WorldWideScience

Sample records for resistance genes including

  1. Antimicrobial susceptibility and antibiotic resistance gene transfer analysis of foodborne, clinical, and environmental Listeria spp. isolates including Listeria monocytogenes.

    Science.gov (United States)

    Bertsch, David; Muelli, Mirjam; Weller, Monika; Uruty, Anaïs; Lacroix, Christophe; Meile, Leo

    2014-02-01

    The aims of this study were to assess antibiotic resistance pheno- and genotypes in foodborne, clinical, and environmental Listeria isolates, as well as to elucidate the horizontal gene transfer potential of detected resistance genes. A small fraction of in total 524 Listeria spp. isolates (3.1%) displayed acquired antibiotic resistance mainly to tetracycline (n = 11), but also to clindamycin (n = 4) and trimethoprim (n = 3), which was genotypically confirmed. In two cases, a tetracycline resistance phenotype was observed together with a trimethoprim resistance phenotype, namely in a clinical L. monocytogenes strain and in a foodborne L. innocua isolate. Depending on the applied guidelines, a differing number of isolates (n = 2 or n = 20) showed values for ampicillin that are on the edge between intermediate susceptibility and resistance. Transferability of the antibiotic resistance genes from the Listeria donors, elucidated in vitro by filter matings, was demonstrated for genes located on transposons of the Tn916 family and for an unknown clindamycin resistance determinant. Transfer rates of up to 10(-5) transconjugants per donor were obtained with a L. monocytogenes recipient and up to 10(-7) with an Enterococcus faecalis recipient, respectively. Although the prevalence of acquired antibiotic resistance in Listeria isolates from this study was rather low, the transferability of these resistances enables further spread in the future. This endorses the importance of surveillance of L. monocytogenes and other Listeria spp. in terms of antibiotic susceptibility. © 2014 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

  2. Seawater is a reservoir of multi-resistant Escherichia coli, including strains hosting plasmid-mediated quinolones resistance and extended-spectrum beta-lactamases genes.

    Science.gov (United States)

    Alves, Marta S; Pereira, Anabela; Araújo, Susana M; Castro, Bruno B; Correia, António C M; Henriques, Isabel

    2014-01-01

    The aim of this study was to examine antibiotic resistance (AR) dissemination in coastal water, considering the contribution of different sources of fecal contamination. Samples were collected in Berlenga, an uninhabited island classified as Natural Reserve and visited by tourists for aquatic recreational activities. To achieve our aim, AR in Escherichia coli isolates from coastal water was compared to AR in isolates from two sources of fecal contamination: human-derived sewage and seagull feces. Isolation of E. coli was done on Chromocult agar. Based on genetic typing 414 strains were established. Distribution of E. coli phylogenetic groups was similar among isolates of all sources. Resistances to streptomycin, tetracycline, cephalothin, and amoxicillin were the most frequent. Higher rates of AR were found among seawater and feces isolates, except for last-line antibiotics used in human medicine. Multi-resistance rates in isolates from sewage and seagull feces (29 and 32%) were lower than in isolates from seawater (39%). Seawater AR profiles were similar to those from seagull feces and differed significantly from sewage AR profiles. Nucleotide sequences matching resistance genes bla TEM, sul1, sul2, tet(A), and tet(B), were present in isolates of all sources. Genes conferring resistance to 3rd generation cephalosporins were detected in seawater (bla CTX-M-1 and bla SHV-12) and seagull feces (bla CMY-2). Plasmid-mediated determinants of resistance to quinolones were found: qnrS1 in all sources and qnrB19 in seawater and seagull feces. Our results show that seawater is a relevant reservoir of AR and that seagulls are an efficient vehicle to spread human-associated bacteria and resistance genes. The E. coli resistome recaptured from Berlenga coastal water was mainly modulated by seagulls-derived fecal pollution. The repertoire of resistance genes covers antibiotics critically important for humans, a potential risk for human health.

  3. Seawater is a reservoir of multi-resistant Escherichia coli, including strains hosting plasmid-mediated quinolones resistance and extended-spectrum beta-lactamases genes

    Directory of Open Access Journals (Sweden)

    Marta S. Alves

    2014-08-01

    Full Text Available The aim of this study was to examine antibiotic resistance (AR dissemination in coastal water, considering the contribution of different sources of faecal contamination. Samples were collected in Berlenga, an uninhabited island classified as Natural Reserve and visited by tourists for aquatic recreational activities. To achieve our aim, AR in Escherichia coli isolates from coastal water was compared to AR in isolates from two sources of faecal contamination: human-derived sewage and seagull faeces. Isolation of E. coli was done on Chromocult agar. Based on genetic typing 414 strains were established. Distribution of E. coli phylogenetic groups was similar among isolates of all sources. Resistances to streptomycin, tetracycline, cephalothin and amoxicillin were the most frequent. Higher rates of AR were found among seawater and faeces isolates, except for last-line antibiotics used in human medicine. Multi-resistance rates in isolates from sewage and seagull faeces (29% and 32% were lower than in isolates from seawater (39%. Seawater AR profiles were similar to those from seagull faeces and differed significantly from sewage AR profiles. Nucleotide sequences matching resistance genes blaTEM, sul1, sul2, tet(A and tet(B, were present in isolates of all sources. Genes conferring resistance to 3rd generation cephalosporins were detected in seawater (blaCTX-M-1 and blaSHV-12 and seagull faeces (blaCMY-2. Plasmid-mediated determinants of resistance to quinolones were found: qnrS1 in all sources and qnrB19 in seawater and seagull faeces. Our results show that seawater is a relevant reservoir of AR and that seagulls are an efficient vehicle to spread human-associated bacteria and resistance genes. The E. coli resistome recaptured from Berlenga coastal water was mainly modulated by seagulls-derived faecal pollution. The repertoire of resistance genes covers antibiotics critically important for humans, a potential risk for human health.

  4. A 1,681-locus consensus genetic map of cultivated cucumber including 67 NB-LRR resistance gene homolog and ten gene loci.

    Science.gov (United States)

    Yang, Luming; Li, Dawei; Li, Yuhong; Gu, Xingfang; Huang, Sanwen; Garcia-Mas, Jordi; Weng, Yiqun

    2013-03-25

    Cucumber is an important vegetable crop that is susceptible to many pathogens, but no disease resistance (R) genes have been cloned. The availability of whole genome sequences provides an excellent opportunity for systematic identification and characterization of the nucleotide binding and leucine-rich repeat (NB-LRR) type R gene homolog (RGH) sequences in the genome. Cucumber has a very narrow genetic base making it difficult to construct high-density genetic maps. Development of a consensus map by synthesizing information from multiple segregating populations is a method of choice to increase marker density. As such, the objectives of the present study were to identify and characterize NB-LRR type RGHs, and to develop a high-density, integrated cucumber genetic-physical map anchored with RGH loci. From the Gy14 draft genome, 70 NB-containing RGHs were identified and characterized. Most RGHs were in clusters with uneven distribution across seven chromosomes. In silico analysis indicated that all 70 RGHs had EST support for gene expression. Phylogenetic analysis classified 58 RGHs into two clades: CNL and TNL. Comparative analysis revealed high-degree sequence homology and synteny in chromosomal locations of these RGH members between the cucumber and melon genomes. Fifty-four molecular markers were developed to delimit 67 of the 70 RGHs, which were integrated into a genetic map through linkage analysis. A 1,681-locus cucumber consensus map including 10 gene loci and spanning 730.0 cM in seven linkage groups was developed by integrating three component maps with a bin-mapping strategy. Physically, 308 scaffolds with 193.2 Mbp total DNA sequences were anchored onto this consensus map that covered 52.6% of the 367 Mbp cucumber genome. Cucumber contains relatively few NB-LRR RGHs that are clustered and unevenly distributed in the genome. All RGHs seem to be transcribed and shared significant sequence homology and synteny with the melon genome suggesting conservation of

  5. Genotypic and Antimicrobial Susceptibility of Carbapenem-Resistant Acinetobacter baumannii: Analysis of ISAba Elements and blaOXA-23-like Genes Including A New Variant

    Directory of Open Access Journals (Sweden)

    Abbas eBahador

    2015-11-01

    Full Text Available Carbapenem-resistant Acinetobacter baumannii (CR-AB causes serious nosocomial infections, especially in ICU wards of hospitals, worldwide. Expression of blaOXA genes is the chief mechanism of conferring carbapenem resistance among CR-AB. Although some blaOXA genes have been studied among CR-AB isolates from Iran, their blaOXA-23-like genes have not been investigated. We used a multiplex-PCR to detect Ambler class A, B, and D carbapenemases of 85 isolates, and determined that 34 harbored blaOXA-23-like genes. Amplified fragment length polymorphism (AFLP genotyping, followed by DNA sequencing of blaOXA-23-like amplicons of CR-AB from each AFLP group was used to characterize their blaOXA-23-like genes. We also assessed the antimicrobial susceptibility pattern of CR-AB isolates, and tested whether they harbored insertion sequences ISAba1 and ISAba4. Sequence comparison with reference strain A. baumannii (NCTC12156 revealed five types of mutations in blaOXA-23-like genes; including one novel variant and four mutants that were already reported from China and the USA. All of the blaOXA-23-like genes mutations were associated with increased minimum inhibitory concentrations (MICs against imipenem. ISAba1 and ISAba4 sequences were detected upstream of blaOXA-23 genes in 19% and 7% of isolates, respectively. The isolation of CR-AB with new blaOXA-23 mutations including some that have been reported from the USA and China highlights CR-AB pervasive distribution, which underscores the importance of concerted national and global efforts to control the spread of CR-AB isolates worldwide.

  6. Multidrug-Resistant CTX-M-(15, 9, 2)- and KPC-2-Producing Enterobacter hormaechei and Enterobacter asburiae Isolates Possessed a Set of Acquired Heavy Metal Tolerance Genes Including a Chromosomal sil Operon (for Acquired Silver Resistance).

    Science.gov (United States)

    Andrade, Leonardo N; Siqueira, Thiago E S; Martinez, Roberto; Darini, Ana Lucia C

    2018-01-01

    Bacterial resistance to antibiotics is concern in healthcare-associated infections. On the other hand, bacterial tolerance to other antimicrobials, like heavy metals, has been neglected and underestimated in hospital pathogens. Silver has long been used as an antimicrobial agent and it seems to be an important indicator of heavy metal tolerance. To explore this perspective, we searched for the presence of acquired silver resistance genes ( sil operon: silE, silS, silR, silC, silF, silB, silA , and silP ) and acquired extended-spectrum cephalosporin and carbapenem resistance genes ( bla CTX-M and bla KPC ) in Enterobacter cloacae Complex (EcC) ( n = 27) and Enterobacter aerogenes ( n = 8) isolated from inpatients at a general hospital. Moreover, the genetic background of the silA (silver-efflux pump) and the presence of other acquired heavy metal tolerance genes, pcoD (copper-efflux pump), arsB (arsenite-efflux pump), terF (tellurite resistance protein), and merA (mercuric reductase) were also investigated. Outstandingly, 21/27 (78%) EcC isolates harbored silA gene located in the chromosome. Complete sil operon was found in 19/21 silA -positive EcC isolates. Interestingly, 8/20 (40%) E. hormaechei and 5/6 (83%) E. asburiae co-harbored silA/pcoD genes and bla CTX-M-(15,2,or9) and/or bla KPC-2 genes. Frequent occurrences of arsB, terF , and merA genes were detected, especially in silA/pcoD -positive, multidrug-resistant (MDR) and/or CTX-M-producing isolates. Our study showed co-presence of antibiotic and heavy metal tolerance genes in MDR EcC isolates. In our viewpoint, there are few studies regarding to bacterial heavy metal tolerance and we call attention for more investigations and discussion about this issue in different hospital pathogens.

  7. Multidrug-Resistant CTX-M-(15, 9, 2- and KPC-2-Producing Enterobacter hormaechei and Enterobacter asburiae Isolates Possessed a Set of Acquired Heavy Metal Tolerance Genes Including a Chromosomal sil Operon (for Acquired Silver Resistance

    Directory of Open Access Journals (Sweden)

    Leonardo N. Andrade

    2018-03-01

    Full Text Available Bacterial resistance to antibiotics is concern in healthcare-associated infections. On the other hand, bacterial tolerance to other antimicrobials, like heavy metals, has been neglected and underestimated in hospital pathogens. Silver has long been used as an antimicrobial agent and it seems to be an important indicator of heavy metal tolerance. To explore this perspective, we searched for the presence of acquired silver resistance genes (sil operon: silE, silS, silR, silC, silF, silB, silA, and silP and acquired extended-spectrum cephalosporin and carbapenem resistance genes (blaCTX−M and blaKPC in Enterobacter cloacae Complex (EcC (n = 27 and Enterobacter aerogenes (n = 8 isolated from inpatients at a general hospital. Moreover, the genetic background of the silA (silver-efflux pump and the presence of other acquired heavy metal tolerance genes, pcoD (copper-efflux pump, arsB (arsenite-efflux pump, terF (tellurite resistance protein, and merA (mercuric reductase were also investigated. Outstandingly, 21/27 (78% EcC isolates harbored silA gene located in the chromosome. Complete sil operon was found in 19/21 silA-positive EcC isolates. Interestingly, 8/20 (40% E. hormaechei and 5/6 (83% E. asburiae co-harbored silA/pcoD genes and blaCTX−M−(15,2,or9 and/or blaKPC−2 genes. Frequent occurrences of arsB, terF, and merA genes were detected, especially in silA/pcoD-positive, multidrug-resistant (MDR and/or CTX-M-producing isolates. Our study showed co-presence of antibiotic and heavy metal tolerance genes in MDR EcC isolates. In our viewpoint, there are few studies regarding to bacterial heavy metal tolerance and we call attention for more investigations and discussion about this issue in different hospital pathogens.

  8. Major haplotype divergence including multiple germin-like protein genes, at the wheat Sr2 adult plant stem rust resistance locus

    Czech Academy of Sciences Publication Activity Database

    Mago, R.; Tabe, L.; Vautrin, S.; Šimková, Hana; Kubaláková, Marie; Upadhyaya, N.; Berges, H.; Kong, X.Y.; Breen, J.; Doležel, Jaroslav; Appels, R.; Ellis, J.G.; Spielmeyer, W.

    2014-01-01

    Roč. 14, č. 379 (2014) ISSN 1471-2229 R&D Projects: GA ČR GBP501/12/G090; GA MŠk(CZ) LO1204 Institutional support: RVO:61389030 Keywords : Adult plant resistance (APR) * Map-based cloning * Sr2 Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.813, year: 2014

  9. Resistance Genes in Global Crop Breeding Networks.

    Science.gov (United States)

    Garrett, K A; Andersen, K F; Asche, F; Bowden, R L; Forbes, G A; Kulakow, P A; Zhou, B

    2017-10-01

    Resistance genes are a major tool for managing crop diseases. The networks of crop breeders who exchange resistance genes and deploy them in varieties help to determine the global landscape of resistance and epidemics, an important system for maintaining food security. These networks function as a complex adaptive system, with associated strengths and vulnerabilities, and implications for policies to support resistance gene deployment strategies. Extensions of epidemic network analysis can be used to evaluate the multilayer agricultural networks that support and influence crop breeding networks. Here, we evaluate the general structure of crop breeding networks for cassava, potato, rice, and wheat. All four are clustered due to phytosanitary and intellectual property regulations, and linked through CGIAR hubs. Cassava networks primarily include public breeding groups, whereas others are more mixed. These systems must adapt to global change in climate and land use, the emergence of new diseases, and disruptive breeding technologies. Research priorities to support policy include how best to maintain both diversity and redundancy in the roles played by individual crop breeding groups (public versus private and global versus local), and how best to manage connectivity to optimize resistance gene deployment while avoiding risks to the useful life of resistance genes. [Formula: see text] Copyright © 2017 The Author(s). This is an open access article distributed under the CC BY 4.0 International license .

  10. Obesity genes and insulin resistance.

    Science.gov (United States)

    Belkina, Anna C; Denis, Gerald V

    2010-10-01

    The exploding prevalence of insulin resistance and Type 2 diabetes (T2D) linked to obesity has become an alarming public health concern. Worldwide, approximately 171 million people suffer from obesity-induced diabetes and public health authorities expect this situation to deteriorate rapidly. An interesting clinical population of 'metabolically healthy but obese' (MHO) cases is relatively protected from T2D and its associated cardiovascular risk. The molecular basis for this protection is not well understood but is likely to involve reduced inflammatory responses. The inflammatory cells and pathways that respond to overnutrition are the primary subject matter for this review. The chance discovery of a genetic mutation in the Brd2 gene, which is located in the class II major histocompatibility complex and makes mice enormously fat but protects them from diabetes, offers revolutionary new insights into the cellular mechanisms that link obesity to insulin resistance and T2D. These Brd2-hypomorphic mice have reduced inflammation in fat that is normally associated with insulin resistance, and resemble MHO patients, suggesting novel therapeutic pathways for obese patients at risk for T2D. Deeper understanding of the functional links between genes that control inflammatory responses to diet-induced obesity is crucial to the development of therapies for obese, insulin-resistant patients.

  11. Linezolid susceptibility in Helicobacter pylori, including strains with multidrug resistance.

    Science.gov (United States)

    Boyanova, Lyudmila; Evstatiev, Ivailo; Gergova, Galina; Yaneva, Penka; Mitov, Ivan

    2015-12-01

    Only a few studies have evaluated Helicobacter pylori susceptibility to linezolid. The aim of the present study was to assess linezolid susceptibility in H. pylori, including strains with double/multidrug resistance. The susceptibility of 53 H. pylori strains was evaluated by Etest and a breakpoint susceptibility testing method. Helicobacter pylori resistance rates were as follows: amoxicillin, 1.9%; metronidazole, 37.7%; clarithromycin, 17.0%; tetracycline, 1.9%; levofloxacin, 24.5%; and linezolid (>4 mg/L), 39.6%. The linezolid MIC50 value was 31.2-fold higher than that of clarithromycin and 10.5-fold higher than that of levofloxacin; however, 4 of 11 strains with double/multidrug resistance were linezolid-susceptible. The MIC range of the oxazolidinone agent was larger (0.125-64 mg/L) compared with those in the previous two reports. The linezolid resistance rate was 2.2-fold higher in metronidazole-resistant strains and in strains resistant to at least one antibiotic compared with the remaining strains. Briefly, linezolid was less active against H. pylori compared with clarithromycin and levofloxacin, and linezolid resistance was linked to resistance to metronidazole as well as to resistance to at least one antibiotic. However, linezolid activity against some strains with double/multidrug resistance may render the agent appropriate to treat some associated H. pylori infections following in vitro susceptibility testing of the strains. Clinical trials are required to confirm this suggestion. Copyright © 2015 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

  12. Identification of acquired antimicrobial resistance genes

    DEFF Research Database (Denmark)

    Zankari, Ea; Hasman, Henrik; Cosentino, Salvatore

    2012-01-01

    ObjectivesIdentification of antimicrobial resistance genes is important for understanding the underlying mechanisms and the epidemiology of antimicrobial resistance. As the costs of whole-genome sequencing (WGS) continue to decline, it becomes increasingly available in routine diagnostic laborato......ObjectivesIdentification of antimicrobial resistance genes is important for understanding the underlying mechanisms and the epidemiology of antimicrobial resistance. As the costs of whole-genome sequencing (WGS) continue to decline, it becomes increasingly available in routine diagnostic...... laboratories and is anticipated to substitute traditional methods for resistance gene identification. Thus, the current challenge is to extract the relevant information from the large amount of generated data.MethodsWe developed a web-based method, ResFinder that uses BLAST for identification of acquired...... antimicrobial resistance genes in whole-genome data. As input, the method can use both pre-assembled, complete or partial genomes, and short sequence reads from four different sequencing platforms. The method was evaluated on 1862 GenBank files containing 1411 different resistance genes, as well as on 23 de...

  13. Identification of astrocytoma associated genes including cell surface markers

    International Nuclear Information System (INIS)

    Boon, Kathy; Edwards, Jennifer B; Eberhart, Charles G; Riggins, Gregory J

    2004-01-01

    Despite intense effort the treatment options for the invasive astrocytic tumors are still limited to surgery and radiation therapy, with chemotherapy showing little or no increase in survival. The generation of Serial Analysis of Gene Expression (SAGE) profiles is expected to aid in the identification of astrocytoma-associated genes and highly expressed cell surface genes as molecular therapeutic targets. SAGE tag counts can be easily added to public expression databases and quickly disseminated to research efforts worldwide. We generated and analyzed the SAGE transcription profiles of 25 primary grade II, III and IV astrocytomas [1]. These profiles were produced as part of the Cancer Genome Anatomy Project's SAGE Genie [2], and were used in an in silico search for candidate therapeutic targets by comparing astrocytoma to normal brain transcription. Real-time PCR and immunohistochemistry were used for the validation of selected candidate target genes in 2 independent sets of primary tumors. A restricted set of tumor-associated genes was identified for each grade that included genes not previously associated with astrocytomas (e.g. VCAM1, SMOC1, and thymidylate synthetase), with a high percentage of cell surface genes. Two genes with available antibodies, Aquaporin 1 and Topoisomerase 2A, showed protein expression consistent with transcript level predictions. This survey of transcription in malignant and normal brain tissues reveals a small subset of human genes that are activated in malignant astrocytomas. In addition to providing insights into pathway biology, we have revealed and quantified expression for a significant portion of cell surface and extra-cellular astrocytoma genes

  14. Candidate genes for performance in horses, including monocarboxylate transporters

    Directory of Open Access Journals (Sweden)

    Inaê Cristina Regatieri

    Full Text Available ABSTRACT: Some horse breeds are highly selected for athletic activities. The athletic potential of each animal can be measured by its performance in sports. High athletic performance depends on the animal capacity to produce energy through aerobic and anaerobic metabolic pathways, among other factors. Transmembrane proteins called monocarboxylate transporters, mainly the isoform 1 (MCT1 and its ancillary protein CD147, can help the organism to adapt to physiological stress caused by physical exercise, transporting lactate and H+ ions. Horse breeds are selected for different purposes so we might expect differences in the amount of those proteins and in the genotypic frequencies for genes that play a significant role in the performance of the animals. The study of MCT1 and CD147 gene polymorphisms, which can affect the formation of the proteins and transport of lactate and H+, can provide enough information to be used for selection of athletic horses increasingly resistant to intense exercise. Two other candidate genes, the PDK4 and DMRT3, have been associated with athletic potential and indicated as possible markers for performance in horses. The oxidation of fatty acids is highly effective in generating ATP and is controlled by the expression of PDK4 (pyruvate dehydrogenase kinase, isozyme 4 in skeletal muscle during and after exercise. The doublesex and mab-3 related transcription factor 3 (DMRT3 gene encodes an important transcription factor in the setting of spinal cord circuits controlling movement in vertebrates and may be associated with gait performance in horses. This review describes how the monocarboxylate transporters work during physical exercise in athletic horses and the influence of polymorphisms in candidate genes for athletic performance in horses.

  15. Environmental cycle of antibiotic resistance encoded genes: A systematic review

    Directory of Open Access Journals (Sweden)

    R. ghanbari

    2017-12-01

    Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.

  16. Pediatric fecal microbiota harbor diverse and novel antibiotic resistance genes.

    Directory of Open Access Journals (Sweden)

    Aimée M Moore

    Full Text Available Emerging antibiotic resistance threatens human health. Gut microbes are an epidemiologically important reservoir of resistance genes (resistome, yet prior studies indicate that the true diversity of gut-associated resistomes has been underestimated. To deeply characterize the pediatric gut-associated resistome, we created metagenomic recombinant libraries in an Escherichia coli host using fecal DNA from 22 healthy infants and children (most without recent antibiotic exposure, and performed functional selections for resistance to 18 antibiotics from eight drug classes. Resistance-conferring DNA fragments were sequenced (Illumina HiSeq 2000, and reads assembled and annotated with the PARFuMS computational pipeline. Resistance to 14 of the 18 antibiotics was found in stools of infants and children. Recovered genes included chloramphenicol acetyltransferases, drug-resistant dihydrofolate reductases, rRNA methyltransferases, transcriptional regulators, multidrug efflux pumps, and every major class of beta-lactamase, aminoglycoside-modifying enzyme, and tetracycline resistance protein. Many resistance-conferring sequences were mobilizable; some had low identity to any known organism, emphasizing cryptic organisms as potentially important resistance reservoirs. We functionally confirmed three novel resistance genes, including a 16S rRNA methylase conferring aminoglycoside resistance, and two tetracycline-resistance proteins nearly identical to a bifidobacterial MFS transporter (B. longum s. longum JDM301. We provide the first report to our knowledge of resistance to folate-synthesis inhibitors conferred by a predicted Nudix hydrolase (part of the folate synthesis pathway. This functional metagenomic survey of gut-associated resistomes, the largest of its kind to date, demonstrates that fecal resistomes of healthy children are far more diverse than previously suspected, that clinically relevant resistance genes are present even without recent selective

  17. Persistence of antimicrobial resistance genes from sows to finisher pigs

    DEFF Research Database (Denmark)

    Birkegård, Anna Camilla; Halasa, Tariq; Folkesson, Anders

    2018-01-01

    Antimicrobial resistance in pigs has been under scrutiny for many years. However, many questions remain unanswered, including whether the initial antimicrobial resistance level of a pig will influence the antimicrobial resistance found at slaughter. Faecal samples from finishers pigs from 681 farms...... and from sows from 82 farms were collected, and levels of seven antimicrobial resistance genes, ermB, ermF, sulI, sulII, tet(M), tet(O), and tet(W), were quantified by high-capacity qPCR. There were 40 pairs of observations where the finishers were born in the farms of the sows. The objective of this study...

  18. Expression Study of Banana Pathogenic Resistance Genes

    Directory of Open Access Journals (Sweden)

    Fenny M. Dwivany

    2016-10-01

    Full Text Available Banana is one of the world's most important trade commodities. However, infection of banana pathogenic fungi (Fusarium oxysporum race 4 is one of the major causes of decreasing production in Indonesia. Genetic engineering has become an alternative way to control this problem by isolating genes that involved in plant defense mechanism against pathogens. Two of the important genes are API5 and ChiI1, each gene encodes apoptosis inhibitory protein and chitinase enzymes. The purpose of this study was to study the expression of API5 and ChiI1 genes as candidate pathogenic resistance genes. The amplified fragments were then cloned, sequenced, and confirmed with in silico studies. Based on sequence analysis, it is showed that partial API5 gene has putative transactivation domain and ChiI1 has 9 chitinase family GH19 protein motifs. Data obtained from this study will contribute in banana genetic improvement.

  19. Resistive mode in rotating plasma columns including the hall current

    International Nuclear Information System (INIS)

    Galvao, R.M.O.

    1983-01-01

    A new resistive mode is shown to exist in rotating plasma columns. The mode is localized in the neighbourhood of the radius where the angular velocity of the bulk plasma is equal to minus half the local angular velocity of the ions. This singular point is caused by the Hall term in the generalized Ohm law. The growth rate of the mode scales with eta sup(1/2), where eta is the plasma resistivity. (Author) [pt

  20. Kinetic models of gene expression including non-coding RNAs

    Energy Technology Data Exchange (ETDEWEB)

    Zhdanov, Vladimir P., E-mail: zhdanov@catalysis.r

    2011-03-15

    In cells, genes are transcribed into mRNAs, and the latter are translated into proteins. Due to the feedbacks between these processes, the kinetics of gene expression may be complex even in the simplest genetic networks. The corresponding models have already been reviewed in the literature. A new avenue in this field is related to the recognition that the conventional scenario of gene expression is fully applicable only to prokaryotes whose genomes consist of tightly packed protein-coding sequences. In eukaryotic cells, in contrast, such sequences are relatively rare, and the rest of the genome includes numerous transcript units representing non-coding RNAs (ncRNAs). During the past decade, it has become clear that such RNAs play a crucial role in gene expression and accordingly influence a multitude of cellular processes both in the normal state and during diseases. The numerous biological functions of ncRNAs are based primarily on their abilities to silence genes via pairing with a target mRNA and subsequently preventing its translation or facilitating degradation of the mRNA-ncRNA complex. Many other abilities of ncRNAs have been discovered as well. Our review is focused on the available kinetic models describing the mRNA, ncRNA and protein interplay. In particular, we systematically present the simplest models without kinetic feedbacks, models containing feedbacks and predicting bistability and oscillations in simple genetic networks, and models describing the effect of ncRNAs on complex genetic networks. Mathematically, the presentation is based primarily on temporal mean-field kinetic equations. The stochastic and spatio-temporal effects are also briefly discussed.

  1. Gene pyramiding as a Bt resistance management strategy: How ...

    African Journals Online (AJOL)

    Reports on the emergence of insect resistance to Bacillus thuringiensis delta endotoxins have raised doubts on the sustainability of Bt-toxin based pest management technologies. Corporate industry has responded to this challenge with innovations that include gene pyramiding among others. Pyramiding entails stacking ...

  2. Antibiotic resistance and resistance genes in Escherichia coli from poultry farms, southwest Nigeria.

    Science.gov (United States)

    Adelowo, Olawale O; Fagade, Obasola E; Agersø, Yvonne

    2014-09-12

    This study investigated the mechanisms of resistance in 36 E. coli isolated from waste, litter, soil and water samples collected from poultry farms in Southwestern Nigeria. Minimum inhibitory concentration (MIC) distributions of the isolates were determined using the methods of the Clinical and Laboratory Standard Institute and resistance genes detected by PCR. A total of 30 isolates (94%) showed resistance to more than one antimicrobial. Percentage resistance was: tetracycline 81%, sulphamethoxazole 67%, streptomycin 56%, trimethoprim 47 %, ciprofloxacin 42%, ampicillin 36%, spectinomycin 28%, nalidixic acid 25%, chloramphenicol 22%, neomycin 14%, gentamicin 8%, amoxicillin-clavulanate, ceftiofur, cefotaxime, colistin, florfenicol and apramycin 0%. Resistance genes found among the isolates include bla-TEM (85%), sul2 (67%), sul3 (17%), aadA (65%), strA (70%), strB (61%), catA1 (25%), cmlA1 (13%), tetA (21%) and tetB (17%). Class 1 and 2 integrons were found in five (14%) and six (17%) isolates, respectively, while one isolate was positive for both classes of integrons. Seven out of eight isolates with resistance to ciprofloxacin and MIC ≤ 32 mg/L to nalidixic acid contained qnrS genes. Our findings provided additional evidence that the poultry production environment in Nigeria represents an important reservoir of antibiotic resistance genes such as qnrS that may spread from livestock production farms to human populations via manure and water.

  3. Major Gene for Field Stem Rust Resistance Co-Locates with Resistance Gene Sr12 in 'Thatcher' Wheat.

    Science.gov (United States)

    Hiebert, Colin W; Kolmer, James A; McCartney, Curt A; Briggs, Jordan; Fetch, Tom; Bariana, Harbans; Choulet, Frederic; Rouse, Matthew N; Spielmeyer, Wolfgang

    2016-01-01

    Stem rust, caused by Puccinia graminis (Pgt), is a damaging disease of wheat that can be controlled by utilizing effective stem rust resistance genes. 'Thatcher' wheat carries complex resistance to stem rust that is enhanced in the presence of the resistance gene Lr34. The purpose of this study was to examine APR in 'Thatcher' and look for genetic interactions with Lr34. A RIL population was tested for stem rust resistance in field nurseries in Canada, USA, and Kenya. BSA was used to find SNP markers associated with reduced stem rust severity. A major QTL was identified on chromosome 3BL near the centromere in all environments. Seedling testing showed that Sr12 mapped to the same region as the QTL for APR. The SNP markers were physically mapped and the region carrying the resistance was searched for sequences with homology to members of the NB-LRR resistance gene family. SNP marker from one NB-LRR-like sequence, NB-LRR3 co-segregated with Sr12. Two additional populations, including one that lacked Lr34, were tested in field nurseries. NB-LRR3 mapped near the maximum LOD for reduction in stem rust severity in both populations. Lines from a population that segregated for Sr12 and Lr34 were tested for seedling Pgt biomass and infection type, as well as APR to field stem rust which showed an interaction between the genes. We concluded that Sr12, or a gene closely linked to Sr12, was responsible for 'Thatcher'-derived APR in several environments and this resistance was enhanced in the presence of Lr34.

  4. Major Gene for Field Stem Rust Resistance Co-Locates with Resistance Gene Sr12 in ‘Thatcher’ Wheat

    Science.gov (United States)

    Hiebert, Colin W.; Kolmer, James A.; McCartney, Curt A.; Briggs, Jordan; Fetch, Tom; Bariana, Harbans; Choulet, Frederic; Rouse, Matthew N.; Spielmeyer, Wolfgang

    2016-01-01

    Stem rust, caused by Puccinia graminis (Pgt), is a damaging disease of wheat that can be controlled by utilizing effective stem rust resistance genes. ‘Thatcher’ wheat carries complex resistance to stem rust that is enhanced in the presence of the resistance gene Lr34. The purpose of this study was to examine APR in ‘Thatcher’ and look for genetic interactions with Lr34. A RIL population was tested for stem rust resistance in field nurseries in Canada, USA, and Kenya. BSA was used to find SNP markers associated with reduced stem rust severity. A major QTL was identified on chromosome 3BL near the centromere in all environments. Seedling testing showed that Sr12 mapped to the same region as the QTL for APR. The SNP markers were physically mapped and the region carrying the resistance was searched for sequences with homology to members of the NB-LRR resistance gene family. SNP marker from one NB-LRR-like sequence, NB-LRR3 co-segregated with Sr12. Two additional populations, including one that lacked Lr34, were tested in field nurseries. NB-LRR3 mapped near the maximum LOD for reduction in stem rust severity in both populations. Lines from a population that segregated for Sr12 and Lr34 were tested for seedling Pgt biomass and infection type, as well as APR to field stem rust which showed an interaction between the genes. We concluded that Sr12, or a gene closely linked to Sr12, was responsible for ‘Thatcher’-derived APR in several environments and this resistance was enhanced in the presence of Lr34. PMID:27309724

  5. Antibiotic resistance and resistance genes in Escherichia coli from poultry farms, southwest Nigeria

    DEFF Research Database (Denmark)

    Adelowo, Olawale O.; Fagade, Obasola E.; Agersø, Yvonne

    2014-01-01

    %, ampicillin 36%, spectinomycin 28%, nalidixic acid 25%, chloramphenicol 22%, neomycin 14%, gentamicin 8%, amoxicillin-clavulanate, ceftiofur, cefotaxime, colistin, florfenicol and apramycin 0%. Resistance genes found among the isolates include bla-TEM (85%), sul2 (67%), sul3 (17%), aadA (65%), strA (70%), str...

  6. IGSA: Individual Gene Sets Analysis, including Enrichment and Clustering.

    Science.gov (United States)

    Wu, Lingxiang; Chen, Xiujie; Zhang, Denan; Zhang, Wubing; Liu, Lei; Ma, Hongzhe; Yang, Jingbo; Xie, Hongbo; Liu, Bo; Jin, Qing

    2016-01-01

    Analysis of gene sets has been widely applied in various high-throughput biological studies. One weakness in the traditional methods is that they neglect the heterogeneity of genes expressions in samples which may lead to the omission of some specific and important gene sets. It is also difficult for them to reflect the severities of disease and provide expression profiles of gene sets for individuals. We developed an application software called IGSA that leverages a powerful analytical capacity in gene sets enrichment and samples clustering. IGSA calculates gene sets expression scores for each sample and takes an accumulating clustering strategy to let the samples gather into the set according to the progress of disease from mild to severe. We focus on gastric, pancreatic and ovarian cancer data sets for the performance of IGSA. We also compared the results of IGSA in KEGG pathways enrichment with David, GSEA, SPIA, ssGSEA and analyzed the results of IGSA clustering and different similarity measurement methods. Notably, IGSA is proved to be more sensitive and specific in finding significant pathways, and can indicate related changes in pathways with the severity of disease. In addition, IGSA provides with significant gene sets profile for each sample.

  7. Organization of a resistance gene cluster linked to rhizomania resistance in sugar beet

    Science.gov (United States)

    Genetic resistance to rhizomania has been in use for over 40 years. Characterization of the molecular basis for susceptibility and resistance has proved challenging. Nucleotide-binding leucine-rich-repeat-containing (NB-LRR) genes have been implicated in numerous gene-for-gene resistance interaction...

  8. Host range of antibiotic resistance genes in wastewater treatment plant influent and effluent.

    Science.gov (United States)

    Hultman, Jenni; Tamminen, Manu; Pärnänen, Katariina; Cairns, Johannes; Karkman, Antti; Virta, Marko

    2018-04-01

    Wastewater treatment plants (WWTPs) collect wastewater from various sources for a multi-step treatment process. By mixing a large variety of bacteria and promoting their proximity, WWTPs constitute potential hotspots for the emergence of antibiotic resistant bacteria. Concerns have been expressed regarding the potential of WWTPs to spread antibiotic resistance genes (ARGs) from environmental reservoirs to human pathogens. We utilized epicPCR (Emulsion, Paired Isolation and Concatenation PCR) to detect the bacterial hosts of ARGs in two WWTPs. We identified the host distribution of four resistance-associated genes (tetM, int1, qacEΔ1and blaOXA-58) in influent and effluent. The bacterial hosts of these resistance genes varied between the WWTP influent and effluent, with a generally decreasing host range in the effluent. Through 16S rRNA gene sequencing, it was determined that the resistance gene carrying bacteria include both abundant and rare taxa. Our results suggest that the studied WWTPs mostly succeed in decreasing the host range of the resistance genes during the treatment process. Still, there were instances where effluent contained resistance genes in bacterial groups not carrying these genes in the influent. By permitting exhaustive profiling of resistance-associated gene hosts in WWTP bacterial communities, the application of epicPCR provides a new level of precision to our resistance gene risk estimates.

  9. Dissemination of antibiotic resistance genes from antibiotic producers to pathogens

    DEFF Research Database (Denmark)

    Jiang, Xinglin; Ellabaan, Mostafa M Hashim; Charusanti, Pep

    2017-01-01

    It has been hypothesized that some antibiotic resistance genes (ARGs) found in pathogenic bacteria derive from antibiotic-producing actinobacteria. Here we provide bioinformatic and experimental evidence supporting this hypothesis. We identify genes in proteobacteria, including some pathogens...... and experimentally test a 'carry-back' mechanism for the transfer, involving conjugative transfer of a carrier sequence from proteobacteria to actinobacteria, recombination of the carrier sequence with the actinobacterial ARG, followed by natural transformation of proteobacteria with the carrier-sandwiched ARG. Our...... results support the existence of ancient and, possibly, recent transfers of ARGs from antibiotic-producing actinobacteria to proteobacteria, and provide evidence for a defined mechanism....

  10. Transcriptome profiling and digital gene expression analysis of genes associated with salinity resistance in peanut

    Directory of Open Access Journals (Sweden)

    Jiongming Sui

    2018-03-01

    Full Text Available Background: Soil salinity can significantly reduce crop production, but the molecular mechanism of salinity tolerance in peanut is poorly understood. A mutant (S1 with higher salinity resistance than its mutagenic parent HY22 (S3 was obtained. Transcriptome sequencing and digital gene expression (DGE analysis were performed with leaves of S1 and S3 before and after plants were irrigated with 250 mM NaCl. Results: A total of 107,725 comprehensive transcripts were assembled into 67,738 unigenes using TIGR Gene Indices clustering tools (TGICL. All unigenes were searched against the euKaryotic Ortholog Groups (KOG, gene ontology (GO and Kyoto Encyclopedia of Genes and Genomes (KEGG databases, and these unigenes were assigned to 26 functional KOG categories, 56 GO terms, 32 KEGG groups, respectively. In total 112 differentially expressed genes (DEGs between S1 and S3 after salinity stress were screened, among them, 86 were responsive to salinity stress in S1 and/or S3. These 86 DEGs included genes that encoded the following kinds of proteins that are known to be involved in resistance to salinity stress: late embryogenesis abundant proteins (LEAs, major intrinsic proteins (MIPs or aquaporins, metallothioneins (MTs, lipid transfer protein (LTP, calcineurin B-like protein-interacting protein kinases (CIPKs, 9-cis-epoxycarotenoid dioxygenase (NCED and oleosins, etc. Of these 86 DEGs, 18 could not be matched with known proteins. Conclusion: The results from this study will be useful for further research on the mechanism of salinity resistance and will provide a useful gene resource for the variety breeding of salinity resistance in peanut. Keywords: Digital gene expression, Gene, Mutant, NaCl, Peanut (Arachis hypogaea L., RNA-seq, Salinity stress, Salinity tolerance, Soil salinity, Transcripts, Unigenes

  11. Alteration of gene expression and DNA methylation in drug-resistant gastric cancer.

    Science.gov (United States)

    Maeda, Osamu; Ando, Takafumi; Ohmiya, Naoki; Ishiguro, Kazuhiro; Watanabe, Osamu; Miyahara, Ryoji; Hibi, Yoko; Nagai, Taku; Yamada, Kiyofumi; Goto, Hidemi

    2014-04-01

    The mechanisms of drug resistance in cancer are not fully elucidated. To study the drug resistance of gastric cancer, we analyzed gene expression and DNA methylation profiles of 5-fluorouracil (5-FU)- and cisplatin (CDDP)-resistant gastric cancer cells and biopsy specimens. Drug-resistant gastric cancer cells were established with culture for >10 months in a medium containing 5-FU or CDDP. Endoscopic biopsy specimens were obtained from gastric cancer patients who underwent chemotherapy with oral fluoropyrimidine S-1 and CDDP. Gene expression and DNA methylation analyses were performed using microarray, and validated using real-time PCR and pyrosequencing, respectively. Out of 17,933 genes, 541 genes commonly increased and 569 genes decreased in both 5-FU- and CDDP-resistant AGS cells. Genes with expression changed by drugs were related to GO term 'extracellular region' and 'p53 signaling pathway' in both 5-FU- and CDDP-treated cells. Expression of 15 genes including KLK13 increased and 12 genes including ETV7 decreased, in both drug-resistant cells and biopsy specimens of two patients after chemotherapy. Out of 10,365 genes evaluated with both expression microarray and methylation microarray, 74 genes were hypermethylated and downregulated, or hypomethylated and upregulated in either 5-FU-resistant or CDDP-resistant cells. Of these genes, expression of 21 genes including FSCN1, CPT1C and NOTCH3, increased from treatment with a demethylating agent. There are alterations of gene expression and DNA methylation in drug-resistant gastric cancer; they may be related to mechanisms of drug resistance and may be useful as biomarkers of gastric cancer drug sensitivity.

  12. Multi drug resistance to cancer chemotherapy: Genes involved and blockers

    International Nuclear Information System (INIS)

    Sayed-Ahmed, Mohamed M.

    2007-01-01

    During the last three decades, important and considerable research efforts had been performed to investigate the mechanism through which cancer cells overcome the cytotoxic effects of a variety of chemotherapeutic drugs. Most of the previously published work has been focused on the resistance of tumor cells to those anticancer drugs of natural source. Multidrug resistance (MDR) is a cellular cross-resistance to a broad spectrum of natural products used in cancer chemotherapy and is believed to be the major cause of the therapeutic failures of the drugs belonging to different naturally obtained or semisynthetic groups including vinca alkaloids, taxans, epipodophyllotoxins and certain antibiotics. This phenomenon results from overexpression of four MDR genes and their corresponding proteins that act as membrane-bound ATP consuming pumps. These proteins mediate the efflux of many structurally and functionally unrelated anticancer drugs of natural source. MDR may be intrinsic or acquired following exposure to chemotherapy. The existence of intrinsically resistant tumor cell clone before and following chemotherapeutic treatment has been associated with a worse final outcome because of increased incidence of distant metasis. In view of irreplaceability of natural product anticancer drugs as effective chemotherapeutic agents, and in view of MDR as a major obstacle to successful chemotherapy, this review is aimed to highlight the genes involved in MDR, classical MDR blockers and gene therapy approaches to overcome MDR. (author)

  13. The diversity of antimicrobial resistance genes among staphylococci of animal origin.

    Science.gov (United States)

    Wendlandt, Sarah; Feßler, Andrea T; Monecke, Stefan; Ehricht, Ralf; Schwarz, Stefan; Kadlec, Kristina

    2013-08-01

    Staphylococci of animal origin harbor a wide variety of resistance genes. So far, more than 40 different resistance genes have been identified in staphylococci from animals. This includes genes that confer resistance to virtually all classes of antimicrobial agents approved for use in animals, such as penicillins, cephalosporins, tetracyclines, macrolides, lincosamides, phenicols, aminoglycosides, aminocyclitols, pleuromutilins, and diaminopyrimidines. The gene products of some of these resistance genes confer resistance to only specific members of a class of antimicrobial agents, whereas others confer resistance to the entire class or even to members of different classes of antimicrobial agents. The resistance mechanisms specified by the resistance genes fall into three major categories: (i) enzymatic inactivation, (ii) active efflux, or (iii) protection/modification/replacement of the cellular target sites of the antimicrobial agents. Mobile genetic elements, in particular plasmids and transposons, play a major role as carriers of antimicrobial resistance genes in animal staphylococci. They facilitate the exchange of resistance genes with staphylococci of human origin but also with other Gram-positive bacteria. Copyright © 2013 Elsevier GmbH. All rights reserved.

  14. Antibiotic resistance genes in anaerobic bacteria isolated from primary dental root canal infections.

    Science.gov (United States)

    Rôças, Isabela N; Siqueira, José F

    2012-12-01

    Fourty-one bacterial strains isolated from infected dental root canals and identified by 16S rRNA gene sequence were screened for the presence of 14 genes encoding resistance to beta-lactams, tetracycline and macrolides. Thirteen isolates (32%) were positive for at least one of the target antibiotic resistance genes. These strains carrying at least one antibiotic resistance gene belonged to 11 of the 26 (42%) infected root canals sampled. Two of these positive cases had two strains carrying resistance genes. Six out of 7 Fusobacterium strains harbored at least one of the target resistance genes. One Dialister invisus strain was positive for 3 resistance genes, and 4 other strains carried two of the target genes. Of the 6 antibiotic resistance genes detected in root canal strains, the most prevalent were blaTEM (17% of the strains), tetW (10%), and ermC (10%). Some as-yet-uncharacterized Fusobacterium and Prevotella isolates were positive for blaTEM, cfxA and tetM. Findings demonstrated that an unexpectedly large proportion of dental root canal isolates, including as-yet-uncharacterized strains previously regarded as uncultivated phylotypes, can carry antibiotic resistance genes. Copyright © 2012 Elsevier Ltd. All rights reserved.

  15. Identification of Gene Resistance to Avian InfluenzaVirus (Mx Gene among Wild Waterbirds

    Directory of Open Access Journals (Sweden)

    Dewi Elfidasari

    2013-04-01

    Full Text Available The Mx gene is an antiviral gene used to determine the resistance or the susceptibility to different types of viruses, including the Avian Influenza (AI virus subtype H5N1. The AI virus subtype H5N1 infection in chickens causes Mx gene polymorphism. The Mx+ gene shows resistant to the AIvirus subtype H5N1, whereas the Mx-gene shows signs of susceptible. The objective of thisresearch was to detect the Mxgene in wild aquatic birds using the Polymerase Chain Reaction Restriction Fragment Length Polymorphism (PCR-RFLP method with the primer pairs F2 and NE-R2/R and the RsaI restriction enzyme. DNA samples were obtained from eight species of wild waterbirds with positive and negative exposure to the AI virus subtype H5N1. DNA amplification results showed that the Mxgene in wild aquatic birds is found in a 100 bp fragment, which is the same as the Mx gene found in chickens. However, unlike chickens, the Mxgene in wild aquatic birds did not show any polymorphism. This study proves that Mx- based resistance to AI virus subtype H5N1 in different in wild birds than in chickens.

  16. Dissection of Resistance Genes to Pseudomonas syringae pv. phaseolicola in UI3 Common Bean Cultivar.

    Science.gov (United States)

    González, Ana M; Godoy, Luís; Santalla, Marta

    2017-11-23

    Few quantitative trait loci have been mapped for resistance to Pseudomonas syringae pv. phaseolicola in common bean. Two F₂ populations were developed from the host differential UI3 cultivar. The objective of this study was to further characterize the resistance to races 1, 5, 7 and 9 of Psp included in UI3. Using a QTL mapping approach, 16 and 11 main-effect QTLs for pod and primary leaf resistance were located on LG10, explaining up to 90% and 26% of the phenotypic variation, respectively. The homologous genomic region corresponding to primary leaf resistance QTLs detected tested positive for the presence of resistance-associated gene cluster encoding nucleotide-binding and leucine-rich repeat (NL), Natural Resistance Associated Macrophage (NRAMP) and Pentatricopeptide Repeat family (PPR) proteins. It is worth noting that the main effect QTLs for resistance in pod were located inside a 3.5 Mb genomic region that included the Phvul.010G021200 gene, which encodes a protein that has the highest sequence similarity to the RIN4 gene of Arabidopsis, and can be considered an important candidate gene for the organ-specific QTLs identified here. These results support that resistance to Psp from UI3 might result from the immune response activated by combinations of R proteins, and suggest the guard model as an important mechanism in pod resistance to halo blight. The candidate genes identified here warrant functional studies that will help in characterizing the actual defense gene(s) in UI3 genotype.

  17. QTL mapping and transcriptome analysis of cowpea reveals candidate genes for root-knot nematode resistance.

    Science.gov (United States)

    Santos, Jansen Rodrigo Pereira; Ndeve, Arsenio Daniel; Huynh, Bao-Lam; Matthews, William Charles; Roberts, Philip Alan

    2018-01-01

    Cowpea is one of the most important food and forage legumes in drier regions of the tropics and subtropics. However, cowpea yield worldwide is markedly below the known potential due to abiotic and biotic stresses, including parasitism by root-knot nematodes (Meloidogyne spp., RKN). Two resistance genes with dominant effect, Rk and Rk2, have been reported to provide resistance against RKN in cowpea. Despite their description and use in breeding for resistance to RKN and particularly genetic mapping of the Rk locus, the exact genes conferring resistance to RKN remain unknown. In the present work, QTL mapping using recombinant inbred line (RIL) population 524B x IT84S-2049 segregating for a newly mapped locus and analysis of the transcriptome changes in two cowpea near-isogenic lines (NIL) were used to identify candidate genes for Rk and the newly mapped locus. A major QTL, designated QRk-vu9.1, associated with resistance to Meloidogyne javanica reproduction, was detected and mapped on linkage group LG9 at position 13.37 cM using egg production data. Transcriptome analysis on resistant and susceptible NILs 3 and 9 days after inoculation revealed up-regulation of 109 and 98 genes and down-regulation of 110 and 89 genes, respectively, out of 19,922 unique genes mapped to the common bean reference genome. Among the differentially expressed genes, four and nine genes were found within the QRk-vu9.1 and QRk-vu11.1 QTL intervals, respectively. Six of these genes belong to the TIR-NBS-LRR family of resistance genes and three were upregulated at one or more time-points. Quantitative RT-PCR validated gene expression to be positively correlated with RNA-seq expression pattern for eight genes. Future functional analysis of these cowpea genes will enhance our understanding of Rk-mediated resistance and identify the specific gene responsible for the resistance.

  18. QTL mapping and transcriptome analysis of cowpea reveals candidate genes for root-knot nematode resistance.

    Directory of Open Access Journals (Sweden)

    Jansen Rodrigo Pereira Santos

    Full Text Available Cowpea is one of the most important food and forage legumes in drier regions of the tropics and subtropics. However, cowpea yield worldwide is markedly below the known potential due to abiotic and biotic stresses, including parasitism by root-knot nematodes (Meloidogyne spp., RKN. Two resistance genes with dominant effect, Rk and Rk2, have been reported to provide resistance against RKN in cowpea. Despite their description and use in breeding for resistance to RKN and particularly genetic mapping of the Rk locus, the exact genes conferring resistance to RKN remain unknown. In the present work, QTL mapping using recombinant inbred line (RIL population 524B x IT84S-2049 segregating for a newly mapped locus and analysis of the transcriptome changes in two cowpea near-isogenic lines (NIL were used to identify candidate genes for Rk and the newly mapped locus. A major QTL, designated QRk-vu9.1, associated with resistance to Meloidogyne javanica reproduction, was detected and mapped on linkage group LG9 at position 13.37 cM using egg production data. Transcriptome analysis on resistant and susceptible NILs 3 and 9 days after inoculation revealed up-regulation of 109 and 98 genes and down-regulation of 110 and 89 genes, respectively, out of 19,922 unique genes mapped to the common bean reference genome. Among the differentially expressed genes, four and nine genes were found within the QRk-vu9.1 and QRk-vu11.1 QTL intervals, respectively. Six of these genes belong to the TIR-NBS-LRR family of resistance genes and three were upregulated at one or more time-points. Quantitative RT-PCR validated gene expression to be positively correlated with RNA-seq expression pattern for eight genes. Future functional analysis of these cowpea genes will enhance our understanding of Rk-mediated resistance and identify the specific gene responsible for the resistance.

  19. Presence of antiseptic resistance genes in porcine methicillin-resistant Staphylococcus aureus.

    Science.gov (United States)

    Wong, T Z; Zhang, M; O'Donoghue, M; Boost, M

    2013-03-23

    Numerous studies have documented the presence of methicillin-resistant Staphylococcus aureus (MRSA) in meat-producing animals, which has led to concern about its spread into the community. Disinfectants play an important role in reduction of contamination in both animal husbandry and food-preparation, helping control spread of organisms from foodstuffs, including raw meat. Plasmid-borne antiseptic resistance (AR) genes increasing tolerance to several disinfectants have been reported in S. aureus of human origin (qacA/B and smr) and from bovine, equine, and caprine staphylococcal isolates (qacG, qacH, and qacJ). This study investigated the presence of AR genes in porcine MRSA isolates. Plasmid DNA from 100 MRSA ST9 strains isolated from pig carcasses was amplified for the presence of AR genes. Minimum inhibitory concentrations (MICs) and minimum bactericidal concentrations (MBCs) to benzalkonium chloride (BC) and chlorhexidine gluconate (CHX) were determined in AR gene-positive isolates. qacG was present in 45 strains, eight of which also harbored smr. No strains carried qacA/B, qacH or qacJ. Presence of smr increased MICs to both BC and CHX and MBCs of CHX, but qacG presence only resulted in elevated MBC for CHX. This is the first report of AR genes from a porcine source. AR gene positivity has previously been associated with methicillin resistance and AR gene presence in these strains may increase their ability to persist in the environment. Improved implementation of hygiene measures during transportation and pre- and post-slaughter should be considered to prevent spread in the community. Copyright © 2012 Elsevier B.V. All rights reserved.

  20. Antimicrobial resistance of Helicobacter pylori strains to five antibiotics, including levofloxacin, in Northwestern Turkey

    Directory of Open Access Journals (Sweden)

    Reyhan Caliskan

    2015-06-01

    Full Text Available INTRODUCTION: Antibiotic resistance is the main factor that affects the efficacy of current therapeutic regimens against Helicobacter pylori. This study aimed to determine the rates of resistance to efficacy clarithromycin, amoxicillin, tetracycline, levofloxacin and metronidazole among H. pylori strains isolated from Turkish patients with dyspepsia. METHODS: H. pylori was cultured from corpus and antrum biopsies that were collected from patients with dyspeptic symptoms, and the antimicrobial susceptibility of H. pylori was determined using the E-test (clarithromycin, amoxicillin, tetracycline, metronidazole and levofloxacin according to the EUCAST breakpoints. Point mutations in the 23S rRNA gene of clarithromycin-resistant strains were investigated using real-time PCR. RESULTS: A total of 98 H. pylori strains were isolated, all of which were susceptible to amoxicillin and tetracycline. Of these strains, 36.7% (36/98 were resistant to clarithromycin, 35.5% (34/98 were resistant to metronidazole, and 29.5% (29/98 were resistant to levofloxacin. Multiple resistance was detected in 19.3% of the isolates. The A2143G and A2144G point mutations in the 23S rRNA-encoding gene were found in all 36 (100% of the clarithromycin-resistant strains. Additionally, the levofloxacin MIC values increased to 32 mg/L in our H. pylori strains. Finally, among the clarithromycin-resistant strains, 27.2% were resistant to levofloxacin, and 45.4% were resistant to metronidazole. CONCLUSIONS: We conclude that treatment failure after clarithromycin- or levofloxacin-based triple therapy is not surprising and that metronidazole is not a reliable agent for the eradication of H. pylori infection in Turkey.

  1. Molecular detection of disease resistance genes to powdery mildew ...

    African Journals Online (AJOL)

    A study was conducted to detect the presence of disease resistance genes to infection of wheat powdery mildew (Blumeria graminis f. sp. tritici) in selected wheat cultivars from China using molecular markers. Genomic DNA of sixty cultivars was extracted and tested for the presence of selected prominent resistance genes to ...

  2. Genome scanning for identification of resistance gene analogs (RGAs)

    African Journals Online (AJOL)

    Disease resistance in plants is a desirable economic trait. Many disease resistance genes from various plants have been cloned so far. The gene products of some of these can be distinguished by the presence of an N terminal nucleotide binding site and a C-terminal stretch of leucine-rich repeats. Oligonucleotides already ...

  3. Mapping of novel powdery mildew resistance gene(s) from Agropyron cristatum chromosome 2P.

    Science.gov (United States)

    Li, Huanhuan; Jiang, Bo; Wang, Jingchang; Lu, Yuqing; Zhang, Jinpeng; Pan, Cuili; Yang, Xinming; Li, Xiuquan; Liu, Weihua; Li, Lihui

    2017-01-01

    A physical map of Agropyron cristatum 2P chromosome was constructed for the first time and the novel powdery mildew resistance gene(s) from chromosome 2P was(were) also mapped. Agropyron cristatum (L.) Gaertn. (2n = 28, PPPP), a wild relative of common wheat, is highly resistant to powdery mildew. Previous studies showed that wheat-A. cristatum 2P disomic addition line II-9-3 displayed high resistance to powdery mildew, and the resistance was attributable to A. cristatum chromosome 2P. To utilize and physically map the powdery mildew resistance gene(s), 15 wheat-A. cristatum 2P translocation lines and three A. cristatum 2P deletion lines with different chromosomal segment sizes, obtained from II-9-3 using 60 Co-γ ray irradiation, were characterized using cytogenetic and molecular marker analysis. A. cristatum 2P chromosomal segments in the translocations were translocated to different wheat chromosomes, including 1A, 4A, 5A, 6A, 7A, 1B, 2B, 3B, 7B, 3D, 4D, and 6D. A physical map of the 2P chromosome was constructed with 82 STS markers, consisting of nine bins with 34 markers on 2PS and eight bins with 48 markers on 2PL. The BC 1 F 2 populations of seven wheat-A. cristatum 2P translocation lines (2PT-3, 2PT-4, 2PT-5, 2PT-6, 2PT-8, 2PT-9, and 2PT-10) were developed by self-pollination, tested with powdery mildew and genotyped with 2P-specific STS markers. From these results, the gene(s) conferring powdery mildew resistance was(were) located on 2PL bin FL 0.66-0.86 and 19 2P-specific markers were identified in this bin. Moreover, two new powdery mildew-resistant translocation lines (2PT-4 and 2PT-5) with small 2PL chromosome segments were obtained. The newly developed wheat lines with powdery mildew resistance and the closely linked molecular markers will be valuable for wheat disease breeding in the future.

  4. Occurrence of integrons and resistance genes among sulphonamide-resistant Shigella spp. from Brazil

    DEFF Research Database (Denmark)

    Peirano, G.; Agersø, Yvonne; Aarestrup, Frank Møller

    2005-01-01

    Objectives: To determine the occurrence of class 1 and 2 integrons and antimicrobial resistance genes among sulphonamide-resistant Shigella strains isolated in Brazil during 1999-2003. Methods: Sixty-two Shigella (Shigella flexneri, n = 47 and Shigella sonnei, n = 15) were tested against 21...... antimicrobial agents. The presence of integrons classes 1 and 2 and antimicrobial resistance genes was investigated by PCR using specific primers. Results: A total of eight antimicrobial resistance profiles were identified, with the profile of resistance to sulfamethoxazole, trimethoprim, spectinomycin...... of 2214 bp harbouring a gene cassette array conferring resistance to trimethoprim, streptothricin and spectinomycin/streptomycin. The genes coding for resistance to chloramphenicol (catA1), tetracycline [tet(A) and tet(B)] and ampicillin (bla(OXA) and bla(TEM)), were detected in resistant strains...

  5. Genome mining of Streptomyces scabrisporus NF3 reveals symbiotic features including genes related to plant interactions

    Science.gov (United States)

    Rodríguez-Luna, Stefany Daniela; Cruz Vázquez, Angélica Patricia; Jiménez Suárez, Verónica; Rodríguez-Sanoja, Romina; Alvarez-Buylla, Elena R.; Sánchez, Sergio

    2018-01-01

    Endophytic bacteria are wide-spread and associated with plant physiological benefits, yet their genomes and secondary metabolites remain largely unidentified. In this study, we explored the genome of the endophyte Streptomyces scabrisporus NF3 for discovery of potential novel molecules as well as genes and metabolites involved in host interactions. The complete genomes of seven Streptomyces and three other more distantly related bacteria were used to define the functional landscape of this unique microbe. The S. scabrisporus NF3 genome is larger than the average Streptomyces genome and not structured for an obligate endosymbiotic lifestyle; this and the fact that can grow in R2YE media implies that it could include a soil-living stage. The genome displays an enrichment of genes associated with amino acid production, protein secretion, secondary metabolite and antioxidants production and xenobiotic degradation, indicating that S. scabrisporus NF3 could contribute to the metabolic enrichment of soil microbial communities and of its hosts. Importantly, besides its metabolic advantages, the genome showed evidence for differential functional specificity and diversification of plant interaction molecules, including genes for the production of plant hormones, stress resistance molecules, chitinases, antibiotics and siderophores. Given the diversity of S. scabrisporus mechanisms for host upkeep, we propose that these strategies were necessary for its adaptation to plant hosts and to face changes in environmental conditions. PMID:29447216

  6. Genome mining of Streptomyces scabrisporus NF3 reveals symbiotic features including genes related to plant interactions.

    Directory of Open Access Journals (Sweden)

    Corina Diana Ceapă

    Full Text Available Endophytic bacteria are wide-spread and associated with plant physiological benefits, yet their genomes and secondary metabolites remain largely unidentified. In this study, we explored the genome of the endophyte Streptomyces scabrisporus NF3 for discovery of potential novel molecules as well as genes and metabolites involved in host interactions. The complete genomes of seven Streptomyces and three other more distantly related bacteria were used to define the functional landscape of this unique microbe. The S. scabrisporus NF3 genome is larger than the average Streptomyces genome and not structured for an obligate endosymbiotic lifestyle; this and the fact that can grow in R2YE media implies that it could include a soil-living stage. The genome displays an enrichment of genes associated with amino acid production, protein secretion, secondary metabolite and antioxidants production and xenobiotic degradation, indicating that S. scabrisporus NF3 could contribute to the metabolic enrichment of soil microbial communities and of its hosts. Importantly, besides its metabolic advantages, the genome showed evidence for differential functional specificity and diversification of plant interaction molecules, including genes for the production of plant hormones, stress resistance molecules, chitinases, antibiotics and siderophores. Given the diversity of S. scabrisporus mechanisms for host upkeep, we propose that these strategies were necessary for its adaptation to plant hosts and to face changes in environmental conditions.

  7. Sponge microbiota are a reservoir of functional antibiotic resistance genes

    Directory of Open Access Journals (Sweden)

    Dennis Versluis

    2016-11-01

    Full Text Available Wide application of antibiotics has contributed to the evolution of multi-drug resistant human pathogens, resulting in poorer treatment outcomes for infections. In the marine environment, seawater samples have been investigated as a resistance reservoir; however, no studies have methodically examined sponges as a reservoir of antibiotic resistance. Sponges could be important in this respect because they often contain diverse microbial communities that have the capacity to produce bioactive metabolites. Here, we applied functional metagenomics to study the presence and diversity of functional resistance genes in the sponges Aplysina aerophoba, Petrosia ficiformis and Corticium candelabrum. We obtained 37 insert sequences facilitating resistance to D-cycloserine (n=6, gentamicin (n=1, amikacin (n=7, trimethoprim (n=17, chloramphenicol (n=1, rifampicin (n=2 and ampicillin (n=3. Fifteen of 37 inserts harboured resistance genes that shared <90% amino acid identity with known gene products, whereas on 13 inserts no resistance gene could be identified with high confidence, in which case we predicted resistance to be mainly mediated by antibiotic efflux. One marine-specific ampicillin-resistance-conferring β-lactamase was identified in the genus Pseudovibrio with 41% global amino acid identity to the closest β-lactamase with demonstrated functionality, and subsequently classified into a new family termed PSV. Taken together, our results show that sponge microbiota host diverse and novel resistance genes that may be harnessed by phylogenetically distinct bacteria.

  8. The cfr and cfr-like multiple resistance genes

    DEFF Research Database (Denmark)

    Vester, Birte

    2018-01-01

    . The cfr gene is found in various bacteria in many geographical locations and placed on plasmids or associated with transposons. Cfr-related genes providing similar resistance have been identified in Bacillales, and now also in the pathogens Clostridium difficile and Enterococcus faecium. In addition......, the presence of the cfr gene has been detected in harbours and food markets....

  9. Associations between Antimicrobial Resistance Phenotypes, Antimicrobial Resistance Genes, and Virulence Genes of Fecal Escherichia coli Isolates from Healthy Grow-Finish Pigs ▿

    OpenAIRE

    Rosengren, Leigh B.; Waldner, Cheryl L.; Reid-Smith, Richard J.

    2009-01-01

    Escherichia coli often carries linked antimicrobial resistance genes on transmissible genetic elements. Through coselection, antimicrobial use may select for unrelated but linked resistance or virulence genes. This study used unconditional statistical associations to investigate the relationships between antimicrobial resistance phenotypes and antimicrobial resistance genes in 151 E. coli isolates from healthy pigs. Phenotypic resistance to each drug was significantly associated with phenotyp...

  10. Identification and characterization of two novel bla(KLUC resistance genes through large-scale resistance plasmids sequencing.

    Directory of Open Access Journals (Sweden)

    Teng Xu

    Full Text Available Plasmids are important antibiotic resistance determinant carriers that can disseminate various drug resistance genes among species or genera. By using a high throughput sequencing approach, two groups of plasmids of Escherichia coli (named E1 and E2, each consisting of 160 clinical E. coli strains isolated from different periods of time were sequenced and analyzed. A total of 20 million reads were obtained and mapped onto the known resistance gene sequences. As a result, a total of 9 classes, including 36 types of antibiotic resistant genes, were identified. Among these genes, 25 and 27 single nucleotide polymorphisms (SNPs appeared, of which 9 and 12 SNPs are nonsynonymous substitutions in the E1 and E2 samples. It is interesting to find that a novel genotype of bla(KLUC, whose close relatives, bla(KLUC-1 and bla(KLUC-2, have been previously reported as carried on the Kluyvera cryocrescens chromosome and Enterobacter cloacae plasmid, was identified. It shares 99% and 98% amino acid identities with Kluc-1 and Kluc-2, respectively. Further PCR screening of 608 Enterobacteriaceae family isolates yielded a second variant (named bla(KLUC-4. It was interesting to find that Kluc-3 showed resistance to several cephalosporins including cefotaxime, whereas bla(KLUC-4 did not show any resistance to the antibiotics tested. This may be due to a positively charged residue, Arg, replaced by a neutral residue, Leu, at position 167, which is located within an omega-loop. This work represents large-scale studies on resistance gene distribution, diversification and genetic variation in pooled multi-drug resistance plasmids, and provides insight into the use of high throughput sequencing technology for microbial resistance gene detection.

  11. A Gene Homologous to rRNA Methylase Genes Confers Erythromycin and Clindamycin Resistance in Bifidobacterium breve.

    Science.gov (United States)

    Martínez, Noelia; Luque, Roberto; Milani, Christian; Ventura, Marco; Bañuelos, Oscar; Margolles, Abelardo

    2018-05-15

    Bifidobacteria are mutualistic intestinal bacteria, and their presence in the human gut has been associated with health-promoting activities. The presence of antibiotic resistance genes in this genus is controversial, since, although bifidobacteria are nonpathogenic microorganisms, they could serve as reservoirs of resistance determinants for intestinal pathogens. However, until now, few antibiotic resistance determinants have been functionally characterized in this genus. In this work, we show that Bifidobacterium breve CECT7263 displays atypical resistance to erythromycin and clindamycin. In order to delimit the genomic region responsible for the observed resistance phenotype, a library of genomic DNA was constructed and a fragment of 5.8 kb containing a gene homologous to rRNA methylase genes was able to confer erythromycin resistance in Escherichia coli This genomic region seems to be very uncommon, and homologs of the gene have been detected in only one strain of Bifidobacterium longum and two other strains of B. breve In this context, analysis of shotgun metagenomics data sets revealed that the gene is also uncommon in the microbiomes of adults and infants. The structural gene and its upstream region were cloned into a B. breve -sensitive strain, which became resistant after acquiring the genetic material. In vitro conjugation experiments did not allow us to detect gene transfer to other recipients. Nevertheless, prediction of genes potentially acquired through horizontal gene transfer events revealed that the gene is located in a putative genomic island. IMPORTANCE Bifidobacterium breve is a very common human intestinal bacterium. Often described as a pioneer microorganism in the establishment of early-life intestinal microbiota, its presence has been associated with several beneficial effects for the host, including immune stimulation and protection against infections. Therefore, some strains of this species are considered probiotics. In relation to this

  12. Determination of rust resistance genes in pakistani bread wheats

    International Nuclear Information System (INIS)

    Qamar, M.; Ahmad, S.D.; Rabbani, M.A.; Shinwari, Z.K.

    2014-01-01

    Stripe and leaf rusts are the major constraints to bread wheat production in Pakistan. Molecular markers were used to investigate the presence of leaf rust and stripe rust resistance gene cluster Lr34/Yr18 and stem rust resistance gene Sr2 in 52 Pakistani bread wheat cultivars/lines. PCR amplification of DNA fragments using DNA marker csLV-34 showed that 13 of the studied cultivars/lines, namely 03FJ26, NR 337, NR 339, NR 347, NR 350, Manthar, Margalla 99, Iqbal 2000, Saleem 2000, Wafaq 2001, Marwat 2001, Pirsabak 2004 and Fareed 2006 carry leaf rust and stripe rust resistance genes Lr34/Yr18. Stem rust resistance gene Sr2 was observed in 36 Pakistani spring wheat cultivars/lines using stm560.3tgag marker. The slow rusting gene Sr2 needs to be combined with additional stem rust resistance genes to establish durable resistance against Ug99 in modern wheat cultivars. Low frequency of Lr34/Yr18 was found in Pakistani wheats. This gene cluster needs to be incorporated into Pakistani wheats for durable rust resistance. (author)

  13. SSTAR, a Stand-Alone Easy-To-Use Antimicrobial Resistance Gene Predictor.

    Science.gov (United States)

    de Man, Tom J B; Limbago, Brandi M

    2016-01-01

    We present the easy-to-use Sequence Search Tool for Antimicrobial Resistance, SSTAR. It combines a locally executed BLASTN search against a customizable database with an intuitive graphical user interface for identifying antimicrobial resistance (AR) genes from genomic data. Although the database is initially populated from a public repository of acquired resistance determinants (i.e., ARG-ANNOT), it can be customized for particular pathogen groups and resistance mechanisms. For instance, outer membrane porin sequences associated with carbapenem resistance phenotypes can be added, and known intrinsic mechanisms can be included. Unique about this tool is the ability to easily detect putative new alleles and truncated versions of existing AR genes. Variants and potential new alleles are brought to the attention of the user for further investigation. For instance, SSTAR is able to identify modified or truncated versions of porins, which may be of great importance in carbapenemase-negative carbapenem-resistant Enterobacteriaceae. SSTAR is written in Java and is therefore platform independent and compatible with both Windows and Unix operating systems. SSTAR and its manual, which includes a simple installation guide, are freely available from https://github.com/tomdeman-bio/Sequence-Search-Tool-for-Antimicrobial-Resistance-SSTAR-. IMPORTANCE Whole-genome sequencing (WGS) is quickly becoming a routine method for identifying genes associated with antimicrobial resistance (AR). However, for many microbiologists, the use and analysis of WGS data present a substantial challenge. We developed SSTAR, software with a graphical user interface that enables the identification of known AR genes from WGS and has the unique capacity to easily detect new variants of known AR genes, including truncated protein variants. Current software solutions do not notify the user when genes are truncated and, therefore, likely nonfunctional, which makes phenotype predictions less accurate. SSTAR

  14. Characterization of Soybean WRKY Gene Family and Identification of Soybean WRKY Genes that Promote Resistance to Soybean Cyst Nematode.

    Science.gov (United States)

    Yang, Yan; Zhou, Yuan; Chi, Yingjun; Fan, Baofang; Chen, Zhixiang

    2017-12-19

    WRKY proteins are a superfamily of plant transcription factors with important roles in plants. WRKY proteins have been extensively analyzed in plant species including Arabidopsis and rice. Here we report characterization of soybean WRKY gene family and their functional analysis in resistance to soybean cyst nematode (SCN), the most important soybean pathogen. Through search of the soybean genome, we identified 174 genes encoding WRKY proteins that can be classified into seven groups as established in other plants. WRKY variants including a WRKY-related protein unique to legumes have also been identified. Expression analysis reveals both diverse expression patterns in different soybean tissues and preferential expression of specific WRKY groups in certain tissues. Furthermore, a large number of soybean WRKY genes were responsive to salicylic acid. To identify soybean WRKY genes that promote soybean resistance to SCN, we first screened soybean WRKY genes for enhancing SCN resistance when over-expressed in transgenic soybean hairy roots. To confirm the results, we transformed five WRKY genes into a SCN-susceptible soybean cultivar and generated transgenic soybean lines. Transgenic soybean lines overexpressing three WRKY transgenes displayed increased resistance to SCN. Thus, WRKY genes could be explored to develop new soybean cultivars with enhanced resistance to SCN.

  15. Isolation of NBS-LRR class resistant gene (I2 gene) from tomato ...

    African Journals Online (AJOL)

    aghomotsegin

    2013-10-16

    Oct 16, 2013 ... type of F. oxysporum f. sp. lycopersici observed commonly which require presence of I1 gene in tomato plant for the incompatibility ... Key words: Fusarium wilt, race, R-gene, resistance, tomato. ... MATERIALS AND METHODS.

  16. Fate of antibiotic resistant bacteria and genes during wastewater chlorination: implication for antibiotic resistance control.

    Directory of Open Access Journals (Sweden)

    Qing-Bin Yuan

    Full Text Available This study investigated fates of nine antibiotic-resistant bacteria as well as two series of antibiotic resistance genes in wastewater treated by various doses of chlorine (0, 15, 30, 60, 150 and 300 mg Cl2 min/L. The results indicated that chlorination was effective in inactivating antibiotic-resistant bacteria. Most bacteria were inactivated completely at the lowest dose (15 mg Cl2 min/L. By comparison, sulfadiazine- and erythromycin-resistant bacteria exhibited tolerance to low chlorine dose (up to 60 mg Cl2 min/L. However, quantitative real-time PCRs revealed that chlorination decreased limited erythromycin or tetracycline resistance genes, with the removal levels of overall erythromycin and tetracycline resistance genes at 0.42 ± 0.12 log and 0.10 ± 0.02 log, respectively. About 40% of erythromycin-resistance genes and 80% of tetracycline resistance genes could not be removed by chlorination. Chlorination was considered not effective in controlling antimicrobial resistance. More concern needs to be paid to the potential risk of antibiotic resistance genes in the wastewater after chlorination.

  17. Electric fields, weighting fields, signals and charge diffusion in detectors including resistive materials

    CERN Document Server

    Riegler, Werner

    2016-11-07

    In this report we discuss static and time dependent electric fields in detector geometries with an arbitrary number of parallel layers of a given permittivity and weak conductivity. We derive the Green's functions i.e. the field of a point charge, as well as the weighting fields for readout pads and readout strips in these geometries. The effect of 'bulk' resistivity on electric fields and signals is investigated. The spreading of charge on thin resistive layers is also discussed in detail, and the conditions for allowing the effect to be described by the diffusion equation is discussed. We apply the results to derive fields and induced signals in Resistive Plate Chambers, Micromega detectors including resistive layers for charge spreading and discharge protection as well as detectors using resistive charge division readout like the MicroCAT detector. We also discuss in detail how resistive layers affect signal shapes and increase crosstalk between readout electrodes.

  18. Electric fields, weighting fields, signals and charge diffusion in detectors including resistive materials

    International Nuclear Information System (INIS)

    Riegler, W.

    2016-01-01

    In this report we discuss static and time dependent electric fields in detector geometries with an arbitrary number of parallel layers of a given permittivity and weak conductivity. We derive the Green's functions i.e. the field of a point charge, as well as the weighting fields for readout pads and readout strips in these geometries. The effect of 'bulk' resistivity on electric fields and signals is investigated. The spreading of charge on thin resistive layers is also discussed in detail, and the conditions for allowing the effect to be described by the diffusion equation is discussed. We apply the results to derive fields and induced signals in Resistive Plate Chambers, MICROMEGAS detectors including resistive layers for charge spreading and discharge protection as well as detectors using resistive charge division readout like the MicroCAT detector. We also discuss in detail how resistive layers affect signal shapes and increase crosstalk between readout electrodes.

  19. [Mechanisms of endogenous drug resistance acquisition by spontaneous chromosomal gene mutation].

    Science.gov (United States)

    Fukuda, H; Hiramatsu, K

    1997-05-01

    Endogenous resistance in bacteria is caused by a change or loss of function and generally genetically recessive. However, this type of resistance acquisition are now prevalent in clinical setting. Chromosomal genes that afford endogenous resistance are the genes correlated with the target of the drug, the drug inactivating enzymes, and permeability of the molecules including the antibacterial agents. Endogenous alteration of the drug target are mediated by the spontaneous mutation of their structural gene. This mutation provides much lower affinity of the drugs for the target. Gene expression of the inactivating enzymes, such as class C beta-lactamase, is generally regulated by regulatory genes. Spontaneous mutations in the regulatory genes cause constitutive enzyme production and provides the resistant to the agent which is usually stable for such enzymes. Spontaneous mutation in the structural gene gives the enzyme extra-spectrum substrate specificity, like ESBL (Extra-Spectrum-beta-Lactamase). Expression of structural genes encoding the permeability systems are also regulated by some regulatory genes. The spontaneous mutation of the regulatory genes reduce an amount of porin protein. This mutation causes much lower influx of the drug in the cell. Spontaneous mutation in promoter region of the structural gene of efflux protein was observed. This mutation raised the gene transcription and overproduced efflux protein. This protein progresses the drug efflux from the cell.

  20. AMINOGLYCOSIDE RESISTANCE GENES IN Pseudomonas aeruginosa ISOLATES FROM CUMANA, VENEZUELA.

    Science.gov (United States)

    Teixeira, Bertinellys; Rodulfo, Hectorina; Carreño, Numirin; Guzmán, Militza; Salazar, Elsa; De Donato, Marcos

    2016-01-01

    The enzymatic modification of aminoglycosides by aminoglycoside-acetyltransferases (AAC), aminoglycoside-adenyltransferases (AAD), and aminoglycoside-phosphotransferases (APH), is the most common resistance mechanism in P. aeruginosa and these enzymes can be coded on mobile genetic elements that contribute to their dispersion. One hundred and thirty seven P. aeruginosa isolates from the University Hospital, Cumana, Venezuela (HUAPA) were evaluated. Antimicrobial susceptibility was determined by the disk diffusion method and theaac, aadB and aph genes were detected by PCR. Most of the P. aeruginosa isolates (33/137) were identified from the Intensive Care Unit (ICU), mainly from discharges (96/137). The frequency of resistant P. aeruginosaisolates was found to be higher for the aminoglycosides tobramycin and amikacin (30.7 and 29.9%, respectively). Phenotype VI, resistant to these antibiotics, was the most frequent (14/49), followed by phenotype I, resistant to all the aminoglycosides tested (12/49). The aac(6´)-Ib,aphA1 and aadB genes were the most frequently detected, and the simultaneous presence of several resistance genes in the same isolate was demonstrated. Aminoglycoside resistance in isolates ofP. aeruginosa at the HUAPA is partly due to the presence of the aac(6´)-Ib, aphA1 andaadB genes, but the high rates of antimicrobial resistance suggest the existence of several mechanisms acting together. This is the first report of aminoglycoside resistance genes in Venezuela and one of the few in Latin America.

  1. Candidate gene association analyses for ketosis resistance in Holsteins.

    Science.gov (United States)

    Kroezen, V; Schenkel, F S; Miglior, F; Baes, C F; Squires, E J

    2018-06-01

    High-yielding dairy cattle are susceptible to ketosis, a metabolic disease that negatively affects the health, fertility, and milk production of the cow. Interest in breeding for more robust dairy cattle with improved resistance to disease is global; however, genetic evaluations for ketosis would benefit from the additional information provided by genetic markers. Candidate genes that are proposed to have a biological role in the pathogenesis of ketosis were investigated in silico and a custom panel of 998 putative single nucleotide polymorphism (SNP) markers was developed. The objective of this study was to test the associations of these new markers with deregressed estimated breeding values (EBV) for ketosis. A sample of 653 Canadian Holstein cows that had been previously genotyped with a medium-density SNP chip were regenotyped with the custom panel. The EBV for ketosis in first and later lactations were obtained for each animal and deregressed for use as pseudo-phenotypes for association analyses. Results of the mixed inheritance model for single SNP association analyses suggested 15 markers in 6 unique candidate genes were associated with the studied trait. Genes encoding proteins involved in metabolic processes, including the synthesis and degradation of fatty acids and ketone bodies, gluconeogenesis, lipid mobilization, and the citric acid cycle, were identified to contain SNP associated with ketosis resistance. This work confirmed the presence of previously described quantitative trait loci for dairy cattle, suggested novel markers for ketosis-resistance, and provided insight into the underlying biology of this disease. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  2. Are duplicated genes responsible for anthracnose resistance in common bean?

    Science.gov (United States)

    Costa, Larissa Carvalho; Nalin, Rafael Storto; Ramalho, Magno Antonio Patto; de Souza, Elaine Aparecida

    2017-01-01

    The race 65 of Colletotrichum lindemuthianum, etiologic agent of anthracnose in common bean, is distributed worldwide, having great importance in breeding programs for anthracnose resistance. Several resistance alleles have been identified promoting resistance to this race. However, the variability that has been detected within race has made it difficult to obtain cultivars with durable resistance, because cultivars may have different reactions to each strain of race 65. Thus, this work aimed at studying the resistance inheritance of common bean lines to different strains of C. lindemuthianum, race 65. We used six C. lindemuthianum strains previously characterized as belonging to the race 65 through the international set of differential cultivars of anthracnose and nine commercial cultivars, adapted to the Brazilian growing conditions and with potential ability to discriminate the variability within this race. To obtain information on the resistance inheritance related to nine commercial cultivars to six strains of race 65, these cultivars were crossed two by two in all possible combinations, resulting in 36 hybrids. Segregation in the F2 generations revealed that the resistance to each strain is conditioned by two independent genes with the same function, suggesting that they are duplicated genes, where the dominant allele promotes resistance. These results indicate that the specificity between host resistance genes and pathogen avirulence genes is not limited to races, it also occurs within strains of the same race. Further research may be carried out in order to establish if the alleles identified in these cultivars are different from those described in the literature.

  3. sugE: A gene involved in tributyltin (TBT) resistance of Aeromonas molluscorum Av27.

    Science.gov (United States)

    Cruz, Andreia; Micaelo, Nuno; Félix, Vitor; Song, Jun-Young; Kitamura, Shin-Ichi; Suzuki, Satoru; Mendo, Sónia

    2013-01-01

    The mechanism of bacterial resistance to tributyltin (TBT) is still unclear. The results herein presented contribute to clarify that mechanism in the TBT-resistant bacterium Aeromonas molluscorum Av27. We have identified and cloned a new gene that is involved in TBT resistance in this strain. The gene is highly homologous (84%) to the Aeromonas hydrophila-sugE gene belonging to the small multidrug resistance gene family (SMR), which includes genes involved in the transport of lipophilic drugs. In Av27, expression of the Av27-sugE was observed at the early logarithmic growth phase in the presence of a high TBT concentration (500 μM), thus suggesting the contribution of this gene for TBT resistance. E. coli cells transformed with Av27-sugE become resistant to ethidium bromide (EtBr), chloramphenicol (CP) and tetracycline (TE), besides TBT. According to the Moriguchi logP (miLogP) values, EtBr, CP and TE have similar properties and are substrates for the sugE-efflux system. Despite the different miLogP of TBT, E. coli cells transformed with Av27-sugE become resistant to this compound. So it seems that TBT is also a substrate for the SugE protein. The modelling studies performed also support this hypothesis. The data herein presented clearly indicate that sugE is involved in TBT resistance of this bacterium.

  4. Overexpression of antibiotic resistance genes in hospital effluents over time.

    Science.gov (United States)

    Rowe, Will P M; Baker-Austin, Craig; Verner-Jeffreys, David W; Ryan, Jim J; Micallef, Christianne; Maskell, Duncan J; Pearce, Gareth P

    2017-06-01

    Effluents contain a diverse abundance of antibiotic resistance genes that augment the resistome of receiving aquatic environments. However, uncertainty remains regarding their temporal persistence, transcription and response to anthropogenic factors, such as antibiotic usage. We present a spatiotemporal study within a river catchment (River Cam, UK) that aims to determine the contribution of antibiotic resistance gene-containing effluents originating from sites of varying antibiotic usage to the receiving environment. Gene abundance in effluents (municipal hospital and dairy farm) was compared against background samples of the receiving aquatic environment (i.e. the catchment source) to determine the resistome contribution of effluents. We used metagenomics and metatranscriptomics to correlate DNA and RNA abundance and identified differentially regulated gene transcripts. We found that mean antibiotic resistance gene and transcript abundances were correlated for both hospital ( ρ  = 0.9, two-tailed P  hospital effluent samples. High β-lactam resistance gene transcript abundance was related to hospital antibiotic usage over time and hospital effluents contained antibiotic residues. We conclude that effluents contribute high levels of antibiotic resistance genes to the aquatic environment; these genes are expressed at significant levels and are possibly related to the level of antibiotic usage at the effluent source. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy.

  5. The transport of antibiotic resistance genes and residues in groundwater near swine production facilities

    Science.gov (United States)

    Lin, Y. F.; Yannarell, A. C.; Mackie, R. I.; Krapac, I. G.; Chee-Sanford, J. S.; Koike, S.

    2008-12-01

    The use of antibiotics at concentrated animal feeding operations (CAFOs) for disease prevention, disease treatment, and growth promotion can contribute to the spread of antibiotic compounds, their breakdown products, and antibiotic resistant bacteria and/or the genes that confer resistance. In addition, constitutive use of antibiotics at sub-therapeutic levels can select for antibiotic resistance among the bacteria that inhabit animal intestinal tracts, onsite manure treatment facilities, and any environments receiving significant inputs of manure (e.g. through waste lagoon leakage or fertilizer amendments to farm soils). If the antibiotic resistant organisms persist in these new environments, or if they participate in genetic exchanges with the native microflora, then CAFOs may constitute a significant reservoir for the spread of antibiotic resistance to the environment at large. Our results have demonstrated that leakage from waste treatment lagoons can influence the presence and persistence of tetracycline resistance genes in the shallow aquifer adjacent to swine CAFOs, and molecular phylogeny allowed us to distinguish "native" tetracycline resistance genes in control groundwater wells from manure-associated genes introduced from the lagoon. We have also been able to detect the presence of erythromycin resistance genes in CAFO surface and groundwater even though erythromycin is strictly reserved for use in humans and thus is not utilized at any of these sites. Ongoing research, including modeling of particle transport in groundwater, will help to determine the potential spatial and temporal extent of CAFO-derived antibiotic resistance.

  6. Induced resistance and gene expression in wheat against leaf rust ...

    African Journals Online (AJOL)

    uvp

    2013-05-15

    May 15, 2013 ... 2Department of Soil, Crop and Climate Sciences, University of the Free State, P.O Box ... Key words: Wheat leaf rust, induced resistance, priming, gene ..... transformation: susceptibility of transgenic Nicotiana sylvestris plants.

  7. Molecular Detection of Virulence Genes and Antibiotic Resistance ...

    African Journals Online (AJOL)

    Pathogen, E. coli O157:H7, virulence genes, antibiotic-resistance, beef meat. Correspondence: ... box to the laboratory for further processing. Isolation and identification of ... Technologies (IDT) Inc, U.S.A. The sequences and annealing ...

  8. Mapping of stripe rust resistance gene in an Aegilops caudata ...

    Indian Academy of Sciences (India)

    PUNEET INDER TOOR

    A pair of stripe rust and leaf rust resistance genes was introgressed from Aegilops caudata, a nonprogenitor diploid species with the CC genome, to cultivated .... infector rows and experimental material with the mixture of uredinospores of Pst ...

  9. Resistance gene management: concepts and practice

    Science.gov (United States)

    Christopher C. Mundt

    2012-01-01

    There is now a very long history of genetics/breeding for disease resistance in annual crops. These efforts have resulted in conceptual advances and frustrations, as well as practical successes and failures. This talk will review this history and its relevance to the genetics of resistance in forest species. All plant breeders and pathologists are familiar with boom-...

  10. Gene Expression Analysis of Four Radiation-resistant Bacteria

    OpenAIRE

    Gao, Na; Ma, Bin-Guang; Zhang, Yu-Sheng; Song, Qin; Chen, Ling-Ling; Zhang, Hong-Yu

    2009-01-01

    To investigate the general radiation-resistant mechanisms of bacteria, bioinformatic method was employed to predict highly expressed genes for four radiation-resistant bacteria, i.e. Deinococcus geothermalis (D. geo), Deinococcus radiodurans (D. rad), Kineococcus radiotolerans (K. rad) and Rubrobacter xylanophilus (R. xyl). It is revealed that most of the three reference gene sets, i.e. ribosomal proteins, transcription factors and major chaperones, are generally highly expressed in the four ...

  11. Overexpression of antibiotic resistance genes in hospital effluents over time

    OpenAIRE

    Rowe, Will P. M.; Baker-Austin, Craig; Verner-Jeffreys, David W.; Ryan, Jim J.; Micallef, Christianne; Maskell, Duncan J.; Pearce, Gareth P.

    2017-01-01

    $\\textbf{Objectives}$: Effluents contain a diverse abundance of antibiotic resistance genes that augment the resistome of receiving aquatic environments. However, uncertainty remains regarding their temporal persistence, transcription and response to anthropogenic factors, such as antibiotic usage. We present a spatiotemporal study within a river catchment (River Cam, UK) that aims to determine the contribution of antibiotic resistance gene-containing effluents originating from sites of varyi...

  12. Analysis of metal and biocides resistance genes in drug resistance and susceptible Salmonella enterica from food animals

    Science.gov (United States)

    Background Generally drug resistant bacteria carry antibiotic resistance genes and heavy metal and biocide resistance genes on large conjugative plasmids. The presence of these metal and biocide resistance genes in susceptible bacteria are not assessed comprehensively. Hence, WGS data of susceptib...

  13. The antimicrobial resistance crisis: management through gene monitoring

    Science.gov (United States)

    2016-01-01

    Antimicrobial resistance (AMR) is an acknowledged crisis for humanity. Its genetic origins and dire potential outcomes are increasingly well understood. However, diagnostic techniques for monitoring the crisis are currently largely limited to enumerating the increasing incidence of resistant pathogens. Being the end-stage of the evolutionary process that produces antimicrobial resistant pathogens, these measurements, while diagnostic, are not prognostic, and so are not optimal in managing this crisis. A better test is required. Here, using insights from an understanding of evolutionary processes ruling the changing abundance of genes under selective pressure, we suggest a predictive framework for the AMR crisis. We then discuss the likely progression of resistance for both existing and prospective antimicrobial therapies. Finally, we suggest that by the environmental monitoring of resistance gene frequency, resistance may be detected and tracked presumptively, and how this tool may be used to guide decision-making in the local and global use of antimicrobials. PMID:27831476

  14. The Number of Genes Controlling Resistance in Beans to Common ...

    African Journals Online (AJOL)

    Ten crosses were made between resistant (R), susceptible (S), RxS susceptible and Intermediate (I), SxI and RxR bean lines to common bacterial blight. The F1 were advanced to F2 and in each cross over 250 F2 plants were used to evaluate for the number of genes controlling resistance using Mendelian genetics and ...

  15. Prevalence, antibiotic-resistance properties and enterotoxin gene ...

    African Journals Online (AJOL)

    Prevalence, antibiotic-resistance properties and enterotoxin gene profile of Bacillus cereus strains isolated from milk-based baby foods. ... Conclusion: Considerable prevalence of resistant and toxigenic B. cereus and high consumption of milk-based infant foods in Iran, represent an important public health issue which ...

  16. Spread of tetracycline resistance genes at a conventional dairy farm

    NARCIS (Netherlands)

    Kyselková, Martina; Jirout, Jiří; Vrchotová, Naděžda; Schmitt, Heike; Elhottová, Dana

    2015-01-01

    The use of antibiotics in animal husbandry contributes to the worldwide problem of increasing antibiotic resistance in animal and human pathogens. Intensive animal production is considered an important source of antibiotic resistance genes released to the environment, while the contribution of

  17. Isolation and characterization of a candidate gene for resistance to ...

    African Journals Online (AJOL)

    ARC) domain, and a leucine-rich repeat (LRR) domain, all of which are typical characteristics of resistance genes. We proposed the resistance mechanism of CreV8 based on functional analysis and predictions from its conserved domains and ...

  18. Identification of virus and nematode resistance genes in the Chilota Potato Genebank of the Universidad Austral de Chile

    Directory of Open Access Journals (Sweden)

    Marlon López

    2015-09-01

    Full Text Available Potato Genebank of the Universidad Austral de Chile (UACh is an important gene bank in Chile. The accessions collected all over the country possess high genetic diversity, present interesting agronomic and cooking traits, and show resistance to biotic and abiotic stress. A particularly interesting subgroup of the gene bank includes the accessions collected in the South of Chile, the Chilota Potato Genebank. The focus of this study is the identification of virus and nematode resistant genes in potatoes (Solatium tuberosum L., using the RYSC3 and YES3-3B molecular markers. The Potato virus Y(PVY resistance genes Ry adg and Ry sto were identified. Furthermore, the CP60 marker was used to assess the Rx resistance gene that confers resistance to Potato virus X (PVX. In addition, the HC and GRO1-4 markers were utilized to identify the GpaVvrn_QTL and Gro1-4, resistance genes of Globodera pallida and Globodera rostochiensis, respectively. Both G. pallida and G. rostochiensis are Potato Cyst Nematodes (PCN. The plant material used in this study included leaves from 271 accessions of the gene bank. These samples were collected in the field where natural pathogen pressure of potential viruses and diseases exists. ELISA assays were run for field detection of PVY and PVX. However, there have been no previous reports of nematode presence in the plant material. The results herein presented indicate presence of virus and nematode resistance genes in accessions of the Chilota Potato Genebank. In terms of virus resistance, 99 accessions out of the 271 tested possess the Ry adg resistance gene and 17 accessions of these 271 tested have the Ry sto resistance gene. Also, 10 accessions showed positive amplification of the Rxl resistant gene marker. As to nematode resistance, 99 accessions have possible resistance to G. pallida and 54 accessions show potential resistance to G. rostochiensis as detected using the available molecular markers.

  19. Cloning and characterization of NBS-LRR resistance gene ...

    African Journals Online (AJOL)

    biotech

    2013-07-03

    Jul 3, 2013 ... Rose using degernate primers designed from the conserved motifs of different plant resistance genes. A total of 40 sequences were hit with various R genes, of which 20 .... absorption ratio OD260 nm/OD280 nm between 1.80 and ..... status and outlook for small-holders agriculture in C S Gold and B.

  20. Induced mutations of rust resistance genes in wheat

    International Nuclear Information System (INIS)

    McIntosh, R.A.

    1983-01-01

    Induced mutations are being used as a tool to study genes for resistance in wheat. It was found that Pm1 can be separated from Lr20 and Sr15, but these two react like a single pleiotropic gene. Mutants were further examined in crosses and backmutations have been attempted. (author)

  1. Dihydropteroate synthase gene mutations in Pneumocystis and sulfa resistance

    DEFF Research Database (Denmark)

    Huang, Laurence; Crothers, Kristina; Atzori, Chiara

    2004-01-01

    in the dihydropteroate synthase (DHPS) gene. Similar mutations have been observed in P. jirovecii. Studies have consistently demonstrated a significant association between the use of sulfa drugs for PCP prophylaxis and DHPS gene mutations. Whether these mutations confer resistance to TMP-SMX or dapsone plus trimethoprim...

  2. Testing of disease-resistance of pokeweed antiviral protein gene ...

    African Journals Online (AJOL)

    Transformation of pokeweed antiviral protein gene (PAP) into plants was shown to improve plant resistance to several viruses or fungi pathogens with no much negative effect on plant growth. The non-virulent defective PAP inhibits only the virus but does not interfere with the host. A non-virulent defective PAP gene ...

  3. Resistance gene candidates identified by PCR with degenerate oligonucleotide primers map to clusters of resistance genes in lettuce.

    Science.gov (United States)

    Shen, K A; Meyers, B C; Islam-Faridi, M N; Chin, D B; Stelly, D M; Michelmore, R W

    1998-08-01

    The recent cloning of genes for resistance against diverse pathogens from a variety of plants has revealed that many share conserved sequence motifs. This provides the possibility of isolating numerous additional resistance genes by polymerase chain reaction (PCR) with degenerate oligonucleotide primers. We amplified resistance gene candidates (RGCs) from lettuce with multiple combinations of primers with low degeneracy designed from motifs in the nucleotide binding sites (NBSs) of RPS2 of Arabidopsis thaliana and N of tobacco. Genomic DNA, cDNA, and bacterial artificial chromosome (BAC) clones were successfully used as templates. Four families of sequences were identified that had the same similarity to each other as to resistance genes from other species. The relationship of the amplified products to resistance genes was evaluated by several sequence and genetic criteria. The amplified products contained open reading frames with additional sequences characteristic of NBSs. Hybridization of RGCs to genomic DNA and to BAC clones revealed large numbers of related sequences. Genetic analysis demonstrated the existence of clustered multigene families for each of the four RGC sequences. This parallels classical genetic data on clustering of disease resistance genes. Two of the four families mapped to known clusters of resistance genes; these two families were therefore studied in greater detail. Additional evidence that these RGCs could be resistance genes was gained by the identification of leucine-rich repeat (LRR) regions in sequences adjoining the NBS similar to those in RPM1 and RPS2 of A. thaliana. Fluorescent in situ hybridization confirmed the clustered genomic distribution of these sequences. The use of PCR with degenerate oligonucleotide primers is therefore an efficient method to identify numerous RGCs in plants.

  4. Characterization of antimicrobial resistance genes in Haemophilus parasuis isolated from pigs in China

    Directory of Open Access Journals (Sweden)

    Yongda Zhao

    2018-04-01

    Full Text Available Background Haemophilus parasuis is a common porcine respiratory pathogen that causes high rates of morbidity and mortality in farmed swine. We performed a molecular characterization of antimicrobial resistance genes harbored by H. parasuis from pig farms in China. Methods We screened 143 H. parasuis isolates for antimicrobial susceptibility against six fluoroquinolone antibiotics testing by the broth microdilution method, and the presence of 64 antimicrobial resistance genes by PCR amplification and DNA sequence analysis. We determined quinolone resistance determining region mutations of DNA gyrase (gyrA and gyrB and topoisomerase IV (parC and parE. The genetic relatedness among the strains was analyzed by pulsed-field gel electrophoresis. Results Susceptibility test showed that all isolates were low resistance to lomefloxacin (28.67%, levofloxacin (20.28%, norfloxacin (22.38%, ciprofloxacin (23.78%, however, high resistance levels were found to nalidixic acid (82.52% and enrofloxacin (55.94%. In addition, we found 14 antimicrobial resistance genes were present in these isolates, including blaTEM-1, blaROB-1, ermB, ermA, flor, catl, tetB, tetC, rmtB, rmtD, aadA1, aac(3′-llc, sul1, and sul2 genes. Interestingly, one isolate carried five antibiotic resistance genes (tetB, tetC, flor, rmtB, sul1. The genes tetB, rmtB, and flor were the most prevalent resistance genes in H. parasuis in China. Alterations in the gyrA gene (S83F/Y, D87Y/N/H/G were detected in 81% of the strains and parC mutations were often accompanied by a gyrA mutation. Pulsed-field gel electrophoresis typing revealed 51 unique patterns in the isolates carrying high-level antibiotic resistance genes, indicating considerable genetic diversity and suggesting that the genes were spread horizontally. Discussion The current study demonstrated that the high antibiotic resistance of H. parasuis in piglets is a combination of transferable antibiotic resistance genes and multiple target

  5. Characterization of antimicrobial resistance genes in Haemophilus parasuis isolated from pigs in China.

    Science.gov (United States)

    Zhao, Yongda; Guo, Lili; Li, Jie; Huang, Xianhui; Fang, Binghu

    2018-01-01

    Haemophilus parasuis is a common porcine respiratory pathogen that causes high rates of morbidity and mortality in farmed swine. We performed a molecular characterization of antimicrobial resistance genes harbored by H. parasuis from pig farms in China. We screened 143 H. parasuis isolates for antimicrobial susceptibility against six fluoroquinolone antibiotics testing by the broth microdilution method, and the presence of 64 antimicrobial resistance genes by PCR amplification and DNA sequence analysis. We determined quinolone resistance determining region mutations of DNA gyrase ( gyrA and gyrB ) and topoisomerase IV ( parC and parE ). The genetic relatedness among the strains was analyzed by pulsed-field gel electrophoresis. Susceptibility test showed that all isolates were low resistance to lomefloxacin (28.67%), levofloxacin (20.28%), norfloxacin (22.38%), ciprofloxacin (23.78%), however, high resistance levels were found to nalidixic acid (82.52%) and enrofloxacin (55.94%). In addition, we found 14 antimicrobial resistance genes were present in these isolates, including bla TEM-1 , bla ROB-1 , ermB, ermA, flor, catl, tetB, tetC, rmtB, rmtD, aadA1, aac(3')-llc, sul1, and sul2 genes. Interestingly, one isolate carried five antibiotic resistance genes ( tetB, tetC, flor, rmtB, sul1 ). The genes tetB , rmtB, and flor were the most prevalent resistance genes in H. parasuis in China. Alterations in the gyrA gene (S83F/Y, D87Y/N/H/G) were detected in 81% of the strains and parC mutations were often accompanied by a gyrA mutation. Pulsed-field gel electrophoresis typing revealed 51 unique patterns in the isolates carrying high-level antibiotic resistance genes, indicating considerable genetic diversity and suggesting that the genes were spread horizontally. The current study demonstrated that the high antibiotic resistance of H. parasuis in piglets is a combination of transferable antibiotic resistance genes and multiple target gene mutations. These data provide novel

  6. Antimicrobial Chemicals Are Associated with Elevated Antibiotic Resistance Genes in the Indoor Dust Microbiome.

    Science.gov (United States)

    Hartmann, Erica M; Hickey, Roxana; Hsu, Tiffany; Betancourt Román, Clarisse M; Chen, Jing; Schwager, Randall; Kline, Jeff; Brown, G Z; Halden, Rolf U; Huttenhower, Curtis; Green, Jessica L

    2016-09-20

    Antibiotic resistance is increasingly widespread, largely due to human influence. Here, we explore the relationship between antibiotic resistance genes and the antimicrobial chemicals triclosan, triclocarban, and methyl-, ethyl-, propyl-, and butylparaben in the dust microbiome. Dust samples from a mixed-use athletic and educational facility were subjected to microbial and chemical analyses using a combination of 16S rRNA amplicon sequencing, shotgun metagenome sequencing, and liquid chromatography tandem mass spectrometry. The dust resistome was characterized by identifying antibiotic resistance genes annotated in the Comprehensive Antibiotic Resistance Database (CARD) from the metagenomes of each sample using the Short, Better Representative Extract Data set (ShortBRED). The three most highly abundant antibiotic resistance genes were tet(W), blaSRT-1, and erm(B). The complete dust resistome was then compared against the measured concentrations of antimicrobial chemicals, which for triclosan ranged from 0.5 to 1970 ng/g dust. We observed six significant positive associations between the concentration of an antimicrobial chemical and the relative abundance of an antibiotic resistance gene, including one between the ubiquitous antimicrobial triclosan and erm(X), a 23S rRNA methyltransferase implicated in resistance to several antibiotics. This study is the first to look for an association between antibiotic resistance genes and antimicrobial chemicals in dust.

  7. Removal of bacterial cells, antibiotic resistance genes and integrase genes by on-site hospital wastewater treatment plants: surveillance of treated hospital effluent quality

    KAUST Repository

    Timraz, Kenda Hussain Hassan; Xiong, Yanghui; Al Qarni, Hamed; Hong, Pei-Ying

    2016-01-01

    This study aims to evaluate the removal efficiency of microbial contaminants, including total cell counts, antibiotic-resistant bacteria (ARB), antibiotic resistance genes (ARGs, e.g. tetO, tetZ, sul1 and sul2) and integrase genes (e.g. intl1

  8. Paradoxical DNA repair and peroxide resistance gene conservation in Bacillus pumilus SAFR-032.

    Directory of Open Access Journals (Sweden)

    Jason Gioia

    Full Text Available BACKGROUND: Bacillus spores are notoriously resistant to unfavorable conditions such as UV radiation, gamma-radiation, H2O2, desiccation, chemical disinfection, or starvation. Bacillus pumilus SAFR-032 survives standard decontamination procedures of the Jet Propulsion Lab spacecraft assembly facility, and both spores and vegetative cells of this strain exhibit elevated resistance to UV radiation and H2O2 compared to other Bacillus species. PRINCIPAL FINDINGS: The genome of B. pumilus SAFR-032 was sequenced and annotated. Lists of genes relevant to DNA repair and the oxidative stress response were generated and compared to B. subtilis and B. licheniformis. Differences in conservation of genes, gene order, and protein sequences are highlighted because they potentially explain the extreme resistance phenotype of B. pumilus. The B. pumilus genome includes genes not found in B. subtilis or B. licheniformis and conserved genes with sequence divergence, but paradoxically lacks several genes that function in UV or H2O2 resistance in other Bacillus species. SIGNIFICANCE: This study identifies several candidate genes for further research into UV and H2O2 resistance. These findings will help explain the resistance of B. pumilus and are applicable to understanding sterilization survival strategies of microbes.

  9. Dissection of Resistance Genes to Pseudomonas syringae pv. phaseolicola in UI3 Common Bean Cultivar

    Directory of Open Access Journals (Sweden)

    Ana M. González

    2017-11-01

    Full Text Available Few quantitative trait loci have been mapped for resistance to Pseudomonas syringae pv. phaseolicola in common bean. Two F2 populations were developed from the host differential UI3 cultivar. The objective of this study was to further characterize the resistance to races 1, 5, 7 and 9 of Psp included in UI3. Using a QTL mapping approach, 16 and 11 main-effect QTLs for pod and primary leaf resistance were located on LG10, explaining up to 90% and 26% of the phenotypic variation, respectively. The homologous genomic region corresponding to primary leaf resistance QTLs detected tested positive for the presence of resistance-associated gene cluster encoding nucleotide-binding and leucine-rich repeat (NL, Natural Resistance Associated Macrophage (NRAMP and Pentatricopeptide Repeat family (PPR proteins. It is worth noting that the main effect QTLs for resistance in pod were located inside a 3.5 Mb genomic region that included the Phvul.010G021200 gene, which encodes a protein that has the highest sequence similarity to the RIN4 gene of Arabidopsis, and can be considered an important candidate gene for the organ-specific QTLs identified here. These results support that resistance to Psp from UI3 might result from the immune response activated by combinations of R proteins, and suggest the guard model as an important mechanism in pod resistance to halo blight. The candidate genes identified here warrant functional studies that will help in characterizing the actual defense gene(s in UI3 genotype.

  10. RESISTANCE-RELATED GENE TRANSCRIPTION AND ...

    African Journals Online (AJOL)

    jdx

    2014-02-05

    Feb 5, 2014 ... By 72 hpi, the pathogen switched to necrotrophic growth to avoid contact with the increasing ... A better understanding of the gene network underlying ... 5.0 software under default parameters and were custom-ordered.

  11. The Lr34 adult plant rust resistance gene provides seedling resistance in durum wheat without senescence.

    Science.gov (United States)

    Rinaldo, Amy; Gilbert, Brian; Boni, Rainer; Krattinger, Simon G; Singh, Davinder; Park, Robert F; Lagudah, Evans; Ayliffe, Michael

    2017-07-01

    The hexaploid wheat (Triticum aestivum) adult plant resistance gene, Lr34/Yr18/Sr57/Pm38/Ltn1, provides broad-spectrum resistance to wheat leaf rust (Lr34), stripe rust (Yr18), stem rust (Sr57) and powdery mildew (Pm38) pathogens, and has remained effective in wheat crops for many decades. The partial resistance provided by this gene is only apparent in adult plants and not effective in field-grown seedlings. Lr34 also causes leaf tip necrosis (Ltn1) in mature adult plant leaves when grown under field conditions. This D genome-encoded bread wheat gene was transferred to tetraploid durum wheat (T. turgidum) cultivar Stewart by transformation. Transgenic durum lines were produced with elevated gene expression levels when compared with the endogenous hexaploid gene. Unlike nontransgenic hexaploid and durum control lines, these transgenic plants showed robust seedling resistance to pathogens causing wheat leaf rust, stripe rust and powdery mildew disease. The effectiveness of seedling resistance against each pathogen correlated with the level of transgene expression. No evidence of accelerated leaf necrosis or up-regulation of senescence gene markers was apparent in these seedlings, suggesting senescence is not required for Lr34 resistance, although leaf tip necrosis occurred in mature plant flag leaves. Several abiotic stress-response genes were up-regulated in these seedlings in the absence of rust infection as previously observed in adult plant flag leaves of hexaploid wheat. Increasing day length significantly increased Lr34 seedling resistance. These data demonstrate that expression of a highly durable, broad-spectrum adult plant resistance gene can be modified to provide seedling resistance in durum wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  12. [Analysis of resistant genes of beta-lactam antibiotics from Pseudomonas aeruginosa in pediatric patients].

    Science.gov (United States)

    Dong, Fang; Xu, Xi-wei; Song, Wen-qi; Lü, Ping; Yang, Yong-hong; Shen, Xu-zhuang

    2008-11-18

    To analyze the antibiotic resistance of the Pseudomonas aeruginosa (PA) isolated from pediatric patients and the resistant genes of beta-lactam antibiotics thereof. 146 PA strains were isolated from pediatric patients. Agar dilution method recommended by the Clinical and Laboratory Standards Institute was used to examine the minimum inhibitory concentrations (MICs) of 12 antimicrobial agents, including the penicillins, third and fourth genet ration cephalosporins, carbapenemase, Aztreonam, beta-lactamase inhibitors, quinolones, and aminoglycosides. PCR was used to detect the expression of the genes TEM, SHV, OXA, PER, GES, CTX-M, IMP, VIM, DHA, MIR, FOX, and oprD2. The multi-drug resistance rates against different antibiotic were high among the 146 PA strains. The rates of imipenem and meropenem resistance were 41.1% and 35.6% respectively. Among the 146 PA strains, 46 (31.5%) were positive for the MBL genotype; 38 (82.6%) carried the blaIMP gene, 8 (17.4%) carried the blaVIM gene, and 114 (78.1%) were oprD2 negative. The genes TEM, SHV, OXA, CTX-M, PER, VEB, GES, FOX, MIR, and DHA were not found in all strains. Many PA isolated from pediatric patients carry the genes IMP or VIM and losses oprD2 gene related to the expression of the outer membrane porin OprD2. The loss of the gene oprD2 is essential mechanism of beta-lactam antibiotics resistance in PA.

  13. Antibiotic resistance and virulence genes in coliform water isolates.

    Science.gov (United States)

    Stange, C; Sidhu, J P S; Tiehm, A; Toze, S

    2016-11-01

    Widespread fecal pollution of surface water may present a major health risk and a significant pathway for dissemination of antibiotic resistance bacteria. The River Rhine is one of the longest and most important rivers in Europe and an important raw water source for drinking water production. A total of 100 coliform isolates obtained from River Rhine (Germany) were examined for their susceptibility to seven antimicrobial agents. Resistances against amoxicillin, trimethoprim/sulfamethoxazole and tetracycline were detected in 48%, 11% and 9% of isolates respectively. The antibiotic resistance could be traced back to the resistance genes bla TEM , bla SHV , ampC, sul1, sul2, dfrA1, tet(A) and tet(B). Whereby, the ampC gene represents a special case, because its presence is not inevitably linked to a phenotypic antibiotic resistance. Multiple antibiotics resistance was often accompanied by the occurrence of class 1 or 2 integrons. E. coli isolates belonging to phylogenetic groups A and B1 (commensal) were more predominant (57%) compared to B2 and D groups (43%) which are known to carry virulent genes. Additionally, six E. coli virulence genes were also detected. However, the prevalence of virulence genes in the E. coli isolates was low (not exceeding 4.3% per gene) and no diarrheagenic E. coli pathotypes were detected. This study demonstrates that surface water is an important reservoir of ARGs for a number of antibiotic classes such as sulfonamide, trimethoprim, beta-lactam-antibiotics and tetracycline. The occurrence of antibiotic resistance in coliform bacteria isolated from River Rhine provides evidence for the need to develop management strategies to limit the spread of antibiotic resistant bacteria in aquatic environment. Copyright © 2016 Elsevier GmbH. All rights reserved.

  14. Deinococcus geothermalis: The Pool of Extreme Radiation Resistance Genes Shrinks

    Energy Technology Data Exchange (ETDEWEB)

    Makarova, Kira S.; Omelchenko, Marina V.; Gaidamakova, Elena K.; Matrosova, Vera Y.; Vasilenko, Alexander; Zhai, Min; Lapidus, Alla; Copeland, Alex; Kim, Edwin; Land, Miriam; Mavrommatis, Konstantinos; Pitluck, Samuel; Richardson, Paul M.; Detter, Chris; Brettin, Thomas; Saunders, Elizabeth; Lai, Barry; Ravel, Bruce; Kemner, Kenneth M.; Wolf, Yuri I.; Sorokin, Alexander; Gerasimova, Anna V.; Gelfand, Mikhail S.; Fredrickson, James K.; Koonin, Eugene V.; Daly, Michael J.

    2007-07-24

    Bacteria of the genus Deinococcus are extremely resistant to ionizing radiation (IR), ultraviolet light (UV) and desiccation. The mesophile Deinococcus radiodurans was the first member of this group whose genome was completely sequenced. Analysis of the genome sequence of D. radiodurans, however, failed to identify unique DNA repair systems. To further delineate the genes underlying the resistance phenotypes, we report the whole-genome sequence of a second Deinococcus species, the thermophile Deinococcus geothermalis, which at itsoptimal growth temperature is as resistant to IR, UV and desiccation as D. radiodurans, and a comparative analysis of the two Deinococcus genomes. Many D. radiodurans genes previously implicated in resistance, but for which no sensitive phenotype was observed upon disruption, are absent in D. geothermalis. In contrast, most D. radiodurans genes whose mutants displayed a radiation-sensitive phenotype in D. radiodurans are conserved in D. geothermalis. Supporting the existence of a Deinococcus radiation response regulon, a common palindromic DNA motif was identified in a conserved set of genes associated with resistance, and a dedicated transcriptional regulator was predicted. We present the case that these two species evolved essentially the same diverse set of gene families, and that the extreme stress-resistance phenotypes of the Deinococcus lineage emerged progressively by amassing cell-cleaning systems from different sources, but not by acquisition of novel DNA repair systems. Our reconstruction of the genomic evolution of the Deinococcus-Thermus phylum indicates that the corresponding set of enzymes proliferated mainly in the common ancestor of Deinococcus. Results of the comparative analysis weaken the arguments for a role of higher-order chromosome alignment structures in resistance; more clearly define and substantially revise downward the number of uncharacterized genes that might participate in DNA repair and contribute to

  15. Identifying resistance gene analogs associated with resistances to different pathogens in common bean.

    Science.gov (United States)

    López, Camilo E; Acosta, Iván F; Jara, Carlos; Pedraza, Fabio; Gaitán-Solís, Eliana; Gallego, Gerardo; Beebe, Steve; Tohme, Joe

    2003-01-01

    ABSTRACT A polymerase chain reaction approach using degenerate primers that targeted the conserved domains of cloned plant disease resistance genes (R genes) was used to isolate a set of 15 resistance gene analogs (RGAs) from common bean (Phaseolus vulgaris). Eight different classes of RGAs were obtained from nucleotide binding site (NBS)-based primers and seven from not previously described Toll/Interleukin-1 receptor-like (TIR)-based primers. Putative amino acid sequences of RGAs were significantly similar to R genes and contained additional conserved motifs. The NBS-type RGAs were classified in two subgroups according to the expected final residue in the kinase-2 motif. Eleven RGAs were mapped at 19 loci on eight linkage groups of the common bean genetic map constructed at Centro Internacional de Agricultura Tropical. Genetic linkage was shown for eight RGAs with partial resistance to anthracnose, angular leaf spot (ALS) and Bean golden yellow mosaic virus (BGYMV). RGA1 and RGA2 were associated with resistance loci to anthracnose and BGYMV and were part of two clusters of R genes previously described. A new major cluster was detected by RGA7 and explained up to 63.9% of resistance to ALS and has a putative contribution to anthracnose resistance. These results show the usefulness of RGAs as candidate genes to detect and eventually isolate numerous R genes in common bean.

  16. The relationship between codon usage bias and cold resistant genes

    International Nuclear Information System (INIS)

    Barozai, M.Y.; Din, M.

    2014-01-01

    This research is based on synonymous codon usage which has been well-known as a feature that affects typical expression level of protein in an organism. Different organisms prefer different codons for same amino acid and this is called Codon Usage Bias (CUB). The codon usage directly affects the level or even direction of changes in protein expression in responses to environmental stimuli. Cold stress is a major abiotic factor that limits the agricultural productivity of plants. In the recent study CUB has been studied in Arabidopsis thaliana cold resistant and housekeeping genes and their homologs in rice (Oryza sativa) to understand the cold stress and housekeeping genes relation with CUB. Six cold resistant and three housekeeping genes in Arabidopsis thaliana and their homologs in rice, were subjected to CUB analysis. The three cold resistant genes (DREB1B, RCI and MYB15) showed more than 50% (52%, 61% and 66% respectively) similar codon usage bias for Arabidopsis thaliana and rice. On the other hand three cold resistant genes (MPK3, ICE1 and ZAT12) showed less than 50% (38%, 38% and 47% respectively) similar codon usage bias for Arabidopsis thaliana and rice. The three housekeeping genes (Actin, Tubulin and Ubiquitin) showed 76% similar codon usage bias for Arabidopsis thaliana and rice. This study will help to manage the plant gene expression through codon optimization under the cold stress. (author)

  17. Molecular screening for erythromycin resistance genes in ...

    African Journals Online (AJOL)

    Aghomotsegin

    2015-07-15

    Jul 15, 2015 ... in Streptococcus pyogenes isolated from Iraqi patients with tonsilo-pharyngites. Hassan .... is an automated colorimetric method used for identification of bacteria and for .... counter medicines in private pharmacies against the regulations. ... Effect of telithromycin on erythromycin resistant S. pyogenes. In this ...

  18. AMINOGLYCOSIDE RESISTANCE GENES IN Pseudomonas aeruginosa ISOLATES FROM CUMANA, VENEZUELA

    Directory of Open Access Journals (Sweden)

    Bertinellys TEIXEIRA

    2016-01-01

    Full Text Available The enzymatic modification of aminoglycosides by aminoglycoside-acetyltransferases (AAC, aminoglycoside-adenyltransferases (AAD, and aminoglycoside-phosphotransferases (APH, is the most common resistance mechanism in P. aeruginosa and these enzymes can be coded on mobile genetic elements that contribute to their dispersion. One hundred and thirty seven P. aeruginosa isolates from the University Hospital, Cumana, Venezuela (HUAPA were evaluated. Antimicrobial susceptibility was determined by the disk diffusion method and theaac, aadB and aph genes were detected by PCR. Most of the P. aeruginosa isolates (33/137 were identified from the Intensive Care Unit (ICU, mainly from discharges (96/137. The frequency of resistant P. aeruginosaisolates was found to be higher for the aminoglycosides tobramycin and amikacin (30.7 and 29.9%, respectively. Phenotype VI, resistant to these antibiotics, was the most frequent (14/49, followed by phenotype I, resistant to all the aminoglycosides tested (12/49. The aac(6´-Ib,aphA1 and aadB genes were the most frequently detected, and the simultaneous presence of several resistance genes in the same isolate was demonstrated. Aminoglycoside resistance in isolates ofP. aeruginosa at the HUAPA is partly due to the presence of the aac(6´-Ib, aphA1 andaadB genes, but the high rates of antimicrobial resistance suggest the existence of several mechanisms acting together. This is the first report of aminoglycoside resistance genes in Venezuela and one of the few in Latin America.

  19. Molecular Scree ning of Blast Resistance Genes in Rice Germplasms Resistant to Magnaporthe oryzae

    Directory of Open Access Journals (Sweden)

    Liang Yan

    2017-01-01

    Full Text Available Molecular screening of major rice blast resistance genes was determined with molecular markers, which showed close-set linkage to 11 major rice blast resistance genes (Pi-d2, Pi-z, Piz-t, Pi-9, Pi-36, Pi-37, Pi5, Pi-b, Pik-p, Pik-h and Pi-ta2, in a collection of 32 accessions resistant to Magnaporthe oryzae. Out of the 32 accessions, the Pi-d2 and Pi-z appeared to be omnipresent and gave positive express. As the second dominant, Pi-b and Piz-t gene frequencies were 96.9% and 87.5%. And Pik-h and Pik-p gene frequencies were 43.8% and 28.1%, respectively. The molecular marker linkage to Pi-ta2 produced positive bands in eleven accessions, while the molecular marker linkage to Pi-36 and Pi-37 in only three and four accessions, respectively. The natural field evaluation analysis showed that 30 of the 32 accessions were resistant, one was moderately resistant and one was susceptible. Infection types were negatively correlated with the genotype scores of Pi-9, Pi5, Pi-b, Pi-ta2 and Pik-p, although the correlation coefficients were very little. These results are useful in identification and incorporation of functional resistance genes from these germplasms into elite cultivars through marker-assisted selection for improved blast resistance in China and worldwide.

  20. Gene Profiling in Late Blight Resistance in Potato Genotype SD20

    Directory of Open Access Journals (Sweden)

    Xiaohui Yang

    2018-06-01

    Full Text Available Late blight caused by the oomycete fungus Phytophthora infestans (Pi is the most serious obstacle to potato (Solanum tuberosum production in the world. A super race isolate, CN152, which was identified from Sichuan Province, China, could overcome nearly all known late blight resistance genes and caused serious damage in China. The potato genotype SD20 was verified to be highly resistant to CN152; however, the molecular regulation network underlying late blight resistance pathway remains unclear in SD20. Here, we performed a time-course experiment to systematically profile the late blight resistance response genes using RNA-sequencing in SD20. We identified 3354 differentially expressed genes (DEGs, which mainly encoded transcription factors and protein kinases, and also included four NBS-LRR genes. The late blight responsive genes showed time-point-specific induction/repression. Multi-signaling pathways of salicylic acid, jasmonic acid, and ethylene signaling pathways involved in resistance and defense against Pi in SD20. Gene Ontology and KEGG analyses indicated that the DEGs were significantly enriched in metabolic process, protein serine/threonine kinase activity, and biosynthesis of secondary metabolites. Forty-three DEGs were involved in immune response, of which 19 were enriched in hypersensitive response reaction, which could play an important role in broad-spectrum resistance to Pi infection. Experimental verification confirmed the induced expression of the responsive genes in the late blight resistance signaling pathway, such as WRKY, ERF, MAPK, and NBS-LRR family genes. Our results provided valuable information for understanding late blight resistance mechanism of potato.

  1. A novel gene of Kalanchoe daigremontiana confers plant drought resistance.

    Science.gov (United States)

    Wang, Li; Zhu, Chen; Jin, Lin; Xiao, Aihua; Duan, Jie; Ma, Luyi

    2018-02-07

    Kalanchoe (K.) daigremontiana is important for studying asexual reproduction under different environmental conditions. Here, we describe a novel KdNOVEL41 (KdN41) gene that may confer drought resistance and could thereby affect K. daigremontiana development. The detected subcellular localization of a KdN41/Yellow Fluorescent Protein (YFP) fusion protein was in the nucleus and cell membrane. Drought, salt, and heat stress treatment in tobacco plants containing the KdN41 gene promoter driving β-glucuronidase (GUS) gene transcription revealed that only drought stress triggered strong GUS staining in the vascular tissues. Overexpression (OE) of the KdN41 gene conferred improved drought resistance in tobacco plants compared to wild-type and transformed with empty vector plants by inducing higher antioxidant enzyme activities, decreasing cell membrane damage, increasing abscisic acid (ABA) content, causing reinforced drought resistance related gene expression profiles. The 3,3'-diaminobenzidine (DAB) and nitroblue tetrazolium (NBT) staining results also showed less relative oxygen species (ROS) content in KdN41-overexpressing tobacco leaf during drought stress. Surprisingly, by re-watering after drought stress, KdN41-overexpressing tobacco showed earlier flowering. Overall, the KdN41 gene plays roles in ROS scavenging and osmotic damage reduction to improve tobacco drought resistance, which may increase our understanding of the molecular network involved in developmental manipulation under drought stress in K. daigremontiana.

  2. Identification of a novel gene family that includes the interferon-inducible human genes 6–16 and ISG12

    Directory of Open Access Journals (Sweden)

    Parker Nadeene

    2004-01-01

    Full Text Available Abstract Background The human 6–16 and ISG12 genes are transcriptionally upregulated in a variety of cell types in response to type I interferon (IFN. The predicted products of these genes are small (12.9 and 11.5 kDa respectively, hydrophobic proteins that share 36% overall amino acid identity. Gene disruption and over-expression studies have so far failed to reveal any biochemical or cellular roles for these proteins. Results We have used in silico analyses to identify a novel family of genes (the ISG12 gene family related to both the human 6–16 and ISG12 genes. Each ISG12 family member codes for a small hydrophobic protein containing a conserved ~80 amino-acid motif (the ISG12 motif. So far we have detected 46 family members in 25 organisms, ranging from unicellular eukaryotes to humans. Humans have four ISG12 genes: the 6–16 gene at chromosome 1p35 and three genes (ISG12(a, ISG12(b and ISG12(c clustered at chromosome 14q32. Mice have three family members (ISG12(a, ISG12(b1 and ISG12(b2 clustered at chromosome 12F1 (syntenic with human chromosome 14q32. There does not appear to be a murine 6–16 gene. On the basis of phylogenetic analyses, genomic organisation and intron-alignments we suggest that this family has arisen through divergent inter- and intra-chromosomal gene duplication events. The transcripts from human and mouse genes are detectable, all but two (human ISG12(b and ISG12(c being upregulated in response to type I IFN in the cell lines tested. Conclusions Members of the eukaryotic ISG12 gene family encode a small hydrophobic protein with at least one copy of a newly defined motif of ~80 amino-acids (the ISG12 motif. In higher eukaryotes, many of the genes have acquired a responsiveness to type I IFN during evolution suggesting that a role in resisting cellular or environmental stress may be a unifying property of all family members. Analysis of gene-function in higher eukaryotes is complicated by the possibility of

  3. Antibiotic resistance and resistance genes in Escherichia coli from poultry farms, southwest Nigeria

    OpenAIRE

    Adelowo, Olawale O.; Fagade, Obasola E.; Agersø, Yvonne

    2014-01-01

    Introduction: This study investigated the mechanisms of resistance in 36 E. coli isolated from waste, litter, soil and water samples collected from poultry farms in Southwestern Nigeria. Methodology: Minimum inhibitory concentration (MIC) distributions of the isolates were determined using the methods of the Clinical and Laboratory Standard Institute and resistance genes detected by PCR. Results: A total of 30 isolates (94%) showed resistance to more than one antimicrobial. Percentage resista...

  4. Antimicrobial resistance and resistance gene determinants in clinical Escherichia coli from different animal species in Switzerland.

    Science.gov (United States)

    Lanz, Roland; Kuhnert, Peter; Boerlin, Patrick

    2003-01-02

    Antimicrobial susceptibility testing was performed on a total of 581 clinical Escherichia coli isolates from diarrhea and edema disease in pigs, from acute mastitis in dairy cattle, from urinary tract infections in dogs and cats, and from septicemia in laying hens collected in Switzerland between 1999 and 2001. Among the 16 antimicrobial agents tested, resistance was most frequent for sulfonamides, tetracycline, and streptomycin. Isolates from swine presented significantly more resistance than those from the other animal species. The distribution of the resistance determinants for sulfonamides, tetracycline, and streptomycin was assessed by hybridization and PCR in resistant isolates. Significant differences in the distribution of resistance determinants for tetracycline (tetA, tetB) and sulfonamides (sulII) were observed between the isolates from swine and those from the other species. Resistance to sulfonamides could not be explained by known resistance mechanisms in more than a quarter of the sulfonamide-resistant and sulfonamide-intermediate isolates from swine, dogs and cats. This finding suggests that one or several new resistance mechanisms for sulfonamides may be widespread among E. coli isolates from these animal species. The integrase gene (intI) from class I integrons was detected in a large proportion of resistant isolates in association with the sulI and aadA genes, thus demonstrating the importance of integrons in the epidemiology of resistance in clinical E. coli isolates from animals.

  5. Comparative mapping of powdery mildew resistance gene Pm21 and functional characterization of resistance-related genes in wheat.

    Science.gov (United States)

    He, Huagang; Zhu, Shanying; Jiang, Zhengning; Ji, Yaoyong; Wang, Feng; Zhao, Renhui; Bie, Tongde

    2016-04-01

    The powdery mildew resistance gene Pm21 was physically and comparatively mapped by newly developed markers. Seven candidate genes were verified to be required for Pm21 -mediated resistance to wheat powdery mildew. Pm21, a gene derived from wheat wild relative Dasypyrum villosum, has been transferred into common wheat and widely utilized in wheat resistance breeding for powdery mildew. Previously, Pm21 has been located to the bin FL0.45-0.58 of 6VS by using deletion stocks. However, its fine mapping is still a hard work. In the present study, 30 gene-derived 6VS-specific markers were obtained based on the collinearity among genomes of Brachypodium distachyon, Oryza and Triticeae, and then physically and comparatively mapped in the bin FL0.45-0.58 and its nearby chromosome region. According to the maps, the bin FL0.45-0.58 carrying Pm21 was closely flanked by the markers 6VS-03 and 6VS-23, which further narrowed the orthologous regions to 1.06 Mb in Brachypodium and 1.38 Mb in rice, respectively. Among the conserved genes shared by Brachypodium and rice, four serine/threonine protein kinase genes (DvMPK1, DvMLPK, DvUPK and DvPSYR1), one protein phosphatase gene (DvPP2C) and two transcription factor genes (DvGATA and DvWHY) were confirmed to be required for Pm21-mediated resistance to wheat powdery mildew by barley stripe mosaic virus-induced gene silencing (BSMV-VIGS) and transcriptional pattern analyses. In summary, this study gives new insights into the genetic basis of the Pm21 locus and the disease resistance pathways mediated by Pm21.

  6. Occurrence and Distribution of Antibiotic-resistant Bacteria and Transfer of Resistance Genes in Lake Taihu

    Science.gov (United States)

    Yin, Qian; Yue, Dongmei; Peng, Yuke; Liu, Ying; Xiao, Lin

    2013-01-01

    The overuse of antibiotics has accelerated antibiotic resistance in the natural environment, especially fresh water, generating a potential risk for public health around the world. In this study, antibiotic resistance in Lake Taihu was investigated and this was the first thorough data obtained through culture-dependent methods. High percentages of resistance to streptomycin and ampicillin among bacterial isolates were detected, followed by tetracycline and chloramphenicol. Especially high levels of ampicillin resistance in the western and northern regions were illustrated. Bacterial identification of the isolates selected for further study indicated the prevalence of some opportunistic pathogens and 62.0% of the 78 isolates exhibited multiple antibiotic resistance. The presence of ESBLs genes was in the following sequence: blaTEM > blaSHV > blaCTMX and 38.5% of the isolates had a class I integrase gene. Of all tested strains, 80.8% were able to transfer antibiotic resistance through conjugation. We also concluded that some new families of human-associated ESBLs and AmpC genes can be found in natural environmental isolates. The prevalence of antibiotic resistance and the dissemination of transferable antibiotic resistance in bacterial isolates (especially in opportunistic pathogens) was alarming and clearly indicated the urgency of realizing the health risks of antibiotic resistance to human and animal populations who are dependent on Lake Taihu for water consumption. PMID:24240317

  7. Antibiotic Resistance and Antibiotic Resistance Genes in Escherichia coli Isolates from Hospital Wastewater in Vietnam.

    Science.gov (United States)

    Lien, La Thi Quynh; Lan, Pham Thi; Chuc, Nguyen Thi Kim; Hoa, Nguyen Quynh; Nhung, Pham Hong; Thoa, Nguyen Thi Minh; Diwan, Vishal; Tamhankar, Ashok J; Stålsby Lundborg, Cecilia

    2017-06-29

    The environmental spread of antibiotic-resistant bacteria has been recognised as a growing public health threat for which hospitals play a significant role. The aims of this study were to investigate the prevalence of antibiotic resistance and antibiotic resistance genes (ARGs) in Escherichia coli isolates from hospital wastewater in Vietnam. Wastewater samples before and after treatment were collected using continuous sampling every month over a year. Standard disk diffusion and E-test were used for antibiotic susceptibility testing. Extended-spectrum beta-lactamase (ESBL) production was tested using combined disk diffusion. ARGs were detected by polymerase chain reactions. Resistance to at least one antibiotic was detected in 83% of isolates; multidrug resistance was found in 32%. The highest resistance prevalence was found for co-trimoxazole (70%) and the lowest for imipenem (1%). Forty-three percent of isolates were ESBL-producing, with the bla TEM gene being more common than bla CTX-M . Co-harbouring of the bla CTX-M , bla TEM and qepA genes was found in 46% of isolates resistant to ciprofloxacin. The large presence of antibiotic-resistant E. coli isolates combined with ARGs in hospital wastewater, even post-treatment, poses a threat to public health. It highlights the need to develop effective processes for hospital wastewater treatment plants to eliminate antibiotic resistant bacteria and ARGs.

  8. Antimicrobial resistance and prevalence of resistance genes of obligate anaerobes isolated from periodontal abscesses.

    Science.gov (United States)

    Xie, Yi; Chen, Jiazhen; He, Junlin; Miao, Xinyu; Xu, Meng; Wu, Xingwen; Xu, Beiyun; Yu, Liying; Zhang, Wenhong

    2014-02-01

    This study attempts to determine the antimicrobial resistance profiles of obligate anaerobic bacteria that were isolated from a periodontal abscess and to evaluate the prevalence of resistance genes in these bacteria. Forty-one periodontal abscess samples were cultivated on selective and non-selective culture media to isolate the oral anaerobes. Their antibiotic susceptibilities to clindamycin, doxycycline, amoxicillin, imipenem, cefradine, cefixime, roxithromycin, and metronidazole were determined using the agar dilution method, and polymerase chain reaction assays were performed to detect the presence of the ermF, tetQ, nim, and cfxA drug resistance genes. A total of 60 different bacterial colonies was isolated and identified. All of the isolates were sensitive to imipenem. Of the strains, 6.7%, 13.3%, 16.7%, and 25% were resistant to doxycycline, metronidazole, cefixime, and amoxicillin, respectively. The resistance rate for both clindamycin and roxithromycin was 31.7%. Approximately 60.7% of the strains had the ermF gene, and 53.3% of the amoxicillin-resistant strains were found to have the cfxA gene. Two nim genes that were found in eight metronidazole-resistant strains were identified as nimB. In the present study, the Prevotella species are the most frequently isolated obligate anaerobes from periodontal abscesses. The current results show their alarmingly high resistance rate against clindamycin and roxithromycin; thus, the use of these antibiotics is unacceptable for the empirical therapy of periodontal abscesses. A brief prevalence of four resistance genes in the anaerobic bacteria that were isolated was also demonstrated.

  9. Marfan syndrome with a complex chromosomal rearrangement including deletion of the FBN1 gene

    Directory of Open Access Journals (Sweden)

    Colovati Mileny ES

    2012-01-01

    Full Text Available Abstract Background The majority of Marfan syndrome (MFS cases is caused by mutations in the fibrillin-1 gene (FBN1, mapped to chromosome 15q21.1. Only few reports on deletions including the whole FBN1 gene, detected by molecular cytogenetic techniques, were found in literature. Results We report here on a female patient with clinical symptoms of the MFS spectrum plus craniostenosis, hypothyroidism and intellectual deficiency who presents a 1.9 Mb deletion, including the FBN1 gene and a complex rearrangement with eight breakpoints involving chromosomes 6, 12 and 15. Discussion This is the first report of MFS with a complex chromosome rearrangement involving a deletion of FBN1 and contiguous genes. In addition to the typical clinical findings of the Marfan syndrome due to FBN1 gene haploinsufficiency, the patient presents features which may be due to the other gene deletions and possibly to the complex chromosome rearrangement.

  10. Dissecting the organ specificity of insecticide resistance candidate genes in Anopheles gambiae: known and novel candidate genes.

    Science.gov (United States)

    Ingham, Victoria A; Jones, Christopher M; Pignatelli, Patricia; Balabanidou, Vasileia; Vontas, John; Wagstaff, Simon C; Moore, Jonathan D; Ranson, Hilary

    2014-11-25

    The elevated expression of enzymes with insecticide metabolism activity can lead to high levels of insecticide resistance in the malaria vector, Anopheles gambiae. In this study, adult female mosquitoes from an insecticide susceptible and resistant strain were dissected into four different body parts. RNA from each of these samples was used in microarray analysis to determine the enrichment patterns of the key detoxification gene families within the mosquito and to identify additional candidate insecticide resistance genes that may have been overlooked in previous experiments on whole organisms. A general enrichment in the transcription of genes from the four major detoxification gene families (carboxylesterases, glutathione transferases, UDP glucornyltransferases and cytochrome P450s) was observed in the midgut and malpighian tubules. Yet the subset of P450 genes that have previously been implicated in insecticide resistance in An gambiae, show a surprisingly varied profile of tissue enrichment, confirmed by qPCR and, for three candidates, by immunostaining. A stringent selection process was used to define a list of 105 genes that are significantly (p ≤0.001) over expressed in body parts from the resistant versus susceptible strain. Over half of these, including all the cytochrome P450s on this list, were identified in previous whole organism comparisons between the strains, but several new candidates were detected, notably from comparisons of the transcriptomes from dissected abdomen integuments. The use of RNA extracted from the whole organism to identify candidate insecticide resistance genes has a risk of missing candidates if key genes responsible for the phenotype have restricted expression within the body and/or are over expression only in certain tissues. However, as transcription of genes implicated in metabolic resistance to insecticides is not enriched in any one single organ, comparison of the transcriptome of individual dissected body parts cannot

  11. Distribution of the multidrug resistance gene cfr in Staphylococcus species isolates from swine farms in China.

    Science.gov (United States)

    Wang, Yang; Zhang, Wanjiang; Wang, Juan; Wu, Congming; Shen, Zhangqi; Fu, Xiao; Yan, Yang; Zhang, Qijing; Schwarz, Stefan; Shen, Jianzhong

    2012-03-01

    A total of 149 porcine Staphylococcus isolates with florfenicol MICs of ≥ 16 μg/ml were screened for the presence of the multiresistance gene cfr, its location on plasmids, and its genetic environment. In total, 125 isolates carried either cfr (16 isolates), fexA (92 isolates), or both genes (17 isolates). The 33 cfr-carrying staphylococci, which included isolates of the species Staphylococcus cohnii, S. arlettae, and S. saprophyticus in which the cfr gene has not been described before, exhibited a wide variety of SmaI pulsed-field gel electrophoresis patterns. In 18 cases, the cfr gene was located on plasmids. Four different types of cfr-carrying plasmids--pSS-01 (n = 2; 40 kb), pSS-02 (n = 3; 35.4 kb), pSS-03 (n = 10; 7.1 kb), and pBS-01 (n = 3; 16.4 kb)--were differentiated on the basis of their sizes, restriction patterns, and additional resistance genes. Sequence analysis revealed that in plasmid pSS-01, the cfr gene was flanked in the upstream part by a complete aacA-aphD-carrying Tn4001-like transposon and in the downstream part by a complete fexA-carrying transposon Tn558. In plasmid pSS-02, an insertion sequence IS21-558 and the cfr gene were integrated into transposon Tn558 and thereby truncated the tnpA and tnpB genes. The smallest cfr-carrying plasmid pSS-03 carried the macrolide-lincosamide-streptogramin B resistance gene erm(C). Plasmid pBS-01, previously described in Bacillus spp., harbored a Tn917-like transposon, including the macrolide-lincosamide-streptogramin B resistance gene erm(B) in the cfr downstream region. Plasmids, which in part carry additional resistance genes, seem to play an important role in the dissemination of the gene cfr among porcine staphylococci.

  12. Cloning of synthetic gene including antigens against Urinary Tract Infections in pET28a+ vector

    Directory of Open Access Journals (Sweden)

    Zohreh Haghri

    2017-12-01

    Full Text Available There are many different bacterial infections in the world that patients are suffering from and research teams are trying to find suitable ways to prevent and treat them. Urinary Tract Infections (UTIs are most important infections in the world , and they are more common among women because vaginal cavity is near to urethral opening. The aim of this study is cloning of synthetic gene include antigens against UTIs in pET28a+ vector. Antibiotic resistant has been increasing because of antibiotic overuse recently, so It shows the necessity of developing a vaccine against these infections. There for, it will be imperative to develop a vaccine instead of antibiotics. This infection causes by many organisms, most important of which are Uropathogenic Escherichia coli (UPEC, Proteus mirabilis and Klebsiella pneumoniae Uropathogenic Escherichia .coli is the most important microorganism that causes these infections more than other bacteria, so in developing a vaccine it is the most important one, that have to be considered. The synthetic Gene which was designed against these three bacteria including antigens which are important and common to cause these infections. This gene has involved 1293bp. It was ordered to Gene Ray Biotechnology. Primers were designed by Gene Runner. Gene and pET28a+ vector was checked by SnappGene. Synthetic gene was multiplied by PCR and cloned in pET28a+ vector. Construct was transformed into E. coli TOP10.The clone was confirmed by PCR, Digestion. This data indicates that this gene can be expressed and it might be a vaccine candidate to protect people from these infections in the future.

  13. Comparative genome analysis and resistance gene mapping in grain legumes

    International Nuclear Information System (INIS)

    Young, N.D.

    1998-01-01

    Using, DNA markers and genome organization, several important disease resistance genes have been analyzed in mungbean (Vigna radiata), cowpea (Vigna unguiculata), common bean (Phaseolus vulgaris), and soybean (Glycine max). In the process, medium-density linkage maps consisting of restriction fragment length polymorphism (RFLP) markers were constructed for both mungbean and cowpea. Comparisons between these maps, as well as the maps of soybean and common bean, indicate that there is significant conservation of DNA marker order, though the conserved blocks in soybean are much shorter than in the others. DNA mapping results also indicate that a gene for seed weight may be conserved between mungbean and cowpea. Using the linkage maps, genes that control bruchid (genus Callosobruchus) and powdery mildew (Erysiphe polygoni) resistance in mungbean, aphid resistance in cowpea (Aphis craccivora), and cyst nematode (Heterodera glycines) resistance in soybean have all been mapped and characterized. For some of these traits resistance was found to be oligogenic and DNA mapping uncovered multiple genes involved in the phenotype. (author)

  14. Sequence Exchange between Homologous NB-LRR Genes Converts Virus Resistance into Nematode Resistance, and Vice Versa.

    Science.gov (United States)

    Slootweg, Erik; Koropacka, Kamila; Roosien, Jan; Dees, Robert; Overmars, Hein; Lankhorst, Rene Klein; van Schaik, Casper; Pomp, Rikus; Bouwman, Liesbeth; Helder, Johannes; Schots, Arjen; Bakker, Jaap; Smant, Geert; Goverse, Aska

    2017-09-01

    Plants have evolved a limited repertoire of NB-LRR disease resistance ( R ) genes to protect themselves against myriad pathogens. This limitation is thought to be counterbalanced by the rapid evolution of NB-LRR proteins, as only a few sequence changes have been shown to be sufficient to alter resistance specificities toward novel strains of a pathogen. However, little is known about the flexibility of NB-LRR R genes to switch resistance specificities between phylogenetically unrelated pathogens. To investigate this, we created domain swaps between the close homologs Gpa2 and Rx1 , which confer resistance in potato ( Solanum tuberosum ) to the cyst nematode Globodera pallida and Potato virus X , respectively. The genetic fusion of the CC-NB-ARC of Gpa2 with the LRR of Rx1 (Gpa2 CN /Rx1 L ) results in autoactivity, but lowering the protein levels restored its specific activation response, including extreme resistance to Potato virus X in potato shoots. The reciprocal chimera (Rx1 CN /Gpa2 L ) shows a loss-of-function phenotype, but exchange of the first three LRRs of Gpa2 by the corresponding region of Rx1 was sufficient to regain a wild-type resistance response to G. pallida in the roots. These data demonstrate that exchanging the recognition moiety in the LRR is sufficient to convert extreme virus resistance in the leaves into mild nematode resistance in the roots, and vice versa. In addition, we show that the CC-NB-ARC can operate independently of the recognition specificities defined by the LRR domain, either aboveground or belowground. These data show the versatility of NB-LRR genes to generate resistance to unrelated pathogens with completely different lifestyles and routes of invasion. © 2017 American Society of Plant Biologists. All Rights Reserved.

  15. Urinary tract infections in hospital pediatrics: many previous antibiotherapy and antibiotics resistance, including fluoroquinolones.

    Science.gov (United States)

    Garraffo, A; Marguet, C; Checoury, A; Boyer, S; Gardrat, A; Houivet, E; Caron, F

    2014-02-01

    We studied antibiotic resistance in pediatric UTIs and we evaluated the impact of antibiotic exposure in the previous 12 months, very little French data being available for this population. We conducted a multicenter prospective study including children consulting for, or admitted in 2 hospitals. Prior antibiotic exposure was documented from their health record. One hundred and ten patients (73 girls), 11 days to 12 years of age, were included in 10 months. Ninety-six percent presented with pyelonephritis, associated to uropathy for 25%. Escherichia coli was predominant (78%), followed by Proteus spp. and Enterococcus spp. The antibiotic resistance rate of E. coli was high and close to that reported for adults with complicated UTIs: amoxicillin 60%, amoxicillin-clavulanate 35%, cefotaxim 5%, trimethoprim-sulfametoxazole 26%, nalidixic acid 9%, ciprofloxacin 7%, gentamycin 1%, nitrofurantoin and fosfomycin 0%. The antibiotic exposure in the previous 12 months involved 62 children (56%) most frequently with β-lactams (89%) for a respiratory tract infection (56%). A clear relationship between exposure and resistance was observed for amoxicillin (71% vs. 46%), first generation (65% vs. 46%) and third generation (9% vs. 3%) cephalosporins, or trimethoprim-sulfamethoxazole (36% vs. 15%). However, antibiotic exposure could not account alone for the results, as suggested by the 7% of ciprofloxacin resistance, observed without any identified previous treatment. Bacterial species and antibiotic resistance level in children are similar to those reported for adults. Antibiotic exposure in the previous 12 months increases the risk of resistance but other factors are involved (previous antibiotic therapies and fecal-oral or mother-to-child transmission). Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  16. High chlorpyrifos resistance in Culex pipiens mosquitoes: strong synergy between resistance genes

    Science.gov (United States)

    Alout, H; Labbé, P; Berthomieu, A; Makoundou, P; Fort, P; Pasteur, N; Weill, M

    2016-01-01

    We investigated the genetic determinism of high chlorpyrifos resistance (HCR), a phenotype first described in 1999 in Culex pipiens mosquitoes surviving chlorpyrifos doses ⩾1 mg l−1 and more recently found in field samples from Tunisia, Israel or Indian Ocean islands. Through chlorpyrifos selection, we selected several HCR strains that displayed over 10 000-fold resistance. All strains were homozygous for resistant alleles at two main loci: the ace-1 gene, with the resistant ace-1R allele expressing the insensitive G119S acetylcholinesterase, and a resistant allele of an unknown gene (named T) linked to the sex and ace-2 genes. We constructed a strain carrying only the T-resistant allele and studied its resistance characteristics. By crossing this strain with strains harboring different alleles at the ace-1 locus, we showed that the resistant ace-1R and the T alleles act in strong synergy, as they elicited a resistance 100 times higher than expected from a simple multiplicative effect. This effect was specific to chlorpyrifos and parathion and was not affected by synergists. We also examined how HCR was expressed in strains carrying other ace-1-resistant alleles, such as ace-1V or the duplicated ace-1D allele, currently spreading worldwide. We identified two major parameters that influenced the level of resistance: the number and the nature of the ace-1-resistant alleles and the number of T alleles. Our data fit a model that predicts that the T allele acts by decreasing chlorpyrifos concentration in the compartment targeted in insects. PMID:26463842

  17. Spread of tetracycline resistance genes at a conventional dairy farm

    Directory of Open Access Journals (Sweden)

    Martina eKyselkova

    2015-05-01

    Full Text Available The use of antibiotics in animal husbandry contributes to the worldwide problem of increasing antibiotic resistance in animal and human pathogens. Intensive animal production is considered an important source of antibiotic resistance genes released to the environment, while the contribution of smaller farms remains to be evaluated. Here we monitor the spread of tetracycline resistance (TC-r genes at a middle-size conventional dairy farm, where chlortetracycline (CTC, as intrauterine suppository is prophylactically used after each calving. Our study has shown that animals at the farm acquired the TC-r genes in their early age (1-2 weeks, likely due to colonization with TC-resistant bacteria from their mothers and/or the farm environment. The relative abundance of the TC-r genes tet(W, tet(Q and tet(M in fresh excrements of calves was about 1-2 orders of magnitude higher compared to heifers and dairy cows, possibly due to the presence of antibiotic residues in milk fed to calves. The occurrence and abundance of TC-r genes in fresh excrements of heifers and adult cows remained unaffected by intrauterine CTC applications, with tet(O, tet(Q and tet(W representing a ‘core TC-resistome’ of the farm, and tet(A, tet(M, tet(Y and tet(X occurring occasionally. The genes tet(A, tet(M, tet(Y and tet(X were shown to be respectively harbored by Shigella, Lactobacillus and Clostridium, Acinetobacter, and Wautersiella. Soil in the farm proximity, as well as field soil to which manure from the farm was applied, was contaminated with TC-r genes occurring in the farm, and some of the TC-r genes persisted in the field over 3 months following the manure application. Concluding, our study shows that antibiotic resistance genes may be a stable part of the intestinal metagenome of cattle even if antibiotics are not used for growth stimulation, and that smaller dairy farms may also contribute to environmental pollution with antibiotic resistance genes.

  18. Recessive Resistance to Plant Viruses: Potential Resistance Genes Beyond Translation Initiation Factors

    Directory of Open Access Journals (Sweden)

    Masayoshi Hashimoto

    2016-10-01

    Full Text Available The ability of plant viruses to propagate their genomes in host cells depends on many host factors. In the absence of an agrochemical that specifically targets plant viral infection cycles, one of the most effective methods for controlling viral diseases in plants is taking advantage of the host plant’s resistance machinery. Recessive resistance is conferred by a recessive gene mutation that encodes a host factor critical for viral infection. It is a branch of the resistance machinery and, as an inherited characteristic, is very durable. Moreover, recessive resistance may be acquired by a deficiency in a negative regulator of plant defense responses, possibly due to the autoactivation of defense signaling. Eukaryotic translation initiation factor (eIF 4E and eIF4G and their isoforms are the most widely exploited recessive resistance genes in several crop species, and they are effective against a subset of viral species. However, the establishment of efficient, recessive resistance-type antiviral control strategies against a wider range of plant viral diseases requires genetic resources other than eIF4Es. In this review, we focus on recent advances related to antiviral recessive resistance genes evaluated in model plants and several crop species. We also address the roles of next-generation sequencing and genome editing technologies in improving plant genetic resources for recessive resistance-based antiviral breeding in various crop species.

  19. Bacterial metal resistance genes and metal bioavailability in contaminated sediments

    International Nuclear Information System (INIS)

    Roosa, Stéphanie; Wattiez, Ruddy; Prygiel, Emilie; Lesven, Ludovic; Billon, Gabriel; Gillan, David C.

    2014-01-01

    In bacteria a metal may be defined as bioavailable if it crosses the cytoplasmic membrane to reach the cytoplasm. Once inside the cell, specific metal resistance systems may be triggered. In this research, specific metal resistance genes were used to estimate metal bioavailability in sediment microbial communities. Gene levels were measured by quantitative PCR and correlated to metals in sediments using five different protocols to estimate dissolved, particle-adsorbed and occluded metals. The best correlations were obtained with czcA (a Cd/Zn/Co efflux pump) and Cd/Zn adsorbed or occluded in particles. Only adsorbed Co was correlated to czcA levels. We concluded that the measurement of czcA gene levels by quantitative PCR is a promising tool which may complement the classical approaches used to estimate Cd/Zn/Co bioavailability in sediment compartments. - Highlights: • Metal resistance genes were used to estimate metal bioavailability in sediments. • Gene levels were correlated to metals using 5 different metal extraction protocols. • CzcA gene levels determined by quantitative PCR is a promising tool for Cd/Zn/Co. - Capsule Bacterial czcA is a potential biomarker of Cd, Zn and Co bioavailability in aquatic sediments as shown by quantitative PCR and sequential metal extraction

  20. Prediction and analysis of three gene families related to leaf rust (Puccinia triticina) resistance in wheat (Triticum aestivum L.).

    Science.gov (United States)

    Peng, Fred Y; Yang, Rong-Cai

    2017-06-20

    adult resistance and six SNPs for seedling resistance in the NLR genes. Most of these coding SNPs were predicted to alter encoded amino acids and such information may serve as a starting point towards more thorough molecular and functional characterization of the designated Lr genes. Using the primer sequences of 99 known non-SNP markers from leaf rust resistance QTLs, we found candidate genes closely linked to these markers, including Lr34 with distances to its two gene-specific markers being 1212 bases (to cssfr1) and 2189 bases (to cssfr2). This study represents a comprehensive analysis of ABC, NLR and START genes in the hexaploid wheat genome and their physical relationships with QTLs for leaf rust resistance at seedling and adult stages. Our analysis suggests that the ABC (and START) genes are more likely to be co-located with QTLs for race-nonspecific, adult resistance whereas the NLR genes are more likely to be co-located with QTLs for race-specific resistance that would be often expressed at the seedling stage. Though our analysis was hampered by inaccurate or unknown physical positions of numerous QTLs due to the incomplete assembly of the complex hexaploid wheat genome that is currently available, the observed associations between (i) QTLs for race-specific resistance and NLR genes and (ii) QTLs for nonspecific resistance and ABC genes will help discover SNP variants for leaf rust resistance at seedling and adult stages. The genes containing nonsynonymous SNPs are promising candidates that can be investigated in future studies as potential new sources of leaf rust resistance in wheat breeding.

  1. Sponge Microbiota are a Reservoir of Functional Antibiotic Resistance Genes

    DEFF Research Database (Denmark)

    Versluis, Dennis; de Evgrafov, Mari Cristina Rodriguez; Sommer, Morten Otto Alexander

    2016-01-01

    examined sponges as a reservoir of antibiotic resistance. Sponges could be important in this respect because they often contain diverse microbial communities that have the capacity to produce bioactive metabolites. Here, we applied functional metagenomics to study the presence and diversity of functional...... resistance genes in the sponges Aplysina aerophoba, Petrosia ficiformis, and Corticium candelabrum. We obtained 37 insert sequences facilitating resistance to D-cycloserine (n = 6), gentamicin (n = 1), amikacin (n = 7), trimethoprim (n = 17), chloramphenicol (n = 1), rifampicin (n = 2) and ampicillin (n = 3......-resistance-conferring β-lactamase was identified in the genus Pseudovibrio with 41% global amino acid identity to the closest β-lactamase with demonstrated functionality, and subsequently classified into a new family termed PSV. Taken together, our results show that sponge microbiota host diverse and novel resistance...

  2. Tagging of resistance gene(s) to rhizomania disease in sugar beet ...

    African Journals Online (AJOL)

    SERVER

    2008-02-19

    Feb 19, 2008 ... plasmodiophoride-like fungus, Polymyxa betae Keskin. (1964) (Tamada and Richard, 1992). Source of resistance to rhizomania were found in Holly sugar beet company source (Lewellen, 1987). Resistance in Holly is simply inherited by a single dominant gene(Rz1). (Lewellen et al., 1987; Scholten et al., ...

  3. Tagging of resistance gene(s) to rhizomania disease in sugar beet ...

    African Journals Online (AJOL)

    The rhizomania disease is one of the most important diseases in Iran and some other parts of the world which potentially could play a role in decreasing sugar yield in fields. One approach to combat with this disease is the use of resistance varieties. This varieties have been identified which are having resistance genes to ...

  4. Alteration of gene expression profiling including GPR174 and GNG2 is associated with vasovagal syncope.

    Science.gov (United States)

    Huang, Yu-Juan; Zhou, Zai-wei; Xu, Miao; Ma, Qing-wen; Yan, Jing-bin; Wang, Jian-yi; Zhang, Quo-qin; Huang, Min; Bao, Liming

    2015-03-01

    Vasovagal syncope (VVS) causes accidental harm for susceptible patients. However, pathophysiology of this disorder remains largely unknown. In an effort to understanding of molecular mechanism for VVS, genome-wide gene expression profiling analyses were performed on VVS patients at syncope state. A total of 66 Type 1 VVS child patients and the same number healthy controls were enrolled in this study. Peripheral blood RNAs were isolated from all subjects, of which 10 RNA samples were randomly selected from each groups for gene expression profile analysis using Gene ST 1.0 arrays (Affymetrix). The results revealed that 103 genes were differently expressed between the patients and controls. Significantly, two G-proteins related genes, GPR174 and GNG2 that have not been related to VVS were among the differently expressed genes. The microarray results were confirmed by qRT-PCR in all the tested individuals. Ingenuity pathway analysis and gene ontology annotation study showed that the differently expressed genes are associated with stress response and apoptosis, suggesting that the alteration of some gene expression including G-proteins related genes is associated with VVS. This study provides new insight into the molecular mechanism of VVS and would be helpful to further identify new molecular biomarkers for the disease.

  5. Remapping of the stripe rust resistance gene Yr10 in common wheat.

    Science.gov (United States)

    Yuan, Cuiling; Wu, Jingzheng; Yan, Baiqiang; Hao, Qunqun; Zhang, Chaozhong; Lyu, Bo; Ni, Fei; Caplan, Allan; Wu, Jiajie; Fu, Daolin

    2018-02-23

    Yr10 is an important gene to control wheat stripe rust, and the search for Yr10 needs to be continued. Wheat stripe rust or yellow rust is a devastating fungal disease caused by Puccinia striiformis f. sp. tritici (Pst). Host disease resistance offers a primary source for controlling wheat stripe rust. The stripe rust resistance gene Yr10 confers the race-specific resistance to most tested Pst races in China including CYR29. Early studies proposed that Yr10 was a nucleotide-binding site, leucine-rich repeat gene archived as GenBank accession AF149112 (hereafter designated the Yr10 candidate gene or Yr10 CG ). In this study, we revealed that 15 Chinese wheat cultivars positive for Yr10 CG are susceptible to CYR29. We then expressed the Yr10 CG cDNA in the common wheat 'Bobwhite'. The Yr10 CG -cDNA positive transgenic plants were also susceptible to CYR29. Thus, it is highly unlikely that Yr10 CG corresponds to the Yr10 resistance gene. Using the Yr10 donor 'Moro' and the Pst-susceptible wheat 'Huixianhong', we generated two F 3 populations that displayed a single Mendelian segregation on the Yr10 gene, and used them to remap the Yr10 gene. Six markers were placed in the Yr10 region, with the Yr10 CG gene now mapping about 1.2-cM proximal to the Yr10 locus and the Xsdauw79 marker is completely linked to the Yr10 locus. Apparently, the Yr10 gene has not yet been identified. Fine mapping and positional cloning of Yr10 is important for gene pyramiding for stripe rust resistance in wheat.

  6. Bioinformatics Analysis of NBS-LRR Encoding Resistance Genes in Setaria italica.

    Science.gov (United States)

    Zhao, Yan; Weng, Qiaoyun; Song, Jinhui; Ma, Hailian; Yuan, Jincheng; Dong, Zhiping; Liu, Yinghui

    2016-06-01

    In plants, resistance (R) genes are involved in pathogen recognition and subsequent activation of innate immune responses. The nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes family forms the largest R-gene family among plant genomes and play an important role in plant disease resistance. In this paper, comprehensive analysis of NBS-encoding genes is performed in the whole Setaria italica genome. A total of 96 NBS-LRR genes are identified, and comprehensive overview of the NBS-LRR genes is undertaken, including phylogenetic analysis, chromosome locations, conserved motifs of proteins, and gene expression. Based on the domain, these genes are divided into two groups and distributed in all Setaria italica chromosomes. Most NBS-LRR genes are located at the distal tip of the long arms of the chromosomes. Setaria italica NBS-LRR proteins share at least one nucleotide-biding domain and one leucine-rich repeat domain. Our results also show the duplication of NBS-LRR genes in Setaria italica is related to their gene structure.

  7. Loci and candidate genes conferring resistance to soybean cyst nematode HG type 2.5.7.

    Science.gov (United States)

    Zhao, Xue; Teng, Weili; Li, Yinghui; Liu, Dongyuan; Cao, Guanglu; Li, Dongmei; Qiu, Lijuan; Zheng, Hongkun; Han, Yingpeng; Li, Wenbin

    2017-06-14

    Soybean (Glycine max L. Merr.) cyst nematode (SCN, Heterodera glycines I,) is a major pest of soybean worldwide. The most effective strategy to control this pest involves the use of resistant cultivars. The aim of the present study was to investigate the genome-wide genetic architecture of resistance to SCN HG Type 2.5.7 (race 1) in landrace and elite cultivated soybeans. A total of 200 diverse soybean accessions were screened for resistance to SCN HG Type 2.5.7 and genotyped through sequencing using the Specific Locus Amplified Fragment Sequencing (SLAF-seq) approach with a 6.14-fold average sequencing depth. A total of 33,194 SNPs were identified with minor allele frequencies (MAF) over 4%, covering 97% of all the genotypes. Genome-wide association mapping (GWAS) revealed thirteen SNPs associated with resistance to SCN HG Type 2.5.7. These SNPs were distributed on five chromosomes (Chr), including Chr7, 8, 14, 15 and 18. Four SNPs were novel resistance loci and nine SNPs were located near known QTL. A total of 30 genes were identified as candidate genes underlying SCN resistance. A total of sixteen novel soybean accessions were identified with significant resistance to HG Type 2.5.7. The beneficial alleles and candidate genes identified by GWAS might be valuable for improving marker-assisted breeding efficiency and exploring the molecular mechanisms underlying SCN resistance.

  8. Patterns of genetic diversity and differentiation in resistance gene clusters of two hybridizing European Populus species

    OpenAIRE

    Casey, Céline; Stölting, Kai N.; Barbará, Thelma; González-Martínez, Santiago C.; Lexer, Christian

    2015-01-01

    Resistance genes (R-genes) are essential for long-lived organisms such as forest trees, which are exposed to diverse herbivores and pathogens. In short-lived model species, R-genes have been shown to be involved in species isolation. Here, we studied more than 400 trees from two natural hybrid zones of the European Populus species Populus alba and Populus tremula for microsatellite markers located in three R-gene clusters, including one cluster situated in the incipient sex chromosome region....

  9. Resistance-related gene transcription and antioxidant enzyme ...

    African Journals Online (AJOL)

    The two tobacco relatives of Nicotiana alata and Nicotiana longiflora display a high level of resistance against Colletotrichum nicotianae and the two genes NTF6 and NtPAL related to pathogen defense transcription were higher in N. alata and N. longiflora than the commercial cv. K326. Inoculation with C. nicotianae ...

  10. Antibiotic resistance and ndvB gene expression among biofilm ...

    African Journals Online (AJOL)

    A novel antibiotic resistant mechanism among biofilms is glucan-mediated sequestration in which ndvB gene encodes a glucosyltransferase involved in the formation of this glucans. We studied the biofilm formation and antibiotic susceptibility pattern of P. aeruginosa isolated from clinical samples, and measured the ...

  11. Prevalence, antibiotic-resistance properties and enterotoxin gene ...

    African Journals Online (AJOL)

    milk-based infant foods in Iran, represent an important public health issue which should be considered ... Keywords: Prevalence, Bacillus cereus, Antibiotic resistance, Enterotoxigenic genes, Milk-based infant food. Tropical Journal of Pharmaceutical Research is indexed by Science ..... and cereals collected in Korea.

  12. Spatial patterns of Antimicrobial Resistance Genes in Danish Pig Farms

    DEFF Research Database (Denmark)

    Birkegård, Anna Camilla; Ersbøll, A. K.; Hisham Beshara Halasa, Tariq

    2016-01-01

    antimicrobial resistance genes, ermB, ermF, sulI, sulII, tet(M), tet(O) and tet(W), was quantified by a high-throughput qPCR. It was evaluated whether the sample method resulted in a study population representative of Danish pig farms with finishers where it was found that the study population was biased...

  13. Molecular Detection of Virulence Genes and Antibiotic Resistance ...

    African Journals Online (AJOL)

    Escherichia coli O157:H7 is an important food-borne pathogen that can cause diarrhea, haemorrhagic colitis and haemolytic uremic syndrome. This study was conducted to investigate the prevalence, virulence genes and antibiotic resistance patterns of E. coli O157:H7 in raw beef meat sold in Abeokuta, South west Nigeria ...

  14. Transcriptome profiling to discover putative genes associated with paraquat resistance in goosegrass (Eleusine indica L..

    Directory of Open Access Journals (Sweden)

    Jing An

    Full Text Available BACKGROUND: Goosegrass (Eleusine indica L., a serious annual weed in the world, has evolved resistance to several herbicides including paraquat, a non-selective herbicide. The mechanism of paraquat resistance in weeds is only partially understood. To further study the molecular mechanism underlying paraquat resistance in goosegrass, we performed transcriptome analysis of susceptible and resistant biotypes of goosegrass with or without paraquat treatment. RESULTS: The RNA-seq libraries generated 194,716,560 valid reads with an average length of 91.29 bp. De novo assembly analysis produced 158,461 transcripts with an average length of 1153.74 bp and 100,742 unigenes with an average length of 712.79 bp. Among these, 25,926 unigenes were assigned to 65 GO terms that contained three main categories. A total of 13,809 unigenes with 1,208 enzyme commission numbers were assigned to 314 predicted KEGG metabolic pathways, and 12,719 unigenes were categorized into 25 KOG classifications. Furthermore, our results revealed that 53 genes related to reactive oxygen species scavenging, 10 genes related to polyamines and 18 genes related to transport were differentially expressed in paraquat treatment experiments. The genes related to polyamines and transport are likely potential candidate genes that could be further investigated to confirm their roles in paraquat resistance of goosegrass. CONCLUSION: This is the first large-scale transcriptome sequencing of E. indica using the Illumina platform. Potential genes involved in paraquat resistance were identified from the assembled sequences. The transcriptome data may serve as a reference for further analysis of gene expression and functional genomics studies, and will facilitate the study of paraquat resistance at the molecular level in goosegrass.

  15. Transcriptome profiling to discover putative genes associated with paraquat resistance in goosegrass (Eleusine indica L.).

    Science.gov (United States)

    An, Jing; Shen, Xuefeng; Ma, Qibin; Yang, Cunyi; Liu, Simin; Chen, Yong

    2014-01-01

    Goosegrass (Eleusine indica L.), a serious annual weed in the world, has evolved resistance to several herbicides including paraquat, a non-selective herbicide. The mechanism of paraquat resistance in weeds is only partially understood. To further study the molecular mechanism underlying paraquat resistance in goosegrass, we performed transcriptome analysis of susceptible and resistant biotypes of goosegrass with or without paraquat treatment. The RNA-seq libraries generated 194,716,560 valid reads with an average length of 91.29 bp. De novo assembly analysis produced 158,461 transcripts with an average length of 1153.74 bp and 100,742 unigenes with an average length of 712.79 bp. Among these, 25,926 unigenes were assigned to 65 GO terms that contained three main categories. A total of 13,809 unigenes with 1,208 enzyme commission numbers were assigned to 314 predicted KEGG metabolic pathways, and 12,719 unigenes were categorized into 25 KOG classifications. Furthermore, our results revealed that 53 genes related to reactive oxygen species scavenging, 10 genes related to polyamines and 18 genes related to transport were differentially expressed in paraquat treatment experiments. The genes related to polyamines and transport are likely potential candidate genes that could be further investigated to confirm their roles in paraquat resistance of goosegrass. This is the first large-scale transcriptome sequencing of E. indica using the Illumina platform. Potential genes involved in paraquat resistance were identified from the assembled sequences. The transcriptome data may serve as a reference for further analysis of gene expression and functional genomics studies, and will facilitate the study of paraquat resistance at the molecular level in goosegrass.

  16. Putative resistance genes in the CitEST database

    Directory of Open Access Journals (Sweden)

    Simone Guidetti-Gonzalez

    2007-01-01

    Full Text Available Disease resistance in plants is usually associated with the activation of a wide variety of defense responses to prevent pathogen replication and/or movement. The ability of the host plant to recognize the pathogen and to activate defense responses is regulated by direct or indirect interaction between the products of plant resistance (R and pathogen avirulence (Avr genes. Attempted infection of plants by avirulent pathogens elicits a battery of defenses often followed by the collapse of the challenged host cells. Localized host cell death may help to prevent the pathogen from spreading to uninfected tissues, known as hypersensitive response (HR. When either the plant or the pathogen lacks its cognate gene, activation of the plant’s defense responses fails to occur or is delayed and does not prevent pathogen colonization. In the CitEST database, we identified 1,300 reads related to R genes in Citrus which have been reported in other plant species. These reads were translated in silico, and alignments of their amino acid sequences revealed the presence of characteristic domains and motifs that are specific to R gene classes. The description of the reads identified suggests that they function as resistance genes in citrus.

  17. Identification of antimicrobial resistance genes in multidrug-resistant clinical Bacteroides fragilis isolates by whole genome shotgun sequencing

    DEFF Research Database (Denmark)

    Sydenham, Thomas Vognbjerg; Sóki, József; Hasman, Henrik

    2015-01-01

    Bacteroides fragilis constitutes the most frequent anaerobic bacterium causing bacteremia in humans. The genetic background for antimicrobial resistance in B. fragilis is diverse with some genes requiring insertion sequence (IS) elements inserted upstream for increased expression. To evaluate whole...... genome shotgun sequencing as a method for predicting antimicrobial resistance properties, one meropenem resistant and five multidrug-resistant blood culture isolates were sequenced and antimicrobial resistance genes and IS elements identified using ResFinder 2.1 (http...

  18. The identification of new genes related to cisplatin resistance in ovarian adenocarcinoma cell line A2780

    International Nuclear Information System (INIS)

    Solar, P.; Fedorocko, P.; Sytkowski, A.; Hodorova, I.

    2006-01-01

    Ovarian cancer cells are usually sensitive to platinum-based chemotherapy, such as cisplatin (CDDP), initially but typically become resistant to the drug over time. The phenomenon of clinical drug resistance represents a serious problem for successful disease treatment, and the molecular mechanism(s) are not fully understood. In search of novel mechanisms that may lead to the development of CDDP chemoresistance we have applied subtractive hybridization based on the PCR-select cDNA subtraction. In current study we have used subtractive hybridization to identify differentially-expressed genes in CDDP resistant CP70 and C200 cells versus CDDP-sensitive A2780 human ovarian adenocarcinoma cells. We have analyzed 256 randomly selected clones. Subtraction efficiency was determined by dot blot and DNA sequencing. Confirmation of differentially expressed cDNAs was done by virtual northern blot analysis, and 17 genes that were differentially expressed in both CDDP resistant cell lines versus CDDP sensitive A2780 cells were identified. The expression of 10 of these genes was undetectable or detected with low expression in sensitive A2780 cells in comparison to resistant ones. These genes included ARHGDIB, RANBP2, ASPH, PRTFDC1, SSX2IP, MBNL1, DNAJC15, MMP10, TCTE1L and one unidentified sequence. Additional 7 genes that were more highly expressed in resistant CP70 and C200 vs. A2780 cells included ANXA2, USP8, HSPCA, TRA1, CNAP1, ATP2B1 and COX2. Interestingly, multi-drug resistance associated p-glycoprotein (p170) was not detected by the western blot in CDDP resistant CP70 and C200 cells. Our identified genes are involved in diverse processes, such as stress response, chromatin condensation, protection from protein degradation, invasiveness of cells, alterations of Ca 2+ homeostasis and others which may contribute to CDDP resistance of ovarian adenocarcinoma cells. Further characterization of these genes and gene products should yield important insights into the biology of

  19. Anthropogenic antibiotic resistance genes mobilization to the polar regions.

    Science.gov (United States)

    Hernández, Jorge; González-Acuña, Daniel

    2016-01-01

    Anthropogenic influences in the southern polar region have been rare, but lately microorganisms associated with humans have reached Antarctica, possibly from military bases, fishing boats, scientific expeditions, and/or ship-borne tourism. Studies of seawater in areas of human intervention and proximal to fresh penguin feces revealed the presence of Escherichia coli strains least resistant to antibiotics in penguins, whereas E. coli from seawater elsewhere showed resistance to one or more of the following antibiotics: ampicillin, tetracycline, streptomycin, and trim-sulfa. In seawater samples, bacteria were found carrying extended-spectrum β-lactamase (ESBL)-type CTX-M genes in which multilocus sequencing typing (MLST) showed different sequence types (STs), previously reported in humans. In the Arctic, on the contrary, people have been present for a long time, and the presence of antibiotic resistance genes (ARGs) appears to be much more wide-spread than was previously reported. Studies of E coli from Arctic birds (Bering Strait) revealed reduced susceptibility to antibiotics, but one globally spreading clone of E. coli genotype O25b-ST131, carrying genes of ESBL-type CTX-M, was identified. In the few years between sample collections in the same area, differences in resistance pattern were observed, with E. coli from birds showing resistance to a maximum of five different antibiotics. Presence of resistance-type ESBLs (TEM, SHV, and CTX-M) in E. coli and Klebsiella pneumoniae was also confirmed by specified PCR methods. MLST revealed that those bacteria carried STs that connect them to previously described strains in humans. In conclusion, bacteria previously related to humans could be found in relatively pristine environments, and presently human-associated, antibiotic-resistant bacteria have reached a high global level of distribution that they are now found even in the polar regions.

  20. Relationship between Psidium species (Myrtaceae) by resistance gene analog markers: focus on nematode resistance.

    Science.gov (United States)

    Noia, L R; Tuler, A C; Ferreira, A; Ferreira, M F S

    2017-03-16

    Guava (Psidium guajava L.) crop is severely affected by the nematode Meloidogyne enterolobii. Native Psidium species have been reported as sources of resistance against this nematode. Knowledge on the molecular relationship between Psidium species based on plant resistance gene analogs (RGA) can be useful in the genetic breeding of guava for resistance to M. enterolobii. In this study, RGA markers from conserved domains, and structural features of plant R genes, were employed to characterize Psidium species and establish genetic proximity, with a focus on nematode resistance. SSR markers were also applied owing to their neutral nature, thus differing from RGA markers. For this, species reported as sources of resistance to M. enterolobii, such as P. cattleianum and P. friedrichsthalianum, as well as species occurring in the Atlantic Rainforest and susceptible genotypes, were investigated. In 10 evaluated Psidium species, high interspecific genetic variability was verified through RGA and SSR markers, with intraspecific variation in P. guajava higher with SSR, as was expected. Resistant species were clustered by RGA markers, and differential amplicons among genotypes resistant and susceptible to M. enterolobii were identified. Knowledge on the molecular relationships between Psidium species constitutes useful information for breeding of the guava tree, providing direction for hybridization and material for rootstocks. Additionally, the genetic relationship between native species, which have been little studied, and P. guajava were estimated by RGAs, which were confirmed as important markers for genetic diversity related to pathogen resistance.

  1. Functional study of the novel multidrug resistance gene HA117 and its comparison to multidrug resistance gene 1

    Directory of Open Access Journals (Sweden)

    Chen Tingfu

    2010-07-01

    Full Text Available Abstract Background The novel gene HA117 is a multidrug resistance (MDR gene expressed by all-trans retinoic acid-resistant HL-60 cells. In the present study, we compared the multidrug resistance of the HA117 with that of the classical multidrug resistance gene 1 (MDR1 in breast cancer cell line 4T1. Methods Transduction of the breast cancer cell line 4T1 with adenoviral vectors encoding the HA117 gene and the green fluorescence protein gene (GFP (Ad-GFP-HA117, the MDR1 and GFP (Ad-GFP-MDR1 or GFP (Ad-GFP was respectively carried out. The transduction efficiency and the multiplicity of infection (MOI were detected by fluorescence microscope and flow cytometry. The transcription of HA117 gene and MDR1 gene were detected by reverse transcription polymerase chain reaction (RT-PCR. Western blotting analysis was used to detect the expression of P-glycoprotein (P-gp but the expression of HA117 could not be analyzed as it is a novel gene and its antibody has not yet been synthesized. The drug-excretion activity of HA117 and MDR1 were determined by daunorubicin (DNR efflux assay. The drug sensitivities of 4T1/HA117 and 4T1/MDR1 to chemotherapeutic agents were detected by Methyl-Thiazolyl-Tetrazolium (MTT assay. Results The transducted efficiency of Ad-GFP-HA117 and Ad-GFP-MDR1 were 75%-80% when MOI was equal to 50. The transduction of Ad-GFP-HA117 and Ad-GFP-MDR1 could increase the expression of HA117 and MDR1. The drug resistance index to Adriamycin (ADM, vincristine (VCR, paclitaxel (Taxol and bleomycin (BLM increased to19.8050, 9.0663, 9.7245, 3.5650 respectively for 4T1/HA117 and 24.2236, 11.0480, 11.3741, 0.9630 respectively for 4T1/MDR1 as compared to the control cells. There were no significant differences in drug sensitivity between 4T1/HA117 and 4T1/MDR1 for the P-gp substrates (ADM, VCR and Taxol (P Conclusions These results confirm that HA117 is a strong MDR gene in both HL-60 and 4T1 cells. Furthermore, our results indicate that the MDR

  2. Polymorphisms in Plasmodium falciparum chloroquine resistance transporter and multidrug resistance 1 genes

    DEFF Research Database (Denmark)

    Venkatesan, Meera; Gadalla, Nahla B; Stepniewska, Kasia

    2014-01-01

    Adequate clinical and parasitologic cure by artemisinin combination therapies relies on the artemisinin component and the partner drug. Polymorphisms in the Plasmodium falciparum chloroquine resistance transporter (pfcrt) and P. falciparum multidrug resistance 1 (pfmdr1) genes are associated...... with decreased sensitivity to amodiaquine and lumefantrine, but effects of these polymorphisms on therapeutic responses to artesunate-amodiaquine (ASAQ) and artemether-lumefantrine (AL) have not been clearly defined. Individual patient data from 31 clinical trials were harmonized and pooled by using standardized...

  3. Simulated selection responses for breeding programs including resistance and resilience to parasites in Creole goats.

    Science.gov (United States)

    Gunia, M; Phocas, F; Gourdine, J-L; Bijma, P; Mandonnet, N

    2013-02-01

    The Creole goat is a local breed used for meat production in Guadeloupe (French West Indies). As in other tropical countries, improvement of parasite resistance is needed. In this study, we compared predicted selection responses for alternative breeding programs with or without parasite resistance and resilience traits. The overall breeding goal included traits for production, reproduction, and parasite resilience and resistance to ensure a balanced selection outcome. The production traits were BW and dressing percentage (DP). The reproduction trait was fertility (FER), which was the number of doe kiddings per mating. The resistance trait was worm fecal egg count (FEC), which is a measurement of the number of gastro-intestinal parasite eggs found in the feces. The resilience trait was the packed cell volume (PCV), which is a measurement of the volume of red blood cells in the blood. Dressing percentage, BW, and FEC were measured at 11 mo of age, which is the mating or selling age. Fertility and PCV were measured on females at each kidding period. The breeding program accounting for the overall breeding goal and a selection index including all traits gave annual selection responses of 800 g for BW, 3.75% for FER, 0.08% for DP, -0.005 ln(eggs/g) for FEC, and 0.28% for PCV. The expected selection responses for BW and DP in this breeding program were reduced by 2% and 6%, respectively, compared with a breeding program not accounting for FEC and PCV. The overall breeding program, proposed for the Creole breed, offers the best breeding strategy in terms of expected selection responses, making it possible to improve all traits together. It offers a good balance between production and adaptation traits and may present some interest for the selection of other goat breeds in the tropics.

  4. Recombination Rate Heterogeneity within Arabidopsis Disease Resistance Genes.

    Science.gov (United States)

    Choi, Kyuha; Reinhard, Carsten; Serra, Heïdi; Ziolkowski, Piotr A; Underwood, Charles J; Zhao, Xiaohui; Hardcastle, Thomas J; Yelina, Nataliya E; Griffin, Catherine; Jackson, Matthew; Mézard, Christine; McVean, Gil; Copenhaver, Gregory P; Henderson, Ian R

    2016-07-01

    Meiotic crossover frequency varies extensively along chromosomes and is typically concentrated in hotspots. As recombination increases genetic diversity, hotspots are predicted to occur at immunity genes, where variation may be beneficial. A major component of plant immunity is recognition of pathogen Avirulence (Avr) effectors by resistance (R) genes that encode NBS-LRR domain proteins. Therefore, we sought to test whether NBS-LRR genes would overlap with meiotic crossover hotspots using experimental genetics in Arabidopsis thaliana. NBS-LRR genes tend to physically cluster in plant genomes; for example, in Arabidopsis most are located in large clusters on the south arms of chromosomes 1 and 5. We experimentally mapped 1,439 crossovers within these clusters and observed NBS-LRR gene associated hotspots, which were also detected as historical hotspots via analysis of linkage disequilibrium. However, we also observed NBS-LRR gene coldspots, which in some cases correlate with structural heterozygosity. To study recombination at the fine-scale we used high-throughput sequencing to analyze ~1,000 crossovers within the RESISTANCE TO ALBUGO CANDIDA1 (RAC1) R gene hotspot. This revealed elevated intragenic crossovers, overlapping nucleosome-occupied exons that encode the TIR, NBS and LRR domains. The highest RAC1 recombination frequency was promoter-proximal and overlapped CTT-repeat DNA sequence motifs, which have previously been associated with plant crossover hotspots. Additionally, we show a significant influence of natural genetic variation on NBS-LRR cluster recombination rates, using crosses between Arabidopsis ecotypes. In conclusion, we show that a subset of NBS-LRR genes are strong hotspots, whereas others are coldspots. This reveals a complex recombination landscape in Arabidopsis NBS-LRR genes, which we propose results from varying coevolutionary pressures exerted by host-pathogen relationships, and is influenced by structural heterozygosity.

  5. Emergence of Lamivudine-Resistant HBV during Antiretroviral Therapy Including Lamivudine for Patients Coinfected with HIV and HBV in China

    Science.gov (United States)

    Li, Yijia; Zhu, Ting; Song, Xiaojing; Huang, Ying; Yang, Feifei; Guan, Shuo; Xie, Jing; Gohda, Jin; Hosoya, Noriaki; Kawana-Tachikawa, Ai; Liu, Wenjun; Gao, George Fu; Iwamoto, Aikichi; Li, Taisheng; Ishida, Takaomi

    2015-01-01

    In China, HIV-1-infected patients typically receive antiretroviral therapy (ART) that includes lamivudine (3TC) as a reverse-transcriptase inhibitor (RTI) (ART-3TC). Previous studies from certain developed countries have shown that, in ART-3TC, 3TC-resistant HBV progressively emerges at an annual rate of 15–20% in patients coinfected with HIV-1 and HBV. This scenario in China warrants investigation because >10% of all HIV-infected patients in China are HBV carriers. We measured the occurrence of 3TC-resistant HBV during ART-3TC for HIV-HBV coinfection and also tested the effect of tenofovir disoproxil fumarate (TDF) used as an additional RTI (ART-3TC/TDF) in a cohort study in China. We obtained 200 plasma samples collected from 50 Chinese patients coinfected with HIV-1 and HBV (positive for hepatitis B surface antigen) and examined them for the prevalence of 3TC-resistant HBV by directly sequencing PCR products that covered the HBV reverse-transcriptase gene. We divided the patients into ART-3TC and ART-3TC/TDF groups and compared the efficacy of treatment and incidence of drug-resistance mutation between the groups. HIV RNA and HBV DNA loads drastically decreased in both ART-3TC and ART-3TC/TDF groups. In the ART-3TC group, HBV breakthrough or insufficient suppression of HBV DNA loads was observed in 20% (10/50) of the patients after 96-week treatment, and 8 of these patients harbored 3TC-resistant mutants. By contrast, neither HBV breakthrough nor treatment failure was recorded in the ART-3TC/TDF group. All of the 3TC-resistant HBV mutants emerged from the cases in which HBV DNA loads were high at baseline. Our results clearly demonstrated that ART-3TC is associated with the emergence of 3TC-resistant HBV in patients coinfected with HIV-1 and HBV and that ART-3TC/TDF reduces HBV DNA loads to an undetectable level. These findings support the use of TDF-based treatment regimens for patients coinfected with HIV-1 and HBV. PMID:26288093

  6. Comparative Transcriptomics Reveals Differential Gene Expression Related to Colletotrichum gloeosporioides Resistance in the Octoploid Strawberry

    Directory of Open Access Journals (Sweden)

    Feng Wang

    2017-05-01

    Full Text Available The strawberry is an important fruit worldwide; however, the development of the strawberry industry is limited by fungal disease. Anthracnose is caused by the pathogen Colletotrichum gloeosporioides and leads to large-scale losses in strawberry quality and production. However, the transcriptional response of strawberry to infection with C. gloeosporioides is poorly understood. In the present study, the strawberry leaf transcriptome of the ‘Yanli’ and ‘Benihoppe’ cultivars were deep sequenced via an RNA-seq analysis to study C. gloeosporioides resistance in strawberry. Among the sequences, differentially expressed genes were annotated with Gene Ontology terms and subjected to pathway enrichment analysis. Significant categories included defense, plant–pathogen interactions and flavonoid biosynthesis were identified. The comprehensive transcriptome data set provides molecular insight into C. gloeosporioides resistance genes in resistant and susceptible strawberry cultivars. Our findings can enhance breeding efforts in strawberry.

  7. The natural history of class I primate alcohol dehydrogenases includes gene duplication, gene loss, and gene conversion.

    Directory of Open Access Journals (Sweden)

    Matthew A Carrigan

    Full Text Available Gene duplication is a source of molecular innovation throughout evolution. However, even with massive amounts of genome sequence data, correlating gene duplication with speciation and other events in natural history can be difficult. This is especially true in its most interesting cases, where rapid and multiple duplications are likely to reflect adaptation to rapidly changing environments and life styles. This may be so for Class I of alcohol dehydrogenases (ADH1s, where multiple duplications occurred in primate lineages in Old and New World monkeys (OWMs and NWMs and hominoids.To build a preferred model for the natural history of ADH1s, we determined the sequences of nine new ADH1 genes, finding for the first time multiple paralogs in various prosimians (lemurs, strepsirhines. Database mining then identified novel ADH1 paralogs in both macaque (an OWM and marmoset (a NWM. These were used with the previously identified human paralogs to resolve controversies relating to dates of duplication and gene conversion in the ADH1 family. Central to these controversies are differences in the topologies of trees generated from exonic (coding sequences and intronic sequences.We provide evidence that gene conversions are the primary source of difference, using molecular clock dating of duplications and analyses of microinsertions and deletions (micro-indels. The tree topology inferred from intron sequences appear to more correctly represent the natural history of ADH1s, with the ADH1 paralogs in platyrrhines (NWMs and catarrhines (OWMs and hominoids having arisen by duplications shortly predating the divergence of OWMs and NWMs. We also conclude that paralogs in lemurs arose independently. Finally, we identify errors in database interpretation as the source of controversies concerning gene conversion. These analyses provide a model for the natural history of ADH1s that posits four ADH1 paralogs in the ancestor of Catarrhine and Platyrrhine primates

  8. Mapping fusiform rust resistance genes within a complex mating design of loblolly pine

    Science.gov (United States)

    Tania Quesada; Marcio F.R. Resende Jr.; Patricio Munoz; Jill L. Wegrzyn; David B. Neale; Matias Kirst; Gary F. Peter; Salvador A. Gezan; C.Dana Nelson; John M. Davis

    2014-01-01

    Fusiform rust resistance can involve gene-for-gene interactions where resistance (Fr) genes in the host interact with corresponding avirulence genes in the pathogen, Cronartium quercuum f.sp. fusiforme (Cqf). Here, we identify trees with Fr genes in a loblolly pine population derived from a complex mating design challenged with two Cqf inocula (one gall and 10 gall...

  9. Antimicrobial resistance and virulence genes in enterococci from wild game meat in Spain.

    Science.gov (United States)

    Guerrero-Ramos, Emilia; Cordero, Jorge; Molina-González, Diana; Poeta, Patrícia; Igrejas, Gilberto; Alonso-Calleja, Carlos; Capita, Rosa

    2016-02-01

    A total of 55 enterococci (45 Enterococcus faecium, 7 Enterococcus faecalis, and three Enterococcus durans) isolated from the meat of wild game animals (roe deer, boar, rabbit, pheasant, and pigeon) in North-Western Spain were tested for susceptibility to 14 antimicrobials by the disc diffusion method. All strains showed a multi-resistant phenotype (resistance to between three and 10 antimicrobials). The strains exhibited high percentages of resistance to erythromycin (89.1%), tetracycline (67.3%), ciprofloxacin (92.7%), nitrofurantoin (67.3%), and quinupristin-dalfopristin (81.8%). The lowest values (9.1%) were observed for high-level resistance to gentamicin, kanamycin, and streptomycin. The average number of resistances per strain was 5.8 for E. faecium isolates, 7.9 for E. faecalis, and 5.7 for E. durans. Genes encoding antimicrobial resistance and virulence were studied by polymerase chain reaction. A total of 15 (57.7%) of the 26 vancomycin-resistant isolates harboured the vanA gene. Other resistance genes detected included vanB, erm(B) and/or erm(C), tet(L) and/or tet(M), acc(6')-aph(2″), and aph(3')-IIIa in strains resistant to vancomycin, erythromycin, tetracycline, gentamicin, and kanamycin, respectively. Specific genes of the Tn5397 transposon were detected in 54.8% of the tet(M)-positive enterococci. Nine virulence factors (gelE, agg, ace, cpd, frs, esp, hyl, efaAfs and efaAfm) were studied. All virulence genes, with the exception of the frs gene, were found to be present in the enterococcal isolates. At least one virulence gene was detected in 20.0% of E. faecium, 71.4% of E. faecalis and 33.3% of E. durans isolates, with ace and cpd being the most frequently detected genes (6 isolates each). This suggests that wild game meat might play a role in the spreading through the food chain of enterococci with antimicrobial resistance and virulence determinants to humans. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. The Order Bacillales Hosts Functional Homologs of the Worrisome cfr Antibiotic Resistance Gene

    DEFF Research Database (Denmark)

    Hansen, Lykke H.; Planellas, Mercè H.; Long, Katherine S.

    2012-01-01

    The cfr gene encodes the Cfr methyltransferase that methylates a single adenine in the peptidyl transferase region of bacterial ribosomes. The methylation provides resistance to several classes of antibiotics that include drugs of clinical and veterinary importance. This paper describes a first...

  11. Reprogramming of the ERRα and ERα target gene landscape triggers tamoxifen resistance in breast cancer.

    Science.gov (United States)

    Thewes, Verena; Simon, Ronald; Schroeter, Petra; Schlotter, Magdalena; Anzeneder, Tobias; Büttner, Reinhard; Benes, Vladimir; Sauter, Guido; Burwinkel, Barbara; Nicholson, Robert I; Sinn, Hans-Peter; Schneeweiss, Andreas; Deuschle, Ulrich; Zapatka, Marc; Heck, Stefanie; Lichter, Peter

    2015-02-15

    Endocrine treatment regimens for breast cancer that target the estrogen receptor-α (ERα) are effective, but acquired resistance remains a limiting drawback. One mechanism of acquired resistance that has been hypothesized is functional substitution of the orphan receptor estrogen-related receptor-α (ERRα) for ERα. To examine this hypothesis, we analyzed ERRα and ERα in recurrent tamoxifen-resistant breast tumors and conducted a genome-wide target gene profiling analysis of MCF-7 breast cancer cell populations that were sensitive or resistant to tamoxifen treatment. This analysis uncovered a global redirection in the target genes controlled by ERα, ERRα, and their coactivator AIB1, defining a novel set of target genes in tamoxifen-resistant cells. Beyond differences in the ERα and ERRα target gene repertoires, both factors were engaged in similar pathobiologic processes relevant to acquired resistance. Functional analyses confirmed a requirement for ERRα in tamoxifen- and fulvestrant-resistant MCF-7 cells, with pharmacologic inhibition of ERRα sufficient to partly restore sensitivity to antiestrogens. In clinical specimens (n = 1041), increased expression of ERRα was associated with enhanced proliferation and aggressive disease parameters, including increased levels of p53 in ERα-positive cases. In addition, increased ERRα expression was linked to reduced overall survival in independent tamoxifen-treated patient cohorts. Taken together, our results suggest that ERα and ERRα cooperate to promote endocrine resistance, and they provide a rationale for the exploration of ERRα as a candidate drug target to treat endocrine-resistant breast cancer. ©2015 American Association for Cancer Research.

  12. Spread of tetracycline resistance genes at a conventional dairy farm

    Czech Academy of Sciences Publication Activity Database

    Kyselková, Martina; Jirout, Jiří; Vrchotová, Naděžda; Schmitt, H.; Elhottová, Dana

    2015-01-01

    Roč. 6, may (2015), s. 536 ISSN 1664-302X R&D Projects: GA ČR GAP504/10/2077; GA MŠk(CZ) EE2.3.30.0032; GA MŠk(CZ) LO1415 Institutional support: RVO:67179843 ; RVO:60077344 Keywords : antibiotic resistance spread * animal manure * cattle intestinal microflora * chlortetracycline * dairy cattle * dairy farm * heavy metals * tetracycline resistance genes Subject RIV: EI - Biotechnology ; Bionics; EE - Microbiology, Virology (BC-A) Impact factor: 4.165, year: 2015

  13. Using SNP genetic markers to elucidate the linkage of the Co-34/Phg-3 anthracnose and angular leaf spot resistance gene cluster with the Ur-14 resistance gene

    Science.gov (United States)

    The Ouro Negro common bean cultivar contains the Co-34/Phg-3 gene cluster that confers resistance to the anthracnose (ANT) and angular leaf spot (ALS) pathogens. These genes are tightly linked on chromosome 4. Ouro Negro also has the Ur-14 rust resistance gene, reportedly in the vicinity of Co- 34; ...

  14. Distribution of different efflux pump genes in clinical isolates of multidrug-resistant Acinetobacter baumannii and their correlation with antimicrobial resistance.

    Science.gov (United States)

    Lin, Ming-Feng; Lin, Yun-You; Tu, Chi-Chao; Lan, Chung-Yu

    2017-04-01

    Efflux pumps are one of the major mechanisms of antimicrobial resistance in Acinetobacter baumannii. This study aimed to understand the distribution of different types of pump genes in clinical isolates of multidrug-resistant A. baumannii (MDRAB) and to reveal the relationship between their presence and expression with antimicrobial resistance. MDRAB isolates were collected from five hospitals in Taiwan. Different categories of pump genes, including adeB, adeJ, macB, abeM, abeS, emrA-like, emrB-like, and craA, were chosen, and their presence in the collected isolates was determined. Three induced resistant strains of A. baumannii ATCC 17978 to tigecycline, imipenem, and amikacin were also included. The expressions of the selected pump genes were determined using quantitative reverse transcription-polymerase chain reaction. Twenty-one MDRAB clinical isolates were obtained from five hospitals. All of the studied pump genes were present in the collected MDRAB isolates except one isolate that lacked the emrA-like gene. The gene expression of these efflux pumps was variable among the strains. The upregulation of the adeB, adeJ, and macB genes was responsible for tigecycline resistance, and the increased abeS expression was strongly related to amikacin resistance. Of all the antibiotics studied, tigecycline was the strongest inducer of gene expression for many efflux pumps in A. baumannii. Efflux pump genes are universally present in the collected clinical MDRAB isolates. The upregulation of the adeB, adeJ, macB and abeS genes is more related with antibiotic resistance. Copyright © 2015. Published by Elsevier B.V.

  15. Overexpression of SOS genes in ciprofloxacin resistant Escherichia coli mutants.

    Science.gov (United States)

    Pourahmad Jaktaji, Razieh; Pasand, Shirin

    2016-01-15

    Fluoroquinolones are important antibiotics for the treatment of urinary tract infections caused by Escherichia coli. Mutational studies have shown that ciprofloxacin, a member of fluoroquinolones induces SOS response and mutagenesis in pathogenic bacteria which in turn develop antibiotic resistance. However, inhibition of SOS response can increase recombination activity which in turn leads to genetic variation. The aim of this study was to measure 5 SOS genes expressions in nine E. coli mutants with different MICs for ciprofloxacin following exposure to ciprofloxacin. Gene expression was assessed by quantitative real time PCR. Gene alteration assessment was conducted by PCR amplification and DNA sequencing. Results showed that the expression of recA was increased in 5 mutants. This overexpression is not related to gene alteration, and enhances the expression of polB and umuCD genes encoding nonmutagenic and mutagenic polymerases, respectively. The direct relationship between the level of SOS expression and the level of resistance to ciprofloxacin was also indicated. It was concluded that novel therapeutic strategy that inhibits RecA activity would enhance the efficiency of common antibiotics against pathogenic bacteria. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. Environmental and Public Health Implications of Water Reuse: Antibiotics, Antibiotic Resistant Bacteria, and Antibiotic Resistance Genes

    Science.gov (United States)

    Hong, Pei-Ying; Al-Jassim, Nada; Ansari, Mohd Ikram; Mackie, Roderick I.

    2013-01-01

    Water scarcity is a global problem, and is particularly acute in certain regions like Africa, the Middle East, as well as the western states of America. A breakdown on water usage revealed that 70% of freshwater supplies are used for agricultural irrigation. The use of reclaimed water as an alternative water source for agricultural irrigation would greatly alleviate the demand on freshwater sources. This paradigm shift is gaining momentum in several water scarce countries like Saudi Arabia. However, microbial problems associated with reclaimed water may hinder the use of reclaimed water for agricultural irrigation. Of particular concern is that the occurrence of antibiotic residues in the reclaimed water can select for antibiotic resistance genes among the microbial community. Antibiotic resistance genes can be associated with mobile genetic elements, which in turn allow a promiscuous transfer of resistance traits from one bacterium to another. Together with the pathogens that are present in the reclaimed water, antibiotic resistant bacteria can potentially exchange mobile genetic elements to create the “perfect microbial storm”. Given the significance of this issue, a deeper understanding of the occurrence of antibiotics in reclaimed water, and their potential influence on the selection of resistant microorganisms would be essential. In this review paper, we collated literature over the past two decades to determine the occurrence of antibiotics in municipal wastewater and livestock manure. We then discuss how these antibiotic resistant bacteria may impose a potential microbial risk to the environment and public health, and the knowledge gaps that would have to be addressed in future studies. Overall, the collation of the literature in wastewater treatment and agriculture serves to frame and identify potential concerns with respect to antibiotics, antibiotic resistant bacteria, and antibiotic resistance genes in reclaimed water. PMID:27029309

  17. Environmental and Public Health Implications of Water Reuse: Antibiotics, Antibiotic Resistant Bacteria, and Antibiotic Resistance Genes

    KAUST Repository

    Hong, Pei-Ying; Aljassim, Nada I.; Ansari, Mohd Ikram; Mackie, Roderick

    2013-01-01

    Water scarcity is a global problem, and is particularly acute in certain regions like Africa, the Middle East, as well as the western states of America. A breakdown on water usage revealed that 70% of freshwater supplies are used for agricultural irrigation. The use of reclaimed water as an alternative water source for agricultural irrigation would greatly alleviate the demand on freshwater sources. This paradigm shift is gaining momentum in several water scarce countries like Saudi Arabia. However, microbial problems associated with reclaimed water may hinder the use of reclaimed water for agricultural irrigation. Of particular concern is that the occurrence of antibiotic residues in the reclaimed water can select for antibiotic resistance genes among the microbial community. Antibiotic resistance genes can be associated with mobile genetic elements, which in turn allow a promiscuous transfer of resistance traits from one bacterium to another. Together with the pathogens that are present in the reclaimed water, antibiotic resistant bacteria can potentially exchange mobile genetic elements to create the “perfect microbial storm”. Given the significance of this issue, a deeper understanding of the occurrence of antibiotics in reclaimed water, and their potential influence on the selection of resistant microorganisms would be essential. In this review paper, we collated literature over the past two decades to determine the occurrence of antibiotics in municipal wastewater and livestock manure. We then discuss how these antibiotic resistant bacteria may impose a potential microbial risk to the environment and public health, and the knowledge gaps that would have to be addressed in future studies. Overall, the collation of the literature in wastewater treatment and agriculture serves to frame and identify potential concerns with respect to antibiotics, antibiotic resistant bacteria, and antibiotic resistance genes in reclaimed water.

  18. Environmental and Public Health Implications of Water Reuse: Antibiotics, Antibiotic Resistant Bacteria, and Antibiotic Resistance Genes

    Directory of Open Access Journals (Sweden)

    Roderick I. Mackie

    2013-07-01

    Full Text Available Water scarcity is a global problem, and is particularly acute in certain regions like Africa, the Middle East, as well as the western states of America. A breakdown on water usage revealed that 70% of freshwater supplies are used for agricultural irrigation. The use of reclaimed water as an alternative water source for agricultural irrigation would greatly alleviate the demand on freshwater sources. This paradigm shift is gaining momentum in several water scarce countries like Saudi Arabia. However, microbial problems associated with reclaimed water may hinder the use of reclaimed water for agricultural irrigation. Of particular concern is that the occurrence of antibiotic residues in the reclaimed water can select for antibiotic resistance genes among the microbial community. Antibiotic resistance genes can be associated with mobile genetic elements, which in turn allow a promiscuous transfer of resistance traits from one bacterium to another. Together with the pathogens that are present in the reclaimed water, antibiotic resistant bacteria can potentially exchange mobile genetic elements to create the “perfect microbial storm”. Given the significance of this issue, a deeper understanding of the occurrence of antibiotics in reclaimed water, and their potential influence on the selection of resistant microorganisms would be essential. In this review paper, we collated literature over the past two decades to determine the occurrence of antibiotics in municipal wastewater and livestock manure. We then discuss how these antibiotic resistant bacteria may impose a potential microbial risk to the environment and public health, and the knowledge gaps that would have to be addressed in future studies. Overall, the collation of the literature in wastewater treatment and agriculture serves to frame and identify potential concerns with respect to antibiotics, antibiotic resistant bacteria, and antibiotic resistance genes in reclaimed water.

  19. Environmental and Public Health Implications of Water Reuse: Antibiotics, Antibiotic Resistant Bacteria, and Antibiotic Resistance Genes

    KAUST Repository

    Hong, Pei-Ying

    2013-07-31

    Water scarcity is a global problem, and is particularly acute in certain regions like Africa, the Middle East, as well as the western states of America. A breakdown on water usage revealed that 70% of freshwater supplies are used for agricultural irrigation. The use of reclaimed water as an alternative water source for agricultural irrigation would greatly alleviate the demand on freshwater sources. This paradigm shift is gaining momentum in several water scarce countries like Saudi Arabia. However, microbial problems associated with reclaimed water may hinder the use of reclaimed water for agricultural irrigation. Of particular concern is that the occurrence of antibiotic residues in the reclaimed water can select for antibiotic resistance genes among the microbial community. Antibiotic resistance genes can be associated with mobile genetic elements, which in turn allow a promiscuous transfer of resistance traits from one bacterium to another. Together with the pathogens that are present in the reclaimed water, antibiotic resistant bacteria can potentially exchange mobile genetic elements to create the “perfect microbial storm”. Given the significance of this issue, a deeper understanding of the occurrence of antibiotics in reclaimed water, and their potential influence on the selection of resistant microorganisms would be essential. In this review paper, we collated literature over the past two decades to determine the occurrence of antibiotics in municipal wastewater and livestock manure. We then discuss how these antibiotic resistant bacteria may impose a potential microbial risk to the environment and public health, and the knowledge gaps that would have to be addressed in future studies. Overall, the collation of the literature in wastewater treatment and agriculture serves to frame and identify potential concerns with respect to antibiotics, antibiotic resistant bacteria, and antibiotic resistance genes in reclaimed water.

  20. Staphylococcus aureus nasal carriage in Ukraine: antibacterial resistance and virulence factor encoding genes.

    Science.gov (United States)

    Netsvyetayeva, Irina; Fraczek, Mariusz; Piskorska, Katarzyna; Golas, Marlena; Sikora, Magdalena; Mlynarczyk, Andrzej; Swoboda-Kopec, Ewa; Marusza, Wojciech; Palmieri, Beniamino; Iannitti, Tommaso

    2014-03-05

    The number of studies regarding the incidence of multidrug resistant strains and distribution of genes encoding virulence factors, which have colonized the post-Soviet states, is considerably limited. The aim of the study was (1) to assess the Staphylococcus (S.) aureus nasal carriage rate, including Methicillin Resistant S. aureus (MRSA) strains in adult Ukrainian population, (2) to determine antibiotic resistant pattern and (3) the occurrence of Panton Valentine Leukocidine (PVL)-, Fibronectin-Binding Protein A (FnBPA)- and Exfoliative Toxin (ET)-encoding genes. Nasal samples for S. aureus culture were obtained from 245 adults. The susceptibility pattern for several classes of antibiotics was determined by disk diffusion method according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines. The virulence factor encoding genes, mecA, lukS-lukF, eta, etb, etd, fnbA, were detected by Polymerase Chain Reaction (PCR). The S. aureus nasal carriage rate was 40%. The prevalence of nasal MRSA carriage in adults was 3.7%. LukS-lukF genes were detected in over 58% of the strains. ET-encoding genes were detected in over 39% of the strains and the most prevalent was etd. The fnbA gene was detected in over 59% of the strains. All MRSA isolates tested were positive for the mecA gene. LukS-lukF genes and the etd gene were commonly co-present in MRSA, while lukS-lukF genes and the fnbA gene were commonly co-present in Methicillin Sensitive S. aureus (MSSA) isolates. No significant difference was detected between the occurrence of lukS-lukF genes (P > 0.05) and the etd gene (P > 0.05) when comparing MRSA and MSSA. The occurrence of the fnbA gene was significantly more frequent in MSSA strains (P aureus is a common cause of infection. The prevalence of S. aureus nasal carriage in our cohort of patients from Ukraine was 40.4%. We found that 9.1% of the strains were classified as MRSA and all MRSA isolates tested positive for the mecA gene

  1. A novel resistance gene, lnu(H), conferring resistance to lincosamides in Riemerella anatipestifer CH-2.

    Science.gov (United States)

    Luo, Hong-Yan; Liu, Ma-Feng; Wang, Ming-Shu; Zhao, Xin-Xin; Jia, Ren-Yong; Chen, Shun; Sun, Kun-Feng; Yang, Qiao; Wu, Ying; Chen, Xiao-Yue; Biville, Francis; Zou, Yuan-Feng; Jing, Bo; Cheng, An-Chun; Zhu, De-Kang

    2018-01-01

    The Gram-negative bacterium Riemerella anatipestifer CH-2 is resistant to lincosamides, having a lincomycin (LCM) minimum inhibitory concentration (MIC) of 128 µg/mL. The G148_1775 gene of R. anatipestifer CH-2, designated lnu(H), encodes a 260-amino acid protein with ≤41% identity to other reported lincosamide nucleotidylyltransferases. Escherichia coli Rosetta TM (DE3) containing the pBAD24-lnu(H) plasmid showed four- and two-fold increases in the MICs of LCM and clindamycin (CLI), respectively. A kinetic assay of the purified Lnu(H) enzyme for LCM and CLI showed that the protein could inactive lincosamides. Mass spectrometry analysis demonstrated that the Lnu(H) enzyme catalysed adenylylation of lincosamides. In addition, an lnu(H) gene deletion strain exhibited 512- and 32-fold decreases in LCM and CLI MICs, respectively. The wild-type level of lincosamide resistance could be restored by complementation with a shuttle plasmid carrying the lnu(H) gene. The transformant R. anatipestifer ATCC 11845 [lnu(H)] acquired by natural transformation also exhibited high-level lincosamide resistance. Moreover, among 175 R. anatipestifer field isolates, 56 (32.0%) were positive for the lnu(H) gene by PCR. In conclusion, Lnu(H) is a novel lincosamide nucleotidylyltransferase that inactivates LCM and CLI by nucleotidylylation, thus conferring high-level lincosamide resistance to R. anatipestifer CH-2. Copyright © 2017. Published by Elsevier B.V.

  2. Who possesses drug resistance genes in the aquatic environment?: sulfamethoxazole (SMX) resistance genes among the bacterial community in water environment of Metro-Manila, Philippines.

    Science.gov (United States)

    Suzuki, Satoru; Ogo, Mitsuko; Miller, Todd W; Shimizu, Akiko; Takada, Hideshige; Siringan, Maria Auxilia T

    2013-01-01

    Recent evidence has shown that antibiotic resistant bacteria (ARB) and antibiotic resistance genes (ARGs) are ubiquitous in natural environments, including sites considered pristine. To understand the origin of ARGs and their dynamics, we must first define their actual presence in the natural bacterial assemblage. Here we found varying distribution profiles of sul genes in "colony forming bacterial assemblages" and "natural bacterial assemblages." Our monitoring for antibiotic contamination revealed that sulfamethoxazole (SMX) is a major contaminant in aquatic environments of Metro-Manila, which would have been derived from human and animal use, and subsequently decreased through the process of outflow from source to the sea. The SMX-resistant bacterial rate evaluated by the colony forming unit showed 10 to 86% of the total colony numbers showed higher rates from freshwater sites compared to marine sites. When sul genes were quantified by qPCR, colony-forming bacteria conveyed sul1 and sul2 genes in freshwater and seawater (10(-5)-10(-2) copy/16S) but not sul3. Among the natural bacterial assemblage, all sul1, sul2, and sul3 were detected (10(-5)-10(-3) copy/16S), whereas all sul genes were at an almost non-detectable level in the freshwater assemblage. This study suggests that sul1 and sul2 are main sul genes in culturable bacteria, whereas sul3 is conveyed by non-culturable bacteria in the sea. As a result marine bacteria possess sul1, sul2 and sul3 genes in the marine environment.

  3. Who Possesses Drug Resistance Genes in the Aquatic Environment? : Sulfamethoxazole (SMX Resistance Genes among the Bacterial Community in Water Environment of Metro-Manila, Philippines

    Directory of Open Access Journals (Sweden)

    Satoru eSuzuki

    2013-04-01

    Full Text Available Recent evidence has shown that antibiotic resistant bacteria (ARB and antibiotic resistance genes (ARG are ubiquitous in natural environments, including sites considered pristine. To understand the origin of ARGs and their dynamics, we must first define their actual presence in the natural bacterial assemblage. Here we found varying distribution profiles of sul genes in colony forming bacterial assemblages and natural bacterial assemblages. Our monitoring for antibiotic contamination revealed that sulfamethoxazole (SMX is a major contaminant in aquatic environments of Metro-Manila, which would have been derived from human and animal use, and subsequently decreased through the process of outflow from source to the sea. The SMX-resistant bacterial rate evaluated by the colony forming unit showed 10 to 86 % of the total colony numbers showed higher rates from freshwater sites compared to marine sites. When sul genes were quantified by qPCR, colony-forming bacteria conveyed sul1 and sul2 genes in freshwater and seawater (10-5-10-2 copy/16S but not sul3. Among the natural bacterial assemblage, all sul1, sul2 and sul3 were detected (10-5-10-3 copy/16S, whereas all sul genes were at an almost non-detectable level in the freshwater assemblage. This study suggests that sul1 and sul2 are main sul genes in culturable bacteria, whereas sul3 is conveyed by non-culturable bacteria in the sea. As a result marine bacteria possess sul1, sul2 and sul3 genes in the marine environment.

  4. Isolation and Cloning of mercuric reductase gene (merA from mercury-resistant bacteria

    Directory of Open Access Journals (Sweden)

    Parisa Khoshniyat

    2018-03-01

    Full Text Available Introduction: Some of the bacteria having merA gene coding mineral mercury reducing enzyme, has genetic potential of Hg removing via reduction of mineral mercury and transformation of that to gas form and finally bioremediation of polluted area. The aim of this study is the isolation of merA gene from resistance bacteria and cloning of that into suitable expression vector and then the environmental bioremediation by the transformation of bacteria with this vector. Materials and methods: A number of bacteria were collected in contaminated areas with mercury in order to isolate merA genes. Polymerase chain reaction had done on the four bacterial genomes including Klebsiella pneumoniae, Pseudomonas aeruginosa, Serratia marcescens and Escherichia coli using the specific primers in order to detect merA gene. For cloning, the primers containing restriction enzyme sites are used, merA gene was isolated and amplified. The amplified fragments were cloned in the expression vector pET21a+ and via heat shock method were transformed into E. coli TOP10 competent cell. For clustering of genes, Mega software version 4 was used and bioanformatic studies were achieved for predicted enzyme. Results: merA gene with 1686 bp in length was isolated from K pneumoniae and E. coli. Recombinant vectors in transgenic bacteria were confirmed by various methods and finally were confirmed by sequencing. The result of clustering these genes with existence genes in NCBI showed high similarity. Discussion and conclusion: The existence of merA gene in bacteria that adapted to Hg pollution area is because of resistance, so with cloning this gene into suitable expression vector and transformation of susceptible bacteria with this vector ability of resistance to Hg in bacteria for bioremediation could be given.

  5. Antimicrobial susceptibility and occurrence of resistance genes among Salmonella enterica serovar Weltevreden from different countries

    DEFF Research Database (Denmark)

    Aarestrup, Frank Møller; Lertworapreecha, M.; Evans, M.C.

    2003-01-01

    and gentamicin. All nine ampicillin-resistant isolates contained a sequence similar to the bla(TEM-1b) gene, one of the eight chloramphenicol-resistant isolates a sequence similar to the catA1 gene, all three neomycin-resistant isolates a sequence similar to the aphA-2 gene, 16 (73%) of the 22 streptomycin...... isolates were examined for susceptibility to antimicrobial agents, and resistant isolates were examined for the presence of selected resistance genes by PCR. Results: Only 48 (9.5%) of the isolates were resistant to one or more of the antimicrobial agents tested. A low frequency of resistance was found...

  6. Erythromycin-resistant genes in group A β-haemolytic Streptococci in Chengdu, Southwestern China

    Directory of Open Access Journals (Sweden)

    W Zhou

    2014-01-01

    Full Text Available Context: The management of Group A β-haemolytic Streptococci (Streptococcus pyogenes or GAS infection include the use of penicillins, cephalosporins or macrolides for treatment. A general increase in macrolides resistance in GAS has been observed in recent years. Differences in rates of resistance to these agents have existed according to geographical location and investigators. Aims: To investigate the antibiotic pattern and erythromycin-resistant genes of GAS isolates associated with acute tonsillitis and scarlet fever in Chengdu, southwestern China. Settings and Design: To assess the macrolide resistance, phenotype, and genotypic characterization of GAS isolated from throat swabs of children suffering from different acute tonsillitis or scarlet fever between 2004 and 2011 in the city of Chengdu, located in the southwestern region of China. Materials and Methods: Minimal inhibitory concentration with seven antibiotics was performed on 127 GAS isolates. Resistance phenotypes of erythromycin-resistant GAS isolates were determined by the double-disk test. Their macrolide-resistant genes (mefA, ermB and ermTR were amplified by PCR. Results: A total of 98.4% (125/127 of the isolates exhibited resistance to erythromycin, clindamycin and tetracycline. All isolates were sensitive to penicillin G and cefotaxime. Moreover, 113 ermB-positive isolates demonstrating the cMLS phenotype of erythromycin resistance were predominant (90.4% and these isolates showed high-level resistance to both erythromycin and clindamycin (MIC 90 > 256 μg/ml; 12 (9.6% isolates demonstrating the MLS phenotype of erythromycin resistance carried the mefA gene, which showed low-level resistance to both erythromycin (MIC 90 = 8 μg/ml and clindamycin (MIC 90 = 0.5 μg/ml; and none of the isolates exhibited the M phenotype. Conclusions: The main phenotype is cMLS, and the ermB gene code is the main resistance mechanism against macrolides in GAS. Penicillin is the most beneficial

  7. Effect of adrenomedullin gene delivery on insulin resistance in type 2 diabetic rats

    Directory of Open Access Journals (Sweden)

    Hoda Y. Henein

    2011-01-01

    Full Text Available Type 2 diabetes mellitus is one of the common metabolic disorders that ultimately afflicts large number of individuals. Adrenomedullin (AM is a potent vasodilator peptide; previous studies reported development of insulin resistance in aged AM deficient mice. In this study, we employed a gene delivery approach to explore its potential role in insulin resistance. Four groups were included: control, diabetic, non-diabetic injected with the AM gene and diabetic injected with the AM gene. One week following gene delivery, serum glucose, insulin, triglycerides, leptin, adiponectin and corticosterone were measured as well as the insulin resistance index (HOMA-IR. Soleus muscle glucose uptake and RT-PCR of both AM and glucose transporter-4 (GLUT 4 gene expressions were assessed. A single tail vein injection of adrenomedullin gene in type 2 diabetic rats improved skeletal muscle insulin responsiveness with significant improvement of soleus muscle glucose uptake, HOMA-IR, serum glucose, insulin and triglycerides and significant increase in muscle GLUT 4 gene expression (P < 0.05 compared with the non-injected diabetic rats. The beneficial effects of AM gene delivery were accompanied by a significant increase in the serum level of adiponectin (2.95 ± 0.09 versus 2.33 ± 0.17 μg/ml in the non-injected diabetic group as well as a significant decrease in leptin and corticosterone levels (7.51 ± 0.51 and 262.88 ± 10.34 versus 10.63 ± 1.4 and 275.86 ± 11.19 ng/ml respectively in the non-injected diabetic group. The conclusion of the study is that AM gene delivery can improve insulin resistance and may have significant therapeutic applications in type 2 diabetes mellitus.

  8. Evolution of resistance against CRISPR/Cas9 gene drive

    OpenAIRE

    Clark, Andrew; Unckless, Robert; Messer, Philipp

    2016-01-01

    CRISPR/Cas9 gene drive (CGD) promises to be a highly adaptable approach for spreading genetically engineered alleles throughout a species, even if those alleles impair reproductive success. CGD has been shown to be effective in laboratory crosses of insects, yet it remains unclear to what extent potential resistance mechanisms will affect the dynamics of this process in large natural populations. Here we develop a comprehensive population genetic framework for modeling CGD dynamics, which inc...

  9. Inactivation Effect of Antibiotic-Resistant Gene Using Chlorine Disinfection

    Directory of Open Access Journals (Sweden)

    Takashi Furukawa

    2017-07-01

    Full Text Available The aim of this study was to elucidate the inactivation effects on the antibiotic-resistance gene (vanA of vancomycin-resistant enterococci (VRE using chlorination, a disinfection method widely used in various water treatment facilities. Suspensions of VRE were prepared by adding VRE to phosphate-buffered saline, or the sterilized secondary effluent of a wastewater treatment plant. The inactivation experiments were carried out at several chlorine concentrations and stirring time. Enterococci concentration and presence of vanA were determined. The enterococci concentration decreased as chlorine concentrations and stirring times increased, with more than 7.0 log reduction occurring under the following conditions: 40 min stirring at 0.5 mg Cl2/L, 20 min stirring at 1.0 mg Cl2/L, and 3 min stirring at 3.0 mg Cl2/L. In the inactivation experiment using VRE suspended in secondary effluent, the culturable enterococci required much higher chlorine concentration and longer treatment time for complete disinfection than the cases of suspension of VRE. However, vanA was detected in all chlorinated suspensions of VRE, even in samples where no enterococcal colonies were present on the medium agar plate. The chlorine disinfection was not able to destroy antibiotic-resistance genes, though it can inactivate and decrease bacterial counts of antibiotic-resistant bacteria (ARB. Therefore, it was suggested that remaining ARB and/or antibiotic-resistance gene in inactivated bacterial cells after chlorine disinfection tank could be discharged into water environments.

  10. Occurrence of antibiotic resistance and characterization of resistant genes and integrons in Enterobacteriaceae isolated from integrated fish farms south China

    Science.gov (United States)

    Su, Hao-Chang; Ying, Guang-Guo; Tao, Ran; Zhang, Rui-Quan; Fogarty, Lisa R.; Kolpin, Dana W.

    2011-01-01

    Antibiotics are still widely applied in animal husbandry to prevent diseases and used as feed additives to promote animal growth. This could result in antibiotic resistance to bacteria and antibiotic residues in animals. In this paper, Enterobacteriaceae isolated from four integrated fish farms in Zhongshan, South China were tested for antibiotic resistance, tetracycline resistance genes, sulfonamide resistance genes, and class 1 integrons. The Kirby-Bauer disk diffusion method and polymerase chain reaction (PCR) assays were carried out to test antibiotic susceptibility and resistance genes, respectively. Relatively high antibiotic resistance frequencies were found, especially for ampicillin (80%), tetracycline (52%), and trimethoprim (50%). Out of 203 Enterobacteriaceae isolates, 98.5% were resistant to one or more antibiotics tested. Multiple antibiotic resistance (MAR) was found highest in animal manures with a MAR index of 0.56. Tetracycline resistance genes (tet(A), tet(C)) and sulfonamide resistance genes (sul2) were detected in more than 50% of the isolates. The intI1 gene was found in 170 isolates (83.7%). Both classic and non-classic class 1 integrons were found. Four genes, aadA5, aadA22, dfr2, and dfrA17, were detected. To our knowledge, this is the first report for molecular characterization of antibiotic resistance genes in Enterobacteriaceae isolated from integrated fish farms in China and the first time that gene cassette array dfrA17-aadA5 has been detected in such fish farms. Results of this study indicated that fish farms may be a reservoir of highly diverse and abundant antibiotic resistant genes and gene cassettes. Integrons may play a key role in multiple antibiotic resistances posing potential health risks to the general public and aquaculture.

  11. Sulfonamide-Resistant Bacteria and Their Resistance Genes in Soils Fertilized with Manures from Jiangsu Province, Southeastern China

    OpenAIRE

    Wang, Na; Yang, Xiaohong; Jiao, Shaojun; Zhang, Jun; Ye, Boping; Gao, Shixiang

    2014-01-01

    Antibiotic-resistant bacteria and genes are recognized as new environmental pollutants that warrant special concern. There were few reports on veterinary antibiotic-resistant bacteria and genes in China. This work systematically analyzed the prevalence and distribution of sulfonamide resistance genes in soils from the environments around poultry and livestock farms in Jiangsu Province, Southeastern China. The results showed that the animal manure application made the spread and abundance of a...

  12. The rumen microbiome as a reservoir of antimicrobial resistance and pathogenicity genes is directly affected by diet in beef cattle.

    Science.gov (United States)

    Auffret, Marc D; Dewhurst, Richard J; Duthie, Carol-Anne; Rooke, John A; John Wallace, R; Freeman, Tom C; Stewart, Robert; Watson, Mick; Roehe, Rainer

    2017-12-11

    The emergence and spread of antimicrobial resistance is the most urgent current threat to human and animal health. An improved understanding of the abundance of antimicrobial resistance genes and genes associated with microbial colonisation and pathogenicity in the animal gut will have a major role in reducing the contribution of animal production to this problem. Here, the influence of diet on the ruminal resistome and abundance of pathogenicity genes was assessed in ruminal digesta samples taken from 50 antibiotic-free beef cattle, comprising four cattle breeds receiving two diets containing different proportions of concentrate. Two hundred and four genes associated with antimicrobial resistance (AMR), colonisation, communication or pathogenicity functions were identified from 4966 metagenomic genes using KEGG identification. Both the diversity and abundance of these genes were higher in concentrate-fed animals. Chloramphenicol and microcin resistance genes were dominant in samples from forage-fed animals (P resistances were enriched in concentrate-fed animals. The concentrate-based diet also increased the relative abundance of Proteobacteria, which includes many animal and zoonotic pathogens. A high ratio of Proteobacteria to (Firmicutes + Bacteroidetes) was confirmed as a good indicator for rumen dysbiosis, with eight cases all from concentrate-fed animals. Finally, network analysis demonstrated that the resistance/pathogenicity genes are potentially useful as biomarkers for health risk assessment of the ruminal microbiome. Diet has important effects on the complement of AMR genes in the rumen microbial community, with potential implications for human and animal health.

  13. Geographic and Research Center Origins of Rice Resistance to Asian Planthoppers and Leafhoppers: Implications for Rice Breeding and Gene Deployment

    Directory of Open Access Journals (Sweden)

    Finbarr G. Horgan

    2017-09-01

    Full Text Available This study examines aspects of virulence to resistant rice varieties among planthoppers and leafhoppers. Using a series of resistant varieties, brown planthopper, Nilaparvata lugens, virulence was assessed in seedlings and early-tillering plants at seven research centers in South and East Asia. Virulence of the whitebacked planthopper, Sogatella furcifera, in Taiwan and the Philippines was also assessed. Phylogenetic analysis of the varieties using single-nucleotide polymorphisms (SNPs indicated a clade of highly resistant varieties from South Asia with two further South Asian clades of moderate resistance. Greenhouse bioassays indicated that planthoppers can develop virulence against multiple resistance genes including genes introgressed from wild rice species. Nilaparvata lugens populations from Punjab (India and the Mekong Delta (Vietnam were highly virulent to a range of key resistance donors irrespective of variety origin. Sogatella furcifera populations were less virulent to donors than N. lugens; however, several genes for resistance to S. furcifera are now ineffective in East Asia. A clade of International Rice Research Institute (IRRI-bred varieties and breeding lines, without identified leafhopper-resistance genes, were highly resistant to the green leafhopper, Nephotettix virescens. Routine phenotyping during breeding programs likely maintains high levels of quantitative resistance to leafhoppers. We discuss these results in the light of breeding and deploying resistant rice in Asia.

  14. Hairpin RNA Targeting Multiple Viral Genes Confers Strong Resistance to Rice Black-Streaked Dwarf Virus

    Directory of Open Access Journals (Sweden)

    Fangquan Wang

    2016-05-01

    Full Text Available Rice black-streaked dwarf virus (RBSDV belongs to the genus Fijivirus in the family of Reoviridae and causes severe yield loss in rice-producing areas in Asia. RNA silencing, as a natural defence mechanism against plant viruses, has been successfully exploited for engineering virus resistance in plants, including rice. In this study, we generated transgenic rice lines harbouring a hairpin RNA (hpRNA construct targeting four RBSDV genes, S1, S2, S6 and S10, encoding the RNA-dependent RNA polymerase, the putative core protein, the RNA silencing suppressor and the outer capsid protein, respectively. Both field nursery and artificial inoculation assays of three generations of the transgenic lines showed that they had strong resistance to RBSDV infection. The RBSDV resistance in the segregating transgenic populations correlated perfectly with the presence of the hpRNA transgene. Furthermore, the hpRNA transgene was expressed in the highly resistant transgenic lines, giving rise to abundant levels of 21–24 nt small interfering RNA (siRNA. By small RNA deep sequencing, the RBSDV-resistant transgenic lines detected siRNAs from all four viral gene sequences in the hpRNA transgene, indicating that the whole chimeric fusion sequence can be efficiently processed by Dicer into siRNAs. Taken together, our results suggest that long hpRNA targeting multiple viral genes can be used to generate stable and durable virus resistance in rice, as well as other plant species.

  15. Hairpin RNA Targeting Multiple Viral Genes Confers Strong Resistance to Rice Black-Streaked Dwarf Virus.

    Science.gov (United States)

    Wang, Fangquan; Li, Wenqi; Zhu, Jinyan; Fan, Fangjun; Wang, Jun; Zhong, Weigong; Wang, Ming-Bo; Liu, Qing; Zhu, Qian-Hao; Zhou, Tong; Lan, Ying; Zhou, Yijun; Yang, Jie

    2016-05-11

    Rice black-streaked dwarf virus (RBSDV) belongs to the genus Fijivirus in the family of Reoviridae and causes severe yield loss in rice-producing areas in Asia. RNA silencing, as a natural defence mechanism against plant viruses, has been successfully exploited for engineering virus resistance in plants, including rice. In this study, we generated transgenic rice lines harbouring a hairpin RNA (hpRNA) construct targeting four RBSDV genes, S1, S2, S6 and S10, encoding the RNA-dependent RNA polymerase, the putative core protein, the RNA silencing suppressor and the outer capsid protein, respectively. Both field nursery and artificial inoculation assays of three generations of the transgenic lines showed that they had strong resistance to RBSDV infection. The RBSDV resistance in the segregating transgenic populations correlated perfectly with the presence of the hpRNA transgene. Furthermore, the hpRNA transgene was expressed in the highly resistant transgenic lines, giving rise to abundant levels of 21-24 nt small interfering RNA (siRNA). By small RNA deep sequencing, the RBSDV-resistant transgenic lines detected siRNAs from all four viral gene sequences in the hpRNA transgene, indicating that the whole chimeric fusion sequence can be efficiently processed by Dicer into siRNAs. Taken together, our results suggest that long hpRNA targeting multiple viral genes can be used to generate stable and durable virus resistance in rice, as well as other plant species.

  16. Imidacloprid does not induce Cyp genes involved in insecticide resistance of a mutant Drosophila melanogaster line.

    Science.gov (United States)

    Kalajdzic, Predrag; Markaki, Maria; Oehler, Stefan; Savakis, Charalambos

    2013-10-01

    Certain xenobiotics have the capacity to induce the expression of genes involved in various biological phenomena, including insecticide resistance. The induction potential of different chemicals, among them different insecticides, has been documented for a number of insect species. In this study, we have analyzed the induction potential of Imidacloprid, a widely used member of the neonicotinoid insecticide family. Genes Cyp6g1 and Cyp6a2, known to be involved in the resistance of mutant Drosophila melanogaster line MiT[W⁻]3R2 to Imidacloprid and DDT were included in the analyzed sample. We find that Imidacloprid does not induce expression of the analyzed genes. Copyright © 2013 Elsevier Ltd. All rights reserved.

  17. Detection systems for carbapenemase gene identification should include the SME serine carbapenemase.

    Science.gov (United States)

    Bush, Karen; Pannell, Megan; Lock, John L; Queenan, Anne Marie; Jorgensen, James H; Lee, Ryan M; Lewis, James S; Jarrett, Deidre

    2013-01-01

    Carbapenemase detection has become a major problem in hospitals that encounter outbreaks of infections caused by carbapenem-resistant Gram-negative bacteria. Rapid detection systems have been reported using multiplex PCR analyses and DNA microarray assays. Major carbapenemases that are detected by these systems include the KPC and OXA serine carbapenemases, and the IMP, VIM and NDM families of metallo-β-lactamases. However, increasing numbers of the SME serine carbapenemase are being reported from Serratia marcescens, especially from North and South America. These organisms differ from many of the other carbapenemase-producing pathogens in that they are generally susceptible to the expanded-spectrum cephalosporins ceftazidime and cefepime while retaining resistance to almost all other β-lactam antibiotics. Thus, multiplex PCR assays or DNA microarray testing of carbapenem-resistant S. marcescens isolates should include analyses for production of the SME carbapenemase. Confirmation of the presence of this enzyme may provide reassurance that oxyimino-cephalosporins can be considered for treatment of infections caused by these carbapenem-resistant pathogens. Copyright © 2012 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

  18. Antibiotic resistance profile and virulence genes of uropathogenic Escherichia coli isolates in relation to phylogeny.

    Science.gov (United States)

    Adib, N; Ghanbarpour, R; Solatzadeh, H; Alizade, H

    2014-03-01

    Escherichia coli (E. coli) strains are the major cause of urinary tract infections (UTI) and belong to the large group of extra-intestinal pathogenic E. coli. The purposes of this study were to determine the antibiotic resistance profile, virulence genes and phylogenetic background of E. coli isolates from UTI cases. A total of 137 E. coli isolates were obtained from UTI samples. The antimicrobial susceptibility of confirmed isolates was determined by disk diffusion method against eight antibiotics. The isolates were examined to determine the presence and prevalence of selected virulence genes including iucD, sfa/focDE, papEF and hly. ECOR phylo-groups of isolates were determined by detection of yjaA and chuA genes and fragment TspE4.C2. The antibiogram results showed that 71% of the isolates were resistant to cefazolin, 60.42% to co-trimoxazole, 54.16% to nalidixic acid, 36.45% to gentamicin, 29.18% to ciprofloxacin, 14.58% to cefepime, 6.25% to nitrofurantoin and 0.00% to imipenem. Twenty-two antibiotic resistance patterns were observed among the isolates. Virulence genotyping of isolates revealed that 58.39% isolates had at least one of the four virulence genes. The iucD gene was the most prevalent gene (43.06%). The other genes including sfa/focDE, papEF and hly genes were detected in 35.76%, 18.97% and 2.18% isolates, respectively. Nine combination patterns of the virulence genes were detected in isolates. Phylotyping of 137 isolates revealed that the isolates fell into A (45.99%), B1 (13.14%), B2 (19.71%) and D (21.16%) groups. Phylotyping of multidrug resistant isolates indicated that these isolates are mostly in A (60.34%) and D (20.38%) groups. In conclusion, the isolates that possessed the iucD, sfa/focDE, papEF and hly virulence genes mostly belonged to A and B2 groups, whereas antibiotic resistant isolates were in groups A and D. Escherichia coli strains carrying virulence factors and antibiotic resistance are distributed in specific phylogenetic

  19. Molecular characterization of antimicrobial resistance genes against Staphylococcus aureus isolates from Trinidad and Tobago.

    Science.gov (United States)

    Akpaka, Patrick E; Roberts, Rashida; Monecke, Stefan

    Staphylococcus aureus continues to pose major public health challenges in many areas because of antibiotic resistance problems. In the Caribbean, especially Trinidad and Tobago, the challenge is not different. This study was performed to evaluate the antimicrobial resistance gene prevalence among S. aureus isolates in Trinidad and Tobago. Standard and molecular microbiological methods, including the Microscan automated system, DNA microarray and multi locus sequence typing (MLST) analysis, were performed on 309 clinical S. aureus isolates recovered from patients who were treated at three of the country's main health institutions. S. aureus exhibited susceptibilities ≥80% to eleven of the 19 antimicrobials tested against it, and these belong to the most commonly used and available antibiotics in the country. While the antibiotic to which it was most susceptible of the commonly used antibiotics was trimethoprim/sulfamethoxazole, the antibiotics to which it was least susceptible or most resistant to were ampicillin and penicillin. S. aureus isolates from the pediatric ward produced the greatest rate of susceptibility among the isolates recovered from patients admitted into hospitals, while isolates from Accident and Emergency rooms displayed the greatest susceptibilities among patients from the community. S. aureus isolates from the country did not harbor acquired resistant genes targeting clindamycin/macrolides (ermB), linezolid (cfr) or vancomycin (vanA). The blaZ gene, which is the most common beta lactam (Penicillinase) resistance mechanism for S. aureus, was observed in 88.7% of the methicillin susceptible S. aureus, while methicillin resistance mediated by the mec gene was present in 13.6%. Most of the resistance markers found in MRSA isolates were significantly associated with the ST239-MRSA-III strain in this study, and all isolates that belonged to the USA300 strain, which additionally encoded both the PVL gene and ACME cluster, belonged to CC8. Several

  20. Molecular characterization of antimicrobial resistance genes against Staphylococcus aureus isolates from Trinidad and Tobago

    Directory of Open Access Journals (Sweden)

    Patrick E. Akpaka

    2017-05-01

    Full Text Available Summary: Staphylococcus aureus continues to pose major public health challenges in many areas because of antibiotic resistance problems. In the Caribbean, especially Trinidad and Tobago, the challenge is not different. This study was performed to evaluate the antimicrobial resistance gene prevalence among S. aureus isolates in Trinidad and Tobago.Standard and molecular microbiological methods, including the Microscan automated system, DNA microarray and multi locus sequence typing (MLST analysis, were performed on 309 clinical S. aureus isolates recovered from patients who were treated at three of the country's main health institutions.S. aureus exhibited susceptibilities ≥80% to eleven of the 19 antimicrobials tested against it, and these belong to the most commonly used and available antibiotics in the country. While the antibiotic to which it was most susceptible of the commonly used antibiotics was trimethoprim/sulfamethoxazole, the antibiotics to which it was least susceptible or most resistant to were ampicillin and penicillin. S. aureus isolates from the pediatric ward produced the greatest rate of susceptibility among the isolates recovered from patients admitted into hospitals, while isolates from Accident and Emergency rooms displayed the greatest susceptibilities among patients from the community.S. aureus isolates from the country did not harbor acquired resistant genes targeting clindamycin/macrolides (ermB, linezolid (cfr or vancomycin (vanA. The blaZ gene, which is the most common beta lactam (Penicillinase resistance mechanism for S. aureus, was observed in 88.7% of the methicillin susceptible S. aureus, while methicillin resistance mediated by the mec gene was present in 13.6%. Most of the resistance markers found in MRSA isolates were significantly associated with the ST239-MRSA-III strain in this study, and all isolates that belonged to the USA300 strain, which additionally encoded both the PVL gene and ACME cluster

  1. A double EPSPS gene mutation endowing glyphosate resistance shows a remarkably high resistance cost.

    Science.gov (United States)

    Han, Heping; Vila-Aiub, Martin M; Jalaludin, Adam; Yu, Qin; Powles, Stephen B

    2017-12-01

    A novel glyphosate resistance double point mutation (T102I/P106S, TIPS) in the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene has been recently identified for the first time only in the weed species Eleusine indica. Quantification of plant resistance cost associated with the TIPS and the often reported glyphosate resistance single P106S mutation was performed. A significant resistance cost (50% in seed number currency) associated with the homozygous TIPS but not the homozygous P106S EPSPS variant was identified in E. indica plants. The resistance cost associated with the TIPS mutation escalated to 85% in plants under resource competition with rice crops. The resistance cost was not detected in nonhomozygous TIPS plants denoting the recessive nature of the cost associated with the TIPS allele. An excess of 11-fold more shikimate and sixfold more quinate in the shikimate pathway was detected in TIPS plants in the absence of glyphosate treatment compared to wild type, whereas no changes in these compounds were observed in P106S plants when compared to wild type. TIPS plants show altered metabolite levels in several other metabolic pathways that may account for the expression of the observed resistance cost. © 2017 John Wiley & Sons Ltd.

  2. Transcriptome Profiling to Identify Genes Involved in Mesosulfuron-Methyl Resistance in Alopecurus aequalis

    Directory of Open Access Journals (Sweden)

    Ning Zhao

    2017-08-01

    Full Text Available Non-target-site resistance (NTSR to herbicides is a worldwide concern for weed control. However, as the dominant NTSR mechanism in weeds, metabolic resistance is not yet well-characterized at the genetic level. For this study, we have identified a shortawn foxtail (Alopecurus aequalis Sobol. population displaying both TSR and NTSR to mesosulfuron-methyl and fenoxaprop-P-ethyl, yet the molecular basis for this NTSR remains unclear. To investigate the mechanisms of metabolic resistance, an RNA-Seq transcriptome analysis was used to find candidate genes that may confer metabolic resistance to the herbicide mesosulfuron-methyl in this plant population. The RNA-Seq libraries generated 831,846,736 clean reads. The de novo transcriptome assembly yielded 95,479 unigenes (averaging 944 bp in length that were assigned putative annotations. Among these, a total of 29,889 unigenes were assigned to 67 GO terms that contained three main categories, and 14,246 unigenes assigned to 32 predicted KEGG metabolic pathways. Global gene expression was measured using the reads generated from the untreated control (CK, water-only control (WCK, and mesosulfuron-methyl treatment (T of R and susceptible (S. Contigs that showed expression differences between mesosulfuron-methyl-treated R and S biotypes, and between mesosulfuron-methyl-treated, water-treated and untreated R plants were selected for further quantitative real-time PCR (qRT-PCR validation analyses. Seventeen contigs were consistently highly expressed in the resistant A. aequalis plants, including four cytochrome P450 monooxygenase (CytP450 genes, two glutathione S-transferase (GST genes, two glucosyltransferase (GT genes, two ATP-binding cassette (ABC transporter genes, and seven additional contigs with functional annotations related to oxidation, hydrolysis, and plant stress physiology. These 17 contigs could serve as major candidate genes for contributing to metabolic mesosulfuron-methyl resistance; hence

  3. Functional Repertoire of Antibiotic Resistance Genes in Antibiotic Manufacturing Effluents and Receiving Freshwater Sediments

    Science.gov (United States)

    González-Plaza, Juan J.; Šimatović, Ana; Milaković, Milena; Bielen, Ana; Wichmann, Fabienne; Udiković-Kolić, Nikolina

    2018-01-01

    Environments polluted by direct discharges of effluents from antibiotic manufacturing are important reservoirs for antibiotic resistance genes (ARGs), which could potentially be transferred to human pathogens. However, our knowledge about the identity and diversity of ARGs in such polluted environments remains limited. We applied functional metagenomics to explore the resistome of two Croatian antibiotic manufacturing effluents and sediments collected upstream of and at the effluent discharge sites. Metagenomic libraries built from an azithromycin-production site were screened for resistance to macrolide antibiotics, whereas the libraries from a site producing veterinary antibiotics were screened for resistance to sulfonamides, tetracyclines, trimethoprim, and beta-lactams. Functional analysis of eight libraries identified a total of 82 unique, often clinically relevant ARGs, which were frequently found in clusters and flanked by mobile genetic elements. The majority of macrolide resistance genes identified from matrices exposed to high levels of macrolides were similar to known genes encoding ribosomal protection proteins, macrolide phosphotransferases, and transporters. Potentially novel macrolide resistance genes included one most similar to a 23S rRNA methyltransferase from Clostridium and another, derived from upstream unpolluted sediment, to a GTPase HflX from Emergencia. In libraries deriving from sediments exposed to lower levels of veterinary antibiotics, we found 8 potentially novel ARGs, including dihydrofolate reductases and beta-lactamases from classes A, B, and D. In addition, we detected 7 potentially novel ARGs in upstream sediment, including thymidylate synthases, dihydrofolate reductases, and class D beta-lactamase. Taken together, in addition to finding known gene types, we report the discovery of novel and diverse ARGs in antibiotic-polluted industrial effluents and sediments, providing a qualitative basis for monitoring the dispersal of ARGs

  4. Functional Repertoire of Antibiotic Resistance Genes in Antibiotic Manufacturing Effluents and Receiving Freshwater Sediments

    Directory of Open Access Journals (Sweden)

    Juan J. González-Plaza

    2018-01-01

    Full Text Available Environments polluted by direct discharges of effluents from antibiotic manufacturing are important reservoirs for antibiotic resistance genes (ARGs, which could potentially be transferred to human pathogens. However, our knowledge about the identity and diversity of ARGs in such polluted environments remains limited. We applied functional metagenomics to explore the resistome of two Croatian antibiotic manufacturing effluents and sediments collected upstream of and at the effluent discharge sites. Metagenomic libraries built from an azithromycin-production site were screened for resistance to macrolide antibiotics, whereas the libraries from a site producing veterinary antibiotics were screened for resistance to sulfonamides, tetracyclines, trimethoprim, and beta-lactams. Functional analysis of eight libraries identified a total of 82 unique, often clinically relevant ARGs, which were frequently found in clusters and flanked by mobile genetic elements. The majority of macrolide resistance genes identified from matrices exposed to high levels of macrolides were similar to known genes encoding ribosomal protection proteins, macrolide phosphotransferases, and transporters. Potentially novel macrolide resistance genes included one most similar to a 23S rRNA methyltransferase from Clostridium and another, derived from upstream unpolluted sediment, to a GTPase HflX from Emergencia. In libraries deriving from sediments exposed to lower levels of veterinary antibiotics, we found 8 potentially novel ARGs, including dihydrofolate reductases and beta-lactamases from classes A, B, and D. In addition, we detected 7 potentially novel ARGs in upstream sediment, including thymidylate synthases, dihydrofolate reductases, and class D beta-lactamase. Taken together, in addition to finding known gene types, we report the discovery of novel and diverse ARGs in antibiotic-polluted industrial effluents and sediments, providing a qualitative basis for monitoring the

  5. Candidate genes that may be responsible for the unusual resistances exhibited by Bacillus pumilus SAFR-032 spores.

    Directory of Open Access Journals (Sweden)

    Madhan R Tirumalai

    Full Text Available The spores of several Bacillus species, including Bacillus pumilus SAFR-032 and B. safensis FO-36b, which were isolated from the spacecraft assembly facility at NASA's Jet Propulsion Laboratory, are unusually resistant to UV radiation and hydrogen peroxide. In order to identify candidate genes that might be associated with these resistances, the whole genome of B. pumilus SAFR-032, and the draft genome of B. safensis FO-36b were compared in detail with the very closely related type strain B. pumilus ATCC7061(T. 170 genes are considered characteristic of SAFR-032, because they are absent from both FO-36b and ATCC7061(T. Forty of these SAFR-032 characteristic genes are entirely unique open reading frames. In addition, four genes are unique to the genomes of the resistant SAFR-032 and FO-36b. Fifty three genes involved in spore coat formation, regulation and germination, DNA repair, and peroxide resistance, are missing from all three genomes. The vast majority of these are cleanly deleted from their usual genomic context without any obvious replacement. Several DNA repair and peroxide resistance genes earlier reported to be unique to SAFR-032 are in fact shared with ATCC7061(T and no longer considered to be promising candidates for association with the elevated resistances. Instead, several SAFR-032 characteristic genes were identified, which along with one or more of the unique SAFR-032 genes may be responsible for the elevated resistances. These new candidates include five genes associated with DNA repair, namely, BPUM_0608 a helicase, BPUM_0652 an ATP binding protein, BPUM_0653 an endonuclease, BPUM_0656 a DNA cytosine-5- methyltransferase, and BPUM_3674 a DNA helicase. Three of these candidate genes are in immediate proximity of two conserved hypothetical proteins, BPUM_0654 and BPUM_0655 that are also absent from both FO-36b and ATCC7061(T. This cluster of five genes is considered to be an especially promising target for future experimental

  6. Simulation of thermal reset transitions in resistive switching memories including quantum effects

    Energy Technology Data Exchange (ETDEWEB)

    Villena, M. A.; Jiménez-Molinos, F.; Roldán, J. B. [Departamento de Electrónica y Tecnología de Computadores, Universidad de Granada, Facultad de Ciencias, Avd. Fuentenueva s/n, 18071 Granada (Spain); González, M. B.; Campabadal, F. [Institut de Microelectrònica de Barcelona, IMB-CNM (CSIC), Campus UAB, 08193 Bellaterra (Spain); Suñé, J.; Miranda, E. [Departament d' Enginyeria Electrònica, Universitat Autònoma de Barcelona, Bellaterra Cerdanyola del Vallès 08193 (Spain); Romera, E. [Departamento de Física Atómica, Molecular y Nuclear and Instituto Carlos I de Física Teórica y Computacional, Universidad de Granada, Avd. Fuentenueva s/n, 18071 Granada (Spain)

    2014-06-07

    An in-depth study of reset processes in RRAMs (Resistive Random Access Memories) based on Ni/HfO{sub 2}/Si-n{sup +} structures has been performed. To do so, we have developed a physically based simulator where both ohmic and tunneling based conduction regimes are considered along with the thermal description of the devices. The devices under study have been successfully fabricated and measured. The experimental data are correctly reproduced with the simulator for devices with a single conductive filament as well as for devices including several conductive filaments. The contribution of each conduction regime has been explained as well as the operation regimes where these ohmic and tunneling conduction processes dominate.

  7. The wheat Lr34 multipathogen resistance gene confers resistance to anthracnose and rust in sorghum.

    Science.gov (United States)

    Schnippenkoetter, Wendelin; Lo, Clive; Liu, Guoquan; Dibley, Katherine; Chan, Wai Lung; White, Jodie; Milne, Ricky; Zwart, Alexander; Kwong, Eunjung; Keller, Beat; Godwin, Ian; Krattinger, Simon G; Lagudah, Evans

    2017-11-01

    The ability of the wheat Lr34 multipathogen resistance gene (Lr34res) to function across a wide taxonomic boundary was investigated in transgenic Sorghum bicolor. Increased resistance to sorghum rust and anthracnose disease symptoms following infection with the biotrophic pathogen Puccinia purpurea and the hemibiotroph Colletotrichum sublineolum, respectively, occurred in transgenic plants expressing the Lr34res ABC transporter. Transgenic sorghum lines that highly expressed the wheat Lr34res gene exhibited immunity to sorghum rust compared to the low-expressing single copy Lr34res genotype that conferred partial resistance. Pathogen-induced pigmentation mediated by flavonoid phytoalexins was evident on transgenic sorghum leaves following P. purpurea infection within 24-72 h, which paralleled Lr34res gene expression. Elevated expression of flavone synthase II, flavanone 4-reductase and dihydroflavonol reductase genes which control the biosynthesis of flavonoid phytoalexins characterized the highly expressing Lr34res transgenic lines 24-h post-inoculation with P. purpurea. Metabolite analysis of mesocotyls infected with C. sublineolum showed increased levels of 3-deoxyanthocyanidin metabolites were associated with Lr34res expression, concomitant with reduced symptoms of anthracnose. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  8. Data mining and influential analysis of gene expression data for plant resistance gene identification in tomato (Solanum lycopersicum

    Directory of Open Access Journals (Sweden)

    Francisco Torres-Avilés

    2014-03-01

    Conclusion: Application of different statistical analyses to detect potential resistance genes reliably has shown to conduct interesting results that improve knowledge on molecular mechanisms of plant resistance to pathogens.

  9. Functional Analysis of Genes Comprising the Locus of Heat Resistance in Escherichia coli.

    Science.gov (United States)

    Mercer, Ryan; Nguyen, Oanh; Ou, Qixing; McMullen, Lynn; Gänzle, Michael G

    2017-10-15

    The locus of heat resistance (LHR) is a 15- to 19-kb genomic island conferring exceptional heat resistance to organisms in the family Enterobacteriaceae , including pathogenic strains of Salmonella enterica and Escherichia coli The complement of LHR-comprising genes that is necessary for heat resistance and the stress-induced or growth-phase-induced expression of LHR-comprising genes are unknown. This study determined the contribution of the seven LHR-comprising genes yfdX1 GI , yfdX2 , hdeD GI , orf11 , trx GI , kefB , and psiE GI by comparing the heat resistances of E. coli strains harboring plasmid-encoded derivatives of the different LHRs in these genes. (Genes carry a subscript "GI" [genomic island] if an ortholog of the same gene is present in genomes of E. coli ) LHR-encoded heat shock proteins sHSP20, ClpK GI , and sHSP GI are not sufficient for the heat resistance phenotype; YfdX1, YfdX2, and HdeD are necessary to complement the LHR heat shock proteins and to impart a high level of resistance. Deletion of trx GI , kefB , and psiE GI from plasmid-encoded copies of the LHR did not significantly affect heat resistance. The effect of the growth phase and the NaCl concentration on expression from the putative LHR promoter p2 was determined by quantitative reverse transcription-PCR and by a plasmid-encoded p2:GFP promoter fusion. The expression levels of exponential- and stationary-phase E. coli cells were not significantly different, but the addition of 1% NaCl significantly increased LHR expression. Remarkably, LHR expression in E. coli was dependent on a chromosomal copy of evgA In conclusion, this study improved our understanding of the genes required for exceptional heat resistance in E. coli and factors that increase their expression in food. IMPORTANCE The locus of heat resistance (LHR) is a genomic island conferring exceptional heat resistance to several foodborne pathogens. The exceptional level of heat resistance provided by the LHR questions the

  10. Prevalence and resistance of commensal Staphylococcus aureus, including meticillin-resistant Staphylococcus aureus: a European cross-sectional study.

    NARCIS (Netherlands)

    Heijer, C.D.J. den; Bijnen, E.M.E. van; Paget, W.J.; Pringle, M.; Goossen, H.; Bruggeman, C.A.; Schellevis, F.G.; Stobberingh, E.E.

    2014-01-01

    Background: Information on the prevalence of Staphylococcus aureus resistance has mainly been obtained from invasive strains, although the commensal flora is considered an important reservoir of resistance. Within ‘The Appropriateness of prescribing antibiotics in primary health care in Europe with

  11. [State-of-the-art status on airborne antibiotic resistant bacteria and antibiotic resistance genes].

    Science.gov (United States)

    Li, J; Yao, M S

    2018-04-06

    The world is facing more deaths due to increasing antibiotic-resistant bacterial infections and the shortage of new highly effective antibiotics, however the air media as its important transmission route has not been adequately studied. Based on the latest literature acquired in this work, we have discussed the state-of-the-art research progress of the concentration, distribution and spread of antibiotic resistant bacteria (ARB) and antibiotic resistance genes (ARGs) in different environmental air media, and also analyzed some future prevention and control measures. The large use of antibiotics in the medical settings and animal husbandry places has resulted in higher abundances of ARB and ARGs in the relevant and surrounding atmosphere than in urban and general indoor air environments. ARGs can be spread by adhering to airborne particles, and researchers have also found that air media contain more abundant ARGs than other environmental media such as soil, water and sediment. It was suggested in this review that strengthening the monitoring, study on spreading factors and biological toxicity, and also research and development on pathogen accurate diagnosis and new green antibiotic are expected to help effectively monitor, prevent and control of the impacts of airborne resistant bacteria and resistance genes on both human and ecologies.

  12. Altered gene regulation and potential association with metabolic resistance development to imidacloprid in the tarnished plant bug, Lygus lineolaris.

    Science.gov (United States)

    Zhu, Yu Cheng; Luttrell, Randall

    2015-01-01

    Chemical spray on cotton is almost an exclusive method for controlling tarnished plant bug (TPB), Lygus lineolaris. Frequent use of imidacloprid is a concern for neonicotinoid resistance in this key pest. Information of how and why TPB becomes less susceptible to imidacloprid is essential for effective monitoring and managing resistance. Microarray analysis of 6688 genes in imidacloprid-selected TPB (Im1500FF) revealed 955 upregulated and 1277 downregulated (≥twofold) genes in Im1500FF, with 369 and 485 of them annotated. Five P450 and nine esterase genes were significantly upregulated, and only one esterase gene and no P450 genes were downregulated. Other upregulated genes include helicases, phosphodiesterases, ATPases and kinases. Pathway analyses identified 65 upregulated cDNAs that encode 51 different enzymes involved in 62 different pathways, including P450 and esterase genes for drug and xenobiotic metabolisms. Sixty-four downregulated cDNAs code only 17 enzymes that are associated with only 23 pathways mostly related to food digestion. This study demonstrated a significant change in gene expression related to metabolic processes in imidacloprid-selected TPB, resulting in overexpression of P450 and esterase genes for potential excess detoxification and cross/multiple resistance development. The identification of these and other enzyme genes establishes a foundation to explore the complicity of potential imidacloprid resistance in TPB. Published 2014. This article is a U.S. Government work and is in the public domain in the USA.

  13. Evolution by Pervasive Gene Fusion in Antibiotic Resistance and Antibiotic Synthesizing Genes

    Directory of Open Access Journals (Sweden)

    Orla Coleman

    2015-03-01

    Full Text Available Phylogenetic (tree-based approaches to understanding evolutionary history are unable to incorporate convergent evolutionary events where two genes merge into one. In this study, as exemplars of what can be achieved when a tree is not assumed a priori, we have analysed the evolutionary histories of polyketide synthase genes and antibiotic resistance genes and have shown that their history is replete with convergent events as well as divergent events. We demonstrate that the overall histories of these genes more closely resembles the remodelling that might be seen with the children’s toy Lego, than the standard model of the phylogenetic tree. This work demonstrates further that genes can act as public goods, available for re-use and incorporation into other genetic goods.

  14. A Novel Phytophthora sojae Resistance Rps12 Gene Mapped to a Genomic Region That Contains Several Rps Genes.

    Science.gov (United States)

    Sahoo, Dipak K; Abeysekara, Nilwala S; Cianzio, Silvia R; Robertson, Alison E; Bhattacharyya, Madan K

    2017-01-01

    Phytophthora sojae Kaufmann and Gerdemann, which causes Phytophthora root rot, is a widespread pathogen that limits soybean production worldwide. Development of Phytophthora resistant cultivars carrying Phytophthora resistance Rps genes is a cost-effective approach in controlling this disease. For this mapping study of a novel Rps gene, 290 recombinant inbred lines (RILs) (F7 families) were developed by crossing the P. sojae resistant cultivar PI399036 with the P. sojae susceptible AR2 line, and were phenotyped for responses to a mixture of three P. sojae isolates that overcome most of the known Rps genes. Of these 290 RILs, 130 were homozygous resistant, 12 heterzygous and segregating for Phytophthora resistance, and 148 were recessive homozygous and susceptible. From this population, 59 RILs homozygous for Phytophthora sojae resistance and 61 susceptible to a mixture of P. sojae isolates R17 and Val12-11 or P7074 that overcome resistance encoded by known Rps genes mapped to Chromosome 18 were selected for mapping novel Rps gene. A single gene accounted for the 1:1 segregation of resistance and susceptibility among the RILs. The gene encoding the Phytophthora resistance mapped to a 5.8 cM interval between the SSR markers BARCSOYSSR_18_1840 and Sat_064 located in the lower arm of Chromosome 18. The gene is mapped 2.2 cM proximal to the NBSRps4/6-like sequence that was reported to co-segregate with the Phytophthora resistance genes Rps4 and Rps6. The gene is mapped to a highly recombinogenic, gene-rich genomic region carrying several nucleotide binding site-leucine rich repeat (NBS-LRR)-like genes. We named this novel gene as Rps12, which is expected to be an invaluable resource in breeding soybeans for Phytophthora resistance.

  15. A Novel Phytophthora sojae Resistance Rps12 Gene Mapped to a Genomic Region That Contains Several Rps Genes.

    Directory of Open Access Journals (Sweden)

    Dipak K Sahoo

    Full Text Available Phytophthora sojae Kaufmann and Gerdemann, which causes Phytophthora root rot, is a widespread pathogen that limits soybean production worldwide. Development of Phytophthora resistant cultivars carrying Phytophthora resistance Rps genes is a cost-effective approach in controlling this disease. For this mapping study of a novel Rps gene, 290 recombinant inbred lines (RILs (F7 families were developed by crossing the P. sojae resistant cultivar PI399036 with the P. sojae susceptible AR2 line, and were phenotyped for responses to a mixture of three P. sojae isolates that overcome most of the known Rps genes. Of these 290 RILs, 130 were homozygous resistant, 12 heterzygous and segregating for Phytophthora resistance, and 148 were recessive homozygous and susceptible. From this population, 59 RILs homozygous for Phytophthora sojae resistance and 61 susceptible to a mixture of P. sojae isolates R17 and Val12-11 or P7074 that overcome resistance encoded by known Rps genes mapped to Chromosome 18 were selected for mapping novel Rps gene. A single gene accounted for the 1:1 segregation of resistance and susceptibility among the RILs. The gene encoding the Phytophthora resistance mapped to a 5.8 cM interval between the SSR markers BARCSOYSSR_18_1840 and Sat_064 located in the lower arm of Chromosome 18. The gene is mapped 2.2 cM proximal to the NBSRps4/6-like sequence that was reported to co-segregate with the Phytophthora resistance genes Rps4 and Rps6. The gene is mapped to a highly recombinogenic, gene-rich genomic region carrying several nucleotide binding site-leucine rich repeat (NBS-LRR-like genes. We named this novel gene as Rps12, which is expected to be an invaluable resource in breeding soybeans for Phytophthora resistance.

  16. Study on drug resistance of mycobacterium tuberculosis in patients with pulmonary tuberculosis by drug resistance gene detecting

    International Nuclear Information System (INIS)

    Wang Wei; Li Hongmin; Wu Xueqiong; Wang Ansheng; Ye Yixiu; Wang Zhongyuan; Liu Jinwei; Chen Hongbing; Lin Minggui; Wang Jinhe; Li Sumei; Jiang Ping; Feng Bai; Chen Dongjing

    2004-01-01

    To investigate drug resistance of mycobacterium tuberculosis in different age group, compare detecting effect of two methods and evaluate their the clinical application value, all of the strains of mycobacterium tuberculosis were tested for resistance to RFP, INH SM PZA and EMB by the absolute concentration method on Lowenstein-Jensen medium and the mutation of the rpoB, katG, rpsL, pncA and embB resistance genes in M. tuberculosis was tested by PCR-SSCP. In youth, middle and old age group, the rate of acquired drug resistance was 89.2%, 85.3% and 67.6% respectively, the gene mutation rate was 76.2%, 81.3% and 63.2% respectively. The rate of acquired drug resistance and multiple drug resistance in youth group was much higher than those in other groups. The gene mutation was correlated with drug resistance level of mycobacterium tuberculosis. The gene mutation rate was higher in strains isolated from high concentration resistance than those in strains isolated from low concentration resistance. The more irregular treatment was longer, the rate of drug resistance was higher. Acquired drug resistance varies in different age group. It suggested that surveillance of drug resistence in different age group should be taken seriously, especially in youth group. PCR - SSCP is a sensitive and specific method for rapid detecting rpoB, katG, rpsL, pncA and embB genes mutations of MTB. (authors)

  17. Metagenomic analysis of antibiotic resistance genes in coastal industrial mariculture systems.

    Science.gov (United States)

    Wang, Jian-Hua; Lu, Jian; Zhang, Yu-Xuan; Wu, Jun; Luo, Yongming; Liu, Hao

    2018-04-01

    The overuse of antibiotics has posed a propagation of antibiotic resistance genes (ARGs) in aquaculture systems. This study firstly explored the ARGs profiles of the typical mariculture farms including conventional and recirculating systems using metagenomics approach. Fifty ARGs subtypes belonging to 21 ARGs types were identified, showing the wide-spectrum profiles of ARGs in the coastal industrial mariculture systems. ARGs with multiple antibiotics resistance have emerged in the mariculure systems. The co-occurrence pattern between ARGs and microbial taxa showed that Proteobacteria and Bacteroidetes were potential dominant hosts of ARGs in the industrial mariculture systems. Typical nitrifying bacteria such as Nitrospinae in mariculture systems also carried with some resistance genes. Relative abundance of ARGs in fish ponds and wastewater treatment units was relatively high. The investigation showed that industrial mariculture systems were important ARGs reservoirs in coastal area, indicating the critical role of recirculating systems in the terms of ARGs pollution control. Copyright © 2018 Elsevier Ltd. All rights reserved.

  18. DNA tagging of blast resistant gene(s in three Brazilian rice cultivars

    Directory of Open Access Journals (Sweden)

    S.S. Sandhu

    2003-12-01

    Full Text Available Rice blast is the most important fungal disease of rice and is caused by Pyricularia oryzae Sacc. (Telomorph Magnoporthe grisea Barr.. Seven randomly amplified polymorphic DNA (RAPD markers OPA5, OPG17, OPG18, OPG19, OPF9, OPF17 and OPF19 showed very clear polymorphism in resistant cultivar lines which differed from susceptible lines. By comparing different susceptible lines, nine DNA amplifications of seven primers (OPA5(1000, OPA5(1200, OPG17(700, OPG18(850, OPG19(500, OPG19(600, OPF9(600, OPF17(1200 and OPF19(600 were identified as dominant markers for the blast resistant gene in resistant cultivar lines. These loci facilitate the indirect scoring of blast resistant and blast susceptible genotypes. The codomine RAPDs markers will facilitate marker-assisted selection of the blast resistant gene in two blast resistant genotypes of rice (Labelle and Line 11 and will be useful in rice breeding programs.

  19. Expression profile of genes during resistance reversal in a temephos selected strain of the dengue vector, Aedes aegypti.

    Directory of Open Access Journals (Sweden)

    Clare Strode

    Full Text Available BACKGROUND: The mosquito Aedes aegypti is one of the most important disease vectors because it transmits two major arboviruses, dengue and yellow fever, which cause significant global morbidity and mortality. Chemical insecticides form the cornerstone of vector control. The organophosphate temephos a larvicide recommended by WHO for controlling Ae. aegypti, however, resistance to this compound has been reported in many countries, including Brazil. METHODOLOGY/PRINCIPAL FINDINGS: The aim of this study was to identify genes implicated in metabolic resistance in an Ae. aegypti temephos resistant strain, named RecR, through microarray analysis. We utilized a custom 'Ae. aegypti detox chip' and validated microarray data through RT-PCR comparing susceptible and resistant individuals. In addition, we analyzed gene expression in 4(th instar larvae from a reversed susceptible strain (RecRev, exposed and unexposed to temephos. The results obtained revealed a set of 13 and 6 genes significantly over expressed in resistant adult mosquitoes and larvae, respectively. One of these genes, the cytochrome P450 CYP6N12, was up-regulated in both stages. RT-PCR confirmed the microarray results and, additionally, showed no difference in gene expression between temephos exposed and unexposed RecRev mosquitoes. This suggested that the differences in the transcript profiles among the strains are heritable due to a selection process and are not caused by immediate insecticide exposure. Reversal of temephos resistance was demonstrated and, importantly, there was a positive correlation between a decrease in the resistance ratio and an accompanying decrease in the expression levels of previously over expressed genes. Some of the genes identified here have also been implicated in metabolic resistance in other mosquito species and insecticide resistant populations of Ae. aegypti. CONCLUSIONS/SIGNIFICANCE: The identification of gene expression signatures associated to

  20. Genotypes, Virulence Factors and Antimicrobial Resistance Genes of Staphylococcus aureus Isolated in Bovine Subclinical Mastitis from Eastern China

    Directory of Open Access Journals (Sweden)

    Javed Memon§, Yongchun Yang§, Jam Kashifa, Muhammad Yaqoob, Rehana Buriroa, Jamila Soomroa, Wang Liping and Fan Hongjie*

    2013-11-01

    Full Text Available This study was carried out to determine the genotypes, virulence factors and antimicrobial resistance traits of 34 Staphylococcus aureus isolated from subclinical mastitis in Eastern China. Minimal inhibitory concentration (MIC results showed resistance to erythromycin in all isolates. A high frequency of Methicillin resistant S. aureus (MRSA; 29% was observed and these isolates were also highly resistant to penicillin, oxacillin, oxytetracycline and chloramphenicol than methicillin sensitive S. aureus (MSSA isolates. Thirteen pathogenic factors and seven resistance genes including mecA and blaZ gene were checked through PCR. The spaX gene was found in all isolates, whereas cna, spaIg, nuc, clfA, fnbpB, hlA, hlB and seA were present in 35, 79, 85, 59, 35, 85, 71 and 38% isolates, respectively. Nine isolates carried a group of 8 different virulence genes. Moreover, macrolide resistance genes ermB and ermC were present in all isolates. High resistance rate against methicillin was found but no isolate was positive for mecA gene, whereas blaZ and tetK were detected in 82 and 56% isolates, respectively. Genes; fnbpA, seB, seC, seD, dfrK and tetM were not found in any isolate. The statistical association between phenotypic resistance and virulence genes showed, clfA, fnbpB, hlB and seA, were potentially associated with penicillin G, ciprofloxacin, methicillin, chloramphenicol, trimethoprim and oxytetracycline resistance (P≤0.05. REP-PCR based genotyping showed seven distinct genotypes (A-G prevalent in this region. This study reports the presence of multidrug resistant S. aureus in sub-clinical mastitis which were also highly virulent that could be a major obstacle in the treatment of mastitis in this region of China.

  1. Development of a miniaturised microarray-based assay for the rapid identification of antimicrobial resistance genes in Gram-negative bacteria

    DEFF Research Database (Denmark)

    Batchelor, Miranda; Hopkins, Katie L; Liebana, Ernesto

    2008-01-01

    We describe the development of a miniaturised microarray for the detection of antimicrobial resistance genes in Gram-negative bacteria. Included on the array are genes encoding resistance to aminoglycosides, trimethoprim, sulphonamides, tetracyclines and beta-lactams, including extended-spectrum ...

  2. Integrated database for identifying candidate genes for Aspergillus flavus resistance in maize.

    Science.gov (United States)

    Kelley, Rowena Y; Gresham, Cathy; Harper, Jonathan; Bridges, Susan M; Warburton, Marilyn L; Hawkins, Leigh K; Pechanova, Olga; Peethambaran, Bela; Pechan, Tibor; Luthe, Dawn S; Mylroie, J E; Ankala, Arunkanth; Ozkan, Seval; Henry, W B; Williams, W P

    2010-10-07

    Aspergillus flavus Link:Fr, an opportunistic fungus that produces aflatoxin, is pathogenic to maize and other oilseed crops. Aflatoxin is a potent carcinogen, and its presence markedly reduces the value of grain. Understanding and enhancing host resistance to A. flavus infection and/or subsequent aflatoxin accumulation is generally considered an efficient means of reducing grain losses to aflatoxin. Different proteomic, genomic and genetic studies of maize (Zea mays L.) have generated large data sets with the goal of identifying genes responsible for conferring resistance to A. flavus, or aflatoxin. In order to maximize the usage of different data sets in new studies, including association mapping, we have constructed a relational database with web interface integrating the results of gene expression, proteomic (both gel-based and shotgun), Quantitative Trait Loci (QTL) genetic mapping studies, and sequence data from the literature to facilitate selection of candidate genes for continued investigation. The Corn Fungal Resistance Associated Sequences Database (CFRAS-DB) (http://agbase.msstate.edu/) was created with the main goal of identifying genes important to aflatoxin resistance. CFRAS-DB is implemented using MySQL as the relational database management system running on a Linux server, using an Apache web server, and Perl CGI scripts as the web interface. The database and the associated web-based interface allow researchers to examine many lines of evidence (e.g. microarray, proteomics, QTL studies, SNP data) to assess the potential role of a gene or group of genes in the response of different maize lines to A. flavus infection and subsequent production of aflatoxin by the fungus. CFRAS-DB provides the first opportunity to integrate data pertaining to the problem of A. flavus and aflatoxin resistance in maize in one resource and to support queries across different datasets. The web-based interface gives researchers different query options for mining the database

  3. Novel Mutations Detected in Avirulence Genes Overcoming Tomato Cf Resistance Genes in Isolates of a Japanese Population of Cladosporium fulvum.

    Directory of Open Access Journals (Sweden)

    Yuichiro Iida

    Full Text Available Leaf mold of tomato is caused by the biotrophic fungus Cladosporium fulvum which complies with the gene-for-gene system. The disease was first reported in Japan in the 1920s and has since been frequently observed. Initially only race 0 isolates were reported, but since the consecutive introduction of resistance genes Cf-2, Cf-4, Cf-5 and Cf-9 new races have evolved. Here we first determined the virulence spectrum of 133 C. fulvum isolates collected from 22 prefectures in Japan, and subsequently sequenced the avirulence (Avr genes Avr2, Avr4, Avr4E, Avr5 and Avr9 to determine the molecular basis of overcoming Cf genes. Twelve races of C. fulvum with a different virulence spectrum were identified, of which races 9, 2.9, 4.9, 4.5.9 and 4.9.11 occur only in Japan. The Avr genes in many of these races contain unique mutations not observed in races identified elsewhere in the world including (i frameshift mutations and (ii transposon insertions in Avr2, (iii point mutations in Avr4 and Avr4E, and (iv deletions of Avr4E, Avr5 and Avr9. New races have developed by selection pressure imposed by consecutive introductions of Cf-2, Cf-4, Cf-5 and Cf-9 genes in commercially grown tomato cultivars. Our study shows that molecular variations to adapt to different Cf genes in an isolated C. fulvum population in Japan are novel but overall follow similar patterns as those observed in populations from other parts of the world. Implications for breeding of more durable C. fulvum resistant varieties are discussed.

  4. Occurrence of the mcr-1 Colistin Resistance Gene and other Clinically Relevant Antibiotic Resistance Genes in Microbial Populations at Different Municipal Wastewater Treatment Plants in Germany

    Directory of Open Access Journals (Sweden)

    Norman Hembach

    2017-07-01

    Full Text Available Seven wastewater treatment plants (WWTPs with different population equivalents and catchment areas were screened for the prevalence of the colistin resistance gene mcr-1 mediating resistance against last resort antibiotic polymyxin E. The abundance of the plasmid-associated mcr-1 gene in total microbial populations during water treatment processes was quantitatively analyzed by qPCR analyses. The presence of the colistin resistance gene was documented for all of the influent wastewater samples of the seven WWTPs. In some cases the mcr-1 resistance gene was also detected in effluent samples of the WWTPs after conventional treatment reaching the aquatic environment. In addition to the occurrence of mcr-1 gene, CTX-M-32, blaTEM, CTX-M, tetM, CMY-2, and ermB genes coding for clinically relevant antibiotic resistances were quantified in higher abundances in all WWTPs effluents. In parallel, the abundances of Acinetobacter baumannii, Klebsiella pneumoniae, and Escherichia coli were quantified via qPCR using specific taxonomic gene markers which were detected in all influent and effluent wastewaters in significant densities. Hence, opportunistic pathogens and clinically relevant antibiotic resistance genes in wastewaters of the analyzed WWTPs bear a risk of dissemination to the aquatic environment. Since many of the antibiotic resistance gene are associated with mobile genetic elements horizontal gene transfer during wastewater treatment can't be excluded.

  5. Untreated urban waste contaminates Indian river sediments with resistance genes to last resort antibiotics.

    Science.gov (United States)

    Marathe, Nachiket P; Pal, Chandan; Gaikwad, Swapnil S; Jonsson, Viktor; Kristiansson, Erik; Larsson, D G Joakim

    2017-11-01

    Efficient sewage treatment is critical for limiting environmental transmission of antibiotic-resistant bacteria. In many low and middle income countries, however, large proportions of sewage are still released untreated into receiving water bodies. In-depth knowledge of how such discharges of untreated urban waste influences the environmental resistome is largely lacking. Here, we highlight the impact of uncontrolled discharge of partially treated and/or untreated wastewater on the structure of bacterial communities and resistome of sediments collected from Mutha river flowing through Pune city in India. Using shotgun metagenomics, we found a wide array (n = 175) of horizontally transferable antibiotic resistance genes (ARGs) including carbapenemases such as NDM, VIM, KPC, OXA-48 and IMP types. The relative abundance of total ARGs was 30-fold higher in river sediments within the city compared to upstream sites. Forty four ARGs, including the tet(X) gene conferring resistance to tigecycline, OXA-58 and GES type carbapenemases, were significantly more abundant in city sediments, while two ARGs were more common at upstream sites. The recently identified mobile colistin resistance gene mcr-1 was detected only in one of the upstream samples, but not in city samples. In addition to ARGs, higher abundances of various mobile genetic elements were found in city samples, including integron-associated integrases and ISCR transposases, as well as some biocide/metal resistance genes. Virulence toxin genes as well as bacterial genera comprising many pathogens were more abundant here; the genus Acinetobacter, which is often associated with multidrug resistance and nosocomial infections, comprised up to 29% of the 16S rRNA reads, which to our best knowledge is unmatched in any other deeply sequenced metagenome. There was a strong correlation between the abundance of Acinetobacter and the OXA-58 carbapenemase gene. Our study shows that uncontrolled discharge of untreated urban

  6. Tetracycline residues and tetracycline resistance genes in groundwater impacted by swine production facilities

    Science.gov (United States)

    Mackie, R.I.; Koike, S.; Krapac, I.; Chee-Sanford, J.; Maxwell, Susan; Aminov, R.I.

    2006-01-01

    Antibiotics are used at therapeutic levels to treat disease; at slightly lower levels as prophylactics; and at low, subtherapeutic levels for growth promotion and improvement of feed efficiency. Over 88% of swine producers in the United States gave antimicrobials to grower/finisher pigs in feed as a growth promoter in 2000. It is estimated that ca. 75% of antibiotics are not absorbed by animals and are excreted in urine and feces. The extensive use of antibiotics in swine production has resulted in antibiotic resistance in many intestinal bacteria, which are also excreted in swine feces, resulting in dissemination of resistance genes into the environment.To assess the impact of manure management on groundwater quality, groundwater samples have been collected near two swine confinement facilities that use lagoons for manure storage and treatment. Several key contaminant indicators-including inorganic ions, antibiotics, and antibiotic resistance genes-were analyzed in groundwater collected from the monitoring wells. Chloride, ammonium, potassium, and sodium were predominant inorganic constituents in the manure samples and served as indicators of groundwater contamination. Based on these analyses, shallow groundwater has been impacted by lagoon seepage at both sites. Liquid chromatography-mass spectroscopy (LC-MS) was used to measure the dissolved concentrations of tetracycline, chlortetracycline, and oxytetracycline in groundwater and manure. Although tetracyclines were regularly used at both facilities, they were infrequently detected in manure samples and then at relatively trace concentrations. Concentrations of all tetracyclines and their breakdown products in the groundwater sampled were generally less than 0.5 ??g/L.Bacterial tetracycline resistance genes served as distinct genotypic markers to indicate the dissemination and mobility of antibiotic resistance genes that originated from the lagoons. Applying PCR to genomic DNA extracted from the lagoon and

  7. Transcriptome profiling identifies genes/pathways associated with experimental resistance to paromomycin in Leishmania donovani

    Directory of Open Access Journals (Sweden)

    Aditya Verma

    2017-12-01

    Full Text Available Widespread resistance towards antimony and reports of relapses following miltefosine treatment has severely affected the management of visceral leishmaniasis (VL in the Indian subcontinent. Paromomycin (PMM, an aminoglycoside antibiotic, has been licensed for VL treatment in India in 2007. Although its use is still restricted in the field, unraveling the molecular mechanism of resistance towards PMM is the key to preserve the drug. In this study, PMM resistant lines were selected up to 100 μM of PMM in three distinct field isolates of Leishmania donovani at promastigote stage. The resistance induced at promastigote level was also evident in amastigotes which showed 6 fold decreases in PMM susceptibility. Comparative transcriptome profiling of PMM resistant (PMM-R and the corresponding PMM sensitive (PMM-S parasites revealed modulated expression of 500 genes (1.5 fold cut off in PMM-R parasites. Selected genes were validated for their modulated expression by quantitative real-time PCR. Functional classification and pathway analysis of modulated genes indicated probable adaptations in drug resistant lines which included a reduced oxidative phosphorylation; b increased glycosomal succinate fermentation and substrate level phosphorylation; c dependency on lipids and amino acids for energy generation; d reduced DNA synthesis and increased DNA damage repair and e decreased protein synthesis and degradation. Interestingly, PMM-R parasites showed a marked increase in PMM susceptibility in presence of verapamil and amlodipine, antagonists of Ca2+ channel that are also modulators of ABC transporters. Moreover, infection of macrophages by PMM-R parasites led to modulated nitric oxide (NO levels while reactive oxygen species (ROS level remained unaltered. The present study highlights the putative mechanisms of PMM resistance in Leishmania. Keywords: Leishmania donovani, Drug resistance, Paromomycin, Transcriptome, ABC transporters, Nitric oxide, Visceral

  8. Antimicrobial Resistance and Resistance Genes in Aerobic Bacteria Isolated from Pork at Slaughter.

    Science.gov (United States)

    Li, Lili; Heidemann Olsen, Rikke; Ye, Lei; Yan, He; Nie, Qing; Meng, Hecheng; Shi, Lei

    2016-04-01

    The aim of this study was to investigate the phenotypic and genotypic antimicrobial resistance, integrons, and transferability of resistance markers in 243 aerobic bacteria recovered from pork at slaughter in the People's Republic of China. The organisms belonged to 22 genera of gram-negative bacteria (92.2%) and gram-positive bacteria (7.8%). High levels of resistance were detected to tetracycline, trimethoprim-sulfamethoxazole, and ampicillin (36.2 to 54.3%), and lower levels were detected to nitrofurantoin, cefotaxime, gentamicin, ciprofloxacin, and chloramphenicol (7.8 to 29.2%). Across species, genes conferring antimicrobial resistance were observed with the following frequencies: blaTEM, 40.7%; blaCMY-2, 15.2%; blaCTX-M, 11.5%; sul2, 27.2%; sul1, 14.4%; tet(A), 5.4%; tet(L), 5.4%; tet(M), 5.0%; tet(E), 3.7%; tet(C), 3.3%; tet(S), 2.5%; and tet(K), 0.8%. Various antimicrobial resistance genes were found in new carriers: blaTEM in Lactococcus garvieae, Myroides odoratimimus, Aeromonas hydrophila, Staphylococcus sciuri, Raoultella terrigena, Macrococcus caseolyticus, Acinetobacter ursingii, Sphingobacterium sp., and Oceanobacillus sp.; blaCMY-2 in Lactococcus lactis, Klebsiella oxytoca, Serratia marcescens, Acinetobacter baumannii, and Myroides phaeus; tet(L) in M. caseolyticus; sul1 in Vibrio cincinnatiensis; sul2 in Acinetobacter bereziniae, Acinetobacter johnsonii, and V. cincinnatiensis; and the class 1 integron and gene cassette aadA2 in V. cincinnatiensis. Approximately 6.6% of isolates contained class 1 integrons, and one isolate harbored class 2 integrons. Plasmid associated intI1 and androgen receptor- encoding genes were transferred into Escherichia coli J53 and E. coli DH5α by conjugation and transformation experiments, respectively. Our study highlights the importance of aerobic bacteria from pork as reservoirs for antimicrobial resistance genes and mobile genetic elements that can readily be transferred intra- and interspecies.

  9. Microsatellite polymorphisms associated with human behavioural and psychological phenotypes including a gene-environment interaction.

    Science.gov (United States)

    Bagshaw, Andrew T M; Horwood, L John; Fergusson, David M; Gemmell, Neil J; Kennedy, Martin A

    2017-02-03

    The genetic and environmental influences on human personality and behaviour are a complex matter of ongoing debate. Accumulating evidence indicates that short tandem repeats (STRs) in regulatory regions are good candidates to explain heritability not accessed by genome-wide association studies. We tested for associations between the genotypes of four selected repeats and 18 traits relating to personality, behaviour, cognitive ability and mental health in a well-studied longitudinal birth cohort (n = 458-589) using one way analysis of variance. The repeats were a highly conserved poly-AC microsatellite in the upstream promoter region of the T-box brain 1 (TBR1) gene and three previously studied STRs in the activating enhancer-binding protein 2-beta (AP2-β) and androgen receptor (AR) genes. Where significance was found we used multiple regression to assess the influence of confounding factors. Carriers of the shorter, most common, allele of the AR gene's GGN microsatellite polymorphism had fewer anxiety-related symptoms, which was consistent with previous studies, but in our study this was not significant following Bonferroni correction. No associations with two repeats in the AP2-β gene withstood this correction. A novel finding was that carriers of the minor allele of the TBR1 AC microsatellite were at higher risk of conduct problems in childhood at age 7-9 (p = 0.0007, which did pass Bonferroni correction). Including maternal smoking during pregnancy (MSDP) in models controlling for potentially confounding influences showed that an interaction between TBR1 genotype and MSDP was a significant predictor of conduct problems in childhood and adolescence (p behaviour up to age 25 years (p ≤ 0.02). This interaction remained significant after controlling for possible confounders including maternal age at birth, socio-economic status and education, and offspring birth weight. The potential functional importance of the TBR1 gene's promoter microsatellite

  10. Prevalence of antibiotic resistance genes in the bacterial flora of integrated fish farming environments of Pakistan and Tanzania.

    Science.gov (United States)

    Shah, Syed Q A; Colquhoun, Duncan J; Nikuli, Hamisi L; Sørum, Henning

    2012-08-21

    The use of a wide variety of antimicrobials in human and veterinary medicine, including aquaculture, has led to the emergence of antibiotic resistant pathogens. In the present study, bacteria from water, sediments, and fish were collected from fish farms in Pakistan and Tanzania with no recorded history of antibiotic use. The isolates were screened for the presence of resistance genes against various antimicrobials used in aquaculture and animal husbandry. Resistant isolates selected by disk diffusion and genotyped by Southern hybridization were further screened by polymerase chain reaction (PCR) and amplicon sequencing. The prominent resistance genes identified encoded tetracycline [tetA(A) and tetA(G)], trimethoprim [dfrA1, dfrA5, dfrA7, dfrA12, and dfrA15], amoxicillin [bla(TEM)], streptomycin [strA-strB], chloramphenicol [cat-1], and erythromycin resistance [mefA]. The int1 gene was found in more than 30% of the bacterial isolates in association with gene cassettes. MAR indices ranged from 0.2 to 1. The bla(NDM-1) gene was not identified in ertapenem resistant isolates. It is hypothesized that integrated fish farming practices utilizing domestic farm and poultry waste along with antibiotic residues from animal husbandry may have contributed to a pool of resistance genes in the aquaculture systems studied.

  11. SolRgene: an online database to explore disease resistance genes in tuber-bearing Solanum species

    Directory of Open Access Journals (Sweden)

    Vleeshouwers Vivianne GAA

    2011-08-01

    Full Text Available Abstract Background The cultivated potato (Solanum tuberosum L. is an important food crop, but highly susceptible to many pathogens. The major threat to potato production is the Irish famine pathogen Phytophthora infestans, which causes the devastating late blight disease. Potato breeding makes use of germplasm from wild relatives (wild germplasm to introduce resistances into cultivated potato. The Solanum section Petota comprises tuber-bearing species that are potential donors of new disease resistance genes. The aim of this study was to explore Solanum section Petota for resistance genes and generate a widely accessible resource that is useful for studying and implementing disease resistance in potato. Description The SolRgene database contains data on resistance to P. infestans and presence of R genes and R gene homologues in Solanum section Petota. We have explored Solanum section Petota for resistance to late blight in high throughput disease tests under various laboratory conditions and in field trials. From resistant wild germplasm, segregating populations were generated and assessed for the presence of resistance genes. All these data have been entered into the SolRgene database. To facilitate genetic and resistance gene evolution studies, phylogenetic data of the entire SolRgene collection are included, as well as a tool for generating phylogenetic trees of selected groups of germplasm. Data from resistance gene allele-mining studies are incorporated, which enables detection of R gene homologs in related germplasm. Using these resources, various resistance genes have been detected and some of these have been cloned, whereas others are in the cloning pipeline. All this information is stored in the online SolRgene database, which allows users to query resistance data, sequences, passport data of the accessions, and phylogenic classifications. Conclusion Solanum section Petota forms the basis of the SolRgene database, which contains a

  12. Molecular study on some antibiotic resistant genes in Salmonella spp. isolates

    Science.gov (United States)

    Nabi, Ari Q.

    2017-09-01

    Studying the genes related with antimicrobial resistance in Salmonella spp. is a crucial step toward a correct and faster treatment of infections caused by the pathogen. In this work Integron mediated antibiotic resistant gene IntI1 (Class I Integrase IntI1) and some plasmid mediated antibiotic resistance genes (Qnr) were scanned among the isolated non-Typhoid Salmonellae strains with known resistance to some important antimicrobial drugs using Sybr Green real time PCR. The aim of the study was to correlate the multiple antibiotics and antimicrobial resistance of Salmonella spp. with the presence of integrase (IntI1) gene and plasmid mediated quinolone resistant genes. Results revealed the presence of Class I Integrase gene in 76% of the isolates with confirmed multiple antibiotic resistances. Moreover, about 32% of the multiple antibiotic resistant serotypes showed a positive R-PCR for plasmid mediated qnrA gene encoding for nalidixic acid and ciprofloxacin resistance. No positive results could be revealed form R-PCRs targeting qnrB or qnrS. In light of these results we can conclude that the presence of at least one of the qnr genes and/or the presence of Integrase Class I gene were responsible for the multiple antibiotic resistance to for nalidixic acid and ciprofloxacin from the studied Salmonella spp. and further studies required to identify the genes related with multiple antibiotic resistance of the pathogen.

  13. Antibiotic Resistance Genetic Markers and Integrons in White Soft Cheese: Aspects of Clinical Resistome and Potentiality of Horizontal Gene Transfer.

    Science.gov (United States)

    de Paula, Ana Caroline L; Medeiros, Julliane D; de Azevedo, Analice C; de Assis Chagas, Jéssica M; da Silva, Vânia L; Diniz, Cláudio G

    2018-02-19

    Antibiotic resistance poses an important threat to global public health and has become a challenge to modern medicine. The occurrence of antibiotic-resistant bacteria in a broad range of foods has led to a growing concern about the impact that food may have as a reservoir of antibiotic resistance genes. Considering Minas Frescal Cheese (MFC)-a typical Brazilian white soft cheese-and its economic and cultural values, in this study, medically relevant antimicrobial-resistance genetic markers (AR genes) were screened, and the occurrence of integrons were evaluated in manufactured MFC using culture-independent approaches. Through a fingerprinting analysis, the tested MFCs were brand-clustered, indicating reproducibility along the production chain. A common core of resistance markers in all brands evaluated and related antimicrobials such as β-lactams, tetracyclines, quinolones, and sulfonamide was detected. Several other markers, including efflux pumps and aminoglycosides-resistance were distributed among brands. Class 1 and 2 integrons were observed, respectively, in 77% and 97% of the samples. The presence of AR genes is of special interest due to their clinical relevance. Taken together, the data may suggest that the production chain of MFC might contribute to the spread of putative drug-resistant bacteria, which could greatly impact human health. Furthermore, detection of class 1 and class 2 integrons in MFC has led to discussions about resistance gene spread in this traditional cheese, providing evidence of potential horizontal transfer of AR genes to human gut microbiota.

  14. Antibiotic Resistance Genetic Markers and Integrons in White Soft Cheese: Aspects of Clinical Resistome and Potentiality of Horizontal Gene Transfer

    Directory of Open Access Journals (Sweden)

    Ana Caroline L. de Paula

    2018-02-01

    Full Text Available Antibiotic resistance poses an important threat to global public health and has become a challenge to modern medicine. The occurrence of antibiotic-resistant bacteria in a broad range of foods has led to a growing concern about the impact that food may have as a reservoir of antibiotic resistance genes. Considering Minas Frescal Cheese (MFC—a typical Brazilian white soft cheese—and its economic and cultural values, in this study, medically relevant antimicrobial-resistance genetic markers (AR genes were screened, and the occurrence of integrons were evaluated in manufactured MFC using culture-independent approaches. Through a fingerprinting analysis, the tested MFCs were brand-clustered, indicating reproducibility along the production chain. A common core of resistance markers in all brands evaluated and related antimicrobials such as β-lactams, tetracyclines, quinolones, and sulfonamide was detected. Several other markers, including efflux pumps and aminoglycosides-resistance were distributed among brands. Class 1 and 2 integrons were observed, respectively, in 77% and 97% of the samples. The presence of AR genes is of special interest due to their clinical relevance. Taken together, the data may suggest that the production chain of MFC might contribute to the spread of putative drug-resistant bacteria, which could greatly impact human health. Furthermore, detection of class 1 and class 2 integrons in MFC has led to discussions about resistance gene spread in this traditional cheese, providing evidence of potential horizontal transfer of AR genes to human gut microbiota.

  15. Survival of Antibiotic Resistant Bacteria and Horizontal Gene Transfer Control Antibiotic Resistance Gene Content in Anaerobic Digesters.

    Science.gov (United States)

    Miller, Jennifer H; Novak, John T; Knocke, William R; Pruden, Amy

    2016-01-01

    Understanding fate of antibiotic resistant bacteria (ARB) vs. their antibiotic resistance genes (ARGs) during wastewater sludge treatment is critical in order to reduce the spread of antibiotic resistance through process optimization. Here, we spiked high concentrations of tetracycline-resistant bacteria, isolated from mesophilic (Iso M1-1-a Pseudomonas sp.) and thermophilic (Iso T10-a Bacillus sp.) anaerobic digested sludge, into batch digesters and monitored their fate by plate counts and quantitative polymerase chain reaction (QPCR) of their corresponding tetracycline ARGs. In batch studies, spiked ARB plate counts returned to baseline (thermophilic) or 1-log above baseline (mesophilic) while levels of the ARG present in the spiked isolate [tet(G)] remained high in mesophilic batch reactors. To compare results under semi-continuous flow conditions with natural influent variation, tet(O), tet(W), and sul1 ARGs, along with the intI1 integrase gene, were monitored over a 9-month period in the raw feed sludge and effluent sludge of lab-scale thermophilic and mesophilic anaerobic digesters. sul1 and intI1 in mesophilic and thermophilic digesters correlated positively (Spearman rho = 0.457-0.829, P < 0.05) with the raw feed sludge. There was no correlation in tet(O) or tet(W) ratios in raw sludge and mesophilic digested sludge or thermophilic digested sludge (Spearman rho = 0.130-0.486, P = 0.075-0.612). However, in the thermophilic digester, the tet(O) and tet(W) ratios remained consistently low over the entire monitoring period. We conclude that the influent sludge microbial composition can influence the ARG content of a digester, apparently as a result of differential survival or death of ARBs or horizontal gene transfer of genes between raw sludge ARBs and the digester microbial community. Notably, mesophilic digestion was more susceptible to ARG intrusion than thermophilic digestion, which may be attributed to a higher rate of ARB survival and/or horizontal gene

  16. A multiple genome analysis of Mycobacterium tuberculosis reveals specific novel genes and mutations associated with pyrazinamide resistance

    KAUST Repository

    Sheen, Patricia

    2017-10-11

    Tuberculosis (TB) is a major global health problem and drug resistance compromises the efforts to control this disease. Pyrazinamide (PZA) is an important drug used in both first and second line treatment regimes. However, its complete mechanism of action and resistance remains unclear.We genotyped and sequenced the complete genomes of 68 M. tuberculosis strains isolated from unrelated TB patients in Peru. No clustering pattern of the strains was verified based on spoligotyping. We analyzed the association between PZA resistance with non-synonymous mutations and specific genes. We found mutations in pncA and novel genes significantly associated with PZA resistance in strains without pncA mutations. These included genes related to transportation of metal ions, pH regulation and immune system evasion.These results suggest potential alternate mechanisms of PZA resistance that have not been found in other populations, supporting that the antibacterial activity of PZA may hit multiple targets.

  17. A multiple genome analysis of Mycobacterium tuberculosis reveals specific novel genes and mutations associated with pyrazinamide resistance

    KAUST Repository

    Sheen, Patricia; Requena, David; Gushiken, Eduardo; Gilman, Robert H.; Antiparra, Ricardo; Lucero, Bryan; Lizá rraga, Pilar; Cieza, Basilio; Roncal, Elisa; Grandjean, Louis; Pain, Arnab; McNerney, Ruth; Clark, Taane G.; Moore, David; Zimic, Mirko

    2017-01-01

    Tuberculosis (TB) is a major global health problem and drug resistance compromises the efforts to control this disease. Pyrazinamide (PZA) is an important drug used in both first and second line treatment regimes. However, its complete mechanism of action and resistance remains unclear.We genotyped and sequenced the complete genomes of 68 M. tuberculosis strains isolated from unrelated TB patients in Peru. No clustering pattern of the strains was verified based on spoligotyping. We analyzed the association between PZA resistance with non-synonymous mutations and specific genes. We found mutations in pncA and novel genes significantly associated with PZA resistance in strains without pncA mutations. These included genes related to transportation of metal ions, pH regulation and immune system evasion.These results suggest potential alternate mechanisms of PZA resistance that have not been found in other populations, supporting that the antibacterial activity of PZA may hit multiple targets.

  18. Genetic mapping of the rice resistance-breaking gene of the brown planthopper Nilaparvata lugens

    OpenAIRE

    Kobayashi, Tetsuya; Yamamoto, Kimiko; Suetsugu, Yoshitaka; Kuwazaki, Seigo; Hattori, Makoto; Jairin, Jirapong; Sanada-Morimura, Sachiyo; Matsumura, Masaya

    2014-01-01

    Host plant resistance has been widely used for controlling the major rice pest brown planthopper (BPH, Nilaparvata lugens). However, adaptation of the wild BPH population to resistance limits the effective use of resistant rice varieties. Quantitative trait locus (QTL) analysis was conducted to identify resistance-breaking genes against the anti-feeding mechanism mediated by the rice resistance gene Bph1. QTL analysis in iso-female BPH lines with single-nucleotide polymorphism (SNP) markers d...

  19. EPSPS variability, gene expression, and enzymatic activity in glyphosate-resistant biotypes of Digitaria insularis.

    Science.gov (United States)

    Galeano, E; Barroso, A A M; Vasconcelos, T S; López-Rubio, A; Albrecht, A J P; Victoria Filho, R; Carrer, H

    2016-08-12

    Weed resistance to herbicides is a natural phenomenon that exerts selection on individuals in a population. In Brazil, glyphosate resistance was recently detected in Digitaria insularis. The objective of this study was to elucidate mechanisms of weed resistance in this plant, including genetic variability, allelism, amino acid substitutions, gene expression, and enzymatic activity levels. Most of these have not previously been studied in this species. D. insularis DNA sequences were used to analyze genetic variability. cDNA from resistant and susceptible plants was used to identify mutations, alleles, and 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) expression, using real-time quantitative reverse transcription-polymerase chain reaction. In addition, EPSPS activity was measured. We found a decrease in genetic variability between populations related to glyphosate application. Substitutions from proline to threonine and tyrosine to cysteine led to a decrease in EPSPS affinity for the glyphosate. In addition, the EPSPS enzymatic activity was slightly higher in resistant plants, whereas EPSPS gene expression was almost identical in both biotypes, suggesting feedback regulation at different levels. To conclude, our results suggest new molecular mechanisms used by D. insularis to increase glyphosate resistance.

  20. Analysis of differentially expressed genes related to resistance in spinosad- and neonicotinoid-resistant Musca domestica L. (Diptera: Muscidae) strains

    DEFF Research Database (Denmark)

    Castberg, Dorte Heidi Højland; Kristensen, Michael

    2017-01-01

    strains differing significantly in their response to insecticides. High differential expression of P450s and genes coding for cuticle protein indicates a combination of factors involved in metabolic neonicotinoid and spinosad resistance. Conclusion Resistance in these strains is apparently not linked...... interesting in terms of neonicotinoid resistance, while cyp4d9 was overexpressed in 791spin compared to spinosad-susceptible strains. GSTs, ESTs and UGTs were mostly overexpressed, but not to the same degree as P450s. We present a comprehensive and comparative picture of gene expression in three housefly......Background The housefly is a global pest that has developed resistance to most insecticides applied against it. Resistance of the spinosad-resistant strain 791spin and the neonicotinoid-resistant 766b strain is believed to be due to metabolism. We investigate differentially expressed genes...

  1. Simulated selection responses for breeding programs including resistance and resilience to parasites in Creole goats

    NARCIS (Netherlands)

    Gunia, M.; Phocas, F.; Gourdine, J.L.; Bijma, P.; Mandonnet, N.

    2013-01-01

    The Creole goat is a local breed used for meat production in Guadeloupe (French West Indies). As in other tropical countries, improvement of parasite resistance is needed. In this study, we compared predicted selection responses for alternative breeding programs with or without parasites resistance

  2. Enriched whole genome sequencing identified compensatory mutations in the RNA polymerase gene of rifampicin-resistant Mycobacterium leprae strains.

    Science.gov (United States)

    Lavania, Mallika; Singh, Itu; Turankar, Ravindra P; Gupta, Anuj Kumar; Ahuja, Madhvi; Pathak, Vinay; Sengupta, Utpal

    2018-01-01

    Despite more than three decades of multidrug therapy (MDT), leprosy remains a major public health issue in several endemic countries, including India. The emergence of drug resistance in Mycobacterium leprae (M. leprae) is a cause of concern and poses a threat to the leprosy-control program, which might ultimately dampen the achievement of the elimination program of the country. Rifampicin resistance in clinical strains of M. leprae are supposed to arise from harboring bacterial strains with mutations in the 81-bp rifampicin resistance determining region (RRDR) of the rpoB gene. However, complete dynamics of rifampicin resistance are not explained only by this mutation in leprosy strains. To understand the role of other compensatory mutations and transmission dynamics of drug-resistant leprosy, a genome-wide sequencing of 11 M. leprae strains - comprising five rifampicin-resistant strains, five sensitive strains, and one reference strain - was done in this study. We observed the presence of compensatory mutations in two rifampicin-resistant strains in rpoC and mmpL7 genes, along with rpoB , that may additionally be responsible for conferring resistance in those strains. Our findings support the role for compensatory mutation(s) in RNA polymerase gene(s), resulting in rifampicin resistance in relapsed leprosy patients.

  3. High prevalence of multidrug-resistant tuberculosis among patients with rifampicin resistance using GeneXpert Mycobacterium tuberculosis/rifampicin in Ghana.

    Science.gov (United States)

    Boakye-Appiah, Justice K; Steinmetz, Alexis R; Pupulampu, Peter; Ofori-Yirenkyi, Stephen; Tetteh, Ishmael; Frimpong, Michael; Oppong, Patrick; Opare-Sem, Ohene; Norman, Betty R; Stienstra, Ymkje; van der Werf, Tjip S; Wansbrough-Jones, Mark; Bonsu, Frank; Obeng-Baah, Joseph; Phillips, Richard O

    2016-06-01

    Drug-resistant strains of tuberculosis (TB) represent a major threat to global TB control. In low- and middle-income countries, resource constraints make it difficult to identify and monitor cases of resistance using drug susceptibility testing and culture. Molecular assays such as the GeneXpert Mycobacterium tuberculosis/rifampicin may prove to be a cost-effective solution to this problem in these settings. The objective of this study is to evaluate the use of GeneXpert in the diagnosis of pulmonary TB since it was introduced into two tertiary hospitals in Ghana in 2013. A 2-year retrospective audit of clinical cases involving patients who presented with clinically suspected TB or documented TB not improving on standard therapy and had samples sent for GeneXpert testing. GeneXpert identified 169 cases of TB, including 17 cases of rifampicin-resistant TB. Of the seven cases with final culture and drug susceptibility testing results, six demonstrated further drug resistance and five of these were multidrug-resistant TB. These findings call for a scale-up of TB control in Ghana and provide evidence that the expansion of GeneXpert may be an optimal means to improve case finding and guide treatment of drug-resistant TB in this setting. Copyright © 2016. Published by Elsevier Ltd.

  4. Pyramiding, alternating or mixing: comparative performances of deployment strategies of nematode resistance genes to promote plant resistance efficiency and durability.

    Science.gov (United States)

    Djian-Caporalino, Caroline; Palloix, Alain; Fazari, Ariane; Marteu, Nathalie; Barbary, Arnaud; Abad, Pierre; Sage-Palloix, Anne-Marie; Mateille, Thierry; Risso, Sabine; Lanza, Roger; Taussig, Catherine; Castagnone-Sereno, Philippe

    2014-02-22

    Resistant cultivars are key elements for pathogen control and pesticide reduction, but their repeated use may lead to the emergence of virulent pathogen populations, able to overcome the resistance. Increased research efforts, mainly based on theoretical studies, explore spatio-temporal deployment strategies of resistance genes in order to maximize their durability. We evaluated experimentally three of these strategies to control root-knot nematodes: cultivar mixtures, alternating and pyramiding resistance genes, under controlled and field conditions over a 3-years period, assessing the efficiency and the durability of resistance in a protected crop rotation system with pepper as summer crop and lettuce as winter crop. The choice of the resistance gene and the genetic background in which it is introgressed, affected the frequency of resistance breakdown. The pyramiding of two different resistance genes in one genotype suppressed the emergence of virulent isolates. Alternating different resistance genes in rotation was also efficient to decrease virulent populations in fields due to the specificity of the virulence and the trapping effect of resistant plants. Mixing resistant cultivars together appeared as a less efficient strategy to control nematodes. This work provides experimental evidence that, in a cropping system with seasonal sequences of vegetable species, pyramiding or alternating resistance genes benefit yields in the long-term by increasing the durability of resistant cultivars and improving the long-term control of a soil-borne pest. To our knowledge, this result is the first one obtained for a plant-nematode interaction, which helps demonstrate the general applicability of such strategies for breeding and sustainable management of resistant cultivars against pathogens.

  5. Sulfonamide-resistant bacteria and their resistance genes in soils fertilized with manures from Jiangsu Province, Southeastern China.

    Science.gov (United States)

    Wang, Na; Yang, Xiaohong; Jiao, Shaojun; Zhang, Jun; Ye, Boping; Gao, Shixiang

    2014-01-01

    Antibiotic-resistant bacteria and genes are recognized as new environmental pollutants that warrant special concern. There were few reports on veterinary antibiotic-resistant bacteria and genes in China. This work systematically analyzed the prevalence and distribution of sulfonamide resistance genes in soils from the environments around poultry and livestock farms in Jiangsu Province, Southeastern China. The results showed that the animal manure application made the spread and abundance of antibiotic resistance genes (ARGs) increasingly in the soil. The frequency of sulfonamide resistance genes was sul1 > sul2 > sul3 in pig-manured soil DNA and sul2 > sul1 > sul3 in chicken-manured soil DNA. Further analysis suggested that the frequency distribution of the sul genes in the genomic DNA and plasmids of the SR isolates from manured soil was sul2 > sul1 > sul3 overall (psulfonamide resistance genes. The present study also indicated that Bacillus, Pseudomonas and Shigella were the most prevalent sul-positive genera in the soil, suggesting a potential human health risk. The above results could be important in the evaluation of antibiotic-resistant bacteria and genes from manure as sources of agricultural soil pollution; the results also demonstrate the necessity and urgency of the regulation and supervision of veterinary antibiotics in China.

  6. Survey of Candidate Genes for Maize Resistance to Infection by Aspergillus flavus and/or Aflatoxin Contamination

    Science.gov (United States)

    Hawkins, Leigh K.; Tang, Juliet D.; Tomashek, John; Alves Oliveira, Dafne; Ogunola, Oluwaseun F.; Smith, J. Spencer; Williams, W. Paul

    2018-01-01

    Many projects have identified candidate genes for resistance to aflatoxin accumulation or Aspergillus flavus infection and growth in maize using genetic mapping, genomics, transcriptomics and/or proteomics studies. However, only a small percentage of these candidates have been validated in field conditions, and their relative contribution to resistance, if any, is unknown. This study presents a consolidated list of candidate genes identified in past studies or in-house studies, with descriptive data including genetic location, gene annotation, known protein identifiers, and associated pathway information, if known. A candidate gene pipeline to test the phenotypic effect of any maize DNA sequence on aflatoxin accumulation resistance was used in this study to determine any measurable effect on polymorphisms within or linked to the candidate gene sequences, and the results are published here. PMID:29385107

  7. Survey of Candidate Genes for Maize Resistance to Infection by Aspergillus flavus and/or Aflatoxin Contamination

    Directory of Open Access Journals (Sweden)

    Leigh K. Hawkins

    2018-01-01

    Full Text Available Many projects have identified candidate genes for resistance to aflatoxin accumulation or Aspergillus flavus infection and growth in maize using genetic mapping, genomics, transcriptomics and/or proteomics studies. However, only a small percentage of these candidates have been validated in field conditions, and their relative contribution to resistance, if any, is unknown. This study presents a consolidated list of candidate genes identified in past studies or in-house studies, with descriptive data including genetic location, gene annotation, known protein identifiers, and associated pathway information, if known. A candidate gene pipeline to test the phenotypic effect of any maize DNA sequence on aflatoxin accumulation resistance was used in this study to determine any measurable effect on polymorphisms within or linked to the candidate gene sequences, and the results are published here.

  8. Antimicrobial Resistance and Resistance Genes in Aerobic Bacteria Isolated from Pork at Slaughter

    DEFF Research Database (Denmark)

    Li, Lili; Olsen, Rikke Heidemann; Ye, Lei

    2016-01-01

    The aim of this study was to investigate the phenotypic and genotypic antimicrobial resistance, integrons, and transferability of resistance markers in 243 aerobic bacteria recovered from pork at slaughter in the People's Republic of China. The organisms belonged to 22 genera of gram-negative bac......The aim of this study was to investigate the phenotypic and genotypic antimicrobial resistance, integrons, and transferability of resistance markers in 243 aerobic bacteria recovered from pork at slaughter in the People's Republic of China. The organisms belonged to 22 genera of gram......-negative bacteria (92.2%) and gram-positive bacteria (7.8%). High levels of resistance were detected to tetracycline, trimethoprim-sulfamethoxazole, and ampicillin (36.2 to 54.3%), and lower levels were detected to nitrofurantoin, cefotaxime, gentamicin, ciprofloxacin, and chloramphenicol (7.8 to 29.2%). Across.......6% of isolates contained class 1 integrons, and one isolate harbored class 2 integrons. Plasmid associated intI1 and androgen receptor– encoding genes were transferred into Escherichia coli J53 and E. coli DH5α by conjugation and transformation experiments, respectively. Our study highlights the importance...

  9. A physical map of the heterozygous grapevine 'Cabernet Sauvignon' allows mapping candidate genes for disease resistance

    Directory of Open Access Journals (Sweden)

    Scalabrin Simone

    2008-06-01

    Full Text Available Abstract Background Whole-genome physical maps facilitate genome sequencing, sequence assembly, mapping of candidate genes, and the design of targeted genetic markers. An automated protocol was used to construct a Vitis vinifera 'Cabernet Sauvignon' physical map. The quality of the result was addressed with regard to the effect of high heterozygosity on the accuracy of contig assembly. Its usefulness for the genome-wide mapping of genes for disease resistance, which is an important trait for grapevine, was then assessed. Results The physical map included 29,727 BAC clones assembled into 1,770 contigs, spanning 715,684 kbp, and corresponding to 1.5-fold the genome size. Map inflation was due to high heterozygosity, which caused either the separation of allelic BACs in two different contigs, or local mis-assembly in contigs containing BACs from the two haplotypes. Genetic markers anchored 395 contigs or 255,476 kbp to chromosomes. The fully automated assembly and anchorage procedures were validated by BAC-by-BAC blast of the end sequences against the grape genome sequence, unveiling 7.3% of chimerical contigs. The distribution across the physical map of candidate genes for non-host and host resistance, and for defence signalling pathways was then studied. NBS-LRR and RLK genes for host resistance were found in 424 contigs, 133 of them (32% were assigned to chromosomes, on which they are mostly organised in clusters. Non-host and defence signalling genes were found in 99 contigs dispersed without a discernable pattern across the genome. Conclusion Despite some limitations that interfere with the correct assembly of heterozygous clones into contigs, the 'Cabernet Sauvignon' physical map is a useful and reliable intermediary step between a genetic map and the genome sequence. This tool was successfully exploited for a quick mapping of complex families of genes, and it strengthened previous clues of co-localisation of major NBS-LRR clusters and

  10. Differential gene expression in response to Fusarium oxysporum infection in resistant and susceptible genotypes of flax (Linum usitatissimum L.).

    Science.gov (United States)

    Dmitriev, Alexey A; Krasnov, George S; Rozhmina, Tatiana A; Novakovskiy, Roman O; Snezhkina, Anastasiya V; Fedorova, Maria S; Yurkevich, Olga Yu; Muravenko, Olga V; Bolsheva, Nadezhda L; Kudryavtseva, Anna V; Melnikova, Nataliya V

    2017-12-28

    Flax (Linum usitatissimum L.) is a crop plant used for fiber and oil production. Although potentially high-yielding flax varieties have been developed, environmental stresses markedly decrease flax production. Among biotic stresses, Fusarium oxysporum f. sp. lini is recognized as one of the most devastating flax pathogens. It causes wilt disease that is one of the major limiting factors for flax production worldwide. Breeding and cultivation of flax varieties resistant to F. oxysporum is the most effective method for controlling wilt disease. Although the mechanisms of flax response to Fusarium have been actively studied, data on the plant response to infection and resistance gene candidates are currently very limited. The transcriptomes of two resistant and two susceptible flax cultivars with respect to Fusarium wilt, as well as two resistant BC 2 F 5 populations, which were grown under control conditions or inoculated with F. oxysporum, were sequenced using the Illumina platform. Genes showing changes in expression under F. oxysporum infection were identified in both resistant and susceptible flax genotypes. We observed the predominant overexpression of numerous genes that are involved in defense response. This was more pronounced in resistant cultivars. In susceptible cultivars, significant downregulation of genes involved in cell wall organization or biogenesis was observed in response to F. oxysporum. In the resistant genotypes, upregulation of genes related to NAD(P)H oxidase activity was detected. Upregulation of a number of genes, including that encoding beta-1,3-glucanase, was significantly greater in the cultivars and BC 2 F 5 populations resistant to Fusarium wilt than in susceptible cultivars in response to F. oxysporum infection. Using high-throughput sequencing, we identified genes involved in the early defense response of L. usitatissimum against the fungus F. oxysporum. In response to F. oxysporum infection, we detected changes in the

  11. Simulation of E. coli gene regulation including overlapping cell cycles, growth, division, time delays and noise.

    Directory of Open Access Journals (Sweden)

    Ruoyu Luo

    Full Text Available Due to the complexity of biological systems, simulation of biological networks is necessary but sometimes complicated. The classic stochastic simulation algorithm (SSA by Gillespie and its modified versions are widely used to simulate the stochastic dynamics of biochemical reaction systems. However, it has remained a challenge to implement accurate and efficient simulation algorithms for general reaction schemes in growing cells. Here, we present a modeling and simulation tool, called 'GeneCircuits', which is specifically developed to simulate gene-regulation in exponentially growing bacterial cells (such as E. coli with overlapping cell cycles. Our tool integrates three specific features of these cells that are not generally included in SSA tools: 1 the time delay between the regulation and synthesis of proteins that is due to transcription and translation processes; 2 cell cycle-dependent periodic changes of gene dosage; and 3 variations in the propensities of chemical reactions that have time-dependent reaction rates as a consequence of volume expansion and cell division. We give three biologically relevant examples to illustrate the use of our simulation tool in quantitative studies of systems biology and synthetic biology.

  12. Including α s1 casein gene information in genomic evaluations of French dairy goats.

    Science.gov (United States)

    Carillier-Jacquin, Céline; Larroque, Hélène; Robert-Granié, Christèle

    2016-08-04

    Genomic best linear unbiased prediction methods assume that all markers explain the same fraction of the genetic variance and do not account effectively for genes with major effects such as the α s1 casein polymorphism in dairy goats. In this study, we investigated methods to include the available α s1 casein genotype effect in genomic evaluations of French dairy goats. First, the α s1 casein genotype was included as a fixed effect in genomic evaluation models based only on bucks that were genotyped at the α s1 casein locus. Less than 1 % of the females with phenotypes were genotyped at the α s1 casein gene. Thus, to incorporate these female phenotypes in the genomic evaluation, two methods that allowed for this large number of missing α s1 casein genotypes were investigated. Probabilities for each possible α s1 casein genotype were first estimated for each female of unknown genotype based on iterative peeling equations. The second method is based on a multiallelic gene content approach. For each model tested, we used three datasets each divided into a training and a validation set: (1) two-breed population (Alpine + Saanen), (2) Alpine population, and (3) Saanen population. The α s1 casein genotype had a significant effect on milk yield, fat content and protein content. Including an α s1 casein effect in genetic and genomic evaluations based only on male known α s1 casein genotypes improved accuracies (from 6 to 27 %). In genomic evaluations based on all female phenotypes, the gene content approach performed better than the other tested methods but the improvement in accuracy was only slightly better (from 1 to 14 %) than that of a genomic model without the α s1 casein effect. Including the α s1 casein effect in a genomic evaluation model for French dairy goats is possible and useful to improve accuracy. Difficulties in predicting the genotypes for ungenotyped animals limited the improvement in accuracy of the obtained estimated breeding values.

  13. Distribution of triclosan-resistant genes in major pathogenic microorganisms revealed by metagenome and genome-wide analysis

    Science.gov (United States)

    Khan, Raees; Roy, Nazish; Choi, Kihyuck

    2018-01-01

    The substantial use of triclosan (TCS) has been aimed to kill pathogenic bacteria, but TCS resistance seems to be prevalent in microbial species and limited knowledge exists about TCS resistance determinants in a majority of pathogenic bacteria. We aimed to evaluate the distribution of TCS resistance determinants in major pathogenic bacteria (N = 231) and to assess the enrichment of potentially pathogenic genera in TCS contaminated environments. A TCS-resistant gene (TRG) database was constructed and experimentally validated to predict TCS resistance in major pathogenic bacteria. Genome-wide in silico analysis was performed to define the distribution of TCS-resistant determinants in major pathogens. Microbiome analysis of TCS contaminated soil samples was also performed to investigate the abundance of TCS-resistant pathogens. We experimentally confirmed that TCS resistance could be accurately predicted using genome-wide in silico analysis against TRG database. Predicted TCS resistant phenotypes were observed in all of the tested bacterial strains (N = 17), and heterologous expression of selected TCS resistant genes from those strains conferred expected levels of TCS resistance in an alternative host Escherichia coli. Moreover, genome-wide analysis revealed that potential TCS resistance determinants were abundant among the majority of human-associated pathogens (79%) and soil-borne plant pathogenic bacteria (98%). These included a variety of enoyl-acyl carrier protein reductase (ENRs) homologues, AcrB efflux pumps, and ENR substitutions. FabI ENR, which is the only known effective target for TCS, was either co-localized with other TCS resistance determinants or had TCS resistance-associated substitutions. Furthermore, microbiome analysis revealed that pathogenic genera with intrinsic TCS-resistant determinants exist in TCS contaminated environments. We conclude that TCS may not be as effective against the majority of bacterial pathogens as previously presumed

  14. Distribution of triclosan-resistant genes in major pathogenic microorganisms revealed by metagenome and genome-wide analysis.

    Directory of Open Access Journals (Sweden)

    Raees Khan

    Full Text Available The substantial use of triclosan (TCS has been aimed to kill pathogenic bacteria, but TCS resistance seems to be prevalent in microbial species and limited knowledge exists about TCS resistance determinants in a majority of pathogenic bacteria. We aimed to evaluate the distribution of TCS resistance determinants in major pathogenic bacteria (N = 231 and to assess the enrichment of potentially pathogenic genera in TCS contaminated environments. A TCS-resistant gene (TRG database was constructed and experimentally validated to predict TCS resistance in major pathogenic bacteria. Genome-wide in silico analysis was performed to define the distribution of TCS-resistant determinants in major pathogens. Microbiome analysis of TCS contaminated soil samples was also performed to investigate the abundance of TCS-resistant pathogens. We experimentally confirmed that TCS resistance could be accurately predicted using genome-wide in silico analysis against TRG database. Predicted TCS resistant phenotypes were observed in all of the tested bacterial strains (N = 17, and heterologous expression of selected TCS resistant genes from those strains conferred expected levels of TCS resistance in an alternative host Escherichia coli. Moreover, genome-wide analysis revealed that potential TCS resistance determinants were abundant among the majority of human-associated pathogens (79% and soil-borne plant pathogenic bacteria (98%. These included a variety of enoyl-acyl carrier protein reductase (ENRs homologues, AcrB efflux pumps, and ENR substitutions. FabI ENR, which is the only known effective target for TCS, was either co-localized with other TCS resistance determinants or had TCS resistance-associated substitutions. Furthermore, microbiome analysis revealed that pathogenic genera with intrinsic TCS-resistant determinants exist in TCS contaminated environments. We conclude that TCS may not be as effective against the majority of bacterial pathogens as previously

  15. I Have a Dream: Organic Movements Include Gene Manipulation to Improve Sustainable Farming

    Directory of Open Access Journals (Sweden)

    Gerhart U. Ryffel

    2017-03-01

    Full Text Available Several papers in a Special Issue of Sustainability have recently discussed various aspects to evaluate whether organic farming and gene manipulation are compatible. A special emphasis was given to new plant breeding techniques (NPBTs. These new approaches allow the most predictable genetic alterations of crop plants in ways that the genetically modified plant is identical to a plant generated by conventional breeding. The articles of the Special Issue present the arguments pro and contra the inclusion of the plants generated by NPBTs in organic farming. Organic movements have not yet made a final decision whether some of these techniques should be accepted or banned. In my view these novel genetically manipulated (GM crops could be used in such a way as to respect the requirements for genetically manipulated organisms (GMOs formulated by the International Federation of Organic Movements (IFOAM. Reviewing the potential benefits of disease-resistant potatoes and bananas, it seems possible that these crops support organic farming. To this end, I propose specific requirements that the organic movements should proactively formulate as their standards to accept specific GM crops.

  16. Molecular diagnostics for congenital hearing loss including 15 deafness genes using a next generation sequencing platform

    Directory of Open Access Journals (Sweden)

    De Keulenaer Sarah

    2012-05-01

    Full Text Available Abstract Background Hereditary hearing loss (HL can originate from mutations in one of many genes involved in the complex process of hearing. Identification of the genetic defects in patients is currently labor intensive and expensive. While screening with Sanger sequencing for GJB2 mutations is common, this is not the case for the other known deafness genes (> 60. Next generation sequencing technology (NGS has the potential to be much more cost efficient. Published methods mainly use hybridization based target enrichment procedures that are time saving and efficient, but lead to loss in sensitivity. In this study we used a semi-automated PCR amplification and NGS in order to combine high sensitivity, speed and cost efficiency. Results In this proof of concept study, we screened 15 autosomal recessive deafness genes in 5 patients with congenital genetic deafness. 646 specific primer pairs for all exons and most of the UTR of the 15 selected genes were designed using primerXL. Using patient specific identifiers, all amplicons were pooled and analyzed using the Roche 454 NGS technology. Three of these patients are members of families in which a region of interest has previously been characterized by linkage studies. In these, we were able to identify two new mutations in CDH23 and OTOF. For another patient, the etiology of deafness was unclear, and no causal mutation was found. In a fifth patient, included as a positive control, we could confirm a known mutation in TMC1. Conclusions We have developed an assay that holds great promise as a tool for screening patients with familial autosomal recessive nonsyndromal hearing loss (ARNSHL. For the first time, an efficient, reliable and cost effective genetic test, based on PCR enrichment, for newborns with undiagnosed deafness is available.

  17. Intrachromosomal amplification, locus deletion and point mutation in the aquaglyceroporin AQP1 gene in antimony resistant Leishmania (Viannia guyanensis.

    Directory of Open Access Journals (Sweden)

    Rubens Monte-Neto

    2015-02-01

    Full Text Available Antimony resistance complicates the treatment of infections caused by the parasite Leishmania.Using next generation sequencing, we sequenced the genome of four independent Leishmania guyanensis antimony-resistant (SbR mutants and found different chromosomal alterations including aneuploidy, intrachromosomal gene amplification and gene deletion. A segment covering 30 genes on chromosome 19 was amplified intrachromosomally in three of the four mutants. The gene coding for the multidrug resistance associated protein A involved in antimony resistance was also amplified in the four mutants, most likely through chromosomal translocation. All mutants also displayed a reduced accumulation of antimony mainly due to genomic alterations at the level of the subtelomeric region of chromosome 31 harboring the gene coding for the aquaglyceroporin 1 (LgAQP1. Resistance involved the loss of LgAQP1 through subtelomeric deletions in three mutants. Interestingly, the fourth mutant harbored a single G133D point mutation in LgAQP1 whose role in resistance was functionality confirmed through drug sensitivity and antimony accumulation assays. In contrast to the Leishmania subspecies that resort to extrachromosomal amplification, the Viannia strains studied here used intrachromosomal amplification and locus deletion.This is the first report of a naturally occurred point mutation in AQP1 in antimony resistant parasites.

  18. High prevalence of the PER-1 gene among carbapenem-resistant Acinetobacter baumannii in Riyadh, Saudi Arabia.

    Science.gov (United States)

    Aly, M M; Abu Alsoud, N M; Elrobh, M S; Al Johani, S M; Balkhy, H H

    2016-11-01

    The prevalence of carbapenem-resistant Acinetobacter baumannii in Saudi Arabia and their resistance genetic mechanisms are yet to be identified. We studied the prevalence and genetic diversity of extended-spectrum beta-lactamase genes, particularly the PER-1 gene, among carbapenem-resistant A. baumannii strains from patients at a tertiary care hospital in Riyadh, Saudi Arabia between 2006 and 2014. Fresh subcultured samples were tested for antimicrobial susceptibility minimum inhibitory concentration (MIC). Total genomic DNA was extracted from each isolate and further used for polymerase chain reaction (PCR) genotyping, sequence-based typing (SBT) of PER-1 and OXA-51-like gene, and multilocus sequence typing (MLST) of positive isolates. Randomly selected clinical isolates (n = 100) were subjected to MLST. A total of 503 isolates were characterized as multidrug-resistant (MDR) using the MIC. Isolates were further PCR tested for bla -TEM and bla -PER-1 resistance genes (n = 503). The genotyping results showed that 68/503 (14 %) isolates were positive to bla TEM. The genotyping results of PER-1-like genes showed that 384/503 (76.3 %) were positive among MDR Acinetobacter isolates. Based on SBT, the majority of these isolates were clustered into three main groups including isolates harboring PER-1: AB11 (bla -PER-1 ), isolate AB16 (bla -PER-1 ), and, finally, the plasmid pAB154 (bla -PER-7 ). Remarkably, many isolates were concealing the PER-1 gene and harboring the TEM resistance genes as well. MLST results for selected isolates (n = 100) identified four main sequence types (STs: 2, 19, 20, and 25) and four novel isolates (ST 486-489). We report 76.3 % prevalence of the PER-1 resistance gene among Acinetobacter clinical isolates from Riyadh, Saudi Arabia. Further work is needed to explore the clinical risks and patient outcome with such resistance related to healthcare-associated infections and investigate the genetic and molecular mechanisms that confer the MDR

  19. Mutation spectrum of genes associated with steroid-resistant nephrotic syndrome in Chinese children.

    Science.gov (United States)

    Wang, Ying; Dang, Xiqiang; He, Qingnan; Zhen, Yan; He, Xiaoxie; Yi, Zhuwen; Zhu, Kuichun

    2017-08-20

    Approximately 20% of children with idiopathic nephrotic syndrome do not respond to steroid therapy. More than 30 genes have been identified as disease-causing genes for the steroid-resistant nephrotic syndrome (SRNS). Few reports were from the Chinese population. The coding regions of genes commonly associated with SRNS were analyzed to characterize the gene mutation spectrum in children with SRNS in central China. The first phase study involved 38 children with five genes (NPHS1, NPHS2, PLCE1, WT1, and TRPC6) by Sanger sequencing. The second phase study involved 33 children with 17 genes by next generation DNA sequencing (NGS. 22 new patients, and 11 patients from first phase study but without positive findings). Overall deleterious or putatively deleterious gene variants were identified in 19 patients (31.7%), including four NPHS1 variants among five patients and three PLCE1 variants among four other patients. Variants in COL4A3, COL4A4, or COL4A5 were found in six patients. Eight novel variants were identified, including two in NPHS1, two in PLCE1, one in NPHS2, LAMB2, COL4A3, and COL4A4, respectively. 55.6% of the children with variants failed to respond to immunosuppressive agent therapy, while the resistance rate in children without variants was 44.4%. Our results show that screening for deleterious variants in some common genes in children clinically suspected with SRNS might be helpful for disease diagnosis as well as prediction of treatment efficacy and prognosis. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Genome Wide Analysis of Nucleotide-Binding Site Disease Resistance Genes in Brachypodium distachyon

    Directory of Open Access Journals (Sweden)

    Shenglong Tan

    2012-01-01

    Full Text Available Nucleotide-binding site (NBS disease resistance genes play an important role in defending plants from a variety of pathogens and insect pests. Many R-genes have been identified in various plant species. However, little is known about the NBS-encoding genes in Brachypodium distachyon. In this study, using computational analysis of the B. distachyon genome, we identified 126 regular NBS-encoding genes and characterized them on the bases of structural diversity, conserved protein motifs, chromosomal locations, gene duplications, promoter region, and phylogenetic relationships. EST hits and full-length cDNA sequences (from Brachypodium database of 126 R-like candidates supported their existence. Based on the occurrence of conserved protein motifs such as coiled-coil (CC, NBS, leucine-rich repeat (LRR, these regular NBS-LRR genes were classified into four subgroups: CC-NBS-LRR, NBS-LRR, CC-NBS, and X-NBS. Further expression analysis of the regular NBS-encoding genes in Brachypodium database revealed that these genes are expressed in a wide range of libraries, including those constructed from various developmental stages, tissue types, and drought challenged or nonchallenged tissue.

  1. Localization of the Laevigatum powdery mildew resistance gene to barley chromosome 2 by the use of RFLP markers

    DEFF Research Database (Denmark)

    Giese, H.; Holm-Jensen, A.G.; Jensen, H.P.

    1993-01-01

    The powdery mildew disease resistance gene Ml(La) was found to belong to a locus on barely chromosome 2. We suggest that this locus be designated MlLa. Linkage analysis was carried out on 72 chromosome-doubled, spring-type progeny lines from a cross between the winter var 'Vogelsanger Gold' and t......' and the spring var 'Alf'. A map of chromosome 2 spanning 119 cM and flanked by two peroxidase gene loci was constructed. In addition to the Laevigatum resistance locus the map includes nine RFLP markers, the two peroxidase gene loci and the six-row locus in barley....

  2. Ex Vivo Activity of Endoperoxide Antimalarials, Including Artemisone and Arterolane, against Multidrug-Resistant Plasmodium falciparum Isolates from Cambodia

    Science.gov (United States)

    2014-10-01

    OCT 2014 2. REPORT TYPE N/A 3. DATES COVERED - 4. TITLE AND SUBTITLE Ex Vivo Activity of Endoperoxide Antimalarials , Including Artemisone...Prescribed by ANSI Std Z39-18 Ex Vivo Activity of Endoperoxide Antimalarials , Including Artemisone and Arterolane, against Multidrug-Resistant...potent antimalarial activity (2, 3). Despite having a rapid mecha- nism of action, artemisinin resistance eventually emerged and was first detected

  3. Isolation and identification of antibiotic resistance genes in Staphylococcus aureus isolates from respiratory system infections in shahrekord, Iran

    Directory of Open Access Journals (Sweden)

    Maryam Reisi

    2014-07-01

    Full Text Available   Introduction : Staphylococcus aureus is considered as one of pathogenic agents in humans, that engages different body parts including respiratory system and causes to spend lots of costs and extending patient’s treatment period. This study which is performed to separate and investigate the pattern of antibiotic resistance in Staphylococcus aureus isolates from upper respiratory system infections in Shahrekord.   Materials and methods: This study was done by sectional-descriptive method On 200 suspicious persons to the upper respiratory system infections who were referred to the Imam Ali clinic in Shahrekord in 2012. After isolation of Staphylococcus aureus from cultured nose discharges, antibiotic resistance genes were identified by polymerase chain reaction (PCR by using defined primer pairs .   Results : Among 200 investigated samples in 60 cases (30% Staphylococcus aureus infection (by culturing and PCR method was determined. Isolates showed the lowest amount of antibiotic resistance to vancomycin (0.5% and the highest amount of resistance to the penicillin G and cefotaxime (100%. mecA gene (encoding methicillin resistance with frequency of 85.18% and aacA-D gene (encoding resistance to aminoglycosides with frequency of 28.33% showed the highest and lowest frequency of antibiotic resistance genes coding in Staphylococcus aureus isolates respectively .   Discussion and conclusion : Notable prevalence of resistant Staphylococcus aureus isolates in community acquired respiratory infections, recommend continuous control necessity to impede the spreading of these bacteria and their infections.  

  4. Identification of antibiotic resistance genes in the multidrug-resistant Acinetobacter baumannii strain, MDR-SHH02, using whole-genome sequencing.

    Science.gov (United States)

    Wang, Hualiang; Wang, Jinghua; Yu, Peijuan; Ge, Ping; Jiang, Yanqun; Xu, Rong; Chen, Rong; Liu, Xuejie

    2017-02-01

    This study aimed to investigate antibiotic resistance genes in the multidrug-resistant (MDR) Acinetobacter baumannii (A. baumanii) strain, MDR-SHH02, using whole‑genome sequencing (WGS). The antibiotic resistance of MDR-SHH02 isolated from a patient with breast cancer to 19 types of antibiotics was determined using the Kirby‑Bauer method. WGS of MDR-SHH02 was then performed. Following quality control and transcriptome assembly, functional annotation of genes was conducted, and the phylogenetic tree of MDR-SHH02, along with another 5 A. baumanii species and 2 Acinetobacter species, was constructed using PHYLIP 3.695 and FigTree v1.4.2. Furthermore, pathogenicity islands (PAIs) were predicted by the pathogenicity island database. Potential antibiotic resistance genes in MDR-SHH02 were predicted based on the information in the Antibiotic Resistance Genes Database (ARDB). MDR-SHH02 was found to be resistant to all of the tested antibiotics. The total draft genome length of MDR-SHH02 was 4,003,808 bp. There were 74.25% of coding sequences to be annotated into 21 of the Clusters of Orthologous Groups (COGs) of protein terms, such as 'transcription' and 'amino acid transport and metabolism'. Furthermore, there were 45 PAIs homologous to the sequence MDRSHH02000806. Additionally, a total of 12 gene sequences in MDR-SHH02 were highly similar to the sequences of antibiotic resistance genes in ARDB, including genes encoding aminoglycoside‑modifying enzymes [e.g., aac(3)-Ia, ant(2'')‑Ia, aph33ib and aph(3')-Ia], β-lactamase genes (bl2b_tem and bl2b_tem1), sulfonamide-resistant dihydropteroate synthase genes (sul1 and sul2), catb3 and tetb. These results suggest that numerous genes mediate resistance to various antibiotics in MDR-SHH02, and provide a clinical guidance for the personalized therapy of A. baumannii-infected patients.

  5. Clusters of Antibiotic Resistance Genes Enriched Together Stay Together in Swine Agriculture.

    Science.gov (United States)

    Johnson, Timothy A; Stedtfeld, Robert D; Wang, Qiong; Cole, James R; Hashsham, Syed A; Looft, Torey; Zhu, Yong-Guan; Tiedje, James M

    2016-04-12

    Antibiotic resistance is a worldwide health risk, but the influence of animal agriculture on the genetic context and enrichment of individual antibiotic resistance alleles remains unclear. Using quantitative PCR followed by amplicon sequencing, we quantified and sequenced 44 genes related to antibiotic resistance, mobile genetic elements, and bacterial phylogeny in microbiomes from U.S. laboratory swine and from swine farms from three Chinese regions. We identified highly abundant resistance clusters: groups of resistance and mobile genetic element alleles that cooccur. For example, the abundance of genes conferring resistance to six classes of antibiotics together with class 1 integrase and the abundance of IS6100-type transposons in three Chinese regions are directly correlated. These resistance cluster genes likely colocalize in microbial genomes in the farms. Resistance cluster alleles were dramatically enriched (up to 1 to 10% as abundant as 16S rRNA) and indicate that multidrug-resistant bacteria are likely the norm rather than an exception in these communities. This enrichment largely occurred independently of phylogenetic composition; thus, resistance clusters are likely present in many bacterial taxa. Furthermore, resistance clusters contain resistance genes that confer resistance to antibiotics independently of their particular use on the farms. Selection for these clusters is likely due to the use of only a subset of the broad range of chemicals to which the clusters confer resistance. The scale of animal agriculture and its wastes, the enrichment and horizontal gene transfer potential of the clusters, and the vicinity of large human populations suggest that managing this resistance reservoir is important for minimizing human risk. Agricultural antibiotic use results in clusters of cooccurring resistance genes that together confer resistance to multiple antibiotics. The use of a single antibiotic could select for an entire suite of resistance genes if

  6. Detection of antibiotic resistance and tetracycline resistance genes in Enterobacteriaceae isolated from the Pearl rivers in South China

    International Nuclear Information System (INIS)

    Tao Ran; Ying Guangguo; Su Haochang; Zhou Hongwei; Sidhu, Jatinder P.S.

    2010-01-01

    This study investigated antibiotic resistance profiles and tetracycline resistance genes in Enterobacteriaceae family isolates from the Pearl rivers. The Enterobacteriaceae isolates were tested for susceptibility to seven antibiotics ampicillin, chloramphenicol, ciprofloxacin, levofloxacin, sulphamethoxazole/trimethoprim, tetracycline and trimethoprim. In Liuxi reservoir, with an exception to ampicillin resistant strains (11%) no other antibiotic resistance bacterial strains were detected. However, multiple drug resistance in bacterial isolates from the other sites of Pearl rivers was observed which is possibly due to sewage discharge and input from other anthropogenic sources along the rivers. Four tetracycline resistance genes tet A, tet B, tet C and tet D were detected in the isolates from the rivers. The genes tet A and tet B were widely detected with the detection frequencies of 43% and 40% respectively. Ciprofloxacin and levofloxacin resistant enteric bacteria were also isolated from the pig and duck manures which suggest a wider distribution of human specific drugs in the environment. This investigation provided a baseline data on antibiotic resistance profiles and tetracycline resistance genes in the Pearl rivers delta. - High rates of antibiotic resistance in Enterobacteriaceae from river water are attributed to wastewater contamination.

  7. Detection of antibiotic resistance and tetracycline resistance genes in Enterobacteriaceae isolated from the Pearl rivers in South China

    Energy Technology Data Exchange (ETDEWEB)

    Tao Ran [State Key Laboratory of Organic Geochemistry, Guangzhou Institute of Geochemistry, Chinese Academy of Sciences, 511 Kehua Street, Tianhe District, Guangzhou 510640 (China); Ying Guangguo, E-mail: guangguo.ying@gmail.co [State Key Laboratory of Organic Geochemistry, Guangzhou Institute of Geochemistry, Chinese Academy of Sciences, 511 Kehua Street, Tianhe District, Guangzhou 510640 (China); Su Haochang [State Key Laboratory of Organic Geochemistry, Guangzhou Institute of Geochemistry, Chinese Academy of Sciences, 511 Kehua Street, Tianhe District, Guangzhou 510640 (China); Zhou Hongwei [Department of Environmental Health, School of Public Health and Tropical Medicine, Southern Medical University, 1838 North Guangzhou Street, Baiyun District, Guangzhou 510515 (China); Sidhu, Jatinder P.S. [CSIRO Land and Water, Queensland Bioscience Precinct, 306 Carmody Road, St Lucia QLD 4067 (Australia)

    2010-06-15

    This study investigated antibiotic resistance profiles and tetracycline resistance genes in Enterobacteriaceae family isolates from the Pearl rivers. The Enterobacteriaceae isolates were tested for susceptibility to seven antibiotics ampicillin, chloramphenicol, ciprofloxacin, levofloxacin, sulphamethoxazole/trimethoprim, tetracycline and trimethoprim. In Liuxi reservoir, with an exception to ampicillin resistant strains (11%) no other antibiotic resistance bacterial strains were detected. However, multiple drug resistance in bacterial isolates from the other sites of Pearl rivers was observed which is possibly due to sewage discharge and input from other anthropogenic sources along the rivers. Four tetracycline resistance genes tet A, tet B, tet C and tet D were detected in the isolates from the rivers. The genes tet A and tet B were widely detected with the detection frequencies of 43% and 40% respectively. Ciprofloxacin and levofloxacin resistant enteric bacteria were also isolated from the pig and duck manures which suggest a wider distribution of human specific drugs in the environment. This investigation provided a baseline data on antibiotic resistance profiles and tetracycline resistance genes in the Pearl rivers delta. - High rates of antibiotic resistance in Enterobacteriaceae from river water are attributed to wastewater contamination.

  8. Strategy of gene silencing in cassava for validation of resistance genes

    International Nuclear Information System (INIS)

    Cortes, Simon; Lopez, Camilo

    2010-01-01

    Cassava (Manihot esculenta) is a major source of food for more than 1000 million people in the world and constitutes an important staple crop. Cassava bacterial blight, caused by the gram negative bacterium Xanthomonas axonopodis pv. manihotis, is one of the most important constraints for this crop. A candidate resistance gene against cassava bacterial blight, named RXam1, has been identified previously. In this work, we employed the gene silencing approach using the African cassava mosaic virus (ACMV) to validate the function of the RXam1 gene. We used as positive control the su gen, which produce photo blanching in leaves when is silenced. Plants from the SG10735 variety were bombardment with the ACMV-A-SU+ACMV-B y ACMV-A-RXam1+ACMV-B constructions. The silencing efficiency employing the su gene was low, only one of seven plants showed photo blanching. In the putative silenced plants for the RXam1 gene, no presence of siRNAs corresponding to RXam1 was observed; although a low diminution of the RXam1 gene expression was obtained. The growth curves for the Xam strain CIO136 in cassava plants inoculated showing a little but no significance difference in the susceptibility in the silenced plants compared to not silenced

  9. De novo mutations in synaptic transmission genes including DNM1 cause epileptic encephalopathies

    DEFF Research Database (Denmark)

    2014-01-01

    in five individuals and de novo mutations in GABBR2, FASN, and RYR3 in two individuals each. Unlike previous studies, this cohort is sufficiently large to show a significant excess of de novo mutations in epileptic encephalopathy probands compared to the general population using a likelihood analysis (p...... = 8.2 × 10(-4)), supporting a prominent role for de novo mutations in epileptic encephalopathies. We bring statistical evidence that mutations in DNM1 cause epileptic encephalopathy, find suggestive evidence for a role of three additional genes, and show that at least 12% of analyzed individuals have...... analyzed exome-sequencing data of 356 trios with the "classical" epileptic encephalopathies, infantile spasms and Lennox Gastaut syndrome, including 264 trios previously analyzed by the Epi4K/EPGP consortium. In this expanded cohort, we find 429 de novo mutations, including de novo mutations in DNM1...

  10. Functional screen for genes responsible for tamoxifen resistance in human breast cancer cells

    NARCIS (Netherlands)

    Meijer, Danielle; van Agthoven, Ton; Bosma, Peter T.; Nooter, Kees; Dorssers, Lambert C. J.

    2006-01-01

    Antiestrogens, such as tamoxifen, are widely used for endocrine treatment of estrogen receptor-positive breast cancer. However, as breast cancer progresses, development of tamoxifen resistance is inevitable. The mechanisms underlying this resistance are not well understood. To identify genes

  11. Advances in the theory and application of BSF cells. [including electrical resistivity and photovoltaic cells

    Science.gov (United States)

    Mandelkorn, J.; Lamneck, J. H.

    1975-01-01

    The characteristics and behavior of p(+), p solar cells were investigated. The p(+), p cells were made by the removal of the n(+) surface layers from n(+), p p(+), BSF cells followed by application of a suitable contact to the resultant p(+), p structures. The open circuit voltage of p(+), p cells was found to increase with increasing 'p' bulk resistivity. The measured open circuit velocity-temperature coefficients were positive and increased with increasing resistivity. An outline of prior limitations in solar cell design is presented, and the removal of these limitations through use of BSF effects is pointed out. The study of BSF effects made feasible production of very thin high efficiency silicon cells as well as high resistivity-high efficiency cells, two desirable types of silicon cells which were previously impossible to make.

  12. Current Status and Challenges in Identifying Disease Resistance Genes in Brassica napus

    Science.gov (United States)

    Neik, Ting Xiang; Barbetti, Martin J.; Batley, Jacqueline

    2017-01-01

    Brassica napus is an economically important crop across different continents including temperate and subtropical regions in Europe, Canada, South Asia, China and Australia. Its widespread cultivation also brings setbacks as it plays host to fungal, oomycete and chytrid pathogens that can lead to serious yield loss. For sustainable crop production, identification of resistance (R) genes in B. napus has become of critical importance. In this review, we discuss four key pathogens affecting Brassica crops: Clubroot (Plasmodiophora brassicae), Blackleg (Leptosphaeria maculans and L. biglobosa), Sclerotinia Stem Rot (Sclerotinia sclerotiorum), and Downy Mildew (Hyaloperonospora parasitica). We first review current studies covering prevalence of these pathogens on Brassica crops and highlight the R genes and QTL that have been identified from Brassica species against these pathogens. Insights into the relationships between the pathogen and its Brassica host, the unique host resistance mechanisms and how these affect resistance outcomes is also presented. We discuss challenges in identification and deployment of R genes in B. napus in relation to highly specific genetic interactions between host subpopulations and pathogen pathotypes and emphasize the need for common or shared techniques and research materials or tighter collaboration between researchers to reconcile the inconsistencies in the research outcomes. Using current genomics tools, we provide examples of how characterization and cloning of R genes in B. napus can be carried out more effectively. Lastly, we put forward strategies to breed resistant cultivars through introgressions supported by genomic approaches and suggest prospects that can be implemented in the future for a better, pathogen-resistant B. napus. PMID:29163558

  13. Current Status and Challenges in Identifying Disease Resistance Genes in Brassica napus

    Directory of Open Access Journals (Sweden)

    Ting Xiang Neik

    2017-11-01

    Full Text Available Brassica napus is an economically important crop across different continents including temperate and subtropical regions in Europe, Canada, South Asia, China and Australia. Its widespread cultivation also brings setbacks as it plays host to fungal, oomycete and chytrid pathogens that can lead to serious yield loss. For sustainable crop production, identification of resistance (R genes in B. napus has become of critical importance. In this review, we discuss four key pathogens affecting Brassica crops: Clubroot (Plasmodiophora brassicae, Blackleg (Leptosphaeria maculans and L. biglobosa, Sclerotinia Stem Rot (Sclerotinia sclerotiorum, and Downy Mildew (Hyaloperonospora parasitica. We first review current studies covering prevalence of these pathogens on Brassica crops and highlight the R genes and QTL that have been identified from Brassica species against these pathogens. Insights into the relationships between the pathogen and its Brassica host, the unique host resistance mechanisms and how these affect resistance outcomes is also presented. We discuss challenges in identification and deployment of R genes in B. napus in relation to highly specific genetic interactions between host subpopulations and pathogen pathotypes and emphasize the need for common or shared techniques and research materials or tighter collaboration between researchers to reconcile the inconsistencies in the research outcomes. Using current genomics tools, we provide examples of how characterization and cloning of R genes in B. napus can be carried out more effectively. Lastly, we put forward strategies to breed resistant cultivars through introgressions supported by genomic approaches and suggest prospects that can be implemented in the future for a better, pathogen-resistant B. napus.

  14. Improvement of Scratch and Wear Resistance of Polymers by Fillers Including Nanofillers

    Directory of Open Access Journals (Sweden)

    Witold Brostow

    2017-03-01

    Full Text Available Polymers have lower resistance to scratching and wear than metals. Liquid lubricants work well for metals but not for polymers nor for polymer-based composites (PBCs. We review approaches for improvement of tribological properties of polymers based on inclusion of fillers. The fillers can be metallic or ceramic—with obvious consequences for electrical resistivity of the composites. Distinctions between effectiveness of micro- versus nano-particles are analyzed. For example, aluminum nanoparticles as filler are more effective for property improvement than microparticles at the same overall volumetric concentration. Prevention of local agglomeration of filler particles is discussed along with a technique to verify the prevention.

  15. A maize resistance gene functions against bacterial streak disease in rice

    OpenAIRE

    Zhao, Bingyu; Lin, Xinghua; Poland, Jesse; Trick, Harold; Leach, Jan; Hulbert, Scot

    2005-01-01

    Although cereal crops all belong to the grass family (Poacea), most of their diseases are specific to a particular species. Thus, a given cereal species is typically resistant to diseases of other grasses, and this nonhost resistance is generally stable. To determine the feasibility of transferring nonhost resistance genes (R genes) between distantly related grasses to control specific diseases, we identified a maize R gene that recognizes a rice pathogen, Xanthomonas oryzae pv. oryzicola, wh...

  16. Bioaerosol emissions and detection of airborne antibiotic resistance genes from a wastewater treatment plant

    Science.gov (United States)

    Li, Jing; Zhou, Liantong; Zhang, Xiangyu; Xu, Caijia; Dong, Liming; Yao, Maosheng

    2016-01-01

    Air samples from twelve sampling sites (including seven intra-plant sites, one upwind site and four downwind sites) from a wastewater treatment plant (WWTP) in Beijing were collected using a Reuter Centrifugal Sampler High Flow (RCS); and their microbial fractions were studied using culturing and high throughput gene sequence. In addition, the viable (fluorescent) bioaerosol concentrations for 7 intra-plant sites were also monitored for 30 min each using an ultraviolet aerodynamic particle sizer (UV-APS). Both air and water samples collected from the plant were investigated for possible bacterial antibiotic resistance genes and integrons using polymerase chain reaction (PCR) coupled with gel electrophoresis. The results showed that the air near sludge thickening basin was detected to have the highest level of culturable bacterial aerosols (up to 1697 CFU/m3) and fungal aerosols (up to 930 CFU/m3). For most sampling sites, fluorescent peaks were observed at around 3-4 μm, except the office building with a peak at 1.5 μm, with a number concentration level up to 1233-6533 Particles/m3. About 300 unique bacterial species, including human opportunistic pathogens, such as Comamonas Testosteroni and Moraxella Osloensis, were detected from the air samples collected over the biological reaction basin. In addition, we have detected the sul2 gene resistant to cotrimoxazole (also known as septra, bactrim and TMP-SMX) and class 1 integrase gene from the air samples collected from the screen room and the biological reaction basin. Overall, the screen room, sludge thickening basin and biological reaction basin imposed significant microbial exposure risks, including those from airborne antibiotic resistance genes.

  17. Coral thermal tolerance: tuning gene expression to resist thermal stress.

    Directory of Open Access Journals (Sweden)

    Anthony J Bellantuono

    Full Text Available The acclimatization capacity of corals is a critical consideration in the persistence of coral reefs under stresses imposed by global climate change. The stress history of corals plays a role in subsequent response to heat stress, but the transcriptomic changes associated with these plastic changes have not been previously explored. In order to identify host transcriptomic changes associated with acquired thermal tolerance in the scleractinian coral Acropora millepora, corals preconditioned to a sub-lethal temperature of 3°C below bleaching threshold temperature were compared to both non-preconditioned corals and untreated controls using a cDNA microarray platform. After eight days of hyperthermal challenge, conditions under which non-preconditioned corals bleached and preconditioned corals (thermal-tolerant maintained Symbiodinium density, a clear differentiation in the transcriptional profiles was revealed among the condition examined. Among these changes, nine differentially expressed genes separated preconditioned corals from non-preconditioned corals, with 42 genes differentially expressed between control and preconditioned treatments, and 70 genes between non-preconditioned corals and controls. Differentially expressed genes included components of an apoptotic signaling cascade, which suggest the inhibition of apoptosis in preconditioned corals. Additionally, lectins and genes involved in response to oxidative stress were also detected. One dominant pattern was the apparent tuning of gene expression observed between preconditioned and non-preconditioned treatments; that is, differences in expression magnitude were more apparent than differences in the identity of genes differentially expressed. Our work revealed a transcriptomic signature underlying the tolerance associated with coral thermal history, and suggests that understanding the molecular mechanisms behind physiological acclimatization would be critical for the modeling of reefs

  18. Comparative genomic and transcriptomic analysis of selected fatty acid biosynthesis genes and CNL disease resistance genes in oil palm

    Science.gov (United States)

    Rosli, Rozana; Amiruddin, Nadzirah; Ab Halim, Mohd Amin; Chan, Pek-Lan; Chan, Kuang-Lim; Azizi, Norazah; Morris, Priscilla E.; Leslie Low, Eng-Ti; Ong-Abdullah, Meilina; Sambanthamurthi, Ravigadevi; Singh, Rajinder

    2018-01-01

    Comparative genomics and transcriptomic analyses were performed on two agronomically important groups of genes from oil palm versus other major crop species and the model organism, Arabidopsis thaliana. The first analysis was of two gene families with key roles in regulation of oil quality and in particular the accumulation of oleic acid, namely stearoyl ACP desaturases (SAD) and acyl-acyl carrier protein (ACP) thioesterases (FAT). In both cases, these were found to be large gene families with complex expression profiles across a wide range of tissue types and developmental stages. The detailed classification of the oil palm SAD and FAT genes has enabled the updating of the latest version of the oil palm gene model. The second analysis focused on disease resistance (R) genes in order to elucidate possible candidates for breeding of pathogen tolerance/resistance. Ortholog analysis showed that 141 out of the 210 putative oil palm R genes had homologs in banana and rice. These genes formed 37 clusters with 634 orthologous genes. Classification of the 141 oil palm R genes showed that the genes belong to the Kinase (7), CNL (95), MLO-like (8), RLK (3) and Others (28) categories. The CNL R genes formed eight clusters. Expression data for selected R genes also identified potential candidates for breeding of disease resistance traits. Furthermore, these findings can provide information about the species evolution as well as the identification of agronomically important genes in oil palm and other major crops. PMID:29672525

  19. Comparative genomic and transcriptomic analysis of selected fatty acid biosynthesis genes and CNL disease resistance genes in oil palm.

    Science.gov (United States)

    Rosli, Rozana; Amiruddin, Nadzirah; Ab Halim, Mohd Amin; Chan, Pek-Lan; Chan, Kuang-Lim; Azizi, Norazah; Morris, Priscilla E; Leslie Low, Eng-Ti; Ong-Abdullah, Meilina; Sambanthamurthi, Ravigadevi; Singh, Rajinder; Murphy, Denis J

    2018-01-01

    Comparative genomics and transcriptomic analyses were performed on two agronomically important groups of genes from oil palm versus other major crop species and the model organism, Arabidopsis thaliana. The first analysis was of two gene families with key roles in regulation of oil quality and in particular the accumulation of oleic acid, namely stearoyl ACP desaturases (SAD) and acyl-acyl carrier protein (ACP) thioesterases (FAT). In both cases, these were found to be large gene families with complex expression profiles across a wide range of tissue types and developmental stages. The detailed classification of the oil palm SAD and FAT genes has enabled the updating of the latest version of the oil palm gene model. The second analysis focused on disease resistance (R) genes in order to elucidate possible candidates for breeding of pathogen tolerance/resistance. Ortholog analysis showed that 141 out of the 210 putative oil palm R genes had homologs in banana and rice. These genes formed 37 clusters with 634 orthologous genes. Classification of the 141 oil palm R genes showed that the genes belong to the Kinase (7), CNL (95), MLO-like (8), RLK (3) and Others (28) categories. The CNL R genes formed eight clusters. Expression data for selected R genes also identified potential candidates for breeding of disease resistance traits. Furthermore, these findings can provide information about the species evolution as well as the identification of agronomically important genes in oil palm and other major crops.

  20. Antimicrobial-Resistant Bacterial Populations and Antimicrobial Resistance Genes Obtained from Environments Impacted by Livestock and Municipal Waste.

    Directory of Open Access Journals (Sweden)

    Getahun E Agga

    Full Text Available This study compared the populations of antimicrobial-resistant bacteria and the repertoire of antimicrobial resistance genes in four environments: effluent of three municipal wastewater treatment facilities, three cattle feedlot runoff catchment ponds, three swine waste lagoons, and two "low impact" environments (an urban lake and a relict prairie. Multiple liquid and solid samples were collected from each environment. The prevalences and concentrations of antimicrobial-resistant (AMR Gram-negative (Escherichia coli and Salmonella enterica and Gram-positive (enterococci bacteria were determined from individual samples (n = 174. The prevalences of 84 antimicrobial resistance genes in metagenomic DNA isolated from samples pooled (n = 44 by collection date, location, and sample type were determined. The prevalences and concentrations of AMR E. coli and Salmonella were similar among the livestock and municipal sample sources. The levels of erythromycin-resistant enterococci were significantly higher in liquid samples from cattle catchment ponds and swine waste lagoons than in liquid samples from municipal wastewater treatment facilities, but solid samples from these environments did not differ significantly. Similarly, trimethoprim/sulfamethoxazole-resistant E. coli concentrations were significantly higher in swine liquid than in municipal liquid samples, but there was no difference in solid samples. Multivariate analysis of the distribution of antimicrobial resistance genes using principal coordinate analysis showed distinct clustering of samples with livestock (cattle and swine, low impact environment and municipal samples forming three separate clusters. The numbers of class A beta-lactamase, class C beta-lactamase, and fluoroquinolone resistance genes detected were significantly higher (P < 0.05 in municipal samples than in cattle runoff or swine lagoon samples. In conclusion, we report that AMR is a very widespread phenomenon and that similar

  1. Thioridazine affects transcription of genes involved in cell wall biosynthesis in methicillin-resistant Staphylococcus aureus

    DEFF Research Database (Denmark)

    Bonde, Mette; Højland, Dorte Heidi; Kolmos, Hans Jørn

    2011-01-01

    have previously shown that the expression of some resistance genes is abolished after treatment with thioridazine and oxacillin. To further understand the mechanism underlying the reversal of resistance, we tested the expression of genes involved in antibiotic resistance and cell wall biosynthesis...... in response to thioridazine in combination with oxacillin. We observed that the oxacillin-induced expression of genes belonging to the VraSR regulon is reduced by the addition of thioridazine. The exclusion of such key factors involved in cell wall biosynthesis will most likely lead to a weakened cell wall...... reversal of resistance by thioridazine relies on decreased expression of specific genes involved in cell wall biosynthesis....

  2. Candidate genes for cross-resistance against DNA-damaging drugs

    DEFF Research Database (Denmark)

    Wittig, Rainer; Nessling, Michelle; Will, Rainer D

    2002-01-01

    Drug resistance of tumor cells leads to major drawbacks in the treatment of cancer. To identify candidate genes for drug resistance, we compared the expression patterns of the drug-sensitive human malignant melanoma cell line MeWo and three derived sublines with acquired resistance to the DNA...... as several apoptosis-related genes, in particular STK17A and CRYAB. As MPP1 and CRYAB are also among the 14 genes differentially expressed in all three of the drug-resistant sublines, they represent the strongest candidates for resistance against DNA-damaging drugs....

  3. Microarray Analysis in a Cell Death Resistant Glioma Cell Line to Identify Signaling Pathways and Novel Genes Controlling Resistance and Malignancy

    Energy Technology Data Exchange (ETDEWEB)

    Seznec, Janina; Naumann, Ulrike, E-mail: ulrike.naumann@uni-tuebingen.de [Laboratory of Molecular Neuro-Oncology, Department of General Neurology, Hertie-Institute for Clinical Brain Research and Center Neurology, University of Tuebingen, Otfried-Mueller-Str. 27, Tuebingen 72076 (Germany)

    2011-06-27

    Glioblastoma multiforme (GBM) is a lethal type of cancer mainly resistant to radio- and chemotherapy. Since the tumor suppressor p53 functions as a transcription factor regulating the expression of genes involved in growth inhibition, DNA repair and apoptosis, we previously assessed whether specific differences in the modulation of gene expression are responsible for the anti-tumor properties of a dominant positive p53, chimeric tumor suppressor (CTS)-1. CTS-1 is based on the sequence of p53 and designed to resist various mechanisms of inactivation which limit the activity of p53. To identify CTS-1-regulated cell death-inducing genes, we generated a CTS-1-resistant glioma cell line (229R). We used Affymetrix whole-genome microarray expression analysis to analyze alterations in gene expression and identified a variety of CTS-1 regulated genes involved in cancer-linked processes. 313 genes were differentially expressed in Adeno-CTS-1 (Ad-CTS-1)-infected and 700 genes in uninfected 229R cells compared to matching parental cells. Ingenuity Pathway Analysis (IPA) determined a variety of differentially expressed genes in Ad-CTS-1-infected cells that were members of the intracellular networks with central tumor-involved players such as nuclear factor kappa B (NF-κB), protein kinase B (PKB/AKT) or transforming growth factor beta (TGF-β). Differentially regulated genes include secreted factors as well as intracellular proteins and transcription factors regulating not only cell death, but also processes such as tumor cell motility and immunity. This work gives an overview of the pathways differentially regulated in the resistant versus parental glioma cells and might be helpful to identify candidate genes which could serve as targets to develop novel glioma specific therapy strategies.

  4. Microarray Analysis in a Cell Death Resistant Glioma Cell Line to Identify Signaling Pathways and Novel Genes Controlling Resistance and Malignancy

    International Nuclear Information System (INIS)

    Seznec, Janina; Naumann, Ulrike

    2011-01-01

    Glioblastoma multiforme (GBM) is a lethal type of cancer mainly resistant to radio- and chemotherapy. Since the tumor suppressor p53 functions as a transcription factor regulating the expression of genes involved in growth inhibition, DNA repair and apoptosis, we previously assessed whether specific differences in the modulation of gene expression are responsible for the anti-tumor properties of a dominant positive p53, chimeric tumor suppressor (CTS)-1. CTS-1 is based on the sequence of p53 and designed to resist various mechanisms of inactivation which limit the activity of p53. To identify CTS-1-regulated cell death-inducing genes, we generated a CTS-1-resistant glioma cell line (229R). We used Affymetrix whole-genome microarray expression analysis to analyze alterations in gene expression and identified a variety of CTS-1 regulated genes involved in cancer-linked processes. 313 genes were differentially expressed in Adeno-CTS-1 (Ad-CTS-1)-infected and 700 genes in uninfected 229R cells compared to matching parental cells. Ingenuity Pathway Analysis (IPA) determined a variety of differentially expressed genes in Ad-CTS-1-infected cells that were members of the intracellular networks with central tumor-involved players such as nuclear factor kappa B (NF-κB), protein kinase B (PKB/AKT) or transforming growth factor beta (TGF-β). Differentially regulated genes include secreted factors as well as intracellular proteins and transcription factors regulating not only cell death, but also processes such as tumor cell motility and immunity. This work gives an overview of the pathways differentially regulated in the resistant versus parental glioma cells and might be helpful to identify candidate genes which could serve as targets to develop novel glioma specific therapy strategies

  5. Gene Expression Profiling and Identification of Resistance Genes to Aspergillus flavus Infection in Peanut through EST and Microarray Strategies

    Directory of Open Access Journals (Sweden)

    Baozhu Guo

    2011-06-01

    Full Text Available Aspergillus flavus and A. parasiticus infect peanut seeds and produce aflatoxins, which are associated with various diseases in domestic animals and humans throughout the world. The most cost-effective strategy to minimize aflatoxin contamination involves the development of peanut cultivars that are resistant to fungal infection and/or aflatoxin production. To identify peanut Aspergillus-interactive and peanut Aspergillus-resistance genes, we carried out a large scale peanut Expressed Sequence Tag (EST project which we used to construct a peanut glass slide oligonucleotide microarray. The fabricated microarray represents over 40% of the protein coding genes in the peanut genome. For expression profiling, resistant and susceptible peanut cultivars were infected with a mixture of Aspergillus flavus and parasiticus spores. The subsequent microarray analysis identified 62 genes in resistant cultivars that were up-expressed in response to Aspergillus infection. In addition, we identified 22 putative Aspergillus-resistance genes that were constitutively up-expressed in the resistant cultivar in comparison to the susceptible cultivar. Some of these genes were homologous to peanut, corn, and soybean genes that were previously shown to confer resistance to fungal infection. This study is a first step towards a comprehensive genome-scale platform for developing Aspergillus-resistant peanut cultivars through targeted marker-assisted breeding and genetic engineering.

  6. Specific balance training included in an endurance-resistance exercise program improves postural balance in elderly patients undergoing haemodialysis.

    Science.gov (United States)

    Frih, Bechir; Mkacher, Wajdi; Jaafar, Hamdi; Frih, Ameur; Ben Salah, Zohra; El May, Mezry; Hammami, Mohamed

    2018-04-01

    The purpose of this study was to evaluate the effects of 6 months of specific balance training included in endurance-resistance program on postural balance in haemodialysis (HD) patients. Forty-nine male patients undergoing HD were randomly assigned to an intervention group (balance training included in an endurance-resistance training, n = 26) or a control group (resistance-endurance training only, n = 23). Postural control was assessed using six clinical tests; Timed Up and Go test, Tinetti Mobility Test, Berg Balance Scale, Unipodal Stance test, Mini-Balance Evaluation Systems Test and Activities Balance Confidence scale. All balance measures increased significantly after the period of rehabilitation training in the intervention group. Only the Timed Up and Go, Berg Balance Scale, Mini-Balance Evaluation Systems Test and Activities Balance Confidence scores were improved in the control group. The ranges of change in these tests were greater in the balance training group. In HD patients, specific balance training included in a usual endurance-resistance training program improves static and dynamic balance better than endurance-resistance training only. Implications for rehabilitation Rehabilitation using exercise in haemodialysis patients improved global mobility and functional abilities. Specific balance training included in usual endurance resistance training program could lead to improved static and dynamic balance.

  7. Molecular characterization of β-lactamase genes in clinical isolates of carbapenem-resistant Acinetobacter baumannii.

    Science.gov (United States)

    Raible, Kevin M; Sen, Bhaswati; Law, Nancy; Bias, Tiffany E; Emery, Christopher L; Ehrlich, Garth D; Joshi, Suresh G

    2017-11-16

    Acinetobacter baumannii is a nosocomial pathogen which is establishing as a major cause of morbidity and mortality within the healthcare community. The success of this pathogen is largely due to its ability to rapidly gain resistance to antimicrobial therapies and its capability to persist in an abiotic environment through the production of a biofilm. Our tertiary-care hospital has showed high incidence of carbapenem-resistant Acinetobacter baumannii (CRAB) isolates. In this study we explore both genotypic and phenotypic properties of 26 CRAB isolates: 16 isolates were collected from January 2010 to March 2011, and 10 were collected between February and May 2015. We determined that all 26 CRAB isolates possessed multiple β-lactamase genes, including genes from Groups A, C, and D. Specifically, 42% of the isolates possesses the potentially plasmid-borne genes of OXA-23-like or OXA-40-like β-lactamase. The presence of mobile gene element integron cassettes and/or integrases in 88% of the isolates suggests a possible mechanism of dissemination of antibiotic resistance genes. Additionally, the location of insertion sequence (IS) ISAba1 in promotor region of of the OXA-51-like, ADC-7, and ampC genes was confirmed. Multilocus sequence typing (MLST) demonstrated that all 26 CRAB isolates were either sequence type (ST)-229 or ST-2. Interestingly, ST-2 went from being the minority CRAB strain in the 2010-2011 isolates to the predominant strain in the 2015 isolates (from 32 to 90%). We show that the ST-2 strains have an enhanced ability to produce biofilms in comparison to the ST-229 strains, and this fact has potentially led to more successful colonization of the clinical environment over time. This study provides a longitudinal genetic and phenotypic survey of two CRAB sequence types, and suggests how their differing phenotypes may interact with the selective pressures of a hospital setting effecting strain dominance over a 5-year period.

  8. Identification of a New Antimicrobial Resistance Gene Provides Fresh Insights Into Pleuromutilin Resistance in Brachyspira hyodysenteriae, Aetiological Agent of Swine Dysentery

    Directory of Open Access Journals (Sweden)

    Roderick M. Card

    2018-06-01

    Full Text Available Brachyspira hyodysenteriae is the aetiological agent of swine dysentery, a globally distributed disease that causes profound economic loss, impedes the free trade and movement of animals, and has significant impact on pig health. Infection is generally treated with antibiotics of which pleuromutilins, such as tiamulin, are widely used for this purpose, but reports of resistance worldwide threaten continued effective control. In Brachyspira hyodysenteriae pleuromutilin resistance has been associated with mutations in chromosomal genes encoding ribosome-associated functions, however the dynamics of resistance acquisition are poorly understood, compromising stewardship efforts to preserve pleuromutilin effectiveness. In this study we undertook whole genome sequencing (WGS and phenotypic susceptibility testing of 34 UK field isolates and 3 control strains to investigate pleuromutilin resistance in Brachyspira hyodysenteriae. Genome-wide association studies identified a new pleuromutilin resistance gene, tva(A (tiamulin valnemulin antibiotic resistance, encoding a predicted ABC-F transporter. In vitro culture of isolates in the presence of inhibitory or sub-inhibitory concentrations of tiamulin showed that tva(A confers reduced pleuromutilin susceptibility that does not lead to clinical resistance but facilitates the development of higher-level resistance via mutations in genes encoding ribosome-associated functions. Genome sequencing of antibiotic-exposed isolates identified both new and previously described mutations in chromosomal genes associated with reduced pleuromutilin susceptibility, including the 23S rRNA gene and rplC, which encodes the L3 ribosomal protein. Interesting three antibiotic-exposed isolates harboured mutations in fusA, encoding Elongation Factor G, a gene not previously associated with pleuromutilin resistance. A longitudinal molecular epidemiological examination of two episodes of swine dysentery at the same farm indicated

  9. Antimicrobial resistance genes in marine bacteria and human uropathogenic Escherichia coli from a region of intensive aquaculture.

    Science.gov (United States)

    Tomova, Alexandra; Ivanova, Larisa; Buschmann, Alejandro H; Rioseco, Maria Luisa; Kalsi, Rajinder K; Godfrey, Henry P; Cabello, Felipe C

    2015-10-01

    Antimicrobials are heavily used in Chilean salmon aquaculture. We previously found significant differences in antimicrobial-resistant bacteria between sediments from an aquaculture and a non-aquaculture site. We now show that levels of antimicrobial resistance genes (ARG) are significantly higher in antimicrobial-selected marine bacteria than in unselected bacteria from these sites. While ARG in tetracycline- and florfenicol-selected bacteria from aquaculture and non-aquaculture sites were equally frequent, there were significantly more plasmid-mediated quinolone resistance genes per bacterium and significantly higher numbers of qnrB genes in quinolone-selected bacteria from the aquaculture site. Quinolone-resistant urinary Escherichia coli from patients in the Chilean aquacultural region were significantly enriched for qnrB (including a novel qnrB gene), qnrS, qnrA and aac(6')-1b, compared with isolates from New York City. Sequences of qnrA1, qnrB1 and qnrS1 in quinolone-resistant Chilean E. coli and Chilean marine bacteria were identical, suggesting horizontal gene transfer between antimicrobial-resistant marine bacteria and human pathogens. © 2015 Society for Applied Microbiology and John Wiley & Sons Ltd.

  10. Fine-mapping diabetes-related traits, including insulin resistance, in heterogeneous stock rats

    Science.gov (United States)

    Holl, Katie L.; Oreper, Daniel; Xie, Yuying; Tsaih, Shirng-Wern; Valdar, William

    2012-01-01

    Type 2 diabetes (T2D) is a disease of relative insulin deficiency resulting from both insulin resistance and beta cell failure. We have previously used heterogeneous stock (HS) rats to fine-map a locus for glucose tolerance. We show here that glucose intolerance in the founder strains of the HS colony is mediated by different mechanisms: insulin resistance in WKY and an insulin secretion defect in ACI, and we demonstrate a high degree of variability for measures of insulin resistance and insulin secretion in HS rats. As such, our goal was to use HS rats to fine-map several diabetes-related traits within a region on rat chromosome 1. We measured blood glucose and plasma insulin levels after a glucose tolerance test in 782 male HS rats. Using 97 SSLP markers, we genotyped a 68 Mb region on rat chromosome 1 previously implicated in glucose and insulin regulation. We used linkage disequilibrium mapping by mixed model regression with inferred descent to identify a region from 198.85 to 205.9 that contains one or more quantitative trait loci (QTL) for fasting insulin and a measure of insulin resistance, the quantitative insulin sensitivity check index. This region also encompasses loci identified for fasting glucose and Insulin_AUC (area under the curve). A separate <3 Mb QTL was identified for body weight. Using a novel penalized regression method we then estimated effects of alternative haplotype pairings under each locus. These studies highlight the utility of HS rats for fine-mapping genetic loci involved in the underlying causes of T2D. PMID:22947656

  11. SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

    Directory of Open Access Journals (Sweden)

    Mehmet AYBEKE

    2015-12-01

    Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

  12. Class 1 and 2 integrons, sul resistance genes and antibiotic resistance in Escherichia coli isolated from Dongjiang River, South China

    International Nuclear Information System (INIS)

    Su Haochang; Ying Guangguo; Tao Ran; Zhang Ruiquan; Zhao Jianliang; Liu Yousheng

    2012-01-01

    Antibiotic susceptibility, detection of sul gene types and presence of class 1, 2 and 3 integrons and gene cassettes using PCR assays were investigated in 3456 Escherichia coli isolates obtained from 38 sampling sites of the Dongjiang River catchment in the dry and wet seasons. 89.1% of the isolates were resistant and 87.5% showed resistance to at least three antibiotics. sul2 was detected most frequently in 89.2% of 1403 SXT-resistant isolates. The presence of integrons (class 1 and 2) was frequently observed (82.3%) while no class 3 integron was found. In these integrons, 21 resistance genes of 14 gene cassette arrays and 10 different families of resistance genes were identified. Three gene cassette arrays, aac(6')-Ib-cr-aar-3-dfrA27-aadA16, aacA4-catB3-dfrA1 and aadA2-lnuF, were detected for the first time in surface water. The results showed that bacterial resistance in the catchment was seriously influenced by human activities, especially discharge of wastewater. Highlights: ► Antibiotic resistance was investigated for a river catchment of southern China. ► 87.5% of E coli isolates showed resistance to at least three antibiotics. ► The presence of integrons (class 1 and 2) was frequently observed (82.3%). ► Bacterial resistance in the catchment was seriously influenced by human activities. - Bacterial resistance to antibiotics in a catchment is related to the discharge of wastewater into the aquatic environment.

  13. Phylogenetic relatedness determined between antibiotic resistance and 16S rRNA genes in actinobacteria.

    Science.gov (United States)

    Sagova-Mareckova, Marketa; Ulanova, Dana; Sanderova, Petra; Omelka, Marek; Kamenik, Zdenek; Olsovska, Jana; Kopecky, Jan

    2015-04-01

    Distribution and evolutionary history of resistance genes in environmental actinobacteria provide information on intensity of antibiosis and evolution of specific secondary metabolic pathways at a given site. To this day, actinobacteria producing biologically active compounds were isolated mostly from soil but only a limited range of soil environments were commonly sampled. Consequently, soil remains an unexplored environment in search for novel producers and related evolutionary questions. Ninety actinobacteria strains isolated at contrasting soil sites were characterized phylogenetically by 16S rRNA gene, for presence of erm and ABC transporter resistance genes and antibiotic production. An analogous analysis was performed in silico with 246 and 31 strains from Integrated Microbial Genomes (JGI_IMG) database selected by the presence of ABC transporter genes and erm genes, respectively. In the isolates, distances of erm gene sequences were significantly correlated to phylogenetic distances based on 16S rRNA genes, while ABC transporter gene distances were not. The phylogenetic distance of isolates was significantly correlated to soil pH and organic matter content of isolation sites. In the analysis of JGI_IMG datasets the correlation between phylogeny of resistance genes and the strain phylogeny based on 16S rRNA genes or five housekeeping genes was observed for both the erm genes and ABC transporter genes in both actinobacteria and streptomycetes. However, in the analysis of sequences from genomes where both resistance genes occurred together the correlation was observed for both ABC transporter and erm genes in actinobacteria but in streptomycetes only in the erm gene. The type of erm resistance gene sequences was influenced by linkage to 16S rRNA gene sequences and site characteristics. The phylogeny of ABC transporter gene was correlated to 16S rRNA genes mainly above the genus level. The results support the concept of new specific secondary metabolite

  14. Identification and validation of a gene causing cross-resistance between insecticide classes in Anopheles gambiae from Ghana.

    Science.gov (United States)

    Mitchell, Sara N; Stevenson, Bradley J; Müller, Pie; Wilding, Craig S; Egyir-Yawson, Alexander; Field, Stuart G; Hemingway, Janet; Paine, Mark J I; Ranson, Hilary; Donnelly, Martin James

    2012-04-17

    In the last decade there have been marked reductions in malaria incidence in sub-Saharan Africa. Sustaining these reductions will rely upon insecticides to control the mosquito malaria vectors. We report that in the primary African malaria vector, Anopheles gambiae sensu stricto, a single enzyme, CYP6M2, confers resistance to two classes of insecticide. This is unique evidence in a disease vector of cross-resistance associated with a single metabolic gene that simultaneously reduces the efficacy of two of the four classes of insecticide routinely used for malaria control. The gene-expression profile of a highly DDT-resistant population of A. gambiae s.s. from Ghana was characterized using a unique whole-genome microarray. A number of genes were significantly overexpressed compared with two susceptible West African colonies, including genes from metabolic families previously linked to insecticide resistance. One of the most significantly overexpressed probe groups (false-discovery rate-adjusted P P450 gene CYP6M2. This gene is associated with pyrethroid resistance in wild A. gambiae s.s. populations) and can metabolize both type I and type II pyrethroids in recombinant protein assays. Using in vitro assays we show that recombinant CYP6M2 is also capable of metabolizing the organochlorine insecticide DDT in the presence of solubilizing factor sodium cholate.

  15. The human genome and sport, including epigenetics, gene doping, and athleticogenomics.

    Science.gov (United States)

    Sharp, N C Craig

    2010-03-01

    Hugh Montgomery's discovery of the first of more than 239 fitness genes together with rapid advances in human gene therapy have created a prospect of using genes, genetic elements, and cells that have the capacity to enhance athletic performance (to paraphrase the World Anti-Doping Agency's definition of gene doping). This brief overview covers the main areas of interface between genetics and sport, attempts to provide a context against which gene doping may be viewed, and predicts a futuristic legitimate use of genomic (and possibly epigenetic) information in sport. Copyright 2010 Elsevier Inc. All rights reserved.

  16. Antibiotic Resistant Bacteria And Their Associated Resistance Genes in a Conventional Municipal Wastewater Treatment Plant

    KAUST Repository

    Aljassim, Nada I.

    2013-12-01

    With water scarcity as a pressing issue in Saudi Arabia and other Middle Eastern countries, the treatment and reuse of municipal wastewater is increasingly being used as an alternative water source to supplement country water needs. Standards are in place to ensure a safe treated wastewater quality, however they do not regulate pathogenic bacteria and emerging contaminants. Information is lacking on the levels of risk to public health associated with these factors, the efficiency of conventional treatment strategies in removing them, and on wastewater treatment in Saudi Arabia in general. In this study, a municipal wastewater treatment plant in Saudi Arabia is investigated to assess the efficiency of conventional treatment in meeting regulations and removing pathogens and emerging contaminants. The study found pathogenic bacterial genera, antibiotic resistance genes and antibiotic resistant bacteria, many of which were multi-resistant in plant discharges. It was found that although the treatments are able to meet traditional quality guidelines, there remains a risk from the discussed contaminants with wastewater reuse. A deeper understanding of this risk, and suggestions for more thorough guidelines and monitoring are needed.

  17. The biofilm-specific antibiotic resistance gene ndvB is important for expression of ethanol oxidation genes in Pseudomonas aeruginosa biofilms.

    Science.gov (United States)

    Beaudoin, Trevor; Zhang, Li; Hinz, Aaron J; Parr, Christopher J; Mah, Thien-Fah

    2012-06-01

    Bacteria growing in biofilms are responsible for a large number of persistent infections and are often more resistant to antibiotics than are free-floating bacteria. In a previous study, we identified a Pseudomonas aeruginosa gene, ndvB, which is important for the formation of periplasmic glucans. We established that these glucans function in biofilm-specific antibiotic resistance by sequestering antibiotic molecules away from their cellular targets. In this study, we investigate another function of ndvB in biofilm-specific antibiotic resistance. DNA microarray analysis identified 24 genes that were responsive to the presence of ndvB. A subset of 20 genes, including 8 ethanol oxidation genes (ercS', erbR, exaA, exaB, eraR, pqqB, pqqC, and pqqE), was highly expressed in wild-type biofilm cells but not in ΔndvB biofilms, while 4 genes displayed the reciprocal expression pattern. Using quantitative real-time PCR, we confirmed the ndvB-dependent expression of the ethanol oxidation genes and additionally demonstrated that these genes were more highly expressed in biofilms than in planktonic cultures. Expression of erbR in ΔndvB biofilms was restored after the treatment of the biofilm with periplasmic extracts derived from wild-type biofilm cells. Inactivation of ethanol oxidation genes increased the sensitivity of biofilms to tobramycin. Together, these results reveal that ndvB affects the expression of multiple genes in biofilms and that ethanol oxidation genes are linked to biofilm-specific antibiotic resistance.

  18. Fine mapping and identification of a candidate gene for the barley Un8 true loose smut resistance gene.

    Science.gov (United States)

    Zang, Wen; Eckstein, Peter E; Colin, Mark; Voth, Doug; Himmelbach, Axel; Beier, Sebastian; Stein, Nils; Scoles, Graham J; Beattie, Aaron D

    2015-07-01

    The candidate gene for the barley Un8 true loose smut resistance gene encodes a deduced protein containing two tandem protein kinase domains. In North America, durable resistance against all known isolates of barley true loose smut, caused by the basidiomycete pathogen Ustilago nuda (Jens.) Rostr. (U. nuda), is under the control of the Un8 resistance gene. Previous genetic studies mapped Un8 to the long arm of chromosome 5 (1HL). Here, a population of 4625 lines segregating for Un8 was used to delimit the Un8 gene to a 0.108 cM interval on chromosome arm 1HL, and assign it to fingerprinted contig 546 of the barley physical map. The minimal tilling path was identified for the Un8 locus using two flanking markers and consisted of two overlapping bacterial artificial chromosomes. One gene located close to a marker co-segregating with Un8 showed high sequence identity to a disease resistance gene containing two kinase domains. Sequence of the candidate gene from the parents of the segregating population, and in an additional 19 barley lines representing a broader spectrum of diversity, showed there was no intron in alleles present in either resistant or susceptible lines, and fifteen amino acid variations unique to the deduced protein sequence in resistant lines differentiated it from the deduced protein sequences in susceptible lines. Some of these variations were present within putative functional domains which may cause a loss of function in the deduced protein sequences within susceptible lines.

  19. Two whitebacked planthopper resistance genes in rice share the same loci with those for brown planthopper resistance.

    Science.gov (United States)

    Tan, G X; Weng, Q M; Ren, X; Huang, Z; Zhu, L L; He, G C

    2004-03-01

    The whitebacked planthopper (WBPH), Sogatella furcifera, and brown planthopper (BPH) Nilaparvata lugens Stål are important sucking insects of rice (Oryza sativa L.) crops throughout the world. Rice 'B5', which has derived its resistance genes from the wild rice O. officinalis Wall ex Watt, is a line that is highly resistant to both WBPH and BPH. Previously, two resistance genes against BPH, Qbp1, and Qbp2 in 'B5' had been mapped onto chromosome 3 and chromosome 4, respectively. In this study, we employed a mapping population composed of 187 recombinant inbred lines (RILs), produced from a cross between 'B5' and susceptible variety 'Minghui63', to locate the WBPH and BPH resistance genes. A RFLP survey of the bulked extremes from the RIL population identified two genomic regions, one on chromosome 3 and the other on chromosome 4, likely containing the resistance genes to planthoppers. QTL analysis of the RILs further confirmed that two WBPH resistance genes were mapped on the same loci as Qbp1 and Qbp2, using a linkage map with 242 molecular markers distributed on 12 rice chromosomes. Of the two WBPH resistance genes, one designated Wbph7(t) was located within a 1.1-cM region between R1925 and G1318 on chromosome 3, the other designated Wbph8(t) was within a 0.3-cM region flanked by R288 and S11182 on chromosome 4. A two-way analysis of variance showed that two loci acted independently with each other in determining WBPH resistance. The results have significant implications in studying the interactions between sucking insects and plants and in breeding programs of resistance to rice planthoppers.

  20. Innate immune genes including a mucin-like gene, mul-1, induced by ionizing radiation in Caenorhabditis elegans.

    Science.gov (United States)

    Kimura, Takafumi; Takanami, Takako; Sakashita, Tetsuya; Wada, Seiichi; Kobayashi, Yasuhiko; Higashitani, Atsushi

    2012-10-01

    The effect of radiation on the intestine has been studied for more than one hundred years. It remains unclear, however, whether this organ uses specific defensive mechanisms against ionizing radiation. The infection with Pseudomonas aeruginosa (PA14) in Caenorhabditis elegans induces up-regulation of innate immune response genes. Here, we found that exposure to ionizing radiation also induces certain innate immune response genes such as F49F1.6 (termed mul-1), clec-4, clec-67, lys-1 and lys-2 in the intestine. Moreover, pre-treatment with ionizing radiation before seeding on PA14 lawn plate significantly increased survival rate in the nematode. We also studied transcription pathway of the mul-1 in response to ionizing radiation. Induction of mul-1 gene was highly dependent on the ELT-2 transcription factor and p38 MAPK. Moreover, the insulin/IGF-1 signal pathway works to enhance induction of this gene. The mul-1 gene showed a different induction pattern from the DNA damage response gene, ced-13, which implies that the expression of this gene might be triggered as an indirect effect of radiation. Silencing of the mul-1 gene led to growth retardation after treatment with ionizing radiation. We describe the cross-tolerance between the response to radiation exposure and the innate immune system.

  1. The Medicago truncatula lysine motif-receptor-like kinase gene family includes NFP and new nodule-expressed genes

    NARCIS (Netherlands)

    Arrighi, J.F.; Barre, A.; Amor, Ben B.; Bersoult, A.; Campos Soriano, L.; Mirabella, R.; Carvalho-Niebel, de F.; Journet, E.P.; Ghérardi, M.; Huguet, T.; Geurts, R.; Dénarié, J.; Rougé, P.; Gough, C.

    2006-01-01

    Rhizobial Nod factors are key symbiotic signals responsible for starting the nodulation process in host legume plants. Of the six Medicago truncatula genes controlling a Nod factor signaling pathway, Nod Factor Perception (NFP) was reported as a candidate Nod factor receptor gene. Here, we provide

  2. Sulfonamide-resistant bacteria and their resistance genes in soils fertilized with manures from Jiangsu Province, Southeastern China.

    Directory of Open Access Journals (Sweden)

    Na Wang

    Full Text Available Antibiotic-resistant bacteria and genes are recognized as new environmental pollutants that warrant special concern. There were few reports on veterinary antibiotic-resistant bacteria and genes in China. This work systematically analyzed the prevalence and distribution of sulfonamide resistance genes in soils from the environments around poultry and livestock farms in Jiangsu Province, Southeastern China. The results showed that the animal manure application made the spread and abundance of antibiotic resistance genes (ARGs increasingly in the soil. The frequency of sulfonamide resistance genes was sul1 > sul2 > sul3 in pig-manured soil DNA and sul2 > sul1 > sul3 in chicken-manured soil DNA. Further analysis suggested that the frequency distribution of the sul genes in the genomic DNA and plasmids of the SR isolates from manured soil was sul2 > sul1 > sul3 overall (p<0.05. The combination of sul1 and sul2 was the most frequent, and the co-existence of sul1 and sul3 was not found either in the genomic DNA or plasmids. The sample type, animal type and sampling time can influence the prevalence and distribution pattern of sulfonamide resistance genes. The present study also indicated that Bacillus, Pseudomonas and Shigella were the most prevalent sul-positive genera in the soil, suggesting a potential human health risk. The above results could be important in the evaluation of antibiotic-resistant bacteria and genes from manure as sources of agricultural soil pollution; the results also demonstrate the necessity and urgency of the regulation and supervision of veterinary antibiotics in China.

  3. Adaptive Landscapes of Resistance Genes Change as Antibiotic Concentrations Change.

    Science.gov (United States)

    Mira, Portia M; Meza, Juan C; Nandipati, Anna; Barlow, Miriam

    2015-10-01

    Most studies on the evolution of antibiotic resistance are focused on selection for resistance at lethal antibiotic concentrations, which has allowed the detection of mutant strains that show strong phenotypic traits. However, solely focusing on lethal concentrations of antibiotics narrowly limits our perspective of antibiotic resistance evolution. New high-resolution competition assays have shown that resistant bacteria are selected at relatively low concentrations of antibiotics. This finding is important because sublethal concentrations of antibiotics are found widely in patients undergoing antibiotic therapies, and in nonmedical conditions such as wastewater treatment plants, and food and water used in agriculture and farming. To understand the impacts of sublethal concentrations on selection, we measured 30 adaptive landscapes for a set of TEM β-lactamases containing all combinations of the four amino acid substitutions that exist in TEM-50 for 15 β-lactam antibiotics at multiple concentrations. We found that there are many evolutionary pathways within this collection of landscapes that lead to nearly every TEM-genotype that we studied. While it is known that the pathways change depending on the type of β-lactam, this study demonstrates that the landscapes including fitness optima also change dramatically as the concentrations of antibiotics change. Based on these results we conclude that the presence of multiple concentrations of β-lactams in an environment result in many different adaptive landscapes through which pathways to nearly every genotype are available. Ultimately this may increase the diversity of genotypes in microbial populations. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  4. Evolution of Regions Containing Antibiotic Resistance Genes in FII-2-FIB-1 ColV-Colla Virulence Plasmids.

    Science.gov (United States)

    Moran, Robert A; Hall, Ruth M

    2018-05-01

    Three ColV virulence plasmids carrying antibiotic resistance genes were assembled from draft genome sequences of commensal ST95, ST131, and ST2705 Escherichia coli isolates from healthy Australians. Plasmids pCERC4, pCERC5, and pCERC9 include almost identical backbones containing FII-2 and FIB-1 replicons and the conserved ColV virulence region with an additional ColIa determinant. Only pCERC5 includes a complete, uninterrupted F-like transfer region and was able to conjugate. pCERC5 and pCERC9 contain Tn1721, carrying the tet(A) tetracycline resistance determinant in the same location, with Tn2 (bla TEM ; ampicillin resistance) interrupting the Tn1721 in pCERC5. pCERC4 has a Tn1721/Tn21 hybrid transposon carrying dfrA5 (trimethoprim resistance) and sul1 (sulfamethoxazole resistance) in a class 1 integron. Four FII-2:FIB-1 ColV-ColIa plasmids in the GenBank nucleotide database have a related transposon in the same position, but an IS26 has reshaped the resistance gene region, deleting 2,069 bp of the integron 3'-CS, including sul1, and serving as a target for IS26 translocatable units containing bla TEM , sul2 and strAB (streptomycin resistance), or aphA1 (kanamycin/neomycin resistance). Another ColV-ColIa plasmid containing a related resistance gene region has lost the FII replicon and acquired a unique transfer region via recombination within the resistance region and at oriT. Eighteen further complete ColV plasmid sequences in GenBank contained FIB-1, but the FII replicons were of three types, FII-24, FII-18, and a variant of FII-36.

  5. Removal of antibiotics and antibiotic resistance genes from domestic sewage by constructed wetlands: Optimization of wetland substrates and hydraulic loading.

    Science.gov (United States)

    Chen, Jun; Wei, Xiao-Dong; Liu, You-Sheng; Ying, Guang-Guo; Liu, Shuang-Shuang; He, Liang-Ying; Su, Hao-Chang; Hu, Li-Xin; Chen, Fan-Rong; Yang, Yong-Qiang

    2016-09-15

    This study aimed to assess removal potential of antibiotics and antibiotic resistance genes (ARGs) in raw domestic wastewater by various mesocosm-scale horizontal subsurface-flow constructed wetlands (CWs) planted Cyperus alternifolius L. with different design parameters. Twelve CWs with three hydraulic loading rates (HLR 10, 20 and 30cm/day) and four substrates (oyster shell, zeolite, medical stone and ceramic) were set up in order to select the best optimized wetland. The result showed that 7 target antibiotics compounds including erythromycin-H2O, lincomycin, monensin, ofloxacin, sulfamerazine, sulfamethazine and novobiocin were detected, and all selected 18 genes (three sulfonamide resistance genes (sul1, sul2 and sul3), four tetracycline resistance genes (tetG, tetM, tetO and tetX), two macrolide resistance genes (ermB and ermC), three quinolone resistance genes (qnrB, qnrD and qnrS) and four chloramphenicol resistance genes (cmlA, fexA, fexB and floR)) and two integrase genes (int1 and int2) were positively detected in the domestic wastewaters. The aqueous removal rates of the total antibiotics ranged from17.9 to 98.5%, while those for the total ARGs varied between 50.0 and 85.8% by the mesocosm-scale CWs. After considering their aqueous removal rates in combination with their mass removals, the CW with zeolite as the substrate and HLR of 20cm/day was selected as the best choice. Combined chemical and biological analyses indicate that both microbial degradation and physical sorption processes were responsible for the fate of antibiotics and ARGs in the wetlands. The findings from this study suggest constructed wetlands could be a promising technology for the removal of emerging contaminants such as antibiotics and ARGs in domestic wastewater. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. Expressed sequence enrichment for candidate gene analysis of citrus tristeza virus resistance.

    Science.gov (United States)

    Bernet, G P; Bretó, M P; Asins, M J

    2004-02-01

    Several studies have reported markers linked to a putative resistance gene from Poncirus trifoliata ( Ctv-R) located at linkage group 4 that confers resistance against one of the most important citrus pathogens, citrus tristeza virus (CTV). To be successful in both marker-assisted selection and transformation experiments, its accurate mapping is needed. Several factors may affect its localization, among them two are considered here: the definition of resistance and the genetic background of progeny. Two progenies derived from P. trifoliata, by self-pollination and by crossing with sour orange ( Citrus aurantium), a citrus rootstock well-adapted to arid and semi-arid areas, were used for linkage group-4 marker enrichment. Two new methodologies were used to enrich this region with expressed sequences. The enrichment of group 4 resulted in the fusion of several C. aurantium linkage groups. The new one A(7+3+4) is now saturated with 48 markers including expressed sequences. Surprisingly, sour orange was as resistant to the CTV isolate tested as was P. trifoliata, and three hybrids that carry Ctv-R, as deduced from its flanking markers, are susceptible to CTV. The new linkage maps were used to map Ctv-R under the hypothesis of monogenic inheritance. Its position on linkage group 4 of P. trifoliata differs from the location previously reported in other progenies. The genetic analysis of virus-plant interaction in the family derived from C. aurantium after a CTV chronic infection showed the segregation of five types of interaction, which is not compatible with the hypothesis of a single gene controlling resistance. Two major issues are discussed: another type of genetic analysis of CTV resistance is needed to avoid the assumption of monogenic inheritance, and transferring Ctv-R from P. trifoliata to sour orange might not avoid the CTV decline of sweet orange trees.

  7. Natural variation of rice blast resistance gene Pi-d2

    Science.gov (United States)

    Studying natural variation of rice resistance (R) genes in cultivated and wild rice relatives can predict resistance stability to rice blast fungus. In the present study, the protein coding regions of rice R gene Pi-d2 in 35 rice accessions of subgroups, aus (AUS), indica (IND), temperate japonica (...

  8. Transport and transformation of genetic information in the critical zone: The case of antibiotic resistance genes

    Science.gov (United States)

    Zhu, Y. G.

    2015-12-01

    In addition to material and energy flows, the dynamics and functions of the Earth's critical zone are intensively mediated by biological actions performed by diverse organisms. These biological actions are modulated by the expression of functional genes and their translation into enzymes that catalyze geochemical reactions, such as nutrient turnover and pollutant biodegradation. Although geobiology, as an interdisciplinary research area, is playing and vital role in linking biological and geochemical processes at different temporal and spatial scales, the distribution and transport of functional genes have rarely been investigated from the Earth's critical zone perspectives. To illustrate the framework of studies on the transport and transformation of genetic information in the critical zone, antibiotic resistance is taken as an example. Antibiotic resistance genes are considered as a group of emerging contaminants, and their emergence and spread within the critical zone on one hand are induced by anthropogenic activities, and on other hand are threatening human health worldwide. The transport and transformation of antibiotic resistance genes are controlled by both horizontal gene transfer between bacterial cells and the movement of bacteria harboring antibiotic resistance genes. In this paper, the fate and behavior of antibiotic resistance genes will be discussed in the following aspects: 1) general overview of environmental antibiotic resistance; 2) high through quantification of the resistome in various environmental media; 3) pathways of resistance gene flow within the critical zone; and 4) potential strategies in mitigating antibiotic resistance, particularly from the critical zone perspectives.

  9. Molecular characterization of the CRa gene conferring clubroot resistance in Brassica rapa.

    Science.gov (United States)

    Ueno, Hiroki; Matsumoto, Etsuo; Aruga, Daisuke; Kitagawa, Satoshi; Matsumura, Hideo; Hayashida, Nobuaki

    2012-12-01

    Clubroot disease is one of the major diseases affecting Brassicaceae crops, and a number of these crops grown commercially, such as Chinese cabbage (Brassica rapa L. ssp. pekinensis), are known to be highly susceptible to clubroot disease. To provide protection from this disease, plant breeders have introduced genes for resistance to clubroot from the European turnip into susceptible lines. The CRa gene confers specific resistance to the clubroot pathogen Plasmodiophora brassicae isolate M85. Fine mapping of the CRa locus using synteny to the Arabidopsis thaliana genome and partial genome sequences of B. rapa revealed a candidate gene encoding a TIR-NBS-LRR protein. Several structural differences in this candidate gene were found between susceptible and resistant lines, and CRa expression was observed only in the resistant line. Four mutant lines lacking clubroot resistance were obtained by the UV irradiation of pollen from a resistant line, and all of these mutant lines carried independent mutations in the candidate TIR-NBS-LRR gene. This genetic and molecular evidence strongly suggests that the identified gene is CRa. This is the first report on the molecular characterization of a clubroot Resistance gene in Brassicaceae and of the disease resistance gene in B. rapa.

  10. An AFLP marker linked to turnip mosaic virus resistance gene in pak ...

    African Journals Online (AJOL)

    An AFLP marker linked to turnip mosaic virus resistance gene in pak-choi. W Xinhua, C Huoying, Z Yuying, H Ruixian. Abstract. Pak-choi is one of the most important vegetable crops in China. Turnip mosaic virus (TuMV) is one of its main pathogen. Screening the molecular marker linked to the TuMV resistance gene is an ...

  11. Identification of leaf rust resistant gene Lr10 in Pakistani wheat ...

    African Journals Online (AJOL)

    Leaf (brown) rust is the major disease of wheat in Pakistan and other countries. The disease is more effectively controlled when several rust resistance genes are pyramided into a single line. Molecular survey was conducted to screen 25 Pakistan wheat germplasm for the presence of leaf rust resistance gene Lr10 using ...

  12. Characterization of the psoRPM1 gene for resistance to root-knot ...

    African Journals Online (AJOL)

    Several root-knot nematode (Meloidogyne spp.) resistance genes have been discovered in different stone fruit crops. However, none of them has yet been cloned and they were only located on the chromosomes. In this study, a candidate root-knot nematode resistance gene (designated as psoRPM1) was isolated from the ...

  13. Identification of virulence genes carried by bacteriophages obtained from clinically isolated methicillin-resistant Staphylococcus aureus.

    Science.gov (United States)

    Karasartova, Djursun; Cavusoglu, Zeynep Burcin; Turegun, Buse; Ozsan, Murat T; Şahin, Fikret

    2016-12-01

    Bacteriophages play an important role in the pathogenicity of Staphylococcus aureus (S. aureus) either by carrying accessory virulence factors or several superantigens. Despite their importance, there are not many studies showing the actual distribution of the virulence genes carried by the prophages obtained from the clinically isolated Staphylococcus. In this study, we investigated prophages obtained from methicillin-resistant S. aureus (MRSA) strains isolated from hospital- and community-associated (HA-CA) infections for the virulence factors. In the study, 43 phages isolated from 48 MRSA were investigated for carrying toxin genes including the sak, eta, lukF-PV, sea, selp, sek, seg, seq chp, and scn virulence genes using polymerase chain reaction (PCR) and Southern blot. Restriction fragment length polymorphism was used to analyze phage genomes to investigate the relationship between the phage profiles and the toxin genes' presence. MRSA strains isolated from HA infections tended to have higher prophage presence than the MRSA strains obtained from the CA infections (97% and 67%, respectively). The study showed that all the phages with the exception of one phage contained one or more virulence genes in their genomes with different combinations. The most common toxin genes found were sea (83%) followed by sek (77%) and seq (64%). The study indicates that prophages encode a significant proportion of MRSA virulence factors.

  14. Enriched whole genome sequencing identified compensatory mutations in the RNA polymerase gene of rifampicin-resistant Mycobacterium leprae strains

    Directory of Open Access Journals (Sweden)

    Lavania M

    2018-01-01

    Full Text Available Mallika Lavania,1 Itu Singh,1 Ravindra P Turankar,1 Anuj Kumar Gupta,2 Madhvi Ahuja,1 Vinay Pathak,1 Utpal Sengupta1 1Stanley Browne Laboratory, The Leprosy Mission Trust India, TLM Community Hospital Nand Nagari, 2Agilent Technologies India Pvt Ltd, Jasola District Centre, New Delhi, India Abstract: Despite more than three decades of multidrug therapy (MDT, leprosy remains a major public health issue in several endemic countries, including India. The emergence of drug resistance in Mycobacterium leprae (M. leprae is a cause of concern and poses a threat to the leprosy-control program, which might ultimately dampen the achievement of the elimination program of the country. Rifampicin resistance in clinical strains of M. leprae are supposed to arise from harboring bacterial strains with mutations in the 81-bp rifampicin resistance determining region (RRDR of the rpoB gene. However, complete dynamics of rifampicin resistance are not explained only by this mutation in leprosy strains. To understand the role of other compensatory mutations and transmission dynamics of drug-resistant leprosy, a genome-wide sequencing of 11 M. leprae strains – comprising five rifampicin-resistant strains, five sensitive strains, and one reference strain – was done in this study. We observed the presence of compensatory mutations in two rifampicin-resistant strains in rpoC and mmpL7 genes, along with rpoB, that may additionally be responsible for conferring resistance in those strains. Our findings support the role for compensatory mutation(s in RNA polymerase gene(s, resulting in rifampicin resistance in relapsed leprosy patients. Keywords: leprosy, rifampicin resistance, compensatory mutations, next generation sequencing, relapsed, MDT, India

  15. Listeria monocytogenes isolates from food and food environment harbouring tetM and ermB resistance genes.

    Science.gov (United States)

    Haubert, L; Mendonça, M; Lopes, G V; de Itapema Cardoso, M R; da Silva, W P

    2016-01-01

    Listeria monocytogenes is a foodborne pathogen that has become an important cause of human and animal diseases worldwide. The purpose of this study was to evaluate the serotypes, virulence potential, antimicrobial resistance profile, and genetic relationships of 50 L. monocytogenes isolates from food and food environment in southern Brazil. In this study, the majority of L. monocytogenes isolates belonged to the serotypes 1/2b (42%) and 4b (26%), which are the main serotypes associated with human listeriosis. In addition, all isolates harboured internalin genes (inlA, inlC, inlJ), indicating a virulence potential. The isolates were sensitive to most of the antimicrobial compounds analysed, and five isolates (10%) were multi-resistant. Two isolates harboured antimicrobial resistance genes (tetM and ermB) and in one of them, the gene was present in the plasmid. Moreover, according to the pulsed field gel electrophoresis assay, two multi-resistant isolates were a single clone isolated from food and the processing plant. The isolates were susceptible to the most frequently used antibiotics for listeriosis treatment. However, the presence of multidrug-resistant isolates and antimicrobial resistance genes including in the plasmid could even be transferred between bacterial species, suggesting a potential health risk to consumers and a potential risk of spreading multi-resistance genes to other bacteria. Listeria monocytogenes is an important agent of foodborne diseases. The results of this study suggest a potential capacity of L. monocytogenes isolates from food and food environment to cause human infections. Antimicrobial multi-resistance profiles were detected in 10%, and two isolates harboured tetM and ermB resistance genes. Moreover, the present research can help to build up a better knowledge about antimicrobial resistance of L. monocytogenes. Additionally, we found one isolate carrying tetM resistance gene in a plasmid, that suggests a possible transmission

  16. Sulfate and Chloride Resistance of High Fluidity Concrete including Fly Ash and GGBS for NPP

    International Nuclear Information System (INIS)

    Noh, Jea Myoung; Cho, Myung Sug

    2010-01-01

    Fly ash mixed concrete has been used for NPP concrete structures in Korea in order to prevent aging and improve durability since the Shin.Kori no.1,2 in 2005. Concentrated efforts to develop technology for the streamlining of construction work and to affect labor savings have been conducted in construction. The application of high fluidity concrete for nuclear power plants has been the research subject with the aim of further rationalization of construction works. Since high fluidity concrete can have the characteristics of high density and high strength without compaction. However, high fluidity concrete can cause thermal cracking by heat of hydration. For this reason, the amount of pozzolan binder should be increased in high fluidity concrete for nuclear power plants. In this study, the resistance of high fluidity concrete on sulfate and chloride was compared with that of the concrete currently using for nuclear power plants

  17. Wrought stainless steel butt-welding fittings: including reference to other corrosion resistant materials - approved 1971

    International Nuclear Information System (INIS)

    Anon.

    1975-01-01

    ANSI B16.9 is the American Standard for steel butt-welding fittings and although not so stated, it is implied that its scope deals primarily with the schedules of wall thicknesses which are common to carbon steel and the grades of alloy steel piping that are selected for pressure and temperature considerations. The purpose of this standard is to provide industry with a set of dimensional standards for butt-welding fittings that can be used with these light wall pipes of corrosion resisting materials. The center-to-end dimensions of all fittings are identical with those in ANSI B16.9 which give to industry the advantage of uniform design room practice and a maximum utilization of existing die equipment. The only departure from this is in the lap-joint stub end where for purposes of economy the face-to-end of the product has been reduced for use with thin wall piping

  18. Identifying clinically relevant drug resistance genes in drug-induced resistant cancer cell lines and post-chemotherapy tissues.

    Science.gov (United States)

    Tong, Mengsha; Zheng, Weicheng; Lu, Xingrong; Ao, Lu; Li, Xiangyu; Guan, Qingzhou; Cai, Hao; Li, Mengyao; Yan, Haidan; Guo, You; Chi, Pan; Guo, Zheng

    2015-12-01

    Until recently, few molecular signatures of drug resistance identified in drug-induced resistant cancer cell models can be translated into clinical practice. Here, we defined differentially expressed genes (DEGs) between pre-chemotherapy colorectal cancer (CRC) tissue samples of non-responders and responders for 5-fluorouracil and oxaliplatin-based therapy as clinically relevant drug resistance genes (CRG5-FU/L-OHP). Taking CRG5-FU/L-OHP as reference, we evaluated the clinical relevance of several types of genes derived from HCT116 CRC cells with resistance to 5-fluorouracil and oxaliplatin, respectively. The results revealed that DEGs between parental and resistant cells, when both were treated with the corresponding drug for a certain time, were significantly consistent with the CRG5-FU/L-OHP as well as the DEGs between the post-chemotherapy CRC specimens of responders and non-responders. This study suggests a novel strategy to extract clinically relevant drug resistance genes from both drug-induced resistant cell models and post-chemotherapy cancer tissue specimens.

  19. The expression of antibiotic resistance genes in antibiotic-producing bacteria.

    Science.gov (United States)

    Mak, Stefanie; Xu, Ye; Nodwell, Justin R

    2014-08-01

    Antibiotic-producing bacteria encode antibiotic resistance genes that protect them from the biologically active molecules that they produce. The expression of these genes needs to occur in a timely manner: either in advance of or concomitantly with biosynthesis. It appears that there have been at least two general solutions to this problem. In many cases, the expression of resistance genes is tightly linked to that of antibiotic biosynthetic genes. In others, the resistance genes can be induced by their cognate antibiotics or by intermediate molecules from their biosynthetic pathways. The regulatory mechanisms that couple resistance to antibiotic biosynthesis are mechanistically diverse and potentially relevant to the origins of clinical antibiotic resistance. © 2014 John Wiley & Sons Ltd.

  20. Complete genome sequence analysis of the fish pathogen Flavobacterium columnare provides insights into antibiotic resistance and pathogenicity related genes.

    Science.gov (United States)

    Zhang, Yulei; Zhao, Lijuan; Chen, Wenjie; Huang, Yunmao; Yang, Ling; Sarathbabu, V; Wu, Zaohe; Li, Jun; Nie, Pin; Lin, Li

    2017-10-01

    We analyzed here the complete genome sequences of a highly virulent Flavobacterium columnare Pf1 strain isolated in our laboratory. The complete genome consists of a 3,171,081 bp circular DNA with 2784 predicted protein-coding genes. Among these, 286 genes were predicted as antibiotic resistance genes, including 32 RND-type efflux pump related genes which were associated with the export of aminoglycosides, indicating inducible aminoglycosides resistances in F. columnare. On the other hand, 328 genes were predicted as pathogenicity related genes which could be classified as virulence factors, gliding motility proteins, adhesins, and many putative secreted proteases. These genes were probably involved in the colonization, invasion and destruction of fish tissues during the infection of F. columnare. Apparently, our obtained complete genome sequences provide the basis for the explanation of the interactions between the F. columnare and the infected fish. The predicted antibiotic resistance and pathogenicity related genes will shed a new light on the development of more efficient preventional strategies against the infection of F. columnare, which is a major worldwide fish pathogen. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Occurrence of antibiotics and antibiotic resistance genes in a sewage treatment plant and its effluent-receiving river.

    Science.gov (United States)

    Xu, Jian; Xu, Yan; Wang, Hongmei; Guo, Changsheng; Qiu, Huiyun; He, Yan; Zhang, Yuan; Li, Xiaochen; Meng, Wei

    2015-01-01

    The extensive use of antibiotics has caused the contamination of both antibiotics and antibiotic resistance genes (ARGs) in the environment. In this study, the abundance and distribution of antibiotics and ARGs from a sewage treatment plant (STP) and its effluent-receiving river in Beijing China were characterized. Three classes of antibiotics including tetracycline, sulfonamide and quinolone were quantified by LC-MS/MS. In the secondary effluent they were detected at 195, 2001 and 3866 ng L(-1), respectively, which were higher than in the receiving river water. A total of 13 ARGs (6 tet genes: tetA, tetB, tetE, tetW, tetM and tetZ, 3 sulfonamide genes: sul1, sul2 and sul3, and 4 quinolone genes: gryA, parC, qnrC and qnrD) were determined by quantitative PCR. For all ARGs, sulfonamide resistance genes were present at relatively high concentrations in all samples, with the highest ARG concentration above 10(-1). ARGs remained relatively stable along each sewage treatment process. The abundances of detected ARGs from the STP were also higher than its receiving river. Bivariate correlation analysis showed that relative tet gene copies (tetB/16S-rRNA and tetW/16S-rRNA) were strongly correlated with the concentrations of tetracycline residues (r(2)>0.8, pgenes. A negative correlation between the relative abundance of quinolone resistance gene (qnrC/16S-rRNA) and the concentrations of enrofloxacin (ENR) was also determined. The difference of ARGs levels in the raw influent and secondary effluent suggested that the STP treatment process may induce to increase the abundance of resistance genes. The results showed that the sewage was an important repository of the resistance genes, which need to be effectively treated before discharge into the natural water body. Copyright © 2014 Elsevier Ltd. All rights reserved.

  2. Virulence-associated and antibiotic resistance genes of microbial populations in cattle feces analyzed using a metagenomic approach.

    Science.gov (United States)

    Durso, Lisa M; Harhay, Gregory P; Bono, James L; Smith, Timothy P L

    2011-02-01

    The bovine fecal microbiota impacts human food safety as well as animal health. Although the bacteria of cattle feces have been well characterized using culture-based and culture-independent methods, techniques have been lacking to correlate total community composition with community function. We used high throughput sequencing of total DNA extracted from fecal material to characterize general community composition and examine the repertoire of microbial genes present in beef cattle feces, including genes associated with antibiotic resistance and bacterial virulence. Results suggest that traditional 16S sequencing using "universal" primers to generate full-length sequence may under represent Acitinobacteria and Proteobacteria. Over eight percent (8.4%) of the sequences from our beef cattle fecal pool sample could be categorized as virulence genes, including a suite of genes associated with resistance to antibiotic and toxic compounds (RATC). This is a higher proportion of virulence genes found in Sargasso sea, chicken cecum, and cow rumen samples, but comparable to the proportion found in Antarctic marine derived lake, human fecal, and farm soil samples. The quantitative nature of metagenomic data, combined with the large number of RATC classes represented in samples from widely different habitats indicates that metagenomic data can be used to track relative amounts of antibiotic resistance genes in individual animals over time. Consequently, these data can be used to generate sample-specific and temporal antibiotic resistance gene profiles to facilitate an understanding of the ecology of the microbial communities in each habitat as well as the epidemiology of antibiotic resistant gene transport between and among habitats. Published by Elsevier B.V.

  3. Isolation and characterization of NBS-LRR- resistance gene candidates in turmeric (Curcuma longa cv. surama).

    Science.gov (United States)

    Joshi, R K; Mohanty, S; Subudhi, E; Nayak, S

    2010-09-08

    Turmeric (Curcuma longa), an important asexually reproducing spice crop of the family Zingiberaceae is highly susceptible to bacterial and fungal pathogens. The identification of resistance gene analogs holds great promise for development of resistant turmeric cultivars. Degenerate primers designed based on known resistance genes (R-genes) were used in combinations to elucidate resistance gene analogs from Curcuma longa cultivar surama. The three primers resulted in amplicons with expected sizes of 450-600 bp. The nucleotide sequence of these amplicons was obtained through sequencing; their predicted amino acid sequences compared to each other and to the amino acid sequences of known R-genes revealed significant sequence similarity. The finding of conserved domains, viz., kinase-1a, kinase-2 and hydrophobic motif, provided evidence that the sequences belong to the NBS-LRR class gene family. The presence of tryptophan as the last residue of kinase-2 motif further qualified them to be in the non-TIR-NBS-LRR subfamily of resistance genes. A cluster analysis based on the neighbor-joining method was carried out using Curcuma NBS analogs together with several resistance gene analogs and known R-genes, which classified them into two distinct subclasses, corresponding to clades N3 and N4 of non-TIR-NBS sequences described in plants. The NBS analogs that we isolated can be used as guidelines to eventually isolate numerous R-genes in turmeric.

  4. No linkage and association of atopy to chromosome 16 including the interleukin-4 receptor gene

    DEFF Research Database (Denmark)

    Haagerup, A; Bjerke, T; Schiøtz, P O

    2001-01-01

    BACKGROUND: Several susceptibility genes for atopy have been suggested in recent years. Few have been investigated as intensively as the interleukin-4-receptor alpha (IL4Ralpha) gene on chromosome 16. The results remain in dispute. Therefore, in a robust design, we tested for association of type ...

  5. Differential fate of erythromycin and beta-lactam resistance genes from swine lagoon waste under different aquatic conditions

    Energy Technology Data Exchange (ETDEWEB)

    Knapp, Charles W., E-mail: charles.knapp@strath.ac.u [David Livingstone Centre for Sustainability, Department of Civil Engineering, University of Strathclyde, 50 Richmond Street, Glasgow, G1 1XN (United Kingdom); School of Civil Engineering and Geosciences, Newcastle University, Newcastle upon Tyne, NE1 7RU (United Kingdom); Zhang, Wen; Sturm, Belinda S.M. [Department of Civil, Environmental and Architectural Engineering, University of Kansas, Lawrence, KS 66045 (United States); Graham, David W. [School of Civil Engineering and Geosciences, Newcastle University, Newcastle upon Tyne, NE1 7RU (United Kingdom); Department of Civil, Environmental and Architectural Engineering, University of Kansas, Lawrence, KS 66045 (United States)

    2010-05-15

    The attenuation and fate of erythromycin-resistance-methylase (erm) and extended-spectrum beta-lactamse (bla) genes were quantified over time in aquatic systems by adding 20-L swine waste to 11,300-L outdoor mesocosms that simulated receiving water conditions below intensive agricultural operations. The units were prepared with two different light-exposure scenarios and included artificial substrates to assess gene movement into biofilms. Of eleven genes tested, only erm(B), erm(F), bla{sub SHV} and bla{sub TEM} were found in sufficient quantity for monitoring. The genes disappeared rapidly from the water column and first-order water-column disappearance coefficients were calculated. However, detected gene levels became elevated in the biofilms within 2 days, but then disappeared over time. Differences were observed between sunlight and dark treatments and among individual genes, suggesting that ecological and gene-specific factors play roles in the fate of these genes after release into the environment. Ultimately, this information will aid in generating better predictive models for gene fate. - The disappearance and fate of erythromycin-resistance-methylase and beta-lactamase genes were monitored in outdoor mesocosms under different light conditions.

  6. Effect of Chlorine Exposure on the Survival and Antibiotic Gene Expression of Multidrug Resistant Acinetobacter baumannii in Water

    Directory of Open Access Journals (Sweden)

    Deepti Prasad Karumathil

    2014-02-01

    Full Text Available Acinetobacter baumannii is a multidrug resistant pathogen capable of causing a wide spectrum of clinical conditions in humans. Acinetobacter spp. is ubiquitously found in different water sources. Chlorine being the most commonly used disinfectant in water, the study investigated the effect of chlorine on the survival of A. baumannii in water and transcription of genes conferring antibiotic resistance. Eight clinical isolates of A. baumannii, including a fatal meningitis isolate (ATCC 17978 (~108 CFU/mL were separately exposed to free chlorine concentrations (0.2, 1, 2, 3 and 4 ppm with a contact time of 30, 60, 90 and 120 second. The surviving pathogen counts at each specified contact time were determined using broth dilution assay. In addition, real-time quantitative PCR (RT-qPCR analysis of the antibiotic resistance genes (efflux pump genes and those encoding resistance to specific antibiotics of three selected A. baumannii strains following exposure to chlorine was performed. Results revealed that all eight A. baumannii isolates survived the tested chlorine levels during all exposure times (p > 0.05. Additionally, there was an up-regulation of all or some of the antibiotic resistance genes in A. baumannii, indicating a chlorine-associated induction of antibiotic resistance in the pathogen.

  7. Genome Comparison of Erythromycin Resistant Campylobacter from Turkeys Identifies Hosts and Pathways for Horizontal Spread of erm(B Genes

    Directory of Open Access Journals (Sweden)

    Diego Florez-Cuadrado

    2017-11-01

    Full Text Available Pathogens in the genus Campylobacter are the most common cause of food-borne bacterial gastro-enteritis. Campylobacteriosis, caused principally by Campylobacter jejuni and Campylobacter coli, is transmitted to humans by food of animal origin, especially poultry. As for many pathogens, antimicrobial resistance in Campylobacter is increasing at an alarming rate. Erythromycin prescription is the treatment of choice for clinical cases requiring antimicrobial therapy but this is compromised by mobility of the erythromycin resistance gene erm(B between strains. Here, we evaluate resistance to six antimicrobials in 170 Campylobacter isolates (133 C. coli and 37 C. jejuni from turkeys. Erythromycin resistant isolates (n = 85; 81 C. coli and 4 C. jejuni were screened for the presence of the erm(B gene, that has not previously been identified in isolates from turkeys. The genomes of two positive C. coli isolates were sequenced and in both isolates the erm(B gene clustered with resistance determinants against aminoglycosides plus tetracycline, including aad9, aadE, aph(2″-IIIa, aph(3′-IIIa, and tet(O genes. Comparative genomic analysis identified identical erm(B sequences among Campylobacter from turkeys, Streptococcus suis from pigs and Enterococcus faecium and Clostridium difficile from humans. This is consistent with multiple horizontal transfer events among different bacterial species colonizing turkeys. This example highlights the potential for dissemination of antimicrobial resistance across bacterial species boundaries which may compromise their effectiveness in antimicrobial therapy.

  8. Quadruple-first line drug resistance in Mycobacterium tuberculosis in Vietnam: What can we learn from genes?

    Science.gov (United States)

    Nguyen, Huy Quang; Nguyen, Nhung Viet; Contamin, Lucie; Tran, Thanh Hoa Thi; Vu, Thuong Thi; Nguyen, Hung Van; Nguyen, Ngoc Lan Thi; Nguyen, Son Thai; Dang, Anh Duc; Bañuls, Anne-Laure; Nguyen, Van Anh Thi

    2017-06-01

    In Vietnam, a country with high tuberculosis (137/100.000 population) and multidrug-resistant (MDR)-TB burdens (7.8/100.000 population), little is known about the molecular signatures of drug resistance in general and more particularly of second line drug (SLD) resistance. This study is specifically focused on Mycobacterium tuberculosis isolates resistant to four first-line drugs (FLDs) that make TB much more difficult to treat. The aim is to determine the proportion of SLD resistance in these quadruple drug resistant isolates and the genetic determinants linked to drug resistance to better understand the genetic processes leading to quadruple and extremely drug resistance (XDR). 91 quadruple (rifampicin, isoniazid, ethambutol and streptomycin) FLD resistant and 55 susceptible isolates were included. Spoligotyping and 24-locus MIRU-VNTR techniques were performed and 9 genes and promoters linked to FLD and SLD resistance were sequenced. SLD susceptibility testing was carried out on a subsample of isolates. High proportion of quadruple-FLD resistant isolates was resistant to fluoroquinolones (27%) and second-line injectable drugs (30.2%) by drug susceptibility testing. The sequencing revealed high mutation diversity with prevailing mutations at positions katG315, inhA-15, rpoB531, embB306, rrs1401, rpsL43 and gyrA94. The sensitivity and specificity were high for most drug resistances (>86%), but the sensitivity was lower for injectable drug resistances (resistance. Nevertheless, particular mutation patterns linked to high-level resistance and low fitness costs seem to be favored. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Phenotypic and genotypic antimicrobial resistance and virulence genes of Salmonella enterica isolated from pet dogs and cats

    Science.gov (United States)

    Srisanga, Songsak; Angkititrakul, Sunpetch; Sringam, Patcharee; Le Ho, Phuong T.; Vo, An T. T.

    2017-01-01

    Salmonella enterica isolates (n = 122), including 32 serotypes from 113 dogs and 9 cats, were obtained from household dogs (n = 250) and cats (n = 50) during 2012–2015. The isolates were characterized by serotyping, antimicrobial resistance phenotyping and genotyping, and virulence gene screening. Serovars Weltevreden (15.6%) and Typhimurium (13.9%) were the most common. The majority (43%) of the isolates were multidrug resistant. The dog isolates (12.3%) harbored class 1 integrons, of which the dfrA12-aadA2 cassette was most frequent (66.7%). The only class integron in serovar Albany was located on a conjugative plasmid. Two ESBL-producing isolates (i.e., a serovar Krefeld and a serovar Enteritridis) carried blaTEM and blaCTX-M, and the blaTEM gene in both was horizontally transferred. Of the plasmid-mediated quinolone resistance genes tested, only qnrS (4.9%) was detected. Most Salmonella isolates harbored invA (100%), prgH (91.8%), and sipB (91%). Positive associations between resistance and virulence genes were observed for blaPSE-1/orgA, cmlA/spaN, tolC, and sul1/tolC (p resistance and virulence genes and that antimicrobial use in companion animals may select for the examined Salmonella virulence factors. PMID:27586467

  10. Mapping, isolation and characterization of genes responsible for late blight resistance in potato

    NARCIS (Netherlands)

    Pel, M.

    2010-01-01

    Late blight (LB), caused by the oomycete Phytophthora infestans, is one of the most
    devastating diseases on potato. Resistance (R) genes from the wild species Solanum demissum
    have been used by breeders to generate late blight resistant cultivars, but resistance was soon
    overcome

  11. In Silico Assigned Resistance Genes Confer Bifidobacterium with Partial Resistance to Aminoglycosides but Not to Β-Lactams

    Science.gov (United States)

    Fouhy, Fiona; O’Connell Motherway, Mary; Fitzgerald, Gerald F.; Ross, R. Paul; Stanton, Catherine; van Sinderen, Douwe; Cotter, Paul D.

    2013-01-01

    Bifidobacteria have received significant attention due to their contribution to human gut health and the use of specific strains as probiotics. It is thus not surprising that there has also been significant interest with respect to their antibiotic resistance profile. Numerous culture-based studies have demonstrated that bifidobacteria are resistant to the majority of aminoglycosides, but are sensitive to β-lactams. However, limited research exists with respect to the genetic basis for the resistance of bifidobacteria to aminoglycosides. Here we performed an in-depth in silico analysis of putative Bifidobacterium-encoded aminoglycoside resistance proteins and β-lactamases and assess the contribution of these proteins to antibiotic resistance. The in silico-based screen detected putative aminoglycoside and β-lactam resistance proteins across the Bifidobacterium genus. Laboratory-based investigations of a number of representative bifidobacteria strains confirmed that despite containing putative β-lactamases, these strains were sensitive to β-lactams. In contrast, all strains were resistant to the aminoglycosides tested. To assess the contribution of genes encoding putative aminoglycoside resistance proteins in Bifidobacterium sp. two genes, namely Bbr_0651 and Bbr_1586, were targeted for insertional inactivation in B. breve UCC2003. As compared to the wild-type, the UCC2003 insertion mutant strains exhibited decreased resistance to gentamycin, kanamycin and streptomycin. This study highlights the associated risks of relying on the in silico assignment of gene function. Although several putative β-lactam resistance proteins are located in bifidobacteria, their presence does not coincide with resistance to these antibiotics. In contrast however, this approach has resulted in the identification of two loci that contribute to the aminoglycoside resistance of B. breve UCC2003 and, potentially, many other bifidobacteria. PMID:24324818

  12. In silico assigned resistance genes confer Bifidobacterium with partial resistance to aminoglycosides but not to β-lactams.

    Directory of Open Access Journals (Sweden)

    Fiona Fouhy

    Full Text Available Bifidobacteria have received significant attention due to their contribution to human gut health and the use of specific strains as probiotics. It is thus not surprising that there has also been significant interest with respect to their antibiotic resistance profile. Numerous culture-based studies have demonstrated that bifidobacteria are resistant to the majority of aminoglycosides, but are sensitive to β-lactams. However, limited research exists with respect to the genetic basis for the resistance of bifidobacteria to aminoglycosides. Here we performed an in-depth in silico analysis of putative Bifidobacterium-encoded aminoglycoside resistance proteins and β-lactamases and assess the contribution of these proteins to antibiotic resistance. The in silico-based screen detected putative aminoglycoside and β-lactam resistance proteins across the Bifidobacterium genus. Laboratory-based investigations of a number of representative bifidobacteria strains confirmed that despite containing putative β-lactamases, these strains were sensitive to β-lactams. In contrast, all strains were resistant to the aminoglycosides tested. To assess the contribution of genes encoding putative aminoglycoside resistance proteins in Bifidobacterium sp. two genes, namely Bbr_0651 and Bbr_1586, were targeted for insertional inactivation in B. breve UCC2003. As compared to the wild-type, the UCC2003 insertion mutant strains exhibited decreased resistance to gentamycin, kanamycin and streptomycin. This study highlights the associated risks of relying on the in silico assignment of gene function. Although several putative β-lactam resistance proteins are located in bifidobacteria, their presence does not coincide with resistance to these antibiotics. In contrast however, this approach has resulted in the identification of two loci that contribute to the aminoglycoside resistance of B. breve UCC2003 and, potentially, many other bifidobacteria.

  13. The tetracycline resistance determinant Tet 39 and the sulphonamide resistance gene sulII are common among resistant Acinetobacter spp. isolated from integrated fish farms in Thailand

    DEFF Research Database (Denmark)

    Agersø, Yvonne; Petersen, Andreas

    2007-01-01

    Objectives: To determine the genetic basis for tetracycline and sulphonamide resistance and the prevalence of class I and II integrons in oxytetracycline-resistant Acinetobacter spp. from integrated fish farms in Thailand. Methods: A total of 222 isolates were screened for tetracycline resistance...... and Southern blots with sulII and tet(39) probes were performed on selected isolates. Results: The recently identified tetracycline resistance gene tet(39) was demonstrated in 75% (166/222) of oxytetracycline-resistant Acinetobacter spp. from integrated fish farms in Thailand. Isolates that were also...

  14. Incorporation of Bacterial Blight Resistance Genes Into Lowland Rice Cultivar Through Marker-Assisted Backcross Breeding.

    Science.gov (United States)

    Pradhan, Sharat Kumar; Nayak, Deepak Kumar; Pandit, Elssa; Behera, Lambodar; Anandan, Annamalai; Mukherjee, Arup Kumar; Lenka, Srikanta; Barik, Durga Prasad

    2016-07-01

    Bacterial blight (BB) of rice caused by Xanthomonas oryzae pv. oryzae is a major disease of rice in many rice growing countries. Pyramided lines carrying two BB resistance gene combinations (Xa21+xa13 and Xa21+xa5) were developed in a lowland cultivar Jalmagna background through backcross breeding by integrating molecular markers. In each backcross generation, markers closely linked to the disease resistance genes were used to select plants possessing the target genes. Background selection was continued in those plants carrying resistant genes until BC(3) generation. Plants having the maximum contribution from the recurrent parent genome were selected in each generation and hybridized with the recipient parent. The BB-pyramided line having the maximum recipient parent genome recovery of 95% was selected among BC3F1 plants and selfed to isolate homozygous BC(3)F(2) plants with different combinations of BB resistance genes. Twenty pyramided lines with two resistance gene combinations exhibited high levels of tolerance against the BB pathogen. In order to confirm the resistance, the pyramided lines were inoculated with different X. oryzae pv. oryzae strains of Odisha for bioassay. The genotypes with combination of two BB resistance genes conferred high levels of resistance to the predominant X. oryzae pv. oryzae isolates prevalent in the region. The pyramided lines showed similarity with the recipient parent with respect to major agro-morphologic traits.

  15. Molecular Identification and Quantification of Tetracycline and Erythromycin Resistance Genes in Spanish and Italian Retail Cheeses

    Directory of Open Access Journals (Sweden)

    Ana Belén Flórez

    2014-01-01

    Full Text Available Large antibiotic resistance gene pools in the microbiota of foods may ultimately pose a risk for human health. This study reports the identification and quantification of tetracycline- and erythromycin-resistant populations, resistance genes, and gene diversity in traditional Spanish and Italian cheeses, via culturing, conventional PCR, real-time quantitative PCR (qPCR, and denaturing gradient gel electrophoresis (DGGE. The numbers of resistant bacteria varied widely among the antibiotics and the different cheese varieties; in some cheeses, all the bacterial populations seemed to be resistant. Up to eight antibiotic resistance genes were sought by gene-specific PCR, six with respect to tetracycline, that is, tet(K, tet(L, tet(M, tet(O, tet(S, and tet(W, and two with respect to erythromycin, that is, erm(B and erm(F. The most common resistance genes in the analysed cheeses were tet(S, tet(W, tet(M, and erm(B. The copy numbers of these genes, as quantified by qPCR, ranged widely between cheeses (from 4.94 to 10.18log⁡10/g. DGGE analysis revealed distinct banding profiles and two polymorphic nucleotide positions for tet(W-carrying cheeses, though the similarity of the sequences suggests this tet(W to have a monophyletic origin. Traditional cheeses would therefore appear to act as reservoirs for large numbers of many types of antibiotic resistance determinants.

  16. Trueperella pyogenes isolated from dairy cows with endometritis in Inner Mongolia, China: Tetracycline susceptibility and tetracycline-resistance gene distribution.

    Science.gov (United States)

    Zhang, Dexian; Zhao, Jingcui; Wang, Qiuxia; Liu, Yaochuan; Tian, Chunlian; Zhao, Yujun; Yu, Lihui; Liu, Mingchun

    2017-04-01

    Trueperella pyogenes plays a crucial role in endometritis pathogenesis and is also associated with many infections, including metritis, mastitis, arthritis and liver abscessation, in many domestic animals. In this study, we investigated the prevalence of tetracycline resistance in T. pyogenes isolated from dairy cows with endometritis in Inner Mongolia, China, and we assessed tetracycline-resistance gene distribution among the isolates. Our results indicated that 68.7% and 62.5% of the isolates were resistant to tetracycline and doxycycline, respectively, and the rate of resistance to metacycline was 18.8%. The tetracycline resistance gene tetK was present in all isolates (n = 32), whereas the tetM gene was identified in 12.5% and 9.4% of the isolates, in the chromosome and plasmid, respectively. Strains carrying tetW were also common in the chromosome and plasmid, with abundances of 53.1% and 46.9%, respectively. However, tetO and otrA were absent in all isolates. The resistance phenotype analysis indicated that 6.3% of strains were susceptible to all tetracyclines, while 3.1% showed resistance to all tetracyclines. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Effective genes for resistance to stripe rust and virulence of Puccinia ...

    African Journals Online (AJOL)

    The results revealed that stripe rust resistance genes Yr3, Yr5, Yr10, Yr15, Yr26, YrSP and YrCV were resistant, while Yr18 showed moderate susceptibility at all locations. Genes YrA-, Yr2, Yr6, Yr7, Yr8, Yr9, Yr17, Yr27 and gene combinations Opata (Yr27+Yr18) and Super Kauz (Yr9, Yr27, Yr18) were found susceptible.

  18. Genetics and mapping of a new leaf rust resistance gene in Triticum ...

    Indian Academy of Sciences (India)

    Genetic analysis in F1, F2 and F2.3 families at the seedling stage revealed that leaf rust resistance in Selection G12 is conditioned by a single incompletely dominant gene. The leaf rust resistance gene was mapped to chromosome 3BL with SSR markers Xgwm114 and Xgwm547 flanking the gene at a distance of 28.3 cM ...

  19. Genetic mapping of the rice resistance-breaking gene of the brown planthopper Nilaparvata lugens.

    Science.gov (United States)

    Kobayashi, Tetsuya; Yamamoto, Kimiko; Suetsugu, Yoshitaka; Kuwazaki, Seigo; Hattori, Makoto; Jairin, Jirapong; Sanada-Morimura, Sachiyo; Matsumura, Masaya

    2014-07-22

    Host plant resistance has been widely used for controlling the major rice pest brown planthopper (BPH, Nilaparvata lugens). However, adaptation of the wild BPH population to resistance limits the effective use of resistant rice varieties. Quantitative trait locus (QTL) analysis was conducted to identify resistance-breaking genes against the anti-feeding mechanism mediated by the rice resistance gene Bph1. QTL analysis in iso-female BPH lines with single-nucleotide polymorphism (SNP) markers detected a single region on the 10th linkage group responsible for the virulence. The QTL explained from 57 to 84% of the total phenotypic variation. Bulked segregant analysis with next-generation sequencing in F2 progenies identified five SNPs genetically linked to the virulence. These analyses showed that virulence to Bph1 was controlled by a single recessive gene. In contrast to previous studies, the gene-for-gene relationship between the major resistance gene Bph1 and virulence gene of BPH was confirmed. Identified markers are available for map-based cloning of the major gene controlling BPH virulence to rice resistance. © 2014 The Author(s) Published by the Royal Society. All rights reserved.

  20. Coincidence in map positions between pathogen-induced defense-responsive genes and quantitative resistance loci in rice

    Institute of Scientific and Technical Information of China (English)

    熊敏; 王石平; 张启发

    2002-01-01

    Quantitative disease resistance conferred by quantitative trait loci (QTLs) is presumably of wider spectrum and durable. Forty-four cDNA clones, representing 44 defense-responsive genes, were fine mapped to 56 loci distributed on 9 of the 12 rice chromosomes. The locations of 32 loci detected by 27 cDNA clones were associated with previously identified resistance QTLs for different rice diseases, including blast, bacterial blight, sheath blight and yellow mottle virus. The loci detected by the same multiple-copy cDNA clones were frequently located on similar locations of different chromosomes. Some of the multiple loci detected by the same clones were all associated with resistance QTLs. These results suggest that some of the genes may be important components in regulation of defense responses against pathogen invasion and they may be the candidates for studying the mechanism of quantitative disease resistance in rice.

  1. Molecular mapping of the novel powdery mildew resistance gene Pm36 introgressed from Triticum turgidum var. dicoccoides in durum wheat.

    Science.gov (United States)

    Blanco, Antonio; Gadaleta, A; Cenci, A; Carluccio, A V; Abdelbacki, A M M; Simeone, R

    2008-06-01

    Powdery mildew, caused by Blumeria graminis f.sp. tritici, is one of the most important wheat diseases in many regions of the world. Triticum turgidum var. dicoccoides (2n=4x=AABB), the progenitor of cultivated wheats, shows particular promises as a donor of useful genetic variation for several traits, including disease resistances. The wild emmer accession MG29896, resistant to powdery mildew, was backcrossed to the susceptible durum wheat cultivar Latino, and a set of backcross inbred lines (BC(5)F(5)) was produced. Genetic analysis of F(3) populations from two resistant introgression lines (5BIL-29 x Latino and 5BIL-42 x Latino) indicated that the powdery mildew resistance is controlled by a single dominant gene. Molecular markers and the bulked segregant analysis were used to characterize and map the powdery mildew resistance. Five AFLP markers (XP43M32((250)), XP46M31((410)), XP41M37((100)), XP41M39((250)), XP39M32((120))), three genomic SSR markers (Xcfd07, Xwmc75, Xgwm408) and one EST-derived SSR marker (BJ261635) were found to be linked to the resistance gene in 5BIL-29 and only the BJ261635 marker in 5BIL-42. By means of Chinese Spring nullisomic-tetrasomic, ditelosomic and deletion lines, the polymorphic markers and the resistance gene were assigned to chromosome bin 5BL6-0.29-0.76. These results indicated that the two lines had the same resistance gene and that the introgressed dicoccoides chromosome segment was longer (35.5 cM) in 5BIL-29 than that introgressed in 5BIL-42 (less than 1.5 cM). As no powdery mildew resistance gene has been reported on chromosome arm 5BL, the novel resistance gene derived from var. dicoccoides was designated Pm36. The 244 bp allele of BJ261635 in 5BIL-42 can be used for marker-assisted selection during the wheat resistance breeding process for facilitating gene pyramiding.

  2. DETERMINATION OF THE SPECTRUM OF ANTIBIOTIC RESISTANCE GENES HAVE PHENOTYPIC RESISTANT STRAINS OF PARIETAL INTESTINAL MICROBIOTA IN RATS BY RT-PCR

    Directory of Open Access Journals (Sweden)

    Bukina Y.V.

    2016-06-01

    resistance to glycopeptides, particularly vancomycin. Thus, of the 46 strains studied E.faecalis, 10,87% of isolates possessed Van A genes and 8,7% - Van B. Out of 50 studied cultures E.faecium 12% were in their genotype Van A and 4% - Van B. However, the frequency of detection of genes Van A and Van B in E.faecalis strains circulating in Russia, 1,7% and 2,2%, while E.faecium - 9,3% and 11,5% respectively. Bacteria of the family Peptostreptococcaceae these genes were not identified. During the molecular genetic studies we have not detected phenotypically resistant strains that have combined carbapenemases activity. Conclusions. The findings of the research results indicate the presence of carbapenem resistance genes in strains of microorganisms families Enterobacteriaceae, Bacteroidaceae and Pseudomonadaceae (P. aeruginosae, to cephalosporins - Enterobacteriaceae, Bacteroidaceae and Peptostreptococcaceae, vancomycin - from family Enterococcaceae bacteria. Phenotypically resistant strains that have combined carbapenemases activity, not revealed. Despite the wide range of activity of appointment carbapenems, cephalosporins and vancomycin should take into account the results of determination of resistance genes causing resistance to these drugs. It is advisable to creating circulation monitoring program of antibiotic-resistant strains, including those with сarbapenemases activity in humans and in the environment.

  3. Antibacterial and antibiotic resistance modifying activity of the extracts from Allanblackia gabonensis, Combretum molle and Gladiolus quartinianus against Gram-negative bacteria including multi-drug resistant phenotypes.

    Science.gov (United States)

    Fankam, Aimé G; Kuiate, Jules R; Kuete, Victor

    2015-06-30

    Bacterial resistance to antibiotics is becoming a serious problem worldwide. The discovery of new and effective antimicrobials and/or resistance modulators is necessary to tackle the spread of resistance or to reverse the multi-drug resistance. We investigated the antibacterial and antibiotic-resistance modifying activities of the methanol extracts from Allanblackia gabonensis, Gladiolus quartinianus and Combretum molle against 29 Gram-negative bacteria including multi-drug resistant (MDR) phenotypes. The broth microdilution method was used to determine the minimal inhibitory concentrations (MIC) and minimal bactericidal concentrations (MBC) of the samples meanwhile the standard phytochemical methods were used for the preliminary phytochemical screening of the plant extracts. Phytochemical analysis showed the presence of alkaloids, flavonoids, phenols and tannins in all studied extracts. Other chemical classes of secondary metabolites were selectively presents. Extracts from A. gabonensis and C. molle displayed a broad spectrum of activity with MICs varying from 16 to 1024 μg/mL against about 72.41% of the tested bacteria. The extract from the fruits of A. gabonensis had the best activity, with MIC values below 100 μg/mL on 37.9% of tested bacteria. Percentages of antibiotic-modulating effects ranging from 67 to 100% were observed against tested MDR bacteria when combining the leaves extract from C. molle (at MIC/2 and MIC/4) with chloramphenicol, kanamycin, streptomycin and tetracycline. The overall results of the present study provide information for the possible use of the studied plant, especially Allanblackia gabonensis and Combretum molle in the control of Gram-negative bacterial infections including MDR species as antibacterials as well as resistance modulators.

  4. Mapping and characterization of wheat stem rust resistance genes SrTm5 and Sr60 from Triticum monococcum

    Science.gov (United States)

    The emergence and spread of new virulent races of the wheat stem rust pathogen (Puccinia graminis f. sp. tritici; Pgt), including the TTKSK (Ug99) race group, is a serious threat to global wheat production. In this study, we mapped and characterized two stem rust resistance genes from diploid wheat ...

  5. Characterization of resistance to tetracyclines and aminoglycosides of sheep mastitis pathogens: study of the effect of gene content on resistance.

    Science.gov (United States)

    Lollai, S A; Ziccheddu, M; Duprè, I; Piras, D

    2016-10-01

    Mastitis causes economic losses and antimicrobials are frequently used for mastitis treatment. Antimicrobial resistance surveys are still rare in the ovine field and characterization of strains is important in order to acquire information about resistance and for optimization of therapy. Bacterial pathogens recovered in milk samples from mastitis-affected ewes were characterized for resistance to tetracyclines and aminoglycosides, members of which are frequently used antimicrobials in small ruminants. A total of 185 strains of staphylococci, streptococci, and enterococci, common mastitis pathogens, were tested for minimal inhibitory concentration (MIC) to tetracycline, doxycycline, minocycline, gentamicin, kanamycin, streptomycin, and for resistance genes by PCR. Effects of different tet genes arrangements on MICs were also investigated. Staphylococci expressed the lowest MIC for tetracycline and tet(K) was the most common gene recovered; tet(M) and tet(O) were also found. Gene content was shown to influence the tetracycline MIC values. Enterococci and streptococci showed higher MICs to tetracyclines and nonsusceptible strains always harboured at least one ribosomal protection gene (MIC above 8 μg ml(-1) ). Streptococci often harboured two or more tet determinants. As regards the resistance to aminoglycosides, staphylococci showed the lowest gentamicin and kanamycin median MIC along with streptomycin high level resistant (HLR) strains (MIC >1024 μg ml(-1) ) all harbouring str gene. The resistance determinant aac(6')-Ie-aph(2″)-Ia was present in few strains. Streptococci were basically nonsusceptible to aminoglycosides but neither HLR isolates nor resistance genes were detected. Enterococci revealed the highest MICs for gentamicin; two str harbouring isolates were shown to be HLR to streptomycin. Evidence was obtained for the circulation of antimicrobial-resistant strains and genes in sheep dairy farming. Tetracycline MIC of 64 μg ml(-1) and high

  6. RNAi validation of resistance genes and their interactions in the highly DDT-resistant 91-R strain of Drosophila melanogaster.

    Science.gov (United States)

    Gellatly, Kyle J; Yoon, Kyong Sup; Doherty, Jeffery J; Sun, Weilin; Pittendrigh, Barry R; Clark, J Marshall

    2015-06-01

    4,4'-dichlorodiphenyltrichloroethane (DDT) has been re-recommended by the World Health Organization for malaria mosquito control. Previous DDT use has resulted in resistance, and with continued use resistance will increase in terms of level and extent. Drosophila melanogaster is a model dipteran that has many available genetic tools, numerous studies done on insecticide resistance mechanisms, and is related to malaria mosquitoes allowing for extrapolation. The 91-R strain of D. melanogaster is highly resistant to DDT (>1500-fold), however, there is no mechanistic scheme that accounts for this level of resistance. Recently, reduced penetration, increased detoxification, and direct excretion have been identified as resistance mechanisms in the 91-R strain. Their interactions, however, remain unclear. Use of UAS-RNAi transgenic lines of D. melanogaster allowed for the targeted knockdown of genes putatively involved in DDT resistance and has validated the role of several cuticular proteins (Cyp4g1 and Lcp1), cytochrome P450 monooxygenases (Cyp6g1 and Cyp12d1), and ATP binding cassette transporters (Mdr50, Mdr65, and Mrp1) involved in DDT resistance. Further, increased sensitivity to DDT in the 91-R strain after intra-abdominal dsRNA injection for Mdr50, Mdr65, and Mrp1 was determined by a DDT contact bioassay, directly implicating these genes in DDT efflux and resistance. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. Detection and Characterizations of Genes Resistant to Tetracycline and Sulfa among the Bacteria in Mariculture Water

    Science.gov (United States)

    Qu, L.; Li, Y.; Zhu, P.

    2013-12-01

    One hundred and thirty-five bacteria from maricultural environments were tested for sensitivity to tetracycline and sulfa. Result show that 72% of the bacteria were sulfa-resistant, 36% of the bacteria were tetracycline-resistant, and 16.5% of bacteria showed resistance to both tetracyclines and sulfa ,indicating that the proportion of sulfa and tetracycline resistance bacteria isvery large in the maricultural environments. PCR methods were used to detect if these resistant bacteria carry tetracycline and sulfa resistance genes. Out of the 33 tetracycline-resistant bacteria screened, 3 were positive for tetA, 6 were positive for tetB and no isolate wasboth positive for tetA and tetB. Of the 97 sulfa-resistant bacteria screened, 9 were positive for sul2, 6 were positive for sul1, 1 isolate was positive for bothsul1 and sul2. The minimum inhibitory concentration (MIC) of tetracycline for tetA-carrying isolates were higher than those tetB-carrying isolates.while The MIC of sulfa for sul2-carrying isolates were higher than those sul1-carrying isolates. Indicating that tetA and sul2 gene may play ubknown roles in resisting tetracycline and sulfa than tetB and sul1 genes. The results showed the 4 kinds of genes (tetA,tetB,sul1,sul2) has no host specificity. All these 16S sequence are from the isolates which are positive for the above genes, it indicated the above antibiotic resistance genes are widespread in the environment regardless of the host. While the DNA sequence of these four genes showed tetA, sul1, sul2 genes are conservative in different bacteria , etB gene conserved poorly. The research aim is to get a preliminary understanding of resistance mechanism related to the resistant bacteria and the resistance genes in marine aquaculture environment through the analysis of resistant genes, providing research base for the prevention and treatment of drug-resistant bacteria so as to reduce the threat to the ecological environment, aquaculture and human health.

  8. Integrative Analysis of Gene Expression Data Including an Assessment of Pathway Enrichment for Predicting Prostate Cancer

    Directory of Open Access Journals (Sweden)

    Pingzhao Hu

    2006-01-01

    Full Text Available Background: Microarray technology has been previously used to identify genes that are differentially expressed between tumour and normal samples in a single study, as well as in syntheses involving multiple studies. When integrating results from several Affymetrix microarray datasets, previous studies summarized probeset-level data, which may potentially lead to a loss of information available at the probe-level. In this paper, we present an approach for integrating results across studies while taking probe-level data into account. Additionally, we follow a new direction in the analysis of microarray expression data, namely to focus on the variation of expression phenotypes in predefined gene sets, such as pathways. This targeted approach can be helpful for revealing information that is not easily visible from the changes in the individual genes. Results: We used a recently developed method to integrate Affymetrix expression data across studies. The idea is based on a probe-level based test statistic developed for testing for differentially expressed genes in individual studies. We incorporated this test statistic into a classic random-effects model for integrating data across studies. Subsequently, we used a gene set enrichment test to evaluate the significance of enriched biological pathways in the differentially expressed genes identified from the integrative analysis. We compared statistical and biological significance of the prognostic gene expression signatures and pathways identified in the probe-level model (PLM with those in the probeset-level model (PSLM. Our integrative analysis of Affymetrix microarray data from 110 prostate cancer samples obtained from three studies reveals thousands of genes significantly correlated with tumour cell differentiation. The bioinformatics analysis, mapping these genes to the publicly available KEGG database, reveals evidence that tumour cell differentiation is significantly associated with many

  9. Mutations inside rifampicin-resistance determining region of rpoB gene associated with rifampicin-resistance in Mycobacterium tuberculosis.

    Science.gov (United States)

    Zaw, Myo T; Emran, Nor A; Lin, Zaw

    2018-04-26

    Rifampicin (RIF) plays a pivotal role in the treatment of tuberculosis due to its bactericidal effects. Because the action of RIF is on rpoB gene encoding RNA polymerase β subunit, 95% of RIF resistant mutations are present in rpoB gene. The majority of the mutations in rpoB gene are found within an 81bp RIF-resistance determining region (RRDR). Literatures on RIF resistant mutations published between 2010 and 2016 were thoroughly reviewed. The most commonly mutated codons in RRDR of rpoB gene are 531, 526 and 516. The possibilities of absence of mutation in RRDR of rpoB gene in MDR-TB isolates in few studies was due to existence of other rare rpoB mutations outside RRDR or different mechanism of rifampicin resistance. Molecular methods which can identify extensive mutations associated with multiple anti-tuberculous drugs are in urgent need so that the research on drug resistant mutations should be extended. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  10. Amino acid substitutions in the thymidine kinase gene of induced acyclovir-resistant herpes simplex virus type 1

    Science.gov (United States)

    Hussin, Ainulkhir; Nor, Norefrina Shafinaz Md; Ibrahim, Nazlina

    2013-11-01

    Acyclovir (ACV) is an antiviral drug of choice in healthcare setting to treat infections caused by herpes viruses, including, but not limited to genital herpes, cold sores, shingles and chicken pox. Acyclovir resistance has emerged significantly due to extensive use and misuse of this antiviral in human, especially in immunocompromised patients. However, it remains unclear about the amino acid substitutions in thymidine (TK) gene, which specifically confer the resistance-associated mutation in herpes simplex virus. Hence, acyclovir-resistant HSV-1 was selected at high concentration (2.0 - 4.5 μg/mL), and the TK-gene was subjected to sequencing and genotypic characterization. Genotypic sequences comparison was done using HSV-1 17 (GenBank Accesion no. X14112) for resistance-associated mutation determination whereas HSV-1 KOS, HSV-1 473/08 and HSV clinical isolates sequences were used for polymorphism-associated mutation. The result showed that amino acid substitutions at the non-conserved region (UKM-1: Gln34Lys, UKM-2: Arg32Ser & UKM-5: Arg32Cys) and ATP-binding site (UKM-3: Tyr53End & UKM-4: Ile54Leu) of the TK-gene. These discoveries play an important role to extend another dimension to the evolution of acyclovir-resistant HSV-1 and suggest that selection at high ACV concentration induced ACV-resistant HSV-1 evolution. These findings also expand the knowledge on the type of mutations among acyclovir-resistant HSV-1. In conclusion, HSV-1 showed multiple strategies to exhibit acyclovir resistance, including amino acid substitutions in the TK gene.

  11. Transcriptome analysis highlights defense and signaling pathways mediated by rice pi21 gene with partial resistance to Magnaporthe oryzae

    Directory of Open Access Journals (Sweden)

    Yu Zhang

    2016-12-01

    Full Text Available Rice blast disease is one of the most destructive rice diseases worldwide. The pi21 gene confers partial and durable resistance to Magnaporthe oryzae. However, little is known regarding the molecular mechanisms of resistance mediated by the loss-of-function of Pi21. In this study, comparative transcriptome profiling of the Pi21-RNAi transgenic rice line and Nipponbare with M. oryzae infection at different time points (0, 12, 24, 48, and 72 hpi were investigated using RNA sequencing. The results generated 43,222 unique genes mapped to the rice genome. In total, 1,109 differentially expressed genes (DEGs were identified between the Pi21-RNAi line and Nipponbare with M. oryzae infection, with 103, 281, 209, 69, and 678 DEGs at 0, 12, 24, 48, and 72 hpi, respectively. Functional analysis showed that most of the DEGs were involved in metabolism, transport, signaling, and defense. Among the genes assigned to plant–pathogen interaction, we identified 43 receptor kinase genes associated with pathogen-associated molecular pattern recognition and calcium ion influx. The expression levels of brassinolide-insensitive 1, flagellin sensitive 2 and elongation factor Tu receptor, ethylene (ET biosynthesis and signaling genes, were higher in the Pi21-RNAi line than Nipponbare. This suggested that there was a more robust PTI response in Pi21-RNAi plants and that ET signaling was important to rice blast resistance. We also identified 53 transcription factor genes, including WRKY, NAC, DOF, and ERF families that show differential expression between the two genotypes. This study highlights possible candidate genes that may serve a function in the partial rice blast resistance mediated by the loss-of-function of Pi21 and increase our understanding of the molecular mechanisms involved in partial resistance against M. oryzae.

  12. Thyroid profiles in a patient with resistance to thyroid hormone and episodes of thyrotoxicosis, including repeated painless thyroiditis.

    Science.gov (United States)

    Taniyama, Matsuo; Otsuka, Fumiko; Tozaki, Teruaki; Ban, Yoshiyuki

    2013-07-01

    Thyrotoxic disease can be difficult to recognize in patients with resistance to thyroid hormone (RTH) because the clinical symptoms of thyrotoxicosis cannot be observed, and thyrotropin (TSH) may not be suppressed because of hormone resistance. Painless thyroiditis is a relatively common cause of thyrotoxicosis, but its occurrence in RTH has not been reported. We assessed the thyroid profile in a patient with RTH and episodes of thyrotoxicosis who experienced repeated painless thyroiditis. A 44-year-old Japanese woman with RTH, which was confirmed by the presence of a P453A mutation in the thyroid hormone receptor β (TRβ) gene, showed a slight elevation of the basal levels of thyroid hormones, which indicated that her pituitary RTH was mild. She experienced a slight exacerbation of hyperthyroxinemia concomitant with TSH suppression. A diagnosis of painless thyroiditis was made because of the absence of TSH receptor antibodies, low Tc-99m pertechnetate uptake by the thyroid gland, and transient suppression followed by a slight elevation of TSH following the elevation of thyroid hormones. The patient's complaints of general malaise and occasional palpitations did not change throughout the course of painless thyroiditis. Three years later, painless thyroiditis occurred again without any deterioration of the clinical manifestations. Mild pituitary RTH can be overcome by slight exacerbation of hyperthyroxinemia during mild thyrotoxicosis. When pituitary resistance is severe and TSH is not suppressed, thyrotoxicosis may be overlooked.

  13. Gene Expression Profiling of Cecropin B-Resistant Haemophilus parasuis

    NARCIS (Netherlands)

    Wang, Chunmei; Chen, Fangzhou; Hu, Han; Li, Wentao; Wang, Yang; Chen, Pin; Liu, Yingyu; Ku, Xugang; He, Qigai; Chen, Huanchun; Xue, Feiqun

    2014-01-01

    Synthetically designed antimicrobial peptides (AMPs) present the potential of replacing antibiotics in the treatment of bacterial infections. However, microbial resistance to AMPs has been reported and little is known regarding the underlying mechanism of such resistance. The naturally occurring AMP

  14. PCR detection of indicator genes in methicillin-resistant ...

    African Journals Online (AJOL)

    MRSA) isolated from three Saudi hospitals. ... Resistance towards eight antimicrobial agents revealed that most of the tested strains of Staphylococcus aureus showed resistance to the tested antimicrobials in the following order; Oxacillin 100% ...

  15. The LBP Gene and Its Association with Resistance to Aeromonas hydrophila in Tilapia

    Directory of Open Access Journals (Sweden)

    Gui Hong Fu

    2014-12-01

    Full Text Available Resistance to pathogens is important for the sustainability and profitability of food fish production. In immune-related genes, the lipopolysaccharide-binding protein (LBP gene is an important mediator of the inflammatory reaction. We analyzed the cDNA and genomic structure of the LBP gene in tilapia. The full-length cDNA (1901 bp of the gene contained a 1416 bp open reading frame, encoding 471 amino acid residues. Its genomic sequence was 5577 bp, comprising 15 exons and 14 introns. Under normal conditions, the gene was constitutively expressed in all examined tissues. The highest expression was detected in intestine and kidney. We examined the responses of the gene to challenges with two bacterial pathogens Streptcoccus agalactiae and Aeromonas hydrophila. The gene was significantly upregulated in kidney and spleen post-infection with S. agalactiae and A. hydrophila, respectively. However, the expression profiles of the gene after the challenge with the two pathogens were different. Furthermore, we identified three SNPs in the gene. There were significant associations (p < 0.05 of two of the three SNPs with the resistance to A. hydrophila, but not with the resistance to S. agalactiae or growth performance. These results suggest that the LBP gene is involved in the acute-phase immunologic response to the bacterial infections, and the responses to the two bacterial pathogens are different. The two SNPs associated with the resistance to A. hydrophila may be useful in the selection of tilapia resistant to A. hydrophila.

  16. Including dietary fiber and resistant starch to increase satiety and reduce aggression in gestating sows

    Science.gov (United States)

    The swine industry is under a great deal of pressure to return sows to group housing. However, aggression during mixing of pregnant sows impacts sow welfare and productivity. The aim of this study was to increase satiety and reduce aggression by including dietary fiber and fermentable carbohydrate. ...

  17. Detection and coexistence of six categories of resistance genes in Escherichia coli strains from chickens in Anhui Province, China

    Directory of Open Access Journals (Sweden)

    Lin Li

    2015-12-01

    Full Text Available The aim of this study was to characterise the prevalence of class 1 integrons and gene cassettes, tetracycline-resistance genes, phenicol-resistance genes, 16S rRNA methylase genes, extended-spectrum β-lactamase genes and plasmid-mediated fluoroquinolone resistance determinants in 184 Escherichia coli isolates from chickens in Anhui Province, China. Susceptibility to 15 antimicrobials was determined using broth micro-dilution. Polymerase chain reaction and DNA sequencing were used to characterise the molecular basis of the antibiotic resistance. High rates of antimicrobial resistance were observed; 131 out of the 184 (72.3% isolates were resistant to at least six antimicrobial agents. The prevalences of class 1 integrons, tetracycline-resistance genes, phenicol-resistance genes, 16S rRNA methylase genes, extended-spectrum β-lactamase genes and plasmid-mediated fluoroquinolone resistance determinants were 49.5, 17.4, 15.8, 0.5, 57.6 and 46.2%, respectively. In 82 isolates, 48 different kinds of coexistence of the different genes were identified. Statistical (χ2 analysis showed that the resistance to amoxicillin, doxycycline, florfenicol, ofloxacin and gentamicin had significant differences (P<0.01 or 0.01resistance genes, which showed a certain correlation between antimicrobial resistance and the presence of resistance genes.

  18. Antimicrobial resistance and resistance genes in Salmonella strains isolated from broiler chickens along the slaughtering process in China.

    Science.gov (United States)

    Zhu, Yuanting; Lai, Haimei; Zou, Likou; Yin, Sheng; Wang, Chengtao; Han, Xinfeng; Xia, Xiaolong; Hu, Kaidi; He, Li; Zhou, Kang; Chen, Shujuan; Ao, Xiaolin; Liu, Shuliang

    2017-10-16

    A total of 189 Salmonella isolates were recovered from 627 samples which were collected from cecal contents of broilers, chicken carcasses, chicken meat after cutting step and frozen broiler chicken products along the slaughtering process at a slaughterhouse in Sichuan province of China. The Salmonella isolates were subjected to antimicrobial susceptibility testing to 10 categories of antimicrobial agents using the Kirby-Bauer disk diffusion method. Those antibiotics-resistant isolates were further investigated for the occurrence of resistance genes, the presence of class 1 integron as well as the associated gene cassettes, and the mutations within the gyrA and parC genes. Consequently, the prevalence of Salmonella was 30.14% (47.96% for cecal content, 18.78% for chicken carcasses, 31.33% for cutting meat and 14.00% for frozen meat, respectively). The predominant serotypes were S. Typhimurium (15.34%) and S. Enteritidis (69.84%). High resistance rates to the following drugs were observed: nalidixic acid (99.5%), ampicillin (87.8%), tetracycline (51.9%), ciprofloxacin (48.7%), trimethoprim/sulfamethoxazole (48.1%), and spectinomycin (34.4%). Antimicrobial resistance profiling showed that 60.8% of isolates were multidrug resistant (MDR), and MDR strains increased from 44.7% to 78.6% along the slaughtering line. 94.6% (n=157) of beta-lactam-resistant isolates harbored at least one resistance gene of bla TEM or bla CTX-M . The relatively low prevalence of aminoglycoside resistance genes (aac(3)-II, aac(3)-IV, and ant(2″)-I) was found in 49 (66.2%) of antibiotic-resistant isolates. The tetracycline resistance genes (tet(A), tet(B), tet(C), and tet(G) and sulfonamide resistance genes (sul1, sul2, and sul3) were identified in 84 (85.7%) and 89 (97.8%) antibiotic-resistant isolates respectively. floR was identified in 44 (97.8%) florfenicol-resistant isolates. Class 1 integron was detected in 37.4% (n=43) of the MDR isolates. Two different gene cassettes, bla OXA-30 -aad

  19. Cloning and characterization of NBS-LRR resistance gene ...

    African Journals Online (AJOL)

    Nendran) cultivar. C6 was expressed only in resistant cultivar not in susceptible one. But there was no change in the expression of C2 and C3 in both resistant and susceptible cultivars. These results indicate that in depth study on C1, and C5 RGAs will be helpful for further improvement of P. coffeae resistance in banana.

  20. Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants

    Science.gov (United States)

    Somerville, Chris R [Portola Valley, CA; Scheible, Wolf [Golm, DE

    2007-07-10

    Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  1. An aureobasidin A resistance gene isolated from Aspergillus is a homolog of yeast AUR1, a gene responsible for inositol phosphorylceramide (IPC) synthase activity.

    Science.gov (United States)

    Kuroda, M; Hashida-Okado, T; Yasumoto, R; Gomi, K; Kato, I; Takesako, K

    1999-03-01

    The AUR1 gene of Saccharomyces cerevisiae, mutations in which confer resistance to the antibiotic aureobasidin A, is necessary for inositol phosphorylceramide (IPC) synthase activity. We report the molecular cloning and characterization of the Aspergillus nidulans aurA gene, which is homologous to AUR1. A single point mutation in the aurA gene of A. nidulans confers a high level of resistance to aureobasidin A. The A. nidulans aurA gene was used to identify its homologs in other Aspergillus species, including A. fumigatus, A. niger, and A. oryzae. The deduced amino acid sequence of an aurA homolog from the pathogenic fungus A. fumigatus showed 87% identity to that of A. nidulans. The AurA proteins of A. nidulans and A. fumigatus shared common characteristics in primary structure, including sequence, hydropathy profile, and N-glycosylation sites, with their S. cerevisiae, Schizosaccharomyces pombe, and Candida albicans counterparts. These results suggest that the aureobasidin resistance gene is conserved evolutionarily in various fungi.

  2. A maize resistance gene functions against bacterial streak disease in rice.

    Science.gov (United States)

    Zhao, Bingyu; Lin, Xinghua; Poland, Jesse; Trick, Harold; Leach, Jan; Hulbert, Scot

    2005-10-25

    Although cereal crops all belong to the grass family (Poacea), most of their diseases are specific to a particular species. Thus, a given cereal species is typically resistant to diseases of other grasses, and this nonhost resistance is generally stable. To determine the feasibility of transferring nonhost resistance genes (R genes) between distantly related grasses to control specific diseases, we identified a maize R gene that recognizes a rice pathogen, Xanthomonas oryzae pv. oryzicola, which causes bacterial streak disease. Bacterial streak is an important disease of rice in Asia, and no simply inherited sources of resistance have been identified in rice. Although X. o. pv. oryzicola does not cause disease on maize, we identified a maize gene, Rxo1, that conditions a resistance reaction to a diverse collection of pathogen strains. Surprisingly, Rxo1 also controls resistance to the unrelated pathogen Burkholderia andropogonis, which causes bacterial stripe of sorghum and maize. The same gene thus controls resistance reactions to both pathogens and nonpathogens of maize. Rxo1 has a nucleotide-binding site-leucine-rich repeat structure, similar to many previously identified R genes. Most importantly, Rxo1 functions after transfer as a transgene to rice, demonstrating the feasibility of nonhost R gene transfer between cereals and providing a valuable tool for controlling bacterial streak disease.

  3. Characterization of Antimicrobial Resistance Patterns and Detection of Virulence Genes in Campylobacter Isolates in Italy

    Science.gov (United States)

    Di Giannatale, Elisabetta; Di Serafino, Gabriella; Zilli, Katiuscia; Alessiani, Alessandra; Sacchini, Lorena; Garofolo, Giuliano; Aprea, Giuseppe; Marotta, Francesca

    2014-01-01

    Campylobacter has developed resistance to several antimicrobial agents over the years, including macrolides, quinolones and fluoroquinolones, becoming a significant public health hazard. A total of 145 strains derived from raw milk, chicken faeces, chicken carcasses, cattle faeces and human faeces collected from various Italian regions, were screened for antimicrobial susceptibility, molecular characterization (SmaI pulsed-field gel electrophoresis) and detection of virulence genes (sequencing and DNA microarray analysis). The prevalence of C. jejuni and C. coli was 62.75% and 37.24% respectively. Antimicrobial susceptibility revealed a high level of resistance for ciprofloxacin (62.76%), tetracycline (55.86%) and nalidixic acid (55.17%). Genotyping of Campylobacter isolates using PFGE revealed a total of 86 unique SmaI patterns. Virulence gene profiles were determined using a new microbial diagnostic microarray composed of 70-mer oligonucleotide probes targeting genes implicated in Campylobacter pathogenicity. Correspondence between PFGE and microarray clusters was observed. Comparisons of PFGE and virulence profiles reflected the high genetic diversity of the strains examined, leading us to speculate different degrees of pathogenicity inside Campylobacter populations. PMID:24556669

  4. Characterization of Antibiotic Resistance Genes from Lactobacillus Isolated from Traditional Dairy Products.

    Science.gov (United States)

    Guo, Huiling; Pan, Lin; Li, Lina; Lu, Jie; Kwok, Laiyu; Menghe, Bilige; Zhang, Heping; Zhang, Wenyi

    2017-03-01

    Lactobacilli are widely used as starter cultures or probiotics in yoghurt, cheese, beer, wine, pickles, preserved food, and silage. They are generally recognized as safe (GRAS). However, recent studies have shown that some lactic acid bacteria (LAB) strains carry antibiotic resistance genes and are resistant to antibiotics. Some of them may even transfer their intrinsic antibiotic resistance genes to other LAB or pathogens via horizontal gene transfer, thus threatening human health. A total of 33 Lactobacillus strains was isolated from fermented milk collected from different areas of China. We analyzed (1) their levels of antibiotic resistance using a standardized dilution method, (2) their antibiotic resistance gene profiles by polymerase chain reaction (PCR) using gene-specific primers, and (3) the transferability of some of the detected resistance markers by a filter mating assay. All Lactobacillus strains were found to be resistant to vancomycin, but susceptible to gentamicin, linezolid, neomycin, erythromycin, and clindamycin. Their susceptibilities to tetracycline, kanamycin, ciprofloxacin, streptomycin, quinupristin/dalfopristin, trimethoprim, ampicillin, rifampicin, and chloramphenicol was different. Results from our PCR analysis revealed 19 vancomycin, 10 ciprofloxacin, and 1 tetracycline-resistant bacteria that carried the van(X), van(E), gyr(A), and tet(M) genes, respectively. Finally, no transferal of the monitored antibiotic resistance genes was observed in the filter mating assay. Taken together, our study generated the antibiotic resistance profiles of some milk-originated lactobacilli isolates and preliminarily assessed their risk of transferring antibiotic gene to other bacteria. The study may provide important data concerning the safe use of LAB. © 2017 Institute of Food Technologists®.

  5. RNA-Seq analysis reveals candidate genes for ontogenic resistance in Malus-Venturia pathosystem.

    Directory of Open Access Journals (Sweden)

    Michele Gusberti

    Full Text Available Ontogenic scab resistance in apple leaves and fruits is a horizontal resistance against the plant pathogen Venturia inaequalis and is expressed as a decrease in disease symptoms and incidence with the ageing of the leaves. Several studies at the biochemical level tried to unveil the nature of this resistance; however, no conclusive results were reported. We decided therefore to investigate the genetic origin of this phenomenon by performing a full quantitative transcriptome sequencing and comparison of young (susceptible and old (ontogenic resistant leaves, infected or not with the pathogen. Two time points at 72 and 96 hours post-inoculation were chosen for RNA sampling and sequencing. Comparison between the different conditions (young and old leaves, inoculated or not should allow the identification of differentially expressed genes which may represent different induced plant defence reactions leading to ontogenic resistance or may be the cause of a constitutive (uninoculated with the pathogen shift toward resistance in old leaves. Differentially expressed genes were then characterised for their function by homology to A. thaliana and other plant genes, particularly looking for genes involved in pathways already suspected of appertaining to ontogenic resistance in apple or other hosts, or to plant defence mechanisms in general. IN THIS WORK, FIVE CANDIDATE GENES PUTATIVELY INVOLVED IN THE ONTOGENIC RESISTANCE OF APPLE WERE IDENTIFIED: a gene encoding an "enhanced disease susceptibility 1 protein" was found to be down-regulated in both uninoculated and inoculated old leaves at 96 hpi, while the other four genes encoding proteins (metallothionein3-like protein, lipoxygenase, lipid transfer protein, and a peroxidase 3 were found to be constitutively up-regulated in inoculated and uninoculated old leaves. The modulation of the five candidate genes has been validated using the real-time quantitative PCR. Thus, ontogenic resistance may be the result

  6. Human Activity Determines the Presence of Integron-Associated and Antibiotic Resistance Genes in Southwestern British Columbia

    Directory of Open Access Journals (Sweden)

    Miguel I. Uyaguari-Díaz

    2018-05-01

    Full Text Available The dissemination of antibiotic resistant bacteria from anthropogenic sources into the environment poses an emerging public health threat. Antibiotic resistance genes (ARGs and gene-capturing systems such as integron-associated integrase genes (intI play a key role in alterations of microbial communities and the spread of antibiotic resistant bacteria into the environment. In order to assess the effect of anthropogenic activities on watersheds in southwestern British Columbia, the presence of putative antibiotic resistance and integrase genes was analyzed in the microbiome of agricultural, urban influenced, and protected watersheds. A metagenomics approach and high-throughput quantitative PCR (HT qPCR were used to screen for elements of resistance including ARGs and intI. Metagenomic sequencing of bacterial genomic DNA was used to characterize the resistome of microbial communities present in watersheds over a 1-year period. There was a low prevalence of ARGs relative to the microbial population (<1%. Analysis of the metagenomic sequences detected a total of 60 elements of resistance including 46 ARGs, intI1, and groEL/intI1 genes and 12 quaternary ammonium compounds (qac resistance genes across all watershed locations. The relative abundance and richness of ARGs was found to be highest in agriculture impacted watersheds compared to urban and protected watersheds. A downstream transport pattern was observed in the impacted watersheds (urban and agricultural during dry months. Similar to other reports, this study found a strong association between intI1 and ARGs (e.g., sul1, an association which may be used as a proxy for anthropogenic activities. Chemical analysis of water samples for three major groups of antibiotics was below the detection limit. However, the high richness and gene copy numbers (GCNs of ARGs in impacted sites suggest that the effects of effluents on microbial communities are occurring even at low concentrations of

  7. Human Activity Determines the Presence of Integron-Associated and Antibiotic Resistance Genes in Southwestern British Columbia.

    Science.gov (United States)

    Uyaguari-Díaz, Miguel I; Croxen, Matthew A; Luo, Zhiyao; Cronin, Kirby I; Chan, Michael; Baticados, Waren N; Nesbitt, Matthew J; Li, Shaorong; Miller, Kristina M; Dooley, Damion; Hsiao, William; Isaac-Renton, Judith L; Tang, Patrick; Prystajecky, Natalie

    2018-01-01

    The dissemination of antibiotic resistant bacteria from anthropogenic sources into the environment poses an emerging public health threat. Antibiotic resistance genes (ARGs) and gene-capturing systems such as integron-associated integrase genes ( intI ) play a key role in alterations of microbial communities and the spread of antibiotic resistant bacteria into the environment. In order to assess the effect of anthropogenic activities on watersheds in southwestern British Columbia, the presence of putative antibiotic resistance and integrase genes was analyzed in the microbiome of agricultural, urban influenced, and protected watersheds. A metagenomics approach and high-throughput quantitative PCR (HT qPCR) were used to screen for elements of resistance including ARGs and intI . Metagenomic sequencing of bacterial genomic DNA was used to characterize the resistome of microbial communities present in watersheds over a 1-year period. There was a low prevalence of ARGs relative to the microbial population (<1%). Analysis of the metagenomic sequences detected a total of 60 elements of resistance including 46 ARGs, intI1 , and groEL/ intI1 genes and 12 quaternary ammonium compounds ( qac ) resistance genes across all watershed locations. The relative abundance and richness of ARGs was found to be highest in agriculture impacted watersheds compared to urban and protected watersheds. A downstream transport pattern was observed in the impacted watersheds (urban and agricultural) during dry months. Similar to other reports, this study found a strong association between intI1 and ARGs (e.g., sul1 ), an association which may be used as a proxy for anthropogenic activities. Chemical analysis of water samples for three major groups of antibiotics was below the detection limit. However, the high richness and gene copy numbers (GCNs) of ARGs in impacted sites suggest that the effects of effluents on microbial communities are occurring even at low concentrations of antimicrobials

  8. Gene Expression Analysis of Plum pox virus (Sharka Susceptibility/Resistance in Apricot (Prunus armeniaca L..

    Directory of Open Access Journals (Sweden)

    Manuel Rubio

    Full Text Available RNA-Seq has proven to be a very powerful tool in the analysis of the Plum pox virus (PPV, sharka disease/Prunus interaction. This technique is an important complementary tool to other means of studying genomics. In this work an analysis of gene expression of resistance/susceptibility to PPV in apricot is performed. RNA-Seq has been applied to analyse the gene expression changes induced by PPV infection in leaves from two full-sib apricot genotypes, "Rojo Pasión" and "Z506-7", resistant and susceptible to PPV, respectively. Transcriptomic analyses revealed the existence of more than 2,000 genes related to the pathogen response and resistance to PPV in apricot. These results showed that the response to infection by the virus in the susceptible genotype is associated with an induction of genes involved in pathogen resistance such as the allene oxide synthase, S-adenosylmethionine synthetase 2 and the major MLP-like protein 423. Over-expression of the Dicer protein 2a may indicate the suppression of a gene silencing mechanism of the plant by PPV HCPro and P1 PPV proteins. On the other hand, there were 164 genes involved in resistance mechanisms that have been identified in apricot, 49 of which are located in the PPVres region (scaffold 1 positions from 8,050,804 to 8,244,925, which is responsible for PPV resistance in apricot. Among these genes in apricot there are several MATH domain-containing genes, although other genes inside (Pleiotropic drug resistance 9 gene or outside (CAP, Cysteine-rich secretory proteins, Antigen 5 and Pathogenesis-related 1 protein; and LEA, Late embryogenesis abundant protein PPVres region could also be involved in the resistance.

  9. Gene Expression Analysis of Plum pox virus (Sharka) Susceptibility/Resistance in Apricot (Prunus armeniaca L.).

    Science.gov (United States)

    Rubio, Manuel; Ballester, Ana Rosa; Olivares, Pedro Manuel; Castro de Moura, Manuel; Dicenta, Federico; Martínez-Gómez, Pedro

    2015-01-01

    RNA-Seq has proven to be a very powerful tool in the analysis of the Plum pox virus (PPV, sharka disease)/Prunus interaction. This technique is an important complementary tool to other means of studying genomics. In this work an analysis of gene expression of resistance/susceptibility to PPV in apricot is performed. RNA-Seq has been applied to analyse the gene expression changes induced by PPV infection in leaves from two full-sib apricot genotypes, "Rojo Pasión" and "Z506-7", resistant and susceptible to PPV, respectively. Transcriptomic analyses revealed the existence of more than 2,000 genes related to the pathogen response and resistance to PPV in apricot. These results showed that the response to infection by the virus in the susceptible genotype is associated with an induction of genes involved in pathogen resistance such as the allene oxide synthase, S-adenosylmethionine synthetase 2 and the major MLP-like protein 423. Over-expression of the Dicer protein 2a may indicate the suppression of a gene silencing mechanism of the plant by PPV HCPro and P1 PPV proteins. On the other hand, there were 164 genes involved in resistance mechanisms that have been identified in apricot, 49 of which are located in the PPVres region (scaffold 1 positions from 8,050,804 to 8,244,925), which is responsible for PPV resistance in apricot. Among these genes in apricot there are several MATH domain-containing genes, although other genes inside (Pleiotropic drug resistance 9 gene) or outside (CAP, Cysteine-rich secretory proteins, Antigen 5 and Pathogenesis-related 1 protein; and LEA, Late embryogenesis abundant protein) PPVres region could also be involved in the resistance.

  10. Prevalence of antimicrobial resistance and the cfiA resistance gene in Danish Bacteroides fragilis group isolates since 1973

    DEFF Research Database (Denmark)

    Ferløv-Schwensen, Simon Andreas; Sydenham, Thomas Vognbjerg; Hansen, Kia Cirkeline Møller

    2017-01-01

    Desorption/Ionization Time-Of-Flight Mass Spectrometry (MALDI-TOF MS) on the Biotyper platform. Antimicrobial resistance was determined using a disk diffusion screening method and commercial antibiotic gradient strips. Division I (cfiA-negative) and division II (cfiA-positive) B. fragilis strains were...... differentiated using MALDI-TOF MS and real-time polymerase chain reaction (PCR). RESULTS: From 1973-1980 to 2010-2015 the prevalence of antimicrobial resistance rose from 0% to 21.2%, 2.5%, and 1% for clindamycin, meropenem, and metronidazole, respectively. MALDI-TOF MS and real-time PCR identified 16 of 266 (6...... established in the recent decades in Europe. Resistance to meropenem, facilitated by expression of the cfiA resistance gene, seems to be increasing; therefore, it is imperative to monitor the occurrence of this gene, e.g. using MALDI-TOF MS....

  11. Detection of methicillin resistant Staphylococcus aureus (MRSA) from recreational beach using the mecA gene

    Science.gov (United States)

    Zulkifli, Aisya; Ahmad, Asmat

    2015-09-01

    Water samples were collected in triplicates from three different locations choosen from the recreational beach of Teluk Kemang, Port Dickson as sampling station including main area of recreation activity for the public. Bacteria were isolated from the water and cultured. Out of 286 presumptive Staphylococcus aureus enumerated by using culture method, only 4 (1.4 %) confirmed as Meticillin Resistant S. aureus (MRSA) based on PCR detection of mecA gene. Interestingly, all of MRSA detections were found at the main area of recreational activity. Our results suggested that public beaches may be reservoir for transmission of MRSA to beach visitors and PCR using the mecA gene is the fastest way to detect this pathogenic bacteria.

  12. Network analysis of S. aureus response to ramoplanin reveals modules for virulence factors and resistance mechanisms and characteristic novel genes.

    Science.gov (United States)

    Subramanian, Devika; Natarajan, Jeyakumar

    2015-12-10

    Staphylococcus aureus is a major human pathogen and ramoplanin is an antimicrobial attributed for effective treatment. The goal of this study was to examine the transcriptomic profiles of ramoplanin sensitive and resistant S. aureus to identify putative modules responsible for virulence and resistance-mechanisms and its characteristic novel genes. The dysregulated genes were used to reconstruct protein functional association networks for virulence-factors and resistance-mechanisms individually. Strong link between metabolic-pathways and development of virulence/resistance is suggested. We identified 15 putative modules of virulence factors. Six hypothetical genes were annotated with novel virulence activity among which SACOL0281 was discovered to be an essential virulence factor EsaD. The roles of MazEF toxin-antitoxin system, SACOL0202/SACOL0201 two-component system and that of amino-sugar and nucleotide-sugar metabolism in virulence are also suggested. In addition, 14 putative modules of resistance mechanisms including modules of ribosomal protein-coding genes and metabolic pathways such as biotin-synthesis, TCA-cycle, riboflavin-biosynthesis, peptidoglycan-biosynthesis etc. are also indicated. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. Prevalence of sulfonamide resistance genes in bacterial isolates from manured agricultural soils and pig slurry in the United Kingdom.

    Science.gov (United States)

    Byrne-Bailey, K G; Gaze, W H; Kay, P; Boxall, A B A; Hawkey, P M; Wellington, E M H

    2009-02-01

    The prevalences of three sulfonamide resistance genes, sul1, sul2, and sul3 and sulfachloropyridazine (SCP) resistance were determined in bacteria isolated from manured agricultural clay soils and slurry samples in the United Kingdom over a 2-year period. Slurry from tylosin-fed pigs amended with SCP and oxytetracycline was used for manuring. Isolates positive for sul genes were further screened for the presence of class 1 and 2 integrons. Phenotypic resistance to SCP was significantly higher in isolates from pig slurry and postapplication soil than in those from preapplication soil. Of 531 isolates, 23% carried sul1, 18% sul2, and 9% sul3 only. Two percent of isolates contained all three sul genes. Class 1 and class 2 integrons were identified in 5% and 11.7%, respectively, of sul-positive isolates. In previous reports, sul1 was linked to class 1 integrons, but in this study only 8% of sul1-positive isolates carried the intI1 gene. Sulfonamide-resistant pathogens, including Shigella flexneri, Aerococcus spp., and Acinetobacter baumannii, were identified in slurry-amended soil and soil leachate, suggesting a potential environmental reservoir. Sulfonamide resistance in Psychrobacter, Enterococcus, and Bacillus spp. is reported for the first time, and this study also provides the first description of the genotypes sul1, sul2, and sul3 outside the Enterobacteriaceae and in the soil environment.

  14. Prevalence of Sulfonamide Resistance Genes in Bacterial Isolates from Manured Agricultural Soils and Pig Slurry in the United Kingdom▿

    Science.gov (United States)

    Byrne-Bailey, K. G.; Gaze, W. H.; Kay, P.; Boxall, A. B. A.; Hawkey, P. M.; Wellington, E. M. H.

    2009-01-01

    The prevalences of three sulfonamide resistance genes, sul1, sul2, and sul3 and sulfachloropyridazine (SCP) resistance were determined in bacteria isolated from manured agricultural clay soils and slurry samples in the United Kingdom over a 2-year period. Slurry from tylosin-fed pigs amended with SCP and oxytetracycline was used for manuring. Isolates positive for sul genes were further screened for the presence of class 1 and 2 integrons. Phenotypic resistance to SCP was significantly higher in isolates from pig slurry and postapplication soil than in those from preapplication soil. Of 531 isolates, 23% carried sul1, 18% sul2, and 9% sul3 only. Two percent of isolates contained all three sul genes. Class 1 and class 2 integrons were identified in 5% and 11.7%, respectively, of sul-positive isolates. In previous reports, sul1 was linked to class 1 integrons, but in this study only 8% of sul1-positive isolates carried the intI1 gene. Sulfonamide-resistant pathogens, including Shigella flexneri, Aerococcus spp., and Acinetobacter baumannii, were identified in slurry-amended soil and soil leachate, suggesting a potential environmental reservoir. Sulfonamide resistance in Psychrobacter, Enterococcus, and Bacillus spp. is reported for the first time, and this study also provides the first description of the genotypes sul1, sul2, and sul3 outside the Enterobacteriaceae and in the soil environment. PMID:19064898

  15. Differential gene expression in granulosa cells from polycystic ovary syndrome patients with and without insulin resistance: identification of susceptibility gene sets through network analysis.

    Science.gov (United States)

    Kaur, Surleen; Archer, Kellie J; Devi, M Gouri; Kriplani, Alka; Strauss, Jerome F; Singh, Rita

    2012-10-01

    Polycystic ovary syndrome (PCOS) is a heterogeneous, genetically complex, endocrine disorder of uncertain etiology in women. Our aim was to compare the gene expression profiles in stimulated granulosa cells of PCOS women with and without insulin resistance vs. matched controls. This study included 12 normal ovulatory women (controls), 12 women with PCOS without evidence for insulin resistance (PCOS non-IR), and 16 women with insulin resistance (PCOS-IR) undergoing in vitro fertilization. Granulosa cell gene expression profiling was accomplished using Affymetrix Human Genome-U133 arrays. Differentially expressed genes were classified according to gene ontology using ingenuity pathway analysis tools. Microarray results for selected genes were confirmed by real-time quantitative PCR. A total of 211 genes were differentially expressed in PCOS non-IR and PCOS-IR granulosa cells (fold change≥1.5; P≤0.001) vs. matched controls. Diabetes mellitus and inflammation genes were significantly increased in PCOS-IR patients. Real-time quantitative PCR confirmed higher expression of NCF2 (2.13-fold), TCF7L2 (1.92-fold), and SERPINA1 (5.35-fold). Increased expression of inflammation genes ITGAX (3.68-fold) and TAB2 (1.86-fold) was confirmed in PCOS non-IR. Different cardiometabolic disease genes were differentially expressed in the two groups. Decreased expression of CAV1 (-3.58-fold) in PCOS non-IR and SPARC (-1.88-fold) in PCOS-IR was confirmed. Differential expression of genes involved in TGF-β signaling (IGF2R, increased; and HAS2, decreased), and oxidative stress (TXNIP, increased) was confirmed in both groups. Microarray analysis demonstrated differential expression of genes linked to diabetes mellitus, inflammation, cardiovascular diseases, and infertility in the granulosa cells of PCOS women with and without insulin resistance. Because these dysregulated genes are also involved in oxidative stress, lipid metabolism, and insulin signaling, we hypothesize that these

  16. Analysis of cold resistance and identification of SSR markers linked to cold resistance genes in Brassica rapa L.

    Science.gov (United States)

    Huang, Zhen; Zhang, Xuexian; Jiang, Shouhua; Qin, Mengfan; Zhao, Na; Lang, Lina; Liu, Yaping; Tian, Zhengshu; Liu, Xia; Wang, Yang; Zhang, Binbin; Xu, Aixia

    2017-06-01

    Currently, cold temperatures are one of the main factors threatening rapeseed production worldwide; thus, it is imperative to identify cold-resistant germplasm and to cultivate cold-resistant rapeseed varieties. In this study, the cold resistance of four Brassica rapa varieties was analyzed. The cold resistance of Longyou6 and Longyou7 was better than that of Tianyou2 and Tianyou4. Thus, an F 2 population derived from Longyou6 and Tianyou4 was used to study the correlation of cold resistance and physiological indexes. Our results showed that the degree of frost damage was related to the relative conductivity and MDA content (r1 = 0.558 and r2 = 0.447, respectively). In order to identify the markers related to cold resistance, 504 pairs of SSR (simple sequence repeats) primers were used to screen the two parents and F 2 population. Four and five SSR markers had highly significant positive correlation to relative conductivity and MDA, respectively. In addition, three of these SSR markers had a highly significant positive correlation to both of these two indexes. These three SSR markers were subsequently confirmed to be used to distinguish between cold-resistant and non-cold-resistant varieties. The results of this study will lay a solid foundation for the mapping of cold-resistant genes and molecular markers assisted selection for the cold-resistance.

  17. Use of an activated beta-catenin to identify Wnt pathway target genes in caenorhabditis elegans, including a subset of collagen genes expressed in late larval development.

    Science.gov (United States)

    Jackson, Belinda M; Abete-Luzi, Patricia; Krause, Michael W; Eisenmann, David M

    2014-04-16

    The Wnt signaling pathway plays a fundamental role during metazoan development, where it regulates diverse processes, including cell fate specification, cell migration, and stem cell renewal. Activation of the beta-catenin-dependent/canonical Wnt pathway up-regulates expression of Wnt target genes to mediate a cellular response. In the nematode Caenorhabditis elegans, a canonical Wnt signaling pathway regulates several processes during larval development; however, few target genes of this pathway have been identified. To address this deficit, we used a novel approach of conditionally activated Wnt signaling during a defined stage of larval life by overexpressing an activated beta-catenin protein, then used microarray analysis to identify genes showing altered expression compared with control animals. We identified 166 differentially expressed genes, of which 104 were up-regulated. A subset of the up-regulated genes was shown to have altered expression in mutants with decreased or increased Wnt signaling; we consider these genes to be bona fide C. elegans Wnt pathway targets. Among these was a group of six genes, including the cuticular collagen genes, bli-1 col-38, col-49, and col-71. These genes show a peak of expression in the mid L4 stage during normal development, suggesting a role in adult cuticle formation. Consistent with this finding, reduction of function for several of the genes causes phenotypes suggestive of defects in cuticle function or integrity. Therefore, this work has identified a large number of putative Wnt pathway target genes during larval life, including a small subset of Wnt-regulated collagen genes that may function in synthesis of the adult cuticle.

  18. Identification and characterization of antibiotic resistance genes in Lactobacillus reuteri and Lactobacillus plantarum.

    Science.gov (United States)

    Egervärn, M; Roos, S; Lindmark, H

    2009-11-01

    The study aimed to identify the resistance genes mediating atypical minimum inhibitory concentrations (MICs) for tetracycline, erythromycin, clindamycin and chloramphenicol within two sets of representative strains of the species Lactobacillus reuteri and Lactobacillus plantarum and to characterize identified genes by means of gene location and sequencing of flanking regions. A tet(W) gene was found in 24 of the 28 Lact. reuteri strains with atypical MIC for tetracycline, whereas four of the six strains with atypical MIC for erythromycin were positive for erm(B) and one strain each was positive for erm(C) and erm(T). The two Lact. plantarum strains with atypical MIC for tetracycline harboured a plasmid-encoded tet(M) gene. The majority of the tet(W)-positive Lact. reuteri strains and all erm-positive Lact. reuteri strains carried the genes on plasmids, as determined by Southern blot and a real-time PCR method developed in this study. Most of the antibiotic-resistant strains of Lact. reuteri and Lact. plantarum harboured known plasmid-encoded resistance genes. Examples of putative transfer machineries adjacent to both plasmid- and chromosome-located resistance genes were also demonstrated. These data provide some of the knowledge required for assessing the possible risk of using Lact. reuteri and Lact. plantarum strains carrying antibiotic resistance genes as starter cultures and probiotics.

  19. Brownian dynamics simulations of a flexible polymer chain which includes continuous resistance and multibody hydrodynamic interactions

    Science.gov (United States)

    Butler, Jason E.; Shaqfeh, Eric S. G.

    2005-01-01

    Using methods adapted from the simulation of suspension dynamics, we have developed a Brownian dynamics algorithm with multibody hydrodynamic interactions for simulating the dynamics of polymer molecules. The polymer molecule is modeled as a chain composed of a series of inextensible, rigid rods with constraints at each joint to ensure continuity of the chain. The linear and rotational velocities of each segment of the polymer chain are described by the slender-body theory of Batchelor [J. Fluid Mech. 44, 419 (1970)]. To include hydrodynamic interactions between the segments of the chain, the line distribution of forces on each segment is approximated by making a Legendre polynomial expansion of the disturbance velocity on the segment, where the first two terms of the expansion are retained in the calculation. Thus, the resulting linear force distribution is specified by a center of mass force, couple, and stresslet on each segment. This method for calculating the hydrodynamic interactions has been successfully used to simulate the dynamics of noncolloidal suspensions of rigid fibers [O. G. Harlen, R. R. Sundararajakumar, and D. L. Koch, J. Fluid Mech. 388, 355 (1999); J. E. Butler and E. S. G. Shaqfeh, J. Fluid Mech. 468, 204 (2002)]. The longest relaxation time and center of mass diffusivity are among the quantities calculated with the simulation technique. Comparisons are made for different levels of approximation of the hydrodynamic interactions, including multibody interactions, two-body interactions, and the "freely draining" case with no interactions. For the short polymer chains studied in this paper, the results indicate a difference in the apparent scaling of diffusivity with polymer length for the multibody versus two-body level of approximation for the hydrodynamic interactions.

  20. PCR-based detection of resistance genes in anaerobic bacteria isolated from intra-abdominal infections.

    Science.gov (United States)

    Tran, Chau Minh; Tanaka, Kaori; Watanabe, Kunitomo

    2013-04-01

    Little information is available on the distribution of antimicrobial resistance genes in anaerobes in Japan. To understand the background of antimicrobial resistance in anaerobes involved in intra-abdominal infections, we investigated the distribution of eight antimicrobial resistance genes (cepA, cfiA, cfxA, ermF, ermB, mefA, tetQ, and nim) and a mutation in the gyrA gene in a total of 152 organisms (Bacteroides spp., Prevotella spp., Fusobacterium spp., Porphyromonas spp., Bilophila wadsworthia, Desulfovibrio desulfuricans, Veillonella spp., gram-positive cocci, and non-spore-forming gram-positive bacilli) isolated between 2003 and 2004 in Japan. The cepA gene was distributed primarily in Bacteroides fragilis. Gene cfxA was detected in about 9 % of the Bacteroides isolates and 75 % of the Prevotella spp. isolates and did not appear to contribute to cephamycin resistance. Two strains of B. fragilis contained the metallo-β-lactamase gene cfiA, but they did not produce the protein product. Gene tetQ was detected in about 81, 44, and 63 % of B. fragilis isolates, other Bacteroides spp., and Prevotella spp. isolates, respectively. The ermF gene was detected in 25, 13, 56, 64, and 16 % of Bacteroides spp., Prevotella spp., Fusobacterium spp., B. wadsworthia, and anaerobic cocci, respectively. Gene mefA was found in only 10 % of the B. fragilis strains and 3 % of the non-B. fragilis strains. Genes nim and ermB were not detected in any isolate. Substitution at position 82 (Ser to Phe) in gyrA was detected in B. fragilis isolates that were less susceptible or resistant to moxifloxacin. This study is the first report on the distribution of resistance genes in anaerobes isolated from intra-abdominal infections in Japan. We expect that the results might help in understanding the resistance mechanisms of specific anaerobes.

  1. Microbiological characterization of aquatic microbiomes targeting taxonomical marker genes and antibiotic resistance genes of opportunistic bacteria.

    Science.gov (United States)

    Alexander, Johannes; Bollmann, Anna; Seitz, Wolfram; Schwartz, Thomas

    2015-04-15

    The dissemination of medically relevant antibiotic resistance genes (ARGs) (blaVIM-1, vanA, ampC, ermB, and mecA) and opportunistic bacteria (Enterococcus faecium/faecalis, Pseudomonas aeruginosa, Enterobacteriaceae, Staphylococcus aureus, and CNS) was determined in different anthropogenically influenced aquatic habitats in a selected region of Germany. Over a period of two years, four differently sized wastewater treatment plants (WWTPs) with and without clinical influence, three surface waters, four rain overflow basins, and three groundwater sites were analyzed by quantitative Polymerase Chain Reaction (qPCR). Results were calculated in cell equivalents per 100 ng of total DNA extracted from water samples and per 100 mL sample volume, which seems to underestimate the abundance of antibiotic resistance and opportunistic bacteria. High abundances of opportunistic bacteria and ARG were quantified in clinical wastewaters and influents of the adjacent WWTP. The removal capacities of WWTP were up to 99% for some, but not all investigated bacteria. The abundances of most ARG targets were found to be increased in the bacterial population after conventional wastewater treatment. As a consequence, downstream surface water and also some groundwater compartments displayed high abundances of all four ARGs. It became obvious that the dynamics of the ARG differed from the fate of the opportunistic bacteria. This underlines the necessity of an advanced microbial characterization of anthropogenically influenced environments. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Trends of drug-resistance-associated mutations in the reverse transcriptase gene of HIV type 1 isolates from North India.

    Science.gov (United States)

    Azam, Mohd; Malik, Abida; Rizvi, Meher; Rai, Arvind

    2014-04-01

    A major cause of failure of antiretroviral therapy (ART) is the presence of drug-resistance-associated mutations in the polymerase gene of HIV-1. The paucity of data regarding potential drug resistance to reverse transcriptase inhibitors (RTIs) prompted us to carry out this study. This information will shed light on the extent of drug resistance already present in HIV strains and will give future directions in patient treatment and in drug design. Drug resistance genotyping of a partial reverse transcriptase gene was done in 103 HIV-1-infected patients, including the ART-naive and ART-experienced population. The drug resistance pattern was analyzed using the Stanford HIV-DR database, the IAS-USA mutation list and the REGA algorithm-v8.0. Subtyping was done using the REGA HIV-1 subtyping tool-v2.01. The majority of our sequences (96 %) were found to be subtype C, and four (3.8 %) were subtype A1. Significant prevalence of DR mutations (28 %) was observed in the RT gene. Major amino acid substitutions were seen at positions 41, 90, 98, 103, 106, 108, 138, 181, 184, 190, 215, and 219, which confer high/intermediate levels of resistance to most RTIs, independently or together. Our results show that there is an urgent need to tailor ART drug regimens to the individual to achieve optimum therapeutic outcome in North India.

  3. Characterisation of the legume SERK-NIK gene superfamily including splice variants: Implications for development and defence

    Directory of Open Access Journals (Sweden)

    Rose Ray J

    2011-03-01

    Full Text Available Abstract Background SOMATIC EMBRYOGENESIS RECEPTOR-LIKE KINASE (SERK genes are part of the regulation of diverse signalling events in plants. Current evidence shows SERK proteins function both in developmental and defence signalling pathways, which occur in response to both peptide and steroid ligands. SERKs are generally present as small gene families in plants, with five SERK genes in Arabidopsis. Knowledge gained primarily through work on Arabidopsis SERKs indicates that these proteins probably interact with a wide range of other receptor kinases and form a fundamental part of many essential signalling pathways. The SERK1 gene of the model legume, Medicago truncatula functions in somatic and zygotic embryogenesis, and during many phases of plant development, including nodule and lateral root formation. However, other SERK genes in M. truncatula and other legumes are largely unidentified and their functions unknown. Results To aid the understanding of signalling pathways in M. truncatula, we have identified and annotated the SERK genes in this species. Using degenerate PCR and database mining, eight more SERK-like genes have been identified and these have been shown to be expressed. The amplification and sequencing of several different PCR products from one of these genes is consistent with the presence of splice variants. Four of the eight additional genes identified are upregulated in cultured leaf tissue grown on embryogenic medium. The sequence information obtained from M. truncatula was used to identify SERK family genes in the recently sequenced soybean (Glycine max genome. Conclusions A total of nine SERK or SERK-like genes have been identified in M. truncatula and potentially 17 in soybean. Five M. truncatula SERK genes arose from duplication events not evident in soybean and Lotus. The presence of splice variants has not been previously reported in a SERK gene. Upregulation of four newly identified SERK genes (in addition to the

  4. A bacterial antibiotic-resistance gene that complements the human multidrug-resistance P-glycoprotein gene

    NARCIS (Netherlands)

    van Veen, HW; Callaghan, R; Soceneantu, L; Sardini, A; Konings, WN; Higgins, CF

    1998-01-01

    Bacteria have developed many fascinating antibiotic-resistance mechanisms(1,2). A protein in Lactococcus lactis, LmrA, mediates antibiotic resistance by extruding amphiphilic compounds from the inner leaflet of the cytoplasmic membrane(3,4). Unlike other known bacterial multidrug-resistance

  5. Characterization and cloning of TMV resistance gene N homologues ...

    African Journals Online (AJOL)

    Tobacco cultivars Nicotiana tabacum cv. Samsun NN plants carrying the N gene contain a multitude of N-related genes. We cloned a few N homologues and isolated two full-length cDNAs of NL-C26 and NL-B69 genes from N. tabacum cv. Samsun NN. Nucleotide sequence analysis showed that the coding regions of ...

  6. Identification of yeast genes that confer resistance to chitosan oligosaccharide (COS using chemogenomics

    Directory of Open Access Journals (Sweden)

    Jaime Maria DLA

    2012-06-01

    Full Text Available Abstract Background Chitosan oligosaccharide (COS, a deacetylated derivative of chitin, is an abundant, and renewable natural polymer. COS has higher antimicrobial properties than chitosan and is presumed to act by disrupting/permeabilizing the cell membranes of bacteria, yeast and fungi. COS is relatively non-toxic to mammals. By identifying the molecular and genetic targets of COS, we hope to gain a better understanding of the antifungal mode of action of COS. Results Three different chemogenomic fitness assays, haploinsufficiency (HIP, homozygous deletion (HOP, and multicopy suppression (MSP profiling were combined with a transcriptomic analysis to gain insight in to the mode of action and mechanisms of resistance to chitosan oligosaccharides. The fitness assays identified 39 yeast deletion strains sensitive to COS and 21 suppressors of COS sensitivity. The genes identified are involved in processes such as RNA biology (transcription, translation and regulatory mechanisms, membrane functions (e.g. signalling, transport and targeting, membrane structural components, cell division, and proteasome processes. The transcriptomes of control wild type and 5 suppressor strains overexpressing ARL1, BCK2, ERG24, MSG5, or RBA50, were analyzed in the presence and absence of COS. Some of the up-regulated transcripts in the suppressor overexpressing strains exposed to COS included genes involved in transcription, cell cycle, stress response and the Ras signal transduction pathway. Down-regulated transcripts included those encoding protein folding components and respiratory chain proteins. The COS-induced transcriptional response is distinct from previously described environmental stress responses (i.e. thermal, salt, osmotic and oxidative stress and pre-treatment with these well characterized environmental stressors provided little or any resistance to COS. Conclusions Overexpression of the ARL1 gene, a member of the Ras superfamily that regulates membrane

  7. Identification of aminoglycoside and β-lactam resistance genes from within an infant gut functional metagenomic library.

    Directory of Open Access Journals (Sweden)

    Fiona Fouhy

    Full Text Available The infant gut microbiota develops rapidly during the first 2 years of life, acquiring microorganisms from diverse sources. During this time, significant opportunities exist for the infant to acquire antibiotic resistant bacteria, which can become established and constitute the infant gut resistome. With increased antibiotic resistance limiting our ability to treat bacterial infections, investigations into resistance reservoirs are highly pertinent. This study aimed to explore the nascent resistome in antibiotically-naïve infant gut microbiomes, using a combination of metagenomic approaches. Faecal samples from 22 six-month-old infants without previous antibiotic exposure were used to construct a pooled metagenomic library, which was functionally screened for ampicillin and gentamicin resistance. Our library of ∼220Mb contained 0.45 ampicillin resistant hits/Mb and 0.059 gentamicin resistant hits/Mb. PCR-based analysis of fosmid clones and uncloned metagenomic DNA, revealed a diverse and abundant aminoglycoside and β-lactam resistance reservoir within the infant gut, with resistance determinants exhibiting homology to those found in common gut inhabitants, including Escherichia coli, Enterococcus sp., and Clostridium difficile, as well as to genes from cryptic environmental bacteria. Notably, the genes identified differed from those revealed when a sequence-driven PCR-based screen of metagenomic DNA was employed. Carriage of these antibiotic resistance determinants conferred substantial, but varied (2-512x, increases in antibiotic resistance to their bacterial host. These data provide insights into the infant gut resistome, revealing the presence of a varied aminoglycoside and β-lactam resistance reservoir even in the absence of selective pressure, confirming the infant resistome establishes early in life, perhaps even at birth.

  8. Identification and mapping of two powdery mildew resistance genes in Triticum boeoticum L.

    Science.gov (United States)

    Chhuneja, Parveen; Kumar, Krishan; Stirnweis, Daniel; Hurni, Severine; Keller, Beat; Dhaliwal, Harcharan S; Singh, Kuldeep

    2012-04-01

    Powdery mildew (PM) caused by Blumeria graminis f. sp. tritici (Bgt), is one of the important foliar diseases of wheat that can cause serious yield losses. Breeding for cultivars with diverse resources of resistance is the most promising approach for combating this disease. The diploid A genome progenitor species of wheat are an important resource for new variability for disease resistance genes. An accession of Triticum boeoticum (A(b)A(b)) showed resistance against a number of Bgt isolates, when tested using detached leaf segments. Inheritance studies in a recombinant inbred line population (RIL), developed from crosses of PM resistant T. boeoticum acc. pau5088 with a PM susceptible T. monococcum acc. pau14087, indicated the presence of two powdery mildew resistance genes in T. boeoticum acc. pau5088. Analysis of powdery mildew infection and molecular marker data of the RIL population revealed that both powdery mildew resistance genes are located on the long arm of chromosome 7A. Mapping was conducted using an integrated linkage map of 7A consisting of SSR, RFLP, STS, and DArT markers. These powdery mildew resistance genes are tentatively designated as PmTb7A.1 and PmTb7A.2. The PmTb7A.2 is closely linked to STS markers MAG2185 and MAG1759 derived from RFLP probes which are linked to powdery mildew resistance gene Pm1. This indicated that PmTb7A.2 might be allelic to Pm1. The PmTb7A.1, flanked by a DArT marker wPt4553 and an SSR marker Xcfa2019 in a 4.3 cM interval, maps proximal to PmT7A.2. PmTb7A.1 is putatively a new powdery mildew resistance gene. The powdery mildew resistance genes from T. boeoticum are currently being transferred to cultivated wheat background through marker-assisted backcrossing, using T. durum as bridging species.

  9. Candidate genes revealed by a genome scan for mosquito resistance to a bacterial insecticide: sequence and gene expression variations

    Directory of Open Access Journals (Sweden)

    David Jean-Philippe

    2009-11-01

    Full Text Available Abstract Background Genome scans are becoming an increasingly popular approach to study the genetic basis of adaptation and speciation, but on their own, they are often helpless at identifying the specific gene(s or mutation(s targeted by selection. This shortcoming is hopefully bound to disappear in the near future, thanks to the wealth of new genomic resources that are currently being developed for many species. In this article, we provide a foretaste of this exciting new era by conducting a genome scan in the mosquito Aedes aegypti with the aim to look for candidate genes involved in resistance to Bacillus thuringiensis subsp. israelensis (Bti insecticidal toxins. Results The genome of a Bti-resistant and a Bti-susceptible strains was surveyed using about 500 MITE-based molecular markers, and the loci showing the highest inter-strain genetic differentiation were sequenced and mapped on the Aedes aegypti genome sequence. Several good candidate genes for Bti-resistance were identified in the vicinity of these highly differentiated markers. Two of them, coding for a cadherin and a leucine aminopeptidase, were further examined at the sequence and gene expression levels. In the resistant strain, the cadherin gene displayed patterns of nucleotide polymorphisms consistent with the action of positive selection (e.g. an excess of high compared to intermediate frequency mutations, as well as a significant under-expression compared to the susceptible strain. Conclusion Both sequence and gene expression analyses agree to suggest a role for positive selection in the evolution of this cadherin gene in the resistant strain. However, it is unlikely that resistance to Bti is conferred by this gene alone, and further investigation will be needed to characterize other genes significantly associated with Bti resistance in Ae. aegypti. Beyond these results, this article illustrates how genome scans can build on the body of new genomic information (here, full

  10. Comparison of antimicrobial resistant genes in chicken gut microbiome grown on organic and conventional diet

    Directory of Open Access Journals (Sweden)

    Narasimha V. Hegde

    2016-12-01

    Full Text Available Antibiotics are widely used in chicken production for therapeutic purposes, disease prevention and growth promotion, and this may select for drug resistant microorganisms known to spread to humans through consumption of contaminated food. Raising chickens on an organic feed regimen, without the use of antibiotics, is increasingly popular with the consumers. In order to determine the effects of diet regimen on antibiotic resistant genes in the gut microbiome, we analyzed the phylotypes and identified the antimicrobial resistant genes in chicken, grown under conventional and organic dietary regimens. Phylotypes were analyzed from DNA extracted from fecal samples from chickens grown under these dietary conditions. While gut microbiota of chicken raised in both conventional and organic diet exhibited the presence of DNA from members of Proteobacteria and Bacteroidetes, organic diet favored the growth of members of Fusobacteria. Antimicrobial resistance genes were identified from metagenomic libraries following cloning and sequencing of DNA fragments from fecal samples and selecting for the resistant clones (n=340 on media containing different concentrations of eight antibiotics. The antimicrobial resistant genes exhibited diversity in their host distribution among the microbial population and expressed more in samples from chicken grown on a conventional diet at higher concentrations of certain antimicrobials than samples from chicken grown on organic diet. Further studies will elucidate if this phenomena is widespread and whether the antimicrobial resistance is indeed modulated by diet. This may potentially assist in defining strategies for intervention to reduce the prevalence and dissemination of antibiotic resistance genes in the production environment.

  11. Genetic mapping of a major dominant gene for resistance to Ralstonia solanacearum in eggplant.

    Science.gov (United States)

    Lebeau, A; Gouy, M; Daunay, M C; Wicker, E; Chiroleu, F; Prior, P; Frary, A; Dintinger, J

    2013-01-01

    Resistance of eggplant against Ralstonia solanacearum phylotype I strains was assessed in a F(6) population of recombinant inbred lines (RILs) derived from a intra-specific cross between S. melongena MM738 (susceptible) and AG91-25 (resistant). Resistance traits were determined as disease score, percentage of wilted plants, and stem-based bacterial colonization index, as assessed in greenhouse experiments conducted in Réunion Island, France. The AG91-25 resistance was highly efficient toward strains CMR134, PSS366 and GMI1000, but only partial toward the highly virulent strain PSS4. The partial resistance found against PSS4 was overcome under high inoculation pressure, with heritability estimates from 0.28 to 0.53, depending on the traits and season. A genetic map was built with 119 AFLP, SSR and SRAP markers positioned on 18 linkage groups (LG), for a total length of 884 cM, and used for quantitative trait loci (QTL) analysis. A major dominant gene, named ERs1, controlled the resistance to strains CMR134, PSS366, and GMI1000. Against strain PSS4, this gene was not detected, but a significant QTL involved in delay of disease progress was detected on another LG. The possible use of the major resistance gene ERs1 in marker-assisted selection and the prospects offered for academic studies of a possible gene for gene system controlling resistance to bacterial wilt in solanaceous plants are discussed.

  12. PCR Screening of Antibiotic Resistance Genes in Faecal Samples from Australian and Chinese Children.

    Science.gov (United States)

    Ravensdale, Joshua T; Xian, Darren Ten Wei; Wei, Chooi Ming; Lv, Quanjun; Wen, Xiajian; Guo, Jing; Coorey, Ranil; LeSouëf, Peter; Lu, Fengmin; Zhang, Brad; Dykes, Gary A

    2018-03-31

    Recent public awareness campaigns on the risk of antibiotic resistance in pathogenic microbes has placed pressure on governments to enforce stricter antimicrobial stewardship policies on the hospital and agricultural industry. This study aimed to screen faecal samples from Australian and Chinese children for the presence of antibiotic resistance genes to identify demographics at risk of carriage of these genes and examine antimicrobial stewardship policies from the two countries which may influence carriage. Faecal samples from 46 Australian and 53 Chinese children were screened for the presence of six clinically relevant antibiotic resistance genes using PCR. Clinical and demographic data was also collected from each patient. Over 90% of faecal samples from Chinese children tested positive for β-lactam, macrolide, tetracycline, and aminoglycoside resistance genes, which was substantially higher than Australian samples. Besides country of origin, no clear trend could be seen to predict carriage of resistance genes. The exception to this was Chinese born children who immigrated to Australia having higher rates of carriage for bla TEM and tetM genes than children born and still living in Australia. These data indicated that Chinese children were more likely to carry certain antibiotic resistance genes than Australian children. The Chinese government has recently implemented strict policies to control the overuse of antibiotics in hospitals. However, many of these policies do not extend to the agricultural industry which could explain the differences seen in this study. Copyright © 2018. Published by Elsevier Ltd.

  13. Candidate Gene Identification with SNP Marker-Based Fine Mapping of Anthracnose Resistance Gene Co-4 in Common Bean.

    Science.gov (United States)

    Burt, Andrew J; William, H Manilal; Perry, Gregory; Khanal, Raja; Pauls, K Peter; Kelly, James D; Navabi, Alireza

    2015-01-01

    Anthracnose, caused by Colletotrichum lindemuthianum, is an important fungal disease of common bean (Phaseolus vulgaris). Alleles at the Co-4 locus confer resistance to a number of races of C. lindemuthianum. A population of 94 F4:5 recombinant inbred lines of a cross between resistant black bean genotype B09197 and susceptible navy bean cultivar Nautica was used to identify markers associated with resistance in bean chromosome 8 (Pv08) where Co-4 is localized. Three SCAR markers with known linkage to Co-4 and a panel of single nucleotide markers were used for genotyping. A refined physical region on Pv08 with significant association with anthracnose resistance identified by markers was used in BLAST searches with the genomic sequence of common bean accession G19833. Thirty two unique annotated candidate genes were identified that spanned a physical region of 936.46 kb. A majority of the annotated genes identified had functional similarity to leucine rich repeats/receptor like kinase domains. Three annotated genes had similarity to 1, 3-β-glucanase domains. There were sequence similarities between some of the annotated genes found in the study and the genes associated with phosphoinositide-specific phosphilipases C associated with Co-x and the COK-4 loci found in previous studies. It is possible that the Co-4 locus is structured as a group of genes with functional domains dominated by protein tyrosine kinase along with leucine rich repeats/nucleotide binding site, phosphilipases C as well as β-glucanases.

  14. Metagenomic profiles of antibiotic resistance genes (ARGs) between human impacted estuary and deep ocean sediments.

    Science.gov (United States)

    Chen, Baowei; Yang, Ying; Liang, Ximei; Yu, Ke; Zhang, Tong; Li, Xiangdong

    2013-11-19

    Knowledge of the origins and dissemination of antibiotic resistance genes (ARGs) is essential for understanding modern resistomes in the environment. The mechanisms of the dissemination of ARGs can be revealed through comparative studies on the metagenomic profiling of ARGs between relatively pristine and human-impacted environments. The deep ocean bed of the South China Sea (SCS) is considered to be largely devoid of anthropogenic impacts, while the Pearl River Estuary (PRE) in south China has been highly impacted by intensive human activities. Commonly used antibiotics (sulfamethazine, norfloxacin, ofloxacin, tetracycline, and erythromycin) have been detected through chemical analysis in the PRE sediments, but not in the SCS sediments. In the relatively pristine SCS sediments, the most prevalent and abundant ARGs are those related to resistance to macrolides and polypeptides, with efflux pumps as the predominant mechanism. In the contaminated PRE sediments, the typical ARG profiles suggest a prevailing resistance to antibiotics commonly used in human health and animal farming (including sulfonamides, fluoroquinolones, and aminoglycosides), and higher diversity in both genotype and resistance mechanism than those in the SCS. In particular, antibiotic inactivation significantly contributed to the resistance to aminoglycosides, β-lactams, and macrolides observed in the PRE sediments. There was a significant correlation in the levels of abundance of ARGs and those of mobile genetic elements (including integrons and plasmids), which serve as carriers in the dissemination of ARGs in the aquatic environment. The metagenomic results from the current study support the view that ARGs naturally originate in pristine environments, while human activities accelerate the dissemination of ARGs so that microbes would be able to tolerate selective environmental stress in response to anthropogenic impacts.

  15. A novel Capsicum gene inhibits host-specific disease resistance to Phytophthora capsici.

    Science.gov (United States)

    Reeves, Gregory; Monroy-Barbosa, Ariadna; Bosland, Paul W

    2013-05-01

    A novel disease resistance inhibitor gene (inhibitor of P. capsici resistance [Ipcr]), found in the chile pepper (Capsicum annuum) variety 'New Mexico Capsicum Accession 10399' (NMCA10399), inhibits resistance to Phytophthora capsici but not to other species of Phytophthora. When a highly P. capsici-resistant variety was hybridized with NMCA10399, the resultant F1 populations, when screened, were completely susceptible to P. capsici for root rot and foliar blight disease syndromes, despite the dominance inheritance of P. capsici resistance in chile pepper. The F2 population displayed a 3:13 resistant-to-susceptible (R:S) ratio. The testcross population displayed a 1:1 R:S ratio, and a backcross population to NMCA10399 displayed complete susceptibility. These results demonstrate the presence of a single dominant inhibitor gene affecting P. capsici resistance in chile pepper. Moreover, when lines carrying the Ipcr gene were challenged against six Phytophthora spp., the nonhost resistance was not overcome. Therefore, the Ipcr gene is interfering with host-specific resistance but not the pathogen- or microbe-associated molecular pattern nonhost responses.

  16. Molecular mapping and genetic analysis of a rice brown planthopper (Nilaparvata lugens Stål) resistance gene.

    Science.gov (United States)

    Yang, Haiyuan; Ren, Xiang; Weng, Qingmei; Zhu, Lili; He, Guangcun

    2002-01-01

    The brown planthopper (BPH), Nilaparvata lugens Stål, is a serious insect pest of rice (Oryza saliva L.). We have determined the chromosomal location of a BPH resistance gene in rice using SSR and RFLP techniques. A rice line 'B14', derived from the wild rice Oryza latifolia, showed high resistance to BPH. For tagging the resistance gene in 'B14X', an F2 population and a recombinant inbred (RI) population from a cross between Taichung Native 1 and 'B14' were developed and evaluated for BPH resistance. The results showed that a single dominant gene controlled the resistance of 'B14' to BPH. Bulked segregant SSR analysis was employed for identification of DNA markers linked to the resistance gene. From the survey of 302 SSR primer pairs, three SSR (RM335, RM261, RM185) markers linked to the resistance gene were identified. The closest SSR marker RM261 was linked to the resistance gene at a distance of 1.8 cM. Regions surrounding the resistance gene and the SSR markers were examined with additional RFLP markers on chromosome 4 to define the location of the resistance gene. Linkage of RFLP markers C820, R288, C946 with the resistance gene further confirmed its location on the short arm of chromosome 4. Closely linked DNA markers will facilitate selection for resistant lines in breeding programs and provide the basis for map-based cloning of this resistance gene.

  17. Overexpression of multiple detoxification genes in deltamethrin resistant Laodelphax striatellus (Hemiptera: Delphacidae in China.

    Directory of Open Access Journals (Sweden)

    Lu Xu

    Full Text Available BACKGROUND: The small brown planthopper (SBPH, Laodelphax striatellus (Fallén, is one of the major rice pests in Asia and has developed resistance to multiple classes of insecticides. Understanding resistance mechanisms is essential to the management of this pest. Biochemical and molecular assays were performed in this study to systematically characterize deltamethrin resistance mechanisms with laboratory-selected resistant and susceptible strains of SBPH. METHODOLOGY/PRINCIPAL FINDINGS: Deltamethrin resistant strains of SBPH (JH-del were derived from a field population by continuously selections (up to 30 generations in the laboratory, while a susceptible strain (JHS was obtained from the same population by removing insecticide pressure for 30 generations. The role of detoxification enzymes in the resistance was investigated using synergism and enzyme activity assays with strains of different resistant levels. Furthermore, 71 cytochrome P450, 93 esterases and 12 glutathione-S-transferases cDNAs were cloned based on transcriptome data of a field collected population. Semi-quantitative RT-PCR screening analysis of 176 identified detoxification genes demonstrated that multiple P450 and esterase genes were overexpressed (>2-fold in JH-del strains (G4 and G30 when compared to that in JHS, and the results of quantitative PCR coincided with the semi-quantitative RT-PCR results. Target mutation at IIS3-IIS6 regions encoded by the voltage-gated sodium channel gene was ruled out for conferring the observed resistance. CONCLUSION/SIGNIFICANCE: As the first attempt to discover genes potentially involved in SBPH pyrethroid resistance, this study putatively identified several candidate genes of detoxification enzymes that were significantly overexpressed in the resistant strain, which matched the synergism and enzyme activity testing. The biochemical and molecular evidences suggest that the high level pyrethroid resistance in L. striatellus could be due to

  18. ICESag37, a Novel Integrative and Conjugative Element Carrying Antimicrobial Resistance Genes and Potential Virulence Factors in Streptococcus agalactiae.

    Science.gov (United States)

    Zhou, Kaixin; Xie, Lianyan; Han, Lizhong; Guo, Xiaokui; Wang, Yong; Sun, Jingyong

    2017-01-01

    ICE Sag37 , a novel integrative and conjugative element carrying multidrug resistance and potential virulence factors, was characterized in a clinical isolate of Streptococcus agalactiae . Two clinical strains of S. agalactiae , Sag37 and Sag158, were isolated from blood samples of new-borns with bacteremia. Sag37 was highly resistant to erythromycin and tetracycline, and susceptible to levofloxacin and penicillin, while Sag158 was resistant to tetracycline and levofloxacin, and susceptible to erythromycin. Transfer experiments were performed and selection was carried out with suitable antibiotic concentrations. Through mating experiments, the erythromycin resistance gene was found to be transferable from Sag37 to Sag158. Sma I-PFGE revealed a new Sma I fragment, confirming the transfer of the fragment containing the erythromycin resistance gene. Whole genome sequencing and sequence analysis revealed a mobile element, ICE Sag37 , which was characterized using several molecular methods and in silico analyses. ICE Sag37 was excised to generate a covalent circular intermediate, which was transferable to S. agalactiae . Inverse PCR was performed to detect the circular form. A serine family integrase mediated its chromosomal integration into rumA , which is a known hotspot for the integration of streptococcal ICEs. The integration site was confirmed using PCR. ICE Sag37 carried genes for resistance to multiple antibiotics, including erythromycin [ erm(B) ], tetracycline [ tet(O) ], and aminoglycosides [ aadE, aphA , and ant(6) ]. Potential virulence factors, including a two-component signal transduction system ( nisK/nisR ), were also observed in ICE Sag37 . S1-PFGE analysis ruled out the existence of plasmids. ICE Sag37 is the first ICE Sa2603 family-like element identified in S. agalactiae carrying both resistance and potential virulence determinants. It might act as a vehicle for the dissemination of multidrug resistance and pathogenicity among S. agalactiae .

  19. Tagging of blast resistance gene(s) to DNA markers and marker-assisted selection (MAS) in rice improvement

    International Nuclear Information System (INIS)

    Zhuang, J.Y.; Lu, J.; Qian, H.R.; Lin, H.X.; Zheng, K.L.

    1998-01-01

    This paper reports progress made on the tagging of blast resistance gene(s) to DNA markers and on the initiation of marker-assisted selection (MAS) for blast resistance in rice improvement. A pair of near isogenic lines, K8OR and K79S, were developed using a Chinese landrace Hong-jiao-zhan as the resistance donor. Ten putatively positive markers were identified by screening 177 mapped DNA markers. Using the F 2 population of 143 plants and the derived F 3 lines, three Restriction Fragment Length Polymorphism (RFLP) markers (RG81, RG869 and RZ397) on chromosome 12 of rice were identified to be closely linked to the blast resistance gene Pi-12(t). The genetic distance between Pi-12(t) and the closest marker RG869 was 5.1 cM. By employing the bulk segregant analysis (BSA) procedure, six of 199 arbitrary primers were found to produce positive Randomly Amplified Polymorphic DNA (RAPD) bands. Tight linkage between Pi-12(t) and three RAPD bands, each from a different primer, was confirmed after amplification of DNA of all F 2 individuals. Two fragments were cloned and sequenced, and two sequence characterised amplified re-ion (SCAR) markers were established. In two other F 3 populations, Xian-feng I/Tetep and Xian-feng, 1/Hong-jiao-zhan, the blast resistance was found to be controlled by interactions of two or more genes. One resistance gene was located in the vicinity of RG81 in both populations. Work to identify other gene(s) is currently under way. Marker assisted selection for blast resistance was initiated. Crosses were made between elite varieties and blast resistance donors to develop populations for DNA marker-assisted selection of blast resistance. In addition, 48 varieties widely used in current rice breeding programs were provided by rice breeders. DNA marker-based polymorphism among, these varieties and resistance donors were analysed to produce a database for future MAS program. (author)

  20. A Public Platform for the Verification of the Phenotypic Effect of Candidate Genes for Resistance to Aflatoxin Accumulation and Aspergillus flavus Infection in Maize

    Directory of Open Access Journals (Sweden)

    Xueyan Shan

    2011-06-01

    Full Text Available A public candidate gene testing pipeline for resistance to aflatoxin accumulation or Aspergillus flavus infection in maize is presented here. The pipeline consists of steps for identifying, testing, and verifying the association of selected maize gene sequences with resistance under field conditions. Resources include a database of genetic and protein sequences associated with the reduction in aflatoxin contamination from previous studies; eight diverse inbred maize lines for polymorphism identification within any maize gene sequence; four Quantitative Trait Loci (QTL mapping populations and one association mapping panel, all phenotyped for aflatoxin accumulation resistance and associated phenotypes; and capacity for Insertion/Deletion (InDel and SNP genotyping in the population(s for mapping. To date, ten genes have been identified as possible candidate genes and put through the candidate gene testing pipeline, and results are presented here to demonstrate the utility of the pipeline.

  1. Tetracycline resistance genes persist in soil amended with cattle feces independently from chlortetracycline selection pressure

    NARCIS (Netherlands)

    Kyselkova, Martina; Kotrbova, Lucie; Bhumibhamon, Gamonsiri; Chronakova, Alica; Jirout, Jiri; Vrchotova, Nadezda; Schmitt, Heike; Elhottova, Dana

    Antibiotic residues and antibiotic resistance genes originating from animal waste represent environmental pollutants with possible human health consequences. In this study, we addressed the question whether chlortetracycline (CTC) residues in soils can act as selective pressure enhancing the

  2. Studies to identify genes and their expression for resistance to blast ...

    African Journals Online (AJOL)

    aps

    2013-06-26

    Jun 26, 2013 ... INTRODUCTION. Rice (Oryza sativa L.) is the staple food for more than ... disease under induced artificial epiphytotic conditions at SVP. University farm .... resistance is under the control of several additive genes having small ...

  3. Phylogenetic relatedness determined between antibiotic resistance and 16S rRNA genes in actinobacteria

    Czech Academy of Sciences Publication Activity Database

    Ságová-Marečková, M.; Ulanová, Dana; Šanderová, P.; Omelka, M.; Kameník, Zdeněk; Olšovská, J.; Kopecký, J.

    2015-01-01

    Roč. 15, APR 2015 (2015) ISSN 1471-2180 Institutional support: RVO:61388971 Keywords : Actinobacteria * 16S rRNA diversity * Resistance genes Subject RIV: EH - Ecology, Behaviour Impact factor: 2.581, year: 2015

  4. Benchmarking of methods for identification of antimicrobial resistance genes in bacterial whole genome data

    DEFF Research Database (Denmark)

    Clausen, Philip T. L. C.; Zankari, Ea; Aarestrup, Frank Møller

    2016-01-01

    to two different methods in current use for identification of antibiotic resistance genes in bacterial WGS data. A novel method, KmerResistance, which examines the co-occurrence of k-mers between the WGS data and a database of resistance genes, was developed. The performance of this method was compared...... with two previously described methods; ResFinder and SRST2, which use an assembly/BLAST method and BWA, respectively, using two datasets with a total of 339 isolates, covering five species, originating from the Oxford University Hospitals NHS Trust and Danish pig farms. The predicted resistance...... was compared with the observed phenotypes for all isolates. To challenge further the sensitivity of the in silico methods, the datasets were also down-sampled to 1% of the reads and reanalysed. The best results were obtained by identification of resistance genes by mapping directly against the raw reads...

  5. Gene expression analysis of two extensively drug-resistant tuberculosis isolates show that two-component response systems enhance drug resistance.

    Science.gov (United States)

    Yu, Guohua; Cui, Zhenling; Sun, Xian; Peng, Jinfu; Jiang, Jun; Wu, Wei; Huang, Wenhua; Chu, Kaili; Zhang, Lu; Ge, Baoxue; Li, Yao

    2015-05-01

    Global analysis of expression profiles using DNA microarrays was performed between a reference strain H37Rv and two clinical extensively drug-resistant isolates in response to three anti-tuberculosis drug exposures (isoniazid, capreomycin, and rifampicin). A deep analysis was then conducted using a combination of genome sequences of the resistant isolates, resistance information, and related public microarray data. Certain known resistance-associated gene sets were significantly overrepresented in upregulated genes in the resistant isolates relative to that observed in H37Rv, which suggested a link between resistance and expression levels of particular genes. In addition, isoniazid and capreomycin response genes, but not rifampicin, either obtained from published works or our data, were highly consistent with the differentially expressed genes of resistant isolates compared to those of H37Rv, indicating a strong association between drug resistance of the isolates and genes differentially regulated by isoniazid and capreomycin exposures. Based on these results, 92 genes of the studied isolates were identified as candidate resistance genes, 10 of which are known resistance-related genes. Regulatory network analysis of candidate resistance genes using published networks and literature mining showed that three two-component regulatory systems and regulator CRP play significant roles in the resistance of the isolates by mediating the production of essential envelope components. Finally, drug sensitivity testing indicated strong correlations between expression levels of these regulatory genes and sensitivity to multiple anti-tuberculosis drugs in Mycobacterium tuberculosis. These findings may provide novel insights into the mechanism underlying the emergence and development of drug resistance in resistant tuberculosis isolates and useful clues for further studies on this issue. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. Expression Analysis of Stress-Related Genes in Kernels of Different Maize (Zea mays L.) Inbred Lines with Different Resistance to Aflatoxin Contamination

    Science.gov (United States)

    Jiang, Tingbo; Zhou, Boru; Luo, Meng; Abbas, Hamed K.; Kemerait, Robert; Lee, Robert Dewey; Scully, Brian T.; Guo, Baozhu

    2011-01-01

    This research examined the expression patterns of 94 stress-related genes in seven maize inbred lines with differential expressions of resistance to aflatoxin contamination. The objective was to develop a set of genes/probes associated with resistance to A. flavus and/or aflatoxin contamination. Ninety four genes were selected from previous gene expression studies with abiotic stress to test the differential expression in maize lines, A638, B73, Lo964, Lo1016, Mo17, Mp313E, and Tex6, using real-time RT-PCR. Based on the relative-expression levels, the seven maize inbred lines clustered into two different groups. One group included B73, Lo1016 and Mo17, which had higher levels of aflatoxin contamination and lower levels of overall gene expression. The second group which included Tex6, Mp313E, Lo964 and A638 had lower levels of aflatoxin contamination and higher overall levels of gene expressions. A total of six “cross-talking” genes were identified between the two groups, which are highly expressed in the resistant Group 2 but down-regulated in susceptible Group 1. When further subjected to drought stress, Tex6 expressed more genes up-regulated and B73 has fewer genes up-regulated. The transcript patterns and interactions measured in these experiments indicate that the resistant mechanism is an interconnected process involving many gene products and transcriptional regulators, as well as various host interactions with environmental factors, particularly, drought and high temperature. PMID:22069724

  7. Characterisation of ALS genes in the polyploid species Schoenoplectus mucronatus and implications for resistance management.

    Science.gov (United States)

    Scarabel, Laura; Locascio, Antonella; Furini, Antonella; Sattin, Maurizio; Varotto, Serena

    2010-03-01

    The polyploid weed Schoenoplectus mucronatus (L.) Palla has evolved target-site resistance to ALS-inhibiting herbicides in Italian rice crops. Molecular and genetic characterisation of the resistance mechanism is relevant to the evolution and management of herbicide resistance. The authors aimed (a) to study the organisation of the target-site loci in two field-selected S. mucronatus populations with different cross-resistance patterns, (b) to identify the mutations endowing resistance to ALS inhibitors and determine the role of these mutations by using transgenesis and (c) to analyse the implications for the management of the S. mucronatus populations. Two complete ALS genes (ALS1 and ALS2) having an intron and a third partial intronless ALS gene (ALS3) were identified. The presence of multiple ALS genes was confirmed by Southern blot analyses, and ALS loci were characterised by examining cytosine methylation. In S. mucronatus leaves, the transcripts of ALS1, ALS2 and ALS3 were detected. Two mutations endowing resistance (Pro(197) to His and Trp(574) to Leu) were found in both resistant populations, but at different frequencies. Tobacco plants transformed with the two resistant alleles indicated that the Pro(197)-to-His substitution conferred resistance to SU and TP herbicides, while the allele with the Trp(574)-to-Leu substitution conferred cross-resistance to SU, TP, IMI and PTB herbicides. Schoenoplectus mucronatus has multiple ALS genes characterised by methylated sites that can influence the expression profile. The two mutated alleles proved to be responsible for ALS resistance. At population level, the resistance pattern depends on the frequency of various resistant genotypes, and this influences the efficacy of various ALS-inhibiting herbicides.

  8. Consolidating and Exploring Antibiotic Resistance Gene Data Resources

    DEFF Research Database (Denmark)

    Xavier, Basil Britto; Das, Anupam J.; Cochrane, Guy

    2016-01-01

    The unrestricted use of antibiotics has resulted in rapid acquisition of antibiotic resistance (AR) and spread of multidrug-resistant (MDR) bacterial pathogens. With the advent of next-generation sequencing technologies and their application in understanding MDR pathogen dynamics, it has become i...

  9. Environmental dissemination of antibiotic resistance genes and correlation to anthropogenic contamination with antibiotics

    Science.gov (United States)

    Berglund, Björn

    2015-01-01

    Antibiotic resistance is a growing problem which threatens modern healthcare globally. Resistance has traditionally been viewed as a clinical problem, but recently non-clinical environments have been highlighted as an important factor in the dissemination of antibiotic resistance genes (ARGs). Horizontal gene transfer (HGT) events are likely to be common in aquatic environments; integrons in particular are well suited for mediating environmental dissemination of ARGs. A growing body of evidence suggests that ARGs are ubiquitous in natural environments. Particularly, elevated levels of ARGs and integrons in aquatic environments are correlated to proximity to anthropogenic activities. The source of this increase is likely to be routine discharge of antibiotics and resistance genes, for example, via wastewater or run-off from livestock facilities and agriculture. While very high levels of antibiotic contamination are likely to select for resistant bacteria directly, the role of sub-inhibitory concentrations of antibiotics in environmental antibiotic resistance dissemination remains unclear. In vitro studies have shown that low levels of antibiotics can select for resistant mutants and also facilitate HGT, indicating the need for caution. Overall, it is becoming increasingly clear that the environment plays an important role in dissemination of antibiotic resistance; further studies are needed to elucidate key aspects of this process. Importantly, the levels of environmental antibiotic contamination at which resistant bacteria are selected for and HGT is facilitated at should be determined. This would enable better risk analyses and facilitate measures for preventing dissemination and development of antibiotic resistance in the environment. PMID:26356096

  10. Discovery and characterization of two new stem rust resistance genes in Aegilops sharonensis.

    Science.gov (United States)

    Yu, Guotai; Champouret, Nicolas; Steuernagel, Burkhard; Olivera, Pablo D; Simmons, Jamie; Williams, Cole; Johnson, Ryan; Moscou, Matthew J; Hernández-Pinzón, Inmaculada; Green, Phon; Sela, Hanan; Millet, Eitan; Jones, Jonathan D G; Ward, Eric R; Steffenson, Brian J; Wulff, Brande B H

    2017-06-01

    We identified two novel wheat stem rust resistance genes, Sr-1644-1Sh and Sr-1644-5Sh in Aegilops sharonensis that are effective against widely virulent African races of the wheat stem rust pathogen. Stem rust is one of the most important diseases of wheat in the world. When single stem rust resistance (Sr) genes are deployed in wheat, they are often rapidly overcome by the pathogen. To this end, we initiated a search for novel sources of resistance in diverse wheat relatives and identified the wild goatgrass species Aegilops sharonesis (Sharon goatgrass) as a rich reservoir of resistance to wheat stem rust. The objectives of this study were to discover and map novel Sr genes in Ae. sharonensis and to explore the possibility of identifying new Sr genes by genome-wide association study (GWAS). We developed two biparental populations between resistant and susceptible accessions of Ae. sharonensis and performed QTL and linkage analysis. In an F 6 recombinant inbred line and an F 2 population, two genes were identified that mapped to the short arm of chromosome 1S sh , designated as Sr-1644-1Sh, and the long arm of chromosome 5S sh , designated as Sr-1644-5Sh. The gene Sr-1644-1Sh confers a high level of resistance to race TTKSK (a member of the Ug99 race group), while the gene Sr-1644-5Sh conditions strong resistance to TRTTF, another widely virulent race found in Yemen. Additionally, GWAS was conducted on 125 diverse Ae. sharonensis accessions for stem rust resistance. The gene Sr-1644-1Sh was detected by GWAS, while Sr-1644-5Sh was not detected, indicating that the effectiveness of GWAS might be affected by marker density, population structure, low allele frequency and other factors.

  11. Does human activity impact the natural antibiotic resistance background? Abundance of antibiotic resistance genes in 21 Swiss lakes.

    Science.gov (United States)

    Czekalski, Nadine; Sigdel, Radhika; Birtel, Julia; Matthews, Blake; Bürgmann, Helmut

    2015-08-01

    Antibiotic resistance genes (ARGs) are emerging environmental contaminants, known to be continuously discharged into the aquatic environment via human and animal waste. Freshwater aquatic environments represent potential reservoirs for ARG and potentially allow sewage-derived ARG to persist and spread in the environment. This may create increased opportunities for an eventual contact with, and gene transfer to, human and animal pathogens via the food chain or drinking water. However, assessment of this risk requires a better understanding of the level and variability of the natural resistance background and the extent of the human impact. We have analyzed water samples from 21 Swiss lakes, taken at sampling points that were not under the direct influence of local contamination sources and analyzed the relative abundance of ARG using quantitative real-time PCR. Copy numbers of genes mediating resistance to three different broad-spectrum antibiotic classes (sulfonamides: sul1, sul2, tetracyclines: tet(B), tet(M), tet(W) and fluoroquinolones: qnrA) were normalized to copy numbers of bacterial 16S rRNA genes. We used multiple linear regression to assess if ARG abundance is related to human activities in the catchment, microbial community composition and the eutrophication status of the lakes. Sul genes were detected in all sampled lakes, whereas only four lakes contained quantifiable numbers of tet genes, and qnrA remained below detection in all lakes. Our data indicate higher abundance of sul1 in lakes with increasing number and capacity of wastewater treatment plants (WWTPs) in the catchment. sul2 abundance was rather related to long water residence times and eutrophication status. Our study demonstrates the potential of freshwater lakes to preserve antibiotic resistance genes, and provides a reference for ARG abundance from lake systems with low human impact as a baseline for assessing ARG contamination in lake water. Copyright © 2015 Elsevier Ltd. All rights

  12. Resistance genes in barley (Hordeum vulgare L.) and their identification with molecular markers.

    Science.gov (United States)

    Chełkowski, Jerzy; Tyrka, Mirosław; Sobkiewicz, Andrzej

    2003-01-01

    Current information on barley resistance genes available from scientific papers and on-line databases is summarised. The recent literature contains information on 107 major resistance genes (R genes) against fungal pathogens (excluding powdery mildew), pathogenic viruses and aphids identified in Hordeum vulgare accessions. The highest number of resistance genes was identified against Puccinia hordei, Rhynchosporium secalis, and the viruses BaYMV and BaMMV, with 17, 14 and 13 genes respectively. There is still a lot of confusion regarding symbols for R genes against powdery mildew. Among the 23 loci described to date, two regions Mla and Mlo comprise approximately 31 and 25 alleles. Over 50 R genes have already been localised and over 30 mapped on 7 barley chromosomes. Four barley R genes have been cloned recently: Mlo, Rpg1, Mla1 and Mla6, and their structures (sequences) are available. The paper presents a catalogue of barley resistance gene symbols, their chromosomalocation and the list of available DNA markers useful in characterising cultivars and breeding accessions.

  13. Rootstock-regulated gene expression patterns associated with fire blight resistance in apple

    Directory of Open Access Journals (Sweden)

    Jensen Philip J

    2012-01-01

    Full Text Available Abstract Background Desirable apple varieties are clonally propagated by grafting vegetative scions onto rootstocks. Rootstocks influence many phenotypic traits of the scion, including resistance to pathogens such as Erwinia amylovora, which causes fire blight, the most serious bacterial disease of apple. The purpose of the present study was to quantify rootstock-mediated differences in scion fire blight susceptibility and to identify transcripts in the scion whose expression levels correlated with this response. Results Rootstock influence on scion fire blight resistance was quantified by inoculating three-year old, orchard-grown apple trees, consisting of 'Gala' scions grafted to a range of rootstocks, with E. amylovora. Disease severity was measured by the extent of shoot necrosis over time. 'Gala' scions grafted to G.30 or MM.111 rootstocks showed the lowest rates of necrosis, while 'Gala' on M.27 and B.9 showed the highest rates of necrosis. 'Gala' scions on M.7, S.4 or M.9F56 had intermediate necrosis rates. Using an apple DNA microarray representing 55,230 unique transcripts, gene expression patterns were compared in healthy, un-inoculated, greenhouse-grown 'Gala' scions on the same series of rootstocks. We identified 690 transcripts whose steady-state expression levels correlated with the degree of fire blight susceptibility of the scion/rootstock combinations. Transcripts known to be differentially expressed during E. amylovora infection were disproportionately represented among these transcripts. A second-generation apple microarray representing 26,000 transcripts was developed and was used to test these correlations in an orchard-grown population of trees segregating for fire blight resistance. Of the 690 transcripts originally identified using the first-generation array, 39 had expression levels that correlated with fire blight resistance in the breeding population. Conclusions Rootstocks had significant effects on the fire blight

  14. Gene Expression Contributes to the Recent Evolution of Host Resistance in a Model Host Parasite System

    Directory of Open Access Journals (Sweden)

    Brian K. Lohman

    2017-09-01

    Full Text Available Heritable population differences in immune gene expression following infection can reveal mechanisms of host immune evolution. We compared gene expression in infected and uninfected threespine stickleback (Gasterosteus aculeatus from two natural populations that differ in resistance to a native cestode parasite, Schistocephalus solidus. Genes in both the innate and adaptive immune system were differentially expressed as a function of host population, infection status, and their interaction. These genes were enriched for loci controlling immune functions known to differ between host populations or in response to infection. Coexpression network analysis identified two distinct processes contributing to resistance: parasite survival and suppression of growth. Comparing networks between populations showed resistant fish have a dynamic expression profile while susceptible fish are static. In summary, recent evolutionary divergence between two vertebrate populations has generated population-specific gene expression responses to parasite infection, affecting parasite establishment and growth.

  15. TaEDS1 genes positively regulate resistance to powdery mildew in wheat.

    Science.gov (United States)

    Chen, Guiping; Wei, Bo; Li, Guoliang; Gong, Caiyan; Fan, Renchun; Zhang, Xiangqi

    2018-04-01

    Three EDS1 genes were cloned from common wheat and were demonstrated to positively regulate resistance to powdery mildew in wheat. The EDS1 proteins play important roles in plant basal resistance and TIR-NB-LRR protein-triggered resistance in dicots. Until now, there have been very few studies on EDS1 in monocots, and none in wheat. Here, we report on three common wheat orthologous genes of EDS1 family (TaEDS1-5A, 5B and 5D) and their function in powdery mildew resistance. Comparisons of these genes with their orthologs in diploid ancestors revealed that EDS1 is a conserved gene family in Triticeae. The cDNA sequence similarity among the three TaEDS1 genes was greater than 96.5%, and they shared sequence similarities of more than 99.6% with the respective orthologs from diploid ancestors. The phylogenetic analysis revealed that the EDS1 family originated prior to the differentiation of monocots and dicots, and EDS1 members have since undergone clear structural differentiation. The transcriptional levels of TaEDS1 genes in the leaves were obviously higher than those of the other organs, and they were induced by Blumeria graminis f. sp. tritici (Bgt) infection and salicylic acid (SA) treatment. The BSMV-VIGS experiments indicated that knock-down the transcriptional levels of the TaEDS1 genes in a powdery mildew-resistant variety of common wheat compromised resistance. Contrarily, transient overexpression of TaEDS1 genes in a susceptible common wheat variety significantly reduced the haustorium index and attenuated the growth of Bgt. Furthermore, the expression of TaEDS1 genes in the Arabidopsis mutant eds1-1 complemented its susceptible phenotype to powdery mildew. The above evidences strongly suggest that TaEDS1 acts as a positive regulator and confers resistance against powdery mildew in common wheat.

  16. Screening for Resistance to Brown Rust of Sugarcane: Use of Bru1 resistance gene prospects and challenges

    Science.gov (United States)

    Brown rust of sugarcane caused by, Puccinia melanocephala, is a serious problem in the US sugarcane industry. A major resistance gene, Bru1 was identified and methodology for detecting it was developed by French scientists at CIRAD. The majority of the research resulting in the discovery of Bru1 res...

  17. Deep sequence analysis reveals the ovine rumen as a reservoir of antibiotic resistance genes.

    Science.gov (United States)

    Hitch, Thomas C A; Thomas, Ben J; Friedersdorff, Jessica C A; Ougham, Helen; Creevey, Christopher J

    2018-04-01

    Antibiotic resistance is an increasingly important environmental pollutant with direct consequences for human health. Identification of environmental sources of antibiotic resistance genes (ARGs) makes it possible to follow their evolution and prevent their entry into the clinical setting. ARGs have been found in environmental sources exogenous to the original source and previous studies have shown that these genes are capable of being transferred from livestock to humans. Due to the nature of farming and the slaughter of ruminants for food, humans interact with these animals in close proximity, and for this reason it is important to consider the risks to human health. In this study, we characterised the ARG populations in the ovine rumen, termed the resistome. This was done using the Comprehensive Antibiotic Resistance Database (CARD) to identify the presence of genes conferring resistance to antibiotics within the rumen. Genes were successfully mapped to those that confer resistance to a total of 30 different antibiotics. Daptomycin was identified as the most common antibiotic for which resistance is present, suggesting that ruminants may be a source of daptomycin ARGs. Colistin resistance, conferred by the gene pmrE, was also found to be present within all samples, with an average abundance of 800 counts. Due to the high abundance of some ARGs (against daptomycin) and the presence of rare ARGs (against colistin), we suggest further study and monitoring of the rumen resistome as a possible source of clinically relevant ARGs. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  18. The NB-LRR gene Pm60 confers powdery mildew resistance in wheat.

    Science.gov (United States)

    Zou, Shenghao; Wang, Huan; Li, Yiwen; Kong, Zhaosheng; Tang, Dingzhong

    2018-04-01

    Powdery mildew is one of the most devastating diseases of wheat. To date, few powdery mildew resistance genes have been cloned from wheat due to the size and complexity of the wheat genome. Triticum urartu is the progenitor of the A genome of wheat and is an important source for powdery mildew resistance genes. Using molecular markers designed from scaffolds of the sequenced T. urartu accession and standard map-based cloning, a powdery mildew resistance locus was mapped to a 356-kb region, which contains two nucleotide-binding and leucine-rich repeat domain (NB-LRR) protein-encoding genes. Virus-induced gene silencing, single-cell transient expression, and stable transformation assays demonstrated that one of these two genes, designated Pm60, confers resistance to powdery mildew. Overexpression of full-length Pm60 and two allelic variants in Nicotiana benthamiana leaves induced hypersensitive cell death response, but expression of the coiled-coil domain alone was insufficient to induce hypersensitive response. Yeast two-hybrid, bimolecular fluorescence complementation and luciferase complementation imaging assays showed that Pm60 protein interacts with its neighboring NB-containing protein, suggesting that they might be functionally related. The identification and cloning of this novel wheat powdery mildew resistance gene will facilitate breeding for disease resistance in wheat. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

  19. Comparative Digital Gene Expression Analysis of Tissue-Cultured Plantlets of Highly Resistant and Susceptible Banana Cultivarsin Response to Fusarium oxysporum

    Directory of Open Access Journals (Sweden)

    Yuqing Niu

    2018-01-01

    Full Text Available Banana Fusarium wilt caused by Fusarium oxysporum f. sp. cubense (Foc is one of the most destructive soil-borne diseases. In this study, young tissue-cultured plantlets of banana (Musa spp. AAA cultivars differing in Foc susceptibility were used to reveal their differential responses to this pathogen using digital gene expression (DGE. Data were evaluated by various bioinformatic tools (Venn diagrams, gene ontology (GO annotation and Kyoto encyclopedia of genes and genomes (KEGG pathway analyses and immunofluorescence labelling method to support the identification of gene candidates determining the resistance of banana against Foc. Interestingly, we have identified MaWRKY50 as an important gene involved in both constitutive and induced resistance. We also identified new genes involved in the resistance of banana to Foc, including several other transcription factors (TFs, pathogenesis-related (PR genes and some genes related to the plant cell wall biosynthesis or degradation (e.g., pectinesterases, β-glucosidases, xyloglucan endotransglucosylase/hydrolase and endoglucanase. The resistant banana cultivar shows activation of PR-3 and PR-4 genes as well as formation of different constitutive cell barriers to restrict spreading of the pathogen. These data suggest new mechanisms of banana resistance to Foc.

  20. Does Nilaparvata lugens gain tolerance to rice resistance genes through conspecifics at shared feeding sites?

    NARCIS (Netherlands)

    Ferrater, Jedeliza B.; Horgan, Finbarr G.

    2016-01-01

    This study examines the possibility of horizontal and vertical transmission of virulence (the ability to tolerate a given resistant plant or resistance gene) between individuals from brown planthopper, Nilaparvata lugens (Stål) (Hemiptera: Delphacidae), populations with distinct feeding abilities

  1. Inheritance and molecular mapping of anthracnose resistance genes present in sorghum line SC112-14

    Science.gov (United States)

    Anthracnose (Colletotrichum sublineolum) is one of the most destructive diseases of sorghum (Sorghum bicolor L. Moench) affecting all aerial tissues of the plant. The most effective strategy for its control is the incorporation of resistance genes. Therefore, the anthracnose resistance response pr...

  2. Mutations in rpoB and katG genes of multidrug resistant ...

    African Journals Online (AJOL)

    Introduction: Tuberculosis remains the leading causes of death worldwide with frequencies of mutations in rifampicin and isoniazid resistant Mycobacterium tuberculosis isolates varying according to geographical location. There is limited information in Zimbabwe on specific antibiotic resistance gene mutation patterns in ...

  3. AFLP/SSR mapping of resistance genes to Alectra vogelii in cowpea ...

    African Journals Online (AJOL)

    To find and map the resistance gene to A. vogelii in cowpea, a F2 population from a cross involving a resistant parent IT81D-994 and a susceptible TVX3236 was screened. Amplified fragment length polymorphism (AFLP) in combination with Single Sequence Repeat (SSR) analysis was used to identify markers that may be ...

  4. Cloning and functional characterization of the Rvi15 (Vr2) gene for apple scab resistance

    NARCIS (Netherlands)

    Schouten, H.J.; Brinkhuis, J.; Burgh, van der S.; Schaart, J.; Groenwold, R.; Broggini, G.A.L.; Gessler, C.

    2014-01-01

    Apple scab, caused by Venturia inaequalis, is a serious disease of apple. Previously, the scab resistance Rvi15 (Vr2) from the accession GMAL 2473 was genetically mapped, and three candidate resistance genes were identified. Here, we report the cloning and functional characterization of these three

  5. Expression of the Bs2 pepper gene confers resistance to bacterial spot disease in tomato.

    Science.gov (United States)

    Tai, T H; Dahlbeck, D; Clark, E T; Gajiwala, P; Pasion, R; Whalen, M C; Stall, R E; Staskawicz, B J

    1999-11-23

    The Bs2 resistance gene of pepper specifically recognizes and confers resistance to strains of Xanthomonas campestris pv. vesicatoria that contain the corresponding bacterial avirulence gene, avrBs2. The involvement of avrBs2 in pathogen fitness and its prevalence in many X. campestris pathovars suggests that the Bs2 gene may be durable in the field and provide resistance when introduced into other plant species. Employing a positional cloning strategy, the Bs2 locus was isolated and the gene was identified by coexpression with avrBs2 in an Agrobacterium-mediated transient assay. A single candidate gene, predicted to encode motifs characteristic of the nucleotide binding site-leucine-rich repeat class of resistance genes, was identified. This gene specifically controlled the hypersensitive response when transiently expressed in susceptible pepper and tomato lines and in a nonhost species, Nicotiana benthamiana, and was designated as Bs2. Functional expression of Bs2 in stable transgenic tomatoes supports its use as a source of resistance in other Solanaceous plant species.

  6. Occurrence and Diversity of Tetracycline Resistance Genes in Lagoons and Groundwater Underlying Two Swine Production Facilities

    Science.gov (United States)

    Chee-Sanford, J. C.; Aminov, R.I.; Krapac, I.J.; Garrigues-Jeanjean, N.; Mackie, R.I.

    2001-01-01

    In this study, we used PCR typing methods to assess the presence of tetracycline resistance determinants conferring ribosomal protection in waste lagoons and in groundwater underlying two swine farms. All eight classes of genes encoding this mechanism of resistance [tet(O), tet(Q), tet(W), tet(M), tetB(P), tet(S), tet(T), and otrA] were found in total DNA extracted from water of two lagoons. These determinants were found to be seeping into the underlying groundwater and could be detected as far as 250 m downstream from the lagoons. The identities and origin of these genes in groundwater were confirmed by PCR-denaturing gradient gel electrophoresis and sequence analyses. Tetracycline-resistant bacterial isolates from groundwater harbored the tet(M) gene, which was not predominant in the environmental samples and was identical to tet(M) from the lagoons. The presence of this gene in some typical soil inhabitants suggests that the vector of antibiotic resistance gene dissemination is not limited to strains of gastrointestinal origin carrying the gene but can be mobilized into the indigenous soil microbiota. This study demonstrated that tet genes occur in the environment as a direct result of agriculture and suggested that groundwater may be a potential source of antibiotic resistance in the food chain.

  7. Metagenomic profiling of antibiotic resistance genes and mobile genetic elements in a tannery wastewater treatment plant.

    Directory of Open Access Journals (Sweden)

    Zhu Wang

    Full Text Available Antibiotics are often used to prevent sickness and improve production in animal agriculture, and the residues in animal bodies may enter tannery wastewater during leather production. This study aimed to use Illumina high-throughput sequencing to investigate the occurrence, diversity and abundance of antibiotic resistance genes (ARGs and mobile genetic elements (MGEs in aerobic and anaerobic sludge of a full-scale tannery wastewater treatment plant (WWTP. Metagenomic analysis showed that Proteobacteria, Firmicutes, Bacteroidetes and Actinobacteria dominated in the WWTP, but the relative abundance of archaea in anaerobic sludge was higher than in aerobic sludge. Sequencing reads from aerobic and anaerobic sludge revealed differences in the abundance of functional genes between both microbial communities. Genes coding for antibiotic resistance were identified in both communities. BLAST analysis against Antibiotic Resistance Genes Database (ARDB further revealed that aerobic and anaerobic sludge contained various ARGs with high abundance, among which sulfonamide resistance gene sul1 had the highest abundance, occupying over 20% of the total ARGs reads. Tetracycline resistance genes (tet were highly rich in the anaerobic sludge, among which tet33 had the highest abundance, but was absent in aerobic sludge. Over 70 types of insertion sequences were detected in each sludge sample, and class 1 integrase genes were prevalent in the WWTP. The results highlighted prevalence of ARGs and MGEs in tannery WWTPs, which may deserve more public health concerns.

  8. Evaluation of five antibiotic resistance genes in wastewater treatment systems of swine farms by real-time PCR.

    Science.gov (United States)

    Tao, Chi-Wei; Hsu, Bing-Mu; Ji, Wen-Tsai; Hsu, Tsui-Kang; Kao, Po-Min; Hsu, Chun-Po; Shen, Shu-Min; Shen, Tzung-Yu; Wan, Terng-Jou; Huang, Yu-Li

    2014-10-15

    Antibiotics are widely used in livestock for infection treatment and growth promotion. Wastes from animal husbandry are a potential environmental source of antibiotic-insensitive pathogens, and the removal efficiency of the resistance genotypes in current wastewater treatment plants (WWTPs) is unknown. In this study, quantitative PCR was used for evaluating antibiotic resistance genes in wastewater treatment processes. Six wastewater treatment plants in different swine farms were included in this study, and five antibiotic resistance genes (ARGs) were tested for each treatment procedure. All of the tested ARGs including tetA, tetW, sulI, sulII, and blaTEM genes were detected in six swine farms with considerable amounts. The results showed that antibiotic resistance is prevalent in livestock farming. The ARG levels were varied by wastewater treatment procedure, frequently with the highest level at anaerobic treatment tank and lowest in the activated sludge unit and the effluents. After normalizing the ARG levels to 16S rRNA gene copies, the results showed that ARGs in WWTP units fluctuated partly with the quantity of bacteria. Regardless of its importance in biodegradation, the anaerobic procedure may facilitate bacterial growth thus increasing the sustainability of the antibiotic resistance genotypes. After comparing the copy numbers in influx and efflux samples, the mean removal efficiency of ARGs ranged between 33.30 and 97.56%. The results suggested that treatments in the WWTP could partially reduce the spread of antibiotic-resistant bacteria, and additional procedures such as sedimentation may not critically affect the removal efficiency. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. Detection and characterisation of genes encoding antibiotic resistance in the cultivable oral microflora.

    OpenAIRE

    Villedieu, A.

    2006-01-01

    The emergence of antibiotic-resistant bacteria has become a major threat to public health. The increased use of antibiotics has selected for the dissemination of antibiotic resistance genes between organisms from different species and different genera. There is a large body of evidence that the indigenous microbiota can act as a reservoir of antibiotic-resistant bacteria. However little is known about the molecular basis for this in bacteria from the oral cavity. Therefore the aim of this wor...

  10. Fate of antibiotic resistance genes within the microbial communities of three waste water treatment plants

    OpenAIRE

    Di Cesare, Andrea; Eckert, Ester; D'Urso, Silvia; Doppelbauer, Julia; Corno, Gianluca

    2016-01-01

    Although Waste Water Treatment Plant (WWTP) are designed to reduce the biological pollution of urban waters, they lack a specific action against antibiotic resistance bacteria (ARB) or antibiotic resistance genes (ARGs). Nowadays, it is well documented that WWTPs constitute a reservoir of antibiotic resistances and, in some cases, they can be a favorable environment for the selection of ARB. This represent a serious concern for the public health, because the effluents of the WWTPs can be reus...

  11. Identification of genes associated with cisplatin resistance in human oral squamous cell carcinoma cell line

    OpenAIRE

    Zhang Ping; Zhang Zhiyuan; Zhou Xiaojian; Qiu Weiliu; Chen Fangan; Chen Wantao

    2006-01-01

    Abstract Background Cisplatin is widely used for chemotherapy of head and neck squamous cell carcinoma. However, details of the molecular mechanism responsible for cisplatin resistance are still unclear. The aim of this study was to identify the expression of genes related to cisplatin resistance in oral squamous cell carcinoma cells. Methods A cisplatin-resistant cell line, Tca/cisplatin, was established from a cisplatin-sensitive cell line, Tca8113, which was derived from moderately-differe...

  12. Analysis of the CYP51 gene and encoded protein in propiconazole-resistant isolates of Mycosphaerella fijiensis.

    Science.gov (United States)

    Cañas-Gutiérrez, Gloria P; Angarita-Velásquez, Mónica J; Restrepo-Flórez, Juan M; Rodríguez, Paola; Moreno, Claudia X; Arango, Rafael

    2009-08-01

    Mycosphaerella fijiensis Morelet causes black sigatoka, the most important disease in bananas and plantains. Disease control is mainly through the application of systemic fungicides, including sterol demethylation inhibitors (DMIs). Their intensive use has favoured the appearance of resistant strains. However, no studies have been published on the possible resistance mechanisms. In this work, the CYP51 gene was isolated and sequenced in 11 M. fijiensis strains that had shown different degrees of in vitro sensitivity to propiconazole, one of the most widely used DMI fungicides. Six mutations that could be related to the loss in sensitivity to this fungicide were found: Y136F, A313G, Y461D, Y463D, Y463H and Y463N. The mutations were analysed using a homology model of the protein that was constructed from the crystallographic structure of Mycobacterium tuberculosis (Zoff.) Lehmann & Neumann. Additionally, gene expression was determined in 13 M. fijiensis strains through quantitative analysis of products obtained by RT-PCR. Several changes in the sequence of the gene encoding sterol 14alpha-demethylase were found that have been described in other fungi as being correlated with resistance to azole fungicides. No correlation was found between gene expression and propiconazole resistance.

  13. VRprofile: gene-cluster-detection-based profiling of virulence and antibiotic resistance traits encoded within genome sequences of pathogenic bacteria.

    Science.gov (United States)

    Li, Jun; Tai, Cui; Deng, Zixin; Zhong, Weihong; He, Yongqun; Ou, Hong-Yu

    2017-01-10

    VRprofile is a Web server that facilitates rapid investigation of virulence and antibiotic resistance genes, as well as extends these trait transfer-related genetic contexts, in newly sequenced pathogenic bacterial genomes. The used backend database MobilomeDB was firstly built on sets of known gene cluster loci of bacterial type III/IV/VI/VII secretion systems and mobile genetic elements, including integrative and conjugative elements, prophages, class I integrons, IS elements and pathogenicity/antibiotic resistance islands. VRprofile is thus able to co-localize the homologs of these conserved gene clusters using HMMer or BLASTp searches. With the integration of the homologous gene cluster search module with a sequence composition module, VRprofile has exhibited better performance for island-like region predictions than the other widely used methods. In addition, VRprofile also provides an integrated Web interface for aligning and visualizing identified gene clusters with MobilomeDB-archived gene clusters, or a variety set of bacterial genomes. VRprofile might contribute to meet the increasing demands of re-annotations of bacterial variable regions, and aid in the real-time definitions of disease-relevant gene clusters in pathogenic bacteria of interest. VRprofile is freely available at http://bioinfo-mml.sjtu.edu.cn/VRprofile. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  14. Full-Length Sequence of Mouse Acupuncture-Induced 1-L (Aig1l Gene Including Its Transcriptional Start Site

    Directory of Open Access Journals (Sweden)

    Mika Ohta

    2011-01-01

    Full Text Available We have been investigating the molecular efficacy of electroacupuncture (EA, which is one type of acupuncture therapy. In our previous molecular biological study of acupuncture, we found an EA-induced gene, named acupuncture-induced 1-L (Aig1l, in mouse skeletal muscle. The aims of this study consisted of identification of the full-length cDNA sequence of Aig1l including the transcriptional start site, determination of the tissue distribution of Aig1l and analysis of the effect of EA on Aig1l gene expression. We determined the complete cDNA sequence including the transcriptional start site via cDNA cloning with the cap site hunting method. We then analyzed the tissue distribution of Aig1l by means of northern blot analysis and real-time quantitative polymerase chain reaction. We used the semiquantitative reverse transcriptase-polymerase chain reaction to examine the effect of EA on Aig1l gene expression. Our results showed that the complete cDNA sequence of Aig1l was 6073 bp long, and the putative protein consisted of 962 amino acids. All seven tissues that we analyzed expressed the Aig1l gene. In skeletal muscle, EA induced expression of the Aig1l gene, with high expression observed after 3 hours of EA. Our findings thus suggest that the Aig1l gene may play a key role in the molecular mechanisms of EA efficacy.

  15. The majority of genes in the pathogenic Neisseria species are present in non-pathogenic Neisseria lactamica, including those designated as 'virulence genes'

    Directory of Open Access Journals (Sweden)

    Saunders Nigel J

    2006-05-01

    Full Text Available Abstract Background Neisseria meningitidis causes the life-threatening diseases meningococcal meningitis and meningococcal septicemia. Neisseria gonorrhoeae is closely related to the meningococcus, but is the cause of the very different infection, gonorrhea. A number of genes have been implicated in the virulence of these related yet distinct pathogens, but the genes that define and differentiate the species and their behaviours have not been established. Further, a related species, Neisseria lactamica is not associated with either type of infection in normally healthy people, and lives as a harmless commensal. We have determined which of the genes so far identified in the genome sequences of the pathogens are also present in this non-pathogenic related species. Results Thirteen unrelated strains of N. lactamica were investigated using comparative genome hybridization to the pan-Neisseria microarray-v2, which contains 2845 unique gene probes. The presence of 127 'virulence genes' was specifically addressed; of these 85 are present in N. lactamica. Of the remaining 42 'virulence genes' only 11 are present in all four of the sequenced pathogenic Neisseria. Conclusion Assessment of the complete dataset revealed that the vast majority of genes present in the pathogens are also present in N. lactamica. Of the 1,473 probes to genes shared by all four pathogenic genome sequences, 1,373 hybridize to N. lactamica. These shared genes cannot include genes that are necessary and sufficient for the virulence of the pathogens, since N. lactamica does not share this behaviour. This provides an essential context for the interpretation of gene complement studies of the pathogens.

  16. Multiple drug resistance protein (MDR-1, multidrug resistance-related protein (MRP and lung resistance protein (LRP gene expression in childhood acute lymphoblastic leukemia

    Directory of Open Access Journals (Sweden)

    Elvis Terci Valera

    Full Text Available CONTEXT: Despite the advances in the cure rate for acute lymphoblastic leukemia, approximately 25% of affected children suffer relapses. Expression of genes for the multiple drug resistance protein (MDR-1, multidrug resistance-related protein (MRP, and lung resistance protein (LRP may confer the phenotype of resistance to the treatment of neoplasias. OBJECTIVE: To analyze the expression of the MDR-1, MRP and LRP genes in children with a diagnosis of acute lymphoblastic leukemia via the semiquantitative reverse transcription polymerase chain reaction (RT-PCR, and to determine the correlation between expression and event-free survival and clinical and laboratory variables. DESIGN: A retrospective clinical study. SETTING: Laboratory of Pediatric Oncology, Department of Pediatrics, Faculdade de Medicina de Ribeirão Preto, Universidade de São Paulo, Brazil. METHODS: Bone marrow aspirates from 30 children with a diagnosis of acute lymphoblastic leukemia were assessed for the expression of messenger RNA for the MDR-1, MRP and LRP genes by semi-quantitative RT-PCR. RESULTS: In the three groups studied, only the increased expression of LRP was related to worsened event-free survival (p = 0.005. The presence of the common acute lymphoblastic leukemia antigen (CALLA was correlated with increased LRP expression (p = 0.009 and increased risk of relapse or death (p = 0.05. The relative risk of relapse or death was six times higher among children with high LRP expression upon diagnosis (p = 0.05, as confirmed by multivariate analysis of the three genes studied (p = 0.035. DISCUSSION: Cell resistance to drugs is a determinant of the response to chemotherapy and its detection via RT-PCR may be of clinical importance. CONCLUSIONS: Evaluation of the expression of genes for resistance to antineoplastic drugs in childhood acute lymphoblastic leukemia upon diagnosis, and particularly the expression of the LRP gene, may be of clinical relevance, and should be the

  17. Members of the genera Paenibacillus and Rhodococcus harbor genes homologous to enterococcal glycopeptide resistance genes vanA and vanB

    DEFF Research Database (Denmark)

    Guardabassi, L.; Christensen, H.; Hasman, Henrik

    2004-01-01

    Genes homologous to enterococcal glycopeptide resistance genes vanA and vanB were found in glycopeptide-resistant Paenibacillus and Rhodococcus strains from soil. The putative D-Ala:D-Lac ligase genes in Paenibacillus thiaminolyticus PT-2B1 and Paenibacillus apiarius PA-B2B were closely related...

  18. 40 CFR 174.513 - Potato Leaf Roll Virus Resistance Gene (also known as orf1/orf2 gene); exemption from the...

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Potato Leaf Roll Virus Resistance Gene... REQUIREMENTS FOR PLANT-INCORPORATED PROTECTANTS Tolerances and Tolerance Exemptions § 174.513 Potato Leaf Roll... protectant Potato Leaf Roll Virus Resistance Gene (also known as orf1/orf2 gene) in or on all food...

  19. Isolation and characterization of resistant gene analogs in cassava ...

    African Journals Online (AJOL)

    These candidate sequences mapped to the draft cassava genome with high sequence similarity to predicted NBS-LRR genes. These novel sequences may serve as a stepping stone for further characterization and experimental validation of predicted R genes in the draft cassava genome, ultimately leading to the ...

  20. Mapping of stripe rust resistance gene in an Aegilops caudata ...

    Indian Academy of Sciences (India)

    Seedling resistance is usually race-specific, but often pro- vides complete ... Genomic DNA was extracted using the CTAB method of. Saghai-Maroof ... Polymerase chain reactions (PCR) were performed in ..... The continuous supply of the rust ...

  1. Genetic analysis and location of a resistance gene to Puccinia ...

    Indian Academy of Sciences (India)

    Administrator

    the wheat production in Asia, North America, Europe and other wheat growing areas. China is the largest ..... A history of wheat breeding. ... and Yr65 for stripe rust resistance in hexaploid derivatives of durum wheat accessions PI 331260.

  2. Simulation of AZ-PN100 resist pattern fluctuation in X-ray lithography, including synchrotron beam polarization

    International Nuclear Information System (INIS)

    Scheckler, E.W.; Ogawa, Taro; Tanaka, Toshihiko; Takeda, Eiji; Oizumi, Hiroaki.

    1993-01-01

    A new simulation model for nanometer-scale pattern fluctuation in X-ray lithography is presented and applied to a study of AZ-PN100 negative chemical amplification resist. The exposure simulation considers polarized photons from a synchrotron radiation (SR) source. Monte Carlo simulation of Auger and photoelectron generation is followed by electron scattering simulation to determine the deposited energy distribution at the nanometer scale, including beam polarization effects. An acid-catalyst random walk model simulates the post-exposure bake (PEB) step. Fourier transform infrared (FTIR) spectroscopy and developed resist thickness measurements are used to fit PEB and rate models for AZ-PN100. A polymer removal model for development simulation predicts the macroscopic resist shape and pattern roughness. The simulated 3σ linewidth variation is in excess of 24 nm. Simulation also shows a detrimental effect if the beam polarization is perpendicular to the line. Simulation assuming a theoretical ideal exposure yields a 50 nm minimum line for standard process conditions. (author)

  3. EPSPS gene amplification conferring resistance to glyphosate in windmill grass (Chloris truncata) in Australia.

    Science.gov (United States)

    Ngo, The D; Malone, Jenna M; Boutsalis, Peter; Gill, Gurjeet; Preston, Christopher

    2018-05-01

    Five glyphosate-resistant populations of Chloris truncata originally collected from New South Wales were compared with one susceptible (S) population from South Australia to confirm glyphosate resistance and elucidate possible mechanisms of resistance. Based on the amounts of glyphosate required to kill 50% of treated plants (LD 50 ), glyphosate resistance (GR) was confirmed in five populations of C. truncata (A536, A528, T27, A534 and A535.1). GR plants were 2.4-8.7-fold more resistant and accumulated less shikimate after glyphosate treatment than S plants. There was no difference in glyphosate absorption and translocation between GR and S plants. The EPSPS gene did not contain any point mutation that had previously been associated with resistance to glyphosate. The resistant plants (A528 and A536) contained up to 32-48 more copies of the EPSPS gene than the susceptible plants. This study has identified EPSPS gene amplification contributing to glyphosate resistance in C. truncata. In addition, a Glu-91-Ala mutation within EPSPS was identified that may contribute to glyphosate resistance in this species. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  4. Seedling Resistance to Stem Rust and Molecular Marker Analysis of Resistance Genes in Wheat Cultivars of Yunnan, China.

    Directory of Open Access Journals (Sweden)

    Tian Ya Li

    Full Text Available Stem rust is one of the most potentially harmful wheat diseases, but has been effectively controlled in China since 1970s. However, the interest in breeding wheat with durable resistance to stem rust has been renewed with the emergence of Ug99 (TTKSK virulent to the widely used resistance gene Sr31, and by which the wheat stem rust was controlled for 40 years in wheat production area worldwide. Yunnan Province, located on the Southwest border of China, is one of the main wheat growing regions, playing a pivotal role in the wheat stem rust epidemic in China. This study investigated the levels of resistance in key wheat cultivars (lines of Yunnan Province. In addition, the existence of Sr25, Sr26, Sr28, Sr31, Sr32, and Sr38 genes in 119 wheat cultivars was assessed using specific DNA markers. The results indicated that 77 (64.7% tested wheat varieties showed different levels of resistance to all the tested races of Puccinia graminis f. sp. tritici. Using molecular markers, we identified the resistance gene Sr31 in 43 samples; Sr38 in 10 samples; Sr28 in 12 samples, and one sample which was resistant against Ug99 (avirulent to Sr32. No Sr25 or Sr26 (effective against Ug99 was identified in any cultivars tested. Furthermore, 5 out of 119 cultivars tested carried both Sr31 and Sr38 and eight contained both Sr31 and Sr28. The results enable the development of appropriate strategies to breed varieties resistant to stem rust.

  5. Association between antimicrobial resistance and virulence genes in Escherichia coli obtained from blood and faeces

    DEFF Research Database (Denmark)

    Bagger-Skjøt, Line; Sandvang, Dorthe; Frimodt-Møller, Niels

    2007-01-01

    Escherichia coli isolates obtained from faeces (n = 85) and blood (n = 123) were susceptibility tested against 17 antimicrobial agents and the presence of 9 virulence genes was determined by PCR. Positive associations between several antimicrobial resistances and 2 VF genes (iutA and traT) were...

  6. Rapid cloning of disease-resistance genes in plants using mutagenesis and sequence capture

    Science.gov (United States)

    Genetic solutions to protect crops against pests and pathogens are preferable to agrichemicals 1. Wild crop relatives carry immense diversity of disease resistance (R) genes that could enable more sustainable disease control. However, recruiting R genes for crop improvement typically involves long b...

  7. Host-Induced Silencing of Pathogenicity Genes Enhances Resistance to Fusarium oxysporum Wilt in Tomato.

    Science.gov (United States)

    Bharti, Poonam; Jyoti, Poonam; Kapoor, Priya; Sharma, Vandana; Shanmugam, V; Yadav, Sudesh Kumar

    2017-08-01

    This study presents a novel approach of controlling vascular wilt in tomato by RNAi expression directed to pathogenicity genes of Fusarium oxysporum f. sp. lycopersici. Vascular wilt of tomato caused by Fusarium oxysporum f. sp. lycopersici leads to qualitative and quantitative loss of the crop. Limitation in the existing control measures necessitates the development of alternative strategies to increase resistance in the plants against pathogens. Recent findings paved way to RNAi, as a promising method for silencing of pathogenicity genes in fungus and provided effective resistance against fungal pathogens. Here, two important pathogenicity genes FOW2, a Zn(II)2Cys6 family putative transcription regulator, and chsV, a putative myosin motor and a chitin synthase domain, were used for host-induced gene silencing through hairpinRNA cassettes of these genes against Fusarium oxysporum f. sp. lycopersici. HairpinRNAs were assembled in appropriate binary vectors and transformed into tomato plant targeting FOW2 and chsV genes, for two highly pathogenic strains of Fusarium oxysporum viz. TOFOL-IHBT and TOFOL-IVRI. Transgenic tomatoes were analyzed for possible attainment of resistance in transgenic lines against fungal infection. Eight transgenic lines expressing hairpinRNA cassettes showed trivial disease symptoms after 6-8 weeks of infection. Hence, the host-induced posttranscriptional gene silencing of pathogenicity genes in transgenic tomato plants has enhanced their resistance to vascular wilt disease caused by Fusarium oxysporum.

  8. Introgression of a leaf rust resistance gene from Aegilops caudata to ...

    Indian Academy of Sciences (India)

    tance genes (Lr) and 48 stripe rust resistance genes (Yr) have .... Leaf rust reaction of the parents, wheat – Ae. caudata introgression lines and representative F2 plants developed from the cross: .... segregation ratio, which is otherwise a serious problem with ... Financial assistance was provided by the USDA-ARS under the.

  9. Genetic analysis and location of gene for resistance to stripe rust in ...

    Indian Academy of Sciences (India)

    2013-08-06

    Aug 6, 2013 ... Institute of Plant Protection, Chinese Academy of Agriculture Science, No 2, West ... The molecular marker Xbarc59 closely linked to the gene YrSD could be ... and a minor resistance gene postulated in it (Calonnec et al.

  10. Position on mouse chromosome 1 of a gene that controls resistance to Salmonella typhimurium.

    Science.gov (United States)

    Taylor, B A; O'Brien, A D

    1982-06-01

    Ity is a gene which regulates the magnitude of Salmonella typhimurium growth in murine tissues and, hence, the innate salmonella resistance of mice. The results of a five-point backcross clearly showed that the correct gene order on chromosome 1 is fz-Idh-1-Ity-ln-Pep-3.

  11. Systematic Analysis and Comparison of Nucleotide-Binding Site Disease Resistance Genes in a Diploid Cotton Gossypium raimondii

    Science.gov (United States)

    Wei, Hengling; Li, Wei; Sun, Xiwei; Zhu, Shuijin; Zhu, Jun

    2013-01-01

    Plant disease resistance genes are a key component of defending plants from a range of pathogens. The majority of these resistance genes belong to the super-family that harbors a Nucleotide-binding site (NBS). A number of studies have focused on NBS-encoding genes in disease resistant breeding programs for diverse plants. However, little information has been reported with an emphasis on systematic analysis and comparison of NBS-encoding genes in cotton. To fill this gap of knowledge, in this study, we identified and investigated the NBS-encoding resistance genes in cotton using the whole genome sequence information of Gossypium raimondii. Totally, 355 NBS-encoding resistance genes were identified. Analyses of the conserved motifs and structural diversity showed that the most two distinct features for these genes are the high proportion of non-regular NBS genes and the high diversity of N-termini domains. Analyses of the physical locations and duplications of NBS-encoding genes showed that gene duplication of disease resistance genes could play an important role in cotton by leading to an increase in the functional diversity of the cotton NBS-encoding genes. Analyses of phylogenetic comparisons indicated that, in cotton, the NBS-encoding genes with TIR domain not only have their own evolution pattern different from those of genes without TIR domain, but also have their own species-specific pattern that differs from those of TIR genes in other plants. Analyses of the correlation between disease resistance QTL and NBS-encoding resistance genes showed that there could be more than half of the disease resistance QTL associated to the NBS-encoding genes in cotton, which agrees with previous studies establishing that more than half of plant resistance genes are NBS-encoding genes. PMID:23936305

  12. Introgression and pyramiding into common bean market class fabada of genes conferring resistance to anthracnose and potyvirus.

    Science.gov (United States)

    Ferreira, Juan José; Campa, Ana; Pérez-Vega, Elena; Rodríguez-Suárez, Cristina; Giraldez, Ramón

    2012-03-01

    Anthracnose and bean common mosaic (BCM) are considered major diseases in common bean crop causing severe yield losses worldwide. This work describes the introgression and pyramiding of genes conferring genetic resistance to BCM and anthracnose local races into line A25, a bean genotype classified as market class fabada. Resistant plants were selected using resistance tests or combining resistance tests and marker-assisted selection. Lines A252, A321, A493, Sanilac BC6-Are, and BRB130 were used as resistance sources. Resistance genes to anthracnose (Co-2 ( C ), Co-2 ( A252 ) and Co-3/9) and/or BCM (I and bc-3) were introgressed in line A25 through six parallel backcrossing programs, and six breeding lines showing a fabada seed phenotype were obtained after six backcross generations: line A1258 from A252; A1231 from A321; A1220 from A493; A1183 and A1878 from Sanilac BC6-Are; and line A2418 from BRB130. Pyramiding of different genes were developed using the pedigree method from a single cross between lines obtained in the introgression step: line A1699 (derived from cross A1258 × A1220), A2438 (A1220 × A1183), A2806 (A1878 × A2418), and A3308 (A1699 × A2806). A characterization based on eight morpho-agronomic traits revealed a limited differentiation among the obtained breeding lines and the recurrent line A25. However, using a set of seven molecular markers linked to the loci used in the breeding programs it was possible to differentiate the 11 fabada lines. Considering the genetic control of the resistance in resistant donor lines, the observed segregations in the last backcrossing generation, the reaction against the pathogens, and the expression of the molecular markers it was also possible to infer the genotype conferring resistance in the ten fabada breeding lines obtained. As a result of these breeding programs, genetic resistance to three anthracnose races controlled by genes included in clusters Co-2 and Co-3/9, and genetic resistance to BCM controlled

  13. Association between selected antimicrobial resistance genes and antimicrobial exposure in Danish pig farms

    DEFF Research Database (Denmark)

    Birkegård, Anna Camilla; Hisham Beshara Halasa, Tariq; Græsbøll, Kaare

    2017-01-01

    Bacterial antimicrobial resistance (AMR) in pigs is an important public health concern due to its possible transfer to humans. We aimed at quantifying the relationship between the lifetime exposure of antimicrobials and seven antimicrobial resistance genes in Danish slaughter pig farms. AMR gene...... levels were quantified by qPCR of total-community DNA in faecal samples obtained from 681 batches of slaughter pigs. The lifetime exposure to antimicrobials was estimated at batch level for the piglet, weaner, and finisher periods individually for the sampled batches. We showed that the effect...... of antimicrobial exposure on the levels of AMR genes was complex and unique for each individual gene. Several antimicrobial classes had both negative and positive correlations with the AMR genes. From 10-42% of the variation in AMR gene levels could be explained in the final regression models, indicating...

  14. Antibiotic Resistance Genes and Correlations with Microbial Community and Metal Resistance Genes in Full-Scale Biogas Reactors As Revealed by Metagenomic Analysis

    DEFF Research Database (Denmark)

    Luo, Gang; Li, Bing; Li, Li-Guan

    2017-01-01

    resistance genes (MRGs). The total abundance of ARGs in all the samples varied from 7 × 10-3 to 1.08 × 10-1 copy of ARG/copy of 16S-rRNA gene, and the samples obtained from thermophilic biogas reactors had a lower total abundance of ARGs, indicating the superiority of thermophilic anaerobic digestion......Digested residues from biogas plants are often used as biofertilizers for agricultural crops cultivation. The antibiotic resistance genes (ARGs) in digested residues pose a high risk to public health due to their potential spread to the disease-causing microorganisms and thus reduce...... the susceptibility of disease-causing microorganisms to antibiotics in medical treatment. A high-throughput sequencing (HTS)-based metagenomic approach was used in the present study to investigate the variations of ARGs in full-scale biogas reactors and the correlations of ARGs with microbial communities and metal...

  15. Characterization of resistance gene analogues (RGAs in apple (Malus × domestica Borkh. and their evolutionary history of the Rosaceae family.

    Directory of Open Access Journals (Sweden)

    Michele Perazzolli

    Full Text Available The family of resistance gene analogues (RGAs with a nucleotide-binding site (NBS domain accounts for the largest number of disease resistance genes and is one of the largest gene families in plants. We have identified 868 RGAs in the genome of the apple (Malus × domestica Borkh. cultivar 'Golden Delicious'. This represents 1.51% of the total number of predicted genes for this cultivar. Several evolutionary features are pronounced in M. domestica, including a high fraction (80% of RGAs occurring in clusters. This suggests frequent tandem duplication and ectopic translocation events. Of the identified RGAs, 56% are located preferentially on six chromosomes (Chr 2, 7, 8, 10, 11, and 15, and 25% are located on Chr 2. TIR-NBS and non-TIR-NBS classes of RGAs are primarily exclusive of different chromosomes, and 99% of non-TIR-NBS RGAs are located on Chr 11. A phylogenetic reconstruction was conducted to study the evolution of RGAs in the Rosaceae family. More than 1400 RGAs were identified in six species based on their NBS domain, and a neighbor-joining analysis was used to reconstruct the phylogenetic relationships among the protein sequences. Specific phylogenetic clades were found for RGAs of Malus, Fragaria, and Rosa, indicating genus-specific evolution of resistance genes. However, strikingly similar RGAs were shared in Malus, Pyrus, and Prunus, indicating high conservation of specific RGAs and suggesting a monophyletic origin of these three genera.

  16. Characterization of Resistance Gene Analogues (RGAs) in Apple (Malus × domestica Borkh.) and Their Evolutionary History of the Rosaceae Family

    Science.gov (United States)

    Baldo, Angela; Righetti, Laura; Bailey, Aubrey; Fontana, Paolo; Velasco, Riccardo; Malnoy, Mickael

    2014-