 91.4%, 94.3% and 91.4%, respectively. The distribution analysis of int genes showed that 25.7%, 88.6% and 28.6% of isolates carried the intI, intII and intIII genes, respectively. The prevalence of aadB, dfrA1, bla-OXA 30 and aadA1 genes were 94.3%, 77.1%, 40% and 5.7%, respectively. The current study showed that a high level of A. baumannii isolates harbor integrons in our therapeutic center, which may lead to distribution of multiple antimicrobial resistance. The different types of gene cassette arrays in the present study highlight the important role of geographical features in MDR isolates dissemination which could be credited to different profiles of drug consumption in different areas. The findings emphasized that the need for continuous surveillance to prevent distribution of multidrug resistance among A. baumannii strains in Iran. Copyright © 2017. Published by Elsevier Ltd.

  9. Sales presentation anxiety, cortisol levels, self-reports, and gene-gene interactions

    NARCIS (Netherlands)

    Verbeke, W.; Bagozzi, R.P.; van den Berg, W.; Worm, L.; Belschak, F.D.


    We study sales presentation anxiety (SPA) using multilevel analysis of a quasi-natural field experiment: the final exam of an executive training course where sales professionals (n = 128) compete in teams to present an account plan to a critical audience who then ask questions and evaluate their

  10. A bacterial antibiotic-resistance gene that complements the human multidrug-resistance P-glycoprotein gene

    NARCIS (Netherlands)

    van Veen, HW; Callaghan, R; Soceneantu, L; Sardini, A; Konings, WN; Higgins, CF


    Bacteria have developed many fascinating antibiotic-resistance mechanisms(1,2). A protein in Lactococcus lactis, LmrA, mediates antibiotic resistance by extruding amphiphilic compounds from the inner leaflet of the cytoplasmic membrane(3,4). Unlike other known bacterial multidrug-resistance

  11. Trends of drug-resistance-associated mutations in the reverse transcriptase gene of HIV type 1 isolates from North India. (United States)

    Azam, Mohd; Malik, Abida; Rizvi, Meher; Rai, Arvind


    A major cause of failure of antiretroviral therapy (ART) is the presence of drug-resistance-associated mutations in the polymerase gene of HIV-1. The paucity of data regarding potential drug resistance to reverse transcriptase inhibitors (RTIs) prompted us to carry out this study. This information will shed light on the extent of drug resistance already present in HIV strains and will give future directions in patient treatment and in drug design. Drug resistance genotyping of a partial reverse transcriptase gene was done in 103 HIV-1-infected patients, including the ART-naive and ART-experienced population. The drug resistance pattern was analyzed using the Stanford HIV-DR database, the IAS-USA mutation list and the REGA algorithm-v8.0. Subtyping was done using the REGA HIV-1 subtyping tool-v2.01. The majority of our sequences (96 %) were found to be subtype C, and four (3.8 %) were subtype A1. Significant prevalence of DR mutations (28 %) was observed in the RT gene. Major amino acid substitutions were seen at positions 41, 90, 98, 103, 106, 108, 138, 181, 184, 190, 215, and 219, which confer high/intermediate levels of resistance to most RTIs, independently or together. Our results show that there is an urgent need to tailor ART drug regimens to the individual to achieve optimum therapeutic outcome in North India.

  12. Dissecting the organ specificity of insecticide resistance candidate genes in Anopheles gambiae: known and novel candidate genes. (United States)

    Ingham, Victoria A; Jones, Christopher M; Pignatelli, Patricia; Balabanidou, Vasileia; Vontas, John; Wagstaff, Simon C; Moore, Jonathan D; Ranson, Hilary


    The elevated expression of enzymes with insecticide metabolism activity can lead to high levels of insecticide resistance in the malaria vector, Anopheles gambiae. In this study, adult female mosquitoes from an insecticide susceptible and resistant strain were dissected into four different body parts. RNA from each of these samples was used in microarray analysis to determine the enrichment patterns of the key detoxification gene families within the mosquito and to identify additional candidate insecticide resistance genes that may have been overlooked in previous experiments on whole organisms. A general enrichment in the transcription of genes from the four major detoxification gene families (carboxylesterases, glutathione transferases, UDP glucornyltransferases and cytochrome P450s) was observed in the midgut and malpighian tubules. Yet the subset of P450 genes that have previously been implicated in insecticide resistance in An gambiae, show a surprisingly varied profile of tissue enrichment, confirmed by qPCR and, for three candidates, by immunostaining. A stringent selection process was used to define a list of 105 genes that are significantly (p ≤0.001) over expressed in body parts from the resistant versus susceptible strain. Over half of these, including all the cytochrome P450s on this list, were identified in previous whole organism comparisons between the strains, but several new candidates were detected, notably from comparisons of the transcriptomes from dissected abdomen integuments. The use of RNA extracted from the whole organism to identify candidate insecticide resistance genes has a risk of missing candidates if key genes responsible for the phenotype have restricted expression within the body and/or are over expression only in certain tissues. However, as transcription of genes implicated in metabolic resistance to insecticides is not enriched in any one single organ, comparison of the transcriptome of individual dissected body parts cannot

  13. Characterization and cloning of TMV resistance gene N homologues ...

    African Journals Online (AJOL)

    Tobacco cultivars Nicotiana tabacum cv. Samsun NN plants carrying the N gene contain a multitude of N-related genes. We cloned a few N homologues and isolated two full-length cDNAs of NL-C26 and NL-B69 genes from N. tabacum cv. Samsun NN. Nucleotide sequence analysis showed that the coding regions of ...

  14. Sequence Exchange between Homologous NB-LRR Genes Converts Virus Resistance into Nematode Resistance, and Vice Versa. (United States)

    Slootweg, Erik; Koropacka, Kamila; Roosien, Jan; Dees, Robert; Overmars, Hein; Lankhorst, Rene Klein; van Schaik, Casper; Pomp, Rikus; Bouwman, Liesbeth; Helder, Johannes; Schots, Arjen; Bakker, Jaap; Smant, Geert; Goverse, Aska


    Plants have evolved a limited repertoire of NB-LRR disease resistance ( R ) genes to protect themselves against myriad pathogens. This limitation is thought to be counterbalanced by the rapid evolution of NB-LRR proteins, as only a few sequence changes have been shown to be sufficient to alter resistance specificities toward novel strains of a pathogen. However, little is known about the flexibility of NB-LRR R genes to switch resistance specificities between phylogenetically unrelated pathogens. To investigate this, we created domain swaps between the close homologs Gpa2 and Rx1 , which confer resistance in potato ( Solanum tuberosum ) to the cyst nematode Globodera pallida and Potato virus X , respectively. The genetic fusion of the CC-NB-ARC of Gpa2 with the LRR of Rx1 (Gpa2 CN /Rx1 L ) results in autoactivity, but lowering the protein levels restored its specific activation response, including extreme resistance to Potato virus X in potato shoots. The reciprocal chimera (Rx1 CN /Gpa2 L ) shows a loss-of-function phenotype, but exchange of the first three LRRs of Gpa2 by the corresponding region of Rx1 was sufficient to regain a wild-type resistance response to G. pallida in the roots. These data demonstrate that exchanging the recognition moiety in the LRR is sufficient to convert extreme virus resistance in the leaves into mild nematode resistance in the roots, and vice versa. In addition, we show that the CC-NB-ARC can operate independently of the recognition specificities defined by the LRR domain, either aboveground or belowground. These data show the versatility of NB-LRR genes to generate resistance to unrelated pathogens with completely different lifestyles and routes of invasion. © 2017 American Society of Plant Biologists. All Rights Reserved.

  15. Identification and mapping of two powdery mildew resistance genes in Triticum boeoticum L. (United States)

    Chhuneja, Parveen; Kumar, Krishan; Stirnweis, Daniel; Hurni, Severine; Keller, Beat; Dhaliwal, Harcharan S; Singh, Kuldeep


    Powdery mildew (PM) caused by Blumeria graminis f. sp. tritici (Bgt), is one of the important foliar diseases of wheat that can cause serious yield losses. Breeding for cultivars with diverse resources of resistance is the most promising approach for combating this disease. The diploid A genome progenitor species of wheat are an important resource for new variability for disease resistance genes. An accession of Triticum boeoticum (A(b)A(b)) showed resistance against a number of Bgt isolates, when tested using detached leaf segments. Inheritance studies in a recombinant inbred line population (RIL), developed from crosses of PM resistant T. boeoticum acc. pau5088 with a PM susceptible T. monococcum acc. pau14087, indicated the presence of two powdery mildew resistance genes in T. boeoticum acc. pau5088. Analysis of powdery mildew infection and molecular marker data of the RIL population revealed that both powdery mildew resistance genes are located on the long arm of chromosome 7A. Mapping was conducted using an integrated linkage map of 7A consisting of SSR, RFLP, STS, and DArT markers. These powdery mildew resistance genes are tentatively designated as PmTb7A.1 and PmTb7A.2. The PmTb7A.2 is closely linked to STS markers MAG2185 and MAG1759 derived from RFLP probes which are linked to powdery mildew resistance gene Pm1. This indicated that PmTb7A.2 might be allelic to Pm1. The PmTb7A.1, flanked by a DArT marker wPt4553 and an SSR marker Xcfa2019 in a 4.3 cM interval, maps proximal to PmT7A.2. PmTb7A.1 is putatively a new powdery mildew resistance gene. The powdery mildew resistance genes from T. boeoticum are currently being transferred to cultivated wheat background through marker-assisted backcrossing, using T. durum as bridging species.

  16. Candidate genes revealed by a genome scan for mosquito resistance to a bacterial insecticide: sequence and gene expression variations

    Directory of Open Access Journals (Sweden)

    David Jean-Philippe


    Full Text Available Abstract Background Genome scans are becoming an increasingly popular approach to study the genetic basis of adaptation and speciation, but on their own, they are often helpless at identifying the specific gene(s or mutation(s targeted by selection. This shortcoming is hopefully bound to disappear in the near future, thanks to the wealth of new genomic resources that are currently being developed for many species. In this article, we provide a foretaste of this exciting new era by conducting a genome scan in the mosquito Aedes aegypti with the aim to look for candidate genes involved in resistance to Bacillus thuringiensis subsp. israelensis (Bti insecticidal toxins. Results The genome of a Bti-resistant and a Bti-susceptible strains was surveyed using about 500 MITE-based molecular markers, and the loci showing the highest inter-strain genetic differentiation were sequenced and mapped on the Aedes aegypti genome sequence. Several good candidate genes for Bti-resistance were identified in the vicinity of these highly differentiated markers. Two of them, coding for a cadherin and a leucine aminopeptidase, were further examined at the sequence and gene expression levels. In the resistant strain, the cadherin gene displayed patterns of nucleotide polymorphisms consistent with the action of positive selection (e.g. an excess of high compared to intermediate frequency mutations, as well as a significant under-expression compared to the susceptible strain. Conclusion Both sequence and gene expression analyses agree to suggest a role for positive selection in the evolution of this cadherin gene in the resistant strain. However, it is unlikely that resistance to Bti is conferred by this gene alone, and further investigation will be needed to characterize other genes significantly associated with Bti resistance in Ae. aegypti. Beyond these results, this article illustrates how genome scans can build on the body of new genomic information (here, full

  17. Antimicrobial Chemicals Are Associated with Elevated Antibiotic Resistance Genes in the Indoor Dust Microbiome. (United States)

    Hartmann, Erica M; Hickey, Roxana; Hsu, Tiffany; Betancourt Román, Clarisse M; Chen, Jing; Schwager, Randall; Kline, Jeff; Brown, G Z; Halden, Rolf U; Huttenhower, Curtis; Green, Jessica L


    Antibiotic resistance is increasingly widespread, largely due to human influence. Here, we explore the relationship between antibiotic resistance genes and the antimicrobial chemicals triclosan, triclocarban, and methyl-, ethyl-, propyl-, and butylparaben in the dust microbiome. Dust samples from a mixed-use athletic and educational facility were subjected to microbial and chemical analyses using a combination of 16S rRNA amplicon sequencing, shotgun metagenome sequencing, and liquid chromatography tandem mass spectrometry. The dust resistome was characterized by identifying antibiotic resistance genes annotated in the Comprehensive Antibiotic Resistance Database (CARD) from the metagenomes of each sample using the Short, Better Representative Extract Data set (ShortBRED). The three most highly abundant antibiotic resistance genes were tet(W), blaSRT-1, and erm(B). The complete dust resistome was then compared against the measured concentrations of antimicrobial chemicals, which for triclosan ranged from 0.5 to 1970 ng/g dust. We observed six significant positive associations between the concentration of an antimicrobial chemical and the relative abundance of an antibiotic resistance gene, including one between the ubiquitous antimicrobial triclosan and erm(X), a 23S rRNA methyltransferase implicated in resistance to several antibiotics. This study is the first to look for an association between antibiotic resistance genes and antimicrobial chemicals in dust.

  18. Comparison of antimicrobial resistant genes in chicken gut microbiome grown on organic and conventional diet

    Directory of Open Access Journals (Sweden)

    Narasimha V. Hegde


    Full Text Available Antibiotics are widely used in chicken production for therapeutic purposes, disease prevention and growth promotion, and this may select for drug resistant microorganisms known to spread to humans through consumption of contaminated food. Raising chickens on an organic feed regimen, without the use of antibiotics, is increasingly popular with the consumers. In order to determine the effects of diet regimen on antibiotic resistant genes in the gut microbiome, we analyzed the phylotypes and identified the antimicrobial resistant genes in chicken, grown under conventional and organic dietary regimens. Phylotypes were analyzed from DNA extracted from fecal samples from chickens grown under these dietary conditions. While gut microbiota of chicken raised in both conventional and organic diet exhibited the presence of DNA from members of Proteobacteria and Bacteroidetes, organic diet favored the growth of members of Fusobacteria. Antimicrobial resistance genes were identified from metagenomic libraries following cloning and sequencing of DNA fragments from fecal samples and selecting for the resistant clones (n=340 on media containing different concentrations of eight antibiotics. The antimicrobial resistant genes exhibited diversity in their host distribution among the microbial population and expressed more in samples from chicken grown on a conventional diet at higher concentrations of certain antimicrobials than samples from chicken grown on organic diet. Further studies will elucidate if this phenomena is widespread and whether the antimicrobial resistance is indeed modulated by diet. This may potentially assist in defining strategies for intervention to reduce the prevalence and dissemination of antibiotic resistance genes in the production environment.

  19. Genetic mapping of a major dominant gene for resistance to Ralstonia solanacearum in eggplant. (United States)

    Lebeau, A; Gouy, M; Daunay, M C; Wicker, E; Chiroleu, F; Prior, P; Frary, A; Dintinger, J


    Resistance of eggplant against Ralstonia solanacearum phylotype I strains was assessed in a F(6) population of recombinant inbred lines (RILs) derived from a intra-specific cross between S. melongena MM738 (susceptible) and AG91-25 (resistant). Resistance traits were determined as disease score, percentage of wilted plants, and stem-based bacterial colonization index, as assessed in greenhouse experiments conducted in Réunion Island, France. The AG91-25 resistance was highly efficient toward strains CMR134, PSS366 and GMI1000, but only partial toward the highly virulent strain PSS4. The partial resistance found against PSS4 was overcome under high inoculation pressure, with heritability estimates from 0.28 to 0.53, depending on the traits and season. A genetic map was built with 119 AFLP, SSR and SRAP markers positioned on 18 linkage groups (LG), for a total length of 884 cM, and used for quantitative trait loci (QTL) analysis. A major dominant gene, named ERs1, controlled the resistance to strains CMR134, PSS366, and GMI1000. Against strain PSS4, this gene was not detected, but a significant QTL involved in delay of disease progress was detected on another LG. The possible use of the major resistance gene ERs1 in marker-assisted selection and the prospects offered for academic studies of a possible gene for gene system controlling resistance to bacterial wilt in solanaceous plants are discussed.

  20. Knockdown resistance (kdr) of the voltage-gated sodium channel gene of Aedes aegypti population in Denpasar, Bali, Indonesia. (United States)

    Hamid, Penny Humaidah; Prastowo, Joko; Widyasari, Anis; Taubert, Anja; Hermosilla, Carlos


    Aedes aegypti is the main vector of several arthropod-borne viral infections in the tropics profoundly affecting humans, such as dengue fever (DF), West Nile (WN), chikungunya and more recently Zika. Eradication of Aedes still largely depends on insecticides, which is the most cost-effective strategy, and often inefficient due to resistance development in exposed Aedes populations. We here conducted a study of Ae. aegypti resistance towards several insecticides regularly used in the city of Denpasar, Bali, Indonesia. Aedes aegypti egg samples were collected with ovitraps and thereafter hatched in the insectary of the Gadjah Mada University. The F0 generation was used for all bioassay-related experiments and knockdown resistance (kdr) assays. Results clearly showed resistance development of Ae. aegypti against tested insecticides. Mortalities of Ae. aegypti were less than 90% with highest resistance observed against 0.75% permethrin. Mosquitoes from the southern parts of Denpasar presented high level of resistance pattern in comparison to those from the western and northern parts of Denpasar. Kdr analysis of voltage-gated sodium channel (Vgsc) gene showed significant association to S989P and V1016G mutations linked to resistance phenotypes against 0.75% permethrin. Conversely, Ae. aegypti F1534C gene mutation did not result in any significant correlation to resistance development. Periodically surveillance of insecticide resistances in Ae. aegypti mosquitoes will help local public health authorities to set better goals and allow proper evaluation of on-going mosquito control strategies. Initial detection of insecticide resistance will contribute to conduct proper actions in delaying mosquito resistance development such as insecticide rotation or combination of compounds in order to prolong chemical efficacy in combating Ae. aegypti vectors in Indonesia.

  1. Paradoxical DNA repair and peroxide resistance gene conservation in Bacillus pumilus SAFR-032.

    Directory of Open Access Journals (Sweden)

    Jason Gioia

    Full Text Available BACKGROUND: Bacillus spores are notoriously resistant to unfavorable conditions such as UV radiation, gamma-radiation, H2O2, desiccation, chemical disinfection, or starvation. Bacillus pumilus SAFR-032 survives standard decontamination procedures of the Jet Propulsion Lab spacecraft assembly facility, and both spores and vegetative cells of this strain exhibit elevated resistance to UV radiation and H2O2 compared to other Bacillus species. PRINCIPAL FINDINGS: The genome of B. pumilus SAFR-032 was sequenced and annotated. Lists of genes relevant to DNA repair and the oxidative stress response were generated and compared to B. subtilis and B. licheniformis. Differences in conservation of genes, gene order, and protein sequences are highlighted because they potentially explain the extreme resistance phenotype of B. pumilus. The B. pumilus genome includes genes not found in B. subtilis or B. licheniformis and conserved genes with sequence divergence, but paradoxically lacks several genes that function in UV or H2O2 resistance in other Bacillus species. SIGNIFICANCE: This study identifies several candidate genes for further research into UV and H2O2 resistance. These findings will help explain the resistance of B. pumilus and are applicable to understanding sterilization survival strategies of microbes.

  2. PCR Screening of Antibiotic Resistance Genes in Faecal Samples from Australian and Chinese Children. (United States)

    Ravensdale, Joshua T; Xian, Darren Ten Wei; Wei, Chooi Ming; Lv, Quanjun; Wen, Xiajian; Guo, Jing; Coorey, Ranil; LeSouëf, Peter; Lu, Fengmin; Zhang, Brad; Dykes, Gary A


    Recent public awareness campaigns on the risk of antibiotic resistance in pathogenic microbes has placed pressure on governments to enforce stricter antimicrobial stewardship policies on the hospital and agricultural industry. This study aimed to screen faecal samples from Australian and Chinese children for the presence of antibiotic resistance genes to identify demographics at risk of carriage of these genes and examine antimicrobial stewardship policies from the two countries which may influence carriage. Faecal samples from 46 Australian and 53 Chinese children were screened for the presence of six clinically relevant antibiotic resistance genes using PCR. Clinical and demographic data was also collected from each patient. Over 90% of faecal samples from Chinese children tested positive for β-lactam, macrolide, tetracycline, and aminoglycoside resistance genes, which was substantially higher than Australian samples. Besides country of origin, no clear trend could be seen to predict carriage of resistance genes. The exception to this was Chinese born children who immigrated to Australia having higher rates of carriage for bla TEM and tetM genes than children born and still living in Australia. These data indicated that Chinese children were more likely to carry certain antibiotic resistance genes than Australian children. The Chinese government has recently implemented strict policies to control the overuse of antibiotics in hospitals. However, many of these policies do not extend to the agricultural industry which could explain the differences seen in this study. Copyright © 2018. Published by Elsevier Ltd.

  3. Candidate Gene Identification with SNP Marker-Based Fine Mapping of Anthracnose Resistance Gene Co-4 in Common Bean. (United States)

    Burt, Andrew J; William, H Manilal; Perry, Gregory; Khanal, Raja; Pauls, K Peter; Kelly, James D; Navabi, Alireza


    Anthracnose, caused by Colletotrichum lindemuthianum, is an important fungal disease of common bean (Phaseolus vulgaris). Alleles at the Co-4 locus confer resistance to a number of races of C. lindemuthianum. A population of 94 F4:5 recombinant inbred lines of a cross between resistant black bean genotype B09197 and susceptible navy bean cultivar Nautica was used to identify markers associated with resistance in bean chromosome 8 (Pv08) where Co-4 is localized. Three SCAR markers with known linkage to Co-4 and a panel of single nucleotide markers were used for genotyping. A refined physical region on Pv08 with significant association with anthracnose resistance identified by markers was used in BLAST searches with the genomic sequence of common bean accession G19833. Thirty two unique annotated candidate genes were identified that spanned a physical region of 936.46 kb. A majority of the annotated genes identified had functional similarity to leucine rich repeats/receptor like kinase domains. Three annotated genes had similarity to 1, 3-β-glucanase domains. There were sequence similarities between some of the annotated genes found in the study and the genes associated with phosphoinositide-specific phosphilipases C associated with Co-x and the COK-4 loci found in previous studies. It is possible that the Co-4 locus is structured as a group of genes with functional domains dominated by protein tyrosine kinase along with leucine rich repeats/nucleotide binding site, phosphilipases C as well as β-glucanases.

  4. A novel Capsicum gene inhibits host-specific disease resistance to Phytophthora capsici. (United States)

    Reeves, Gregory; Monroy-Barbosa, Ariadna; Bosland, Paul W


    A novel disease resistance inhibitor gene (inhibitor of P. capsici resistance [Ipcr]), found in the chile pepper (Capsicum annuum) variety 'New Mexico Capsicum Accession 10399' (NMCA10399), inhibits resistance to Phytophthora capsici but not to other species of Phytophthora. When a highly P. capsici-resistant variety was hybridized with NMCA10399, the resultant F1 populations, when screened, were completely susceptible to P. capsici for root rot and foliar blight disease syndromes, despite the dominance inheritance of P. capsici resistance in chile pepper. The F2 population displayed a 3:13 resistant-to-susceptible (R:S) ratio. The testcross population displayed a 1:1 R:S ratio, and a backcross population to NMCA10399 displayed complete susceptibility. These results demonstrate the presence of a single dominant inhibitor gene affecting P. capsici resistance in chile pepper. Moreover, when lines carrying the Ipcr gene were challenged against six Phytophthora spp., the nonhost resistance was not overcome. Therefore, the Ipcr gene is interfering with host-specific resistance but not the pathogen- or microbe-associated molecular pattern nonhost responses.

  5. Molecular mapping and genetic analysis of a rice brown planthopper (Nilaparvata lugens Stål) resistance gene. (United States)

    Yang, Haiyuan; Ren, Xiang; Weng, Qingmei; Zhu, Lili; He, Guangcun


    The brown planthopper (BPH), Nilaparvata lugens Stål, is a serious insect pest of rice (Oryza saliva L.). We have determined the chromosomal location of a BPH resistance gene in rice using SSR and RFLP techniques. A rice line 'B14', derived from the wild rice Oryza latifolia, showed high resistance to BPH. For tagging the resistance gene in 'B14X', an F2 population and a recombinant inbred (RI) population from a cross between Taichung Native 1 and 'B14' were developed and evaluated for BPH resistance. The results showed that a single dominant gene controlled the resistance of 'B14' to BPH. Bulked segregant SSR analysis was employed for identification of DNA markers linked to the resistance gene. From the survey of 302 SSR primer pairs, three SSR (RM335, RM261, RM185) markers linked to the resistance gene were identified. The closest SSR marker RM261 was linked to the resistance gene at a distance of 1.8 cM. Regions surrounding the resistance gene and the SSR markers were examined with additional RFLP markers on chromosome 4 to define the location of the resistance gene. Linkage of RFLP markers C820, R288, C946 with the resistance gene further confirmed its location on the short arm of chromosome 4. Closely linked DNA markers will facilitate selection for resistant lines in breeding programs and provide the basis for map-based cloning of this resistance gene.

  6. Overexpression of multiple detoxification genes in deltamethrin resistant Laodelphax striatellus (Hemiptera: Delphacidae in China.

    Directory of Open Access Journals (Sweden)

    Lu Xu

    Full Text Available BACKGROUND: The small brown planthopper (SBPH, Laodelphax striatellus (Fallén, is one of the major rice pests in Asia and has developed resistance to multiple classes of insecticides. Understanding resistance mechanisms is essential to the management of this pest. Biochemical and molecular assays were performed in this study to systematically characterize deltamethrin resistance mechanisms with laboratory-selected resistant and susceptible strains of SBPH. METHODOLOGY/PRINCIPAL FINDINGS: Deltamethrin resistant strains of SBPH (JH-del were derived from a field population by continuously selections (up to 30 generations in the laboratory, while a susceptible strain (JHS was obtained from the same population by removing insecticide pressure for 30 generations. The role of detoxification enzymes in the resistance was investigated using synergism and enzyme activity assays with strains of different resistant levels. Furthermore, 71 cytochrome P450, 93 esterases and 12 glutathione-S-transferases cDNAs were cloned based on transcriptome data of a field collected population. Semi-quantitative RT-PCR screening analysis of 176 identified detoxification genes demonstrated that multiple P450 and esterase genes were overexpressed (>2-fold in JH-del strains (G4 and G30 when compared to that in JHS, and the results of quantitative PCR coincided with the semi-quantitative RT-PCR results. Target mutation at IIS3-IIS6 regions encoded by the voltage-gated sodium channel gene was ruled out for conferring the observed resistance. CONCLUSION/SIGNIFICANCE: As the first attempt to discover genes potentially involved in SBPH pyrethroid resistance, this study putatively identified several candidate genes of detoxification enzymes that were significantly overexpressed in the resistant strain, which matched the synergism and enzyme activity testing. The biochemical and molecular evidences suggest that the high level pyrethroid resistance in L. striatellus could be due to

  7. Resistance to Downy Mildew in Lettuce 'La Brillante' is Conferred by Dm50 Gene and Multiple QTL. (United States)

    Simko, Ivan; Ochoa, Oswaldo E; Pel, Mathieu A; Tsuchida, Cayla; Font I Forcada, Carolina; Hayes, Ryan J; Truco, Maria-Jose; Antonise, Rudie; Galeano, Carlos H; Michelmore, Richard W


    Many cultivars of lettuce (Lactuca sativa L.) are susceptible to downy mildew, a nearly globally ubiquitous disease caused by Bremia lactucae. We previously determined that Batavia type cultivar 'La Brillante' has a high level of field resistance to the disease in California. Testing of a mapping population developed from a cross between 'Salinas 88' and La Brillante in multiple field and laboratory experiments revealed that at least five loci conferred resistance in La Brillante. The presence of a new dominant resistance gene (designated Dm50) that confers complete resistance to specific isolates was detected in laboratory tests of seedlings inoculated with multiple diverse isolates. Dm50 is located in the major resistance cluster on linkage group 2 that contains at least eight major, dominant Dm genes conferring resistance to downy mildew. However, this Dm gene is ineffective against the isolates of B. lactucae prevalent in the field in California and the Netherlands. A quantitative trait locus (QTL) located at the Dm50 chromosomal region (qDM2.2) was detected, though, when the amount of disease was evaluated a month before plants reached harvest maturity. Four additional QTL for resistance to B. lactucae were identified on linkage groups 4 (qDM4.1 and qDM4.2), 7 (qDM7.1), and 9 (qDM9.2). The largest effect was associated with qDM7.1 (up to 32.9% of the total phenotypic variance) that determined resistance in multiple field experiments. Markers identified in the present study will facilitate introduction of these resistance loci into commercial cultivars of lettuce.

  8. Human Activity Determines the Presence of Integron-Associated and Antibiotic Resistance Genes in Southwestern British Columbia

    Directory of Open Access Journals (Sweden)

    Miguel I. Uyaguari-Díaz


    Full Text Available The dissemination of antibiotic resistant bacteria from anthropogenic sources into the environment poses an emerging public health threat. Antibiotic resistance genes (ARGs and gene-capturing systems such as integron-associated integrase genes (intI play a key role in alterations of microbial communities and the spread of antibiotic resistant bacteria into the environment. In order to assess the effect of anthropogenic activities on watersheds in southwestern British Columbia, the presence of putative antibiotic resistance and integrase genes was analyzed in the microbiome of agricultural, urban influenced, and protected watersheds. A metagenomics approach and high-throughput quantitative PCR (HT qPCR were used to screen for elements of resistance including ARGs and intI. Metagenomic sequencing of bacterial genomic DNA was used to characterize the resistome of microbial communities present in watersheds over a 1-year period. There was a low prevalence of ARGs relative to the microbial population (<1%. Analysis of the metagenomic sequences detected a total of 60 elements of resistance including 46 ARGs, intI1, and groEL/intI1 genes and 12 quaternary ammonium compounds (qac resistance genes across all watershed locations. The relative abundance and richness of ARGs was found to be highest in agriculture impacted watersheds compared to urban and protected watersheds. A downstream transport pattern was observed in the impacted watersheds (urban and agricultural during dry months. Similar to other reports, this study found a strong association between intI1 and ARGs (e.g., sul1, an association which may be used as a proxy for anthropogenic activities. Chemical analysis of water samples for three major groups of antibiotics was below the detection limit. However, the high richness and gene copy numbers (GCNs of ARGs in impacted sites suggest that the effects of effluents on microbial communities are occurring even at low concentrations of

  9. Human Activity Determines the Presence of Integron-Associated and Antibiotic Resistance Genes in Southwestern British Columbia. (United States)

    Uyaguari-Díaz, Miguel I; Croxen, Matthew A; Luo, Zhiyao; Cronin, Kirby I; Chan, Michael; Baticados, Waren N; Nesbitt, Matthew J; Li, Shaorong; Miller, Kristina M; Dooley, Damion; Hsiao, William; Isaac-Renton, Judith L; Tang, Patrick; Prystajecky, Natalie


    The dissemination of antibiotic resistant bacteria from anthropogenic sources into the environment poses an emerging public health threat. Antibiotic resistance genes (ARGs) and gene-capturing systems such as integron-associated integrase genes ( intI ) play a key role in alterations of microbial communities and the spread of antibiotic resistant bacteria into the environment. In order to assess the effect of anthropogenic activities on watersheds in southwestern British Columbia, the presence of putative antibiotic resistance and integrase genes was analyzed in the microbiome of agricultural, urban influenced, and protected watersheds. A metagenomics approach and high-throughput quantitative PCR (HT qPCR) were used to screen for elements of resistance including ARGs and intI . Metagenomic sequencing of bacterial genomic DNA was used to characterize the resistome of microbial communities present in watersheds over a 1-year period. There was a low prevalence of ARGs relative to the microbial population (<1%). Analysis of the metagenomic sequences detected a total of 60 elements of resistance including 46 ARGs, intI1 , and groEL/ intI1 genes and 12 quaternary ammonium compounds ( qac ) resistance genes across all watershed locations. The relative abundance and richness of ARGs was found to be highest in agriculture impacted watersheds compared to urban and protected watersheds. A downstream transport pattern was observed in the impacted watersheds (urban and agricultural) during dry months. Similar to other reports, this study found a strong association between intI1 and ARGs (e.g., sul1 ), an association which may be used as a proxy for anthropogenic activities. Chemical analysis of water samples for three major groups of antibiotics was below the detection limit. However, the high richness and gene copy numbers (GCNs) of ARGs in impacted sites suggest that the effects of effluents on microbial communities are occurring even at low concentrations of antimicrobials

  10. Tagging of blast resistance gene(s) to DNA markers and marker-assisted selection (MAS) in rice improvement

    International Nuclear Information System (INIS)

    Zhuang, J.Y.; Lu, J.; Qian, H.R.; Lin, H.X.; Zheng, K.L.


    This paper reports progress made on the tagging of blast resistance gene(s) to DNA markers and on the initiation of marker-assisted selection (MAS) for blast resistance in rice improvement. A pair of near isogenic lines, K8OR and K79S, were developed using a Chinese landrace Hong-jiao-zhan as the resistance donor. Ten putatively positive markers were identified by screening 177 mapped DNA markers. Using the F 2 population of 143 plants and the derived F 3 lines, three Restriction Fragment Length Polymorphism (RFLP) markers (RG81, RG869 and RZ397) on chromosome 12 of rice were identified to be closely linked to the blast resistance gene Pi-12(t). The genetic distance between Pi-12(t) and the closest marker RG869 was 5.1 cM. By employing the bulk segregant analysis (BSA) procedure, six of 199 arbitrary primers were found to produce positive Randomly Amplified Polymorphic DNA (RAPD) bands. Tight linkage between Pi-12(t) and three RAPD bands, each from a different primer, was confirmed after amplification of DNA of all F 2 individuals. Two fragments were cloned and sequenced, and two sequence characterised amplified re-ion (SCAR) markers were established. In two other F 3 populations, Xian-feng I/Tetep and Xian-feng, 1/Hong-jiao-zhan, the blast resistance was found to be controlled by interactions of two or more genes. One resistance gene was located in the vicinity of RG81 in both populations. Work to identify other gene(s) is currently under way. Marker assisted selection for blast resistance was initiated. Crosses were made between elite varieties and blast resistance donors to develop populations for DNA marker-assisted selection of blast resistance. In addition, 48 varieties widely used in current rice breeding programs were provided by rice breeders. DNA marker-based polymorphism among, these varieties and resistance donors were analysed to produce a database for future MAS program. (author)

  11. [Analysis of resistant genes of beta-lactam antibiotics from Pseudomonas aeruginosa in pediatric patients]. (United States)

    Dong, Fang; Xu, Xi-wei; Song, Wen-qi; Lü, Ping; Yang, Yong-hong; Shen, Xu-zhuang


    To analyze the antibiotic resistance of the Pseudomonas aeruginosa (PA) isolated from pediatric patients and the resistant genes of beta-lactam antibiotics thereof. 146 PA strains were isolated from pediatric patients. Agar dilution method recommended by the Clinical and Laboratory Standards Institute was used to examine the minimum inhibitory concentrations (MICs) of 12 antimicrobial agents, including the penicillins, third and fourth genet ration cephalosporins, carbapenemase, Aztreonam, beta-lactamase inhibitors, quinolones, and aminoglycosides. PCR was used to detect the expression of the genes TEM, SHV, OXA, PER, GES, CTX-M, IMP, VIM, DHA, MIR, FOX, and oprD2. The multi-drug resistance rates against different antibiotic were high among the 146 PA strains. The rates of imipenem and meropenem resistance were 41.1% and 35.6% respectively. Among the 146 PA strains, 46 (31.5%) were positive for the MBL genotype; 38 (82.6%) carried the blaIMP gene, 8 (17.4%) carried the blaVIM gene, and 114 (78.1%) were oprD2 negative. The genes TEM, SHV, OXA, CTX-M, PER, VEB, GES, FOX, MIR, and DHA were not found in all strains. Many PA isolated from pediatric patients carry the genes IMP or VIM and losses oprD2 gene related to the expression of the outer membrane porin OprD2. The loss of the gene oprD2 is essential mechanism of beta-lactam antibiotics resistance in PA.

  12. Presentations

    International Nuclear Information System (INIS)


    The presented materials consist of presentations of international workshop which held in Warsaw from 4 to 5 October 2007. Main subject of the meeting was progress in manufacturing as well as research program development for neutron detector which is planned to be placed at GANIL laboratory and will be used in nuclear spectroscopy research

  13. Tetracycline resistance genes persist in soil amended with cattle feces independently from chlortetracycline selection pressure

    NARCIS (Netherlands)

    Kyselkova, Martina; Kotrbova, Lucie; Bhumibhamon, Gamonsiri; Chronakova, Alica; Jirout, Jiri; Vrchotova, Nadezda; Schmitt, Heike; Elhottova, Dana

    Antibiotic residues and antibiotic resistance genes originating from animal waste represent environmental pollutants with possible human health consequences. In this study, we addressed the question whether chlortetracycline (CTC) residues in soils can act as selective pressure enhancing the

  14. Studies to identify genes and their expression for resistance to blast ...

    African Journals Online (AJOL)



    Jun 26, 2013 ... INTRODUCTION. Rice (Oryza sativa L.) is the staple food for more than ... disease under induced artificial epiphytotic conditions at SVP. University farm .... resistance is under the control of several additive genes having small ...

  15. Phylogenetic relatedness determined between antibiotic resistance and 16S rRNA genes in actinobacteria

    Czech Academy of Sciences Publication Activity Database

    Ságová-Marečková, M.; Ulanová, Dana; Šanderová, P.; Omelka, M.; Kameník, Zdeněk; Olšovská, J.; Kopecký, J.


    Roč. 15, APR 2015 (2015) ISSN 1471-2180 Institutional support: RVO:61388971 Keywords : Actinobacteria * 16S rRNA diversity * Resistance genes Subject RIV: EH - Ecology, Behaviour Impact factor: 2.581, year: 2015

  16. Benchmarking of methods for identification of antimicrobial resistance genes in bacterial whole genome data

    DEFF Research Database (Denmark)

    Clausen, Philip T. L. C.; Zankari, Ea; Aarestrup, Frank Møller


    to two different methods in current use for identification of antibiotic resistance genes in bacterial WGS data. A novel method, KmerResistance, which examines the co-occurrence of k-mers between the WGS data and a database of resistance genes, was developed. The performance of this method was compared...... with two previously described methods; ResFinder and SRST2, which use an assembly/BLAST method and BWA, respectively, using two datasets with a total of 339 isolates, covering five species, originating from the Oxford University Hospitals NHS Trust and Danish pig farms. The predicted resistance...... was compared with the observed phenotypes for all isolates. To challenge further the sensitivity of the in silico methods, the datasets were also down-sampled to 1% of the reads and reanalysed. The best results were obtained by identification of resistance genes by mapping directly against the raw reads...

  17. Gene expression analysis of two extensively drug-resistant tuberculosis isolates show that two-component response systems enhance drug resistance. (United States)

    Yu, Guohua; Cui, Zhenling; Sun, Xian; Peng, Jinfu; Jiang, Jun; Wu, Wei; Huang, Wenhua; Chu, Kaili; Zhang, Lu; Ge, Baoxue; Li, Yao


    Global analysis of expression profiles using DNA microarrays was performed between a reference strain H37Rv and two clinical extensively drug-resistant isolates in response to three anti-tuberculosis drug exposures (isoniazid, capreomycin, and rifampicin). A deep analysis was then conducted using a combination of genome sequences of the resistant isolates, resistance information, and related public microarray data. Certain known resistance-associated gene sets were significantly overrepresented in upregulated genes in the resistant isolates relative to that observed in H37Rv, which suggested a link between resistance and expression levels of particular genes. In addition, isoniazid and capreomycin response genes, but not rifampicin, either obtained from published works or our data, were highly consistent with the differentially expressed genes of resistant isolates compared to those of H37Rv, indicating a strong association between drug resistance of the isolates and genes differentially regulated by isoniazid and capreomycin exposures. Based on these results, 92 genes of the studied isolates were identified as candidate resistance genes, 10 of which are known resistance-related genes. Regulatory network analysis of candidate resistance genes using published networks and literature mining showed that three two-component regulatory systems and regulator CRP play significant roles in the resistance of the isolates by mediating the production of essential envelope components. Finally, drug sensitivity testing indicated strong correlations between expression levels of these regulatory genes and sensitivity to multiple anti-tuberculosis drugs in Mycobacterium tuberculosis. These findings may provide novel insights into the mechanism underlying the emergence and development of drug resistance in resistant tuberculosis isolates and useful clues for further studies on this issue. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. Characterisation of ALS genes in the polyploid species Schoenoplectus mucronatus and implications for resistance management. (United States)

    Scarabel, Laura; Locascio, Antonella; Furini, Antonella; Sattin, Maurizio; Varotto, Serena


    The polyploid weed Schoenoplectus mucronatus (L.) Palla has evolved target-site resistance to ALS-inhibiting herbicides in Italian rice crops. Molecular and genetic characterisation of the resistance mechanism is relevant to the evolution and management of herbicide resistance. The authors aimed (a) to study the organisation of the target-site loci in two field-selected S. mucronatus populations with different cross-resistance patterns, (b) to identify the mutations endowing resistance to ALS inhibitors and determine the role of these mutations by using transgenesis and (c) to analyse the implications for the management of the S. mucronatus populations. Two complete ALS genes (ALS1 and ALS2) having an intron and a third partial intronless ALS gene (ALS3) were identified. The presence of multiple ALS genes was confirmed by Southern blot analyses, and ALS loci were characterised by examining cytosine methylation. In S. mucronatus leaves, the transcripts of ALS1, ALS2 and ALS3 were detected. Two mutations endowing resistance (Pro(197) to His and Trp(574) to Leu) were found in both resistant populations, but at different frequencies. Tobacco plants transformed with the two resistant alleles indicated that the Pro(197)-to-His substitution conferred resistance to SU and TP herbicides, while the allele with the Trp(574)-to-Leu substitution conferred cross-resistance to SU, TP, IMI and PTB herbicides. Schoenoplectus mucronatus has multiple ALS genes characterised by methylated sites that can influence the expression profile. The two mutated alleles proved to be responsible for ALS resistance. At population level, the resistance pattern depends on the frequency of various resistant genotypes, and this influences the efficacy of various ALS-inhibiting herbicides.

  19. Consolidating and Exploring Antibiotic Resistance Gene Data Resources

    DEFF Research Database (Denmark)

    Xavier, Basil Britto; Das, Anupam J.; Cochrane, Guy


    The unrestricted use of antibiotics has resulted in rapid acquisition of antibiotic resistance (AR) and spread of multidrug-resistant (MDR) bacterial pathogens. With the advent of next-generation sequencing technologies and their application in understanding MDR pathogen dynamics, it has become i...


    Directory of Open Access Journals (Sweden)

    Andreeva I.A.


    Full Text Available Introduction. At the present stage for ensuring epidemic safety and prevention of nosocomial infections the complex of analytical study and managerial procedure to improve the epidemiological supervision over nosocomial infections through the introduction of infection control in health care practice are using. The microbiological monitoring is part of the infectious control and allows supervising circulation of microorganisms and their antimicrobial resistance by dynamic observation over structure and level of resistance to antibiotics that are used in the given particular hospital. Materials and methods. For the dynamic observation of the structure and the level of resistance of microorganisms to antimicrobial agents the computer software WHONET recommended by WHO has been used. With using WHONET in Dnepropetrovsk Children's Hospital № 3 the computer database has been created. In this database the information about each patient, hospital department, samples under test and the date of its excretion, the data about the detected microorganism and its sensitivity/resistance to antimicrobial agents have been stored. The examination and analysis of antibiotic resistance of microorganisms has been provided for 2010- 2014 years, in total the data on 6168 isolates from 3876 patients have been analyzed. Results and discussion. By the total data the isolates belong to a wide spectrum of microorganisms (more than 40 different types. By means of the analysis of isolating of clinically significant microorganisms it has been established that one of the most frequent isolated were Escherichia coli (1-20 %, Klebsiella pneumoniae (4-18 %, Staphylococcus epidermidis (1-12 %, S. aureus (1-10 %, Enterobacter cloacae (2-9 %, Pseudomonas aeruginosa (1-8 %. Detection of other microorganisms was irregular and its frequency is varied from 0 % to 10 %. As a result of examining the sensitivity of microorganisms it has been shown that tested strains of bacteria were

  1. Environmental dissemination of antibiotic resistance genes and correlation to anthropogenic contamination with antibiotics (United States)

    Berglund, Björn


    Antibiotic resistance is a growing problem which threatens modern healthcare globally. Resistance has traditionally been viewed as a clinical problem, but recently non-clinical environments have been highlighted as an important factor in the dissemination of antibiotic resistance genes (ARGs). Horizontal gene transfer (HGT) events are likely to be common in aquatic environments; integrons in particular are well suited for mediating environmental dissemination of ARGs. A growing body of evidence suggests that ARGs are ubiquitous in natural environments. Particularly, elevated levels of ARGs and integrons in aquatic environments are correlated to proximity to anthropogenic activities. The source of this increase is likely to be routine discharge of antibiotics and resistance genes, for example, via wastewater or run-off from livestock facilities and agriculture. While very high levels of antibiotic contamination are likely to select for resistant bacteria directly, the role of sub-inhibitory concentrations of antibiotics in environmental antibiotic resistance dissemination remains unclear. In vitro studies have shown that low levels of antibiotics can select for resistant mutants and also facilitate HGT, indicating the need for caution. Overall, it is becoming increasingly clear that the environment plays an important role in dissemination of antibiotic resistance; further studies are needed to elucidate key aspects of this process. Importantly, the levels of environmental antibiotic contamination at which resistant bacteria are selected for and HGT is facilitated at should be determined. This would enable better risk analyses and facilitate measures for preventing dissemination and development of antibiotic resistance in the environment. PMID:26356096

  2. Dissection of Resistance Genes to Pseudomonas syringae pv. phaseolicola in UI3 Common Bean Cultivar

    Directory of Open Access Journals (Sweden)

    Ana M. González


    Full Text Available Few quantitative trait loci have been mapped for resistance to Pseudomonas syringae pv. phaseolicola in common bean. Two F2 populations were developed from the host differential UI3 cultivar. The objective of this study was to further characterize the resistance to races 1, 5, 7 and 9 of Psp included in UI3. Using a QTL mapping approach, 16 and 11 main-effect QTLs for pod and primary leaf resistance were located on LG10, explaining up to 90% and 26% of the phenotypic variation, respectively. The homologous genomic region corresponding to primary leaf resistance QTLs detected tested positive for the presence of resistance-associated gene cluster encoding nucleotide-binding and leucine-rich repeat (NL, Natural Resistance Associated Macrophage (NRAMP and Pentatricopeptide Repeat family (PPR proteins. It is worth noting that the main effect QTLs for resistance in pod were located inside a 3.5 Mb genomic region that included the Phvul.010G021200 gene, which encodes a protein that has the highest sequence similarity to the RIN4 gene of Arabidopsis, and can be considered an important candidate gene for the organ-specific QTLs identified here. These results support that resistance to Psp from UI3 might result from the immune response activated by combinations of R proteins, and suggest the guard model as an important mechanism in pod resistance to halo blight. The candidate genes identified here warrant functional studies that will help in characterizing the actual defense gene(s in UI3 genotype.

  3. Gene Profiling in Late Blight Resistance in Potato Genotype SD20

    Directory of Open Access Journals (Sweden)

    Xiaohui Yang


    Full Text Available Late blight caused by the oomycete fungus Phytophthora infestans (Pi is the most serious obstacle to potato (Solanum tuberosum production in the world. A super race isolate, CN152, which was identified from Sichuan Province, China, could overcome nearly all known late blight resistance genes and caused serious damage in China. The potato genotype SD20 was verified to be highly resistant to CN152; however, the molecular regulation network underlying late blight resistance pathway remains unclear in SD20. Here, we performed a time-course experiment to systematically profile the late blight resistance response genes using RNA-sequencing in SD20. We identified 3354 differentially expressed genes (DEGs, which mainly encoded transcription factors and protein kinases, and also included four NBS-LRR genes. The late blight responsive genes showed time-point-specific induction/repression. Multi-signaling pathways of salicylic acid, jasmonic acid, and ethylene signaling pathways involved in resistance and defense against Pi in SD20. Gene Ontology and KEGG analyses indicated that the DEGs were significantly enriched in metabolic process, protein serine/threonine kinase activity, and biosynthesis of secondary metabolites. Forty-three DEGs were involved in immune response, of which 19 were enriched in hypersensitive response reaction, which could play an important role in broad-spectrum resistance to Pi infection. Experimental verification confirmed the induced expression of the responsive genes in the late blight resistance signaling pathway, such as WRKY, ERF, MAPK, and NBS-LRR family genes. Our results provided valuable information for understanding late blight resistance mechanism of potato.

  4. Discovery and characterization of two new stem rust resistance genes in Aegilops sharonensis. (United States)

    Yu, Guotai; Champouret, Nicolas; Steuernagel, Burkhard; Olivera, Pablo D; Simmons, Jamie; Williams, Cole; Johnson, Ryan; Moscou, Matthew J; Hernández-Pinzón, Inmaculada; Green, Phon; Sela, Hanan; Millet, Eitan; Jones, Jonathan D G; Ward, Eric R; Steffenson, Brian J; Wulff, Brande B H


    We identified two novel wheat stem rust resistance genes, Sr-1644-1Sh and Sr-1644-5Sh in Aegilops sharonensis that are effective against widely virulent African races of the wheat stem rust pathogen. Stem rust is one of the most important diseases of wheat in the world. When single stem rust resistance (Sr) genes are deployed in wheat, they are often rapidly overcome by the pathogen. To this end, we initiated a search for novel sources of resistance in diverse wheat relatives and identified the wild goatgrass species Aegilops sharonesis (Sharon goatgrass) as a rich reservoir of resistance to wheat stem rust. The objectives of this study were to discover and map novel Sr genes in Ae. sharonensis and to explore the possibility of identifying new Sr genes by genome-wide association study (GWAS). We developed two biparental populations between resistant and susceptible accessions of Ae. sharonensis and performed QTL and linkage analysis. In an F 6 recombinant inbred line and an F 2 population, two genes were identified that mapped to the short arm of chromosome 1S sh , designated as Sr-1644-1Sh, and the long arm of chromosome 5S sh , designated as Sr-1644-5Sh. The gene Sr-1644-1Sh confers a high level of resistance to race TTKSK (a member of the Ug99 race group), while the gene Sr-1644-5Sh conditions strong resistance to TRTTF, another widely virulent race found in Yemen. Additionally, GWAS was conducted on 125 diverse Ae. sharonensis accessions for stem rust resistance. The gene Sr-1644-1Sh was detected by GWAS, while Sr-1644-5Sh was not detected, indicating that the effectiveness of GWAS might be affected by marker density, population structure, low allele frequency and other factors.

  5. Does human activity impact the natural antibiotic resistance background? Abundance of antibiotic resistance genes in 21 Swiss lakes. (United States)

    Czekalski, Nadine; Sigdel, Radhika; Birtel, Julia; Matthews, Blake; Bürgmann, Helmut


    Antibiotic resistance genes (ARGs) are emerging environmental contaminants, known to be continuously discharged into the aquatic environment via human and animal waste. Freshwater aquatic environments represent potential reservoirs for ARG and potentially allow sewage-derived ARG to persist and spread in the environment. This may create increased opportunities for an eventual contact with, and gene transfer to, human and animal pathogens via the food chain or drinking water. However, assessment of this risk requires a better understanding of the level and variability of the natural resistance background and the extent of the human impact. We have analyzed water samples from 21 Swiss lakes, taken at sampling points that were not under the direct influence of local contamination sources and analyzed the relative abundance of ARG using quantitative real-time PCR. Copy numbers of genes mediating resistance to three different broad-spectrum antibiotic classes (sulfonamides: sul1, sul2, tetracyclines: tet(B), tet(M), tet(W) and fluoroquinolones: qnrA) were normalized to copy numbers of bacterial 16S rRNA genes. We used multiple linear regression to assess if ARG abundance is related to human activities in the catchment, microbial community composition and the eutrophication status of the lakes. Sul genes were detected in all sampled lakes, whereas only four lakes contained quantifiable numbers of tet genes, and qnrA remained below detection in all lakes. Our data indicate higher abundance of sul1 in lakes with increasing number and capacity of wastewater treatment plants (WWTPs) in the catchment. sul2 abundance was rather related to long water residence times and eutrophication status. Our study demonstrates the potential of freshwater lakes to preserve antibiotic resistance genes, and provides a reference for ARG abundance from lake systems with low human impact as a baseline for assessing ARG contamination in lake water. Copyright © 2015 Elsevier Ltd. All rights

  6. Characterizing the pathotype structure of barley powdery mildew and effectiveness of resistance genes to this pathogen in Kazakhstan. (United States)

    Rsaliyev, Aralbek; Pahratdinova, Zhazira; Rsaliyev, Shynbolat


    Powdery mildew of barley is a wind-borne and obligate biotrophic pathogen, which ranks among the most widespread barley pathogens worldwide. However, purposeful research towards studying the structure of the barley powdery mildew populations, of their virulence and of effectiveness of certain resistance genes against the infection was not conducted in Kazakhstan till present time. This paper is the first to describe characteristics of the pathotype structure of Blumeria graminis f.sp. hordei (Bgh) population and effectiveness of resistance genes in two regions of barley cultivation in the republic. One hundred and seven isolates of Bgh were obtained from seven populations occurring on cultivated barley at two geographically locations in Kazakhstan during 2015 and 2016. Their virulence frequency was determined on 17 differential lines Pallas. All isolates were virulent on the resistance gene Mla8 and avirulent for the resistance genes Mla9, Mla1 + MlaAl2, Mla6 + Mla14, Mla13 + MlRu3, Mla7 + MlNo3, Mla10 + MlDu2, Mla13 + MlRu3 and Mlo-5. The frequencies of isolates overcoming the genes Mla3, Mla22, Mlat Mlg + MlCP and Mla12 + MlEm2 were 0.0-33.33%, and frequencies of isolates overcoming the genes Mlra, Mlk, MlLa and Mlh ranged from 10.0 to 78.6%. Based on reactions of differential lines possessing the genes Mla22, Mlra, Mlk, Mlat, MlLa and Mlh, pathotypes were identified. In total, 23 pathotypes with virulence complexity ranging from 1 to 6 were identified. During both years in all populations of South Kazakhstan and Zhambyl regions pathotypes 24 and 64 mainly prevailed. Obtained data suggest that low similarity of populations Bgh in Kazakhstan to European, African, Australian and South-East Asian populations. The present study provides a foundation for future studies on the pathogenic variability within of Bgh populations in Kazakhstan and addresses the knowledge gap on the virulence structure of Bgh in Central Asia. Complete effectiveness of the

  7. The identification of a tetracycline resistance gene tet(M), on a Tn916-like transposon, in the Bacillus cereus group

    DEFF Research Database (Denmark)

    Agersø, Yvonne; Jensen, Lars Bogø; Givskov, Michael Christian


    In order to investigate whether resistance genes present in bacteria in manure could transfer to indigenous soil bacteria, resistant isolates belonging to the Bacillus cereus group (Bacillus cereus, Bacillus anthracis and Bacillus thuringiensis) were isolated from farm soil (72 isolates) and manure...

  8. Gene Expression Contributes to the Recent Evolution of Host Resistance in a Model Host Parasite System

    Directory of Open Access Journals (Sweden)

    Brian K. Lohman


    Full Text Available Heritable population differences in immune gene expression following infection can reveal mechanisms of host immune evolution. We compared gene expression in infected and uninfected threespine stickleback (Gasterosteus aculeatus from two natural populations that differ in resistance to a native cestode parasite, Schistocephalus solidus. Genes in both the innate and adaptive immune system were differentially expressed as a function of host population, infection status, and their interaction. These genes were enriched for loci controlling immune functions known to differ between host populations or in response to infection. Coexpression network analysis identified two distinct processes contributing to resistance: parasite survival and suppression of growth. Comparing networks between populations showed resistant fish have a dynamic expression profile while susceptible fish are static. In summary, recent evolutionary divergence between two vertebrate populations has generated population-specific gene expression responses to parasite infection, affecting parasite establishment and growth.

  9. Reclaimed water as a reservoir of antibiotic resistance genes: distribution system and irrigation implications

    Directory of Open Access Journals (Sweden)

    Nicole L Fahrenfeld


    Full Text Available Treated wastewater is increasingly being reused to achieve sustainable water management in arid regions. The objective of this study was to quantify the distribution of antibiotic resistance genes (ARGs in recycled water, particularly after it has passed through the distribution system, and to consider point-of-use implications for soil irrigation. Three separate reclaimed wastewater distribution systems in the western U.S. were examined. Quantitative polymerase chain reaction (qPCR was used to quantify ARGs corresponding to resistance to sulfonamides (sul1, sul2, macrolides (ermF, tetracycline (tet(A, tet(O, glycopeptides (vanA, and methicillin (mecA, in addition to genes present in waterborne pathogens Legionella pneumophila (Lmip, Escherichia coli (gadAB, and Pseudomonas aeruginosa (ecfx, gyrB. In a parallel lab study, the effect of irrigating an agricultural soil with secondary, chlorinated, or dechlorinated wastewater effluent was examined in batch microcosms. A broader range of ARGs were detected after the reclaimed water passed through the distribution systems, highlighting the importance of considering bacterial re-growth and the overall water quality at the point of use. Screening for pathogens with qPCR indicated presence of Lmip and gadAB genes, but not ecfx or gyrB. In the lab study, chlorination was observed to reduce 16S rRNA and sul2 gene copies in the wastewater effluent, while dechlorination had no apparent effect. ARGs levels did not change with time in soil slurries incubated after a single irrigation event with any of the effluents. However, when irrigated repeatedly with secondary wastewater effluent (not chlorinated or dechlorinated, elevated levels of sul1 and sul2 were observed. This study suggests that reclaimed water may be an important reservoir of ARGs, especially at the point of use, and that attention should be directed towards the fate of ARGs in irrigation water and the implications for human health.

  10. TaEDS1 genes positively regulate resistance to powdery mildew in wheat. (United States)

    Chen, Guiping; Wei, Bo; Li, Guoliang; Gong, Caiyan; Fan, Renchun; Zhang, Xiangqi


    Three EDS1 genes were cloned from common wheat and were demonstrated to positively regulate resistance to powdery mildew in wheat. The EDS1 proteins play important roles in plant basal resistance and TIR-NB-LRR protein-triggered resistance in dicots. Until now, there have been very few studies on EDS1 in monocots, and none in wheat. Here, we report on three common wheat orthologous genes of EDS1 family (TaEDS1-5A, 5B and 5D) and their function in powdery mildew resistance. Comparisons of these genes with their orthologs in diploid ancestors revealed that EDS1 is a conserved gene family in Triticeae. The cDNA sequence similarity among the three TaEDS1 genes was greater than 96.5%, and they shared sequence similarities of more than 99.6% with the respective orthologs from diploid ancestors. The phylogenetic analysis revealed that the EDS1 family originated prior to the differentiation of monocots and dicots, and EDS1 members have since undergone clear structural differentiation. The transcriptional levels of TaEDS1 genes in the leaves were obviously higher than those of the other organs, and they were induced by Blumeria graminis f. sp. tritici (Bgt) infection and salicylic acid (SA) treatment. The BSMV-VIGS experiments indicated that knock-down the transcriptional levels of the TaEDS1 genes in a powdery mildew-resistant variety of common wheat compromised resistance. Contrarily, transient overexpression of TaEDS1 genes in a susceptible common wheat variety significantly reduced the haustorium index and attenuated the growth of Bgt. Furthermore, the expression of TaEDS1 genes in the Arabidopsis mutant eds1-1 complemented its susceptible phenotype to powdery mildew. The above evidences strongly suggest that TaEDS1 acts as a positive regulator and confers resistance against powdery mildew in common wheat.

  11. Rootstock-regulated gene expression patterns associated with fire blight resistance in apple

    Directory of Open Access Journals (Sweden)

    Jensen Philip J


    Full Text Available Abstract Background Desirable apple varieties are clonally propagated by grafting vegetative scions onto rootstocks. Rootstocks influence many phenotypic traits of the scion, including resistance to pathogens such as Erwinia amylovora, which causes fire blight, the most serious bacterial disease of apple. The purpose of the present study was to quantify rootstock-mediated differences in scion fire blight susceptibility and to identify transcripts in the scion whose expression levels correlated with this response. Results Rootstock influence on scion fire blight resistance was quantified by inoculating three-year old, orchard-grown apple trees, consisting of 'Gala' scions grafted to a range of rootstocks, with E. amylovora. Disease severity was measured by the extent of shoot necrosis over time. 'Gala' scions grafted to G.30 or MM.111 rootstocks showed the lowest rates of necrosis, while 'Gala' on M.27 and B.9 showed the highest rates of necrosis. 'Gala' scions on M.7, S.4 or M.9F56 had intermediate necrosis rates. Using an apple DNA microarray representing 55,230 unique transcripts, gene expression patterns were compared in healthy, un-inoculated, greenhouse-grown 'Gala' scions on the same series of rootstocks. We identified 690 transcripts whose steady-state expression levels correlated with the degree of fire blight susceptibility of the scion/rootstock combinations. Transcripts known to be differentially expressed during E. amylovora infection were disproportionately represented among these transcripts. A second-generation apple microarray representing 26,000 transcripts was developed and was used to test these correlations in an orchard-grown population of trees segregating for fire blight resistance. Of the 690 transcripts originally identified using the first-generation array, 39 had expression levels that correlated with fire blight resistance in the breeding population. Conclusions Rootstocks had significant effects on the fire blight

  12. Screening for Resistance to Brown Rust of Sugarcane: Use of Bru1 resistance gene prospects and challenges (United States)

    Brown rust of sugarcane caused by, Puccinia melanocephala, is a serious problem in the US sugarcane industry. A major resistance gene, Bru1 was identified and methodology for detecting it was developed by French scientists at CIRAD. The majority of the research resulting in the discovery of Bru1 res...

  13. The NB-LRR gene Pm60 confers powdery mildew resistance in wheat. (United States)

    Zou, Shenghao; Wang, Huan; Li, Yiwen; Kong, Zhaosheng; Tang, Dingzhong


    Powdery mildew is one of the most devastating diseases of wheat. To date, few powdery mildew resistance genes have been cloned from wheat due to the size and complexity of the wheat genome. Triticum urartu is the progenitor of the A genome of wheat and is an important source for powdery mildew resistance genes. Using molecular markers designed from scaffolds of the sequenced T. urartu accession and standard map-based cloning, a powdery mildew resistance locus was mapped to a 356-kb region, which contains two nucleotide-binding and leucine-rich repeat domain (NB-LRR) protein-encoding genes. Virus-induced gene silencing, single-cell transient expression, and stable transformation assays demonstrated that one of these two genes, designated Pm60, confers resistance to powdery mildew. Overexpression of full-length Pm60 and two allelic variants in Nicotiana benthamiana leaves induced hypersensitive cell death response, but expression of the coiled-coil domain alone was insufficient to induce hypersensitive response. Yeast two-hybrid, bimolecular fluorescence complementation and luciferase complementation imaging assays showed that Pm60 protein interacts with its neighboring NB-containing protein, suggesting that they might be functionally related. The identification and cloning of this novel wheat powdery mildew resistance gene will facilitate breeding for disease resistance in wheat. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

  14. Does Nilaparvata lugens gain tolerance to rice resistance genes through conspecifics at shared feeding sites?

    NARCIS (Netherlands)

    Ferrater, Jedeliza B.; Horgan, Finbarr G.


    This study examines the possibility of horizontal and vertical transmission of virulence (the ability to tolerate a given resistant plant or resistance gene) between individuals from brown planthopper, Nilaparvata lugens (Stål) (Hemiptera: Delphacidae), populations with distinct feeding abilities

  15. Mutations in rpoB and katG genes of multidrug resistant ...

    African Journals Online (AJOL)

    Introduction: Tuberculosis remains the leading causes of death worldwide with frequencies of mutations in rifampicin and isoniazid resistant Mycobacterium tuberculosis isolates varying according to geographical location. There is limited information in Zimbabwe on specific antibiotic resistance gene mutation patterns in ...

  16. AFLP/SSR mapping of resistance genes to Alectra vogelii in cowpea ...

    African Journals Online (AJOL)

    To find and map the resistance gene to A. vogelii in cowpea, a F2 population from a cross involving a resistant parent IT81D-994 and a susceptible TVX3236 was screened. Amplified fragment length polymorphism (AFLP) in combination with Single Sequence Repeat (SSR) analysis was used to identify markers that may be ...

  17. Cloning and functional characterization of the Rvi15 (Vr2) gene for apple scab resistance

    NARCIS (Netherlands)

    Schouten, H.J.; Brinkhuis, J.; Burgh, van der S.; Schaart, J.; Groenwold, R.; Broggini, G.A.L.; Gessler, C.


    Apple scab, caused by Venturia inaequalis, is a serious disease of apple. Previously, the scab resistance Rvi15 (Vr2) from the accession GMAL 2473 was genetically mapped, and three candidate resistance genes were identified. Here, we report the cloning and functional characterization of these three

  18. Expression of the Bs2 pepper gene confers resistance to bacterial spot disease in tomato. (United States)

    Tai, T H; Dahlbeck, D; Clark, E T; Gajiwala, P; Pasion, R; Whalen, M C; Stall, R E; Staskawicz, B J


    The Bs2 resistance gene of pepper specifically recognizes and confers resistance to strains of Xanthomonas campestris pv. vesicatoria that contain the corresponding bacterial avirulence gene, avrBs2. The involvement of avrBs2 in pathogen fitness and its prevalence in many X. campestris pathovars suggests that the Bs2 gene may be durable in the field and provide resistance when introduced into other plant species. Employing a positional cloning strategy, the Bs2 locus was isolated and the gene was identified by coexpression with avrBs2 in an Agrobacterium-mediated transient assay. A single candidate gene, predicted to encode motifs characteristic of the nucleotide binding site-leucine-rich repeat class of resistance genes, was identified. This gene specifically controlled the hypersensitive response when transiently expressed in susceptible pepper and tomato lines and in a nonhost species, Nicotiana benthamiana, and was designated as Bs2. Functional expression of Bs2 in stable transgenic tomatoes supports its use as a source of resistance in other Solanaceous plant species.

  19. Occurrence and Diversity of Tetracycline Resistance Genes in Lagoons and Groundwater Underlying Two Swine Production Facilities (United States)

    Chee-Sanford, J. C.; Aminov, R.I.; Krapac, I.J.; Garrigues-Jeanjean, N.; Mackie, R.I.


    In this study, we used PCR typing methods to assess the presence of tetracycline resistance determinants conferring ribosomal protection in waste lagoons and in groundwater underlying two swine farms. All eight classes of genes encoding this mechanism of resistance [tet(O), tet(Q), tet(W), tet(M), tetB(P), tet(S), tet(T), and otrA] were found in total DNA extracted from water of two lagoons. These determinants were found to be seeping into the underlying groundwater and could be detected as far as 250 m downstream from the lagoons. The identities and origin of these genes in groundwater were confirmed by PCR-denaturing gradient gel electrophoresis and sequence analyses. Tetracycline-resistant bacterial isolates from groundwater harbored the tet(M) gene, which was not predominant in the environmental samples and was identical to tet(M) from the lagoons. The presence of this gene in some typical soil inhabitants suggests that the vector of antibiotic resistance gene dissemination is not limited to strains of gastrointestinal origin carrying the gene but can be mobilized into the indigenous soil microbiota. This study demonstrated that tet genes occur in the environment as a direct result of agriculture and suggested that groundwater may be a potential source of antibiotic resistance in the food chain.

  20. Metagenomic profiling of antibiotic resistance genes and mobile genetic elements in a tannery wastewater treatment plant.

    Directory of Open Access Journals (Sweden)

    Zhu Wang

    Full Text Available Antibiotics are often used to prevent sickness and improve production in animal agriculture, and the residues in animal bodies may enter tannery wastewater during leather production. This study aimed to use Illumina high-throughput sequencing to investigate the occurrence, diversity and abundance of antibiotic resistance genes (ARGs and mobile genetic elements (MGEs in aerobic and anaerobic sludge of a full-scale tannery wastewater treatment plant (WWTP. Metagenomic analysis showed that Proteobacteria, Firmicutes, Bacteroidetes and Actinobacteria dominated in the WWTP, but the relative abundance of archaea in anaerobic sludge was higher than in aerobic sludge. Sequencing reads from aerobic and anaerobic sludge revealed differences in the abundance of functional genes between both microbial communities. Genes coding for antibiotic resistance were identified in both communities. BLAST analysis against Antibiotic Resistance Genes Database (ARDB further revealed that aerobic and anaerobic sludge contained various ARGs with high abundance, among which sulfonamide resistance gene sul1 had the highest abundance, occupying over 20% of the total ARGs reads. Tetracycline resistance genes (tet were highly rich in the anaerobic sludge, among which tet33 had the highest abundance, but was absent in aerobic sludge. Over 70 types of insertion sequences were detected in each sludge sample, and class 1 integrase genes were prevalent in the WWTP. The results highlighted prevalence of ARGs and MGEs in tannery WWTPs, which may deserve more public health concerns.

  1. Detection and characterisation of genes encoding antibiotic resistance in the cultivable oral microflora.


    Villedieu, A.


    The emergence of antibiotic-resistant bacteria has become a major threat to public health. The increased use of antibiotics has selected for the dissemination of antibiotic resistance genes between organisms from different species and different genera. There is a large body of evidence that the indigenous microbiota can act as a reservoir of antibiotic-resistant bacteria. However little is known about the molecular basis for this in bacteria from the oral cavity. Therefore the aim of this wor...

  2. Fate of antibiotic resistance genes within the microbial communities of three waste water treatment plants


    Di Cesare, Andrea; Eckert, Ester; D'Urso, Silvia; Doppelbauer, Julia; Corno, Gianluca


    Although Waste Water Treatment Plant (WWTP) are designed to reduce the biological pollution of urban waters, they lack a specific action against antibiotic resistance bacteria (ARB) or antibiotic resistance genes (ARGs). Nowadays, it is well documented that WWTPs constitute a reservoir of antibiotic resistances and, in some cases, they can be a favorable environment for the selection of ARB. This represent a serious concern for the public health, because the effluents of the WWTPs can be reus...

  3. Identification of genes associated with cisplatin resistance in human oral squamous cell carcinoma cell line


    Zhang Ping; Zhang Zhiyuan; Zhou Xiaojian; Qiu Weiliu; Chen Fangan; Chen Wantao


    Abstract Background Cisplatin is widely used for chemotherapy of head and neck squamous cell carcinoma. However, details of the molecular mechanism responsible for cisplatin resistance are still unclear. The aim of this study was to identify the expression of genes related to cisplatin resistance in oral squamous cell carcinoma cells. Methods A cisplatin-resistant cell line, Tca/cisplatin, was established from a cisplatin-sensitive cell line, Tca8113, which was derived from moderately-differe...

  4. Epidemiology, clinical presentation, and patterns of drug resistance of Salmonella Typhi in Karachi, Pakistan. (United States)

    Khan, M Imran; Soofi, Sajid Bashir; Ochiai, R Leon; Khan, Mohammad Jawed; Sahito, Shah Muhammad; Habib, Mohammad Atif; Puri, Mahesh K; Von Seidlein, Lorenz; Park, Jin Kyung; You, Young Ae; Ali, Mohammad; Nizami, S Qamarudding; Acosta, Camilo J; Sack, R Bradley; Clemens, John D; Bhutta, Zulfiqar A


    Enteric fever remains a major public health problem in Asia. Planning appropriate preventive measures such as immunization requires a clear understanding of disease burden. We conducted a community-based surveillance for Salmonella Typhi infection in children in Karachi, Pakistan. A de jure household census was conducted at baseline in the study setting to enumerate all individuals. A health-care facility-based passive surveillance system was used to capture episodes of fever lasting three or more 3 days in children 2 to 16 years old. A total of 7,401 blood samples were collected for microbiological confirmation, out of which 189 S. Typhi and 32 S. Paratyphi A isolates were identified with estimated annual incidences of 451/100,000 (95% CI: 446 - 457) and 76/100,000 (95% CI: 74 - 78) respectively. At the time of presentation, after adjusting for age, there was an association between the duration of fever and temperature at presentation, and being infected with multidrug-resistant S. Typhi. Of 189 isolates 83 were found to be resistant to first-line antimicrobial therapy. There was no statistically significant difference in clinical presentation of blood culture sensitive and resistant S. Typhi isolates. Incidence of S. Typhi in children is high in urban squatter settlements of Karachi, Pakistan. Findings from this study identified duration of fever and temperature at the time of presentation as important symptoms associated with blood culture-confirmed typhoid fever. Preventive strategies such as immunization and improvements in water and sanitation conditions should be the focus of typhoid control in urban settlements of Pakistan.

  5. Multiple drug resistance protein (MDR-1, multidrug resistance-related protein (MRP and lung resistance protein (LRP gene expression in childhood acute lymphoblastic leukemia

    Directory of Open Access Journals (Sweden)

    Elvis Terci Valera

    Full Text Available CONTEXT: Despite the advances in the cure rate for acute lymphoblastic leukemia, approximately 25% of affected children suffer relapses. Expression of genes for the multiple drug resistance protein (MDR-1, multidrug resistance-related protein (MRP, and lung resistance protein (LRP may confer the phenotype of resistance to the treatment of neoplasias. OBJECTIVE: To analyze the expression of the MDR-1, MRP and LRP genes in children with a diagnosis of acute lymphoblastic leukemia via the semiquantitative reverse transcription polymerase chain reaction (RT-PCR, and to determine the correlation between expression and event-free survival and clinical and laboratory variables. DESIGN: A retrospective clinical study. SETTING: Laboratory of Pediatric Oncology, Department of Pediatrics, Faculdade de Medicina de Ribeirão Preto, Universidade de São Paulo, Brazil. METHODS: Bone marrow aspirates from 30 children with a diagnosis of acute lymphoblastic leukemia were assessed for the expression of messenger RNA for the MDR-1, MRP and LRP genes by semi-quantitative RT-PCR. RESULTS: In the three groups studied, only the increased expression of LRP was related to worsened event-free survival (p = 0.005. The presence of the common acute lymphoblastic leukemia antigen (CALLA was correlated with increased LRP expression (p = 0.009 and increased risk of relapse or death (p = 0.05. The relative risk of relapse or death was six times higher among children with high LRP expression upon diagnosis (p = 0.05, as confirmed by multivariate analysis of the three genes studied (p = 0.035. DISCUSSION: Cell resistance to drugs is a determinant of the response to chemotherapy and its detection via RT-PCR may be of clinical importance. CONCLUSIONS: Evaluation of the expression of genes for resistance to antineoplastic drugs in childhood acute lymphoblastic leukemia upon diagnosis, and particularly the expression of the LRP gene, may be of clinical relevance, and should be the

  6. Members of the genera Paenibacillus and Rhodococcus harbor genes homologous to enterococcal glycopeptide resistance genes vanA and vanB

    DEFF Research Database (Denmark)

    Guardabassi, L.; Christensen, H.; Hasman, Henrik


    Genes homologous to enterococcal glycopeptide resistance genes vanA and vanB were found in glycopeptide-resistant Paenibacillus and Rhodococcus strains from soil. The putative D-Ala:D-Lac ligase genes in Paenibacillus thiaminolyticus PT-2B1 and Paenibacillus apiarius PA-B2B were closely related...

  7. 40 CFR 174.513 - Potato Leaf Roll Virus Resistance Gene (also known as orf1/orf2 gene); exemption from the... (United States)


    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Potato Leaf Roll Virus Resistance Gene... REQUIREMENTS FOR PLANT-INCORPORATED PROTECTANTS Tolerances and Tolerance Exemptions § 174.513 Potato Leaf Roll... protectant Potato Leaf Roll Virus Resistance Gene (also known as orf1/orf2 gene) in or on all food...

  8. Isolation and characterization of resistant gene analogs in cassava ...

    African Journals Online (AJOL)

    These candidate sequences mapped to the draft cassava genome with high sequence similarity to predicted NBS-LRR genes. These novel sequences may serve as a stepping stone for further characterization and experimental validation of predicted R genes in the draft cassava genome, ultimately leading to the ...

  9. Correlation between Group B Streptococcal Genotypes, Their Antimicrobial Resistance Profiles, and Virulence Genes among Pregnant Women in Lebanon

    Directory of Open Access Journals (Sweden)

    Antoine Hannoun


    Full Text Available The antimicrobial susceptibility profiles of 76 Streptococcus agalactiae (Group B Streptococci [GBS] isolates from vaginal specimens of pregnant women near term were correlated to their genotypes generated by Random Amplified Polymorphic DNA analysis and their virulence factors encoding genes cylE, lmb, scpB, rib, and bca by PCR. Based on the distribution of the susceptibility patterns, six profiles were generated. RAPD analysis detected 7 clusters of genotypes. The cylE gene was present in 99% of the isolates, the lmb in 96%, scpB in 94.7%, rib in 33%, and bca in 56.5% of isolates. The isolates demonstrated a significant correlation between antimicrobial resistance and genotype clusters denoting the distribution of particular clones with different antimicrobial resistance profiles, entailing the practice of caution in therapeutic options. All virulence factors encoding genes were detected in all seven genotypic clusters with rib and bca not coexisting in the same genome.

  10. Mapping of stripe rust resistance gene in an Aegilops caudata ...

    Indian Academy of Sciences (India)

    Seedling resistance is usually race-specific, but often pro- vides complete ... Genomic DNA was extracted using the CTAB method of. Saghai-Maroof ... Polymerase chain reactions (PCR) were performed in ..... The continuous supply of the rust ...

  11. Genetic analysis and location of a resistance gene to Puccinia ...

    Indian Academy of Sciences (India)


    the wheat production in Asia, North America, Europe and other wheat growing areas. China is the largest ..... A history of wheat breeding. ... and Yr65 for stripe rust resistance in hexaploid derivatives of durum wheat accessions PI 331260.

  12. Removal of selected PPCPs, EDCs, and antibiotic resistance genes in landfill leachate by a full-scale constructed wetlands system. (United States)

    Yi, Xinzhu; Tran, Ngoc Han; Yin, Tingru; He, Yiliang; Gin, Karina Yew-Hoong


    Landfill leachate could be a significant source of emerging contaminants (ECs) and antibiotic resistance genes (ARGs) into the environment. This study provides the first information on the occurrence of selected ECs and ARGs in raw leachate from 16-year old closed landfill site in Singapore. Among the investigated ECs, acetaminophen (ACT), bisphenol A (BPA), clofibric acid (CA), caffeine (CF), crotamiton (CTMT), diclofenac (DCF), N,N-diethyl-m-toluamide (DEET), gemfibrozil (GFZ), lincomycin (LIN), salicylic acid (SA), and sulfamethazine (SMZ) were the most frequently detected compounds in raw landfill leachate. The concentrations of detected ECs in raw landfill leachate varied significantly, from below quantification limit to 473,977 ng/L, depending on the compound. In this study, Class I integron (intl1) gene and ten ARGs were detected in raw landfill leachate. Sulfonamide resistance (sul1, sul2, and dfrA), aminoglycoside resistance (aac6), tetracycline resistance (tetO), quinolone resistance (qnrA), and intl1 were ubiquitously present in raw landfill leachate. Other resistance genes, such as beta-lactam resistance (blaNMD1, blaKPC, and blaCTX) and macrolide-lincosamide resistance (ermB) were also detected, detection frequency of 90%) in the investigated hybrid CW system. This hybrid CW system was also found to be effective in the reduction of several ARGs (intl1, sul1, sul2, and qnrA). Aeration lagoons and reed beds appeared to be the most important treatment units of the hybrid CW for removing the majority of ECs from the leachate. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. EPSPS gene amplification conferring resistance to glyphosate in windmill grass (Chloris truncata) in Australia. (United States)

    Ngo, The D; Malone, Jenna M; Boutsalis, Peter; Gill, Gurjeet; Preston, Christopher


    Five glyphosate-resistant populations of Chloris truncata originally collected from New South Wales were compared with one susceptible (S) population from South Australia to confirm glyphosate resistance and elucidate possible mechanisms of resistance. Based on the amounts of glyphosate required to kill 50% of treated plants (LD 50 ), glyphosate resistance (GR) was confirmed in five populations of C. truncata (A536, A528, T27, A534 and A535.1). GR plants were 2.4-8.7-fold more resistant and accumulated less shikimate after glyphosate treatment than S plants. There was no difference in glyphosate absorption and translocation between GR and S plants. The EPSPS gene did not contain any point mutation that had previously been associated with resistance to glyphosate. The resistant plants (A528 and A536) contained up to 32-48 more copies of the EPSPS gene than the susceptible plants. This study has identified EPSPS gene amplification contributing to glyphosate resistance in C. truncata. In addition, a Glu-91-Ala mutation within EPSPS was identified that may contribute to glyphosate resistance in this species. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  14. PageRank analysis reveals topologically expressed genes correspond to psoriasis and their functions are associated with apoptosis resistance. (United States)

    Zeng, Xue; Zhao, Jingjing; Wu, Xiaohong; Shi, Hongbo; Liu, Wali; Cui, Bingnan; Yang, Li; Ding, Xu; Song, Ping


    Psoriasis is an inflammatory skin disease. Deceleration in keratinocyte apoptosis is the most significant pathological change observed in psoriasis. To detect a meaningful correlation between the genes and gene functions associated with the mechanism underlying psoriasis, 927 differentially expressed genes (DEGs) were identified using the Gene Expression Omnibus database, GSE13355 [false discovery rate (FDR) 1] with the package in R langue. The selected DEGs were further constructed using the search tool for the retrieval of interacting genes, in order to analyze the interaction network between the DEGs. Subsequent to PageRank analysis, 14 topological hub genes were identified, and the functions and pathways in the hub genes network were analyzed. The top‑ranked hub gene, estrogen receptor‑1 (ESR1) is downregulated in psoriasis, exhibited binding sites enriched with genes possessing anti‑apoptotic functions. The ESR1 gene encodes estrogen receptor α (ERα); a reduced level of ERα expression provides a crucial foundation in response to the anti‑apoptotic activity of psoriatic keratinocytes by activating the expression of anti‑apoptotic genes. Furthermore, it was detected that the pathway that is associated most significantly with psoriasis is the pathways in cancer. Pathways in cancer may protect psoriatic cells from apoptosis by inhibition of ESR1 expression. The present study provides support towards the investigation of ESR1 gene function and elucidates that the interaction with anti‑apoptotic genes is involved in the underlying biological mechanisms of resistance to apoptosis in psoriasis. However, further investigation is required to confirm the present results.

  15. CRISPR/Cas9-Mediated Gene Editing in Rice (Oryza sativa L. japonica cv. Katy) for Stable Resistance against Blast Fungus (Magnaporthe oryzae) (United States)

    Rice blast is a recurring and devastating disease in the USA and worldwide. In the USA, the blast-resistance (R) genes found in a tropical japonica cultivar, Katy, reduce blast damages from 1990 to present. The cultivar is still used as a principal donor of blast R genes in developing numerous elit...

  16. Seedling Resistance to Stem Rust and Molecular Marker Analysis of Resistance Genes in Wheat Cultivars of Yunnan, China.

    Directory of Open Access Journals (Sweden)

    Tian Ya Li

    Full Text Available Stem rust is one of the most potentially harmful wheat diseases, but has been effectively controlled in China since 1970s. However, the interest in breeding wheat with durable resistance to stem rust has been renewed with the emergence of Ug99 (TTKSK virulent to the widely used resistance gene Sr31, and by which the wheat stem rust was controlled for 40 years in wheat production area worldwide. Yunnan Province, located on the Southwest border of China, is one of the main wheat growing regions, playing a pivotal role in the wheat stem rust epidemic in China. This study investigated the levels of resistance in key wheat cultivars (lines of Yunnan Province. In addition, the existence of Sr25, Sr26, Sr28, Sr31, Sr32, and Sr38 genes in 119 wheat cultivars was assessed using specific DNA markers. The results indicated that 77 (64.7% tested wheat varieties showed different levels of resistance to all the tested races of Puccinia graminis f. sp. tritici. Using molecular markers, we identified the resistance gene Sr31 in 43 samples; Sr38 in 10 samples; Sr28 in 12 samples, and one sample which was resistant against Ug99 (avirulent to Sr32. No Sr25 or Sr26 (effective against Ug99 was identified in any cultivars tested. Furthermore, 5 out of 119 cultivars tested carried both Sr31 and Sr38 and eight contained both Sr31 and Sr28. The results enable the development of appropriate strategies to breed varieties resistant to stem rust.

  17. Association between antimicrobial resistance and virulence genes in Escherichia coli obtained from blood and faeces

    DEFF Research Database (Denmark)

    Bagger-Skjøt, Line; Sandvang, Dorthe; Frimodt-Møller, Niels


    Escherichia coli isolates obtained from faeces (n = 85) and blood (n = 123) were susceptibility tested against 17 antimicrobial agents and the presence of 9 virulence genes was determined by PCR. Positive associations between several antimicrobial resistances and 2 VF genes (iutA and traT) were...

  18. Rapid cloning of disease-resistance genes in plants using mutagenesis and sequence capture (United States)

    Genetic solutions to protect crops against pests and pathogens are preferable to agrichemicals 1. Wild crop relatives carry immense diversity of disease resistance (R) genes that could enable more sustainable disease control. However, recruiting R genes for crop improvement typically involves long b...

  19. Introgression of a leaf rust resistance gene from Aegilops caudata to ...

    Indian Academy of Sciences (India)

    tance genes (Lr) and 48 stripe rust resistance genes (Yr) have .... Leaf rust reaction of the parents, wheat – Ae. caudata introgression lines and representative F2 plants developed from the cross: .... segregation ratio, which is otherwise a serious problem with ... Financial assistance was provided by the USDA-ARS under the.

  20. Genetic analysis and location of gene for resistance to stripe rust in ...

    Indian Academy of Sciences (India)


    Aug 6, 2013 ... Institute of Plant Protection, Chinese Academy of Agriculture Science, No 2, West ... The molecular marker Xbarc59 closely linked to the gene YrSD could be ... and a minor resistance gene postulated in it (Calonnec et al.

  1. Position on mouse chromosome 1 of a gene that controls resistance to Salmonella typhimurium. (United States)

    Taylor, B A; O'Brien, A D


    Ity is a gene which regulates the magnitude of Salmonella typhimurium growth in murine tissues and, hence, the innate salmonella resistance of mice. The results of a five-point backcross clearly showed that the correct gene order on chromosome 1 is fz-Idh-1-Ity-ln-Pep-3.

  2. Systematic Analysis and Comparison of Nucleotide-Binding Site Disease Resistance Genes in a Diploid Cotton Gossypium raimondii (United States)

    Wei, Hengling; Li, Wei; Sun, Xiwei; Zhu, Shuijin; Zhu, Jun


    Plant disease resistance genes are a key component of defending plants from a range of pathogens. The majority of these resistance genes belong to the super-family that harbors a Nucleotide-binding site (NBS). A number of studies have focused on NBS-encoding genes in disease resistant breeding programs for diverse plants. However, little information has been reported with an emphasis on systematic analysis and comparison of NBS-encoding genes in cotton. To fill this gap of knowledge, in this study, we identified and investigated the NBS-encoding resistance genes in cotton using the whole genome sequence information of Gossypium raimondii. Totally, 355 NBS-encoding resistance genes were identified. Analyses of the conserved motifs and structural diversity showed that the most two distinct features for these genes are the high proportion of non-regular NBS genes and the high diversity of N-termini domains. Analyses of the physical locations and duplications of NBS-encoding genes showed that gene duplication of disease resistance genes could play an important role in cotton by leading to an increase in the functional diversity of the cotton NBS-encoding genes. Analyses of phylogenetic comparisons indicated that, in cotton, the NBS-encoding genes with TIR domain not only have their own evolution pattern different from those of genes without TIR domain, but also have their own species-specific pattern that differs from those of TIR genes in other plants. Analyses of the correlation between disease resistance QTL and NBS-encoding resistance genes showed that there could be more than half of the disease resistance QTL associated to the NBS-encoding genes in cotton, which agrees with previous studies establishing that more than half of plant resistance genes are NBS-encoding genes. PMID:23936305

  3. Presentations

    International Nuclear Information System (INIS)


    The PARIS meeting held in Cracow, Poland from 14 to 15 May 2007. The main subjects discussed during this meeting were the status of international project dedicated to gamma spectroscopy research. The scientific research program includes investigations of giant dipole resonance, probe of hot nuclei induced in heavy reactions, Jacobi shape transitions, isospin mixing and nuclear multifragmentation. The mentioned programme needs Rand D development such as new scintillations materials as lanthanum chlorides and bromides as well as new photo detection sensors as avalanche photodiodes - such subjects are also subjects of discussion. Additionally results of computerized simulations of scintillation detectors properties by means of GEANT- 4 code are presented

  4. Sequence similarity between the cp gene and the transgene in transgenic papayas = Similaridade de seqüência entre o gene cp do vírus e do transgene presente em mamoeiros transgênicos

    NARCIS (Netherlands)

    Souza, M.T.; Teixeira, M.; Gonsalves, D.


    The Papaya ringspot virus (PRSV) coat protein transgene present in 'Rainbow' and 'SunUp' papayas disclose high sequence similarity (>89%) to the cp gene from PRSV BR and TH. Despite this, both isolates are able to break down the resistance in 'Rainbow', while only the latter is able to do so in

  5. Association between selected antimicrobial resistance genes and antimicrobial exposure in Danish pig farms

    DEFF Research Database (Denmark)

    Birkegård, Anna Camilla; Hisham Beshara Halasa, Tariq; Græsbøll, Kaare


    Bacterial antimicrobial resistance (AMR) in pigs is an important public health concern due to its possible transfer to humans. We aimed at quantifying the relationship between the lifetime exposure of antimicrobials and seven antimicrobial resistance genes in Danish slaughter pig farms. AMR gene...... levels were quantified by qPCR of total-community DNA in faecal samples obtained from 681 batches of slaughter pigs. The lifetime exposure to antimicrobials was estimated at batch level for the piglet, weaner, and finisher periods individually for the sampled batches. We showed that the effect...... of antimicrobial exposure on the levels of AMR genes was complex and unique for each individual gene. Several antimicrobial classes had both negative and positive correlations with the AMR genes. From 10-42% of the variation in AMR gene levels could be explained in the final regression models, indicating...

  6. PRGPred: A platform for prediction of domains of resistance gene analogue (RGA in Arecaceae developed using machine learning algorithms

    Directory of Open Access Journals (Sweden)



    Full Text Available Plant disease resistance genes (R-genes are responsible for initiation of defense mechanism against various phytopathogens. The majority of plant R-genes are members of very large multi-gene families, which encode structurally related proteins containing nucleotide binding site domains (NBS and C-terminal leucine rich repeats (LRR. Other classes possess' an extracellular LRR domain, a transmembrane domain and sometimes, an intracellular serine/threonine kinase domain. R-proteins work in pathogen perception and/or the activation of conserved defense signaling networks. In the present study, sequences representing resistance gene analogues (RGAs of coconut, arecanut, oil palm and date palm were collected from NCBI, sorted based on domains and assembled into a database. The sequences were analyzed in PRINTS database to find out the conserved domains and their motifs present in the RGAs. Based on these domains, we have also developed a tool to predict the domains of palm R-genes using various machine learning algorithms. The model files were selected based on the performance of the best classifier in training and testing. All these information is stored and made available in the online ‘PRGpred' database and prediction tool.

  7. Prevalence of the antibiotic resistance genes in coagulase-positive- and negative-Staphylococcus in chicken meat retailed to consumers

    Directory of Open Access Journals (Sweden)

    Kamelia Mahmoud Osman


    Full Text Available The use of antibiotics in farm management (growing crops and raising animals has become a major area of concern. Its implications is the consequent emergence of antibiotic resistant bacteria (ARB and accordingly their access into the human food chain with passage of antibiotic resistance genes (ARG to the normal human intestinal microbiota and hence to other pathogenic bacteria causative human disease. Therefore, we pursued in this study to unravel the frequency and the quinolone resistance determining region, mecA and cfr genes of methicillin-susceptible Staphylococcus aureus (MSSA, methicillin-resistant S. aureus (MRSA, methicillin-resistant coagulase-negative staphylococci (MRCNS and methicillin-susceptible coagulase-negative staphylococci (MSCNS isolated from the retail trade of ready-to-eat raw chicken meat samples collected during one year and sold across the Great Cairo area. The 50 Staphylococcus isolated from retail raw chicken meat were analyzed for their antibiotic resistance phenotypic profile on 12 antibiotics (penicillin, oxacillin, methicillin, ampicillin-sulbactam, erythromycin, tetracycline, clindamycin, gentamicin, ciprofloxacin, chloramphenicol, sulfamethoxazole-trimethoprim and vancomycin and their endorsement of the quinolone resistance determining region, mecA and cfr genes. The isolation results revealed 50 isolates, CPS (14 and CNS (36, representing ten species (S. aureus, S. hyicus, S. epidermedius, S. lugdunensis, S. haemolyticus, S. hominus, S. schleiferi, S. cohnii, S. intermedius and S. lentus. Twenty seven isolates were methicillin-resistant. Out of the characterized 50 staphylococcal isolates, three were MRSA but only 2/3 carried the mecA gene. The ARG that bestows resistance to quinolones, β-lactams, macrolides, lincosamides and streptogramin B (MLS(B in MRSA and MR-CNS were perceived. According to the available literature, the present investigation was a unique endeavor into the identification of the quinolone-resistance

  8. Mapping of stripe rust resistance gene in an Aegilops caudate introgression line in wheat and its genetic association with leaf rust resistance. (United States)

    Toor, Puneet Inder; Kaur, Satinder; Bansal, Mitaly; Yadav, Bharat; Chhuneja, Parveen


    A pair of stripe rust and leaf rust resistance genes was introgressed from Aegilops caudata, a nonprogenitor diploid species with the CC genome, to cultivated wheat. Inheritance and genetic mapping of stripe rust resistance gene in backcrossrecombinant inbred line (BC-RIL) population derived from the cross of a wheat-Ae. caudata introgression line (IL) T291- 2(pau16060) with wheat cv. PBW343 is reported here. Segregation of BC-RILs for stripe rust resistance depicted a single major gene conditioning adult plant resistance (APR) with stripe rust reaction varying from TR-20MS in resistant RILs signifying the presence of some minor genes as well. Genetic association with leaf rust resistance revealed that two genes are located at a recombination distance of 13%. IL T291-2 had earlier been reported to carry introgressions on wheat chromosomes 2D, 3D, 4D, 5D, 6D and 7D. Genetic mapping indicated the introgression of stripe rust resistance gene on wheat chromosome 5DS in the region carrying leaf rust resistance gene LrAc, but as an independent introgression. Simple sequence repeat (SSR) and sequence-tagged site (STS) markers designed from the survey sequence data of 5DS enriched the target region harbouring stripe and leaf rust resistance genes. Stripe rust resistance locus, temporarily designated as YrAc, mapped at the distal most end of 5DS linked with a group of four colocated SSRs and two resistance gene analogue (RGA)-STS markers at a distance of 5.3 cM. LrAc mapped at a distance of 9.0 cM from the YrAc and at 2.8 cM from RGA-STS marker Ta5DS_2737450, YrAc and LrAc appear to be the candidate genes for marker-assisted enrichment of the wheat gene pool for rust resistance.

  9. Imipenem Treatment Induces Expression of Important Genes and Phenotypes in a Resistant Acinetobacter baumannii Isolate. (United States)

    Dhabaan, Ghulam Nasser; AbuBakar, Sazaly; Cerqueira, Gustavo Maia; Al-Haroni, Mohammed; Pang, Sui Ping; Hassan, Hamimah


    Acinetobacter baumannii has emerged as a notorious multidrug-resistant pathogen, and development of novel control measures is of the utmost importance. Understanding the factors that play a role in drug resistance may contribute to the identification of novel therapeutic targets. Pili are essential for A. baumannii adherence to and biofilm formation on abiotic surfaces as well as virulence. In the present study, we found that biofilm formation was significantly induced in an imipenem-resistant (Imp(r)) strain treated with a subinhibitory concentration of antibiotic compared to that in an untreated control and an imipenem-susceptible (Imp(s)) isolate. Using microarray and quantitative PCR analyses, we observed that several genes responsible for the synthesis of type IV pili were significantly upregulated in the Imp(r) but not in the Imp(s) isolate. Notably, this finding is corroborated by an increase in the motility of the Imp(r) strain. Our results suggest that the ability to overproduce colonization factors in response to imipenem treatment confers biological advantage to A. baumannii and may contribute to clinical success. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  10. Distribution of the multidrug resistance gene cfr in Staphylococcus species isolates from swine farms in China. (United States)

    Wang, Yang; Zhang, Wanjiang; Wang, Juan; Wu, Congming; Shen, Zhangqi; Fu, Xiao; Yan, Yang; Zhang, Qijing; Schwarz, Stefan; Shen, Jianzhong


    A total of 149 porcine Staphylococcus isolates with florfenicol MICs of ≥ 16 μg/ml were screened for the presence of the multiresistance gene cfr, its location on plasmids, and its genetic environment. In total, 125 isolates carried either cfr (16 isolates), fexA (92 isolates), or both genes (17 isolates). The 33 cfr-carrying staphylococci, which included isolates of the species Staphylococcus cohnii, S. arlettae, and S. saprophyticus in which the cfr gene has not been described before, exhibited a wide variety of SmaI pulsed-field gel electrophoresis patterns. In 18 cases, the cfr gene was located on plasmids. Four different types of cfr-carrying plasmids--pSS-01 (n = 2; 40 kb), pSS-02 (n = 3; 35.4 kb), pSS-03 (n = 10; 7.1 kb), and pBS-01 (n = 3; 16.4 kb)--were differentiated on the basis of their sizes, restriction patterns, and additional resistance genes. Sequence analysis revealed that in plasmid pSS-01, the cfr gene was flanked in the upstream part by a complete aacA-aphD-carrying Tn4001-like transposon and in the downstream part by a complete fexA-carrying transposon Tn558. In plasmid pSS-02, an insertion sequence IS21-558 and the cfr gene were integrated into transposon Tn558 and thereby truncated the tnpA and tnpB genes. The smallest cfr-carrying plasmid pSS-03 carried the macrolide-lincosamide-streptogramin B resistance gene erm(C). Plasmid pBS-01, previously described in Bacillus spp., harbored a Tn917-like transposon, including the macrolide-lincosamide-streptogramin B resistance gene erm(B) in the cfr downstream region. Plasmids, which in part carry additional resistance genes, seem to play an important role in the dissemination of the gene cfr among porcine staphylococci.

  11. Occurrence of Ambler Class B Metallo-β-Lactamase Gene in Imipenem-Resistant Pseudomonas Aeruginosa Strains Isolated from Clinical Samples

    Directory of Open Access Journals (Sweden)

    Zeynab Golshani


    Full Text Available Background: 5TMetallo-β-lactamase (MBLs can hydrolyze a broad spectrum of beta-lactams, including penicillins, cephalosporins, and carbapenems. Genes encoding these enzymes are located on the plasmid that can easily be transferred to other bacteria. The aim of this study was to isolate and identify the Pseudomonas aeruginosa strains encoding VIM1 gene, in clinical samples, using the PCR technique. Materials and Methods: During a 4 month period, 100 strains of Pseudomonas aeruginosa from clinical specimens were collected. Standard tests were performed to identify strains of Pseudomonas aeruginosa. Resistance to antibiotics was examined and then the PCR was used to detect VIM1gene. Results:In this study, the highest rates of resistance to antibiotics, amikacin and cefotaxime was observed (65% and 62%, the lowest resistance to antibiotics piperacillin (48% and imipenem and cefepime with 55% resistance was reported. DDST method was performed for 37 strains for the MBl detection. Among the 37 isolate, 30 strains were MBL-producing with imipenem-EDTA method. Twelve strains (18% were carriers of VIM1 gene using the PCR method. Conclusion: In the present study, the prevalence of strains producing MBL genes in strains of hospitals is a growing trend; correct prescription of medications can prevent the spread of resistant pathogens. It is suggested that molecular methods for rapid detection of resistance genes can be used to prevent the spread of this genes.


    Directory of Open Access Journals (Sweden)

    Ye. S. Kulikov


    Full Text Available Introduction: The leading mechanisms and causes of severe therapy resistant asthma are poorly understood. The aim of this study was to define global patterns of gene expression in adults with severe therapy-resistant asthma in dynamic during treatment period.Methods: Performed 24-week prospective interventional study in parallel groups. Severe asthma patients was aposterior divided at therapy sensitive and resistant patients according to ATS criteria. Global transcriptome profile was characterized using the Affymetrix HuGene ST1.0 chip. Cluster analysis was performed.Results and conclusion: According to our data several mechanisms of therapy resistance may be considered: increased levels of nitric oxide and beta2-agonists nitration, dysregulation of endogenous steroids secretion and involvement in the pathogenesis of Staphylococcus aureus. Absence of suppression of gene expression KEGG-pathway “asthma" may reflect the low efficiency or long period of anti-inflammatory therapy effect realization.

  13. Plasmid metagenomics reveals multiple antibiotic resistance gene classes among the gut microbiomes of hospitalised patients

    DEFF Research Database (Denmark)

    Jitwasinkul, Tossawan; Suriyaphol, Prapat; Tangphatsornruang, Sithichoke


    Antibiotic resistance genes are rapidly spread between pathogens and the normal flora, with plasmids playing an important role in their circulation. This study aimed to investigate antibiotic resistance plasmids in the gut microbiome of hospitalised patients. Stool samples were collected from seven...... inpatients at Siriraj Hospital (Bangkok, Thailand) and were compared with a sample from a healthy volunteer. Plasmids from the gut microbiomes extracted from the stool samples were subjected to high-throughput DNA sequencing (GS Junior). Newbler-assembled DNA reads were categorised into known and unknown...... in the gut microbiome; however, it was difficult to link these to the antibiotic resistance genes identified. That the antibiotic resistance genes came from hospital and community environments is worrying....

  14. Involvement of hepatic xenobiotic related genes in bromadiolone resistance in wild Norway rats, Rattus norvegicus (Berk.)

    DEFF Research Database (Denmark)

    Markussen, Mette Drude; Heiberg, Ann-Charlotte; Alsbo, Carsten


    To examine the role of xenobiotic relevant genes in bromadiolone resistance in wild Norway rats (Rattus norvegicus) we compared the constitutive liver gene expression and expression upon bromadiolone administration in bromadiolone resistant and anticoagulant susceptible female rats using a LNA...... expressed in resistant than susceptible rats upon bromadiolone exposure. To establish how bromadiolone affected xenobiotic gene expression in the two strains we compared bromadiolone expression profiles to saline profiles of both strains. Bromadiolone mediated significant up-regulation of Cyp2e1 and Cyp3a3...... expression in the resistant rats whereas the rodenticide conferred down-regulation of Cyp2e1, Cyp3a3 and Gpox1 and induction of Cyp2c12 expression in susceptible rats. Cyp2c13 and Cyp3a2 expression were markedly suppressed in both strains upon treatment. This suggests that xenobiotic relevant enzymes play...

  15. Detection of antibiotic resistance genes in samples from acute and chronic endodontic infections and after treatment. (United States)

    Rôças, Isabela N; Siqueira, José F


    The purpose of this study was twofold: survey samples from acute and chronic endodontic infections for the presence of genes encoding resistance to beta-lactams, tetracycline and erythromycin, and evaluate the ability of treatment to eliminate these genes from root canals. DNA extracts from samples of abscess aspirates (n=25) and root canals of teeth with asymptomatic apical periodontitis (n=24) were used as template for direct detection of the genes blaTEM, cfxA, tetM, tetQ, tetW, and ermC using real-time polymerase chain reaction (PCR). Bacterial presence was determined using PCR with universal bacterial primers. Root canals of the asymptomatic cases were also sampled and evaluated after chemomechanical procedures using NiTi instruments with 2.5% NaOCl irrigation. All abscess and initial root canal samples were positive for bacteria. At least one of the target resistance genes was found in 36% of the abscess samples and 67% of the asymptomatic cases. The most prevalent genes in abscesses were blaTEM (24%) and ermC (24%), while tetM (42%) and tetW (29%) prevailed in asymptomatic cases. The blaTEM gene was significantly associated with acute cases (p=0.02). Conversely, tetM was significantly more prevalent in asymptomatic cases (p=0.008). Treatment eliminated resistance genes from most cases. Acute and chronic endodontic infections harboured resistance genes for 3 classes of widely used antibiotics. In most cases, treatment was effective in eliminating these genes, but there were a few cases in which they persisted. The implications of persistence are unknown. Direct detection of resistance genes in abscesses may be a potential method for rapid diagnosis and establishment of proactive antimicrobial therapy. Copyright © 2013 Elsevier Ltd. All rights reserved.

  16. Remapping of the stripe rust resistance gene Yr10 in common wheat. (United States)

    Yuan, Cuiling; Wu, Jingzheng; Yan, Baiqiang; Hao, Qunqun; Zhang, Chaozhong; Lyu, Bo; Ni, Fei; Caplan, Allan; Wu, Jiajie; Fu, Daolin


    Yr10 is an important gene to control wheat stripe rust, and the search for Yr10 needs to be continued. Wheat stripe rust or yellow rust is a devastating fungal disease caused by Puccinia striiformis f. sp. tritici (Pst). Host disease resistance offers a primary source for controlling wheat stripe rust. The stripe rust resistance gene Yr10 confers the race-specific resistance to most tested Pst races in China including CYR29. Early studies proposed that Yr10 was a nucleotide-binding site, leucine-rich repeat gene archived as GenBank accession AF149112 (hereafter designated the Yr10 candidate gene or Yr10 CG ). In this study, we revealed that 15 Chinese wheat cultivars positive for Yr10 CG are susceptible to CYR29. We then expressed the Yr10 CG cDNA in the common wheat 'Bobwhite'. The Yr10 CG -cDNA positive transgenic plants were also susceptible to CYR29. Thus, it is highly unlikely that Yr10 CG corresponds to the Yr10 resistance gene. Using the Yr10 donor 'Moro' and the Pst-susceptible wheat 'Huixianhong', we generated two F 3 populations that displayed a single Mendelian segregation on the Yr10 gene, and used them to remap the Yr10 gene. Six markers were placed in the Yr10 region, with the Yr10 CG gene now mapping about 1.2-cM proximal to the Yr10 locus and the Xsdauw79 marker is completely linked to the Yr10 locus. Apparently, the Yr10 gene has not yet been identified. Fine mapping and positional cloning of Yr10 is important for gene pyramiding for stripe rust resistance in wheat.

  17. PRGdb 3.0: a comprehensive platform for prediction and analysis of plant disease resistance genes. (United States)

    Osuna-Cruz, Cristina M; Paytuvi-Gallart, Andreu; Di Donato, Antimo; Sundesha, Vicky; Andolfo, Giuseppe; Aiese Cigliano, Riccardo; Sanseverino, Walter; Ercolano, Maria R


    The Plant Resistance Genes database (PRGdb; has been redesigned with a new user interface, new sections, new tools and new data for genetic improvement, allowing easy access not only to the plant science research community but also to breeders who want to improve plant disease resistance. The home page offers an overview of easy-to-read search boxes that streamline data queries and directly show plant species for which data from candidate or cloned genes have been collected. Bulk data files and curated resistance gene annotations are made available for each plant species hosted. The new Gene Model view offers detailed information on each cloned resistance gene structure to highlight shared attributes with other genes. PRGdb 3.0 offers 153 reference resistance genes and 177 072 annotated candidate Pathogen Receptor Genes (PRGs). Compared to the previous release, the number of putative genes has been increased from 106 to 177 K from 76 sequenced Viridiplantae and algae genomes. The DRAGO 2 tool, which automatically annotates and predicts (PRGs) from DNA and amino acid with high accuracy and sensitivity, has been added. BLAST search has been implemented to offer users the opportunity to annotate and compare their own sequences. The improved section on plant diseases displays useful information linked to genes and genomes to connect complementary data and better address specific needs. Through, a revised and enlarged collection of data, the development of new tools and a renewed portal, PRGdb 3.0 engages the plant science community in developing a consensus plan to improve knowledge and strategies to fight diseases that afflict main crops and other plants. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. Allele mining in barley genetic resources reveals genes of race-nonspecific powdery mildew resistance

    Directory of Open Access Journals (Sweden)

    Annika eSpies


    Full Text Available Race-nonspecific, or quantitative, pathogen resistance is of high importance to plant breeders due to its expected durability. However, it is usually controlled by multiple quantitative trait loci (QTL and therefore difficult to handle in practice. Knowing the genes that underlie race-nonspecific resistance would allow its exploitation in a more targeted manner. Here, we performed an association-genetic study in a customized worlwide collection of spring barley accessions for candidate genes of race-nonspecific resistance to the powdery mildew fungus Blumeria graminis f.sp. hordei (Bgh and combined data with results from QTL-mapping- as well as functional-genomics approaches. This led to the idenfication of 11 associated genes with converging evidence for an important role in race-nonspecific resistance in the presence of the Mlo-gene for basal susceptibility. Outstanding in this respect was the gene encoding the transcription factor WRKY2. The results suggest that unlocking plant genetic resources and integrating functional-genomic with genetic approaches accelerates the discovery of genes underlying race-nonspecific resistance in barley and other crop plants.

  19. Identification and characterization of potential NBS-encoding resistance genes and induction kinetics of a putative candidate gene associated with downy mildew resistance in Cucumis

    Directory of Open Access Journals (Sweden)

    Wan Hongjian


    Full Text Available Abstract Background Due to the variation and mutation of the races of Pseudoperonospora cubensis, downy mildew has in recent years become the most devastating leaf disease of cucumber worldwide. Novel resistance to downy mildew has been identified in the wild Cucumis species, C. hystrix Chakr. After the successful hybridization between C. hystrix and cultivated cucumber (C. sativus L., an introgression line (IL5211S was identified as highly resistant to downy mildew. Nucleotide-binding site and leucine-rich repeat (NBS-LRR genes are the largest class of disease resistance genes cloned from plant with highly conserved domains, which can be used to facilitate the isolation of candidate genes associated with downy mildew resistance in IL5211S. Results Degenerate primers that were designed based on the conserved motifs in the NBS domain of resistance (R proteins were used to isolate NBS-type sequences from IL5211S. A total of 28 sequences were identified and named as cucumber (C. sativus = CS resistance gene analogs as CSRGAs. Polygenetic analyses separated these sequences into four different classes. Quantitative real-time polymerase chain reaction (qRT-PCR analysis showed that these CSRGAs expressed at different levels in leaves, roots, and stems. In addition, introgression from C. hystrix induced expression of the partial CSRGAs in cultivated cucumber, especially CSRGA23, increased four-fold when compared to the backcross parent CC3. Furthermore, the expression of CSRGA23 under P. cubensis infection and abiotic stresses was also analyzed at different time points. Results showed that the P. cubensis treatment and four tested abiotic stimuli, MeJA, SA, ABA, and H2O2, triggered a significant induction of CSRGA23 within 72 h of inoculation. The results indicate that CSRGA23 may play a critical role in protecting cucumber against P. cubensis through a signaling the pathway triggered by these molecules. Conclusions Four classes of NBS-type RGAs were

  20. Gene interactions and genetics of blast resistance and yield ...

    Indian Academy of Sciences (India)


    Aug 11, 2014 ... of chemical measures for the control and management of blast, which are not .... tion of genetic components of variation, epistasis model and gene effects in two .... and environmental variance is estimated from mean variance.

  1. Plasmid-Mediated Quinolone Resistance Genes in Escherichia coli ...

    African Journals Online (AJOL)


    PMQR) genes and the prevalence of extended spectrum β-lactamase (ESBL) types in Escherichia coli clinical isolates. Methods: Sixty-one ESBL-producing urinary E. coli isolates were studied. An antibiotic susceptibility test was performed ...

  2. Isolation and characterization of a candidate gene for resistance to ...

    African Journals Online (AJOL)



    May 17, 2012 ... Real-time polymerase chain reaction (PCR) showed that. CreV8 was expressed .... Two housekeeping genes (GAPDH and actin) were used as interior references for accuracy ..... Future world supply and demand. Loivoisier ...

  3. High-throughput genotyping-by-sequencing facilitates molecular tagging of a novel rust resistance gene, R 15 , in sunflower (Helianthus annuus L.). (United States)

    Ma, G J; Song, Q J; Markell, S G; Qi, L L


    A novel rust resistance gene, R 15 , derived from the cultivated sunflower HA-R8 was assigned to linkage group 8 of the sunflower genome using a genotyping-by-sequencing approach. SNP markers closely linked to R 15 were identified, facilitating marker-assisted selection of resistance genes. The rust virulence gene is co-evolving with the resistance gene in sunflower, leading to the emergence of new physiologic pathotypes. This presents a continuous threat to the sunflower crop necessitating the development of resistant sunflower hybrids providing a more efficient, durable, and environmentally friendly host plant resistance. The inbred line HA-R8 carries a gene conferring resistance to all known races of the rust pathogen in North America and can be used as a broad-spectrum resistance resource. Based on phenotypic assessments of 140 F 2 individuals derived from a cross of HA 89 with HA-R8, rust resistance in the population was found to be conferred by a single dominant gene (R 15 ) originating from HA-R8. Genotypic analysis with the currently available SSR markers failed to find any association between rust resistance and any markers. Therefore, we used genotyping-by-sequencing (GBS) analysis to achieve better genomic coverage. The GBS data showed that R 15 was located at the top end of linkage group (LG) 8. Saturation with 71 previously mapped SNP markers selected within this region further showed that it was located in a resistance gene cluster on LG8, and mapped to a 1.0-cM region between three co-segregating SNP makers SFW01920, SFW00128, and SFW05824 as well as the NSA_008457 SNP marker. These closely linked markers will facilitate marker-assisted selection and breeding in sunflower.

  4. Presentation

    Directory of Open Access Journals (Sweden)

    Eduardo Vicente


    Full Text Available In the present edition of Significação – Scientific Journal for Audiovisual Culture and in the others to follow something new is brought: the presence of thematic dossiers which are to be organized by invited scholars. The appointed subject for the very first one of them was Radio and the invited scholar, Eduardo Vicente, professor at the Graduate Course in Audiovisual and at the Postgraduate Program in Audiovisual Media and Processes of the School of Communication and Arts of the University of São Paulo (ECA-USP. Entitled Radio Beyond Borders the dossier gathers six articles and the intention of reuniting works on the perspectives of usage of such media as much as on the new possibilities of aesthetical experimenting being build up for it, especially considering the new digital technologies and technological convergences. It also intends to present works with original theoretical approach and original reflections able to reset the way we look at what is today already a centennial media. Having broadened the meaning of “beyond borders”, four foreign authors were invited to join the dossier. This is the first time they are being published in this country and so, in all cases, the articles where either written or translated into Portuguese.The dossier begins with “Radio is dead…Long live to the sound”, which is the transcription of a thought provoking lecture given by Armand Balsebre (Autonomous University of Barcelona – one of the most influential authors in the world on the Radio study field. It addresses the challenges such media is to face so that it can become “a new sound media, in the context of a new soundscape or sound-sphere, for the new listeners”. Andrew Dubber (Birmingham City University regarding the challenges posed by a Digital Era argues for a theoretical approach in radio studies which can consider a Media Ecology. The author understands the form and discourse of radio as a negotiation of affordances and

  5. Skeletal muscle gene expression in response to resistance exercise: sex specific regulation

    Directory of Open Access Journals (Sweden)

    Burant Charles F


    Full Text Available Abstract Background The molecular mechanisms underlying the sex differences in human muscle morphology and function remain to be elucidated. The sex differences in the skeletal muscle transcriptome in both the resting state and following anabolic stimuli, such as resistance exercise (RE, might provide insight to the contributors of sexual dimorphism of muscle phenotypes. We used microarrays to profile the transcriptome of the biceps brachii of young men and women who underwent an acute unilateral RE session following 12 weeks of progressive training. Bilateral muscle biopsies were obtained either at an early (4 h post-exercise or late recovery (24 h post-exercise time point. Muscle transcription profiles were compared in the resting state between men (n = 6 and women (n = 8, and in response to acute RE in trained exercised vs. untrained non-exercised control muscle for each sex and time point separately (4 h post-exercise, n = 3 males, n = 4 females; 24 h post-exercise, n = 3 males, n = 4 females. A logistic regression-based method (LRpath, following Bayesian moderated t-statistic (IMBT, was used to test gene functional groups and biological pathways enriched with differentially expressed genes. Results This investigation identified extensive sex differences present in the muscle transcriptome at baseline and following acute RE. In the resting state, female muscle had a greater transcript abundance of genes involved in fatty acid oxidation and gene transcription/translation processes. After strenuous RE at the same relative intensity, the time course of the transcriptional modulation was sex-dependent. Males experienced prolonged changes while females exhibited a rapid restoration. Most of the biological processes involved in the RE-induced transcriptional regulation were observed in both males and females, but sex specificity was suggested for several signaling pathways including activation of notch signaling and TGF-beta signaling in females

  6. Occurrence and Distribution of Antibiotic-resistant Bacteria and Transfer of Resistance Genes in Lake Taihu


    Yin, Qian; Yue, Dongmei; Peng, Yuke; Liu, Ying; Xiao, Lin


    The overuse of antibiotics has accelerated antibiotic resistance in the natural environment, especially fresh water, generating a potential risk for public health around the world. In this study, antibiotic resistance in Lake Taihu was investigated and this was the first thorough data obtained through culture-dependent methods. High percentages of resistance to streptomycin and ampicillin among bacterial isolates were detected, followed by tetracycline and chloramphenicol. Especially high lev...

  7. High frequency of silver resistance genes in invasive isolates of Enterobacter and Klebsiella species. (United States)

    Sütterlin, S; Dahlö, M; Tellgren-Roth, C; Schaal, W; Melhus, Å


    Silver-based products have been marketed as an alternative to antibiotics, and their consumption has increased. Bacteria may, however, develop resistance to silver. To study the presence of genes encoding silver resistance (silE, silP, silS) over time in three clinically important Enterobacteriaceae genera. Using polymerase chain reaction (PCR), 752 bloodstream isolates from the years 1990-2010 were investigated. Age, gender, and ward of patients were registered, and the susceptibility to antibiotics and silver nitrate was tested. Clonality and single nucleotide polymorphism were assessed with repetitive element sequence-based PCR, multi-locus sequence typing, and whole-genome sequencing. Genes encoding silver resistance were detected most frequently in Enterobacter spp. (48%), followed by Klebsiella spp. (41%) and Escherichia coli 4%. Phenotypical resistance to silver nitrate was found in Enterobacter (13%) and Klebsiella (3%) isolates. The lowest carriage rate of sil genes was observed in blood isolates from the neonatology ward (24%), and the highest in blood isolates from the oncology/haematology wards (66%). Presence of sil genes was observed in international high-risk clones. Sequences of the sil and pco clusters indicated that a single mutational event in the silS gene could have caused the phenotypic resistance. Despite a restricted consumption of silver-based products in Swedish health care, silver resistance genes are widely represented in clinical isolates of Enterobacter and Klebsiella species. To avoid further selection and spread of silver-resistant bacteria with a high potential for healthcare-associated infections, the use of silver-based products needs to be controlled and the silver resistance monitored. Copyright © 2017 The Healthcare Infection Society. Published by Elsevier Ltd. All rights reserved.

  8. Who possesses drug resistance genes in the aquatic environment?: sulfamethoxazole (SMX) resistance genes among the bacterial community in water environment of Metro-Manila, Philippines. (United States)

    Suzuki, Satoru; Ogo, Mitsuko; Miller, Todd W; Shimizu, Akiko; Takada, Hideshige; Siringan, Maria Auxilia T


    Recent evidence has shown that antibiotic resistant bacteria (ARB) and antibiotic resistance genes (ARGs) are ubiquitous in natural environments, including sites considered pristine. To understand the origin of ARGs and their dynamics, we must first define their actual presence in the natural bacterial assemblage. Here we found varying distribution profiles of sul genes in "colony forming bacterial assemblages" and "natural bacterial assemblages." Our monitoring for antibiotic contamination revealed that sulfamethoxazole (SMX) is a major contaminant in aquatic environments of Metro-Manila, which would have been derived from human and animal use, and subsequently decreased through the process of outflow from source to the sea. The SMX-resistant bacterial rate evaluated by the colony forming unit showed 10 to 86% of the total colony numbers showed higher rates from freshwater sites compared to marine sites. When sul genes were quantified by qPCR, colony-forming bacteria conveyed sul1 and sul2 genes in freshwater and seawater (10(-5)-10(-2) copy/16S) but not sul3. Among the natural bacterial assemblage, all sul1, sul2, and sul3 were detected (10(-5)-10(-3) copy/16S), whereas all sul genes were at an almost non-detectable level in the freshwater assemblage. This study suggests that sul1 and sul2 are main sul genes in culturable bacteria, whereas sul3 is conveyed by non-culturable bacteria in the sea. As a result marine bacteria possess sul1, sul2 and sul3 genes in the marine environment.

  9. Who Possesses Drug Resistance Genes in the Aquatic Environment? : Sulfamethoxazole (SMX Resistance Genes among the Bacterial Community in Water Environment of Metro-Manila, Philippines

    Directory of Open Access Journals (Sweden)

    Satoru eSuzuki


    Full Text Available Recent evidence has shown that antibiotic resistant bacteria (ARB and antibiotic resistance genes (ARG are ubiquitous in natural environments, including sites considered pristine. To understand the origin of ARGs and their dynamics, we must first define their actual presence in the natural bacterial assemblage. Here we found varying distribution profiles of sul genes in colony forming bacterial assemblages and natural bacterial assemblages. Our monitoring for antibiotic contamination revealed that sulfamethoxazole (SMX is a major contaminant in aquatic environments of Metro-Manila, which would have been derived from human and animal use, and subsequently decreased through the process of outflow from source to the sea. The SMX-resistant bacterial rate evaluated by the colony forming unit showed 10 to 86 % of the total colony numbers showed higher rates from freshwater sites compared to marine sites. When sul genes were quantified by qPCR, colony-forming bacteria conveyed sul1 and sul2 genes in freshwater and seawater (10-5-10-2 copy/16S but not sul3. Among the natural bacterial assemblage, all sul1, sul2 and sul3 were detected (10-5-10-3 copy/16S, whereas all sul genes were at an almost non-detectable level in the freshwater assemblage. This study suggests that sul1 and sul2 are main sul genes in culturable bacteria, whereas sul3 is conveyed by non-culturable bacteria in the sea. As a result marine bacteria possess sul1, sul2 and sul3 genes in the marine environment.

  10. Transcriptome profiling to discover putative genes associated with paraquat resistance in goosegrass (Eleusine indica L..

    Directory of Open Access Journals (Sweden)

    Jing An

    Full Text Available BACKGROUND: Goosegrass (Eleusine indica L., a serious annual weed in the world, has evolved resistance to several herbicides including paraquat, a non-selective herbicide. The mechanism of paraquat resistance in weeds is only partially understood. To further study the molecular mechanism underlying paraquat resistance in goosegrass, we performed transcriptome analysis of susceptible and resistant biotypes of goosegrass with or without paraquat treatment. RESULTS: The RNA-seq libraries generated 194,716,560 valid reads with an average length of 91.29 bp. De novo assembly analysis produced 158,461 transcripts with an average length of 1153.74 bp and 100,742 unigenes with an average length of 712.79 bp. Among these, 25,926 unigenes were assigned to 65 GO terms that contained three main categories. A total of 13,809 unigenes with 1,208 enzyme commission numbers were assigned to 314 predicted KEGG metabolic pathways, and 12,719 unigenes were categorized into 25 KOG classifications. Furthermore, our results revealed that 53 genes related to reactive oxygen species scavenging, 10 genes related to polyamines and 18 genes related to transport were differentially expressed in paraquat treatment experiments. The genes related to polyamines and transport are likely potential candidate genes that could be further investigated to confirm their roles in paraquat resistance of goosegrass. CONCLUSION: This is the first large-scale transcriptome sequencing of E. indica using the Illumina platform. Potential genes involved in paraquat resistance were identified from the assembled sequences. The transcriptome data may serve as a reference for further analysis of gene expression and functional genomics studies, and will facilitate the study of paraquat resistance at the molecular level in goosegrass.

  11. Transcriptome profiling to discover putative genes associated with paraquat resistance in goosegrass (Eleusine indica L.). (United States)

    An, Jing; Shen, Xuefeng; Ma, Qibin; Yang, Cunyi; Liu, Simin; Chen, Yong


    Goosegrass (Eleusine indica L.), a serious annual weed in the world, has evolved resistance to several herbicides including paraquat, a non-selective herbicide. The mechanism of paraquat resistance in weeds is only partially understood. To further study the molecular mechanism underlying paraquat resistance in goosegrass, we performed transcriptome analysis of susceptible and resistant biotypes of goosegrass with or without paraquat treatment. The RNA-seq libraries generated 194,716,560 valid reads with an average length of 91.29 bp. De novo assembly analysis produced 158,461 transcripts with an average length of 1153.74 bp and 100,742 unigenes with an average length of 712.79 bp. Among these, 25,926 unigenes were assigned to 65 GO terms that contained three main categories. A total of 13,809 unigenes with 1,208 enzyme commission numbers were assigned to 314 predicted KEGG metabolic pathways, and 12,719 unigenes were categorized into 25 KOG classifications. Furthermore, our results revealed that 53 genes related to reactive oxygen species scavenging, 10 genes related to polyamines and 18 genes related to transport were differentially expressed in paraquat treatment experiments. The genes related to polyamines and transport are likely potential candidate genes that could be further investigated to confirm their roles in paraquat resistance of goosegrass. This is the first large-scale transcriptome sequencing of E. indica using the Illumina platform. Potential genes involved in paraquat resistance were identified from the assembled sequences. The transcriptome data may serve as a reference for further analysis of gene expression and functional genomics studies, and will facilitate the study of paraquat resistance at the molecular level in goosegrass.

  12. The Use of a Combined Bioinformatics Approach to Locate Antibiotic Resistance Genes on Plasmids From Whole Genome Sequences of Salmonella enterica Serovars From Humans in Ghana

    Directory of Open Access Journals (Sweden)

    Egle Kudirkiene


    Full Text Available In the current study, we identified plasmids carrying antimicrobial resistance genes in draft whole genome sequences of 16 selected Salmonella enterica isolates representing six different serovars from humans in Ghana. The plasmids and the location of resistance genes in the genomes were predicted using a combination of PlasmidFinder, ResFinder, plasmidSPAdes and BLAST genomic analysis tools. Subsequently, S1-PFGE was employed for analysis of plasmid profiles. Whole genome sequencing confirmed the presence of antimicrobial resistance genes in Salmonella isolates showing multidrug resistance phenotypically. ESBL, either blaTEM52−B or blaCTX−M15 were present in two cephalosporin resistant isolates of S. Virchow and S. Poona, respectively. The systematic genome analysis revealed the presence of different plasmids in different serovars, with or without insertion of antimicrobial resistance genes. In S. Enteritidis, resistance genes were carried predominantly on plasmids of IncN type, in S. Typhimurium on plasmids of IncFII(S/IncFIB(S/IncQ1 type. In S. Virchow and in S. Poona, resistance genes were detected on plasmids of IncX1 and TrfA/IncHI2/IncHI2A type, respectively. The latter two plasmids were described for the first time in these serovars. The combination of genomic analytical tools allowed nearly full mapping of the resistance plasmids in all Salmonella strains analyzed. The results suggest that the improved analytical approach used in the current study may be used to identify plasmids that are specifically associated with resistance phenotypes in whole genome sequences. Such knowledge would allow the development of rapid multidrug resistance tracking tools in Salmonella populations using WGS.

  13. Bioinformatics Analysis of NBS-LRR Encoding Resistance Genes in Setaria italica. (United States)

    Zhao, Yan; Weng, Qiaoyun; Song, Jinhui; Ma, Hailian; Yuan, Jincheng; Dong, Zhiping; Liu, Yinghui


    In plants, resistance (R) genes are involved in pathogen recognition and subsequent activation of innate immune responses. The nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes family forms the largest R-gene family among plant genomes and play an important role in plant disease resistance. In this paper, comprehensive analysis of NBS-encoding genes is performed in the whole Setaria italica genome. A total of 96 NBS-LRR genes are identified, and comprehensive overview of the NBS-LRR genes is undertaken, including phylogenetic analysis, chromosome locations, conserved motifs of proteins, and gene expression. Based on the domain, these genes are divided into two groups and distributed in all Setaria italica chromosomes. Most NBS-LRR genes are located at the distal tip of the long arms of the chromosomes. Setaria italica NBS-LRR proteins share at least one nucleotide-biding domain and one leucine-rich repeat domain. Our results also show the duplication of NBS-LRR genes in Setaria italica is related to their gene structure.

  14. A new 2DS·2RL Robertsonian translocation transfers stem rust resistance gene Sr59 into wheat. (United States)

    Rahmatov, Mahbubjon; Rouse, Matthew N; Nirmala, Jayaveeramuthu; Danilova, Tatiana; Friebe, Bernd; Steffenson, Brian J; Johansson, Eva


    A new stem rust resistance gene Sr59 from Secale cereale was introgressed into wheat as a 2DS·2RL Robertsonian translocation. Emerging new races of the wheat stem rust pathogen (Puccinia graminis f. sp. tritici), from Africa threaten global wheat (Triticum aestivum L.) production. To broaden the resistance spectrum of wheat to these widely virulent African races, additional resistance genes must be identified from all possible gene pools. From the screening of a collection of wheat-rye (Secale cereale L.) chromosome substitution lines developed at the Swedish University of Agricultural Sciences, we described the line 'SLU238' 2R (2D) as possessing resistance to many races of P. graminis f. sp. tritici, including the widely virulent race TTKSK (isolate synonym Ug99) from Africa. The breakage-fusion mechanism of univalent chromosomes was used to produce a new Robertsonian translocation: T2DS·2RL. Molecular marker analysis and stem rust seedling assays at multiple generations confirmed that the stem rust resistance from 'SLU238' is present on the rye chromosome arm 2RL. Line TA5094 (#101) was derived from 'SLU238' and was found to be homozygous for the T2DS·2RL translocation. The stem rust resistance gene on chromosome 2RL arm was designated as Sr59. Although introgressions of rye chromosome arms into wheat have most often been facilitated by irradiation, this study highlights the utility of the breakage-fusion mechanism for rye chromatin introgression. Sr59 provides an additional asset for wheat improvement to mitigate yield losses caused by stem rust.

  15. The genetics of resistance to powdery mildew in cultivated oats (Avena sativa L.): current status of major genes. (United States)

    Hsam, Sai L K; Mohler, Volker; Zeller, Friedrich J


    The genetics of resistance to powdery mildew caused by Blumeria graminis f. sp. avenae of four cultivated oats was studied using monosomic analysis. Cultivar 'Bruno' carries a gene (Pm6) that shows a recessive mode of inheritance and is located on chromosome 10D. Cultivar 'Jumbo' possesses a dominant resistance gene (Pm1) on chromosome 1C. In cultivar 'Rollo', in addition to the gene Pm3 on chromosome 17A, a second dominant resistance gene (Pm8) was identified and assigned to chromosome 4C. In breeding line APR 122, resistance was conditioned by a dominant resistance gene (Pm7) that was allocated to chromosome 13A. Genetic maps established for resistance genes Pm1, Pm6 and Pm7 employing amplified fragment length polymorphism (AFLP) markers indicated that these genes are independent of each other, supporting the results from monosomic analysis.

  16. The role of Cercospora zeae-maydis homologs of Rhodobacter sphaeroides 1O2-resistance genes in resistance to the photoactivated toxin cercosporin. (United States)

    Beseli, Aydin; Goulart da Silva, Marilia; Daub, Margaret E


    The photosynthetic bacterium Rhodobacter sphaeroides and plant pathogenic fungus Cercospora nicotianae have been used as models for understanding resistance to singlet oxygen ((1)O(2)), a highly toxic reactive oxygen species. In Rhodobacter and Cercospora, (1)O(2) is derived, respectively, from photosynthesis and from the (1)O(2)-generating toxin cercosporin which the fungus produces to parasitize plants. We identified common genes recovered in transcriptome studies of putative (1)O(2)-resistance genes in these two systems, suggesting common (1)O(2)-resistance mechanisms. To determine if the Cercospora homologs of R. sphaeroides (1)O(2)-resistance genes are involved in resistance to cercosporin, we expressed the genes in the cercosporin-sensitive fungus Neurospora crassa and assayed for increases in cercosporin resistance. Neurospora crassa transformants expressing genes encoding aldo/keto reductase, succinyl-CoA ligase, O-acetylhomoserine (thiol) lyase, peptide methionine sulphoxide reductase and glutathione S-transferase did not have elevated levels of cercosporin resistance. Several transformants expressing aldehyde dehydrogenase were significantly more resistant to cercosporin. Expression of the transgene and enzyme activity did not correlate with resistance, however. We conclude that although the genes tested in this study are important in (1)O(2) resistance in R. sphaeroides, their Cercospora homologs are not involved in resistance to (1)O(2) generated from cercosporin. © FEMS 2014. All rights reserved. For permissions, please e-mail:

  17. PROP1 gene mutations in a 36-year-old female presenting with psychosis

    Directory of Open Access Journals (Sweden)

    Durgesh Prasad Chaudhary


    Full Text Available Combined pituitary hormonal deficiency (CPHD is a rare disease that results from mutations in genes coding for transcription factors that regulate the differentiation of pituitary cells. PROP1 gene mutations are one of the etiological diagnoses of congenital panhypopituitarism, however symptoms vary depending on phenotypic expression. We present a case of psychosis in a 36-year-old female with congenital panhypopituitarism who presented with paranoia, flat affect and ideas of reference without a delirious mental state, which resolved with hormone replacement and antipsychotics. Further evaluation revealed that she had a homozygous mutation of PROP1 gene. In summary, compliance with hormonal therapy for patients with hypopituitarism appears to be effective for the prevention and treatment of acute psychosis symptoms.

  18. Survey of rice blast race identity for blast resistance gene identification in the USA and Puerto Rico (United States)

    Rice blast disease is a significant threat to stable rice production in the USA and worldwide. The major resistance gene (Pi-ta) located within a cluster of resistance genes on rice chromosome 12 has been demonstrated to confer resistance to the rice blast disease. Katy, a rice cultivar released in ...

  19. Tsw gene-based resistance is triggered by a functional RNA silencing suppressor protein of the Tomato spotted wilt virus

    NARCIS (Netherlands)

    Ronde, de D.; Butterbach, P.B.E.; Lohuis, H.; Hedil, M.; Lent, van J.W.M.; Kormelink, R.J.M.


    As a result of contradictory reports, the avirulence (Avr) determinant that triggers Tsw gene-based resistance in Capsicum annuum against the Tomato spotted wilt virus (TSWV) is still unresolved. Here, the N and NSs genes of resistance-inducing (RI) and resistance-breaking (RB) isolates were cloned

  20. Coral thermal tolerance: tuning gene expression to resist thermal stress.

    Directory of Open Access Journals (Sweden)

    Anthony J Bellantuono

    Full Text Available The acclimatization capacity of corals is a critical consideration in the persistence of coral reefs under stresses imposed by global climate change. The stress history of corals plays a role in subsequent response to heat stress, but the transcriptomic changes associated with these plastic changes have not been previously explored. In order to identify host transcriptomic changes associated with acquired thermal tolerance in the scleractinian coral Acropora millepora, corals preconditioned to a sub-lethal temperature of 3°C below bleaching threshold temperature were compared to both non-preconditioned corals and untreated controls using a cDNA microarray platform. After eight days of hyperthermal challenge, conditions under which non-preconditioned corals bleached and preconditioned corals (thermal-tolerant maintained Symbiodinium density, a clear differentiation in the transcriptional profiles was revealed among the condition examined. Among these changes, nine differentially expressed genes separated preconditioned corals from non-preconditioned corals, with 42 genes differentially expressed between control and preconditioned treatments, and 70 genes between non-preconditioned corals and controls. Differentially expressed genes included components of an apoptotic signaling cascade, which suggest the inhibition of apoptosis in preconditioned corals. Additionally, lectins and genes involved in response to oxidative stress were also detected. One dominant pattern was the apparent tuning of gene expression observed between preconditioned and non-preconditioned treatments; that is, differences in expression magnitude were more apparent than differences in the identity of genes differentially expressed. Our work revealed a transcriptomic signature underlying the tolerance associated with coral thermal history, and suggests that understanding the molecular mechanisms behind physiological acclimatization would be critical for the modeling of reefs

  1. Regulation of the pT181 encoded tetracycline resistance gene in Straphylococcus aureus

    International Nuclear Information System (INIS)

    Mojumdar, M.


    pT181 is a naturally-occurring 4437 basepair (bp) plasmid isolated from Staphylococcus aureus which encodes inducible resistance to tetracycline (Tc). The DNA sequence data has identified three open reading frames (ORFs). The largest ORF B, has been found to be responsible for the Tc resistance phenotype of pT181. Since most Tc resistance systems appear to be regulated by an effector protein and a repressor protein, several Bal 31 deletion mutants of pT181 were constructed and analyzed in an effort to identify the elements involved in Tc resistance. Two transcomplementing groups of mutants were identified within the tet gene. The mechanism of Tc resistance was studied by assaying the accumulation of [7- 3 H] Tc by Tc sensitive cells, and uninduced and induced pT181-containing cells. A sharp decrease in accumulation of the drug after an initial increase was observed in Tc induced pT181-containing cells. In vivo labeling of Bacillus subtilis minicells containing pT181 was performed with 35 S-methionine to identify the polypeptide product of the tet gene. A Tc-inducible protein having a molecular weight of approximately 50,000 daltons was detected only in B. subtilis minicells carrying pT181. Cell fractionation studies of S. aureus cells with and without pT181 showed that an approximately 28,000 daltons Tc-inducible protein was present in membranes of pT181 containing cells. The amount of TET protein in Tc induced minicells was about fifteen-fold higher than that in uninduced minicells. RNA prepared from stationary phase cells analyzed by Northern blot hybridization showed that the steady-state level of the tet mRNA in induced pT181-containing cells was bout four-fold higher than that in uninduced pT181-containing cells. When RNA synthesis was blocked with rifampicin, tet mRAN was found to be much more stable in Tc induced cells as compared to that in uninduced cells over a 30 min period

  2. Pl(17) is a novel gene independent of known downy mildew resistance genes in the cultivated sunflower (Helianthus annuus L.). (United States)

    Qi, L L; Long, Y M; Jan, C C; Ma, G J; Gulya, T J


    Pl 17, a novel downy mildew resistance gene independent of known downy mildew resistance genes in sunflowers, was genetically mapped to linkage group 4 of the sunflower genome. Downy mildew (DM), caused by Plasmopara halstedii (Farl.). Berl. et de Toni, is one of the serious sunflower diseases in the world due to its high virulence and the variability of the pathogen. DM resistance in the USDA inbred line, HA 458, has been shown to be effective against all virulent races of P. halstedii currently identified in the USA. To determine the chromosomal location of this resistance, 186 F 2:3 families derived from a cross of HA 458 with HA 234 were phenotyped for their resistance to race 734 of P. halstedii. The segregation ratio of the population supported that the resistance was controlled by a single dominant gene, Pl 17. Simple sequence repeat (SSR) and single nucleotide polymorphism (SNP) primers were used to identify molecular markers linked to Pl 17. Bulked segregant analysis using 849 SSR markers located Pl 17 to linkage group (LG) 4, which is the first DM gene discovered in this linkage group. An F2 population of 186 individuals was screened with polymorphic SSR and SNP primers from LG4. Two flanking markers, SNP SFW04052 and SSR ORS963, delineated Pl 17 in an interval of 3.0 cM. The markers linked to Pl 17 were validated in a BC3 population. A search for the physical location of flanking markers in sunflower genome sequences revealed that the Pl 17 region had a recombination frequency of 0.59 Mb/cM, which was a fourfold higher recombination rate relative to the genomic average. This region can be considered amenable to molecular manipulation for further map-based cloning of Pl 17.

  3. Genetically based location from triploid populations and gene ontology of a 3.3-mb genome region linked to Alternaria brown spot resistance in citrus reveal clusters of resistance genes.

    Directory of Open Access Journals (Sweden)

    José Cuenca

    Full Text Available Genetic analysis of phenotypical traits and marker-trait association in polyploid species is generally considered as a challenge. In the present work, different approaches were combined taking advantage of the particular genetic structures of 2n gametes resulting from second division restitution (SDR to map a genome region linked to Alternaria brown spot (ABS resistance in triploid citrus progeny. ABS in citrus is a serious disease caused by the tangerine pathotype of the fungus Alternaria alternata. This pathogen produces ACT-toxin, which induces necrotic lesions on fruit and young leaves, defoliation and fruit drop in susceptible genotypes. It is a strong concern for triploid breeding programs aiming to produce seedless mandarin cultivars. The monolocus dominant inheritance of susceptibility, proposed on the basis of diploid population studies, was corroborated in triploid progeny. Bulk segregant analysis coupled with genome scan using a large set of genetically mapped SNP markers and targeted genetic mapping by half tetrad analysis, using SSR and SNP markers, allowed locating a 3.3 Mb genomic region linked to ABS resistance near the centromere of chromosome III. Clusters of resistance genes were identified by gene ontology analysis of this genomic region. Some of these genes are good candidates to control the dominant susceptibility to the ACT-toxin. SSR and SNP markers were developed for efficient early marker-assisted selection of ABS resistant hybrids.

  4. Genetically based location from triploid populations and gene ontology of a 3.3-mb genome region linked to Alternaria brown spot resistance in citrus reveal clusters of resistance genes. (United States)

    Cuenca, José; Aleza, Pablo; Vicent, Antonio; Brunel, Dominique; Ollitrault, Patrick; Navarro, Luis


    Genetic analysis of phenotypical traits and marker-trait association in polyploid species is generally considered as a challenge. In the present work, different approaches were combined taking advantage of the particular genetic structures of 2n gametes resulting from second division restitution (SDR) to map a genome region linked to Alternaria brown spot (ABS) resistance in triploid citrus progeny. ABS in citrus is a serious disease caused by the tangerine pathotype of the fungus Alternaria alternata. This pathogen produces ACT-toxin, which induces necrotic lesions on fruit and young leaves, defoliation and fruit drop in susceptible genotypes. It is a strong concern for triploid breeding programs aiming to produce seedless mandarin cultivars. The monolocus dominant inheritance of susceptibility, proposed on the basis of diploid population studies, was corroborated in triploid progeny. Bulk segregant analysis coupled with genome scan using a large set of genetically mapped SNP markers and targeted genetic mapping by half tetrad analysis, using SSR and SNP markers, allowed locating a 3.3 Mb genomic region linked to ABS resistance near the centromere of chromosome III. Clusters of resistance genes were identified by gene ontology analysis of this genomic region. Some of these genes are good candidates to control the dominant susceptibility to the ACT-toxin. SSR and SNP markers were developed for efficient early marker-assisted selection of ABS resistant hybrids.

  5. (SRAP) markers linked to bacterial wilt resistance genes i

    African Journals Online (AJOL)



    Mar 19, 2014 ... Bacterial wilt caused by Ralstonia solanacearum is one of the most economically important diseases affecting potato (Solanum tuberosum). It is necessary to develop more molecular markers for potential use in potato genetic research. A highly resistant primitive cultivated species Solanum phureja was.

  6. Characterizing and identifying black spot resistance genes in polyploid roses (United States)

    The ornamental quality of outdoor grown roses (Rosa hybrida) is under constant threat from foliar diseases, such as black spot caused by Diplocarpon rosae. Fungicides are primarily used to manage black spot; however, there is a high consumer demand for disease resistant roses which eliminate the nee...

  7. Resistance Pattern and Detection of Metallo-beta-lactamase Genes ...

    African Journals Online (AJOL)


    Feb 23, 2018 ... Background: Acquired metallo-β-lactamases (MBLs) pose serious problem both in terms of ... P. aeruginosa from clinical samples submitted to the Medical Microbiology ... pan-drug-resistant .... Phenotypically confirmed MBL producers were stored ... 103 (51.5%); ear swab 32 (16%); urine 27 (13.5%); and.

  8. Resistance pattern and detection of metallo‑beta‑lactamase genes ...

    African Journals Online (AJOL)

    Materials and Methods: Two hundred nonduplicate, consecutive isolates of P. aeruginosa from clinical samples submitted to the Medical Microbiology Laboratory of National Hospital, Abuja were screened for carbapenem resistance using imipenem and meropenem. Phenotypic detection of MBL‑producing strains was ...

  9. Pyramiding of blast and bacterial leaf blight resistance genes into ...

    African Journals Online (AJOL)

    Blast caused by the fungus Magnaporthe oryzae (Hebert) Barr. and bacterial leaf blight (BLB) caused by Xanthomonas oryzae pv. oryzae (Xoo) are two major diseases of rice (Oryza sativa). The use of varietal resistance is the most appropriate strategy for controlling the diseases, and molecular assisted selection can ...

  10. Improvement of resistance to Fusarium root rot through gene ...

    African Journals Online (AJOL)

    Fusarium root rot (FRR), caused by Fusarium solani f.sp. , is one of the most serious root rot diseases of common bean (Phaseolus vulgaris L.) throughout the world. Yield losses of up to 84% have been attributed to the disease. Development and deployment of resistant materials is the most feasible approach to managing ...

  11. Composting swine slurry to reduce indicators and antibiotic resistance genes (United States)

    Over the last twenty years there have been considerable increases in the incidence of human infections with bacteria that are resistant to commonly used antibiotics. This has precipitated concerns about the use of antibiotics in livestock production. Composting of swine manure has several advantages...

  12. stem rust seedling resistance genes in ethiopian wheat cultivars

    African Journals Online (AJOL)

    Prof. Adipala Ekwamu

    Stem rust caused by Puccinia graminis f. sp. tritici is one of the major biotic limiting factors for wheat production in Ethiopia. Host plant resistance is the best option to manage stem rust from its economic and environmental points of view. Wheat cultivars are released for production without carrying race specific tests against ...

  13. Identification of bacterial blight resistance genes Xa4 in Pakistani ...

    African Journals Online (AJOL)



    Mar 4, 2008 ... Bacterial blight (BB) caused by Xanthomonas oryzae pv oryzae (Xoo) is a major biotic constraint in the irrigated rice belts. Genetic resistance is the most effective and economical control for bacterial blight. Molecular survey was conducted to identify the rice germplasm/lines for the presence of Xa4, a.

  14. Dissection of the multigenic wheat stem rust resistance present in the Montenegrin spring wheat accession PI 362698 (United States)

    Research to identify and characterize stem rust resistance genes in common wheat, Triticum aestivum, has been stimulated by the emergence of Ug99-lineage races of the wheat stem rust pathogen, Puccinia graminis f. sp. tritici (Pgt), in Eastern Africa. The Montenegrin spring wheat landrace PI 362698 ...

  15. Candidate Gene Identification with SNP Marker-Based Fine Mapping of Anthracnose Resistance Gene Co-4 in Common Bean.

    Directory of Open Access Journals (Sweden)

    Andrew J Burt

    Full Text Available Anthracnose, caused by Colletotrichum lindemuthianum, is an important fungal disease of common bean (Phaseolus vulgaris. Alleles at the Co-4 locus confer resistance to a number of races of C. lindemuthianum. A population of 94 F4:5 recombinant inbred lines of a cross between resistant black bean genotype B09197 and susceptible navy bean cultivar Nautica was used to identify markers associated with resistance in bean chromosome 8 (Pv08 where Co-4 is localized. Three SCAR markers with known linkage to Co-4 and a panel of single nucleotide markers were used for genotyping. A refined physical region on Pv08 with significant association with anthracnose resistance identified by markers was used in BLAST searches with the genomic sequence of common bean accession G19833. Thirty two unique annotated candidate genes were identified that spanned a physical region of 936.46 kb. A majority of the annotated genes identified had functional similarity to leucine rich repeats/receptor like kinase domains. Three annotated genes had similarity to 1, 3-β-glucanase domains. There were sequence similarities between some of the annotated genes found in the study and the genes associated with phosphoinositide-specific phosphilipases C associated with Co-x and the COK-4 loci found in previous studies. It is possible that the Co-4 locus is structured as a group of genes with functional domains dominated by protein tyrosine kinase along with leucine rich repeats/nucleotide binding site, phosphilipases C as well as β-glucanases.

  16. The identification of new genes related to cisplatin resistance in ovarian adenocarcinoma cell line A2780

    International Nuclear Information System (INIS)

    Solar, P.; Fedorocko, P.; Sytkowski, A.; Hodorova, I.


    Ovarian cancer cells are usually sensitive to platinum-based chemotherapy, such as cisplatin (CDDP), initially but typically become resistant to the drug over time. The phenomenon of clinical drug resistance represents a serious problem for successful disease treatment, and the molecular mechanism(s) are not fully understood. In search of novel mechanisms that may lead to the development of CDDP chemoresistance we have applied subtractive hybridization based on the PCR-select cDNA subtraction. In current study we have used subtractive hybridization to identify differentially-expressed genes in CDDP resistant CP70 and C200 cells versus CDDP-sensitive A2780 human ovarian adenocarcinoma cells. We have analyzed 256 randomly selected clones. Subtraction efficiency was determined by dot blot and DNA sequencing. Confirmation of differentially expressed cDNAs was done by virtual northern blot analysis, and 17 genes that were differentially expressed in both CDDP resistant cell lines versus CDDP sensitive A2780 cells were identified. The expression of 10 of these genes was undetectable or detected with low expression in sensitive A2780 cells in comparison to resistant ones. These genes included ARHGDIB, RANBP2, ASPH, PRTFDC1, SSX2IP, MBNL1, DNAJC15, MMP10, TCTE1L and one unidentified sequence. Additional 7 genes that were more highly expressed in resistant CP70 and C200 vs. A2780 cells included ANXA2, USP8, HSPCA, TRA1, CNAP1, ATP2B1 and COX2. Interestingly, multi-drug resistance associated p-glycoprotein (p170) was not detected by the western blot in CDDP resistant CP70 and C200 cells. Our identified genes are involved in diverse processes, such as stress response, chromatin condensation, protection from protein degradation, invasiveness of cells, alterations of Ca 2+ homeostasis and others which may contribute to CDDP resistance of ovarian adenocarcinoma cells. Further characterization of these genes and gene products should yield important insights into the biology of

  17. Transgenic rice plants harboring an introduced potato proteinase inhibitor II gene are insect resistant. (United States)

    Duan, X; Li, X; Xue, Q; Abo-el-Saad, M; Xu, D; Wu, R


    We introduced the potato proteinase inhibitor II (PINII) gene (pin2) into several Japonica rice varieties, and regenerated a large number of transgenic rice plants. Wound-inducible expression of the pin2 gene driven by its own promoter, together with the first intron of the rice actin 1 gene (act1), resulted in high-level accumulation of the PINII protein in the transgenic plants. The introduced pin2 gene was stably inherited in the second, third, and fourth generations, as shown by molecular analyses. Based on data from the molecular analyses, several homozygous transgenic lines were obtained. Bioassay for insect resistance with the fifth-generation transgenic rice plants showed that transgenic rice plants had increased resistance to a major rice insect pest, pink stem borer (Sesamia inferens). Thus, introduction of an insecticidal proteinase inhibitor gene into cereal plants can be used as a general strategy for control of insect pests.

  18. Frequency of antiseptic resistance genes in clinical staphycocci and enterococci isolates in Turkey

    Directory of Open Access Journals (Sweden)

    Seyda Ignak


    Full Text Available Abstract Background Disinfectants and antiseptics are biocides widely used in hospitals to prevent spread of pathogens. It has been reported that antiseptic resistance genes, qac’s, caused tolerance to a variety of biocidal agents, such as benzalkonium chloride (BAC and chlorhexidine digluconate (CHDG in Staphylococcus spp. isolates. We aimed to search the frequency of antiseptic resistance genes in clinical Staphylococcus spp. and Enterococcus spp. isolates to investigate the possible association with antiseptic tolerance and antibiotic resistance. Methods Antiseptic resistance genes (qacA/B, smr, qacG, qacH, and qacJ isolated from Gram-positive cocci (69 Staphylococcus spp. and 69 Enterococcus spp. were analyzed by PCR method. The minimum inhibitory concentrations (MICs of BAC and CHDG were determined by agar dilution method, whereas antibiotic susceptibility was analyzed by disk diffusion method according to Clinical and Laboratory Standards Institute (CLSI criteria. Results The frequency of antiseptic resistance genes was found to be high (49/69; 71.0% in our clinical staphylococci isolates but absent (0/69; 0% in enterococci isolates. The frequency of qacA/B and smr genes was higher (25/40; 62.5% and 7/40; 17.5%, respectively in coagulase negative staphylococci (CNS when compared to Staphylococcus aureus strains (3/29; 10.3%, and 4/29; 13.8%, respectively. In contrast, the frequency of qacG and qacJ genes was higher (11/29; 37.9% and 8/29; 27.5%, respectively in S. aureus than those of CNS (5/40; 12.5%, 10/40; 25.0% strains. qacH was not identified in none of the strains. We found an association between presence of antiseptic resistance genes and increased MIC values of BAC (>4 μg/mL in staphylococci and it was found to be statistically statistically significant (p < 0.01. We also showed that MICs of BAC and CHDG of vancomycin-resistant enterococci (VRE isolates were significantly higher than those of vancomycin

  19. Prevalence of quinolone resistance genes, copper resistance genes, and the bacterial communities in a soil-ryegrass system co-polluted with copper and ciprofloxacin. (United States)

    Tuo, Xiaxia; Gu, Jie; Wang, Xiaojuan; Sun, YiXin; Duan, Manli; Sun, Wei; Yin, Yanan; Guo, Aiyun; Zhang, Li


    The presence of high concentrations of residual antibiotics and antibiotic resistance genes (ARGs) in soil may pose potential health and environmental risks. This study investigated the prevalence of plasmid-mediated quinolone resistance (PMQR) genes, copper resistance genes (CRGs), and the bacterial communities in a soil-ryegrass pot system co-polluted with copper and ciprofloxacin (CIP; 0, 20, or 80 mg kg -1 dry soil). Compared with the samples on day 0, the total relative abundances of the PMQR genes and mobile genetic elements (MGEs) were reduced significantly by 80-89% in the ryegrass and soil by the cutting stage (after 75 days). The abundances of PMQR genes and MGEs were reduced by 63-81% in soil treated with 20 mg kg -1 CIP compared with the other treatments, but the abundances of CRGs increased by 18-42%. The presence of 80 mg kg -1 CIP affected the microbial community structure in the soil by increasing the abundances of Acidobacteria and Thaumarchaeota, but decreasing those of Firmicutes. Redundancy analysis indicated that the pH and microbial composition were the main factors that affected the variations in PMQR genes, MGEs, and CRGs, where they could explain 42.2% and 33.3% of the variation, respectively. Furthermore, intI2 may play an important role in the transfer of ARGs. We found that 80 mg kg -1 CIP could increase the abundances of ARGs and CRGs in a soil-ryegrass pot system. Copyright © 2018 Elsevier Ltd. All rights reserved.

  20. Neofunctionalization of Duplicated P450 Genes Drives the Evolution of Insecticide Resistance in the Brown Planthopper. (United States)

    Zimmer, Christoph T; Garrood, William T; Singh, Kumar Saurabh; Randall, Emma; Lueke, Bettina; Gutbrod, Oliver; Matthiesen, Svend; Kohler, Maxie; Nauen, Ralf; Davies, T G Emyr; Bass, Chris


    Gene duplication is a major source of genetic variation that has been shown to underpin the evolution of a wide range of adaptive traits [1, 2]. For example, duplication or amplification of genes encoding detoxification enzymes has been shown to play an important role in the evolution of insecticide resistance [3-5]. In this context, gene duplication performs an adaptive function as a result of its effects on gene dosage and not as a source of functional novelty [3, 6-8]. Here, we show that duplication and neofunctionalization of a cytochrome P450, CYP6ER1, led to the evolution of insecticide resistance in the brown planthopper. Considerable genetic variation was observed in the coding sequence of CYP6ER1 in populations of brown planthopper collected from across Asia, but just two sequence variants are highly overexpressed in resistant strains and metabolize imidacloprid. Both variants are characterized by profound amino-acid alterations in substrate recognition sites, and the introduction of these mutations into a susceptible P450 sequence is sufficient to confer resistance. CYP6ER1 is duplicated in resistant strains with individuals carrying paralogs with and without the gain-of-function mutations. Despite numerical parity in the genome, the susceptible and mutant copies exhibit marked asymmetry in their expression with the resistant paralogs overexpressed. In the primary resistance-conferring CYP6ER1 variant, this results from an extended region of novel sequence upstream of the gene that provides enhanced expression. Our findings illustrate the versatility of gene duplication in providing opportunities for functional and regulatory innovation during the evolution of an adaptive trait. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  1. Differential expression of jasmonate biosynthesis genes in cacao genotypes contrasting for resistance against Moniliophthora perniciosa. (United States)

    Litholdo, Celso G; Leal, Gildemberg A; Albuquerque, Paulo S B; Figueira, Antonio


    The resistance mechanism of cacao against M. perniciosa is likely to be mediated by JA/ET-signaling pathways due to the preferential TcAOS and TcSAM induction in a resistant genotype. The basidiomycete Moniliophthora perniciosa causes a serious disease in cacao (Theobroma cacao L.), and the use of resistant varieties is the only sustainable long-term solution. Cacao resistance against M. perniciosa is characterized by pathogen growth inhibition with reduced colonization and an attenuation of disease symptoms, suggesting a regulation by jasmonate (JA)/ethylene (ET) signaling pathways. The hypothesis that genes involved in JA biosynthesis would be active in the interaction of T. cacao and M. perniciosa was tested here. The cacao JA-related genes were evaluated for their relative quantitative expression in susceptible and resistant genotypes upon the exogenous application of ET, methyl-jasmonate (MJ), and salicylic acid (SA), or after M. perniciosa inoculation. MJ treatment triggered changes in the expression of genes involved in JA biosynthesis, indicating that the mechanism of positive regulation by exogenous MJ application occurs in cacao. However, a higher induction of these genes was observed in the susceptible genotype. Further, a contrast in JA-related transcriptional expression was detected between susceptible and resistant plants under M. perniciosa infection, with the induction of the allene oxide synthase gene (TcAOS), which encodes a key enzyme in the JA biosynthesis pathway in the resistant genotype. Altogether, this work provides additional evidences that the JA-dependent signaling pathway is modulating the defense response against M. perniciosa in a cacao-resistant genotype.

  2. PCR detection of oxytetracycline resistance genes otr(A) and otr(B) in tetracycline-resistant streptomycete isolates from diverse habitats

    NARCIS (Netherlands)

    Nikolakopoulou, T; Egan, S; van Overbeek, L; Guillaume, G; Heuer, H; Wellington, EMH; van Elsas, JD; Collard, JM; Smalla, K; Karagouni, A


    A range of European habitats was screened by PCR for detection of the oxytetracycline resistance genes otr(A) and otr(B), found in the oxytetracycline-producing strain Streptomyces rimosus. Primers were developed to detect these otr genes in tetracycline-resistant (Tc-R) streptomycete isolates from

  3. Molecular mapping and candidate gene analysis for resistance to powdery mildew in Cucumis sativus stem. (United States)

    Liu, P N; Miao, H; Lu, H W; Cui, J Y; Tian, G L; Wehner, T C; Gu, X F; Zhang, S P


    Powdery mildew (PM) of cucumber (Cucumis sativus), caused by Podosphaera xanthii, is a major foliar disease worldwide and resistance is one of the main objectives in cucumber breeding programs. The resistance to PM in cucumber stem is important to the resistance for the whole plant. In this study, genetic analysis and gene mapping were implemented with cucumber inbred lines NCG-122 (with resistance to PM in the stem) and NCG-121 (with susceptibility in the stem). Genetic analysis showed that resistance to PM in the stem of NCG-122 was qualitative and controlled by a single-recessive nuclear gene (pm-s). Susceptibility was dominant to resistance. In the initial genetic mapping of the pm-s gene, 10 SSR markers were discovered to be linked to pm-s, which was mapped to chromosome 5 (Chr.5) of cucumber. The pm-s gene's closest flanking markers were SSR20486 and SSR06184/SSR13237 with genetic distances of 0.9 and 1.8 cM, respectively. One hundred and fifty-seven pairs of new SSR primers were exploited by the sequence information in the initial mapping region of pm-s. The analysis on the F 2 mapping population using the new molecular markers showed that 17 SSR markers were confirmed to be linked to the pm-s gene. The two closest flanking markers, pmSSR27and pmSSR17, were 0.1 and 0.7 cM from pm-s, respectively, confirming the location of this gene on Chr.5. The physical length of the genomic region containing pm-s was 135.7 kb harboring 21 predicted genes. Among these genes, the gene Csa5G623470 annotated as encoding Mlo-related protein was defined as the most probable candidate gene for the pm-s. The results of this study will provide a basis for marker-assisted selection, and make the benefit for the cloning of the resistance gene.

  4. Porcine E. coli: virulence-associated genes, resistance genes and adhesion and probiotic activity tested by a new screening method. (United States)

    Schierack, Peter; Rödiger, Stefan; Kuhl, Christoph; Hiemann, Rico; Roggenbuck, Dirk; Li, Ganwu; Weinreich, Jörg; Berger, Enrico; Nolan, Lisa K; Nicholson, Bryon; Römer, Antje; Frömmel, Ulrike; Wieler, Lothar H; Schröder, Christian


    We established an automated screening method to characterize adhesion of Escherichia coli to intestinal porcine epithelial cells (IPEC-J2) and their probiotic activity against infection by enteropathogenic E. coli (EPEC). 104 intestinal E. coli isolates from domestic pigs were tested by PCR for the occurrence of virulence-associated genes, genes coding for resistances to antimicrobial agents and metals, and for phylogenetic origin by PCR. Adhesion rates and probiotic activity were examined for correlation with the presence of these genes. Finally, data were compared with those from 93 E. coli isolates from wild boars. Isolates from domestic pigs carried a broad variety of all tested genes and showed great diversity in gene patterns. Adhesions varied with a maximum of 18.3 or 24.2 mean bacteria adherence per epithelial cell after 2 or 6 hours respectively. Most isolates from domestic pigs and wild boars showed low adherence, with no correlation between adhesion/probiotic activity and E. coli genes or gene clusters. The gene sfa/foc, encoding for a subunit of F1C fimbriae did show a positive correlative association with adherence and probiotic activity; however E. coli isolates from wild boars with the sfa/foc gene showed less adhesion and probiotic activity than E. coli with the sfa/foc gene isolated from domestic pigs after 6 hour incubation. In conclusion, screening porcine E. coli for virulence associated genes genes, adhesion to intestinal epithelial cells, and probiotic activity revealed a single important adhesion factor, several probiotic candidates, and showed important differences between E. coli of domestic pigs and wild boars.

  5. Porcine E. coli: virulence-associated genes, resistance genes and adhesion and probiotic activity tested by a new screening method.

    Directory of Open Access Journals (Sweden)

    Peter Schierack

    Full Text Available We established an automated screening method to characterize adhesion of Escherichia coli to intestinal porcine epithelial cells (IPEC-J2 and their probiotic activity against infection by enteropathogenic E. coli (EPEC. 104 intestinal E. coli isolates from domestic pigs were tested by PCR for the occurrence of virulence-associated genes, genes coding for resistances to antimicrobial agents and metals, and for phylogenetic origin by PCR. Adhesion rates and probiotic activity were examined for correlation with the presence of these genes. Finally, data were compared with those from 93 E. coli isolates from wild boars. Isolates from domestic pigs carried a broad variety of all tested genes and showed great diversity in gene patterns. Adhesions varied with a maximum of 18.3 or 24.2 mean bacteria adherence per epithelial cell after 2 or 6 hours respectively. Most isolates from domestic pigs and wild boars showed low adherence, with no correlation between adhesion/probiotic activity and E. coli genes or gene clusters. The gene sfa/foc, encoding for a subunit of F1C fimbriae did show a positive correlative association with adherence and probiotic activity; however E. coli isolates from wild boars with the sfa/foc gene showed less adhesion and probiotic activity than E. coli with the sfa/foc gene isolated from domestic pigs after 6 hour incubation. In conclusion, screening porcine E. coli for virulence associated genes genes, adhesion to intestinal epithelial cells, and probiotic activity revealed a single important adhesion factor, several probiotic candidates, and showed important differences between E. coli of domestic pigs and wild boars.

  6. Prevalence, antibiotic-resistance properties and enterotoxin gene ...

    African Journals Online (AJOL)

    Methods: Three-hundred milk-based infant foods were collected and immediately transferred to the laboratory. ... and entFM (55.5 %) were the most commonly detected enterotoxigenic genes. Bacteria showed the ... conditions like pasteurization and sterilization. [2,3]. ... spaghetti, noodle, milk powder and infant formula.

  7. Stem rust seedling resistance genes in Ethiopian wheat cultivars ...

    African Journals Online (AJOL)

    Thirty durum wheat (19 commercial cultivars and 11 breeding lines) and 30 bread wheat (20 commercial cultivars and 10 breeding lines) were tested for gene postulation. Stem rust infection types produced on wheat cultivars and breeding lines by ten Pgt races was compared with infection types produced on 40 near ...

  8. Genetic anaylsis of a disease resistance gene from loblolly pine (United States)

    Yinghua Huang; Nili Jin; Alex Diner; Chuck Tauer; Yan Zhang; John Damicone


    Rapid advances in molecular genetics provide great opportunities for studies of host defense mechanisms. Examination of plant responses to disease at the cellular and molecular level permits both discovery of changes in gene expression in the tissues attacked by pathogens, and identification of genetic components involved in the interaction between host and pathogens....

  9. Overexpression of a New Chitinase Gene EuCHIT2 Enhances Resistance to Erysiphe cichoracearum DC. in Tobacco Plants

    Directory of Open Access Journals (Sweden)

    Xuan Dong


    Full Text Available In this study, we cloned a new chitinase gene, EuCHIT2, from Eucommia ulmoides Oliver (E. ulmoides using rapid amplification of cDNA ends (RACE technology and constructed an overexpression vector, pSH-35S-EuCHIT2, to introduce it into tobacco (Nicotiana tabacum cv. Xanthi. Resistance to Erysiphe cichoracearum de Candolle (E.cichoracearum DC and molecular mechanisms in the transgenic tobacco were determined by drop inoculation, spore counting, determination of physicochemical indicators, and analysis of gene expression. The chitinase activity and resistance to E. cichoracearum DC were significantly higher in the transgenic tobacco than in wild-type tobacco (p < 0.05. The activities of peroxidase (POD and catalase (CAT, after inoculation with E. cichoracearum DC, were higher in the transgenic tobacco than in the wild-type. Conversely, the malondialdehyde (MDA content was significantly lower in the transgenic tobacco than the wild-type before and after inoculation. In addition, our study also indicated that the resistance to E. cichoracearum DC might involve the salicylic acid (SA and jasmonic acid (JA pathways, because the expression levels of pathogenesis-related gene 1 (PR-1a and coronatine-insensitive 1 (COI1 were significantly increased and decreased, respectively, after inoculation with E. cichoracearum DC. The present study supports the notion that PR-1a and POD participate in resistance to E. cichoracearum DC in the transgenic tobacco plants.

  10. Effect of biochar amendment on the control of soil sulfonamides, antibiotic-resistant bacteria, and gene enrichment in lettuce tissues. (United States)

    Ye, Mao; Sun, Mingming; Feng, Yanfang; Wan, Jinzhong; Xie, Shanni; Tian, Da; Zhao, Yu; Wu, Jun; Hu, Feng; Li, Huixin; Jiang, Xin


    Considering the potential threat of vegetables growing in antibiotic-polluted soil with high abundance of antibiotic-resistant genes (ARGs) against human health through the food chain, it is thus urgent to develop novel control technology to ensure vegetable safety. In the present work, pot experiments were conducted in lettuce cultivation to assess the impedance effect of biochar amendment on soil sulfonamides (SAs), antibiotic-resistant bacteria (ARB), and ARG enrichment in lettuce tissues. After 100 days of cultivation, lettuce cultivation with biochar amendment exhibited the greatest soil SA dissipation as well as the significant improvement of lettuce growth indices, with residual soil SAs mainly existing as the tightly bound fraction. Moreover, the SA contents in roots and new/old leaves were reduced by one to two orders of magnitude compared to those without biochar amendment. In addition, isolate counts for SA-resistant bacterial endophytes in old leaves and sul gene abundances in roots and old leaves also decreased significantly after biochar application. However, neither SA resistant bacteria nor sul genes were detected in new leaves. It was the first study to demonstrate that biochar amendment can be a practical strategy to protect lettuce safety growing in SA-polluted soil with rich ARB and ARGs. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. Molecular typing, antibiotic resistance, virulence gene and biofilm formation of different Salmonella enterica serotypes. (United States)

    Turki, Yousra; Mehr, Ines; Ouzari, Hadda; Khessairi, Amel; Hassen, Abdennaceur


    Salmonella enterica isolates representing commonly isolated serotypes in Tunisia were analyzed using genotyping and phenotyping methods. ERIC and ITS-PCR applied to 48 Salmonella spp. isolates revealed the presence of 12 and 10 different profiles, respectively. The distribution of profiles among serotypes demonstrated the presence of strains showing an identical fingerprinting pattern. All Salmonella strains used in this study were positive for the sdiA gene. Three Salmonella isolates belonging to serotypes Anatum, Enteritidis and Amsterdam were negative for the invA gene. The spvC gene was detected in thirteen isolates belonging to serotypes Anatum, Typhimurium, Enteritidis, Gallinarum and Montevideo. Antibiotic resistance was frequent among the recovered Salmonella isolates belonging to serotypes Anatum, Typhimurium, Enteritidis, Zanzibar and Derby. The majority of these isolates exhibited resistance to at least two antibiotic families. Four multidrug-resistant isolates were recovered from food animals and poultry products. These isolates exhibited not only resistance to tetracycline, sulphonamides, and ampicillin, but also have shown resistance to fluoroquinolones. Common resistance to nalidixic acid, ciprofloxacin and ofloxacin in two S. Anatum and S. Zanzibar strains isolated from raw meat and poultry was also obtained. Furthermore, wastewater and human isolates exhibited frequent resistance to nalidixic acid and tetracycline. Of all isolates, 33.5% were able to form biofilm.

  12. Analysis of acetohydroxyacid synthase1 gene in chickpea conferring resistance to imazamox herbicide. (United States)

    Jain, Parul; Tar'an, Bunyamin


    Chickpea (Cicer arietinum L.) production in the Canadian prairies is challenging due to a lack of effective weed management mainly because of poor competition ability of the crop and limited registered herbicide options. Chickpea genotype with resistance to imidazolinone (IMI) herbicides has been identified. A point mutation in the acetohydroxyacid synthase1 (AHAS1) gene at C581 to T581, resulting in an amino acid substitution from Ala194 to Val194 (position 205, standardized to arabidopsis), confers the resistance to imazamox in chickpea. However, the molecular mechanism leading to the resistance is not fully understood. In many plant species, contrasting transcription levels of AHAS gene has been implicated in the resistant and susceptible genotypes in response to IMI. The objectives of this research were to compare the AHAS gene expression and AHAS enzyme activity in resistant and susceptible chickpea cultivars in response to imazamox herbicide treatment. Results from RT-qPCR indicated that there is no significant change in the transcript levels of AHAS1 between the susceptible and the resistant genotypes in response to imazamox treatment. Protein hydrophobic cluster analysis, protein-ligand docking analysis, and AHAS enzyme activity assay all indicated that the resistance to imazamox in chickpea is due to the alteration of interaction of the AHAS1 enzyme with the imazamox herbicide.

  13. Role of G-protein-coupled receptor-related genes in insecticide resistance of the mosquito, Culex quinquefasciatus. (United States)

    Li, Ting; Liu, Lena; Zhang, Lee; Liu, Nannan


    G-protein-coupled receptors regulate signal transduction pathways and play diverse and pivotal roles in the physiology of insects, however, the precise function of GPCRs in insecticide resistance remains unclear. Using quantitative RT-PCR and functional genomic methods, we, for the first time, explored the function of GPCRs and GPCR-related genes in insecticide resistance of mosquitoes, Culex quinquefasciatus. A comparison of the expression of 115 GPCR-related genes at a whole genome level between resistant and susceptible Culex mosquitoes identified one and three GPCR-related genes that were up-regulated in highly resistant Culex mosquito strains, HAmCq(G8) and MAmCq(G6), respectively. To characterize the function of these up-regulated GPCR-related genes in resistance, the up-regulated GPCR-related genes were knockdown in HAmCq(G8) and MAmCq(G6) using RNAi technique. Knockdown of these four GPCR-related genes not only decreased resistance of the mosquitoes to permethrin but also repressed the expression of four insecticide resistance-related P450 genes, suggesting the role of GPCR-related genes in resistance is involved in the regulation of resistance P450 gene expression. This results help in understanding of molecular regulation of resistance development in Cx. quinquefasciatus.

  14. Evaluation of Antimicrobial Resistance and Virulence Genes in Uropathogenic Escherichia coli in Pediatric and Adult Patients
