WorldWideScience

Sample records for resistance genes including

  1. Antimicrobial susceptibility and antibiotic resistance gene transfer analysis of foodborne, clinical, and environmental Listeria spp. isolates including Listeria monocytogenes.

    Science.gov (United States)

    Bertsch, David; Muelli, Mirjam; Weller, Monika; Uruty, Anaïs; Lacroix, Christophe; Meile, Leo

    2014-02-01

    The aims of this study were to assess antibiotic resistance pheno- and genotypes in foodborne, clinical, and environmental Listeria isolates, as well as to elucidate the horizontal gene transfer potential of detected resistance genes. A small fraction of in total 524 Listeria spp. isolates (3.1%) displayed acquired antibiotic resistance mainly to tetracycline (n = 11), but also to clindamycin (n = 4) and trimethoprim (n = 3), which was genotypically confirmed. In two cases, a tetracycline resistance phenotype was observed together with a trimethoprim resistance phenotype, namely in a clinical L. monocytogenes strain and in a foodborne L. innocua isolate. Depending on the applied guidelines, a differing number of isolates (n = 2 or n = 20) showed values for ampicillin that are on the edge between intermediate susceptibility and resistance. Transferability of the antibiotic resistance genes from the Listeria donors, elucidated in vitro by filter matings, was demonstrated for genes located on transposons of the Tn916 family and for an unknown clindamycin resistance determinant. Transfer rates of up to 10(-5) transconjugants per donor were obtained with a L. monocytogenes recipient and up to 10(-7) with an Enterococcus faecalis recipient, respectively. Although the prevalence of acquired antibiotic resistance in Listeria isolates from this study was rather low, the transferability of these resistances enables further spread in the future. This endorses the importance of surveillance of L. monocytogenes and other Listeria spp. in terms of antibiotic susceptibility. © 2014 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

  2. Multidrug resistance genes, including bla(KPC) and bla(CTX)-M-2, among Klebsiella pneumoniae isolated in Recife, Brazil.

    Science.gov (United States)

    Cabral, Adriane Borges; Melo, Rita de Cássia de Andrade; Maciel, Maria Amélia Vieira; Lopes, Ana Catarina Souza

    2012-10-01

    The prevalence of cephalosporins and carbapenem-resistant Klebsiella pneumoniae strains is rising in Brazil, with potential serious consequences in terms of patients' outcomes and general care. This study characterized 24 clinical isolates of K. pneumoniae from two hospitals in Recife, Brazil, through the antimicrobial susceptibility profile, analyses of β-lactamase genes (bla(TEM), bla(SHV),bla(CTX-M), bla(KPC), bla(VIM), bla(IMP), and bla(SPM), plasmidial profile and ERIC-PCR (Enterobacterial repetitive intergenic consensus-polymerase chain reaction). ERIC-PCR and plasmidial analysis grouped the isolates in 17 and 19 patterns, respectively. Six isolates from one hospital presented the same pattern by ERIC-PCR, indicating clonal dissemination. All isolates presented bla(SHV), 62.5% presented bla(CTX)-M-2, 29% bla(TEM), and 41.7% bla(KPC). Metallo-β-lactamase genes bla(VIM), bla(IMP), and bla(SPM) not detected. Eleven isolates were identified carrying at least 3 β-lactamase studied genes, and 2 isolates carried bla(SHV), bla(TEM), bla (CTX-M-2) and bla(KPC) simultaneously. The accumulation of resistance genes in some strains, observed in this study, imposes limitations in the therapeutic options available for the treatment of infections caused by K. pneumoniae in Recife, Brazil. These results should alert the Brazilian medical authorities to establish rigorous methods for more efficiently control the dissemination of antimicrobial resistance genes in the hospital environment.

  3. Seawater is a reservoir of multi-resistant Escherichia coli, including strains hosting plasmid-mediated quinolones resistance and extended-spectrum beta-lactamases genes

    Directory of Open Access Journals (Sweden)

    Marta S. Alves

    2014-08-01

    Full Text Available The aim of this study was to examine antibiotic resistance (AR dissemination in coastal water, considering the contribution of different sources of faecal contamination. Samples were collected in Berlenga, an uninhabited island classified as Natural Reserve and visited by tourists for aquatic recreational activities. To achieve our aim, AR in Escherichia coli isolates from coastal water was compared to AR in isolates from two sources of faecal contamination: human-derived sewage and seagull faeces. Isolation of E. coli was done on Chromocult agar. Based on genetic typing 414 strains were established. Distribution of E. coli phylogenetic groups was similar among isolates of all sources. Resistances to streptomycin, tetracycline, cephalothin and amoxicillin were the most frequent. Higher rates of AR were found among seawater and faeces isolates, except for last-line antibiotics used in human medicine. Multi-resistance rates in isolates from sewage and seagull faeces (29% and 32% were lower than in isolates from seawater (39%. Seawater AR profiles were similar to those from seagull faeces and differed significantly from sewage AR profiles. Nucleotide sequences matching resistance genes blaTEM, sul1, sul2, tet(A and tet(B, were present in isolates of all sources. Genes conferring resistance to 3rd generation cephalosporins were detected in seawater (blaCTX-M-1 and blaSHV-12 and seagull faeces (blaCMY-2. Plasmid-mediated determinants of resistance to quinolones were found: qnrS1 in all sources and qnrB19 in seawater and seagull faeces. Our results show that seawater is a relevant reservoir of AR and that seagulls are an efficient vehicle to spread human-associated bacteria and resistance genes. The E. coli resistome recaptured from Berlenga coastal water was mainly modulated by seagulls-derived faecal pollution. The repertoire of resistance genes covers antibiotics critically important for humans, a potential risk for human health.

  4. A 1,681-locus consensus genetic map of cultivated cucumber including 67 NB-LRR resistance gene homolog and ten gene loci.

    Science.gov (United States)

    Yang, Luming; Li, Dawei; Li, Yuhong; Gu, Xingfang; Huang, Sanwen; Garcia-Mas, Jordi; Weng, Yiqun

    2013-03-25

    Cucumber is an important vegetable crop that is susceptible to many pathogens, but no disease resistance (R) genes have been cloned. The availability of whole genome sequences provides an excellent opportunity for systematic identification and characterization of the nucleotide binding and leucine-rich repeat (NB-LRR) type R gene homolog (RGH) sequences in the genome. Cucumber has a very narrow genetic base making it difficult to construct high-density genetic maps. Development of a consensus map by synthesizing information from multiple segregating populations is a method of choice to increase marker density. As such, the objectives of the present study were to identify and characterize NB-LRR type RGHs, and to develop a high-density, integrated cucumber genetic-physical map anchored with RGH loci. From the Gy14 draft genome, 70 NB-containing RGHs were identified and characterized. Most RGHs were in clusters with uneven distribution across seven chromosomes. In silico analysis indicated that all 70 RGHs had EST support for gene expression. Phylogenetic analysis classified 58 RGHs into two clades: CNL and TNL. Comparative analysis revealed high-degree sequence homology and synteny in chromosomal locations of these RGH members between the cucumber and melon genomes. Fifty-four molecular markers were developed to delimit 67 of the 70 RGHs, which were integrated into a genetic map through linkage analysis. A 1,681-locus cucumber consensus map including 10 gene loci and spanning 730.0 cM in seven linkage groups was developed by integrating three component maps with a bin-mapping strategy. Physically, 308 scaffolds with 193.2 Mbp total DNA sequences were anchored onto this consensus map that covered 52.6% of the 367 Mbp cucumber genome. Cucumber contains relatively few NB-LRR RGHs that are clustered and unevenly distributed in the genome. All RGHs seem to be transcribed and shared significant sequence homology and synteny with the melon genome suggesting conservation of

  5. Genotypic and Antimicrobial Susceptibility of Carbapenem-Resistant Acinetobacter baumannii: Analysis of ISAba Elements and blaOXA-23-like Genes Including A New Variant

    Directory of Open Access Journals (Sweden)

    Abbas eBahador

    2015-11-01

    Full Text Available Carbapenem-resistant Acinetobacter baumannii (CR-AB causes serious nosocomial infections, especially in ICU wards of hospitals, worldwide. Expression of blaOXA genes is the chief mechanism of conferring carbapenem resistance among CR-AB. Although some blaOXA genes have been studied among CR-AB isolates from Iran, their blaOXA-23-like genes have not been investigated. We used a multiplex-PCR to detect Ambler class A, B, and D carbapenemases of 85 isolates, and determined that 34 harbored blaOXA-23-like genes. Amplified fragment length polymorphism (AFLP genotyping, followed by DNA sequencing of blaOXA-23-like amplicons of CR-AB from each AFLP group was used to characterize their blaOXA-23-like genes. We also assessed the antimicrobial susceptibility pattern of CR-AB isolates, and tested whether they harbored insertion sequences ISAba1 and ISAba4. Sequence comparison with reference strain A. baumannii (NCTC12156 revealed five types of mutations in blaOXA-23-like genes; including one novel variant and four mutants that were already reported from China and the USA. All of the blaOXA-23-like genes mutations were associated with increased minimum inhibitory concentrations (MICs against imipenem. ISAba1 and ISAba4 sequences were detected upstream of blaOXA-23 genes in 19% and 7% of isolates, respectively. The isolation of CR-AB with new blaOXA-23 mutations including some that have been reported from the USA and China highlights CR-AB pervasive distribution, which underscores the importance of concerted national and global efforts to control the spread of CR-AB isolates worldwide.

  6. Travelers Can Import Colistin-Resistant Enterobacteriaceae, Including Those Possessing the Plasmid-Mediated mcr-1 Gene.

    Science.gov (United States)

    Bernasconi, Odette J; Kuenzli, Esther; Pires, João; Tinguely, Regula; Carattoli, Alessandra; Hatz, Christoph; Perreten, Vincent; Endimiani, Andrea

    2016-08-01

    Stool samples from 38 travelers returning from India were screened for extended-spectrum cephalosporin- and carbapenem-resistant Enterobacteriaceae implementing standard selective plates. Twenty-six (76.3%) people were colonized with CTX-M or DHA producers, but none of the strains was colistin resistant and/or mcr-1 positive. Nevertheless, using overnight enrichment and CHROMagar Orientation plates supplemented with colistin, four people (10.5%) were found to be colonized with colistin-resistant Escherichia coli One cephalosporin-susceptible sequence type 10 (ST10) strain carried a 4,211-bp ISApl1-mcr-1-ISApl1 element in an IncHI2 plasmid backbone. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  7. Antibiotic Resistance Pattern and Evaluation of Metallo-Beta Lactamase Genes Including bla- IMP and bla- VIM Types in Pseudomonas aeruginosa Isolated from Patients in Tehran Hospitals.

    Science.gov (United States)

    Aghamiri, Samira; Amirmozafari, Nour; Fallah Mehrabadi, Jalil; Fouladtan, Babak; Samadi Kafil, Hossein

    2014-01-01

    Beta-lactamase producing strains of Pseudomonas aeruginosa are important etiological agents of hospital infections. Carbapenems are among the most effective antibiotics used against Pseudomonas infections, but they can be rendered infective by group B β -lactamase, commonly called metallo-beta lactamase. In this study, the antimicrobial sensitivity patterns of P. aeruginosa strains isolated from 9 different hospitals in Tehran, Iran, as well as the prevalence of MBLs genes (bla- VIM and bla- IMP ) were determined. A total of 212 strains of P. aeruginosa recovered from patients in hospitals in Tehran were confirmed by both biochemical methods and PCR. Their antimicrobial sensitivity patterns were determined by Kirby-Bauer disk diffusion method. Following MIC determination, imipenem resistant strains were selected by DDST method which was followed by PCR tests for determination of MBLs genes: bla- IMP and bla- VIM . The results indicated that, in the DDST phenotypic method, among the 100 imipenem resistant isolates, 75 strains were MBLs positive. The PCR test indicated that 70 strains (33%) carried bla- VIM gene and 20 strains (9%) harbored bla- IMP . The results indicated that the extent of antibiotic resistance among Pseudomonas aeruginosa is on the rise. This may be due to production of MBLs enzymes. Therefore, determination of antibiotic sensitivity patterns and MBLs production by these bacteria, can be important in control of clinical Pseudomonas infection.

  8. Major haplotype divergence including multiple germin-like protein genes, at the wheat Sr2 adult plant stem rust resistance locus

    Czech Academy of Sciences Publication Activity Database

    Mago, R.; Tabe, L.; Vautrin, S.; Šimková, Hana; Kubaláková, Marie; Upadhyaya, N.; Berges, H.; Kong, X.Y.; Breen, J.; Doležel, Jaroslav; Appels, R.; Ellis, J.G.; Spielmeyer, W.

    2014-01-01

    Roč. 14, č. 379 (2014) ISSN 1471-2229 R&D Projects: GA ČR GBP501/12/G090; GA MŠk(CZ) LO1204 Institutional support: RVO:61389030 Keywords : Adult plant resistance (APR) * Map-based cloning * Sr2 Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.813, year: 2014

  9. Exploring Antibiotic Resistance Genes and Metal Resistance Genes in Plasmid Metagenomes from Wastewater Treatment Plants

    Directory of Open Access Journals (Sweden)

    An-Dong eLi

    2015-09-01

    Full Text Available Plasmids operate as independent genetic elements in microorganism communities. Through horizontal gene transfer, they can provide their host microorganisms with important functions such as antibiotic resistance and heavy metal resistance. In this study, six metagenomic libraries were constructed with plasmid DNA extracted from influent, activated sludge and digested sludge of two wastewater treatment plants. Compared with the metagenomes of the total DNA extracted from the same sectors of the wastewater treatment plant, the plasmid metagenomes had significantly higher annotation rates, indicating that the functional genes on plasmids are commonly shared by those studied microorganisms. Meanwhile, the plasmid metagenomes also encoded many more genes related to defense mechanisms, including ARGs. Searching against an antibiotic resistance genes (ARGs database and a metal resistance genes (MRGs database revealed a broad-spectrum of antibiotic (323 out of a total 618 subtypes and metal resistance genes (23 out of a total 23 types on these plasmid metagenomes. The influent plasmid metagenomes contained many more resistance genes (both ARGs and MRGs than the activated sludge and the digested sludge metagenomes. Sixteen novel plasmids with a complete circular structure that carried these resistance genes were assembled from the plasmid metagenomes. The results of this study demonstrated that the plasmids in wastewater treatment plants could be important reservoirs for resistance genes, and may play a significant role in the horizontal transfer of these genes.

  10. Resistance Genes in Global Crop Breeding Networks.

    Science.gov (United States)

    Garrett, K A; Andersen, K F; Asche, F; Bowden, R L; Forbes, G A; Kulakow, P A; Zhou, B

    2017-10-01

    Resistance genes are a major tool for managing crop diseases. The networks of crop breeders who exchange resistance genes and deploy them in varieties help to determine the global landscape of resistance and epidemics, an important system for maintaining food security. These networks function as a complex adaptive system, with associated strengths and vulnerabilities, and implications for policies to support resistance gene deployment strategies. Extensions of epidemic network analysis can be used to evaluate the multilayer agricultural networks that support and influence crop breeding networks. Here, we evaluate the general structure of crop breeding networks for cassava, potato, rice, and wheat. All four are clustered due to phytosanitary and intellectual property regulations, and linked through CGIAR hubs. Cassava networks primarily include public breeding groups, whereas others are more mixed. These systems must adapt to global change in climate and land use, the emergence of new diseases, and disruptive breeding technologies. Research priorities to support policy include how best to maintain both diversity and redundancy in the roles played by individual crop breeding groups (public versus private and global versus local), and how best to manage connectivity to optimize resistance gene deployment while avoiding risks to the useful life of resistance genes. [Formula: see text] Copyright © 2017 The Author(s). This is an open access article distributed under the CC BY 4.0 International license .

  11. Bullous Impetigo in Children Infected with Methicillin-Resistant Staphylococcus aureus Alone or in Combination with Methicillin-Susceptible S. aureus: Analysis of Genetic Characteristics, Including Assessment of Exfoliative Toxin Gene Carriage▿

    Science.gov (United States)

    Shi, Da; Higuchi, Wataru; Takano, Tomomi; Saito, Kohei; Ozaki, Kyoko; Takano, Misao; Nitahara, Yoshiyuki; Yamamoto, Tatsuo

    2011-01-01

    Among bullous impetigo isolates, exfoliative toxin (ET) gene carriage was found in 61.5% of methicillin-resistant Staphylococcus aureus (MRSA) isolates versus 90.6% of methicillin-susceptible S. aureus (MSSA) isolates. MRSA-only cases were ETB or ETA positive, while MRSA/MSSA coinfection cases were ET negative for MRSA but ETA positive for MSSA. Collagen adhesin may facilitate some MRSA infections. PMID:21430094

  12. Obesity genes and insulin resistance.

    Science.gov (United States)

    Belkina, Anna C; Denis, Gerald V

    2010-10-01

    The exploding prevalence of insulin resistance and Type 2 diabetes (T2D) linked to obesity has become an alarming public health concern. Worldwide, approximately 171 million people suffer from obesity-induced diabetes and public health authorities expect this situation to deteriorate rapidly. An interesting clinical population of 'metabolically healthy but obese' (MHO) cases is relatively protected from T2D and its associated cardiovascular risk. The molecular basis for this protection is not well understood but is likely to involve reduced inflammatory responses. The inflammatory cells and pathways that respond to overnutrition are the primary subject matter for this review. The chance discovery of a genetic mutation in the Brd2 gene, which is located in the class II major histocompatibility complex and makes mice enormously fat but protects them from diabetes, offers revolutionary new insights into the cellular mechanisms that link obesity to insulin resistance and T2D. These Brd2-hypomorphic mice have reduced inflammation in fat that is normally associated with insulin resistance, and resemble MHO patients, suggesting novel therapeutic pathways for obese patients at risk for T2D. Deeper understanding of the functional links between genes that control inflammatory responses to diet-induced obesity is crucial to the development of therapies for obese, insulin-resistant patients.

  13. Antibiotic Resistance Patterns and a Survey of Metallo-β-Lactamase Genes Including bla-IMP and bla-VIM Types in Acinetobacter baumannii Isolated from Hospital Patients in Tehran.

    Science.gov (United States)

    Aghamiri, Samira; Amirmozafari, Nour; Fallah Mehrabadi, Jalil; Fouladtan, Babak; Hanafi Abdar, Mojtaba

    2016-01-01

    Metallo-β-lactamases (MBLs) producing strains of Acinetobacter baumannii are serious etiological agents of hospital infections worldwide. Among the β- lactams, carbapenems are the most effective antibiotics used against A. baumannii. However, resistance to these drugs among clinical strains of A. baumannii has been increasing in recent years. In this study, the antimicrobial sensitivity patterns of A. baumannii strains isolated from eleven different hospitals in Tehran, Iran, and the prevalence of MBL genes (bla-VIM and bla-IMP) were determined. During a period of 5 months, 176 isolates of A. baumannii were collected from different clinical specimens from hospitalized patients in Tehran. All isolates were confirmed by biochemical methods. The isolates were tested for antibiotic sensitivity by the Kirby-Bauer disk diffusion method. Following minimum inhibitory concentration determination, imipenem-resistant isolates were further tested for MBL production by the double disk synergy test (DDST) method. PCR assays were performed for the detection of the MBL genes bla-IMP and bla-VIM. The DDST phenotypic method indicated that among the 169 imipenem-resistant isolates, 165 strains were MBL positive. The PCR assays revealed that 63 of the overall isolates (36%) carried the bla-VIM gene and 70 strains (40%) harbored bla-IMP. It is obvious that nosocomial infections associated with multidrug-resistant Acinetobacter spp. are on the rise. Therefore, the determination of antibiotic sensitivity patterns and screening for MBL production among A. baumannii isolates is important for controlling clinical Acinetobacter infections. © 2016 S. Karger AG, Basel.

  14. Complex Interactions between Fungal Avirulence Genes and Their Corresponding Plant Resistance Genes and Consequences for Disease Resistance Management

    Directory of Open Access Journals (Sweden)

    Yohann Petit-Houdenot

    2017-06-01

    Full Text Available During infection, pathogens secrete an arsenal of molecules, collectively called effectors, key elements of pathogenesis which modulate innate immunity of the plant and facilitate infection. Some of these effectors can be recognized directly or indirectly by resistance (R proteins from the plant and are then called avirulence (AVR proteins. This recognition usually triggers defense responses including the hypersensitive response and results in resistance of the plant. R—AVR gene interactions are frequently exploited in the field to control diseases. Recently, the availability of fungal genomes has accelerated the identification of AVR genes in plant pathogenic fungi, including in fungi infecting agronomically important crops. While single AVR genes recognized by their corresponding R gene were identified, more and more complex interactions between AVR and R genes are reported (e.g., AVR genes recognized by several R genes, R genes recognizing several AVR genes in distinct organisms, one AVR gene suppressing recognition of another AVR gene by its corresponding R gene, two cooperating R genes both necessary to recognize an AVR gene. These complex interactions were particularly reported in pathosystems showing a long co-evolution with their host plant but could also result from the way agronomic crops were obtained and improved (e.g., through interspecific hybridization or introgression of resistance genes from wild related species into cultivated crops. In this review, we describe some complex R—AVR interactions between plants and fungi that were recently reported and discuss their implications for AVR gene evolution and R gene management.

  15. New resistance genes in the Zea mays: exserohilum turcicum pathosystem

    Directory of Open Access Journals (Sweden)

    Juliana Bernardi Ogliari

    2005-09-01

    Full Text Available The use of monogenic race-specific resistance is widespread for the control of maize (Zea mays L. helminthosporiosis caused by Exserohilum turcicum. Inoculation of 18 Brazilian isolates of E. turcicum onto elite maize lines containing previously identified resistance genes and onto differential near-isogenic lines allowed the identification of new qualitative resistance genes. The inoculation of one selected isolate on differential near-isogenic lines, F1 generations and a BC1F1 population from the referred elite lines enabled the characterization of the resistance spectrum of three new genes, one dominant (HtP, one recessive (rt and a third with non-identified genetic action. Three physiological races of the pathogen were also identified including two with new virulence factors capable of overcoming the resistance of one of the resistance genes identified here (rt.

  16. Effect of swine manure application timing on the persistence and transport of antibiotic-resistant Enterococcus and resistance genes

    Science.gov (United States)

    Swine manure applied to agricultural fields may lead to the transport of antibiotic resistant bacteria and antibiotic resistance genes to freshwater systems. Enterococci were studied because they are fecal indicator bacteria associated with manure. Resistance genes include genes from live cells, dea...

  17. Barley Stem Rust Resistance Genes: Structure and Function

    Directory of Open Access Journals (Sweden)

    Andris Kleinhofs

    2009-07-01

    Full Text Available Rusts are biotrophic pathogens that attack many plant species but are particularly destructive on cereal crops. The stem rusts (caused by have historically caused severe crop losses and continue to threaten production today. Barley ( L. breeders have controlled major stem rust epidemics since the 1940s with a single durable resistance gene . As new epidemics have threatened, additional resistance genes were identified to counter new rust races, such as the complex locus against races QCCJ and TTKSK. To understand how these genes work, we initiated research to clone and characterize them. The gene encodes a unique protein kinase with dual kinase domains, an active kinase, and a pseudokinase. Function of both domains is essential to confer resistance. The and genes are closely linked and function coordinately to confer resistance to several wheat ( L. stem rust races, including the race TTKSK (also called Ug99 that threatens the world's barley and wheat crops. The gene encodes typical resistance gene domains NBS, LRR, and protein kinase but is unique in that all three domains reside in a single gene, a previously unknown structure among plant disease resistance genes. The gene encodes an actin depolymerizing factor that functions in cytoskeleton rearrangement.

  18. Candidate genes for performance in horses, including monocarboxylate transporters

    Directory of Open Access Journals (Sweden)

    Inaê Cristina Regatieri

    Full Text Available ABSTRACT: Some horse breeds are highly selected for athletic activities. The athletic potential of each animal can be measured by its performance in sports. High athletic performance depends on the animal capacity to produce energy through aerobic and anaerobic metabolic pathways, among other factors. Transmembrane proteins called monocarboxylate transporters, mainly the isoform 1 (MCT1 and its ancillary protein CD147, can help the organism to adapt to physiological stress caused by physical exercise, transporting lactate and H+ ions. Horse breeds are selected for different purposes so we might expect differences in the amount of those proteins and in the genotypic frequencies for genes that play a significant role in the performance of the animals. The study of MCT1 and CD147 gene polymorphisms, which can affect the formation of the proteins and transport of lactate and H+, can provide enough information to be used for selection of athletic horses increasingly resistant to intense exercise. Two other candidate genes, the PDK4 and DMRT3, have been associated with athletic potential and indicated as possible markers for performance in horses. The oxidation of fatty acids is highly effective in generating ATP and is controlled by the expression of PDK4 (pyruvate dehydrogenase kinase, isozyme 4 in skeletal muscle during and after exercise. The doublesex and mab-3 related transcription factor 3 (DMRT3 gene encodes an important transcription factor in the setting of spinal cord circuits controlling movement in vertebrates and may be associated with gait performance in horses. This review describes how the monocarboxylate transporters work during physical exercise in athletic horses and the influence of polymorphisms in candidate genes for athletic performance in horses.

  19. Plasmids carrying antimicrobial resistance genes in Enterobacteriaceae

    NARCIS (Netherlands)

    Rozwandowicz, M.; Brouwer, M.S.M.; Fischer, J.; Wagenaar, J.A.; Gonzalez-Zorn, B.; Guerra, B.; Mevius, D.J.; Hordijk, J.

    2018-01-01

    Bacterial antimicrobial resistance (AMR) is constantly evolving and horizontal gene transfer through plasmids plays a major role. The identification of plasmid characteristics and their association with different bacterial hosts provides crucial knowledge that is essential to understand the

  20. Identification of acquired antimicrobial resistance genes

    DEFF Research Database (Denmark)

    Zankari, Ea; Hasman, Henrik; Cosentino, Salvatore

    2012-01-01

    ObjectivesIdentification of antimicrobial resistance genes is important for understanding the underlying mechanisms and the epidemiology of antimicrobial resistance. As the costs of whole-genome sequencing (WGS) continue to decline, it becomes increasingly available in routine diagnostic laborato......ObjectivesIdentification of antimicrobial resistance genes is important for understanding the underlying mechanisms and the epidemiology of antimicrobial resistance. As the costs of whole-genome sequencing (WGS) continue to decline, it becomes increasingly available in routine diagnostic...... laboratories and is anticipated to substitute traditional methods for resistance gene identification. Thus, the current challenge is to extract the relevant information from the large amount of generated data.MethodsWe developed a web-based method, ResFinder that uses BLAST for identification of acquired...... antimicrobial resistance genes in whole-genome data. As input, the method can use both pre-assembled, complete or partial genomes, and short sequence reads from four different sequencing platforms. The method was evaluated on 1862 GenBank files containing 1411 different resistance genes, as well as on 23 de...

  1. Distribution of Florfenicol Resistance Genes fexA and cfr among Chloramphenicol-Resistant Staphylococcus Isolates

    Science.gov (United States)

    Kehrenberg, Corinna; Schwarz, Stefan

    2006-01-01

    A total of 302 chloramphenicol-resistant Staphylococcus isolates were screened for the presence of the florfenicol/chloramphenicol resistance genes fexA and cfr and their localization on mobile genetic elements. Of the 114 isolates from humans, only a single Staphylococcus aureus isolate showed an elevated MIC to florfenicol, but did not carry either of the known resistance genes, cfr or fexA. In contrast, 11 of the 188 staphylococci from animal sources were considered florfenicol resistant and carried either cfr (one isolate), fexA (five isolates), or both resistance genes (five isolates). In nine cases we confirmed that these genes were carried on a plasmid. Five different types of plasmids could be differentiated on the basis of their sizes, restriction patterns, and resistance genes. The gene fexA, which has previously been shown to be part of the nonconjugative transposon Tn558, was identified in 10 of the 11 resistant isolates from animals. PCR assays were developed to detect different parts of this transposon as well as their physical linkage. Complete copies of Tn558 were found in five different isolates and shown by inverse PCR to be functionally active. Truncated copies of Tn558, in which the tnpA-tnpB area was in part deleted by the integration of a 4,674-bp segment including the gene cfr and a novel 2,446-bp IS21-like insertion sequence, were seen in a plasmid present in three staphylococcal isolates. PMID:16569824

  2. Environmental cycle of antibiotic resistance encoded genes: A systematic review

    Directory of Open Access Journals (Sweden)

    R. ghanbari

    2017-12-01

    Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.

  3. Resistive mode in rotating plasma columns including the hall current

    International Nuclear Information System (INIS)

    Galvao, R.M.O.

    1983-01-01

    A new resistive mode is shown to exist in rotating plasma columns. The mode is localized in the neighbourhood of the radius where the angular velocity of the bulk plasma is equal to minus half the local angular velocity of the ions. This singular point is caused by the Hall term in the generalized Ohm law. The growth rate of the mode scales with eta sup(1/2), where eta is the plasma resistivity. (Author) [pt

  4. Multiple antibiotic resistance genes distribution in ten large-scale membrane bioreactors for municipal wastewater treatment.

    Science.gov (United States)

    Sun, Yanmei; Shen, Yue-Xiao; Liang, Peng; Zhou, Jizhong; Yang, Yunfeng; Huang, Xia

    2016-12-01

    Wastewater treatment plants are thought to be potential reservoirs of antibiotic resistance genes. In this study, GeoChip was used for analyzing multiple antibiotic resistance genes, including four multidrug efflux system gene groups and three β-lactamase genes in ten large-scale membrane bioreactors (MBRs) for municipal wastewater treatment. Results revealed that the diversity of antibiotic genes varied a lot among MBRs, but about 40% common antibiotic resistance genes were existent. The average signal intensity of each antibiotic resistance group was similar among MBRs, nevertheless the total abundance of each group varied remarkably and the dominant resistance gene groups were different in individual MBR. The antibiotic resistance genes majorly derived from Proteobacteria and Actinobacteria. Further study indicated that TN, TP and COD of influent, temperature and conductivity of mixed liquor were significant (Pantibiotic resistance genes distribution in MBRs. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. Expression Study of Banana Pathogenic Resistance Genes

    Directory of Open Access Journals (Sweden)

    Fenny M. Dwivany

    2016-10-01

    Full Text Available Banana is one of the world's most important trade commodities. However, infection of banana pathogenic fungi (Fusarium oxysporum race 4 is one of the major causes of decreasing production in Indonesia. Genetic engineering has become an alternative way to control this problem by isolating genes that involved in plant defense mechanism against pathogens. Two of the important genes are API5 and ChiI1, each gene encodes apoptosis inhibitory protein and chitinase enzymes. The purpose of this study was to study the expression of API5 and ChiI1 genes as candidate pathogenic resistance genes. The amplified fragments were then cloned, sequenced, and confirmed with in silico studies. Based on sequence analysis, it is showed that partial API5 gene has putative transactivation domain and ChiI1 has 9 chitinase family GH19 protein motifs. Data obtained from this study will contribute in banana genetic improvement.

  6. Mapping of stripe rust resistance gene in an Aegilops caudata ...

    Indian Academy of Sciences (India)

    ... rust resistance depicted a single major gene conditioning adult plant resistance (APR) with stripe rust reaction varying from TR-20MS in resistant RILs signifying the presence of some minor genes as well. Genetic association with leaf rust resistance revealed that two genes are located at a recombination distance of 13%.

  7. Antibiotic-Resistance Genes in Waste Water.

    Science.gov (United States)

    Karkman, Antti; Do, Thi Thuy; Walsh, Fiona; Virta, Marko P J

    2018-03-01

    Waste water and waste water treatment plants can act as reservoirs and environmental suppliers of antibiotic resistance. They have also been proposed to be hotspots for horizontal gene transfer, enabling the spread of antibiotic resistance genes between different bacterial species. Waste water contains antibiotics, disinfectants, and metals which can form a selection pressure for antibiotic resistance, even in low concentrations. Our knowledge of antibiotic resistance in waste water has increased tremendously in the past few years with advances in the molecular methods available. However, there are still some gaps in our knowledge on the subject, such as how active is horizontal gene transfer in waste water and what is the role of the waste water treatment plant in the environmental resistome? The purpose of this review is to briefly describe some of the main methods for studying antibiotic resistance in waste waters and the latest research and main knowledge gaps on the issue. In addition, some future research directions are proposed. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Dissemination of antibiotic resistance genes from antibiotic producers to pathogens

    DEFF Research Database (Denmark)

    Jiang, Xinglin; Ellabaan, Mostafa M Hashim; Charusanti, Pep

    2017-01-01

    It has been hypothesized that some antibiotic resistance genes (ARGs) found in pathogenic bacteria derive from antibiotic-producing actinobacteria. Here we provide bioinformatic and experimental evidence supporting this hypothesis. We identify genes in proteobacteria, including some pathogens......, that appear to be closely related to actinobacterial ARGs known to confer resistance against clinically important antibiotics. Furthermore, we identify two potential examples of recent horizontal transfer of actinobacterial ARGs to proteobacterial pathogens. Based on this bioinformatic evidence, we propose...... results support the existence of ancient and, possibly, recent transfers of ARGs from antibiotic-producing actinobacteria to proteobacteria, and provide evidence for a defined mechanism....

  9. Antibiotic resistance and resistance genes in Escherichia coli from poultry farms, southwest Nigeria

    DEFF Research Database (Denmark)

    Adelowo, Olawale O.; Fagade, Obasola E.; Agersø, Yvonne

    2014-01-01

    Introduction: This study investigated the mechanisms of resistance in 36 E. coli isolated from waste, litter, soil and water samples collected from poultry farms in Southwestern Nigeria. Methodology: Minimum inhibitory concentration (MIC) distributions of the isolates were determined using...... the methods of the Clinical and Laboratory Standard Institute and resistance genes detected by PCR. Results: A total of 30 isolates (94%) showed resistance to more than one antimicrobial. Percentage resistance was: tetracycline 81%, sulphamethoxazole 67%, streptomycin 56%, trimethoprim 47 %, ciprofloxacin 42......%, ampicillin 36%, spectinomycin 28%, nalidixic acid 25%, chloramphenicol 22%, neomycin 14%, gentamicin 8%, amoxicillin-clavulanate, ceftiofur, cefotaxime, colistin, florfenicol and apramycin 0%. Resistance genes found among the isolates include bla-TEM (85%), sul2 (67%), sul3 (17%), aadA (65%), strA (70%), str...

  10. Gene pyramiding as a Bt resistance management strategy: How ...

    African Journals Online (AJOL)

    Reports on the emergence of insect resistance to Bacillus thuringiensis delta endotoxins have raised doubts on the sustainability of Bt-toxin based pest management technologies. Corporate industry has responded to this challenge with innovations that include gene pyramiding among others. Pyramiding entails stacking ...

  11. Antibiotic resistance and resistance genes in Escherichia coli from poultry farms, southwest Nigeria.

    Science.gov (United States)

    Adelowo, Olawale O; Fagade, Obasola E; Agersø, Yvonne

    2014-09-12

    This study investigated the mechanisms of resistance in 36 E. coli isolated from waste, litter, soil and water samples collected from poultry farms in Southwestern Nigeria. Minimum inhibitory concentration (MIC) distributions of the isolates were determined using the methods of the Clinical and Laboratory Standard Institute and resistance genes detected by PCR. A total of 30 isolates (94%) showed resistance to more than one antimicrobial. Percentage resistance was: tetracycline 81%, sulphamethoxazole 67%, streptomycin 56%, trimethoprim 47 %, ciprofloxacin 42%, ampicillin 36%, spectinomycin 28%, nalidixic acid 25%, chloramphenicol 22%, neomycin 14%, gentamicin 8%, amoxicillin-clavulanate, ceftiofur, cefotaxime, colistin, florfenicol and apramycin 0%. Resistance genes found among the isolates include bla-TEM (85%), sul2 (67%), sul3 (17%), aadA (65%), strA (70%), strB (61%), catA1 (25%), cmlA1 (13%), tetA (21%) and tetB (17%). Class 1 and 2 integrons were found in five (14%) and six (17%) isolates, respectively, while one isolate was positive for both classes of integrons. Seven out of eight isolates with resistance to ciprofloxacin and MIC ≤ 32 mg/L to nalidixic acid contained qnrS genes. Our findings provided additional evidence that the poultry production environment in Nigeria represents an important reservoir of antibiotic resistance genes such as qnrS that may spread from livestock production farms to human populations via manure and water.

  12. IGSA: Individual Gene Sets Analysis, including Enrichment and Clustering.

    Science.gov (United States)

    Wu, Lingxiang; Chen, Xiujie; Zhang, Denan; Zhang, Wubing; Liu, Lei; Ma, Hongzhe; Yang, Jingbo; Xie, Hongbo; Liu, Bo; Jin, Qing

    2016-01-01

    Analysis of gene sets has been widely applied in various high-throughput biological studies. One weakness in the traditional methods is that they neglect the heterogeneity of genes expressions in samples which may lead to the omission of some specific and important gene sets. It is also difficult for them to reflect the severities of disease and provide expression profiles of gene sets for individuals. We developed an application software called IGSA that leverages a powerful analytical capacity in gene sets enrichment and samples clustering. IGSA calculates gene sets expression scores for each sample and takes an accumulating clustering strategy to let the samples gather into the set according to the progress of disease from mild to severe. We focus on gastric, pancreatic and ovarian cancer data sets for the performance of IGSA. We also compared the results of IGSA in KEGG pathways enrichment with David, GSEA, SPIA, ssGSEA and analyzed the results of IGSA clustering and different similarity measurement methods. Notably, IGSA is proved to be more sensitive and specific in finding significant pathways, and can indicate related changes in pathways with the severity of disease. In addition, IGSA provides with significant gene sets profile for each sample.

  13. A stochastic model of gene expression including splicing events

    OpenAIRE

    Penim, Flávia Alexandra Mendes

    2014-01-01

    Tese de mestrado, Bioinformática e Biologia Computacional, Universidade de Lisboa, Faculdade de Ciências, 2014 Proteins carry out the great majority of the catalytic and structural work within an organism. The RNA templates used in their synthesis determines their identity, and this is dictated by which genes are transcribed. Therefore, gene expression is the fundamental determinant of an organism’s nature. The main objective of this thesis was to develop a stochastic computational model a...

  14. Association mapping and gene-gene interaction for stem rust resistance in CIMMYT spring wheat germplasm.

    Science.gov (United States)

    Yu, Long-Xi; Lorenz, Aaron; Rutkoski, Jessica; Singh, Ravi P; Bhavani, Sridhar; Huerta-Espino, Julio; Sorrells, Mark E

    2011-12-01

    The recent emergence of wheat stem rust Ug99 and evolution of new races within the lineage threatens global wheat production because they overcome widely deployed stem rust resistance (Sr) genes that had been effective for many years. To identify loci conferring adult plant resistance to races of Ug99 in wheat, we employed an association mapping approach for 276 current spring wheat breeding lines from the International Maize and Wheat Improvement Center (CIMMYT). Breeding lines were genotyped with Diversity Array Technology (DArT) and microsatellite markers. Phenotypic data was collected on these lines for stem rust race Ug99 resistance at the adult plant stage in the stem rust resistance screening nursery in Njoro, Kenya in seasons 2008, 2009 and 2010. Fifteen marker loci were found to be significantly associated with stem rust resistance. Several markers appeared to be linked to known Sr genes, while other significant markers were located in chromosome regions where no Sr genes have been previously reported. Most of these new loci colocalized with QTLs identified recently in different biparental populations. Using the same data and Q + K covariate matrices, we investigated the interactions among marker loci using linear regression models to calculate P values for pairwise marker interactions. Resistance marker loci including the Sr2 locus on 3BS and the wPt1859 locus on 7DL had significant interaction effects with other loci in the same chromosome arm and with markers on chromosome 6B. Other resistance marker loci had significant pairwise interactions with markers on different chromosomes. Based on these results, we propose that a complex network of gene-gene interactions is, in part, responsible for resistance to Ug99. Further investigation may provide insight for understanding mechanisms that contribute to this resistance gene network.

  15. Fate of antibiotic resistance genes and metal resistance genes during thermophilic aerobic digestion of sewage sludge.

    Science.gov (United States)

    Jang, Hyun Min; Lee, Jangwoo; Kim, Young Beom; Jeon, Jong Hun; Shin, Jingyeong; Park, Mee-Rye; Kim, Young Mo

    2018-02-01

    This study examines the fate of twenty-three representative antibiotic resistance genes (ARGs) encoding tetracyclines, sulfonamides, quinolones, β-lactam antibiotics, macrolides, florfenicol and multidrug resistance during thermophilic aerobic digestion (TAD) of sewage sludge. The bacterial community, class 1 integrons (intI1) and four metal resistance genes (MRGs) were also quantified to determine the key drivers of changes in ARGs during TAD. At the end of digestion, significant decreases in the quantities of ARGs, MRGs and intI1 as well as 16S rRNA genes were observed. Partial redundancy analysis (RDA) showed that shifts in temperature were the key factors affecting a decrease in ARGs. Shifts in temperature led to decreased amounts of ARGs by reducing resistome and bacterial diversity, rather than by lowering horizontal transfer potential via intI1 or co-resistance via MRGs. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Plant resistance genes : their structure, function and evolution

    NARCIS (Netherlands)

    Takken, F.L.W.; Joosten, M.H.A.J.

    2000-01-01

    Plants have developed efficient mechanisms to avoid infection or to mount responses that render them resistant upon attack by a pathogen. One of the best-studied defence mechanisms is based on gene-for-gene resistance through which plants, harbouring specific resistance (R) genes, specifically

  17. Major Gene for Field Stem Rust Resistance Co-Locates with Resistance Gene Sr12 in 'Thatcher' Wheat.

    Directory of Open Access Journals (Sweden)

    Colin W Hiebert

    Full Text Available Stem rust, caused by Puccinia graminis (Pgt, is a damaging disease of wheat that can be controlled by utilizing effective stem rust resistance genes. 'Thatcher' wheat carries complex resistance to stem rust that is enhanced in the presence of the resistance gene Lr34. The purpose of this study was to examine APR in 'Thatcher' and look for genetic interactions with Lr34. A RIL population was tested for stem rust resistance in field nurseries in Canada, USA, and Kenya. BSA was used to find SNP markers associated with reduced stem rust severity. A major QTL was identified on chromosome 3BL near the centromere in all environments. Seedling testing showed that Sr12 mapped to the same region as the QTL for APR. The SNP markers were physically mapped and the region carrying the resistance was searched for sequences with homology to members of the NB-LRR resistance gene family. SNP marker from one NB-LRR-like sequence, NB-LRR3 co-segregated with Sr12. Two additional populations, including one that lacked Lr34, were tested in field nurseries. NB-LRR3 mapped near the maximum LOD for reduction in stem rust severity in both populations. Lines from a population that segregated for Sr12 and Lr34 were tested for seedling Pgt biomass and infection type, as well as APR to field stem rust which showed an interaction between the genes. We concluded that Sr12, or a gene closely linked to Sr12, was responsible for 'Thatcher'-derived APR in several environments and this resistance was enhanced in the presence of Lr34.

  18. Major Gene for Field Stem Rust Resistance Co-Locates with Resistance Gene Sr12 in 'Thatcher' Wheat.

    Science.gov (United States)

    Hiebert, Colin W; Kolmer, James A; McCartney, Curt A; Briggs, Jordan; Fetch, Tom; Bariana, Harbans; Choulet, Frederic; Rouse, Matthew N; Spielmeyer, Wolfgang

    2016-01-01

    Stem rust, caused by Puccinia graminis (Pgt), is a damaging disease of wheat that can be controlled by utilizing effective stem rust resistance genes. 'Thatcher' wheat carries complex resistance to stem rust that is enhanced in the presence of the resistance gene Lr34. The purpose of this study was to examine APR in 'Thatcher' and look for genetic interactions with Lr34. A RIL population was tested for stem rust resistance in field nurseries in Canada, USA, and Kenya. BSA was used to find SNP markers associated with reduced stem rust severity. A major QTL was identified on chromosome 3BL near the centromere in all environments. Seedling testing showed that Sr12 mapped to the same region as the QTL for APR. The SNP markers were physically mapped and the region carrying the resistance was searched for sequences with homology to members of the NB-LRR resistance gene family. SNP marker from one NB-LRR-like sequence, NB-LRR3 co-segregated with Sr12. Two additional populations, including one that lacked Lr34, were tested in field nurseries. NB-LRR3 mapped near the maximum LOD for reduction in stem rust severity in both populations. Lines from a population that segregated for Sr12 and Lr34 were tested for seedling Pgt biomass and infection type, as well as APR to field stem rust which showed an interaction between the genes. We concluded that Sr12, or a gene closely linked to Sr12, was responsible for 'Thatcher'-derived APR in several environments and this resistance was enhanced in the presence of Lr34.

  19. Major Gene for Field Stem Rust Resistance Co-Locates with Resistance Gene Sr12 in ‘Thatcher’ Wheat

    Science.gov (United States)

    Hiebert, Colin W.; Kolmer, James A.; McCartney, Curt A.; Briggs, Jordan; Fetch, Tom; Bariana, Harbans; Choulet, Frederic; Rouse, Matthew N.; Spielmeyer, Wolfgang

    2016-01-01

    Stem rust, caused by Puccinia graminis (Pgt), is a damaging disease of wheat that can be controlled by utilizing effective stem rust resistance genes. ‘Thatcher’ wheat carries complex resistance to stem rust that is enhanced in the presence of the resistance gene Lr34. The purpose of this study was to examine APR in ‘Thatcher’ and look for genetic interactions with Lr34. A RIL population was tested for stem rust resistance in field nurseries in Canada, USA, and Kenya. BSA was used to find SNP markers associated with reduced stem rust severity. A major QTL was identified on chromosome 3BL near the centromere in all environments. Seedling testing showed that Sr12 mapped to the same region as the QTL for APR. The SNP markers were physically mapped and the region carrying the resistance was searched for sequences with homology to members of the NB-LRR resistance gene family. SNP marker from one NB-LRR-like sequence, NB-LRR3 co-segregated with Sr12. Two additional populations, including one that lacked Lr34, were tested in field nurseries. NB-LRR3 mapped near the maximum LOD for reduction in stem rust severity in both populations. Lines from a population that segregated for Sr12 and Lr34 were tested for seedling Pgt biomass and infection type, as well as APR to field stem rust which showed an interaction between the genes. We concluded that Sr12, or a gene closely linked to Sr12, was responsible for ‘Thatcher’-derived APR in several environments and this resistance was enhanced in the presence of Lr34. PMID:27309724

  20. Multiple herbicide resistance in Lolium multiflorum and identification of conserved regulatory elements of herbicide resistance genes

    Directory of Open Access Journals (Sweden)

    Khalid Mahmood

    2016-08-01

    Full Text Available Herbicide resistance is a ubiquitous challenge to herbicide sustainability and a looming threat to control weeds in crops. Recently four genes were found constituently over-expressed in herbicide resistant individuals of Lolium rigidum, a close relative of L. multiflorum. These include two cytochrome P450s, one nitronate monooxygenase and one glycosyl-transferase. Higher expressions of these four herbicide metabolism related (HMR genes were also observed after herbicides exposure in the gene expression databases, indicating them a reliable marker. In order to get an overview of herbicidal resistance status of Lolium multiflorum L, 19 field populations were collected. Among these populations, four populations were found to be resistant to acetolactate synthase (ALS inhibitors while three exhibited resistance to acetyl-CoA carboxylase (ACCase inhibitors in our initial screening and dose response study. The genotyping showed the presence of mutations Trp-574-Leu and Ile-2041-Asn in ALS and ACCase, respectively and qPCR experiments revealed the enhanced expression of HMR genes in individuals of certain resistant populations. Moreover, co-expression networks and promoter analyses of HMR genes in O.sativa and A.thaliana resulted in the identification of a cis-regulatory motif and zinc finger transcription factors. The identified transcription factors were highly expressed similar to HMR genes in response to xenobiotics whereas the identified motif known to play a vital role in coping with environmental stresses and maintaining genome stability. Overall, our findings provide an important step forward towards a better understanding of metabolism-based herbicide resistance that can be utilized to devise novel strategies of weed management.

  1. Exploring antibiotic resistance genes and metal resistance genes in plasmid metagenomes from wastewater treatment plants

    OpenAIRE

    Li, An-Dong; Li, Li-Guan; Zhang, Tong

    2015-01-01

    Plasmids operate as independent genetic elements in microorganism communities. Through horizontal gene transfer, they can provide their host microorganisms with important functions such as antibiotic resistance and heavy metal resistance. In this study, six metagenomic libraries were constructed with plasmid DNA extracted from influent, activated sludge and digested sludge of two wastewater treatment plants. Compared with the metagenomes of the total DNA extracted from the same sectors of the...

  2. Multifocal outbreaks of metallo-beta-lactamase-producing Pseudomonas aeruginosa resistant to broad-spectrum beta-lactams, including carbapenems.

    Science.gov (United States)

    Senda, K; Arakawa, Y; Nakashima, K; Ito, H; Ichiyama, S; Shimokata, K; Kato, N; Ohta, M

    1996-02-01

    A total of 3,700 Pseudomonas aeruginosa isolates were collected from 17 general hospitals in Japan from 1992 to 1994. Of these isolates, 132 carbapenem-resistant strains were subjected to DNA hybridization analysis with the metallo-beta-lactamase gene (blaIMP)-specific probe. Fifteen strains carrying the metallo-beta-lactamase gene were identified in five hospitals in different geographical areas. Three strains of P. aeruginosa demonstrated high-level imipenem resistance (MIC, > or = 128 micrograms/ml), two strains exhibited low-level imipenem resistance (MIC, carbapenems. In several strains, the metallo-beta-lactamase gene was carried by large plasmids, and carbapenem resistance was transferred from P. aeruginosa to Escherichia coli by electroporation in association with the acquisition of the large plasmid. Southern hybridization analysis and genomic DNA fingerprinting profiles revealed different genetic backgrounds for these 15 isolates, although considerable similarity was observed for the strains isolated from the same hospital. These findings suggest that the metallo-beta-lactamase-producing P. aeruginosa strains are not confined to a unique clonal lineage but proliferated multifocally by plasmid-mediated dissemination of the metallo-beta-lactamase gene in strains of different genetic backgrounds. Thus, further proliferation of metallo-beta-lactamase-producing strains with resistance to various beta-lactams may well be inevitable in the future, which emphasizes the need for early recognition of metallo-beta-lactamase-producing strains, rigorous infection control, and restricted clinical use of broad-spectrum beta-lactams including carbapenems.

  3. Host range of antibiotic resistance genes in wastewater treatment plant influent and effluent.

    Science.gov (United States)

    Hultman, Jenni; Tamminen, Manu; Pärnänen, Katariina; Cairns, Johannes; Karkman, Antti; Virta, Marko

    2018-04-01

    Wastewater treatment plants (WWTPs) collect wastewater from various sources for a multi-step treatment process. By mixing a large variety of bacteria and promoting their proximity, WWTPs constitute potential hotspots for the emergence of antibiotic resistant bacteria. Concerns have been expressed regarding the potential of WWTPs to spread antibiotic resistance genes (ARGs) from environmental reservoirs to human pathogens. We utilized epicPCR (Emulsion, Paired Isolation and Concatenation PCR) to detect the bacterial hosts of ARGs in two WWTPs. We identified the host distribution of four resistance-associated genes (tetM, int1, qacEΔ1and blaOXA-58) in influent and effluent. The bacterial hosts of these resistance genes varied between the WWTP influent and effluent, with a generally decreasing host range in the effluent. Through 16S rRNA gene sequencing, it was determined that the resistance gene carrying bacteria include both abundant and rare taxa. Our results suggest that the studied WWTPs mostly succeed in decreasing the host range of the resistance genes during the treatment process. Still, there were instances where effluent contained resistance genes in bacterial groups not carrying these genes in the influent. By permitting exhaustive profiling of resistance-associated gene hosts in WWTP bacterial communities, the application of epicPCR provides a new level of precision to our resistance gene risk estimates.

  4. Plant agricultural streptomycin formulations do not carry antibiotic resistance genes.

    Science.gov (United States)

    Rezzonico, Fabio; Stockwell, Virginia O; Duffy, Brion

    2009-07-01

    Streptomycin is used in plant agriculture for bacterial disease control, particularly against fire blight in pome fruit orchards. Concerns that this may increase environmental antibiotic resistance have led to bans or restrictions on use. Experience with antibiotic use in animal feeds raises the possible influence of formulation-delivered resistance genes. We demonstrate that agricultural streptomycin formulations do not carry producer organism resistance genes. By using an optimized extraction procedure, Streptomyces 16S rRNA genes and the streptomycin resistance gene strA were not detected in agricultural streptomycin formulations. This diminishes the likelihood for one potential factor in resistance development due to streptomycin use.

  5. Marker mapping and resistance gene associations in soybean

    OpenAIRE

    2011-01-01

    The invention provides novel molecular genetic markers in soybean, where the markers are useful, for example, in the marker-assisted selection of gene alleles that impart disease-resistance, thereby allowing the identification and selection of a disease-resistant plant. The markers also find use in positional cloning of disease-resistance genes.

  6. Heavy metal and disinfectant resistance genes among livestock-associated methicillin-resistant Staphylococcus aureus isolates

    DEFF Research Database (Denmark)

    Argudin, Maria Angeles; Lauzat, Birgit; Kraushaar, Britta

    2016-01-01

    substances with antimicrobial activity applied in animal feed, including metal-containing compounds might contribute to their selection. Some of these genes have been found in various novel SCCmec cassettes. The aim of this study was to assess the occurrence of metal-resistance genes among a LA-S. aureus...... collection [n = 554, including 542 MRSA and 12 methicillin-susceptible S. aureus (MSSA)] isolated from livestock and food thereof. Most LA-MRSA isolates (76%) carried at least one metal-resistance gene. Among the LA-MRSA CC398 isolates (n = 456), 4.8%, 0.2%, 24.3% and 71.5% were positive for arsA (arsenic......, 72% carried one metal-resistance gene, and the remaining harboured two or more in different combinations. Differences between LA-MRSA CC398 and non-CC398 were statistically significant for arsA and czrC. The czrC gene was almost exclusively found (98%) in the presence of SCCmec V in both CC398...

  7. Presence of tetracycline resistance genes in ecosystems with distinct levels of human impact

    OpenAIRE

    STEHLÍKOVÁ, Zuzana

    2011-01-01

    The incidence of tetracycline resistance genes in the environments with different levels of human impact were compared in this work. The experimental part included detection of eight tetracycline resistance genes in soils from manured and non-manured farms (representing man-affected environment) and soils from national parks (representing non-affected environment).

  8. Persistence of antimicrobial resistance genes from sows to finisher pigs

    DEFF Research Database (Denmark)

    Birkegård, Anna Camilla; Halasa, Tariq; Folkesson, Anders

    2018-01-01

    Antimicrobial resistance in pigs has been under scrutiny for many years. However, many questions remain unanswered, including whether the initial antimicrobial resistance level of a pig will influence the antimicrobial resistance found at slaughter. Faecal samples from finishers pigs from 681 farms...... and from sows from 82 farms were collected, and levels of seven antimicrobial resistance genes, ermB, ermF, sulI, sulII, tet(M), tet(O), and tet(W), were quantified by high-capacity qPCR. There were 40 pairs of observations where the finishers were born in the farms of the sows. The objective of this study...... was to evaluate whether the levels of AMR genes found in finisher pigs at slaughter were associated with the levels in the farm where the finishers were born, and whether the levels of the AMR genes were equal in the sow and finisher pig populations. We found a significant positive correlation between the levels...

  9. Antibiotic resistance genes in anaerobic bacteria isolated from primary dental root canal infections.

    Science.gov (United States)

    Rôças, Isabela N; Siqueira, José F

    2012-12-01

    Fourty-one bacterial strains isolated from infected dental root canals and identified by 16S rRNA gene sequence were screened for the presence of 14 genes encoding resistance to beta-lactams, tetracycline and macrolides. Thirteen isolates (32%) were positive for at least one of the target antibiotic resistance genes. These strains carrying at least one antibiotic resistance gene belonged to 11 of the 26 (42%) infected root canals sampled. Two of these positive cases had two strains carrying resistance genes. Six out of 7 Fusobacterium strains harbored at least one of the target resistance genes. One Dialister invisus strain was positive for 3 resistance genes, and 4 other strains carried two of the target genes. Of the 6 antibiotic resistance genes detected in root canal strains, the most prevalent were blaTEM (17% of the strains), tetW (10%), and ermC (10%). Some as-yet-uncharacterized Fusobacterium and Prevotella isolates were positive for blaTEM, cfxA and tetM. Findings demonstrated that an unexpectedly large proportion of dental root canal isolates, including as-yet-uncharacterized strains previously regarded as uncultivated phylotypes, can carry antibiotic resistance genes. Copyright © 2012 Elsevier Ltd. All rights reserved.

  10. Mining microbial metatranscriptomes for expression of antibiotic resistance genes under natural conditions

    Science.gov (United States)

    Versluis, Dennis; D'Andrea, Marco Maria; Ramiro Garcia, Javier; Leimena, Milkha M.; Hugenholtz, Floor; Zhang, Jing; Öztürk, Başak; Nylund, Lotta; Sipkema, Detmer; Schaik, Willem Van; de Vos, Willem M.; Kleerebezem, Michiel; Smidt, Hauke; Passel, Mark W. J. Van

    2015-07-01

    Antibiotic resistance genes are found in a broad range of ecological niches associated with complex microbiota. Here we investigated if resistance genes are not only present, but also transcribed under natural conditions. Furthermore, we examined the potential for antibiotic production by assessing the expression of associated secondary metabolite biosynthesis gene clusters. Metatranscriptome datasets from intestinal microbiota of four human adults, one human infant, 15 mice and six pigs, of which only the latter have received antibiotics prior to the study, as well as from sea bacterioplankton, a marine sponge, forest soil and sub-seafloor sediment, were investigated. We found that resistance genes are expressed in all studied ecological niches, albeit with niche-specific differences in relative expression levels and diversity of transcripts. For example, in mice and human infant microbiota predominantly tetracycline resistance genes were expressed while in human adult microbiota the spectrum of expressed genes was more diverse, and also included β-lactam, aminoglycoside and macrolide resistance genes. Resistance gene expression could result from the presence of natural antibiotics in the environment, although we could not link it to expression of corresponding secondary metabolites biosynthesis clusters. Alternatively, resistance gene expression could be constitutive, or these genes serve alternative roles besides antibiotic resistance.

  11. Identification of Gene Resistance to Avian InfluenzaVirus (Mx Gene among Wild Waterbirds

    Directory of Open Access Journals (Sweden)

    Dewi Elfidasari

    2013-04-01

    Full Text Available The Mx gene is an antiviral gene used to determine the resistance or the susceptibility to different types of viruses, including the Avian Influenza (AI virus subtype H5N1. The AI virus subtype H5N1 infection in chickens causes Mx gene polymorphism. The Mx+ gene shows resistant to the AIvirus subtype H5N1, whereas the Mx-gene shows signs of susceptible. The objective of thisresearch was to detect the Mxgene in wild aquatic birds using the Polymerase Chain Reaction Restriction Fragment Length Polymorphism (PCR-RFLP method with the primer pairs F2 and NE-R2/R and the RsaI restriction enzyme. DNA samples were obtained from eight species of wild waterbirds with positive and negative exposure to the AI virus subtype H5N1. DNA amplification results showed that the Mxgene in wild aquatic birds is found in a 100 bp fragment, which is the same as the Mx gene found in chickens. However, unlike chickens, the Mxgene in wild aquatic birds did not show any polymorphism. This study proves that Mx- based resistance to AI virus subtype H5N1 in different in wild birds than in chickens.

  12. Dissection of Resistance Genes to Pseudomonas syringae pv. phaseolicola in UI3 Common Bean Cultivar.

    Science.gov (United States)

    González, Ana M; Godoy, Luís; Santalla, Marta

    2017-11-23

    Few quantitative trait loci have been mapped for resistance to Pseudomonas syringae pv. phaseolicola in common bean. Two F₂ populations were developed from the host differential UI3 cultivar. The objective of this study was to further characterize the resistance to races 1, 5, 7 and 9 of Psp included in UI3. Using a QTL mapping approach, 16 and 11 main-effect QTLs for pod and primary leaf resistance were located on LG10, explaining up to 90% and 26% of the phenotypic variation, respectively. The homologous genomic region corresponding to primary leaf resistance QTLs detected tested positive for the presence of resistance-associated gene cluster encoding nucleotide-binding and leucine-rich repeat (NL), Natural Resistance Associated Macrophage (NRAMP) and Pentatricopeptide Repeat family (PPR) proteins. It is worth noting that the main effect QTLs for resistance in pod were located inside a 3.5 Mb genomic region that included the Phvul.010G021200 gene, which encodes a protein that has the highest sequence similarity to the RIN4 gene of Arabidopsis, and can be considered an important candidate gene for the organ-specific QTLs identified here. These results support that resistance to Psp from UI3 might result from the immune response activated by combinations of R proteins, and suggest the guard model as an important mechanism in pod resistance to halo blight. The candidate genes identified here warrant functional studies that will help in characterizing the actual defense gene(s) in UI3 genotype.

  13. Genes (including RNA editing information) - RMG | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available switchLanguage; BLAST Search Image Search Home About Archive Update History Data List Contact us RMG Genes... (including RNA editing information) Data detail Data name Genes (including RNA edi... Site Policy | Contact Us Genes (including RNA editing information) - RMG | LSDB Archive ...

  14. Who possesses drug resistance genes in the aquatic environment?: sulfamethoxazole (SMX) resistance genes among the bacterial community in water environment of Metro-Manila, Philippines

    OpenAIRE

    Suzuki, Satoru; Ogo, Mitsuko; Miller, Todd W.; Shimizu, Akiko; Takada, Hideshige; Siringan, Maria Auxilia T.

    2013-01-01

    Recent evidence has shown that antibiotic resistant bacteria (ARB) and antibiotic resistance genes (ARGs) are ubiquitous in natural environments, including sites considered pristine. To understand the origin of ARGs and their dynamics, we must first define their actual presence in the natural bacterial assemblage. Here we found varying distribution profiles of sul genes in “colony forming bacterial assemblages” and “natural bacterial assemblages.” Our monitoring for antibiotic contamination r...

  15. Genetics and mapping of a new leaf rust resistance gene in Triticum ...

    Indian Academy of Sciences (India)

    AMIT KUMAR SINGH

    friendly method. Wild relatives of wheat are reservoir of useful genes, including genes for rust resis- tance. To date, 74 leaf rust resistance genes have been des- ignated and about half of them have originated from various closely or distantly related ...

  16. Susceptibility trends including emergence of linezolid resistance among coagulase-negative staphylococci and meticillin-resistant Staphylococcus aureus from invasive infections.

    Science.gov (United States)

    Decousser, Jean-Winoc; Desroches, Marine; Bourgeois-Nicolaos, Nadège; Potier, Julien; Jehl, François; Lina, Gérard; Cattoir, Vincent; Vandenesh, François; Doucet-Populaire, Florence

    2015-12-01

    Multiresistance in staphylococci constitutes a major challenge for the antimicrobial chemotherapy of invasive infections such as bacteraemia or bone and joint infections (BJIs). A nationwide prospective study was performed to detect antimicrobial resistance trends among staphylococci causing invasive infections. Between October 2011 and February 2012, 367 meticillin-resistant Staphylococcus aureus (MRSA) and 695 coagulase-negative staphylococci (CoNS) were collected from 37 French hospitals, mainly from bacteraemia (59.9%) and osteoarticular infections (29.0%). Minimum inhibitory concentrations (MICs) were determined by broth microdilution, and specific screening and confirmation tests were performed to detect heterogeneous vancomycin-intermediate S. aureus (hVISA). Staphylococcal isolates exhibiting a linezolid MIC>4 mg/L were further characterised to determinate their clonal relationships and the mechanism of resistance. MRSA exhibited additional resistances, including levofloxacin (82% associated resistance), gentamicin (13.6%), fusidic acid (13.6%) and rifampicin (6.5%), compromising oral step-down therapy in BJIs. Only two hVISA strains (0.5%) were identified. Among the CoNS, mainly Staphylococcus epidermidis (506/695; 72.8%), resistance to first- and second-line agents was more common. Linezolid resistance was identified in 10 CoNS (1.4%). The most frequent linezolid resistance mechanism was the G2576T mutation in 23S rDNA (9/10). For the first time in France, the cfr gene was found in five related sequence type 2 (ST2) S. epidermidis from two different hospitals, in association with ribosomal RNA and L3 ribosomal protein mutations. These national data must be considered when selecting empirical treatment for invasive staphylococcal infections. Moreover, the emergence and spread of linezolid-resistant CoNS carrying the cfr gene is of concern. Copyright © 2015 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

  17. Resistance gene homologues in melon are linked to genetic loci conferring disease and pest resistance.

    Science.gov (United States)

    Brotman, Y.; Silberstein, L.; Kovalski, I.; Perin, C.; Dogimont, C.; Pitrat, M.; Klingler, J.; Thompson, A.; Perl-Treves, R.

    2002-05-01

    Genomic and cDNA fragments with homology to known disease resistance genes (RGH fragments) were cloned from Cucumis melo using degenerate-primer PCR. Fifteen homologues of the NBS-LRR gene family have been isolated. The NBS-LRR homologues show high divergence and, based on the partial NBS-fragment sequences, appear to include members of the two major subfamilies that have been described in dicot plants, one that possesses a TIR-protein element and one that lacks such a domain. Genomic organization of these sequences was explored by DNA gel-blot analysis, and conservation among other Cucurbitaceae was assessed. Two mapping populations that segregate for several disease and pest resistance loci were used to map the RGH probes onto the melon genetic map. Several NBS-LRR related sequences mapped to the vicinity of genetic loci that control resistance to papaya ringspot virus, Fusarium oxysporum race 1, F. oxysporum race 2 and to the insect pest Aphis gossypii. The utility of such markers for breeding resistant melon cultivars and for cloning the respective R-genes is discussed.

  18. [Establishment of 5 resistant ovarian cancer cell strains and expression of resistance-related genes].

    Science.gov (United States)

    Luan, Ying-zi; Li, Li; Li, Dang-rong; Zhang, Wei; Tang, Bu-jian

    2004-06-01

    To investigate expression difference of several drug resistance related genes between sensitive and resistant ovarian carcinoma cells. Cell lines resistant to cisplatin, carboplatin and taxol were established from ovarian carcinoma cell lines of SKOV3 and A2780, and their biological features were detected. The expressions of several genes related to drug resistance were measured by RT-PCR method. (1) The values of resistance index (RI) of resistant cells to relevant drugs were elevated 3 times or more, with different degrees of cross-resistance to several other drugs (RI 2 approximately 20). They grew more slowly than primary cells (Td elongated 1.4 approximately 2.4 times, P 0.05). Intracellular concentrations of relevant drugs were reduced 2.0 approximately 8.5 times in resistant cells (P p53, lung resistance protein-1 (LRP-1), multiple drug resistance related protein-1 (MRP-1) genes were expressed at lower levels in resistant cells than in sensitive cells; while protein kinase C (PKC), topoisomerase (topo) I, and topo II beta were expressed higher, no obvious alterations were found concerning glutathione S transferase-pi (GST-pi), and topo II alpha. Expression of multiple drug resistance-1 (MDR-1) gene was either elevated or reduced in different cells. The expressions of resistance related genes were widely different in different kinds of resistant cells, suggesting more than one pathway leading to resistance transformation. This adds more difficulties for clinical management.

  19. Could bacteriophages transfer antibiotic resistance genes from environmental bacteria to human-body associated bacterial populations?

    Science.gov (United States)

    Muniesa, Maite; Colomer-Lluch, Marta; Jofre, Juan

    2013-07-01

    Environments without any contact with anthropogenic antibiotics show a great abundance of antibiotic resistance genes that use to be chromosomal and are part of the core genes of the species that harbor them. Some of these genes are shared with human pathogens where they appear in mobile genetic elements. Diversity of antibiotic resistance genes in non-contaminated environments is much greater than in human and animal pathogens, and in environments contaminated with antibiotic from anthropogenic activities. This suggests the existence of some bottleneck effect for the mobilization of antibiotic resistance genes among different biomes. Bacteriophages have characteristics that make them suitable vectors between different biomes, and as well for transferring genes from biome to biome. Recent metagenomic studies and detection of bacterial genes by genomic techniques in the bacteriophage fraction of different microbiota provide indirect evidences that the mobilization of genes mediated by phages, including antibiotic resistance genes, is far more relevant than previously thought. Our hypothesis is that bacteriophages might be of critical importance for evading one of the bottlenecks, the lack of ecological connectivity that modulates the pass of antibiotic resistance genes from natural environments such as waters and soils, to animal and human microbiomes. This commentary concentrates on the potential importance of bacteriophages in transferring resistance genes from the environment to human and animal body microbiomes, but there is no doubt that transduction occurs also in body microbiomes.

  20. Microarray-based Detection of Antibiotic Resisteance Genes in Salmonella

    NARCIS (Netherlands)

    Hoek, van A.H.A.M.; Aarts, H.J.M.

    2008-01-01

    In the presented study, 143 Salmonella isolates belonging to 26 different serovars were screened for the presence of antibiotic resistance genes by microarray analysis. The microarray contained a total of 223 oligonucleotides representing genes encoding for resistance to the following antibiotic

  1. Gene interactions and genetics of blast resistance and yield ...

    Indian Academy of Sciences (India)

    2016-08-26

    Oryza sativa L.) ... four blast resistance genes Pi1, Pi2, Pi33 and Pi54 in combination were used to study the nature and magnitude of gene action for disease resistance and yield attributes. ... Please take note of this change.

  2. Molecular detection of disease resistance genes to powdery mildew ...

    African Journals Online (AJOL)

    A study was conducted to detect the presence of disease resistance genes to infection of wheat powdery mildew (Blumeria graminis f. sp. tritici) in selected wheat cultivars from China using molecular markers. Genomic DNA of sixty cultivars was extracted and tested for the presence of selected prominent resistance genes to ...

  3. Codon-optimized antibiotic resistance gene improves efficiency of ...

    Indian Academy of Sciences (India)

    Success rate of transient transformation and cell growth in selective culture were significantly increased by use of fgmR instead of a native gentamicin resistance gene, suggesting that codon optimization improved translation efficiency of the marker gene and increased antibiotic resistance. Our result shows that similarity in ...

  4. Mapping of stripe rust resistance gene in an Aegilops caudata ...

    Indian Academy of Sciences (India)

    Genetic mapping indicated the introgression of stripe rust resistance gene on wheat chromosome. 5DS in the region carrying leaf rust resistance gene LrAc, but as an independent introgression. Simple sequence repeat (SSR) and sequence-tagged site (STS) markers designed from the survey sequence data of 5DS ...

  5. Genome scanning for identification of resistance gene analogs (RGAs)

    African Journals Online (AJOL)

    Disease resistance in plants is a desirable economic trait. Many disease resistance genes from various plants have been cloned so far. The gene products of some of these can be distinguished by the presence of an N terminal nucleotide binding site and a C-terminal stretch of leucine-rich repeats. Oligonucleotides already ...

  6. Electric fields, weighting fields, signals and charge diffusion in detectors including resistive materials

    International Nuclear Information System (INIS)

    Riegler, W.

    2016-01-01

    In this report we discuss static and time dependent electric fields in detector geometries with an arbitrary number of parallel layers of a given permittivity and weak conductivity. We derive the Green's functions i.e. the field of a point charge, as well as the weighting fields for readout pads and readout strips in these geometries. The effect of 'bulk' resistivity on electric fields and signals is investigated. The spreading of charge on thin resistive layers is also discussed in detail, and the conditions for allowing the effect to be described by the diffusion equation is discussed. We apply the results to derive fields and induced signals in Resistive Plate Chambers, MICROMEGAS detectors including resistive layers for charge spreading and discharge protection as well as detectors using resistive charge division readout like the MicroCAT detector. We also discuss in detail how resistive layers affect signal shapes and increase crosstalk between readout electrodes.

  7. Occurrence of integrons and resistance genes among sulphonamide-resistant Shigella spp. from Brazil

    DEFF Research Database (Denmark)

    Peirano, G.; Agersø, Yvonne; Aarestrup, Frank Møller

    2005-01-01

    Objectives: To determine the occurrence of class 1 and 2 integrons and antimicrobial resistance genes among sulphonamide-resistant Shigella strains isolated in Brazil during 1999-2003. Methods: Sixty-two Shigella (Shigella flexneri, n = 47 and Shigella sonnei, n = 15) were tested against 21....... Conclusions: The detection of class 1 and 2 integrons and additional antimicrobial resistance genes allowed us to identify the most frequent antimicrobial resistance patterns of Shigella spp. isolated in Brazil....

  8. Transfer of tetracycline resistance gene (tetr) between replicons in ...

    African Journals Online (AJOL)

    Antimicrobial susceptibility testing among the isolates showed resistance to amoxicillin (92%), amoxicillin-clavulanic acid (84.4%), tetracycline (71.4%), gentamycin (43.5%), nalidixic acid (38.3%) and nitrofurantoin (7.9%). E. coli showed the highest resistance to most of the antibiotics. Tetracycline resistance gene was ...

  9. Mapping of stripe rust resistance gene in an Aegilops caudata ...

    Indian Academy of Sciences (India)

    PUNEET INDER TOOR

    end of 5DS linked with a group of four colocated SSRs and two resistance gene analogue (RGA)-STS markers at a distance of 5.3 cM. ... and LrAc appear to be the candidate genes for marker-assisted enrichment of the wheat gene pool for rust resistance. [Toor P. I., Kaur S., Bansal ..... stocks with reduced alien chromatin.

  10. Overexpression of antibiotic resistance genes in hospital effluents over time.

    Science.gov (United States)

    Rowe, Will P M; Baker-Austin, Craig; Verner-Jeffreys, David W; Ryan, Jim J; Micallef, Christianne; Maskell, Duncan J; Pearce, Gareth P

    2017-06-01

    Effluents contain a diverse abundance of antibiotic resistance genes that augment the resistome of receiving aquatic environments. However, uncertainty remains regarding their temporal persistence, transcription and response to anthropogenic factors, such as antibiotic usage. We present a spatiotemporal study within a river catchment (River Cam, UK) that aims to determine the contribution of antibiotic resistance gene-containing effluents originating from sites of varying antibiotic usage to the receiving environment. Gene abundance in effluents (municipal hospital and dairy farm) was compared against background samples of the receiving aquatic environment (i.e. the catchment source) to determine the resistome contribution of effluents. We used metagenomics and metatranscriptomics to correlate DNA and RNA abundance and identified differentially regulated gene transcripts. We found that mean antibiotic resistance gene and transcript abundances were correlated for both hospital ( ρ  = 0.9, two-tailed P  resistance genes ( bla GES and bla OXA ) were overexpressed in all hospital effluent samples. High β-lactam resistance gene transcript abundance was related to hospital antibiotic usage over time and hospital effluents contained antibiotic residues. We conclude that effluents contribute high levels of antibiotic resistance genes to the aquatic environment; these genes are expressed at significant levels and are possibly related to the level of antibiotic usage at the effluent source. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy.

  11. Generation of novel resistance genes using mutation and targeted gene editing

    Science.gov (United States)

    Classical breeding for virus resistance is a lengthy process and is restricted by the availability of resistance genes. Precise genome editing is a "dream technology" to improve plants for virus resistance and these tools have opened new and very promising ways to generate virus resistant plants by ...

  12. Stacking of blast resistance orthologue genes in susceptible indica rice line improves resistance againstMagnaporthe oryzae.

    Science.gov (United States)

    Kumari, Mandeep; Devanna, B N; Singh, Pankaj Kumar; Rajashekara, H; Sharma, Vinay; Sharma, Tilak Raj

    2018-01-01

    The emergence of new strains of Magnaporthe oryzae ( M. oryzae ) is associated with recurrent failure of resistance response mediated by single resistance ( R ) gene in rice. Therefore, stacking or combining of multiple R genes could improve the durability of resistance against multiple strains of M. oryzae . To achieve this, in the present study, intragenic stacking of rice blast resistance orthologue genes Pi54 and Pi54rh was performed through co-transformation approach. Both these genes were expressed under the control of independent promoters and blast susceptible indica rice line IET17021 was used for transformation. The highly virulent M. oryzae strain Mo-ei-ger1 that could knock down most of the major single blast R genes including Pi54 and exhibiting 89% virulence spectrum was used for phenotypic analysis. The stacked transgenic IET17021 lines ( Pi54  +  Pi54rh ) have shown complete resistance to Mo-ei-ger1 strain in comparison to non-transgenic lines. These two R gene stacked indica transgenic lines could serves as a novel germplasm for rice blast resistance breeding programmes.

  13. Associations between Antimicrobial Resistance Phenotypes, Antimicrobial Resistance Genes, and Virulence Genes of Fecal Escherichia coli Isolates from Healthy Grow-Finish Pigs ▿

    OpenAIRE

    Rosengren, Leigh B.; Waldner, Cheryl L.; Reid-Smith, Richard J.

    2009-01-01

    Escherichia coli often carries linked antimicrobial resistance genes on transmissible genetic elements. Through coselection, antimicrobial use may select for unrelated but linked resistance or virulence genes. This study used unconditional statistical associations to investigate the relationships between antimicrobial resistance phenotypes and antimicrobial resistance genes in 151 E. coli isolates from healthy pigs. Phenotypic resistance to each drug was significantly associated with phenotyp...

  14. Codon-optimized antibiotic resistance gene improves efficiency of ...

    Indian Academy of Sciences (India)

    2013-10-01

    Oct 1, 2013 ... native gentamicin resistance gene, suggesting that codon optimization improved translation efficiency of the marker gene and ... to be taken into account when exogenous transgenes are expressed in Frankia cells. [Kucho K, Kakoi K, ..... gene coding for the green fluorescent protein (GFP) is a versatile ...

  15. The cfr and cfr-like multiple resistance genes

    DEFF Research Database (Denmark)

    Vester, Birte

    2018-01-01

    . The cfr gene is found in various bacteria in many geographical locations and placed on plasmids or associated with transposons. Cfr-related genes providing similar resistance have been identified in Bacillales, and now also in the pathogens Clostridium difficile and Enterococcus faecium. In addition......, the presence of the cfr gene has been detected in harbours and food markets....

  16. Linking microbial community structure and function to characterize antibiotic resistant bacteria and antibiotic resistant genes from cattle feces

    Science.gov (United States)

    There is widespread interest in monitoring the development of antibiotic resistant bacteria and antibiotic resistance genes in agriculturally impacted environments, however little is known about the relationships between bacterial community structure, and antibiotic resistance gene profiles. Cattl...

  17. Mobile antibiotic resistance – the spread of genes determining the resistance of bacteria through food products

    Directory of Open Access Journals (Sweden)

    Jolanta Godziszewska

    2016-07-01

    Full Text Available In recent years, more and more antibiotics have become ineffective in the treatment of bacterial nfections. The acquisition of antibiotic resistance by bacteria is associated with circulation of genes in the environment. Determinants of antibiotic resistance may be transferred to pathogenic bacteria. It has been shown that conjugation is one of the key mechanisms responsible for spread of antibiotic resistance genes, which is highly efficient and allows the barrier to restrictions and modifications to be avoided. Some conjugative modules enable the transfer of plasmids even between phylogenetically distant bacterial species. Many scientific reports indicate that food is one of the main reservoirs of these genes. Antibiotic resistance genes have been identified in meat products, milk, fruits and vegetables. The reason for such a wide spread of antibiotic resistance genes is the overuse of antibiotics by breeders of plants and animals, as well as by horizontal gene transfer. It was shown, that resistance determinants located on mobile genetic elements, which are isolated from food products, can easily be transferred to another niche. The antibiotic resistance genes have been in the environment for 30 000 years. Their removal from food products is not possible, but the risks associated with the emergence of multiresistant pathogenic strains are very large. The only option is to control the emergence, selection and spread of these genes. Therefore measures are sought to prevent horizontal transfer of genes. Promising concepts involve the combination of developmental biology, evolution and ecology in the fight against the spread of antibiotic resistance.

  18. Mobile antibiotic resistance - the spread of genes determining the resistance of bacteria through food products.

    Science.gov (United States)

    Godziszewska, Jolanta; Guzek, Dominika; Głąbski, Krzysztof; Wierzbicka, Agnieszka

    2016-07-07

    In recent years, more and more antibiotics have become ineffective in the treatment of bacterial nfections. The acquisition of antibiotic resistance by bacteria is associated with circulation of genes in the environment. Determinants of antibiotic resistance may be transferred to pathogenic bacteria. It has been shown that conjugation is one of the key mechanisms responsible for spread of antibiotic resistance genes, which is highly efficient and allows the barrier to restrictions and modifications to be avoided. Some conjugative modules enable the transfer of plasmids even between phylogenetically distant bacterial species. Many scientific reports indicate that food is one of the main reservoirs of these genes. Antibiotic resistance genes have been identified in meat products, milk, fruits and vegetables. The reason for such a wide spread of antibiotic resistance genes is the overuse of antibiotics by breeders of plants and animals, as well as by horizontal gene transfer. It was shown, that resistance determinants located on mobile genetic elements, which are isolated from food products, can easily be transferred to another niche. The antibiotic resistance genes have been in the environment for 30 000 years. Their removal from food products is not possible, but the risks associated with the emergence of multiresistant pathogenic strains are very large. The only option is to control the emergence, selection and spread of these genes. Therefore measures are sought to prevent horizontal transfer of genes. Promising concepts involve the combination of developmental biology, evolution and ecology in the fight against the spread of antibiotic resistance.

  19. Genetic analysis and molecular mapping of resistance gene to Phakopsora pachyrhizi in soybean germplasm SX6907.

    Science.gov (United States)

    Chen, Haifeng; Zhao, Sheng; Yang, Zhonglu; Sha, Aihua; Wan, Qiao; Zhang, Chanjuan; Chen, Limiao; Yuan, Songli; Qiu, Dezhen; Chen, Shuilian; Shan, Zhihui; Zhou, Xin-an

    2015-04-01

    In this study, Rpp6907, a novel resistance gene/allele to Phakopsora pachyrhizi in soybean, was mapped in a 111.9-kb region, including three NBS-LRR type predicted genes, on chromosome 18. Soybean rust caused by Phakopsora pachyrhizi Sydow has been reported in numerous soybean-growing regions worldwide. The development of rust-resistant varieties is the most economical and environmentally safe method to control the disease. The Chinese soybean germplasm SX6907 is resistant to P. pachyrhizi and exhibits immune reaction compared with the known Rpp genes. These characteristics suggest that SX6907 may carry at least one novel Rpp gene/allele. Three F2 populations from the crosses of SX6907 (resistant) and Tianlong 1, Zhongdou40, and Pudou11 (susceptible) were used to map the Rpp gene. Three resistance responses (immune, red-brown, and tan-colored lesion) were observed from the F2 individuals. The segregation follows a ratio of 1(resistance):2(heterozygous):1(susceptible), indicating that the resistance in SX6907 is controlled by a single incomplete dominant gene (designated as Rpp6907). Results showed that Rpp6907 was mapped on soybean chromosome 18 (molecular linkage group G, MLG G) flanked by simple sequence repeat (SSR) markers SSR24 and SSR40 at a distance of 111.9 kb. Among the ten genes marked within this 111.9-kb region between the two markers, three genes (Glyma18g51930, Glyma18g51950, and Glyma18g51960) are nucleotide-binding site and leucine-rich repeat-type genes. These genes may be involved in recognizing the presence of pathogens and ultimately conferring resistance. Based on resistance spectrum analysis and mapping results, we inferred that Rpp6907 is a novel gene different from Rpp1 in PI 200492, PI 561356, PI 587880A, PI 587886, and PI 594538A, or a new Rpp1-b allele.

  20. Distribution of Putative Virulence Genes and Antimicrobial Drug Resistance in Vibrio harveyi

    OpenAIRE

    Parvathi, Ammini; Mendez, Dafini; Anto, Ciana

    2011-01-01

    The marine-estuarine bacterium Vibrio harveyi is an important pathogen of invertebrates, most significantly, the larvae of commercially important shrimp Penaeus monodon. In this study, we analyzed V. harveyi isolated from shrimp hatchery environments for understanding the distribution of putative virulence genes and antimicrobial drug resistance. The putative genes targeted for PCR detection included four reversible toxin (Rtx)/hemolysin genes, a gene encoding homologue of Vibriocholerae zonu...

  1. Determination of rust resistance genes in pakistani bread wheats

    International Nuclear Information System (INIS)

    Qamar, M.; Ahmad, S.D.; Rabbani, M.A.; Shinwari, Z.K.

    2014-01-01

    Stripe and leaf rusts are the major constraints to bread wheat production in Pakistan. Molecular markers were used to investigate the presence of leaf rust and stripe rust resistance gene cluster Lr34/Yr18 and stem rust resistance gene Sr2 in 52 Pakistani bread wheat cultivars/lines. PCR amplification of DNA fragments using DNA marker csLV-34 showed that 13 of the studied cultivars/lines, namely 03FJ26, NR 337, NR 339, NR 347, NR 350, Manthar, Margalla 99, Iqbal 2000, Saleem 2000, Wafaq 2001, Marwat 2001, Pirsabak 2004 and Fareed 2006 carry leaf rust and stripe rust resistance genes Lr34/Yr18. Stem rust resistance gene Sr2 was observed in 36 Pakistani spring wheat cultivars/lines using stm560.3tgag marker. The slow rusting gene Sr2 needs to be combined with additional stem rust resistance genes to establish durable resistance against Ug99 in modern wheat cultivars. Low frequency of Lr34/Yr18 was found in Pakistani wheats. This gene cluster needs to be incorporated into Pakistani wheats for durable rust resistance. (author)

  2. Fate of antibiotic resistant bacteria and genes during wastewater chlorination: implication for antibiotic resistance control.

    Directory of Open Access Journals (Sweden)

    Qing-Bin Yuan

    Full Text Available This study investigated fates of nine antibiotic-resistant bacteria as well as two series of antibiotic resistance genes in wastewater treated by various doses of chlorine (0, 15, 30, 60, 150 and 300 mg Cl2 min/L. The results indicated that chlorination was effective in inactivating antibiotic-resistant bacteria. Most bacteria were inactivated completely at the lowest dose (15 mg Cl2 min/L. By comparison, sulfadiazine- and erythromycin-resistant bacteria exhibited tolerance to low chlorine dose (up to 60 mg Cl2 min/L. However, quantitative real-time PCRs revealed that chlorination decreased limited erythromycin or tetracycline resistance genes, with the removal levels of overall erythromycin and tetracycline resistance genes at 0.42 ± 0.12 log and 0.10 ± 0.02 log, respectively. About 40% of erythromycin-resistance genes and 80% of tetracycline resistance genes could not be removed by chlorination. Chlorination was considered not effective in controlling antimicrobial resistance. More concern needs to be paid to the potential risk of antibiotic resistance genes in the wastewater after chlorination.

  3. Fate of antibiotic resistant bacteria and genes during wastewater chlorination: implication for antibiotic resistance control.

    Science.gov (United States)

    Yuan, Qing-Bin; Guo, Mei-Ting; Yang, Jian

    2015-01-01

    This study investigated fates of nine antibiotic-resistant bacteria as well as two series of antibiotic resistance genes in wastewater treated by various doses of chlorine (0, 15, 30, 60, 150 and 300 mg Cl2 min/L). The results indicated that chlorination was effective in inactivating antibiotic-resistant bacteria. Most bacteria were inactivated completely at the lowest dose (15 mg Cl2 min/L). By comparison, sulfadiazine- and erythromycin-resistant bacteria exhibited tolerance to low chlorine dose (up to 60 mg Cl2 min/L). However, quantitative real-time PCRs revealed that chlorination decreased limited erythromycin or tetracycline resistance genes, with the removal levels of overall erythromycin and tetracycline resistance genes at 0.42 ± 0.12 log and 0.10 ± 0.02 log, respectively. About 40% of erythromycin-resistance genes and 80% of tetracycline resistance genes could not be removed by chlorination. Chlorination was considered not effective in controlling antimicrobial resistance. More concern needs to be paid to the potential risk of antibiotic resistance genes in the wastewater after chlorination.

  4. Survival of Antibiotic Resistant Bacteria and Horizontal Gene Transfer Control Antibiotic Resistance Gene Content in Anaerobic Digesters

    OpenAIRE

    Miller, Jennifer H.; Novak, John T.; Knocke, William R.; Pruden, Amy

    2016-01-01

    Understanding fate of antibiotic resistant bacteria (ARB) versus their antibiotic resistance genes (ARGs) during wastewater sludge treatment is critical in order to reduce the spread of antibiotic resistance through process optimization. Here, we spiked high concentrations of tetracycline-resistant bacteria, isolated from mesophilic (Iso M1-1- a Pseudomonas sp.) and thermophilic (Iso T10- a Bacillus sp.) anaerobic digested sludge, into batch digesters and monitored their fate by plate counts ...

  5. Sponge Microbiota are a Reservoir of Functional Antibiotic Resistance Genes

    DEFF Research Database (Denmark)

    Versluis, Dennis; de Evgrafov, Mari Cristina Rodriguez; Sommer, Morten Otto Alexander

    2016-01-01

    Wide application of antibiotics has contributed to the evolution of multi-drug resistant human pathogens, resulting in poorer treatment outcomes for infections. In the marine environment, seawater samples have been investigated as a resistance reservoir; however, no studies have methodically...... examined sponges as a reservoir of antibiotic resistance. Sponges could be important in this respect because they often contain diverse microbial communities that have the capacity to produce bioactive metabolites. Here, we applied functional metagenomics to study the presence and diversity of functional......). Fifteen of 37 inserts harbored resistance genes that shared resistance gene could be identified with high confidence, in which case we predicted resistance to be mainly mediated by antibiotic efflux. One marine-specific ampicillin-resistance...

  6. sugE: A gene involved in tributyltin (TBT) resistance of Aeromonas molluscorum Av27.

    Science.gov (United States)

    Cruz, Andreia; Micaelo, Nuno; Félix, Vitor; Song, Jun-Young; Kitamura, Shin-Ichi; Suzuki, Satoru; Mendo, Sónia

    2013-01-01

    The mechanism of bacterial resistance to tributyltin (TBT) is still unclear. The results herein presented contribute to clarify that mechanism in the TBT-resistant bacterium Aeromonas molluscorum Av27. We have identified and cloned a new gene that is involved in TBT resistance in this strain. The gene is highly homologous (84%) to the Aeromonas hydrophila-sugE gene belonging to the small multidrug resistance gene family (SMR), which includes genes involved in the transport of lipophilic drugs. In Av27, expression of the Av27-sugE was observed at the early logarithmic growth phase in the presence of a high TBT concentration (500 μM), thus suggesting the contribution of this gene for TBT resistance. E. coli cells transformed with Av27-sugE become resistant to ethidium bromide (EtBr), chloramphenicol (CP) and tetracycline (TE), besides TBT. According to the Moriguchi logP (miLogP) values, EtBr, CP and TE have similar properties and are substrates for the sugE-efflux system. Despite the different miLogP of TBT, E. coli cells transformed with Av27-sugE become resistant to this compound. So it seems that TBT is also a substrate for the SugE protein. The modelling studies performed also support this hypothesis. The data herein presented clearly indicate that sugE is involved in TBT resistance of this bacterium.

  7. AMINOGLYCOSIDE RESISTANCE GENES IN Pseudomonas aeruginosa ISOLATES FROM CUMANA, VENEZUELA.

    Science.gov (United States)

    Teixeira, Bertinellys; Rodulfo, Hectorina; Carreño, Numirin; Guzmán, Militza; Salazar, Elsa; De Donato, Marcos

    2016-01-01

    The enzymatic modification of aminoglycosides by aminoglycoside-acetyltransferases (AAC), aminoglycoside-adenyltransferases (AAD), and aminoglycoside-phosphotransferases (APH), is the most common resistance mechanism in P. aeruginosa and these enzymes can be coded on mobile genetic elements that contribute to their dispersion. One hundred and thirty seven P. aeruginosa isolates from the University Hospital, Cumana, Venezuela (HUAPA) were evaluated. Antimicrobial susceptibility was determined by the disk diffusion method and theaac, aadB and aph genes were detected by PCR. Most of the P. aeruginosa isolates (33/137) were identified from the Intensive Care Unit (ICU), mainly from discharges (96/137). The frequency of resistant P. aeruginosaisolates was found to be higher for the aminoglycosides tobramycin and amikacin (30.7 and 29.9%, respectively). Phenotype VI, resistant to these antibiotics, was the most frequent (14/49), followed by phenotype I, resistant to all the aminoglycosides tested (12/49). The aac(6´)-Ib,aphA1 and aadB genes were the most frequently detected, and the simultaneous presence of several resistance genes in the same isolate was demonstrated. Aminoglycoside resistance in isolates ofP. aeruginosa at the HUAPA is partly due to the presence of the aac(6´)-Ib, aphA1 andaadB genes, but the high rates of antimicrobial resistance suggest the existence of several mechanisms acting together. This is the first report of aminoglycoside resistance genes in Venezuela and one of the few in Latin America.

  8. Fine mapping of the Asian soybean rust resistance gene Rpp2 from soybean PI 230970.

    Science.gov (United States)

    Yu, Neil; Kim, Myungsik; King, Zachary R; Harris, Donna K; Buck, James W; Li, Zenglu; Diers, Brian W

    2015-03-01

    Asian soybean rust (ASR) resistance gene Rpp2 has been fine mapped into a 188.1 kb interval on Glyma.Wm82.a2, which contains a series of plant resistance ( R ) genes. Asian soybean rust (ASR), caused by the fungus Phakopsora pachyrihizi Syd. & P. Syd., is a serious disease in major soybean [Glycine max (L.) Merr.] production countries worldwide and causes yield losses up to 75 %. Defining the exact chromosomal position of ASR resistance genes is critical for improving the effectiveness of marker-assisted selection (MAS) for resistance and for cloning these genes. The objective of this study was to fine map the ASR resistance gene Rpp2 from the plant introduction (PI) 230970. Rpp2 was previously mapped within a 12.9-cM interval on soybean chromosome 16. The fine mapping was initiated by identifying recombination events in F2 and F3 plants using simple sequence repeat (SSR) and single nucleotide polymorphism (SNP) markers that flank the gene. Seventeen recombinant plants were identified and then tested with additional genetic markers saturating the gene region to localize the positions of each recombination. The progeny of these selected plants were tested for resistance to ASR and with SSR markers resulting in the mapping of Rpp2 to a 188.1 kb interval on the Williams 82 reference genome (Glyma.Wm82.a2). Twelve genes including ten toll/interleukin-1 receptor (TIR)-nucleotide-binding site (NBS)-leucine-rich repeat (LRR) genes were predicted to exist in this interval on the Glyma.Wm82.a2.v1 gene model map. Eight of these ten genes were homologous to the Arabidopsis TIR-NBS-LRR gene AT5G17680.1. The identified SSR and SNP markers close to Rpp2 and the candidate gene information presented in this study will be significant resources for MAS and gene cloning research.

  9. The transport of antibiotic resistance genes and residues in groundwater near swine production facilities

    Science.gov (United States)

    Lin, Y. F.; Yannarell, A. C.; Mackie, R. I.; Krapac, I. G.; Chee-Sanford, J. S.; Koike, S.

    2008-12-01

    The use of antibiotics at concentrated animal feeding operations (CAFOs) for disease prevention, disease treatment, and growth promotion can contribute to the spread of antibiotic compounds, their breakdown products, and antibiotic resistant bacteria and/or the genes that confer resistance. In addition, constitutive use of antibiotics at sub-therapeutic levels can select for antibiotic resistance among the bacteria that inhabit animal intestinal tracts, onsite manure treatment facilities, and any environments receiving significant inputs of manure (e.g. through waste lagoon leakage or fertilizer amendments to farm soils). If the antibiotic resistant organisms persist in these new environments, or if they participate in genetic exchanges with the native microflora, then CAFOs may constitute a significant reservoir for the spread of antibiotic resistance to the environment at large. Our results have demonstrated that leakage from waste treatment lagoons can influence the presence and persistence of tetracycline resistance genes in the shallow aquifer adjacent to swine CAFOs, and molecular phylogeny allowed us to distinguish "native" tetracycline resistance genes in control groundwater wells from manure-associated genes introduced from the lagoon. We have also been able to detect the presence of erythromycin resistance genes in CAFO surface and groundwater even though erythromycin is strictly reserved for use in humans and thus is not utilized at any of these sites. Ongoing research, including modeling of particle transport in groundwater, will help to determine the potential spatial and temporal extent of CAFO-derived antibiotic resistance.

  10. Detection of bacterial blight resistance genes in basmati rice landraces.

    Science.gov (United States)

    Ullah, I; Jamil, S; Iqbal, M Z; Shaheen, H L; Hasni, S M; Jabeen, S; Mehmood, A; Akhter, M

    2012-07-20

    Aromatic basmati rice is vulnerable to bacterial blight disease. Genes conferring resistance to bacterial blight have been identified in coarse rice; however, their incorporation into basmati varieties compromises the prized basmati aroma. We identified bacterial blight resistance genes Xa4, xa5, Xa7, and xa13 in 52 basmati landraces and five basmati cultivars using PCR markers. The Xa7 gene was found to be the most prevalent among the cultivars and landraces. The cultivars Basmati-385 and Basmati-2000 also contained the Xa4 gene; however, xa5 and xa13 were confined to landraces only. Ten landraces were found to have multiple resistance genes. Landraces Basmati-106, Basmati-189 and Basmati-208 contained Xa4 and Xa7 genes. Whereas, landraces Basmati-122, Basmati-427, Basmati-433 were observed to have xa5 and Xa7 genes. Landraces Basmati-48, Basmati-51A, Basmati-334, and Basmati-370A possessed Xa7 and xa13 genes. The use of landraces containing recessive genes xa5 and xa13 as donor parents in hybridization with cultivars Basmati-385 and Basmati-2000, which contain the genes Xa4 and Xa7, will expedite efforts to develop bacterial blight-resistant basmati rice cultivars through marker assisted selection, based on a pyramiding approach, without compromising aroma and grain quality.

  11. Genotypic and phenotypic nevirapine resistance correlates with virological failure during salvage therapy including abacavir and nevirapine

    DEFF Research Database (Denmark)

    Jørgensen, L.B.; Katzenstein, T.L.; Gerstoft, J.

    2000-01-01

    OBJECTIVE: To study the development of resistance during 8 weeks of salvage therapy with abacavir and nevirapine in combination with other reverse transcriptase inhibitors (RTIs) and protease inhibitors (PIs). METHODS: Samples obtained at baseline and after 8 weeks of therapy from 16 heavily...... and after 2, 4 and 8 weeks of therapy. RESULTS: The majority of patients was genotypically and phenotypically resistant to lamivudine, abacavir, zidovudine and PIs, whereas 50% of the patients showed resistance to nevirapine at baseline in at least one of the methods used. After 8 weeks of salvage therapy...... higher transient reduction in viral load was observed in patients with nevirapine-sensitive HIV at baseline compared to patients with resistant HIV at baseline. CONCLUSION: The transient effect of salvage therapy including abacavir and nevirapine was due to the effect of nevirapine. The lack of effect...

  12. The gene Sr33, an ortholog of barley Mla genes, encodes resistance to wheat stem rust race Ug99.

    Science.gov (United States)

    Periyannan, Sambasivam; Moore, John; Ayliffe, Michael; Bansal, Urmil; Wang, Xiaojing; Huang, Li; Deal, Karin; Luo, Mingcheng; Kong, Xiuying; Bariana, Harbans; Mago, Rohit; McIntosh, Robert; Dodds, Peter; Dvorak, Jan; Lagudah, Evans

    2013-08-16

    Wheat stem rust, caused by the fungus Puccinia graminis f. sp. tritici, afflicts bread wheat (Triticum aestivum). New virulent races collectively referred to as "Ug99" have emerged, which threaten global wheat production. The wheat gene Sr33, introgressed from the wild relative Aegilops tauschii into bread wheat, confers resistance to diverse stem rust races, including the Ug99 race group. We cloned Sr33, which encodes a coiled-coil, nucleotide-binding, leucine-rich repeat protein. Sr33 is orthologous to the barley (Hordeum vulgare) Mla mildew resistance genes that confer resistance to Blumeria graminis f. sp. hordei. The wheat Sr33 gene functions independently of RAR1, SGT1, and HSP90 chaperones. Haplotype analysis from diverse collections of Ae. tauschii placed the origin of Sr33 resistance near the southern coast of the Caspian Sea.

  13. Antimicrobial Peptide Resistance Genes in the Plant Pathogen Dickeya dadantii.

    Science.gov (United States)

    Pandin, Caroline; Caroff, Martine; Condemine, Guy

    2016-11-01

    Modification of teichoic acid through the incorporation of d-alanine confers resistance in Gram-positive bacteria to antimicrobial peptides (AMPs). This process involves the products of the dltXABCD genes. These genes are widespread in Gram-positive bacteria, and they are also found in a few Gram-negative bacteria. Notably, these genes are present in all soft-rot enterobacteria (Pectobacterium and Dickeya) whose dltDXBAC operons have been sequenced. We studied the function and regulation of these genes in Dickeya dadantii dltB expression was induced in the presence of the AMP polymyxin. It was not regulated by PhoP, which controls the expression of some genes involved in AMP resistance, but was regulated by ArcA, which has been identified as an activator of genes involved in AMP resistance. However, arcA was not the regulator responsible for polymyxin induction of these genes in this bacterium, which underlines the complexity of the mechanisms controlling AMP resistance in D. dadantii Two other genes involved in resistance to AMPs have also been characterized, phoS and phoH dltB, phoS, phoH, and arcA but not dltD mutants were more sensitive to polymyxin than the wild-type strain. Decreased fitness of the dltB, phoS, and phoH mutants in chicory leaves indicates that their products are important for resistance to plant AMPs. Gram-negative bacteria can modify their lipopolysaccharides (LPSs) to resist antimicrobial peptides (AMPs). Soft-rot enterobacteria (Dickeya and Pectobacterium spp.) possess homologues of the dlt genes in their genomes which, in Gram-positive bacteria, are involved in resistance to AMPs. In this study, we show that these genes confer resistance to AMPs, probably by modifying LPSs, and that they are required for the fitness of the bacteria during plant infection. Two other new genes involved in resistance were also analyzed. These results show that bacterial resistance to AMPs can occur in bacteria through many different mechanisms that need to be

  14. Resistance gene management: concepts and practice

    Science.gov (United States)

    Christopher C. Mundt

    2012-01-01

    There is now a very long history of genetics/breeding for disease resistance in annual crops. These efforts have resulted in conceptual advances and frustrations, as well as practical successes and failures. This talk will review this history and its relevance to the genetics of resistance in forest species. All plant breeders and pathologists are familiar with boom-...

  15. Analysis of metal and biocides resistance genes in drug resistance and susceptible Salmonella enterica from food animals

    Science.gov (United States)

    Background Generally drug resistant bacteria carry antibiotic resistance genes and heavy metal and biocide resistance genes on large conjugative plasmids. The presence of these metal and biocide resistance genes in susceptible bacteria are not assessed comprehensively. Hence, WGS data of susceptib...

  16. The antimicrobial resistance crisis: management through gene monitoring

    Science.gov (United States)

    2016-01-01

    Antimicrobial resistance (AMR) is an acknowledged crisis for humanity. Its genetic origins and dire potential outcomes are increasingly well understood. However, diagnostic techniques for monitoring the crisis are currently largely limited to enumerating the increasing incidence of resistant pathogens. Being the end-stage of the evolutionary process that produces antimicrobial resistant pathogens, these measurements, while diagnostic, are not prognostic, and so are not optimal in managing this crisis. A better test is required. Here, using insights from an understanding of evolutionary processes ruling the changing abundance of genes under selective pressure, we suggest a predictive framework for the AMR crisis. We then discuss the likely progression of resistance for both existing and prospective antimicrobial therapies. Finally, we suggest that by the environmental monitoring of resistance gene frequency, resistance may be detected and tracked presumptively, and how this tool may be used to guide decision-making in the local and global use of antimicrobials. PMID:27831476

  17. The Number of Genes Controlling Resistance in Beans to Common ...

    African Journals Online (AJOL)

    Ten crosses were made between resistant (R), susceptible (S), RxS susceptible and Intermediate (I), SxI and RxR bean lines to common bacterial blight. The F1 were advanced to F2 and in each cross over 250 F2 plants were used to evaluate for the number of genes controlling resistance using Mendelian genetics and ...

  18. Prevalence, antibiotic-resistance properties and enterotoxin gene ...

    African Journals Online (AJOL)

    Prevalence, antibiotic-resistance properties and enterotoxin gene profile of Bacillus cereus strains isolated from milk-based baby foods. ... Conclusion: Considerable prevalence of resistant and toxigenic B. cereus and high consumption of milk-based infant foods in Iran, represent an important public health issue which ...

  19. Occurrence and reservoirs of antibiotic resistance genes in the environment

    NARCIS (Netherlands)

    Seveno, N.; Kallifidas, D.; Smalla, K.; Elsas, van J.D.; Collard, J.M.; Karagouni, A.; Wellington, E.M.H.

    2002-01-01

    Antibiotic resistance genes have become highly mobile since the development of antibiotic chemotherapy. A considerable body of evidence exists proving the link between antibiotic use and the significant increase in drug-resistant human bacterial pathogens. The application of molecular detection and

  20. Identification of bacterial blight resistance genes Xa4 in Pakistani ...

    African Journals Online (AJOL)

    Identification of bacterial blight resistance genes Xa4 in Pakistani rice germplasm using PCR. M Arif, M Jaffar, M Babar, MA Sheikh, S Kousar, A Arif, Y Zafar. Abstract. Bacterial blight (BB) caused by Xanthomonas oryzae pv oryzae (Xoo) is a major biotic constraint in the irrigated rice belts. Genetic resistance is the most ...

  1. Spread of tetracycline resistance genes at a conventional dairy farm

    NARCIS (Netherlands)

    Kyselková, Martina; Jirout, Jiří; Vrchotová, Naděžda; Schmitt, Heike; Elhottová, Dana

    2015-01-01

    The use of antibiotics in animal husbandry contributes to the worldwide problem of increasing antibiotic resistance in animal and human pathogens. Intensive animal production is considered an important source of antibiotic resistance genes released to the environment, while the contribution of

  2. gene effects for resistance to groundnut rossette disease in exotic ...

    African Journals Online (AJOL)

    ACSS

    2016-02-25

    Feb 25, 2016 ... Opposite and significant signs of dominance [d] and dominance × dominance [l] components indicated the importance of duplicate epitasis in the latter crosses in the control of GRD resistance, which revealed a complex nature of inheritance of GRD resistance. Key Words: Arachis hypogaea, gene effects, ...

  3. Progress on introduction of rust resistance genes into confection sunflower

    Science.gov (United States)

    Sunflower rust (Puccinia helianthi) emerged as a serious disease in the last few years. Confection sunflower is particularly vulnerable to the disease due to the lack of resistance sources. The objectives of this project are to transfer rust resistance genes from oil sunflower to confectionery sunfl...

  4. Isolation and characterization of a candidate gene for resistance to ...

    African Journals Online (AJOL)

    ARC) domain, and a leucine-rich repeat (LRR) domain, all of which are typical characteristics of resistance genes. We proposed the resistance mechanism of CreV8 based on functional analysis and predictions from its conserved domains and ...

  5. Identification of virus and nematode resistance genes in the Chilota Potato Genebank of the Universidad Austral de Chile

    Directory of Open Access Journals (Sweden)

    Marlon López

    2015-09-01

    Full Text Available Potato Genebank of the Universidad Austral de Chile (UACh is an important gene bank in Chile. The accessions collected all over the country possess high genetic diversity, present interesting agronomic and cooking traits, and show resistance to biotic and abiotic stress. A particularly interesting subgroup of the gene bank includes the accessions collected in the South of Chile, the Chilota Potato Genebank. The focus of this study is the identification of virus and nematode resistant genes in potatoes (Solatium tuberosum L., using the RYSC3 and YES3-3B molecular markers. The Potato virus Y(PVY resistance genes Ry adg and Ry sto were identified. Furthermore, the CP60 marker was used to assess the Rx resistance gene that confers resistance to Potato virus X (PVX. In addition, the HC and GRO1-4 markers were utilized to identify the GpaVvrn_QTL and Gro1-4, resistance genes of Globodera pallida and Globodera rostochiensis, respectively. Both G. pallida and G. rostochiensis are Potato Cyst Nematodes (PCN. The plant material used in this study included leaves from 271 accessions of the gene bank. These samples were collected in the field where natural pathogen pressure of potential viruses and diseases exists. ELISA assays were run for field detection of PVY and PVX. However, there have been no previous reports of nematode presence in the plant material. The results herein presented indicate presence of virus and nematode resistance genes in accessions of the Chilota Potato Genebank. In terms of virus resistance, 99 accessions out of the 271 tested possess the Ry adg resistance gene and 17 accessions of these 271 tested have the Ry sto resistance gene. Also, 10 accessions showed positive amplification of the Rxl resistant gene marker. As to nematode resistance, 99 accessions have possible resistance to G. pallida and 54 accessions show potential resistance to G. rostochiensis as detected using the available molecular markers.

  6. Gene pyramiding enhances durable blast disease resistance in rice

    OpenAIRE

    Fukuoka, Shuichi; Saka, Norikuni; Mizukami, Yuko; Koga, Hironori; Yamanouchi, Utako; Yoshioka, Yosuke; Hayashi, Nagao; Ebana, Kaworu; Mizobuchi, Ritsuko; Yano, Masahiro

    2015-01-01

    Effective control of blast, a devastating fungal disease of rice, would increase and stabilize worldwide food production. Resistance mediated by quantitative trait loci (QTLs), which usually have smaller individual effects than R-genes but confer broad-spectrum or non-race-specific resistance, is a promising alternative to less durable race-specific resistance for crop improvement, yet evidence that validates the impact of QTL combinations (pyramids) on the durability of plant disease resista...

  7. Marfan syndrome with a complex chromosomal rearrangement including deletion of the FBN1 gene

    Directory of Open Access Journals (Sweden)

    Colovati Mileny ES

    2012-01-01

    Full Text Available Abstract Background The majority of Marfan syndrome (MFS cases is caused by mutations in the fibrillin-1 gene (FBN1, mapped to chromosome 15q21.1. Only few reports on deletions including the whole FBN1 gene, detected by molecular cytogenetic techniques, were found in literature. Results We report here on a female patient with clinical symptoms of the MFS spectrum plus craniostenosis, hypothyroidism and intellectual deficiency who presents a 1.9 Mb deletion, including the FBN1 gene and a complex rearrangement with eight breakpoints involving chromosomes 6, 12 and 15. Discussion This is the first report of MFS with a complex chromosome rearrangement involving a deletion of FBN1 and contiguous genes. In addition to the typical clinical findings of the Marfan syndrome due to FBN1 gene haploinsufficiency, the patient presents features which may be due to the other gene deletions and possibly to the complex chromosome rearrangement.

  8. Shotgun metagenomics reveals a wide array of antibiotic resistance genes and mobile elements in a polluted lake in India

    Directory of Open Access Journals (Sweden)

    Johan eBengtsson-Palme

    2014-12-01

    Full Text Available There is increasing evidence for an environmental origin of many antibiotic resistance genes. Consequently, it is important to identify environments of particular risk for selecting and maintaining such resistance factors. In this study, we described the diversity of antibiotic resistance genes in an Indian lake subjected to industrial pollution with fluoroquinolone antibiotics. We also assessed the genetic context of the identified resistance genes, to try to predict their genetic transferability. The lake harbored a wide range of resistance genes (81 identified gene types against essentially every major class of antibiotics, as well as genes responsible for mobilization of genetic material. Resistance genes were estimated to be 7000 times more abundant than in a Swedish lake included for comparison, where only eight resistance genes were found. The sul2 and qnrD genes were the most common resistance genes in the Indian lake. Twenty-six known and twenty-one putative novel plasmids were recovered in the Indian lake metagenome, which, together with the genes found, indicate a large potential for horizontal gene transfer through conjugation. Interestingly, the microbial community of the lake still included a wide range of taxa, suggesting that, across most phyla, bacteria has adapted relatively well to this highly polluted environment. Based on the wide range and high abundance of known resistance factors we have detected, it is plausible that yet unrecognized resistance genes are also present in the lake. Thus, we conclude that environments polluted with waste from antibiotic manufacturing could be important reservoirs for mobile antibiotic resistance genes.

  9. Characterization of antimicrobial resistance genes in Haemophilus parasuis isolated from pigs in China.

    Science.gov (United States)

    Zhao, Yongda; Guo, Lili; Li, Jie; Huang, Xianhui; Fang, Binghu

    2018-01-01

    Haemophilus parasuis is a common porcine respiratory pathogen that causes high rates of morbidity and mortality in farmed swine. We performed a molecular characterization of antimicrobial resistance genes harbored by H. parasuis from pig farms in China. We screened 143 H. parasuis isolates for antimicrobial susceptibility against six fluoroquinolone antibiotics testing by the broth microdilution method, and the presence of 64 antimicrobial resistance genes by PCR amplification and DNA sequence analysis. We determined quinolone resistance determining region mutations of DNA gyrase ( gyrA and gyrB ) and topoisomerase IV ( parC and parE ). The genetic relatedness among the strains was analyzed by pulsed-field gel electrophoresis. Susceptibility test showed that all isolates were low resistance to lomefloxacin (28.67%), levofloxacin (20.28%), norfloxacin (22.38%), ciprofloxacin (23.78%), however, high resistance levels were found to nalidixic acid (82.52%) and enrofloxacin (55.94%). In addition, we found 14 antimicrobial resistance genes were present in these isolates, including bla TEM-1 , bla ROB-1 , ermB, ermA, flor, catl, tetB, tetC, rmtB, rmtD, aadA1, aac(3')-llc, sul1, and sul2 genes. Interestingly, one isolate carried five antibiotic resistance genes ( tetB, tetC, flor, rmtB, sul1 ). The genes tetB , rmtB, and flor were the most prevalent resistance genes in H. parasuis in China. Alterations in the gyrA gene (S83F/Y, D87Y/N/H/G) were detected in 81% of the strains and parC mutations were often accompanied by a gyrA mutation. Pulsed-field gel electrophoresis typing revealed 51 unique patterns in the isolates carrying high-level antibiotic resistance genes, indicating considerable genetic diversity and suggesting that the genes were spread horizontally. The current study demonstrated that the high antibiotic resistance of H. parasuis in piglets is a combination of transferable antibiotic resistance genes and multiple target gene mutations. These data provide novel

  10. Nucleotide diversity and linkage disequilibrium in 11 expressed resistance candidate genes in Lolium perenne

    Directory of Open Access Journals (Sweden)

    Asp Torben

    2007-08-01

    Full Text Available Abstract Background Association analysis is an alternative way for QTL mapping in ryegrass. So far, knowledge on nucleotide diversity and linkage disequilibrium in ryegrass is lacking, which is essential for the efficiency of association analyses. Results 11 expressed disease resistance candidate (R genes including 6 nucleotide binding site and leucine rich repeat (NBS-LRR like genes and 5 non-NBS-LRR genes were analyzed for nucleotide diversity. For each of the genes about 1 kb genomic fragments were isolated from 20 heterozygous genotypes in ryegrass. The number of haplotypes per gene ranged from 9 to 27. On average, one single nucleotide polymorphism (SNP was present per 33 bp between two randomly sampled sequences for the 11 genes. NBS-LRR like gene fragments showed a high degree of nucleotide diversity, with one SNP every 22 bp between two randomly sampled sequences. NBS-LRR like gene fragments showed very high non-synonymous mutation rates, leading to altered amino acid sequences. Particularly LRR regions showed very high diversity with on average one SNP every 10 bp between two sequences. In contrast, non-NBS LRR resistance candidate genes showed a lower degree of nucleotide diversity, with one SNP every 112 bp. 78% of haplotypes occurred at low frequency ( Conclusion Substantial LD decay was found within a distance of 500 bp for most resistance candidate genes in this study. Hence, LD based association analysis is feasible and promising for QTL fine mapping of resistance traits in ryegrass.

  11. Paradoxical DNA repair and peroxide resistance gene conservation in Bacillus pumilus SAFR-032.

    Directory of Open Access Journals (Sweden)

    Jason Gioia

    Full Text Available BACKGROUND: Bacillus spores are notoriously resistant to unfavorable conditions such as UV radiation, gamma-radiation, H2O2, desiccation, chemical disinfection, or starvation. Bacillus pumilus SAFR-032 survives standard decontamination procedures of the Jet Propulsion Lab spacecraft assembly facility, and both spores and vegetative cells of this strain exhibit elevated resistance to UV radiation and H2O2 compared to other Bacillus species. PRINCIPAL FINDINGS: The genome of B. pumilus SAFR-032 was sequenced and annotated. Lists of genes relevant to DNA repair and the oxidative stress response were generated and compared to B. subtilis and B. licheniformis. Differences in conservation of genes, gene order, and protein sequences are highlighted because they potentially explain the extreme resistance phenotype of B. pumilus. The B. pumilus genome includes genes not found in B. subtilis or B. licheniformis and conserved genes with sequence divergence, but paradoxically lacks several genes that function in UV or H2O2 resistance in other Bacillus species. SIGNIFICANCE: This study identifies several candidate genes for further research into UV and H2O2 resistance. These findings will help explain the resistance of B. pumilus and are applicable to understanding sterilization survival strategies of microbes.

  12. Induced mutations of rust resistance genes in wheat

    International Nuclear Information System (INIS)

    McIntosh, R.A.

    1983-01-01

    Induced mutations are being used as a tool to study genes for resistance in wheat. It was found that Pm1 can be separated from Lr20 and Sr15, but these two react like a single pleiotropic gene. Mutants were further examined in crosses and backmutations have been attempted. (author)

  13. Characterization of genomic sequence of a drought-resistant gene ...

    Indian Academy of Sciences (India)

    Characterization of genomic sequence of a drought-resistant gene. TaSnRK2.7 in wheat species. HONG YING ZHANG1,2, WEI LI3, XIN GUO MAO1 and RUI LIAN JING1∗. 1The National Key Facility for Crop Gene Resources and Genetic Improvement, Institute of Crop Science,. Chinese Academy of Agricultural Sciences, ...

  14. Testing of disease-resistance of pokeweed antiviral protein gene ...

    African Journals Online (AJOL)

    Transformation of pokeweed antiviral protein gene (PAP) into plants was shown to improve plant resistance to several viruses or fungi pathogens with no much negative effect on plant growth. The non-virulent defective PAP inhibits only the virus but does not interfere with the host. A non-virulent defective PAP gene ...

  15. Isolation and characterization of a candidate gene for resistance to ...

    African Journals Online (AJOL)

    xudelin

    2012-05-17

    May 17, 2012 ... Cereal cyst nematode (CCN) (Heterodera avenae Woll.) is one of the most economically damaging endoparasite pests of wheat worldwide. We isolated and characterized a novel cereal CCN resistance candidate gene, CreV8, from Aegilops variabilis (2n = 28, UUSvSv). The gene was 3,568 bp long and.

  16. Cloning of synthetic gene including antigens against Urinary Tract Infections in pET28a+ vector

    Directory of Open Access Journals (Sweden)

    Zohreh Haghri

    2017-12-01

    Full Text Available There are many different bacterial infections in the world that patients are suffering from and research teams are trying to find suitable ways to prevent and treat them. Urinary Tract Infections (UTIs are most important infections in the world , and they are more common among women because vaginal cavity is near to urethral opening. The aim of this study is cloning of synthetic gene include antigens against UTIs in pET28a+ vector. Antibiotic resistant has been increasing because of antibiotic overuse recently, so It shows the necessity of developing a vaccine against these infections. There for, it will be imperative to develop a vaccine instead of antibiotics. This infection causes by many organisms, most important of which are Uropathogenic Escherichia coli (UPEC, Proteus mirabilis and Klebsiella pneumoniae Uropathogenic Escherichia .coli is the most important microorganism that causes these infections more than other bacteria, so in developing a vaccine it is the most important one, that have to be considered. The synthetic Gene which was designed against these three bacteria including antigens which are important and common to cause these infections. This gene has involved 1293bp. It was ordered to Gene Ray Biotechnology. Primers were designed by Gene Runner. Gene and pET28a+ vector was checked by SnappGene. Synthetic gene was multiplied by PCR and cloned in pET28a+ vector. Construct was transformed into E. coli TOP10.The clone was confirmed by PCR, Digestion. This data indicates that this gene can be expressed and it might be a vaccine candidate to protect people from these infections in the future.

  17. Identification of a soybean rust resistance gene in PI 567104B.

    Science.gov (United States)

    Liu, Min; Li, Shuxian; Swaminathan, Sivakumar; Sahu, Binod B; Leandro, Leonor F; Cardinal, Andrea J; Bhattacharyya, Madan K; Song, Qijian; Walker, David R; Cianzio, Silvia R

    2016-05-01

    Using a combination of phenotypic screening and molecular, statistical, and linkage analyses, we have mapped a dominant soybean rust resistance gene in soybean PI 567104B. Asian soybean rust (SBR), caused by the fungus Phakopsora pachyrhizi Syd. and P. Syd., is one of the most economically important diseases that affect soybean production worldwide. A long-term strategy for minimizing the effects of SBR is the development of genetically resistant cultivars. The objectives of the study were to identify the location of a rust-resistance (Rpp) gene(s) in plant introduction (PI) 567104B, and to determine if the gene(s) in PI 567104B was different from previously mapped Rpp loci. The progeny of the cross of 'IAR 2001 BSR' × PI 567104B was phenotyped from field assays of the F 2:3 and F 4:5 generations and from a growth chamber assay of 253 F 5:6 recombinant inbred lines (RILs). For the growth chamber, the phenotyping was conducted by inoculation with a purified 2006 fungal isolate from Mississippi. A resistance gene locus on PI 567104B was mapped to a region containing the Rpp6 locus on chromosome 18. The high level of resistance of F 1 plants from two other crosses with PI 567104B as one of the parents indicated that the gene from PI 567104B was dominant. The interval containing the gene is flanked by the simple sequence repeat (SSR) markers Satt131 and Satt394, and includes the SSR markers BARCSOYSSR_18_0331 and BARCSOYSSR_18_0380. The results also indicated that the resistance gene from PI 567104B is different from the Rpp1 to the Rpp4 genes previously identified. To determine if the gene from PI 567104B is different from the Rpp6 gene from PI 567102B, additional research will be required.

  18. Dissection of Resistance Genes to Pseudomonas syringae pv. phaseolicola in UI3 Common Bean Cultivar

    Directory of Open Access Journals (Sweden)

    Ana M. González

    2017-11-01

    Full Text Available Few quantitative trait loci have been mapped for resistance to Pseudomonas syringae pv. phaseolicola in common bean. Two F2 populations were developed from the host differential UI3 cultivar. The objective of this study was to further characterize the resistance to races 1, 5, 7 and 9 of Psp included in UI3. Using a QTL mapping approach, 16 and 11 main-effect QTLs for pod and primary leaf resistance were located on LG10, explaining up to 90% and 26% of the phenotypic variation, respectively. The homologous genomic region corresponding to primary leaf resistance QTLs detected tested positive for the presence of resistance-associated gene cluster encoding nucleotide-binding and leucine-rich repeat (NL, Natural Resistance Associated Macrophage (NRAMP and Pentatricopeptide Repeat family (PPR proteins. It is worth noting that the main effect QTLs for resistance in pod were located inside a 3.5 Mb genomic region that included the Phvul.010G021200 gene, which encodes a protein that has the highest sequence similarity to the RIN4 gene of Arabidopsis, and can be considered an important candidate gene for the organ-specific QTLs identified here. These results support that resistance to Psp from UI3 might result from the immune response activated by combinations of R proteins, and suggest the guard model as an important mechanism in pod resistance to halo blight. The candidate genes identified here warrant functional studies that will help in characterizing the actual defense gene(s in UI3 genotype.

  19. Urinary tract infections in hospital pediatrics: many previous antibiotherapy and antibiotics resistance, including fluoroquinolones.

    Science.gov (United States)

    Garraffo, A; Marguet, C; Checoury, A; Boyer, S; Gardrat, A; Houivet, E; Caron, F

    2014-02-01

    We studied antibiotic resistance in pediatric UTIs and we evaluated the impact of antibiotic exposure in the previous 12 months, very little French data being available for this population. We conducted a multicenter prospective study including children consulting for, or admitted in 2 hospitals. Prior antibiotic exposure was documented from their health record. One hundred and ten patients (73 girls), 11 days to 12 years of age, were included in 10 months. Ninety-six percent presented with pyelonephritis, associated to uropathy for 25%. Escherichia coli was predominant (78%), followed by Proteus spp. and Enterococcus spp. The antibiotic resistance rate of E. coli was high and close to that reported for adults with complicated UTIs: amoxicillin 60%, amoxicillin-clavulanate 35%, cefotaxim 5%, trimethoprim-sulfametoxazole 26%, nalidixic acid 9%, ciprofloxacin 7%, gentamycin 1%, nitrofurantoin and fosfomycin 0%. The antibiotic exposure in the previous 12 months involved 62 children (56%) most frequently with β-lactams (89%) for a respiratory tract infection (56%). A clear relationship between exposure and resistance was observed for amoxicillin (71% vs. 46%), first generation (65% vs. 46%) and third generation (9% vs. 3%) cephalosporins, or trimethoprim-sulfamethoxazole (36% vs. 15%). However, antibiotic exposure could not account alone for the results, as suggested by the 7% of ciprofloxacin resistance, observed without any identified previous treatment. Bacterial species and antibiotic resistance level in children are similar to those reported for adults. Antibiotic exposure in the previous 12 months increases the risk of resistance but other factors are involved (previous antibiotic therapies and fecal-oral or mother-to-child transmission). Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  20. The Lr34 adult plant rust resistance gene provides seedling resistance in durum wheat without senescence.

    Science.gov (United States)

    Rinaldo, Amy; Gilbert, Brian; Boni, Rainer; Krattinger, Simon G; Singh, Davinder; Park, Robert F; Lagudah, Evans; Ayliffe, Michael

    2017-07-01

    The hexaploid wheat (Triticum aestivum) adult plant resistance gene, Lr34/Yr18/Sr57/Pm38/Ltn1, provides broad-spectrum resistance to wheat leaf rust (Lr34), stripe rust (Yr18), stem rust (Sr57) and powdery mildew (Pm38) pathogens, and has remained effective in wheat crops for many decades. The partial resistance provided by this gene is only apparent in adult plants and not effective in field-grown seedlings. Lr34 also causes leaf tip necrosis (Ltn1) in mature adult plant leaves when grown under field conditions. This D genome-encoded bread wheat gene was transferred to tetraploid durum wheat (T. turgidum) cultivar Stewart by transformation. Transgenic durum lines were produced with elevated gene expression levels when compared with the endogenous hexaploid gene. Unlike nontransgenic hexaploid and durum control lines, these transgenic plants showed robust seedling resistance to pathogens causing wheat leaf rust, stripe rust and powdery mildew disease. The effectiveness of seedling resistance against each pathogen correlated with the level of transgene expression. No evidence of accelerated leaf necrosis or up-regulation of senescence gene markers was apparent in these seedlings, suggesting senescence is not required for Lr34 resistance, although leaf tip necrosis occurred in mature plant flag leaves. Several abiotic stress-response genes were up-regulated in these seedlings in the absence of rust infection as previously observed in adult plant flag leaves of hexaploid wheat. Increasing day length significantly increased Lr34 seedling resistance. These data demonstrate that expression of a highly durable, broad-spectrum adult plant resistance gene can be modified to provide seedling resistance in durum wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  1. Interspecies gene transfer provides soybean resistance to a fungal pathogen.

    Science.gov (United States)

    Langenbach, Caspar; Schultheiss, Holger; Rosendahl, Martin; Tresch, Nadine; Conrath, Uwe; Goellner, Katharina

    2016-02-01

    Fungal pathogens pose a major challenge to global crop production. Crop varieties that resist disease present the best defence and offer an alternative to chemical fungicides. Exploiting durable nonhost resistance (NHR) for crop protection often requires identification and transfer of NHR-linked genes to the target crop. Here, we identify genes associated with NHR of Arabidopsis thaliana to Phakopsora pachyrhizi, the causative agent of the devastating fungal disease called Asian soybean rust. We transfer selected Arabidopsis NHR-linked genes to the soybean host and discover enhanced resistance to rust disease in some transgenic soybean lines in the greenhouse. Interspecies NHR gene transfer thus presents a promising strategy for genetically engineered control of crop diseases. © 2015 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  2. Deinococcus geothermalis: The Pool of Extreme Radiation Resistance Genes Shrinks

    Energy Technology Data Exchange (ETDEWEB)

    Makarova, Kira S. [National Center for Biotechnology Information; Omelchenko, Marina [National Center for Biotechnology Information; Gaidamakova, Elena [Uniformed Services University of the Health Sciences (USUHS); Matrosova, Vera [Uniformed Services University of the Health Sciences (USUHS); Vasilenko, Alexander [Uniformed Services University of the Health Sciences (USUHS); Zhai, Min [Uniformed Services University of the Health Sciences (USUHS); Lapidus, Alla L. [U.S. Department of Energy, Joint Genome Institute; Copeland, A [U.S. Department of Energy, Joint Genome Institute; Kim, Edwin [U.S. Department of Energy, Joint Genome Institute; Land, Miriam L [ORNL; Mavromatis, K [U.S. Department of Energy, Joint Genome Institute; Pitluck, Samual [U.S. Department of Energy, Joint Genome Institute; Richardson, P M [U.S. Department of Energy, Joint Genome Institute; Detter, J. Chris [U.S. Department of Energy, Joint Genome Institute; Brettin, Tom [Los Alamos National Laboratory (LANL); Saunders, Elizabeth H [Los Alamos National Laboratory (LANL); Lai, Barry [Argonne National Laboratory (ANL); Ravel, Bruce [Argonne National Laboratory (ANL); Kemner, Kenneth M [Argonne National Laboratory (ANL); Wolf, Yuri [National Center for Biotechnology Information; Sorokin, Alexei [Genetique Microbienne; Gerasimova, Anna [Research Institute of Genetics and Selection of Industrial Microorganisms, Mosco; Gelfand, Mikhail [Moscow State University; Fredrickson, James K [Pacific Northwest National Laboratory (PNNL); Koonin, Eugene [National Center for Biotechnology Information; Daly, Michael [Uniformed Services University of the Health Sciences (USUHS)

    2007-01-01

    Bacteria of the genus Deinococcus are extremely resistant to ionizing radiation (IR), ultraviolet light (UV) and desiccation. The mesophile Deinococcus radiodurans was the first member of this group whose genome was completely sequenced. Analysis of the genome sequence of D. radiodurans, however, failed to identify unique DNA repair systems. To further delineate the genes underlying the resistance phenotypes, we report the whole-genome sequence of a second Deinococcus species, the thermophile Deinococcus geothermalis, which at its optimal growth temperature is as resistant to IR, UV and desiccation as D. radiodurans, and a comparative analysis of the two Deinococcus genomes. Many D. radiodurans genes previously implicated in resistance, but for which no sensitive phenotype was observed upon disruption, are absent in D. geothermalis. In contrast, most D. radiodurans genes whose mutants displayed a radiation-sensitive phenotype in D. radiodurans are conserved in D. geothermalis. Supporting the existence of a Deinococcus radiation response regulon, a common palindromic DNA motif was identified in a conserved set of genes associated with resistance, and a dedicated transcriptional regulator was predicted. We present the case that these two species evolved essentially the same diverse set of gene families, and that the extreme stress-resistance phenotypes of the Deinococcus lineage emerged progressively by amassing cell-cleaning systems from different sources, but not by acquisition of novel DNA repair systems. Our reconstruction of the genomic evolution of the Deinococcus-Thermus phylum indicates that the corresponding set of enzymes proliferated mainly in the common ancestor of Deinococcus. Results of the comparative analysis weaken the arguments for a role of higher-order chromosome alignment structures in resistance; more clearly define and substantially revise downward the number of uncharacterized genes that might participate in DNA repair and contribute to

  3. Deinococcus geothermalis: The Pool of Extreme Radiation Resistance Genes Shrinks

    Energy Technology Data Exchange (ETDEWEB)

    Makarova, Kira S.; Omelchenko, Marina V.; Gaidamakova, Elena K.; Matrosova, Vera Y.; Vasilenko, Alexander; Zhai, Min; Lapidus, Alla; Copeland, Alex; Kim, Edwin; Land, Miriam; Mavrommatis, Konstantinos; Pitluck, Samuel; Richardson, Paul M.; Detter, Chris; Brettin, Thomas; Saunders, Elizabeth; Lai, Barry; Ravel, Bruce; Kemner, Kenneth M.; Wolf, Yuri I.; Sorokin, Alexander; Gerasimova, Anna V.; Gelfand, Mikhail S.; Fredrickson, James K.; Koonin, Eugene V.; Daly, Michael J.

    2007-07-24

    Bacteria of the genus Deinococcus are extremely resistant to ionizing radiation (IR), ultraviolet light (UV) and desiccation. The mesophile Deinococcus radiodurans was the first member of this group whose genome was completely sequenced. Analysis of the genome sequence of D. radiodurans, however, failed to identify unique DNA repair systems. To further delineate the genes underlying the resistance phenotypes, we report the whole-genome sequence of a second Deinococcus species, the thermophile Deinococcus geothermalis, which at itsoptimal growth temperature is as resistant to IR, UV and desiccation as D. radiodurans, and a comparative analysis of the two Deinococcus genomes. Many D. radiodurans genes previously implicated in resistance, but for which no sensitive phenotype was observed upon disruption, are absent in D. geothermalis. In contrast, most D. radiodurans genes whose mutants displayed a radiation-sensitive phenotype in D. radiodurans are conserved in D. geothermalis. Supporting the existence of a Deinococcus radiation response regulon, a common palindromic DNA motif was identified in a conserved set of genes associated with resistance, and a dedicated transcriptional regulator was predicted. We present the case that these two species evolved essentially the same diverse set of gene families, and that the extreme stress-resistance phenotypes of the Deinococcus lineage emerged progressively by amassing cell-cleaning systems from different sources, but not by acquisition of novel DNA repair systems. Our reconstruction of the genomic evolution of the Deinococcus-Thermus phylum indicates that the corresponding set of enzymes proliferated mainly in the common ancestor of Deinococcus. Results of the comparative analysis weaken the arguments for a role of higher-order chromosome alignment structures in resistance; more clearly define and substantially revise downward the number of uncharacterized genes that might participate in DNA repair and contribute to

  4. Antibiotic resistance and virulence genes in coliform water isolates.

    Science.gov (United States)

    Stange, C; Sidhu, J P S; Tiehm, A; Toze, S

    2016-11-01

    Widespread fecal pollution of surface water may present a major health risk and a significant pathway for dissemination of antibiotic resistance bacteria. The River Rhine is one of the longest and most important rivers in Europe and an important raw water source for drinking water production. A total of 100 coliform isolates obtained from River Rhine (Germany) were examined for their susceptibility to seven antimicrobial agents. Resistances against amoxicillin, trimethoprim/sulfamethoxazole and tetracycline were detected in 48%, 11% and 9% of isolates respectively. The antibiotic resistance could be traced back to the resistance genes bla TEM , bla SHV , ampC, sul1, sul2, dfrA1, tet(A) and tet(B). Whereby, the ampC gene represents a special case, because its presence is not inevitably linked to a phenotypic antibiotic resistance. Multiple antibiotics resistance was often accompanied by the occurrence of class 1 or 2 integrons. E. coli isolates belonging to phylogenetic groups A and B1 (commensal) were more predominant (57%) compared to B2 and D groups (43%) which are known to carry virulent genes. Additionally, six E. coli virulence genes were also detected. However, the prevalence of virulence genes in the E. coli isolates was low (not exceeding 4.3% per gene) and no diarrheagenic E. coli pathotypes were detected. This study demonstrates that surface water is an important reservoir of ARGs for a number of antibiotic classes such as sulfonamide, trimethoprim, beta-lactam-antibiotics and tetracycline. The occurrence of antibiotic resistance in coliform bacteria isolated from River Rhine provides evidence for the need to develop management strategies to limit the spread of antibiotic resistant bacteria in aquatic environment. Copyright © 2016 Elsevier GmbH. All rights reserved.

  5. Deinococcus geothermalis: the pool of extreme radiation resistance genes shrinks.

    Directory of Open Access Journals (Sweden)

    Kira S Makarova

    2007-09-01

    Full Text Available Bacteria of the genus Deinococcus are extremely resistant to ionizing radiation (IR, ultraviolet light (UV and desiccation. The mesophile Deinococcus radiodurans was the first member of this group whose genome was completely sequenced. Analysis of the genome sequence of D. radiodurans, however, failed to identify unique DNA repair systems. To further delineate the genes underlying the resistance phenotypes, we report the whole-genome sequence of a second Deinococcus species, the thermophile Deinococcus geothermalis, which at its optimal growth temperature is as resistant to IR, UV and desiccation as D. radiodurans, and a comparative analysis of the two Deinococcus genomes. Many D. radiodurans genes previously implicated in resistance, but for which no sensitive phenotype was observed upon disruption, are absent in D. geothermalis. In contrast, most D. radiodurans genes whose mutants displayed a radiation-sensitive phenotype in D. radiodurans are conserved in D. geothermalis. Supporting the existence of a Deinococcus radiation response regulon, a common palindromic DNA motif was identified in a conserved set of genes associated with resistance, and a dedicated transcriptional regulator was predicted. We present the case that these two species evolved essentially the same diverse set of gene families, and that the extreme stress-resistance phenotypes of the Deinococcus lineage emerged progressively by amassing cell-cleaning systems from different sources, but not by acquisition of novel DNA repair systems. Our reconstruction of the genomic evolution of the Deinococcus-Thermus phylum indicates that the corresponding set of enzymes proliferated mainly in the common ancestor of Deinococcus. Results of the comparative analysis weaken the arguments for a role of higher-order chromosome alignment structures in resistance; more clearly define and substantially revise downward the number of uncharacterized genes that might participate in DNA repair and

  6. Genes involved in barley yellow dwarf virus resistance of maize.

    Science.gov (United States)

    Horn, Frederike; Habekuß, Antje; Stich, Benjamin

    2014-12-01

    The results of our study suggest that genes involved in general resistance mechanisms of plants contribute to variation of BYDV resistance in maize. With increasing winter temperatures in Europe, Barley yellow dwarf virus (BYDV) is expected to become a prominent problem in maize cultivation. Breeding for resistance is the best strategy to control the disease and break the transmission cycle of the virus. The objectives of our study were (1) to determine genetic variation with respect to BYDV resistance in a broad germplasm set and (2) to identify single nucleotide polymorphism (SNP) markers linked to genes that are involved in BYDV resistance. An association mapping population with 267 genotypes representing the world's maize gene pool was grown in the greenhouse. Plants were inoculated with BYDV-PAV using viruliferous Rhopalosiphum padi. In the association mapping population, we observed considerable genotypic variance for the trait virus extinction as measured by double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) and the infection rate. In a genome-wide association study, we observed three SNPs significantly [false discovery rate (FDR) = 0.05] associated with the virus extinction on chromosome 10 explaining together 25 % of the phenotypic variance and five SNPs for the infection rate on chromosomes 4 and 10 explaining together 33 % of the phenotypic variance. The SNPs significantly associated with BYDV resistance can be used in marker assisted selection and will accelerate the breeding process for the development of BYDV resistant maize genotypes. Furthermore, these SNPs were located within genes which were in other organisms described to play a role in general resistance mechanisms. This suggests that these genes contribute to variation of BYDV resistance in maize.

  7. Transcriptomic analysis of colistin-susceptible and colistin-resistant isolates identifies genes associated with colistin resistance in Acinetobacter baumannii.

    Science.gov (United States)

    Park, Y K; Lee, J-Y; Ko, K S

    2015-08-01

    The emergence of colistin-resistant Acinetobacter baumannii is concerning, as colistin is often regarded as the last option for treating multidrug-resistant (MDR) A. baumannii infections. Using mRNA sequencing, we compared whole transcriptomes of colistin-susceptible and colistin-resistant A. baumannii strains, with the aim of identifying genes involved in colistin resistance. A clinical colistin-susceptible strain (06AC-179) and a colistin-resistant strain (07AC-052) were analysed in this study. In addition, a colistin-resistant mutant (06AC-179-R1) derived from 06AC-179 was also included in this study. High throughput mRNA sequencing was performed with an Illumina HiSeq TM 2000. In total, six genes were identified as associated with colistin resistance in A. baumannii. These six genes encode PmrAB two-component regulatory enzymes, PmrC (a lipid A phosphoethanolamine transferase), a glycosyltransferase, a poly-β-1,6-N-acetylglucosamine deacetylase, and a putative membrane protein. Matrix-assisted laser desorption/ionization time of flight mass spectrometry revealed that all three colistin-resistant strains used in this study had modified lipid A structure by addition of phosphoethanolamine. As genes found in our results are all associated with either lipopolysaccharide biosynthesis or electrostatic changes in the bacterial cell membrane, lipopolysaccharide modification might be one of the principal modes of acquisition of colistin resistance in some A. baumannii strains. Copyright © 2015 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  8. Identifying resistance gene analogs associated with resistances to different pathogens in common bean.

    Science.gov (United States)

    López, Camilo E; Acosta, Iván F; Jara, Carlos; Pedraza, Fabio; Gaitán-Solís, Eliana; Gallego, Gerardo; Beebe, Steve; Tohme, Joe

    2003-01-01

    ABSTRACT A polymerase chain reaction approach using degenerate primers that targeted the conserved domains of cloned plant disease resistance genes (R genes) was used to isolate a set of 15 resistance gene analogs (RGAs) from common bean (Phaseolus vulgaris). Eight different classes of RGAs were obtained from nucleotide binding site (NBS)-based primers and seven from not previously described Toll/Interleukin-1 receptor-like (TIR)-based primers. Putative amino acid sequences of RGAs were significantly similar to R genes and contained additional conserved motifs. The NBS-type RGAs were classified in two subgroups according to the expected final residue in the kinase-2 motif. Eleven RGAs were mapped at 19 loci on eight linkage groups of the common bean genetic map constructed at Centro Internacional de Agricultura Tropical. Genetic linkage was shown for eight RGAs with partial resistance to anthracnose, angular leaf spot (ALS) and Bean golden yellow mosaic virus (BGYMV). RGA1 and RGA2 were associated with resistance loci to anthracnose and BGYMV and were part of two clusters of R genes previously described. A new major cluster was detected by RGA7 and explained up to 63.9% of resistance to ALS and has a putative contribution to anthracnose resistance. These results show the usefulness of RGAs as candidate genes to detect and eventually isolate numerous R genes in common bean.

  9. The relationship between codon usage bias and cold resistant genes

    International Nuclear Information System (INIS)

    Barozai, M.Y.; Din, M.

    2014-01-01

    This research is based on synonymous codon usage which has been well-known as a feature that affects typical expression level of protein in an organism. Different organisms prefer different codons for same amino acid and this is called Codon Usage Bias (CUB). The codon usage directly affects the level or even direction of changes in protein expression in responses to environmental stimuli. Cold stress is a major abiotic factor that limits the agricultural productivity of plants. In the recent study CUB has been studied in Arabidopsis thaliana cold resistant and housekeeping genes and their homologs in rice (Oryza sativa) to understand the cold stress and housekeeping genes relation with CUB. Six cold resistant and three housekeeping genes in Arabidopsis thaliana and their homologs in rice, were subjected to CUB analysis. The three cold resistant genes (DREB1B, RCI and MYB15) showed more than 50% (52%, 61% and 66% respectively) similar codon usage bias for Arabidopsis thaliana and rice. On the other hand three cold resistant genes (MPK3, ICE1 and ZAT12) showed less than 50% (38%, 38% and 47% respectively) similar codon usage bias for Arabidopsis thaliana and rice. The three housekeeping genes (Actin, Tubulin and Ubiquitin) showed 76% similar codon usage bias for Arabidopsis thaliana and rice. This study will help to manage the plant gene expression through codon optimization under the cold stress. (author)

  10. Multidrug resistance in fungi: regulation of transporter-encoding gene expression.

    Science.gov (United States)

    Paul, Sanjoy; Moye-Rowley, W Scott

    2014-01-01

    A critical risk to the continued success of antifungal chemotherapy is the acquisition of resistance; a risk exacerbated by the few classes of effective antifungal drugs. Predictably, as the use of these drugs increases in the clinic, more resistant organisms can be isolated from patients. A particularly problematic form of drug resistance that routinely emerges in the major fungal pathogens is known as multidrug resistance. Multidrug resistance refers to the simultaneous acquisition of tolerance to a range of drugs via a limited or even single genetic change. This review will focus on recent progress in understanding pathways of multidrug resistance in fungi including those of most medical relevance. Analyses of multidrug resistance in Saccharomyces cerevisiae have provided the most detailed outline of multidrug resistance in a eukaryotic microorganism. Multidrug resistant isolates of S. cerevisiae typically result from changes in the activity of a pair of related transcription factors that in turn elicit overproduction of several target genes. Chief among these is the ATP-binding cassette (ABC)-encoding gene PDR5. Interestingly, in the medically important Candida species, very similar pathways are involved in acquisition of multidrug resistance. In both C. albicans and C. glabrata, changes in the activity of transcriptional activator proteins elicits overproduction of a protein closely related to S. cerevisiae Pdr5 called Cdr1. The major filamentous fungal pathogen, Aspergillus fumigatus, was previously thought to acquire resistance to azole compounds (the principal antifungal drug class) via alterations in the azole drug target-encoding gene cyp51A. More recent data indicate that pathways in addition to changes in the cyp51A gene are important determinants in A. fumigatus azole resistance. We will discuss findings that suggest azole resistance in A. fumigatus and Candida species may share more mechanistic similarities than previously thought.

  11. Targeted introgression of a wheat stem rust resistance gene by DNA marker-assisted chromosome engineering genetics

    Science.gov (United States)

    In wheat (Triticum aestivum L.), stem rust resistance gene Sr39, derived from Aegilops speltoides Tausch, is highly resistant to multiple stem rust races including TTKSK (Ug99). However, the gene has not been used in wheat breeding because of linkage drag associated with the large 2S chromosome segm...

  12. Tetracycline Resistance Genes Identified from Distinct Soil Environments in China by Functional Metagenomics.

    Science.gov (United States)

    Wang, Shaochen; Gao, Xia; Gao, Yuejiao; Li, Yanqing; Cao, Mingming; Xi, Zhenhua; Zhao, Lixing; Feng, Zhiyang

    2017-01-01

    Soil microbiota represents one of the ancient evolutionary origins of antibiotic resistance and has been increasingly recognized as a potentially vast unstudied reservoir of resistance genes with possibilities to exchange with pathogens. Tetracycline resistance is one of the most abundant antibiotic resistances that may transfer among clinical and commensal microorganisms. To investigate tetracycline resistance genes from soil bacteria in different habitats, we performed functional analysis of three metagenomic libraries derived from soil samples collected from Yunnan, Sichuan, and Tibet, respectively, in China. We found efflux transporter genes form all the libraries, including 21 major facilitator superfamily efflux pump genes and one multidrug and toxic compound extrusion (MATE) transporter gene. Interestingly, we also identified two tetracycline destructase genes, belonging to a newly described family of tetracycline-inactivating enzymes that scarcely observed in clinical pathogens, from the Tibet library. The inactivation activity of the putative enzyme was confirmed in vitro by biochemical analysis. Our results indicated that efflux pumps distributed predominantly across habitats. Meanwhile, the mechanism of enzymatic inactivation for tetracycline resistance should not be neglected and merits further investigation.

  13. Tetracycline Resistance Genes Identified from Distinct Soil Environments in China by Functional Metagenomics

    Directory of Open Access Journals (Sweden)

    Shaochen Wang

    2017-07-01

    Full Text Available Soil microbiota represents one of the ancient evolutionary origins of antibiotic resistance and has been increasingly recognized as a potentially vast unstudied reservoir of resistance genes with possibilities to exchange with pathogens. Tetracycline resistance is one of the most abundant antibiotic resistances that may transfer among clinical and commensal microorganisms. To investigate tetracycline resistance genes from soil bacteria in different habitats, we performed functional analysis of three metagenomic libraries derived from soil samples collected from Yunnan, Sichuan, and Tibet, respectively, in China. We found efflux transporter genes form all the libraries, including 21 major facilitator superfamily efflux pump genes and one multidrug and toxic compound extrusion (MATE transporter gene. Interestingly, we also identified two tetracycline destructase genes, belonging to a newly described family of tetracycline-inactivating enzymes that scarcely observed in clinical pathogens, from the Tibet library. The inactivation activity of the putative enzyme was confirmed in vitro by biochemical analysis. Our results indicated that efflux pumps distributed predominantly across habitats. Meanwhile, the mechanism of enzymatic inactivation for tetracycline resistance should not be neglected and merits further investigation.

  14. The Order Bacillales Hosts Functional Homologs of the Worrisome cfr Antibiotic Resistance Gene

    DEFF Research Database (Denmark)

    Hansen, Lykke H.; Planellas, Mercè H.; Long, Katherine S.

    2012-01-01

    The cfr gene encodes the Cfr methyltransferase that methylates a single adenine in the peptidyl transferase region of bacterial ribosomes. The methylation provides resistance to several classes of antibiotics that include drugs of clinical and veterinary importance. This paper describes a first...... coli, and MICs for selected antibiotics indicate that the cfr-like genes confer resistance to PhLOPSa (phenicol, lincosamide, oxazolidinone, pleuromutilin, and streptogramin A) antibiotics in the same way as the cfr gene. In addition, modification at A2503 on 23S rRNA was confirmed by primer extension...

  15. Influence of Soil Use on Prevalence of Tetracycline, Streptomycin, and Erythromycin Resistance and Associated Resistance Genes

    Science.gov (United States)

    Rzeczycka, Marzenna; Miernik, Antoni; Krawczyk-Balska, Agata; Walsh, Fiona; Duffy, Brion

    2012-01-01

    This study examined differences in antibiotic-resistant soil bacteria and the presence and quantity of resistance genes in soils with a range of management histories. We analyzed four soils from agricultural systems that were amended with manure from animals treated with erythromycin and exposed to streptomycin and/or oxytetracycline, as well as non-manure-amended compost and forest soil. Low concentrations of certain antibiotic resistance genes were detected using multiplex quantitative real-time PCR (qPCR), with tet(B), aad(A), and str(A) each present in only one soil and tet(M) and tet(W) detected in all soils. The most frequently detected resistance genes were tet(B), tet(D), tet(O), tet(T), and tet(W) for tetracycline resistance, str(A), str(B), and aac for streptomycin resistance, and erm(C), erm(V), erm(X), msr(A), ole(B), and vga for erythromycin resistance. Transposon genes specific for Tn916, Tn1549, TnB1230, Tn4451, and Tn5397 were detected in soil bacterial isolates. The MIC ranges of isolated bacteria for tetracycline, streptomycin, and erythromycin were 8 to >256 μg/ml, 6 to >1,024 μg/ml, and 0.094 to >256 μg/ml, respectively. Based on 16S rRNA gene similarity, isolated bacteria showed high sequence identity to genera typical of soil communities. Bacteria with the highest MICs were detected in manure-amended soils or soils from agricultural systems with a history of antibiotic use. Non-manure-amended soils yielded larger proportions of antibiotic-resistant bacteria, but these had lower MICs, carried fewer antibiotic resistance genes, and did not display multidrug resistance (MDR). PMID:22203596

  16. Influence of soil use on prevalence of tetracycline, streptomycin, and erythromycin resistance and associated resistance genes.

    Science.gov (United States)

    Popowska, Magdalena; Rzeczycka, Marzenna; Miernik, Antoni; Krawczyk-Balska, Agata; Walsh, Fiona; Duffy, Brion

    2012-03-01

    This study examined differences in antibiotic-resistant soil bacteria and the presence and quantity of resistance genes in soils with a range of management histories. We analyzed four soils from agricultural systems that were amended with manure from animals treated with erythromycin and exposed to streptomycin and/or oxytetracycline, as well as non-manure-amended compost and forest soil. Low concentrations of certain antibiotic resistance genes were detected using multiplex quantitative real-time PCR (qPCR), with tet(B), aad(A), and str(A) each present in only one soil and tet(M) and tet(W) detected in all soils. The most frequently detected resistance genes were tet(B), tet(D), tet(O), tet(T), and tet(W) for tetracycline resistance, str(A), str(B), and aac for streptomycin resistance, and erm(C), erm(V), erm(X), msr(A), ole(B), and vga for erythromycin resistance. Transposon genes specific for Tn916, Tn1549, TnB1230, Tn4451, and Tn5397 were detected in soil bacterial isolates. The MIC ranges of isolated bacteria for tetracycline, streptomycin, and erythromycin were 8 to >256 μg/ml, 6 to >1,024 μg/ml, and 0.094 to >256 μg/ml, respectively. Based on 16S rRNA gene similarity, isolated bacteria showed high sequence identity to genera typical of soil communities. Bacteria with the highest MICs were detected in manure-amended soils or soils from agricultural systems with a history of antibiotic use. Non-manure-amended soils yielded larger proportions of antibiotic-resistant bacteria, but these had lower MICs, carried fewer antibiotic resistance genes, and did not display multidrug resistance (MDR).

  17. AMINOGLYCOSIDE RESISTANCE GENES IN Pseudomonas aeruginosa ISOLATES FROM CUMANA, VENEZUELA

    Directory of Open Access Journals (Sweden)

    Bertinellys TEIXEIRA

    2016-01-01

    Full Text Available The enzymatic modification of aminoglycosides by aminoglycoside-acetyltransferases (AAC, aminoglycoside-adenyltransferases (AAD, and aminoglycoside-phosphotransferases (APH, is the most common resistance mechanism in P. aeruginosa and these enzymes can be coded on mobile genetic elements that contribute to their dispersion. One hundred and thirty seven P. aeruginosa isolates from the University Hospital, Cumana, Venezuela (HUAPA were evaluated. Antimicrobial susceptibility was determined by the disk diffusion method and theaac, aadB and aph genes were detected by PCR. Most of the P. aeruginosa isolates (33/137 were identified from the Intensive Care Unit (ICU, mainly from discharges (96/137. The frequency of resistant P. aeruginosaisolates was found to be higher for the aminoglycosides tobramycin and amikacin (30.7 and 29.9%, respectively. Phenotype VI, resistant to these antibiotics, was the most frequent (14/49, followed by phenotype I, resistant to all the aminoglycosides tested (12/49. The aac(6´-Ib,aphA1 and aadB genes were the most frequently detected, and the simultaneous presence of several resistance genes in the same isolate was demonstrated. Aminoglycoside resistance in isolates ofP. aeruginosa at the HUAPA is partly due to the presence of the aac(6´-Ib, aphA1 andaadB genes, but the high rates of antimicrobial resistance suggest the existence of several mechanisms acting together. This is the first report of aminoglycoside resistance genes in Venezuela and one of the few in Latin America.

  18. Molecular Scree ning of Blast Resistance Genes in Rice Germplasms Resistant to Magnaporthe oryzae

    Directory of Open Access Journals (Sweden)

    Liang Yan

    2017-01-01

    Full Text Available Molecular screening of major rice blast resistance genes was determined with molecular markers, which showed close-set linkage to 11 major rice blast resistance genes (Pi-d2, Pi-z, Piz-t, Pi-9, Pi-36, Pi-37, Pi5, Pi-b, Pik-p, Pik-h and Pi-ta2, in a collection of 32 accessions resistant to Magnaporthe oryzae. Out of the 32 accessions, the Pi-d2 and Pi-z appeared to be omnipresent and gave positive express. As the second dominant, Pi-b and Piz-t gene frequencies were 96.9% and 87.5%. And Pik-h and Pik-p gene frequencies were 43.8% and 28.1%, respectively. The molecular marker linkage to Pi-ta2 produced positive bands in eleven accessions, while the molecular marker linkage to Pi-36 and Pi-37 in only three and four accessions, respectively. The natural field evaluation analysis showed that 30 of the 32 accessions were resistant, one was moderately resistant and one was susceptible. Infection types were negatively correlated with the genotype scores of Pi-9, Pi5, Pi-b, Pi-ta2 and Pik-p, although the correlation coefficients were very little. These results are useful in identification and incorporation of functional resistance genes from these germplasms into elite cultivars through marker-assisted selection for improved blast resistance in China and worldwide.

  19. Multifocal outbreaks of metallo-beta-lactamase-producing Pseudomonas aeruginosa resistant to broad-spectrum beta-lactams, including carbapenems.

    OpenAIRE

    Senda, K; Arakawa, Y; Nakashima, K; Ito, H; Ichiyama, S; Shimokata, K; Kato, N; Ohta, M

    1996-01-01

    A total of 3,700 Pseudomonas aeruginosa isolates were collected from 17 general hospitals in Japan from 1992 to 1994. Of these isolates, 132 carbapenem-resistant strains were subjected to DNA hybridization analysis with the metallo-beta-lactamase gene (blaIMP)-specific probe. Fifteen strains carrying the metallo-beta-lactamase gene were identified in five hospitals in different geographical areas. Three strains of P. aeruginosa demonstrated high-level imipenem resistance (MIC, > or = 128 micr...

  20. The rpg4/Rpg5 stem rust resistance locus in barley: resistance genes and cytoskeleton dynamics.

    Science.gov (United States)

    Brueggeman, Robert; Steffenson, Brian J; Kleinhofs, Andris

    2009-04-01

    Two closely linked resistance genes, rpg4 and Rpg5, conferring resistance to several races of Puccinia graminis, were cloned and characterized. The Rpg5 gene confers resistance to an isolate of Puccinia graminis f. sp. secalis (Pgs), while rpg4 confers resistance to Puccinia graminis f. sp. tritici (Pgt). Rpg5 is a novel gene containing nucleotide binding site-leucine rich repeat domains in combination with a serine threonine protein kinase domain. High-resolution mapping plus allele and recombinant sequencing identified the rpg4 gene, which encodes an actin depolymerizing factor-like protein (ADF2). Resistance against the Pgt races QCCJ, MCCF, TTKSK (aka Ug99) and RCRS requires both Rpg5 and rpg4, while Rpg5 alone confers resistance to Pgs isolate 92-MN-90. The dependency on the actin modifying protein ADF2 indicates cytoskeleton reorganization or redirection plays a role in pathogen-host interactions. Rpg5 may interact with ADF2 to activate or deactivate its function in the resistance response. Alternatively, Rpg5 could initiate signal transduction leading to resistance in response to detecting ADF2 protein modification. Pgt may redirect the actin cytoskeleton by inducing modifications of ADF2. The redirection of actin could possibly enable the pathogen to develop a haustoria-plant cell cytoskeleton interface for acquisition of nutrients.

  1. A novel gene of Kalanchoe daigremontiana confers plant drought resistance.

    Science.gov (United States)

    Wang, Li; Zhu, Chen; Jin, Lin; Xiao, Aihua; Duan, Jie; Ma, Luyi

    2018-02-07

    Kalanchoe (K.) daigremontiana is important for studying asexual reproduction under different environmental conditions. Here, we describe a novel KdNOVEL41 (KdN41) gene that may confer drought resistance and could thereby affect K. daigremontiana development. The detected subcellular localization of a KdN41/Yellow Fluorescent Protein (YFP) fusion protein was in the nucleus and cell membrane. Drought, salt, and heat stress treatment in tobacco plants containing the KdN41 gene promoter driving β-glucuronidase (GUS) gene transcription revealed that only drought stress triggered strong GUS staining in the vascular tissues. Overexpression (OE) of the KdN41 gene conferred improved drought resistance in tobacco plants compared to wild-type and transformed with empty vector plants by inducing higher antioxidant enzyme activities, decreasing cell membrane damage, increasing abscisic acid (ABA) content, causing reinforced drought resistance related gene expression profiles. The 3,3'-diaminobenzidine (DAB) and nitroblue tetrazolium (NBT) staining results also showed less relative oxygen species (ROS) content in KdN41-overexpressing tobacco leaf during drought stress. Surprisingly, by re-watering after drought stress, KdN41-overexpressing tobacco showed earlier flowering. Overall, the KdN41 gene plays roles in ROS scavenging and osmotic damage reduction to improve tobacco drought resistance, which may increase our understanding of the molecular network involved in developmental manipulation under drought stress in K. daigremontiana.

  2. Antibiotic resistance and resistance genes in Escherichia coli from poultry farms, southwest Nigeria

    OpenAIRE

    Adelowo, Olawale O.; Fagade, Obasola E.; Agersø, Yvonne

    2014-01-01

    Introduction: This study investigated the mechanisms of resistance in 36 E. coli isolated from waste, litter, soil and water samples collected from poultry farms in Southwestern Nigeria. Methodology: Minimum inhibitory concentration (MIC) distributions of the isolates were determined using the methods of the Clinical and Laboratory Standard Institute and resistance genes detected by PCR. Results: A total of 30 isolates (94%) showed resistance to more than one antimicrobial. Percentage resista...

  3. Antimicrobial resistance and resistance gene determinants in clinical Escherichia coli from different animal species in Switzerland.

    Science.gov (United States)

    Lanz, Roland; Kuhnert, Peter; Boerlin, Patrick

    2003-01-02

    Antimicrobial susceptibility testing was performed on a total of 581 clinical Escherichia coli isolates from diarrhea and edema disease in pigs, from acute mastitis in dairy cattle, from urinary tract infections in dogs and cats, and from septicemia in laying hens collected in Switzerland between 1999 and 2001. Among the 16 antimicrobial agents tested, resistance was most frequent for sulfonamides, tetracycline, and streptomycin. Isolates from swine presented significantly more resistance than those from the other animal species. The distribution of the resistance determinants for sulfonamides, tetracycline, and streptomycin was assessed by hybridization and PCR in resistant isolates. Significant differences in the distribution of resistance determinants for tetracycline (tetA, tetB) and sulfonamides (sulII) were observed between the isolates from swine and those from the other species. Resistance to sulfonamides could not be explained by known resistance mechanisms in more than a quarter of the sulfonamide-resistant and sulfonamide-intermediate isolates from swine, dogs and cats. This finding suggests that one or several new resistance mechanisms for sulfonamides may be widespread among E. coli isolates from these animal species. The integrase gene (intI) from class I integrons was detected in a large proportion of resistant isolates in association with the sulI and aadA genes, thus demonstrating the importance of integrons in the epidemiology of resistance in clinical E. coli isolates from animals.

  4. Confirmation of root-knot nematode resistant gene Rmi1 using SSR markers

    Directory of Open Access Journals (Sweden)

    Musarrat Ramzan

    2017-02-01

    Full Text Available Background: The Root Knot Nematode (RKN is a serious economic threat to various cultivated crops worldwide. It is a devastating pest of soybean and responsible to cause severe yield loss in Pakistan. The cultivation of resistant soybean varieties against this pest is the sustainable strategy to manage the heavy loss and increase yield. There is an utmost need to identify RKN resistant varieties of soybean against cultivated in Pakistan. The presented study is an attempt to identify and confirm the presence of resistant gene Rmi1 in soybean. Method: Molecular studies have been done using Simple Sequence Repeat (SSR marker system to identify resistant soybean varieties against Root Knot Nematode (RKN using fifteen (15 indigenous cultivars and four (4 US cultivars. DNA was isolated, purified, quantified and then used to employ various SSR markers. The amplified product is observed using gel documentation system after electrophoresis. Results: Diagnostic SSR markers Satt-358 and Satt-492 have shown the presence of Rmi1 gene in all resistance carrying genotypes. Satt-358 amplified the fragment of 200 bp and Satt-492 generated 232 bp bands in all resistant genotypes. This study confirmed the Rmi gene locus (G248A-1 in all internationally confirmed resistant including six (6 native varieties. Conclusion: These investigations have identified six (6 resistant cultivars revealing the effective and informative sources that can be utilized in breeding programs for the selection of RKN resistance soybean genotypes in Pakistan.

  5. Transcriptome analysis of Gerbera hybrid: including in silico confirmation of defence genes found

    Directory of Open Access Journals (Sweden)

    Yiqian eFu

    2016-03-01

    Full Text Available For the ornamental crop Gerbera hybrida, breeding at the moment is done using conventional methods. As this has drawbacks in breeding speed and efficiency, especially for complex traits like disease resistance, we set out to develop genomic resources. The leaf and flower bud transcriptomes of four parents, used to generate two gerbera populations, were sequenced using Illumina paired-end sequencing. In total, 36,770 contigs with an average length of 1397 bp were generated and these have been the starting point for SNP identification and annotation. The consensus contig sequences were used to map reads of individual parents, to identify genotype specific SNPs, and to assess the presence of common SNPs between genotypes.Comparison with the non-redundant protein database (nr showed that 29,146 contigs gave BLAST hits. Of sequences with blast results, 73.3% obtained a clear gene ontology (GO annotation. EST contigs coding for enzymes were found in Kyoto Encyclopedia of Genes and Genomes maps (KEGG. Through these annotated data and KEGG molecular interaction network, transcripts associated with the phenylpropanoid metabolism, other secondary metabolite biosynthesis pathways, phytohormone biosynthesis and signal transduction were analysed in more detail. Identifying genes involved in these processes could provide genetic and genomic resources for studying the mechanism of disease resistance in gerbera.

  6. Prevalence of tetracycline resistance genes among multi-drug resistant bacteria from selected water distribution systems in southwestern Nigeria.

    Science.gov (United States)

    Adesoji, Ayodele T; Ogunjobi, Adeniyi A; Olatoye, Isaac O; Call, Douglas R; Douglas, Douglas R

    2015-06-25

    Antibiotic resistance genes [ARGs] in aquatic systems have drawn increasing attention they could be transferred horizontally to pathogenic bacteria. Water treatment plants (WTPs) are intended to provide quality and widely available water to the local populace they serve. However, WTPs in developing countries may not be dependable for clean water and they could serve as points of dissemination for antibiotic resistant bacteria. Only a few studies have investigated the occurrence of ARGs among these bacteria including tetracycline resistance genes in water distribution systems in Nigeria. Multi-drug resistant (MDR) bacteria, including resistance to tetracycline, were isolated from treated and untreated water distribution systems in southwest Nigeria. MDR bacteria were resistant to >3 classes of antibiotics based on break-point assays. Isolates were characterized using partial 16S rDNA sequencing and PCR assays for six tetracycline-resistance genes. Plasmid conjugation was evaluated using E. coli strain DH5α as the recipient strain. Out of the 105 bacteria, 85 (81 %) and 20 (19 %) were Gram- negative or Gram- positive, respectively. Twenty-nine isolates carried at least one of the targeted tetracycline resistance genes including strains of Aeromonas, Alcaligenes, Bacillus, Klebsiella, Leucobacter, Morganella, Proteus and a sequence matching a previously uncultured bacteria. Tet(A) was the most prevalent (16/29) followed by tet(E) (4/29) and tet30 (2/29). Tet(O) was not detected in any of the isolates. Tet(A) was mostly found with Alcaligenes strains (9/10) and a combination of more than one resistance gene was observed only amongst Alcaligenes strains [tet(A) + tet30 (2/10), tet(A) + tet(E) (3/10), tet(E) + tet(M) (1/10), tet(E) + tet30 (1/10)]. Tet(A) was transferred by conjugation for five Alcaligenes and two E. coli isolates. This study found a high prevalence of plasmid-encoded tet(A) among Alcaligenes isolates, raising the possibility that this

  7. Vancomycin-resistance phenotypes, vancomycin-resistance genes, and resistance to antibiotics of enterococci isolated from food of animal origin.

    Science.gov (United States)

    Gousia, Panagiota; Economou, Vangelis; Bozidis, Petros; Papadopoulou, Chrissanthy

    2015-03-01

    In the present study, 500 raw beef, pork, and chicken meat samples and 100 pooled egg samples were analyzed for the presence of vancomycin-resistant enterococci, vancomycin-resistance phenotypes, and resistance genes. Of 141 isolates of enterococci, 88 strains of Enterococcus faecium and 53 strains of E. faecalis were identified. The most prevalent species was E. faecium. Resistance to ampicillin (n = 93, 66%), ciprofloxacin (n = 74, 52.5%), erythromycin (n = 73, 51.8%), penicillin (n = 59, 41.8%) and tetracycline (n = 52, 36.9%) was observed, while 53.2% (n = 75) of the isolates were multiresistant and 15.6% (n = 22) were susceptible to all antibiotics. Resistance to vancomycin was exhibited in 34.1% (n = 30) of the E. faecium isolates (n = 88) and 1.9% (n = 1) of the E. faecalis isolates (n = 53) using the disc-diffusion test and the E-test. All isolates were tested for vanA and vanB using real-time polymerase chain reaction (PCR) and multiplex PCR, and for vanC, vanD, vanE, vanG genes using multiplex PCR only. Among E. faecalis isolates, no resistance genes were identified. Among the E. faecium isolates, 28 carried the vanA gene when tested by multiplex PCR and 29 when tested with real-time PCR. No isolate carrying the vanC, vanD, vanE, or vanG genes was identified. Melting-curve analysis of the positive real-time PCR E. faecium isolates showed that 22 isolates carried the vanA gene only, 2 isolates the vanB2,3 genes only, and seven isolates carried both the vanA and vanB2,3 genes. Enterococci should be considered a significant zoonotic pathogen and a possible reservoir of genes encoding resistance potentially transferred to other bacterial species.

  8. Antibiotic Resistance and Antibiotic Resistance Genes in Escherichia coli Isolates from Hospital Wastewater in Vietnam

    Science.gov (United States)

    Lan, Pham Thi; Chuc, Nguyen Thi Kim; Hoa, Nguyen Quynh; Nhung, Pham Hong; Thoa, Nguyen Thi Minh; Diwan, Vishal; Tamhankar, Ashok J.; Stålsby Lundborg, Cecilia

    2017-01-01

    The environmental spread of antibiotic-resistant bacteria has been recognised as a growing public health threat for which hospitals play a significant role. The aims of this study were to investigate the prevalence of antibiotic resistance and antibiotic resistance genes (ARGs) in Escherichia coli isolates from hospital wastewater in Vietnam. Wastewater samples before and after treatment were collected using continuous sampling every month over a year. Standard disk diffusion and E-test were used for antibiotic susceptibility testing. Extended-spectrum beta-lactamase (ESBL) production was tested using combined disk diffusion. ARGs were detected by polymerase chain reactions. Resistance to at least one antibiotic was detected in 83% of isolates; multidrug resistance was found in 32%. The highest resistance prevalence was found for co-trimoxazole (70%) and the lowest for imipenem (1%). Forty-three percent of isolates were ESBL-producing, with the blaTEM gene being more common than blaCTX-M. Co-harbouring of the blaCTX-M, blaTEM and qepA genes was found in 46% of isolates resistant to ciprofloxacin. The large presence of antibiotic-resistant E. coli isolates combined with ARGs in hospital wastewater, even post-treatment, poses a threat to public health. It highlights the need to develop effective processes for hospital wastewater treatment plants to eliminate antibiotic resistant bacteria and ARGs. PMID:28661465

  9. Antibiotic Resistance and Antibiotic Resistance Genes in Escherichia coli Isolates from Hospital Wastewater in Vietnam.

    Science.gov (United States)

    Lien, La Thi Quynh; Lan, Pham Thi; Chuc, Nguyen Thi Kim; Hoa, Nguyen Quynh; Nhung, Pham Hong; Thoa, Nguyen Thi Minh; Diwan, Vishal; Tamhankar, Ashok J; Stålsby Lundborg, Cecilia

    2017-06-29

    The environmental spread of antibiotic-resistant bacteria has been recognised as a growing public health threat for which hospitals play a significant role. The aims of this study were to investigate the prevalence of antibiotic resistance and antibiotic resistance genes (ARGs) in Escherichia coli isolates from hospital wastewater in Vietnam. Wastewater samples before and after treatment were collected using continuous sampling every month over a year. Standard disk diffusion and E-test were used for antibiotic susceptibility testing. Extended-spectrum beta-lactamase (ESBL) production was tested using combined disk diffusion. ARGs were detected by polymerase chain reactions. Resistance to at least one antibiotic was detected in 83% of isolates; multidrug resistance was found in 32%. The highest resistance prevalence was found for co-trimoxazole (70%) and the lowest for imipenem (1%). Forty-three percent of isolates were ESBL-producing, with the bla TEM gene being more common than bla CTX-M . Co-harbouring of the bla CTX-M , bla TEM and qepA genes was found in 46% of isolates resistant to ciprofloxacin. The large presence of antibiotic-resistant E. coli isolates combined with ARGs in hospital wastewater, even post-treatment, poses a threat to public health. It highlights the need to develop effective processes for hospital wastewater treatment plants to eliminate antibiotic resistant bacteria and ARGs.

  10. Distribution of the Multidrug Resistance Gene cfr in Staphylococcus Species Isolates from Swine Farms in China

    Science.gov (United States)

    Wang, Yang; Zhang, Wanjiang; Wang, Juan; Wu, Congming; Shen, Zhangqi; Fu, Xiao; Yan, Yang; Zhang, Qijing

    2012-01-01

    A total of 149 porcine Staphylococcus isolates with florfenicol MICs of ≥16 μg/ml were screened for the presence of the multiresistance gene cfr, its location on plasmids, and its genetic environment. In total, 125 isolates carried either cfr (16 isolates), fexA (92 isolates), or both genes (17 isolates). The 33 cfr-carrying staphylococci, which included isolates of the species Staphylococcus cohnii, S. arlettae, and S. saprophyticus in which the cfr gene has not been described before, exhibited a wide variety of SmaI pulsed-field gel electrophoresis patterns. In 18 cases, the cfr gene was located on plasmids. Four different types of cfr-carrying plasmids—pSS-01 (n = 2; 40 kb), pSS-02 (n = 3; 35.4 kb), pSS-03 (n = 10; 7.1 kb), and pBS-01 (n = 3; 16.4 kb)—were differentiated on the basis of their sizes, restriction patterns, and additional resistance genes. Sequence analysis revealed that in plasmid pSS-01, the cfr gene was flanked in the upstream part by a complete aacA-aphD-carrying Tn4001-like transposon and in the downstream part by a complete fexA-carrying transposon Tn558. In plasmid pSS-02, an insertion sequence IS21-558 and the cfr gene were integrated into transposon Tn558 and thereby truncated the tnpA and tnpB genes. The smallest cfr-carrying plasmid pSS-03 carried the macrolide-lincosamide-streptogramin B resistance gene erm(C). Plasmid pBS-01, previously described in Bacillus spp., harbored a Tn917-like transposon, including the macrolide-lincosamide-streptogramin B resistance gene erm(B) in the cfr downstream region. Plasmids, which in part carry additional resistance genes, seem to play an important role in the dissemination of the gene cfr among porcine staphylococci. PMID:22183168

  11. Detection of Multidrug-Resistant Salmonella enterica Serotype typhimurium DT104 Based on a Gene Which Confers Cross-Resistance to Florfenicol and Chloramphenicol

    Science.gov (United States)

    Bolton, Lance F.; Kelley, Lynda C.; Lee, Margie D.; Fedorka-Cray, Paula J.; Maurer, John J.

    1999-01-01

    Salmonella enterica serotype typhimurium (S. typhimurium) DT104 (DT104) first emerged as a major pathogen in Europe and is characterized by its pentadrug-resistant pattern. It has also been associated with outbreaks in the United States. The organism typically carries resistance to ampicillin, chloramphenicol, streptomycin, sulfonamides, and tetracycline. The mechanism of chloramphenicol resistance in DT104 was determined by producing antibiotic-resistant Escherichia coli host strain clones from DT104 DNA. DNA from chloramphenicol-resistant clones was sequenced, and probes specific for the genes floS. typhimurium (floSt), int, invA, and spvC were produced for colony blot hybridizations. One hundred nine Salmonella isolates, including 44 multidrug-resistant DT104 isolates, were tested to evaluate the specificities of the probes. The gene floSt, reported in this study, confers chloramphenicol and florfenicol resistance on S. typhimurium DT104. Florfenicol resistance is unique to S. typhimurium DT104 and multidrug-resistant S. typhimurium isolates with the same drug resistance profile among all isolates evaluated. Of 44 DT104 isolates tested, 98% were detected based on phenotypic florfenicol resistance and 100% had the floSt-positive genotype. Resistances to florfenicol and chloramphenicol are conferred by the gene floSt, described in this paper. Presumptive identification of S. typhimurium DT104 can be made rapidly based on the presence of the floSt gene or its resulting phenotype. PMID:10203484

  12. The Lr34 adult plant rust resistance gene provides seedling resistance in durum wheat without senescence

    OpenAIRE

    Rinaldo, Amy; Gilbert, Brian; Boni, Rainer; Krattinger, Simon G.; Singh, Davinder; Park, Robert F.; Lagudah, Evans; Ayliffe, Michael

    2017-01-01

    Summary The hexaploid wheat (Triticum aestivum) adult plant resistance gene, Lr34/Yr18/Sr57/Pm38/Ltn1, provides broad?spectrum resistance to wheat leaf rust (Lr34), stripe rust (Yr18), stem rust (Sr57) and powdery mildew (Pm38) pathogens, and has remained effective in wheat crops for many decades. The partial resistance provided by this gene is only apparent in adult plants and not effective in field?grown seedlings. Lr34 also causes leaf tip necrosis (Ltn1) in mature adult plant leaves when ...

  13. Gene interactions and genetics of blast resistance and yield

    Indian Academy of Sciences (India)

    Blast disease caused by the pathogen Pyricularia oryzae is a serious threat to rice production. Six generations viz., P1, P2, F1, F2, B1 and B2 of a cross between blast susceptible high-yielding rice cultivar ADT 43 and resistant near isogenic line (NIL) CT13432-3R, carrying four blast resistance genes Pi1, Pi2, Pi33 and Pi54 ...

  14. Comparative genome analysis and resistance gene mapping in grain legumes

    International Nuclear Information System (INIS)

    Young, N.D.

    1998-01-01

    Using, DNA markers and genome organization, several important disease resistance genes have been analyzed in mungbean (Vigna radiata), cowpea (Vigna unguiculata), common bean (Phaseolus vulgaris), and soybean (Glycine max). In the process, medium-density linkage maps consisting of restriction fragment length polymorphism (RFLP) markers were constructed for both mungbean and cowpea. Comparisons between these maps, as well as the maps of soybean and common bean, indicate that there is significant conservation of DNA marker order, though the conserved blocks in soybean are much shorter than in the others. DNA mapping results also indicate that a gene for seed weight may be conserved between mungbean and cowpea. Using the linkage maps, genes that control bruchid (genus Callosobruchus) and powdery mildew (Erysiphe polygoni) resistance in mungbean, aphid resistance in cowpea (Aphis craccivora), and cyst nematode (Heterodera glycines) resistance in soybean have all been mapped and characterized. For some of these traits resistance was found to be oligogenic and DNA mapping uncovered multiple genes involved in the phenotype. (author)

  15. Abundance of antibiotic resistance genes in environmental bacteriophages.

    Science.gov (United States)

    Anand, Taruna; Bera, Bidhan Ch; Vaid, Rajesh K; Barua, Sanjay; Riyesh, Thachamvally; Virmani, Nitin; Hussain, Mubarik; Singh, Raj K; Tripathi, Bhupendra N

    2016-12-01

    The ecosystem is continuously exposed to a wide variety of antimicrobials through waste effluents, agricultural run-offs and animal-related and anthropogenic activities, which contribute to the spread of antibiotic resistance genes (ARGs). The contamination of ecosystems with ARGs may create increased opportunities for their transfer to naive microbes and eventually lead to entry into the human food chain. Transduction is a significant mechanism of horizontal gene transfer in natural environments, which has traditionally been underestimated as compared to transformation. We explored the presence of ARGs in environmental bacteriophages in order to recognize their contribution in the spread of ARGs in environmental settings. Bacteriophages were isolated against environmental bacterial isolates, purified and bulk cultured. They were characterized, and detection of ARG and intI genes including blaTEM, blaOXA-2, intI1, intI2, intI3, tetA and tetW was carried out by PCR. This study revealed the presence of various genes [tetA (12.7 %), intI1 (10.9 %), intI2 (10.9 %), intI3 (9.1 %), tetW (9.1 %) and blaOXA-2 (3.6 %)] and blaTEM in a significantly higher proportion (30.9 %). blaSHV, blaOXA-1, tetO, tetB, tetG, tetM and tetS were not detected in any of the phages. Soil phages were the most versatile in terms of ARG carriage. Also, the relative abundance of tetA differed significantly vis-à-vis source. The phages from organized farms showed varied ARGs as compared to the unorganized sector, although blaTEM ARG incidences did not differ significantly. The study reflects on the role of phages in dissemination of ARGs in environmental reservoirs, which may provide an early warning system for future clinically relevant resistance mechanisms.

  16. Prediction and analysis of three gene families related to leaf rust (Puccinia triticina) resistance in wheat (Triticum aestivum L.).

    Science.gov (United States)

    Peng, Fred Y; Yang, Rong-Cai

    2017-06-20

    adult resistance and six SNPs for seedling resistance in the NLR genes. Most of these coding SNPs were predicted to alter encoded amino acids and such information may serve as a starting point towards more thorough molecular and functional characterization of the designated Lr genes. Using the primer sequences of 99 known non-SNP markers from leaf rust resistance QTLs, we found candidate genes closely linked to these markers, including Lr34 with distances to its two gene-specific markers being 1212 bases (to cssfr1) and 2189 bases (to cssfr2). This study represents a comprehensive analysis of ABC, NLR and START genes in the hexaploid wheat genome and their physical relationships with QTLs for leaf rust resistance at seedling and adult stages. Our analysis suggests that the ABC (and START) genes are more likely to be co-located with QTLs for race-nonspecific, adult resistance whereas the NLR genes are more likely to be co-located with QTLs for race-specific resistance that would be often expressed at the seedling stage. Though our analysis was hampered by inaccurate or unknown physical positions of numerous QTLs due to the incomplete assembly of the complex hexaploid wheat genome that is currently available, the observed associations between (i) QTLs for race-specific resistance and NLR genes and (ii) QTLs for nonspecific resistance and ABC genes will help discover SNP variants for leaf rust resistance at seedling and adult stages. The genes containing nonsynonymous SNPs are promising candidates that can be investigated in future studies as potential new sources of leaf rust resistance in wheat breeding.

  17. Relationship between antibiotic resistance genes and metals in residential soil samples from Western Australia.

    Science.gov (United States)

    Knapp, Charles W; Callan, Anna C; Aitken, Beatrice; Shearn, Rylan; Koenders, Annette; Hinwood, Andrea

    2017-01-01

    Increasing drug-resistant infections have drawn research interest towards examining environmental bacteria and the discovery that many factors, including elevated metal conditions, contribute to proliferation of antibiotic resistance (AR). This study examined 90 garden soils from Western Australia to evaluate predictions of antibiotic resistance genes from total metal conditions by comparing the concentrations of 12 metals and 13 genes related to tetracycline, beta-lactam and sulphonamide resistance. Relationships existed between metals and genes, but trends varied. All metals, except Se and Co, were related to at least one AR gene in terms of absolute gene numbers, but only Al, Mn and Pb were associated with a higher percentage of soil bacteria exhibiting resistance, which is a possible indicator of population selection. Correlations improved when multiple factors were considered simultaneously in a multiple linear regression model, suggesting the possibility of additive effects occurring. Soil-metal concentrations must be considered when determining risks of AR in the environment and the proliferation of resistance.

  18. Presence of the optrA Gene in Methicillin-Resistant Staphylococcus sciuri of Porcine Origin.

    Science.gov (United States)

    Fan, Run; Li, Dexi; Wang, Yang; He, Tao; Feßler, Andrea T; Schwarz, Stefan; Wu, Congming

    2016-12-01

    A total of 57 methicillin-resistant Staphylococcus aureus (MRSA) isolates and 475 methicillin-resistant coagulase-negative staphylococci (MRCoNS) collected from pigs in the Guangdong province of China in 2014 were investigated for the presence of the novel oxazolidinone-phenicol resistance gene optrA The optrA gene was detected in 6.9% (n = 33) of the MRCoNS, all of which were Staphylococcus sciuri isolates, but in none of the MRSA isolates. Five optrA-carrying methicillin-resistant (MR) S. sciuri isolates also harbored the multiresistance gene cfr Pulsed-field gel electrophoresis (PFGE) and dru typing of the 33 optrA-carrying MR S. sciuri isolates revealed 25 patterns and 5 sequence types, respectively. S1 nuclease PFGE and Southern blotting confirmed that optrA was located in the chromosomal DNAs of 29 isolates, including 1 cfr-positive isolate. The remaining four isolates harbored a ∼35-kb pWo28-3-like plasmid on which optrA and cfr were located together with other resistance genes, as confirmed by sequence analysis. Six different types of genetic environments (types I to VI) of the chromosome-borne optrA genes were identified; these types had the optrA gene and its transcriptional regulator araC in common. Tn558 was found to be associated with araC-optrA in types II to VI. The optrA gene in types II and III was found in close proximity to the ccr gene complex of the respective staphylococcal cassette chromosome mec element (SCCmec). Since oxazolidinones are last-resort antimicrobial agents for the control of serious infections caused by methicillin-resistant staphylococci in humans, the location of the optrA gene close to the ccr complex is an alarming observation. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  19. High chlorpyrifos resistance in Culex pipiens mosquitoes: strong synergy between resistance genes.

    Science.gov (United States)

    Alout, H; Labbé, P; Berthomieu, A; Makoundou, P; Fort, P; Pasteur, N; Weill, M

    2016-02-01

    We investigated the genetic determinism of high chlorpyrifos resistance (HCR), a phenotype first described in 1999 in Culex pipiens mosquitoes surviving chlorpyrifos doses ⩾1 mg l(-1) and more recently found in field samples from Tunisia, Israel or Indian Ocean islands. Through chlorpyrifos selection, we selected several HCR strains that displayed over 10 000-fold resistance. All strains were homozygous for resistant alleles at two main loci: the ace-1 gene, with the resistant ace-1(R) allele expressing the insensitive G119S acetylcholinesterase, and a resistant allele of an unknown gene (named T) linked to the sex and ace-2 genes. We constructed a strain carrying only the T-resistant allele and studied its resistance characteristics. By crossing this strain with strains harboring different alleles at the ace-1 locus, we showed that the resistant ace-1(R) and the T alleles act in strong synergy, as they elicited a resistance 100 times higher than expected from a simple multiplicative effect. This effect was specific to chlorpyrifos and parathion and was not affected by synergists. We also examined how HCR was expressed in strains carrying other ace-1-resistant alleles, such as ace-1(V) or the duplicated ace-1(D) allele, currently spreading worldwide. We identified two major parameters that influenced the level of resistance: the number and the nature of the ace-1-resistant alleles and the number of T alleles. Our data fit a model that predicts that the T allele acts by decreasing chlorpyrifos concentration in the compartment targeted in insects.

  20. Recessive Resistance to Plant Viruses: Potential Resistance Genes Beyond Translation Initiation Factors

    Directory of Open Access Journals (Sweden)

    Masayoshi Hashimoto

    2016-10-01

    Full Text Available The ability of plant viruses to propagate their genomes in host cells depends on many host factors. In the absence of an agrochemical that specifically targets plant viral infection cycles, one of the most effective methods for controlling viral diseases in plants is taking advantage of the host plant’s resistance machinery. Recessive resistance is conferred by a recessive gene mutation that encodes a host factor critical for viral infection. It is a branch of the resistance machinery and, as an inherited characteristic, is very durable. Moreover, recessive resistance may be acquired by a deficiency in a negative regulator of plant defense responses, possibly due to the autoactivation of defense signaling. Eukaryotic translation initiation factor (eIF 4E and eIF4G and their isoforms are the most widely exploited recessive resistance genes in several crop species, and they are effective against a subset of viral species. However, the establishment of efficient, recessive resistance-type antiviral control strategies against a wider range of plant viral diseases requires genetic resources other than eIF4Es. In this review, we focus on recent advances related to antiviral recessive resistance genes evaluated in model plants and several crop species. We also address the roles of next-generation sequencing and genome editing technologies in improving plant genetic resources for recessive resistance-based antiviral breeding in various crop species.

  1. Spread of tetracycline resistance genes at a conventional dairy farm

    Directory of Open Access Journals (Sweden)

    Martina eKyselkova

    2015-05-01

    Full Text Available The use of antibiotics in animal husbandry contributes to the worldwide problem of increasing antibiotic resistance in animal and human pathogens. Intensive animal production is considered an important source of antibiotic resistance genes released to the environment, while the contribution of smaller farms remains to be evaluated. Here we monitor the spread of tetracycline resistance (TC-r genes at a middle-size conventional dairy farm, where chlortetracycline (CTC, as intrauterine suppository is prophylactically used after each calving. Our study has shown that animals at the farm acquired the TC-r genes in their early age (1-2 weeks, likely due to colonization with TC-resistant bacteria from their mothers and/or the farm environment. The relative abundance of the TC-r genes tet(W, tet(Q and tet(M in fresh excrements of calves was about 1-2 orders of magnitude higher compared to heifers and dairy cows, possibly due to the presence of antibiotic residues in milk fed to calves. The occurrence and abundance of TC-r genes in fresh excrements of heifers and adult cows remained unaffected by intrauterine CTC applications, with tet(O, tet(Q and tet(W representing a ‘core TC-resistome’ of the farm, and tet(A, tet(M, tet(Y and tet(X occurring occasionally. The genes tet(A, tet(M, tet(Y and tet(X were shown to be respectively harbored by Shigella, Lactobacillus and Clostridium, Acinetobacter, and Wautersiella. Soil in the farm proximity, as well as field soil to which manure from the farm was applied, was contaminated with TC-r genes occurring in the farm, and some of the TC-r genes persisted in the field over 3 months following the manure application. Concluding, our study shows that antibiotic resistance genes may be a stable part of the intestinal metagenome of cattle even if antibiotics are not used for growth stimulation, and that smaller dairy farms may also contribute to environmental pollution with antibiotic resistance genes.

  2. Emergence of Lamivudine-Resistant HBV during Antiretroviral Therapy Including Lamivudine for Patients Coinfected with HIV and HBV in China

    Science.gov (United States)

    Li, Yijia; Zhu, Ting; Song, Xiaojing; Huang, Ying; Yang, Feifei; Guan, Shuo; Xie, Jing; Gohda, Jin; Hosoya, Noriaki; Kawana-Tachikawa, Ai; Liu, Wenjun; Gao, George Fu; Iwamoto, Aikichi; Li, Taisheng; Ishida, Takaomi

    2015-01-01

    In China, HIV-1-infected patients typically receive antiretroviral therapy (ART) that includes lamivudine (3TC) as a reverse-transcriptase inhibitor (RTI) (ART-3TC). Previous studies from certain developed countries have shown that, in ART-3TC, 3TC-resistant HBV progressively emerges at an annual rate of 15–20% in patients coinfected with HIV-1 and HBV. This scenario in China warrants investigation because >10% of all HIV-infected patients in China are HBV carriers. We measured the occurrence of 3TC-resistant HBV during ART-3TC for HIV-HBV coinfection and also tested the effect of tenofovir disoproxil fumarate (TDF) used as an additional RTI (ART-3TC/TDF) in a cohort study in China. We obtained 200 plasma samples collected from 50 Chinese patients coinfected with HIV-1 and HBV (positive for hepatitis B surface antigen) and examined them for the prevalence of 3TC-resistant HBV by directly sequencing PCR products that covered the HBV reverse-transcriptase gene. We divided the patients into ART-3TC and ART-3TC/TDF groups and compared the efficacy of treatment and incidence of drug-resistance mutation between the groups. HIV RNA and HBV DNA loads drastically decreased in both ART-3TC and ART-3TC/TDF groups. In the ART-3TC group, HBV breakthrough or insufficient suppression of HBV DNA loads was observed in 20% (10/50) of the patients after 96-week treatment, and 8 of these patients harbored 3TC-resistant mutants. By contrast, neither HBV breakthrough nor treatment failure was recorded in the ART-3TC/TDF group. All of the 3TC-resistant HBV mutants emerged from the cases in which HBV DNA loads were high at baseline. Our results clearly demonstrated that ART-3TC is associated with the emergence of 3TC-resistant HBV in patients coinfected with HIV-1 and HBV and that ART-3TC/TDF reduces HBV DNA loads to an undetectable level. These findings support the use of TDF-based treatment regimens for patients coinfected with HIV-1 and HBV. PMID:26288093

  3. Emergence of Lamivudine-Resistant HBV during Antiretroviral Therapy Including Lamivudine for Patients Coinfected with HIV and HBV in China.

    Directory of Open Access Journals (Sweden)

    Lijun Gu

    Full Text Available In China, HIV-1-infected patients typically receive antiretroviral therapy (ART that includes lamivudine (3TC as a reverse-transcriptase inhibitor (RTI (ART-3TC. Previous studies from certain developed countries have shown that, in ART-3TC, 3TC-resistant HBV progressively emerges at an annual rate of 15-20% in patients coinfected with HIV-1 and HBV. This scenario in China warrants investigation because >10% of all HIV-infected patients in China are HBV carriers. We measured the occurrence of 3TC-resistant HBV during ART-3TC for HIV-HBV coinfection and also tested the effect of tenofovir disoproxil fumarate (TDF used as an additional RTI (ART-3TC/TDF in a cohort study in China. We obtained 200 plasma samples collected from 50 Chinese patients coinfected with HIV-1 and HBV (positive for hepatitis B surface antigen and examined them for the prevalence of 3TC-resistant HBV by directly sequencing PCR products that covered the HBV reverse-transcriptase gene. We divided the patients into ART-3TC and ART-3TC/TDF groups and compared the efficacy of treatment and incidence of drug-resistance mutation between the groups. HIV RNA and HBV DNA loads drastically decreased in both ART-3TC and ART-3TC/TDF groups. In the ART-3TC group, HBV breakthrough or insufficient suppression of HBV DNA loads was observed in 20% (10/50 of the patients after 96-week treatment, and 8 of these patients harbored 3TC-resistant mutants. By contrast, neither HBV breakthrough nor treatment failure was recorded in the ART-3TC/TDF group. All of the 3TC-resistant HBV mutants emerged from the cases in which HBV DNA loads were high at baseline. Our results clearly demonstrated that ART-3TC is associated with the emergence of 3TC-resistant HBV in patients coinfected with HIV-1 and HBV and that ART-3TC/TDF reduces HBV DNA loads to an undetectable level. These findings support the use of TDF-based treatment regimens for patients coinfected with HIV-1 and HBV.

  4. Dissemination of metal resistance genes among animal methicillin-resistant coagulase-negative Staphylococci.

    Science.gov (United States)

    Argudín, M Angeles; Butaye, Patrick

    2016-04-01

    The use of metals as feed supplement has been recognized as a potential driver for co-selection of methicillin-resistant Staphylococcus aureus in pigs. However, the prevalence of these determinants in methicillin-resistant coagulase-negative staphylococci (MRCoNS) is largely unknown. In this study, a collection of 130 MRCoNS from pigs and veal calves were investigated for the presence of metal-resistance genes (czrC, copB, cadD, arsA) associated to SCCmec. Near half of the isolates carried metal resistance genes (czrC 5.4%, copB 38.5%, cadD 7.7%, arsA 26.2%) regardless of their SCCmec type. The increased use of metals in livestock animals, especially zinc in pigs in several European countries may co-select for methicillin-resistance in several staphylococcal species. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. Tagging of resistance gene(s) to rhizomania disease in sugar beet ...

    African Journals Online (AJOL)

    SERVER

    2008-02-19

    Feb 19, 2008 ... plasmodiophoride-like fungus, Polymyxa betae Keskin. (1964) (Tamada and Richard, 1992). Source of resistance to rhizomania were found in Holly sugar beet company source (Lewellen, 1987). Resistance in Holly is simply inherited by a single dominant gene(Rz1). (Lewellen et al., 1987; Scholten et al., ...

  6. Tagging of resistance gene(s) to rhizomania disease in sugar beet ...

    African Journals Online (AJOL)

    The rhizomania disease is one of the most important diseases in Iran and some other parts of the world which potentially could play a role in decreasing sugar yield in fields. One approach to combat with this disease is the use of resistance varieties. This varieties have been identified which are having resistance genes to ...

  7. Identification of aac(2')-I type b aminoglycoside-modifying enzyme genes in resistant Acinetobacter baumannii.

    Science.gov (United States)

    Lin, T; Tang, C G; Li, Q H; Ji, J; Ge, H Y; Zhang, X Y; Sun, H P

    2015-03-13

    The aim of this study was to investigate the mechanism underlying the drug resistance of Acinetobacter baumannii toward aminoglycosides. A total of 32 A. baumannii strains were identified by molecular identification and subsequently isolated. The isolates were then amplified by polymerase chain reaction to analyze the 9 aminoglycoside-modifying enzyme genes and 7 16S rRNA methylase genes. Five types of aminoglycoside-modifying enzyme genes and 1 type of 16S rRNA methylase gene were detected in the 32 drug-resistant A. baumannii strains. Positive genes included 7 detection modes, of which the all-6-gene-positive mode aac(2')-Ib+aac(3)-I+aac(6')-Ib+ant(3'')-I+aph(3')-I+armA exhibited the largest number of strains (12, 37.5%). The resistance of A. baumannii against aminoglycosides resulted from the presence of 5 types of aminoglycoside-modifying enzyme genes and the 16S rRNA methylase gene armA. This study is the first to isolate the aac(2')-Ib aminoglycoside-modifying enzyme gene from A. baumannii in a domestic clinical setting.

  8. Loci and candidate genes conferring resistance to soybean cyst nematode HG type 2.5.7.

    Science.gov (United States)

    Zhao, Xue; Teng, Weili; Li, Yinghui; Liu, Dongyuan; Cao, Guanglu; Li, Dongmei; Qiu, Lijuan; Zheng, Hongkun; Han, Yingpeng; Li, Wenbin

    2017-06-14

    Soybean (Glycine max L. Merr.) cyst nematode (SCN, Heterodera glycines I,) is a major pest of soybean worldwide. The most effective strategy to control this pest involves the use of resistant cultivars. The aim of the present study was to investigate the genome-wide genetic architecture of resistance to SCN HG Type 2.5.7 (race 1) in landrace and elite cultivated soybeans. A total of 200 diverse soybean accessions were screened for resistance to SCN HG Type 2.5.7 and genotyped through sequencing using the Specific Locus Amplified Fragment Sequencing (SLAF-seq) approach with a 6.14-fold average sequencing depth. A total of 33,194 SNPs were identified with minor allele frequencies (MAF) over 4%, covering 97% of all the genotypes. Genome-wide association mapping (GWAS) revealed thirteen SNPs associated with resistance to SCN HG Type 2.5.7. These SNPs were distributed on five chromosomes (Chr), including Chr7, 8, 14, 15 and 18. Four SNPs were novel resistance loci and nine SNPs were located near known QTL. A total of 30 genes were identified as candidate genes underlying SCN resistance. A total of sixteen novel soybean accessions were identified with significant resistance to HG Type 2.5.7. The beneficial alleles and candidate genes identified by GWAS might be valuable for improving marker-assisted breeding efficiency and exploring the molecular mechanisms underlying SCN resistance.

  9. Human hepatocellular carcinoma cell lines exhibit multidrug resistance unrelated to MRD1 gene expression.

    Science.gov (United States)

    Shen, D W; Lu, Y G; Chin, K V; Pastan, I; Gottesman, M M

    1991-03-01

    Multidrug resistance of human cancer cells may result from expression of P-glycoprotein, the product of the MRD1 gene, acting as an energy-dependent drug efflux pump. However, direct evidence that expression of the MDR1 gene contributes to the multidrug resistance of human liver carcinomas has not been established. In this study, we tested five cell lines derived from human hepatocellular carcinomas for sensitivity to a variety of drugs used widely as anticancer agents; these included vinblastine, doxorubicin, actinomycin D, mitomycin C, 5-fluorouracil, 6-mercaptopurine, melphalan, methotrexate, cis-platinum and etoposide (VP-16). All five hepatoma cell lines were resistant at different levels to these chemicals compared to human KB cells. Although it has been demonstrated that resistance to vinblastine, colchicine, doxorubicin and actinomycin D in human multidrug-resistant cells is associated with overexpression of P-glycoprotein, very little expression of P-glycoprotein was found in these human hepatoma cells. Neither verapamil nor quinidine, inhibitors of the drug efflux pump, were able to overcome multidrug resistance in hepatoma cells. These results indicate that the multidrug resistance phenotype in human hepatocellular carcinoma cells cannot be attributed to expression of the MDR1 gene, but that novel mechanisms may account for the resistance of these cancer cells.

  10. Remapping of the stripe rust resistance gene Yr10 in common wheat.

    Science.gov (United States)

    Yuan, Cuiling; Wu, Jingzheng; Yan, Baiqiang; Hao, Qunqun; Zhang, Chaozhong; Lyu, Bo; Ni, Fei; Caplan, Allan; Wu, Jiajie; Fu, Daolin

    2018-02-23

    Yr10 is an important gene to control wheat stripe rust, and the search for Yr10 needs to be continued. Wheat stripe rust or yellow rust is a devastating fungal disease caused by Puccinia striiformis f. sp. tritici (Pst). Host disease resistance offers a primary source for controlling wheat stripe rust. The stripe rust resistance gene Yr10 confers the race-specific resistance to most tested Pst races in China including CYR29. Early studies proposed that Yr10 was a nucleotide-binding site, leucine-rich repeat gene archived as GenBank accession AF149112 (hereafter designated the Yr10 candidate gene or Yr10 CG ). In this study, we revealed that 15 Chinese wheat cultivars positive for Yr10 CG are susceptible to CYR29. We then expressed the Yr10 CG cDNA in the common wheat 'Bobwhite'. The Yr10 CG -cDNA positive transgenic plants were also susceptible to CYR29. Thus, it is highly unlikely that Yr10 CG corresponds to the Yr10 resistance gene. Using the Yr10 donor 'Moro' and the Pst-susceptible wheat 'Huixianhong', we generated two F 3 populations that displayed a single Mendelian segregation on the Yr10 gene, and used them to remap the Yr10 gene. Six markers were placed in the Yr10 region, with the Yr10 CG gene now mapping about 1.2-cM proximal to the Yr10 locus and the Xsdauw79 marker is completely linked to the Yr10 locus. Apparently, the Yr10 gene has not yet been identified. Fine mapping and positional cloning of Yr10 is important for gene pyramiding for stripe rust resistance in wheat.

  11. Thioridazine affects transcription of genes involved in cell wall biosynthesis in methicillin-resistant Staphylococcus aureus

    DEFF Research Database (Denmark)

    Bonde, Mette; Højland, Dorte Heidi; Kolmos, Hans Jørn

    2011-01-01

    have previously shown that the expression of some resistance genes is abolished after treatment with thioridazine and oxacillin. To further understand the mechanism underlying the reversal of resistance, we tested the expression of genes involved in antibiotic resistance and cell wall biosynthesis...... reversal of resistance by thioridazine relies on decreased expression of specific genes involved in cell wall biosynthesis....

  12. Isolation of NBS-LRR class resistant gene (I2 gene) from tomato ...

    African Journals Online (AJOL)

    aghomotsegin

    2013-10-16

    Oct 16, 2013 ... Isolation of NBS-LRR class resistant gene (I2 gene) from tomato cultivar Heamsona ... avirulence protein or effector protein secreted by fungal pathogen during the host colonization in tomato. These effector proteins .... and efficient method for isolation of genomic DNA from plant tissue. J. Cell Tissue Res.

  13. A Comprehensive Insight into Tetracycline Resistant Bacteria and Antibiotic Resistance Genes in Activated Sludge Using Next-Generation Sequencing

    Science.gov (United States)

    Huang, Kailong; Tang, Junying; Zhang, Xu-Xiang; Xu, Ke; Ren, Hongqiang

    2014-01-01

    In order to comprehensively investigate tetracycline resistance in activated sludge of sewage treatment plants, 454 pyrosequencing and Illumina high-throughput sequencing were used to detect potential tetracycline resistant bacteria (TRB) and antibiotic resistance genes (ARGs) in sludge cultured with different concentrations of tetracycline. Pyrosequencing of 16S rRNA gene revealed that tetracycline treatment greatly affected the bacterial community structure of the sludge. Nine genera consisting of Sulfuritalea, Armatimonas, Prosthecobacter, Hyphomicrobium, Azonexus, Longilinea, Paracoccus, Novosphingobium and Rhodobacter were identified as potential TRB in the sludge. Results of qPCR, molecular cloning and metagenomic analysis consistently indicated that tetracycline treatment could increase both the abundance and diversity of the tet genes, but decreased the occurrence and diversity of non-tetracycline ARG, especially sulfonamide resistance gene sul2. Cluster analysis showed that tetracycline treatment at subinhibitory concentrations (5 mg/L) was found to pose greater effects on the bacterial community composition, which may be responsible for the variations of the ARGs abundance. This study indicated that joint use of 454 pyrosequencing and Illumina high-throughput sequencing can be effectively used to explore ARB and ARGs in the environment, and future studies should include an in-depth investigation of the relationship between microbial community, ARGs and antibiotics in sewage treatment plant (STP) sludge. PMID:24905407

  14. A Comprehensive Insight into Tetracycline Resistant Bacteria and Antibiotic Resistance Genes in Activated Sludge Using Next-Generation Sequencing

    Directory of Open Access Journals (Sweden)

    Kailong Huang

    2014-06-01

    Full Text Available In order to comprehensively investigate tetracycline resistance in activated sludge of sewage treatment plants, 454 pyrosequencing and Illumina high-throughput sequencing were used to detect potential tetracycline resistant bacteria (TRB and antibiotic resistance genes (ARGs in sludge cultured with different concentrations of tetracycline. Pyrosequencing of 16S rRNA gene revealed that tetracycline treatment greatly affected the bacterial community structure of the sludge. Nine genera consisting of Sulfuritalea, Armatimonas, Prosthecobacter, Hyphomicrobium, Azonexus, Longilinea, Paracoccus, Novosphingobium and Rhodobacter were identified as potential TRB in the sludge. Results of qPCR, molecular cloning and metagenomic analysis consistently indicated that tetracycline treatment could increase both the abundance and diversity of the tet genes, but decreased the occurrence and diversity of non-tetracycline ARG, especially sulfonamide resistance gene sul2. Cluster analysis showed that tetracycline treatment at subinhibitory concentrations (5 mg/L was found to pose greater effects on the bacterial community composition, which may be responsible for the variations of the ARGs abundance. This study indicated that joint use of 454 pyrosequencing and Illumina high-throughput sequencing can be effectively used to explore ARB and ARGs in the environment, and future studies should include an in-depth investigation of the relationship between microbial community, ARGs and antibiotics in sewage treatment plant (STP sludge.

  15. A comprehensive insight into tetracycline resistant bacteria and antibiotic resistance genes in activated sludge using next-generation sequencing.

    Science.gov (United States)

    Huang, Kailong; Tang, Junying; Zhang, Xu-Xiang; Xu, Ke; Ren, Hongqiang

    2014-06-05

    In order to comprehensively investigate tetracycline resistance in activated sludge of sewage treatment plants, 454 pyrosequencing and Illumina high-throughput sequencing were used to detect potential tetracycline resistant bacteria (TRB) and antibiotic resistance genes (ARGs) in sludge cultured with different concentrations of tetracycline. Pyrosequencing of 16S rRNA gene revealed that tetracycline treatment greatly affected the bacterial community structure of the sludge. Nine genera consisting of Sulfuritalea, Armatimonas, Prosthecobacter, Hyphomicrobium, Azonexus, Longilinea, Paracoccus, Novosphingobium and Rhodobacter were identified as potential TRB in the sludge. Results of qPCR, molecular cloning and metagenomic analysis consistently indicated that tetracycline treatment could increase both the abundance and diversity of the tet genes, but decreased the occurrence and diversity of non-tetracycline ARG, especially sulfonamide resistance gene sul2. Cluster analysis showed that tetracycline treatment at subinhibitory concentrations (5 mg/L) was found to pose greater effects on the bacterial community composition, which may be responsible for the variations of the ARGs abundance. This study indicated that joint use of 454 pyrosequencing and Illumina high-throughput sequencing can be effectively used to explore ARB and ARGs in the environment, and future studies should include an in-depth investigation of the relationship between microbial community, ARGs and antibiotics in sewage treatment plant (STP) sludge.

  16. Transcriptome Profiling to Discover Putative Genes Associated with Paraquat Resistance in Goosegrass (Eleusine indica L.)

    Science.gov (United States)

    An, Jing; Shen, Xuefeng; Ma, Qibin; Yang, Cunyi; Liu, Simin; Chen, Yong

    2014-01-01

    Background Goosegrass (Eleusine indica L.), a serious annual weed in the world, has evolved resistance to several herbicides including paraquat, a non-selective herbicide. The mechanism of paraquat resistance in weeds is only partially understood. To further study the molecular mechanism underlying paraquat resistance in goosegrass, we performed transcriptome analysis of susceptible and resistant biotypes of goosegrass with or without paraquat treatment. Results The RNA-seq libraries generated 194,716,560 valid reads with an average length of 91.29 bp. De novo assembly analysis produced 158,461 transcripts with an average length of 1153.74 bp and 100,742 unigenes with an average length of 712.79 bp. Among these, 25,926 unigenes were assigned to 65 GO terms that contained three main categories. A total of 13,809 unigenes with 1,208 enzyme commission numbers were assigned to 314 predicted KEGG metabolic pathways, and 12,719 unigenes were categorized into 25 KOG classifications. Furthermore, our results revealed that 53 genes related to reactive oxygen species scavenging, 10 genes related to polyamines and 18 genes related to transport were differentially expressed in paraquat treatment experiments. The genes related to polyamines and transport are likely potential candidate genes that could be further investigated to confirm their roles in paraquat resistance of goosegrass. Conclusion This is the first large-scale transcriptome sequencing of E. indica using the Illumina platform. Potential genes involved in paraquat resistance were identified from the assembled sequences. The transcriptome data may serve as a reference for further analysis of gene expression and functional genomics studies, and will facilitate the study of paraquat resistance at the molecular level in goosegrass. PMID:24927422

  17. Antibiotic resistance and ndvB gene expression among biofilm ...

    African Journals Online (AJOL)

    A novel antibiotic resistant mechanism among biofilms is glucan-mediated sequestration in which ndvB gene encodes a glucosyltransferase involved in the formation of this glucans. We studied the biofilm formation and antibiotic susceptibility pattern of P. aeruginosa isolated from clinical samples, and measured the ...

  18. Determination and expression of genes for resistance to blast ...

    African Journals Online (AJOL)

    Determination and expression of genes for resistance to blast (Magnaporthe oryza) in Basmati and non-Basmati indica rices (Oryza sativa L.) Naveen Kumar, D Singh, S Gupta, A Sirohi, B Ramesh, Preeti Sirohi, Parul Sirohi, Atar Singh, N Kumar, A Kumar, Rajendra Kumar, R Kumar, J Singh, P. Kumar, P. Chauhan, ...

  19. Gene interactions and genetics of blast resistance and yield ...

    Indian Academy of Sciences (India)

    2014-08-11

    Aug 11, 2014 ... Keywords. blast; gene action; generation mean analysis; resistance; yield. Journal of Genetics, Vol. 93, No. .... Utilizing the variance of different generations, the variances of A, B, C and D scales were ...... Jia Y. 2003 Marker assisted selection for the control of rice blast disease. Pesticide Outlook 14 ...

  20. Evaluating antibiotic resistance genes in soils with applied manures

    Science.gov (United States)

    Antibiotics are commonly used in livestock production to promote growth and combat disease. Recent studies have shown the potential for spread of antibiotic resistance genes (ARG) to the environment following application of livestock manures. In this study, concentrations of bacteria with ARG in soi...

  1. Absence of meca gene in methicillin-resistant staphylococcus ...

    African Journals Online (AJOL)

    Methicillin-resistant Staphylococcus aureus has emerged as a serious threat to public health, causing both hospital and community-associated infections. The gold standard for MRSA detection is the amplification of the mecA gene that codes for the production of the altered penicillin-binding protein (PBP2a) responsible for ...

  2. Molecular Detection of Virulence Genes and Antibiotic Resistance ...

    African Journals Online (AJOL)

    Escherichia coli O157:H7 is an important food-borne pathogen that can cause diarrhea, haemorrhagic colitis and haemolytic uremic syndrome. This study was conducted to investigate the prevalence, virulence genes and antibiotic resistance patterns of E. coli O157:H7 in raw beef meat sold in Abeokuta, South west Nigeria ...

  3. Molecular detection of disease resistance genes to powdery mildew ...

    African Journals Online (AJOL)

    Tuoyo Aghomotsegin

    2017-01-04

    Jan 4, 2017 ... 2. State Key Laboratory of Biology for Plant Diseases and Insect Pests, Institute of Plant Protection, Chinese Academy of. Agricultural Sciences, Beijing 100193, China. Received 10 October, 2016; Accepted 14 December, 2016. A study was conducted to detect the presence of disease resistance genes to ...

  4. Cloning of a carbendazim-resistant gene from Colletotrichum ...

    African Journals Online (AJOL)

    Cloning of a carbendazim-resistant gene from Colletotrichum gloeosporioides of mango in South China. ... Abstract. Mango anthracnose caused by Colletotrichum gloeosporioides is an important disease and prevalent in tropical regions of China. High carbendazim ... employed to further test the above results. It involved an ...

  5. Cloning and characterization of NBS-LRR resistance gene ...

    African Journals Online (AJOL)

    biotech

    2013-07-03

    Jul 3, 2013 ... Resistance genes honologues I theobroma cacao as useful genetic markers. Theor. Appl. Gent. 107:191-202. Kumar S, Tamura K, Nei M (2004). MEGA3: integrated software for molecular evolutionary genetics analysis and sequence alignment. Brief Bioinform. 5:150-163. Lacock L, Niekerk CV, Loots S, ...

  6. Cloning and characterization of NBS-LRR resistance gene ...

    African Journals Online (AJOL)

    biotech

    2013-07-03

    Jul 3, 2013 ... Full Length Research Paper. Cloning and characterization of NBS-LRR resistance gene analogues of Musa spp. and their expression profiling studies against Pratylenchus coffeae. S. Backiyarani*, S. Uma, G. Arunkumar, M. S. Saraswathi and P. Sundararaju. National Research Centre for Banana (ICAR), ...

  7. Prevalence, antibiotic-resistance properties and enterotoxin gene ...

    African Journals Online (AJOL)

    milk-based infant foods in Iran, represent an important public health issue which should be considered ... Keywords: Prevalence, Bacillus cereus, Antibiotic resistance, Enterotoxigenic genes, Milk-based infant food. Tropical Journal of Pharmaceutical Research is indexed by Science ..... and cereals collected in Korea.

  8. Codon-optimized antibiotic resistance gene improves efficiency of ...

    Indian Academy of Sciences (India)

    We generated a synthetic gentamicin resistance gene whose codon usage is optimized to Frankia (fgmR) and evaluated its usefulness as a selection marker using a transient transformation system. Success rate of transient transformation and cell growth in selective culture were significantly increased by use of fgmR ...

  9. Resistance-related gene transcription and antioxidant enzyme ...

    African Journals Online (AJOL)

    The two tobacco relatives of Nicotiana alata and Nicotiana longiflora display a high level of resistance against Colletotrichum nicotianae and the two genes NTF6 and NtPAL related to pathogen defense transcription were higher in N. alata and N. longiflora than the commercial cv. K326. Inoculation with C. nicotianae ...

  10. Genetic analysis and location of a resistance gene to Puccinia ...

    Indian Academy of Sciences (India)

    Administrator

    Electrophoresis was carried out at 1400. V for 1.0 - 1.5 h. Gel staining and visualization was done as previously described (Chen et al. 1998). Polymorphic markers were used to genotype the F2 population. Genotype data were used to construct a genetic map and locate the resistance gene. Mapping and Data analysis.

  11. Functional screening of antibiotic resistance genes from human gut microbiota reveals a novel gene fusion.

    Science.gov (United States)

    Cheng, Gong; Hu, Yongfei; Yin, Yeshi; Yang, Xi; Xiang, Chunsheng; Wang, Baohong; Chen, Yanfei; Yang, Fengling; Lei, Fang; Wu, Na; Lu, Na; Li, Jing; Chen, Quanze; Li, Lanjuan; Zhu, Baoli

    2012-11-01

    The human gut microbiota has a high density of bacteria that are considered a reservoir for antibiotic resistance genes (ARGs). In this study, one fosmid metagenomic library generated from the gut microbiota of four healthy humans was used to screen for ARGs against seven antibiotics. Eight new ARGs were obtained: one against amoxicillin, six against d-cycloserine, and one against kanamycin. The new amoxicillin resistance gene encodes a protein with 53% identity to a class D β-lactamase from Riemerella anatipestifer RA-GD. The six new d-cycloserine resistance genes encode proteins with 73-81% identity to known d-alanine-d-alanine ligases. The new kanamycin resistance gene encodes a protein of 274 amino acids with an N-terminus (amino acids 1-189) that has 42% identity to the 6'-aminoglycoside acetyltransferase [AAC(6')] from Enterococcus hirae and a C-terminus (amino acids 190-274) with 35% identity to a hypothetical protein from Clostridiales sp. SSC/2. A functional study on the novel kanamycin resistance gene showed that only the N-terminus conferred kanamycin resistance. Our results showed that functional metagenomics is a useful tool for the identification of new ARGs. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  12. Diversity of Antibiotic Resistance Genes in Enterococcus Strains Isolated from Ready-to-Eat Meat Products.

    Science.gov (United States)

    Chajęcka-Wierzchowska, Wioleta; Zadernowska, Anna; Łaniewska-Trokenheim, Łucja

    2016-10-25

    The objective of the study was to answer the question of whether the ready-to-eat meat products can pose indirect hazard for consumer health serving as reservoir of Enterococcus strains harboring tetracyclines, aminoglycosides, and macrolides resistance genes. A total of 390 samples of ready-to-eat meat products were investigated. Enterococcus strains were found in 74.1% of the samples. A total of 302 strains were classified as: Enterococcus faecalis (48.7%), Enterococcus faecium (39.7%), Enterococcus casseliflavus (4.3%), Enterococcus durans (3.0%), Enterococcus hirae (2.6%), and other Enterococcus spp. (1.7%). A high percentage of isolates were resistant to streptomycin high level (45%) followed by erythromycin (42.7%), fosfomycin (27.2%), rifampicin (19.2%), tetracycline (36.4%), tigecycline (19.9%). The ant(6')-Ia gene was the most frequently found gene (79.6%). Among the other genes that encode aminoglycosides-modifying enzymes, the highest portion of the strains had the aac(6')-Ie-aph(2'')-Ia (18.5%) and aph(3'')-IIIa (16.6%), but resistance of isolates from food is also an effect of the presence of aph(2'')-Ib, aph(2'')-Ic, aph(2'')-Id genes. Resistance to tetracyclines was associated with the presence of tetM (43.7%), tetL (32.1%), tetK (14.6%), tetW (0.7%), and tetO (0.3%) genes. The ermB and ermA genes were found in 33.8% and 18.9% of isolates, respectively. Nearly half of the isolates contained a conjugative transposon of the Tn916/Tn1545 family. Enterococci are widely present in retail ready-to-eat meat products. Many isolated strains (including such species as E. casseliflavus, E. durans, E. hirae, and Enterococcus gallinarum) are antibiotic resistant and carry transferable resistance genes. © 2016 Institute of Food Technologists®.

  13. The identification of new genes related to cisplatin resistance in ovarian adenocarcinoma cell line A2780

    International Nuclear Information System (INIS)

    Solar, P.; Fedorocko, P.; Sytkowski, A.; Hodorova, I.

    2006-01-01

    Ovarian cancer cells are usually sensitive to platinum-based chemotherapy, such as cisplatin (CDDP), initially but typically become resistant to the drug over time. The phenomenon of clinical drug resistance represents a serious problem for successful disease treatment, and the molecular mechanism(s) are not fully understood. In search of novel mechanisms that may lead to the development of CDDP chemoresistance we have applied subtractive hybridization based on the PCR-select cDNA subtraction. In current study we have used subtractive hybridization to identify differentially-expressed genes in CDDP resistant CP70 and C200 cells versus CDDP-sensitive A2780 human ovarian adenocarcinoma cells. We have analyzed 256 randomly selected clones. Subtraction efficiency was determined by dot blot and DNA sequencing. Confirmation of differentially expressed cDNAs was done by virtual northern blot analysis, and 17 genes that were differentially expressed in both CDDP resistant cell lines versus CDDP sensitive A2780 cells were identified. The expression of 10 of these genes was undetectable or detected with low expression in sensitive A2780 cells in comparison to resistant ones. These genes included ARHGDIB, RANBP2, ASPH, PRTFDC1, SSX2IP, MBNL1, DNAJC15, MMP10, TCTE1L and one unidentified sequence. Additional 7 genes that were more highly expressed in resistant CP70 and C200 vs. A2780 cells included ANXA2, USP8, HSPCA, TRA1, CNAP1, ATP2B1 and COX2. Interestingly, multi-drug resistance associated p-glycoprotein (p170) was not detected by the western blot in CDDP resistant CP70 and C200 cells. Our identified genes are involved in diverse processes, such as stress response, chromatin condensation, protection from protein degradation, invasiveness of cells, alterations of Ca 2+ homeostasis and others which may contribute to CDDP resistance of ovarian adenocarcinoma cells. Further characterization of these genes and gene products should yield important insights into the biology of

  14. Methicillin-resistant Staphylococcus aureus in minas frescal cheese: evaluation of classic enterotoxin genes, antimicrobial resistance and clonal diversity.

    Science.gov (United States)

    Gonzalez, Alice Gonçalves Martins; Marques, Leila Márcia Peres; Gomes, Marcel da Silva Amorim; Beltrão, Jhonathan Campos do Couto; Pinheiro, Marcos Gabriel; Esper, Luciana Maria Ramires; Paula, Geraldo Renato de; Teixeira, Lenise Arneiro; Aguiar-Alves, Fábio

    2017-12-15

    This study aimed to investigate classical enterotoxin (sea to see) and mecA genes, by polymerase chain reaction and anitimicrobial susceptibility, by disk diffusion test of Staphylococcus aureus isolated from minas frescal cheese (MFC). All methicillin-resistant S. aureus (MRSA) isolates were investigated for the presence of Panton-Valentine leukocidin (PVL) genes and clonal diversity. Thirty-one S. aureus were isolated from four MFC samples. Seven (22.6%) S. aureus carried mecA gene and two of them carried enterotoxin genes seb/sec and sea/seb. Five (16.1%) S. aureus isolates showed induced resistance to clindamycin and nine (29%) were resistant to multiple -antibiotics (MDR), among these, six were MRSA. No MRSA isolates presented the PVL genes. Four MRSA were grouped into three clones and three isolates were not typable by pulsed field gel electrophoresis. MRSA isolates showed, by multilocus sequence typing, sequence types ST1, ST5, ST72 and ST4304 (new ST) and S. aureus protein A (spa type) t127, t568 and t2703. These data suggest that MFC may constitute a risk to the consumer because of its potential for staphylococcal food poisoning; however it might, also, become one of MRSA and MDR strains disseminator, including clones usually found in the hospital environment. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  15. Putative resistance genes in the CitEST database

    Directory of Open Access Journals (Sweden)

    Simone Guidetti-Gonzalez

    2007-01-01

    Full Text Available Disease resistance in plants is usually associated with the activation of a wide variety of defense responses to prevent pathogen replication and/or movement. The ability of the host plant to recognize the pathogen and to activate defense responses is regulated by direct or indirect interaction between the products of plant resistance (R and pathogen avirulence (Avr genes. Attempted infection of plants by avirulent pathogens elicits a battery of defenses often followed by the collapse of the challenged host cells. Localized host cell death may help to prevent the pathogen from spreading to uninfected tissues, known as hypersensitive response (HR. When either the plant or the pathogen lacks its cognate gene, activation of the plant’s defense responses fails to occur or is delayed and does not prevent pathogen colonization. In the CitEST database, we identified 1,300 reads related to R genes in Citrus which have been reported in other plant species. These reads were translated in silico, and alignments of their amino acid sequences revealed the presence of characteristic domains and motifs that are specific to R gene classes. The description of the reads identified suggests that they function as resistance genes in citrus.

  16. Identification of antimicrobial resistance genes in multidrug-resistant clinical Bacteroides fragilis isolates by whole genome shotgun sequencing

    DEFF Research Database (Denmark)

    Sydenham, Thomas Vognbjerg; Sóki, József; Hasman, Henrik

    2015-01-01

    Bacteroides fragilis constitutes the most frequent anaerobic bacterium causing bacteremia in humans. The genetic background for antimicrobial resistance in B. fragilis is diverse with some genes requiring insertion sequence (IS) elements inserted upstream for increased expression. To evaluate whole...... genome shotgun sequencing as a method for predicting antimicrobial resistance properties, one meropenem resistant and five multidrug-resistant blood culture isolates were sequenced and antimicrobial resistance genes and IS elements identified using ResFinder 2.1 (http...

  17. Effects of ultraviolet disinfection on antibiotic-resistant Escherichia coli from wastewater: inactivation, antibiotic resistance profiles and antibiotic resistance genes.

    Science.gov (United States)

    Zhang, Chong-Miao; Xu, Li-Mei; Wang, Xiaochang C; Zhuang, Kai; Liu, Qiang-Qiang

    2017-04-29

    To evaluate the effect of ultraviolet (UV) disinfection on antibiotic-resistant Escherichia coli (E. coli). Antibiotic-resistant E. coli strains were isolated from a wastewater treatment plant and subjected to UV disinfection. The effect of UV disinfection on the antibiotic resistance profiles and the antibiotic resistance genes (ARGs) of antibiotic-resistant E. coli was evaluated by a combination of antibiotic susceptibility analysis and molecular methods. Results indicated that multiple-antibiotic-resistant (MAR) E. coli were more resistant at low UV doses and required a higher UV dose (20 mJ cm -2 ) to enter the tailing phase compared with those of antibiotic-sensitive E. coli (8 mJ cm -2 ). UV disinfection caused a selective change in the inhibition zone diameters of surviving antibiotic-resistant E. coli and a slight damage to ARGs. The inhibition zone diameters of the strains resistant to antibiotics were more difficult to alter than those susceptible to antibiotics because of the existence and persistence of corresponding ARGs. The resistance of MAR bacteria to UV disinfection at low UV doses and the changes in inhibition zone diameters could potentially contribute to the selection of ARB in wastewater treatment after UV disinfection. The risk of spread of antibiotic resistance still exists owing to the persistence of ARGs. Our study highlights the acquisition of other methods to control the spread of ARGs. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  18. Bacteria from Animals as a Pool of Antimicrobial Resistance Genes

    Science.gov (United States)

    Argudín, Maria Angeles; Deplano, Ariane; Meghraoui, Alaeddine; Dodémont, Magali; Heinrichs, Amelie; Denis, Olivier; Nonhoff, Claire; Roisin, Sandrine

    2017-01-01

    Antimicrobial agents are used in both veterinary and human medicine. The intensive use of antimicrobials in animals may promote the fixation of antimicrobial resistance genes in bacteria, which may be zoonotic or capable to transfer these genes to human-adapted pathogens or to human gut microbiota via direct contact, food or the environment. This review summarizes the current knowledge of the use of antimicrobial agents in animal health and explores the role of bacteria from animals as a pool of antimicrobial resistance genes for human bacteria. This review focused in relevant examples within the ESC(K)APE (Enterococcus faecium, Staphylococcus aureus, Clostridium difficile (Klebsiella pneumoniae), Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacteriaceae) group of bacterial pathogens that are the leading cause of nosocomial infections throughout the world. PMID:28587316

  19. Rapid cloning of disease-resistance genes in plants using mutagenesis and sequence capture.

    Science.gov (United States)

    Steuernagel, Burkhard; Periyannan, Sambasivam K; Hernández-Pinzón, Inmaculada; Witek, Kamil; Rouse, Matthew N; Yu, Guotai; Hatta, Asyraf; Ayliffe, Mick; Bariana, Harbans; Jones, Jonathan D G; Lagudah, Evans S; Wulff, Brande B H

    2016-06-01

    Wild relatives of domesticated crop species harbor multiple, diverse, disease resistance (R) genes that could be used to engineer sustainable disease control. However, breeding R genes into crop lines often requires long breeding timelines of 5-15 years to break linkage between R genes and deleterious alleles (linkage drag). Further, when R genes are bred one at a time into crop lines, the protection that they confer is often overcome within a few seasons by pathogen evolution. If several cloned R genes were available, it would be possible to pyramid R genes in a crop, which might provide more durable resistance. We describe a three-step method (MutRenSeq)-that combines chemical mutagenesis with exome capture and sequencing for rapid R gene cloning. We applied MutRenSeq to clone stem rust resistance genes Sr22 and Sr45 from hexaploid bread wheat. MutRenSeq can be applied to other commercially relevant crops and their relatives, including, for example, pea, bean, barley, oat, rye, rice and maize.

  20. Anthropogenic antibiotic resistance genes mobilization to the polar regions.

    Science.gov (United States)

    Hernández, Jorge; González-Acuña, Daniel

    2016-01-01

    Anthropogenic influences in the southern polar region have been rare, but lately microorganisms associated with humans have reached Antarctica, possibly from military bases, fishing boats, scientific expeditions, and/or ship-borne tourism. Studies of seawater in areas of human intervention and proximal to fresh penguin feces revealed the presence of Escherichia coli strains least resistant to antibiotics in penguins, whereas E. coli from seawater elsewhere showed resistance to one or more of the following antibiotics: ampicillin, tetracycline, streptomycin, and trim-sulfa. In seawater samples, bacteria were found carrying extended-spectrum β-lactamase (ESBL)-type CTX-M genes in which multilocus sequencing typing (MLST) showed different sequence types (STs), previously reported in humans. In the Arctic, on the contrary, people have been present for a long time, and the presence of antibiotic resistance genes (ARGs) appears to be much more wide-spread than was previously reported. Studies of E coli from Arctic birds (Bering Strait) revealed reduced susceptibility to antibiotics, but one globally spreading clone of E. coli genotype O25b-ST131, carrying genes of ESBL-type CTX-M, was identified. In the few years between sample collections in the same area, differences in resistance pattern were observed, with E. coli from birds showing resistance to a maximum of five different antibiotics. Presence of resistance-type ESBLs (TEM, SHV, and CTX-M) in E. coli and Klebsiella pneumoniae was also confirmed by specified PCR methods. MLST revealed that those bacteria carried STs that connect them to previously described strains in humans. In conclusion, bacteria previously related to humans could be found in relatively pristine environments, and presently human-associated, antibiotic-resistant bacteria have reached a high global level of distribution that they are now found even in the polar regions.

  1. Anthropogenic antibiotic resistance genes mobilization to the polar regions

    Directory of Open Access Journals (Sweden)

    Jorge Hernández

    2016-12-01

    Full Text Available Anthropogenic influences in the southern polar region have been rare, but lately microorganisms associated with humans have reached Antarctica, possibly from military bases, fishing boats, scientific expeditions, and/or ship-borne tourism. Studies of seawater in areas of human intervention and proximal to fresh penguin feces revealed the presence of Escherichia coli strains least resistant to antibiotics in penguins, whereas E. coli from seawater elsewhere showed resistance to one or more of the following antibiotics: ampicillin, tetracycline, streptomycin, and trim-sulfa. In seawater samples, bacteria were found carrying extended-spectrum β-lactamase (ESBL-type CTX-M genes in which multilocus sequencing typing (MLST showed different sequence types (STs, previously reported in humans. In the Arctic, on the contrary, people have been present for a long time, and the presence of antibiotic resistance genes (ARGs appears to be much more wide-spread than was previously reported. Studies of E coli from Arctic birds (Bering Strait revealed reduced susceptibility to antibiotics, but one globally spreading clone of E. coli genotype O25b-ST131, carrying genes of ESBL-type CTX-M, was identified. In the few years between sample collections in the same area, differences in resistance pattern were observed, with E. coli from birds showing resistance to a maximum of five different antibiotics. Presence of resistance-type ESBLs (TEM, SHV, and CTX-M in E. coli and Klebsiella pneumoniae was also confirmed by specified PCR methods. MLST revealed that those bacteria carried STs that connect them to previously described strains in humans. In conclusion, bacteria previously related to humans could be found in relatively pristine environments, and presently human-associated, antibiotic-resistant bacteria have reached a high global level of distribution that they are now found even in the polar regions.

  2. Relationship between Psidium species (Myrtaceae) by resistance gene analog markers: focus on nematode resistance.

    Science.gov (United States)

    Noia, L R; Tuler, A C; Ferreira, A; Ferreira, M F S

    2017-03-16

    Guava (Psidium guajava L.) crop is severely affected by the nematode Meloidogyne enterolobii. Native Psidium species have been reported as sources of resistance against this nematode. Knowledge on the molecular relationship between Psidium species based on plant resistance gene analogs (RGA) can be useful in the genetic breeding of guava for resistance to M. enterolobii. In this study, RGA markers from conserved domains, and structural features of plant R genes, were employed to characterize Psidium species and establish genetic proximity, with a focus on nematode resistance. SSR markers were also applied owing to their neutral nature, thus differing from RGA markers. For this, species reported as sources of resistance to M. enterolobii, such as P. cattleianum and P. friedrichsthalianum, as well as species occurring in the Atlantic Rainforest and susceptible genotypes, were investigated. In 10 evaluated Psidium species, high interspecific genetic variability was verified through RGA and SSR markers, with intraspecific variation in P. guajava higher with SSR, as was expected. Resistant species were clustered by RGA markers, and differential amplicons among genotypes resistant and susceptible to M. enterolobii were identified. Knowledge on the molecular relationships between Psidium species constitutes useful information for breeding of the guava tree, providing direction for hybridization and material for rootstocks. Additionally, the genetic relationship between native species, which have been little studied, and P. guajava were estimated by RGAs, which were confirmed as important markers for genetic diversity related to pathogen resistance.

  3. Metagenomic analysis reveals that bacteriophages are reservoirs of antibiotic resistance genes.

    Science.gov (United States)

    Subirats, Jéssica; Sànchez-Melsió, Alexandre; Borrego, Carles M; Balcázar, José Luis; Simonet, Pascal

    2016-08-01

    A metagenomics approach was applied to explore the presence of antibiotic resistance genes (ARGs) in bacteriophages from hospital wastewater. Metagenomic analysis showed that most phage sequences affiliated to the order Caudovirales, comprising the tailed phage families Podoviridae, Siphoviridae and Myoviridae. Moreover, the relative abundance of ARGs in the phage DNA fraction (0.26%) was higher than in the bacterial DNA fraction (0.18%). These differences were particularly evident for genes encoding ATP-binding cassette (ABC) and resistance-nodulation-cell division (RND) proteins, phosphotransferases, β-lactamases and plasmid-mediated quinolone resistance. Analysis of assembled contigs also revealed that blaOXA-10, blaOXA-58 and blaOXA-24 genes belonging to class D β-lactamases as well as a novel blaTEM (98.9% sequence similarity to the blaTEM-1 gene) belonging to class A β-lactamases were detected in a higher proportion in phage DNA. Although preliminary, these findings corroborate the role of bacteriophages as reservoirs of resistance genes and thus highlight the necessity to include them in future studies on the emergence and spread of antibiotic resistance in the environment. Copyright © 2016 Elsevier B.V. and International Society of Chemotherapy. All rights reserved.

  4. RNA-seq analyses of changes in the Anopheles gambiae transcriptome associated with resistance to pyrethroids in Kenya: identification of candidate-resistance genes and candidate-resistance SNPs.

    Science.gov (United States)

    Bonizzoni, Mariangela; Ochomo, Eric; Dunn, William Augustine; Britton, Monica; Afrane, Yaw; Zhou, Guofa; Hartsel, Joshua; Lee, Ming-Chieh; Xu, Jiabao; Githeko, Andrew; Fass, Joseph; Yan, Guiyun

    2015-09-17

    The extensive use of pyrethroids for control of malaria vectors, driven by their cost, efficacy and safety, has led to widespread resistance. To favor their sustainable use, the World Health Organization (WHO) formulated an insecticide resistance management plan, which includes the identification of the mechanisms of resistance and resistance surveillance. Recognized physiological mechanisms of resistance include target site mutations in the para voltage-gated sodium channel, metabolic detoxification and penetration resistance. Such understanding of resistance mechanisms has allowed the development of resistance monitoring tools, including genotyping of the kdr mutation L1014F/S in the para gene. The sequence-based technique RNA-seq was applied to study changes in the transcriptome of deltamethrin-resistant and -susceptible Anopheles gambiae mosquitoes from the Western Province of Kenya. The resulting gene expression profiles were compared to data in the most recent literature to derive a list of candidate resistance genes. RNA-seq data were analyzed also to identify sequence polymorphisms linked to resistance. A total of five candidate-resistance genes (AGAP04177, AGAP004572, AGAP008840, AGAP007530 and AGAP013036) were identified with altered expression between resistant and susceptible mosquitoes from West and East Africa. A change from G to C at position 36043997 of chromosome 3R resulting in A101G of the sulfotransferase gene AGAP009551 was significantly associated with the resistance phenotype (odds ratio: 5.10). The kdr L1014S mutation was detected at similar frequencies in both phenotypically resistant and susceptible mosquitoes, suggesting it is no longer fully predictive of the resistant phenotype. Overall, these results support the conclusion that resistance to pyrethroids is a complex and evolving phenotype, dependent on multiple gene functions including, but not limited to, metabolic detoxification. Functional convergence among metabolic detoxification

  5. Functional study of the novel multidrug resistance gene HA117 and its comparison to multidrug resistance gene 1

    Directory of Open Access Journals (Sweden)

    Chen Tingfu

    2010-07-01

    Full Text Available Abstract Background The novel gene HA117 is a multidrug resistance (MDR gene expressed by all-trans retinoic acid-resistant HL-60 cells. In the present study, we compared the multidrug resistance of the HA117 with that of the classical multidrug resistance gene 1 (MDR1 in breast cancer cell line 4T1. Methods Transduction of the breast cancer cell line 4T1 with adenoviral vectors encoding the HA117 gene and the green fluorescence protein gene (GFP (Ad-GFP-HA117, the MDR1 and GFP (Ad-GFP-MDR1 or GFP (Ad-GFP was respectively carried out. The transduction efficiency and the multiplicity of infection (MOI were detected by fluorescence microscope and flow cytometry. The transcription of HA117 gene and MDR1 gene were detected by reverse transcription polymerase chain reaction (RT-PCR. Western blotting analysis was used to detect the expression of P-glycoprotein (P-gp but the expression of HA117 could not be analyzed as it is a novel gene and its antibody has not yet been synthesized. The drug-excretion activity of HA117 and MDR1 were determined by daunorubicin (DNR efflux assay. The drug sensitivities of 4T1/HA117 and 4T1/MDR1 to chemotherapeutic agents were detected by Methyl-Thiazolyl-Tetrazolium (MTT assay. Results The transducted efficiency of Ad-GFP-HA117 and Ad-GFP-MDR1 were 75%-80% when MOI was equal to 50. The transduction of Ad-GFP-HA117 and Ad-GFP-MDR1 could increase the expression of HA117 and MDR1. The drug resistance index to Adriamycin (ADM, vincristine (VCR, paclitaxel (Taxol and bleomycin (BLM increased to19.8050, 9.0663, 9.7245, 3.5650 respectively for 4T1/HA117 and 24.2236, 11.0480, 11.3741, 0.9630 respectively for 4T1/MDR1 as compared to the control cells. There were no significant differences in drug sensitivity between 4T1/HA117 and 4T1/MDR1 for the P-gp substrates (ADM, VCR and Taxol (P Conclusions These results confirm that HA117 is a strong MDR gene in both HL-60 and 4T1 cells. Furthermore, our results indicate that the MDR

  6. Polymorphisms in Plasmodium falciparum chloroquine resistance transporter and multidrug resistance 1 genes

    DEFF Research Database (Denmark)

    Venkatesan, Meera; Gadalla, Nahla B; Stepniewska, Kasia

    2014-01-01

    Adequate clinical and parasitologic cure by artemisinin combination therapies relies on the artemisinin component and the partner drug. Polymorphisms in the Plasmodium falciparum chloroquine resistance transporter (pfcrt) and P. falciparum multidrug resistance 1 (pfmdr1) genes are associated...... with decreased sensitivity to amodiaquine and lumefantrine, but effects of these polymorphisms on therapeutic responses to artesunate-amodiaquine (ASAQ) and artemether-lumefantrine (AL) have not been clearly defined. Individual patient data from 31 clinical trials were harmonized and pooled by using standardized...

  7. Comparative Transcriptomics Reveals Differential Gene Expression Related to Colletotrichum gloeosporioides Resistance in the Octoploid Strawberry

    Directory of Open Access Journals (Sweden)

    Feng Wang

    2017-05-01

    Full Text Available The strawberry is an important fruit worldwide; however, the development of the strawberry industry is limited by fungal disease. Anthracnose is caused by the pathogen Colletotrichum gloeosporioides and leads to large-scale losses in strawberry quality and production. However, the transcriptional response of strawberry to infection with C. gloeosporioides is poorly understood. In the present study, the strawberry leaf transcriptome of the ‘Yanli’ and ‘Benihoppe’ cultivars were deep sequenced via an RNA-seq analysis to study C. gloeosporioides resistance in strawberry. Among the sequences, differentially expressed genes were annotated with Gene Ontology terms and subjected to pathway enrichment analysis. Significant categories included defense, plant–pathogen interactions and flavonoid biosynthesis were identified. The comprehensive transcriptome data set provides molecular insight into C. gloeosporioides resistance genes in resistant and susceptible strawberry cultivars. Our findings can enhance breeding efforts in strawberry.

  8. Identification of the rice blast resistance gene Pib in the National Small Grains Collection.

    Science.gov (United States)

    Roychowdhury, M; Jia, Y; Jia, M H; Fjellstrom, R; Cartwright, R D

    2012-07-01

    The Pib gene in rice confers resistance to a wide range of races of the rice blast pathogen, Magnaporthe oryzae, including race IE1k that overcomes Pita, another broad-spectrum resistance gene. In this study, the presence of Pib was determined in 164 rice germplasm accessions from a core subset of the National Small Grains Collection utilizing DNA markers and pathogenicity assays. The presence of Pib was evaluated with two simple sequence repeat (SSR) markers and a dominant marker (Pib-dom) derived from the Pib gene sequence. Pathogenicity assays using two avirulent races (IE1k and IB1) and a virulent race (IB54) were performed to verify the resistance responses of accessions. Of the 164 accessions evaluated, 109 contained the Pib gene as determined using both SSR markers and pathogenicity assays, albeit different haplotypes were detected. The remaining 52 germplasm accessions were different in their responses to the blast races IB54, IE1k, and IB1, thus indicating the presence of R gene(s) other than Pib. The accessions characterized in this study could be used for marker-assisted breeding to improve blast resistance in indica and japonica cultivars worldwide.

  9. Virulence genes in isolates of Klebsiella pneumoniae from the UK during 2016, including among carbapenemase gene-positive hypervirulent K1-ST23 and 'non-hypervirulent' types ST147, ST15 and ST383.

    Science.gov (United States)

    Turton, Jane F; Payne, Zoë; Coward, Amy; Hopkins, Katie L; Turton, Jack A; Doumith, Michel; Woodford, Neil

    2018-01-01

    Klebsiella pneumoniae is a concern because of its multidrug resistance and the ability of hypervirulent types, especially capsular type K1-clonal complex 23 (K1-CC23), to cause community-acquired, life-threatening infections. Hypervirulent types carry an array of virulence genes including rmpA/rmpA2, coding for capsule up-regulation. We sought to identify isolates carrying these elements among submissions to the UK national reference laboratory during 2016. Virulence elements and carbapenemase genes were sought by PCR or from whole genome sequences. Isolates were typed by variable number tandem repeat analysis or by multi locus sequence typing from whole genome sequences. Long read nanopore sequencing was carried out on two isolates.Results/Key findings. Twelve of 1090 isolates (1.1 %) belonged to hypervirulent K1-CC23, with one carrying blaOXA-48 (KpvST23L_OXA-48). A further 24 rmpA/rmpA2-positive isolates were detected: eight belonged to hypervirulent types of capsular types K2 and K54; and 14 belonged to 'non-hypervirulent' ST147, ST15 and ST383 and also carried carbapenemase gene(s). Virulence, heavy metal and antibiotic resistance gene contents were compared from whole genome sequences of KpvST23L_OXA-48 and one of the ST147 isolates carrying blaNDM-1. They carried 94/96 and 26/96 of the virulence genes sought, and 23/23 and 9/23 of the heavy metal resistance genes, respectively. In the ST147 isolate, rmpA/rmpA2 and the aerobactin siderophore cluster were on a large virulence plasmid together with resistance genes. The yersiniabactin cluster was widely present among carbapenemase gene-positive isolates, including among those that were rmpA/rmpA2-negative. Our results highlight a combination of virulence and resistance genes, which could lead to untreatable invasive infections.

  10. Recombination Rate Heterogeneity within Arabidopsis Disease Resistance Genes.

    Science.gov (United States)

    Choi, Kyuha; Reinhard, Carsten; Serra, Heïdi; Ziolkowski, Piotr A; Underwood, Charles J; Zhao, Xiaohui; Hardcastle, Thomas J; Yelina, Nataliya E; Griffin, Catherine; Jackson, Matthew; Mézard, Christine; McVean, Gil; Copenhaver, Gregory P; Henderson, Ian R

    2016-07-01

    Meiotic crossover frequency varies extensively along chromosomes and is typically concentrated in hotspots. As recombination increases genetic diversity, hotspots are predicted to occur at immunity genes, where variation may be beneficial. A major component of plant immunity is recognition of pathogen Avirulence (Avr) effectors by resistance (R) genes that encode NBS-LRR domain proteins. Therefore, we sought to test whether NBS-LRR genes would overlap with meiotic crossover hotspots using experimental genetics in Arabidopsis thaliana. NBS-LRR genes tend to physically cluster in plant genomes; for example, in Arabidopsis most are located in large clusters on the south arms of chromosomes 1 and 5. We experimentally mapped 1,439 crossovers within these clusters and observed NBS-LRR gene associated hotspots, which were also detected as historical hotspots via analysis of linkage disequilibrium. However, we also observed NBS-LRR gene coldspots, which in some cases correlate with structural heterozygosity. To study recombination at the fine-scale we used high-throughput sequencing to analyze ~1,000 crossovers within the RESISTANCE TO ALBUGO CANDIDA1 (RAC1) R gene hotspot. This revealed elevated intragenic crossovers, overlapping nucleosome-occupied exons that encode the TIR, NBS and LRR domains. The highest RAC1 recombination frequency was promoter-proximal and overlapped CTT-repeat DNA sequence motifs, which have previously been associated with plant crossover hotspots. Additionally, we show a significant influence of natural genetic variation on NBS-LRR cluster recombination rates, using crosses between Arabidopsis ecotypes. In conclusion, we show that a subset of NBS-LRR genes are strong hotspots, whereas others are coldspots. This reveals a complex recombination landscape in Arabidopsis NBS-LRR genes, which we propose results from varying coevolutionary pressures exerted by host-pathogen relationships, and is influenced by structural heterozygosity.

  11. Ex Vivo Activity of Endoperoxide Antimalarials, Including Artemisone and Arterolane, against Multidrug-Resistant Plasmodium falciparum Isolates from Cambodia

    Science.gov (United States)

    2014-10-01

    correlated with that of the ACT partner drug, mefloquine . Isolates had mutations associ- ated with clinical resistance to mefloquine , with 35% prevalence of P...falciparum multidrug resistance gene 1 (pfmdr1) amplifi- cation and 84.5% occurrence of the pfmdr1 Y184F mutation. GM IC50s for mefloquine ...dihydroartemisinin [DHA], arte- sunate [AS], chloroquine [CQ], quinine [QN], mefloquine [MQ], and lumefantrine [LUM]) evaluated in parallel. After data analysis was

  12. Emergence of Plasmid-Borne dfrA14 Trimethoprim Resistance Gene in Shigella sonnei

    Directory of Open Access Journals (Sweden)

    ALFONSO MIRANDA

    2016-07-01

    Full Text Available The most common mechanism of trimethoprim (TMP-resistance is the acquisition of dihydrofolate reductase enzyme resistant to this drug. Previous molecular characterization of TMP-genes resistance in Chilean isolates of S. sonnei searching for dfrA1 and dfrA8, showed solely the presence of dfrA8 (formerly dhfrIIIc. However, these genetic markers were absent in S. sonnei strains further isolated during an outbreak in 2009. To identify the TMP-resistance gene in these strains, a genomic DNA library from a TMP-resistant (TMPR S. sonnei representative strain for the outbreak was used to clone, select and identify a TMP-resistance marker. The TMPR clone was sequenced by primer walking, identifying the presence of the dfrA14 gene in the sul2-strA’-dfrA14-‘strA-strB gene arrangement, harbored in a native 6,779-bp plasmid. The same plasmid was isolated by transforming with a ~4.2 MDa plasmid extracted from several TMPR S. sonnei strains into E. coli. This plasmid, named pABC-3, was present only in dfrA14-positive strains and was homologous to a previously described pCERC-1, but different due to the absence of an 11-bp repetitive unit. The distribution of dfrA1, dfrA8 and dfrA14 TMP-resistance genes was determined in 126 TMPR S. sonnei isolates. Most of the strains (96 % carried only one of the three TMP-resistance genes assessed. Thus, all strains obtained during the 2009-outbreak harbored only dfrA14, whereas, dfrA8 was the most abundant gene marker before outbreak and, after the outbreak dfrA1 seems have appeared in circulating strains. According to PFGE, dfrA14-positive strains were clustered in a genetically related group including some dfrA1- and dfrA8-positive strains; meanwhile other genetic group included most of the dfrA8-positive strains. This distribution also correlated with the isolation period, showing a dynamics of trimethoprim genetic markers prevalent in Chilean S. sonnei strains. To our knowledge, dfrA14 gene associated to a small

  13. Prevalence of streptomycin resistance genes in bacterial populations in European habitats

    NARCIS (Netherlands)

    Overbeek, van L.S.; Wellington, E.M.H.; Karagouni, A.; Smalla, K.; Collard, J.M.; Elsas, van J.D.

    2002-01-01

    The prevalence of selected streptomycin (Sm)-resistance genes, i.e. aph (3''), aph (6)-1d, aph (6)-1c, ant (3'') and ant (6), was assessed in a range of pristine as well as polluted European habitats. These habitats included bulk and rhizosphere soils, manure from farm animals, activated sludge from

  14. Gene pyramiding enhances durable blast disease resistance in rice.

    Science.gov (United States)

    Fukuoka, Shuichi; Saka, Norikuni; Mizukami, Yuko; Koga, Hironori; Yamanouchi, Utako; Yoshioka, Yosuke; Hayashi, Nagao; Ebana, Kaworu; Mizobuchi, Ritsuko; Yano, Masahiro

    2015-01-14

    Effective control of blast, a devastating fungal disease of rice, would increase and stabilize worldwide food production. Resistance mediated by quantitative trait loci (QTLs), which usually have smaller individual effects than R-genes but confer broad-spectrum or non-race-specific resistance, is a promising alternative to less durable race-specific resistance for crop improvement, yet evidence that validates the impact of QTL combinations (pyramids) on the durability of plant disease resistance has been lacking. Here, we developed near-isogenic experimental lines representing all possible combinations of four QTL alleles from a durably resistant cultivar. These lines enabled us to evaluate the QTLs singly and in combination in a homogeneous genetic background. We present evidence that pyramiding QTL alleles, each controlling a different response to M. oryzae, confers strong, non-race-specific, environmentally stable resistance to blast disease. Our results suggest that this robust defence system provides durable resistance, thus avoiding an evolutionary "arms race" between a crop and its pathogen.

  15. Mapping fusiform rust resistance genes within a complex mating design of loblolly pine

    Science.gov (United States)

    Tania Quesada; Marcio F.R. Resende Jr.; Patricio Munoz; Jill L. Wegrzyn; David B. Neale; Matias Kirst; Gary F. Peter; Salvador A. Gezan; C.Dana Nelson; John M. Davis

    2014-01-01

    Fusiform rust resistance can involve gene-for-gene interactions where resistance (Fr) genes in the host interact with corresponding avirulence genes in the pathogen, Cronartium quercuum f.sp. fusiforme (Cqf). Here, we identify trees with Fr genes in a loblolly pine population derived from a complex mating design challenged with two Cqf inocula (one gall and 10 gall...

  16. Reprogramming of the ERRα and ERα target gene landscape triggers tamoxifen resistance in breast cancer.

    Science.gov (United States)

    Thewes, Verena; Simon, Ronald; Schroeter, Petra; Schlotter, Magdalena; Anzeneder, Tobias; Büttner, Reinhard; Benes, Vladimir; Sauter, Guido; Burwinkel, Barbara; Nicholson, Robert I; Sinn, Hans-Peter; Schneeweiss, Andreas; Deuschle, Ulrich; Zapatka, Marc; Heck, Stefanie; Lichter, Peter

    2015-02-15

    Endocrine treatment regimens for breast cancer that target the estrogen receptor-α (ERα) are effective, but acquired resistance remains a limiting drawback. One mechanism of acquired resistance that has been hypothesized is functional substitution of the orphan receptor estrogen-related receptor-α (ERRα) for ERα. To examine this hypothesis, we analyzed ERRα and ERα in recurrent tamoxifen-resistant breast tumors and conducted a genome-wide target gene profiling analysis of MCF-7 breast cancer cell populations that were sensitive or resistant to tamoxifen treatment. This analysis uncovered a global redirection in the target genes controlled by ERα, ERRα, and their coactivator AIB1, defining a novel set of target genes in tamoxifen-resistant cells. Beyond differences in the ERα and ERRα target gene repertoires, both factors were engaged in similar pathobiologic processes relevant to acquired resistance. Functional analyses confirmed a requirement for ERRα in tamoxifen- and fulvestrant-resistant MCF-7 cells, with pharmacologic inhibition of ERRα sufficient to partly restore sensitivity to antiestrogens. In clinical specimens (n = 1041), increased expression of ERRα was associated with enhanced proliferation and aggressive disease parameters, including increased levels of p53 in ERα-positive cases. In addition, increased ERRα expression was linked to reduced overall survival in independent tamoxifen-treated patient cohorts. Taken together, our results suggest that ERα and ERRα cooperate to promote endocrine resistance, and they provide a rationale for the exploration of ERRα as a candidate drug target to treat endocrine-resistant breast cancer. ©2015 American Association for Cancer Research.

  17. Resistance-Gene Cassettes Associated With Salmonella enterica Genotypes.

    Science.gov (United States)

    Bakhshi, Bita; Ghafari, Mohsen; Pourshafie, Mohammad R; Zarbakhsh, Behnaz; Katouli, Mohammad; Rahbar, Mohammad; Hajia, Masoud; Hosseini-Aliabad, Neda; Boustanshenas, Mina

    2015-01-01

    The epidemiology of salmonellosis is complex because of the diversity and different serotypes of Salmonella enterica (S. enterica) that occur in different reservoirs and geographic incidences. To determine the genotype distribution and resistance-gene content of 2 classes of integron among S. enterica isolates. Thirty-six S. enterica species were isolated and tested for their serological distribution and the resistance-gene contents of 2 classes of integron, as well as for their genetic diversity, using the pulsed-field gel electrophoresis (PFGE) genotyping method. Serogroups E (36.1%) and D (30.5%) were dominant among the isolates. All of the isolates in serogroup D belonged to the serovar enteritidis. The aadA1 gene was found within all resistance-gene cassettes. We observed 4 common and 26 single pulsotypes among the isolates, which indicated a high degree of genetic diversity among the isolates. Using the PulseNet International standard protocol, it was found that these isolates were different from those reported previously in Iran. The presence of a few common and new pulsotypes among the isolates suggests the emergence and spread of new clones of S. enterica in Iran. Copyright© by the American Society for Clinical Pathology (ASCP).

  18. Continental-scale pollution of estuaries with antibiotic resistance genes.

    Science.gov (United States)

    Zhu, Yong-Guan; Zhao, Yi; Li, Bing; Huang, Chu-Long; Zhang, Si-Yu; Yu, Shen; Chen, Yong-Shan; Zhang, Tong; Gillings, Michael R; Su, Jian-Qiang

    2017-01-30

    Antibiotic resistance genes (ARGs) have moved from the environmental resistome into human commensals and pathogens, driven by human selection with antimicrobial agents. These genes have increased in abundance in humans and domestic animals, to become common components of waste streams. Estuarine habitats lie between terrestrial/freshwater and marine ecosystems, acting as natural filtering points for pollutants. Here, we have profiled ARGs in sediments from 18 estuaries over 4,000 km of coastal China using high-throughput quantitative polymerase chain reaction, and investigated their relationship with bacterial communities, antibiotic residues and socio-economic factors. ARGs in estuarine sediments were diverse and abundant, with over 200 different resistance genes being detected, 18 of which were found in all 90 sediment samples. The strong correlations of identified resistance genes with known mobile elements, network analyses and partial redundancy analysis all led to the conclusion that human activity is responsible for the abundance and dissemination of these ARGs. Such widespread pollution with xenogenetic elements has environmental, agricultural and medical consequences.

  19. Resistance gene transfer during treatments for experimental avian colibacillosis.

    Science.gov (United States)

    Dheilly, Alexandra; Le Devendec, Laëtitia; Mourand, Gwenaëlle; Bouder, Axelle; Jouy, Eric; Kempf, Isabelle

    2012-01-01

    An experiment was conducted in animal facilities to compare the impacts of four avian colibacillosis treatments-oxytetracycline (OTC), trimethoprim-sulfadimethoxine (SXT), amoxicillin (AMX), or enrofloxacin (ENR)-on the susceptibility of Escherichia coli in broiler intestinal tracts. Birds were first orally inoculated with rifampin-resistant E. coli strains bearing plasmid genes conferring resistance to fluoroquinolones (qnr), cephalosporins (bla(CTX-M) or bla(FOX)), trimethoprim-sulfonamides, aminoglycosides, or tetracyclines. Feces samples were collected before, during, and after antimicrobial treatments. The susceptibilities of E. coli strains were studied, and resistance gene transfer was analyzed. An increase in the tetracycline-resistant E. coli population was observed only in OTC-treated birds, whereas multiresistant E. coli was detected in the dominant E. coli populations of SXT-, AMX-, or ENR-treated birds. Most multiresistant E. coli strains were susceptible to rifampin and exhibited various pulsed-field gel electrophoresis profiles, suggesting the transfer of one of the multiresistance plasmids from the inoculated strains to other E. coli strains in the intestinal tract. In conclusion, this study clearly illustrates how, in E. coli, "old" antimicrobials may coselect antimicrobial resistance to recent and critical molecules.

  20. Comparative genome analysis of ciprofloxacin-resistant Pseudomonas aeruginosa reveals genes within newly identified high variability regions associated with drug resistance development.

    Science.gov (United States)

    Su, Hsun-Cheng; Khatun, Jainab; Kanavy, Dona M; Giddings, Morgan C

    2013-12-01

    The alarming rise of ciprofloxacin-resistant Pseudomonas aeruginosa has been reported in several clinical studies. Though the mutation of resistance genes and their role in drug resistance has been researched, the process by which the bacterium acquires high-level resistance is still not well understood. How does the genomic evolution of P. aeruginosa affect resistance development? Could the exposure of antibiotics to the bacteria enrich genomic variants that lead to the development of resistance, and if so, how are these variants distributed through the genome? To answer these questions, we performed 454 pyrosequencing and a whole genome analysis both before and after exposure to ciprofloxacin. The comparative sequence data revealed 93 unique resistance strain variation sites, which included a mutation in the DNA gyrase subunit A gene. We generated variation-distribution maps comparing the wild and resistant types, and isolated 19 candidates from three discrete resistance-associated high variability regions that had available transposon mutants, to perform a ciprofloxacin exposure assay. Of these region candidates with transposon disruptions, 79% (15/19) showed a reduction in the ability to gain high-level resistance, suggesting that genes within these high variability regions might enrich for certain functions associated with resistance development.

  1. Gene Prioritization of Resistant Rice Gene against Xanthomas oryzae pv. oryzae by Using Text Mining Technologies

    Directory of Open Access Journals (Sweden)

    Jingbo Xia

    2013-01-01

    Full Text Available To effectively assess the possibility of the unknown rice protein resistant to Xanthomonas oryzae pv. oryzae, a hybrid strategy is proposed to enhance gene prioritization by combining text mining technologies with a sequence-based approach. The text mining technique of term frequency inverse document frequency is used to measure the importance of distinguished terms which reflect biomedical activity in rice before candidate genes are screened and vital terms are produced. Afterwards, a built-in classifier under the chaos games representation algorithm is used to sieve the best possible candidate gene. Our experiment results show that the combination of these two methods achieves enhanced gene prioritization.

  2. Distribution of different efflux pump genes in clinical isolates of multidrug-resistant Acinetobacter baumannii and their correlation with antimicrobial resistance.

    Science.gov (United States)

    Lin, Ming-Feng; Lin, Yun-You; Tu, Chi-Chao; Lan, Chung-Yu

    2017-04-01

    Efflux pumps are one of the major mechanisms of antimicrobial resistance in Acinetobacter baumannii. This study aimed to understand the distribution of different types of pump genes in clinical isolates of multidrug-resistant A. baumannii (MDRAB) and to reveal the relationship between their presence and expression with antimicrobial resistance. MDRAB isolates were collected from five hospitals in Taiwan. Different categories of pump genes, including adeB, adeJ, macB, abeM, abeS, emrA-like, emrB-like, and craA, were chosen, and their presence in the collected isolates was determined. Three induced resistant strains of A. baumannii ATCC 17978 to tigecycline, imipenem, and amikacin were also included. The expressions of the selected pump genes were determined using quantitative reverse transcription-polymerase chain reaction. Twenty-one MDRAB clinical isolates were obtained from five hospitals. All of the studied pump genes were present in the collected MDRAB isolates except one isolate that lacked the emrA-like gene. The gene expression of these efflux pumps was variable among the strains. The upregulation of the adeB, adeJ, and macB genes was responsible for tigecycline resistance, and the increased abeS expression was strongly related to amikacin resistance. Of all the antibiotics studied, tigecycline was the strongest inducer of gene expression for many efflux pumps in A. baumannii. Efflux pump genes are universally present in the collected clinical MDRAB isolates. The upregulation of the adeB, adeJ, macB and abeS genes is more related with antibiotic resistance. Copyright © 2015. Published by Elsevier B.V.

  3. Spread of tetracycline resistance genes at a conventional dairy farm

    Czech Academy of Sciences Publication Activity Database

    Kyselková, Martina; Jirout, Jiří; Vrchotová, Naděžda; Schmitt, H.; Elhottová, Dana

    2015-01-01

    Roč. 6, may (2015), s. 536 ISSN 1664-302X R&D Projects: GA ČR GAP504/10/2077; GA MŠk(CZ) EE2.3.30.0032; GA MŠk(CZ) LO1415 Institutional support: RVO:67179843 ; RVO:60077344 Keywords : antibiotic resistance spread * animal manure * cattle intestinal microflora * chlortetracycline * dairy cattle * dairy farm * heavy metals * tetracycline resistance genes Subject RIV: EI - Biotechnology ; Bionics; EE - Microbiology, Virology (BC-A) Impact factor: 4.165, year: 2015

  4. Using SNP genetic markers to elucidate the linkage of the Co-34/Phg-3 anthracnose and angular leaf spot resistance gene cluster with the Ur-14 resistance gene

    Science.gov (United States)

    The Ouro Negro common bean cultivar contains the Co-34/Phg-3 gene cluster that confers resistance to the anthracnose (ANT) and angular leaf spot (ALS) pathogens. These genes are tightly linked on chromosome 4. Ouro Negro also has the Ur-14 rust resistance gene, reportedly in the vicinity of Co- 34; ...

  5. Detection of the florfenicol resistance gene floR in Chryseobacterium isolates from rainbow trout. Exception to the general rule?

    Science.gov (United States)

    Verner-Jeffreys, David W; Brazier, Thomas; Perez, Ramon Y; Ryder, David; Card, Roderick M; Welch, Timothy J; Hoare, Rowena; Ngo, Thao; McLaren, Nikki; Ellis, Richard; Bartie, Kerry L; Feist, Stephen W; Rowe, William M P; Adams, Alexandra; Thompson, Kim D

    2017-04-01

    Bacteria from the family Flavobacteriaceae often show low susceptibility to antibiotics. With the exception of two Chryseobacterium spp. isolates that were positive for the florfenicol resistance gene floR, no clinical resistance genes were identified by microarray in 36 Flavobacteriaceae isolates from salmonid fish that could grow in ≥ 4 mg/L florfenicol. Whole genome sequence analysis of the floR positive isolates revealed the presence of a region that contained the antimicrobial resistance genes floR, a tet(X) tetracycline resistance gene, a streptothricin resistance gene and a chloramphenicol acetyltransferase gene. In silico analysis of 377 published genomes for Flavobacteriaceae isolates from a range of sources confirmed that well-characterised resistance gene cassettes were not widely distributed in bacteria from this group. Efflux pump-mediated decreased susceptibility to a range of antimicrobials was confirmed in both floR positive isolates using an efflux pump inhibitor (phenylalanine-arginine β-naphthylamide) assay. The floR isolates possessed putative virulence factors, including production of siderophores and haemolysins, and were mildly pathogenic in rainbow trout. Results support the suggestion that, despite the detection of floR, susceptibility to antimicrobials in Flavobacteriaceae is mostly mediated via intrinsic mechanisms rather than the horizontally acquired resistance genes more normally associated with Gram-negative bacterial pathogens such as Enterobacteriaceae. © Crown copyright 2017.

  6. Identification of genes differentially expressed in a resistant reaction to Mycosphaerella pinodes in pea using microarray technology

    Directory of Open Access Journals (Sweden)

    Cubero José I

    2011-01-01

    Full Text Available Abstract Background Ascochyta blight, caused by Mycosphaerella pinodes is one of the most important pea pathogens. However, little is known about the genes and mechanisms of resistance acting against M. pinodes in pea. Resistance identified so far to this pathogen is incomplete, polygenic and scarce in pea, being most common in Pisum relatives. The identification of the genes underlying resistance would increase our knowledge about M. pinodes-pea interaction and would facilitate the introgression of resistance into pea varieties. In the present study differentially expressed genes in the resistant P. sativum ssp. syriacum accession P665 comparing to the susceptible pea cv. Messire after inoculation with M. pinodes have been identified using a M. truncatula microarray. Results Of the 16,470 sequences analysed, 346 were differentially regulated. Differentially regulated genes belonged to almost all functional categories and included genes involved in defense such as genes involved in cell wall reinforcement, phenylpropanoid and phytoalexins metabolism, pathogenesis- related (PR proteins and detoxification processes. Genes associated with jasmonic acid (JA and ethylene signal transduction pathways were induced suggesting that the response to M. pinodes in pea is regulated via JA and ET pathways. Expression levels of ten differentially regulated genes were validated in inoculated and control plants using qRT-PCR showing that the P665 accession shows constitutively an increased expression of the defense related genes as peroxidases, disease resistance response protein 39 (DRR230-b, glutathione S-transferase (GST and 6a-hydroxymaackiain methyltransferase. Conclusions Through this study a global view of genes expressed during resistance to M. pinodes has been obtained, giving relevant information about the mechanisms and pathways conferring resistance to this important disease. In addition, the M. truncatula microarray represents an efficient tool to

  7. Identification of genes differentially expressed in a resistant reaction to Mycosphaerella pinodes in pea using microarray technology.

    Science.gov (United States)

    Fondevilla, Sara; Küster, Helge; Krajinski, Franziska; Cubero, José I; Rubiales, Diego

    2011-01-13

    Ascochyta blight, caused by Mycosphaerella pinodes is one of the most important pea pathogens. However, little is known about the genes and mechanisms of resistance acting against M. pinodes in pea. Resistance identified so far to this pathogen is incomplete, polygenic and scarce in pea, being most common in Pisum relatives. The identification of the genes underlying resistance would increase our knowledge about M. pinodes-pea interaction and would facilitate the introgression of resistance into pea varieties. In the present study differentially expressed genes in the resistant P. sativum ssp. syriacum accession P665 comparing to the susceptible pea cv. Messire after inoculation with M. pinodes have been identified using a M. truncatula microarray. Of the 16,470 sequences analysed, 346 were differentially regulated. Differentially regulated genes belonged to almost all functional categories and included genes involved in defense such as genes involved in cell wall reinforcement, phenylpropanoid and phytoalexins metabolism, pathogenesis- related (PR) proteins and detoxification processes. Genes associated with jasmonic acid (JA) and ethylene signal transduction pathways were induced suggesting that the response to M. pinodes in pea is regulated via JA and ET pathways. Expression levels of ten differentially regulated genes were validated in inoculated and control plants using qRT-PCR showing that the P665 accession shows constitutively an increased expression of the defense related genes as peroxidases, disease resistance response protein 39 (DRR230-b), glutathione S-transferase (GST) and 6a-hydroxymaackiain methyltransferase. Through this study a global view of genes expressed during resistance to M. pinodes has been obtained, giving relevant information about the mechanisms and pathways conferring resistance to this important disease. In addition, the M. truncatula microarray represents an efficient tool to identify candidate genes controlling resistance to M

  8. Prevalence and resistance of commensal Staphylococcus aureus, including meticillin-resistant Staphylococcus aureus: a European cross-sectional study.

    NARCIS (Netherlands)

    Heijer, C.D.J. den; Bijnen, E.M.E. van; Paget, W.J.; Pringle, M.; Goossen, H.; Bruggeman, C.A.; Schellevis, F.G.; Stobberingh, E.E.

    2014-01-01

    Background: Information on the prevalence of Staphylococcus aureus resistance has mainly been obtained from invasive strains, although the commensal flora is considered an important reservoir of resistance. Within ‘The Appropriateness of prescribing antibiotics in primary health care in Europe with

  9. Erythromycin-resistant genes in group A β-haemolytic Streptococci in Chengdu, Southwestern China

    Directory of Open Access Journals (Sweden)

    W Zhou

    2014-01-01

    Full Text Available Context: The management of Group A β-haemolytic Streptococci (Streptococcus pyogenes or GAS infection include the use of penicillins, cephalosporins or macrolides for treatment. A general increase in macrolides resistance in GAS has been observed in recent years. Differences in rates of resistance to these agents have existed according to geographical location and investigators. Aims: To investigate the antibiotic pattern and erythromycin-resistant genes of GAS isolates associated with acute tonsillitis and scarlet fever in Chengdu, southwestern China. Settings and Design: To assess the macrolide resistance, phenotype, and genotypic characterization of GAS isolated from throat swabs of children suffering from different acute tonsillitis or scarlet fever between 2004 and 2011 in the city of Chengdu, located in the southwestern region of China. Materials and Methods: Minimal inhibitory concentration with seven antibiotics was performed on 127 GAS isolates. Resistance phenotypes of erythromycin-resistant GAS isolates were determined by the double-disk test. Their macrolide-resistant genes (mefA, ermB and ermTR were amplified by PCR. Results: A total of 98.4% (125/127 of the isolates exhibited resistance to erythromycin, clindamycin and tetracycline. All isolates were sensitive to penicillin G and cefotaxime. Moreover, 113 ermB-positive isolates demonstrating the cMLS phenotype of erythromycin resistance were predominant (90.4% and these isolates showed high-level resistance to both erythromycin and clindamycin (MIC 90 > 256 μg/ml; 12 (9.6% isolates demonstrating the MLS phenotype of erythromycin resistance carried the mefA gene, which showed low-level resistance to both erythromycin (MIC 90 = 8 μg/ml and clindamycin (MIC 90 = 0.5 μg/ml; and none of the isolates exhibited the M phenotype. Conclusions: The main phenotype is cMLS, and the ermB gene code is the main resistance mechanism against macrolides in GAS. Penicillin is the most beneficial

  10. Environmental and Public Health Implications of Water Reuse: Antibiotics, Antibiotic Resistant Bacteria, and Antibiotic Resistance Genes

    KAUST Repository

    Hong, Pei-Ying

    2013-07-31

    Water scarcity is a global problem, and is particularly acute in certain regions like Africa, the Middle East, as well as the western states of America. A breakdown on water usage revealed that 70% of freshwater supplies are used for agricultural irrigation. The use of reclaimed water as an alternative water source for agricultural irrigation would greatly alleviate the demand on freshwater sources. This paradigm shift is gaining momentum in several water scarce countries like Saudi Arabia. However, microbial problems associated with reclaimed water may hinder the use of reclaimed water for agricultural irrigation. Of particular concern is that the occurrence of antibiotic residues in the reclaimed water can select for antibiotic resistance genes among the microbial community. Antibiotic resistance genes can be associated with mobile genetic elements, which in turn allow a promiscuous transfer of resistance traits from one bacterium to another. Together with the pathogens that are present in the reclaimed water, antibiotic resistant bacteria can potentially exchange mobile genetic elements to create the “perfect microbial storm”. Given the significance of this issue, a deeper understanding of the occurrence of antibiotics in reclaimed water, and their potential influence on the selection of resistant microorganisms would be essential. In this review paper, we collated literature over the past two decades to determine the occurrence of antibiotics in municipal wastewater and livestock manure. We then discuss how these antibiotic resistant bacteria may impose a potential microbial risk to the environment and public health, and the knowledge gaps that would have to be addressed in future studies. Overall, the collation of the literature in wastewater treatment and agriculture serves to frame and identify potential concerns with respect to antibiotics, antibiotic resistant bacteria, and antibiotic resistance genes in reclaimed water.

  11. The Medicago truncatula lysin [corrected] motif-receptor-like kinase gene family includes NFP and new nodule-expressed genes.

    Science.gov (United States)

    Arrighi, Jean-François; Barre, Annick; Ben Amor, Besma; Bersoult, Anne; Soriano, Lidia Campos; Mirabella, Rossana; de Carvalho-Niebel, Fernanda; Journet, Etienne-Pascal; Ghérardi, Michèle; Huguet, Thierry; Geurts, René; Dénarié, Jean; Rougé, Pierre; Gough, Clare

    2006-09-01

    Rhizobial Nod factors are key symbiotic signals responsible for starting the nodulation process in host legume plants. Of the six Medicago truncatula genes controlling a Nod factor signaling pathway, Nod Factor Perception (NFP) was reported as a candidate Nod factor receptor gene. Here, we provide further evidence for this by showing that NFP is a lysin [corrected] motif (LysM)-receptor-like kinase (RLK). NFP was shown both to be expressed in association with infection thread development and to be involved in the infection process. Consistent with deviations from conserved kinase domain sequences, NFP did not show autophosphorylation activity, suggesting that NFP needs to associate with an active kinase or has unusual functional characteristics different from classical kinases. Identification of nine new M. truncatula LysM-RLK genes revealed a larger family than in the nonlegumes Arabidopsis (Arabidopsis thaliana) or rice (Oryza sativa) of at least 17 members that can be divided into three subfamilies. Three LysM domains could be structurally predicted for all M. truncatula LysM-RLK proteins, whereas one subfamily, which includes NFP, was characterized by deviations from conserved kinase sequences. Most of the newly identified genes were found to be expressed in roots and nodules, suggesting this class of receptors may be more extensively involved in nodulation than was previously known.

  12. Who possesses drug resistance genes in the aquatic environment?: sulfamethoxazole (SMX) resistance genes among the bacterial community in water environment of Metro-Manila, Philippines.

    Science.gov (United States)

    Suzuki, Satoru; Ogo, Mitsuko; Miller, Todd W; Shimizu, Akiko; Takada, Hideshige; Siringan, Maria Auxilia T

    2013-01-01

    Recent evidence has shown that antibiotic resistant bacteria (ARB) and antibiotic resistance genes (ARGs) are ubiquitous in natural environments, including sites considered pristine. To understand the origin of ARGs and their dynamics, we must first define their actual presence in the natural bacterial assemblage. Here we found varying distribution profiles of sul genes in "colony forming bacterial assemblages" and "natural bacterial assemblages." Our monitoring for antibiotic contamination revealed that sulfamethoxazole (SMX) is a major contaminant in aquatic environments of Metro-Manila, which would have been derived from human and animal use, and subsequently decreased through the process of outflow from source to the sea. The SMX-resistant bacterial rate evaluated by the colony forming unit showed 10 to 86% of the total colony numbers showed higher rates from freshwater sites compared to marine sites. When sul genes were quantified by qPCR, colony-forming bacteria conveyed sul1 and sul2 genes in freshwater and seawater (10(-5)-10(-2) copy/16S) but not sul3. Among the natural bacterial assemblage, all sul1, sul2, and sul3 were detected (10(-5)-10(-3) copy/16S), whereas all sul genes were at an almost non-detectable level in the freshwater assemblage. This study suggests that sul1 and sul2 are main sul genes in culturable bacteria, whereas sul3 is conveyed by non-culturable bacteria in the sea. As a result marine bacteria possess sul1, sul2 and sul3 genes in the marine environment.

  13. Who Possesses Drug Resistance Genes in the Aquatic Environment? : Sulfamethoxazole (SMX Resistance Genes among the Bacterial Community in Water Environment of Metro-Manila, Philippines

    Directory of Open Access Journals (Sweden)

    Satoru eSuzuki

    2013-04-01

    Full Text Available Recent evidence has shown that antibiotic resistant bacteria (ARB and antibiotic resistance genes (ARG are ubiquitous in natural environments, including sites considered pristine. To understand the origin of ARGs and their dynamics, we must first define their actual presence in the natural bacterial assemblage. Here we found varying distribution profiles of sul genes in colony forming bacterial assemblages and natural bacterial assemblages. Our monitoring for antibiotic contamination revealed that sulfamethoxazole (SMX is a major contaminant in aquatic environments of Metro-Manila, which would have been derived from human and animal use, and subsequently decreased through the process of outflow from source to the sea. The SMX-resistant bacterial rate evaluated by the colony forming unit showed 10 to 86 % of the total colony numbers showed higher rates from freshwater sites compared to marine sites. When sul genes were quantified by qPCR, colony-forming bacteria conveyed sul1 and sul2 genes in freshwater and seawater (10-5-10-2 copy/16S but not sul3. Among the natural bacterial assemblage, all sul1, sul2 and sul3 were detected (10-5-10-3 copy/16S, whereas all sul genes were at an almost non-detectable level in the freshwater assemblage. This study suggests that sul1 and sul2 are main sul genes in culturable bacteria, whereas sul3 is conveyed by non-culturable bacteria in the sea. As a result marine bacteria possess sul1, sul2 and sul3 genes in the marine environment.

  14. Abundant rifampin resistance genes and significant correlations of antibiotic resistance genes and plasmids in various environments revealed by metagenomic analysis.

    Science.gov (United States)

    Ma, Liping; Li, Bing; Zhang, Tong

    2014-06-01

    In the present study, a newly developed metagenomic analysis approach was applied to investigate the abundance and diversity of antibiotic resistance genes (ARGs) and mobile genetic elements (MGEs) in aquaculture farm sediments, activated sludge, biofilm, anaerobic digestion sludge, and river water. BLASTX analysis against the Comprehensive Antibiotic Resistance Database was conducted for the metagenomic sequence data of each sample and then the ARG-like sequences were sorted based on structured sub-database using customized scripts. The results showed that freshwater fishpond sediment had the highest abundance (196 ppm), and anaerobic digestion sludge possessed the highest diversity (133 subtypes) of ARGs among the samples in this study. Significantly, rifampin resistance genes were universal in all the diverse samples and consistently accounted for 26.9~38.6 % of the total annotated ARG sequences. Furthermore, a significant linear correlation (R (2) = 0.924) was found between diversities (number of subtypes) of ARGs and diversities of plasmids in diverse samples. This work provided a wide spectrum scan of ARGs and MGEs in different environments and revealed the prevalence of rifampin resistance genes and the strong correlation between ARG diversity and plasmid diversity for the first time.

  15. Isolation and Cloning of mercuric reductase gene (merA from mercury-resistant bacteria

    Directory of Open Access Journals (Sweden)

    Parisa Khoshniyat

    2018-03-01

    Full Text Available Introduction: Some of the bacteria having merA gene coding mineral mercury reducing enzyme, has genetic potential of Hg removing via reduction of mineral mercury and transformation of that to gas form and finally bioremediation of polluted area. The aim of this study is the isolation of merA gene from resistance bacteria and cloning of that into suitable expression vector and then the environmental bioremediation by the transformation of bacteria with this vector. Materials and methods: A number of bacteria were collected in contaminated areas with mercury in order to isolate merA genes. Polymerase chain reaction had done on the four bacterial genomes including Klebsiella pneumoniae, Pseudomonas aeruginosa, Serratia marcescens and Escherichia coli using the specific primers in order to detect merA gene. For cloning, the primers containing restriction enzyme sites are used, merA gene was isolated and amplified. The amplified fragments were cloned in the expression vector pET21a+ and via heat shock method were transformed into E. coli TOP10 competent cell. For clustering of genes, Mega software version 4 was used and bioanformatic studies were achieved for predicted enzyme. Results: merA gene with 1686 bp in length was isolated from K pneumoniae and E. coli. Recombinant vectors in transgenic bacteria were confirmed by various methods and finally were confirmed by sequencing. The result of clustering these genes with existence genes in NCBI showed high similarity. Discussion and conclusion: The existence of merA gene in bacteria that adapted to Hg pollution area is because of resistance, so with cloning this gene into suitable expression vector and transformation of susceptible bacteria with this vector ability of resistance to Hg in bacteria for bioremediation could be given.

  16. Effect of adrenomedullin gene delivery on insulin resistance in type 2 diabetic rats

    Directory of Open Access Journals (Sweden)

    Hoda Y. Henein

    2011-01-01

    Full Text Available Type 2 diabetes mellitus is one of the common metabolic disorders that ultimately afflicts large number of individuals. Adrenomedullin (AM is a potent vasodilator peptide; previous studies reported development of insulin resistance in aged AM deficient mice. In this study, we employed a gene delivery approach to explore its potential role in insulin resistance. Four groups were included: control, diabetic, non-diabetic injected with the AM gene and diabetic injected with the AM gene. One week following gene delivery, serum glucose, insulin, triglycerides, leptin, adiponectin and corticosterone were measured as well as the insulin resistance index (HOMA-IR. Soleus muscle glucose uptake and RT-PCR of both AM and glucose transporter-4 (GLUT 4 gene expressions were assessed. A single tail vein injection of adrenomedullin gene in type 2 diabetic rats improved skeletal muscle insulin responsiveness with significant improvement of soleus muscle glucose uptake, HOMA-IR, serum glucose, insulin and triglycerides and significant increase in muscle GLUT 4 gene expression (P < 0.05 compared with the non-injected diabetic rats. The beneficial effects of AM gene delivery were accompanied by a significant increase in the serum level of adiponectin (2.95 ± 0.09 versus 2.33 ± 0.17 μg/ml in the non-injected diabetic group as well as a significant decrease in leptin and corticosterone levels (7.51 ± 0.51 and 262.88 ± 10.34 versus 10.63 ± 1.4 and 275.86 ± 11.19 ng/ml respectively in the non-injected diabetic group. The conclusion of the study is that AM gene delivery can improve insulin resistance and may have significant therapeutic applications in type 2 diabetes mellitus.

  17. Linezolid-resistant Staphylococcus aureus strain 1128105, the first known clinical isolate possessing the cfr multidrug resistance gene.

    Science.gov (United States)

    Locke, Jeffrey B; Zuill, Douglas E; Scharn, Caitlyn R; Deane, Jennifer; Sahm, Daniel F; Denys, Gerald A; Goering, Richard V; Shaw, Karen J

    2014-11-01

    The Cfr methyltransferase confers resistance to six classes of drugs which target the peptidyl transferase center of the 50S ribosomal subunit, including some oxazolidinones, such as linezolid (LZD). The mobile cfr gene was identified in European veterinary isolates from the late 1990s, although the earliest report of a clinical cfr-positive strain was the 2005 Colombian methicillin-resistant Staphylococcus aureus (MRSA) isolate CM05. Here, through retrospective analysis of LZD(r) clinical strains from a U.S. surveillance program, we identified a cfr-positive MRSA isolate, 1128105, from January 2005, predating CM05 by 5 months. Molecular typing of 1128105 revealed a unique pulsed-field gel electrophoresis (PFGE) profile most similar to that of USA100, spa type t002, and multilocus sequence type 5 (ST5). In addition to cfr, LZD resistance in 1128105 is partially attributed to the presence of a single copy of the 23S rRNA gene mutation T2500A. Transformation of the ∼37-kb conjugative p1128105 cfr-bearing plasmid from 1128105 into S. aureus ATCC 29213 background strains was successful in recapitulating the Cfr antibiogram, as well as resistance to aminoglycosides and trimethoprim. A 7-kb cfr-containing region of p1128105 possessed sequence nearly identical to that found in the Chinese veterinary Proteus vulgaris isolate PV-01 and in U.S. clinical S. aureus isolate 1900, although the presence of IS431-like sequences is unique to p1128105. The cfr gene environment in this early clinical cfr-positive isolate has now been identified in Gram-positive and Gram-negative strains of clinical and veterinary origin and has been associated with multiple mobile elements, highlighting the versatility of this multidrug resistance gene and its potential for further dissemination. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  18. Transcriptome analyses and virus induced gene silencing identify genes in the Rpp4-mediated Asian soybean rust resistance pathway

    Science.gov (United States)

    Rpp4 (Resistance to Phakopsora pachyrhizi 4) confers resistance to P. pachyrhizi, the causal agent of Asian soybean rust (ASR). By combining expression profiling and virus induced gene silencing (VIGS), we are developing a genetic framework for Rpp4-mediated resistance. We measured gene expression i...

  19. Fate and transport of antibiotic resistant bacteria and resistance genes in artificially drained agricultural fields receiving swine manure application

    Science.gov (United States)

    While previous studies have examined the occurrence of antibiotic resistant bacteria and antibiotic resistant genes around confined swine feeding operations, little information is known about their release and transport from artificially drained fields receiving swine manure application. Much of the...

  20. A novel resistance gene, lnu(H), conferring resistance to lincosamides in Riemerella anatipestifer CH-2.

    Science.gov (United States)

    Luo, Hong-Yan; Liu, Ma-Feng; Wang, Ming-Shu; Zhao, Xin-Xin; Jia, Ren-Yong; Chen, Shun; Sun, Kun-Feng; Yang, Qiao; Wu, Ying; Chen, Xiao-Yue; Biville, Francis; Zou, Yuan-Feng; Jing, Bo; Cheng, An-Chun; Zhu, De-Kang

    2018-01-01

    The Gram-negative bacterium Riemerella anatipestifer CH-2 is resistant to lincosamides, having a lincomycin (LCM) minimum inhibitory concentration (MIC) of 128 µg/mL. The G148_1775 gene of R. anatipestifer CH-2, designated lnu(H), encodes a 260-amino acid protein with ≤41% identity to other reported lincosamide nucleotidylyltransferases. Escherichia coli Rosetta TM (DE3) containing the pBAD24-lnu(H) plasmid showed four- and two-fold increases in the MICs of LCM and clindamycin (CLI), respectively. A kinetic assay of the purified Lnu(H) enzyme for LCM and CLI showed that the protein could inactive lincosamides. Mass spectrometry analysis demonstrated that the Lnu(H) enzyme catalysed adenylylation of lincosamides. In addition, an lnu(H) gene deletion strain exhibited 512- and 32-fold decreases in LCM and CLI MICs, respectively. The wild-type level of lincosamide resistance could be restored by complementation with a shuttle plasmid carrying the lnu(H) gene. The transformant R. anatipestifer ATCC 11845 [lnu(H)] acquired by natural transformation also exhibited high-level lincosamide resistance. Moreover, among 175 R. anatipestifer field isolates, 56 (32.0%) were positive for the lnu(H) gene by PCR. In conclusion, Lnu(H) is a novel lincosamide nucleotidylyltransferase that inactivates LCM and CLI by nucleotidylylation, thus conferring high-level lincosamide resistance to R. anatipestifer CH-2. Copyright © 2017. Published by Elsevier B.V.

  1. Spectrum of Resistance Conferred by ml-o Powdery Mildew Resistance Genes in Barley

    DEFF Research Database (Denmark)

    Jørgensen, Jørgen Helms

    1977-01-01

    /(4) in all tests. They were also resistant to field populations of the pathogen when scored in disease nurseries at more than 78 locations in 29 countries in Europe, the Near East, North and South America. New Zealand, and Japan. This indicates that the 11 genes confer the same, world-wide spectrum...

  2. Allele characterization of genes required for rpg4-mediated wheat stem rust resistance identifies Rpg5 as the R gene.

    Science.gov (United States)

    Arora, D; Gross, T; Brueggeman, R

    2013-11-01

    stop codon at amino acid 161, a single cytosine indel causing a frame shift, and a stop codon at amino acid 217, or an indel that deleted the entire STPK domain. The three P. graminis f. sp. tritici race QCCJ-susceptible lines (Swiss landraces Hv489, Hv492, and Hv611) and the wild barley accession WBDC160 contain rpg5 alleles predicted to encode full-length proteins containing a nonsynonomous nucleotide substitution that results in the amino acid substitution E1287A. This amino acid substitution present in the uncharacterized C-terminal domain is not found in any resistant line and may be important to elicit the resistance reaction. These data suggest that rpg4-mediated resistance against many wheat stem rust pathogen races, including P. graminis f. sp. tritici race TTKSK, rely on the Rpg5 R gene; thus, rpg4- and Rpg5-mediated resistance rely on a common R gene and should not be considered completely distinct. The data also determined that Rpg5 gene-specific molecular markers could be used to detect rpg4-mediated wheat stem rust resistance for marker-assisted selection.

  3. Survival of Antibiotic Resistant Bacteria and Horizontal Gene Transfer Control Antibiotic Resistance Gene Content in Anaerobic Digesters

    Science.gov (United States)

    Miller, Jennifer H.; Novak, John T.; Knocke, William R.; Pruden, Amy

    2016-01-01

    Understanding fate of antibiotic resistant bacteria (ARB) vs. their antibiotic resistance genes (ARGs) during wastewater sludge treatment is critical in order to reduce the spread of antibiotic resistance through process optimization. Here, we spiked high concentrations of tetracycline-resistant bacteria, isolated from mesophilic (Iso M1-1—a Pseudomonas sp.) and thermophilic (Iso T10—a Bacillus sp.) anaerobic digested sludge, into batch digesters and monitored their fate by plate counts and quantitative polymerase chain reaction (QPCR) of their corresponding tetracycline ARGs. In batch studies, spiked ARB plate counts returned to baseline (thermophilic) or 1-log above baseline (mesophilic) while levels of the ARG present in the spiked isolate [tet(G)] remained high in mesophilic batch reactors. To compare results under semi-continuous flow conditions with natural influent variation, tet(O), tet(W), and sul1 ARGs, along with the intI1 integrase gene, were monitored over a 9-month period in the raw feed sludge and effluent sludge of lab-scale thermophilic and mesophilic anaerobic digesters. sul1 and intI1 in mesophilic and thermophilic digesters correlated positively (Spearman rho = 0.457–0.829, P digested sludge or thermophilic digested sludge (Spearman rho = 0.130–0.486, P = 0.075–0.612). However, in the thermophilic digester, the tet(O) and tet(W) ratios remained consistently low over the entire monitoring period. We conclude that the influent sludge microbial composition can influence the ARG content of a digester, apparently as a result of differential survival or death of ARBs or horizontal gene transfer of genes between raw sludge ARBs and the digester microbial community. Notably, mesophilic digestion was more susceptible to ARG intrusion than thermophilic digestion, which may be attributed to a higher rate of ARB survival and/or horizontal gene transfer between raw sludge bacteria and the digester microbial community. PMID:27014196

  4. Occurrence of antibiotic resistance and characterization of resistant genes and integrons in Enterobacteriaceae isolated from integrated fish farms south China

    Science.gov (United States)

    Su, Hao-Chang; Ying, Guang-Guo; Tao, Ran; Zhang, Rui-Quan; Fogarty, Lisa R.; Kolpin, Dana W.

    2011-01-01

    Antibiotics are still widely applied in animal husbandry to prevent diseases and used as feed additives to promote animal growth. This could result in antibiotic resistance to bacteria and antibiotic residues in animals. In this paper, Enterobacteriaceae isolated from four integrated fish farms in Zhongshan, South China were tested for antibiotic resistance, tetracycline resistance genes, sulfonamide resistance genes, and class 1 integrons. The Kirby-Bauer disk diffusion method and polymerase chain reaction (PCR) assays were carried out to test antibiotic susceptibility and resistance genes, respectively. Relatively high antibiotic resistance frequencies were found, especially for ampicillin (80%), tetracycline (52%), and trimethoprim (50%). Out of 203 Enterobacteriaceae isolates, 98.5% were resistant to one or more antibiotics tested. Multiple antibiotic resistance (MAR) was found highest in animal manures with a MAR index of 0.56. Tetracycline resistance genes (tet(A), tet(C)) and sulfonamide resistance genes (sul2) were detected in more than 50% of the isolates. The intI1 gene was found in 170 isolates (83.7%). Both classic and non-classic class 1 integrons were found. Four genes, aadA5, aadA22, dfr2, and dfrA17, were detected. To our knowledge, this is the first report for molecular characterization of antibiotic resistance genes in Enterobacteriaceae isolated from integrated fish farms in China and the first time that gene cassette array dfrA17-aadA5 has been detected in such fish farms. Results of this study indicated that fish farms may be a reservoir of highly diverse and abundant antibiotic resistant genes and gene cassettes. Integrons may play a key role in multiple antibiotic resistances posing potential health risks to the general public and aquaculture.

  5. Antibiotic resistance genes and residual antimicrobials in cattle feedlot surface soil

    Science.gov (United States)

    Antibiotic residues and resistant bacteria in cattle feedlot manure may impact antibiotic resistance in the environment. This study investigated common antimicrobials (tetracyclines and monensin) and associated resistance genes in cattle feedlot soils over time. Animal diets and other feedlot soil...

  6. Novel streptomycin and spectinomycin resistance gene as a gene cassette within a class 1 integron isolated from Escherichia coli

    DEFF Research Database (Denmark)

    Sandvang, D.

    1999-01-01

    The aadA genes, encoding resistance to streptomycin and spectinomycin, have been found as gene cassettes in different gram-negative and gram-positive bacterial species. The present study has revealed the sequence of a new gene, aadA5, integrated as a gene cassette together with the trimethoprim...... resistance gene dfr7 in a class 1 integron. The integron was located on a plasmid and was identified in a pathogenic porcine Escherichia coli isolate....

  7. Novel Streptomycin and Spectinomycin Resistance Gene as a Gene Cassette within a Class 1 Integron Isolated from Escherichia coli

    Science.gov (United States)

    Sandvang, Dorthe

    1999-01-01

    The aadA genes, encoding resistance to streptomycin and spectinomycin, have been found as gene cassettes in different gram-negative and gram-positive bacterial species. The present study has revealed the sequence of a new gene, aadA5, integrated as a gene cassette together with the trimethoprim resistance gene dfr7 in a class 1 integron. The integron was located on a plasmid and was identified in a pathogenic porcine Escherichia coli isolate. PMID:10582907

  8. Hairpin RNA Targeting Multiple Viral Genes Confers Strong Resistance to Rice Black-Streaked Dwarf Virus

    Directory of Open Access Journals (Sweden)

    Fangquan Wang

    2016-05-01

    Full Text Available Rice black-streaked dwarf virus (RBSDV belongs to the genus Fijivirus in the family of Reoviridae and causes severe yield loss in rice-producing areas in Asia. RNA silencing, as a natural defence mechanism against plant viruses, has been successfully exploited for engineering virus resistance in plants, including rice. In this study, we generated transgenic rice lines harbouring a hairpin RNA (hpRNA construct targeting four RBSDV genes, S1, S2, S6 and S10, encoding the RNA-dependent RNA polymerase, the putative core protein, the RNA silencing suppressor and the outer capsid protein, respectively. Both field nursery and artificial inoculation assays of three generations of the transgenic lines showed that they had strong resistance to RBSDV infection. The RBSDV resistance in the segregating transgenic populations correlated perfectly with the presence of the hpRNA transgene. Furthermore, the hpRNA transgene was expressed in the highly resistant transgenic lines, giving rise to abundant levels of 21–24 nt small interfering RNA (siRNA. By small RNA deep sequencing, the RBSDV-resistant transgenic lines detected siRNAs from all four viral gene sequences in the hpRNA transgene, indicating that the whole chimeric fusion sequence can be efficiently processed by Dicer into siRNAs. Taken together, our results suggest that long hpRNA targeting multiple viral genes can be used to generate stable and durable virus resistance in rice, as well as other plant species.

  9. Inactivation Effect of Antibiotic-Resistant Gene Using Chlorine Disinfection

    Directory of Open Access Journals (Sweden)

    Takashi Furukawa

    2017-07-01

    Full Text Available The aim of this study was to elucidate the inactivation effects on the antibiotic-resistance gene (vanA of vancomycin-resistant enterococci (VRE using chlorination, a disinfection method widely used in various water treatment facilities. Suspensions of VRE were prepared by adding VRE to phosphate-buffered saline, or the sterilized secondary effluent of a wastewater treatment plant. The inactivation experiments were carried out at several chlorine concentrations and stirring time. Enterococci concentration and presence of vanA were determined. The enterococci concentration decreased as chlorine concentrations and stirring times increased, with more than 7.0 log reduction occurring under the following conditions: 40 min stirring at 0.5 mg Cl2/L, 20 min stirring at 1.0 mg Cl2/L, and 3 min stirring at 3.0 mg Cl2/L. In the inactivation experiment using VRE suspended in secondary effluent, the culturable enterococci required much higher chlorine concentration and longer treatment time for complete disinfection than the cases of suspension of VRE. However, vanA was detected in all chlorinated suspensions of VRE, even in samples where no enterococcal colonies were present on the medium agar plate. The chlorine disinfection was not able to destroy antibiotic-resistance genes, though it can inactivate and decrease bacterial counts of antibiotic-resistant bacteria (ARB. Therefore, it was suggested that remaining ARB and/or antibiotic-resistance gene in inactivated bacterial cells after chlorine disinfection tank could be discharged into water environments.

  10. Deletions of 5' HOXC genes are associated with lower extremity malformations, including clubfoot and vertical talus.

    Science.gov (United States)

    Alvarado, David M; McCall, Kevin; Hecht, Jacqueline T; Dobbs, Matthew B; Gurnett, Christina A

    2016-04-01

    Deletions of the HOXC gene cluster result in variable phenotypes in mice, but have been rarely described in humans. To report chromosome 12q13.13 microdeletions ranging from 13 to 175 kb and involving the 5' HOXC genes in four families, segregating congenital lower limb malformations, including clubfoot, vertical talus and hip dysplasia. Probands (N=253) with clubfoot or vertical talus were screened for point mutations and copy number variants using multiplexed direct genomic selection, a pooled BAC targeted capture approach. SNP genotyping included 1178 probands with clubfoot or vertical talus and 1775 controls. The microdeletions share a minimal non-coding region overlap upstream of HOXC13, with variable phenotypes depending upon HOXC13, HOXC12 or the HOTAIR lncRNA inclusion. SNP analysis revealed HOXC11 p.Ser191Phe segregating with clubfoot in a small family and enrichment of HOXC12 p.Asn176Lys in patients with clubfoot or vertical talus (rs189468720, p=0.0057, OR=3.8). Defects in limb morphogenesis include shortened and overlapping toes, as well as peroneus muscle hypoplasia. Finally, HOXC and HOXD gene expression is reduced in fibroblasts from a patient with a 5' HOXC deletion, consistent with previous studies demonstrating that dosage of lncRNAs alters expression of HOXD genes in trans. Because HOXD10 has been implicated in the aetiology of congenital vertical talus, variation in its expression may contribute to the lower limb phenotypes occurring with 5' HOXC microdeletions. Identification of 5' HOXC microdeletions highlights the importance of transcriptional regulators in the aetiology of severe lower limb malformations and will improve their diagnosis and management. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  11. Transport of tylosin and tylosin-resistance genes in subsurface drainage water from manured fields

    Science.gov (United States)

    Animal agriculture appears to contribute to the spread of antibiotic resistance genes, but few studies have quantified gene transport in agricultural fields. The transport of tylosin, tylosin-resistance genes (erm B, F, A) and tylosin-resistant Enterococcus were measured in tile drainage water from ...

  12. Antimicrobial susceptibility and occurrence of resistance genes among Salmonella enterica serovar Weltevreden from different countries

    DEFF Research Database (Denmark)

    Aarestrup, Frank Møller; Lertworapreecha, M.; Evans, M.C.

    2003-01-01

    and gentamicin. All nine ampicillin-resistant isolates contained a sequence similar to the bla(TEM-1b) gene, one of the eight chloramphenicol-resistant isolates a sequence similar to the catA1 gene, all three neomycin-resistant isolates a sequence similar to the aphA-2 gene, 16 (73%) of the 22 streptomycin...

  13. Resistance of Antimicrobial Peptide Gene Transgenic Rice to Bacterial Blight

    Directory of Open Access Journals (Sweden)

    Wei WANG

    2011-03-01

    Full Text Available Antimicrobial peptide is a polypeptide with antimicrobial activity. Antimicrobial peptide genes Np3 and Np5 from Chinese shrimp (Fenneropenaeus Chinensis were integrated into Oryza sativa L. subsp. japonica cv. Aichi ashahi by Agrobacterium mediated transformation system. PCR analysis showed that the positive ratios of Np3 and Np5 were 36% and 45% in T0 generation, respectively. RT-PCR analysis showed that the antimicrobial peptide genes were expressed in T1 generation, and there was no obvious difference in agronomic traits between transgenic plants and non-transgenic plants. Four Np3 and Np5 transgenic lines in T1 generation were inoculated with Xanthomonas oryzae pv. oryzae strain CR4, and all the four transgenic lines had significantly enhanced resistance to bacterial blight caused by the strain CR4. The Np5 transgenic lines also showed higher resistance to bacterial blight caused by strains JS97-2, Zhe 173 and OS-225. It is suggested that transgenic lines with Np5 gene might possess broad spectrum resistance to rice bacterial blight.

  14. Distribution of tetracycline and streptomycin resistance genes and class 1 integrons in Enterobacteriaceae isolated from dairy and nondairy farm soils.

    Science.gov (United States)

    Srinivasan, Velusamy; Nam, Hyang-Mi; Sawant, Ashish A; Headrick, Susan I; Nguyen, Lien T; Oliver, Stephen P

    2008-02-01

    The prevalence of selected tetracycline and streptomycin resistance genes and class 1 integrons in Enterobacteriaceae (n = 80) isolated from dairy farm soil and nondairy soils was evaluated. Among 56 bacteria isolated from dairy farm soils, 36 (64.3%) were resistant to tetracycline, and 17 (30.4%) were resistant to streptomycin. Lower frequencies of tetracycline (9 of 24 or 37.5%) and streptomycin (1 of 24 or 4.2%) resistance were observed in bacteria isolated from nondairy soils. Bacteria (n = 56) isolated from dairy farm soil had a higher frequency of tetracycline resistance genes including tetM (28.6%), tetA (21.4%), tetW (8.9%), tetB (5.4%), tetS (5.4%), tetG (3.6%), and tetO (1.8%). Among 24 bacteria isolated from nondairy soils, four isolates carried tetM, tetO, tetS, and tetW in different combinations; whereas tetA, tetB, and tetG were not detected. Similarly, a higher prevalence of streptomycin resistance genes including strA (12.5%), strB (12.5%), ant(3'') (12.5), aph(6)-1c (12.5%), aph(3'') (10.8%), and addA (5.4%) was detected in bacteria isolated from dairy farm soils than in nondairy soils. None of the nondairy soil isolates carried aadA gene. Other tetracycline (tetC, tetD, tetE, tetK, tetL, tetQ, and tetT) and streptomycin (aph(6)-1c and ant(6)) resistance genes were not detected in both dairy and nondairy soil isolates. A higher distribution of multiple resistance genes was observed in bacteria isolated from dairy farm soil than in nondairy soil. Among 36 tetracycline- and 17 streptomycin-resistant isolates from dairy farm soils, 11 (30.6%) and 9 (52.9%) isolates carried multiple resistance genes encoding resistance to tetracycline and streptomycin, respectively, which was higher than in bacteria isolated from nondairy soils. One strain each of Citrobacter freundii and C. youngae isolated from dairy farm soils carried class 1 integrons with different inserted gene cassettes. Results of this small study suggest that the presence of multiple

  15. Expression levels of resistant genes affect cervical cancer prognosis.

    Science.gov (United States)

    Yang, Fengmei; Gao, Bo; Li, Rui; Li, Wencui; Chen, Wei; Yu, Zongtao; Zhang, Jicai

    2017-05-01

    Tumor cells may develop multidrug resistance (MDR) to various chemotherapy regimens. Such resistance reduces the sensitivity of cells to chemotherapy drugs, leading to the failure of cervical cancer (CC) treatment and disease progression. The present study aimed to investigate the role of MDR1, lung resistance protein (LRP) and placental glutathione S‑transferase π 1 (GSTP1) in CC and MDR, and the prognostic value of these genes. The mRNA expression levels of these resistance‑associated genes were determined in 47 CC and 20 healthy cervical tissue samples. Subsequently, the data was analyzed alongside clinicopathological parameters. The mRNA expression levels of MDR1, LRP and GSTP1 in CC were 0.57±0.32, 0.58±0.29 and 0.44±0.24, respectively, whereas those in healthy cervical tissues were 0.19±0.10, 0.17±0.14 and 0.18±0.10, respectively. Therefore, the expression levels of these genes were significantly greater in CC compared with healthy cervical tissue (PMRD1 were increased in the well differentiated group (0.68±0.27) compared with the poorly differentiated group (0.38±0.33; P0.05). Multivariate logistic regression indicated that the degree of differentiation and the MDR1 gene expression levels were predictors of CC prognosis (P<0.05). The survival rate of patients in the MDR1‑negative group was significantly greater compared with the MDR1‑positive group (P<0.05). The results of the present study therefore suggested that MDR1 gene expression is a predictor of poor survival in CC.

  16. Simulated selection responses for breeding programs including resistance and resilience to parasites in Creole goats

    NARCIS (Netherlands)

    Gunia, M.; Phocas, F.; Gourdine, J.L.; Bijma, P.; Mandonnet, N.

    2013-01-01

    The Creole goat is a local breed used for meat production in Guadeloupe (French West Indies). As in other tropical countries, improvement of parasite resistance is needed. In this study, we compared predicted selection responses for alternative breeding programs with or without parasites resistance

  17. Evolutionarily Dynamic, but Robust, Targeting of Resistance Genes by the miR482/2118 Gene Family in the Solanaceae.

    Science.gov (United States)

    de Vries, Sophie; Kloesges, Thorsten; Rose, Laura E

    2015-11-19

    Plants are exposed to pathogens around the clock. A common resistance response in plants upon pathogen detection is localized cell death. Given the irreversible nature of this response, multiple layers of negative regulation are present to prevent the untimely or misexpression of resistance genes. One layer of negative regulation is provided by a recently discovered microRNA (miRNA) gene family, miR482/2118. This family targets the transcripts of resistance genes in plants. We investigated the evolutionary history and specificity of this miRNA gene family within the Solanaceae. This plant family includes many important crop species, providing a set of well-defined resistance gene repertoires. Across 14 species from the Solanaceae, we identified eight distinct miR482/2118 gene family members. Our studies show conservation of miRNA type and number in the group of wild tomatoes and, to a lesser extent, throughout the Solanaceae. The eight orthologous miRNA gene clusters evolved under different evolutionary constraints, allowing for individual subfunctionalization of the miRNAs. Despite differences in the predicted targeting behavior of each miRNA, the miRNA-R-gene network is robust due to its high degree of interconnectivity and redundant targeting. Our data suggest that the miR482/2118 gene family acts as an evolutionary buffer for R-gene sequence diversity. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  18. Gene expression profile is associated with chemoradiation resistance in rectal cancer.

    Science.gov (United States)

    Gantt, G A; Chen, Y; Dejulius, K; Mace, A G; Barnholtz-Sloan, J; Kalady, M F

    2014-01-01

    Patients with rectal cancer who achieve a complete pathological response after preoperative chemoradiation (CRT) have an improved oncological outcome. Identifying factors associated with a lack of response could help our understanding of the underlying biology of treatment resistance. This study aimed to develop a gene expression signature for CRT-resistant rectal cancer using high-throughput nucleotide microarrays. Pretreatment biopsies of rectal adenocarcinomas were prospectively collected and freshly frozen according to an institutional review board-approved protocol. Total tumour mRNA was extracted and gene expression levels were measured using microarrays. Patients underwent proctectomy after completing standard long-course CRT and the resected specimens were graded for treatment response. Gene expression profiles for nonresponders were compared with those of responders. Differentially expressed genes were analyzed for functional significance using the Ingenuity Pathway Analysis (IPA) software. Thirty-three patients treated between 2006 and 2009 were included. We derived 812-gene and 183-gene signatures separating nonresponders from responders. The classifiers were able to identify nonresponders with a sensitivity and specificity of 100% using the 812-gene signature, and sensitivity and specificity of 33% and 100% using the 183-gene signature. IPA canonical pathway analysis revealed a significant ratio of differentially expressed genes in the 'DNA double-strand break repair by homologous recombination' pathway. Certain rectal cancer gene profiles are associated with poor response to CRT. Alterations in the DNA double-strand break repair pathway could contribute to treatment resistance and provides an opportunity for further studies. Colorectal Disease © 2013 The Association of Coloproctology of Great Britain and Ireland.

  19. Detection of 140 clinically relevant antibiotic-resistance genes in the plasmid metagenome of wastewater treatment plant bacteria showing reduced susceptibility to selected antibiotics.

    Science.gov (United States)

    Szczepanowski, Rafael; Linke, Burkhard; Krahn, Irene; Gartemann, Karl-Heinz; Gützkow, Tim; Eichler, Wolfgang; Pühler, Alfred; Schlüter, Andreas

    2009-07-01

    To detect plasmid-borne antibiotic-resistance genes in wastewater treatment plant (WWTP) bacteria, 192 resistance-gene-specific PCR primer pairs were designed and synthesized. Subsequent PCR analyses on total plasmid DNA preparations obtained from bacteria of activated sludge or the WWTP's final effluents led to the identification of, respectively, 140 and 123 different resistance-gene-specific amplicons. The genes detected included aminoglycoside, beta-lactam, chloramphenicol, fluoroquinolone, macrolide, rifampicin, tetracycline, trimethoprim and sulfonamide resistance genes as well as multidrug efflux and small multidrug resistance genes. Some of these genes were only recently described from clinical isolates, demonstrating genetic exchange between clinical and WWTP bacteria. Sequencing of selected resistance-gene-specific amplicons confirmed their identity or revealed that the amplicon nucleotide sequence is very similar to a gene closely related to the reference gene used for primer design. These results demonstrate that WWTP bacteria are a reservoir for various resistance genes. Moreover, detection of about 64 % of the 192 reference resistance genes in bacteria obtained from the WWTP's final effluents indicates that these resistance determinants might be further disseminated in habitats downstream of the sewage plant.

  20. Fine mapping and candidate gene analysis of two loci conferring resistance to Phytophthora sojae in soybean.

    Science.gov (United States)

    Li, Linghong; Lin, Feng; Wang, Weidong; Ping, Jieqing; Fitzgerald, Joshua C; Zhao, Meixia; Li, Shuai; Sun, Lianjun; Cai, Chunmei; Ma, Jianxin

    2016-12-01

    RpsUN1 and RpsUN2 were fine mapped to two genomic regions harboring disease resistance-like genes. The haplotypes and instability of the regions and candidate genes for the two resistance loci were characterized. Phytophthora root and stem rot caused by Phytophthora sojae, is one of the most destructive diseases of soybean. Deploying soybean cultivars carrying race-specific resistance conferred by Rps genes is the most practical approach to managing this disease. Previously, two Rps genes, RpsUN1 and RpsUN2 were identified in a landrace PI 567139B and mapped to a 6.5 cM region on chromosome 3 and a 3.0 cM region on chromosome 16, corresponding to 1387 and 423 kb of the soybean reference genome sequences. By analyzing recombinants defined by genotypic and phenotypic screening of the 826 F 2:3 families derived from two reciprocal crosses between the two parental lines, RpsUN1 and RpsUN2, were further narrowed to a 151 kb region that harbors five genes including three disease resistance (R)-like genes, and a 36 kb region that contains four genes including five R-like genes, respectively, according to the reference genome. Expressional changes of these nine genes before and after inoculation with the pathogen, as revealed by RNA-seq, suggest that Glyma.03g034600 in the RpsUN1 region and Glyma.16g215200 and Glyma.16g214900 in the RpsUN2 region of PI 567139B may be associated with the resistance to P. sojae. It is also suggested that unequal recombination between/among R-like genes may have occurred, resulting in the formation of two recombinants with inconsistent genotypic and phenotypic observations. The haplotype variation of genomic regions where RpsUN1 and RpsUN2 reside in the entire soybean germplasm deposited in the US soybean germplasm collection suggests that RpsUN1 and RpsUN2 are most likely novel genes.

  1. Functional Repertoire of Antibiotic Resistance Genes in Antibiotic Manufacturing Effluents and Receiving Freshwater Sediments

    Science.gov (United States)

    González-Plaza, Juan J.; Šimatović, Ana; Milaković, Milena; Bielen, Ana; Wichmann, Fabienne; Udiković-Kolić, Nikolina

    2018-01-01

    Environments polluted by direct discharges of effluents from antibiotic manufacturing are important reservoirs for antibiotic resistance genes (ARGs), which could potentially be transferred to human pathogens. However, our knowledge about the identity and diversity of ARGs in such polluted environments remains limited. We applied functional metagenomics to explore the resistome of two Croatian antibiotic manufacturing effluents and sediments collected upstream of and at the effluent discharge sites. Metagenomic libraries built from an azithromycin-production site were screened for resistance to macrolide antibiotics, whereas the libraries from a site producing veterinary antibiotics were screened for resistance to sulfonamides, tetracyclines, trimethoprim, and beta-lactams. Functional analysis of eight libraries identified a total of 82 unique, often clinically relevant ARGs, which were frequently found in clusters and flanked by mobile genetic elements. The majority of macrolide resistance genes identified from matrices exposed to high levels of macrolides were similar to known genes encoding ribosomal protection proteins, macrolide phosphotransferases, and transporters. Potentially novel macrolide resistance genes included one most similar to a 23S rRNA methyltransferase from Clostridium and another, derived from upstream unpolluted sediment, to a GTPase HflX from Emergencia. In libraries deriving from sediments exposed to lower levels of veterinary antibiotics, we found 8 potentially novel ARGs, including dihydrofolate reductases and beta-lactamases from classes A, B, and D. In addition, we detected 7 potentially novel ARGs in upstream sediment, including thymidylate synthases, dihydrofolate reductases, and class D beta-lactamase. Taken together, in addition to finding known gene types, we report the discovery of novel and diverse ARGs in antibiotic-polluted industrial effluents and sediments, providing a qualitative basis for monitoring the dispersal of ARGs

  2. Functional Analysis of Genes Comprising the Locus of Heat Resistance in Escherichia coli.

    Science.gov (United States)

    Mercer, Ryan; Nguyen, Oanh; Ou, Qixing; McMullen, Lynn; Gänzle, Michael G

    2017-10-15

    The locus of heat resistance (LHR) is a 15- to 19-kb genomic island conferring exceptional heat resistance to organisms in the family Enterobacteriaceae , including pathogenic strains of Salmonella enterica and Escherichia coli The complement of LHR-comprising genes that is necessary for heat resistance and the stress-induced or growth-phase-induced expression of LHR-comprising genes are unknown. This study determined the contribution of the seven LHR-comprising genes yfdX1 GI , yfdX2 , hdeD GI , orf11 , trx GI , kefB , and psiE GI by comparing the heat resistances of E. coli strains harboring plasmid-encoded derivatives of the different LHRs in these genes. (Genes carry a subscript "GI" [genomic island] if an ortholog of the same gene is present in genomes of E. coli ) LHR-encoded heat shock proteins sHSP20, ClpK GI , and sHSP GI are not sufficient for the heat resistance phenotype; YfdX1, YfdX2, and HdeD are necessary to complement the LHR heat shock proteins and to impart a high level of resistance. Deletion of trx GI , kefB , and psiE GI from plasmid-encoded copies of the LHR did not significantly affect heat resistance. The effect of the growth phase and the NaCl concentration on expression from the putative LHR promoter p2 was determined by quantitative reverse transcription-PCR and by a plasmid-encoded p2:GFP promoter fusion. The expression levels of exponential- and stationary-phase E. coli cells were not significantly different, but the addition of 1% NaCl significantly increased LHR expression. Remarkably, LHR expression in E. coli was dependent on a chromosomal copy of evgA In conclusion, this study improved our understanding of the genes required for exceptional heat resistance in E. coli and factors that increase their expression in food. IMPORTANCE The locus of heat resistance (LHR) is a genomic island conferring exceptional heat resistance to several foodborne pathogens. The exceptional level of heat resistance provided by the LHR questions the

  3. Silencing of a unique integrated domain nucleotide-binding leucine-rich repeat gene in wheat abolishes Diuraphis noxia resistance.

    Science.gov (United States)

    Nicolis, Vittorio Filippo; Venter, Eduard

    2018-03-13

    Plants respond in a similar manner to aphid feeding as to pathogen attack. Diuraphis noxia is a specialist aphid, feeding only on selected grasses that include wheat, barley, and oats. The wheat-Diuraphis noxia interaction is characterized by very similar responses as seen in wheat-pathogen interactions with none of the underlying resistance pathways and genes characterized yet. From wheat harboring the Dn1 resistance gene, we have identified a nucleotide-binding leucine-rich repeat (NLR) gene containing two integrated domains (IDs). These are three C-terminus ankyrin repeat-domains and an N-terminus WRKY domain. The NLR core of the gene can be traced through speciation events within the grass family, with a recent WRKY domain integration that is Triticum specific. Virus induced gene silencing of the gene in a resistant wheat line resulted in the abolishment of the resistance response and induced a highly susceptible phenotype. Silenced plants supported a higher number of aphids similar to the susceptible NIL and the intrinsic rate of increase of the aphids matched that of aphids feeding on the susceptible NIL. The presence of the gene is necessary for Dn1 resistance and we have named the gene Associated with Dn resistance 1 (Adr1) to reflect this function.

  4. Altered gene regulation and potential association with metabolic resistance development to imidacloprid in the tarnished plant bug, Lygus lineolaris.

    Science.gov (United States)

    Zhu, Yu Cheng; Luttrell, Randall

    2015-01-01

    Chemical spray on cotton is almost an exclusive method for controlling tarnished plant bug (TPB), Lygus lineolaris. Frequent use of imidacloprid is a concern for neonicotinoid resistance in this key pest. Information of how and why TPB becomes less susceptible to imidacloprid is essential for effective monitoring and managing resistance. Microarray analysis of 6688 genes in imidacloprid-selected TPB (Im1500FF) revealed 955 upregulated and 1277 downregulated (≥twofold) genes in Im1500FF, with 369 and 485 of them annotated. Five P450 and nine esterase genes were significantly upregulated, and only one esterase gene and no P450 genes were downregulated. Other upregulated genes include helicases, phosphodiesterases, ATPases and kinases. Pathway analyses identified 65 upregulated cDNAs that encode 51 different enzymes involved in 62 different pathways, including P450 and esterase genes for drug and xenobiotic metabolisms. Sixty-four downregulated cDNAs code only 17 enzymes that are associated with only 23 pathways mostly related to food digestion. This study demonstrated a significant change in gene expression related to metabolic processes in imidacloprid-selected TPB, resulting in overexpression of P450 and esterase genes for potential excess detoxification and cross/multiple resistance development. The identification of these and other enzyme genes establishes a foundation to explore the complicity of potential imidacloprid resistance in TPB. Published 2014. This article is a U.S. Government work and is in the public domain in the USA.

  5. Development of a miniaturised microarray-based assay for the rapid identification of antimicrobial resistance genes in Gram-negative bacteria

    NARCIS (Netherlands)

    Batchelor, M.; Hopkins, K.L.; Liebana, E.; Slickers, P.; Ehricht, R.; Mafura, M.; Aerestrup, F.; Mevius, D.J.; Clifton-Hadley, F.A.; Woodward, M.; Davies, R.; Threlfall, J.; Anjum, F.M.

    2008-01-01

    We describe the development of a miniaturised microarray for the detection of antimicrobial resistance genes in Gram-negative bacteria. Included on the array are genes encoding resistance to aminoglycosides, trimethoprim, sulphonamides, tetracyclines and ß-lactams, including extended-spectrum

  6. A double EPSPS gene mutation endowing glyphosate resistance shows a remarkably high resistance cost.

    Science.gov (United States)

    Han, Heping; Vila-Aiub, Martin M; Jalaludin, Adam; Yu, Qin; Powles, Stephen B

    2017-12-01

    A novel glyphosate resistance double point mutation (T102I/P106S, TIPS) in the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene has been recently identified for the first time only in the weed species Eleusine indica. Quantification of plant resistance cost associated with the TIPS and the often reported glyphosate resistance single P106S mutation was performed. A significant resistance cost (50% in seed number currency) associated with the homozygous TIPS but not the homozygous P106S EPSPS variant was identified in E. indica plants. The resistance cost associated with the TIPS mutation escalated to 85% in plants under resource competition with rice crops. The resistance cost was not detected in nonhomozygous TIPS plants denoting the recessive nature of the cost associated with the TIPS allele. An excess of 11-fold more shikimate and sixfold more quinate in the shikimate pathway was detected in TIPS plants in the absence of glyphosate treatment compared to wild type, whereas no changes in these compounds were observed in P106S plants when compared to wild type. TIPS plants show altered metabolite levels in several other metabolic pathways that may account for the expression of the observed resistance cost. © 2017 John Wiley & Sons Ltd.

  7. A Novel Phytophthora sojae Resistance Rps12 Gene Mapped to a Genomic Region That Contains Several Rps Genes.

    Science.gov (United States)

    Sahoo, Dipak K; Abeysekara, Nilwala S; Cianzio, Silvia R; Robertson, Alison E; Bhattacharyya, Madan K

    2017-01-01

    Phytophthora sojae Kaufmann and Gerdemann, which causes Phytophthora root rot, is a widespread pathogen that limits soybean production worldwide. Development of Phytophthora resistant cultivars carrying Phytophthora resistance Rps genes is a cost-effective approach in controlling this disease. For this mapping study of a novel Rps gene, 290 recombinant inbred lines (RILs) (F7 families) were developed by crossing the P. sojae resistant cultivar PI399036 with the P. sojae susceptible AR2 line, and were phenotyped for responses to a mixture of three P. sojae isolates that overcome most of the known Rps genes. Of these 290 RILs, 130 were homozygous resistant, 12 heterzygous and segregating for Phytophthora resistance, and 148 were recessive homozygous and susceptible. From this population, 59 RILs homozygous for Phytophthora sojae resistance and 61 susceptible to a mixture of P. sojae isolates R17 and Val12-11 or P7074 that overcome resistance encoded by known Rps genes mapped to Chromosome 18 were selected for mapping novel Rps gene. A single gene accounted for the 1:1 segregation of resistance and susceptibility among the RILs. The gene encoding the Phytophthora resistance mapped to a 5.8 cM interval between the SSR markers BARCSOYSSR_18_1840 and Sat_064 located in the lower arm of Chromosome 18. The gene is mapped 2.2 cM proximal to the NBSRps4/6-like sequence that was reported to co-segregate with the Phytophthora resistance genes Rps4 and Rps6. The gene is mapped to a highly recombinogenic, gene-rich genomic region carrying several nucleotide binding site-leucine rich repeat (NBS-LRR)-like genes. We named this novel gene as Rps12, which is expected to be an invaluable resource in breeding soybeans for Phytophthora resistance.

  8. A Novel Phytophthora sojae Resistance Rps12 Gene Mapped to a Genomic Region That Contains Several Rps Genes.

    Directory of Open Access Journals (Sweden)

    Dipak K Sahoo

    Full Text Available Phytophthora sojae Kaufmann and Gerdemann, which causes Phytophthora root rot, is a widespread pathogen that limits soybean production worldwide. Development of Phytophthora resistant cultivars carrying Phytophthora resistance Rps genes is a cost-effective approach in controlling this disease. For this mapping study of a novel Rps gene, 290 recombinant inbred lines (RILs (F7 families were developed by crossing the P. sojae resistant cultivar PI399036 with the P. sojae susceptible AR2 line, and were phenotyped for responses to a mixture of three P. sojae isolates that overcome most of the known Rps genes. Of these 290 RILs, 130 were homozygous resistant, 12 heterzygous and segregating for Phytophthora resistance, and 148 were recessive homozygous and susceptible. From this population, 59 RILs homozygous for Phytophthora sojae resistance and 61 susceptible to a mixture of P. sojae isolates R17 and Val12-11 or P7074 that overcome resistance encoded by known Rps genes mapped to Chromosome 18 were selected for mapping novel Rps gene. A single gene accounted for the 1:1 segregation of resistance and susceptibility among the RILs. The gene encoding the Phytophthora resistance mapped to a 5.8 cM interval between the SSR markers BARCSOYSSR_18_1840 and Sat_064 located in the lower arm of Chromosome 18. The gene is mapped 2.2 cM proximal to the NBSRps4/6-like sequence that was reported to co-segregate with the Phytophthora resistance genes Rps4 and Rps6. The gene is mapped to a highly recombinogenic, gene-rich genomic region carrying several nucleotide binding site-leucine rich repeat (NBS-LRR-like genes. We named this novel gene as Rps12, which is expected to be an invaluable resource in breeding soybeans for Phytophthora resistance.

  9. Expression profile of genes during resistance reversal in a temephos selected strain of the dengue vector, Aedes aegypti.

    Directory of Open Access Journals (Sweden)

    Clare Strode

    Full Text Available BACKGROUND: The mosquito Aedes aegypti is one of the most important disease vectors because it transmits two major arboviruses, dengue and yellow fever, which cause significant global morbidity and mortality. Chemical insecticides form the cornerstone of vector control. The organophosphate temephos a larvicide recommended by WHO for controlling Ae. aegypti, however, resistance to this compound has been reported in many countries, including Brazil. METHODOLOGY/PRINCIPAL FINDINGS: The aim of this study was to identify genes implicated in metabolic resistance in an Ae. aegypti temephos resistant strain, named RecR, through microarray analysis. We utilized a custom 'Ae. aegypti detox chip' and validated microarray data through RT-PCR comparing susceptible and resistant individuals. In addition, we analyzed gene expression in 4(th instar larvae from a reversed susceptible strain (RecRev, exposed and unexposed to temephos. The results obtained revealed a set of 13 and 6 genes significantly over expressed in resistant adult mosquitoes and larvae, respectively. One of these genes, the cytochrome P450 CYP6N12, was up-regulated in both stages. RT-PCR confirmed the microarray results and, additionally, showed no difference in gene expression between temephos exposed and unexposed RecRev mosquitoes. This suggested that the differences in the transcript profiles among the strains are heritable due to a selection process and are not caused by immediate insecticide exposure. Reversal of temephos resistance was demonstrated and, importantly, there was a positive correlation between a decrease in the resistance ratio and an accompanying decrease in the expression levels of previously over expressed genes. Some of the genes identified here have also been implicated in metabolic resistance in other mosquito species and insecticide resistant populations of Ae. aegypti. CONCLUSIONS/SIGNIFICANCE: The identification of gene expression signatures associated to

  10. Genotypes, Virulence Factors and Antimicrobial Resistance Genes of Staphylococcus aureus Isolated in Bovine Subclinical Mastitis from Eastern China

    Directory of Open Access Journals (Sweden)

    Javed Memon§, Yongchun Yang§, Jam Kashifa, Muhammad Yaqoob, Rehana Buriroa, Jamila Soomroa, Wang Liping and Fan Hongjie*

    2013-11-01

    Full Text Available This study was carried out to determine the genotypes, virulence factors and antimicrobial resistance traits of 34 Staphylococcus aureus isolated from subclinical mastitis in Eastern China. Minimal inhibitory concentration (MIC results showed resistance to erythromycin in all isolates. A high frequency of Methicillin resistant S. aureus (MRSA; 29% was observed and these isolates were also highly resistant to penicillin, oxacillin, oxytetracycline and chloramphenicol than methicillin sensitive S. aureus (MSSA isolates. Thirteen pathogenic factors and seven resistance genes including mecA and blaZ gene were checked through PCR. The spaX gene was found in all isolates, whereas cna, spaIg, nuc, clfA, fnbpB, hlA, hlB and seA were present in 35, 79, 85, 59, 35, 85, 71 and 38% isolates, respectively. Nine isolates carried a group of 8 different virulence genes. Moreover, macrolide resistance genes ermB and ermC were present in all isolates. High resistance rate against methicillin was found but no isolate was positive for mecA gene, whereas blaZ and tetK were detected in 82 and 56% isolates, respectively. Genes; fnbpA, seB, seC, seD, dfrK and tetM were not found in any isolate. The statistical association between phenotypic resistance and virulence genes showed, clfA, fnbpB, hlB and seA, were potentially associated with penicillin G, ciprofloxacin, methicillin, chloramphenicol, trimethoprim and oxytetracycline resistance (P≤0.05. REP-PCR based genotyping showed seven distinct genotypes (A-G prevalent in this region. This study reports the presence of multidrug resistant S. aureus in sub-clinical mastitis which were also highly virulent that could be a major obstacle in the treatment of mastitis in this region of China.

  11. Antibiotics, Antibiotic Resistance Genes, and Bacterial Community Composition in Fresh Water Aquaculture Environment in China.

    Science.gov (United States)

    Xiong, Wenguang; Sun, Yongxue; Zhang, Tong; Ding, Xueyao; Li, Yafei; Wang, Mianzhi; Zeng, Zhenling

    2015-08-01

    Environmental antibiotic resistance has drawn increasing attention due to its great threat to human health. In this study, we investigated concentrations of antibiotics (tetracyclines, sulfonamides and (fluoro)quinolones) and abundances of antibiotic resistance genes (ARGs), including tetracycline resistance genes, sulfonamide resistance genes, and plasmid-mediated quinolone resistance genes, and analyzed bacterial community composition in aquaculture environment in Guangdong, China. The concentrations of sulfametoxydiazine, sulfamethazine, sulfamethoxazole, oxytetracycline, chlorotetracycline, doxycycline, ciprofloxacin, norfloxacin, and enrofloxacin were as high as 446 μg kg(-1) and 98.6 ng L(-1) in sediment and water samples, respectively. The relative abundances (ARG copies/16S ribosomal RNA (rRNA) gene copies) of ARGs (sul1, sul2, sul3, tetM, tetO, tetW, tetS, tetQ, tetX, tetB/P, qepA, oqxA, oqxB, aac(6')-Ib, and qnrS) were as high as 2.8 × 10(-2). The dominant phyla were Proteobacteria, Bacteroidetes, and Firmicutes in sediment samples and Proteobacteria, Actinobacteria and Bacteroidetes in water samples. The genera associated with pathogens were also observed, such as Acinetobacter, Arcobacter, and Clostridium. This study comprehensively investigated antibiotics, ARGs, and bacterial community composition in aquaculture environment in China. The results indicated that fish ponds are reservoirs of ARGs and the presence of potential resistant and pathogen-associated taxonomic groups in fish ponds might imply the potential risk to human health.

  12. [ISOLATION OF ANTIBIOTICS RESISTANCE GENES IN VIBRIO CHOLERAE O1 AND O139 SEROGROUP STRAINS].

    Science.gov (United States)

    Zadnova, S P; Smirnova, N I

    2015-01-01

    Determination of sensitivity of V. cholerae O1 serogroup El Tor biovar and O139 serogroup strains to antibiotics and determination of the presence of antibiotics resistance genes in their genome. The studies were carried out in 75 V. cholerae O1 and O139 serogroup strains. Sensitivity of cultures to antibiotics was determined by disc-diffusion method. DNA isolation was carried out in the presence of 6M guanidine thiocyanate. PCR was carried out in multi-channel amplificator Tercyc. A multiplex PCR was constructed, that includes 5 primer pairs for the detection of O1 and O139 serogroup resistance genes of vibrios to sulfame- thoxazolum, streptomycin B, trimethoprim, the presence of SXT element, an amplification program was developed. Using the developed PCR, V. cholerae O1 serogroup El Tor biovar strains with multiple drug resistance were established to be imported into Russia in 1993. The presence of SXT elements with genes of resistance to 4 antibiotics simultaneously was detected precisely in these strains, that belong to toxigenic genovariants of V. cholerae El Tor biovar. All the El Tor vibrio strains imported in the subsequent years were shown to stably preserve SXT element, this indicates its important role in biology of cholera vibrios. O139 serogroup strains with intact SXT element and having a deletion of the gene coding trimethoprim resistance were isolated. The data obtained may be used to establish molecular-genetic mechanisms of emergence of antibiotics resistant strains of cholera vibrio, construction of novel gene diagnostic test-systems and carrying out passportization of strains that are stored in the State collection of pathogenic bacteria.

  13. cor, a novel carbon monoxide resistance gene, is essential for Mycobacterium tuberculosis pathogenesis.

    Science.gov (United States)

    Zacharia, Vineetha M; Manzanillo, Paolo S; Nair, Vidhya R; Marciano, Denise K; Kinch, Lisa N; Grishin, Nick V; Cox, Jeffery S; Shiloh, Michael U

    2013-11-19

    Tuberculosis, caused by Mycobacterium tuberculosis, remains a devastating human infectious disease, causing two million deaths annually. We previously demonstrated that M. tuberculosis induces an enzyme, heme oxygenase (HO1), that produces carbon monoxide (CO) gas and that M. tuberculosis adapts its transcriptome during CO exposure. We now demonstrate that M. tuberculosis carries a novel resistance gene to combat CO toxicity. We screened an M. tuberculosis transposon library for CO-susceptible mutants and found that disruption of Rv1829 (carbon monoxide resistance, Cor) leads to marked CO sensitivity. Heterologous expression of Cor in Escherichia coli rescued it from CO toxicity. Importantly, the virulence of the cor mutant is attenuated in a mouse model of tuberculosis. Thus, Cor is necessary and sufficient to protect bacteria from host-derived CO. Taken together, this represents the first report of a role for HO1-derived CO in controlling infection of an intracellular pathogen and the first identification of a CO resistance gene in a pathogenic organism. Macrophages produce a variety of antimicrobial molecules, including nitric oxide (NO), hydrogen peroxide (H2O2), and acid (H+), that serve to kill engulfed bacteria. In addition to these molecules, human and mouse macrophages also produce carbon monoxide (CO) gas by the heme oxygenase (HO1) enzyme. We observed that, in contrast to other bacteria, mycobacteria are resistant to CO, suggesting that this might be an evolutionary adaptation of mycobacteria for survival within macrophages. We screened a panel of ~2,500 M. tuberculosis mutants to determine which genes are required for survival of M. tuberculosis in the presence of CO. Within this panel, we identified one such gene, cor, that specifically confers CO resistance. Importantly, we found that the ability of M. tuberculosis cells carrying a mutated copy of this gene to cause tuberculosis in a mouse disease model is significantly attenuated. This indicates that

  14. I Have a Dream: Organic Movements Include Gene Manipulation to Improve Sustainable Farming

    Directory of Open Access Journals (Sweden)

    Gerhart U. Ryffel

    2017-03-01

    Full Text Available Several papers in a Special Issue of Sustainability have recently discussed various aspects to evaluate whether organic farming and gene manipulation are compatible. A special emphasis was given to new plant breeding techniques (NPBTs. These new approaches allow the most predictable genetic alterations of crop plants in ways that the genetically modified plant is identical to a plant generated by conventional breeding. The articles of the Special Issue present the arguments pro and contra the inclusion of the plants generated by NPBTs in organic farming. Organic movements have not yet made a final decision whether some of these techniques should be accepted or banned. In my view these novel genetically manipulated (GM crops could be used in such a way as to respect the requirements for genetically manipulated organisms (GMOs formulated by the International Federation of Organic Movements (IFOAM. Reviewing the potential benefits of disease-resistant potatoes and bananas, it seems possible that these crops support organic farming. To this end, I propose specific requirements that the organic movements should proactively formulate as their standards to accept specific GM crops.

  15. [State-of-the-art status on airborne antibiotic resistant bacteria and antibiotic resistance genes].

    Science.gov (United States)

    Li, J; Yao, M S

    2018-04-06

    The world is facing more deaths due to increasing antibiotic-resistant bacterial infections and the shortage of new highly effective antibiotics, however the air media as its important transmission route has not been adequately studied. Based on the latest literature acquired in this work, we have discussed the state-of-the-art research progress of the concentration, distribution and spread of antibiotic resistant bacteria (ARB) and antibiotic resistance genes (ARGs) in different environmental air media, and also analyzed some future prevention and control measures. The large use of antibiotics in the medical settings and animal husbandry places has resulted in higher abundances of ARB and ARGs in the relevant and surrounding atmosphere than in urban and general indoor air environments. ARGs can be spread by adhering to airborne particles, and researchers have also found that air media contain more abundant ARGs than other environmental media such as soil, water and sediment. It was suggested in this review that strengthening the monitoring, study on spreading factors and biological toxicity, and also research and development on pathogen accurate diagnosis and new green antibiotic are expected to help effectively monitor, prevent and control of the impacts of airborne resistant bacteria and resistance genes on both human and ecologies.

  16. Study on drug resistance of mycobacterium tuberculosis in patients with pulmonary tuberculosis by drug resistance gene detecting

    International Nuclear Information System (INIS)

    Wang Wei; Li Hongmin; Wu Xueqiong; Wang Ansheng; Ye Yixiu; Wang Zhongyuan; Liu Jinwei; Chen Hongbing; Lin Minggui; Wang Jinhe; Li Sumei; Jiang Ping; Feng Bai; Chen Dongjing

    2004-01-01

    To investigate drug resistance of mycobacterium tuberculosis in different age group, compare detecting effect of two methods and evaluate their the clinical application value, all of the strains of mycobacterium tuberculosis were tested for resistance to RFP, INH SM PZA and EMB by the absolute concentration method on Lowenstein-Jensen medium and the mutation of the rpoB, katG, rpsL, pncA and embB resistance genes in M. tuberculosis was tested by PCR-SSCP. In youth, middle and old age group, the rate of acquired drug resistance was 89.2%, 85.3% and 67.6% respectively, the gene mutation rate was 76.2%, 81.3% and 63.2% respectively. The rate of acquired drug resistance and multiple drug resistance in youth group was much higher than those in other groups. The gene mutation was correlated with drug resistance level of mycobacterium tuberculosis. The gene mutation rate was higher in strains isolated from high concentration resistance than those in strains isolated from low concentration resistance. The more irregular treatment was longer, the rate of drug resistance was higher. Acquired drug resistance varies in different age group. It suggested that surveillance of drug resistence in different age group should be taken seriously, especially in youth group. PCR - SSCP is a sensitive and specific method for rapid detecting rpoB, katG, rpsL, pncA and embB genes mutations of MTB. (authors)

  17. Incidence of antimicrobial-resistance genes and integrons in antibiotic-resistant bacteria isolated from eels and aquaculture ponds.

    Science.gov (United States)

    Lin, Mao; Wu, Xiaomei; Yan, Qingpi; Ma, Ying; Huang, Lixing; Qin, Yingxue; Xu, Xiaojin

    2016-07-07

    The overuse of antimicrobials in aquaculture has promoted the selection of antimicrobial-resistant bacteria. Here we investigated the abundance of antimicrobial-resistance genes and integrons in 108 strains of antibiotic-resistant bacteria isolated from eels and aquaculture ponds in China. Conventional PCR was implemented to examine common antibiotic-resistance genes, integrons, and their gene cassette arrays. The results showed that the antibiotic-resistance genes blaTEM, tetC, sulI, aadA, floR, and qnrB were detected at high percentages, as were a number of other resistance genes. Class I integrons were present in 79.63% of the strains, and 10 out of 108 isolates carried class II integrons. Class III integrons were not detected. Three strains carried both class I and class II integrons, and 73.26% of the class I integron-positive isolates contained the qacEΔ1/sul1 gene. Fourteen types of integron cassette arrays were found among class I integron-positive isolates. A new array, dfrB4-catB3-blaOXA-10-aadA1, was discovered in this study. The gene cassette array dfrA12-orfF-aadA2 was the most widely distributed. In summary, 23 different gene cassettes encoding resistance to 8 classes of antibiotics were identified in the class I integrons, and the main cassettes contained genes encoding resistance to aminoglycosides (aad) and trimethoprim (dfr). All class II integron-positive strains had only a single gene cassette array, viz. dfrA1-catB2-sat2-aadA1. High levels of antimicrobial-resistance genes and integrons in eels and auqauculture ponds suggest that the overuse of antimicrobials should be strictly controlled and that the levels of bacterial antimicrobial-resistance genes in aquaculture should be monitored.

  18. Evolution by Pervasive Gene Fusion in Antibiotic Resistance and Antibiotic Synthesizing Genes

    Directory of Open Access Journals (Sweden)

    Orla Coleman

    2015-03-01

    Full Text Available Phylogenetic (tree-based approaches to understanding evolutionary history are unable to incorporate convergent evolutionary events where two genes merge into one. In this study, as exemplars of what can be achieved when a tree is not assumed a priori, we have analysed the evolutionary histories of polyketide synthase genes and antibiotic resistance genes and have shown that their history is replete with convergent events as well as divergent events. We demonstrate that the overall histories of these genes more closely resembles the remodelling that might be seen with the children’s toy Lego, than the standard model of the phylogenetic tree. This work demonstrates further that genes can act as public goods, available for re-use and incorporation into other genetic goods.

  19. vanA Gene Harboring Enterococcal and Non-enterococcal Isolates Expressing High Level Vancomycin and Teicoplanin Resistance Reservoired in Surface Waters.

    Science.gov (United States)

    Nakipoğlu, Mustafa; Yilmaz, Fadime; Icgen, Bulent

    2017-05-01

    Untreated wastewaters and treated effluents even after final disinfection contain antibiotic resistant bacteria and resistance genes before they are released into surface waters. A correlation between resistant bacteria and antibiotics in surface waters has been found, as have antibiotic resistance genes. Of particular interest are vancomycin-resistant enterococci harboring vanA gene that confers high level of resistance to glycopeptide antibiotics including teicoplanin. Therefore, in this study, river water samples were analysed to investigate vancomycin- and teicoplanin-resistant bacterial isolates harboring vanA gene. Out of 290, 15 surface water isolates displayed resistance to both antibiotics. These glycopeptide resistant enterococcal and non-enterococcal isolates, identified by 16S rRNA sequencing, were found to harbor vanA gene with sequence similarities of 50 % to 100 %. The presence of D-alanine-D-lactate ligase encoded by vanA gene was also shown for all vancomycin- and teicoplanin-resistant isolates through western blot analysis. Due to reuse of treated wastewater and release of untreated wastewaters to water bodies, antibiotic resistant bacteria and resistance genes are being introduced into surface waters and present human health risks. Therefore, surface waters are not only hot spots for vanA harboring enterococcal isolates but also non-enterococcal isolates due to gene dissemination and require special scientific consideration.

  20. DNA tagging of blast resistant gene(s in three Brazilian rice cultivars

    Directory of Open Access Journals (Sweden)

    S.S. Sandhu

    2003-12-01

    Full Text Available Rice blast is the most important fungal disease of rice and is caused by Pyricularia oryzae Sacc. (Telomorph Magnoporthe grisea Barr.. Seven randomly amplified polymorphic DNA (RAPD markers OPA5, OPG17, OPG18, OPG19, OPF9, OPF17 and OPF19 showed very clear polymorphism in resistant cultivar lines which differed from susceptible lines. By comparing different susceptible lines, nine DNA amplifications of seven primers (OPA5(1000, OPA5(1200, OPG17(700, OPG18(850, OPG19(500, OPG19(600, OPF9(600, OPF17(1200 and OPF19(600 were identified as dominant markers for the blast resistant gene in resistant cultivar lines. These loci facilitate the indirect scoring of blast resistant and blast susceptible genotypes. The codomine RAPDs markers will facilitate marker-assisted selection of the blast resistant gene in two blast resistant genotypes of rice (Labelle and Line 11 and will be useful in rice breeding programs.

  1. Untreated urban waste contaminates Indian river sediments with resistance genes to last resort antibiotics.

    Science.gov (United States)

    Marathe, Nachiket P; Pal, Chandan; Gaikwad, Swapnil S; Jonsson, Viktor; Kristiansson, Erik; Larsson, D G Joakim

    2017-11-01

    Efficient sewage treatment is critical for limiting environmental transmission of antibiotic-resistant bacteria. In many low and middle income countries, however, large proportions of sewage are still released untreated into receiving water bodies. In-depth knowledge of how such discharges of untreated urban waste influences the environmental resistome is largely lacking. Here, we highlight the impact of uncontrolled discharge of partially treated and/or untreated wastewater on the structure of bacterial communities and resistome of sediments collected from Mutha river flowing through Pune city in India. Using shotgun metagenomics, we found a wide array (n = 175) of horizontally transferable antibiotic resistance genes (ARGs) including carbapenemases such as NDM, VIM, KPC, OXA-48 and IMP types. The relative abundance of total ARGs was 30-fold higher in river sediments within the city compared to upstream sites. Forty four ARGs, including the tet(X) gene conferring resistance to tigecycline, OXA-58 and GES type carbapenemases, were significantly more abundant in city sediments, while two ARGs were more common at upstream sites. The recently identified mobile colistin resistance gene mcr-1 was detected only in one of the upstream samples, but not in city samples. In addition to ARGs, higher abundances of various mobile genetic elements were found in city samples, including integron-associated integrases and ISCR transposases, as well as some biocide/metal resistance genes. Virulence toxin genes as well as bacterial genera comprising many pathogens were more abundant here; the genus Acinetobacter, which is often associated with multidrug resistance and nosocomial infections, comprised up to 29% of the 16S rRNA reads, which to our best knowledge is unmatched in any other deeply sequenced metagenome. There was a strong correlation between the abundance of Acinetobacter and the OXA-58 carbapenemase gene. Our study shows that uncontrolled discharge of untreated urban

  2. Novel Mutations Detected in Avirulence Genes Overcoming Tomato Cf Resistance Genes in Isolates of a Japanese Population of Cladosporium fulvum.

    Directory of Open Access Journals (Sweden)

    Yuichiro Iida

    Full Text Available Leaf mold of tomato is caused by the biotrophic fungus Cladosporium fulvum which complies with the gene-for-gene system. The disease was first reported in Japan in the 1920s and has since been frequently observed. Initially only race 0 isolates were reported, but since the consecutive introduction of resistance genes Cf-2, Cf-4, Cf-5 and Cf-9 new races have evolved. Here we first determined the virulence spectrum of 133 C. fulvum isolates collected from 22 prefectures in Japan, and subsequently sequenced the avirulence (Avr genes Avr2, Avr4, Avr4E, Avr5 and Avr9 to determine the molecular basis of overcoming Cf genes. Twelve races of C. fulvum with a different virulence spectrum were identified, of which races 9, 2.9, 4.9, 4.5.9 and 4.9.11 occur only in Japan. The Avr genes in many of these races contain unique mutations not observed in races identified elsewhere in the world including (i frameshift mutations and (ii transposon insertions in Avr2, (iii point mutations in Avr4 and Avr4E, and (iv deletions of Avr4E, Avr5 and Avr9. New races have developed by selection pressure imposed by consecutive introductions of Cf-2, Cf-4, Cf-5 and Cf-9 genes in commercially grown tomato cultivars. Our study shows that molecular variations to adapt to different Cf genes in an isolated C. fulvum population in Japan are novel but overall follow similar patterns as those observed in populations from other parts of the world. Implications for breeding of more durable C. fulvum resistant varieties are discussed.

  3. Conservation and Dispersion of Genes Conferring Resistance to Tomato Begomoviruses between Tomato and Pepper Genomes

    Directory of Open Access Journals (Sweden)

    Manisha Mangal

    2017-11-01

    Full Text Available In the present climate change scenario, controlling plant disease through exploitation of host plant resistance could contribute toward the sustainable crop production and global food security. In this respect, the identification of new sources of resistance and utilization of genetic diversity within the species may help in the generation of cultivars with improved disease resistance. Begomoviruses namely, Tomato yellow leaf curl virus (TYLCV and Chilli leaf curl virus (ChLCV are known to cause major yield losses in several economically important crop plants of the family Solanaceae. Though co-occurrence, association and synergistic interactions among these viruses in the host plants is reported, whether orthologous genetic loci in related host plants could be responsible for conferring resistance to these viruses has not been investigated yet. Several loci including Ty1, Ty2, Ty3, Ty4, and ty5 have been reported to confer resistance to leaf curl viruses in tomato. Here, we examined the pepper orthologous markers, corresponding to these QTL regions, for polymorphism between ChLCV susceptible and resistant genotypes of pepper. Further, to examine if the polymorphic markers are segregating with the disease resistance, Bulk Segregant Analysis (BSA was performed on F2 population derived from crosses between resistant and susceptible lines. However, none of the markers showed polymorphism in BSA suggesting that the tested markers are not linked to genes/QTLs responsible for conferring resistance to ChLCV in the selected genotypes. In silico analysis was performed to study the synteny and collinearity of genes located within these QTL regions in tomato and pepper genomes, which revealed that more than 60% genes located in Ty2 and Ty4, 13.71% genes in Ty1, 23.07% in Ty3, and 44.77% genes located within ty5 QTL region in tomato are conserved in pepper genome. However, despite such a high conservation in gene content, the linkage relationship in these

  4. Including dietary fiber and resistant starch to increase satiety and reduce aggression in gestating sows.

    Science.gov (United States)

    Sapkota, A; Marchant-Forde, J N; Richert, B T; Lay, D C

    2016-05-01

    Aggression during mixing of pregnant sows impacts sow welfare and productivity. The aim of this study was to increase satiety and reduce aggression by including dietary fiber and fermentable carbohydrates. Sows were housed in individual stalls 7 to 14 d after breeding (moving day was considered d 0 of treatment) and were fed (at 0700 h) with a CONTROL (corn-soybean meal based with no additional fiber sources), RSTARCH (10.8% resistant starch), BEETPULP (27.2% sugar beet pulp), SOYHULLS (19.1% soybean hulls), or INCSOY (14.05% soybean hulls) for 21 d (5 sows/diet × 5 diets × 8 replications = 200 sows). The CONTROL diet was targeted to contain 185 g(d∙sow) NDF and the other diets were targeted to contain 350 g(d∙sow) NDF. The INCSOY diet was fed at 2.2 kg/(d∙sow) and the other diets were fed at 2 kg(d∙sow). On d 22, sows were mixed in groups of 5 (at 1200 h). Behaviors in stalls (on d 1, 7, 14, and 21) and after mixing (d 22 and 23), heart rate (on d 1, 7, 14, and 21), blood metabolites (on d 2, 8, 15, 22, and 25), and the effects of diets on production were collected and analyzed. Sows stood more ( 0.05). Average birth weight was lowest in the INCSOY diet ( = 0.02). This study demonstrates that RSTARCH and SOYHULLS can improve the welfare of sows by reducing aggression and increasing satiety in limit-fed pregnant sows without affecting production.

  5. Transcriptome profiling identifies genes/pathways associated with experimental resistance to paromomycin in Leishmania donovani

    Directory of Open Access Journals (Sweden)

    Aditya Verma

    2017-12-01

    Full Text Available Widespread resistance towards antimony and reports of relapses following miltefosine treatment has severely affected the management of visceral leishmaniasis (VL in the Indian subcontinent. Paromomycin (PMM, an aminoglycoside antibiotic, has been licensed for VL treatment in India in 2007. Although its use is still restricted in the field, unraveling the molecular mechanism of resistance towards PMM is the key to preserve the drug. In this study, PMM resistant lines were selected up to 100 μM of PMM in three distinct field isolates of Leishmania donovani at promastigote stage. The resistance induced at promastigote level was also evident in amastigotes which showed 6 fold decreases in PMM susceptibility. Comparative transcriptome profiling of PMM resistant (PMM-R and the corresponding PMM sensitive (PMM-S parasites revealed modulated expression of 500 genes (1.5 fold cut off in PMM-R parasites. Selected genes were validated for their modulated expression by quantitative real-time PCR. Functional classification and pathway analysis of modulated genes indicated probable adaptations in drug resistant lines which included a reduced oxidative phosphorylation; b increased glycosomal succinate fermentation and substrate level phosphorylation; c dependency on lipids and amino acids for energy generation; d reduced DNA synthesis and increased DNA damage repair and e decreased protein synthesis and degradation. Interestingly, PMM-R parasites showed a marked increase in PMM susceptibility in presence of verapamil and amlodipine, antagonists of Ca2+ channel that are also modulators of ABC transporters. Moreover, infection of macrophages by PMM-R parasites led to modulated nitric oxide (NO levels while reactive oxygen species (ROS level remained unaltered. The present study highlights the putative mechanisms of PMM resistance in Leishmania. Keywords: Leishmania donovani, Drug resistance, Paromomycin, Transcriptome, ABC transporters, Nitric oxide

  6. Occurrence of the mcr-1 Colistin Resistance Gene and other Clinically Relevant Antibiotic Resistance Genes in Microbial Populations at Different Municipal Wastewater Treatment Plants in Germany

    Directory of Open Access Journals (Sweden)

    Norman Hembach

    2017-07-01

    Full Text Available Seven wastewater treatment plants (WWTPs with different population equivalents and catchment areas were screened for the prevalence of the colistin resistance gene mcr-1 mediating resistance against last resort antibiotic polymyxin E. The abundance of the plasmid-associated mcr-1 gene in total microbial populations during water treatment processes was quantitatively analyzed by qPCR analyses. The presence of the colistin resistance gene was documented for all of the influent wastewater samples of the seven WWTPs. In some cases the mcr-1 resistance gene was also detected in effluent samples of the WWTPs after conventional treatment reaching the aquatic environment. In addition to the occurrence of mcr-1 gene, CTX-M-32, blaTEM, CTX-M, tetM, CMY-2, and ermB genes coding for clinically relevant antibiotic resistances were quantified in higher abundances in all WWTPs effluents. In parallel, the abundances of Acinetobacter baumannii, Klebsiella pneumoniae, and Escherichia coli were quantified via qPCR using specific taxonomic gene markers which were detected in all influent and effluent wastewaters in significant densities. Hence, opportunistic pathogens and clinically relevant antibiotic resistance genes in wastewaters of the analyzed WWTPs bear a risk of dissemination to the aquatic environment. Since many of the antibiotic resistance gene are associated with mobile genetic elements horizontal gene transfer during wastewater treatment can't be excluded.

  7. Tetracycline residues and tetracycline resistance genes in groundwater impacted by swine production facilities

    Science.gov (United States)

    Mackie, R.I.; Koike, S.; Krapac, I.; Chee-Sanford, J.; Maxwell, Susan; Aminov, R.I.

    2006-01-01

    Antibiotics are used at therapeutic levels to treat disease; at slightly lower levels as prophylactics; and at low, subtherapeutic levels for growth promotion and improvement of feed efficiency. Over 88% of swine producers in the United States gave antimicrobials to grower/finisher pigs in feed as a growth promoter in 2000. It is estimated that ca. 75% of antibiotics are not absorbed by animals and are excreted in urine and feces. The extensive use of antibiotics in swine production has resulted in antibiotic resistance in many intestinal bacteria, which are also excreted in swine feces, resulting in dissemination of resistance genes into the environment.To assess the impact of manure management on groundwater quality, groundwater samples have been collected near two swine confinement facilities that use lagoons for manure storage and treatment. Several key contaminant indicators-including inorganic ions, antibiotics, and antibiotic resistance genes-were analyzed in groundwater collected from the monitoring wells. Chloride, ammonium, potassium, and sodium were predominant inorganic constituents in the manure samples and served as indicators of groundwater contamination. Based on these analyses, shallow groundwater has been impacted by lagoon seepage at both sites. Liquid chromatography-mass spectroscopy (LC-MS) was used to measure the dissolved concentrations of tetracycline, chlortetracycline, and oxytetracycline in groundwater and manure. Although tetracyclines were regularly used at both facilities, they were infrequently detected in manure samples and then at relatively trace concentrations. Concentrations of all tetracyclines and their breakdown products in the groundwater sampled were generally less than 0.5 ??g/L.Bacterial tetracycline resistance genes served as distinct genotypic markers to indicate the dissemination and mobility of antibiotic resistance genes that originated from the lagoons. Applying PCR to genomic DNA extracted from the lagoon and

  8. Bacterial plasmid-mediated quinolone resistance genes in aquatic environments in China

    OpenAIRE

    Yan, Lei; Liu, Dan; Wang, Xin-Hua; Wang, Yunkun; Zhang, Bo; Wang, Mingyu; Xu, Hai

    2017-01-01

    Emerging antimicrobial resistance is a major threat to human?s health in the 21st century. Understanding and combating this issue requires a full and unbiased assessment of the current status on the prevalence of antimicrobial resistance genes and their correlation with each other and bacterial groups. In aquatic environments that are known reservoirs for antimicrobial resistance genes, we were able to reach this goal on plasmid-mediated quinolone resistance (PMQR) genes that lead to resistan...

  9. Prevalence of antibiotic resistance genes in the bacterial flora of integrated fish farming environments of Pakistan and Tanzania.

    Science.gov (United States)

    Shah, Syed Q A; Colquhoun, Duncan J; Nikuli, Hamisi L; Sørum, Henning

    2012-08-21

    The use of a wide variety of antimicrobials in human and veterinary medicine, including aquaculture, has led to the emergence of antibiotic resistant pathogens. In the present study, bacteria from water, sediments, and fish were collected from fish farms in Pakistan and Tanzania with no recorded history of antibiotic use. The isolates were screened for the presence of resistance genes against various antimicrobials used in aquaculture and animal husbandry. Resistant isolates selected by disk diffusion and genotyped by Southern hybridization were further screened by polymerase chain reaction (PCR) and amplicon sequencing. The prominent resistance genes identified encoded tetracycline [tetA(A) and tetA(G)], trimethoprim [dfrA1, dfrA5, dfrA7, dfrA12, and dfrA15], amoxicillin [bla(TEM)], streptomycin [strA-strB], chloramphenicol [cat-1], and erythromycin resistance [mefA]. The int1 gene was found in more than 30% of the bacterial isolates in association with gene cassettes. MAR indices ranged from 0.2 to 1. The bla(NDM-1) gene was not identified in ertapenem resistant isolates. It is hypothesized that integrated fish farming practices utilizing domestic farm and poultry waste along with antibiotic residues from animal husbandry may have contributed to a pool of resistance genes in the aquaculture systems studied.

  10. SolRgene: an online database to explore disease resistance genes in tuber-bearing Solanum species.

    Science.gov (United States)

    Vleeshouwers, Vivianne G A A; Finkers, Richard; Budding, Dirk; Visser, Marcel; Jacobs, Mirjam M J; van Berloo, Ralph; Pel, Mathieu; Champouret, Nicolas; Bakker, Erin; Krenek, Pavel; Rietman, Hendrik; Huigen, DirkJan; Hoekstra, Roel; Goverse, Aska; Vosman, Ben; Jacobsen, Evert; Visser, Richard G F

    2011-08-18

    The cultivated potato (Solanum tuberosum L.) is an important food crop, but highly susceptible to many pathogens. The major threat to potato production is the Irish famine pathogen Phytophthora infestans, which causes the devastating late blight disease. Potato breeding makes use of germplasm from wild relatives (wild germplasm) to introduce resistances into cultivated potato. The Solanum section Petota comprises tuber-bearing species that are potential donors of new disease resistance genes. The aim of this study was to explore Solanum section Petota for resistance genes and generate a widely accessible resource that is useful for studying and implementing disease resistance in potato. The SolRgene database contains data on resistance to P. infestans and presence of R genes and R gene homologues in Solanum section Petota. We have explored Solanum section Petota for resistance to late blight in high throughput disease tests under various laboratory conditions and in field trials. From resistant wild germplasm, segregating populations were generated and assessed for the presence of resistance genes. All these data have been entered into the SolRgene database. To facilitate genetic and resistance gene evolution studies, phylogenetic data of the entire SolRgene collection are included, as well as a tool for generating phylogenetic trees of selected groups of germplasm. Data from resistance gene allele-mining studies are incorporated, which enables detection of R gene homologs in related germplasm. Using these resources, various resistance genes have been detected and some of these have been cloned, whereas others are in the cloning pipeline. All this information is stored in the online SolRgene database, which allows users to query resistance data, sequences, passport data of the accessions, and phylogenic classifications. Solanum section Petota forms the basis of the SolRgene database, which contains a collection of resistance data of an unprecedented size and

  11. Antibiotic Resistance Genetic Markers and Integrons in White Soft Cheese: Aspects of Clinical Resistome and Potentiality of Horizontal Gene Transfer

    Directory of Open Access Journals (Sweden)

    Ana Caroline L. de Paula

    2018-02-01

    Full Text Available Antibiotic resistance poses an important threat to global public health and has become a challenge to modern medicine. The occurrence of antibiotic-resistant bacteria in a broad range of foods has led to a growing concern about the impact that food may have as a reservoir of antibiotic resistance genes. Considering Minas Frescal Cheese (MFC—a typical Brazilian white soft cheese—and its economic and cultural values, in this study, medically relevant antimicrobial-resistance genetic markers (AR genes were screened, and the occurrence of integrons were evaluated in manufactured MFC using culture-independent approaches. Through a fingerprinting analysis, the tested MFCs were brand-clustered, indicating reproducibility along the production chain. A common core of resistance markers in all brands evaluated and related antimicrobials such as β-lactams, tetracyclines, quinolones, and sulfonamide was detected. Several other markers, including efflux pumps and aminoglycosides-resistance were distributed among brands. Class 1 and 2 integrons were observed, respectively, in 77% and 97% of the samples. The presence of AR genes is of special interest due to their clinical relevance. Taken together, the data may suggest that the production chain of MFC might contribute to the spread of putative drug-resistant bacteria, which could greatly impact human health. Furthermore, detection of class 1 and class 2 integrons in MFC has led to discussions about resistance gene spread in this traditional cheese, providing evidence of potential horizontal transfer of AR genes to human gut microbiota.

  12. Complete genome sequence of Enterobacter cloacae R11 reveals multiple genes potentially associated with high-level polymyxin E resistance.

    Science.gov (United States)

    Zhong, Chuanqing; Zhang, Chao; Fu, Jiafang; Chen, Wenbing; Jiang, Tianyi; Cao, Guangxiang

    2018-01-01

    Enterobacter cloacae strain R11 is a multidrug-resistant bacterium isolated from sewage water near a swine feedlot in China. Strain R11 can survive in medium containing up to 192 μg/mL polymyxin E, indicating a tolerance for this antibiotic that is significantly higher than that reported for other gram-negative bacteria. In this study, conjugation experiments showed that partial polymyxin E resistance could be transferred from strain R11 to Escherichia coli strain 25922, revealing that some genes related to polymyxin E resistance are plasmid-based. The complete genome sequence of this strain was determined, yielding a total of 4 993 008 bp (G+C content, 53.15%) and 4908 genes for the circular chromosome and 4 circular plasmids. Genome analysis revealed a total of 73 putative antibiotic resistance genes, including several polymyxin E resistance genes and genes potentially involved in multidrug resistance. These data provide insights into the genetic basis of the polymyxin E resistance and multidrug resistance of E. cloacae.

  13. A multiple genome analysis of Mycobacterium tuberculosis reveals specific novel genes and mutations associated with pyrazinamide resistance.

    Science.gov (United States)

    Sheen, Patricia; Requena, David; Gushiken, Eduardo; Gilman, Robert H; Antiparra, Ricardo; Lucero, Bryan; Lizárraga, Pilar; Cieza, Basilio; Roncal, Elisa; Grandjean, Louis; Pain, Arnab; McNerney, Ruth; Clark, Taane G; Moore, David; Zimic, Mirko

    2017-10-11

    Tuberculosis (TB) is a major global health problem and drug resistance compromises the efforts to control this disease. Pyrazinamide (PZA) is an important drug used in both first and second line treatment regimes. However, its complete mechanism of action and resistance remains unclear. We genotyped and sequenced the complete genomes of 68 M. tuberculosis strains isolated from unrelated TB patients in Peru. No clustering pattern of the strains was verified based on spoligotyping. We analyzed the association between PZA resistance with non-synonymous mutations and specific genes. We found mutations in pncA and novel genes significantly associated with PZA resistance in strains without pncA mutations. These included genes related to transportation of metal ions, pH regulation and immune system evasion. These results suggest potential alternate mechanisms of PZA resistance that have not been found in other populations, supporting that the antibacterial activity of PZA may hit multiple targets.

  14. A multiple genome analysis of Mycobacterium tuberculosis reveals specific novel genes and mutations associated with pyrazinamide resistance

    KAUST Repository

    Sheen, Patricia

    2017-10-11

    Tuberculosis (TB) is a major global health problem and drug resistance compromises the efforts to control this disease. Pyrazinamide (PZA) is an important drug used in both first and second line treatment regimes. However, its complete mechanism of action and resistance remains unclear.We genotyped and sequenced the complete genomes of 68 M. tuberculosis strains isolated from unrelated TB patients in Peru. No clustering pattern of the strains was verified based on spoligotyping. We analyzed the association between PZA resistance with non-synonymous mutations and specific genes. We found mutations in pncA and novel genes significantly associated with PZA resistance in strains without pncA mutations. These included genes related to transportation of metal ions, pH regulation and immune system evasion.These results suggest potential alternate mechanisms of PZA resistance that have not been found in other populations, supporting that the antibacterial activity of PZA may hit multiple targets.

  15. Culture methods impact recovery of antibiotic-resistant Enterococci including Enterococcus cecorum from pre- and postharvest chicken.

    Science.gov (United States)

    Suyemoto, M M; Barnes, H J; Borst, L B

    2017-03-01

    Pathogenic strains of Enterococcus cecorum (EC) expressing multidrug resistance have emerged. In National Antimicrobial Resistance Monitoring System (NARMS) data, EC is rarely recovered from chickens. Two NARMS methodologies (FDA and USDA) were compared with standard culture (SC) techniques for recovery of EC. NARMS methods failed to detect EC in 58 caecal samples, 20 chicken breast or six whole broiler samples. EC was recovered from 1 of 38 (2·6%) and 2 of 38 (5·2%) preharvest spinal lesions (USDA and FDA method, respectively). In contrast, using the SC method, EC was recovered from 44 of 53 (83%) caecal samples, all 38 (100%) spinal lesions, 14 of 20 (70%) chicken breast samples, and all three spinal lesions identified in whole carcasses. Compared with other Enterococcus spp., EC isolates had a higher prevalence of resistance to macrolides. The NARMS methods significantly affected recovery of enterococcal species other than EC. When the postharvest FDA method was applied to preharvest caecal samples, isolates of Enterococcus faecium were preferentially recovered. All 11 E. faecium isolates were multidrug resistant, including resistance to penicillin, daptomycin and linezolid. These findings confirm that current methodologies may not accurately identify the amount and range of antimicrobial resistance of enterococci from chicken sources. Enterococci are an important reservoir for antimicrobial resistance. This study demonstrates how current culture methods underreport resistance to macrolides in enterococci by selecting against strains of Enterococcus cecorum in pre- and postharvest chicken. Further, the application of postharvest surveillance methods to preharvest samples resulted in selective recovery of Enterococcus faecium over Enterococcus faecalis. Isolates of E. faecium recovered exhibited multidrug resistance including penicillin, daptomycin and linezolid resistance. These findings suggest that culture methodology significantly impacts the range and

  16. Antimicrobial Resistance and Resistance Genes in Aerobic Bacteria Isolated from Pork at Slaughter.

    Science.gov (United States)

    Li, Lili; Heidemann Olsen, Rikke; Ye, Lei; Yan, He; Nie, Qing; Meng, Hecheng; Shi, Lei

    2016-04-01

    The aim of this study was to investigate the phenotypic and genotypic antimicrobial resistance, integrons, and transferability of resistance markers in 243 aerobic bacteria recovered from pork at slaughter in the People's Republic of China. The organisms belonged to 22 genera of gram-negative bacteria (92.2%) and gram-positive bacteria (7.8%). High levels of resistance were detected to tetracycline, trimethoprim-sulfamethoxazole, and ampicillin (36.2 to 54.3%), and lower levels were detected to nitrofurantoin, cefotaxime, gentamicin, ciprofloxacin, and chloramphenicol (7.8 to 29.2%). Across species, genes conferring antimicrobial resistance were observed with the following frequencies: blaTEM, 40.7%; blaCMY-2, 15.2%; blaCTX-M, 11.5%; sul2, 27.2%; sul1, 14.4%; tet(A), 5.4%; tet(L), 5.4%; tet(M), 5.0%; tet(E), 3.7%; tet(C), 3.3%; tet(S), 2.5%; and tet(K), 0.8%. Various antimicrobial resistance genes were found in new carriers: blaTEM in Lactococcus garvieae, Myroides odoratimimus, Aeromonas hydrophila, Staphylococcus sciuri, Raoultella terrigena, Macrococcus caseolyticus, Acinetobacter ursingii, Sphingobacterium sp., and Oceanobacillus sp.; blaCMY-2 in Lactococcus lactis, Klebsiella oxytoca, Serratia marcescens, Acinetobacter baumannii, and Myroides phaeus; tet(L) in M. caseolyticus; sul1 in Vibrio cincinnatiensis; sul2 in Acinetobacter bereziniae, Acinetobacter johnsonii, and V. cincinnatiensis; and the class 1 integron and gene cassette aadA2 in V. cincinnatiensis. Approximately 6.6% of isolates contained class 1 integrons, and one isolate harbored class 2 integrons. Plasmid associated intI1 and androgen receptor- encoding genes were transferred into Escherichia coli J53 and E. coli DH5α by conjugation and transformation experiments, respectively. Our study highlights the importance of aerobic bacteria from pork as reservoirs for antimicrobial resistance genes and mobile genetic elements that can readily be transferred intra- and interspecies.

  17. Functional metagenomic characterization of antibiotic resistance genes in agricultural soils from China.

    Science.gov (United States)

    Su, Jian Qiang; Wei, Bei; Xu, Chun Yan; Qiao, Min; Zhu, Yong Guan

    2014-04-01

    Soil has been regarded as a rich source of antibiotic resistance genes (ARGs) due to the complex microbial community and diverse antibiotic-producing microbes in soil, however, little is known about the ARGs in unculturable bacteria. To investigate the diversity and distribution of ARGs in soil and assess the impact of agricultural practice on the ARGs, we screened soil metagenomic library constructed using DNA from four different agricultural soil for ARGs. We identified 45 clones conferring resistance to minocycline, tetracycline, streptomycin, gentamicin, kanamycin, amikacin, chloramphenicol and rifampicin. The similarity of identified ARGs with the closest protein in GenBank ranged from 26% to 92%, with more than 60% of identified ARGs had low similarity less than 60% at amino acid level. The identified ARGs include aminoglycoside acetyltransferase, aminoglycoside 6-adenyltransferase, ADP-ribosyl transferase, ribosome protection protein, transporters and other antibiotic resistant determinants. The identified ARGs from the soil with manure application account for approximately 70% of the total ARGs in this study, implying that manure amendment may increase the diversity of antibiotic resistance genes in soil bacteria. These results suggest that antibiotic resistance in soil remains unexplored and functional metagenomic approach is powerful in discovering novel ARGs and resistant mechanisms. Copyright © 2013 Elsevier Ltd. All rights reserved.

  18. EPSPS variability, gene expression, and enzymatic activity in glyphosate-resistant biotypes of Digitaria insularis.

    Science.gov (United States)

    Galeano, E; Barroso, A A M; Vasconcelos, T S; López-Rubio, A; Albrecht, A J P; Victoria Filho, R; Carrer, H

    2016-08-12

    Weed resistance to herbicides is a natural phenomenon that exerts selection on individuals in a population. In Brazil, glyphosate resistance was recently detected in Digitaria insularis. The objective of this study was to elucidate mechanisms of weed resistance in this plant, including genetic variability, allelism, amino acid substitutions, gene expression, and enzymatic activity levels. Most of these have not previously been studied in this species. D. insularis DNA sequences were used to analyze genetic variability. cDNA from resistant and susceptible plants was used to identify mutations, alleles, and 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) expression, using real-time quantitative reverse transcription-polymerase chain reaction. In addition, EPSPS activity was measured. We found a decrease in genetic variability between populations related to glyphosate application. Substitutions from proline to threonine and tyrosine to cysteine led to a decrease in EPSPS affinity for the glyphosate. In addition, the EPSPS enzymatic activity was slightly higher in resistant plants, whereas EPSPS gene expression was almost identical in both biotypes, suggesting feedback regulation at different levels. To conclude, our results suggest new molecular mechanisms used by D. insularis to increase glyphosate resistance.

  19. Diversity of Integron- and Culture-Associated Antibiotic Resistance Genes in Freshwater Floc

    OpenAIRE

    Drudge, Christopher N.; Elliott, Amy V. C.; Plach, Janina M.; Ejim, Linda J.; Wright, Gerard D.; Droppo, Ian G.; Warren, Lesley A.

    2012-01-01

    Clinically important antibiotic resistance genes were detected in culturable bacteria and class 1 integron gene cassettes recovered from suspended floc, a significant aquatic repository for microorganisms and trace elements, across freshwater systems variably impacted by anthropogenic activities. Antibiotic resistance gene cassettes in floc total community DNA differed appreciably in number and type from genes detected in bacteria cultured from floc. The number of floc antibiotic resistance g...

  20. Molecular study on some antibiotic resistant genes in Salmonella spp. isolates

    Science.gov (United States)

    Nabi, Ari Q.

    2017-09-01

    Studying the genes related with antimicrobial resistance in Salmonella spp. is a crucial step toward a correct and faster treatment of infections caused by the pathogen. In this work Integron mediated antibiotic resistant gene IntI1 (Class I Integrase IntI1) and some plasmid mediated antibiotic resistance genes (Qnr) were scanned among the isolated non-Typhoid Salmonellae strains with known resistance to some important antimicrobial drugs using Sybr Green real time PCR. The aim of the study was to correlate the multiple antibiotics and antimicrobial resistance of Salmonella spp. with the presence of integrase (IntI1) gene and plasmid mediated quinolone resistant genes. Results revealed the presence of Class I Integrase gene in 76% of the isolates with confirmed multiple antibiotic resistances. Moreover, about 32% of the multiple antibiotic resistant serotypes showed a positive R-PCR for plasmid mediated qnrA gene encoding for nalidixic acid and ciprofloxacin resistance. No positive results could be revealed form R-PCRs targeting qnrB or qnrS. In light of these results we can conclude that the presence of at least one of the qnr genes and/or the presence of Integrase Class I gene were responsible for the multiple antibiotic resistance to for nalidixic acid and ciprofloxacin from the studied Salmonella spp. and further studies required to identify the genes related with multiple antibiotic resistance of the pathogen.

  1. Stormwater loadings of antibiotic resistance genes in an urban stream.

    Science.gov (United States)

    Garner, Emily; Benitez, Romina; von Wagoner, Emily; Sawyer, Richard; Schaberg, Erin; Hession, W Cully; Krometis, Leigh-Anne H; Badgley, Brian D; Pruden, Amy

    2017-10-15

    Antibiotic resistance presents a critical public health challenge and the transmission of antibiotic resistance via environmental pathways continues to gain attention. Factors driving the spread of antibiotic resistance genes (ARGs) in surface water and sources of ARGs in urban stormwater have not been well-characterized. In this study, five ARGs (sul1, sul2, tet(O), tet(W), and erm(F)) were quantified throughout the duration of three storm runoff events in an urban inland stream. Storm loads of all five ARGs were significantly greater than during equivalent background periods. Neither fecal indicator bacteria measured (E. coli or enterococci) was significantly correlated with sul1, sul2, or erm(F), regardless of whether ARG concentration was absolute or normalized to 16S rRNA levels. Both E. coli and enterococci were correlated with the tetracycline resistance genes, tet(O) and tet(W). Next-generation shotgun metagenomic sequencing was conducted to more thoroughly characterize the resistome (i.e., full complement of ARGs) and profile the occurrence of all ARGs described in current databases in storm runoff in order to inform future watershed monitoring and management. Between 37 and 121 different ARGs were detected in each stream sample, though the ARG profiles differed among storms. This study establishes that storm-driven transport of ARGs comprises a considerable fraction of overall downstream loadings and broadly characterizes the urban stormwater resistome to identify potential marker ARGs indicative of impact. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Improvement of Scratch and Wear Resistance of Polymers by Fillers Including Nanofillers

    Directory of Open Access Journals (Sweden)

    Witold Brostow

    2017-03-01

    Full Text Available Polymers have lower resistance to scratching and wear than metals. Liquid lubricants work well for metals but not for polymers nor for polymer-based composites (PBCs. We review approaches for improvement of tribological properties of polymers based on inclusion of fillers. The fillers can be metallic or ceramic—with obvious consequences for electrical resistivity of the composites. Distinctions between effectiveness of micro- versus nano-particles are analyzed. For example, aluminum nanoparticles as filler are more effective for property improvement than microparticles at the same overall volumetric concentration. Prevention of local agglomeration of filler particles is discussed along with a technique to verify the prevention.

  3. A review of the influence of treatment strategies on antibiotic resistant bacteria and antibiotic resistance genes.

    Science.gov (United States)

    Sharma, Virender K; Johnson, Natalie; Cizmas, Leslie; McDonald, Thomas J; Kim, Hyunook

    2016-05-01

    Antibiotic resistant bacteria (ARB) and antibiotic resistance genes (ARG) in the aquatic environment have become an emerging contaminant issue, which has implications for human and ecological health. This review begins with an introduction to the occurrence of ARB and ARG in different environmental systems such as natural environments and drinking water resources. For example, ARG or ARB with resistance to ciprofloxacin, sulfamethoxazole, trimethoprim, quinolone, vancomycin, or tetracycline (e.g., tet(A), tet(B), tet(C), tet(G), tet(O), tet(M), tet(W), sul I, and sul II) have been detected in the environment. The development of resistance may be intrinsic, may be acquired through spontaneous mutations (de novo), or may occur due to horizontal gene transfer from donor bacteria, phages, or free DNA to recipient bacteria. An overview is also provided of the current knowledge regarding inactivation of ARB and ARG, and the mechanism of the effects of different disinfection processes in water and wastewater (chlorination, UV irradiation, Fenton reaction, ozonation, and photocatalytic oxidation). The effects of constructed wetlands and nanotechnology on ARB and ARG are also summarized. Copyright © 2015 Elsevier Ltd. All rights reserved.

  4. Analysis of differentially expressed genes related to resistance in spinosad- and neonicotinoid-resistant Musca domestica L. (Diptera: Muscidae) strains

    DEFF Research Database (Denmark)

    Castberg, Dorte Heidi Højland; Kristensen, Michael

    2017-01-01

    interesting in terms of neonicotinoid resistance, while cyp4d9 was overexpressed in 791spin compared to spinosad-susceptible strains. GSTs, ESTs and UGTs were mostly overexpressed, but not to the same degree as P450s. We present a comprehensive and comparative picture of gene expression in three housefly......Background The housefly is a global pest that has developed resistance to most insecticides applied against it. Resistance of the spinosad-resistant strain 791spin and the neonicotinoid-resistant 766b strain is believed to be due to metabolism. We investigate differentially expressed genes...... strains differing significantly in their response to insecticides. High differential expression of P450s and genes coding for cuticle protein indicates a combination of factors involved in metabolic neonicotinoid and spinosad resistance. Conclusion Resistance in these strains is apparently not linked...

  5. Survival of Antibiotic Resistant Bacteria and Horizontal Gene Transfer Control Antibiotic Resistance Gene Content in Anaerobic Digesters.

    Science.gov (United States)

    Miller, Jennifer H; Novak, John T; Knocke, William R; Pruden, Amy

    2016-01-01

    Understanding fate of antibiotic resistant bacteria (ARB) vs. their antibiotic resistance genes (ARGs) during wastewater sludge treatment is critical in order to reduce the spread of antibiotic resistance through process optimization. Here, we spiked high concentrations of tetracycline-resistant bacteria, isolated from mesophilic (Iso M1-1-a Pseudomonas sp.) and thermophilic (Iso T10-a Bacillus sp.) anaerobic digested sludge, into batch digesters and monitored their fate by plate counts and quantitative polymerase chain reaction (QPCR) of their corresponding tetracycline ARGs. In batch studies, spiked ARB plate counts returned to baseline (thermophilic) or 1-log above baseline (mesophilic) while levels of the ARG present in the spiked isolate [tet(G)] remained high in mesophilic batch reactors. To compare results under semi-continuous flow conditions with natural influent variation, tet(O), tet(W), and sul1 ARGs, along with the intI1 integrase gene, were monitored over a 9-month period in the raw feed sludge and effluent sludge of lab-scale thermophilic and mesophilic anaerobic digesters. sul1 and intI1 in mesophilic and thermophilic digesters correlated positively (Spearman rho = 0.457-0.829, P < 0.05) with the raw feed sludge. There was no correlation in tet(O) or tet(W) ratios in raw sludge and mesophilic digested sludge or thermophilic digested sludge (Spearman rho = 0.130-0.486, P = 0.075-0.612). However, in the thermophilic digester, the tet(O) and tet(W) ratios remained consistently low over the entire monitoring period. We conclude that the influent sludge microbial composition can influence the ARG content of a digester, apparently as a result of differential survival or death of ARBs or horizontal gene transfer of genes between raw sludge ARBs and the digester microbial community. Notably, mesophilic digestion was more susceptible to ARG intrusion than thermophilic digestion, which may be attributed to a higher rate of ARB survival and/or horizontal gene

  6. Survival of antibiotic resistant bacteria and horizontal gene transfer control antibiotic resistance gene content in anaerobic digesters

    Directory of Open Access Journals (Sweden)

    Jennifer Hafer Miller

    2016-03-01

    Full Text Available Understanding fate of antibiotic resistant bacteria (ARB versus their antibiotic resistance genes (ARGs during wastewater sludge treatment is critical in order to reduce the spread of antibiotic resistance through process optimization. Here, we spiked high concentrations of tetracycline-resistant bacteria, isolated from mesophilic (Iso M1-1- a Pseudomonas sp. and thermophilic (Iso T10- a Bacillus sp. anaerobic digested sludge, into batch digesters and monitored their fate by plate counts and quantitative polymerase chain reaction (QPCR of their corresponding tetracycline ARGs. In batch studies, spiked ARB plate counts returned to baseline (thermophilic or 1-log above baseline (mesophilic while levels of the ARG present in the spiked isolate (tet(G remained high in mesophilic batch reactors. To compare results under semi-continuous flow conditions with natural influent variation, tet(O, tet(W, and sul1 ARGs, along with the intI1 integrase gene, were monitored over a 9-month period in the raw feed sludge and effluent sludge of lab-scale thermophilic and mesophilic anaerobic digesters. sul1 and intI1 in mesophilic and thermophilic digesters correlated positively (Spearman rho = 0.457 to 0.829, P<0.05 with the raw feed sludge. There was no correlation in tet(O or tet(W ratios in raw sludge and mesophilic digested sludge or thermophilic digested sludge (Spearman rho = 0.130 to 0.486, P = 0.075 to 0.612. However, in the thermophilic digester, the tet(O and tet(W ratios remained consistently low over the entire monitoring period. We conclude that the influent sludge microbial composition can influence the ARG content of a digester, apparently as a result of differential survival or death of ARBs or horizontal gene transfer of genes between raw sludge ARBs and the digester microbial community. Notably, mesophilic digestion was more susceptible to ARG intrusion than thermophilic digestion, which may be attributed to a higher rate of ARB survival and

  7. A Comprehensive Insight into Tetracycline Resistant Bacteria and Antibiotic Resistance Genes in Activated Sludge Using Next-Generation Sequencing

    OpenAIRE

    Huang, Kailong; Tang, Junying; Zhang, Xu-Xiang; Xu, Ke; Ren, Hongqiang

    2014-01-01

    In order to comprehensively investigate tetracycline resistance in activated sludge of sewage treatment plants, 454 pyrosequencing and Illumina high-throughput sequencing were used to detect potential tetracycline resistant bacteria (TRB) and antibiotic resistance genes (ARGs) in sludge cultured with different concentrations of tetracycline. Pyrosequencing of 16S rRNA gene revealed that tetracycline treatment greatly affected the bacterial community structure of the sludge. Nine genera cons...

  8. Fate of antibiotic resistant cultivable heterotrophic bacteria and antibiotic resistance genes in wastewater treatment processes.

    Science.gov (United States)

    Zhang, Songhe; Han, Bing; Gu, Ju; Wang, Chao; Wang, Peifang; Ma, Yanyan; Cao, Jiashun; He, Zhenli

    2015-09-01

    Antibiotic resistant bacteria (ARB) and antibiotic resistance genes (ARGs) are emerging contaminants of environmental concern. Heterotrophic bacteria in activated sludge have an important role in wastewater treatment plants (WWTPs). However, the fate of cultivable heterotrophic ARB and ARGs in WWPTs process remains unclear. In the present study, we investigated the antibiotic-resistant phenotypes of cultivable heterotrophic bacteria from influent and effluent water of three WWTPs and analysed thirteen ARGs in ARB and in activated sludge from anoxic, anaerobic and aerobic compartments. From each influent or effluent sample of the three plants, 200 isolates were randomly tested for susceptibility to 12 antibiotics. In these samples, between 5% and 64% isolates showed resistance to >9 antibiotics and the proportion of >9-drug-resistant bacteria was lower in isolates from effluent than from influent. Eighteen genera were identified in 188 isolates from influent (n=94) and effluent (n=94) of one WWTP. Six genera (Aeromonas, Bacillus, Lysinibacillus, Microbacterium, Providencia, and Staphylococcus) were detected in both influent and effluent samples. Gram-negative and -positive isolates dominated in influent and effluent, respectively. The 13 tetracycline-, sulphonamide-, streptomycin- and β-lactam-resistance genes were detected at a higher frequency in ARB from influent than from effluent, except for sulA and CTX-M, while in general, the abundances of ARGs in activated sludge from two of the three plants were higher in aerobic compartments than in anoxic ones, indicating abundant ARGs exit in the excess sledges and/or in uncultivable bacteria. These findings may be useful for elucidating the effect of WWTP on ARB and ARGs. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. Identification of Nine Pathotype-Specific Genes Conferring Resistance to Fusiform Rust in Loblolly Pine (Pinus taeda L.

    Directory of Open Access Journals (Sweden)

    Henry V. Amerson

    2015-08-01

    Full Text Available Nearly two decades of research on the host-pathogen interaction in fusiform rust of loblolly pine is detailed. Results clearly indicate that pathotype-specific genes in the host interacting with pathogen avirulence cause resistance as defined by the non-gall phenotype under favorable environmental conditions for disease development. In particular, nine fusiform rust resistance genes (Fr genes are described here including the specific methods to determine each and their localization on the reference genetic map of loblolly pine. Understanding how these and other apparent Fr genes in loblolly pine and other rust-susceptible pines impact resistance screening, parental and progeny selection, and family and clonal deployment is an important area in forest genetics research and operational tree breeding. The documentation of these Fr genes is a key piece of information towards gaining that understanding and ultimately improving breeding and deployment strategies.

  10. Survey of Candidate Genes for Maize Resistance to Infection by Aspergillus flavus and/or Aflatoxin Contamination

    Science.gov (United States)

    Hawkins, Leigh K.; Tang, Juliet D.; Tomashek, John; Alves Oliveira, Dafne; Ogunola, Oluwaseun F.; Smith, J. Spencer; Williams, W. Paul

    2018-01-01

    Many projects have identified candidate genes for resistance to aflatoxin accumulation or Aspergillus flavus infection and growth in maize using genetic mapping, genomics, transcriptomics and/or proteomics studies. However, only a small percentage of these candidates have been validated in field conditions, and their relative contribution to resistance, if any, is unknown. This study presents a consolidated list of candidate genes identified in past studies or in-house studies, with descriptive data including genetic location, gene annotation, known protein identifiers, and associated pathway information, if known. A candidate gene pipeline to test the phenotypic effect of any maize DNA sequence on aflatoxin accumulation resistance was used in this study to determine any measurable effect on polymorphisms within or linked to the candidate gene sequences, and the results are published here. PMID:29385107

  11. Differential gene expression in individual papilla-resistant and powdery mildew-infected barley epidermal cells

    DEFF Research Database (Denmark)

    Gjetting, T.; Carver, Timothy L. W.; Skøt, Leif

    2004-01-01

    leading to papilla deposition and reinforcement of their cell wall. This conveys a race-nonspecific form of resistance. However, this defense is not complete, and a proportion of penetration attempts succeed in infection. The resultant mixture of infected and uninfected leaf cells makes it impossible...... separately. Contents of single epidermal cells (resistant, infected, and unattacked controls) were collected, and after cDNA synthesis and PCR amplification, the resulting sample was hybridized to dot-blots spotted with genes, including some previously reported to be induced upon pathogen attack. Transcripts...

  12. Current treatment in rheumatoid arthritis: a review including nanotechnology and gene therapy

    Directory of Open Access Journals (Sweden)

    Najmeh Malekzadeh

    2017-05-01

    Full Text Available Rheumatoid arthritis (RA is a common inflammatory disease affecting approximately 1% of the adult population worldwide. Before new treatments were available, unchecked RA caused notable inability and mortality .It is now accepted that primary diagnosis and treatment are essential and useful. Progress in therapy of RA has made it possible to deeply influence signs and symptoms as the period that joint destructed in inflammatory arthritis. Earlier and more efficient treatment becomes visible to significantly improve the prognosis of this disease. In this article, the old and new methods for treatment rheumatoid arthritis and their limitation and benefits were reviewed. These methods include nonsteroidal anti-inflammatory drug (NSAIDs, glucocorticoids(GC that are a class of steroid hormones, disease-modifying anti-rheumatic drugs (DMARDs, biological agents that can be divided in two groups of monoclonal antibodies and teeny molecules, bisphosphonate therapy, nanotechnology, oral tolerance, photodynamic therapy, gene therapy, bone marrow transplantation, liposomes, superparamagnetic iron oxide nano particles (SPIONs.

  13. Specific balance training included in an endurance-resistance exercise program improves postural balance in elderly patients undergoing haemodialysis.

    Science.gov (United States)

    Frih, Bechir; Mkacher, Wajdi; Jaafar, Hamdi; Frih, Ameur; Ben Salah, Zohra; El May, Mezry; Hammami, Mohamed

    2018-04-01

    The purpose of this study was to evaluate the effects of 6 months of specific balance training included in endurance-resistance program on postural balance in haemodialysis (HD) patients. Forty-nine male patients undergoing HD were randomly assigned to an intervention group (balance training included in an endurance-resistance training, n = 26) or a control group (resistance-endurance training only, n = 23). Postural control was assessed using six clinical tests; Timed Up and Go test, Tinetti Mobility Test, Berg Balance Scale, Unipodal Stance test, Mini-Balance Evaluation Systems Test and Activities Balance Confidence scale. All balance measures increased significantly after the period of rehabilitation training in the intervention group. Only the Timed Up and Go, Berg Balance Scale, Mini-Balance Evaluation Systems Test and Activities Balance Confidence scores were improved in the control group. The ranges of change in these tests were greater in the balance training group. In HD patients, specific balance training included in a usual endurance-resistance training program improves static and dynamic balance better than endurance-resistance training only. Implications for rehabilitation Rehabilitation using exercise in haemodialysis patients improved global mobility and functional abilities. Specific balance training included in usual endurance resistance training program could lead to improved static and dynamic balance.

  14. Benchmarking of methods for identification of antimicrobial resistance genes in bacterial whole genome data.

    Science.gov (United States)

    Clausen, Philip T L C; Zankari, Ea; Aarestrup, Frank M; Lund, Ole

    2016-09-01

    Next generation sequencing (NGS) may be an alternative to phenotypic susceptibility testing for surveillance and clinical diagnosis. However, current bioinformatics methods may be associated with false positives and negatives. In this study, a novel mapping method was developed and benchmarked to two different methods in current use for identification of antibiotic resistance genes in bacterial WGS data. A novel method, KmerResistance, which examines the co-occurrence of k-mers between the WGS data and a database of resistance genes, was developed. The performance of this method was compared with two previously described methods; ResFinder and SRST2, which use an assembly/BLAST method and BWA, respectively, using two datasets with a total of 339 isolates, covering five species, originating from the Oxford University Hospitals NHS Trust and Danish pig farms. The predicted resistance was compared with the observed phenotypes for all isolates. To challenge further the sensitivity of the in silico methods, the datasets were also down-sampled to 1% of the reads and reanalysed. The best results were obtained by identification of resistance genes by mapping directly against the raw reads. This indicates that information might be lost during assembly. KmerResistance performed significantly better than the other methods, when data were contaminated or only contained few sequence reads. Read mapping is superior to assembly-based methods and the new KmerResistance seemingly outperforms currently available methods particularly when including datasets with few reads. © The Author 2016. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  15. Sulfonamide-Resistant Bacteria and Their Resistance Genes in Soils Fertilized with Manures from Jiangsu Province, Southeastern China

    Science.gov (United States)

    Jiao, Shaojun; Zhang, Jun; Ye, Boping; Gao, Shixiang

    2014-01-01

    Antibiotic-resistant bacteria and genes are recognized as new environmental pollutants that warrant special concern. There were few reports on veterinary antibiotic-resistant bacteria and genes in China. This work systematically analyzed the prevalence and distribution of sulfonamide resistance genes in soils from the environments around poultry and livestock farms in Jiangsu Province, Southeastern China. The results showed that the animal manure application made the spread and abundance of antibiotic resistance genes (ARGs) increasingly in the soil. The frequency of sulfonamide resistance genes was sul1 > sul2 > sul3 in pig-manured soil DNA and sul2 > sul1 > sul3 in chicken-manured soil DNA. Further analysis suggested that the frequency distribution of the sul genes in the genomic DNA and plasmids of the SR isolates from manured soil was sul2 > sul1 > sul3 overall (panimal type and sampling time can influence the prevalence and distribution pattern of sulfonamide resistance genes. The present study also indicated that Bacillus, Pseudomonas and Shigella were the most prevalent sul-positive genera in the soil, suggesting a potential human health risk. The above results could be important in the evaluation of antibiotic-resistant bacteria and genes from manure as sources of agricultural soil pollution; the results also demonstrate the necessity and urgency of the regulation and supervision of veterinary antibiotics in China. PMID:25405870

  16. Novel Genes Related to Ceftriaxone Resistance Found among Ceftriaxone-Resistant Neisseria gonorrhoeae Strains Selected In Vitro.

    Science.gov (United States)

    Gong, Zijian; Lai, Wei; Liu, Min; Hua, Zhengshuang; Sun, Yayin; Xu, Qingfang; Xia, Yue; Zhao, Yue; Xie, Xiaoyuan

    2016-04-01

    The emergence of ceftriaxone-resistantNeisseria gonorrhoeaeis currently a global public health concern. However, the mechanism of ceftriaxone resistance is not yet fully understood. To investigate the potential genes related to ceftriaxone resistance inNeisseria gonorrhoeae, we subcultured six gonococcal strains with increasing concentrations of ceftriaxone and isolated the strains that became resistant. After analyzing several frequently reported genes involved in ceftriaxone resistance, we found only a single mutation inpenA(A501V). However, differential analysis of the genomes and transcriptomes between pre- and postselection strains revealed many other mutated genes as well as up- and downregulated genes. Transformation of the mutatedpenAgene into nonresistant strains increased the MIC between 2.0- and 5.3-fold, and transformation of mutatedftsXincreased the MIC between 3.3- and 13.3-fold. Genes encoding the ABC transporters FarB, Tfq, Hfq, and ExbB were overexpressed, whilepilM,pilN, andpilQwere downregulated. Furthermore, the resistant strain developed cross-resistance to penicillin and cefuroxime, had an increased biochemical metabolic rate, and presented fitness defects such as prolonged growth time and downregulated PilMNQ. In conclusion, antimicrobial pressure could result in the emergence of ceftriaxone resistance, and the evolution of resistance ofNeisseria gonorrhoeaeto ceftriaxone is a complicated process at both the pretranscriptional and posttranscriptional levels, involving several resistance mechanisms of increased efflux and decreased entry. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  17. Genetics and mapping of a new leaf rust resistance gene in Triticum ...

    Indian Academy of Sciences (India)

    AMIT KUMAR SINGH

    Selection G12 showed resistance at both seedling and adult plant stages. Genetic analysis in F1, F2 and F2:3 families at the seedling stage revealed that leaf rust resistance in Selection G12 is conditioned by a single incompletely dominant gene. The leaf rust resistance gene was mapped to chromosome 3BL with SSR ...

  18. Characterization of resistance genes to Cladosporium fulvum on the short arm of chromosome 1 of tomato

    NARCIS (Netherlands)

    Haanstra, J.

    2000-01-01

    Plant breeders generally use qualitative resistance that is associated with a hypersensitive reaction (HR) to obtain cultivars that are resistant to pathogens and pests. The genetics of this resistance is based on the gene-for-gene relationship, which involves the product of a plant

  19. Distribution and quantification of antibiotic resistance genes and bacteria across agricultural and non-agricultural metagenomes

    Science.gov (United States)

    There is concern that antibiotic resistance can potentially be transferred from animals to humans through the food chain. The relationship between specific antibiotic resistant bacteria and the genes they carry remains to be described and few details are known about how antibiotic resistance genes i...

  20. A physical map of the heterozygous grapevine 'Cabernet Sauvignon' allows mapping candidate genes for disease resistance

    Directory of Open Access Journals (Sweden)

    Scalabrin Simone

    2008-06-01

    Full Text Available Abstract Background Whole-genome physical maps facilitate genome sequencing, sequence assembly, mapping of candidate genes, and the design of targeted genetic markers. An automated protocol was used to construct a Vitis vinifera 'Cabernet Sauvignon' physical map. The quality of the result was addressed with regard to the effect of high heterozygosity on the accuracy of contig assembly. Its usefulness for the genome-wide mapping of genes for disease resistance, which is an important trait for grapevine, was then assessed. Results The physical map included 29,727 BAC clones assembled into 1,770 contigs, spanning 715,684 kbp, and corresponding to 1.5-fold the genome size. Map inflation was due to high heterozygosity, which caused either the separation of allelic BACs in two different contigs, or local mis-assembly in contigs containing BACs from the two haplotypes. Genetic markers anchored 395 contigs or 255,476 kbp to chromosomes. The fully automated assembly and anchorage procedures were validated by BAC-by-BAC blast of the end sequences against the grape genome sequence, unveiling 7.3% of chimerical contigs. The distribution across the physical map of candidate genes for non-host and host resistance, and for defence signalling pathways was then studied. NBS-LRR and RLK genes for host resistance were found in 424 contigs, 133 of them (32% were assigned to chromosomes, on which they are mostly organised in clusters. Non-host and defence signalling genes were found in 99 contigs dispersed without a discernable pattern across the genome. Conclusion Despite some limitations that interfere with the correct assembly of heterozygous clones into contigs, the 'Cabernet Sauvignon' physical map is a useful and reliable intermediary step between a genetic map and the genome sequence. This tool was successfully exploited for a quick mapping of complex families of genes, and it strengthened previous clues of co-localisation of major NBS-LRR clusters and

  1. Conferred resistance to Botrytis cinerea in Lilium by overexpression of the RCH10 chitinase gene.

    Science.gov (United States)

    Núñez de Cáceres González, Francisco F; Davey, Michael R; Cancho Sanchez, Ester; Wilson, Zoe A

    2015-07-01

    Transgenic Lilium lines have been generated by Agrobacterium -mediated transformation that have enhanced resistance to Botrytis cinerea as a consequence of ectopic expression of a rice chitinase gene. The production of ornamentals is an important global industry, with Lilium being one of the six major bulb crops in the world. The international trade in ornamentals is in the order of £60-75 billion and is expected to increase worldwide by 2-4% per annum. The continued success of the floriculture industry depends on the introduction of new species/cultivars with major alterations in key agronomic characteristics, such as resistance to pathogens. Fungal diseases are the cause of reduced yields and marketable quality of cultivated plants, including ornamental species. The fungal pathogen Botrytis causes extreme economic losses to a wide range of crop species, including ornamentals such as Lilium. Agrobacterium-mediated transformation was used to develop Lilium oriental cv. 'Star Gazer' plants that ectopically overexpress the Rice Chitinase 10 gene (RCH10), under control of the CaMV35S promoter. Levels of conferred resistance linked to chitinase expression were evaluated by infection with Botrytis cinerea; sporulation was reduced in an in vitro assay and the relative expression of the RCH10 gene was determined by quantitative reverse transcriptase-PCR. The extent of resistance to Botrytis, compared to that of the wild type plants, showed a direct correlation with the level of chitinase gene expression. Transgenic plants grown to flowering showed no detrimental phenotypic effects associated with transgene expression. This is the first report of Lilium plants with resistance to Botrytis cinerea generated by a transgenic approach.

  2. Rapid identification of rice blast resistance gene by specific length amplified fragment sequencing

    Directory of Open Access Journals (Sweden)

    Shen Chen

    2016-05-01

    Full Text Available Excavation of resistance genes is one of the most effective and environment-friendly measures to control the devastating rice disease caused by Magnaporthe oryzae. Many resistance genes have been mapped and characterized in the last century. Nevertheless, only a few of the total resistance genes could be really applied in the rice breeding program. Huazhan (HZ is a new native rice restorer line developed in China and widely used in hybrid rice in recent years. HZ and its crossed combinations usually show a broad spectrum of resistance against rice blast in different rice ecosystems in China. Dissection of the genetic background of HZ is very useful for its further application. In this study, a combined method based on bulked segregation analysis (BSA and specific length amplified fragment sequencing (SLAF-seq was used to identify blast resistance gene(s in HZ. A total of 56,187 SLAFs labels were captured and 9051 polymorphic SLAFs markers were analysed and procured in this study. One trait associated with candidate resistance genes region on chromosome 12 overlapping 10.2–17.6 Mb has been identified, in which 10 NBS-LRR (nucleotide-binding site-leucine-rich repeat coding genes were used as resistance gene candidates. Our result indicated that SLAF-seq with BSA is a rapid and effective method for initial identification of blast resistance genes. The identification of resistance gene in HZ will improve its molecular breeding and resistance variety application.

  3. Distribution of triclosan-resistant genes in major pathogenic microorganisms revealed by metagenome and genome-wide analysis.

    Directory of Open Access Journals (Sweden)

    Raees Khan

    Full Text Available The substantial use of triclosan (TCS has been aimed to kill pathogenic bacteria, but TCS resistance seems to be prevalent in microbial species and limited knowledge exists about TCS resistance determinants in a majority of pathogenic bacteria. We aimed to evaluate the distribution of TCS resistance determinants in major pathogenic bacteria (N = 231 and to assess the enrichment of potentially pathogenic genera in TCS contaminated environments. A TCS-resistant gene (TRG database was constructed and experimentally validated to predict TCS resistance in major pathogenic bacteria. Genome-wide in silico analysis was performed to define the distribution of TCS-resistant determinants in major pathogens. Microbiome analysis of TCS contaminated soil samples was also performed to investigate the abundance of TCS-resistant pathogens. We experimentally confirmed that TCS resistance could be accurately predicted using genome-wide in silico analysis against TRG database. Predicted TCS resistant phenotypes were observed in all of the tested bacterial strains (N = 17, and heterologous expression of selected TCS resistant genes from those strains conferred expected levels of TCS resistance in an alternative host Escherichia coli. Moreover, genome-wide analysis revealed that potential TCS resistance determinants were abundant among the majority of human-associated pathogens (79% and soil-borne plant pathogenic bacteria (98%. These included a variety of enoyl-acyl carrier protein reductase (ENRs homologues, AcrB efflux pumps, and ENR substitutions. FabI ENR, which is the only known effective target for TCS, was either co-localized with other TCS resistance determinants or had TCS resistance-associated substitutions. Furthermore, microbiome analysis revealed that pathogenic genera with intrinsic TCS-resistant determinants exist in TCS contaminated environments. We conclude that TCS may not be as effective against the majority of bacterial pathogens as previously

  4. Genes for resistance to wheat powdery mildew in derivatives of Triticum Timopheevi and T. Carthlicum

    DEFF Research Database (Denmark)

    Jørgensen, Jørgen Helms; Jensen, C. J.

    1972-01-01

    and/or Ml designated genes; a temporary designation, Ml f ,is proposed for this gene. Gene Ml f is closely associated with a gene conditioning resistance to the stem rust fungus (Puccinia graminis f. sp. tritici), probably gene Sr9c. The winter wheat line TP 229 derived from Triticum carthlicum has...

  5. Novel polymorphisms and lack of mutations in the ACD gene in patients with ACTH resistance syndromes.

    Science.gov (United States)

    Keegan, Catherine E; Hutz, Janna E; Krause, Andrea S; Koehler, Katrin; Metherell, Louise A; Boikos, Sosipatros; Stergiopoulos, Sotirios; Clark, Adrian J L; Stratakis, Constantine A; Huebner, Angela; Hammer, Gary D

    2007-08-01

    ACTH resistance is a feature of several human syndromes with known genetic causes, including familial glucocorticoid deficiency (types 1 and 2) and triple A syndrome. However, many patients with ACTH resistance lack an identifiable genetic aetiology. The human homolog of the Acd gene, mutated in a mouse model of adrenal insufficiency, was sequenced in 25 patients with a clinical diagnosis of familial glucocorticoid deficiency or triple A syndrome. A 3.4 kilobase genomic fragment containing the entire ACD gene was analysed for mutations in all 25 patients. Samples were obtained by three investigators from different institutions. The primary cohort consisted of 25 unrelated patients, primarily of European or Middle Eastern descent, with a clinical diagnosis of either familial glucocorticoid deficiency (FGD) or triple A syndrome. Patients lacked mutations in other genes known to cause ACTH resistance, including AAAS for patients diagnosed with triple A syndrome and MC2R and MRAP for patients diagnosed with familial glucocorticoid deficiency. Thirty-five additional patients with adrenal disease phenotypes were added to form an expanded cohort of 60 patients. Identification of DNA sequence changes in the ACD gene in the primary cohort and analysis of putative ACD haplotypes in the expanded cohort. No disease-causing mutations were found, but several novel single nucleotide polymorphisms (SNPs) and two putative haplotypes were identified. The overall frequency of SNPs in ACD is low compared to other gene families. No mutations were identified in ACD in this collection of patients with ACTH resistance phenotypes. However, the newly identified SNPs in ACD should be more closely examined for possible links to disease.

  6. Pfirsch-Tasso versus standard approaches in the plasma stability theory including the resistive wall effects

    Science.gov (United States)

    Pustovitov, V. D.

    2017-11-01

    The study is devoted to theoretical description of plasma stability in toroidal fusion systems with a resistive wall. Its aim is elimination of contradictions between the models recently developed for the resistive wall mode analysis and the Pfirsch-Tasso approach originated from the paper published in 1971 [D. Pfirsch and H. Tasso, Nucl. Fusion 11, 259 (1971)]. The main relations have been given there without detailed proofs. Here, a missing chain of derivations is restored and earlier unknown limitations that restrict the applicability of the Pfirsch-Tasso energy principle are established. Its replacement valid in a wider area is proposed. The new result is free from the constraints implicitly imposed in the Pfirsch-Tasso procedure and can be used with any plasma model (not necessarily ideal) and for arbitrary perturbations. The proposed extensions allow applications for analysis of the rotational stabilization and optimization of the ITER scenarios.

  7. The human genome and sport, including epigenetics, gene doping, and athleticogenomics.

    Science.gov (United States)

    Sharp, N C Craig

    2010-03-01

    Hugh Montgomery's discovery of the first of more than 239 fitness genes together with rapid advances in human gene therapy have created a prospect of using genes, genetic elements, and cells that have the capacity to enhance athletic performance (to paraphrase the World Anti-Doping Agency's definition of gene doping). This brief overview covers the main areas of interface between genetics and sport, attempts to provide a context against which gene doping may be viewed, and predicts a futuristic legitimate use of genomic (and possibly epigenetic) information in sport. Copyright 2010 Elsevier Inc. All rights reserved.

  8. Fine-mapping diabetes-related traits, including insulin resistance, in heterogeneous stock rats.

    Science.gov (United States)

    Solberg Woods, Leah C; Holl, Katie L; Oreper, Daniel; Xie, Yuying; Tsaih, Shirng-Wern; Valdar, William

    2012-11-01

    Type 2 diabetes (T2D) is a disease of relative insulin deficiency resulting from both insulin resistance and beta cell failure. We have previously used heterogeneous stock (HS) rats to fine-map a locus for glucose tolerance. We show here that glucose intolerance in the founder strains of the HS colony is mediated by different mechanisms: insulin resistance in WKY and an insulin secretion defect in ACI, and we demonstrate a high degree of variability for measures of insulin resistance and insulin secretion in HS rats. As such, our goal was to use HS rats to fine-map several diabetes-related traits within a region on rat chromosome 1. We measured blood glucose and plasma insulin levels after a glucose tolerance test in 782 male HS rats. Using 97 SSLP markers, we genotyped a 68 Mb region on rat chromosome 1 previously implicated in glucose and insulin regulation. We used linkage disequilibrium mapping by mixed model regression with inferred descent to identify a region from 198.85 to 205.9 that contains one or more quantitative trait loci (QTL) for fasting insulin and a measure of insulin resistance, the quantitative insulin sensitivity check index. This region also encompasses loci identified for fasting glucose and Insulin_AUC (area under the curve). A separate <3 Mb QTL was identified for body weight. Using a novel penalized regression method we then estimated effects of alternative haplotype pairings under each locus. These studies highlight the utility of HS rats for fine-mapping genetic loci involved in the underlying causes of T2D.

  9. Comparative antimicrobial activity of gatifloxacin tested against Campylobacter jejuni including fluoroquinolone-resistant clinical isolates.

    Science.gov (United States)

    Hayward, C L; Erwin, M E; Barrett, M S; Jones, R N

    1999-06-01

    Campylobacter jejuni is an important pathogen that causes gastroenteritis, as well as other disease states such as meningitis and septic arthritis. In this study, the Etest (AB BIODISK, Solna, Sweden) results were compared to a reference agar dilution method using gatifloxacin, a new 8-methoxyfluoroquinolone. A total of 53 strains of C. jejuni initially isolated from patients in California and Mexico were tested. Results demonstrated a high correlation (r = 0.88) between the two utilized in vitro dilution methods. In addition, gatifloxacin activity was compared to that of ciprofloxacin, metronidazole, amoxicillin, erythromycin, chloramphenicol, gentamicin, tetracycline, and trimethoprim/sulfamethoxazole using the Etest. Gatifloxacin (MIC90, 4 micrograms/ml) was approximately eight- to 16-fold more potent than ciprofloxacin (Mic90, > 32 micrograms/ml), a commonly used fluoroquinolone for Campylobacter infections. Eight strains highly resistant to ciprofloxacin (MIC90, > 32 micrograms/ml) were tested for cross resistance against the newer fluoroquinolones (gatifloxacin, levofloxacin, trovafloxacin) and the rank order of potency was: gatifloxacin (MIC50, 16 micrograms/ml) > trovafloxacin = levofloxacin (MIC50, > 32 micrograms/mL). However, only 25% ciprofloxacin-resistant strains were inhibited by < or = 1 microgram/mL of gatifloxacin or trovafloxacin. These results for gatifloxacin against C. jejuni strains must be further assessed in the context of in vivo trials before the clinical role of this new fluoroquinolone can be determined. The Etest appears to be a simple and precise susceptibility test method for testing C. jejuni isolates against fluoroquinolones and other alternative therapeutic agents.

  10. Surgical Treatment of Complications of Pulmonary Tuberculosis, including Drug-Resistant Tuberculosis

    Directory of Open Access Journals (Sweden)

    Rajhmun Madansein

    2015-03-01

    Full Text Available Surgery for drug-resistant tuberculosis has been shown to be safe and effective, with similar level of mortalities associated with surgical intervention observed with that for lung cancer. While surgery has been an option to treat TB in the pre-antibiotic era, it is now increasingly used to treat complications of pulmonary TB, particularly in patients with drug-resistant TB who do not respond to medical treatment. The two most frequent indications for lung resection in drug- resistant TB, are i failed medical treatment with persistent sputum positivity or ii patients who have had medical treatment and are sputum negative, but with persistent localized cavitary disease or bronchiectasis. Massive hemoptysis is a potentially life-threatening complication of TB. Lung resection is potentially curative in patients with massive hemoptysis and cavitary or bronchiectatic disease. Bronchial artery embolization in these patients has a high success rate but bears also the risk of recurrence. Lung resection can be safely undertaken in selected patients with HIV co-infection and pulmonary complications of TB. Ambulatory drainage is a novel, safe, affordable and effective method of draining a chronic TB associated empyema thoracis. We review here the current surgical treatment of the complications of pulmonary TB and discuss the experience from the Durban Cardiothoracic Surgery Unit for the surgical treatment of patients with complicated pulmonary TB.

  11. Detection and Genetic Environment of Pleuromutilin-Lincosamide-Streptogramin A Resistance Genes in Staphylococci Isolated from Pets.

    Science.gov (United States)

    Deng, Fengru; Wang, Huiwen; Liao, Yifei; Li, Jun; Feßler, Andrea T; Michael, Geovana B; Schwarz, Stefan; Wang, Yang

    2017-01-01

    Increasing emergence of staphylococci resistant to pleuromutilins, lincosamides, and streptogramin A (PLS A ) and isolated from humans and pets is a growing public health concern worldwide. Currently, there was only one published study regarding one of the PLS A genes, vga (A) detected in staphylococci isolated from cat. In this study, eleven pleuromutilin-resistant staphylococci from pets and two from their owners were isolated and further characterized for their antimicrobial susceptibilities, plasmid profiles, genotypes, and genetic context of the PLS A resistance genes. The gene sal (A) identified in 11 staphylococcal isolates was found for the first time in Staphylococcus haemolyticus, Staphylococcus epidermidis , and Staphylococcus xylosus . Moreover, these 11 isolates shared the identical regions flanking the sal (A) gene located in the chromosomal DNA. Two S. haemolyticus isolates from a cat and its owner carried similar vga (A) LC plasmids and displayed indistinguishable PFGE patterns. A novel chromosomal multidrug resistance genomic island (MDRGI) containing 13 resistance genes, including lsa (E), was firstly identified in S. epidermidis . In addition, vga (A) LC , sal (A), and lsa (E) were for the first time identified in staphylococcal isolates originating from pet animals. The plasmids, chromosomal DNA region, and MDRGI associated with the PLS A resistance genes vga (A), vga (A) LC , sal (A), and lsa (E) are present in staphylococci isolated from pets and humans and present significant challenges for the clinical management of infections by limiting therapeutic options.

  12. Identification of genes involved in stem rust resistance from wheat mutant D51 with the cDNA-AFLP technique.

    Science.gov (United States)

    Yin, Jing; Wang, Guangjin; Xiao, Jialei; Ma, Fengming; Zhang, Hongji; Sun, Yan; Diao, Yanling; Huang, Jinghua; Guo, Qiang; Liu, Dongjun

    2010-02-01

    Wheat (Triticum aestivum L.) stem rust caused by Puccinia graminis f. sp. tritici is one of the main diseases of wheat worldwide. Wheat mutant line D51, which was derived from the highly susceptible cultivar L6239, shows resistance to the prevailing races 21C3CPH, 21C3CKH, and 21C3CTR of P. graminis f. sp. tritici in China. In this study, we used the cDNA-AFLP technology to identify the genes that are likely involved in the stem rust resistance. EcoRI/MseI selective primers were used to generate approximately 1920 DNA fragments. Seventy five differentially transcribed fragments (3.91%) were identified by comparing the samples of 21C3CPH infected D51 with infected L6239 or uninfected D51. Eleven amplified cDNA fragments were sequenced. Eight showed significant similarity to known genes, including TaLr1 (leaf rust resistance gene), wlm24 (wheat powdery mildew resistance gene), stress response genes and ESTs of environment stress of tall fescue. These identified genes are involved in plant defense response and stem rust resistance and need further research to determine their usefulness in breeding new resistance cultivars.

  13. Mapping and Cloning of Late Blight Resistance Genes from Solanum venturii Using an Interspecific Candidate Gene Approach

    NARCIS (Netherlands)

    Pel, M.; Foster, S.J.; Park, T.H.; Rietman, H.; Arkel, van G.; Jones, J.D.G.; Eck, van H.J.; Jacobsen, E.; Visser, R.G.F.; Vossen, van der E.A.G.

    2009-01-01

    Late blight, caused by the oomycete Phytophthora infestans, is one of the most devastating diseases of potato. Resistance (R) genes from the wild species Solanum demissum have been used by breeders to generate late-blight-resistant cultivars but resistance was soon overcome by the pathogen. A more

  14. Localization of the Laevigatum powdery mildew resistance gene to barley chromosome 2 by the use of RFLP markers

    DEFF Research Database (Denmark)

    Giese, H.; Holm-Jensen, A.G.; Jensen, H.P.

    1993-01-01

    The powdery mildew disease resistance gene Ml(La) was found to belong to a locus on barely chromosome 2. We suggest that this locus be designated MlLa. Linkage analysis was carried out on 72 chromosome-doubled, spring-type progeny lines from a cross between the winter var 'Vogelsanger Gold' and t......' and the spring var 'Alf'. A map of chromosome 2 spanning 119 cM and flanked by two peroxidase gene loci was constructed. In addition to the Laevigatum resistance locus the map includes nine RFLP markers, the two peroxidase gene loci and the six-row locus in barley....

  15. Localization of the Laevigatum powdery mildew resistance gene to barley chromosome 2 by the use of RFLP markers

    DEFF Research Database (Denmark)

    Giese, H.; Holm-Jensen, A.G.; Jensen, H.P.

    1993-01-01

    The powdery mildew disease resistance gene Ml(La) was found to belong to a locus on barely chromosome 2. We suggest that this locus be designated MlLa. Linkage analysis was carried out on 72 chromosome-doubled, spring-type progeny lines from a cross between the winter var 'Vogelsanger Gold......' and the spring var 'Alf'. A map of chromosome 2 spanning 119 cM and flanked by two peroxidase gene loci was constructed. In addition to the Laevigatum resistance locus the map includes nine RFLP markers, the two peroxidase gene loci and the six-row locus in barley....

  16. Isolation and identification of antibiotic resistance genes in Staphylococcus aureus isolates from respiratory system infections in shahrekord, Iran

    Directory of Open Access Journals (Sweden)

    Maryam Reisi

    2014-07-01

    Full Text Available   Introduction : Staphylococcus aureus is considered as one of pathogenic agents in humans, that engages different body parts including respiratory system and causes to spend lots of costs and extending patient’s treatment period. This study which is performed to separate and investigate the pattern of antibiotic resistance in Staphylococcus aureus isolates from upper respiratory system infections in Shahrekord.   Materials and methods: This study was done by sectional-descriptive method On 200 suspicious persons to the upper respiratory system infections who were referred to the Imam Ali clinic in Shahrekord in 2012. After isolation of Staphylococcus aureus from cultured nose discharges, antibiotic resistance genes were identified by polymerase chain reaction (PCR by using defined primer pairs .   Results : Among 200 investigated samples in 60 cases (30% Staphylococcus aureus infection (by culturing and PCR method was determined. Isolates showed the lowest amount of antibiotic resistance to vancomycin (0.5% and the highest amount of resistance to the penicillin G and cefotaxime (100%. mecA gene (encoding methicillin resistance with frequency of 85.18% and aacA-D gene (encoding resistance to aminoglycosides with frequency of 28.33% showed the highest and lowest frequency of antibiotic resistance genes coding in Staphylococcus aureus isolates respectively .   Discussion and conclusion : Notable prevalence of resistant Staphylococcus aureus isolates in community acquired respiratory infections, recommend continuous control necessity to impede the spreading of these bacteria and their infections.  

  17. Antimicrobial susceptibility and presence of resistance genes in staphylococci from poultry

    DEFF Research Database (Denmark)

    Aarestrup, Frank Møller; Agersø, Yvonne; Ahrens, Peter

    2000-01-01

    to ciprofloxacin. Only six (7%) S. aureus isolates and one Staphylococcus saprophyticus were penicillin resistant. Resistance to sulphamethoxazole was observed among 16 (19%) of S. aureus isolates and two coagulase negative staphylococci (CNS). Twenty (24%) of the S. aureus isolates were resistant to erythromycin...... study showed a frequent occurrence of resistance to fluoroquinolones, tetracycline and macrolides among staphylococci isolated from broilers in Denmark, whereas the occurrence of resistance to other antimicrobial agents remains low. Similar genes, encoding resistance to erythromycin, tetracycline...

  18. Staphylococci isolated from ready-to-eat meat - Identification, antibiotic resistance and toxin gene profile.

    Science.gov (United States)

    Fijałkowski, Karol; Peitler, Dorota; Karakulska, Jolanta

    2016-12-05

    The aim of this study was to analyse the staphylococci isolated from ready-to-eat meat products, including pork ham, chicken cold cuts, pork sausage, salami and pork luncheon meat, sliced in the store to the consumer's specifications, along with species identification and determination of antibiotic resistance. Genes encoding staphylococcal enterotoxins, staphylococcal enterotoxin-like proteins, exfoliative toxins, and toxic shock syndrome toxin 1 were also investigated. From the 41 samples, 75 different staphylococcal isolates were obtained. Based on PCR-RFLP analysis of the gap gene using AluI and HpyCH4V restriction enzymes, the isolates were identified as Staphylococcus equorum (28%), S. vitulinus (16%), S. carnosus (14%), S. succinus (11%), S. xylosus (11%), S. saprophyticus (9%), S. warneri (9%), S. haemolyticus (1%) and S. pasteuri (1%). The incidence and number of resistances to antimicrobials was found to be species but not source of isolation dependent. All S. xylosus, S. saprophyticus, S. haemolyticus and S. pasteuri isolates showed antibiotic resistance. A lower percentage of resistance was recorded for S. warneri (71%) and S. vitulinus (58%), followed by S. equorum (57%), S. carnosus (50%) and S. succinus (50%). The most frequent resistance was observed to fusidic acid (43%). The mecA gene was amplified in 4% of the staphylococci. However, phenotypic resistance to methicillin was not confirmed in any of these isolates. On the other hand, the mecA gene was not detected in any of 9% of the isolates resistant to cefoxitin. It was also found that among 75 isolates, 60 (80%) harbored from 1 to 10 out of 21 analyzed superantigenic toxin genes. The most prevalent genes were: sei (36% isolates) among enterotoxins, seln (32% isolates) among enterotoxin-like proteins and eta encoding exfoliative toxin A (37% isolates). The findings of this study further extend previous observations that, when present in food, not only S. aureus but also other species of

  19. Mutation spectrum of genes associated with steroid-resistant nephrotic syndrome in Chinese children.

    Science.gov (United States)

    Wang, Ying; Dang, Xiqiang; He, Qingnan; Zhen, Yan; He, Xiaoxie; Yi, Zhuwen; Zhu, Kuichun

    2017-08-20

    Approximately 20% of children with idiopathic nephrotic syndrome do not respond to steroid therapy. More than 30 genes have been identified as disease-causing genes for the steroid-resistant nephrotic syndrome (SRNS). Few reports were from the Chinese population. The coding regions of genes commonly associated with SRNS were analyzed to characterize the gene mutation spectrum in children with SRNS in central China. The first phase study involved 38 children with five genes (NPHS1, NPHS2, PLCE1, WT1, and TRPC6) by Sanger sequencing. The second phase study involved 33 children with 17 genes by next generation DNA sequencing (NGS. 22 new patients, and 11 patients from first phase study but without positive findings). Overall deleterious or putatively deleterious gene variants were identified in 19 patients (31.7%), including four NPHS1 variants among five patients and three PLCE1 variants among four other patients. Variants in COL4A3, COL4A4, or COL4A5 were found in six patients. Eight novel variants were identified, including two in NPHS1, two in PLCE1, one in NPHS2, LAMB2, COL4A3, and COL4A4, respectively. 55.6% of the children with variants failed to respond to immunosuppressive agent therapy, while the resistance rate in children without variants was 44.4%. Our results show that screening for deleterious variants in some common genes in children clinically suspected with SRNS might be helpful for disease diagnosis as well as prediction of treatment efficacy and prognosis. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Cyclic nucleotide gated channel gene family in tomato: genome-wide identification and functional analyses in disease resistance

    Directory of Open Access Journals (Sweden)

    Mumtaz Ali Saand

    2015-05-01

    Full Text Available The cyclic nucleotide gated channel (CNGC is suggested to be one of the important calcium conducting channels. Nevertheless, genome-wide identification and systemic functional analysis of CNGC gene family in crop plant species have not yet been conducted. In this study, we performed genome-wide identification of CNGC gene family in the economically important crop tomato (Solanum lycopersicum L. and analyzed function of the group IVb SlCNGC genes in disease resistance. Eighteen CNGC genes were identified in tomato genome, and four CNGC loci that were misannotated at database were corrected by cloning and sequencing. Detailed bioinformatics analyses on gene structure, domain composition and phylogenetic relationship of the SlCNGC gene family were conducted and the group-specific feature was revealed. Comprehensive expression analyses demonstrated that SlCNGC genes were highly and widely responsive to diverse stimuli and the expression profile was gene-dependent. Pharmacological assays showed that the putative CNGC activators cGMP and cAMP enhanced resistance against Sclerotinia sclerotiorum. Silencing of group IVb SlCNGC genes significantly enhanced resistance to fungal pathogens Pythium aphanidermatum and S. sclerotiorum, strongly reduced resistance to viral pathogen Tobacco rattle virus, while attenuated PAMP- and DAMP-triggered immunity as shown by obvious decrease of the flg22- and AtPep1-elicited hydrogen peroxide accumulation in SlCNGC-silenced plants. Additionally, silencing of these SlCNGC genes significantly altered expression of a set of Ca2+ signaling genes including SlCaMs, SlCDPKs and SlCAMTA3. Collectively, our results reveal that group IV SlCNGC genes regulate a wide range of resistance in tomato probably by affecting Ca2+ signaling.

  1. The Mycobacterial Transcriptional Regulator whiB7 Gene Links Redox Homeostasis and Intrinsic Antibiotic Resistance*

    Science.gov (United States)

    Burian, Ján; Ramón-García, Santiago; Sweet, Gaye; Gómez-Velasco, Anaximandro; Av-Gay, Yossef; Thompson, Charles J.

    2012-01-01

    Intrinsic drug resistance in Mycobacterium tuberculosis limits therapeutic options for treating tuberculosis. The mycobacterial transcriptional regulator whiB7 contributes to intrinsic resistance by activating its own expression and many drug resistance genes in response to antibiotics. To investigate whiB7 activation, we constructed a GFP reporter to monitor its expression, and we used it to investigate the whiB7 promoter and to screen our custom library of almost 600 bioactive compounds, including the majority of clinical antibiotics. Results showed whiB7 was transcribed from a promoter that was conserved across mycobacteria and other actinomycetes, including an AT-rich sequence that was likely targeted by WhiB7. Expression was induced by compounds having diverse structures and targets, independent of the ability of whiB7 to mediate resistance, and was dependent on media composition. Pretreatment with whiB7 activators resulted in clinically relevant increases in intrinsic drug resistance. Antibiotic-induced transcription was synergistically increased by the reductant dithiothreitol, an effect mirrored by a whiB7-dependent shift to a highly reduced cytoplasm reflected by the ratio of reduced/oxidized mycothiol. These data provided evidence that intrinsic resistance resulting from whiB7 activation is linked to fundamental changes in cell metabolism. PMID:22069311

  2. Early differential gene expression in haemocytes from resistant and susceptible Biomphalaria glabrata strains in response to Schistosoma mansoni.

    Directory of Open Access Journals (Sweden)

    Anne E Lockyer

    Full Text Available The outcome of infection in the host snail Biomphalaria glabrata with the digenean parasite Schistosoma mansoni is determined by the initial molecular interplay occurring between them. The mechanisms by which schistosomes evade snail immune recognition to ensure survival are not fully understood, but one possibility is that the snail internal defence system is manipulated by the schistosome enabling the parasite to establish infection. This study provides novel insights into the nature of schistosome resistance and susceptibility in B. glabrata at the transcriptomic level by simultaneously comparing gene expression in haemocytes from parasite-exposed and control groups of both schistosome-resistant and schistosome-susceptible strains, 2 h post exposure to S. mansoni miracidia, using an novel 5K cDNA microarray. Differences in gene expression, including those for immune/stress response, signal transduction and matrix/adhesion genes were identified between the two snail strains and tests for asymmetric distributions of gene function also identified immune-related gene expression in resistant snails, but not in susceptible. Gene set enrichment analysis revealed that genes involved in mitochondrial electron transport, ubiquinone biosynthesis and electron carrier activity were consistently up-regulated in resistant snails but down-regulated in susceptible. This supports the hypothesis that schistosome-resistant snails recognize schistosomes and mount an appropriate defence response, while in schistosome-susceptible snails the parasite suppresses this defence response, early in infection.

  3. Genome Wide Analysis of Nucleotide-Binding Site Disease Resistance Genes in Brachypodium distachyon

    Directory of Open Access Journals (Sweden)

    Shenglong Tan

    2012-01-01

    Full Text Available Nucleotide-binding site (NBS disease resistance genes play an important role in defending plants from a variety of pathogens and insect pests. Many R-genes have been identified in various plant species. However, little is known about the NBS-encoding genes in Brachypodium distachyon. In this study, using computational analysis of the B. distachyon genome, we identified 126 regular NBS-encoding genes and characterized them on the bases of structural diversity, conserved protein motifs, chromosomal locations, gene duplications, promoter region, and phylogenetic relationships. EST hits and full-length cDNA sequences (from Brachypodium database of 126 R-like candidates supported their existence. Based on the occurrence of conserved protein motifs such as coiled-coil (CC, NBS, leucine-rich repeat (LRR, these regular NBS-LRR genes were classified into four subgroups: CC-NBS-LRR, NBS-LRR, CC-NBS, and X-NBS. Further expression analysis of the regular NBS-encoding genes in Brachypodium database revealed that these genes are expressed in a wide range of libraries, including those constructed from various developmental stages, tissue types, and drought challenged or nonchallenged tissue.

  4. Modulation of Multidrug Resistance Gene Expression by Coumarin Derivatives in Human Leukemic Cells

    Science.gov (United States)

    Kubrak, Tomasz; Bogucki, Jacek; Galkowski, Dariusz; Kaczmarczyk, Robert; Feldo, Marcin; Cioch, Maria; Kocki, Janusz

    2017-01-01

    The presence of multidrug resistance (MDR) in tumor cells is considered as the major cause of failure of cancer chemotherapy. The mechanism responsible for the phenomenon of multidrug resistance is explained, among others, as overexpression of membrane transporters primarily from the ABC family which actively remove cytostatics from the tumor cell. The effect of 20 coumarin derivatives on the cytotoxicity and expression of MDR1, MRP1, BCRP, and LRP genes (encoding proteins responsible for multidrug resistance) in cancer cells was analyzed in the study. The aim of this research included determination of IC10 and IC50 values of selected coumarin derivatives in the presence and absence of mitoxantrone in leukemia cells and analysis of changes in the expression of genes involved in multidrug resistance: MDR1, MRP, LRP, and BCRP after 24-hour exposure of the investigated cell lines to selected coumarins in the presence and absence of mitoxantrone in IC10 and IC50 concentrations. The designed research was conducted on 5 cell lines derived from the human hematopoietic system: CCRF/CEM, CEM/C1, HL-60, HL-60/MX1, and HL-60/MX2. Cell lines CEM/C1, HL-60/MX1, and HL-60/MX2 exhibit a multidrug resistance phenotype. PMID:29387293

  5. Clusters of Antibiotic Resistance Genes Enriched Together Stay Together in Swine Agriculture.

    Science.gov (United States)

    Johnson, Timothy A; Stedtfeld, Robert D; Wang, Qiong; Cole, James R; Hashsham, Syed A; Looft, Torey; Zhu, Yong-Guan; Tiedje, James M

    2016-04-12

    Antibiotic resistance is a worldwide health risk, but the influence of animal agriculture on the genetic context and enrichment of individual antibiotic resistance alleles remains unclear. Using quantitative PCR followed by amplicon sequencing, we quantified and sequenced 44 genes related to antibiotic resistance, mobile genetic elements, and bacterial phylogeny in microbiomes from U.S. laboratory swine and from swine farms from three Chinese regions. We identified highly abundant resistance clusters: groups of resistance and mobile genetic element alleles that cooccur. For example, the abundance of genes conferring resistance to six classes of antibiotics together with class 1 integrase and the abundance of IS6100-type transposons in three Chinese regions are directly correlated. These resistance cluster genes likely colocalize in microbial genomes in the farms. Resistance cluster alleles were dramatically enriched (up to 1 to 10% as abundant as 16S rRNA) and indicate that multidrug-resistant bacteria are likely the norm rather than an exception in these communities. This enrichment largely occurred independently of phylogenetic composition; thus, resistance clusters are likely present in many bacterial taxa. Furthermore, resistance clusters contain resistance genes that confer resistance to antibiotics independently of their particular use on the farms. Selection for these clusters is likely due to the use of only a subset of the broad range of chemicals to which the clusters confer resistance. The scale of animal agriculture and its wastes, the enrichment and horizontal gene transfer potential of the clusters, and the vicinity of large human populations suggest that managing this resistance reservoir is important for minimizing human risk. Agricultural antibiotic use results in clusters of cooccurring resistance genes that together confer resistance to multiple antibiotics. The use of a single antibiotic could select for an entire suite of resistance genes if

  6. Analytical Performance of Multiplexed Screening Test for 10 Antibiotic Resistance Genes from Perianal Swab Samples.

    Science.gov (United States)

    Walker, G Terrance; Rockweiler, Tony J; Kersey, Rossio K; Frye, Kelly L; Mitchner, Susan R; Toal, Douglas R; Quan, Julia

    2016-02-01

    Multiantibiotic-resistant bacteria pose a threat to patients and place an economic burden on health care systems. Carbapenem-resistant bacilli and extended-spectrum β-lactamase (ESBL) producers drive the need to screen infected and colonized patients for patient management and infection control. We describe a multiplex microfluidic PCR test for perianal swab samples (Acuitas(®) MDRO Gene Test, OpGen) that detects the vancomycin-resistance gene vanA plus hundreds of gene subtypes from the carbapenemase and ESBL families Klebsiella pneumoniae carbapenemase (KPC), New Delhi metallo-β-lactamase (NDM), Verona integron-mediated metallo-β-lactamase (VIM), imipenemase metallo-β-lactamase (IMP), OXA-23, OXA-48, OXA-51, CTX-M-1, and CTX-M-2, regardless of the bacterial species harboring the antibiotic resistance. Analytical test sensitivity per perianal swab is 11-250 CFU of bacteria harboring the antibiotic resistance genes. Test throughput is 182 samples per test run (1820 antibiotic resistance gene family results). We demonstrate reproducible test performance and 100% gene specificity for 265 clinical bacterial organisms harboring a variety of antibiotic resistance genes. The Acuitas MDRO Gene Test is a sensitive, specific, and high-throughput test to screen colonized patients and diagnose infections for several antibiotic resistance genes directly from perianal swab samples, regardless of the bacterial species harboring the resistance genes. © 2015 American Association for Clinical Chemistry.

  7. Pyramiding of three bacterial blight resistance genes for broad-spectrum resistance in deepwater rice variety, Jalmagna.

    Science.gov (United States)

    Pradhan, Sharat Kumar; Nayak, Deepak Kumar; Mohanty, Soumya; Behera, Lambodar; Barik, Saumya Ranjan; Pandit, Elssa; Lenka, Srikanta; Anandan, Annamalai

    2015-12-01

    Jalmagna is a popular deepwater rice variety with farmers of India because of its good yield under waterlogged condition. However, the variety is highly susceptible to bacterial blight (BB) disease. The development of resistant cultivars has been the most effective and economical strategy to control the disease under deepwater situation. Three resistance genes (xa5 + xa13 + Xa21) were transferred from Swarna BB pyramid line, using a marker-assisted backcrossing (MAB) breeding strategy, into the BB-susceptible elite deepwater cultivar, Jalmagna. Molecular marker integrated backcross breeding program has been employed to transfer three major BB resistance genes (Xa21, xa13 and xa5) into Jalmagna variety. During backcross generations, markers closely linked to the three genes were used to select plants possessing these resistance genes and markers polymorphic between donor and recurrent parent were used to select plants that have maximum contribution from the recurrent parent genome. A selected BC3F1 plant was selfed to generate homozygous BC3F2 plants with different combinations of BB resistance genes. The three-gene pyramid and two gene pyramid lines exhibited high levels of resistance against the BB pathogen. Under conditions of BB infection, the three-gene pyramided lines exhibited a significant yield advantage over Jalmagna. The selected pyramided lines showed all agro-morphologic traits of Jalmagna without compromising the yield. The three major BB resistance genes pyramided lines exhibited high level of resistance and are expected to provide durable resistance under deep water situation where control through chemicals is less effective. High similarity in agro-morphologic traits and absence of antagonistic effects for yield and other characters were observed in the best pyramided lines.

  8. Detection of antibiotic resistance and tetracycline resistance genes in Enterobacteriaceae isolated from the Pearl rivers in South China

    Energy Technology Data Exchange (ETDEWEB)

    Tao Ran [State Key Laboratory of Organic Geochemistry, Guangzhou Institute of Geochemistry, Chinese Academy of Sciences, 511 Kehua Street, Tianhe District, Guangzhou 510640 (China); Ying Guangguo, E-mail: guangguo.ying@gmail.co [State Key Laboratory of Organic Geochemistry, Guangzhou Institute of Geochemistry, Chinese Academy of Sciences, 511 Kehua Street, Tianhe District, Guangzhou 510640 (China); Su Haochang [State Key Laboratory of Organic Geochemistry, Guangzhou Institute of Geochemistry, Chinese Academy of Sciences, 511 Kehua Street, Tianhe District, Guangzhou 510640 (China); Zhou Hongwei [Department of Environmental Health, School of Public Health and Tropical Medicine, Southern Medical University, 1838 North Guangzhou Street, Baiyun District, Guangzhou 510515 (China); Sidhu, Jatinder P.S. [CSIRO Land and Water, Queensland Bioscience Precinct, 306 Carmody Road, St Lucia QLD 4067 (Australia)

    2010-06-15

    This study investigated antibiotic resistance profiles and tetracycline resistance genes in Enterobacteriaceae family isolates from the Pearl rivers. The Enterobacteriaceae isolates were tested for susceptibility to seven antibiotics ampicillin, chloramphenicol, ciprofloxacin, levofloxacin, sulphamethoxazole/trimethoprim, tetracycline and trimethoprim. In Liuxi reservoir, with an exception to ampicillin resistant strains (11%) no other antibiotic resistance bacterial strains were detected. However, multiple drug resistance in bacterial isolates from the other sites of Pearl rivers was observed which is possibly due to sewage discharge and input from other anthropogenic sources along the rivers. Four tetracycline resistance genes tet A, tet B, tet C and tet D were detected in the isolates from the rivers. The genes tet A and tet B were widely detected with the detection frequencies of 43% and 40% respectively. Ciprofloxacin and levofloxacin resistant enteric bacteria were also isolated from the pig and duck manures which suggest a wider distribution of human specific drugs in the environment. This investigation provided a baseline data on antibiotic resistance profiles and tetracycline resistance genes in the Pearl rivers delta. - High rates of antibiotic resistance in Enterobacteriaceae from river water are attributed to wastewater contamination.

  9. Detection of antibiotic resistance and tetracycline resistance genes in Enterobacteriaceae isolated from the Pearl rivers in South China

    International Nuclear Information System (INIS)

    Tao Ran; Ying Guangguo; Su Haochang; Zhou Hongwei; Sidhu, Jatinder P.S.

    2010-01-01

    This study investigated antibiotic resistance profiles and tetracycline resistance genes in Enterobacteriaceae family isolates from the Pearl rivers. The Enterobacteriaceae isolates were tested for susceptibility to seven antibiotics ampicillin, chloramphenicol, ciprofloxacin, levofloxacin, sulphamethoxazole/trimethoprim, tetracycline and trimethoprim. In Liuxi reservoir, with an exception to ampicillin resistant strains (11%) no other antibiotic resistance bacterial strains were detected. However, multiple drug resistance in bacterial isolates from the other sites of Pearl rivers was observed which is possibly due to sewage discharge and input from other anthropogenic sources along the rivers. Four tetracycline resistance genes tet A, tet B, tet C and tet D were detected in the isolates from the rivers. The genes tet A and tet B were widely detected with the detection frequencies of 43% and 40% respectively. Ciprofloxacin and levofloxacin resistant enteric bacteria were also isolated from the pig and duck manures which suggest a wider distribution of human specific drugs in the environment. This investigation provided a baseline data on antibiotic resistance profiles and tetracycline resistance genes in the Pearl rivers delta. - High rates of antibiotic resistance in Enterobacteriaceae from river water are attributed to wastewater contamination.

  10. A Two-Dimensional Modeling Procedure to Estimate the Loss Equivalent Resistance Including the Saturation Effect

    Directory of Open Access Journals (Sweden)

    Rosa Ana Salas

    2013-11-01

    Full Text Available We propose a modeling procedure specifically designed for a ferrite inductor excited by a waveform in time domain. We estimate the loss resistance in the core (parameter of the electrical model of the inductor by means of a Finite Element Method in 2D which leads to significant computational advantages over the 3D model. The methodology is validated for an RM (rectangular modulus ferrite core working in the linear and the saturation regions. Excellent agreement is found between the experimental data and the computational results.

  11. Plasmid metagenomics reveals multiple antibiotic resistance gene classes among the gut microbiomes of hospitalised patients

    DEFF Research Database (Denmark)

    Jitwasinkul, Tossawan; Suriyaphol, Prapat; Tangphatsornruang, Sithichoke

    2016-01-01

    Antibiotic resistance genes are rapidly spread between pathogens and the normal flora, with plasmids playing an important role in their circulation. This study aimed to investigate antibiotic resistance plasmids in the gut microbiome of hospitalised patients. Stool samples were collected from seven...... sequences (using >80% alignment length as the cut-off), and ResFinder was used to classify the antibiotic resistance gene pools. Plasmid replicon modules were used for plasmid typing. Forty-six genes conferring resistance to several classes of antibiotics were identified in the stool samples. Several...... antibiotic resistance genes were shared by the patients; interestingly, most were reported previously in food animals and healthy humans. Four antibiotic resistance genes were found in the healthy subject. One gene (aph3-III) was identified in the patients and the healthy subject and was related...

  12. Current Status and Challenges in Identifying Disease Resistance Genes in Brassica napus

    Directory of Open Access Journals (Sweden)

    Ting Xiang Neik

    2017-11-01

    Full Text Available Brassica napus is an economically important crop across different continents including temperate and subtropical regions in Europe, Canada, South Asia, China and Australia. Its widespread cultivation also brings setbacks as it plays host to fungal, oomycete and chytrid pathogens that can lead to serious yield loss. For sustainable crop production, identification of resistance (R genes in B. napus has become of critical importance. In this review, we discuss four key pathogens affecting Brassica crops: Clubroot (Plasmodiophora brassicae, Blackleg (Leptosphaeria maculans and L. biglobosa, Sclerotinia Stem Rot (Sclerotinia sclerotiorum, and Downy Mildew (Hyaloperonospora parasitica. We first review current studies covering prevalence of these pathogens on Brassica crops and highlight the R genes and QTL that have been identified from Brassica species against these pathogens. Insights into the relationships between the pathogen and its Brassica host, the unique host resistance mechanisms and how these affect resistance outcomes is also presented. We discuss challenges in identification and deployment of R genes in B. napus in relation to highly specific genetic interactions between host subpopulations and pathogen pathotypes and emphasize the need for common or shared techniques and research materials or tighter collaboration between researchers to reconcile the inconsistencies in the research outcomes. Using current genomics tools, we provide examples of how characterization and cloning of R genes in B. napus can be carried out more effectively. Lastly, we put forward strategies to breed resistant cultivars through introgressions supported by genomic approaches and suggest prospects that can be implemented in the future for a better, pathogen-resistant B. napus.

  13. Current Status and Challenges in Identifying Disease Resistance Genes in Brassica napus

    Science.gov (United States)

    Neik, Ting Xiang; Barbetti, Martin J.; Batley, Jacqueline

    2017-01-01

    Brassica napus is an economically important crop across different continents including temperate and subtropical regions in Europe, Canada, South Asia, China and Australia. Its widespread cultivation also brings setbacks as it plays host to fungal, oomycete and chytrid pathogens that can lead to serious yield loss. For sustainable crop production, identification of resistance (R) genes in B. napus has become of critical importance. In this review, we discuss four key pathogens affecting Brassica crops: Clubroot (Plasmodiophora brassicae), Blackleg (Leptosphaeria maculans and L. biglobosa), Sclerotinia Stem Rot (Sclerotinia sclerotiorum), and Downy Mildew (Hyaloperonospora parasitica). We first review current studies covering prevalence of these pathogens on Brassica crops and highlight the R genes and QTL that have been identified from Brassica species against these pathogens. Insights into the relationships between the pathogen and its Brassica host, the unique host resistance mechanisms and how these affect resistance outcomes is also presented. We discuss challenges in identification and deployment of R genes in B. napus in relation to highly specific genetic interactions between host subpopulations and pathogen pathotypes and emphasize the need for common or shared techniques and research materials or tighter collaboration between researchers to reconcile the inconsistencies in the research outcomes. Using current genomics tools, we provide examples of how characterization and cloning of R genes in B. napus can be carried out more effectively. Lastly, we put forward strategies to breed resistant cultivars through introgressions supported by genomic approaches and suggest prospects that can be implemented in the future for a better, pathogen-resistant B. napus. PMID:29163558

  14. The Co-Selection of Fluoroquinolone Resistance Genes in the Gut Flora of Vietnamese Children

    NARCIS (Netherlands)

    Vien, Le Thi Minh; Minh, Ngo Ngoc Quang; Thuong, Tang Chi; Khuong, Huynh Duy; Nga, Tran Vu Thieu; Thompson, Corinne; Campbell, James I.; de Jong, Menno; Farrar, Jeremy J.; Schultsz, Constance; van Doorn, H. Rogier; Baker, Stephen

    2012-01-01

    Antimicrobial consumption is one of the major contributing factors facilitating the development and maintenance of bacteria exhibiting antimicrobial resistance. Plasmid-mediated quinolone resistance (PMQR) genes, such as the qnr family, can be horizontally transferred and contribute to reduced

  15. The Medicago truncatula lysine motif-receptor-like kinase gene family includes NFP and new nodule-expressed genes

    NARCIS (Netherlands)

    Arrighi, J.F.; Barre, A.; Amor, Ben B.; Bersoult, A.; Campos Soriano, L.; Mirabella, R.; Carvalho-Niebel, de F.; Journet, E.P.; Ghérardi, M.; Huguet, T.; Geurts, R.; Dénarié, J.; Rougé, P.; Gough, C.

    2006-01-01

    Rhizobial Nod factors are key symbiotic signals responsible for starting the nodulation process in host legume plants. Of the six Medicago truncatula genes controlling a Nod factor signaling pathway, Nod Factor Perception (NFP) was reported as a candidate Nod factor receptor gene. Here, we provide

  16. Bioaerosol emissions and detection of airborne antibiotic resistance genes from a wastewater treatment plant

    Science.gov (United States)

    Li, Jing; Zhou, Liantong; Zhang, Xiangyu; Xu, Caijia; Dong, Liming; Yao, Maosheng

    2016-01-01

    Air samples from twelve sampling sites (including seven intra-plant sites, one upwind site and four downwind sites) from a wastewater treatment plant (WWTP) in Beijing were collected using a Reuter Centrifugal Sampler High Flow (RCS); and their microbial fractions were studied using culturing and high throughput gene sequence. In addition, the viable (fluorescent) bioaerosol concentrations for 7 intra-plant sites were also monitored for 30 min each using an ultraviolet aerodynamic particle sizer (UV-APS). Both air and water samples collected from the plant were investigated for possible bacterial antibiotic resistance genes and integrons using polymerase chain reaction (PCR) coupled with gel electrophoresis. The results showed that the air near sludge thickening basin was detected to have the highest level of culturable bacterial aerosols (up to 1697 CFU/m3) and fungal aerosols (up to 930 CFU/m3). For most sampling sites, fluorescent peaks were observed at around 3-4 μm, except the office building with a peak at 1.5 μm, with a number concentration level up to 1233-6533 Particles/m3. About 300 unique bacterial species, including human opportunistic pathogens, such as Comamonas Testosteroni and Moraxella Osloensis, were detected from the air samples collected over the biological reaction basin. In addition, we have detected the sul2 gene resistant to cotrimoxazole (also known as septra, bactrim and TMP-SMX) and class 1 integrase gene from the air samples collected from the screen room and the biological reaction basin. Overall, the screen room, sludge thickening basin and biological reaction basin imposed significant microbial exposure risks, including those from airborne antibiotic resistance genes.

  17. Strategy of gene silencing in cassava for validation of resistance genes

    International Nuclear Information System (INIS)

    Cortes, Simon; Lopez, Camilo

    2010-01-01

    Cassava (Manihot esculenta) is a major source of food for more than 1000 million people in the world and constitutes an important staple crop. Cassava bacterial blight, caused by the gram negative bacterium Xanthomonas axonopodis pv. manihotis, is one of the most important constraints for this crop. A candidate resistance gene against cassava bacterial blight, named RXam1, has been identified previously. In this work, we employed the gene silencing approach using the African cassava mosaic virus (ACMV) to validate the function of the RXam1 gene. We used as positive control the su gen, which produce photo blanching in leaves when is silenced. Plants from the SG10735 variety were bombardment with the ACMV-A-SU+ACMV-B y ACMV-A-RXam1+ACMV-B constructions. The silencing efficiency employing the su gene was low, only one of seven plants showed photo blanching. In the putative silenced plants for the RXam1 gene, no presence of siRNAs corresponding to RXam1 was observed; although a low diminution of the RXam1 gene expression was obtained. The growth curves for the Xam strain CIO136 in cassava plants inoculated showing a little but no significance difference in the susceptibility in the silenced plants compared to not silenced

  18. [Investigation of plasmid-mediated quinolone resistance genes in quinolone-resistant Escherichia coli and Klebsiella spp. isolates from bloodstream infections].

    Science.gov (United States)

    Buruk, Celal Kurtuluş; Öztel Ocak, Hikmet; Bayramoğlu, Gülçin; Aydın, Faruk

    2016-04-01

    One of the treatment options of Escherichia coli and Klebsiella spp. infections which are the most common opportunistic pathogens of gram-negative sepsis is quinolones. Resistance to quinolones which act by disrupting DNA synthesis has been increasing. Horizontal transfer of plasmid-mediated quinolone resistance (PMQR) genes play an important role in the spread of resistance. The data about the prevalence of PMQR genes in our country is quite limited. The aim of this study was to investigate the presence of known PMQR genes namely qnrA, qnrB, qnrC, qnrS, qnrD, aac(6')-Ib-cr, qepA and oqxAB amongst quinolone-resistant E. coli and Klebsiella spp. strains isolated from blood cultures. One hundred twenty seven E.coli and 66 Klebsiella isolates detected as nalidixic acid- and/or ciprofloxacin-resistant by phenotypical methods, from 193 blood samples of 187 patients admitted to Karadeniz Technical University, Faculty of Medicine, Department of Medical Microbiology, Bacteriology Unit of Patient Service Laboratory between January 2012 to August 2013 were included in the study. The presence of PMQR genes were investigated by polymerase chain reaction (PCR) and for the detection of aac(6')-Ib-cr variants PCR-restriction fragment length polymorphism (PCR-RFLP) method was used. The positive bands were sequenced using the same primers, and aligned with formerly defined resistance gene sequences, and confirmed. In the study, 56.7% (72/127) of E.coli and 19.7% (13/66) of Klebsiella spp. isolates, with a total of 44% (85/193) of all the isolates were found to be phenotypically resistant to quinolones. Of the 13 resistant Klebsiella isolates, 11 were K.pneumoniae, and two were K.oxytoca. Extended-spectrum beta-lactamase (ESBL)-producing isolates showed higher resistance (50/80, 62.5%) to quinolones than the negative ones (35/113, 30.9%). The prevalence of quinolone resistance genes among resistant E. coli and Klebsiella spp. isolates was determined as qnrA, 1.4% and 15.4%; qnrB, 4

  19. Resistance of potential probiotic lactic acid bacteria and bifidobacteria of African and European origin to antimicrobials: Determination and transferability of the resistance genes to other bacteria

    DEFF Research Database (Denmark)

    Ouoba, Labia Irene Ivette; Lei, Vicki; Jensen, Lars Bogø

    2008-01-01

    Probiotic bacteria and starter cultures of Lactobacillus, Weissella and Bifidobacterium of African and European origins were studied and compared for their susceptibility to antimicrobials. The study included, for all isolates, determination of MICs (Minimal Inhibitory Concentration) for 24...... levels of intrinsic resistance were found among the tested species. Positive amplicons were obtained for resistance genes encoding aminoglycoside (aph(3')-III, aadA, aadE) and tetracycline (tet(S)) from isolates from Europe and macrolide (erm(B)) from an isolate from Africa. However, only the erm(B) gene...

  20. Antimicrobial Resistance and Resistance Genes in Aerobic Bacteria Isolated from Pork at Slaughter

    DEFF Research Database (Denmark)

    Li, Lili; Olsen, Rikke Heidemann; Ye, Lei

    2016-01-01

    The aim of this study was to investigate the phenotypic and genotypic antimicrobial resistance, integrons, and transferability of resistance markers in 243 aerobic bacteria recovered from pork at slaughter in the People's Republic of China. The organisms belonged to 22 genera of gram......-negative bacteria (92.2%) and gram-positive bacteria (7.8%). High levels of resistance were detected to tetracycline, trimethoprim-sulfamethoxazole, and ampicillin (36.2 to 54.3%), and lower levels were detected to nitrofurantoin, cefotaxime, gentamicin, ciprofloxacin, and chloramphenicol (7.8 to 29.2%). Across...... species, genes conferring antimicrobial resistance were observed with the following frequencies: bla TEM, 40.7%; bla CMY-2, 15.2%; bla CTX-M, 11.5%; sul2, 27.2%; sul1, 14.4%; tet(A), 5.4%;tet(L), 5.4%; tet(M), 5.0%; tet(E), 3.7%; tet(C), 3.3%; tet(S), 2.5%; and tet(K), 0.8%. Various antimicrobial...

  1. Resistance (R) Genes: Applications and Prospects for Plant Biotechnology and Breeding.

    Science.gov (United States)

    Pandolfi, Valesca; Neto, Jose Ribamar Costa Ferreira; da Silva, Manasses Daniel; Amorim, Lidiane Lindinalva Barbosa; Wanderley-Nogueira, Ana Carolina; de Oliveira Silva, Roberta Lane; Kido, Ederson Akio; Crovella, Sergio; Iseppon, Ana Maria Benko

    2017-01-01

    The discovery of novel plant resistance (R) genes (including their homologs and analogs) opened interesting possibilities for controlling plant diseases caused by several pathogens. However, due to environmental pressure and high selection operated by pathogens, several crop plants have lost specificity, broad-spectrum or durability of resistance. On the other hand, the advances in plant genome sequencing and biotechnological approaches, combined with the increasing knowledge on Rgenes have provided new insights on their applications for plant genetic breeding, allowing the identification and implementation of novel and efficient strategies that enhance or optimize their use for efficiently controlling plant diseases. The present review focuses on main perspectives of application of R-genes and its co-players for the acquisition of resistance to pathogens in cultivated plants, with emphasis on biotechnological inferences, including transgenesis, cisgenesis, directed mutagenesis and gene editing, with examples of success and challenges to be faced. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  2. Candidate genes for cross-resistance against DNA-damaging drugs

    DEFF Research Database (Denmark)

    Wittig, Rainer; Nessling, Michelle; Will, Rainer D

    2002-01-01

    Drug resistance of tumor cells leads to major drawbacks in the treatment of cancer. To identify candidate genes for drug resistance, we compared the expression patterns of the drug-sensitive human malignant melanoma cell line MeWo and three derived sublines with acquired resistance to the DNA...... as several apoptosis-related genes, in particular STK17A and CRYAB. As MPP1 and CRYAB are also among the 14 genes differentially expressed in all three of the drug-resistant sublines, they represent the strongest candidates for resistance against DNA-damaging drugs....

  3. Bacterial plasmid-mediated quinolone resistance genes in aquatic environments in China.

    Science.gov (United States)

    Yan, Lei; Liu, Dan; Wang, Xin-Hua; Wang, Yunkun; Zhang, Bo; Wang, Mingyu; Xu, Hai

    2017-01-17

    Emerging antimicrobial resistance is a major threat to human's health in the 21 st century. Understanding and combating this issue requires a full and unbiased assessment of the current status on the prevalence of antimicrobial resistance genes and their correlation with each other and bacterial groups. In aquatic environments that are known reservoirs for antimicrobial resistance genes, we were able to reach this goal on plasmid-mediated quinolone resistance (PMQR) genes that lead to resistance to quinolones and possibly also to the co-emergence of resistance to β-lactams. Novel findings were made that qepA and aac-(6')-Ib genes that were previously regarded as similarly abundant with qnr genes are now dominant among PMQR genes in aquatic environments. Further statistical analysis suggested that the correlation between PMQR and β-lactam resistance genes in the environment is still weak, that the correlations between antimicrobial resistance genes could be weakened by sufficient wastewater treatment, and that the prevalence of PMQR has been implicated in environmental, pathogenic, predatory, anaerobic, and more importantly, human symbiotic bacteria. This work provides a comprehensive analysis of PMQR genes in aquatic environments in Jinan, China, and provides information with which combat with the antimicrobial resistance problem may be fought.

  4. Antimicrobial-Resistant Bacterial Populations and Antimicrobial Resistance Genes Obtained from Environments Impacted by Livestock and Municipal Waste.

    Science.gov (United States)

    Agga, Getahun E; Arthur, Terrance M; Durso, Lisa M; Harhay, Dayna M; Schmidt, John W

    2015-01-01

    This study compared the populations of antimicrobial-resistant bacteria and the repertoire of antimicrobial resistance genes in four environments: effluent of three municipal wastewater treatment facilities, three cattle feedlot runoff catchment ponds, three swine waste lagoons, and two "low impact" environments (an urban lake and a relict prairie). Multiple liquid and solid samples were collected from each environment. The prevalences and concentrations of antimicrobial-resistant (AMR) Gram-negative (Escherichia coli and Salmonella enterica) and Gram-positive (enterococci) bacteria were determined from individual samples (n = 174). The prevalences of 84 antimicrobial resistance genes in metagenomic DNA isolated from samples pooled (n = 44) by collection date, location, and sample type were determined. The prevalences and concentrations of AMR E. coli and Salmonella were similar among the livestock and municipal sample sources. The levels of erythromycin-resistant enterococci were significantly higher in liquid samples from cattle catchment ponds and swine waste lagoons than in liquid samples from municipal wastewater treatment facilities, but solid samples from these environments did not differ significantly. Similarly, trimethoprim/sulfamethoxazole-resistant E. coli concentrations were significantly higher in swine liquid than in municipal liquid samples, but there was no difference in solid samples. Multivariate analysis of the distribution of antimicrobial resistance genes using principal coordinate analysis showed distinct clustering of samples with livestock (cattle and swine), low impact environment and municipal samples forming three separate clusters. The numbers of class A beta-lactamase, class C beta-lactamase, and fluoroquinolone resistance genes detected were significantly higher (P resistant bacteria and antimicrobial resistance genes exist in cattle, human, and swine waste streams, but a higher diversity of antimicrobial resistance genes are present

  5. Mutations in the rpsL gene are involved in streptomycin resistance in Campylobacter coli.

    Science.gov (United States)

    Olkkola, Satu; Juntunen, Pekka; Heiska, Helmi; Hyytiäinen, Heidi; Hänninen, Marja-Liisa

    2010-06-01

    To characterize the mechanisms of streptomycin (STR) resistance in Campylobacter coli, we chose 17 isolates that were resistant to STR, erythromycin (ERY), or both, and the putative STR resistance target genes rpsL, rrs, and gidB were analyzed for mutations. The presence of the aadE gene encoding aminoglycoside 6-adenylyltransferase was also evaluated. To reveal putative connection between ERY and STR resistance mechanisms, 13 C. coli isolates initially susceptible to STR and ERY were exposed to STR, and resistant variants were characterized. We also assessed the development of ERY resistance with a similar method. Finally, the effect of the putative CmeABC efflux pump inhibitor phenyl-arginine-beta-naphthylamine on STR resistance was tested. Our studies showed an association between mutations in the rpsL gene and STR resistance in C. coli. Further, mutations obtained in vitro were more diverse than those occurring in vivo. However, we observed no resistance associated mutations in the other genes studied, and selection with STR did not result in variants resistant to ERY and vice versa. None of the isolates harbored the aadE gene, and no differences in STR minimum inhibitory concentration levels were detected in the presence or absence of phenyl-arginine-beta-naphthylamine. In conclusion, we found that STR resistance was associated with mutations in the rpsL gene, but no obvious association between STR and ERY resistance mechanisms was found in C. coli.

  6. Resistance Genes and Genetic Elements Associated with Antibiotic Resistance in Clinical and Commensal Isolates of Streptococcus salivarius.

    Science.gov (United States)

    Chaffanel, Fanny; Charron-Bourgoin, Florence; Libante, Virginie; Leblond-Bourget, Nathalie; Payot, Sophie

    2015-06-15

    The diversity of clinical (n = 92) and oral and digestive commensal (n = 120) isolates of Streptococcus salivarius was analyzed by multilocus sequence typing (MLST). No clustering of clinical or commensal strains can be observed in the phylogenetic tree. Selected strains (92 clinical and 46 commensal strains) were then examined for their susceptibilities to tetracyclines, macrolides, lincosamides, aminoglycosides, and phenicol antibiotics. The presence of resistance genes tet(M), tet(O), erm(A), erm(B), mef(A/E), and catQ and associated genetic elements was investigated by PCR, as was the genetic linkage of resistance genes. High rates of erythromycin and tetracycline resistance were observed among the strains. Clinical strains displayed either the erm(B) (macrolide-lincosamide-streptogramin B [MLSB] phenotype) or mef(A/E) (M phenotype) resistance determinant, whereas almost all the commensal strains harbored the mef(A/E) resistance gene, carried by a macrolide efflux genetic assembly (MEGA) element. A genetic linkage between a macrolide resistance gene and genes of Tn916 was detected in 23 clinical strains and 5 commensal strains, with a predominance of Tn3872 elements (n = 13), followed by Tn6002 (n = 11) and Tn2009 (n = 4) elements. Four strains harboring a mef(A/E) gene were also resistant to chloramphenicol and carried a catQ gene. Sequencing of the genome of one of these strains revealed that these genes colocalized on an IQ-like element, as already described for other viridans group streptococci. ICESt3-related elements were also detected in half of the isolates. This work highlights the potential role of S. salivarius in the spread of antibiotic resistance genes both in the oral sphere and in the gut. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  7. [Advances in molecular mechanisms of bacterial resistance caused by stress-induced transfer of resistance genes--a review].

    Science.gov (United States)

    Sun, Dongchang; Wang, Bing; Zhu, Lihong

    2013-07-04

    The transfer of resistance gene is one of the most important causes of bacterial resistance. Recent studies reveal that stresses induce the transfer of antibiotic resistance gene through multiple mechanisms. DNA damage stresses trigger bacterial SOS response and induce the transfer of resistance gene mediated by conjugative DNA. Antibiotic stresses induce natural bacterial competence for transformation in some bacteria which lack the SOS system. In addition, our latest studies show that the general stress response regulator RpoS regulates a novel type of resistance gene transfer which is mediated by double-stranded plasmid DNA and occurs exclusively on the solid surface. In this review, we summarized recent advances in SOS dependent and independent stress-induced DNA transfer which is mediated by conjugation and transformation respectively, and the transfer of double-stranded plasmid DNA on the solid surface which is regulated by RpoS. We propose that future work should address how stresses activate the key regulators and how these regulators control the expression of gene transfer related genes. Answers to the above questions would pave the way for searching for candidate targets for controlling bacterial resistance resulted from the transfer of antibiotic genes.

  8. Apoptosis-related genes confer resistance to Fusarium wilt in transgenic 'Lady Finger' bananas.

    Science.gov (United States)

    Paul, Jean-Yves; Becker, Douglas K; Dickman, Martin B; Harding, Robert M; Khanna, Harjeet K; Dale, James L

    2011-12-01

    Fusarium wilt, caused by Fusarium oxysporum f. sp. cubense (Foc), is one of the most devastating diseases of banana (Musa spp.). Apart from resistant cultivars, there are no effective control measures for the disease. We investigated whether the transgenic expression of apoptosis-inhibition-related genes in banana could be used to confer disease resistance. Embryogenic cell suspensions of the banana cultivar, 'Lady Finger', were stably transformed with animal genes that negatively regulate apoptosis, namely Bcl-xL, Ced-9 and Bcl-2 3' UTR, and independently transformed plant lines were regenerated for testing. Following a 12-week exposure to Foc race 1 in small-plant glasshouse bioassays, seven transgenic lines (2 × Bcl-xL, 3 × Ced-9 and 2 × Bcl-2 3' UTR) showed significantly less internal and external disease symptoms than the wild-type susceptible 'Lady Finger' banana plants used as positive controls. Of these, one Bcl-2 3' UTR line showed resistance that was equivalent to that of wild-type Cavendish bananas that were included as resistant negative controls. Further, the resistance of this line continued for 23-week postinoculation at which time the experiment was terminated. Using TUNEL assays, Foc race 1 was shown to induce apoptosis-like features in the roots of wild-type 'Lady Finger' plants consistent with a necrotrophic phase in the life cycle of this pathogen. This was further supported by the observed reduction in these effects in the roots of the resistant Bcl-2 3' UTR-transgenic line. This is the first report on the generation of transgenic banana plants with resistance to Fusarium wilt. © 2011 The Authors. Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.

  9. Coral thermal tolerance: tuning gene expression to resist thermal stress.

    Directory of Open Access Journals (Sweden)

    Anthony J Bellantuono

    Full Text Available The acclimatization capacity of corals is a critical consideration in the persistence of coral reefs under stresses imposed by global climate change. The stress history of corals plays a role in subsequent response to heat stress, but the transcriptomic changes associated with these plastic changes have not been previously explored. In order to identify host transcriptomic changes associated with acquired thermal tolerance in the scleractinian coral Acropora millepora, corals preconditioned to a sub-lethal temperature of 3°C below bleaching threshold temperature were compared to both non-preconditioned corals and untreated controls using a cDNA microarray platform. After eight days of hyperthermal challenge, conditions under which non-preconditioned corals bleached and preconditioned corals (thermal-tolerant maintained Symbiodinium density, a clear differentiation in the transcriptional profiles was revealed among the condition examined. Among these changes, nine differentially expressed genes separated preconditioned corals from non-preconditioned corals, with 42 genes differentially expressed between control and preconditioned treatments, and 70 genes between non-preconditioned corals and controls. Differentially expressed genes included components of an apoptotic signaling cascade, which suggest the inhibition of apoptosis in preconditioned corals. Additionally, lectins and genes involved in response to oxidative stress were also detected. One dominant pattern was the apparent tuning of gene expression observed between preconditioned and non-preconditioned treatments; that is, differences in expression magnitude were more apparent than differences in the identity of genes differentially expressed. Our work revealed a transcriptomic signature underlying the tolerance associated with coral thermal history, and suggests that understanding the molecular mechanisms behind physiological acclimatization would be critical for the modeling of reefs

  10. Molecular characterization of β-lactamase genes in clinical isolates of carbapenem-resistant Acinetobacter baumannii.

    Science.gov (United States)

    Raible, Kevin M; Sen, Bhaswati; Law, Nancy; Bias, Tiffany E; Emery, Christopher L; Ehrlich, Garth D; Joshi, Suresh G

    2017-11-16

    Acinetobacter baumannii is a nosocomial pathogen which is establishing as a major cause of morbidity and mortality within the healthcare community. The success of this pathogen is largely due to its ability to rapidly gain resistance to antimicrobial therapies and its capability to persist in an abiotic environment through the production of a biofilm. Our tertiary-care hospital has showed high incidence of carbapenem-resistant Acinetobacter baumannii (CRAB) isolates. In this study we explore both genotypic and phenotypic properties of 26 CRAB isolates: 16 isolates were collected from January 2010 to March 2011, and 10 were collected between February and May 2015. We determined that all 26 CRAB isolates possessed multiple β-lactamase genes, including genes from Groups A, C, and D. Specifically, 42% of the isolates possesses the potentially plasmid-borne genes of OXA-23-like or OXA-40-like β-lactamase. The presence of mobile gene element integron cassettes and/or integrases in 88% of the isolates suggests a possible mechanism of dissemination of antibiotic resistance genes. Additionally, the location of insertion sequence (IS) ISAba1 in promotor region of of the OXA-51-like, ADC-7, and ampC genes was confirmed. Multilocus sequence typing (MLST) demonstrated that all 26 CRAB isolates were either sequence type (ST)-229 or ST-2. Interestingly, ST-2 went from being the minority CRAB strain in the 2010-2011 isolates to the predominant strain in the 2015 isolates (from 32 to 90%). We show that the ST-2 strains have an enhanced ability to produce biofilms in comparison to the ST-229 strains, and this fact has potentially led to more successful colonization of the clinical environment over time. This study provides a longitudinal genetic and phenotypic survey of two CRAB sequence types, and suggests how their differing phenotypes may interact with the selective pressures of a hospital setting effecting strain dominance over a 5-year period.

  11. Spatial patterns of Antimicrobial Resistance Genes in Danish Pig Farms

    DEFF Research Database (Denmark)

    Birkegård, Anna Camilla; Ersbøll, A. K.; Hisham Beshara Halasa, Tariq

    2016-01-01

    antimicrobial resistance genes, ermB, ermF, sulI, sulII, tet(M), tet(O) and tet(W), was quantified by a high-throughput qPCR. It was evaluated whether the sample method resulted in a study population representative of Danish pig farms with finishers where it was found that the study population was biased......Samples from 687 Danish pig farms were collected at five finisher slaughterhouses in February and March 2015. Faecal samples from five pigs per farm were collected randomly at the slaughter line and pooled into one sample per farm. DNA was extracted from the pooled samples and the level of seven...

  12. Antimicrobial resistance genes in marine bacteria and human uropathogenic Escherichia coli from a region of intensive aquaculture.

    Science.gov (United States)

    Tomova, Alexandra; Ivanova, Larisa; Buschmann, Alejandro H; Rioseco, Maria Luisa; Kalsi, Rajinder K; Godfrey, Henry P; Cabello, Felipe C

    2015-10-01

    Antimicrobials are heavily used in Chilean salmon aquaculture. We previously found significant differences in antimicrobial-resistant bacteria between sediments from an aquaculture and a non-aquaculture site. We now show that levels of antimicrobial resistance genes (ARG) are significantly higher in antimicrobial-selected marine bacteria than in unselected bacteria from these sites. While ARG in tetracycline- and florfenicol-selected bacteria from aquaculture and non-aquaculture sites were equally frequent, there were significantly more plasmid-mediated quinolone resistance genes per bacterium and significantly higher numbers of qnrB genes in quinolone-selected bacteria from the aquaculture site. Quinolone-resistant urinary Escherichia coli from patients in the Chilean aquacultural region were significantly enriched for qnrB (including a novel qnrB gene), qnrS, qnrA and aac(6')-1b, compared with isolates from New York City. Sequences of qnrA1, qnrB1 and qnrS1 in quinolone-resistant Chilean E. coli and Chilean marine bacteria were identical, suggesting horizontal gene transfer between antimicrobial-resistant marine bacteria and human pathogens. © 2015 Society for Applied Microbiology and John Wiley & Sons Ltd.

  13. [Effects of p53 gene on drug resistance in human lung cancer cell lines.].

    Science.gov (United States)

    Tao, Hong; Zhu, Yunzhong; Wang, Hui; Lai, Baitang; Zhang, Chunyan; Zhan, Xiuping; Wang, Yue; Yang, Xuehui; Yue, Wentao; Zhang, Hongtao

    2008-04-20

    Drug resistance of lung cancer cells is one of main factors which affect the outcome of chemotherapy. It has been reported that abnormal p53 gene is well assosiated with chemotherapy resistance of tumor cells. The aim of this study is to evaluate the effects of p53 gene on drug resistance in human lung cancer cell lines, so as to provide foundation of choosing individual chemotherapy drugs in clinical treatment. The expression vectors which contain p53cDNA and p53 antisense cDNA respectively were constructed and were confirmed by sequencing. Transfected the 801D, a human lung cancer cell line with recombined plasmids by lipofectin mediating. Several kinds of monoclone cell lines, pEGFP-801D,pEGFP-sense p53-801D(including sense p53,pEGFP-p53(RS)-801D),pEGFP-antisense p53-801D(including antisense p53,pEGFP-p53(AS)-801D),which contained p53 of different status were obtained. Green fluorescence was observed through fluorescence microscopy. The extraneous gene was detected by PCR. MTT assay was taken to determine the drug resistance of each cell line to chemotherapy agents. Cell cycle and apoptosis induced by antitumor drugs were examined by flow cytometer. Extraneous sense p53 and antisense p53 were proved to be linked to plasmid respectively by sequencing.Green fluorescence was found in transfected cell lines. The IC50 of pEGFP-p53(AS)-801D cell line(0.26+/-0.09 mug/mL) to Cisplatin(DDP) decreased markedly compared with 801D(0.55+/-0.19 mug/mL,Phigher than that of pEGFP-p53(AS)-801D(P TAX) than 801D(8.40+/-1.50 ng/mL, P TAX induced G2 phase arrest in pEGFP-p53(RS)-801D. A increased S phase proportion was induced by 5FU in pEGFP-p53(RS)-801D. The cell lines experienced apoptosis and necrosis when they were treated with either DDP or TAX. p53 gene of different status have different effects on resistance of chemotherapy agents in lung cancer cell lines. p53 mutation and deletion are related to drug resistance of DDP. p53 deletion connects with chemoresistance of TAX and

  14. Fluoroquinolone induction of phage-mediated gene transfer in multidrug-resistant Salmonella.

    Science.gov (United States)

    Bearson, Bradley L; Brunelle, Brian W

    2015-08-01

    Fluoroquinolones are broad-spectrum antibiotics that inhibit bacterial DNA gyrase and topoisomerase activity, which can cause DNA damage and result in bacterial cell death. In response to DNA damage, bacteria induce an SOS response to stimulate DNA repair. However, the SOS response may also induce prophage with production of infectious virions. Salmonella strains typically contain multiple prophages, and certain strains including phage types DT120 and DT104 contain prophage that upon induction are capable of generalised transduction. In this study, strains of multidrug-resistant (MDR) Salmonella enterica serovar Typhimurium DT120 and DT104 were exposed to fluoroquinolones important for use in human and veterinary disease therapy to determine whether prophage(s) are induced that could facilitate phage-mediated gene transfer. Cultures of MDR S. Typhimurium DT120 and DT104 containing a kanamycin resistance plasmid were lysed after exposure to fluoroquinolones (ciprofloxacin, enrofloxacin and danofloxacin). Bacterial cell lysates were able to transfer the plasmid to a recipient kanamycin-susceptible Salmonella strain by generalised transduction. In addition, exposure of DT120 to ciprofloxacin induced the recA gene of the bacterial SOS response and genes encoded in a P22-like generalised transducing prophage. This research indicates that fluoroquinolone exposure of MDR Salmonella can facilitate horizontal gene transfer, suggesting that fluoroquinolone usage in human and veterinary medicine may have unintended consequences, including the induction of phage-mediated gene transfer from MDR Salmonella. Stimulation of gene transfer following bacterial exposure to fluoroquinolones should be considered an adverse effect, and clinical decisions regarding antibiotic selection for infectious disease therapy should include this potential risk. Published by Elsevier B.V.

  15. Distribution of genes encoding resistance to streptogramin A and related compounds among staphylococci resistant to these antibiotics.

    Science.gov (United States)

    Allignet, J; Aubert, S; Morvan, A; el Solh, N

    1996-01-01

    The levels of resistance to pristinamycin (Pt) and to its major constituents, pristinamycin IIA and IB (PIIA and PIB, respectively; classified as streptogramins A and B, respectively) were determined for 126 staphylococcal isolates. The results suggest tentative susceptibility breakpoints of or = 4 micrograms of PIIA per ml were investigated for the presence of staphylococcal genes encoding resistance to PIIA (vga, vat, and vatB) and PIB (vgb). None of these genes was found in the 4 isolates inhibited by 4 micrograms of PIIA per ml or in 4 of the other 52 isolates tested. The remaining 48 isolates harbored plasmids carrying vatB and vga or combinations of genes (vga-vat-vgb or vga-vat). The absence of any known PIIA resistance gene from the four Staphylococcus aureus isolates inhibited by > or = 8 micrograms of PIIA per ml suggests that there is at least one PIIA resistance mechanism in staphylococci that has not yet been characterized. PMID:8913457

  16. New eight genes identified at the clinical multidrug-resistant Acinetobacter baumannii DMS06669 strain in a Vietnam hospital

    Directory of Open Access Journals (Sweden)

    Nguyen Si-Tuan

    2017-11-01

    Full Text Available Abstract Background Acinetobacter baumannii is an important nosocomial pathogen that can develop multidrug resistance. In this study, we characterized the genome of the A. baumannii strain DMS06669 (isolated from the sputum of a male patient with hospital-acquired pneumonia and focused on identification of genes relevant to antibiotic resistance. Methods Whole genome analysis of A. baumannii DMS06669 from hospital-acquired pneumonia patients included de novo assembly; gene prediction; functional annotation to public databases; phylogenetics tree construction and antibiotics genes identification. Results After sequencing the A. baumannii DMS06669 genome and performing quality control, de novo genome assembly was carried out, producing 24 scaffolds. Public databases were used for gene prediction and functional annotation to construct a phylogenetic tree of the DMS06669 strain with 21 other A. baumannii strains. A total of 18 possible antibiotic resistance genes, conferring resistance to eight distinct classes of antibiotics, were identified. Eight of these genes have not previously been reported to occur in A. baumannii. Conclusions Our results provide important information regarding mechanisms that may contribute to antibiotic resistance in the DMS06669 strain, and have implications for treatment of patients infected with A. baumannii.

  17. Latent introduction to the Netherlands of multiple antibiotic resistance including NDM-1 after hospitalisation in Egypt, August 2013

    NARCIS (Netherlands)

    Bathoorn, E.; Friedrich, A W; Zhou, K; Arends, J P; Borst, D M; Grundmann, H; Rossen, J W

    2013-01-01

    We describe the introduction of various multi-drug resistant bacterial strains, including an NDM-1-producing Klebsiella pneumoniae, through a traveller returning from Egypt, where they had been admitted to a private hospital. All family members of the patient were colonised with one or more

  18. SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

    Directory of Open Access Journals (Sweden)

    Mehmet AYBEKE

    2015-12-01

    Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

  19. Integrative Analysis of Gene Expression Data Including an Assessment of Pathway Enrichment for Predicting Prostate Cancer

    Directory of Open Access Journals (Sweden)

    Pingzhao Hu

    2006-01-01

    Full Text Available Background: Microarray technology has been previously used to identify genes that are differentially expressed between tumour and normal samples in a single study, as well as in syntheses involving multiple studies. When integrating results from several Affymetrix microarray datasets, previous studies summarized probeset-level data, which may potentially lead to a loss of information available at the probe-level. In this paper, we present an approach for integrating results across studies while taking probe-level data into account. Additionally, we follow a new direction in the analysis of microarray expression data, namely to focus on the variation of expression phenotypes in predefined gene sets, such as pathways. This targeted approach can be helpful for revealing information that is not easily visible from the changes in the individual genes. Results: We used a recently developed method to integrate Affymetrix expression data across studies. The idea is based on a probe-level based test statistic developed for testing for differentially expressed genes in individual studies. We incorporated this test statistic into a classic random-effects model for integrating data across studies. Subsequently, we used a gene set enrichment test to evaluate the significance of enriched biological pathways in the differentially expressed genes identified from the integrative analysis. We compared statistical and biological significance of the prognostic gene expression signatures and pathways identified in the probe-level model (PLM with those in the probeset-level model (PSLM. Our integrative analysis of Affymetrix microarray data from 110 prostate cancer samples obtained from three studies reveals thousands of genes significantly correlated with tumour cell differentiation. The bioinformatics analysis, mapping these genes to the publicly available KEGG database, reveals evidence that tumour cell differentiation is significantly associated with many

  20. Antibiotic resistant enterococci—Tales of a drug resistance gene trafficker

    DEFF Research Database (Denmark)

    Werner, Guido; Coque, Teresa M.; Franz, Charles M.A.P.

    2013-01-01

    -level) and glycopeptides are therapeutically important and reported in increasing numbers. On the other hand, isolates of E. faecalis and E. faecium are commensals of the intestines of humans, many vertebrate and invertebrate animals and may also constitute an active part of the plant flora. Certain enterococcal isolates...... and they serve as important key indicator bacteria for various veterinary and human resistance surveillance systems. Enterococci are widely prevalent and genetically capable of acquiring, conserving and disseminating genetic traits including resistance determinants among enterococci and related Gram...... be classified and discuss mechanisms of plasmid transfer and regulation and the role and cross-talk of enterococcal isolates from food and food animals to humans....

  1. Class 1 and 2 integrons, sul resistance genes and antibiotic resistance in Escherichia coli isolated from Dongjiang River, South China

    International Nuclear Information System (INIS)

    Su Haochang; Ying Guangguo; Tao Ran; Zhang Ruiquan; Zhao Jianliang; Liu Yousheng

    2012-01-01

    Antibiotic susceptibility, detection of sul gene types and presence of class 1, 2 and 3 integrons and gene cassettes using PCR assays were investigated in 3456 Escherichia coli isolates obtained from 38 sampling sites of the Dongjiang River catchment in the dry and wet seasons. 89.1% of the isolates were resistant and 87.5% showed resistance to at least three antibiotics. sul2 was detected most frequently in 89.2% of 1403 SXT-resistant isolates. The presence of integrons (class 1 and 2) was frequently observed (82.3%) while no class 3 integron was found. In these integrons, 21 resistance genes of 14 gene cassette arrays and 10 different families of resistance genes were identified. Three gene cassette arrays, aac(6')-Ib-cr-aar-3-dfrA27-aadA16, aacA4-catB3-dfrA1 and aadA2-lnuF, were detected for the first time in surface water. The results showed that bacterial resistance in the catchment was seriously influenced by human activities, especially discharge of wastewater. Highlights: ► Antibiotic resistance was investigated for a river catchment of southern China. ► 87.5% of E coli isolates showed resistance to at least three antibiotics. ► The presence of integrons (class 1 and 2) was frequently observed (82.3%). ► Bacterial resistance in the catchment was seriously influenced by human activities. - Bacterial resistance to antibiotics in a catchment is related to the discharge of wastewater into the aquatic environment.

  2. Detection of Antibiotic Resistance Genes in Source and Drinking Water Samples from a First Nations Community in Canada

    Science.gov (United States)

    Fernando, Dinesh M.; Tun, Hein Min; Poole, Jenna; Patidar, Rakesh; Li, Ru; Mi, Ruidong; Amarawansha, Geethani E. A.; Fernando, W. G. Dilantha; Khafipour, Ehsan; Farenhorst, Annemieke

    2016-01-01

    ABSTRACT Access to safe drinking water is now recognized as a human right by the United Nations. In developed countries like Canada, access to clean water is generally not a matter of concern. However, one in every five First Nations reserves is under a drinking water advisory, often due to unacceptable microbiological quality. In this study, we analyzed source and potable water from a First Nations community for the presence of coliform bacteria as well as various antibiotic resistance genes. Samples, including those from drinking water sources, were found to be positive for various antibiotic resistance genes, namely, ampC, tet(A), mecA, β-lactamase genes (SHV-type, TEM-type, CTX-M-type, OXA-1, and CMY-2-type), and carbapenemase genes (KPC, IMP, VIM, NDM, GES, and OXA-48 genes). Not surprisingly, substantial numbers of total coliforms, including Escherichia coli, were recovered from these samples, and this result was also confirmed using Illumina sequencing of the 16S rRNA gene. These findings deserve further attention, as the presence of coliforms and antibiotic resistance genes potentially puts the health of the community members at risk. IMPORTANCE In this study, we highlight the poor microbiological quality of drinking water in a First Nations community in Canada. We examined the coliform load as well as the presence of antibiotic resistance genes in these samples. This study examined the presence of antibiotic-resistant genes in drinking water samples from a First Nations Community in Canada. We believe that our findings are of considerable significance, since the issue of poor water quality in First Nations communities in Canada is often ignored, and our findings will help shed some light on this important issue. PMID:27235436

  3. Streptomycin and chloramphenicol resistance genes in Escherichia coli isolates from cattle, pigs, and chicken in Kenya.

    Science.gov (United States)

    Kikuvi, G M; Schwarz, S; Ombui, J N; Mitema, E S; Kehrenberg, C

    2007-01-01

    The aims of this study were to determine the genetic basis of streptomycin and chloramphenicol resistance in 30 Escherichia coli isolates from food animals in Kenya and the role of plasmids in the spread of the resistance. Seven of the 29 streptomycin-resistant isolates harbored both the strA and strB genes. Twenty-one of isolates had the strA, strB, and aadA1 genes. The strA gene was disrupted by a functional trimethoprim gene, dfrA14 in 10 of the 21 isolates harboring the three streptomycin resistance genes. Physical linkage of intact strA and sul2 genes was found in two different plasmids from four isolates. Linkage of cassette-borne aadA1 and dfrA1 genes in class 1 integrons was found in two of the isolates. Chloramphenicol resistance was due to the gene catA1 in all the chloramphenicol resistant isolates. The strB, strA, and catA1 genes were transferable by conjugation and this points to the significance of conjugative resistance plasmids in the spread and persistence of streptomycin and chloramphenicol resistance in food animals in Kenya.

  4. Virulence genes and antimicrobial resistance of Pasteurella multocida isolated from poultry and swine.

    Science.gov (United States)

    Furian, Thales Quedi; Borges, Karen Apellanis; Laviniki, Vanessa; Rocha, Silvio Luis da Silveira; de Almeida, Camila Neves; do Nascimento, Vladimir Pinheiro; Salle, Carlos Tadeu Pippi; Moraes, Hamilton Luiz de Souza

    2016-01-01

    Pasteurella multocida causes atrophic rhinitis in swine and fowl cholera in birds, and is a secondary agent in respiratory syndromes. Pathogenesis and virulence factors involved are still poorly understood. The aim of this study was to detect 22 virulence-associated genes by PCR, including capsular serogroups A, B and D genes and to evaluate the antimicrobial susceptibility of P. multocida strains from poultry and swine. ompH, oma87, plpB, psl, exbD-tonB, fur, hgbA, nanB, sodA, sodC, ptfA were detected in more than 90% of the strains of both hosts. 91% and 92% of avian and swine strains, respectively, were classified in serogroup A. toxA and hsf-1 showed a significant association to serogroup D; pmHAS and pfhA to serogroup A. Gentamicin and amoxicillin were the most effective drugs with susceptibility higher than 97%; however, 76.79% of poultry strains and 85% of swine strains were resistant to sulphonamides. Furthermore, 19.64% and 36.58% of avian and swine strains, respectively, were multi-resistant. Virulence genes studied were not specific to a host and may be the result of horizontal transmission throughout evolution. High multidrug resistance demonstrates the need for responsible use of antimicrobials in animals intended for human consumption, in addition to antimicrobial susceptibility testing to P. multocida. Copyright © 2015 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

  5. Genetic basis and importance of metal resistant genes in bacteria for bioremediation of contaminated environments with toxic metal pollutants.

    Science.gov (United States)

    Das, Surajit; Dash, Hirak R; Chakraborty, Jaya

    2016-04-01

    Metal pollution is one of the most persistent and complex environmental issues, causing threat to the ecosystem and human health. On exposure to several toxic metals such as arsenic, cadmium, chromium, copper, lead, and mercury, several bacteria has evolved with many metal-resistant genes as a means of their adaptation. These genes can be further exploited for bioremediation of the metal-contaminated environments. Many operon-clustered metal-resistant genes such as cadB, chrA, copAB, pbrA, merA, and NiCoT have been reported in bacterial systems for cadmium, chromium, copper, lead, mercury, and nickel resistance and detoxification, respectively. The field of environmental bioremediation has been ameliorated by exploiting diverse bacterial detoxification genes. Genetic engineering integrated with bioremediation assists in manipulation of bacterial genome which can enhance toxic metal detoxification that is not usually performed by normal bacteria. These techniques include genetic engineering with single genes or operons, pathway construction, and alternations of the sequences of existing genes. However, numerous facets of bacterial novel metal-resistant genes are yet to be explored for application in microbial bioremediation practices. This review describes the role of bacteria and their adaptive mechanisms for toxic metal detoxification and restoration of contaminated sites.

  6. Resistance gene analogs involved in tolerant cassava--geminivirus interaction that shows a recovery phenotype.

    Science.gov (United States)

    Louis, Bengyella; Rey, Chrissie

    2015-12-01

    The current literature describes recovery from virus-induced symptoms as a RNA silencing defense, but immunity-related genes, including the structurally specific resistance gene analogs (RGAs) that may play a key role in tolerance and recovery is not yet reported. In this study, the transcriptome data of tolerant cassava TME3 (which exhibits a recovery phenotype) and susceptible cassava T200 infected with South African cassava mosaic virus were explored for RGAs. Putative resistance protein analogs (RPAs) with amide-like indole-3-acetic acid-Ile-Leu-Arg (IAA-ILR) and leucine-rich repeat (LRR)-kinase conserved domains were unique to TME3. Common responsive RPAs in TME3 and T200 were the dirigent-like protein, coil-coil nucleotide-binding site (NBS) and toll-interleukin-resistance, disease resistance zinc finger chromosome condensation-like protein (DZC), and NBS-apoptosis repressor with caspase recruitment (ARC)-LRR domains. Mutations in RPAs in the MHD motif of the NBS-ARC2 subdomain associated with the recovery phase in TME3 were observed. Additionally, a cohort of 25 RGAs mined solely during the recovery process in TME3 was identified. Phylogenetic and expression analyses support that diverse RGAs are differentially expressed during tolerance and recovery. This study reveals that in cassava, a perennial crop, RGAs participate in tolerance and differentially accumulate during recovery as a complementary defense mechanism to natural occurring RNA silencing to impair viral replication.

  7. The Helicobacter hepaticus hefA gene is involved in resistance to amoxicillin.

    Science.gov (United States)

    Belzer, Clara; Stoof, Jeroen; Breijer, Simone; Kusters, Johannes G; Kuipers, Ernst J; van Vliet, Arnoud H M

    2009-02-01

    Gastrointestinal infections with pathogenic Helicobacter species are commonly treated with combination therapies, which often include amoxicillin. Although this treatment is effective for eradication of Helicobacter pylori, the few existing reports are less clear about antibiotic susceptibility of other Helicobacter species. In this study we have determined the susceptibility of gastric and enterohepatic Helicobacter species to amoxicillin, and have investigated the mechanism of amoxicillin resistance in Helicobacter hepaticus. The minimal inhibitory concentration (MIC) of antimicrobial compounds was determined by E-test and agar/broth dilution assays. The hefA gene of H. hepaticus was inactivated by insertion of a chloramphenicol resistance gene. Transcription was measured by quantitative real-time polymerase chain reaction. Three gastric Helicobacter species (H. pylori, H. mustelae, and H. acinonychis) were susceptible to amoxicillin (MIC resistant to amoxicillin (MIC of 8, 16, and 6-64 mg/L, respectively). There was no detectable beta-lactamase activity in H. hepaticus, and inhibition of beta-lactamases did not change the MIC of amoxicillin of H. hepaticus. A H. hepaticus hefA (hh0224) mutant, encoding a TolC-component of a putative efflux system, resulted in loss of amoxicillin resistance (MIC 0.25 mg/L), and also resulted in increased sensitivity to bile acids. Finally, transcription of the hefA gene was not responsive to amoxicillin, but induced by bile acids. Rodents are frequently colonized by a variety of enterohepatic Helicobacter species, and this may affect their global health status and intestinal inflammatory responses. Animal facilities should have treatment strategies for Helicobacter infections, and hence resistance of enterohepatic Helicobacter species to amoxicillin should be considered when designing eradication programs.

  8. Evaluation of biofilm-specific antimicrobial resistance genes in Pseudomonas aeruginosa isolates in Farabi Hospital.

    Science.gov (United States)

    Saffari, Mahmood; Karami, Shabnam; Firoozeh, Farzaneh; Sehat, Mojtaba

    2017-07-01

    Biofilm produced from Pseudomonas aeruginosa is the cause of infection induced by contact lenses, trauma and post-surgery infection. The aim of this study was to evaluate biofilm formation and the presence of the genes ndvB and tssC1 in ocular infection isolates of P. aeruginosa. A total of 92 P. aeruginosa strains were collected from patients with ocular infection referred to Farabi Hospital between March 2014 and July 2015. Antibiotic susceptibility patterns were evaluated by the agar disc-diffusion method according to CLSI guidelines. PCR assays were used to detect ndvB and tssC1, genes associated with resistance in biofilm-producing P. aeruginosa isolates. Biofilm formation ability was examined by crystal violet microtitre plate assay. During the period of study, 92 P. aeruginosa were isolated from ocular infections including keratitis (n=84) and endophthalmitis (n=8). The highest resistance rates were seen against colistin (57.6 %) and gentamicin (50 %) and the lowest resistance rates were seen against imipenem (3.3 %), aztreonam (4.3 %), piperacillin-tazobactam (4.3 %), ceftazidime (4.3 %) and ciprofloxacin (5.4 %). Biofilm production ability was found in 100 % of the isolates. PCR assays showed that of the 92 P. aeruginosa isolates, 96.7 and 90.2 % harboured the genes ndvB and tssC1, respectively. Our results showed a considerable ability of biofilm production, as well as the occurrence of biofilm-specific antimicrobial resistance genes (ndvB and tssC1), in P. aeruginosa isolates from ocular infections in Farabi Hospital.

  9. Antibiotic Resistant Bacteria And Their Associated Resistance Genes in a Conventional Municipal Wastewater Treatment Plant

    KAUST Repository

    Aljassim, Nada I.

    2013-12-01

    With water scarcity as a pressing issue in Saudi Arabia and other Middle Eastern countries, the treatment and reuse of municipal wastewater is increasingly being used as an alternative water source to supplement country water needs. Standards are in place to ensure a safe treated wastewater quality, however they do not regulate pathogenic bacteria and emerging contaminants. Information is lacking on the levels of risk to public health associated with these factors, the efficiency of conventional treatment strategies in removing them, and on wastewater treatment in Saudi Arabia in general. In this study, a municipal wastewater treatment plant in Saudi Arabia is investigated to assess the efficiency of conventional treatment in meeting regulations and removing pathogens and emerging contaminants. The study found pathogenic bacterial genera, antibiotic resistance genes and antibiotic resistant bacteria, many of which were multi-resistant in plant discharges. It was found that although the treatments are able to meet traditional quality guidelines, there remains a risk from the discussed contaminants with wastewater reuse. A deeper understanding of this risk, and suggestions for more thorough guidelines and monitoring are needed.

  10. Risk assessment for Helicoverpa zea (Lepidoptera: Noctuidae) resistance on dual-gene versus single-gene corn.

    Science.gov (United States)

    Edwards, Kristine T; Caprio, Michael A; Allen, K Clint; Musser, Fred R

    2013-02-01

    Recent Environmental Protection Agency (EPA) decisions regarding resistance management in Bt-cropping systems have prompted concern in some experts that dual-gene Bt-corn (CrylA.105 and Cry2Ab2 toxins) may result in more rapid selection for resistance in Helicoverpa zea (Boddie) than single-gene Bacillus thuringiensis (Bt)-corn (CrylAb toxin). The concern is that Bt-toxin longevity could be significantly reduced with recent adoption of a natural refuge for dual-gene Bt-cotton (CrylAc and Cry2Ab2 toxins) and concurrent reduction in dual-gene corn refuge from 50 to 20%. A population genetics framework that simulates complex landscapes was applied to risk assessment. Expert opinions on effectiveness of several transgenic corn and cotton varieties were captured and used to assign probabilities to different scenarios in the assessment. At least 350 replicate simulations with randomly drawn parameters were completed for each of four risk assessments. Resistance evolved within 30 yr in 22.5% of simulations with single-gene corn and cotton with no volunteer corn. When volunteer corn was added to this assessment, risk of resistance evolving within 30 yr declined to 13.8%. When dual-gene Bt-cotton planted with a natural refuge and single-gene corn planted with a 50% structured refuge was simulated, simultaneous resistance to both toxins never occurred within 30 yr, but in 38.5% of simulations, resistance evolved to toxin present in single-gene Bt-corn (CrylAb). When both corn and cotton were simulated as dual-gene products, cotton with a natural refuge and corn with a 20% refuge, 3% of simulations evolved resistance to both toxins simultaneously within 30 yr, while 10.4% of simulations evolved resistance to CrylAb/c toxin.

  11. Including dietary fiber and resistant starch to increase satiety and reduce aggression in gestating sows

    Science.gov (United States)

    The swine industry is under a great deal of pressure to return sows to group housing. However, aggression during mixing of pregnant sows impacts sow welfare and productivity. The aim of this study was to increase satiety and reduce aggression by including dietary fiber and fermentable carbohydrate. ...

  12. Thyroid profiles in a patient with resistance to thyroid hormone and episodes of thyrotoxicosis, including repeated painless thyroiditis.

    Science.gov (United States)

    Taniyama, Matsuo; Otsuka, Fumiko; Tozaki, Teruaki; Ban, Yoshiyuki

    2013-07-01

    Thyrotoxic disease can be difficult to recognize in patients with resistance to thyroid hormone (RTH) because the clinical symptoms of thyrotoxicosis cannot be observed, and thyrotropin (TSH) may not be suppressed because of hormone resistance. Painless thyroiditis is a relatively common cause of thyrotoxicosis, but its occurrence in RTH has not been reported. We assessed the thyroid profile in a patient with RTH and episodes of thyrotoxicosis who experienced repeated painless thyroiditis. A 44-year-old Japanese woman with RTH, which was confirmed by the presence of a P453A mutation in the thyroid hormone receptor β (TRβ) gene, showed a slight elevation of the basal levels of thyroid hormones, which indicated that her pituitary RTH was mild. She experienced a slight exacerbation of hyperthyroxinemia concomitant with TSH suppression. A diagnosis of painless thyroiditis was made because of the absence of TSH receptor antibodies, low Tc-99m pertechnetate uptake by the thyroid gland, and transient suppression followed by a slight elevation of TSH following the elevation of thyroid hormones. The patient's complaints of general malaise and occasional palpitations did not change throughout the course of painless thyroiditis. Three years later, painless thyroiditis occurred again without any deterioration of the clinical manifestations. Mild pituitary RTH can be overcome by slight exacerbation of hyperthyroxinemia during mild thyrotoxicosis. When pituitary resistance is severe and TSH is not suppressed, thyrotoxicosis may be overlooked.

  13. [Mobile ISCR elements: structure, functions, and role in the emergence, increasing and spreading of blocks of bacterial genes of multiple antibiotic resistance].

    Science.gov (United States)

    Il'ina, T S

    2012-01-01

    The recently discovered method of horizontal distribution of bacterial genes with atypical ISCR sequences is reviewed using an example of drug resistance genes. The adjacent DNA segment mobilization is provided by the transposition of such elements, including rolling circle replication, formation of autonomous nonreplicable circular structures, and homological recombination. The gene distribution capacity with the ISCR elements is more significant than the capacity of transposons and integrons, thereby providing formation of groups of mobile genes, including antibiotic-resistance genes of pathogenic bacteria. The structure and functions of the ISCR elements were discussed together with their similarity and dissimilarity with the group of IS91-similar elements and their role in the emergence of blocks of bacterial genes encoding of multiple antibiotic resistance and their contribution to evolution of bacterial and plasmid genes.

  14. Removal of antibiotics and antibiotic resistance genes from domestic sewage by constructed wetlands: Optimization of wetland substrates and hydraulic loading.

    Science.gov (United States)

    Chen, Jun; Wei, Xiao-Dong; Liu, You-Sheng; Ying, Guang-Guo; Liu, Shuang-Shuang; He, Liang-Ying; Su, Hao-Chang; Hu, Li-Xin; Chen, Fan-Rong; Yang, Yong-Qiang

    2016-09-15

    This study aimed to assess removal potential of antibiotics and antibiotic resistance genes (ARGs) in raw domestic wastewater by various mesocosm-scale horizontal subsurface-flow constructed wetlands (CWs) planted Cyperus alternifolius L. with different design parameters. Twelve CWs with three hydraulic loading rates (HLR 10, 20 and 30cm/day) and four substrates (oyster shell, zeolite, medical stone and ceramic) were set up in order to select the best optimized wetland. The result showed that 7 target antibiotics compounds including erythromycin-H2O, lincomycin, monensin, ofloxacin, sulfamerazine, sulfamethazine and novobiocin were detected, and all selected 18 genes (three sulfonamide resistance genes (sul1, sul2 and sul3), four tetracycline resistance genes (tetG, tetM, tetO and tetX), two macrolide resistance genes (ermB and ermC), three quinolone resistance genes (qnrB, qnrD and qnrS) and four chloramphenicol resistance genes (cmlA, fexA, fexB and floR)) and two integrase genes (int1 and int2) were positively detected in the domestic wastewaters. The aqueous removal rates of the total antibiotics ranged from17.9 to 98.5%, while those for the total ARGs varied between 50.0 and 85.8% by the mesocosm-scale CWs. After considering their aqueous removal rates in combination with their mass removals, the CW with zeolite as the substrate and HLR of 20cm/day was selected as the best choice. Combined chemical and biological analyses indicate that both microbial degradation and physical sorption processes were responsible for the fate of antibiotics and ARGs in the wetlands. The findings from this study suggest constructed wetlands could be a promising technology for the removal of emerging contaminants such as antibiotics and ARGs in domestic wastewater. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. Sulfonamide-resistant bacteria and their resistance genes in soils fertilized with manures from Jiangsu Province, Southeastern China.

    Directory of Open Access Journals (Sweden)

    Na Wang

    Full Text Available Antibiotic-resistant bacteria and genes are recognized as new environmental pollutants that warrant special concern. There were few reports on veterinary antibiotic-resistant bacteria and genes in China. This work systematically analyzed the prevalence and distribution of sulfonamide resistance genes in soils from the environments around poultry and livestock farms in Jiangsu Province, Southeastern China. The results showed that the animal manure application made the spread and abundance of antibiotic resistance genes (ARGs increasingly in the soil. The frequency of sulfonamide resistance genes was sul1 > sul2 > sul3 in pig-manured soil DNA and sul2 > sul1 > sul3 in chicken-manured soil DNA. Further analysis suggested that the frequency distribution of the sul genes in the genomic DNA and plasmids of the SR isolates from manured soil was sul2 > sul1 > sul3 overall (p<0.05. The combination of sul1 and sul2 was the most frequent, and the co-existence of sul1 and sul3 was not found either in the genomic DNA or plasmids. The sample type, animal type and sampling time can influence the prevalence and distribution pattern of sulfonamide resistance genes. The present study also indicated that Bacillus, Pseudomonas and Shigella were the most prevalent sul-positive genera in the soil, suggesting a potential human health risk. The above results could be important in the evaluation of antibiotic-resistant bacteria and genes from manure as sources of agricultural soil pollution; the results also demonstrate the necessity and urgency of the regulation and supervision of veterinary antibiotics in China.

  16. Listeria monocytogenes isolates from food and food environment harbouring tetM and ermB resistance genes.

    Science.gov (United States)

    Haubert, L; Mendonça, M; Lopes, G V; de Itapema Cardoso, M R; da Silva, W P

    2016-01-01

    Listeria monocytogenes is a foodborne pathogen that has become an important cause of human and animal diseases worldwide. The purpose of this study was to evaluate the serotypes, virulence potential, antimicrobial resistance profile, and genetic relationships of 50 L. monocytogenes isolates from food and food environment in southern Brazil. In this study, the majority of L. monocytogenes isolates belonged to the serotypes 1/2b (42%) and 4b (26%), which are the main serotypes associated with human listeriosis. In addition, all isolates harboured internalin genes (inlA, inlC, inlJ), indicating a virulence potential. The isolates were sensitive to most of the antimicrobial compounds analysed, and five isolates (10%) were multi-resistant. Two isolates harboured antimicrobial resistance genes (tetM and ermB) and in one of them, the gene was present in the plasmid. Moreover, according to the pulsed field gel electrophoresis assay, two multi-resistant isolates were a single clone isolated from food and the processing plant. The isolates were susceptible to the most frequently used antibiotics for listeriosis treatment. However, the presence of multidrug-resistant isolates and antimicrobial resistance genes including in the plasmid could even be transferred between bacterial species, suggesting a potential health risk to consumers and a potential risk of spreading multi-resistance genes to other bacteria. Listeria monocytogenes is an important agent of foodborne diseases. The results of this study suggest a potential capacity of L. monocytogenes isolates from food and food environment to cause human infections. Antimicrobial multi-resistance profiles were detected in 10%, and two isolates harboured tetM and ermB resistance genes. Moreover, the present research can help to build up a better knowledge about antimicrobial resistance of L. monocytogenes. Additionally, we found one isolate carrying tetM resistance gene in a plasmid, that suggests a possible transmission

  17. Adaptive Landscapes of Resistance Genes Change as Antibiotic Concentrations Change.

    Science.gov (United States)

    Mira, Portia M; Meza, Juan C; Nandipati, Anna; Barlow, Miriam

    2015-10-01

    Most studies on the evolution of antibiotic resistance are focused on selection for resistance at lethal antibiotic concentrations, which has allowed the detection of mutant strains that show strong phenotypic traits. However, solely focusing on lethal concentrations of antibiotics narrowly limits our perspective of antibiotic resistance evolution. New high-resolution competition assays have shown that resistant bacteria are selected at relatively low concentrations of antibiotics. This finding is important because sublethal concentrations of antibiotics are found widely in patients undergoing antibiotic therapies, and in nonmedical conditions such as wastewater treatment plants, and food and water used in agriculture and farming. To understand the impacts of sublethal concentrations on selection, we measured 30 adaptive landscapes for a set of TEM β-lactamases containing all combinations of the four amino acid substitutions that exist in TEM-50 for 15 β-lactam antibiotics at multiple concentrations. We found that there are many evolutionary pathways within this collection of landscapes that lead to nearly every TEM-genotype that we studied. While it is known that the pathways change depending on the type of β-lactam, this study demonstrates that the landscapes including fitness optima also change dramatically as the concentrations of antibiotics change. Based on these results we conclude that the presence of multiple concentrations of β-lactams in an environment result in many different adaptive landscapes through which pathways to nearly every genotype are available. Ultimately this may increase the diversity of genotypes in microbial populations. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  18. Transport and transformation of genetic information in the critical zone: The case of antibiotic resistance genes

    Science.gov (United States)

    Zhu, Y. G.

    2015-12-01

    In addition to material and energy flows, the dynamics and functions of the Earth's critical zone are intensively mediated by biological actions performed by diverse organisms. These biological actions are modulated by the expression of functional genes and their translation into enzymes that catalyze geochemical reactions, such as nutrient turnover and pollutant biodegradation. Although geobiology, as an interdisciplinary research area, is playing and vital role in linking biological and geochemical processes at different temporal and spatial scales, the distribution and transport of functional genes have rarely been investigated from the Earth's critical zone perspectives. To illustrate the framework of studies on the transport and transformation of genetic information in the critical zone, antibiotic resistance is taken as an example. Antibiotic resistance genes are considered as a group of emerging contaminants, and their emergence and spread within the critical zone on one hand are induced by anthropogenic activities, and on other hand are threatening human health worldwide. The transport and transformation of antibiotic resistance genes are controlled by both horizontal gene transfer between bacterial cells and the movement of bacteria harboring antibiotic resistance genes. In this paper, the fate and behavior of antibiotic resistance genes will be discussed in the following aspects: 1) general overview of environmental antibiotic resistance; 2) high through quantification of the resistome in various environmental media; 3) pathways of resistance gene flow within the critical zone; and 4) potential strategies in mitigating antibiotic resistance, particularly from the critical zone perspectives.

  19. Identification of leaf rust resistant gene Lr10 in Pakistani wheat ...

    African Journals Online (AJOL)

    Jane

    2011-08-10

    Aug 10, 2011 ... survey was conducted to screen 25 Pakistan wheat germplasm for the presence of leaf rust resistance gene Lr10 using specific STS primer. ... conducted on the life cycles of rust pathogens and their management. Due to airborne nature .... To date, more than 45 stem rust resistance Sr (genes) (McIntosh et ...

  20. Mining microbial metatranscriptomes for expression of antibiotic resistance genes under natural conditions

    NARCIS (Netherlands)

    Versluis, D.; Andrea, D' M.M.; Ramiro Garcia, J.; Leimena, M.M.; Hugenholtz, F.; Zhang, J.; Öztürk, B.; Nylund, L.; Sipkema, D.; Schaik, van W.; Vos, de W.M.; Kleerebezem, M.; Smidt, H.; Passel, van M.W.J.

    2015-01-01

    Antibiotic resistance genes are found in a broad range of ecological niches associated with complex microbiota. Here we investigated if resistance genes are not only present, but also transcribed under natural conditions. Furthermore, we examined the potential for antibiotic production by assessing

  1. Identification of leaf rust resistant gene Lr10 in Pakistani wheat ...

    African Journals Online (AJOL)

    Leaf (brown) rust is the major disease of wheat in Pakistan and other countries. The disease is more effectively controlled when several rust resistance genes are pyramided into a single line. Molecular survey was conducted to screen 25 Pakistan wheat germplasm for the presence of leaf rust resistance gene Lr10 using ...

  2. Characterization of the psoRPM1 gene for resistance to root-knot ...

    African Journals Online (AJOL)

    Several root-knot nematode (Meloidogyne spp.) resistance genes have been discovered in different stone fruit crops. However, none of them has yet been cloned and they were only located on the chromosomes. In this study, a candidate root-knot nematode resistance gene (designated as psoRPM1) was isolated from the ...

  3. An AFLP marker linked to turnip mosaic virus resistance gene in pak ...

    African Journals Online (AJOL)

    An AFLP marker linked to turnip mosaic virus resistance gene in pak-choi. W Xinhua, C Huoying, Z Yuying, H Ruixian. Abstract. Pak-choi is one of the most important vegetable crops in China. Turnip mosaic virus (TuMV) is one of its main pathogen. Screening the molecular marker linked to the TuMV resistance gene is an ...

  4. The underappreciated in vitro activity of tedizolid against Bacteroides fragilis species, including strains resistant to metronidazole and carbapenems.

    Science.gov (United States)

    Goldstein, Ellie J C; Citron, Diane M; Tyrrell, Kerin L; Leoncio, Elisa S; Merriam, C Vreni

    2017-02-01

    Because Bacteroides fragilis has the ability to develop mechanisms of resistance to almost all antibiotics, we studied the comparative in vitro activity of tedizolid against 124 Bacteroides group species clinical isolates, including carbapenem, metronidazole and piperacillin-tazobactam resistant strains. Tedizolid had an MIC 90 of 2 μg/ml (range, 0.5-4 μg/ml) and was 1-4 times more active than linezolid that had an MIC 90 of 8 μg/ml (range, 2-16 μg/ml). It was also active (MICs 0.5-2 μg/ml) against the 27 ertapenem, 2 metronidazole and 12 piperacillin-tazobactam resistant strains tested. This suggests that tedizolid may be useful treating infections, including bacteremias, due to resistant B. fragilis group species, as well as, mixed skin and soft tissue infections such as diabetic foot infections caused by Gram-positive aerobes and B. fragilis group species. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. Identification of virulence genes carried by bacteriophages obtained from clinically isolated methicillin-resistant Staphylococcus aureus.

    Science.gov (United States)

    Karasartova, Djursun; Cavusoglu, Zeynep Burcin; Turegun, Buse; Ozsan, Murat T; Şahin, Fikret

    2016-12-01

    Bacteriophages play an important role in the pathogenicity of Staphylococcus aureus (S. aureus) either by carrying accessory virulence factors or several superantigens. Despite their importance, there are not many studies showing the actual distribution of the virulence genes carried by the prophages obtained from the clinically isolated Staphylococcus. In this study, we investigated prophages obtained from methicillin-resistant S. aureus (MRSA) strains isolated from hospital- and community-associated (HA-CA) infections for the virulence factors. In the study, 43 phages isolated from 48 MRSA were investigated for carrying toxin genes including the sak, eta, lukF-PV, sea, selp, sek, seg, seq chp, and scn virulence genes using polymerase chain reaction (PCR) and Southern blot. Restriction fragment length polymorphism was used to analyze phage genomes to investigate the relationship between the phage profiles and the toxin genes' presence. MRSA strains isolated from HA infections tended to have higher prophage presence than the MRSA strains obtained from the CA infections (97% and 67%, respectively). The study showed that all the phages with the exception of one phage contained one or more virulence genes in their genomes with different combinations. The most common toxin genes found were sea (83%) followed by sek (77%) and seq (64%). The study indicates that prophages encode a significant proportion of MRSA virulence factors.

  6. Quadruple-first line drug resistance in Mycobacterium tuberculosis in Vietnam: What can we learn from genes?

    Science.gov (United States)

    Nguyen, Huy Quang; Nguyen, Nhung Viet; Contamin, Lucie; Tran, Thanh Hoa Thi; Vu, Thuong Thi; Nguyen, Hung Van; Nguyen, Ngoc Lan Thi; Nguyen, Son Thai; Dang, Anh Duc; Bañuls, Anne-Laure; Nguyen, Van Anh Thi

    2017-06-01

    In Vietnam, a country with high tuberculosis (137/100.000 population) and multidrug-resistant (MDR)-TB burdens (7.8/100.000 population), little is known about the molecular signatures of drug resistance in general and more particularly of second line drug (SLD) resistance. This study is specifically focused on Mycobacterium tuberculosis isolates resistant to four first-line drugs (FLDs) that make TB much more difficult to treat. The aim is to determine the proportion of SLD resistance in these quadruple drug resistant isolates and the genetic determinants linked to drug resistance to better understand the genetic processes leading to quadruple and extremely drug resistance (XDR). 91 quadruple (rifampicin, isoniazid, ethambutol and streptomycin) FLD resistant and 55 susceptible isolates were included. Spoligotyping and 24-locus MIRU-VNTR techniques were performed and 9 genes and promoters linked to FLD and SLD resistance were sequenced. SLD susceptibility testing was carried out on a subsample of isolates. High proportion of quadruple-FLD resistant isolates was resistant to fluoroquinolones (27%) and second-line injectable drugs (30.2%) by drug susceptibility testing. The sequencing revealed high mutation diversity with prevailing mutations at positions katG315, inhA-15, rpoB531, embB306, rrs1401, rpsL43 and gyrA94. The sensitivity and specificity were high for most drug resistances (>86%), but the sensitivity was lower for injectable drug resistances (resistance. Nevertheless, particular mutation patterns linked to high-level resistance and low fitness costs seem to be favored. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Role and prevalence of antibiosis and the related resistance genes in the environment

    DEFF Research Database (Denmark)

    Nazaret, Sylvie; Aminov, Rustam

    2014-01-01

    It becomes increasingly clear that the basis of antibiotic resistance problem among bacterial pathogens is not confined to the borders of clinical microbiology but has broader ecological and evolutionary associations. This Research Topic “Role and prevalence of antibiosis and the related resistance...... genes in the environment” in Frontiers in Microbiology: Antimicrobials, Resistance, and Chemotherapy presents the examples of occurrence and diversity of antibiotic resistance genes (ARGs) in the wide range of environments, from the grasslands of the Colombian Andes, to the dairy farms and small animal...... approach to access the probability of rare horizontal gene transfer (HGT) events in bacterial populations....

  8. QTL Mapping by SLAF-seq and Expression Analysis of Candidate Genes for Aphid Resistance in Cucumber

    Directory of Open Access Journals (Sweden)

    Danna Liang

    2016-07-01

    Full Text Available Cucumber, a very important vegetable crop worldwide, is easily damaged by pests. Aphid is one of the most serious cucumber pests and frequently cause severe damage to commercially produced crops. Understanding the genetic mechanisms underlying pest resistance is important for aphid-resistant cucumber varieties breeding. In this study, two parental cucumber lines, JY30 (aphid susceptible and EP6392 (aphid resistant, and pools of resistant and susceptible (n = 50 each plants from 1000 F2 individuals derived from crossing JY30 with EP6392, were used to detect genomic regions associated with aphid resistance in cucumbers. The analysis was performed using specific length amplified fragment sequencing (SLAF-seq, bulked segregant analysis (BSA and single nucleotide polymorphism index (SNP-index methods. A main effect QTL (quantitative trait locus of 0.31 Mb on Chr5, including 43 genes, was identified by association analysis. Sixteen of the 43 genes were identified as potentially associated with aphid resistance through gene annotation analysis. The effect of aphid infestation on the expression of these candidate genes screened by SLAF-seq was investigated in EP6392 plants by qRT-PCR. The results indicated that 7 genes including encoding transcription factor MYB59-like (Csa5M641610.1, auxin transport protein BIG-like (Csa5M642140.1, F-box/kelch-repeat protein At5g15710-like (Csa5M642160.1, transcription factor HBP-1a-like (Csa5M642710.1, beta-glucan-binding protein (Csa5M643380.1, endo-1,3(4-beta-glucanase 1-like (Csa5M643880.1, and proline-rich receptor-like protein kinase PERK10-like (Csa5M643900.1, out of the 16 genes were down regulated after aphid infestation, whereas 5 genes including encoding probable leucine-rich repeat receptor-like serine/threonine-protein kinase At5g15730-like (Csa5M642150.1, Stress-induced protein KIN2 (Csa5M643240.1 and Csa5M643260.1, F-box family protein (Csa5M643280.1, F-box/kelch-repeat protein (Csa5M643290.1, were up

  9. Effect of Chlorine Exposure on the Survival and Antibiotic Gene Expression of Multidrug Resistant Acinetobacter baumannii in Water

    Directory of Open Access Journals (Sweden)

    Deepti Prasad Karumathil

    2014-02-01

    Full Text Available Acinetobacter baumannii is a multidrug resistant pathogen capable of causing a wide spectrum of clinical conditions in humans. Acinetobacter spp. is ubiquitously found in different water sources. Chlorine being the most commonly used disinfectant in water, the study investigated the effect of chlorine on the survival of A. baumannii in water and transcription of genes conferring antibiotic resistance. Eight clinical isolates of A. baumannii, including a fatal meningitis isolate (ATCC 17978 (~108 CFU/mL were separately exposed to free chlorine concentrations (0.2, 1, 2, 3 and 4 ppm with a contact time of 30, 60, 90 and 120 second. The surviving pathogen counts at each specified contact time were determined using broth dilution assay. In addition, real-time quantitative PCR (RT-qPCR analysis of the antibiotic resistance genes (efflux pump genes and those encoding resistance to specific antibiotics of three selected A. baumannii strains following exposure to chlorine was performed. Results revealed that all eight A. baumannii isolates survived the tested chlorine levels during all exposure times (p > 0.05. Additionally, there was an up-regulation of all or some of the antibiotic resistance genes in A. baumannii, indicating a chlorine-associated induction of antibiotic resistance in the pathogen.

  10. Genome Comparison of Erythromycin Resistant Campylobacter from Turkeys Identifies Hosts and Pathways for Horizontal Spread of erm(B Genes

    Directory of Open Access Journals (Sweden)

    Diego Florez-Cuadrado

    2017-11-01

    Full Text Available Pathogens in the genus Campylobacter are the most common cause of food-borne bacterial gastro-enteritis. Campylobacteriosis, caused principally by Campylobacter jejuni and Campylobacter coli, is transmitted to humans by food of animal origin, especially poultry. As for many pathogens, antimicrobial resistance in Campylobacter is increasing at an alarming rate. Erythromycin prescription is the treatment of choice for clinical cases requiring antimicrobial therapy but this is compromised by mobility of the erythromycin resistance gene erm(B between strains. Here, we evaluate resistance to six antimicrobials in 170 Campylobacter isolates (133 C. coli and 37 C. jejuni from turkeys. Erythromycin resistant isolates (n = 85; 81 C. coli and 4 C. jejuni were screened for the presence of the erm(B gene, that has not previously been identified in isolates from turkeys. The genomes of two positive C. coli isolates were sequenced and in both isolates the erm(B gene clustered with resistance determinants against aminoglycosides plus tetracycline, including aad9, aadE, aph(2″-IIIa, aph(3′-IIIa, and tet(O genes. Comparative genomic analysis identified identical erm(B sequences among Campylobacter from turkeys, Streptococcus suis from pigs and Enterococcus faecium and Clostridium difficile from humans. This is consistent with multiple horizontal transfer events among different bacterial species colonizing turkeys. This example highlights the potential for dissemination of antimicrobial resistance across bacterial species boundaries which may compromise their effectiveness in antimicrobial therapy.

  11. Targeted activation tagging of the Arabidopsis NBS-LRR gene, ADR1, conveys resistance to virulent pathogens.

    Science.gov (United States)

    Grant, John J; Chini, Andrea; Basu, Debrabata; Loake, Gary J

    2003-08-01

    A transgenic Arabidopsis line containing a chimeric PR-1::luciferase (LUC) reporter gene was subjected to mutagenesis with activation tags. Screening of lines via high-throughput LUC imaging identified a number of dominant Arabidopsis mutants that exhibited enhanced PR-1 gene expression. Here, we report the characterization of one of these mutants, designated activated disease resistance (adr) 1. This line showed constitutive expression of a number of key defense marker genes and accumulated salicylic acid but not ethylene or jasmonic acid. Furthermore, adr1 plants exhibited resistance against the biotrophic pathogens Peronospora parasitica and Erysiphe cichoracearum but not the necrotrophic fungus Botrytis cinerea. Analysis of a series of adr1 double mutants suggested that adr1-mediated resistance against P. parasitica was salicylic acid (SA)-dependent, while resistance against E. cichoracearum was both SA-dependent and partially NPR1-dependent. The ADR1 gene encoded a protein possessing a number of key features, including homology to subdomains of protein kinases, a nucleotide binding domain, and leucine-rich repeats. The controlled, transient expression of ADR1 conveyed striking disease resistance in the absence of yield penalty, highlighting the potential utility of this gene in crop protection.

  12. Brownian dynamics simulations of a flexible polymer chain which includes continuous resistance and multibody hydrodynamic interactions

    Science.gov (United States)

    Butler, Jason E.; Shaqfeh, Eric S. G.

    2005-01-01

    Using methods adapted from the simulation of suspension dynamics, we have developed a Brownian dynamics algorithm with multibody hydrodynamic interactions for simulating the dynamics of polymer molecules. The polymer molecule is modeled as a chain composed of a series of inextensible, rigid rods with constraints at each joint to ensure continuity of the chain. The linear and rotational velocities of each segment of the polymer chain are described by the slender-body theory of Batchelor [J. Fluid Mech. 44, 419 (1970)]. To include hydrodynamic interactions between the segments of the chain, the line distribution of forces on each segment is approximated by making a Legendre polynomial expansion of the disturbance velocity on the segment, where the first two terms of the expansion are retained in the calculation. Thus, the resulting linear force distribution is specified by a center of mass force, couple, and stresslet on each segment. This method for calculating the hydrodynamic interactions has been successfully used to simulate the dynamics of noncolloidal suspensions of rigid fibers [O. G. Harlen, R. R. Sundararajakumar, and D. L. Koch, J. Fluid Mech. 388, 355 (1999); J. E. Butler and E. S. G. Shaqfeh, J. Fluid Mech. 468, 204 (2002)]. The longest relaxation time and center of mass diffusivity are among the quantities calculated with the simulation technique. Comparisons are made for different levels of approximation of the hydrodynamic interactions, including multibody interactions, two-body interactions, and the "freely draining" case with no interactions. For the short polymer chains studied in this paper, the results indicate a difference in the apparent scaling of diffusivity with polymer length for the multibody versus two-body level of approximation for the hydrodynamic interactions.

  13. Differential fate of erythromycin and beta-lactam resistance genes from swine lagoon waste under different aquatic conditions

    International Nuclear Information System (INIS)

    Knapp, Charles W.; Zhang, Wen; Sturm, Belinda S.M.; Graham, David W.

    2010-01-01

    The attenuation and fate of erythromycin-resistance-methylase (erm) and extended-spectrum beta-lactamse (bla) genes were quantified over time in aquatic systems by adding 20-L swine waste to 11,300-L outdoor mesocosms that simulated receiving water conditions below intensive agricultural operations. The units were prepared with two different light-exposure scenarios and included artificial substrates to assess gene movement into biofilms. Of eleven genes tested, only erm(B), erm(F), bla SHV and bla TEM were found in sufficient quantity for monitoring. The genes disappeared rapidly from the water column and first-order water-column disappearance coefficients were calculated. However, detected gene levels became elevated in the biofilms within 2 days, but then disappeared over time. Differences were observed between sunlight and dark treatments and among individual genes, suggesting that ecological and gene-specific factors play roles in the fate of these genes after release into the environment. Ultimately, this information will aid in generating better predictive models for gene fate. - The disappearance and fate of erythromycin-resistance-methylase and beta-lactamase genes were monitored in outdoor mesocosms under different light conditions.

  14. Differential fate of erythromycin and beta-lactam resistance genes from swine lagoon waste under different aquatic conditions

    Energy Technology Data Exchange (ETDEWEB)

    Knapp, Charles W., E-mail: charles.knapp@strath.ac.u [David Livingstone Centre for Sustainability, Department of Civil Engineering, University of Strathclyde, 50 Richmond Street, Glasgow, G1 1XN (United Kingdom); School of Civil Engineering and Geosciences, Newcastle University, Newcastle upon Tyne, NE1 7RU (United Kingdom); Zhang, Wen; Sturm, Belinda S.M. [Department of Civil, Environmental and Architectural Engineering, University of Kansas, Lawrence, KS 66045 (United States); Graham, David W. [School of Civil Engineering and Geosciences, Newcastle University, Newcastle upon Tyne, NE1 7RU (United Kingdom); Department of Civil, Environmental and Architectural Engineering, University of Kansas, Lawrence, KS 66045 (United States)

    2010-05-15

    The attenuation and fate of erythromycin-resistance-methylase (erm) and extended-spectrum beta-lactamse (bla) genes were quantified over time in aquatic systems by adding 20-L swine waste to 11,300-L outdoor mesocosms that simulated receiving water conditions below intensive agricultural operations. The units were prepared with two different light-exposure scenarios and included artificial substrates to assess gene movement into biofilms. Of eleven genes tested, only erm(B), erm(F), bla{sub SHV} and bla{sub TEM} were found in sufficient quantity for monitoring. The genes disappeared rapidly from the water column and first-order water-column disappearance coefficients were calculated. However, detected gene levels became elevated in the biofilms within 2 days, but then disappeared over time. Differences were observed between sunlight and dark treatments and among individual genes, suggesting that ecological and gene-specific factors play roles in the fate of these genes after release into the environment. Ultimately, this information will aid in generating better predictive models for gene fate. - The disappearance and fate of erythromycin-resistance-methylase and beta-lactamase genes were monitored in outdoor mesocosms under different light conditions.

  15. Isolation and characterization of NBS-LRR- resistance gene candidates in turmeric (Curcuma longa cv. surama).

    Science.gov (United States)

    Joshi, R K; Mohanty, S; Subudhi, E; Nayak, S

    2010-09-08

    Turmeric (Curcuma longa), an important asexually reproducing spice crop of the family Zingiberaceae is highly susceptible to bacterial and fungal pathogens. The identification of resistance gene analogs holds great promise for development of resistant turmeric cultivars. Degenerate primers designed based on known resistance genes (R-genes) were used in combinations to elucidate resistance gene analogs from Curcuma longa cultivar surama. The three primers resulted in amplicons with expected sizes of 450-600 bp. The nucleotide sequence of these amplicons was obtained through sequencing; their predicted amino acid sequences compared to each other and to the amino acid sequences of known R-genes revealed significant sequence similarity. The finding of conserved domains, viz., kinase-1a, kinase-2 and hydrophobic motif, provided evidence that the sequences belong to the NBS-LRR class gene family. The presence of tryptophan as the last residue of kinase-2 motif further qualified them to be in the non-TIR-NBS-LRR subfamily of resistance genes. A cluster analysis based on the neighbor-joining method was carried out using Curcuma NBS analogs together with several resistance gene analogs and known R-genes, which classified them into two distinct subclasses, corresponding to clades N3 and N4 of non-TIR-NBS sequences described in plants. The NBS analogs that we isolated can be used as guidelines to eventually isolate numerous R-genes in turmeric.

  16. Characterisation of penA and tetM resistance genes of Neisseria ...

    African Journals Online (AJOL)

    This gene block, which was found in all the southern African areas studied, appears to predispose isolates to increased penicillin resistance. The 25,2 MDa conjugative plasmid carrying the tetM resistance determinant was readily demonstrated in 11 Botswana Namibia isolates exhibiting high-level resistance to tetracycline ...

  17. Characterisation of penA and tetM resistance genes of Neisseria ...

    African Journals Online (AJOL)

    appears to predispose isolates to increased penicillin resistance. The 25,2 MDa conjugative plasmid carrying the. tetM resistance determinant was readily demonstrated in. 11 Botswana! Namibia isolates exhibiting high-level resistance to tetracycline (MICs ? 16 IJg/ml). The tetM gene was shown to be of the American type.

  18. Chromosomal location and molecular mapping of tan spot resistance genes in common wheat (T. aestivum L.)

    OpenAIRE

    Tadesse, Wuletaw

    2008-01-01

    In this study, 75 cultivars highly resistant to tan spot were identified. A positive correlation (r = 0.864; P = 0.001) was found between seedling resistance and adult plant resistance. Inheritance of tan spot resistance was found to be qualitative goverened by single major genes. Three novel resistance genes: tsn3, tsn4 and tsn5 were identified and located on chromosomes 3D, 3A and 3B, respectively. Linkage analysis using SSR markers showed that both the tsn3 (tsn3a, Tsn3b and tsn3c) and ts...

  19. Genetic engineering of crop plants for fungal resistance: role of antifungal genes.

    Science.gov (United States)

    Ceasar, S Antony; Ignacimuthu, S

    2012-06-01

    Fungal diseases damage crop plants and affect agricultural production. Transgenic plants have been produced by inserting antifungal genes to confer resistance against fungal pathogens. Genes of fungal cell wall-degrading enzymes, such as chitinase and glucanase, are frequently used to produce fungal-resistant transgenic crop plants. In this review, we summarize the details of various transformation studies to develop fungal resistance in crop plants.

  20. Trueperella pyogenes isolated from dairy cows with endometritis in Inner Mongolia, China: Tetracycline susceptibility and tetracycline-resistance gene distribution.

    Science.gov (United States)

    Zhang, Dexian; Zhao, Jingcui; Wang, Qiuxia; Liu, Yaochuan; Tian, Chunlian; Zhao, Yujun; Yu, Lihui; Liu, Mingchun

    2017-04-01

    Trueperella pyogenes plays a crucial role in endometritis pathogenesis and is also associated with many infections, including metritis, mastitis, arthritis and liver abscessation, in many domestic animals. In this study, we investigated the prevalence of tetracycline resistance in T. pyogenes isolated from dairy cows with endometritis in Inner Mongolia, China, and we assessed tetracycline-resistance gene distribution among the isolates. Our results indicated that 68.7% and 62.5% of the isolates were resistant to tetracycline and doxycycline, respectively, and the rate of resistance to metacycline was 18.8%. The tetracycline resistance gene tetK was present in all isolates (n = 32), whereas the tetM gene was identified in 12.5% and 9.4% of the isolates, in the chromosome and plasmid, respectively. Strains carrying tetW were also common in the chromosome and plasmid, with abundances of 53.1% and 46.9%, respectively. However, tetO and otrA were absent in all isolates. The resistance phenotype analysis indicated that 6.3% of strains were susceptible to all tetracyclines, while 3.1% showed resistance to all tetracyclines. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Antibiotic Resistance Genes and Correlations with Microbial Community and Metal Resistance Genes in Full-Scale Biogas Reactors As Revealed by Metagenomic Analysis

    DEFF Research Database (Denmark)

    Luo, Gang; Li, Bing; Li, Li-Guan

    2017-01-01

    resistance genes (MRGs). The total abundance of ARGs in all the samples varied from 7 × 10-3 to 1.08 × 10-1 copy of ARG/copy of 16S-rRNA gene, and the samples obtained from thermophilic biogas reactors had a lower total abundance of ARGs, indicating the superiority of thermophilic anaerobic digestion......Digested residues from biogas plants are often used as biofertilizers for agricultural crops cultivation. The antibiotic resistance genes (ARGs) in digested residues pose a high risk to public health due to their potential spread to the disease-causing microorganisms and thus reduce...

  2. Mechanisms of Streptomycin Resistance: Selection of Mutations in the 16S rRNA Gene Conferring Resistance

    Science.gov (United States)

    Springer, Burkhard; Kidan, Yishak G.; Prammananan, Therdsak; Ellrott, Kerstin; Böttger, Erik C.; Sander, Peter

    2001-01-01

    Chromosomally acquired streptomycin resistance is frequently due to mutations in the gene encoding the ribosomal protein S12, rpsL. The presence of several rRNA operons (rrn) and a single rpsL gene in most bacterial genomes prohibits the isolation of streptomycin-resistant mutants in which resistance is mediated by mutations in the 16S rRNA gene (rrs). Three strains were constructed in this investigation: Mycobacterium smegmatis rrnB, M. smegmatis rpsL3+, and M. smegmatis rrnB rpsL3+. M. smegmatis rrnB carries a single functional rrn operon, i.e., rrnA (comprised of 16S, 23S, and 5S rRNA genes) and a single rpsL+ gene; M. smegmatis rpsL3+ is characterized by the presence of two rrn operons (rrnA and rrnB) and three rpsL+ genes; and M. smegmatis rrnB rpsL3+ carries a single functional rrn operon (rrnA) and three rpsL+ genes. By genetically altering the number of rpsL and rrs alleles in the bacterial genome, mutations in rrs conferring streptomycin resistance could be selected, as revealed by analysis of streptomycin-resistant derivatives of M. smegmatis rrnB rpsL3+. Besides mutations well known to confer streptomycin resistance, novel streptomycin resistance conferring mutations were isolated. Most of the mutations were found to map to a functional pseudoknot structure within the 530 loop region of the 16S rRNA. One of the mutations observed, i.e., 524G→C, severely distorts the interaction between nucleotides 524G and 507C, a Watson-Crick interaction which has been thought to be essential for ribosome function. The use of the single rRNA allelic M. smegmatis strain should help to elucidate the principles of ribosome-drug interactions. PMID:11557484

  3. Recombinant Streptomyces clavuligerus strain including cas2 gene production and analysis its antibiotic overproduction by bioassay

    Directory of Open Access Journals (Sweden)

    Zohreh Hojati

    2014-03-01

    Full Text Available Background: Streptomyces clavuligerus is one of the most important strain that produce clavulanic acid that wildly used in combination of strong but sensitive to β-lactamase antibiotics in clinics. The cas2 is one of the important genes in the biosynthesis pathway of clavulanic acid. Materials and Methods: The recombinant construct pMTcas2 which contain cas2 gene is obtained from Isfahan University. Recombinant plasmid extracts from streptomyces lividans and confirm by enzyme digestion. The streptomyces clavuligerus protoplast was prepared and transformation was done by using polyethylene glycol. Transformation was confirmed by plasmid extraction and PCR using cas2 specific primers. Finally, bioassay method was used to survey the effect of extra copy of cas2 on clavulanic acid production. Result: Plasmid extraction was initially carried out and the structure of plasmid was confirmed by digestion. The typical white colony was seen on protoplast recovery culture containing thiostrepton antibiotic and gray spores were detected after one week. Plasmid extraction was done from transformed strain and transformation was confirmed by PCR. The results of the bioassay show that amplification of the cas2 gene in multicopy plasmids resulted in a 4.1 fold increase in clavulanic acid production. Conclusion: The bioassay was done and the diameters of zone of inhibition in control and sample were compared. The results of the bioassay show that amplification of the cas2 gene in multicopy plasmids resulted in a 4.1 fold increase in clavulanic acid production. Overproduction of clavulanic acid decreases the cost of its dependent drug production.

  4. Identification of genes in a partially resistant genotype of Avena sativa expressed in response to Puccinia coronata infection

    Directory of Open Access Journals (Sweden)

    Yolanda eLoarce

    2016-05-01

    Full Text Available Cultivated oat (Avena sativa, an important crop in many countries, can suffer significant losses through infection by the fungus Puccinia coronata, the causal agent of crown rust disease. Understanding the molecular basis of existing partial resistance to this disease might provide targets of interest for crop improvement programs. A suppressive subtractive hybridization (SSH library was constructed using cDNA from the partially resistant oat genotype MN841801-1 after inoculation with the pathogen. A total of 929 genes returned a BLASTx hit and were annotated under different GO terms, including 139 genes previously described as participants in mechanisms related to the defense response and signal transduction. Among these were genes involved in pathogen recognition, cell-wall modification, oxidative burst/ROS scavenging, and abscisic acid biosynthesis, as well genes related to inducible defense responses mediated by salicylic and jasmonic acid (although none of which had been previously reported involved in strong responses. These findings support the hypothesis that basal defense mechanisms are the main systems operating in oat partial resistance to P. coronata. When the expression profiles of 20 selected genes were examined at different times following inoculation with the pathogen, the partially resistant genotype was much quicker in mounting a response than a susceptible genotype. Additionally, a number of genes not previously described in oat transcriptomes were identified in this work, increasing our molecular knowledge of this crop.

  5. Identification of Genes in a Partially Resistant Genotype of Avena sativa Expressed in Response to Puccinia coronata Infection

    Science.gov (United States)

    Loarce, Yolanda; Navas, Elisa; Paniagua, Carlos; Fominaya, Araceli; Manjón, José L.; Ferrer, Esther

    2016-01-01

    Cultivated oat (Avena sativa), an important crop in many countries, can suffer significant losses through infection by the fungus Puccinia coronata, the causal agent of crown rust disease. Understanding the molecular basis of existing partial resistance to this disease might provide targets of interest for crop improvement programs. A suppressive subtractive hybridization (SSH) library was constructed using cDNA from the partially resistant oat genotype MN841801-1 after inoculation with the pathogen. A total of 929 genes returned a BLASTx hit and were annotated under different GO terms, including 139 genes previously described as participants in mechanisms related to the defense response and signal transduction. Among these were genes involved in pathogen recognition, cell-wall modification, oxidative burst/ROS scavenging, and abscisic acid biosynthesis, as well genes related to inducible defense responses mediated by salicylic and jasmonic acid (although none of which had been previously reported involved in strong responses). These findings support the hypothesis that basal defense mechanisms are the main systems operating in oat partial resistance to P. coronata. When the expression profiles of 20 selected genes were examined at different times following inoculation with the pathogen, the partially resistant genotype was much quicker in mounting a response than a susceptible genotype. Additionally, a number of genes not previously described in oat transcriptomes were identified in this work, increasing our molecular knowledge of this crop. PMID:27303424

  6. Pollen-mediated gene flow from glyphosate-resistant common waterhemp (Amaranthus rudis Sauer): consequences for the dispersal of resistance genes.

    Science.gov (United States)

    Sarangi, Debalin; Tyre, Andrew J; Patterson, Eric L; Gaines, Todd A; Irmak, Suat; Knezevic, Stevan Z; Lindquist, John L; Jhala, Amit J

    2017-03-22

    Gene flow is an important component in evolutionary biology; however, the role of gene flow in dispersal of herbicide-resistant alleles among weed populations is poorly understood. Field experiments were conducted at the University of Nebraska-Lincoln to quantify pollen-mediated gene flow (PMGF) from glyphosate-resistant (GR) to -susceptible (GS) common waterhemp using a concentric donor-receptor design. More than 130,000 common waterhemp plants were screened and 26,199 plants were confirmed resistant to glyphosate. Frequency of gene flow from all distances, directions, and years was estimated with a double exponential decay model using Generalized Nonlinear Model (package gnm) in R. PMGF declined by 50% at <3 m distance from the pollen source, whereas 90% reduction was found at 88 m (maximum) depending on the direction of the pollen-receptor blocks. Amplification of the target site gene, 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS), was identified as the mechanism of glyphosate resistance in parent biotype. The EPSPS gene amplification was heritable in common waterhemp and can be transferred via PMGF, and also correlated with glyphosate resistance in pseudo-F 2 progeny. This is the first report of PMGF in GR common waterhemp and the results are critical in explaining the rapid dispersal of GR common waterhemp in Midwestern United States.

  7. Molecular mapping of the novel powdery mildew resistance gene Pm36 introgressed from Triticum turgidum var. dicoccoides in durum wheat.

    Science.gov (United States)

    Blanco, Antonio; Gadaleta, A; Cenci, A; Carluccio, A V; Abdelbacki, A M M; Simeone, R

    2008-06-01

    Powdery mildew, caused by Blumeria graminis f.sp. tritici, is one of the most important wheat diseases in many regions of the world. Triticum turgidum var. dicoccoides (2n=4x=AABB), the progenitor of cultivated wheats, shows particular promises as a donor of useful genetic variation for several traits, including disease resistances. The wild emmer accession MG29896, resistant to powdery mildew, was backcrossed to the susceptible durum wheat cultivar Latino, and a set of backcross inbred lines (BC(5)F(5)) was produced. Genetic analysis of F(3) populations from two resistant introgression lines (5BIL-29 x Latino and 5BIL-42 x Latino) indicated that the powdery mildew resistance is controlled by a single dominant gene. Molecular markers and the bulked segregant analysis were used to characterize and map the powdery mildew resistance. Five AFLP markers (XP43M32((250)), XP46M31((410)), XP41M37((100)), XP41M39((250)), XP39M32((120))), three genomic SSR markers (Xcfd07, Xwmc75, Xgwm408) and one EST-derived SSR marker (BJ261635) were found to be linked to the resistance gene in 5BIL-29 and only the BJ261635 marker in 5BIL-42. By means of Chinese Spring nullisomic-tetrasomic, ditelosomic and deletion lines, the polymorphic markers and the resistance gene were assigned to chromosome bin 5BL6-0.29-0.76. These results indicated that the two lines had the same resistance gene and that the introgressed dicoccoides chromosome segment was longer (35.5 cM) in 5BIL-29 than that introgressed in 5BIL-42 (less than 1.5 cM). As no powdery mildew resistance gene has been reported on chromosome arm 5BL, the novel resistance gene derived from var. dicoccoides was designated Pm36. The 244 bp allele of BJ261635 in 5BIL-42 can be used for marker-assisted selection during the wheat resistance breeding process for facilitating gene pyramiding.

  8. Incorporation of Bacterial Blight Resistance Genes Into Lowland Rice Cultivar Through Marker-Assisted Backcross Breeding.

    Science.gov (United States)

    Pradhan, Sharat Kumar; Nayak, Deepak Kumar; Pandit, Elssa; Behera, Lambodar; Anandan, Annamalai; Mukherjee, Arup Kumar; Lenka, Srikanta; Barik, Durga Prasad

    2016-07-01

    Bacterial blight (BB) of rice caused by Xanthomonas oryzae pv. oryzae is a major disease of rice in many rice growing countries. Pyramided lines carrying two BB resistance gene combinations (Xa21+xa13 and Xa21+xa5) were developed in a lowland cultivar Jalmagna background through backcross breeding by integrating molecular markers. In each backcross generation, markers closely linked to the disease resistance genes were used to select plants possessing the target genes. Background selection was continued in those plants carrying resistant genes until BC(3) generation. Plants having the maximum contribution from the recurrent parent genome were selected in each generation and hybridized with the recipient parent. The BB-pyramided line having the maximum recipient parent genome recovery of 95% was selected among BC3F1 plants and selfed to isolate homozygous BC(3)F(2) plants with different combinations of BB resistance genes. Twenty pyramided lines with two resistance gene combinations exhibited high levels of tolerance against the BB pathogen. In order to confirm the resistance, the pyramided lines were inoculated with different X. oryzae pv. oryzae strains of Odisha for bioassay. The genotypes with combination of two BB resistance genes conferred high levels of resistance to the predominant X. oryzae pv. oryzae isolates prevalent in the region. The pyramided lines showed similarity with the recipient parent with respect to major agro-morphologic traits.

  9. Genes Expressed Differentially in Hessian Fly Larvae Feeding in Resistant and Susceptible Plants

    Directory of Open Access Journals (Sweden)

    Ming-Shun Chen

    2016-08-01

    Full Text Available The Hessian fly, Mayetiola destructor, is a destructive pest of wheat worldwide and mainly controlled by deploying resistant cultivars. In this study, we investigated the genes that were expressed differentially between larvae in resistant plants and those in susceptible plants through RNA sequencing on the Illumina platform. Informative genes were 11,832, 14,861, 15,708, and 15,071 for the comparisons between larvae in resistant versus susceptible plants for 0.5, 1, 3, and 5 days, respectively, after larvae had reached the feeding site. The transcript abundance corresponding to 5401, 6902, 8457, and 5202 of the informative genes exhibited significant differences (p ≤ 0.05 in the respective paired comparisons. Overall, genes involved in nutrient metabolism, RNA and protein synthesis exhibited lower transcript abundance in larvae from resistant plants, indicating that resistant plants inhibited nutrient metabolism and protein production in larvae. Interestingly, the numbers of cytochrome P450 genes with higher transcript abundance in larvae from resistant plants were comparable to, or higher than those with lower transcript abundance, indicating that toxic chemicals from resistant plants may have played important roles in Hessian fly larval death. Our study also identified several families of genes encoding secreted salivary gland proteins (SSGPs that were expressed at early stage of 1st instar larvae and with more genes with higher transcript abundance in larvae from resistant plants. Those SSGPs are candidate effectors with important roles in plant manipulation.

  10. Mapping and characterization of wheat stem rust resistance genes SrTm5 and Sr60 from Triticum monococcum

    Science.gov (United States)

    The emergence and spread of new virulent races of the wheat stem rust pathogen (Puccinia graminis f. sp. tritici; Pgt), including the TTKSK (Ug99) race group, is a serious threat to global wheat production. In this study, we mapped and characterized two stem rust resistance genes from diploid wheat ...

  11. Evolutionary meta-analysis of solanaceous resistance gene and solanum resistance gene analog sequences and a practical framework for cross-species comparisons.

    Science.gov (United States)

    Quirin, Edmund A; Mann, Harpartap; Meyer, Rachel S; Traini, Alessandra; Chiusano, Maria Luisa; Litt, Amy; Bradeen, James M

    2012-05-01

    Cross-species comparative genomics approaches have been employed to map and clone many important disease resistance (R) genes from Solanum species-especially wild relatives of potato and tomato. These efforts will increase with the recent release of potato genome sequence and the impending release of tomato genome sequence. Most R genes belong to the prominent nucleotide binding site-leucine rich repeat (NBS-LRR) class and conserved NBS-LRR protein motifs enable survey of the R gene space of a plant genome by generation of resistance gene analogs (RGA), polymerase chain reaction fragments derived from R genes. We generated a collection of 97 RGA from the disease-resistant wild potato S. bulbocastanum, complementing smaller collections from other Solanum species. To further comparative genomics approaches, we combined all known Solanum RGA and cloned solanaceous NBS-LRR gene sequences, nearly 800 sequences in total, into a single meta-analysis. We defined R gene diversity bins that reflect both evolutionary relationships and DNA cross-hybridization results. The resulting framework is amendable and expandable, providing the research community with a common vocabulary for present and future study of R gene lineages. Through a series of sequence and hybridization experiments, we demonstrate that all tested R gene lineages are of ancient origin, are shared between Solanum species, and can be successfully accessed via comparative genomics approaches.

  12. An Antimicrobial Metabolite from Bacillus sp.: Significant activity against pathogenic bacteria including multidrug-resistant clinical strains

    Directory of Open Access Journals (Sweden)

    AJAY GHOSH CHALASANI

    2015-12-01

    Full Text Available In this study, the cell free modified trypticase soya broth (pH 7.4+0.2 of Bacillus subtilis URID 12.1 showed significant antimicrobial activity against multidrug-resistant strains of Staphylococcus aureus, S. epidermidis, Streptococcus pyogenes and Enterococcus faecalis. The partially purified antimicrobial molecule was found to be resistant to extremes of pH and temperatures and also to higher concentrations of trypsin and proteinase K. The antimicrobial molecule was purified by a three-step method that included reverse-phased high performance liquid chromatography (RP-HPLC. The minimum inhibitory concentration (MIC values were determined for 11 species of bacteria using a microbroth dilution technique. The HPLC-purified fraction showed the MICs ranging from 0.5 to 1 µg/ml for methicillin and vancomycin resistant Staphylococcus aureus (MVRSA and methicillin-resistant Staphylococcus epidermidis (MRSE strains. The molecular mass of the antimicrobial compound was determined to be 842.37 Da. The same antimicrobial fraction showed negligible haemolytic activity against human red blood cells even at a concentration as high as 100µg/ml. Because of its significant antimicrobial activity at low MIC values coupled with its non-haemolytic property, it may prove to be a novel antimicrobial lead molecule.

  13. Effective genes for resistance to stripe rust and virulence of Puccinia ...

    African Journals Online (AJOL)

    The results revealed that stripe rust resistance genes Yr3, Yr5, Yr10, Yr15, Yr26, YrSP and YrCV were resistant, while Yr18 showed moderate susceptibility at all locations. Genes YrA-, Yr2, Yr6, Yr7, Yr8, Yr9, Yr17, Yr27 and gene combinations Opata (Yr27+Yr18) and Super Kauz (Yr9, Yr27, Yr18) were found susceptible.

  14. Genetics and mapping of a new leaf rust resistance gene in Triticum ...

    Indian Academy of Sciences (India)

    Genetic analysis in F1, F2 and F2.3 families at the seedling stage revealed that leaf rust resistance in Selection G12 is conditioned by a single incompletely dominant gene. The leaf rust resistance gene was mapped to chromosome 3BL with SSR markers Xgwm114 and Xgwm547 flanking the gene at a distance of 28.3 cM ...

  15. Pyramiding B genes in cotton achieves broader but not always higher resistance to bacterial blight.

    Science.gov (United States)

    Essenberg, Margaret; Bayles, Melanie B; Pierce, Margaret L; Verhalen, Laval M

    2014-10-01

    Near-isogenic lines of upland cotton (Gossypium hirsutum) carrying single, race-specific genes B4, BIn, and b7 for resistance to bacterial blight were used to develop a pyramid of lines with all possible combinations of two and three genes to learn whether the pyramid could achieve broad and high resistance approaching that of L. A. Brinkerhoff's exceptional line Im216. Isogenic strains of Xanthomonas axonopodis pv. malvacearum carrying single avirulence (avr) genes were used to identify plants carrying specific resistance (B) genes. Under field conditions in north-central Oklahoma, pyramid lines exhibited broader resistance to individual races and, consequently, higher resistance to a race mixture. It was predicted that lines carrying two or three B genes would also exhibit higher resistance to race 1, which possesses many avr genes. Although some enhancements were observed, they did not approach the level of resistance of Im216. In a growth chamber, bacterial populations attained by race 1 in and on leaves of the pyramid lines decreased significantly with increasing number of B genes in only one of four experiments. The older lines, Im216 and AcHR, exhibited considerably lower bacterial populations than any of the one-, two-, or three-B-gene lines. A spreading collapse of spray-inoculated AcBIn and AcBInb7 leaves appears to be a defense response (conditioned by BIn) that is out of control.

  16. Point mutations in the sodium channel gene conferring tau-fluvalinate resistance in Varroa destructor.

    Science.gov (United States)

    Hubert, Jan; Nesvorna, Marta; Kamler, Martin; Kopecky, Jan; Tyl, Jan; Titera, Dalibor; Stara, Jitka

    2014-06-01

    Sodium channels (SCs) in mites and insects are target sites for pesticides, including pyrethroids. Point mutations in the SC gene have been reported to change the structural conformation of the protein and its sensitivity to pesticides. To find mutations in the SC gene of the mite Varroa destructor (VmNa), the authors analysed the VmNa gene sequences available in GenBank and prepared specific primers for the amplification of two fragments containing the regions coding for (i) the domain II S4-S6 region (bp 2805-3337) and (ii) the domain III S4-3' terminus region (bp 4737-6500), as determined according to the VmNa cDNA sequence AY259834. Sensitive and resistant mite populations did not differ in the amino acid sequences of the III S4-3' terminus VmNa region. However, differences were found in the IIS4-IIS6 fragment. In the resistant population, the mutation C(3004) → G resulted in the substitution L(1002) → V (codon ctg → gtg) at the position equivalent to that of the housefly L925 in the domain II S5 helix. Additionally, the mutation F(1052) → L (codon ttc → ctc) at the position equivalent to that of the housefly F975 in the domain II P-loop connecting segments S5 and S6 was detected in both the resistant and sensitive populations. All individuals that survived the tau-fluvalinate treatment in the bioassay harboured the L(1002) → V mutation combined with the F(1052), while dead individuals from both the sensitive and resistant populations harboured mostly the L(1002) residue and either of the two residues at position 1052. © 2013 Society of Chemical Industry.

  17. DETERMINATION OF THE SPECTRUM OF ANTIBIOTIC RESISTANCE GENES HAVE PHENOTYPIC RESISTANT STRAINS OF PARIETAL INTESTINAL MICROBIOTA IN RATS BY RT-PCR

    Directory of Open Access Journals (Sweden)

    Bukina Y.V.

    2016-06-01

    resistance to glycopeptides, particularly vancomycin. Thus, of the 46 strains studied E.faecalis, 10,87% of isolates possessed Van A genes and 8,7% - Van B. Out of 50 studied cultures E.faecium 12% were in their genotype Van A and 4% - Van B. However, the frequency of detection of genes Van A and Van B in E.faecalis strains circulating in Russia, 1,7% and 2,2%, while E.faecium - 9,3% and 11,5% respectively. Bacteria of the family Peptostreptococcaceae these genes were not identified. During the molecular genetic studies we have not detected phenotypically resistant strains that have combined carbapenemases activity. Conclusions. The findings of the research results indicate the presence of carbapenem resistance genes in strains of microorganisms families Enterobacteriaceae, Bacteroidaceae and Pseudomonadaceae (P. aeruginosae, to cephalosporins - Enterobacteriaceae, Bacteroidaceae and Peptostreptococcaceae, vancomycin - from family Enterococcaceae bacteria. Phenotypically resistant strains that have combined carbapenemases activity, not revealed. Despite the wide range of activity of appointment carbapenems, cephalosporins and vancomycin should take into account the results of determination of resistance genes causing resistance to these drugs. It is advisable to creating circulation monitoring program of antibiotic-resistant strains, including those with сarbapenemases activity in humans and in the environment.

  18. Amino acid substitutions in the thymidine kinase gene of induced acyclovir-resistant herpes simplex virus type 1

    Science.gov (United States)

    Hussin, Ainulkhir; Nor, Norefrina Shafinaz Md; Ibrahim, Nazlina

    2013-11-01

    Acyclovir (ACV) is an antiviral drug of choice in healthcare setting to treat infections caused by herpes viruses, including, but not limited to genital herpes, cold sores, shingles and chicken pox. Acyclovir resistance has emerged significantly due to extensive use and misuse of this antiviral in human, especially in immunocompromised patients. However, it remains unclear about the amino acid substitutions in thymidine (TK) gene, which specifically confer the resistance-associated mutation in herpes simplex virus. Hence, acyclovir-resistant HSV-1 was selected at high concentration (2.0 - 4.5 μg/mL), and the TK-gene was subjected to sequencing and genotypic characterization. Genotypic sequences comparison was done using HSV-1 17 (GenBank Accesion no. X14112) for resistance-associated mutation determination whereas HSV-1 KOS, HSV-1 473/08 and HSV clinical isolates sequences were used for polymorphism-associated mutation. The result showed that amino acid substitutions at the non-conserved region (UKM-1: Gln34Lys, UKM-2: Arg32Ser & UKM-5: Arg32Cys) and ATP-binding site (UKM-3: Tyr53End & UKM-4: Ile54Leu) of the TK-gene. These discoveries play an important role to extend another dimension to the evolution of acyclovir-resistant HSV-1 and suggest that selection at high ACV concentration induced ACV-resistant HSV-1 evolution. These findings also expand the knowledge on the type of mutations among acyclovir-resistant HSV-1. In conclusion, HSV-1 showed multiple strategies to exhibit acyclovir resistance, including amino acid substitutions in the TK gene.

  19. Impact of pre-application treatment on municipal sludge composition, soil dynamics of antibiotic resistance genes, and abundance of antibiotic-resistance genes on vegetables at harvest.

    Science.gov (United States)

    Lau, Calvin Ho-Fung; Li, Bing; Zhang, Tong; Tien, Yuan-Ching; Scott, Andrew; Murray, Roger; Sabourin, Lyne; Lapen, David R; Duenk, Peter; Topp, Edward

    2017-06-01

    In many jurisdictions sludge recovered from the sewage treatment process is a valued fertilizer for crop production. Pre-treatment of sewage sludge prior to land application offers the potential to abate enteric microorganisms that carry genes conferring resistance to antibiotics. Pre-treatment practices that accomplish this should have the desirable effect of reducing the risk of contamination of crops or adjacent water with antibiotic resistance genes carried in these materials. In the present study, we obtained municipal sludge that had been subjected to one of five treatments. There were, anaerobic-digestion or aerobic-digestion, in both instances with and without dewatering; and heat-treatment and pelletization. Each of the five types of biosolids was applied to an agricultural field at commercial rates, following which lettuce, carrots and radishes were planted. Based on qPCR, the estimated antibiotic gene loading rates were comparable with each of the five biosolids. However, the gene abundance in soil following application of the pelletized biosolids was anomalously lower than expected. Following application, the abundance of antibiotic resistance genes decreased in a generally coherent fashion, except sul1 which increased in abundance during the growing season in the soil fertilized with pelletized biosolids. Based on qPCR and high throughput sequencing evidence for transfer of antibiotic resistance genes from the biosolids to the vegetables at harvest was weak. Clostridia were more abundant in soils receiving any of the biosolids except the pelletized. Overall, the behavior of antibiotic resistance genes in soils receiving aerobically or anaerobically-digested biosolids was consistent and coherent with previous studies. However, dynamics of antibiotic resistance genes in soils receiving the heat treated pelletized biosolids were very different, and the underlying mechanisms merit investigation. Crown Copyright © 2017. Published by Elsevier B.V. All

  20. Transcriptome analysis of resistant and susceptible genotypes of Glycine tomentella during Phakopsora pachyrhizi infection reveals novel rust resistance genes.

    Science.gov (United States)

    Soria-Guerra, Ruth Elena; Rosales-Mendoza, Sergio; Chang, Sungyul; Haudenshield, James S; Padmanaban, Annamalai; Rodriguez-Zas, Sandra; Hartman, Glen L; Ghabrial, Said A; Korban, Schuyler S

    2010-05-01

    Soybean rust, caused by Phakopsora pachyrhizi, is a destructive foliar disease in nearly all soybean-producing countries. To identify genes controlling resistance to soybean rust, transcriptome profiling was conducted in resistant and susceptible Glycine tomentella genotypes triggered by P. pachyrhizi infection. Among 38,400 genes monitored using a soybean microarray, at 5% false discovery rate, 1,342 genes were identified exhibiting significant differential expression between uninfected and P. pachyrhizi-infected leaves at 12, 24, 48, and 72 h post-inoculation (hpi) in both rust-susceptible and rust-resistant genotypes. Differentially expressed genes were grouped into 12 functional categories, and among those, large numbers relate to basic plant metabolism. Transcripts for genes involved in the phenylpropanoid pathway were up-regulated early during rust infection. Similarly, genes coding for proteins related to stress and defense responses such as glutathione-S-transferases, peroxidases, heat shock proteins, and lipoxygenases were consistently up-regulated following infection at all four time points. Whereas, subsets of genes involved in cellular transport, cellular communication, cell cycle, and DNA processing were down-regulated. Quantitative real-time reverse-transcription polymerase chain reaction (qRT-PCR) on randomly selected genes from the different categories confirmed these findings. Of differentially expressed genes, those associated with the flavonoid biosynthesis pathway as well as those coding for peroxidases and lipoxygenases were likely to be involved in rust resistance in soybean, and would serve as good candidates for functional studies. These findings provided insights into mechanisms underlying resistance and general activation of plant defense pathways in response to rust infection.

  1. A pigeonpea gene confers resistance to Asian soybean rust in soybean.

    Science.gov (United States)

    Kawashima, Cintia G; Guimarães, Gustavo Augusto; Nogueira, Sônia Regina; MacLean, Dan; Cook, Doug R; Steuernagel, Burkhard; Baek, Jongmin; Bouyioukos, Costas; Melo, Bernardo do V A; Tristão, Gustavo; de Oliveira, Jamile Camargos; Rauscher, Gilda; Mittal, Shipra; Panichelli, Lisa; Bacot, Karen; Johnson, Ebony; Iyer, Geeta; Tabor, Girma; Wulff, Brande B H; Ward, Eric; Rairdan, Gregory J; Broglie, Karen E; Wu, Gusui; van Esse, H Peter; Jones, Jonathan D G; Brommonschenkel, Sérgio H

    2016-06-01

    Asian soybean rust (ASR), caused by the fungus Phakopsora pachyrhizi, is one of the most economically important crop diseases, but is only treatable with fungicides, which are becoming less effective owing to the emergence of fungicide resistance. There are no commercial soybean cultivars with durable resistance to P. pachyrhizi, and although soybean resistance loci have been mapped, no resistance genes have been cloned. We report the cloning of a P. pachyrhizi resistance gene CcRpp1 (Cajanus cajan Resistance against Phakopsora pachyrhizi 1) from pigeonpea (Cajanus cajan) and show that CcRpp1 confers full resistance to P. pachyrhizi in soybean. Our findings show that legume species related to soybean such as pigeonpea, cowpea, common bean and others could provide a valuable and diverse pool of resistance traits for crop improvement.

  2. Detection and Characterizations of Genes Resistant to Tetracycline and Sulfa among the Bacteria in Mariculture Water

    Science.gov (United States)

    Qu, L.; Li, Y.; Zhu, P.

    2013-12-01

    One hundred and thirty-five bacteria from maricultural environments were tested for sensitivity to tetracycline and sulfa. Result show that 72% of the bacteria were sulfa-resistant, 36% of the bacteria were tetracycline-resistant, and 16.5% of bacteria showed resistance to both tetracyclines and sulfa ,indicating that the proportion of sulfa and tetracycline resistance bacteria isvery large in the maricultural environments. PCR methods were used to detect if these resistant bacteria carry tetracycline and sulfa resistance genes. Out of the 33 tetracycline-resistant bacteria screened, 3 were positive for tetA, 6 were positive for tetB and no isolate wasboth positive for tetA and tetB. Of the 97 sulfa-resistant bacteria screened, 9 were positive for sul2, 6 were positive for sul1, 1 isolate was positive for bothsul1 and sul2. The minimum inhibitory concentration (MIC) of tetracycline for tetA-carrying isolates were higher than those tetB-carrying isolates.while The MIC of sulfa for sul2-carrying isolates were higher than those sul1-carrying isolates. Indicating that tetA and sul2 gene may play ubknown roles in resisting tetracycline and sulfa than tetB and sul1 genes. The results showed the 4 kinds of genes (tetA,tetB,sul1,sul2) has no host specificity. All these 16S sequence are from the isolates which are positive for the above genes, it indicated the above antibiotic resistance genes are widespread in the environment regardless of the host. While the DNA sequence of these four genes showed tetA, sul1, sul2 genes are conservative in different bacteria , etB gene conserved poorly. The research aim is to get a preliminary understanding of resistance mechanism related to the resistant bacteria and the resistance genes in marine aquaculture environment through the analysis of resistant genes, providing research base for the prevention and treatment of drug-resistant bacteria so as to reduce the threat to the ecological environment, aquaculture and human health.

  3. Characterization of the Maize Chitinase Genes and Their Effect on Aspergillus flavus and Aflatoxin Accumulation Resistance

    Science.gov (United States)

    Hawkins, Leigh K.; Mylroie, J. Erik; Oliveira, Dafne A.; Smith, J. Spencer; Ozkan, Seval; Windham, Gary L.; Williams, W. Paul; Warburton, Marilyn L.

    2015-01-01

    Maize (Zea mays L.) is a crop of global importance, but prone to contamination by aflatoxins produced by fungi in the genus Aspergillus. The development of resistant germplasm and the identification of genes contributing to resistance would aid in the reduction of the problem with a minimal need for intervention by farmers. Chitinolytic enzymes respond to attack by potential pathogens and have been demonstrated to increase insect and fungal resistance in plants. Here, all chitinase genes in the maize genome were characterized via sequence diversity and expression patterns. Recent evolution within this gene family was noted. Markers from within each gene were developed and used to map the phenotypic effect on resistance of each gene in up to four QTL mapping populations and one association panel. Seven chitinase genes were identified that had alleles associated with increased resistance to aflatoxin accumulation and A. flavus infection in field grown maize. The chitinase in bin 1.05 identified a new and highly significant QTL, while chitinase genes in bins 2.04 and 5.03 fell directly beneath the peaks of previously published QTL. The expression patterns of these genes corroborate possible grain resistance mechanisms. Markers from within the gene sequences or very closely linked to them are presented to aid in the use of marker assisted selection to improve this trait. PMID:26090679

  4. Fluoroquinolone Resistance in Atypical Pneumococci and Oral Streptococci: Evidence of Horizontal Gene Transfer of Fluoroquinolone Resistance Determinants from Streptococcus pneumoniae▿ †

    Science.gov (United States)

    Ip, Margaret; Chau, Shirley S. L.; Chi, Fang; Tang, Julian; Chan, Paul K.

    2007-01-01

    Atypical strains, presumed to be pneumococcus, with ciprofloxacin MICs of ≥4.0 μg/ml and unique sequence variations within the quinolone resistance-determining regions (QRDRs) of the gyrase and topoisomerase genes in comparison with the Streptococcus pneumoniae R6 strain, were examined. These strains were reidentified using phenotypic methods, including detection of optochin susceptibility, bile solubility, and agglutination by serotype-specific antisera, and genotypic methods, including detection of pneumolysin and autolysin genes by PCR, 16S rRNA sequencing, and multilocus sequence typing (MLST). The analysis based on concatenated sequences of the six MLST loci distinguished the “atypical” strains from pneumococci, and these strains clustered closely with S. mitis. However, all these strains and five of nine strains from the viridans streptococcal group possessed one to three gyrA, gyrB, parC, and parE genes whose QRDR sequences clustered with those of S. pneumoniae, providing evidence of horizontal transfer of the QRDRs of the gyrase and topoisomerase genes from pneumococci into viridans streptococci. These genes also conferred fluoroquinolone resistance to viridans streptococci. In addition, the fluoroquinolone resistance determinants of 32 well-characterized Streptococcus mitis and Streptococcus oralis strains from bacteremic patients were also compared. These strains have unique amino acid substitutions in GyrA and ParC that were distinguishable from those in fluoroquinolone-resistant pneumococci and the “atypical” isolates. Both recombinational events and de novo mutations play an important role in the development of fluoroquinolone resistance. PMID:17548487

  5. RNAi validation of resistance genes and their interactions in the highly DDT-resistant 91-R strain of Drosophila melanogaster.

    Science.gov (United States)

    Gellatly, Kyle J; Yoon, Kyong Sup; Doherty, Jeffery J; Sun, Weilin; Pittendrigh, Barry R; Clark, J Marshall

    2015-06-01

    4,4'-dichlorodiphenyltrichloroethane (DDT) has been re-recommended by the World Health Organization for malaria mosquito control. Previous DDT use has resulted in resistance, and with continued use resistance will increase in terms of level and extent. Drosophila melanogaster is a model dipteran that has many available genetic tools, numerous studies done on insecticide resistance mechanisms, and is related to malaria mosquitoes allowing for extrapolation. The 91-R strain of D. melanogaster is highly resistant to DDT (>1500-fold), however, there is no mechanistic scheme that accounts for this level of resistance. Recently, reduced penetration, increased detoxification, and direct excretion have been identified as resistance mechanisms in the 91-R strain. Their interactions, however, remain unclear. Use of UAS-RNAi transgenic lines of D. melanogaster allowed for the targeted knockdown of genes putatively involved in DDT resistance and has validated the role of several cuticular proteins (Cyp4g1 and Lcp1), cytochrome P450 monooxygenases (Cyp6g1 and Cyp12d1), and ATP binding cassette transporters (Mdr50, Mdr65, and Mrp1) involved in DDT resistance. Further, increased sensitivity to DDT in the 91-R strain after intra-abdominal dsRNA injection for Mdr50, Mdr65, and Mrp1 was determined by a DDT contact bioassay, directly implicating these genes in DDT efflux and resistance. Copyright © 2015 Elsevier Inc. All rights reserved.

  6. Prevalence and Abundance of Florfenicol and Linezolid Resistance Genes in Soils Adjacent to Swine Feedlots

    OpenAIRE

    Zhao, Qin; Wang, Yang; Wang, Shaolin; Wang, Zheng; Du, Xiang-dang; Jiang, Haiyang; Xia, Xi; Shen, Zhangqi; Ding, Shuangyang; Wu, Congming; Zhou, Bingrui; Wu, Yongning; Shen, Jianzhong

    2016-01-01

    Florfenicol is extensively used in livestock to prevent or cure bacterial infections. However, it is not known whether the administration of florfenicol has resulted in the emergence and dissemination of florfenicol resistance genes (FRGs, including fexA, fexB, cfr, optrA, floR, and pexA) in microbial populations in surrounding farm environments. Here we collected soil samples for the detection of FRGs and the residue of florfenicol from six swine farms with the record of florfenicol usage. Q...

  7. The role of calcitonin gene-related peptide in peripheral and central pain mechanisms including migraine.

    Science.gov (United States)

    Iyengar, Smriti; Ossipov, Michael H; Johnson, Kirk W

    2017-04-01

    Calcitonin gene-related peptide (CGRP) is a 37-amino acid peptide found primarily in the C and Aδ sensory fibers arising from the dorsal root and trigeminal ganglia, as well as the central nervous system. Calcitonin gene-related peptide was found to play important roles in cardiovascular, digestive, and sensory functions. Although the vasodilatory properties of CGRP are well documented, its somatosensory function regarding modulation of neuronal sensitization and of enhanced pain has received considerable attention recently. Growing evidence indicates that CGRP plays a key role in the development of peripheral sensitization and the associated enhanced pain. Calcitonin gene-related peptide is implicated in the development of neurogenic inflammation and it is upregulated in conditions of inflammatory and neuropathic pain. It is most likely that CGRP facilitates nociceptive transmission and contributes to the development and maintenance of a sensitized, hyperresponsive state not only of the primary afferent sensory neurons but also of the second-order pain transmission neurons within the central nervous system, thus contributing to central sensitization as well. The maintenance of a sensitized neuronal condition is believed to be an important factor underlying migraine. Recent successful clinical studies have shown that blocking the function of CGRP can alleviate migraine. However, the mechanisms through which CGRP may contribute to migraine are still not fully understood. We reviewed the role of CGRP in primary afferents, the dorsal root ganglion, and in the trigeminal system as well as its role in peripheral and central sensitization and its potential contribution to pain processing and to migraine.

  8. Genetic testing including targeted gene panel in a diverse clinical population of children with autism spectrum disorder: Findings and implications.

    Science.gov (United States)

    Kalsner, Louisa; Twachtman-Bassett, Jennifer; Tokarski, Kristin; Stanley, Christine; Dumont-Mathieu, Thyde; Cotney, Justin; Chamberlain, Stormy

    2017-12-21

    Genetic testing of children with autism spectrum disorder (ASD) is now standard in the clinical setting, with American College of Medical Genetics and Genomics (ACMGG) guidelines recommending microarray for all children, fragile X testing for boys and additional gene sequencing, including PTEN and MECP2, in appropriate patients. Increasingly, testing utilizing high throughput sequencing, including gene panels and whole exome sequencing, are offered as well. We performed genetic testing including microarray, fragile X testing and targeted gene panel, consistently sequencing 161 genes associated with ASD risk, in a clinical population of 100 well characterized children with ASD. Frequency of rare variants identified in individual genes was compared with that reported in the Exome Aggregation Consortium (ExAC) database. We did not diagnose any conditions with complete penetrance for ASD; however, copy number variants believed to contribute to ASD risk were identified in 12%. Eleven children were found to have likely pathogenic variants on gene panel, yet, after careful analysis, none was considered likely causative of disease. KIRREL3 variants were identified in 6.7% of children compared to 2% in ExAC, suggesting a potential role for KIRREL3 variants in ASD risk. Children with KIRREL3 variants more often had minor facial dysmorphism and intellectual disability. We also observed an increase in rare variants in TSC2. However, analysis of variant data from the Simons Simplex Collection indicated that rare variants in TSC2 occur more commonly in specific racial/ethnic groups, which are more prevalent in our population than in the ExAC database. The yield of genetic testing including microarray, fragile X (boys) and targeted gene panel was 12%. Gene panel did not increase diagnostic yield; however, we found an increase in rare variants in KIRREL3. Our findings reinforce the need for racial/ethnic diversity in large-scale genomic databases used to identify variants that

  9. Synthetic versions of firefly luciferase and Renilla luciferase reporter genes that resist transgene silencing in sugarcane

    Science.gov (United States)

    2014-01-01

    Background Down-regulation or silencing of transgene expression can be a major hurdle to both molecular studies and biotechnology applications in many plant species. Sugarcane is particularly effective at silencing introduced transgenes, including reporter genes such as the firefly luciferase gene. Synthesizing transgene coding sequences optimized for usage in the host plant is one method of enhancing transgene expression and stability. Using specified design rules we have synthesised new coding sequences for both the firefly luciferase and Renilla luciferase reporter genes. We have tested these optimized versions for enhanced levels of luciferase activity and for increased steady state luciferase mRNA levels in sugarcane. Results The synthetic firefly luciferase (luc*) and Renilla luciferase (Renluc*) coding sequences have elevated G + C contents in line with sugarcane codon usage, but maintain 75% identity to the native firefly or Renilla luciferase nucleotide sequences and 100% identity to the protein coding sequences. Under the control of the maize pUbi promoter, the synthetic luc* and Renluc* genes yielded 60x and 15x higher luciferase activity respectively, over the native firefly and Renilla luciferase genes in transient assays on sugarcane suspension cell cultures. Using a novel transient assay in sugarcane suspension cells combining co-bombardment and qRT-PCR, we showed that synthetic luc* and Renluc* genes generate increased transcript levels compared to the native firefly and Renilla luciferase genes. In stable transgenic lines, the luc* transgene generated significantly higher levels of expression than the native firefly luciferase transgene. The fold difference in expression was highest in the youngest tissues. Conclusions We developed synthetic versions of both the firefly and Renilla luciferase reporter genes that resist transgene silencing in sugarcane. These transgenes will be particularly useful for evaluating the expression patterns conferred

  10. Bovine mastitis Staphylococcus aureus: antibiotic susceptibility profile, resistance genes and molecular typing of methicillin-resistant and methicillin-sensitive strains in China.

    Science.gov (United States)

    Wang, Dengfeng; Wang, Zhicai; Yan, Zuoting; Wu, Jianyong; Ali, Tariq; Li, Jianjun; Lv, Yanli; Han, Bo

    2015-04-01

    The emergence of methicillin-resistant Staphylococcus aureus (MRSA) infection in dairy animals is of great concern for livestock and public health. The aim of present study was to detect new trends of methicillin-resistant Staphylococcus aureus (MRSA) and methicillin-sensitive Staphylococcus aureus (MSSA) towards antibiotic susceptibility, resistance genes and molecular typing by methods of disc diffusion, multiplex PCR assay and multilocus sequence typing (MLST). A total of 219 S. aureus strains were isolated from bovine mastitis cases from six provinces of China, including 34 MRSA strains. The results revealed that more than 70% isolated strains showed resistance to various antibiotics, and multiple-drugs resistance to more than five categories of antibiotics was found more common. The ermC was the most prevalent resistance gene, followed by other genes; however, ermA was the least frequently detected gene. Twenty-eight mecA-negative MRSA and six mecA-positive MRSA strains were detected, and in which three strains were ST97-MRSA-IV, others were ST965-MRSA-IV, ST6-MRSA-IV and ST9-MRSA-SCCmec-NT. The mecA-negative MRSA strains were found resistant to most of the antibiotics, and harbored aac(6')/aph(2''), aph(3')-III and tetM genes higher than MSSA strains. The resistance to most of the antibiotics was significantly higher in MRSA than in MSSA strains. The MLST profiles showed that these strains mainly belonged to CC5, CC398, CC121 and CC50 lineage, especially within ST97 and ST398, while some novel sequence types (ST2154, ST2165 and ST2166) were identified and deposited in the MLST database. This indicates that the resistance of S. aureus is becoming more complicated by changes in multi-drug resistance mechanism and appearance of mecA-negative MRSA isolates, and importantly, MRSA-IV strains in different MLST types are emerging. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. Mutations inside rifampicin-resistance determining region of rpoB gene associated with rifampicin-resistance in Mycobacterium tuberculosis.

    Science.gov (United States)

    Zaw, Myo T; Emran, Nor A; Lin, Zaw

    2018-04-26

    Rifampicin (RIF) plays a pivotal role in the treatment of tuberculosis due to its bactericidal effects. Because the action of RIF is on rpoB gene encoding RNA polymerase β subunit, 95% of RIF resistant mutations are present in rpoB gene. The majority of the mutations in rpoB gene are found within an 81bp RIF-resistance determining region (RRDR). Literatures on RIF resistant mutations published between 2010 and 2016 were thoroughly reviewed. The most commonly mutated codons in RRDR of rpoB gene are 531, 526 and 516. The possibilities of absence of mutation in RRDR of rpoB gene in MDR-TB isolates in few studies was due to existence of other rare rpoB mutations outside RRDR or different mechanism of rifampicin resistance. Molecular methods which can identify extensive mutations associated with multiple anti-tuberculous drugs are in urgent need so that the research on drug resistant mutations should be extended. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  12. Molecular detection of methicillin resistant Staphylococcus aureus harbouring β- lactamase resistance genes isolated from different sources of infections

    Directory of Open Access Journals (Sweden)

    Amir Hani Raziq

    2017-12-01

    Full Text Available Background and objective: The detection and investigation of methicillin resistance staphylococci specifically S. aureus in clinical microbiology setting is very helpful both for informing the appropriate treatment of individual patients and also for the surveillance of these organisms. This study aimed at the rapid molecular detection of methicillin resistant staphylococci harbouring β-lactamase gene and determination of the efficiency of m-PCR through comparison with uniplex PCR. Methods: Standard microbiological techniques were applied for the determination of the presence of methicillin resistant S. aureus in samples recovered from different body sites of patients who attended Al-Kadhumyhia Teaching and Baghdad Teaching Hospitals. The resulting methicillin resistant S. aureus (MRSA isolates were subjected to uni and multiplex PCR amplifications for detecting the existence of mec A gene and β-lactamase (TEM resistance gene. Results: Half of the cases involved were found to be caused by MRSA. All the tested isolates showed positive amplification bands for the presence of mec A gene and only 48.8% of these harbored TEM gene. The obtained results revealed high sensitivity of universal bacterial and TEM primers expressed as 97.6% and 100% respectively, while the sensitivity of mec A primer was limited to 60%. Conclusion: The phenotypic identification of MRSA revealed a higher incidence rate and that different molecular techniques can yield conflicting results and it can also be concluded that resistant due to beta- lactamase production can be a crucial factor added to the previously settled methicillin resistant due to mec A gene.

  13. Detection and coexistence of six categories of resistance genes in Escherichia coli strains from chickens in Anhui Province, China

    Directory of Open Access Journals (Sweden)

    Lin Li

    2015-12-01

    Full Text Available The aim of this study was to characterise the prevalence of class 1 integrons and gene cassettes, tetracycline-resistance genes, phenicol-resistance genes, 16S rRNA methylase genes, extended-spectrum β-lactamase genes and plasmid-mediated fluoroquinolone resistance determinants in 184 Escherichia coli isolates from chickens in Anhui Province, China. Susceptibility to 15 antimicrobials was determined using broth micro-dilution. Polymerase chain reaction and DNA sequencing were used to characterise the molecular basis of the antibiotic resistance. High rates of antimicrobial resistance were observed; 131 out of the 184 (72.3% isolates were resistant to at least six antimicrobial agents. The prevalences of class 1 integrons, tetracycline-resistance genes, phenicol-resistance genes, 16S rRNA methylase genes, extended-spectrum β-lactamase genes and plasmid-mediated fluoroquinolone resistance determinants were 49.5, 17.4, 15.8, 0.5, 57.6 and 46.2%, respectively. In 82 isolates, 48 different kinds of coexistence of the different genes were identified. Statistical (χ2 analysis showed that the resistance to amoxicillin, doxycycline, florfenicol, ofloxacin and gentamicin had significant differences (P<0.01 or 0.01resistance genes, which showed a certain correlation between antimicrobial resistance and the presence of resistance genes.

  14. Non-Target Gene Mutations in the Development of Fluoroquinolone Resistance in Escherichia coli

    Science.gov (United States)

    Kern, W. V.; Oethinger, M.; Jellen-Ritter, A. S.; Levy, S. B.

    2000-01-01

    Mutations in loci other than genes for the target topoisomerases of fluoroquinolones, gyrA and parC, may play a role in the development of fluoroquinolone resistance in Escherichia coli. A series of mutants with increasing resistance to ofloxacin was obtained from an E. coli K-12 strain and five clinical isolates. First-step mutants acquired a gyrA mutation. Second-step mutants reproducibly acquired a phenotype of multiple antibiotic resistance (Mar) and organic solvent tolerance and showed enhanced fluoroquinolone efflux. None of the second-step mutants showed additional topoisomerase mutations. All second-step mutants showed constitutive expression of marA and/or overexpressed soxS. In some third-step mutants, fluoroquinolone efflux was further enhanced compared to that for second-step mutants, even when the mutant had acquired additional topoisomerase mutations. Attempts to circumvent the second-step Mar mutation by induction of the mar locus with sodium salicylate and thus to select for pure topoisomerase mutants at the second step were not successful. At least in vitro, non-target gene mutations accumulate in second- and third-step mutants upon exposure to a fluoroquinolone and typically include, but do not appear to be limited to, mutations in the mar or sox regulons with consequent increas