Molecular tagging of a novel rust resistance gene R(12) in sunflower (Helianthus annuus L.).
Gong, L; Hulke, B S; Gulya, T J; Markell, S G; Qi, L L
2013-01-01
Sunflower production in North America has recently suffered economic losses in yield and seed quality from sunflower rust (Puccinia helianthi Schwein.) because of the increasing incidence and lack of resistance to new rust races. RHA 464, a newly released sunflower male fertility restorer line, is resistant to both of the most predominant and most virulent rust races identified in the Northern Great Plains of the USA. The gene conditioning rust resistance in RHA 464 originated from wild Helianthus annuus L., but has not been molecularly marked or determined to be independent from other rust loci. The objectives of this study are to identify molecular markers linked to the rust resistance gene and to investigate the allelism of this gene with the unmapped rust resistance genes present in HA-R6, HA-R8 and RHA 397. Virulence phenotypes of seedlings for the F(2) population and F(2:3) families suggested that a single dominant gene confers rust resistance in RHA 464, and this gene was designated as R(12). Bulked segregant analysis identified ten markers polymorphic between resistant and susceptible bulks. In subsequent genetic mapping, the ten markers covered 33.4 cM of genetic distance on linkage group 11 of sunflower. A co-dominant marker CRT275-11 is the closest marker distal to R(12) with a genetic distance of 1.0 cM, while ZVG53, a dominant marker linked in the repulsion phase, is proximal to R(12) with a genetic distance of 9.6 cM. The allelism test demonstrated that R(12) is not allelic to the rust resistance genes in HA-R6, HA-R8 and RHA 397, and it is also not linked to any previously mapped rust resistance genes. Discovery of the R(12) novel rust resistance locus in sunflower and associated markers will potentially support the molecular marker-assisted introgression and pyramiding of R(12) into sunflower breeding lines.
The impact of R1and R3a genes on tuber resistance to late blight of the potato breeding clones
Directory of Open Access Journals (Sweden)
Zoteyeva Nadezhda
2016-04-01
Full Text Available Potato breeding clones were evaluated for resistance to late blight (agent Phytophthora infestans using tuber inoculation tests and for presence of the resistance alleles of R1 and R3a genes in polymerase chain reaction tests. Among clones tested those expressing high, moderate and low resistance were identified. The data were analysed for the impact of R1 and R3a genes on tuber resistance to late blight in tested plant material. In previous evaluations performed on smaller amount of clones the tuber resistance levels significantly depended on presence/absence of the resistance allele of R3a gene and did not depend on presence of R1 gene allele. In the current study the statistical analyses did not prove the significant difference in resistance levels depending on presence of the resistance alleles, neither of R1 gene, nor of R3a gene. Tuber resistant clones bearing R3a gene resistance alleles still noticeably prevailed over the clones bearing the alleles of R1 gene as well as over the clones bearing the no resistance alleles of both genes. In several cases the resistance of clones with detected resistance allele of R1 gene was higher compared to those derived from the same crosses and showing amplification of the allele of R3a gene or those with no resistance alleles. Clones accumulating the resistance alleles of both (R1 and R3a genes expressed high tuber resistance accompanied by necrotic reaction.
Selisana, S M; Yanoria, M J; Quime, B; Chaipanya, C; Lu, G; Opulencia, R; Wang, G-L; Mitchell, T; Correll, J; Talbot, N J; Leung, H; Zhou, B
2017-06-01
Avirulence (AVR) genes in Magnaporthe oryzae, the fungal pathogen that causes the devastating rice blast disease, have been documented to be major targets subject to mutations to avoid recognition by resistance (R) genes. In this study, an AVR-gene-based diagnosis tool for determining the virulence spectrum of a rice blast pathogen population was developed and validated. A set of 77 single-spore field isolates was subjected to pathotype analysis using differential lines, each containing a single R gene, and classified into 20 virulent pathotypes, except for 4 isolates that lost pathogenicity. In all, 10 differential lines showed low frequency (95%), inferring the effectiveness of R genes present in the respective differential lines. In addition, the haplotypes of seven AVR genes were determined by polymerase chain reaction amplification and sequencing, if applicable. The calculated frequency of different AVR genes displayed significant variations in the population. AVRPiz-t and AVR-Pii were detected in 100 and 84.9% of the isolates, respectively. Five AVR genes such as AVR-Pik-D (20.5%) and AVR-Pik-E (1.4%), AVRPiz-t (2.7%), AVR-Pita (0%), AVR-Pia (0%), and AVR1-CO39 (0%) displayed low or even zero frequency. The frequency of AVR genes correlated almost perfectly with the resistance frequency of the cognate R genes in differential lines, except for International Rice Research Institute-bred blast-resistant lines IRBLzt-T, IRBLta-K1, and IRBLkp-K60. Both genetic analysis and molecular marker validation revealed an additional R gene, most likely Pi19 or its allele, in these three differential lines. This can explain the spuriously higher resistance frequency of each target R gene based on conventional pathotyping. This study demonstrates that AVR-gene-based diagnosis provides a precise, R-gene-specific, and differential line-free assessment method that can be used for determining the virulence spectrum of a rice blast pathogen population and for predicting the
Qi, L L; Ma, G J; Long, Y M; Hulke, B S; Gong, L; Markell, S G
2015-03-01
The rust resistance gene R 2 was reassigned to linkage group 14 of the sunflower genome. DNA markers linked to R 2 were identified and used for marker-assisted gene pyramiding in a confection type genetic background. Due to the frequent evolution of new pathogen races, sunflower rust is a recurring threat to sunflower production worldwide. The inbred line Morden Cross 29 (MC29) carries the rust resistance gene, R 2 , conferring resistance to numerous races of rust fungus in the US, Canada, and Australia, and can be used as a broad-spectrum resistance resource. Based on phenotypic assessments and SSR marker analyses on the 117 F2 individuals derived from a cross of HA 89 with MC29 (USDA), R 2 was mapped to linkage group (LG) 14 of the sunflower, and not to the previously reported location on LG9. The closest SSR marker HT567 was located at 4.3 cM distal to R 2 . Furthermore, 36 selected SNP markers from LG14 were used to saturate the R 2 region. Two SNP markers, NSA_002316 and SFW01272, flanked R 2 at a genetic distance of 2.8 and 1.8 cM, respectively. Of the three closely linked markers, SFW00211 amplified an allele specific for the presence of R 2 in a marker validation set of 46 breeding lines, and SFW01272 was also shown to be diagnostic for R 2 . These newly developed markers, together with the previously identified markers linked to the gene R 13a , were used to screen 524 F2 individuals from a cross of a confection R 2 line and HA-R6 carrying R 13a . Eleven homozygous double-resistant F2 plants with the gene combination of R 2 and R 13a were obtained. This double-resistant line will be extremely useful in confection sunflower, where few rust R genes are available, risking evolution of new virulence phenotypes and further disease epidemics.
Gellatly, Kyle J; Yoon, Kyong Sup; Doherty, Jeffery J; Sun, Weilin; Pittendrigh, Barry R; Clark, J Marshall
2015-06-01
4,4'-dichlorodiphenyltrichloroethane (DDT) has been re-recommended by the World Health Organization for malaria mosquito control. Previous DDT use has resulted in resistance, and with continued use resistance will increase in terms of level and extent. Drosophila melanogaster is a model dipteran that has many available genetic tools, numerous studies done on insecticide resistance mechanisms, and is related to malaria mosquitoes allowing for extrapolation. The 91-R strain of D. melanogaster is highly resistant to DDT (>1500-fold), however, there is no mechanistic scheme that accounts for this level of resistance. Recently, reduced penetration, increased detoxification, and direct excretion have been identified as resistance mechanisms in the 91-R strain. Their interactions, however, remain unclear. Use of UAS-RNAi transgenic lines of D. melanogaster allowed for the targeted knockdown of genes putatively involved in DDT resistance and has validated the role of several cuticular proteins (Cyp4g1 and Lcp1), cytochrome P450 monooxygenases (Cyp6g1 and Cyp12d1), and ATP binding cassette transporters (Mdr50, Mdr65, and Mrp1) involved in DDT resistance. Further, increased sensitivity to DDT in the 91-R strain after intra-abdominal dsRNA injection for Mdr50, Mdr65, and Mrp1 was determined by a DDT contact bioassay, directly implicating these genes in DDT efflux and resistance. Copyright © 2015 Elsevier Inc. All rights reserved.
Matta, Andrés Jenuer; Zambrano, Diana Carolina; Pazos, Alvaro Jairo
2018-04-14
To characterize punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori ( H. pylori ) and determine their association with therapeutic failure. PCR products of 23S rRNA gene V domain of 74 H. pylori isolates; 34 resistant to clarithromycin (29 from a low-risk gastric cancer (GC) population: Tumaco-Colombia, and 5 from a high-risk population: Tuquerres-Colombia) and 40 from a susceptible population (28 from Tumaco and 12 from Túquerres) were sequenced using capillary electrophoresis. The concordance between mutations of V domain 23S rRNA gene of H. pylori and therapeutic failure was determined using the Kappa coefficient and McNemar's test was performed to determine the relationship between H. pylori mutations and clarithromycin resistance. 23S rRNA gene from H. pylori was amplified in 56/74 isolates, of which 25 were resistant to clarithromycin (20 from Tumaco and 5 from Túquerres, respectively). In 17 resistant isolates (13 from Tumaco and 4 from Túquerres) the following mutations were found: A1593T1, A1653G2, C1770T, C1954T1, and G1827C in isolates from Tumaco, and A2144G from Túquerres. The mutations T2183C, A2144G and C2196T in H. pylori isolates resistant to clarithromycin from Colombia are reported for the first time. No association between the H. pylori mutations and in vitro clarithromycin resistance was found. However, therapeutic failure of eradication treatment was associated with mutations of 23S rRNA gene in clarithromycin-resistant H. pylori ( κ = 0.71). The therapeutic failure of eradication treatment in the two populations from Colombia was associated with mutations of the 23S rRNA gene in clarithromycin-resistant H. pylori .
Kourelis, Jiorgos; van der Hoorn, Renier A L
2018-02-01
Plants have many, highly variable resistance ( R ) gene loci, which provide resistance to a variety of pathogens. The first R gene to be cloned, maize ( Zea mays ) Hm1 , was published over 25 years ago, and since then, many different R genes have been identified and isolated. The encoded proteins have provided clues to the diverse molecular mechanisms underlying immunity. Here, we present a meta-analysis of 314 cloned R genes. The majority of R genes encode cell surface or intracellular receptors, and we distinguish nine molecular mechanisms by which R proteins can elevate or trigger disease resistance: direct (1) or indirect (2) perception of pathogen-derived molecules on the cell surface by receptor-like proteins and receptor-like kinases; direct (3) or indirect (4) intracellular detection of pathogen-derived molecules by nucleotide binding, leucine-rich repeat receptors, or detection through integrated domains (5); perception of transcription activator-like effectors through activation of executor genes (6); and active (7), passive (8), or host reprogramming-mediated (9) loss of susceptibility. Although the molecular mechanisms underlying the functions of R genes are only understood for a small proportion of known R genes, a clearer understanding of mechanisms is emerging and will be crucial for rational engineering and deployment of novel R genes. © 2018 American Society of Plant Biologists. All rights reserved.
Directory of Open Access Journals (Sweden)
S V Kulkarni
2015-01-01
Full Text Available Background and Objectives: Emergence of multi-drug resistant Neisseria gonorrhoeae resulting from new genetic mutation is a serious threat in controlling gonorrhea. This study was undertaken to identify and characterise mutations in the mtrR genes in N.gonorrhoeae isolates resistant to six different antibiotics in the quinolone group. Materials and Methods: The Minimum inhibitory concentrations (MIC of five quinolones for 64 N.gonorrhoeae isolates isolated during Jan 2007-Jun 2009 were determined by E-test method. Mutations in MtrR loci were examined by deoxyribonucleic acid (DNA sequencing. Results: The proportion of N.gonorrhoeae strains resistant to anti-microbials was 98.4% for norfloxacin and ofloxacin, 96.8% for enoxacin and ciprofloxacin, 95.3% for lomefloxacin. Thirty-one (48.4% strains showed mutation (single/multiple in mtrR gene. Ten different mutations were observed and Gly-45 → Asp, Tyr-105 → His being the most common observed mutation. Conclusion: This is the first report from India on quinolone resistance mutations in MtrRCDE efflux system in N.gonorrhoeae. In conclusion, the high level of resistance to quinolone and single or multiple mutations in mtrR gene could limit the drug choices for gonorrhoea.
2018-01-01
Plants have many, highly variable resistance (R) gene loci, which provide resistance to a variety of pathogens. The first R gene to be cloned, maize (Zea mays) Hm1, was published over 25 years ago, and since then, many different R genes have been identified and isolated. The encoded proteins have provided clues to the diverse molecular mechanisms underlying immunity. Here, we present a meta-analysis of 314 cloned R genes. The majority of R genes encode cell surface or intracellular receptors, and we distinguish nine molecular mechanisms by which R proteins can elevate or trigger disease resistance: direct (1) or indirect (2) perception of pathogen-derived molecules on the cell surface by receptor-like proteins and receptor-like kinases; direct (3) or indirect (4) intracellular detection of pathogen-derived molecules by nucleotide binding, leucine-rich repeat receptors, or detection through integrated domains (5); perception of transcription activator-like effectors through activation of executor genes (6); and active (7), passive (8), or host reprogramming-mediated (9) loss of susceptibility. Although the molecular mechanisms underlying the functions of R genes are only understood for a small proportion of known R genes, a clearer understanding of mechanisms is emerging and will be crucial for rational engineering and deployment of novel R genes. PMID:29382771
Resistance to organic hydroperoxides requires ohr and ohrR genes in Sinorhizobium meliloti
Directory of Open Access Journals (Sweden)
Dufour Virginie
2011-05-01
Full Text Available Abstract Background Sinorhizobium meliloti is a symbiotic nitrogen-fixing bacterium that elicits nodules on roots of host plants Medicago sativa. During nodule formation bacteria have to withstand oxygen radicals produced by the plant. Resistance to H2O2 and superoxides has been extensively studied in S. meliloti. In contrast resistance to organic peroxides has not been investigated while S. meliloti genome encodes putative organic peroxidases. Organic peroxides are produced by plants and are highly toxic. The resistance to these oxygen radicals has been studied in various bacteria but never in plant nodulating bacteria. Results In this study we report the characterisation of organic hydroperoxide resistance gene ohr and its regulator ohrR in S. meliloti. The inactivation of ohr affects resistance to cumene and ter-butyl hydroperoxides but not to hydrogen peroxide or menadione in vitro. The expression of ohr and ohrR genes is specifically induced by organic peroxides. OhrR binds to the intergenic region between the divergent genes ohr and ohrR. Two binding sites were characterised. Binding to the operator is prevented by OhrR oxidation that promotes OhrR dimerisation. The inactivation of ohr did not affect symbiosis and nitrogen fixation, suggesting that redundant enzymatic activity exists in this strain. Both ohr and ohrR are expressed in nodules suggesting that they play a role during nitrogen fixation. Conclusions This report demonstrates the significant role Ohr and OhrR proteins play in bacterial stress resistance against organic peroxides in S. meliloti. The ohr and ohrR genes are expressed in nodule-inhabiting bacteroids suggesting a role during nodulation.
Fine mapping of the rice bacterial blight resistance gene Xa-4 and its co-segregation marker
Institute of Scientific and Technical Information of China (English)
无
2000-01-01
An F2 population developed from the Xa-4 near isogenic lines,IR24 and IRBB4,was used for fine mapping of the rice bacterial blight resistance gene,Xa-4.Some restriction fragment length polymorphism (RFLP) markers on the high-density map constructed by Harushima et al.and the amplified DNA fragments homologous to the conserved domains of plant disease resistance (R) genes were used to construct the genetic linkage map around the gene Xa-4 by scoring susceptible individuals in the population.Xa-4 was mapped between the RFLP marker G181 and the polymerase chain reaction (PCR) marker M55.The R gene homologous fragment marker RS13 was found co-segregating with Xa-4 by analyzing all the plants in the population.This result opened an approach to map-based cloning of this gene,and marker RS13 can be applied to molecular marker-assisted selection of Xa-4 in rice breeding programs.
Sagova-Mareckova, Marketa; Ulanova, Dana; Sanderova, Petra; Omelka, Marek; Kamenik, Zdenek; Olsovska, Jana; Kopecky, Jan
2015-04-01
Distribution and evolutionary history of resistance genes in environmental actinobacteria provide information on intensity of antibiosis and evolution of specific secondary metabolic pathways at a given site. To this day, actinobacteria producing biologically active compounds were isolated mostly from soil but only a limited range of soil environments were commonly sampled. Consequently, soil remains an unexplored environment in search for novel producers and related evolutionary questions. Ninety actinobacteria strains isolated at contrasting soil sites were characterized phylogenetically by 16S rRNA gene, for presence of erm and ABC transporter resistance genes and antibiotic production. An analogous analysis was performed in silico with 246 and 31 strains from Integrated Microbial Genomes (JGI_IMG) database selected by the presence of ABC transporter genes and erm genes, respectively. In the isolates, distances of erm gene sequences were significantly correlated to phylogenetic distances based on 16S rRNA genes, while ABC transporter gene distances were not. The phylogenetic distance of isolates was significantly correlated to soil pH and organic matter content of isolation sites. In the analysis of JGI_IMG datasets the correlation between phylogeny of resistance genes and the strain phylogeny based on 16S rRNA genes or five housekeeping genes was observed for both the erm genes and ABC transporter genes in both actinobacteria and streptomycetes. However, in the analysis of sequences from genomes where both resistance genes occurred together the correlation was observed for both ABC transporter and erm genes in actinobacteria but in streptomycetes only in the erm gene. The type of erm resistance gene sequences was influenced by linkage to 16S rRNA gene sequences and site characteristics. The phylogeny of ABC transporter gene was correlated to 16S rRNA genes mainly above the genus level. The results support the concept of new specific secondary metabolite
Martínez, Noelia; Luque, Roberto; Milani, Christian; Ventura, Marco; Bañuelos, Oscar; Margolles, Abelardo
2018-05-15
Bifidobacteria are mutualistic intestinal bacteria, and their presence in the human gut has been associated with health-promoting activities. The presence of antibiotic resistance genes in this genus is controversial, since, although bifidobacteria are nonpathogenic microorganisms, they could serve as reservoirs of resistance determinants for intestinal pathogens. However, until now, few antibiotic resistance determinants have been functionally characterized in this genus. In this work, we show that Bifidobacterium breve CECT7263 displays atypical resistance to erythromycin and clindamycin. In order to delimit the genomic region responsible for the observed resistance phenotype, a library of genomic DNA was constructed and a fragment of 5.8 kb containing a gene homologous to rRNA methylase genes was able to confer erythromycin resistance in Escherichia coli This genomic region seems to be very uncommon, and homologs of the gene have been detected in only one strain of Bifidobacterium longum and two other strains of B. breve In this context, analysis of shotgun metagenomics data sets revealed that the gene is also uncommon in the microbiomes of adults and infants. The structural gene and its upstream region were cloned into a B. breve -sensitive strain, which became resistant after acquiring the genetic material. In vitro conjugation experiments did not allow us to detect gene transfer to other recipients. Nevertheless, prediction of genes potentially acquired through horizontal gene transfer events revealed that the gene is located in a putative genomic island. IMPORTANCE Bifidobacterium breve is a very common human intestinal bacterium. Often described as a pioneer microorganism in the establishment of early-life intestinal microbiota, its presence has been associated with several beneficial effects for the host, including immune stimulation and protection against infections. Therefore, some strains of this species are considered probiotics. In relation to this
Li, Henan; Wang, Qi; Wang, Ruobing; Zhang, Yawei; Wang, Xiaojuan; Wang, Hui
2017-06-01
SoxR is a global regulator contributing to multidrug resistance in Enterobacteriaceae. However, the contribution of SoxR to antibiotic resistance and fitness in Acinetobacter baumannii has not yet been studied. Comparisons of molecular characteristics were performed between 32 multidrug-resistant A. baumannii isolates and 11 susceptible isolates. A soxR overexpression mutant was constructed, and its resistance phenotype was analyzed. The impact of SoxR on efflux pump gene expression was measured at the transcription level. The effect of SoxR on the growth and fitness of A. baumannii was analyzed using a growth rate assay and an in vitro competition assay. The frequency of the Gly39Ser mutation in soxR was higher in multidrug-resistant A. baumannii, whereas the soxS gene was absent in all strains analyzed. SoxR overexpression led to increased susceptibility to chloramphenicol (4-fold), tetracycline (2-fold), tigecycline (2-fold), ciprofloxacin (2-fold), amikacin (2-fold), and trimethoprim (2-fold), but it did not influence imipenem susceptibility. Decreased expression of abeS (3.8-fold), abeM (1.3-fold), adeJ (2.4-fold), and adeG (2.5-fold) were correlated with soxR overexpression (P baumannii.
An, Diaoguo; Zheng, Qi; Zhou, Yilin; Ma, Pengtao; Lv, Zhenling; Li, Lihui; Li, Bin; Luo, Qiaoling; Xu, Hongxing; Xu, Yunfeng
2013-07-01
Rye is an important and valuable gene resource for wheat improvement. However, due to extensive growing of cultivars with disease resistance genes from short arm of rye chromosome 1R and coevolution of pathogen virulence and host resistance, these cultivars successively lost resistance to pathogens. Identification and deployment of new resistance gene sources in rye are, therefore, of especial importance and urgency. A new wheat-rye line, designated as WR41-1, was produced through distant hybridization and chromosome engineering protocols between common wheat cultivar Xiaoyan 6 and rye cultivar German White. It was proved to be a new wheat-rye T4BL·4RL and T7AS·4RS translocation line using sequential genomic in situ hybridization (GISH), multicolor fluorescence in situ hybridization (mc-FISH), and expressed sequence tag-simple sequence repeat (EST-SSR) marker analysis. WR41-1 showed high levels of resistance to powdery mildew (Blumeria graminis f. sp. tritici, Bgt) pathogens prevalent in China at the adult growth stage and 13 of 23 Bgt isolates tested at the seedling stage. According to its resistant pattern to 23 different Bgt isolates, WR41-1 may possess new gene(s) for resistance to powdery mildew, which differed from previously identified and known powdery mildew genes from rye (Pm7, Pm8, Pm17, and Pm20). In addition, WR41-1 was cytologically stable, had a desirable fertility, and is expected to be useful in wheat improvement.
TAL effectors and the executor R genes.
Zhang, Junli; Yin, Zhongchao; White, Frank
2015-01-01
Transcription activator-like (TAL) effectors are bacterial type III secretion proteins that function as transcription factors in plants during Xanthomonas/plant interactions, conditioning either host susceptibility and/or host resistance. Three types of TAL effector associated resistance (R) genes have been characterized-recessive, dominant non-transcriptional, and dominant TAL effector-dependent transcriptional based resistance. Here, we discuss the last type of R genes, whose functions are dependent on direct TAL effector binding to discrete effector binding elements in the promoters. Only five of the so-called executor R genes have been cloned, and commonalities are not clear. We have placed the protein products in two groups for conceptual purposes. Group 1 consists solely of the protein from pepper, BS3, which is predicted to have catalytic function on the basis of homology to a large conserved protein family. Group 2 consists of BS4C-R, XA27, XA10, and XA23, all of which are relatively short proteins from pepper or rice with multiple potential transmembrane domains. Group 2 members have low sequence similarity to proteins of unknown function in closely related species. Firm predictions await further experimentation on these interesting new members to the R gene repertoire, which have potential broad application in new strategies for disease resistance.
TAL effectors and the executor R genes
Directory of Open Access Journals (Sweden)
Junli eZhang
2015-08-01
Full Text Available Transcription activation-like (TAL effectors are bacterial type III secretion proteins that function as transcription factors in plants during Xanthomonas/plant interactions, conditioning either host susceptibility and/or host resistance. Three types of TAL effector associated resistance (R genes have been characterized - recessive, dominant non-transcriptional and dominant TAL effector-dependent transcriptional based resistance. Here, we discuss the last type of R genes, whose functions are dependent on direct TAL effector binding to discrete effector binding elements in the promoters. Only five of the so-called executor R genes have been cloned, and commonalities are not clear. We have placed the protein products in two groups for conceptual purposes. Group 1 consists solely of the protein from pepper, BS3, which is predicted to have catalytic function on the basis of homology to a large conserved protein family. Group 2 consists of BS4C-R, XA27, XA10, and XA23, all of which are relatively short proteins from pepper or rice with multiple potential transmembrane domains. Group 2 members have low sequence similarity to proteins of unknown function in closely related species. Firm predictions await further experimentation on these interesting new members to the R gene repertoire, which have potential broad application in new strategies for disease resistance.
Directory of Open Access Journals (Sweden)
Akkina Ramesh
2008-07-01
Full Text Available Abstract Background Thus far gene therapy strategies for HIV/AIDS have used either conventional retroviral vectors or lentiviral vectors for gene transfer. Although highly efficient, their use poses a certain degree of risk in terms of viral mediated oncogenesis. Sleeping Beauty (SB transposon system offers a non-viral method of gene transfer to avoid this possible risk. With respect to conferring HIV resistance, stable knock down of HIV-1 coreceptors CCR5 and CXCR4 by the use of lentiviral vector delivered siRNAs has proved to be a promising strategy to protect cells from HIV-1 infection. In the current studies our aim is to evaluate the utility of SB system for stable gene transfer of CCR5 and CXCR4 siRNA genes to derive HIV resistant cells as a first step towards using this system for gene therapy. Results Two well characterized siRNAs against the HIV-1 coreceptors CCR5 and CXCR4 were chosen based on their previous efficacy for the SB transposon gene delivery. The siRNA transgenes were incorporated individually into a modified SB transfer plasmid containing a FACS sortable red fluorescence protein (RFP reporter and a drug selectable neomycin resistance gene. Gene transfer was achieved by co-delivery with a construct expressing a hyperactive transposase (HSB5 into the GHOST-R3/X4/R5 cell line, which expresses the major HIV receptor CD4 and and the co-receptors CCR5 and CXCR4. SB constructs expressing CCR5 or CXCR4 siRNAs were also transfected into MAGI-CCR5 or MAGI-CXCR4 cell lines, respectively. Near complete downregulation of CCR5 and CXCR4 surface expression was observed in transfected cells. During viral challenge with X4-tropic (NL4.3 or R5-tropic (BaL HIV-1 strains, the respective transposed cells showed marked viral resistance. Conclusion SB transposon system can be used to deliver siRNA genes for stable gene transfer. The siRNA genes against HIV-1 coreceptors CCR5 and CXCR4 are able to downregulate the respective cell surface proteins
Lavrova, V V; Matveeva, E M; Zinovieva, S V
2015-01-01
The characteristics of expression of two genes, H1 and Gro1-4, which determine the resistance to the sedentary parasitic nematode Globodera rostochiensis (Wollenweber, 1923) Behrens, 1975, in the resistant (Krepysh) and susceptible (Nevskii) potato cultivars was studied under a short-term exposure to low temperatures. Such treatment of susceptible plants at the early stages of ontogeny led to the activation of expression of H1 and Gro1-4 genes in roots and the H1 gene in leaves. The transcriptional activity of R genes was detected not only in roots but also in leaves (i.e., in tissue remote from the site of direct injury by the nematode) in the case of both genetic and induced resistance, indicating the development of a systemic defense response of plants to infection.
Directory of Open Access Journals (Sweden)
Harsi Dewantari Kusumaningrum
2016-08-01
Full Text Available The choice of primer used in 16S rRNA sequencing for identification of Staphylococcus species found in food is important. This study aimed to characterize Staphylococcus aureus isolates by partial sequencing based on 16S rRNA gene employing primers 16sF, 63F or 1387R. The isolates were isolated from milk, egg dishes and chicken dishes and selected based on the presence of sea gene that responsible for formation of enterotoxin-A. Antibiotic susceptibility of the isolates towards six antibiotics was also tested. The use of 16sF resulted generally in higher identity percentage and query coverage compared to the sequencing by 63F or 1387R. BLAST results of all isolates, sequenced by 16sF, showed 99% homology to complete genome of four S. aureus strains, with different characteristics on enterotoxin production and antibiotic resistance. Considering that all isolates were carrying sea gene, indicated by the occurence of 120 bp amplicon after PCR amplification using primer SEA1/SEA2, the isolates were most in agreeing to S. aureus subsp. aureus ST288. This study indicated that 4 out of 8 selected isolates were resistant towards streptomycin. The 16S rRNA gene sequencing using 16sF is useful for identification of S. aureus. However, additional analysis such as PCR employing specific gene target, should give a valuable supplementary information, when specific characteristic is expected.
A dual resistance gene system prevents infection by three distinct pathogens.
Narusaka, Mari; Kubo, Yasuyuki; Shiraishi, Tomonori; Iwabuchi, Masaki; Narusaka, Yoshihiro
2009-10-01
Colletotrichum higginsianum causes typical anthracnose lesions on the leaves, petioles, and stems of cruciferous plants. Inoculation of Arabidopsis thaliana ecotype Columbia leaves with C. higginsianum results in fungal growth and disease symptoms reminiscent of those induced in other cruciferous plants. We performed map-based cloning and natural variation analysis of 19 A. thaliana ecotypes to identify a dominant resistance locus against C. higginsianum. We found that the A. thaliana RCH2 (for recognition of C. higginsianum) locus encodes two NB-LRR proteins, both of which are required for resistance to C. higginsianum in the A. thaliana ecotype Ws-0. Both proteins are well-characterized R proteins involved in resistance against bacterial pathogens; RRS1 (resistance to Ralstonia solanacearum 1) confers resistance to strain Rs1000 of R. solanacearum and RPS4 to Pseudomonas syringae pv. tomato strain DC3000 expressing avrRps4 (Pst-avrRps4). Furthermore, we found that both RRS1-Ws and RPS4-Ws genes are required for resistance to Pst-avrRps4 and to Rs1002 R. solanacearum. We therefore demonstrate that a pair of neighboring genes, RRS1-Ws and RPS4-Ws, function cooperatively as a dual R-gene system against at least three distinct pathogens.
Ma, G J; Song, Q J; Markell, S G; Qi, L L
2018-03-21
A novel rust resistance gene, R 15 , derived from the cultivated sunflower HA-R8 was assigned to linkage group 8 of the sunflower genome using a genotyping-by-sequencing approach. SNP markers closely linked to R 15 were identified, facilitating marker-assisted selection of resistance genes. The rust virulence gene is co-evolving with the resistance gene in sunflower, leading to the emergence of new physiologic pathotypes. This presents a continuous threat to the sunflower crop necessitating the development of resistant sunflower hybrids providing a more efficient, durable, and environmentally friendly host plant resistance. The inbred line HA-R8 carries a gene conferring resistance to all known races of the rust pathogen in North America and can be used as a broad-spectrum resistance resource. Based on phenotypic assessments of 140 F 2 individuals derived from a cross of HA 89 with HA-R8, rust resistance in the population was found to be conferred by a single dominant gene (R 15 ) originating from HA-R8. Genotypic analysis with the currently available SSR markers failed to find any association between rust resistance and any markers. Therefore, we used genotyping-by-sequencing (GBS) analysis to achieve better genomic coverage. The GBS data showed that R 15 was located at the top end of linkage group (LG) 8. Saturation with 71 previously mapped SNP markers selected within this region further showed that it was located in a resistance gene cluster on LG8, and mapped to a 1.0-cM region between three co-segregating SNP makers SFW01920, SFW00128, and SFW05824 as well as the NSA_008457 SNP marker. These closely linked markers will facilitate marker-assisted selection and breeding in sunflower.
New wheat-rye 5DS-4RS·4RL and 4RS-5DS·5DL translocation lines with powdery mildew resistance.
Fu, Shulan; Ren, Zhenglong; Chen, Xiaoming; Yan, Benju; Tan, Feiquan; Fu, Tihua; Tang, Zongxiang
2014-11-01
Powdery mildew is one of the serious diseases of wheat (Triticum aestivum L., 2 n = 6 × = 42, genomes AABBDD). Rye (Secale cereale L., 2 n = 2 × = 14, genome RR) offers a rich reservoir of powdery mildew resistant genes for wheat breeding program. However, extensive use of these resistant genes may render them susceptible to new pathogen races because of co-evolution of host and pathogen. Therefore, the continuous exploration of new powdery mildew resistant genes is important to wheat breeding program. In the present study, we identified several wheat-rye addition lines from the progeny of T. aestivum L. Mianyang11 × S. cereale L. Kustro, i.e., monosomic addition lines of the rye chromosomes 4R and 6R; a disomic addition line of 6R; and monotelosomic or ditelosomic addition lines of the long arms of rye chromosomes 4R (4 RL) and 6R (6 RL). All these lines displayed immunity to powdery mildew. Thus, we concluded that both the 4 RL and 6 RL arms of Kustro contain powdery mildew resistant genes. It is the first time to discover that 4 RL arm carries powdery mildew resistant gene. Additionally, wheat lines containing new wheat-rye translocation chromosomes were also obtained: these lines retained a short arm of wheat chromosome 5D (5 DS) on which rye chromosome 4R was fused through the short arm 4 RS (designated 5 DS-4 RS · 4 RL; 4 RL stands for the long arm of rye chromosome 4R); or they had an extra short arm of rye chromosome 4R (4 RS) that was attached to the short arm of wheat chromosome 5D (5 DS) (designated 4 RS-5 DS · 5 DL; 5 DL stands for the long arm of wheat chromosome 5D). These two translocation chromosomes could be transmitted to next generation stably, and the wheat lines containing 5 DS-4 RS · 4 RL chromosome also displayed immunity to powdery mildew. The materials obtained in this study can be used for wheat powdery mildew resistant breeding program.
Sun, Yucheng; Guo, Huijuan; Yuan, Erliang; Ge, Feng
2018-03-01
Resistance against pathogens and herbivorous insects in many plant results from the expression of resistance (R) genes. Few reports, however, have considered the effects of elevated CO 2 on R gene-based resistance in plants. The current study determined the responses of two near isogenic Medicago truncatula genotypes (Jester has an R gene and A17 does not) to the pea aphid and elevated CO 2 in open-top chambers in the field. Aphid abundance, mean relative growth rate and feeding efficiency were increased by elevated CO 2 on A17 plants but were reduced on Jester plants. According to proteomic and gene expression data, elevated CO 2 enhanced pathogen-associated molecular pattern (PAMP)-triggered immunity (PTI) but decreased the effector-triggered immunity (ETI) in aphid-infested A17 plants. For aphid-infested Jester plants, by contrast, elevated CO 2 enhanced the ETI-related heat shock protein (HSP) 90 and its co-chaperones, the jasmonic acid (JA) signaling pathway, and ubiquitin-mediated proteolysis. In a loss-of-function experiment, silencing of the HSP90 gene in Jester plants impaired the JA signaling pathway and ubiquitin-mediated proteolysis against the aphid under ambient CO 2 , and negated the increased resistance against the aphid under elevated CO 2 . Our results suggest that increases in expression of HSP90 are responsible for the enhanced resistance against the aphid under elevated CO 2 . © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.
Genetic Analysis Using Partial Sequencing of Melanocortin 4 Receptor (MC4R Gene in Bligon Goat
Directory of Open Access Journals (Sweden)
Latifah Latifah
2017-08-01
Full Text Available Melanocortin 4 Receptor gene is involved in sympathetic nerve activity, adrenal and thyroid functions, and media for leptin in regulating energy balance and homeostasis. The aim of this research was to perform genetic analysis of MC4R gene sequences from Bligon goats. Fourty blood samples of Bligon does were used for DNA extraction. The primers were designed after alignment of 12 DNA sequences of MC4R gene from goat, sheep, and cattle. The primers were constructed on the Capra hircus MC4R gene sequence from GenBank (accession No. NM_001285591. Two DNA polymorphisms of MC4R were revealed in exon region (g.998 A/G and g.1079 C/T. The SNP g.998 A/G was a non-synonymous polymorphism i.e., changing of amino acid from methionine (Met to isoleucine (Ile. The SNP g.1079 C/T was a synonymous polymorphism. Restriction enzyme mapping on Bligon goat MC4R gene revealed three restriction enzymes (RsaI (GT’AC, Acc651 (G’GTAC_C, and KpnI (G_GTAC’C, which can recognize the SNP at g.1079 C/T. The restriction enzymes may be used for genotyping of the gene target using PCR-RFLP method in the future research.
Czech Academy of Sciences Publication Activity Database
Ságová-Marečková, M.; Ulanová, Dana; Šanderová, P.; Omelka, M.; Kameník, Zdeněk; Olšovská, J.; Kopecký, J.
2015-01-01
Roč. 15, APR 2015 (2015) ISSN 1471-2180 Institutional support: RVO:61388971 Keywords : Actinobacteria * 16S rRNA diversity * Resistance genes Subject RIV: EH - Ecology, Behaviour Impact factor: 2.581, year: 2015
Zhang, Yueliang; Liu, Baosheng; Zhang, Zhichun; Wang, Lihua; Guo, Huifang; Li, Zhong; He, Peng; Liu, Zewen; Fang, Jichao
2018-05-28
Imidacloprid is a key insecticide used for controlling sucking insect pests, including the small brown planthopper (Laodelphax striatellus, Fallén) (Hemiptera: Delphacidae), an important agricultural pest of rice. A strain of L. striatellus (YN-ILR) developed 21-fold resistance when selected with imidacloprid on a susceptible YN strain. An in vitro study on piperonyl butoxide synergism indicated that enhanced detoxification mediated by cytochrome P450s contributed to imidacloprid resistance to some extent, and multiple P450 genes showed altered expression in the imidacloprid-resistant YN-ILR strain compared with the susceptible YN strain (CYP425B1-CYP6BD10 had 1.51- to 11.45-fold higher expression, CYP4CE2-CYP4DD1V2 had 0.12- to 0.57-fold lower expression). While there were no mutations in target nicotinic acetylcholine receptor (nAChR) genes, subunits of Lsα1, Lsβ1, and Lsβ3 in the YN-ILR strain showed 3.86-, 4.39-, and 2.59-fold higher expression and Lsa8 displayed 0.38-fold lower expression than the YN strain. Moreover, 21-fold moderate imidacloprid resistance in individuals of L. striatellus did not produce a fitness cost. The findings suggest that L. striatellus has the capacity to develop resistance to imidacloprid through P450 detoxification and potential target nAChR expression changes, and moderate imidacloprid resistance was not associated with a fitness cost.
Cidral, Thiago André; Carvalho, Maria Cícera; Figueiredo, Agnes Marie Sá; de Melo, Maria Celeste Nunes
2015-10-01
The aim of this article were to determinate the mechanism of linezolid resistance in coagulase-negative methicillin-resistant staphylococci from hospitals in the northeast of Brazil. We identified the isolates using VITEK(®) 2 and MALDI-TOF. Susceptibility to antibiotics was measured by the disk-diffusion method and by Etest(®) . Extraction of the whole genome DNA was performed, followed by screening of all the strains for the presence of mecA and cfr genes. The domain V region of 23S rRNA gene was sequenced and then aligned with a linezolid-susceptible reference strain. Pulsed-field gel electrophoresis (PFGE) macro-restriction analysis was performed. Three linezolid-resistant Staphylococcus hominis and two linezolid-resistant Staphylococcus epidermidis strains were analyzed. The isolates showed two point mutations in the V region of the 23S rRNA gene (C2190T and G2603T). We did not detect the cfr gene in any isolate by PCR. The S. hominis showed the same pulsotype, while the S. epidermidis did not present any genetic relation to each other. In conclusion, this study revealed three S. hominis and two S. epidermidis strains with resistance to linezolid due to a double mutation (C2190T and G2603T) in the domain V of the 23S rRNA gene. For the first time, the mutation of C2190T in S. epidermidis is described. This study also revealed the clonal spread of a S. hominis pulsotype between three public hospitals in the city of Natal, Brazil. These findings highlight the importance of continued vigilance of linezolid resistance in staphylococci. © 2015 APMIS. Published by John Wiley & Sons Ltd.
Winglee, Kathryn; Lun, Shichun; Pieroni, Marco; Kozikowski, Alan; Bishai, William
2015-11-01
Drug resistance is a major problem in Mycobacterium tuberculosis control, and it is critical to identify novel drug targets and new antimycobacterial compounds. We have previously identified an imidazo[1,2-a]pyridine-4-carbonitrile-based agent, MP-III-71, with strong activity against M. tuberculosis. In this study, we evaluated mechanisms of resistance to MP-III-71. We derived three independent M. tuberculosis mutants resistant to MP-III-71 and conducted whole-genome sequencing of these mutants. Loss-of-function mutations in Rv2887 were common to all three MP-III-71-resistant mutants, and we confirmed the role of Rv2887 as a gene required for MP-III-71 susceptibility using complementation. The Rv2887 protein was previously unannotated, but domain and homology analyses suggested it to be a transcriptional regulator in the MarR (multiple antibiotic resistance repressor) family, a group of proteins first identified in Escherichia coli to negatively regulate efflux pumps and other mechanisms of multidrug resistance. We found that two efflux pump inhibitors, verapamil and chlorpromazine, potentiate the action of MP-III-71 and that mutation of Rv2887 abrogates their activity. We also used transcriptome sequencing (RNA-seq) to identify genes which are differentially expressed in the presence and absence of a functional Rv2887 protein. We found that genes involved in benzoquinone and menaquinone biosynthesis were repressed by functional Rv2887. Thus, inactivating mutations of Rv2887, encoding a putative MarR-like transcriptional regulator, confer resistance to MP-III-71, an effective antimycobacterial compound that shows no cross-resistance to existing antituberculosis drugs. The mechanism of resistance of M. tuberculosis Rv2887 mutants may involve efflux pump upregulation and also drug methylation. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Directory of Open Access Journals (Sweden)
Yuhui Xu
2015-01-01
Full Text Available To better understand the molecular mechanisms of Ethambutol (EMB resistance, the mutant hot spot region of five genes (embB, embA, embC, embR, and ubiA was amplified and sequenced in 109 EMB-resistant and 153 EMB-susceptible clinical isolates from China. Twenty-seven EMB-susceptible isolates were found to have nonsynonym mutations, 23 of which were in embB. The mutations occurred most frequently in embB (85.3%, 93 and were seldom in embC (2.8%, 3, embA (3.7%, 4, embR (3.7%, 4, and ubiA (8.3%, 9 in EMB-resistant isolates. For the embB gene, 63 isolates showed mutations at embB306, 20 at embB406, nine at embB497, and five at embB354 in EMB-resistant isolates. In addition, the particular mutants at embB406 and embB497 indicated both high levels of EMB resistance (MICs>5 μg/mL and broad anti-TB drug resistance spectrums. Our data supported the facts that embB306 could be used as a marker for EMB resistance with a sensitivity of 57.8% and a specificity of 78.8%.
Non-selective regulation of peroxide and superoxide resistance genes by PerR in Campylobacter jejuni
Directory of Open Access Journals (Sweden)
Jong-Chul eKim
2015-02-01
Full Text Available Campylobacter jejuni is an important foodborne pathogen. The molecular mechanisms for the regulation of oxidative stress resistance have not yet been understood fully in this bacterium. In this study, we investigated how PerR (peroxide stress regulator modulates the transcriptional regulation of both peroxide and superoxide resistance genes in C. jejuni, particularly under oxidative stress conditions. The transcriptional levels of ahpC, katA, and sodB were substantially increased by aeration and oxidant exposure. Interestingly, a perR mutation completely abrogated the transcriptional response of ahpC, katA and sodB to oxidants. Furthermore, we demonstrated that perR transcription was reduced by aeration and oxidant exposure. In contrast to the unique role of PerR homologs in peroxide stress regulation in other bacteria, interestingly, C. jejuni PerR directly regulates the transcription of sodB, the most important gene in superoxide defense, as evidenced by the alteration of sodB transcription by the perR mutation and direct binding of rPerR to the sodB promoter. In addition, we also observed notable morphological changes in C. jejuni from spiral rods to coccoid morphology under aerobic conditions. Based on the intracellular ATP levels, C. jejuni entered a viable-but-non-culturable state under aerobic conditions. These findings clearly demonstrate that C. jejuni possesses a unique regulatory mechanism of oxidative stress defense that does not specifically distinguish between peroxide and superoxide defense, and PerR plays a pivotal role in this non-selective regulation of oxidative stress resistance in C. jejuni.
Bulos, Mariano; Vergani, Pablo Nicolas; Altieri, Emiliano
2014-09-01
Rust resistance in the sunflower line P386 is controlled by Pu 6 , a gene which was reported to segregate independently from other rust resistant genes, such as R 4 . The objectives of this work were to map Pu 6 , to provide and validate molecular tools for its identification, and to determine the linkage relationship of Pu 6 and R 4 . Genetic mapping of Pu 6 with six markers covered 24.8 cM of genetic distance on the lower end of linkage Group 13 of the sunflower consensus map. The marker most closely linked to Pu 6 was ORS316 at 2.5 cM in the distal position. ORS316 presented five alleles when was assayed with a representative set of resistant and susceptible lines. Allelism test between Pu 6 and R 4 indicated that both genes are linked at a genetic distance of 6.25 cM. This is the first confirmation based on an allelism test that at least two members of the R adv /R 4 /R 11 / R 13a /R 13b /Pu 6 cluster of genes are at different loci. A fine elucidation of the architecture of this complex locus will allow designing and constructing completely new genomic regions combining genes from different resistant sources and the elimination of the linkage drag around each resistant gene.
R3-R4 deletion in the PRNP gene is associated with Creutzfeldt-Jakob disease (CJD)
Energy Technology Data Exchange (ETDEWEB)
Cervenakova, L.; Brown, P.; Nagle, J. [and others
1994-09-01
There are conflicting reports on the association of deletions in the PRNP gene on chromosome 20 with CJD, a rapidly progressive fatal spongiform encephalopathy. We accumulated data suggesting that a deletion of R3-R4 type (parts of the third and fourth repeats are deleted from the area of four repeating 24 bp sequences in the 5{prime} region of the gene) is causing CJD. Screening of 129 unaffected control individuals demonstrated presence of a deletion of R2 type in four (1.55% of the studied chromosomes), but none of them had the R3-R4 type. Of 181 screened patients with spongiform encephalopathies, two had a deletion of R3-R4 type with no other mutations in the coding sequence. Both patients had a classical rapidly progressive dementing disease and diffuse spongiform degeneration, and both cases were apparently sporadic. The same R3-R4 type of deletion was detected in three additional neuropathologically confirmed spongiform encephalopathy patients, of which two had other known pathogenic mutations in the PRNP gene: at codon 178 on the methionine allele exhibiting the phenotype of fatal familial insomnia, and codon 200 causing CJD with severe dementia; the third was a patient with iatrogenic CJD who developed the disease after treatment with growth hormone extracted from cadaveric human pituitary glands. In all cases the deletion coincided with a variant sequence at position 129 coding for methionine.
López, Camilo E; Acosta, Iván F; Jara, Carlos; Pedraza, Fabio; Gaitán-Solís, Eliana; Gallego, Gerardo; Beebe, Steve; Tohme, Joe
2003-01-01
ABSTRACT A polymerase chain reaction approach using degenerate primers that targeted the conserved domains of cloned plant disease resistance genes (R genes) was used to isolate a set of 15 resistance gene analogs (RGAs) from common bean (Phaseolus vulgaris). Eight different classes of RGAs were obtained from nucleotide binding site (NBS)-based primers and seven from not previously described Toll/Interleukin-1 receptor-like (TIR)-based primers. Putative amino acid sequences of RGAs were significantly similar to R genes and contained additional conserved motifs. The NBS-type RGAs were classified in two subgroups according to the expected final residue in the kinase-2 motif. Eleven RGAs were mapped at 19 loci on eight linkage groups of the common bean genetic map constructed at Centro Internacional de Agricultura Tropical. Genetic linkage was shown for eight RGAs with partial resistance to anthracnose, angular leaf spot (ALS) and Bean golden yellow mosaic virus (BGYMV). RGA1 and RGA2 were associated with resistance loci to anthracnose and BGYMV and were part of two clusters of R genes previously described. A new major cluster was detected by RGA7 and explained up to 63.9% of resistance to ALS and has a putative contribution to anthracnose resistance. These results show the usefulness of RGAs as candidate genes to detect and eventually isolate numerous R genes in common bean.
Vega-Arreguín, Julio C; Shimada-Beltrán, Harumi; Sevillano-Serrano, Jacobo; Moffett, Peter
2017-01-01
The identification of host genes associated with resistance to Phytophthora capsici is crucial to developing strategies of control against this oomycete pathogen. Since there are few sources of resistance to P. capsici in crop plants, non-host plants represent a promising source of resistance genes as well as excellent models to study P. capsici - plant interactions. We have previously shown that non-host resistance to P. capsici in Nicotiana spp. is mediated by the recognition of a specific P. capsici effector protein, PcAvr3a1 in a manner that suggests the involvement of a cognate disease resistance (R) genes. Here, we have used virus-induced gene silencing (VIGS) and transgenic tobacco plants expressing dsRNA in Nicotiana spp. to identify candidate R genes that mediate non-host resistance to P. capsici . Silencing of members of the I2 multigene family in the partially resistant plant N. edwardsonii and in the resistant N. tabacum resulted in compromised resistance to P. capsici . VIGS of two other components required for R gene-mediated resistance, EDS1 and SGT1 , also enhanced susceptibility to P. capsici in N. edwardsonii , as well as in the susceptible plants N. benthamiana and N. clevelandii . The silencing of I2 family members in N. tabacum also compromised the recognition of PcAvr3a1. These results indicate that in this case, non-host resistance is mediated by the same components normally associated with race-specific resistance.
Tan, G X; Weng, Q M; Ren, X; Huang, Z; Zhu, L L; He, G C
2004-03-01
The whitebacked planthopper (WBPH), Sogatella furcifera, and brown planthopper (BPH) Nilaparvata lugens Stål are important sucking insects of rice (Oryza sativa L.) crops throughout the world. Rice 'B5', which has derived its resistance genes from the wild rice O. officinalis Wall ex Watt, is a line that is highly resistant to both WBPH and BPH. Previously, two resistance genes against BPH, Qbp1, and Qbp2 in 'B5' had been mapped onto chromosome 3 and chromosome 4, respectively. In this study, we employed a mapping population composed of 187 recombinant inbred lines (RILs), produced from a cross between 'B5' and susceptible variety 'Minghui63', to locate the WBPH and BPH resistance genes. A RFLP survey of the bulked extremes from the RIL population identified two genomic regions, one on chromosome 3 and the other on chromosome 4, likely containing the resistance genes to planthoppers. QTL analysis of the RILs further confirmed that two WBPH resistance genes were mapped on the same loci as Qbp1 and Qbp2, using a linkage map with 242 molecular markers distributed on 12 rice chromosomes. Of the two WBPH resistance genes, one designated Wbph7(t) was located within a 1.1-cM region between R1925 and G1318 on chromosome 3, the other designated Wbph8(t) was within a 0.3-cM region flanked by R288 and S11182 on chromosome 4. A two-way analysis of variance showed that two loci acted independently with each other in determining WBPH resistance. The results have significant implications in studying the interactions between sucking insects and plants and in breeding programs of resistance to rice planthoppers.
Burt, Andrew J; William, H Manilal; Perry, Gregory; Khanal, Raja; Pauls, K Peter; Kelly, James D; Navabi, Alireza
2015-01-01
Anthracnose, caused by Colletotrichum lindemuthianum, is an important fungal disease of common bean (Phaseolus vulgaris). Alleles at the Co-4 locus confer resistance to a number of races of C. lindemuthianum. A population of 94 F4:5 recombinant inbred lines of a cross between resistant black bean genotype B09197 and susceptible navy bean cultivar Nautica was used to identify markers associated with resistance in bean chromosome 8 (Pv08) where Co-4 is localized. Three SCAR markers with known linkage to Co-4 and a panel of single nucleotide markers were used for genotyping. A refined physical region on Pv08 with significant association with anthracnose resistance identified by markers was used in BLAST searches with the genomic sequence of common bean accession G19833. Thirty two unique annotated candidate genes were identified that spanned a physical region of 936.46 kb. A majority of the annotated genes identified had functional similarity to leucine rich repeats/receptor like kinase domains. Three annotated genes had similarity to 1, 3-β-glucanase domains. There were sequence similarities between some of the annotated genes found in the study and the genes associated with phosphoinositide-specific phosphilipases C associated with Co-x and the COK-4 loci found in previous studies. It is possible that the Co-4 locus is structured as a group of genes with functional domains dominated by protein tyrosine kinase along with leucine rich repeats/nucleotide binding site, phosphilipases C as well as β-glucanases.
Association of MC4R gene variants with carcass and meat quality ...
African Journals Online (AJOL)
STORAGESEVER
2009-08-04
Aug 4, 2009 ... 1College of Animal Science and Technology, Northwest A and F ... MC4R belongs to a seven-transmembrane G-protein-coupled receptor which may regulate body ... targeted disruption of the MC4R gene in mice causes.
Directory of Open Access Journals (Sweden)
Andrew J Burt
Full Text Available Anthracnose, caused by Colletotrichum lindemuthianum, is an important fungal disease of common bean (Phaseolus vulgaris. Alleles at the Co-4 locus confer resistance to a number of races of C. lindemuthianum. A population of 94 F4:5 recombinant inbred lines of a cross between resistant black bean genotype B09197 and susceptible navy bean cultivar Nautica was used to identify markers associated with resistance in bean chromosome 8 (Pv08 where Co-4 is localized. Three SCAR markers with known linkage to Co-4 and a panel of single nucleotide markers were used for genotyping. A refined physical region on Pv08 with significant association with anthracnose resistance identified by markers was used in BLAST searches with the genomic sequence of common bean accession G19833. Thirty two unique annotated candidate genes were identified that spanned a physical region of 936.46 kb. A majority of the annotated genes identified had functional similarity to leucine rich repeats/receptor like kinase domains. Three annotated genes had similarity to 1, 3-β-glucanase domains. There were sequence similarities between some of the annotated genes found in the study and the genes associated with phosphoinositide-specific phosphilipases C associated with Co-x and the COK-4 loci found in previous studies. It is possible that the Co-4 locus is structured as a group of genes with functional domains dominated by protein tyrosine kinase along with leucine rich repeats/nucleotide binding site, phosphilipases C as well as β-glucanases.
Niu, Dongdong; Xia, Jing; Jiang, Chunhao; Qi, Beibei; Ling, Xiaoyu; Lin, Siyuan; Zhang, Weixiong; Guo, Jianhua; Jin, Hailing; Zhao, Hongwei
2016-04-01
Small RNAs play an important role in plant immune responses. However, their regulatory function in induced systemic resistance (ISR) is nascent. Bacillus cereus AR156 is a plant growth-promoting rhizobacterium that induces ISR in Arabidopsis against bacterial infection. Here, by comparing small RNA profiles of Pseudomonas syringae pv. tomato (Pst) DC3000-infected Arabidopsis with and without AR156 pretreatment, we identified a group of Arabidopsis microRNAs (miRNAs) that are differentially regulated by AR156 pretreatment. miR825 and miR825* are two miRNA generated from a single miRNA gene. Northern blot analysis indicated that they were significantly downregulated in Pst DC3000-infected plants pretreated with AR156, in contrast to the plants without AR156 pretreatment. miR825 targets two ubiquitin-protein ligases, while miR825* targets toll-interleukin-like receptor (TIR)-nucleotide binding site (NBS) and leucine-rich repeat (LRR) type resistance (R) genes. The expression of these target genes negatively correlated with the expression of miR825 and miR825*. Moreover, transgenic plants showing reduced expression of miR825 and miR825* displayed enhanced resistance to Pst DC3000 infection, whereas transgenic plants overexpressing miR825 and miR825* were more susceptible. Taken together, our data indicates that Bacillus cereus AR156 pretreatment primes ISR to Pst infection by suppressing miR825 and miR825* and activating the defense related genes they targeted. © 2015 Institute of Botany, Chinese Academy of Sciences.
International Nuclear Information System (INIS)
Wei, Xueju; Wang, Weibin; Wang, Lanlan; Zhang, Yuanyuan; Zhang, Xian; Chen, Mingtai; Wang, Fang; Yu, Jia; Ma, Yanni; Sun, Guotao
2016-01-01
Pancreatic cancer patients are often resistant to chemotherapy treatment, which results in poor prognosis. The objective of this study was to delineate the mechanism by which miR-21 induces drug resistance to 5-fluorouracil (5-FU) in human pancreatic cancer cells (PATU8988 and PANC-1). We report that PATU8988 cells resistant to 5-FU express high levels of miR-21 in comparison to sensitive primary PATU8988 cells. Suppression of miR-21 expression in 5-Fu-resistant PATU8988 cells can alleviate its 5-FU resistance. Meanwhile, lentiviral vector-mediated overexpression of miR-21 not only conferred resistance to 5-FU but also promoted proliferation, migration, and invasion of PATU8988 and PANC-1 cells. The proresistance effects of miR-21 were attributed to the attenuated expression of tumor suppressor genes, including PTEN and PDCD4. Overexpression of PTEN and PDCD4 antagonized miR-21-induced resistance to 5-FU and migration activity. Our work demonstrates that miR-21 can confer drug resistance to 5-FU in pancreatic cancer cells by regulating the expression of tumor suppressor genes, as the target genes of miR-21, PTEN and PDCD4 can rescue 5-FU sensitivity and the phenotypic characteristics disrupted by miR-21
Joshi, R K; Mohanty, S; Subudhi, E; Nayak, S
2010-09-08
Turmeric (Curcuma longa), an important asexually reproducing spice crop of the family Zingiberaceae is highly susceptible to bacterial and fungal pathogens. The identification of resistance gene analogs holds great promise for development of resistant turmeric cultivars. Degenerate primers designed based on known resistance genes (R-genes) were used in combinations to elucidate resistance gene analogs from Curcuma longa cultivar surama. The three primers resulted in amplicons with expected sizes of 450-600 bp. The nucleotide sequence of these amplicons was obtained through sequencing; their predicted amino acid sequences compared to each other and to the amino acid sequences of known R-genes revealed significant sequence similarity. The finding of conserved domains, viz., kinase-1a, kinase-2 and hydrophobic motif, provided evidence that the sequences belong to the NBS-LRR class gene family. The presence of tryptophan as the last residue of kinase-2 motif further qualified them to be in the non-TIR-NBS-LRR subfamily of resistance genes. A cluster analysis based on the neighbor-joining method was carried out using Curcuma NBS analogs together with several resistance gene analogs and known R-genes, which classified them into two distinct subclasses, corresponding to clades N3 and N4 of non-TIR-NBS sequences described in plants. The NBS analogs that we isolated can be used as guidelines to eventually isolate numerous R-genes in turmeric.
Karmakar, Subhasis; Molla, Kutubuddin Ali; Chanda, Palas K; Sarkar, Sailendra Nath; Datta, Swapan K; Datta, Karabi
2016-01-01
Green tissue-specific simultaneous overexpression of two defense-related genes ( OsCHI11 & OsOXO4 ) in rice leads to significant resistance against sheath blight pathogen ( R. solani ) without distressing any agronomically important traits. Overexpressing two defense-related genes (OsOXO4 and OsCHI11) cloned from rice is effective at enhancing resistance against sheath blight caused by Rhizoctonia solani. These genes were expressed under the control of two different green tissue-specific promoters, viz. maize phosphoenolpyruvate carboxylase gene promoter, PEPC, and rice cis-acting 544-bp DNA element, immediately upstream of the D54O translational start site, P D54O-544 . Putative T0 transgenic rice plants were screened by PCR and integration of genes was confirmed by Southern hybridization of progeny (T1) rice plants. Successful expression of OsOXO4 and OsCHI11 in all tested plants was confirmed. Expression of PR genes increased significantly following pathogen infection in overexpressing transgenic plants. Following infection, transgenic plants exhibited elevated hydrogen peroxide levels, significant changes in activity of ROS scavenging enzymes and reduced membrane damage when compared to their wild-type counterpart. In a Rhizoctonia solani toxin assay, a detached leaf inoculation test and an in vivo plant bioassay, transgenic plants showed a significant reduction in disease symptoms in comparison to non-transgenic control plants. This is the first report of overexpression of two different PR genes driven by two green tissue-specific promoters providing enhanced sheath blight resistance in transgenic rice.
Peng, Z X; Zou, M Y; Xu, J; Guan, W Y; Li, Y; Liu, D R; Zhang, S S; Hao, Q; Yan, S F; Wang, W; Yu, D M; Li, F Q
2018-04-06
Objective: To monitor the antimicrobial resistance and drug-resistance genes of Yersinia enterocolitis , Y. intermedia and Y. frederiksenii recovered from retailed fresh poultry of 4 provinces of China. Methods: The susceptibility of 25 isolated Yersinia spp. to 14 classes and 25 kinds of antibiotics was determined by broth microdilution method according to CLSI (Clinical and Laboratory Standards Institute). The antibiotic resistance genes were predicted with antibiotic resistance genes database (ARDB) using whole genome sequences of Yersinia spp. Results: In all 22 Y. enterocolitis tested, 63.7% (14 isolates), 22.8% (5 isolates), 4.6% and 4.6% of 1 isolates exhibited the resistance to cefoxitin, ampicillin-sulbactam, nitrofurantoin and trimethoprim-sulfamethoxazole, respectively. All the 25 isolates were multi-drug resistant to more than 3 antibiotics, while 64.0% of isolates were resistant to more than 4 antibiotics. A few Y. enterocolitis isolates of this study were intermediate to ceftriaxone and ciprofloxacin. Most Yersinia spp. isolates contained antibiotic resistance genes mdtG, ksgA, bacA, blaA, rosAB and acrB , and 5 isolates recovered from fresh chicken also contained dfrA 1, catB 2 and ant 3 ia . Conclusion: The multi-drug resistant Yersinia spp. isolated from retailed fresh poultry is very serious in the 4 provinces of China, and their contained many kinds of drug-resistance genes.
Spread of tetracycline resistance genes at a conventional dairy farm
Czech Academy of Sciences Publication Activity Database
Kyselková, Martina; Jirout, Jiří; Vrchotová, Naděžda; Schmitt, H.; Elhottová, Dana
2015-01-01
Roč. 6, may (2015), s. 536 ISSN 1664-302X R&D Projects: GA ČR GAP504/10/2077; GA MŠk(CZ) EE2.3.30.0032; GA MŠk(CZ) LO1415 Institutional support: RVO:67179843 ; RVO:60077344 Keywords : antibiotic resistance spread * animal manure * cattle intestinal microflora * chlortetracycline * dairy cattle * dairy farm * heavy metals * tetracycline resistance genes Subject RIV: EI - Biotechnology ; Bionics; EE - Microbiology, Virology (BC-A) Impact factor: 4.165, year: 2015
microRNA-mediated R gene regulation: molecular scabbards for double-edged swords.
Deng, Yingtian; Liu, Minglei; Li, Xiaofei; Li, Feng
2018-02-01
Plant resistance (R) proteins are immune receptors that recognize pathogen effectors and trigger rapid defense responses, namely effector-triggered immunity. R protein-mediated pathogen resistance is usually race specific. During plant-pathogen coevolution, plant genomes accumulated large numbers of R genes. Even though plant R genes provide important natural resources for breeding disease-resistant crops, their presence in the plant genome comes at a cost. Misregulation of R genes leads to developmental defects, such as stunted growth and reduced fertility. In the past decade, many microRNAs (miRNAs) have been identified to target various R genes in plant genomes. miRNAs reduce R gene levels under normal conditions and allow induction of R gene expression under various stresses. For these reasons, we consider R genes to be double-edged "swords" and miRNAs as molecular "scabbards". In the present review, we summarize the contributions and potential problems of these "swords" and discuss the features and production of the "scabbards", as well as the mechanisms used to pull the "sword" from the "scabbard" when needed.
Wang, Jun; Zeng, Xuan; Tian, Dongsheng; Yang, Xiaobei; Wang, Lanlan; Yin, Zhongchao
2018-03-30
Transcription activator-like effector (TALE)-dependent dominant disease resistance (R) genes in plants, also referred to as executor R genes, are induced on infection by phytopathogenic bacteria of the genus Xanthomonas harbouring the corresponding TALE genes. Unlike the traditional R proteins, the executor R proteins do not determine the resistance specificity and may function broadly in different plant species. The executor R gene Bs4C-R in the resistant genotype PI 235047 of the pepper species Capsicum pubescens (CpBs4C-R) confers disease resistance to Xanthomonas campestris pv. vesicatoria (Xcv) harbouring the TALE genes avrBsP/avrBs4. In this study, the synthetic genes of CpBs4C-R and two other Bs4C-like genes, the susceptible allele in the genotype PI585270 of C. pubescens (CpBs4C-S) and the CaBs4C-R homologue gene in the cultivar 'CM334' of Capsicum annum (CaBs4C), were characterized in tobacco (Nicotiana benthamiana) and rice (Oryza sativa). The Bs4C genes induced cell death in N. benthamiana. The functional Bs4C-eCFP fusion proteins were localized to the endoplasmic reticulum (ER) membrane in the leaf epidermal cells of N. benthamiana. The Xa10 promoter-Bs4C fusion genes in transgenic rice conferred strain-specific disease resistance to Xanthomonas oryzae pv. oryzae (Xoo), the causal agent of bacterial blight in rice, and were specifically induced by the Xa10-incompatible Xoo strain PXO99 A (pHM1avrXa10). The results indicate that the Bs4C proteins from pepper species function broadly in rice and the Bs4C protein-mediated cell death from the ER is conserved between dicotyledonous and monocotyledonous plants, which can be utilized to engineer novel and enhanced disease resistance in heterologous plants. © 2018 TEMASEK LIFE SCIENCES LABORATORY. MOLECULAR PLANT PATHOLOGY © 2018 JOHN WILEY & SONS LTD.
A maize resistance gene functions against bacterial streak disease in rice.
Zhao, Bingyu; Lin, Xinghua; Poland, Jesse; Trick, Harold; Leach, Jan; Hulbert, Scot
2005-10-25
Although cereal crops all belong to the grass family (Poacea), most of their diseases are specific to a particular species. Thus, a given cereal species is typically resistant to diseases of other grasses, and this nonhost resistance is generally stable. To determine the feasibility of transferring nonhost resistance genes (R genes) between distantly related grasses to control specific diseases, we identified a maize R gene that recognizes a rice pathogen, Xanthomonas oryzae pv. oryzicola, which causes bacterial streak disease. Bacterial streak is an important disease of rice in Asia, and no simply inherited sources of resistance have been identified in rice. Although X. o. pv. oryzicola does not cause disease on maize, we identified a maize gene, Rxo1, that conditions a resistance reaction to a diverse collection of pathogen strains. Surprisingly, Rxo1 also controls resistance to the unrelated pathogen Burkholderia andropogonis, which causes bacterial stripe of sorghum and maize. The same gene thus controls resistance reactions to both pathogens and nonpathogens of maize. Rxo1 has a nucleotide-binding site-leucine-rich repeat structure, similar to many previously identified R genes. Most importantly, Rxo1 functions after transfer as a transgene to rice, demonstrating the feasibility of nonhost R gene transfer between cereals and providing a valuable tool for controlling bacterial streak disease.
Directory of Open Access Journals (Sweden)
Dhananjay Dhokane
Full Text Available Fusarium head blight (FHB caused by Fusarium graminearum not only causes severe losses in yield, but also reduces quality of wheat grain by accumulating mycotoxins. Breeding for host plant resistance is considered as the best strategy to manage FHB. Resistance in wheat to FHB is quantitative in nature, involving cumulative effects of many genes governing resistance. The poor understanding of genetics and lack of precise phenotyping has hindered the development of FHB resistant cultivars. Though more than 100 QTLs imparting FHB resistance have been reported, none discovered the specific genes localized within the QTL region, nor the underlying mechanisms of resistance.In our study recombinant inbred lines (RILs carrying resistant (R-RIL and susceptible (S-RIL alleles of QTL-Fhb2 were subjected to metabolome and transcriptome profiling to discover the candidate genes. Metabolome profiling detected a higher abundance of metabolites belonging to phenylpropanoid, lignin, glycerophospholipid, flavonoid, fatty acid, and terpenoid biosynthetic pathways in R-RIL than in S-RIL. Transcriptome analysis revealed up-regulation of several receptor kinases, transcription factors, signaling, mycotoxin detoxification and resistance related genes. The dissection of QTL-Fhb2 using flanking marker sequences, integrating metabolomic and transcriptomic datasets, identified 4-Coumarate: CoA ligase (4CL, callose synthase (CS, basic Helix Loop Helix (bHLH041 transcription factor, glutathione S-transferase (GST, ABC transporter-4 (ABC4 and cinnamyl alcohol dehydrogenase (CAD as putative resistance genes localized within the QTL-Fhb2 region.Some of the identified genes within the QTL region are associated with structural resistance through cell wall reinforcement, reducing the spread of pathogen through rachis within a spike and few other genes that detoxify DON, the virulence factor, thus eventually reducing disease severity. In conclusion, we report that the wheat
Sahoo, Dipak K; Abeysekara, Nilwala S; Cianzio, Silvia R; Robertson, Alison E; Bhattacharyya, Madan K
2017-01-01
Phytophthora sojae Kaufmann and Gerdemann, which causes Phytophthora root rot, is a widespread pathogen that limits soybean production worldwide. Development of Phytophthora resistant cultivars carrying Phytophthora resistance Rps genes is a cost-effective approach in controlling this disease. For this mapping study of a novel Rps gene, 290 recombinant inbred lines (RILs) (F7 families) were developed by crossing the P. sojae resistant cultivar PI399036 with the P. sojae susceptible AR2 line, and were phenotyped for responses to a mixture of three P. sojae isolates that overcome most of the known Rps genes. Of these 290 RILs, 130 were homozygous resistant, 12 heterzygous and segregating for Phytophthora resistance, and 148 were recessive homozygous and susceptible. From this population, 59 RILs homozygous for Phytophthora sojae resistance and 61 susceptible to a mixture of P. sojae isolates R17 and Val12-11 or P7074 that overcome resistance encoded by known Rps genes mapped to Chromosome 18 were selected for mapping novel Rps gene. A single gene accounted for the 1:1 segregation of resistance and susceptibility among the RILs. The gene encoding the Phytophthora resistance mapped to a 5.8 cM interval between the SSR markers BARCSOYSSR_18_1840 and Sat_064 located in the lower arm of Chromosome 18. The gene is mapped 2.2 cM proximal to the NBSRps4/6-like sequence that was reported to co-segregate with the Phytophthora resistance genes Rps4 and Rps6. The gene is mapped to a highly recombinogenic, gene-rich genomic region carrying several nucleotide binding site-leucine rich repeat (NBS-LRR)-like genes. We named this novel gene as Rps12, which is expected to be an invaluable resource in breeding soybeans for Phytophthora resistance.
Directory of Open Access Journals (Sweden)
Dipak K Sahoo
Full Text Available Phytophthora sojae Kaufmann and Gerdemann, which causes Phytophthora root rot, is a widespread pathogen that limits soybean production worldwide. Development of Phytophthora resistant cultivars carrying Phytophthora resistance Rps genes is a cost-effective approach in controlling this disease. For this mapping study of a novel Rps gene, 290 recombinant inbred lines (RILs (F7 families were developed by crossing the P. sojae resistant cultivar PI399036 with the P. sojae susceptible AR2 line, and were phenotyped for responses to a mixture of three P. sojae isolates that overcome most of the known Rps genes. Of these 290 RILs, 130 were homozygous resistant, 12 heterzygous and segregating for Phytophthora resistance, and 148 were recessive homozygous and susceptible. From this population, 59 RILs homozygous for Phytophthora sojae resistance and 61 susceptible to a mixture of P. sojae isolates R17 and Val12-11 or P7074 that overcome resistance encoded by known Rps genes mapped to Chromosome 18 were selected for mapping novel Rps gene. A single gene accounted for the 1:1 segregation of resistance and susceptibility among the RILs. The gene encoding the Phytophthora resistance mapped to a 5.8 cM interval between the SSR markers BARCSOYSSR_18_1840 and Sat_064 located in the lower arm of Chromosome 18. The gene is mapped 2.2 cM proximal to the NBSRps4/6-like sequence that was reported to co-segregate with the Phytophthora resistance genes Rps4 and Rps6. The gene is mapped to a highly recombinogenic, gene-rich genomic region carrying several nucleotide binding site-leucine rich repeat (NBS-LRR-like genes. We named this novel gene as Rps12, which is expected to be an invaluable resource in breeding soybeans for Phytophthora resistance.
Li, Jianan; Cheng, Weixiao; Xu, Like; Strong, P J; Chen, Hong
2015-03-01
In this study, we determined the abundance of 8 antibiotics (3 tetracyclines, 4 sulfonamides, and 1 trimethoprim), 12 antibiotic-resistant genes (10 tet, 2 sul), 4 antibiotic-resistant bacteria (tetracycline, sulfamethoxazole, and combined resistance), and class 1 integron integrase gene (intI1) in the effluent of residential areas, hospitals, and municipal wastewater treatment plant (WWTP) systems. The concentrations of total/individual targets (antibiotics, genes, and bacteria) varied remarkably among different samples, but the hospital samples generally had a lower abundance than the residential area samples. The WWTP demonstrated removal efficiencies of 50.8% tetracyclines, 66.8% sulfonamides, 0.5 logs to 2.5 logs tet genes, and less than 1 log of sul and intI1 genes, as well as 0.5 log to 1 log removal for target bacteria. Except for the total tetracycline concentration and the proportion of tetracycline-resistant bacteria (R (2) = 0.330, P antibiotics and the corresponding resistant bacteria (P > 0.05). In contrast, various relationships were identified between antibiotics and antibiotic resistance genes (P antibiotic-resistant bacteria (P < 0.01).
Beaudoin, Trevor; Zhang, Li; Hinz, Aaron J; Parr, Christopher J; Mah, Thien-Fah
2012-06-01
Bacteria growing in biofilms are responsible for a large number of persistent infections and are often more resistant to antibiotics than are free-floating bacteria. In a previous study, we identified a Pseudomonas aeruginosa gene, ndvB, which is important for the formation of periplasmic glucans. We established that these glucans function in biofilm-specific antibiotic resistance by sequestering antibiotic molecules away from their cellular targets. In this study, we investigate another function of ndvB in biofilm-specific antibiotic resistance. DNA microarray analysis identified 24 genes that were responsive to the presence of ndvB. A subset of 20 genes, including 8 ethanol oxidation genes (ercS', erbR, exaA, exaB, eraR, pqqB, pqqC, and pqqE), was highly expressed in wild-type biofilm cells but not in ΔndvB biofilms, while 4 genes displayed the reciprocal expression pattern. Using quantitative real-time PCR, we confirmed the ndvB-dependent expression of the ethanol oxidation genes and additionally demonstrated that these genes were more highly expressed in biofilms than in planktonic cultures. Expression of erbR in ΔndvB biofilms was restored after the treatment of the biofilm with periplasmic extracts derived from wild-type biofilm cells. Inactivation of ethanol oxidation genes increased the sensitivity of biofilms to tobramycin. Together, these results reveal that ndvB affects the expression of multiple genes in biofilms and that ethanol oxidation genes are linked to biofilm-specific antibiotic resistance.
Breuker, C.J.; Victoir, K.; Jong, de P.W.; Meijden, van der E.; Brakefield, P.M.; Vrieling, K.
2005-01-01
A so-called R-gene renders the yellow-striped flea beetle Phyllotreta nemorum L. (Coleoptera: Chrysomelidae: Alticinae) resistant to the defenses of the yellow rocket Barbarea vulgaris R.Br. (Brassicacea) and enables it to use it as a host plant in Denmark. In this study, genetic markers for an
Spread of tetracycline resistance genes at a conventional dairy farm
Directory of Open Access Journals (Sweden)
Martina eKyselkova
2015-05-01
Full Text Available The use of antibiotics in animal husbandry contributes to the worldwide problem of increasing antibiotic resistance in animal and human pathogens. Intensive animal production is considered an important source of antibiotic resistance genes released to the environment, while the contribution of smaller farms remains to be evaluated. Here we monitor the spread of tetracycline resistance (TC-r genes at a middle-size conventional dairy farm, where chlortetracycline (CTC, as intrauterine suppository is prophylactically used after each calving. Our study has shown that animals at the farm acquired the TC-r genes in their early age (1-2 weeks, likely due to colonization with TC-resistant bacteria from their mothers and/or the farm environment. The relative abundance of the TC-r genes tet(W, tet(Q and tet(M in fresh excrements of calves was about 1-2 orders of magnitude higher compared to heifers and dairy cows, possibly due to the presence of antibiotic residues in milk fed to calves. The occurrence and abundance of TC-r genes in fresh excrements of heifers and adult cows remained unaffected by intrauterine CTC applications, with tet(O, tet(Q and tet(W representing a ‘core TC-resistome’ of the farm, and tet(A, tet(M, tet(Y and tet(X occurring occasionally. The genes tet(A, tet(M, tet(Y and tet(X were shown to be respectively harbored by Shigella, Lactobacillus and Clostridium, Acinetobacter, and Wautersiella. Soil in the farm proximity, as well as field soil to which manure from the farm was applied, was contaminated with TC-r genes occurring in the farm, and some of the TC-r genes persisted in the field over 3 months following the manure application. Concluding, our study shows that antibiotic resistance genes may be a stable part of the intestinal metagenome of cattle even if antibiotics are not used for growth stimulation, and that smaller dairy farms may also contribute to environmental pollution with antibiotic resistance genes.
Natural variation of rice blast resistance gene Pi-d2
Studying natural variation of rice resistance (R) genes in cultivated and wild rice relatives can predict resistance stability to rice blast fungus. In the present study, the protein coding regions of rice R gene Pi-d2 in 35 rice accessions of subgroups, aus (AUS), indica (IND), temperate japonica (...
Czech Academy of Sciences Publication Activity Database
Kyselková, Martina; Kotrbová, Lucie; Bhumibhamon, G.; Chroňáková, Alica; Jirout, Jiří; Vrchotová, Naděžda; Schmitt, H.; Elhottová, Dana
2015-01-01
Roč. 81, February (2015), s. 259-265 ISSN 0038-0717 R&D Projects: GA ČR GAP504/10/2077; GA MŠk(CZ) EE2.3.30.0032; GA MŠk(CZ) ED1.1.00/02.0073 Institutional support: RVO:60077344 ; RVO:67179843 Keywords : antibiotic resistance * cattle feces * chlortetracycline * grassland soil * tetracycline resistance genes * intI1 gene Subject RIV: EE - Microbiology, Virology; CE - Biochemistry (UEK-B) Impact factor: 4.152, year: 2015
Energy Technology Data Exchange (ETDEWEB)
Chen, Liang [Neurosurgery Institute, Key Laboratory on Brain Function Repair and Regeneration of Guangdong, Zhujiang Hospital of Southern Medical University, Guangzhou 510282 (China); Department of Otolaryngology, Guangzhou General Hospital of PLA Guangzhou Command, Guangzhou 510010 (China); Tang, Yanping [Neurosurgery Institute, Key Laboratory on Brain Function Repair and Regeneration of Guangdong, Zhujiang Hospital of Southern Medical University, Guangzhou 510282 (China); Wang, Jian [Department of Otolaryngology, Guangzhou General Hospital of PLA Guangzhou Command, Guangzhou 510010 (China); Yan, Zhongjie [Affiliated Bayi Brain Hospital, The Military General Hospital of Beijing PLA,The Bayi Clinical Medical Institute of Southern Medical University, Beijing 100700 (China); Xu, Ruxiang, E-mail: RuxiangXu@yahoo.com [Affiliated Bayi Brain Hospital, The Military General Hospital of Beijing PLA,The Bayi Clinical Medical Institute of Southern Medical University, Beijing 100700 (China)
2013-06-14
Highlights: •miR-421 is upregulated in nasopharyngeal carcinoma. •miR-421 induces cell proliferation and apoptosis resistance. •FOXO4 is a direct and functional target of miR-421. -- Abstract: microRNAs have been demonstrated to play important roles in cancer development and progression. Hence, identifying functional microRNAs and better understanding of the underlying molecular mechanisms would provide new clues for the development of targeted cancer therapies. Herein, we reported that a microRNA, miR-421 played an oncogenic role in nasopharyngeal carcinoma. Upregulation of miR-421 induced, whereas inhibition of miR-421 repressed cell proliferation and apoptosis resistance. Furthermore, we found that upregulation of miR-421 inhibited forkhead box protein O4 (FOXO4) signaling pathway following downregulation of p21, p27, Bim and FASL expression by directly targeting FOXO4 3′UTR. Additionally, we demonstrated that FOXO4 expression is critical for miR-421-induced cell growth and apoptosis resistance. Taken together, our findings not only suggest that miR-421 promotes nasopharyngeal carcinoma cell proliferation and anti-apoptosis, but also uncover a novel regulatory mechanism for inactivation of FOXO4 in nasopharyngeal carcinoma.
Rôças, Isabela N; Siqueira, José F
2012-12-01
Fourty-one bacterial strains isolated from infected dental root canals and identified by 16S rRNA gene sequence were screened for the presence of 14 genes encoding resistance to beta-lactams, tetracycline and macrolides. Thirteen isolates (32%) were positive for at least one of the target antibiotic resistance genes. These strains carrying at least one antibiotic resistance gene belonged to 11 of the 26 (42%) infected root canals sampled. Two of these positive cases had two strains carrying resistance genes. Six out of 7 Fusobacterium strains harbored at least one of the target resistance genes. One Dialister invisus strain was positive for 3 resistance genes, and 4 other strains carried two of the target genes. Of the 6 antibiotic resistance genes detected in root canal strains, the most prevalent were blaTEM (17% of the strains), tetW (10%), and ermC (10%). Some as-yet-uncharacterized Fusobacterium and Prevotella isolates were positive for blaTEM, cfxA and tetM. Findings demonstrated that an unexpectedly large proportion of dental root canal isolates, including as-yet-uncharacterized strains previously regarded as uncultivated phylotypes, can carry antibiotic resistance genes. Copyright © 2012 Elsevier Ltd. All rights reserved.
Expressed sequence enrichment for candidate gene analysis of citrus tristeza virus resistance.
Bernet, G P; Bretó, M P; Asins, M J
2004-02-01
Several studies have reported markers linked to a putative resistance gene from Poncirus trifoliata ( Ctv-R) located at linkage group 4 that confers resistance against one of the most important citrus pathogens, citrus tristeza virus (CTV). To be successful in both marker-assisted selection and transformation experiments, its accurate mapping is needed. Several factors may affect its localization, among them two are considered here: the definition of resistance and the genetic background of progeny. Two progenies derived from P. trifoliata, by self-pollination and by crossing with sour orange ( Citrus aurantium), a citrus rootstock well-adapted to arid and semi-arid areas, were used for linkage group-4 marker enrichment. Two new methodologies were used to enrich this region with expressed sequences. The enrichment of group 4 resulted in the fusion of several C. aurantium linkage groups. The new one A(7+3+4) is now saturated with 48 markers including expressed sequences. Surprisingly, sour orange was as resistant to the CTV isolate tested as was P. trifoliata, and three hybrids that carry Ctv-R, as deduced from its flanking markers, are susceptible to CTV. The new linkage maps were used to map Ctv-R under the hypothesis of monogenic inheritance. Its position on linkage group 4 of P. trifoliata differs from the location previously reported in other progenies. The genetic analysis of virus-plant interaction in the family derived from C. aurantium after a CTV chronic infection showed the segregation of five types of interaction, which is not compatible with the hypothesis of a single gene controlling resistance. Two major issues are discussed: another type of genetic analysis of CTV resistance is needed to avoid the assumption of monogenic inheritance, and transferring Ctv-R from P. trifoliata to sour orange might not avoid the CTV decline of sweet orange trees.
A maize resistance gene functions against bacterial streak disease in rice
Zhao, Bingyu; Lin, Xinghua; Poland, Jesse; Trick, Harold; Leach, Jan; Hulbert, Scot
2005-01-01
Although cereal crops all belong to the grass family (Poacea), most of their diseases are specific to a particular species. Thus, a given cereal species is typically resistant to diseases of other grasses, and this nonhost resistance is generally stable. To determine the feasibility of transferring nonhost resistance genes (R genes) between distantly related grasses to control specific diseases, we identified a maize R gene that recognizes a rice pathogen, Xanthomonas oryzae pv. oryzicola, wh...
ACTN3 R577X POLYMORPHISM AND NEUROMUSCULAR RESPONSE TO RESISTANCE TRAINING
Directory of Open Access Journals (Sweden)
Paulo Gentil
2011-06-01
Full Text Available The R577X polymorphism at the ACTN3 gene has been associated with muscle strength, hypertrophy and athletic status. The X allele, which is associated with the absence of ACTN3 protein is supposed to impair performance of high force/velocity muscle contractions. The purpose of the present study was to investigate the association of the R577X polymorphism with the muscle response to resistance training in young men. One hundred forty one men performed two resistance training sessions per week for 11 weeks. Participants were tested for 1RM bench press, knee extensors peak torque, and knee extensors muscle thickness at baseline and after the training period. Genotyping was conducted using de DdeI restriction enzyme. Genotype distribution was 34.4% for RR, 47% for RX and 18.6% for the XX genotype. According to the results, the R577X polymorphism at the ACTN3 gene is not associated with baseline muscle strength or with the muscle strength response to resistance training. However, only carriers of the R allele showed increases in muscle thickness in response to training
Lee, Sae-Mi; Huh, Hee Jae; Song, Dong Joon; Shim, Hyang Jin; Park, Kyung Sun; Kang, Cheol-In; Ki, Chang-Seok; Lee, Nam Yong
2017-12-01
To investigate linezolid-resistance mechanisms in linezolid-nonsusceptible enterococci (LNSE) isolated from a tertiary hospital in Korea. Enterococcal isolates exhibiting linezolid MICs ≥4 mg l -1 that were isolated between December 2011 and May 2016 were investigated by PCR and sequencing for mutations in 23S rRNA or ribosomal proteins (L3, L4 and L22) and for the presence of cfr, cfr(B) and optrA genes.Results/Key findings. Among 135 LNSE (87 Enterococcus faecium and 48 Enterococcus faecalis isolates), 39.1 % (34/87) of E. faecium and 18.8 % (9/48) of E. faecalis isolates were linezolid-resistant. The optrA carriage was the dominant mechanism in E. faecalis: 13 isolates, including 10 E. faecalis [70 % (7/10) linezolid-resistant and 30 % (3/10) linezolid-intermediate] and three E. faecium [33.3 % (1/3) linezolid-resistant and 66.7 % (2/3) linezolid-intermediate], contained the optrA gene. G2576T mutations in the 23S rRNA gene were detected only in E. faecium [14 isolates; 71.4 % (10/14) linezolid-resistant and 28.6 % (4/14) linezolid-intermediate]. One linezolid-intermediate E. faecium harboured a L22 protein alteration (Ser77Thr). No isolates contained cfr or cfr(B) genes and any L3 or L4 protein alterations. No genetic mechanism of resistance was identified for 67.6 % (23/34) of linezolid-resistant E. faecium. A low rate of 23S rRNA mutations and the absence of known linezolid-resistance mechanisms in the majority of E. faecium isolates suggest regional differences in the mechanisms of linezolid resistance and the possibility of additional mechanisms.
Directory of Open Access Journals (Sweden)
Lin Li
2015-12-01
Full Text Available The aim of this study was to characterise the prevalence of class 1 integrons and gene cassettes, tetracycline-resistance genes, phenicol-resistance genes, 16S rRNA methylase genes, extended-spectrum β-lactamase genes and plasmid-mediated fluoroquinolone resistance determinants in 184 Escherichia coli isolates from chickens in Anhui Province, China. Susceptibility to 15 antimicrobials was determined using broth micro-dilution. Polymerase chain reaction and DNA sequencing were used to characterise the molecular basis of the antibiotic resistance. High rates of antimicrobial resistance were observed; 131 out of the 184 (72.3% isolates were resistant to at least six antimicrobial agents. The prevalences of class 1 integrons, tetracycline-resistance genes, phenicol-resistance genes, 16S rRNA methylase genes, extended-spectrum β-lactamase genes and plasmid-mediated fluoroquinolone resistance determinants were 49.5, 17.4, 15.8, 0.5, 57.6 and 46.2%, respectively. In 82 isolates, 48 different kinds of coexistence of the different genes were identified. Statistical (χ2 analysis showed that the resistance to amoxicillin, doxycycline, florfenicol, ofloxacin and gentamicin had significant differences (P<0.01 or 0.01
resistance genes, which showed a certain correlation between antimicrobial resistance and the presence of resistance genes.
Molecular study on some antibiotic resistant genes in Salmonella spp. isolates
Nabi, Ari Q.
2017-09-01
Studying the genes related with antimicrobial resistance in Salmonella spp. is a crucial step toward a correct and faster treatment of infections caused by the pathogen. In this work Integron mediated antibiotic resistant gene IntI1 (Class I Integrase IntI1) and some plasmid mediated antibiotic resistance genes (Qnr) were scanned among the isolated non-Typhoid Salmonellae strains with known resistance to some important antimicrobial drugs using Sybr Green real time PCR. The aim of the study was to correlate the multiple antibiotics and antimicrobial resistance of Salmonella spp. with the presence of integrase (IntI1) gene and plasmid mediated quinolone resistant genes. Results revealed the presence of Class I Integrase gene in 76% of the isolates with confirmed multiple antibiotic resistances. Moreover, about 32% of the multiple antibiotic resistant serotypes showed a positive R-PCR for plasmid mediated qnrA gene encoding for nalidixic acid and ciprofloxacin resistance. No positive results could be revealed form R-PCRs targeting qnrB or qnrS. In light of these results we can conclude that the presence of at least one of the qnr genes and/or the presence of Integrase Class I gene were responsible for the multiple antibiotic resistance to for nalidixic acid and ciprofloxacin from the studied Salmonella spp. and further studies required to identify the genes related with multiple antibiotic resistance of the pathogen.
DEFF Research Database (Denmark)
Hasselbalch, Ann L; Angquist, Lars; Christiansen, Lene
2010-01-01
We investigated the role of the fat mass and obesity associated gene (FTO) and variants near the melanocortin-4 receptor gene (MC4R) in modulating habitual intake of total energy and macronutrients, glycemic index, glycemic load, dietary energy density, and energy from 20 food groups in adults...... with intake of energy from whole grains (P >or= 0.04). These associations did not remain significant after controlling for multiple testing. The outcome of this study indicates that polymorphisms in the FTO gene and near the MC4R gene do not have a role in regulating food intake and preference for specific....... In a population-based sample of 756 healthy adult twin pairs, we studied associations between FTO rs9939609, near-MC4R rs12970134, rs17700633, and rs17782313 single nucleotide polymorphisms (SNP) and habitual dietary intake. Habitual dietary intake was assessed by a 247-question FFQ. Nontransformed variables...
Singh, Sangeeta; Chand, Suresh; Singh, N. K.; Sharma, Tilak Raj
2015-01-01
The resistance (R) genes and defense response (DR) genes have become very important resources for the development of disease resistant cultivars. In the present investigation, genome-wide identification, expression, phylogenetic and synteny analysis was done for R and DR-genes across three species of rice viz: Oryza sativa ssp indica cv 93-11, Oryza sativa ssp japonica and wild rice species, Oryza brachyantha. We used the in silico approach to identify and map 786 R -genes and 167 DR-genes, 672 R-genes and 142 DR-genes, 251 R-genes and 86 DR-genes in the japonica, indica and O. brachyanth a genomes, respectively. Our analysis showed that 60.5% and 55.6% of the R-genes are tandemly repeated within clusters and distributed over all the rice chromosomes in indica and japonica genomes, respectively. The phylogenetic analysis along with motif distribution shows high degree of conservation of R- and DR-genes in clusters. In silico expression analysis of R-genes and DR-genes showed more than 85% were expressed genes showing corresponding EST matches in the databases. This study gave special emphasis on mechanisms of gene evolution and duplication for R and DR genes across species. Analysis of paralogs across rice species indicated 17% and 4.38% R-genes, 29% and 11.63% DR-genes duplication in indica and Oryza brachyantha, as compared to 20% and 26% duplication of R-genes and DR-genes in japonica respectively. We found that during the course of duplication only 9.5% of R- and DR-genes changed their function and rest of the genes have maintained their identity. Syntenic relationship across three genomes inferred that more orthology is shared between indica and japonica genomes as compared to brachyantha genome. Genome wide identification of R-genes and DR-genes in the rice genome will help in allele mining and functional validation of these genes, and to understand molecular mechanism of disease resistance and their evolution in rice and related species. PMID:25902056
Resistance genes in barley (Hordeum vulgare L.) and their identification with molecular markers.
Chełkowski, Jerzy; Tyrka, Mirosław; Sobkiewicz, Andrzej
2003-01-01
Current information on barley resistance genes available from scientific papers and on-line databases is summarised. The recent literature contains information on 107 major resistance genes (R genes) against fungal pathogens (excluding powdery mildew), pathogenic viruses and aphids identified in Hordeum vulgare accessions. The highest number of resistance genes was identified against Puccinia hordei, Rhynchosporium secalis, and the viruses BaYMV and BaMMV, with 17, 14 and 13 genes respectively. There is still a lot of confusion regarding symbols for R genes against powdery mildew. Among the 23 loci described to date, two regions Mla and Mlo comprise approximately 31 and 25 alleles. Over 50 R genes have already been localised and over 30 mapped on 7 barley chromosomes. Four barley R genes have been cloned recently: Mlo, Rpg1, Mla1 and Mla6, and their structures (sequences) are available. The paper presents a catalogue of barley resistance gene symbols, their chromosomalocation and the list of available DNA markers useful in characterising cultivars and breeding accessions.
Isolation of NBS-LRR class resistant gene (I2 gene) from tomato ...
African Journals Online (AJOL)
aghomotsegin
2013-10-16
Oct 16, 2013 ... type of F. oxysporum f. sp. lycopersici observed commonly which require presence of I1 gene in tomato plant for the incompatibility ... Key words: Fusarium wilt, race, R-gene, resistance, tomato. ... MATERIALS AND METHODS.
Putative resistance genes in the CitEST database
Directory of Open Access Journals (Sweden)
Simone Guidetti-Gonzalez
2007-01-01
Full Text Available Disease resistance in plants is usually associated with the activation of a wide variety of defense responses to prevent pathogen replication and/or movement. The ability of the host plant to recognize the pathogen and to activate defense responses is regulated by direct or indirect interaction between the products of plant resistance (R and pathogen avirulence (Avr genes. Attempted infection of plants by avirulent pathogens elicits a battery of defenses often followed by the collapse of the challenged host cells. Localized host cell death may help to prevent the pathogen from spreading to uninfected tissues, known as hypersensitive response (HR. When either the plant or the pathogen lacks its cognate gene, activation of the plant’s defense responses fails to occur or is delayed and does not prevent pathogen colonization. In the CitEST database, we identified 1,300 reads related to R genes in Citrus which have been reported in other plant species. These reads were translated in silico, and alignments of their amino acid sequences revealed the presence of characteristic domains and motifs that are specific to R gene classes. The description of the reads identified suggests that they function as resistance genes in citrus.
High chlorpyrifos resistance in Culex pipiens mosquitoes: strong synergy between resistance genes
Alout, H; Labbé, P; Berthomieu, A; Makoundou, P; Fort, P; Pasteur, N; Weill, M
2016-01-01
We investigated the genetic determinism of high chlorpyrifos resistance (HCR), a phenotype first described in 1999 in Culex pipiens mosquitoes surviving chlorpyrifos doses ⩾1 mg l−1 and more recently found in field samples from Tunisia, Israel or Indian Ocean islands. Through chlorpyrifos selection, we selected several HCR strains that displayed over 10 000-fold resistance. All strains were homozygous for resistant alleles at two main loci: the ace-1 gene, with the resistant ace-1R allele expressing the insensitive G119S acetylcholinesterase, and a resistant allele of an unknown gene (named T) linked to the sex and ace-2 genes. We constructed a strain carrying only the T-resistant allele and studied its resistance characteristics. By crossing this strain with strains harboring different alleles at the ace-1 locus, we showed that the resistant ace-1R and the T alleles act in strong synergy, as they elicited a resistance 100 times higher than expected from a simple multiplicative effect. This effect was specific to chlorpyrifos and parathion and was not affected by synergists. We also examined how HCR was expressed in strains carrying other ace-1-resistant alleles, such as ace-1V or the duplicated ace-1D allele, currently spreading worldwide. We identified two major parameters that influenced the level of resistance: the number and the nature of the ace-1-resistant alleles and the number of T alleles. Our data fit a model that predicts that the T allele acts by decreasing chlorpyrifos concentration in the compartment targeted in insects. PMID:26463842
Pallipparambil, Godshen R; Sayler, Ronald J; Shapiro, Jeffrey P; Thomas, Jean M G; Kring, Timothy J; Goggin, Fiona L
2015-02-01
Mi-1.2 is a single dominant gene in tomato that confers race-specific resistance against certain phloem-feeding herbivores including aphids, whiteflies, psyllids, and root-knot nematodes. Few prior studies have considered the potential non-target effects of race-specific resistance genes (R genes), and this paper evaluates the compatibility of Mi-mediated resistance in tomato with a beneficial zoophytophagous predator, Orius insidiosus (Say). In addition to preying on aphids and other pests, this piercing-sucking insect also feeds from the xylem, epidermis, and/or mesophyll, and oviposits within plant tissues. Comparison of O. insidiosus confined to isogenic tomato plants with and without Mi-1.2 revealed that immatures of O. insidiosus had lower survival on resistant plants even when the immatures were provisioned with prey that did not feed on the host plant. Molecular gut content analysis confirmed that adults and immatures of O. insidiosus feed on both resistant (Mi-1.2+) and susceptible (Mi-1.2-) genotypes, and bioassays suggest that resistance does not affect oviposition rates, plant sampling, or prey acceptance by O. insidiosus adults. These results demonstrate a direct negative impact of R-gene-mediated host plant resistance on a non-target beneficial species, and reveal that Mi-mediated resistance can impact organisms that do not feed on phloem sap. Through laser capture microdissection and RT-PCR, Mi-1.2 transcripts were detected in the epidermis and mesophyll as well as the phloem of tomato plants, consistent with our observations that Mi-mediated resistance is active outside the phloem. These results suggest that the mode of action and potential ecological impacts of Mi-mediated resistance are broader than previously assumed. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology.
Directory of Open Access Journals (Sweden)
Philipp Dalkmann
Full Text Available Irrigation with wastewater releases pharmaceuticals, pathogenic bacteria, and resistance genes, but little is known about the accumulation of these contaminants in the environment when wastewater is applied for decades. We sampled a chronosequence of soils that were variously irrigated with wastewater from zero up to 100 years in the Mezquital Valley, Mexico, and investigated the accumulation of ciprofloxacin, enrofloxacin, sulfamethoxazole, trimethoprim, clarithromycin, carbamazepine, bezafibrate, naproxen, diclofenac, as well as the occurrence of Enterococcus spp., and sul and qnr resistance genes. Total concentrations of ciprofloxacin, sulfamethoxazole, and carbamazepine increased with irrigation duration reaching 95% of their upper limit of 1.4 µg/kg (ciprofloxacin, 4.3 µg/kg (sulfamethoxazole, and 5.4 µg/kg (carbamazepine in soils irrigated for 19-28 years. Accumulation was soil-type-specific, with largest accumulation rates in Leptosols and no time-trend in Vertisols. Acidic pharmaceuticals (diclofenac, naproxen, bezafibrate were not retained and thus did not accumulate in soils. We did not detect qnrA genes, but qnrS and qnrB genes were found in two of the irrigated soils. Relative concentrations of sul1 genes in irrigated soils were two orders of magnitude larger (3.15 × 10(-3 ± 0.22 × 10(-3 copies/16S rDNA than in non-irrigated soils (4.35 × 10(-5± 1.00 × 10(-5 copies/16S rDNA, while those of sul2 exceeded the ones in non-irrigated soils still by a factor of 22 (6.61 × 10(-4 ± 0.59 × 10(-4 versus 2.99 × 10(-5 ± 0.26 × 10(-5 copies/16S rDNA. Absolute numbers of sul genes continued to increase with prolonging irrigation together with Enterococcus spp. 23S rDNA and total 16S rDNA contents. Increasing total concentrations of antibiotics in soil are not accompanied by increasing relative abundances of resistance genes. Nevertheless, wastewater irrigation enlarges the absolute concentration of resistance genes in soils due to a
Luo, Hong-Yan; Liu, Ma-Feng; Wang, Ming-Shu; Zhao, Xin-Xin; Jia, Ren-Yong; Chen, Shun; Sun, Kun-Feng; Yang, Qiao; Wu, Ying; Chen, Xiao-Yue; Biville, Francis; Zou, Yuan-Feng; Jing, Bo; Cheng, An-Chun; Zhu, De-Kang
2018-01-01
The Gram-negative bacterium Riemerella anatipestifer CH-2 is resistant to lincosamides, having a lincomycin (LCM) minimum inhibitory concentration (MIC) of 128 µg/mL. The G148_1775 gene of R. anatipestifer CH-2, designated lnu(H), encodes a 260-amino acid protein with ≤41% identity to other reported lincosamide nucleotidylyltransferases. Escherichia coli Rosetta TM (DE3) containing the pBAD24-lnu(H) plasmid showed four- and two-fold increases in the MICs of LCM and clindamycin (CLI), respectively. A kinetic assay of the purified Lnu(H) enzyme for LCM and CLI showed that the protein could inactive lincosamides. Mass spectrometry analysis demonstrated that the Lnu(H) enzyme catalysed adenylylation of lincosamides. In addition, an lnu(H) gene deletion strain exhibited 512- and 32-fold decreases in LCM and CLI MICs, respectively. The wild-type level of lincosamide resistance could be restored by complementation with a shuttle plasmid carrying the lnu(H) gene. The transformant R. anatipestifer ATCC 11845 [lnu(H)] acquired by natural transformation also exhibited high-level lincosamide resistance. Moreover, among 175 R. anatipestifer field isolates, 56 (32.0%) were positive for the lnu(H) gene by PCR. In conclusion, Lnu(H) is a novel lincosamide nucleotidylyltransferase that inactivates LCM and CLI by nucleotidylylation, thus conferring high-level lincosamide resistance to R. anatipestifer CH-2. Copyright © 2017. Published by Elsevier B.V.
Directory of Open Access Journals (Sweden)
Shatha Hussain Ali
2017-01-01
Full Text Available Background. The polymorphism R229Q is one of the most commonly reported podocin sequence variations among steroid-resistant nephrotic syndromes (SRNS. Aim of the Study. We investigated the frequency and risk of this polymorphism among a group of Iraqi children with SRNS and steroid-sensitive nephrotic syndrome (SSNS. Patients and Methods. A prospective case control study which was conducted in Al-Imamein Al-Kadhimein Medical City, spanning the period from the 1st of April 2015 to 30th of November 2015. Study sample consisted of 54 children having NS, divided into 2 groups: patients group consisted of 27 children with SRNS, and control group involved 27 children with SSNS. Both were screened by real time polymerase chain reaction for R229Q in exon 5 of NPHS2 gene. Results. Molecular study showed R229Q polymorphism in 96.3% of SRNS and 100% of SSNS. There were no phenotypic or histologic characteristics of patients bearing homozygous R229Q polymorphism and the patients with heterozygous R229Q polymorphism. Conclusion. Polymorphism R229Q of NPHS2 gene is prevalent in Iraqi children with SRNS and SSNS. Further study needs to be done, for other exons and polymorphism of NPHS2 gene in those patients.
Wobst, Ivonne; Ebert, Lisa; Birod, Kerstin; Wegner, Marthe-Susanna; Hoffmann, Marika; Thomas, Dominique; Angioni, Carlo; Parnham, Michael J; Steinhilber, Dieter; Tegeder, Irmgard; Geisslinger, Gerd; Grösch, Sabine
2016-12-30
R -flurbiprofen is the non-COX-inhibiting enantiomer of flurbiprofen and is not converted to S -flurbiprofen in human cells. Nevertheless, it reduces extracellular prostaglandin E₂ (PGE₂) in cancer or immune cell cultures and human extracellular fluid. Here, we show that R -flurbiprofen acts through a dual mechanism: (i) it inhibits the translocation of cPLA 2α to the plasma membrane and thereby curtails the availability of arachidonic acid and (ii) R -flurbiprofen traps PGE₂ inside of the cells by inhibiting multidrug resistance-associated protein 4 (MRP4, ABCC4), which acts as an outward transporter for prostaglandins. Consequently, the effects of R -flurbiprofen were mimicked by RNAi-mediated knockdown of MRP4. Our data show a novel mechanism by which R -flurbiprofen reduces extracellular PGs at physiological concentrations, particularly in cancers with high levels of MRP4, but the mechanism may also contribute to its anti-inflammatory and immune-modulating properties and suggests that it reduces PGs in a site- and context-dependent manner.
SolRgene: an online database to explore disease resistance genes in tuber-bearing Solanum species
Directory of Open Access Journals (Sweden)
Vleeshouwers Vivianne GAA
2011-08-01
Full Text Available Abstract Background The cultivated potato (Solanum tuberosum L. is an important food crop, but highly susceptible to many pathogens. The major threat to potato production is the Irish famine pathogen Phytophthora infestans, which causes the devastating late blight disease. Potato breeding makes use of germplasm from wild relatives (wild germplasm to introduce resistances into cultivated potato. The Solanum section Petota comprises tuber-bearing species that are potential donors of new disease resistance genes. The aim of this study was to explore Solanum section Petota for resistance genes and generate a widely accessible resource that is useful for studying and implementing disease resistance in potato. Description The SolRgene database contains data on resistance to P. infestans and presence of R genes and R gene homologues in Solanum section Petota. We have explored Solanum section Petota for resistance to late blight in high throughput disease tests under various laboratory conditions and in field trials. From resistant wild germplasm, segregating populations were generated and assessed for the presence of resistance genes. All these data have been entered into the SolRgene database. To facilitate genetic and resistance gene evolution studies, phylogenetic data of the entire SolRgene collection are included, as well as a tool for generating phylogenetic trees of selected groups of germplasm. Data from resistance gene allele-mining studies are incorporated, which enables detection of R gene homologs in related germplasm. Using these resources, various resistance genes have been detected and some of these have been cloned, whereas others are in the cloning pipeline. All this information is stored in the online SolRgene database, which allows users to query resistance data, sequences, passport data of the accessions, and phylogenic classifications. Conclusion Solanum section Petota forms the basis of the SolRgene database, which contains a
Molecular mapping of a sunflower rust resistance gene from HAR6.
Bulos, Mariano; Ramos, María L; Altieri, Emiliano; Sala, Carlos A
2013-03-01
Sunflower rust, caused by Puccinia helianthi Schw., can result in significant yield losses in cultivated sunflower (Helianthus annuus L. var. macrocarpus Ckll.). HAR6 is a germplasm population resistant to most predominant rust races. The objectives of this study were to map the resistance factor present in HAR6 (R HAR6 ), and to provide and validate molecular tools for the identification of this gene for marker assisted selection purposes. Virulence reaction of seedlings for the F2 population and F2:3 families suggested that a single dominant gene confers rust resistance in HAR6-1, a selected rust resistance line from the original population. Genetic mapping with eight markers covered 97.4 cM of genetic distance on linkage group 13 of the sunflower consensus map. A co-dominant marker ZVG61 is the closest marker distal to R HAR6 at a genetic distance of 0.7 cM, while ORS581, a dominant marker linked in the coupling phase, is proximal to R HAR6 at a genetic distance of 1.5 cM. Validation of these markers was assessed by converting a susceptible line into a rust resistant isoline by means of marker assisted backcrossing. The application of these results to assist the breeding process and to design new strategies for rust control in sunflower is discussed.
Yang, Haiyuan; Ren, Xiang; Weng, Qingmei; Zhu, Lili; He, Guangcun
2002-01-01
The brown planthopper (BPH), Nilaparvata lugens Stål, is a serious insect pest of rice (Oryza saliva L.). We have determined the chromosomal location of a BPH resistance gene in rice using SSR and RFLP techniques. A rice line 'B14', derived from the wild rice Oryza latifolia, showed high resistance to BPH. For tagging the resistance gene in 'B14X', an F2 population and a recombinant inbred (RI) population from a cross between Taichung Native 1 and 'B14' were developed and evaluated for BPH resistance. The results showed that a single dominant gene controlled the resistance of 'B14' to BPH. Bulked segregant SSR analysis was employed for identification of DNA markers linked to the resistance gene. From the survey of 302 SSR primer pairs, three SSR (RM335, RM261, RM185) markers linked to the resistance gene were identified. The closest SSR marker RM261 was linked to the resistance gene at a distance of 1.8 cM. Regions surrounding the resistance gene and the SSR markers were examined with additional RFLP markers on chromosome 4 to define the location of the resistance gene. Linkage of RFLP markers C820, R288, C946 with the resistance gene further confirmed its location on the short arm of chromosome 4. Closely linked DNA markers will facilitate selection for resistant lines in breeding programs and provide the basis for map-based cloning of this resistance gene.
Directory of Open Access Journals (Sweden)
Souza Manoel T
2008-01-01
Full Text Available Abstract Background Many commercial banana varieties lack sources of resistance to pests and diseases, as a consequence of sterility and narrow genetic background. Fertile wild relatives, by contrast, possess greater variability and represent potential sources of disease resistance genes (R-genes. The largest known family of plant R-genes encode proteins with nucleotide-binding site (NBS and C-terminal leucine-rich repeat (LRR domains. Conserved motifs in such genes in diverse plant species offer a means for isolation of candidate genes in banana which may be involved in plant defence. Results A computational strategy was developed for unbiased conserved motif discovery in NBS and LRR domains in R-genes and homologues in monocotyledonous plant species. Degenerate PCR primers targeting conserved motifs were tested on the wild cultivar Musa acuminata subsp. burmannicoides, var. Calcutta 4, which is resistant to a number of fungal pathogens and nematodes. One hundred and seventy four resistance gene analogs (RGAs were amplified and assembled into 52 contiguous sequences. Motifs present were typical of the non-TIR NBS-LRR RGA subfamily. A phylogenetic analysis of deduced amino-acid sequences for 33 RGAs with contiguous open reading frames (ORFs, together with RGAs from Arabidopsis thaliana and Oryza sativa, grouped most Musa RGAs within monocotyledon-specific clades. RFLP-RGA markers were developed, with 12 displaying distinct polymorphisms in parentals and F1 progeny of a diploid M. acuminata mapping population. Eighty eight BAC clones were identified in M. acuminata Calcutta 4, M. acuminata Grande Naine, and M. balbisiana Pisang Klutuk Wulung BAC libraries when hybridized to two RGA probes. Multiple copy RGAs were common within BAC clones, potentially representing variation reservoirs for evolution of new R-gene specificities. Conclusion This is the first large scale analysis of NBS-LRR RGAs in M. acuminata Calcutta 4. Contig sequences were
Rosli, Rozana; Amiruddin, Nadzirah; Ab Halim, Mohd Amin; Chan, Pek-Lan; Chan, Kuang-Lim; Azizi, Norazah; Morris, Priscilla E.; Leslie Low, Eng-Ti; Ong-Abdullah, Meilina; Sambanthamurthi, Ravigadevi; Singh, Rajinder
2018-01-01
Comparative genomics and transcriptomic analyses were performed on two agronomically important groups of genes from oil palm versus other major crop species and the model organism, Arabidopsis thaliana. The first analysis was of two gene families with key roles in regulation of oil quality and in particular the accumulation of oleic acid, namely stearoyl ACP desaturases (SAD) and acyl-acyl carrier protein (ACP) thioesterases (FAT). In both cases, these were found to be large gene families with complex expression profiles across a wide range of tissue types and developmental stages. The detailed classification of the oil palm SAD and FAT genes has enabled the updating of the latest version of the oil palm gene model. The second analysis focused on disease resistance (R) genes in order to elucidate possible candidates for breeding of pathogen tolerance/resistance. Ortholog analysis showed that 141 out of the 210 putative oil palm R genes had homologs in banana and rice. These genes formed 37 clusters with 634 orthologous genes. Classification of the 141 oil palm R genes showed that the genes belong to the Kinase (7), CNL (95), MLO-like (8), RLK (3) and Others (28) categories. The CNL R genes formed eight clusters. Expression data for selected R genes also identified potential candidates for breeding of disease resistance traits. Furthermore, these findings can provide information about the species evolution as well as the identification of agronomically important genes in oil palm and other major crops. PMID:29672525
Rosli, Rozana; Amiruddin, Nadzirah; Ab Halim, Mohd Amin; Chan, Pek-Lan; Chan, Kuang-Lim; Azizi, Norazah; Morris, Priscilla E; Leslie Low, Eng-Ti; Ong-Abdullah, Meilina; Sambanthamurthi, Ravigadevi; Singh, Rajinder; Murphy, Denis J
2018-01-01
Comparative genomics and transcriptomic analyses were performed on two agronomically important groups of genes from oil palm versus other major crop species and the model organism, Arabidopsis thaliana. The first analysis was of two gene families with key roles in regulation of oil quality and in particular the accumulation of oleic acid, namely stearoyl ACP desaturases (SAD) and acyl-acyl carrier protein (ACP) thioesterases (FAT). In both cases, these were found to be large gene families with complex expression profiles across a wide range of tissue types and developmental stages. The detailed classification of the oil palm SAD and FAT genes has enabled the updating of the latest version of the oil palm gene model. The second analysis focused on disease resistance (R) genes in order to elucidate possible candidates for breeding of pathogen tolerance/resistance. Ortholog analysis showed that 141 out of the 210 putative oil palm R genes had homologs in banana and rice. These genes formed 37 clusters with 634 orthologous genes. Classification of the 141 oil palm R genes showed that the genes belong to the Kinase (7), CNL (95), MLO-like (8), RLK (3) and Others (28) categories. The CNL R genes formed eight clusters. Expression data for selected R genes also identified potential candidates for breeding of disease resistance traits. Furthermore, these findings can provide information about the species evolution as well as the identification of agronomically important genes in oil palm and other major crops.
Gene Expression Analysis of Four Radiation-resistant Bacteria
Gao, Na; Ma, Bin-Guang; Zhang, Yu-Sheng; Song, Qin; Chen, Ling-Ling; Zhang, Hong-Yu
2009-01-01
To investigate the general radiation-resistant mechanisms of bacteria, bioinformatic method was employed to predict highly expressed genes for four radiation-resistant bacteria, i.e. Deinococcus geothermalis (D. geo), Deinococcus radiodurans (D. rad), Kineococcus radiotolerans (K. rad) and Rubrobacter xylanophilus (R. xyl). It is revealed that most of the three reference gene sets, i.e. ribosomal proteins, transcription factors and major chaperones, are generally highly expressed in the four ...
Naito, Y; Naito, T; Kobayashi, I
1998-01-01
Previous work from this laboratory demonstrated that plasmids carrying a type II restriction-modification gene complex are not easily lost from their bacterial host because plasmid-free segregant cells are killed through chromosome cleavage. Here, we have followed the course of events that takes place when an Escherichia coli rec BC sbcA strain carrying a plasmid coding for the PaeR7I restriction-modification (R/M) gene complex is transformed by a plasmid with an identical origin of replication. The number of transformants that appeared was far fewer than with the restriction-minus (r-) control. Most of the transformants were very small. After prolonged incubation, the number and the size of the colonies increased, but this increase never attained the level of the r- control. Most of the transformed colonies retained the drug-resistance of the resident, r+ m+ plasmid. These results indicate that post-segregational host killing occurs when a plasmid bearing an R/M gene complex is displaced by an incompatible plasmid. Such cell killing eliminates the competitor plasmid along with the host and, thus, would allow persistence of the R/M plasmid in the neighboring, clonal host cells in nature. This phenomenon is reminiscent of mammalian apoptosis and other forms of altruistic cell death strategy against infection. This type of resistance to displacement was also studied in a wild type Escherichia coli strain that was normal for homologous recombination (rec+). A number of differences between the recBC sbcA strain and the rec+ strain were observed and these will be discussed.
Sánchez Timm, Eduardo; Hidalgo Pardo, Lisette; Pacheco Coello, Ricardo; Chávez Navarrete, Tatiana; Navarrete Villegas, Oscar; Santos Ordóñez, Efrén
2016-01-01
Bananas and plantains are considered an important crop around the world. Banana production is affected by several constraints, of which Black Sigatoka Disease, caused by the fungus Mycosphaerella fijiensis, is considered one of the most important diseases in banana plantations. The banana accession 'Calcutta-4' has a natural resistance to Black Sigatoka; however, the fruit is not valuable for commercialization. Gene identification and expression studies in 'Calcutta-4' might reveal possible gene candidates for resistant to the disease and elucidate mechanisms for resistance. A subtracted cDNA library was generated from leaves after 6, 9 and 12 days inoculated with M. fijiensis conidia on greenhouse banana plants of the accession 'Calcutta-4'. Bioinformatic analysis revealed 99 good quality sequences. Blast2go analysis revealed that 31% of the sequences could not be categorized and, according to the Biological Process Category, 32 and 28 ESTs are related to general metabolic and cellular processes, respectively; while 10 ESTs response to stimulus. Seven sequences were redundant and one was similar to genes that may be involved in pathogen resistance including the putative disease resistance protein RGA1. Genes encoding zinc finger domains were identified and may play an important role in pathogen resistance by inducing the expression of downstream genes. Expression analysis of four selected genes was performed using RT-qPCR during the early stage of the disease development at 6, 9, 12 and 15 days post inoculation showing a peak of up regulation at 9 or 12 days post inoculation. Three of the four genes showed an up-regulation of expression in 'Calcutta-4' when compared to 'Williams' after inoculation with M. fijiensis, suggesting a fine regulation of specific gene candidates that may lead to a resistance response. The genes identified in early responses in a plant-pathogen interaction may be relevant for the resistance response of 'Calcutta-4' to Black Sigatoka
Directory of Open Access Journals (Sweden)
Eduardo Sánchez Timm
Full Text Available Bananas and plantains are considered an important crop around the world. Banana production is affected by several constraints, of which Black Sigatoka Disease, caused by the fungus Mycosphaerella fijiensis, is considered one of the most important diseases in banana plantations. The banana accession 'Calcutta-4' has a natural resistance to Black Sigatoka; however, the fruit is not valuable for commercialization. Gene identification and expression studies in 'Calcutta-4' might reveal possible gene candidates for resistant to the disease and elucidate mechanisms for resistance. A subtracted cDNA library was generated from leaves after 6, 9 and 12 days inoculated with M. fijiensis conidia on greenhouse banana plants of the accession 'Calcutta-4'. Bioinformatic analysis revealed 99 good quality sequences. Blast2go analysis revealed that 31% of the sequences could not be categorized and, according to the Biological Process Category, 32 and 28 ESTs are related to general metabolic and cellular processes, respectively; while 10 ESTs response to stimulus. Seven sequences were redundant and one was similar to genes that may be involved in pathogen resistance including the putative disease resistance protein RGA1. Genes encoding zinc finger domains were identified and may play an important role in pathogen resistance by inducing the expression of downstream genes. Expression analysis of four selected genes was performed using RT-qPCR during the early stage of the disease development at 6, 9, 12 and 15 days post inoculation showing a peak of up regulation at 9 or 12 days post inoculation. Three of the four genes showed an up-regulation of expression in 'Calcutta-4' when compared to 'Williams' after inoculation with M. fijiensis, suggesting a fine regulation of specific gene candidates that may lead to a resistance response. The genes identified in early responses in a plant-pathogen interaction may be relevant for the resistance response of 'Calcutta-4' to
MicroRNAs Suppress NB Domain Genes in Tomato That Confer Resistance to Fusarium oxysporum
Ouyang, Shouqiang; Park, Gyungsoon; Atamian, Hagop S.; Han, Cliff S.; Stajich, Jason E.; Kaloshian, Isgouhi; Borkovich, Katherine A.
2014-01-01
MicroRNAs (miRNAs) suppress the transcriptional and post-transcriptional expression of genes in plants. Several miRNA families target genes encoding nucleotide-binding site–leucine-rich repeat (NB-LRR) plant innate immune receptors. The fungus Fusarium oxysporum f. sp. lycopersici causes vascular wilt disease in tomato. We explored a role for miRNAs in tomato defense against F. oxysporum using comparative miRNA profiling of susceptible (Moneymaker) and resistant (Motelle) tomato cultivars. slmiR482f and slmiR5300 were repressed during infection of Motelle with F. oxysporum. Two predicted mRNA targets each of slmiR482f and slmiR5300 exhibited increased expression in Motelle and the ability of these four targets to be regulated by the miRNAs was confirmed by co-expression in Nicotiana benthamiana. Silencing of the targets in the resistant Motelle cultivar revealed a role in fungal resistance for all four genes. All four targets encode proteins with full or partial nucleotide-binding (NB) domains. One slmiR5300 target corresponds to tm-2, a susceptible allele of the Tomato Mosaic Virus resistance gene, supporting functions in immunity to a fungal pathogen. The observation that none of the targets correspond to I-2, the only known resistance (R) gene for F. oxysporum in tomato, supports roles for additional R genes in the immune response. Taken together, our findings suggest that Moneymaker is highly susceptible because its potential resistance is insufficiently expressed due to the action of miRNAs. PMID:25330340
Identification of Gene Resistance to Avian InfluenzaVirus (Mx Gene among Wild Waterbirds
Directory of Open Access Journals (Sweden)
Dewi Elfidasari
2013-04-01
Full Text Available The Mx gene is an antiviral gene used to determine the resistance or the susceptibility to different types of viruses, including the Avian Influenza (AI virus subtype H5N1. The AI virus subtype H5N1 infection in chickens causes Mx gene polymorphism. The Mx+ gene shows resistant to the AIvirus subtype H5N1, whereas the Mx-gene shows signs of susceptible. The objective of thisresearch was to detect the Mxgene in wild aquatic birds using the Polymerase Chain Reaction Restriction Fragment Length Polymorphism (PCR-RFLP method with the primer pairs F2 and NE-R2/R and the RsaI restriction enzyme. DNA samples were obtained from eight species of wild waterbirds with positive and negative exposure to the AI virus subtype H5N1. DNA amplification results showed that the Mxgene in wild aquatic birds is found in a 100 bp fragment, which is the same as the Mx gene found in chickens. However, unlike chickens, the Mxgene in wild aquatic birds did not show any polymorphism. This study proves that Mx- based resistance to AI virus subtype H5N1 in different in wild birds than in chickens.
A novel Capsicum gene inhibits host-specific disease resistance to Phytophthora capsici.
Reeves, Gregory; Monroy-Barbosa, Ariadna; Bosland, Paul W
2013-05-01
A novel disease resistance inhibitor gene (inhibitor of P. capsici resistance [Ipcr]), found in the chile pepper (Capsicum annuum) variety 'New Mexico Capsicum Accession 10399' (NMCA10399), inhibits resistance to Phytophthora capsici but not to other species of Phytophthora. When a highly P. capsici-resistant variety was hybridized with NMCA10399, the resultant F1 populations, when screened, were completely susceptible to P. capsici for root rot and foliar blight disease syndromes, despite the dominance inheritance of P. capsici resistance in chile pepper. The F2 population displayed a 3:13 resistant-to-susceptible (R:S) ratio. The testcross population displayed a 1:1 R:S ratio, and a backcross population to NMCA10399 displayed complete susceptibility. These results demonstrate the presence of a single dominant inhibitor gene affecting P. capsici resistance in chile pepper. Moreover, when lines carrying the Ipcr gene were challenged against six Phytophthora spp., the nonhost resistance was not overcome. Therefore, the Ipcr gene is interfering with host-specific resistance but not the pathogen- or microbe-associated molecular pattern nonhost responses.
Liu, Miaomiao; Ding, Ran; Zhang, Yu; Gao, Yingxin; Tian, Zhe; Zhang, Tong; Yang, Min
2014-10-15
The behaviors of the Macrolide-Lincosamide-Streptogramin (MLS) resistance genes were investigated in an anaerobic-aerobic pilot-scale system treating spiramycin (SPM) production wastewater. After screening fifteen typical MLS resistance genes with different mechanisms using conventional PCR, eight detected genes were determined by quantitative PCR, together with three mobile elements. Aerobic sludge in the pilot system exhibited a total relative abundance of MLS resistance genes (per 16S rRNA gene) 2.5 logs higher than those in control samples collected from sewage and inosine wastewater treatment systems (P resistance genes. However, the total relative gene abundance in anaerobic sludge (4.3 × 10(-1)) was lower than that in aerobic sludge (3.7 × 10(0)) despite of the higher SPM level in anaerobic reactor, showing the advantage of anaerobic treatment in reducing the production of MLS resistance genes. The rRNA methylase genes (erm(B), erm(F), erm(X)) were the most abundant in the aerobic sludge (5.3 × 10(-1)-1.7 × 10(0)), followed by esterase gene ere(A) (1.3 × 10(-1)) and phosphorylase gene mph(B) (5.7 × 10(-2)). In anaerobic sludge, erm(B), erm(F), ere(A), and msr(D) were the major ones (1.2 × 10(-2)-3.2 × 10(-1)). These MLS resistance genes (except for msr(D)) were positively correlated with Class 1 integron (r(2) = 0.74-0.93, P < 0.05), implying the significance of horizontal transfer in their proliferation. Copyright © 2014 Elsevier Ltd. All rights reserved.
Siebe, Christina; Willaschek, Elisha; Sakinc, Tuerkan; Huebner, Johannes; Amelung, Wulf; Grohmann, Elisabeth; Siemens, Jan
2012-01-01
Irrigation with wastewater releases pharmaceuticals, pathogenic bacteria, and resistance genes, but little is known about the accumulation of these contaminants in the environment when wastewater is applied for decades. We sampled a chronosequence of soils that were variously irrigated with wastewater from zero up to 100 years in the Mezquital Valley, Mexico, and investigated the accumulation of ciprofloxacin, enrofloxacin, sulfamethoxazole, trimethoprim, clarithromycin, carbamazepine, bezafibrate, naproxen, diclofenac, as well as the occurrence of Enterococcus spp., and sul and qnr resistance genes. Total concentrations of ciprofloxacin, sulfamethoxazole, and carbamazepine increased with irrigation duration reaching 95% of their upper limit of 1.4 µg/kg (ciprofloxacin), 4.3 µg/kg (sulfamethoxazole), and 5.4 µg/kg (carbamazepine) in soils irrigated for 19–28 years. Accumulation was soil-type-specific, with largest accumulation rates in Leptosols and no time-trend in Vertisols. Acidic pharmaceuticals (diclofenac, naproxen, bezafibrate) were not retained and thus did not accumulate in soils. We did not detect qnrA genes, but qnrS and qnrB genes were found in two of the irrigated soils. Relative concentrations of sul1 genes in irrigated soils were two orders of magnitude larger (3.15×10−3±0.22×10−3 copies/16S rDNA) than in non-irrigated soils (4.35×10−5±1.00×10−5 copies/16S rDNA), while those of sul2 exceeded the ones in non-irrigated soils still by a factor of 22 (6.61×10–4±0.59×10−4 versus 2.99×10−5±0.26×10−5 copies/16S rDNA). Absolute numbers of sul genes continued to increase with prolonging irrigation together with Enterococcus spp. 23S rDNA and total 16S rDNA contents. Increasing total concentrations of antibiotics in soil are not accompanied by increasing relative abundances of resistance genes. Nevertheless, wastewater irrigation enlarges the absolute concentration of resistance genes in soils due to a long-term increase in
Directory of Open Access Journals (Sweden)
Diana eRohlman
2012-08-01
Full Text Available Activation of the aryl hydrocarbon receptor (AhR by its prototypic ligand, 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD, mediates potent suppression of T-cell dependent immune responses. The suppressive effects of TCDD occur early during CD4+ T-cell differentiation in the absence of effects on proliferation and have recently been associated with the induction of AhR-dependent regulatory T-cells (Treg. Since AhR functions as a ligand-activated transcription factor, changes in gene expression induced by TCDD during the early stages of CD4+ T-cell differentiation are likely to reflect fundamental mechanisms of AhR action. A custom panel of genes associated with T-cell differentiation was used to query changes in gene expression induced by exposure to 1 nM TCDD. CD4+ T-cells from AhR+/+ and AhR-/- mice were cultured with cytokines known to polarize the differentiation of T-cells to various effector lineages. Treatment with TCDD induced expression of Cyp1a1, Cyp1b1 and Ahrr in CD4+ T-cells from AhR+/+ mice under all culture conditions, validating the presence and activation of AhR in these cells. The highest levels of AhR activation occurred under Th17 conditions at 24 hours and Tr1 conditions at 48 hours. Unexpectedly, expression levels of most genes associated with early T-cell differentiation were unaltered by AhR activation, including lineage-specific genes that drive CD4+ T-cell polarization. The major exception was AhR-dependent up-regulation of Il22 that was seen under all culture conditions. Independent of TCDD, AhR down-regulated the expression of Il17a and Rorc based on increased expression of these genes in AhR-deficient cells across culture conditions. These findings are consistent with a role for AhR in down-regulation of inflammatory immune responses and implicate IL-22 as a potential contributor to the immunosuppressive effects of TCDD.
Xu, Jian; Xu, Yan; Wang, Hongmei; Guo, Changsheng; Qiu, Huiyun; He, Yan; Zhang, Yuan; Li, Xiaochen; Meng, Wei
2015-01-01
The extensive use of antibiotics has caused the contamination of both antibiotics and antibiotic resistance genes (ARGs) in the environment. In this study, the abundance and distribution of antibiotics and ARGs from a sewage treatment plant (STP) and its effluent-receiving river in Beijing China were characterized. Three classes of antibiotics including tetracycline, sulfonamide and quinolone were quantified by LC-MS/MS. In the secondary effluent they were detected at 195, 2001 and 3866 ng L(-1), respectively, which were higher than in the receiving river water. A total of 13 ARGs (6 tet genes: tetA, tetB, tetE, tetW, tetM and tetZ, 3 sulfonamide genes: sul1, sul2 and sul3, and 4 quinolone genes: gryA, parC, qnrC and qnrD) were determined by quantitative PCR. For all ARGs, sulfonamide resistance genes were present at relatively high concentrations in all samples, with the highest ARG concentration above 10(-1). ARGs remained relatively stable along each sewage treatment process. The abundances of detected ARGs from the STP were also higher than its receiving river. Bivariate correlation analysis showed that relative tet gene copies (tetB/16S-rRNA and tetW/16S-rRNA) were strongly correlated with the concentrations of tetracycline residues (r(2)>0.8, pgenes. A negative correlation between the relative abundance of quinolone resistance gene (qnrC/16S-rRNA) and the concentrations of enrofloxacin (ENR) was also determined. The difference of ARGs levels in the raw influent and secondary effluent suggested that the STP treatment process may induce to increase the abundance of resistance genes. The results showed that the sewage was an important repository of the resistance genes, which need to be effectively treated before discharge into the natural water body. Copyright © 2014 Elsevier Ltd. All rights reserved.
Venkatesh, Jelli; An, Jeongtak; Kang, Won-Hee; Jahn, Molly; Kang, Byoung-Cheorl
2018-01-01
Pepper mottle virus (PepMoV) is the most common potyvirus infection of pepper plants and causes significant yield losses. The Pvr7 gene from Capsicum chinense PI159236 and the Pvr4 gene from C. annuum CM334 both have been reported to confer dominant resistance to PepMoV. The Pvr7 locus conferring resistance to PepMoV in C. annuum '9093' was previously mapped to chromosome 10. To develop a high-resolution map of the Pvr7 locus in 9093, we constructed an intraspecific F 2 mapping population consisting of 916 individuals by crossing PepMoV-resistant C. annuum '9093' and the PepMoV-susceptible C. annuum 'Jeju'. To delimit the Pvr7 target region, single-nucleotide polymorphism (SNP) markers derived from the Pvr4 region were used for genotyping the F 2 population. Molecular mapping delimited the Pvr7 locus to a physical interval of 258 kb, which was the same region as Pvr4 on chromosome 10. Three SNP markers derived from Pvr4 mapping perfectly cosegregated with PepMoV resistance. Sequencing analyses of the Pvr7 flanking markers and the Pvr4-specific gene indicated that Pvr7 and Pvr4 are the same gene. Resistance spectrum analysis of 9093 against pepper potyviruses showed that 9093 has a resistance spectrum similar to that of cultivar CM334. These combined results demonstrate that, unlike previously thought, the dominant PepMoV resistance in 9093 could be derived from C. annuum 'CM334', and that Pvr4 and Pvr7 should be considered as the same locus.
Paal, Jürgen; Henselewski, Heike; Muth, Jost; Meksem, Khalid; Menéndez, Cristina M; Salamini, Francesco; Ballvora, Agim; Gebhardt, Christiane
2004-04-01
The endoparasitic root cyst nematode Globodera rostochiensis causes considerable damage in potato cultivation. In the past, major genes for nematode resistance have been introgressed from related potato species into cultivars. Elucidating the molecular basis of resistance will contribute to the understanding of nematode-plant interactions and assist in breeding nematode-resistant cultivars. The Gro1 resistance locus to G. rostochiensis on potato chromosome VII co-localized with a resistance-gene-like (RGL) DNA marker. This marker was used to isolate from genomic libraries 15 members of a closely related candidate gene family. Analysis of inheritance, linkage mapping, and sequencing reduced the number of candidate genes to three. Complementation analysis by stable potato transformation showed that the gene Gro1-4 conferred resistance to G. rostochiensis pathotype Ro1. Gro1-4 encodes a protein of 1136 amino acids that contains Toll-interleukin 1 receptor (TIR), nucleotide-binding (NB), leucine-rich repeat (LRR) homology domains and a C-terminal domain with unknown function. The deduced Gro1-4 protein differed by 29 amino acid changes from susceptible members of the Gro1 gene family. Sequence characterization of 13 members of the Gro1 gene family revealed putative regulatory elements and a variable microsatellite in the promoter region, insertion of a retrotransposon-like element in the first intron, and a stop codon in the NB coding region of some genes. Sequence analysis of RT-PCR products showed that Gro1-4 is expressed, among other members of the family including putative pseudogenes, in non-infected roots of nematode-resistant plants. RT-PCR also demonstrated that members of the Gro1 gene family are expressed in most potato tissues.
Prevalence of antibiotic resistance genes from effluent of coastal aquaculture, South Korea.
Jang, Hyun Min; Kim, Young Beom; Choi, Sangki; Lee, Yunho; Shin, Seung Gu; Unno, Tatsuya; Kim, Young Mo
2018-02-01
The wide use of antibiotics in aquaculture for prophylactic and therapeutic purposes can potentially lead to the prevalence of antibiotic resistance genes (ARGs). This study reports for the first time the profile of ARGs from effluents of coastal aquaculture located in South Jeolla province and Jeju Island, South Korea. Using quantitative PCR (qPCR), twenty-two ARGs encoding tetracycline resistance (tetA, tetB, tetD, tetE, tetG, tetH, tetM, tetQ, tetX, tetZ, tetBP), sulfonamide resistance (sul1, sul2), quinolone resistance (qnrD, qnrS, aac(6')-Ib-cr), β-lactams resistance (bla TEM , bla CTX , bla SHV ), macrolide resistance (ermC), florfenicol resistance (floR) and multidrug resistance (oqxA) and a class 1 integrons-integrase gene (intI1) were quantified. In addition, Illumina Miseq sequencing was applied to investigate microbial community differences across fish farm effluents. Results from qPCR showed that the total number of detected ARGs ranged from 4.24 × 10 -3 to 1.46 × 10 -2 copies/16S rRNA gene. Among them, tetB and tetD were predominant, accounting for 74.8%-98.0% of the total ARGs. Furthermore, intI1 gene showed positive correlation with tetB, tetD, tetE, tetH, tetX, tetZ tetQ and sul1. Microbial community analysis revealed potential host bacteria for ARGs and intI1. Two genera, Vibrio and Marinomonas belonging to Gammaproteobacteria, showed significant correlation with tetB and tetD, the most dominant ARGs in all samples. Also, operational taxonomic units (OTUs)-based network analysis revealed that ten OTUs, classified into the phyla Proteobacteria, Cyanobacteria/Chloroplast, Bacteroidetes, Verrucomicrobia and an unclassified phylum, were potential hosts of tetracycline resistance genes (i.e., tetA, tetG, tetH, tetM, tetQ and tetZ). Further systematic monitoring of ARGs is warranted for risk assessment and management of antibacterial resistance from fish farm effluents. Copyright © 2017 Elsevier Ltd. All rights reserved.
Giesbers, Anne K J; Pelgrom, Alexandra J E; Visser, Richard G F; Niks, Rients E; Van den Ackerveken, Guido; Jeuken, Marieke J W
2017-11-01
Candidate effectors from lettuce downy mildew (Bremia lactucae) enable high-throughput germplasm screening for the presence of resistance (R) genes. The nonhost species Lactuca saligna comprises a source of B. lactucae R genes that has hardly been exploited in lettuce breeding. Its cross-compatibility with the host species L. sativa enables the study of inheritance of nonhost resistance (NHR). We performed transient expression of candidate RXLR effector genes from B. lactucae in a diverse Lactuca germplasm set. Responses to two candidate effectors (BLR31 and BLN08) were genetically mapped and tested for co-segregation with disease resistance. BLN08 induced a hypersensitive response (HR) in 55% of the L. saligna accessions, but responsiveness did not co-segregate with resistance to Bl:24. BLR31 triggered an HR in 5% of the L. saligna accessions, and revealed a novel R gene providing complete B. lactucae race Bl:24 resistance. Resistant hybrid plants that were BLR31 nonresponsive indicated other unlinked R genes and/or nonhost QTLs. We have identified a candidate avirulence effector of B. lactucae (BLR31) and its cognate R gene in L. saligna. Concurrently, our results suggest that R genes are not required for NHR of L. saligna. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.
Directory of Open Access Journals (Sweden)
Chen Tingfu
2010-07-01
Full Text Available Abstract Background The novel gene HA117 is a multidrug resistance (MDR gene expressed by all-trans retinoic acid-resistant HL-60 cells. In the present study, we compared the multidrug resistance of the HA117 with that of the classical multidrug resistance gene 1 (MDR1 in breast cancer cell line 4T1. Methods Transduction of the breast cancer cell line 4T1 with adenoviral vectors encoding the HA117 gene and the green fluorescence protein gene (GFP (Ad-GFP-HA117, the MDR1 and GFP (Ad-GFP-MDR1 or GFP (Ad-GFP was respectively carried out. The transduction efficiency and the multiplicity of infection (MOI were detected by fluorescence microscope and flow cytometry. The transcription of HA117 gene and MDR1 gene were detected by reverse transcription polymerase chain reaction (RT-PCR. Western blotting analysis was used to detect the expression of P-glycoprotein (P-gp but the expression of HA117 could not be analyzed as it is a novel gene and its antibody has not yet been synthesized. The drug-excretion activity of HA117 and MDR1 were determined by daunorubicin (DNR efflux assay. The drug sensitivities of 4T1/HA117 and 4T1/MDR1 to chemotherapeutic agents were detected by Methyl-Thiazolyl-Tetrazolium (MTT assay. Results The transducted efficiency of Ad-GFP-HA117 and Ad-GFP-MDR1 were 75%-80% when MOI was equal to 50. The transduction of Ad-GFP-HA117 and Ad-GFP-MDR1 could increase the expression of HA117 and MDR1. The drug resistance index to Adriamycin (ADM, vincristine (VCR, paclitaxel (Taxol and bleomycin (BLM increased to19.8050, 9.0663, 9.7245, 3.5650 respectively for 4T1/HA117 and 24.2236, 11.0480, 11.3741, 0.9630 respectively for 4T1/MDR1 as compared to the control cells. There were no significant differences in drug sensitivity between 4T1/HA117 and 4T1/MDR1 for the P-gp substrates (ADM, VCR and Taxol (P Conclusions These results confirm that HA117 is a strong MDR gene in both HL-60 and 4T1 cells. Furthermore, our results indicate that the MDR
Jena, Kshirod K; Hechanova, Sherry Lou; Verdeprado, Holden; Prahalada, G D; Kim, Sung-Ryul
2017-11-01
A first set of 25 NILs carrying ten BPH resistance genes and their pyramids was developed in the background of indica variety IR24 for insect resistance breeding in rice. Brown planthopper (Nilaparvata lugens Stal.) is one of the most destructive insect pests in rice. Development of near-isogenic lines (NILs) is an important strategy for genetic analysis of brown planthopper (BPH) resistance (R) genes and their deployment against diverse BPH populations. A set of 25 NILs with 9 single R genes and 16 multiple R gene combinations consisting of 11 two-gene pyramids and 5 three-gene pyramids in the genetic background of the susceptible indica rice cultivar IR24 was developed through marker-assisted selection. The linked DNA markers for each of the R genes were used for foreground selection and confirming the introgressed regions of the BPH R genes. Modified seed box screening and feeding rate of BPH were used to evaluate the spectrum of resistance. BPH reaction of each of the NILs carrying different single genes was variable at the antibiosis level with the four BPH populations of the Philippines. The NILs with two- to three-pyramided genes showed a stronger level of antibiosis (49.3-99.0%) against BPH populations compared with NILs with a single R gene NILs (42.0-83.5%) and IR24 (10.0%). Background genotyping by high-density SNPs markers revealed that most of the chromosome regions of the NILs (BC 3 F 5 ) had IR24 genome recovery of 82.0-94.2%. Six major agronomic data of the NILs showed a phenotypically comparable agronomic performance with IR24. These newly developed NILs will be useful as new genetic resources for BPH resistance breeding and are valuable sources of genes in monitoring against the emerging BPH biotypes in different rice-growing countries.
Leveraging long sequencing reads to investigate R-gene clustering and variation in sugar beet
Host-pathogen interactions are of prime importance to modern agriculture. Plants utilize various types of resistance genes to mitigate pathogen damage. Identification of the specific gene responsible for a specific resistance can be difficult due to duplication and clustering within R-gene families....
Prevalence of 16S rRNA methylase genes among β-lactamase ...
African Journals Online (AJOL)
Background: Co production of 16S rRNA methylases gene and β-Lactamase gene among Enterobacteriaceae isolates conferring resistance to both therapeutic options has serious implications for clinicians worldwide. Methods: To study co existence of 16S rRNA methylases (armA, rmtA, rmtB, rmtC, rmtD, and npmA) and ...
Huang, Zhen; Zhang, Xuexian; Jiang, Shouhua; Qin, Mengfan; Zhao, Na; Lang, Lina; Liu, Yaping; Tian, Zhengshu; Liu, Xia; Wang, Yang; Zhang, Binbin; Xu, Aixia
2017-06-01
Currently, cold temperatures are one of the main factors threatening rapeseed production worldwide; thus, it is imperative to identify cold-resistant germplasm and to cultivate cold-resistant rapeseed varieties. In this study, the cold resistance of four Brassica rapa varieties was analyzed. The cold resistance of Longyou6 and Longyou7 was better than that of Tianyou2 and Tianyou4. Thus, an F 2 population derived from Longyou6 and Tianyou4 was used to study the correlation of cold resistance and physiological indexes. Our results showed that the degree of frost damage was related to the relative conductivity and MDA content (r1 = 0.558 and r2 = 0.447, respectively). In order to identify the markers related to cold resistance, 504 pairs of SSR (simple sequence repeats) primers were used to screen the two parents and F 2 population. Four and five SSR markers had highly significant positive correlation to relative conductivity and MDA, respectively. In addition, three of these SSR markers had a highly significant positive correlation to both of these two indexes. These three SSR markers were subsequently confirmed to be used to distinguish between cold-resistant and non-cold-resistant varieties. The results of this study will lay a solid foundation for the mapping of cold-resistant genes and molecular markers assisted selection for the cold-resistance.
Chen, Jingchao; Huang, Hongjuan; Zhang, Chaoxian; Wei, Shouhui; Huang, Zhaofeng; Chen, Jinyi; Wang, Xu
2015-10-01
Field-evolved resistance of goosegrass to glyphosate is due to double or single mutation in EPSPS , or amplification of EPSPS leads to increased transcription and protein levels. Glyphosate has been used widely in the south of China. The high selection pressure from glyphosate use has led to the evolution of resistance to glyphosate in weeds. We investigated the molecular mechanisms of three recently discovered glyphosate-resistant Eleusine indica populations (R1, R2 and R3). The results showed that R1 and R2 had double Thr102Ile and Pro106Ser mutation and a single mutation of Pro106Leu in the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene, respectively. Escherichia coli containing the mutated EPSPS genes was tolerant to glyphosate. EPSPS activity in R1 and R2 plants was higher than in the sensitive plants. There was no amino acid substitution in EPSPS gene in R3. However, expression of EPSPS in R3 plants was higher than in glyphosate-susceptible (S) population (13.8-fold) after glyphosate treatment. EPSPS enzyme activity in both R3 and S plants was inhibited by glyphosate, while shikimate accumulation in R3 was significantly lower than for the S population. Further analysis revealed that the genome of R3 contained 28.3-fold more copies of the EPSPS gene than that of susceptible population. EPSPS expression was positively correlated with copy number of EPSPS. In conclusion, mutation of the EPSPS gene and increased EPSPS expression are part of the molecular mechanisms of resistance to glyphosate in Eleusine indica.
The Number of Genes Controlling Resistance in Beans to Common ...
African Journals Online (AJOL)
Ten crosses were made between resistant (R), susceptible (S), RxS susceptible and Intermediate (I), SxI and RxR bean lines to common bacterial blight. The F1 were advanced to F2 and in each cross over 250 F2 plants were used to evaluate for the number of genes controlling resistance using Mendelian genetics and ...
Inheritance and Gene Mapping of Resistance to Soybean Mosaic Virus Strain SC14 in Soybean
Institute of Scientific and Technical Information of China (English)
Hai-Chao Li; Hai-Jian Zhi; Jun-Yi Gai; Dong-Quan Guo; Yan-Wei Wang; Kai Li; Li Bai; Hua Yang
2006-01-01
Soybean mosaic virus (SMV) is one of the most broadly distributed diseases worldwide. It causes severe yield loss and seed quality deficiency in soybean (Glycine max (L.) Merr.). SMV Strain SC14 isolated from Shanxi Province, China, was a newly identified virulent strain and can infect Kefeng No. 1, a source with wide spectrum resistance. In the present study, soybean accessions, PI96983, Qihuang No. 1 and Qihuang No. 22 were identified to be resistant (R) and Nannong 1138-2, Pixianchadou susceptible (S) to SC14. Segregation analysis of PI96983 × Nannong 1138-2 indicated that a single dominant gene (designated as Rsc14) controlled the resistance to SC14 at both V2 and R1 developmental stages. The same results were obtained for the crosses of Qihuang No. 1 × Nannong 1138-2 and Qihuang No. 22 × Nannong 1138-2 as in PI96983 × Nannong 1138-2 at V2 stage, but at R1 stage,the F1 performed as necrosis (a susceptible symptom other than mosaic), F2 segregated in a ratio of 1R:2N:1S,and the progenies of necrotic (N) F2 individuals segregated also in R, N and S. It indicated that a single gene (designated as Rsc14o, to be different from that of PI96983) controlled the resistance to SC14, its dominance was the same as in PI96983 × Nannong 1138-2 (without symptoms) at V2 stage and not the same at R1 stage. The tightly linked co-dominant simple sequence repeat (SSR) marker Satt334 indicated that all the heterozygous bands were completely corresponding to the necrotic F2 individuals, or all the necrotic F2 individuals were heterozygotes.It was inferred that necrosis might be due to the interaction among SMV strains, resistance genes, genetic background of the resistance genes, and plant development stage. Furthermore, the bulked segregant analysis (BSA) of SSR markers was conducted to map the resistance genes. In F2 of PI96983 × Nannong 1138-2, five SSR markers, Sat_297, Sat_234, Sat_154, Sct_033 and Sat_120, were found closely linked to Rsc14, with genetic distances of 14
The silencing effect of miR-30a on ITGA4 gene expression in vitro: an approach for gene therapy.
Darzi, Leila; Boshtam, Maryam; Shariati, Laleh; Kouhpayeh, Shirin; Gheibi, Azam; Mirian, Mina; Rahimmanesh, Ilnaz; Khanahmad, Hossein; Tabatabaiefar, Mohammad Amin
2017-12-01
Integrins are adhesion molecules which play crucial roles in cell-cell and cell-extracellular matrix interactions. Very late antigen-4 or α4β1 and lymphocyte Peyer's patch adhesion molecule-1 or α4β7, are key factors in the invasion of tumor cells and metastasis. Based on the previous reports, integrin α4 ( ITGA4 ) is overexpressed in some immune disorders and cancers. Thus, inhibition of ITGA4 could be a therapeutic strategy. In the present study, miR-30a was selected in order to suppress ITGA4 expression. The ITGA4 3' UTR was amplified, cloned in the Z2827-M67-( ITGA4 ) plasmid and named as Z2827-M67/3'UTR. HeLa cells were divided into five groups; (1) untreated without any transfection, (2) mock with Z2827-M67/3'UTR transfection and X-tremeGENE reagent, (3) negative control with Z2827-M67/3'UTR transfection alone, (4) test with miR-30a mimic and Z2827-M67/3'UTR transfection and (5) scramble with miR-30a scramble and Z2827-M67/3'UTR transfection. The MTT assay was performed to evaluate cell survival and cytotoxicity in each group. Real-time RT-PCR was applied for the ITGA4 expression analysis. The findings of this study showed that miR-30a downregulated ITGA4 expression and had no effect on the cell survival. Due to the silencing effect of miR-30a on the ITGA4 gene expression, this agent could be considered as a potential tool for cancer and immune disorders therapy.
International Nuclear Information System (INIS)
Parsot, C.; Taxman, E.; Mekalanos, J.J.
1991-01-01
The genes encoding three lipoproteins of Vibrio cholerae were identified by a combination of DNA sequence analysis and [ 3 H]palmitate labeling of hybrid proteins encoded by TnphoA gene fusions. The expression of these three lipoproteins, TagA, AcfD, and TcpC, was controlled by ToxR, the cholera toxin transcriptional activator. The involvement of other bacterial lipoproteins in conferring resistance ot the bactericidal effects of complement prompted us to examine this possibility in V. cholerae. Remarkably, mutations in toxR and tcp genes (including tcpC), involved in the biogenesis of the toxin coregulated pili, rendered V. cholerae about 10 4 - 10 6 times more sensitive to the vibriocidal activity of antibody and complement. Since V. cholerae is a noninvasive organism and toxR and tcp mutants are highly defective in intestinal colonization in animals and humans, these results raise the possibility that resistance to a gut-associated, complement-like bactericidal activity may be a major virulence determinant of V. cholerae and other enterobacterial species
Pediatric fecal microbiota harbor diverse and novel antibiotic resistance genes.
Directory of Open Access Journals (Sweden)
Aimée M Moore
Full Text Available Emerging antibiotic resistance threatens human health. Gut microbes are an epidemiologically important reservoir of resistance genes (resistome, yet prior studies indicate that the true diversity of gut-associated resistomes has been underestimated. To deeply characterize the pediatric gut-associated resistome, we created metagenomic recombinant libraries in an Escherichia coli host using fecal DNA from 22 healthy infants and children (most without recent antibiotic exposure, and performed functional selections for resistance to 18 antibiotics from eight drug classes. Resistance-conferring DNA fragments were sequenced (Illumina HiSeq 2000, and reads assembled and annotated with the PARFuMS computational pipeline. Resistance to 14 of the 18 antibiotics was found in stools of infants and children. Recovered genes included chloramphenicol acetyltransferases, drug-resistant dihydrofolate reductases, rRNA methyltransferases, transcriptional regulators, multidrug efflux pumps, and every major class of beta-lactamase, aminoglycoside-modifying enzyme, and tetracycline resistance protein. Many resistance-conferring sequences were mobilizable; some had low identity to any known organism, emphasizing cryptic organisms as potentially important resistance reservoirs. We functionally confirmed three novel resistance genes, including a 16S rRNA methylase conferring aminoglycoside resistance, and two tetracycline-resistance proteins nearly identical to a bifidobacterial MFS transporter (B. longum s. longum JDM301. We provide the first report to our knowledge of resistance to folate-synthesis inhibitors conferred by a predicted Nudix hydrolase (part of the folate synthesis pathway. This functional metagenomic survey of gut-associated resistomes, the largest of its kind to date, demonstrates that fecal resistomes of healthy children are far more diverse than previously suspected, that clinically relevant resistance genes are present even without recent selective
Nikolakopoulou, T; Egan, S; van Overbeek, L; Guillaume, G; Heuer, H; Wellington, EMH; van Elsas, JD; Collard, JM; Smalla, K; Karagouni, A
2005-01-01
A range of European habitats was screened by PCR for detection of the oxytetracycline resistance genes otr(A) and otr(B), found in the oxytetracycline-producing strain Streptomyces rimosus. Primers were developed to detect these otr genes in tetracycline-resistant (Tc-R) streptomycete isolates from
Bioinformatics Analysis of NBS-LRR Encoding Resistance Genes in Setaria italica.
Zhao, Yan; Weng, Qiaoyun; Song, Jinhui; Ma, Hailian; Yuan, Jincheng; Dong, Zhiping; Liu, Yinghui
2016-06-01
In plants, resistance (R) genes are involved in pathogen recognition and subsequent activation of innate immune responses. The nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes family forms the largest R-gene family among plant genomes and play an important role in plant disease resistance. In this paper, comprehensive analysis of NBS-encoding genes is performed in the whole Setaria italica genome. A total of 96 NBS-LRR genes are identified, and comprehensive overview of the NBS-LRR genes is undertaken, including phylogenetic analysis, chromosome locations, conserved motifs of proteins, and gene expression. Based on the domain, these genes are divided into two groups and distributed in all Setaria italica chromosomes. Most NBS-LRR genes are located at the distal tip of the long arms of the chromosomes. Setaria italica NBS-LRR proteins share at least one nucleotide-biding domain and one leucine-rich repeat domain. Our results also show the duplication of NBS-LRR genes in Setaria italica is related to their gene structure.
Data on the genome-wide identification of CNL R-genes in Setaria italica (L.) P. Beauv.
Andersen, Ethan J.; Nepal, Madhav P.
2017-01-01
We report data associated with the identification of 242 disease resistance genes (R-genes) in the genome of Setaria italica as presented in “Genetic diversity of disease resistance genes in foxtail millet (Setaria italica L.)” (Andersen and Nepal, 2017) [1]. Our data describe the structure and evolution of the Coiled-coil, Nucleotide-binding site, Leucine-rich repeat (CNL) R-genes in foxtail millet. The CNL genes were identified through rigorous extraction and analysis of recently available ...
Kim, Dae Hun; Choi, Ji-Young; Kim, Hae Won; Kim, So Hyun; Chung, Doo Ryeon; Peck, Kyong Ran; Thamlikitkul, Visanu; So, Thomas Man-Kit; Yasin, Rohani M D; Hsueh, Po-Ren; Carlos, Celia C; Hsu, Li Yang; Buntaran, Latre; Lalitha, M K; Song, Jae-Hoon; Ko, Kwan Soo
2013-11-01
In this surveillance study, we identified the genotypes, carbapenem resistance determinants, and structural variations of AbaR-type resistance islands among carbapenem-resistant Acinetobacter baumannii (CRAB) isolates from nine Asian locales. Clonal complex 92 (CC92), corresponding to global clone 2 (GC2), was the most prevalent in most Asian locales (83/108 isolates; 76.9%). CC108, or GC1, was a predominant clone in India. OXA-23 oxacillinase was detected in CRAB isolates from most Asian locales except Taiwan. blaOXA-24 was found in CRAB isolates from Taiwan. AbaR4-type resistance islands, which were divided into six subtypes, were identified in most CRAB isolates investigated. Five isolates from India, Malaysia, Singapore, and Hong Kong contained AbaR3-type resistance islands. Of these, three isolates harbored both AbaR3- and AbaR4-type resistance islands simultaneously. In this study, GC2 was revealed as a prevalent clone in most Asian locales, with the AbaR4-type resistance island predominant, with diverse variants. The significance of this study lies in identifying the spread of global clones of carbapenem-resistant A. baumannii in Asia.
Zhu, Yuanting; Lai, Haimei; Zou, Likou; Yin, Sheng; Wang, Chengtao; Han, Xinfeng; Xia, Xiaolong; Hu, Kaidi; He, Li; Zhou, Kang; Chen, Shujuan; Ao, Xiaolin; Liu, Shuliang
2017-10-16
A total of 189 Salmonella isolates were recovered from 627 samples which were collected from cecal contents of broilers, chicken carcasses, chicken meat after cutting step and frozen broiler chicken products along the slaughtering process at a slaughterhouse in Sichuan province of China. The Salmonella isolates were subjected to antimicrobial susceptibility testing to 10 categories of antimicrobial agents using the Kirby-Bauer disk diffusion method. Those antibiotics-resistant isolates were further investigated for the occurrence of resistance genes, the presence of class 1 integron as well as the associated gene cassettes, and the mutations within the gyrA and parC genes. Consequently, the prevalence of Salmonella was 30.14% (47.96% for cecal content, 18.78% for chicken carcasses, 31.33% for cutting meat and 14.00% for frozen meat, respectively). The predominant serotypes were S. Typhimurium (15.34%) and S. Enteritidis (69.84%). High resistance rates to the following drugs were observed: nalidixic acid (99.5%), ampicillin (87.8%), tetracycline (51.9%), ciprofloxacin (48.7%), trimethoprim/sulfamethoxazole (48.1%), and spectinomycin (34.4%). Antimicrobial resistance profiling showed that 60.8% of isolates were multidrug resistant (MDR), and MDR strains increased from 44.7% to 78.6% along the slaughtering line. 94.6% (n=157) of beta-lactam-resistant isolates harbored at least one resistance gene of bla TEM or bla CTX-M . The relatively low prevalence of aminoglycoside resistance genes (aac(3)-II, aac(3)-IV, and ant(2″)-I) was found in 49 (66.2%) of antibiotic-resistant isolates. The tetracycline resistance genes (tet(A), tet(B), tet(C), and tet(G) and sulfonamide resistance genes (sul1, sul2, and sul3) were identified in 84 (85.7%) and 89 (97.8%) antibiotic-resistant isolates respectively. floR was identified in 44 (97.8%) florfenicol-resistant isolates. Class 1 integron was detected in 37.4% (n=43) of the MDR isolates. Two different gene cassettes, bla OXA-30 -aad
Directory of Open Access Journals (Sweden)
Zhang Xue-qing
2010-06-01
Full Text Available Abstract Background Recently, production of 16S rRNA methylases by Gram-negative bacilli has emerged as a novel mechanism for high-level resistance to aminoglycosides by these organisms in a variety of geographic locations. Therefore, the spread of high-level aminoglycoside resistance determinants has become a great concern. Methods Between January 2006 and July 2008, 680 distinct Escherichia coli clinical isolates were collected from a teaching hospital in Wenzhou, China. PCR and DNA sequencing were used to identify 16S rRNA methylase and extended-spectrum β-lactamase (ESBL genes, including armA and rmtB, and in situ hybridization was performed to determine the location of 16S rRNA methylase genes. Conjugation experiments were subsequently performed to determine whether aminoglycoside resistance was transferable from the E. coli isolates via 16S rRNA methylase-bearing plasmids. Homology of the isolates harboring 16S rRNA methylase genes was determined using pulse-field gel electrophoresis (PFGE. Results Among the 680 E. coli isolates, 357 (52.5%, 346 (50.9% and 44 (6.5% isolates were resistant to gentamicin, tobramycin and amikacin, respectively. Thirty-seven of 44 amikacin-resistant isolates harbored 16S rRNA methylase genes, with 36 of 37 harboring the rmtB gene and only one harboring armA. The positive rates of 16S rRNA methylase genes among all isolates and amikacin-resistant isolates were 5.4% (37/680 and 84.1% (37/44, respectively. Thirty-one isolates harboring 16S rRNA methylase genes also produced ESBLs. In addition, high-level aminoglycoside resistance could be transferred by conjugation from four rmtB-positive donors. The plasmids of incompatibility groups IncF, IncK and IncN were detected in 34, 3 and 3 isolates, respectively. Upstream regions of the armA gene contained ISCR1 and tnpU, the latter a putative transposase gene,. Another putative transposase gene, tnpD, was located within a region downstream of armA. Moreover, a
Mir-1307 regulates cisplatin resistance by targeting Mdm4 in breast cancer expressing wild type P53.
Wang, Xinyan; Zhu, Jianwei
2018-04-26
Many chemotherapy regimens are used to treat breast cancer; however, breast cancer cells often develop drug resistance that usually leads to relapse and poor prognosis. MicroRNAs (miRNAs) are short non-coding RNA molecules that post-transcriptionally regulate gene expression and play crucial roles in diverse biological processes, such as development, differentiation, apoptosis, and proliferation. We investigated the roles of miRNAs in the development of drug resistance in human breast cancer cells. MiRNA expression was detected in human breast cancer cell lines MCF-7 and MDA-MB-468 via real time PCR; 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazoliumbromide, cell viability, colony formation, and luciferase reporter gene assays; Western blot; and immunohistochemistry. MiR-1307 was downregulated while MDM4 was upregulated in MCF-7/cisplatin (CDDP) and MDA-MB-468/CDDP cells compared with parental MCF-7 and MDA-MB-468 cells. in vitro drug sensitivity assay demonstrated that overexpression of miR-1307 sensitized MCF-7/CDDP cells to CDDP. Luciferase activity assay with a reporter containing sequences from the 3' untranslated region of Mdm4 in MCF-7/CDDP cells suggested that Mdm4 was the direct target gene of miR-1307. Ectopic miR-1307 expression reduced the MDM4 protein level and sensitized MCF-7/CDDP cells to CDDP-induced apoptosis. Our findings suggest, for the first time, that miR-1307 could play a role in the development of CDDP resistance in breast cancer, at least in part by modulating apoptosis by targeting Mdm4. © 2018 The Authors. Thoracic Cancer published by China Lung Oncology Group and John Wiley & Sons Australia, Ltd.
Transportin-SR is required for proper splicing of resistance genes and plant immunity.
Directory of Open Access Journals (Sweden)
Shaohua Xu
2011-06-01
Full Text Available Transportin-SR (TRN-SR is a member of the importin-β super-family that functions as the nuclear import receptor for serine-arginine rich (SR proteins, which play diverse roles in RNA metabolism. Here we report the identification and cloning of mos14 (modifier of snc1-1, 14, a mutation that suppresses the immune responses conditioned by the auto-activated Resistance (R protein snc1 (suppressor of npr1-1, constitutive 1. MOS14 encodes a nuclear protein with high similarity to previously characterized TRN-SR proteins in animals. Yeast two-hybrid assays showed that MOS14 interacts with AtRAN1 via its N-terminus and SR proteins via its C-terminus. In mos14-1, localization of several SR proteins to the nucleus was impaired, confirming that MOS14 functions as a TRN-SR. The mos14-1 mutation results in altered splicing patterns of SNC1 and another R gene RPS4 and compromised resistance mediated by snc1 and RPS4, suggesting that nuclear import of SR proteins by MOS14 is required for proper splicing of these two R genes and is important for their functions in plant immunity.
IL-4 Up-Regulates MiR-21 and the MiRNAs Hosted in the CLCN5 Gene in Chronic Lymphocytic Leukemia.
Directory of Open Access Journals (Sweden)
Natalia Ruiz-Lafuente
Full Text Available Interleukin 4 (IL-4 induces B-cell differentiation and survival of chronic lymphocytic leukemia (CLL cells. MicroRNAs (miRNAs regulate mRNA and protein expression, and several miRNAs, deregulated in CLL, might play roles as oncogenes or tumor suppressors. We have studied the miRNA profile of CLL, and its response to IL-4, by oligonucleotide microarrays, resulting in the detection of a set of 129 mature miRNAs consistently expressed in CLL, which included 41 differentially expressed compared to normal B cells (NBC, and 6 significantly underexpressed in ZAP-70 positive patients. IL-4 stimulation brought about up-regulation of the 5p and 3p mature variants of the miR-21 gene, which maps immediately downstream to the VMP1 gene, and of the mature forms generated from the miR-362 (3p and 5p, miR-500a (3p, miR-502 (3p, and miR-532 (3p and 5p genes, which map within the third intron of the CLCN5 gene. Both genes are in turn regulated by IL-4, suggesting that these miRNAs were regulated by IL-4 as passengers from their carrier genes. Their levels of up-regulation by IL-4 significantly correlated with cytoprotection. MiR-21 has been reported to be leukemogenic, associated to bad prognosis in CLL, and the miRNA more frequently overexpressed in human cancer. Up-regulation by IL-4 of miR-21 and the miRNAs hosted in the CLCN5 locus may contribute to evasion of apoptosis of CLL cells. These findings indicate that the IL-4 pathway and the miRNAs induced by IL-4 are promising targets for the development of novel therapies in CLL.
Cloning and characterization of NBS-LRR resistance gene ...
African Journals Online (AJOL)
biotech
2013-07-03
Jul 3, 2013 ... Rose using degernate primers designed from the conserved motifs of different plant resistance genes. A total of 40 sequences were hit with various R genes, of which 20 .... absorption ratio OD260 nm/OD280 nm between 1.80 and ..... status and outlook for small-holders agriculture in C S Gold and B.
Beseli, Aydin; Goulart da Silva, Marilia; Daub, Margaret E
2015-01-01
The photosynthetic bacterium Rhodobacter sphaeroides and plant pathogenic fungus Cercospora nicotianae have been used as models for understanding resistance to singlet oxygen ((1)O(2)), a highly toxic reactive oxygen species. In Rhodobacter and Cercospora, (1)O(2) is derived, respectively, from photosynthesis and from the (1)O(2)-generating toxin cercosporin which the fungus produces to parasitize plants. We identified common genes recovered in transcriptome studies of putative (1)O(2)-resistance genes in these two systems, suggesting common (1)O(2)-resistance mechanisms. To determine if the Cercospora homologs of R. sphaeroides (1)O(2)-resistance genes are involved in resistance to cercosporin, we expressed the genes in the cercosporin-sensitive fungus Neurospora crassa and assayed for increases in cercosporin resistance. Neurospora crassa transformants expressing genes encoding aldo/keto reductase, succinyl-CoA ligase, O-acetylhomoserine (thiol) lyase, peptide methionine sulphoxide reductase and glutathione S-transferase did not have elevated levels of cercosporin resistance. Several transformants expressing aldehyde dehydrogenase were significantly more resistant to cercosporin. Expression of the transgene and enzyme activity did not correlate with resistance, however. We conclude that although the genes tested in this study are important in (1)O(2) resistance in R. sphaeroides, their Cercospora homologs are not involved in resistance to (1)O(2) generated from cercosporin. © FEMS 2014. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Xuan, Shi-Hai; Zhou, Yu-Gui; Shao, Bo; Cui, Ya-Lin; Li, Jian; Yin, Hong-Bo; Song, Xiao-Ping; Cong, Hui; Jing, Feng-Xiang; Jin, Qing-Hui; Wang, Hui-Min; Zhou, Jie
2009-11-01
Macrolide drugs, such as clarithromycin (CAM), are a key component of many combination therapies used to eradicate Helicobacter pylori. However, resistance to CAM is increasing in H. pylori and is becoming a serious problem in H. pylori eradication therapy. CAM resistance in H. pylori is mostly due to point mutations (A2142G/C, A2143G) in the peptidyltransferase-encoding region of the 23S rRNA gene. In this study an enzymic colorimetry-based DNA chip was developed to analyse single-nucleotide polymorphisms of the 23S rRNA gene to determine the prevalence of mutations in CAM-related resistance in H. pylori-positive patients. The results of the colorimetric DNA chip were confirmed by direct DNA sequencing. In 63 samples, the incidence of the A2143G mutation was 17.46 % (11/63). The results of the colorimetric DNA chip were concordant with DNA sequencing in 96.83 % of results (61/63). The colorimetric DNA chip could detect wild-type and mutant signals at every site, even at a DNA concentration of 1.53 x 10(2) copies microl(-1). Thus, the colorimetric DNA chip is a reliable assay for rapid and accurate detection of mutations in the 23S rRNA gene of H. pylori that lead to CAM-related resistance, directly from gastric tissues.
Directory of Open Access Journals (Sweden)
Masayoshi Hashimoto
2016-10-01
Full Text Available The ability of plant viruses to propagate their genomes in host cells depends on many host factors. In the absence of an agrochemical that specifically targets plant viral infection cycles, one of the most effective methods for controlling viral diseases in plants is taking advantage of the host plant’s resistance machinery. Recessive resistance is conferred by a recessive gene mutation that encodes a host factor critical for viral infection. It is a branch of the resistance machinery and, as an inherited characteristic, is very durable. Moreover, recessive resistance may be acquired by a deficiency in a negative regulator of plant defense responses, possibly due to the autoactivation of defense signaling. Eukaryotic translation initiation factor (eIF 4E and eIF4G and their isoforms are the most widely exploited recessive resistance genes in several crop species, and they are effective against a subset of viral species. However, the establishment of efficient, recessive resistance-type antiviral control strategies against a wider range of plant viral diseases requires genetic resources other than eIF4Es. In this review, we focus on recent advances related to antiviral recessive resistance genes evaluated in model plants and several crop species. We also address the roles of next-generation sequencing and genome editing technologies in improving plant genetic resources for recessive resistance-based antiviral breeding in various crop species.
Dissection of Resistance Genes to Pseudomonas syringae pv. phaseolicola in UI3 Common Bean Cultivar.
González, Ana M; Godoy, Luís; Santalla, Marta
2017-11-23
Few quantitative trait loci have been mapped for resistance to Pseudomonas syringae pv. phaseolicola in common bean. Two F₂ populations were developed from the host differential UI3 cultivar. The objective of this study was to further characterize the resistance to races 1, 5, 7 and 9 of Psp included in UI3. Using a QTL mapping approach, 16 and 11 main-effect QTLs for pod and primary leaf resistance were located on LG10, explaining up to 90% and 26% of the phenotypic variation, respectively. The homologous genomic region corresponding to primary leaf resistance QTLs detected tested positive for the presence of resistance-associated gene cluster encoding nucleotide-binding and leucine-rich repeat (NL), Natural Resistance Associated Macrophage (NRAMP) and Pentatricopeptide Repeat family (PPR) proteins. It is worth noting that the main effect QTLs for resistance in pod were located inside a 3.5 Mb genomic region that included the Phvul.010G021200 gene, which encodes a protein that has the highest sequence similarity to the RIN4 gene of Arabidopsis, and can be considered an important candidate gene for the organ-specific QTLs identified here. These results support that resistance to Psp from UI3 might result from the immune response activated by combinations of R proteins, and suggest the guard model as an important mechanism in pod resistance to halo blight. The candidate genes identified here warrant functional studies that will help in characterizing the actual defense gene(s) in UI3 genotype.
Seyfried, Erin E.; Newton, Ryan J.; Rubert, Kennedy F.; Pedersen, Joel A.; McMahon, Katherine D.
2014-01-01
The contribution of human activities to environmental reservoirs of antibiotic resistance is poorly understood. The purpose of this study was to determine if oxytetracycline (OTC) use in aquaculture facilities increased the detection frequency (i.e. prevalence) of tetracycline resistance genes relative to facilities with no recent OTC treatment. We used PCR to screen water and sediment from four non-commercial fish farms in northwestern Wisconsin for the presence of ten tetracycline resistance determinants (tetR): tet(A), tet(B), tet(D), tet(E), tet(G), tet(M), tet(O), tet(Q), tet(S) and tet(W). Water from farms with recent OTC use had significantly higher tetR detection frequencies than did water from farms without recent OTC use, with prevalence in raceways and rearing ponds of farms with recent OTC use exceeded by more than two-fold that of farms not using OTC. Effluent from all farms, regardless of treatment regime, had higher tetR detection frequencies than their corresponding influent for all genes, but the specific combinations of tetR genes detected in a sample were not different from their corresponding influent. Although OTC use was associated with the increased occurrence and diversity of tetR genes in water samples, it was not found to relate to tetR gene occurrence in sediment samples. Sediment samples from facilities with no recent OTC use had significantly higher frequencies of tetR gene detection than did samples from facilities with recent OTC use. All of the tetR genes were detected in both the medicated and non-medicated feed samples analyzed in this study. These findings suggest that both OTC treatment in aquaculture facilities, and the farms themselves, may be sources of tetR gene introduction to the environment. To our knowledge, this is the first study to use genotypic and cultivation-independent methods to examine tetR gene occurrence associated with OTC use in aquaculture. PMID:20217406
MCPA (4-Chloro-2-ethylphenoxyacetate) resistance in hemp-nettle (Galeopsis tetrahit L.).
Weinberg, Tsafrir; Stephenson, Gerald R; McLean, Michael D; Hall, J Christopher
2006-11-29
The physiological basis for MCPA resistance in a hemp-nettle (Galeopsis tetrahit L.) biotype, obtained from a MCPA-resistant field population, was investigated. Dose-response studies revealed that the resistance factor for MCPA, based on GR50 comparisons of total dry weight of resistant (R) and susceptible (S) plants, was 3.3. Resistance factors for fluroxypyr, dicamba, 2,4-D, glyphosate, and chlorsulfuron were 8.2, 1.7, 1.6, 0.7, and 0.6, respectively. MCPA resistance was not due to differences in absorption, because both R and S biotypes absorbed 54% of applied [14C]MCPA 72 h after treatment. However, R plants exported less (45 vs 58% S) recovered 14C out of treated leaves to the apical meristem (6 vs 13% S) and root (32 vs 38% S). In both biotypes, approximately 20% of the 14C recovered in planta was detected as MCPA metabolites. However, less of the 14C recovered in the roots of R plants was MCPA. Therefore, two different mechanisms protect R hemp-nettle from MCPA phytotoxicity: a lower rate of MCPA translocation and a higher rate of MCPA metabolism in the roots. In support of these results, genetic studies indicated that the inheritance of MCPA resistance is governed by at least two nuclear genes with additive effects.
Pacheco Coello, Ricardo; Chávez Navarrete, Tatiana; Navarrete Villegas, Oscar; Santos Ordóñez, Efrén
2016-01-01
Bananas and plantains are considered an important crop around the world. Banana production is affected by several constraints, of which Black Sigatoka Disease, caused by the fungus Mycosphaerella fijiensis, is considered one of the most important diseases in banana plantations. The banana accession ‘Calcutta-4’ has a natural resistance to Black Sigatoka; however, the fruit is not valuable for commercialization. Gene identification and expression studies in ‘Calcutta-4’ might reveal possible gene candidates for resistant to the disease and elucidate mechanisms for resistance. A subtracted cDNA library was generated from leaves after 6, 9 and 12 days inoculated with M. fijiensis conidia on greenhouse banana plants of the accession ‘Calcutta-4’. Bioinformatic analysis revealed 99 good quality sequences. Blast2go analysis revealed that 31% of the sequences could not be categorized and, according to the Biological Process Category, 32 and 28 ESTs are related to general metabolic and cellular processes, respectively; while 10 ESTs response to stimulus. Seven sequences were redundant and one was similar to genes that may be involved in pathogen resistance including the putative disease resistance protein RGA1. Genes encoding zinc finger domains were identified and may play an important role in pathogen resistance by inducing the expression of downstream genes. Expression analysis of four selected genes was performed using RT-qPCR during the early stage of the disease development at 6, 9, 12 and 15 days post inoculation showing a peak of up regulation at 9 or 12 days post inoculation. Three of the four genes showed an up-regulation of expression in ‘Calcutta-4’ when compared to ‘Williams’ after inoculation with M. fijiensis, suggesting a fine regulation of specific gene candidates that may lead to a resistance response. The genes identified in early responses in a plant-pathogen interaction may be relevant for the resistance response of ‘Calcutta-4
Directory of Open Access Journals (Sweden)
Maryam Ghotbaddini
2015-07-01
Full Text Available The reported biological effects of TCDD include induction of drug metabolizing enzymes, wasting syndrome and tumor promotion. TCDD elicits most of its effects through binding the aryl hydrocarbon receptor (AhR. TCDD induced degradation of AhR has been widely reported and requires ubiquitination of the protein. The rapid depletion of AhR following TCDD activation serves as a mechanism to modulate AhR mediated gene induction. In addition to inducing AhR degradation, TCDD has been reported to induce degradation of hormone receptors. The studies reported here, evaluate the effect of TCDD exposure on androgen receptor (AR expression and activity in androgen-sensitive LNCaP and castration-resistant C4-2 prostate cancer cells. Our results show that TCDD exposure does not induce AhR or AR degradation in C4-2 cells. However, both AhR and AR are degraded in LNCaP cells following TCDD exposure. In addition, TCDD enhances AR phosphorylation and induces expression of AR responsive genes in LNCaP cells. Our data reveals that TCDD effect on AR expression and activity differs in androgen-sensitive and castration-resistant prostate cancer cell models.
Comparative Genomics of Non-TNL Disease Resistance Genes from Six Plant Species.
Nepal, Madhav P; Andersen, Ethan J; Neupane, Surendra; Benson, Benjamin V
2017-09-30
Disease resistance genes (R genes), as part of the plant defense system, have coevolved with corresponding pathogen molecules. The main objectives of this project were to identify non-Toll interleukin receptor, nucleotide-binding site, leucine-rich repeat (nTNL) genes and elucidate their evolutionary divergence across six plant genomes. Using reference sequences from Arabidopsis , we investigated nTNL orthologs in the genomes of common bean, Medicago , soybean, poplar, and rice. We used Hidden Markov Models for sequence identification, performed model-based phylogenetic analyses, visualized chromosomal positioning, inferred gene clustering, and assessed gene expression profiles. We analyzed 908 nTNL R genes in the genomes of the six plant species, and classified them into 12 subgroups based on the presence of coiled-coil (CC), nucleotide binding site (NBS), leucine rich repeat (LRR), resistance to Powdery mildew 8 (RPW8), and BED type zinc finger domains. Traditionally classified CC-NBS-LRR (CNL) genes were nested into four clades (CNL A-D) often with abundant, well-supported homogeneous subclades of Type-II R genes. CNL-D members were absent in rice, indicating a unique R gene retention pattern in the rice genome. Genomes from Arabidopsis , common bean, poplar and soybean had one chromosome without any CNL R genes. Medicago and Arabidopsis had the highest and lowest number of gene clusters, respectively. Gene expression analyses suggested unique patterns of expression for each of the CNL clades. Differential gene expression patterns of the nTNL genes were often found to correlate with number of introns and GC content, suggesting structural and functional divergence.
Zhang, Qiulei; Li, Yang; Zhang, Yi; Wu, Chuanbao; Wang, Shengnan; Hao, Li; Wang, Shengyuan; Li, Tianzhong
2017-01-01
MicroRNAs (miRNAs) are key regulators of gene expression that post-transcriptionally regulate transcription factors involved in plant physiological activities. Little is known about the effects of miRNAs in disease resistance in apple ( Malus × domestica ). We globally profiled miRNAs in the apple cultivar Golden Delicious (GD) infected or not with the apple leaf spot fungus Alternaria alternaria f. sp. mali (ALT1), and identified 58 miRNAs that exhibited more than a 2-fold upregulation upon ALT1 infection. We identified a pair of miRNAs that target protein-coding genes involved in the defense response against fungal pathogens; Md-miR156ab targets a novel WRKY transcription factor, MdWRKYN1, which harbors a TIR and a WRKY domain. Md-miR395 targets another transcription factor, MdWRKY26, which contains two WRKY domains. Real-time PCR analysis showed that Md-miR156ab and Md-miR395 levels increased, while MdWRKYN1 and MdWRKY26 expression decreased in ALT1-inoculated GD leaves; furthermore, the overexpression of Md-miR156ab and Md-miR395 resulted in a significant reduction in MdWRKYN1 and MdWRKY26 expression. To investigate whether these miRNAs and their targets play a crucial role in plant defense, we overexpressed MdWRKYN1 or knocked down Md-miR156ab activity, which in both cases enhanced the disease resistance of the plants by upregulating the expression of the WRKY-regulated pathogenesis-related (PR) protein-encoding genes MdPR3-1, MdPR3-2, MdPR4, MdPR5, MdPR10-1 , and MdPR10-2 . In a similar analysis, we overexpressed MdWRKY26 or suppressed Md-miR395 activity, and found that many PR protein-encoding genes were also regulated by MdWRKY26 . In GD, ALT-induced Md-miR156ab and Md-miR395 suppress MdWRKYN1 and MdWRKY26 expression, thereby decreasing the expression of some PR genes, and resulting in susceptibility to ALT1.
Current Status and Challenges in Identifying Disease Resistance Genes in Brassica napus
Directory of Open Access Journals (Sweden)
Ting Xiang Neik
2017-11-01
Full Text Available Brassica napus is an economically important crop across different continents including temperate and subtropical regions in Europe, Canada, South Asia, China and Australia. Its widespread cultivation also brings setbacks as it plays host to fungal, oomycete and chytrid pathogens that can lead to serious yield loss. For sustainable crop production, identification of resistance (R genes in B. napus has become of critical importance. In this review, we discuss four key pathogens affecting Brassica crops: Clubroot (Plasmodiophora brassicae, Blackleg (Leptosphaeria maculans and L. biglobosa, Sclerotinia Stem Rot (Sclerotinia sclerotiorum, and Downy Mildew (Hyaloperonospora parasitica. We first review current studies covering prevalence of these pathogens on Brassica crops and highlight the R genes and QTL that have been identified from Brassica species against these pathogens. Insights into the relationships between the pathogen and its Brassica host, the unique host resistance mechanisms and how these affect resistance outcomes is also presented. We discuss challenges in identification and deployment of R genes in B. napus in relation to highly specific genetic interactions between host subpopulations and pathogen pathotypes and emphasize the need for common or shared techniques and research materials or tighter collaboration between researchers to reconcile the inconsistencies in the research outcomes. Using current genomics tools, we provide examples of how characterization and cloning of R genes in B. napus can be carried out more effectively. Lastly, we put forward strategies to breed resistant cultivars through introgressions supported by genomic approaches and suggest prospects that can be implemented in the future for a better, pathogen-resistant B. napus.
Current Status and Challenges in Identifying Disease Resistance Genes in Brassica napus
Neik, Ting Xiang; Barbetti, Martin J.; Batley, Jacqueline
2017-01-01
Brassica napus is an economically important crop across different continents including temperate and subtropical regions in Europe, Canada, South Asia, China and Australia. Its widespread cultivation also brings setbacks as it plays host to fungal, oomycete and chytrid pathogens that can lead to serious yield loss. For sustainable crop production, identification of resistance (R) genes in B. napus has become of critical importance. In this review, we discuss four key pathogens affecting Brassica crops: Clubroot (Plasmodiophora brassicae), Blackleg (Leptosphaeria maculans and L. biglobosa), Sclerotinia Stem Rot (Sclerotinia sclerotiorum), and Downy Mildew (Hyaloperonospora parasitica). We first review current studies covering prevalence of these pathogens on Brassica crops and highlight the R genes and QTL that have been identified from Brassica species against these pathogens. Insights into the relationships between the pathogen and its Brassica host, the unique host resistance mechanisms and how these affect resistance outcomes is also presented. We discuss challenges in identification and deployment of R genes in B. napus in relation to highly specific genetic interactions between host subpopulations and pathogen pathotypes and emphasize the need for common or shared techniques and research materials or tighter collaboration between researchers to reconcile the inconsistencies in the research outcomes. Using current genomics tools, we provide examples of how characterization and cloning of R genes in B. napus can be carried out more effectively. Lastly, we put forward strategies to breed resistant cultivars through introgressions supported by genomic approaches and suggest prospects that can be implemented in the future for a better, pathogen-resistant B. napus. PMID:29163558
Down-regulation of the miR-543 alleviates insulin resistance through targeting the SIRT1.
Hu, Xiaojing; Chi, Liyi; Zhang, Wentao; Bai, Tiao; Zhao, Wei; Feng, Zhanbin; Tian, Hongyan
2015-12-25
Insulin resistance plays an important role in the development of hypertension, which is seriously detrimental to human health. Recently, Sirtuin-1 (SIRT1) has been found to participate in regulation of insulin resistance. Therefore, further studies focused on the SIRT1 regulators might provide a potential approach for combating insulin resistance and hypertension. Interestingly, in this study, we found that SIRT1 was the target gene of the miR-543 by the Dual-Luciferase Reporter Assay. Moreover, the miR-543 expression notably increased in the insulin-resistant HepG2 cells induced by TNF-α. Further analysis showed that the overexpression of the miR-543 lowered the SIRT1 mRNA and protein levels, resulting in the insulin resistance in the HepG2 cells; the inhibition of miR-543, however, enhanced the mRNA and protein expression of the SIRT1, and alleviated the insulin resistance. Furthermore, the SIRT1 overexpression abrogated the effect of miR-543 on insulin resistance. In addition, the overexpression of the miR-543 by the lentivirus-mediated gene transfer markedly impaired the insulin signaling assessed by the Western blot analysis of the glycogen synthesis and the phosphorylation of Akt and GSK3β. In summary, our study suggested that the downregulation of the miR-543 could alleviate the insulin resistance via the modulation of the SIRT1 expression, which might be a potential new strategy for treating insulin resistance and a promising therapeutic method for hypertension. Copyright © 2015 Elsevier Inc. All rights reserved.
XA23 is an executor R protein and confers broad-spectrum disease resistance in rice.
Wang, Chunlian; Zhang, Xiaoping; Fan, Yinglun; Gao, Ying; Zhu, Qinlong; Zheng, Chongke; Qin, Tengfei; Li, Yanqiang; Che, Jinying; Zhang, Mingwei; Yang, Bing; Liu, Yaoguang; Zhao, Kaijun
2014-11-09
The majority of plant disease resistance (R) genes encode proteins that share common structural features. However, the transcription activator-like effector (TALE) associated executor type R genes show no considerable sequence homology to any known R genes. We adopted a map-based cloning approach and TALE-based technology to isolate and characterize Xa23, a new executor R gene derived from the wild rice (Oryza rufipogon) that confers an extremely broad spectrum of resistance to bacterial blight caused by Xanthomonas oryzae pv. oryzae (Xoo). Xa23 encodes a 113-amino acid protein that shares 50% identity to the known executor R protein XA10. The predicted transmembrane helices in XA23 also overlap with those of XA10. Unlike Xa10, however, Xa23 transcription is specifically activated by AvrXa23, a TALE present in all examined Xoo field isolates. Moreover, the susceptible xa23 allele has an identical open reading frame of Xa23, but differs in promoter region by lacking the TALE binding-element (EBE) for AvrXa23. XA23 can trigger strong hypersensitive response in rice, tobacco and tomato. Our results provide the first evidence that plant genomes have an executor R gene family in which members execute their function and spectrum of disease resistance by recognizing the cognate TALEs in pathogen. © The Author 2014. Published by the Molecular Plant Shanghai Editorial Office in association with Oxford University Press on behalf of CSPB and IPPE, SIBS, CAS.
Rapid cloning of disease-resistance genes in plants using mutagenesis and sequence capture
Genetic solutions to protect crops against pests and pathogens are preferable to agrichemicals 1. Wild crop relatives carry immense diversity of disease resistance (R) genes that could enable more sustainable disease control. However, recruiting R genes for crop improvement typically involves long b...
Li, Feng; Li, Yinghui; Cao, Lirong; Liu, Peiyuan; Geng, Miaomiao; Zhang, Qiang; Qiu, Lina; Sun, Qixin; Xie, Chaojie
2018-01-01
Wheat powdery mildew, caused by Blumeria graminis f. sp. tritici , and wheat leaf rust, caused by Puccinia triticina Eriks, are two important diseases that severely threaten wheat production. Sorento, a hexaploid triticale cultivar from Poland, shows high resistance to the wheat powdery mildew isolate E09 and the leaf rust isolate PHT in Beijing, China. To introduce resistance genes into common wheat, Sorento was crossed with wheat line Xuezao, which is susceptible to both diseases, and the F 1 hybrids were then backcrossed with Xuezao as the recurrent male parent. By marker analysis, we demonstrate that the long arm of the 2R (2RL) chromosome confers resistance to both the leaf rust and powdery mildew isolates at adult-plant and seedling stages, while the long arm of 4R (4RL) confers resistance only to powdery mildew at both stages. The chromosomal composition of BC 2 F 3 plants containing 2R or 2RL and 4R or 4RL in the form of substitution and translocation were confirmed by GISH (genomic in situ hybridization) and FISH (fluorescence in situ hybridization). Monosomic and disomic substitutions of a wheat chromosome with chromosome 2R or 4R, as well as one 4RS-4DL/4DS-4RL reciprocal translocation homozigote and one 2RL-1DL translocation hemizigote, were recovered. Such germplasms are of great value in wheat improvement.
Killiny, Nabil; Hajeri, Subhas; Tiwari, Siddharth; Gowda, Siddarame; Stelinski, Lukasz L
2014-01-01
Silencing of genes through RNA interference (RNAi) in insects has gained momentum during the past few years. RNAi has been used to cause insect mortality, inhibit insect growth, increase insecticide susceptibility, and prevent the development of insecticide resistance. We investigated the efficacy of topically applied dsRNA to induce RNAi for five Cytochrome P450 genes family 4 (CYP4) in Diaphorina citri. We previously reported that these CYP4 genes are associated with the development of insecticide resistance in D. citri. We targeted five CYP4 genes that share a consensus sequence with one dsRNA construct. Quantitative PCR confirmed suppressed expression of the five CYP4 genes as a result of dsRNA topically applied to the thoracic region of D. citri when compared to the expression levels in a control group. Western blot analysis indicated a reduced signal of cytochrome P450 proteins (45 kDa) in adult D. citri treated with the dsRNA. In addition, oxidase activity and insecticide resistance were reduced for D. citri treated with dsRNA that targeted specific CYP4 genes. Mortality was significantly higher in adults treated with dsRNA than in adults treated with water. Our results indicate that topically applied dsRNA can penetrate the cuticle of D. citri and induce RNAi. These results broaden the scope of RNAi as a mechanism to manage pests by targeting a broad range of genes. The results also support the application of RNAi as a viable tool to overcome insecticide resistance development in D. citri populations. However, further research is needed to develop grower-friendly delivery systems for the application of dsRNA under field conditions. Considering the high specificity of dsRNA, this tool can also be used for management of D. citri by targeting physiologically critical genes involved in growth and development.
Directory of Open Access Journals (Sweden)
Nabil Killiny
Full Text Available Silencing of genes through RNA interference (RNAi in insects has gained momentum during the past few years. RNAi has been used to cause insect mortality, inhibit insect growth, increase insecticide susceptibility, and prevent the development of insecticide resistance. We investigated the efficacy of topically applied dsRNA to induce RNAi for five Cytochrome P450 genes family 4 (CYP4 in Diaphorina citri. We previously reported that these CYP4 genes are associated with the development of insecticide resistance in D. citri. We targeted five CYP4 genes that share a consensus sequence with one dsRNA construct. Quantitative PCR confirmed suppressed expression of the five CYP4 genes as a result of dsRNA topically applied to the thoracic region of D. citri when compared to the expression levels in a control group. Western blot analysis indicated a reduced signal of cytochrome P450 proteins (45 kDa in adult D. citri treated with the dsRNA. In addition, oxidase activity and insecticide resistance were reduced for D. citri treated with dsRNA that targeted specific CYP4 genes. Mortality was significantly higher in adults treated with dsRNA than in adults treated with water. Our results indicate that topically applied dsRNA can penetrate the cuticle of D. citri and induce RNAi. These results broaden the scope of RNAi as a mechanism to manage pests by targeting a broad range of genes. The results also support the application of RNAi as a viable tool to overcome insecticide resistance development in D. citri populations. However, further research is needed to develop grower-friendly delivery systems for the application of dsRNA under field conditions. Considering the high specificity of dsRNA, this tool can also be used for management of D. citri by targeting physiologically critical genes involved in growth and development.
Dissection of Resistance Genes to Pseudomonas syringae pv. phaseolicola in UI3 Common Bean Cultivar
Directory of Open Access Journals (Sweden)
Ana M. González
2017-11-01
Full Text Available Few quantitative trait loci have been mapped for resistance to Pseudomonas syringae pv. phaseolicola in common bean. Two F2 populations were developed from the host differential UI3 cultivar. The objective of this study was to further characterize the resistance to races 1, 5, 7 and 9 of Psp included in UI3. Using a QTL mapping approach, 16 and 11 main-effect QTLs for pod and primary leaf resistance were located on LG10, explaining up to 90% and 26% of the phenotypic variation, respectively. The homologous genomic region corresponding to primary leaf resistance QTLs detected tested positive for the presence of resistance-associated gene cluster encoding nucleotide-binding and leucine-rich repeat (NL, Natural Resistance Associated Macrophage (NRAMP and Pentatricopeptide Repeat family (PPR proteins. It is worth noting that the main effect QTLs for resistance in pod were located inside a 3.5 Mb genomic region that included the Phvul.010G021200 gene, which encodes a protein that has the highest sequence similarity to the RIN4 gene of Arabidopsis, and can be considered an important candidate gene for the organ-specific QTLs identified here. These results support that resistance to Psp from UI3 might result from the immune response activated by combinations of R proteins, and suggest the guard model as an important mechanism in pod resistance to halo blight. The candidate genes identified here warrant functional studies that will help in characterizing the actual defense gene(s in UI3 genotype.
Hartmann, Erica M; Hickey, Roxana; Hsu, Tiffany; Betancourt Román, Clarisse M; Chen, Jing; Schwager, Randall; Kline, Jeff; Brown, G Z; Halden, Rolf U; Huttenhower, Curtis; Green, Jessica L
2016-09-20
Antibiotic resistance is increasingly widespread, largely due to human influence. Here, we explore the relationship between antibiotic resistance genes and the antimicrobial chemicals triclosan, triclocarban, and methyl-, ethyl-, propyl-, and butylparaben in the dust microbiome. Dust samples from a mixed-use athletic and educational facility were subjected to microbial and chemical analyses using a combination of 16S rRNA amplicon sequencing, shotgun metagenome sequencing, and liquid chromatography tandem mass spectrometry. The dust resistome was characterized by identifying antibiotic resistance genes annotated in the Comprehensive Antibiotic Resistance Database (CARD) from the metagenomes of each sample using the Short, Better Representative Extract Data set (ShortBRED). The three most highly abundant antibiotic resistance genes were tet(W), blaSRT-1, and erm(B). The complete dust resistome was then compared against the measured concentrations of antimicrobial chemicals, which for triclosan ranged from 0.5 to 1970 ng/g dust. We observed six significant positive associations between the concentration of an antimicrobial chemical and the relative abundance of an antibiotic resistance gene, including one between the ubiquitous antimicrobial triclosan and erm(X), a 23S rRNA methyltransferase implicated in resistance to several antibiotics. This study is the first to look for an association between antibiotic resistance genes and antimicrobial chemicals in dust.
Arabidopsis MAP kinase 4 negatively regulates systemic acquired resistance
DEFF Research Database (Denmark)
Petersen, M.; Brodersen, P.; Naested, H.
2000-01-01
Transposon inactivation of Arabidopsis MAP kinase 4 produced the mpk4 mutant exhibiting constitutive systemic acquired resistance (SAR) including elevated salicylic acid (SA) revels, increased resistance to virulent pathogens, and constitutive pathogenesis-related gene expression shown by Northern...... of NPR1. PDF1.2 and THI2.1 gene induction by jasmonate was blocked in mpk4 expressing NahG, suggesting that MPK4 is required for jasmonic acid-responsive gene expression....
Nakamura, Shinya; Mano, Shoji; Tanaka, Yuji; Ohnishi, Masato; Nakamori, Chihiro; Araki, Masami; Niwa, Tomoko; Nishimura, Mikio; Kaminaka, Hironori; Nakagawa, Tsuyoshi; Sato, Yutaka; Ishiguro, Sumie
2010-01-01
We constructed two series of Gateway binary vectors, pGWBs and R4pGWBs, possessing the bialaphos resistance gene (bar) as a selection marker for plant transformation. The reporters and tags employed in this system are sGFP, GUS, LUC, EYFP, ECFP, G3GFP, mRFP, TagRFP, 6xHis, FLAG, 3xHA, 4xMyc, 10xMyc, GST, T7 and TAP. Selection of Arabidopsis transformants with BASTA was successfully carried out using both plate-grown and soil-grown seedlings. Transformed rice calli and suspension-cultured tobacco cells were selected on plates containing BASTA or glufosinate-ammonium. These vectors are compatible with existing pGWB and R4pGWB vectors carrying kanamycin and hygromycin B resistance.
Data on the genome-wide identification of CNL R-genes in Setaria italica (L.) P. Beauv.
Andersen, Ethan J; Nepal, Madhav P
2017-08-01
We report data associated with the identification of 242 disease resistance genes (R-genes) in the genome of Setaria italica as presented in "Genetic diversity of disease resistance genes in foxtail millet ( Setaria italica L.)" (Andersen and Nepal, 2017) [1]. Our data describe the structure and evolution of the Coiled-coil, Nucleotide-binding site, Leucine-rich repeat (CNL) R-genes in foxtail millet. The CNL genes were identified through rigorous extraction and analysis of recently available plant genome sequences using cutting-edge analytical software. Data visualization includes gene structure diagrams, chromosomal syntenic maps, a chromosomal density plot, and a maximum-likelihood phylogenetic tree comparing Sorghum bicolor , Panicum virgatum , Setaria italica , and Arabidopsis thaliana . Compilation of InterProScan annotations, Gene Ontology (GO) annotations, and Basic Local Alignment Search Tool (BLAST) results for the 242 R-genes identified in the foxtail millet genome are also included in tabular format.
Kang, Chang-Ho; Shin, YuJin; Jang, SeokCheol; Yu, HongSik; Kim, SuKyung; An, Sera; Park, Kunbawui; So, Jae-Seong
2017-05-15
Vibrio parahaemolyticus, found frequently in oysters, is the most prevalent gastroenteritis-causing pathogen in Korea and in several other Asian countries. This study monitored changes in the environmental parameters and occurrence of V. parahaemolyticus in oyster aquaculture sites. Of the 44 presumed V. parahaemolyticus isolates obtained, when tested against 16 antibiotics, 90.9, 86.4, and 75.0% of the 44 isolates exhibited resistance to vancomycin, ampicillin, and streptomycin, respectively. PCR analysis for the presence of the toxR gene confirmed 31 of the 44 isolates as being positive V. parahaemolyticus strains. The toxR positive isolates were tested for the presence of thermostable direct hemolysin (tdh) and tdh-related hemolysin (trh) virulence genes. Only 9.1% toxR positive isolate exhibit the trh gene and none of the isolates were tested positive for tdh. The occurrence of multi drug resistance strains in the environment could be an indication of excessive usage of antibiotics in agriculture and aquaculture fields. Copyright © 2017 Elsevier Ltd. All rights reserved.
Wu, Qingjun; Wang, Shaoli; Xie, Wen; Zhu, Xun; Baxter, Simon W.; Zhou, Xuguo; Jurat-Fuentes, Juan Luis; Zhang, Youjun
2015-01-01
Insecticidal crystal toxins derived from the soil bacterium Bacillus thuringiensis (Bt) are widely used as biopesticide sprays or expressed in transgenic crops to control insect pests. However, large-scale use of Bt has led to field-evolved resistance in several lepidopteran pests. Resistance to Bt Cry1Ac toxin in the diamondback moth, Plutella xylostella (L.), was previously mapped to a multigenic resistance locus (BtR-1). Here, we assembled the 3.15 Mb BtR-1 locus and found high-level resistance to Cry1Ac and Bt biopesticide in four independent P. xylostella strains were all associated with differential expression of a midgut membrane-bound alkaline phosphatase (ALP) outside this locus and a suite of ATP-binding cassette transporter subfamily C (ABCC) genes inside this locus. The interplay between these resistance genes is controlled by a previously uncharacterized trans-regulatory mechanism via the mitogen-activated protein kinase (MAPK) signaling pathway. Molecular, biochemical, and functional analyses have established ALP as a functional Cry1Ac receptor. Phenotypic association experiments revealed that the recessive Cry1Ac resistance was tightly linked to down-regulation of ALP, ABCC2 and ABCC3, whereas it was not linked to up-regulation of ABCC1. Silencing of ABCC2 and ABCC3 in susceptible larvae reduced their susceptibility to Cry1Ac but did not affect the expression of ALP, whereas suppression of MAP4K4, a constitutively transcriptionally-activated MAPK upstream gene within the BtR-1 locus, led to a transient recovery of gene expression thereby restoring the susceptibility in resistant larvae. These results highlight a crucial role for ALP and ABCC genes in field-evolved resistance to Cry1Ac and reveal a novel trans-regulatory signaling mechanism responsible for modulating the expression of these pivotal genes in P. xylostella. PMID:25875245
Directory of Open Access Journals (Sweden)
Zhaojiang Guo
2015-04-01
Full Text Available Insecticidal crystal toxins derived from the soil bacterium Bacillus thuringiensis (Bt are widely used as biopesticide sprays or expressed in transgenic crops to control insect pests. However, large-scale use of Bt has led to field-evolved resistance in several lepidopteran pests. Resistance to Bt Cry1Ac toxin in the diamondback moth, Plutella xylostella (L., was previously mapped to a multigenic resistance locus (BtR-1. Here, we assembled the 3.15 Mb BtR-1 locus and found high-level resistance to Cry1Ac and Bt biopesticide in four independent P. xylostella strains were all associated with differential expression of a midgut membrane-bound alkaline phosphatase (ALP outside this locus and a suite of ATP-binding cassette transporter subfamily C (ABCC genes inside this locus. The interplay between these resistance genes is controlled by a previously uncharacterized trans-regulatory mechanism via the mitogen-activated protein kinase (MAPK signaling pathway. Molecular, biochemical, and functional analyses have established ALP as a functional Cry1Ac receptor. Phenotypic association experiments revealed that the recessive Cry1Ac resistance was tightly linked to down-regulation of ALP, ABCC2 and ABCC3, whereas it was not linked to up-regulation of ABCC1. Silencing of ABCC2 and ABCC3 in susceptible larvae reduced their susceptibility to Cry1Ac but did not affect the expression of ALP, whereas suppression of MAP4K4, a constitutively transcriptionally-activated MAPK upstream gene within the BtR-1 locus, led to a transient recovery of gene expression thereby restoring the susceptibility in resistant larvae. These results highlight a crucial role for ALP and ABCC genes in field-evolved resistance to Cry1Ac and reveal a novel trans-regulatory signaling mechanism responsible for modulating the expression of these pivotal genes in P. xylostella.
Analysis of SNPs of MC4R , GNB3 and FTO gene polymorphism in ...
African Journals Online (AJOL)
Analysis of SNPs of MC4R , GNB3 and FTO gene polymorphism in obese Saudi subjects. Said Salama Moselhy, Yasmeen A Alhetari, Archana Iyer, Etimad A Huwait, Maryam A AL-Ghamdi, Shareefa AL-Ghamdi, Khadijah Saeed Balamash, Ashraf A Basuni, Mohamed N Alama, Taha A Kumosani, Soonham Sami Yaghmoor ...
Herrero, S; Culbreath, A K; Csinos, A S; Pappu, H R; Rufty, R C; Daub, M E
2000-02-01
ABSTRACT Transformation of plants with the nucleocapsid (N) gene of Tomato spotted wilt tospovirus (TSWV) provides resistance to disease development; however, information is lacking on the response of plants to natural inoculum in the field. Three tobacco cultivars were transformed with the N gene of a dahlia isolate of TSWV (TSWV-D), and plants were evaluated over several generations in the greenhouse. The resistant phenotype was more frequently observed in 'Burley 21' than in 'KY-14' or 'K-326', but highly resistant 'Burley 21' transgenic lines were resistant to only 44% of the heterologous TSWV isolates tested. Advanced generation (R(3) and R(4)) transgenic resistant lines of 'Burley 21' and a 'K-326' F(1) hybrid containing the N genes of two TSWV isolates were evaluated in the field near Tifton, GA, where TSWV is endemic. Disease development was monitored by symptom expression and enzyme-linked immunosorbent assay (ELISA) analysis. Whereas incidence of TSWV infection in 'Burley 21' susceptible controls was 20% in 1996 and 62% in 1997, the mean incidence in transgenic lines was reduced to 4 and 31%, respectively. Three transgenic 'Burley 21' lines were identified that had significantly lower incidence of disease than susceptible controls over the two years of the study. In addition, the rate of disease increase at the onset of the 1997 epidemic was reduced for all the 'Burley 21' transgenic lines compared with the susceptible controls. The 'K-326' F(1) hybrid was as susceptible as the 'K-326' nontransformed control. ELISA analysis demonstrated that symptomless plants from the most resistant 'Burley 21' transgenic lines accumulated detectable nucleocapsid protein, whereas symptomless plants from more susceptible lines did not. We conclude that transgenic resistance to TSWV is effective in reducing incidence of the disease in the field, and that accumulation of transgene protein may be important in broad-spectrum resistance.
Prediction of novel target genes and pathways involved in bevacizumab-resistant colorectal cancer
Makondi, Precious Takondwa; Lee, Chia-Hwa; Huang, Chien-Yu; Chu, Chi-Ming; Chang, Yu-Jia
2018-01-01
Bevacizumab combined with cytotoxic chemotherapy is the backbone of metastatic colorectal cancer (mCRC) therapy; however, its treatment efficacy is hampered by therapeutic resistance. Therefore, understanding the mechanisms underlying bevacizumab resistance is crucial to increasing the therapeutic efficacy of bevacizumab. The Gene Expression Omnibus (GEO) database (dataset, GSE86525) was used to identify the key genes and pathways involved in bevacizumab-resistant mCRC. The GEO2R web tool was used to identify differentially expressed genes (DEGs). Functional and pathway enrichment analyses of the DEGs were performed using the Database for Annotation, Visualization, and Integrated Discovery(DAVID). Protein–protein interaction (PPI) networks were established using the Search Tool for the Retrieval of Interacting Genes/Proteins database(STRING) and visualized using Cytoscape software. A total of 124 DEGs were obtained, 57 of which upregulated and 67 were downregulated. PPI network analysis showed that seven upregulated genes and nine downregulated genes exhibited high PPI degrees. In the functional enrichment, the DEGs were mainly enriched in negative regulation of phosphate metabolic process and positive regulation of cell cycle process gene ontologies (GOs); the enriched pathways were the phosphoinositide 3-kinase-serine/threonine kinase signaling pathway, bladder cancer, and microRNAs in cancer. Cyclin-dependent kinase inhibitor 1A(CDKN1A), toll-like receptor 4 (TLR4), CD19 molecule (CD19), breast cancer 1, early onset (BRCA1), platelet-derived growth factor subunit A (PDGFA), and matrix metallopeptidase 1 (MMP1) were the DEGs involved in the pathways and the PPIs. The clinical validation of the DEGs in mCRC (TNM clinical stages 3 and 4) revealed that high PDGFA expression levels were associated with poor overall survival, whereas high BRCA1 and MMP1 expression levels were associated with favorable progress free survival(PFS). The identified genes and pathways
Prediction of novel target genes and pathways involved in bevacizumab-resistant colorectal cancer.
Directory of Open Access Journals (Sweden)
Precious Takondwa Makondi
Full Text Available Bevacizumab combined with cytotoxic chemotherapy is the backbone of metastatic colorectal cancer (mCRC therapy; however, its treatment efficacy is hampered by therapeutic resistance. Therefore, understanding the mechanisms underlying bevacizumab resistance is crucial to increasing the therapeutic efficacy of bevacizumab. The Gene Expression Omnibus (GEO database (dataset, GSE86525 was used to identify the key genes and pathways involved in bevacizumab-resistant mCRC. The GEO2R web tool was used to identify differentially expressed genes (DEGs. Functional and pathway enrichment analyses of the DEGs were performed using the Database for Annotation, Visualization, and Integrated Discovery(DAVID. Protein-protein interaction (PPI networks were established using the Search Tool for the Retrieval of Interacting Genes/Proteins database(STRING and visualized using Cytoscape software. A total of 124 DEGs were obtained, 57 of which upregulated and 67 were downregulated. PPI network analysis showed that seven upregulated genes and nine downregulated genes exhibited high PPI degrees. In the functional enrichment, the DEGs were mainly enriched in negative regulation of phosphate metabolic process and positive regulation of cell cycle process gene ontologies (GOs; the enriched pathways were the phosphoinositide 3-kinase-serine/threonine kinase signaling pathway, bladder cancer, and microRNAs in cancer. Cyclin-dependent kinase inhibitor 1A(CDKN1A, toll-like receptor 4 (TLR4, CD19 molecule (CD19, breast cancer 1, early onset (BRCA1, platelet-derived growth factor subunit A (PDGFA, and matrix metallopeptidase 1 (MMP1 were the DEGs involved in the pathways and the PPIs. The clinical validation of the DEGs in mCRC (TNM clinical stages 3 and 4 revealed that high PDGFA expression levels were associated with poor overall survival, whereas high BRCA1 and MMP1 expression levels were associated with favorable progress free survival(PFS. The identified genes and pathways
Val103Ile polymorphism of the melanocortin-4 receptor gene (MC4R) in cancer cachexia
International Nuclear Information System (INIS)
Knoll, Susanne; Zimmer, Sabiene; Hinney, Anke; Scherag, André; Neubauer, Andreas; Hebebrand, Johannes
2008-01-01
At present pathogenic mechanisms of cancer cachexia are poorly understood. Previous evidence in animal models implicates the melanocortin-4 receptor gene (MC4R) in the development of cancer cachexia. In humans, MC4R mutations that lead to an impaired receptor function are associated with obesity; in contrast, the most frequent polymorphism (Val103Ile, rs2229616; heterozygote frequency approximately 2%) was shown to be negatively associated with obesity. We tested if cancer patients that are homo-/heterozygous for the Val103Ile polymorphism are more likely to develop cachexia and/or a loss of appetite than non-carriers of the 103Ile-allele. BMI (body mass index in kg/m 2 ) of 509 patients (295 males) with malignant neoplasms was determined; additionally patients were asked about premorbid/pretherapeutical changes of appetite and weight loss. Cachexia was defined as a weight loss of at least 5% prior to initiation of therapy; to fulfil this criterion this weight loss had to occur independently of other plausible reasons; in single cases weight loss was the initial reason for seeing a physician. The average age in years (± SD) was 59.0 ± 14.5 (males: 58.8 ± 14.0, females 59.2 ± 14.0). Blood samples were taken for genotyping of the Val103Ile by PCR- RFLP. Most of the patients suffered from lymphoma, leukaemia and gastrointestinal tumours. 107 of the patients (21%) fulfilled our criteria for cancer cachexia. We did not detect association between the Val103Ile polymorphism and cancer cachexia. However, if we exploratively excluded the patients with early leucaemic stages, we detected a trend towards the opposite effect (p < 0.05); heterozygotes for the 103Ile-allele developed cancer cachexia less frequently in comparison to the rest of the study group. Changes of appetite were not associated with the 103Ile-allele carrier status (p > 0.39). Heterozygotes for the 103Ile-allele are not more prone to develop cancer cachexia than patients without this allele; possibly
Val103Ile polymorphism of the melanocortin-4 receptor gene (MC4R) in cancer cachexia
Energy Technology Data Exchange (ETDEWEB)
Knoll, Susanne; Zimmer, Sabiene [Department of Child and Adolescent Psychiatry, University of Duisburg-Essen (Germany); Department of Hematology/Oncology/Immunology, University of Marburg (Germany); Hinney, Anke [Department of Child and Adolescent Psychiatry, University of Duisburg-Essen (Germany); Scherag, André [Zentrum for clinical studies food (ZKSE) c/o Institute for Medical Informatics, Biometry and Epidemiology, University Duisburg-Essen, Essen (Germany); Neubauer, Andreas [Department of Hematology/Oncology/Immunology, University of Marburg (Germany); Hebebrand, Johannes [Department of Child and Adolescent Psychiatry, University of Duisburg-Essen (Germany)
2008-03-31
At present pathogenic mechanisms of cancer cachexia are poorly understood. Previous evidence in animal models implicates the melanocortin-4 receptor gene (MC4R) in the development of cancer cachexia. In humans, MC4R mutations that lead to an impaired receptor function are associated with obesity; in contrast, the most frequent polymorphism (Val103Ile, rs2229616; heterozygote frequency approximately 2%) was shown to be negatively associated with obesity. We tested if cancer patients that are homo-/heterozygous for the Val103Ile polymorphism are more likely to develop cachexia and/or a loss of appetite than non-carriers of the 103Ile-allele. BMI (body mass index in kg/m{sup 2}) of 509 patients (295 males) with malignant neoplasms was determined; additionally patients were asked about premorbid/pretherapeutical changes of appetite and weight loss. Cachexia was defined as a weight loss of at least 5% prior to initiation of therapy; to fulfil this criterion this weight loss had to occur independently of other plausible reasons; in single cases weight loss was the initial reason for seeing a physician. The average age in years (± SD) was 59.0 ± 14.5 (males: 58.8 ± 14.0, females 59.2 ± 14.0). Blood samples were taken for genotyping of the Val103Ile by PCR- RFLP. Most of the patients suffered from lymphoma, leukaemia and gastrointestinal tumours. 107 of the patients (21%) fulfilled our criteria for cancer cachexia. We did not detect association between the Val103Ile polymorphism and cancer cachexia. However, if we exploratively excluded the patients with early leucaemic stages, we detected a trend towards the opposite effect (p < 0.05); heterozygotes for the 103Ile-allele developed cancer cachexia less frequently in comparison to the rest of the study group. Changes of appetite were not associated with the 103Ile-allele carrier status (p > 0.39). Heterozygotes for the 103Ile-allele are not more prone to develop cancer cachexia than patients without this allele
Yin, Shouliang; Wang, Xuefeng; Shi, Mingxin; Yuan, Fang; Wang, Huizhuan; Jia, Xiaole; Yuan, Fang; Sun, Jinliang; Liu, Tiejun; Yang, Keqian; Zhang, Yuxiu; Fan, Keqiang; Li, Zilong
2017-09-01
Increasing the self-resistance levels of Streptomyces is an effective strategy to improve the production of antibiotics. To increase the oxytetracycline (OTC) production in Streptomyces rimosus, we investigated the cooperative effect of three co-overexpressing OTC resistance genes: one gene encodes a ribosomal protection protein (otrA) and the other two express efflux proteins (otrB and otrC). Results indicated that combinational overexpression of otrA, otrB, and otrC (MKABC) exerted a synergetic effect. OTC production increased by 179% in the recombinant strain compared with that of the wild-type strain M4018. The resistance level to OTC was increased by approximately two-fold relative to the parental strain, thereby indicating that applying the cooperative effect of self-resistance genes is useful to improve OTC production. Furthermore, the previously identified cluster-situated activator OtcR was overexpressed in MKABC in constructing the recombinant strain MKRABC; such strain can produce OTC of approximately 7.49 g L -1 , which represents an increase of 19% in comparison with that of the OtcR-overexpressing strain alone. Our work showed that the cooperative overexpression of self-resistance genes is a promising strategy to enhance the antibiotics production in Streptomyces.
Directory of Open Access Journals (Sweden)
Ning Zhao
2017-08-01
Full Text Available Non-target-site resistance (NTSR to herbicides is a worldwide concern for weed control. However, as the dominant NTSR mechanism in weeds, metabolic resistance is not yet well-characterized at the genetic level. For this study, we have identified a shortawn foxtail (Alopecurus aequalis Sobol. population displaying both TSR and NTSR to mesosulfuron-methyl and fenoxaprop-P-ethyl, yet the molecular basis for this NTSR remains unclear. To investigate the mechanisms of metabolic resistance, an RNA-Seq transcriptome analysis was used to find candidate genes that may confer metabolic resistance to the herbicide mesosulfuron-methyl in this plant population. The RNA-Seq libraries generated 831,846,736 clean reads. The de novo transcriptome assembly yielded 95,479 unigenes (averaging 944 bp in length that were assigned putative annotations. Among these, a total of 29,889 unigenes were assigned to 67 GO terms that contained three main categories, and 14,246 unigenes assigned to 32 predicted KEGG metabolic pathways. Global gene expression was measured using the reads generated from the untreated control (CK, water-only control (WCK, and mesosulfuron-methyl treatment (T of R and susceptible (S. Contigs that showed expression differences between mesosulfuron-methyl-treated R and S biotypes, and between mesosulfuron-methyl-treated, water-treated and untreated R plants were selected for further quantitative real-time PCR (qRT-PCR validation analyses. Seventeen contigs were consistently highly expressed in the resistant A. aequalis plants, including four cytochrome P450 monooxygenase (CytP450 genes, two glutathione S-transferase (GST genes, two glucosyltransferase (GT genes, two ATP-binding cassette (ABC transporter genes, and seven additional contigs with functional annotations related to oxidation, hydrolysis, and plant stress physiology. These 17 contigs could serve as major candidate genes for contributing to metabolic mesosulfuron-methyl resistance; hence
Data on the genome-wide identification of CNL R-genes in Setaria italica (L. P. Beauv.
Directory of Open Access Journals (Sweden)
Ethan J. Andersen
2017-08-01
Full Text Available We report data associated with the identification of 242 disease resistance genes (R-genes in the genome of Setaria italica as presented in “Genetic diversity of disease resistance genes in foxtail millet (Setaria italica L.” (Andersen and Nepal, 2017 [1]. Our data describe the structure and evolution of the Coiled-coil, Nucleotide-binding site, Leucine-rich repeat (CNL R-genes in foxtail millet. The CNL genes were identified through rigorous extraction and analysis of recently available plant genome sequences using cutting-edge analytical software. Data visualization includes gene structure diagrams, chromosomal syntenic maps, a chromosomal density plot, and a maximum-likelihood phylogenetic tree comparing Sorghum bicolor, Panicum virgatum, Setaria italica, and Arabidopsis thaliana. Compilation of InterProScan annotations, Gene Ontology (GO annotations, and Basic Local Alignment Search Tool (BLAST results for the 242 R-genes identified in the foxtail millet genome are also included in tabular format.
DEFF Research Database (Denmark)
Liu, M; Kirpekar, F; Van Wezel, G P
2000-01-01
tlrB is one of four resistance genes encoded in the operon for biosynthesis of the macrolide tylosin in antibiotic-producing strains of Streptomyces fradiae. Introduction of tlrB into Streptomyces lividans similarly confers tylosin resistance. Biochemical analysis of the rRNA from the two...... is dependent on the presence of the methyl group donor, S-adenosyl methionine. Analysis of the 74-mer RNA substrate by biochemical and mass spectrometric methods shows that TlrB adds a single methyl group to the base of G748. Homologues of TlrB in other bacteria have been revealed through database searches...
Khallouk, Samira; Voisin, Roger; Portier, Ulysse; Polidori, Joël; Van Ghelder, Cyril; Esmenjaud, Daniel
2013-08-01
Root-knot nematodes (RKNs) (Meloidogyne spp.) are highly polyphagous pests that parasitize Prunus crops in Mediterranean climates. Breeding for RKN-resistant Prunus cultivars, as an alternative to the now-banned use of nematicides, is a real challenge, because the perennial nature of these trees increases the risk of resistance breakdown. The Ma plum resistance (R) gene, with a complete spectrum, and the RMia peach R gene, with a more restricted spectrum, both provide total control of Meloidogyne incognita, the model parthenogenetic species of the genus and the most important RKN in terms of economic losses. We investigated the durability of the resistance to this nematode conferred by these genes, comparing the results obtained with those for the tomato Mi-1 reference gene. In multiyear experiments, we applied a high and continuous nematode inoculum pressure by cultivating nematode-infested susceptible tomato plants with either Prunus accessions carrying Ma or RMia R genes, or with resistant tomato plants carrying the Mi-1 gene. Suitable conditions for Prunus development were achieved by carrying out the studies in a glasshouse, in controlled conditions allowing a short winter leaf fall and dormancy. We first assessed the plum accession 'P.2175', which is heterozygous for the Ma gene, in two successive 2-year evaluations, for resistance to two M. incognita isolates. Whatever the isolate used, no nematodes reproducing on P.2175 were detected, whereas galls and nematodes reproducing on tomato plants carrying Mi-1 were observed. In a second experiment with the most aggressive isolate, interspecific full-sib material (P.2175 × ['Garfi' almond × 'Nemared' peach]), carrying either Ma or RMia (from Nemared) or both (in the heterozygous state) or neither of these genes, was evaluated for 4 years. No virulent nematodes developed on Prunus spp. carrying R genes, whereas galling and virulent individuals were observed on Mi-1-resistant tomato plants. Thus, the resistance to
Inhibition of IGF1-R overcomes IGFBP7-induced chemotherapy resistance in T-ALL
International Nuclear Information System (INIS)
Bartram, Isabelle; Erben, Ulrike; Ortiz-Tanchez, Jutta; Blunert, Katja; Schlee, Cornelia; Neumann, Martin; Heesch, Sandra; Baldus, Claudia D.
2015-01-01
T-cell acute lymphoblastic leukemia (T-ALL) is a genetically heterogeneous disease with the need for treatment optimization. Previously, high expression of Insulin-like growth factor binding protein 7 (IGFBP7), a member of the IGF system, was identified as negative prognostic factor in adult T-ALL patients. Since aberrant IGFBP7 expression was observed in a variety of neoplasia and was relevant for prognosis in T-ALL, we investigated the functional role of IGFBP7 in Jurkat and Molt-4 cells as in vitro models for T-ALL. Jurkat and Molt-4 cells were stably transfected with an IGFBP7 over-expression vector or the empty vector as control. Proliferation of the cells was assessed by WST-1 assays and cell cycle status was measured by flow-cytometry after BrDU/7-AAD staining. The effect of IGFBP7 over-expression on sensitivity to cytostatic drugs was determined in AnnexinV/7-AAD assays. IGF1-R protein expression was measured by Western Blot and flow-cytometric analysis. IGF1-R associated gene expression profiles were generated from microarray gene expression data of 86 T-ALL patients from the Microarrays Innovations in Leukemia (MILE) multicenter study. IGFBP7-transfected Jurkat cells proliferated less, leading to a longer survival in a nutrient–limited environment. Both IGFBP7-transfected Jurkat and Molt-4 cells showed an arrest in the G0/G1 cell cycle phase. Furthermore, Jurkat IGFBP7-transfected cells were resistant to vincristine and asparaginase treatment. Surface expression and whole protein measurement of IGF1-R protein expression showed a reduced abundance of the receptor after IGFBP7 transfection in Jurkat cells. Interestingly, combination of the IGF1-R inhibitor NPV-AEW541 restored sensitivity to vincristine in IGFBP7-transfected cells. Additionally, IGF1-R associated GEP revealed an up-regulation of important drivers of T-ALL pathogenesis and regulators of chemo-resistance and apoptosis such as NOTCH1, BCL-2, PRKCI, and TP53. This study revealed a
Host range of antibiotic resistance genes in wastewater treatment plant influent and effluent.
Hultman, Jenni; Tamminen, Manu; Pärnänen, Katariina; Cairns, Johannes; Karkman, Antti; Virta, Marko
2018-04-01
Wastewater treatment plants (WWTPs) collect wastewater from various sources for a multi-step treatment process. By mixing a large variety of bacteria and promoting their proximity, WWTPs constitute potential hotspots for the emergence of antibiotic resistant bacteria. Concerns have been expressed regarding the potential of WWTPs to spread antibiotic resistance genes (ARGs) from environmental reservoirs to human pathogens. We utilized epicPCR (Emulsion, Paired Isolation and Concatenation PCR) to detect the bacterial hosts of ARGs in two WWTPs. We identified the host distribution of four resistance-associated genes (tetM, int1, qacEΔ1and blaOXA-58) in influent and effluent. The bacterial hosts of these resistance genes varied between the WWTP influent and effluent, with a generally decreasing host range in the effluent. Through 16S rRNA gene sequencing, it was determined that the resistance gene carrying bacteria include both abundant and rare taxa. Our results suggest that the studied WWTPs mostly succeed in decreasing the host range of the resistance genes during the treatment process. Still, there were instances where effluent contained resistance genes in bacterial groups not carrying these genes in the influent. By permitting exhaustive profiling of resistance-associated gene hosts in WWTP bacterial communities, the application of epicPCR provides a new level of precision to our resistance gene risk estimates.
SNPs of melanocortin 4 receptor (MC4R) associated with body weight in Beagle dogs.
Zeng, Ruixia; Zhang, Yibo; Du, Peng
2014-01-01
Melanocortin 4 receptor (MC4R), which is associated with inherited human obesity, is involoved in food intake and body weight of mammals. To study the relationships between MC4R gene polymorphism and body weight in Beagle dogs, we detected and compared the nucleotide sequence of the whole coding region and 3'- and 5'- flanking regions of the dog MC4R gene (1214 bp). In 120 Beagle dogs, two SNPs (A420C, C895T) were identified and their relation with body weight was analyzed with RFLP-PCR method. The results showed that the SNP at A420C was significantly associated with canine body weight trait when it changed amino acid 101 of the MC4R protein from asparagine to threonine, while canine body weight variations were significant in female dogs when MC4R nonsense mutation at C895T. It suggested that the two SNPs might affect the MC4R gene's function which was relative to body weight in Beagle dogs. Therefore, MC4R was a candidate gene for selecting different size dogs with the MC4R SNPs (A420C, C895T) being potentially valuable as a genetic marker.
International Nuclear Information System (INIS)
Sanlioglu, Ahter D; Dirice, Ercument; Aydin, Cigdem; Erin, Nuray; Koksoy, Sadi; Sanlioglu, Salih
2005-01-01
Tumor Necrosis Factor (TNF)-Related Apoptosis-Inducing Ligand (TRAIL) selectively induces apoptosis in cancer cells but not in normal cells. Despite this promising feature, TRAIL resistance observed in cancer cells seriously challenged the use of TRAIL as a death ligand in gene therapy. The current dispute concerns whether or not TRAIL receptor expression pattern is the primary determinant of TRAIL sensitivity in cancer cells. This study investigates TRAIL receptor expression pattern and its connection to TRAIL resistance in breast cancer cells. In addition, a DcR2 siRNA approach and a complementary gene therapy modality involving IKK inhibition (AdIKKβKA) were also tested to verify if these approaches could sensitize MCF7 breast cancer cells to adenovirus delivery of TRAIL (Ad5hTRAIL). TRAIL sensitivity assays were conducted using Molecular Probe's Live/Dead Cellular Viability/Cytotoxicity Kit following the infection of breast cancer cells with Ad5hTRAIL. The molecular mechanism of TRAIL induced cell death under the setting of IKK inhibition was revealed by Annexin V binding. Novel quantitative Real Time RT-PCR and flow cytometry analysis were performed to disclose TRAIL receptor composition in breast cancer cells. MCF7 but not MDA-MB-231 breast cancer cells displayed strong resistance to adenovirus delivery of TRAIL. Only the combinatorial use of Ad5hTRAIL and AdIKKβKA infection sensitized MCF7 breast cancer cells to TRAIL induced cell death. Moreover, novel quantitative Real Time RT-PCR assays suggested that while the level of TRAIL Decoy Receptor-4 (TRAIL-R4) expression was the highest in MCF7 cells, it was the lowest TRAIL receptor expressed in MDA-MB-231 cells. In addition, conventional flow cytometry analysis demonstrated that TRAIL resistant MCF7 cells exhibited substantial levels of TRAIL-R4 expression but not TRAIL decoy receptor-3 (TRAIL-R3) on surface. On the contrary, TRAIL sensitive MDA-MB-231 cells displayed very low levels of surface TRAIL-R4
Directory of Open Access Journals (Sweden)
Read Ronald R
2011-01-01
Full Text Available Abstract Background Environmental transmission of antimicrobial-resistant bacteria and resistance gene determinants originating from livestock is affected by their persistence in agricultural-related matrices. This study investigated the effects of administering subtherapeutic concentrations of antimicrobials to beef cattle on the abundance and persistence of resistance genes within the microbial community of fecal deposits. Cattle (three pens per treatment, 10 steers per pen were administered chlortetracycline, chlortetracycline plus sulfamethazine, tylosin, or no antimicrobials (control. Model fecal deposits (n = 3 were prepared by mixing fresh feces from each pen into a single composite sample. Real-time PCR was used to measure concentrations of tet, sul and erm resistance genes in DNA extracted from composites over 175 days of environmental exposure in the field. The microbial communities were analyzed by quantification and denaturing gradient gel electrophoresis (DGGE of PCR-amplified 16S-rRNA. Results The concentrations of 16S-rRNA in feces were similar across treatments and increased by day 56, declining thereafter. DGGE profiles of 16S-rRNA differed amongst treatments and with time, illustrating temporal shifts in microbial communities. All measured resistance gene determinants were quantifiable in feces after 175 days. Antimicrobial treatment differentially affected the abundance of certain resistance genes but generally not their persistence. In the first 56 days, concentrations of tet(B, tet(C, sul1, sul2, erm(A tended to increase, and decline thereafter, whereas tet(M and tet(W gradually declined over 175 days. At day 7, the concentration of erm(X was greatest in feces from cattle fed tylosin, compared to all other treatments. Conclusion The abundance of genes coding for antimicrobial resistance in bovine feces can be affected by inclusion of antibiotics in the feed. Resistance genes can persist in feces from cattle beyond 175 days
In 2012, an epidemic of powdery mildew occurred in Washington and Idaho on previously resistant cultivars whose resistance was putatively based on the gene designated R6. In 2013, isolates capable of causing severe disease on cultivars with R6-based resistance were confirmed in Oregon and became wid...
Antimicrobial Resistance and Resistance Genes in Aerobic Bacteria Isolated from Pork at Slaughter.
Li, Lili; Heidemann Olsen, Rikke; Ye, Lei; Yan, He; Nie, Qing; Meng, Hecheng; Shi, Lei
2016-04-01
The aim of this study was to investigate the phenotypic and genotypic antimicrobial resistance, integrons, and transferability of resistance markers in 243 aerobic bacteria recovered from pork at slaughter in the People's Republic of China. The organisms belonged to 22 genera of gram-negative bacteria (92.2%) and gram-positive bacteria (7.8%). High levels of resistance were detected to tetracycline, trimethoprim-sulfamethoxazole, and ampicillin (36.2 to 54.3%), and lower levels were detected to nitrofurantoin, cefotaxime, gentamicin, ciprofloxacin, and chloramphenicol (7.8 to 29.2%). Across species, genes conferring antimicrobial resistance were observed with the following frequencies: blaTEM, 40.7%; blaCMY-2, 15.2%; blaCTX-M, 11.5%; sul2, 27.2%; sul1, 14.4%; tet(A), 5.4%; tet(L), 5.4%; tet(M), 5.0%; tet(E), 3.7%; tet(C), 3.3%; tet(S), 2.5%; and tet(K), 0.8%. Various antimicrobial resistance genes were found in new carriers: blaTEM in Lactococcus garvieae, Myroides odoratimimus, Aeromonas hydrophila, Staphylococcus sciuri, Raoultella terrigena, Macrococcus caseolyticus, Acinetobacter ursingii, Sphingobacterium sp., and Oceanobacillus sp.; blaCMY-2 in Lactococcus lactis, Klebsiella oxytoca, Serratia marcescens, Acinetobacter baumannii, and Myroides phaeus; tet(L) in M. caseolyticus; sul1 in Vibrio cincinnatiensis; sul2 in Acinetobacter bereziniae, Acinetobacter johnsonii, and V. cincinnatiensis; and the class 1 integron and gene cassette aadA2 in V. cincinnatiensis. Approximately 6.6% of isolates contained class 1 integrons, and one isolate harbored class 2 integrons. Plasmid associated intI1 and androgen receptor- encoding genes were transferred into Escherichia coli J53 and E. coli DH5α by conjugation and transformation experiments, respectively. Our study highlights the importance of aerobic bacteria from pork as reservoirs for antimicrobial resistance genes and mobile genetic elements that can readily be transferred intra- and interspecies.
Polymorphism and methylation of the MC4R gene in obese and non-obese dogs.
Mankowska, Monika; Nowacka-Woszuk, Joanna; Graczyk, Aneta; Ciazynska, Paulina; Stachowiak, Monika; Switonski, Marek
2017-08-01
The dog is considered to be a useful biomedical model for human diseases and disorders, including obesity. One of the numerous genes associated with human polygenic obesity is MC4R, encoding the melanocortin 4 receptor. The aim of our study was to analyze polymorphisms and methylation of the canine MC4R in relation to adiposity. Altogether 270 dogs representing four breeds predisposed to obesity: Labrador Retriever (n = 187), Golden Retriever (n = 38), Beagle (n = 28) and Cocker Spaniel (n = 17), were studied. The dogs were classified into three groups: lean, overweight and obese, according to the 5-point Body Condition Score (BCS) scale. In the cohort of Labradors a complete phenotypic data (age, sex, neutering status, body weight and BCS) were collected for 127 dogs. The entire coding sequence as well as 5' and 3'-flanking regions of the studied gene were sequenced and six polymorphic sites were reported. Genotype frequencies differed considerably between breeds and Labrador Retrievers appeared to be the less polymorphic. Moreover, distribution of some polymorphic variants differed significantly (P C, c.868C>T and c.*33C>G) and Beagles (c.-435T>C and c.637G>T). On the contrary, in Labradors no association between the studied polymorphisms and BCS or body weight was observed. Methylation analysis, using bisulfite DNA conversion followed by Sanger sequencing, was carried out for 12 dogs with BCS = 3 and 12 dogs with BCS = 5. Two intragenic CpG islands, containing 19 cytosines, were analyzed and the methylation profile did not differ significantly between lean and obese animals. We conclude that an association of the MC4R gene polymorphism with dog obesity or body weight is unlikely, in spite of the fact that some associations were found in small cohorts of Beagles and Golden Retrievers. Also methylation level of this gene is not related with dog adiposity.
Resistance Genes in Global Crop Breeding Networks.
Garrett, K A; Andersen, K F; Asche, F; Bowden, R L; Forbes, G A; Kulakow, P A; Zhou, B
2017-10-01
Resistance genes are a major tool for managing crop diseases. The networks of crop breeders who exchange resistance genes and deploy them in varieties help to determine the global landscape of resistance and epidemics, an important system for maintaining food security. These networks function as a complex adaptive system, with associated strengths and vulnerabilities, and implications for policies to support resistance gene deployment strategies. Extensions of epidemic network analysis can be used to evaluate the multilayer agricultural networks that support and influence crop breeding networks. Here, we evaluate the general structure of crop breeding networks for cassava, potato, rice, and wheat. All four are clustered due to phytosanitary and intellectual property regulations, and linked through CGIAR hubs. Cassava networks primarily include public breeding groups, whereas others are more mixed. These systems must adapt to global change in climate and land use, the emergence of new diseases, and disruptive breeding technologies. Research priorities to support policy include how best to maintain both diversity and redundancy in the roles played by individual crop breeding groups (public versus private and global versus local), and how best to manage connectivity to optimize resistance gene deployment while avoiding risks to the useful life of resistance genes. [Formula: see text] Copyright © 2017 The Author(s). This is an open access article distributed under the CC BY 4.0 International license .
Diversity of 23S rRNA genes within individual prokaryotic genomes.
Directory of Open Access Journals (Sweden)
Anna Pei
Full Text Available BACKGROUND: The concept of ribosomal constraints on rRNA genes is deduced primarily based on the comparison of consensus rRNA sequences between closely related species, but recent advances in whole-genome sequencing allow evaluation of this concept within organisms with multiple rRNA operons. METHODOLOGY/PRINCIPAL FINDINGS: Using the 23S rRNA gene as an example, we analyzed the diversity among individual rRNA genes within a genome. Of 184 prokaryotic species containing multiple 23S rRNA genes, diversity was observed in 113 (61.4% genomes (mean 0.40%, range 0.01%-4.04%. Significant (1.17%-4.04% intragenomic variation was found in 8 species. In 5 of the 8 species, the diversity in the primary structure had only minimal effect on the secondary structure (stem versus loop transition. In the remaining 3 species, the diversity significantly altered local secondary structure, but the alteration appears minimized through complex rearrangement. Intervening sequences (IVS, ranging between 9 and 1471 nt in size, were found in 7 species. IVS in Deinococcus radiodurans and Nostoc sp. encode transposases. T. tengcongensis was the only species in which intragenomic diversity >3% was observed among 4 paralogous 23S rRNA genes. CONCLUSIONS/SIGNIFICANCE: These findings indicate tight ribosomal constraints on individual 23S rRNA genes within a genome. Although classification using primary 23S rRNA sequences could be erroneous, significant diversity among paralogous 23S rRNA genes was observed only once in the 184 species analyzed, indicating little overall impact on the mainstream of 23S rRNA gene-based prokaryotic taxonomy.
Slootweg, Erik; Koropacka, Kamila; Roosien, Jan; Dees, Robert; Overmars, Hein; Lankhorst, Rene Klein; van Schaik, Casper; Pomp, Rikus; Bouwman, Liesbeth; Helder, Johannes; Schots, Arjen; Bakker, Jaap; Smant, Geert; Goverse, Aska
2017-09-01
Plants have evolved a limited repertoire of NB-LRR disease resistance ( R ) genes to protect themselves against myriad pathogens. This limitation is thought to be counterbalanced by the rapid evolution of NB-LRR proteins, as only a few sequence changes have been shown to be sufficient to alter resistance specificities toward novel strains of a pathogen. However, little is known about the flexibility of NB-LRR R genes to switch resistance specificities between phylogenetically unrelated pathogens. To investigate this, we created domain swaps between the close homologs Gpa2 and Rx1 , which confer resistance in potato ( Solanum tuberosum ) to the cyst nematode Globodera pallida and Potato virus X , respectively. The genetic fusion of the CC-NB-ARC of Gpa2 with the LRR of Rx1 (Gpa2 CN /Rx1 L ) results in autoactivity, but lowering the protein levels restored its specific activation response, including extreme resistance to Potato virus X in potato shoots. The reciprocal chimera (Rx1 CN /Gpa2 L ) shows a loss-of-function phenotype, but exchange of the first three LRRs of Gpa2 by the corresponding region of Rx1 was sufficient to regain a wild-type resistance response to G. pallida in the roots. These data demonstrate that exchanging the recognition moiety in the LRR is sufficient to convert extreme virus resistance in the leaves into mild nematode resistance in the roots, and vice versa. In addition, we show that the CC-NB-ARC can operate independently of the recognition specificities defined by the LRR domain, either aboveground or belowground. These data show the versatility of NB-LRR genes to generate resistance to unrelated pathogens with completely different lifestyles and routes of invasion. © 2017 American Society of Plant Biologists. All Rights Reserved.
Directory of Open Access Journals (Sweden)
Patience Chihomvu
2015-04-01
Full Text Available The Klip River has suffered from severe anthropogenic effects from industrial activities such as mining. Long-term exposure to heavy metal pollution has led to the development of heavy metal resistant strains of Pseudomonas sp. KR23, Lysinibacillus sp. KR25, and E. coli KR29. The objectives of this study were to characterize the genetics of copper and chromate resistance of the isolates. Copper and chromate resistance determinants were cloned and sequenced. Open reading frames (ORFs related to the genes CopA and CopR were identified in E. coli KR29, PcoA in Lysinibacillus sp. KR25 and none related to chromate resistance were detected. The 3D-models predicted by I-TASSER disclose that the PcoA proteins consist of β-sheets, which form a part of the cupredoxin domain of the CopA copper resistance family of genes. The model for PcoR_29 revealed the presence of a helix turn helix; this forms part of a DNA binding protein, which is part of a heavy metal transcriptional regulator. The bacterial strains were cured using ethidium bromide. The genes encoding for heavy metal resistance and antibiotic resistance were found to be located on the chromosome for both Pseudomonas sp. (KR23 and E. coli (KR29. For Lysinibacillus (KR25 the heavy metal resistance determinants are suspected to be located on a mobile genetic element, which was not detected using gel electrophoresis.
Chihomvu, Patience; Stegmann, Peter; Pillay, Michael
2015-04-01
The Klip River has suffered from severe anthropogenic effects from industrial activities such as mining. Long-term exposure to heavy metal pollution has led to the development of heavy metal resistant strains of Pseudomonas sp. KR23, Lysinibacillus sp. KR25, and E. coli KR29. The objectives of this study were to characterize the genetics of copper and chromate resistance of the isolates. Copper and chromate resistance determinants were cloned and sequenced. Open reading frames (ORFs) related to the genes CopA and CopR were identified in E. coli KR29, PcoA in Lysinibacillus sp. KR25 and none related to chromate resistance were detected. The 3D-models predicted by I-TASSER disclose that the PcoA proteins consist of β-sheets, which form a part of the cupredoxin domain of the CopA copper resistance family of genes. The model for PcoR_29 revealed the presence of a helix turn helix; this forms part of a DNA binding protein, which is part of a heavy metal transcriptional regulator. The bacterial strains were cured using ethidium bromide. The genes encoding for heavy metal resistance and antibiotic resistance were found to be located on the chromosome for both Pseudomonas sp. (KR23) and E. coli (KR29). For Lysinibacillus (KR25) the heavy metal resistance determinants are suspected to be located on a mobile genetic element, which was not detected using gel electrophoresis.
Liu, He; Yang, Chun-Lan; Ge, Meng-Yu; Ibrahim, Muhammad; Li, Bin; Zhao, Wen-Jun; Chen, Gong-You; Zhu, Bo; Xie, Guan-Lin
2014-01-01
Acidovorax avenae subsp. avenae is the causal agent of bacterial brown stripe disease in rice. In this study, we characterized a novel horizontal transfer of a gene cluster, including tetR, on the chromosome of A. avenae subsp. avenae RS-1 by genome-wide analysis. TetR acted as a repressor in this gene cluster and the oxidative stress resistance was enhanced in tetR-deletion mutant strain. Electrophoretic mobility shift assay demonstrated that TetR regulator bound directly to the promoter of ...
Mapping of novel powdery mildew resistance gene(s) from Agropyron cristatum chromosome 2P.
Li, Huanhuan; Jiang, Bo; Wang, Jingchang; Lu, Yuqing; Zhang, Jinpeng; Pan, Cuili; Yang, Xinming; Li, Xiuquan; Liu, Weihua; Li, Lihui
2017-01-01
A physical map of Agropyron cristatum 2P chromosome was constructed for the first time and the novel powdery mildew resistance gene(s) from chromosome 2P was(were) also mapped. Agropyron cristatum (L.) Gaertn. (2n = 28, PPPP), a wild relative of common wheat, is highly resistant to powdery mildew. Previous studies showed that wheat-A. cristatum 2P disomic addition line II-9-3 displayed high resistance to powdery mildew, and the resistance was attributable to A. cristatum chromosome 2P. To utilize and physically map the powdery mildew resistance gene(s), 15 wheat-A. cristatum 2P translocation lines and three A. cristatum 2P deletion lines with different chromosomal segment sizes, obtained from II-9-3 using 60 Co-γ ray irradiation, were characterized using cytogenetic and molecular marker analysis. A. cristatum 2P chromosomal segments in the translocations were translocated to different wheat chromosomes, including 1A, 4A, 5A, 6A, 7A, 1B, 2B, 3B, 7B, 3D, 4D, and 6D. A physical map of the 2P chromosome was constructed with 82 STS markers, consisting of nine bins with 34 markers on 2PS and eight bins with 48 markers on 2PL. The BC 1 F 2 populations of seven wheat-A. cristatum 2P translocation lines (2PT-3, 2PT-4, 2PT-5, 2PT-6, 2PT-8, 2PT-9, and 2PT-10) were developed by self-pollination, tested with powdery mildew and genotyped with 2P-specific STS markers. From these results, the gene(s) conferring powdery mildew resistance was(were) located on 2PL bin FL 0.66-0.86 and 19 2P-specific markers were identified in this bin. Moreover, two new powdery mildew-resistant translocation lines (2PT-4 and 2PT-5) with small 2PL chromosome segments were obtained. The newly developed wheat lines with powdery mildew resistance and the closely linked molecular markers will be valuable for wheat disease breeding in the future.
Redondo, Javier Jareño; Keller, Peter M; Zbinden, Reinhard; Wagner, Karoline
2018-01-01
In this study we evaluated the commercially available LightMix® RT-PCR assay for Helicobacter pylori detection and identification of clarithromycin (CLR) resistance in culture and clinical specimens (gastric biopsies and stool). The H. pylori LightMix® RT-PCR detects a 97bp long fragment of the 23S rRNA gene and allows the identification of 3 distinct point mutations conferring CLR resistance via melting curve analysis. The performance of the H. pylori LightMix® RT-PCR was evaluated using a set of 60 H. pylori strains showing phenotypical CLR susceptibility or CLR resistance (Minimum inhibitory concentrations from 0.016 to 256mg/L). We found high concordance (95%) between phenotypical CLR resistance screening by E-Test® and the Lightmix® RT-PCR. Discrepant results were verified by sequencing of the 23S rRNA gene that always confirmed the results obtained by Lightmix® RT-PCR. Furthermore, H. pylori was detected in clinical biopsy and stool specimens by Lightmix® RT-PCR that identified the correct H. pylori genotype. The LightMix® RT-PCR is an accurate, sensitive and easy to use test for H. pylori and CLR resistance detection and can therefore be readily implemented in any diagnostic laboratory. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Mapping, isolation and characterization of genes responsible for late blight resistance in potato
Pel, M.
2010-01-01
Late blight (LB), caused by the oomycete Phytophthora infestans, is one of the most
devastating diseases on potato. Resistance (R) genes from the wild species Solanum demissum
have been used by breeders to generate late blight resistant cultivars, but resistance was soon
overcome
Directory of Open Access Journals (Sweden)
Feng Zhi
Full Text Available Multidrug resistance (MDR is a major impediment to successful cancer chemotherapy. Co-delivery of novel MDR-reversing agents and anticancer drugs to cancer cells holds great promise for cancer treatment. MicroRNA-21 (miR-21 overexpression is associated with the development and progression of MDR in breast cancer, and it is emerging as a novel and promising MDR-reversing target. In this study, a multifunctional nanocomplex, composed of polyethylenimine (PEI/poly(sodium 4-styrenesulfonates (PSS/graphene oxide (GO and termed PPG, was prepared using the layer-by-layer assembly method to evaluate the reversal effects of PPG as a carrier for adriamycin (ADR along with miR-21 targeted siRNA (anti-miR-21 in cancer drug resistance. ADR was firstly loaded onto the PPG surface (PPGADR by physical mixing and anti-miR-21 was sequentially loaded onto PPGADR through electric absorption to form (anti-miR-21PPGADR. Cell experiments showed that PPG significantly enhanced the accumulation of ADR in MCF-7/ADR cells (an ADR resistant breast cancer cell line and exhibited much higher cytotoxicity than free ADR, suggesting that PPG could effectively reverse ADR resistance of MCF-7/ADR. Furthermore, the enhanced therapeutic efficacy of PPG could be correlated with effective silencing of miR-21 and with increased accumulation of ADR in drug-resistant tumor cells. The endocytosis study confirmed that PPG could effectively carry drug molecules into cells via the caveolae and clathrin-mediated endocytosis pathways. These results suggest that this PPG could be a potential and efficient non-viral vector for reversing MDR, and the strategy of combining anticancer drugs with miRNA therapy to overcome MDR could be an attractive approach in cancer treatment.
Rin4 causes hybrid necrosis and race-specific resistance in an interspecific lettuce hybrid.
Jeuken, Marieke J W; Zhang, Ningwen W; McHale, Leah K; Pelgrom, Koen; den Boer, Erik; Lindhout, Pim; Michelmore, Richard W; Visser, Richard G F; Niks, Rients E
2009-10-01
Some inter- and intraspecific crosses may result in reduced viability or sterility in the offspring, often due to genetic incompatibilities resulting from interactions between two or more loci. Hybrid necrosis is a postzygotic genetic incompatibility that is phenotypically manifested as necrotic lesions on the plant. We observed hybrid necrosis in interspecific lettuce (Lactuca sativa and Lactuca saligna) hybrids that correlated with resistance to downy mildew. Segregation analysis revealed a specific allelic combination at two interacting loci to be responsible. The allelic interaction had two consequences: (1) a quantitative temperature-dependent autoimmunity reaction leading to necrotic lesions, lethality, and quantitative resistance to an otherwise virulent race of Bremia lactucae; and (2) a qualitative temperature-independent race-specific resistance to an avirulent race of B. lactucae. We demonstrated by transient expression and silencing experiments that one of the two interacting genes was Rin4. In Arabidopsis thaliana, RIN4 is known to interact with multiple R gene products, and their interactions result in hypersensitive resistance to Pseudomonas syringae. Site-directed mutation studies on the necrosis-eliciting allele of Rin4 in lettuce showed that three residues were critical for hybrid necrosis.
Fujita, Yasunori; Kojima, Toshio; Kawakami, Kyojiro; Mizutani, Kosuke; Kato, Taku; Deguchi, Takashi; Ito, Masafumi
2015-10-01
The acquisition of drug resistance is one of the most malignant phenotypes of cancer and identification of its therapeutic target is a prerequisite for the development of novel therapy. MicroRNAs (miRNAs) have been implicated in various types of cancer and proposed as potential therapeutic targets for patients. In the present study, we aimed to identify miRNA that could serve as a therapeutic target for taxane-resistant prostate cancer. In order to identify miRNAs related to taxane-resistance, miRNA profiling was performed using prostate cancer PC-3 cells and paclitaxel-resistant PC-3 cell lines established from PC-3 cells. Microarray analysis of mRNA expression was also conducted to search for potential target genes of miRNA. Luciferase reporter assay was performed to examine miRNA binding to the 3'-UTR of target genes. The effects of ectopic expression of miRNA on cell growth, tubulin polymerization, drug sensitivity, and apoptotic signaling pathway were investigated in a paclitaxel-resistant PC-3 cell line. The expression of miR-130a was down-regulated in all paclitaxel-resistant cell lines compared with parental PC-3 cells. Based on mRNA microarray analysis and luciferase reporter assay, we identified SLAIN1 as a direct target gene for miR-130a. Transfection of a miR-130a precursor into a paclitaxel-resistant cell line suppressed cell growth and increased the sensitivity to paclitaxel. Lastly, ectopic expression of miR-130a did not affect the polymerized tubulin level, but activated apoptotic signaling through activation of caspase-8. Our results suggested that reduced expression of miR-130a may be involved in the paclitaxel-resistance and that miR-130a could be a therapeutic target for taxane-resistant prostate cancer patients. © 2015 Wiley Periodicals, Inc.
Energy Technology Data Exchange (ETDEWEB)
Erichsen, Thomas J; Ehmer, Ursula; Kalthoff, Sandra; Lankisch, Tim O; Mueller, Tordis M [Department of Gastroenterology, Hepatology and Endocrinology, Hannover, Medical School, Hannover (Germany); Munzel, Peter A [Department of Toxicology, Institute of Pharmacology and Toxicology, University of Tubingen, Tubingen (Germany); Manns, Michael P [Department of Gastroenterology, Hepatology and Endocrinology, Hannover, Medical School, Hannover (Germany); Strassburg, Christian P. [Department of Gastroenterology, Hepatology and Endocrinology, Hannover, Medical School, Hannover (Germany)], E-mail: strassburg.christian@mh-hannover.de
2008-07-15
UDP glucuronosyltransferases (UGTs) play an important role for drug detoxification and toxicity. UGT function is genetically modulated by single nucleotide polymorphisms (SNPs) which lead to the expression of functionally altered protein, or altered expression levels. UGT1A4 activity includes anticonvulsants, antidepressants and environmental mutagens. In this study the induction of the human UGT1A4 gene and a potential influence of genetic variation in its promoter region were analyzed. SNPs at bp - 219 and - 163 occurred in 9% among 109 blood donors reducing UGT1A4 transcription by 40%. UGT1A4 transcription was dioxin inducible. Reporter gene experiments identified 2 xenobiotic response elements (XRE), which were functionally confirmed by mutagenesis analyses, and binding was demonstrated by electromobility shift assays. Constitutive human UGT1A4 gene expression and induction was aryl hydrocarbon receptor (AhR)-dependent, and reduced in the presence of SNPs at bp - 219 and - 163. AhR-mediated regulation of the human UGT1A4 gene by two XRE and a modulation by naturally occurring genetic variability by SNPs is demonstrated, which indicates gene-environment interaction with potential relevance for drug metabolism.
International Nuclear Information System (INIS)
Erichsen, Thomas J.; Ehmer, Ursula; Kalthoff, Sandra; Lankisch, Tim O.; Mueller, Tordis M.; Munzel, Peter A.; Manns, Michael P.; Strassburg, Christian P.
2008-01-01
UDP glucuronosyltransferases (UGTs) play an important role for drug detoxification and toxicity. UGT function is genetically modulated by single nucleotide polymorphisms (SNPs) which lead to the expression of functionally altered protein, or altered expression levels. UGT1A4 activity includes anticonvulsants, antidepressants and environmental mutagens. In this study the induction of the human UGT1A4 gene and a potential influence of genetic variation in its promoter region were analyzed. SNPs at bp - 219 and - 163 occurred in 9% among 109 blood donors reducing UGT1A4 transcription by 40%. UGT1A4 transcription was dioxin inducible. Reporter gene experiments identified 2 xenobiotic response elements (XRE), which were functionally confirmed by mutagenesis analyses, and binding was demonstrated by electromobility shift assays. Constitutive human UGT1A4 gene expression and induction was aryl hydrocarbon receptor (AhR)-dependent, and reduced in the presence of SNPs at bp - 219 and - 163. AhR-mediated regulation of the human UGT1A4 gene by two XRE and a modulation by naturally occurring genetic variability by SNPs is demonstrated, which indicates gene-environment interaction with potential relevance for drug metabolism
Wang, Defu; Wang, Xiaobing; Mei, Yu; Dong, Hansong
2016-03-01
Powdery mildew, one of the most destructive wheat diseases worldwide, is caused by Blumeria graminis f. sp. tritici (Bgt), a fungal species with a consistently high mutation rate that makes individual resistance (R) genes ineffective. Therefore, effective resistance-related gene cloning is vital for breeding and studying the resistance mechanisms of the disease. In this study, a putative nucleotide-binding site-leucine-rich repeat (NBS-LRR) R gene (TaRGA) was cloned using a homology-based cloning strategy and analyzed for its effect on powdery mildew disease and wheat defense responses. Real-time reverse transcription-PCR (RT-PCR) analyses revealed that a Bgt isolate 15 and salicylic acid stimulation significantly induced TaRGA in the resistant variety. Furthermore, the silencing of TaRGA in powdery mildew-resistant plants increased susceptibility to Bgt15 and prompted conidia propagation at the infection site. However, the expression of TaRGA in leaf segments after single-cell transient expression assay highly increased the defense responses to Bgt15 by enhancing callose deposition and phenolic autofluorogen accumulation at the pathogen invading sites. Meanwhile, the expression of pathogenesis-related genes decreased in the TaRGA-silenced plants and increased in the TaRGA-transient-overexpressing leaf segments. These results implied that the TaRGA gene positively regulates the defense response to powdery mildew disease in wheat.
Recombination Rate Heterogeneity within Arabidopsis Disease Resistance Genes.
Choi, Kyuha; Reinhard, Carsten; Serra, Heïdi; Ziolkowski, Piotr A; Underwood, Charles J; Zhao, Xiaohui; Hardcastle, Thomas J; Yelina, Nataliya E; Griffin, Catherine; Jackson, Matthew; Mézard, Christine; McVean, Gil; Copenhaver, Gregory P; Henderson, Ian R
2016-07-01
Meiotic crossover frequency varies extensively along chromosomes and is typically concentrated in hotspots. As recombination increases genetic diversity, hotspots are predicted to occur at immunity genes, where variation may be beneficial. A major component of plant immunity is recognition of pathogen Avirulence (Avr) effectors by resistance (R) genes that encode NBS-LRR domain proteins. Therefore, we sought to test whether NBS-LRR genes would overlap with meiotic crossover hotspots using experimental genetics in Arabidopsis thaliana. NBS-LRR genes tend to physically cluster in plant genomes; for example, in Arabidopsis most are located in large clusters on the south arms of chromosomes 1 and 5. We experimentally mapped 1,439 crossovers within these clusters and observed NBS-LRR gene associated hotspots, which were also detected as historical hotspots via analysis of linkage disequilibrium. However, we also observed NBS-LRR gene coldspots, which in some cases correlate with structural heterozygosity. To study recombination at the fine-scale we used high-throughput sequencing to analyze ~1,000 crossovers within the RESISTANCE TO ALBUGO CANDIDA1 (RAC1) R gene hotspot. This revealed elevated intragenic crossovers, overlapping nucleosome-occupied exons that encode the TIR, NBS and LRR domains. The highest RAC1 recombination frequency was promoter-proximal and overlapped CTT-repeat DNA sequence motifs, which have previously been associated with plant crossover hotspots. Additionally, we show a significant influence of natural genetic variation on NBS-LRR cluster recombination rates, using crosses between Arabidopsis ecotypes. In conclusion, we show that a subset of NBS-LRR genes are strong hotspots, whereas others are coldspots. This reveals a complex recombination landscape in Arabidopsis NBS-LRR genes, which we propose results from varying coevolutionary pressures exerted by host-pathogen relationships, and is influenced by structural heterozygosity.
Directory of Open Access Journals (Sweden)
He eLiu
2014-10-01
Full Text Available Acidovorax avenae subsp. avenae is the causal agent of bacterial brown stripe disease in rice. In this study, we characterized a novel horizontal transfer of a gene cluster, including tetR, on the chromosome of A. avenae subsp. avenae RS-1 by genome-wide analysis. TetR acted as a repressor in this gene cluster and the oxidative stress resistance was enhanced in tetR-deletion mutant strain. Electrophoretic mobility shift assay (EMSA demonstrated that TetR regulator bound directly to the promoter of this gene cluster. Consistently, the results of quantitative real-time PCR also showed alterations in expression of associated genes. Moreover, the proteins affected by TetR under oxidative stress were revealed by comparing proteomic profiles of wild-type and mutant strains via 1D SDS-PAGE and LC-MS/MS analyses. Taken together, our results demonstrated that tetR gene in this novel gene cluster contributed to cell survival under oxidative stress, and TetR protein played an important regulatory role in growth kinetics, biofilm-forming capability, SOD and catalase activity, and oxide detoxicating ability.
Liu, He; Yang, Chun-Lan; Ge, Meng-Yu; Ibrahim, Muhammad; Li, Bin; Zhao, Wen-Jun; Chen, Gong-You; Zhu, Bo; Xie, Guan-Lin
2014-01-01
Acidovorax avenae subsp. avenae is the causal agent of bacterial brown stripe disease in rice. In this study, we characterized a novel horizontal transfer of a gene cluster, including tetR, on the chromosome of A. avenae subsp. avenae RS-1 by genome-wide analysis. TetR acted as a repressor in this gene cluster and the oxidative stress resistance was enhanced in tetR-deletion mutant strain. Electrophoretic mobility shift assay demonstrated that TetR regulator bound directly to the promoter of this gene cluster. Consistently, the results of quantitative real-time PCR also showed alterations in expression of associated genes. Moreover, the proteins affected by TetR under oxidative stress were revealed by comparing proteomic profiles of wild-type and mutant strains via 1D SDS-PAGE and LC-MS/MS analyses. Taken together, our results demonstrated that tetR gene in this novel gene cluster contributed to cell survival under oxidative stress, and TetR protein played an important regulatory role in growth kinetics, biofilm-forming capability, superoxide dismutase and catalase activity, and oxide detoxicating ability.
Steele, Laura D.; Coates, Brad; Valero, M. Carmen; Sun, Weilin; Seong, Keon Mook; Muir, William M.; Clark, John M.; Pittendrigh, Barry R.
2015-01-01
Adaptation of insect phenotypes for survival after exposure to xenobiotics can result from selection at multiple loci with additive genetic effects. To the authors’ knowledge, no selective sweep analysis has been performed to identify such loci in highly dichlorodiphenyltrichloroethane (DDT) resistant insects. Here we compared a highly DDT resistant phenotype in the Drosophila melanogaster (Drosophila) 91-R strain to the DDT susceptible 91-C strain, both of common origin. Whole genome re-sequencing data from pools of individuals was generated separately for 91-R and 91-C, and mapped to the reference Drosophila genome assembly (v. 5.72). Thirteen major and three minor effect chromosome intervals with reduced nucleotide diversity (π) were identified only in the 91-R population. Estimates of Tajima's D (D) showed corresponding evidence of directional selection in these same genome regions of 91-R, however, no similar reductions in π or D estimates were detected in 91-C. An overabundance of non-synonymous proteins coding to synonymous changes were identified in putative open reading frames associated with 91-R. Except for NinaC and Cyp4g1, none of the identified genes were the ‘usual suspects’ previously observed to be associated with DDT resistance. Additionally, up-regulated ATP-binding cassette transporters have been previously associated with DDT resistance; however, here we identified a structurally altered MDR49 candidate resistance gene. The remaining fourteen genes have not previously been shown to be associated with DDT resistance. These results suggest hitherto unknown mechanisms of DDT resistance, most of which have been overlooked in previous transcriptional studies, with some genes having orthologs in mammals. PMID:25826265
Directory of Open Access Journals (Sweden)
François Lebreton
Full Text Available Oxidative stress serves as an important host/environmental signal that triggers a wide range of responses in microorganisms. Here, we identified an oxidative stress sensor and response regulator in the important multidrug-resistant nosocomial pathogen Enterococcus faecium belonging to the MarR family and called AsrR (antibiotic and stress response regulator. The AsrR regulator used cysteine oxidation to sense the hydrogen peroxide which results in its dissociation to promoter DNA. Transcriptome analysis showed that the AsrR regulon was composed of 181 genes, including representing functionally diverse groups involved in pathogenesis, antibiotic and antimicrobial peptide resistance, oxidative stress, and adaptive responses. Consistent with the upregulated expression of the pbp5 gene, encoding a low-affinity penicillin-binding protein, the asrR null mutant was found to be more resistant to β-lactam antibiotics. Deletion of asrR markedly decreased the bactericidal activity of ampicillin and vancomycin, which are both commonly used to treat infections due to enterococci, and also led to over-expression of two major adhesins, acm and ecbA, which resulted in enhanced in vitro adhesion to human intestinal cells. Additional pathogenic traits were also reinforced in the asrR null mutant including greater capacity than the parental strain to form biofilm in vitro and greater persistance in Galleria mellonella colonization and mouse systemic infection models. Despite overexpression of oxidative stress-response genes, deletion of asrR was associated with a decreased oxidative stress resistance in vitro, which correlated with a reduced resistance to phagocytic killing by murine macrophages. Interestingly, both strains showed similar amounts of intracellular reactive oxygen species. Finally, we observed a mutator phenotype and enhanced DNA transfer frequencies in the asrR deleted strain. These data indicate that AsrR plays a major role in antimicrobial
Chen, Hongbin; Wu, Weiyuan; Ni, Ming; Liu, Yingmei; Zhang, Jixia; Xia, Fei; He, Wenqiang; Wang, Qi; Wang, Zhanwei; Cao, Bin; Wang, Hui
2013-10-01
Genetic characterisation of linezolid-resistant Gram-positive cocci in a multicentre study in China has not been reported previously. To study the mechanism underlying the resistance of linezolid-resistant isolates, nine Enterococcus faecalis, one Enterococcus faecium and three Staphylococcus cohnii isolates with various levels of resistance were collected from five hospitals across China in 2009-2012. The nine E. faecalis isolates were classified into seven sequence types, indicating that these linezolid-resistant E. faecalis isolates were polyclonal. Enterococci isolates had reduced susceptibility to linezolid (MICs of 4-8 mg/L) and had mutation of ribosomal protein L3, with three also having mutation of L4, but without the multidrug resistance gene cfr or the 23S rRNA mutation G2576T. The three S. cohnii isolates were highly resistant to linezolid (MICs of 64 mg/L to >256 mg/L), harboured the cfr gene and had the 23S rRNA mutation G2576T. Southern blotting indicated that the cfr gene of these three isolates resided on different plasmids (pHK01, pRM01 and pRA01). In plasmid pHK01, IS21-558 and the cfr gene were integrated into transposon Tn558. In plasmids pRM01 and pRA01, the cfr gene was flanked by two copies of an IS256-like insertion sequence, indicating that the transferable form of linezolid resistance is conferred by the cfr gene. In conclusion, the emergence of linezolid-resistant Gram-positive cocci in different regions of China is of concern. The cfr gene and the 23S rRNA mutation contribute to high-level linezolid resistance in S. cohnii, and the L3 and L4 mutations are associated with low-level linezolid resistance in enterococci. Copyright © 2013 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.
Directory of Open Access Journals (Sweden)
Akkina Ramesh
2005-01-01
Full Text Available Abstract Background RNA interference (RNAi mediated by small interfering RNAs (siRNAs has proved to be a highly effective gene silencing mechanism with great potential for HIV/AIDS gene therapy. Previous work with siRNAs against cellular coreceptors CXCR4 and CCR5 had shown that down regulation of these surface molecules could prevent HIV-1 entry and confer viral resistance. Since monospecific siRNAs targeting individual coreceptors are inadequate in protecting against both T cell tropic (X4 and monocyte tropic (R5 viral strains simultaneously, bispecific constructs with dual specificity are required. For effective long range therapy, the bispecific constructs need to be stably transduced into HIV-1 target cells via integrating viral vectors. Results To achieve this goal, lentiviral vectors incorporating both CXCR4 and CCR5 siRNAs of short hairpin design were constructed. The CXCR4 siRNA was driven by a U6 promoter whereas the CCR5 siRNA was driven by an H1 promoter. A CMV promoter driven EGFP reporter gene is also incorporated in the bispecific construct. High efficiency transduction into coreceptor expressing Magi and Ghost cell lines with a concomitant down regulation of respective coreceptors was achieved with lentiviral vectors. When the siRNA expressing transduced cells were challenged with X4 and R5 tropic HIV-1, they demonstrated marked viral resistance. HIV-1 resistance was also observed in bispecific lentiviral vector transduced primary PBMCs. Conclusions Both CXCR4 and CCR5 coreceptors could be simultaneously targeted for down regulation by a single combinatorial lentiviral vector incorporating respective anti-coreceptor siRNAs. Stable down regulation of both the coreceptors protects cells against infection by both X4 and R5 tropic HIV-1. Stable down regulation of cellular molecules that aid in HIV-1 infection will be an effective strategy for long range HIV gene therapy.
Keen, Patricia L; Knapp, Charles W; Hall, Kenneth J; Graham, David W
2018-07-01
Environmental transport of contaminants that can influence the development of antibiotic resistance in bacteria is an important concern in the management of ecological and human health risks. Agricultural regions are locales where practices linked to food crop and livestock production can introduce contaminants that could alter the selective pressures for the development of antibiotic resistance in microbiota. This is important in regions where the use of animal manure or municipal biosolids as waste and/or fertilizer could influence selection for antibiotic resistance in pathogenic bacterial species. To investigate the environmental transport of contaminants that could lead to the development of antibiotic resistance in bacteria, a watershed with one of the highest levels of intensity of agricultural activity in Canada was studied; the Sumas River located 60 km east of Vancouver, British Columbia. This two-year assessment monitored four selected tetracycline resistance genes (tet(O), tet(M), tet(Q), tet(W)) and water quality parameters (temperature, specific conductivity, turbidity, suspended solids, nitrate, phosphate and chloride) at eight locations across the watershed. The tetracycline resistance genes (Tc r ) abundances in the Sumas River network ranged between 1.47 × 10 2 and 3.49 × 10 4 copies/mL and ranged between 2.3 and 6.9 copies/mL in a control stream (located far from agricultural activities) for the duration of the study. Further, Tc r abundances that were detected in the wet season months ranged between 1.3 × 10 3 and 2.29 × 10 4 copies/mL compared with dry season months (ranging between 0.6 and 31.2 copies/mL). Highest transport rates between 1.67 × 10 11 and 1.16 × 10 12 copies/s were observed in November 2005 during periods of high rainfall. The study showed that elevated concentrations of antibiotic resistance genes in the order of 10 2 -10 4 copies/mL can move through stream networks in an
Talukder, Zahirul I; Hulke, Brent S; Qi, Lili; Scheffler, Brian E; Pegadaraju, Venkatramana; McPhee, Kevin; Gulya, Thomas J
2014-01-01
Functional markers for Sclerotinia basal stalk rot resistance in sunflower were obtained using gene-level information from the model species Arabidopsis thaliana. Sclerotinia stalk rot, caused by Sclerotinia sclerotiorum, is one of the most destructive diseases of sunflower (Helianthus annuus L.) worldwide. Markers for genes controlling resistance to S. sclerotiorum will enable efficient marker-assisted selection (MAS). We sequenced eight candidate genes homologous to Arabidopsis thaliana defense genes known to be associated with Sclerotinia disease resistance in a sunflower association mapping population evaluated for Sclerotinia stalk rot resistance. The total candidate gene sequence regions covered a concatenated length of 3,791 bp per individual. A total of 187 polymorphic sites were detected for all candidate gene sequences, 149 of which were single nucleotide polymorphisms (SNPs) and 38 were insertions/deletions. Eight SNPs in the coding regions led to changes in amino acid codons. Linkage disequilibrium decay throughout the candidate gene regions declined on average to an r (2) = 0.2 for genetic intervals of 120 bp, but extended up to 350 bp with r (2) = 0.1. A general linear model with modification to account for population structure was found the best fitting model for this population and was used for association mapping. Both HaCOI1-1 and HaCOI1-2 were found to be strongly associated with Sclerotinia stalk rot resistance and explained 7.4 % of phenotypic variation in this population. These SNP markers associated with Sclerotinia stalk rot resistance can potentially be applied to the selection of favorable genotypes, which will significantly improve the efficiency of MAS during the development of stalk rot resistant cultivars.
Casey, Céline; Stölting, Kai N.; Barbará, Thelma; González-Martínez, Santiago C.; Lexer, Christian
2015-01-01
Resistance genes (R-genes) are essential for long-lived organisms such as forest trees, which are exposed to diverse herbivores and pathogens. In short-lived model species, R-genes have been shown to be involved in species isolation. Here, we studied more than 400 trees from two natural hybrid zones of the European Populus species Populus alba and Populus tremula for microsatellite markers located in three R-gene clusters, including one cluster situated in the incipient sex chromosome region....
Zhang, Chun; Feng, Li; Tian, Xing-Shan
2018-04-26
The herbicide glyphosate inhibits the enzyme 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). Overexpression of the EPSPS gene is one of the molecular mechanisms conferring glyphosate resistance in weeds, but the transcriptional regulation of this gene is poorly understood. The EPSPS gene was found to be significantly up-regulated following glyphosate treatment in a glyphosate- resistant Eleusine indica population from South China. To further investigate the regulation of EPSPS overexpression, the promoter of the EPSPS gene from this E. indica population was cloned and analyzed. Two upstream regulatory sequences, Epro-S (862 bp) and Epro-R (877 bp) of EPSPS were obtained from glyphosate-susceptible (S) and -resistant (R) E. indica plants respectively by HiTAIL-PCR. The Epro-S and Epro-R sequences were 99% homologous, except for the two insertions (3 bp and12 bp) in the R sequence. The 12-base insertion of the Epro-R sequence was located in the 5'-UTR-Py-rich stretch element. The promoter activity tests showed that the 12-base insertion resulted in significant enhancement of the Epro-R promoter activity, whereas the 3-base insertion had little effect on Epro-R promoter activity. Alterations in the 5'-UTR-Py-rich stretch element of EPSPS are responsible for glyphosate induced EPSPS overexpression. Therefore, EPSPS transcriptional regulation confers glyphosate resistance in this E. indica population. This article is protected by copyright. All rights reserved.
Burlibașa, Liliana; Suciu, Ilinca
2015-12-01
Oogenesis is a critical event in the formation of female gamete, whose role in development is to transfer genomic information to the next generation. During this process, the gene expression pattern changes dramatically concomitant with genome remodelling, while genomic information is stably maintained. The aim of the present study was to investigate the presence of H4 acetylation of the oocyte and somatic 5S rRNA genes in Triturus cristatus, using chromatin immunoprecipitation assay (ChIP). Our findings suggest that some epigenetic mechanisms such as histone acetylation could be involved in the transcriptional regulation of 5S rRNA gene families.
Giesbers, A.K.J.; Pelgrom, Alexandra; Visser, R.G.F.; Niks, R.E.; Ackerveken, Van Den Guido; Jeuken, M.J.W.
2017-01-01
Candidate effectors from lettuce downy mildew (Bremia lactucae) enable high-throughput germplasm screening for the presence of resistance (R) genes. The nonhost species Lactuca saligna comprises a source of B. lactucae R genes that has hardly been exploited in lettuce breeding. Its
Giesbers, Anne K J; Pelgrom, Alexandra J E; Visser, Richard G F; Niks, Rients E; Van den Ackerveken, Guido; Jeuken, Marieke J W
2017-01-01
Candidate effectors from lettuce downy mildew (Bremia lactucae) enable high-throughput germplasm screening for the presence of resistance (R) genes. The nonhost species Lactuca saligna comprises a source of B. lactucae R genes that has hardly been exploited in lettuce breeding. Its
Rin4 Causes Hybrid Necrosis and Race-Specific Resistance in an Interspecific Lettuce Hybrid[W
Jeuken, Marieke J.W.; Zhang, Ningwen W.; McHale, Leah K.; Pelgrom, Koen; den Boer, Erik; Lindhout, Pim; Michelmore, Richard W.; Visser, Richard G.F.; Niks, Rients E.
2009-01-01
Some inter- and intraspecific crosses may result in reduced viability or sterility in the offspring, often due to genetic incompatibilities resulting from interactions between two or more loci. Hybrid necrosis is a postzygotic genetic incompatibility that is phenotypically manifested as necrotic lesions on the plant. We observed hybrid necrosis in interspecific lettuce (Lactuca sativa and Lactuca saligna) hybrids that correlated with resistance to downy mildew. Segregation analysis revealed a specific allelic combination at two interacting loci to be responsible. The allelic interaction had two consequences: (1) a quantitative temperature-dependent autoimmunity reaction leading to necrotic lesions, lethality, and quantitative resistance to an otherwise virulent race of Bremia lactucae; and (2) a qualitative temperature-independent race-specific resistance to an avirulent race of B. lactucae. We demonstrated by transient expression and silencing experiments that one of the two interacting genes was Rin4. In Arabidopsis thaliana, RIN4 is known to interact with multiple R gene products, and their interactions result in hypersensitive resistance to Pseudomonas syringae. Site-directed mutation studies on the necrosis-eliciting allele of Rin4 in lettuce showed that three residues were critical for hybrid necrosis. PMID:19855048
Directory of Open Access Journals (Sweden)
Aditya Verma
2017-12-01
Full Text Available Widespread resistance towards antimony and reports of relapses following miltefosine treatment has severely affected the management of visceral leishmaniasis (VL in the Indian subcontinent. Paromomycin (PMM, an aminoglycoside antibiotic, has been licensed for VL treatment in India in 2007. Although its use is still restricted in the field, unraveling the molecular mechanism of resistance towards PMM is the key to preserve the drug. In this study, PMM resistant lines were selected up to 100 μM of PMM in three distinct field isolates of Leishmania donovani at promastigote stage. The resistance induced at promastigote level was also evident in amastigotes which showed 6 fold decreases in PMM susceptibility. Comparative transcriptome profiling of PMM resistant (PMM-R and the corresponding PMM sensitive (PMM-S parasites revealed modulated expression of 500 genes (1.5 fold cut off in PMM-R parasites. Selected genes were validated for their modulated expression by quantitative real-time PCR. Functional classification and pathway analysis of modulated genes indicated probable adaptations in drug resistant lines which included a reduced oxidative phosphorylation; b increased glycosomal succinate fermentation and substrate level phosphorylation; c dependency on lipids and amino acids for energy generation; d reduced DNA synthesis and increased DNA damage repair and e decreased protein synthesis and degradation. Interestingly, PMM-R parasites showed a marked increase in PMM susceptibility in presence of verapamil and amlodipine, antagonists of Ca2+ channel that are also modulators of ABC transporters. Moreover, infection of macrophages by PMM-R parasites led to modulated nitric oxide (NO levels while reactive oxygen species (ROS level remained unaltered. The present study highlights the putative mechanisms of PMM resistance in Leishmania. Keywords: Leishmania donovani, Drug resistance, Paromomycin, Transcriptome, ABC transporters, Nitric oxide, Visceral
Dai, Lingmin; Wang, Dan; Xie, Xiaoqing; Zhang, Chaohong; Wang, Xiping; Xu, Yan; Wang, Yuejin; Zhang, Jianxia
2016-01-01
Pathogenesis-related proteins (PRs) can lead to increased resistance of the whole plant to pathogen attack. Here, we isolate and characterize a PR-4 protein (VpPR4-1) from a wild Chinese grape Vitis pseudoreticulata which shows greatly elevated transcription following powdery mildew infection. Its expression profiles under a number of abiotic stresses were also investigated. Powdery mildew, salicylic acid, and jasmonic acid methyl ester significantly increased the VpPR4-1 induction while NaCl and heat treatments just slightly induced VpPR4-1 expression. Abscisic acid and cold treatment slightly affected the expression level of VpPR4-1. The VpPR4-1 gene was overexpressed in 30 regenerated V. vinifera cv. Red Globe via Agrobacterium tumefaciens-mediated transformation and verified by the Western blot. The 26 transgenic grapevines exhibited higher expression levels of PR-4 protein content than wild-type vines and six of them were inoculated with powdery mildew which showed that the growth of powdery mildew was repressed. The powdery mildew-resistance of Red Globe transformed with VpPR4-1 was enhanced inoculated with powdery mildew. Moreover, other powdery mildew resistant genes were associated with feedback regulation since VpPR4-1 is in abundance. This study demonstrates that PR-4 protein in grapes plays a vital role in defense against powdery mildew invasion.
Miller, Jennifer H; Novak, John T; Knocke, William R; Young, Katherine; Hong, Yanjuan; Vikesland, Peter J; Hull, Matthew S; Pruden, Amy
2013-05-01
Water resource recovery facilities have been described as creating breeding ground conditions for the selection, transfer, and dissemination of antibiotic resistance genes (ARGs) among various bacteria. The objective of this study was to determine the effect of direct addition of antibiotic and silver nanoparticles (Ag NPs, or nanosilver) on the occurrence of ARGs in thermophilic anaerobic digesters. Test thermophilic digesters were amended with environmentally-relevant concentrations of Ag NP (0.01, 0.1, and 1.0 mg-Ag/L; corresponding to approximately 0.7, 7.0, and 70 mg-Ag/kg total solids) and sulfamethoxazole (SMX) that span susceptible to resistant classifications (1, 5, and 50 mg/L) as potential selection pressures for ARGs. Tetracycline (tet(O), tet(W)) and sulfonamide (sulI, sulII) ARGs and the integrase enzyme gene (intI1) associated with Class 1 integrons were measured in raw sludge, test thermophilic digesters, a control thermophilic digester, and a control mesophilic digester. There was no apparent effect of Ag NPs on thermophilic anaerobic digester performance. The maximum SMX addition (50 mg/L) resulted in accumulation of volatile fatty acids and low pH, alkalinity, and volatile solids reduction. There was no significant difference between ARG gene copy numbers (absolute or normalized to 16S rRNA genes) in amended thermophilic digesters and the control thermophilic digester. Antibiotic resistance gene copy numbers in digested sludge ranged from 10(3) to 10(6) copies per microL (approximately 8 x10(1) to 8 x 10(4) copies per microg) of sludge as result of a 1-log reduction of ARGs (2-log reduction for intI1). Quantities of the five ARGs in raw sludge ranged from 10(4) to 10(8) copies per microL (approximately 4 x 10(2) to 4 x 10(6) per microg) of sludge. Test and control thermophilic digesters (53 degrees C, 12-day solids retention time [SRT]) consistently reduced but did not eliminate levels of all analyzed genes. The mesophilic digester (37 degrees C
Transgenic Cavendish bananas with resistance to Fusarium wilt tropical race 4.
Dale, James; James, Anthony; Paul, Jean-Yves; Khanna, Harjeet; Smith, Mark; Peraza-Echeverria, Santy; Garcia-Bastidas, Fernando; Kema, Gert; Waterhouse, Peter; Mengersen, Kerrie; Harding, Robert
2017-11-14
Banana (Musa spp.) is a staple food for more than 400 million people. Over 40% of world production and virtually all the export trade is based on Cavendish banana. However, Cavendish banana is under threat from a virulent fungus, Fusarium oxysporum f. sp. cubense tropical race 4 (TR4) for which no acceptable resistant replacement has been identified. Here we report the identification of transgenic Cavendish with resistance to TR4. In our 3-year field trial, two lines of transgenic Cavendish, one transformed with RGA2, a gene isolated from a TR4-resistant diploid banana, and the other with a nematode-derived gene, Ced9, remain disease free. Transgene expression in the RGA2 lines is strongly correlated with resistance. Endogenous RGA2 homologs are also present in Cavendish but are expressed tenfold lower than that in our most resistant transgenic line. The expression of these homologs can potentially be elevated through gene editing, to provide non-transgenic resistance.
Directory of Open Access Journals (Sweden)
Teng Xu
Full Text Available Plasmids are important antibiotic resistance determinant carriers that can disseminate various drug resistance genes among species or genera. By using a high throughput sequencing approach, two groups of plasmids of Escherichia coli (named E1 and E2, each consisting of 160 clinical E. coli strains isolated from different periods of time were sequenced and analyzed. A total of 20 million reads were obtained and mapped onto the known resistance gene sequences. As a result, a total of 9 classes, including 36 types of antibiotic resistant genes, were identified. Among these genes, 25 and 27 single nucleotide polymorphisms (SNPs appeared, of which 9 and 12 SNPs are nonsynonymous substitutions in the E1 and E2 samples. It is interesting to find that a novel genotype of bla(KLUC, whose close relatives, bla(KLUC-1 and bla(KLUC-2, have been previously reported as carried on the Kluyvera cryocrescens chromosome and Enterobacter cloacae plasmid, was identified. It shares 99% and 98% amino acid identities with Kluc-1 and Kluc-2, respectively. Further PCR screening of 608 Enterobacteriaceae family isolates yielded a second variant (named bla(KLUC-4. It was interesting to find that Kluc-3 showed resistance to several cephalosporins including cefotaxime, whereas bla(KLUC-4 did not show any resistance to the antibiotics tested. This may be due to a positively charged residue, Arg, replaced by a neutral residue, Leu, at position 167, which is located within an omega-loop. This work represents large-scale studies on resistance gene distribution, diversification and genetic variation in pooled multi-drug resistance plasmids, and provides insight into the use of high throughput sequencing technology for microbial resistance gene detection.
Zhang, Yan; Wang, Qing; Chen, Li; Yang, Hsin-Sheng
2015-03-01
Agents targeting insulin-like growth factor 1 receptor (IGF-1R) are being actively examined in clinical trials. Although there has been some initial success of single-agent targeting IGF-1R, attempts in later studies failed because of resistance. This study aimed to understand the effects of programmed cell death 4 (Pdcd4) on the chemosensitivity of the IGF-1R inhibitor OSI-906 in colorectal cancer cells and the mechanism underlying this impact. Using OSI-906-resistant and -sensitive colorectal cancer cells, we found that the Pdcd4 level directly correlates with cell chemosensitivity to OSI-906. In addition, tumors derived from Pdcd4 knockdown cells resist the growth inhibitory effect of OSI-906 in a colorectal cancer xenograft mouse model. Moreover, Pdcd4 enhances the antiproliferative effect of OSI-906 in resistant cells through suppression of p70S6K1 activation. Knockdown of p70S6K1, but not p70S6K2, significantly increases the chemosensitivity of OSI-906 in cultured colorectal cancer cells. Furthermore, the combination of OSI-906 and PF-4708671, a p70S6K1 inhibitor, efficiently suppresses the growth of OSI-906-resistant colon tumor cells in vitro and in vivo. Taken together, activation of p70S6K1 that is inhibited by Pdcd4 is essential for resistance to the IGF-1R inhibitor in colon tumor cells, and the combinational treatment of OSI-906 and PF-4708671 results in enhanced antiproliferation effects in colorectal cancer cells in vitro and in vivo, providing a novel venue to overcome the resistance to the IGF-1R inhibitor in treating colorectal cancer. ©2015 American Association for Cancer Research.
International Nuclear Information System (INIS)
Hoatlin, M.E.; Kozak, S.L.; Kabat, D.; Lilly, F.; Chakraborti, A.; Kozak, C.A.
1990-01-01
The leukemogenic membrane glycoprotein (gp55) encoded by Friend spleen focus-forming virus appears to bind to erythropoietin receptors (EpoR) to stimulate erythroblastosis. To directly compare the effects of gp55 with erythropoietin (Epo), the authors produced retrovirions that encode either gp55, Epo, or EpoR. After infection with EpoR virus, interleukin 3-dependent DA-3 cells bound 125 I-labeled Epo and grew without interleukin 3 in the presence of Epo. These latter cells, but not parental DA-3 cells, became factor-independent after superinfection either with Epo virus or with Friend spleen focus-forming virus. In addition, Epo virus caused a disease in mice that mimicked Friend erythroleukemia. Although Fv-2 r homozygotes are susceptible to all other retroviral diseases, they are resistant to both Epo viral and Friend viral erythroleukemia. These results indicate that both gp55 and Epo stimulate EpoR and that the Fv-2 gene encodes a protein that controls response to these ligands. However, the Fv-2 protein is not EpoR because the corresponding genes map to opposite ends of mouse chromosome 9. These results have important implications for understanding signal transduction by EpoR and the role of host genetic variation in controlling susceptibility to an oncogenic protein
Qi, L L; Seiler, G J; Vick, B A; Gulya, T J
2012-09-01
Sunflower oil is one of the major sources of edible oil. As the second largest hybrid crop in the world, hybrid sunflowers are developed by using the PET1 cytoplasmic male sterility system that contributes to a 20 % yield advantage over the open-pollinated varieties. However, sunflower production in North America has recently been threatened by the evolution of new virulent pathotypes of sunflower rust caused by the fungus Puccinia helianthi Schwein. Rf ANN-1742, an 'HA 89' backcross restorer line derived from wild annual sunflower (Helianthus annuus L.), was identified as resistant to the newly emerged rust races. The aim of this study was to elucidate the inheritance of rust resistance and male fertility restoration and identify the chromosome location of the underlying genes in Rf ANN-1742. Chi-squared analysis of the segregation of rust response and male fertility in F(2) and F(3) populations revealed that both traits are controlled by single dominant genes, and that the rust resistance gene is closely linked to the restorer gene in the coupling phase. The two genes were designated as R ( 11 ) and Rf5, respectively. A set of 723 mapped SSR markers of sunflower was used to screen the polymorphism between HA 89 and the resistant plant. Bulked segregant analysis subsequently located R ( 11 ) on linkage group (LG) 13 of sunflower. Based on the SSR analyses of 192 F(2) individuals, R ( 11 ) and Rf5 both mapped to the lower end of LG13 at a genetic distance of 1.6 cM, and shared a common marker, ORS728, which was mapped 1.3 cM proximal to Rf5 and 0.3 cM distal to R ( 11 ) (Rf5/ORS728/R ( 11 )). Two additional SSRs were linked to Rf5 and R ( 11 ): ORS995 was 4.5 cM distal to Rf5 and ORS45 was 1.0 cM proximal to R ( 11 ). The advantage of such an introduced alien segment harboring two genes is its large phenotypic effect and simple inheritance, thereby facilitating their rapid deployment in sunflower breeding programs. Suppressed recombination was observed in LGs 2, 9
DEFF Research Database (Denmark)
Dam, M; Douthwaite, S; Tenson, T
1996-01-01
Mutations in domain II of Escherichia coli 23 S rRNA that cause resistance to erythromycin do so in a manner fundamentally different from mutations at the drug binding site in domain V of the 23 S rRNA. The domain II mutations are located in a hairpin structure between nucleotides 1198 and 1247...... this hypothesis, a range of point mutations was generated in domain II of 23 S rRNA in the vicinity of the E-peptide open reading frame. We find a correlation between erythromycin resistance of the mutant clones and increased accessibility of the ribosome binding site of the E-peptide gene. Furthermore......, the erythromycin resistance determinant in the mutants was shown to be confined to a small 23 S rRNA segment containing the coding region and the ribosome binding site of the E-peptide open reading frame. It thus appears that the domain II mutations mediate erythromycin resistance by increasing expression...
DEFF Research Database (Denmark)
Luo, Gang; Li, Bing; Li, Li-Guan
2017-01-01
resistance genes (MRGs). The total abundance of ARGs in all the samples varied from 7 × 10-3 to 1.08 × 10-1 copy of ARG/copy of 16S-rRNA gene, and the samples obtained from thermophilic biogas reactors had a lower total abundance of ARGs, indicating the superiority of thermophilic anaerobic digestion......Digested residues from biogas plants are often used as biofertilizers for agricultural crops cultivation. The antibiotic resistance genes (ARGs) in digested residues pose a high risk to public health due to their potential spread to the disease-causing microorganisms and thus reduce...... the susceptibility of disease-causing microorganisms to antibiotics in medical treatment. A high-throughput sequencing (HTS)-based metagenomic approach was used in the present study to investigate the variations of ARGs in full-scale biogas reactors and the correlations of ARGs with microbial communities and metal...
Infante, Victor Hugo Pacagnelli; Conceição, Natália; de Oliveira, Adriana Gonçalves; Darini, Ana Lúcia da Costa
2016-04-01
The aim of the present study was to verify whether penicillin-resistant, ampicillin-susceptible Enterococcus faecalis (PRASEF) occurred in Brazil prior to the beginning of the 21st century, and to verify whether ampicillin susceptibility can predict susceptibility to other β-lactams in E. faecalis with this inconsistent phenotype. The presence of polymorphisms in the pbp4 gene and genetic diversity among the isolates were investigated. Of 21 PRASEF analyzed, 5 (23.8%) and 4 (19.0%) were imipenem and piperacillin resistant simultaneously by disk diffusion and broth dilution respectively, contradicting the current internationally accepted standards of susceptibility testing. Sequencing of pbp4 gene revealed an amino acid substitution (Asp-573→Glu) in all PRASEF isolates but not in the penicillin-susceptible, ampicillin-susceptible E. faecalis. Most PRASEF (90.5%) had related pulsed-field gel electrophoresis profiles, but were different from other PRASEF described to date. Results demonstrate that penicillin-resistant, ampicillin-susceptible phenotype was already a reality in the 1990s in E. faecalis isolates in different Brazilian states, and some of these isolates were also imipenem- and piperacillin-resistant; therefore, internationally accepted susceptibility criteria cannot be applied to these isolates. According to pbp4 gene sequencing, this study suggests that a specific amino acid substitution in pbp4 gene found in all PRASEF analyzed is associated with penicillin resistance. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Directory of Open Access Journals (Sweden)
Ana Paula Matoso Teixeira
2008-01-01
Full Text Available Brazil produced 330,000 metric tons of melons in 2005, principally in the Northeast region where one of the most important melon pathogens is the powdery mildew fungus Podosphaera xanthii. The disease is controlled mainly by incorporating single dominant resistance genes into commercial hybrids. We report on linkage analysis of the Pm-1 resistance gene, introgressed from the AF125Pm-1 Cantalupensis Charentais-type breeding line into the yellow-fleshed melon (Group Inodorus breeding line AF426-S by backcrossing to produce the resistant line AF426-R, and the amplified fragment length polymorphism (AFLP marker M75/H35_155 reported to be polymorphic between AF426-S and AF426-R. Segregation analysis of M75/H35_155 using a backcross population of 143 plants derived from [AF426-R x AF426-S] x AF426-S and screened for resistance to P. xanthii race 1 produced a recombination frequency of 4.9%, indicating close linkage between M75/H35_155 and Pm-1. Using the same segregating population, the M75/H35_155 marker had previously been reported to be distantly linked to Prv¹, a gene conferring resistance to papaya ringspot virus-type W. Since M75/H35_155 is linked to Prv¹ at a distance of 40.9 cM it is possible that Pm-1 and Prv¹ are also linked.
Clusters of Antibiotic Resistance Genes Enriched Together Stay Together in Swine Agriculture.
Johnson, Timothy A; Stedtfeld, Robert D; Wang, Qiong; Cole, James R; Hashsham, Syed A; Looft, Torey; Zhu, Yong-Guan; Tiedje, James M
2016-04-12
Antibiotic resistance is a worldwide health risk, but the influence of animal agriculture on the genetic context and enrichment of individual antibiotic resistance alleles remains unclear. Using quantitative PCR followed by amplicon sequencing, we quantified and sequenced 44 genes related to antibiotic resistance, mobile genetic elements, and bacterial phylogeny in microbiomes from U.S. laboratory swine and from swine farms from three Chinese regions. We identified highly abundant resistance clusters: groups of resistance and mobile genetic element alleles that cooccur. For example, the abundance of genes conferring resistance to six classes of antibiotics together with class 1 integrase and the abundance of IS6100-type transposons in three Chinese regions are directly correlated. These resistance cluster genes likely colocalize in microbial genomes in the farms. Resistance cluster alleles were dramatically enriched (up to 1 to 10% as abundant as 16S rRNA) and indicate that multidrug-resistant bacteria are likely the norm rather than an exception in these communities. This enrichment largely occurred independently of phylogenetic composition; thus, resistance clusters are likely present in many bacterial taxa. Furthermore, resistance clusters contain resistance genes that confer resistance to antibiotics independently of their particular use on the farms. Selection for these clusters is likely due to the use of only a subset of the broad range of chemicals to which the clusters confer resistance. The scale of animal agriculture and its wastes, the enrichment and horizontal gene transfer potential of the clusters, and the vicinity of large human populations suggest that managing this resistance reservoir is important for minimizing human risk. Agricultural antibiotic use results in clusters of cooccurring resistance genes that together confer resistance to multiple antibiotics. The use of a single antibiotic could select for an entire suite of resistance genes if
Involvement of miR-30c in resistance to doxorubicin by regulating YWHAZ in breast cancer cells
Energy Technology Data Exchange (ETDEWEB)
Fang, Y. [Department of Central Laboratory, The First Affiliated People’s Hospital, Jiangsu University, Zhenjiang, Jiangsu (China); Shen, H. [Department of Oncology, The First Affiliated People’s Hospital, Jiangsu University, Zhenjiang, Jiangsu (China); Cao, Y. [Department of Central Laboratory, The First Affiliated People’s Hospital, Jiangsu University, Zhenjiang, Jiangsu (China); Li, H. [Department of Central Laboratory, The Fourth Affiliated People’s Hospital, Jiangsu University, Zhenjiang, Jiangsu (China); Qin, R. [Department of Oncology, The First Affiliated People’s Hospital, Jiangsu University, Zhenjiang, Jiangsu (China); Chen, Q. [Department of Central Laboratory, The First Affiliated People’s Hospital, Jiangsu University, Zhenjiang, Jiangsu (China); Long, L. [Department of Oncology, The First Affiliated People’s Hospital, Jiangsu University, Zhenjiang, Jiangsu (China); Zhu, X.L. [Department of Central Laboratory, The Fourth Affiliated People’s Hospital, Jiangsu University, Zhenjiang, Jiangsu (China); Xie, C.J. [Department of Central Laboratory, The First Affiliated People’s Hospital, Jiangsu University, Zhenjiang, Jiangsu (China); Xu, W.L. [Department of Central Laboratory, The Fourth Affiliated People’s Hospital, Jiangsu University, Zhenjiang, Jiangsu (China)
2014-01-10
MicroRNAs (miRNAs) are small RNA molecules that modulate gene expression implicated in cancer, which play crucial roles in diverse biological processes, such as development, differentiation, apoptosis, and proliferation. The aim of this study was to investigate whether miR-30c mediated the resistance of breast cancer cells to the chemotherapeutic agent doxorubicin (ADR) by targeting tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta (YWHAZ). miR-30c was downregulated in the doxorubicin-resistant human breast cancer cell lines MCF-7/ADR and MDA-MB-231/ADR compared with their parental MCF-7 and MDA-MB-231 cell lines, respectively. Furthermore, we observed that transfection of an miR-30c mimic significantly suppressed the ability of MCF-7/ADR to resist doxorubicin. Moreover, the anti-apoptotic gene YWHAZ was confirmed as a target of miR-30c by luciferase reporter assay, and further studies indicated that the mechanism for miR-30c on the sensitivity of breast cancer cells involved YWHAZ and its downstream p38 mitogen-activated protein kinase (p38MAPK) pathway. Together, our findings provided evidence that miR-30c was one of the important miRNAs in doxorubicin resistance by regulating YWHAZ in the breast cancer cell line MCF-7/ADR.
Directory of Open Access Journals (Sweden)
Clare Strode
Full Text Available BACKGROUND: The mosquito Aedes aegypti is one of the most important disease vectors because it transmits two major arboviruses, dengue and yellow fever, which cause significant global morbidity and mortality. Chemical insecticides form the cornerstone of vector control. The organophosphate temephos a larvicide recommended by WHO for controlling Ae. aegypti, however, resistance to this compound has been reported in many countries, including Brazil. METHODOLOGY/PRINCIPAL FINDINGS: The aim of this study was to identify genes implicated in metabolic resistance in an Ae. aegypti temephos resistant strain, named RecR, through microarray analysis. We utilized a custom 'Ae. aegypti detox chip' and validated microarray data through RT-PCR comparing susceptible and resistant individuals. In addition, we analyzed gene expression in 4(th instar larvae from a reversed susceptible strain (RecRev, exposed and unexposed to temephos. The results obtained revealed a set of 13 and 6 genes significantly over expressed in resistant adult mosquitoes and larvae, respectively. One of these genes, the cytochrome P450 CYP6N12, was up-regulated in both stages. RT-PCR confirmed the microarray results and, additionally, showed no difference in gene expression between temephos exposed and unexposed RecRev mosquitoes. This suggested that the differences in the transcript profiles among the strains are heritable due to a selection process and are not caused by immediate insecticide exposure. Reversal of temephos resistance was demonstrated and, importantly, there was a positive correlation between a decrease in the resistance ratio and an accompanying decrease in the expression levels of previously over expressed genes. Some of the genes identified here have also been implicated in metabolic resistance in other mosquito species and insecticide resistant populations of Ae. aegypti. CONCLUSIONS/SIGNIFICANCE: The identification of gene expression signatures associated to
Nikolakopoulou, T.L.; Egan, S.; Overbeek, van L.S.; Guillaume, G.; Heuer, H.; Wellington, E.M.H.; Elsas, van J.D.; Collard, J.M.; Smalla, K.; Karagouni, A.D.
2005-01-01
A range of European habitats was screened by PCR for detection of the oxytetracycline resistance genes otr(A) and otr(B), found in the oxytetracycline-producing strain Streptomyces rimosus. Primers were developed to detect these otr genes in tetracycline-resistant (TcR) streptomycete isolates from
Horizontal Transfer of Tetracycline Resistance Genes in the Subsurface of a Poultry Farm
You, Y.; Ward, M.; Hilpert, M.
2008-12-01
Concentrated animal feeding operations (CAFOs) are considered to be important man-made reservoirs of antibiotic resistant bacteria and antibiotic resistance genes. At a poultry farm, we, together with Mr.~James Doolittle from USDA, measured the apparent subsurface electrical conductivity (ECa) using a EM38 meter. The resulting ECaR) associated with the poultry farm due to the fact that tetracycline (Tc) is one of the most frequently used antibiotics in food animal production and therefore is probably used at this farm. Soil and aquifer samples were taken from the farm. TcR bacteria were detected, with higher concentrations in the top layer of soil than in the aquifer. TcR bacteria were then enriched from a soil sample, and two classes of TcR genes were detected: tet(M) genes encoding ribosomal protection proteins and tet(L) genes encoding tet efflux pumps. Sequences of the PCR products were compared to known tet(M) and tet(L) genes in GenBank using BLASTN. Phylogenetic trees were also built based on the sequence information. The tet(M) genes found in our soil sample were highly similar to those located on transposons. In a soil microcosm experiment, we used the aforementioned soil sample as incubation medium as well as genetic donor (TcR soil bacteria), and a green fluorescent strain of E. coli as a model genetic recipient to study horizontal transfer of TcR genes from soil bacteria to naïve bacteria. Concentrations of inoculated E. coli were continuously monitored for 15 days, TcR E. coli isolated, and colony PCR performed. The tet(M) genes were found to be transferred to naïve E. coli. The highest horizontal transfer ratio, 0.62 transconjugant per recipient, was observed when Tc was supplemented to a soil microcosm at a concentration of 140 μg/kg soil. Modeling is also ongoing to obtain a better understanding of this complex phenomenon.
Energy Technology Data Exchange (ETDEWEB)
Seznec, Janina; Naumann, Ulrike, E-mail: ulrike.naumann@uni-tuebingen.de [Laboratory of Molecular Neuro-Oncology, Department of General Neurology, Hertie-Institute for Clinical Brain Research and Center Neurology, University of Tuebingen, Otfried-Mueller-Str. 27, Tuebingen 72076 (Germany)
2011-06-27
Glioblastoma multiforme (GBM) is a lethal type of cancer mainly resistant to radio- and chemotherapy. Since the tumor suppressor p53 functions as a transcription factor regulating the expression of genes involved in growth inhibition, DNA repair and apoptosis, we previously assessed whether specific differences in the modulation of gene expression are responsible for the anti-tumor properties of a dominant positive p53, chimeric tumor suppressor (CTS)-1. CTS-1 is based on the sequence of p53 and designed to resist various mechanisms of inactivation which limit the activity of p53. To identify CTS-1-regulated cell death-inducing genes, we generated a CTS-1-resistant glioma cell line (229R). We used Affymetrix whole-genome microarray expression analysis to analyze alterations in gene expression and identified a variety of CTS-1 regulated genes involved in cancer-linked processes. 313 genes were differentially expressed in Adeno-CTS-1 (Ad-CTS-1)-infected and 700 genes in uninfected 229R cells compared to matching parental cells. Ingenuity Pathway Analysis (IPA) determined a variety of differentially expressed genes in Ad-CTS-1-infected cells that were members of the intracellular networks with central tumor-involved players such as nuclear factor kappa B (NF-κB), protein kinase B (PKB/AKT) or transforming growth factor beta (TGF-β). Differentially regulated genes include secreted factors as well as intracellular proteins and transcription factors regulating not only cell death, but also processes such as tumor cell motility and immunity. This work gives an overview of the pathways differentially regulated in the resistant versus parental glioma cells and might be helpful to identify candidate genes which could serve as targets to develop novel glioma specific therapy strategies.
International Nuclear Information System (INIS)
Seznec, Janina; Naumann, Ulrike
2011-01-01
Glioblastoma multiforme (GBM) is a lethal type of cancer mainly resistant to radio- and chemotherapy. Since the tumor suppressor p53 functions as a transcription factor regulating the expression of genes involved in growth inhibition, DNA repair and apoptosis, we previously assessed whether specific differences in the modulation of gene expression are responsible for the anti-tumor properties of a dominant positive p53, chimeric tumor suppressor (CTS)-1. CTS-1 is based on the sequence of p53 and designed to resist various mechanisms of inactivation which limit the activity of p53. To identify CTS-1-regulated cell death-inducing genes, we generated a CTS-1-resistant glioma cell line (229R). We used Affymetrix whole-genome microarray expression analysis to analyze alterations in gene expression and identified a variety of CTS-1 regulated genes involved in cancer-linked processes. 313 genes were differentially expressed in Adeno-CTS-1 (Ad-CTS-1)-infected and 700 genes in uninfected 229R cells compared to matching parental cells. Ingenuity Pathway Analysis (IPA) determined a variety of differentially expressed genes in Ad-CTS-1-infected cells that were members of the intracellular networks with central tumor-involved players such as nuclear factor kappa B (NF-κB), protein kinase B (PKB/AKT) or transforming growth factor beta (TGF-β). Differentially regulated genes include secreted factors as well as intracellular proteins and transcription factors regulating not only cell death, but also processes such as tumor cell motility and immunity. This work gives an overview of the pathways differentially regulated in the resistant versus parental glioma cells and might be helpful to identify candidate genes which could serve as targets to develop novel glioma specific therapy strategies
International Nuclear Information System (INIS)
Verbenko, V.N.; Kuznetsova, L.V.; Bikineeva, E.G.; Kalinin, V.L.
1992-01-01
Lethal effects of γ-irradiation were studied in Escherichia coli strains with normal repair genotype and in radiation-resistant Gam r strains, both carrying additional mutations in the structural genes dnaK, grpE, groES or groEL. The null mutation ΔdnaK52::Cm r enhanced radiation sensitivity of wild-type cells and abolished the effect of heat induced rediation-resistance (ETIRR) and elevated radiation resistance of the Gam r strains
The Ouro Negro common bean cultivar contains the Co-34/Phg-3 gene cluster that confers resistance to the anthracnose (ANT) and angular leaf spot (ALS) pathogens. These genes are tightly linked on chromosome 4. Ouro Negro also has the Ur-14 rust resistance gene, reportedly in the vicinity of Co- 34; ...
Overexpression of miR529a confers enhanced resistance to oxidative stress in rice (Oryza sativa L.).
Yue, Erkui; Liu, Zhen; Li, Chao; Li, Yu; Liu, Qiuxiang; Xu, Jian-Hong
2017-07-01
Overexpressing miR529a can enhance oxidative stress resistance by targeting OsSPL2 and OsSPL14 genes that can regulate the expression of their downstream SOD and POD related genes. MicroRNAs are involved in the regulation of plant developmental and physiological processes, and their expression can be altered when plants suffered environment stresses, including salt, oxidative, drought and Cadmium. The expression of microRNA529 (miR529) can be induced under oxidative stress. However, its biological function under abiotic stress responses is still unclear. In this study, miR529a was overexpressed to investigate the function of miR529a under oxidative stress in rice. Our results demonstrated that the expression of miR529a can be induced by exogenous H 2 O 2 , and overexpressing miR529a can increase plant tolerance to high level of H 2 O 2 , resulting in increased seed germination rate, root tip cell viability, reduced leaf rolling rate and chlorophyll retention. The expression of oxidative stress responsive genes and the activities of superoxide dismutase (SOD) and peroxidase (POD) were increased in miR529a overexpression plant, which could help to reduce redundant reactive oxygen species (ROS). Furthermore, only OsSPL2 and OsSPL14 were targeted by miR529a in rice seedlings, repressing their expression in miR529aOE plants could lead to strengthen plant tolerance to oxidation stress. Our study provided the evidence that overexpression of miR529a could strengthen oxidation resistance, and its target genes OsSPL2 and OsSPL14 were responsible for oxidative tolerance, implied the manipulation of miR529a and its target genes regulation on H 2 O 2 related response genes could improve oxidative stress tolerance in rice.
Identification of acquired antimicrobial resistance genes
DEFF Research Database (Denmark)
Zankari, Ea; Hasman, Henrik; Cosentino, Salvatore
2012-01-01
ObjectivesIdentification of antimicrobial resistance genes is important for understanding the underlying mechanisms and the epidemiology of antimicrobial resistance. As the costs of whole-genome sequencing (WGS) continue to decline, it becomes increasingly available in routine diagnostic laborato......ObjectivesIdentification of antimicrobial resistance genes is important for understanding the underlying mechanisms and the epidemiology of antimicrobial resistance. As the costs of whole-genome sequencing (WGS) continue to decline, it becomes increasingly available in routine diagnostic...... laboratories and is anticipated to substitute traditional methods for resistance gene identification. Thus, the current challenge is to extract the relevant information from the large amount of generated data.MethodsWe developed a web-based method, ResFinder that uses BLAST for identification of acquired...... antimicrobial resistance genes in whole-genome data. As input, the method can use both pre-assembled, complete or partial genomes, and short sequence reads from four different sequencing platforms. The method was evaluated on 1862 GenBank files containing 1411 different resistance genes, as well as on 23 de...
Lee, Chen-Hsiang; Liu, Jien-Wei; Li, Chia-Chin; Chien, Chun-Chih; Tang, Ya-Fen; Su, Lin-Hui
2011-01-01
Increasing resistance to quinolones, aminoglycosides, and/or cephamycins in extended-spectrum-β-lactamase (ESBL)-producing Enterobacteriaceae exacerbates the already limited antibiotic treatment options for infections due to these microbes. In this study, the presence of resistance determinants for these antimicrobial agents was examined by PCR among ESBL-producing Klebsiella pneumoniae (ESBL-KP) isolates that caused bacteremia. Pulsed-field gel electrophoresis was used to differentiate the clonal relationship among the isolates studied. Transferability and the location of the resistance genes were analyzed by conjugation experiments, followed by DNA-DNA hybridization. Among the 94 ESBL-KP isolates studied, 20 isolates of flomoxef-resistant ESBL-KP were identified. They all carried a DHA-1 gene and were genetically diverse. CTX-M genes were found in 18 of the isolates. Among these DHA-1/CTX-M-producing K. pneumoniae isolates, ISCR1 was detected in 13 (72%) isolates, qnr genes (1 qnrA and 17 qnrB genes) were detected in 18 (100%), aac(6′)-Ib-cr was detected in 11 (61%), and 16S rRNA methylase (all armA genes) was detected in 14 (78%). Four transconjugants were available for further analysis, and qnrB4, aac(6′)-Ib-cr, armA, and blaDHA-1 were all identified on these self-transferable blaCTX-M-carrying plasmids. The genetic environments of ISCR1 associated with armA, blaDHA-1, and qnrB4 genes in the four transconjugants were identical. Replicon-type analysis revealed a FIIA plasmid among the four self-transferable plasmids, although the other three were nontypeable. The cotransfer of multiple resistance genes with the ISCR1 element-carrying plasmids has a clinical impact and warrants close monitoring and further study. PMID:21746945
Lee, Chen-Hsiang; Liu, Jien-Wei; Li, Chia-Chin; Chien, Chun-Chih; Tang, Ya-Fen; Su, Lin-Hui
2011-09-01
Increasing resistance to quinolones, aminoglycosides, and/or cephamycins in extended-spectrum-β-lactamase (ESBL)-producing Enterobacteriaceae exacerbates the already limited antibiotic treatment options for infections due to these microbes. In this study, the presence of resistance determinants for these antimicrobial agents was examined by PCR among ESBL-producing Klebsiella pneumoniae (ESBL-KP) isolates that caused bacteremia. Pulsed-field gel electrophoresis was used to differentiate the clonal relationship among the isolates studied. Transferability and the location of the resistance genes were analyzed by conjugation experiments, followed by DNA-DNA hybridization. Among the 94 ESBL-KP isolates studied, 20 isolates of flomoxef-resistant ESBL-KP were identified. They all carried a DHA-1 gene and were genetically diverse. CTX-M genes were found in 18 of the isolates. Among these DHA-1/CTX-M-producing K. pneumoniae isolates, ISCR1 was detected in 13 (72%) isolates, qnr genes (1 qnrA and 17 qnrB genes) were detected in 18 (100%), aac(6')-Ib-cr was detected in 11 (61%), and 16S rRNA methylase (all armA genes) was detected in 14 (78%). Four transconjugants were available for further analysis, and qnrB4, aac(6')-Ib-cr, armA, and bla(DHA-1) were all identified on these self-transferable bla(CTX-M)-carrying plasmids. The genetic environments of ISCR1 associated with armA, bla(DHA-1), and qnrB4 genes in the four transconjugants were identical. Replicon-type analysis revealed a FIIA plasmid among the four self-transferable plasmids, although the other three were nontypeable. The cotransfer of multiple resistance genes with the ISCR1 element-carrying plasmids has a clinical impact and warrants close monitoring and further study.
Role of the Caenorhabditis elegans multidrug resistance gene, mrp-4, in gut granule differentiation.
Currie, Erin; King, Brian; Lawrenson, Andrea L; Schroeder, Lena K; Kershner, Aaron M; Hermann, Greg J
2007-11-01
Caenorhabditis elegans gut granules are lysosome-related organelles with birefringent contents. mrp-4, which encodes an ATP-binding cassette (ABC) transporter homologous to mammalian multidrug resistance proteins, functions in the formation of gut granule birefringence. mrp-4(-) embryos show a delayed appearance of birefringent material in the gut granule but otherwise appear to form gut granules properly. mrp-4(+) activity is required for the extracellular mislocalization of birefringent material, body-length retraction, and NaCl sensitivity, phenotypes associated with defective gut granule biogenesis exhibited by embryos lacking the activity of GLO-1/Rab38, a putative GLO-1 guanine nucleotide exchange factor GLO-4, and the AP-3 complex. Multidrug resistance protein (MRP)-4 localizes to the gut granule membrane, consistent with it playing a direct role in the transport of molecules that compose and/or facilitate the formation of birefringent crystals within the gut granule. However, MRP-4 is also present in oocytes and early embryos, and our genetic analyses indicate that its site of action in the formation of birefringent material may not be limited to just the gut granule in embryos. In a search for genes that function similarly to mrp-4(+), we identified WHT-2, another ABC transporter that acts in parallel to MRP-4 for the formation of birefringent material in the gut granule.
DEFF Research Database (Denmark)
Agersø, Yvonne; Sandvang, Dorthe
2005-01-01
The presence of tetracycline resistance (Tc-r) genes and class I integrons (in-1), and their ability to cotransfer were investigated in Tc-r gram-negative (185 strains) and gram-positive (72 strains) bacteria from Danish farmland and pigsties. The isolates belonged to the groups or species...... tet(33). No isolates contained more than one tet gene. The in-l-positive isolates were tested for resistance to selected antimicrobial agents and showed resistance to three to nine drugs. Filter-mating experiments showed cotransfer of Tc-r and class I integrons from soil isolates to Escherichia coli...... and/or Pseudomonas putida. We conclude that soil bacteria in close contact to manure or pigsty environment may thus have an important role in horizontal spread of resistance. Use of tetracyclines in food animal production may increase not only Tc-r but also multidrug resistance (caused by the presence...
Wang, Jun; Tian, Dongsheng; Gu, Keyu; Yang, Xiaobei; Wang, Lanlan; Zeng, Xuan; Yin, Zhongchao
2017-06-01
Bacterial blight of rice, caused by Xanthomonas oryzae pv. oryzae, is one of the most destructive bacterial diseases throughout the major rice-growing regions in the world. The rice disease resistance (R) gene Xa10 confers race-specific disease resistance to X. oryzae pv. oryzae strains that deliver the corresponding transcription activator-like (TAL) effector AvrXa10. Upon bacterial infection, AvrXa10 binds specifically to the effector binding element in the promoter of the R gene and activates its expression. Xa10 encodes an executor R protein that triggers hypersensitive response and activates disease resistance. 'Nipponbare' rice carries two Xa10-like genes in its genome, of which one is the susceptible allele of the Xa23 gene, a Xa10-like TAL effector-dependent executor R gene isolated recently from 'CBB23' rice. However, the function of the two Xa10-like genes in disease resistance to X. oryzae pv. oryzae strains has not been investigated. Here, we designated the two Xa10-like genes as Xa10-Ni and Xa23-Ni and characterized their function for disease resistance to rice bacterial blight. Both Xa10-Ni and Xa23-Ni provided disease resistance to X. oryzae pv. oryzae strains that deliver the matching artificially designed TAL effectors (dTALE). Transgenic rice plants containing Xa10-Ni and Xa23-Ni under the Xa10 promoter provided specific disease resistance to X. oryzae pv. oryzae strains that deliver AvrXa10. Xa10-Ni and Xa23-Ni knock-out mutants abolished dTALE-dependent disease resistance to X. oryzae pv. oryzae. Heterologous expression of Xa10-Ni and Xa23-Ni in Nicotiana benthamiana triggered cell death. The 19-amino-acid residues at the N-terminal regions of XA10 or XA10-Ni are dispensable for their function in inducing cell death in N. benthamiana and the C-terminal regions of XA10, XA10-Ni, and XA23-Ni are interchangeable among each other without affecting their function. Like XA10, both XA10-Ni and XA23-Ni locate to the endoplasmic reticulum (ER) membrane
Directory of Open Access Journals (Sweden)
Vivianne G A A Vleeshouwers
Full Text Available Potato is the world's fourth largest food crop yet it continues to endure late blight, a devastating disease caused by the Irish famine pathogen Phytophthora infestans. Breeding broad-spectrum disease resistance (R genes into potato (Solanum tuberosum is the best strategy for genetically managing late blight but current approaches are slow and inefficient. We used a repertoire of effector genes predicted computationally from the P. infestans genome to accelerate the identification, functional characterization, and cloning of potentially broad-spectrum R genes. An initial set of 54 effectors containing a signal peptide and a RXLR motif was profiled for activation of innate immunity (avirulence or Avr activity on wild Solanum species and tentative Avr candidates were identified. The RXLR effector family IpiO induced hypersensitive responses (HR in S. stoloniferum, S. papita and the more distantly related S. bulbocastanum, the source of the R gene Rpi-blb1. Genetic studies with S. stoloniferum showed cosegregation of resistance to P. infestans and response to IpiO. Transient co-expression of IpiO with Rpi-blb1 in a heterologous Nicotiana benthamiana system identified IpiO as Avr-blb1. A candidate gene approach led to the rapid cloning of S. stoloniferum Rpi-sto1 and S. papita Rpi-pta1, which are functionally equivalent to Rpi-blb1. Our findings indicate that effector genomics enables discovery and functional profiling of late blight R genes and Avr genes at an unprecedented rate and promises to accelerate the engineering of late blight resistant potato varieties.
Zhang, Yan; Wang, Qing; Chen, Li; Yang, Hsin-Sheng
2015-01-01
Agents targeting insulin-like growth factor 1 receptor (IGF-1R) are being actively examined in clinical trials. Although there has been some initial success of single agent targeting IGF-1R, attempts in later studies failed due to resistance. This study aimed to understand the effects of programmed cell death 4 (Pdcd4) on the chemosensitivity of the IGF-1R inhibitor, OSI-906, in colorectal cancer (CRC) cells and the mechanism underlying this impact. Using OSI-906 resistant and sensitive CRC c...
Vertically integrated ZnO-Based 1D1R structure for resistive switching
International Nuclear Information System (INIS)
Zhang Yang; Duan Ziqing; Li Rui; Ku, Chieh-Jen; Reyes, Pavel I; Ashrafi, Almamun; Zhong Jian; Lu Yicheng
2013-01-01
We report a ZnO-based 1D1R structure, which is formed by a vertical integration of a FeZnO/MgO switching resistor (1R) and an Ag/MgZnO Schottky diode (1D). The multifunctional ZnO and its compounds are grown through MOCVD with in situ doping. For the R element, the current ratio of the high-resistance state (HRS) over the low-resistance state (LRS) at 1 V is 2.4 × 10 6 . The conduction mechanisms of the HRS and LRS are Poole–Frenkel emission and resistive conduction, respectively. The D element shows the forward/reverse current ratio at ±1 V to be 2.4 × 10 7 . This 1D1R structure exhibits high R HRS /R LRS ratio, excellent rectifying characteristics and robust retention. (paper)
Directory of Open Access Journals (Sweden)
Jane J. Kim
2010-01-01
Full Text Available Chronic inflammation is a key feature of insulin resistance and obesity. Toll-Like Receptor 4 (TLR4, involved in modulating innate immunity, is an important mediator of insulin resistance and its comorbidities. TLR4 contributes to the development of insulin resistance and inflammation through its activation by elevated exogenous ligands (e.g., dietary fatty acids and enteric lipopolysaccharide and endogenous ligands (e.g., free fatty acids which are elevated in obese states. TLR4, expressed in insulin target tissues, activates proinflammatory kinases JNK, IKK, and p38 that impair insulin signal transduction directly through inhibitory phosphorylation of insulin receptor substrate (IRS on serine residues. TLR4 activation also leads to increased transcription of pro-inflammatory genes, resulting in elevation of cytokine, chemokine, reactive oxygen species, and eicosanoid levels that promote further insulin-desensitization within the target cell itself and in other cells via paracrine and systemic effects. Increased understanding of cell type-specific TLR4-mediated effects on insulin action present the opportunity and challenge of developing related therapeutic approaches for improving insulin sensitivity while preserving innate immunity.
Choi, Won-Suk; Jeong, Ju Hwan; Kwon, Jin Jung; Ahn, Su Jeong; Lloren, Khristine Kaith S; Kwon, Hyeok-Il; Chae, Hee Bok; Hwang, Jungwon; Kim, Myung Hee; Kim, Chul-Joong; Webby, Richard J; Govorkova, Elena A; Choi, Young Ki; Baek, Yun Hee; Song, Min-Suk
2018-01-01
Several subtypes of avian influenza viruses (AIVs) are emerging as novel human pathogens, and the frequency of related infections has increased in recent years. Although neuraminidase (NA) inhibitors (NAIs) are the only class of antiviral drugs available for therapeutic intervention for AIV-infected patients, studies on NAI resistance among AIVs have been limited, and markers of resistance are poorly understood. Previously, we identified unique NAI resistance substitutions in AIVs of the N3, N7, and N9 NA subtypes. Here, we report profiles of NA substitutions that confer NAI resistance in AIVs of the N4, N5, N6, and N8 NA subtypes using gene-fragmented random mutagenesis. We generated libraries of mutant influenza viruses using reverse genetics (RG) and selected resistant variants in the presence of the NAIs oseltamivir carboxylate and zanamivir in MDCK cells. In addition, two substitutions, H274Y and R292K (N2 numbering), were introduced into each NA gene for comparison. We identified 37 amino acid substitutions within the NA gene, 16 of which (4 in N4, 4 in N5, 4 in N6, and 4 in N8) conferred resistance to NAIs (oseltamivir carboxylate, zanamivir, or peramivir) as determined using a fluorescence-based NA inhibition assay. Substitutions conferring NAI resistance were mainly categorized as either novel NA subtype specific (G/N147V/I, A246V, and I427L) or previously reported in other subtypes (E119A/D/V, Q136K, E276D, R292K, and R371K). Our results demonstrate that each NA subtype possesses unique NAI resistance markers, and knowledge of these substitutions in AIVs is important in facilitating antiviral susceptibility monitoring of NAI resistance in AIVs. IMPORTANCE The frequency of human infections with avian influenza viruses (AIVs) has increased in recent years. Despite the availability of vaccines, neuraminidase inhibitors (NAIs), as the only available class of drugs for AIVs in humans, have been constantly used for treatment, leading to the inevitable emergence
Noia, L R; Tuler, A C; Ferreira, A; Ferreira, M F S
2017-03-16
Guava (Psidium guajava L.) crop is severely affected by the nematode Meloidogyne enterolobii. Native Psidium species have been reported as sources of resistance against this nematode. Knowledge on the molecular relationship between Psidium species based on plant resistance gene analogs (RGA) can be useful in the genetic breeding of guava for resistance to M. enterolobii. In this study, RGA markers from conserved domains, and structural features of plant R genes, were employed to characterize Psidium species and establish genetic proximity, with a focus on nematode resistance. SSR markers were also applied owing to their neutral nature, thus differing from RGA markers. For this, species reported as sources of resistance to M. enterolobii, such as P. cattleianum and P. friedrichsthalianum, as well as species occurring in the Atlantic Rainforest and susceptible genotypes, were investigated. In 10 evaluated Psidium species, high interspecific genetic variability was verified through RGA and SSR markers, with intraspecific variation in P. guajava higher with SSR, as was expected. Resistant species were clustered by RGA markers, and differential amplicons among genotypes resistant and susceptible to M. enterolobii were identified. Knowledge on the molecular relationships between Psidium species constitutes useful information for breeding of the guava tree, providing direction for hybridization and material for rootstocks. Additionally, the genetic relationship between native species, which have been little studied, and P. guajava were estimated by RGAs, which were confirmed as important markers for genetic diversity related to pathogen resistance.
Musumeci, Rosario; Calaresu, Enrico; Gerosa, Jolanda; Oggioni, Davide; Bramati, Simone; Morelli, Patrizia; Mura, Ida; Piana, Andrea; Are, Bianca Maria; Cocuzza, Clementina Elvezia
2016-10-01
Linezolid is the main representative of the oxazolidinones, introduced in 2000 in clinical practice to treat severe Gram-positive infections. This compound inhibits protein synthesis by binding to the peptidyl transferase centre of the 50S bacterial ribosomal subunit. The aim of this study was to characterize 12 clinical strains of linezolid-resistant Staphylococcus spp. isolated in Northern Italy. All isolates of Staphylococcus spp. studied showed a multi-antibiotic resistance phenotype. In particular, all isolates showed the presence of the mecA gene associated with SSCmec types IVa, V or I. Mutations in domain V of 23S rRNA were shown to be the most prevalent mechanism of linezolid resistance: among these a new C2551T mutation was found in S. aureus, whilst the G2576T mutation was shown to be the most prevalent overall. Moreover, three S. epidermidis isolates were shown to have linezolid resistance associated only with alterations in both L3 and L4 ribosomal proteins. No strain was shown to harbor the previously described cfr gene. These results have shown how the clinical use of linezolid in Northern Italy has resulted in the selection of multiple antibiotic-resistant clinical isolates of Staphylococcus spp., with linezolid resistance in these strains being associated with mutations in 23S rRNA or ribosomal proteins L3 and L4.
Xu, Xiaomei; Chao, Juan; Cheng, Xueli; Wang, Rui; Sun, Baojuan; Wang, Hengming; Luo, Shaobo; Xu, Xiaowan; Wu, Tingquan; Li, Ying
2016-01-01
Phytophthora root rot caused by Phytophthora capsici (P. capsici) is a serious limitation to pepper production in Southern China, with high temperature and humidity. Mapping PRR resistance genes can provide linked DNA markers for breeding PRR resistant varieties by molecular marker-assisted selection (MAS). Two BC1 populations and an F2 population derived from a cross between P. capsici-resistant accession, Criollo de Morelos 334 (CM334) and P. capsici-susceptible accession, New Mexico Capsicum Accession 10399 (NMCA10399) were used to investigate the genetic characteristics of PRR resistance. PRR resistance to isolate Byl4 (race 3) was controlled by a single dominant gene, PhR10, that was mapped to an interval of 16.39Mb at the end of the long arm of chromosome 10. Integration of bulked segregant analysis (BSA) and Specific Length Amplified Fragment sequencing (SLAF-seq) provided an efficient genetic mapping strategy. Ten polymorphic Simple Sequence Repeat (SSR) markers were found within this region and used to screen the genotypes of 636 BC1 plants, delimiting PhR10 to a 2.57 Mb interval between markers P52-11-21 (1.5 cM away) and P52-11-41 (1.1 cM). A total of 163 genes were annotated within this region and 31 were predicted to be associated with disease resistance. PhR10 is a novel race specific gene for PRR, and this paper describes linked SSR markers suitable for marker-assisted selection of PRR resistant varieties, also laying a foundation for cloning the resistance gene.
Directory of Open Access Journals (Sweden)
Xiaomei Xu
Full Text Available Phytophthora root rot caused by Phytophthora capsici (P. capsici is a serious limitation to pepper production in Southern China, with high temperature and humidity. Mapping PRR resistance genes can provide linked DNA markers for breeding PRR resistant varieties by molecular marker-assisted selection (MAS. Two BC1 populations and an F2 population derived from a cross between P. capsici-resistant accession, Criollo de Morelos 334 (CM334 and P. capsici-susceptible accession, New Mexico Capsicum Accession 10399 (NMCA10399 were used to investigate the genetic characteristics of PRR resistance. PRR resistance to isolate Byl4 (race 3 was controlled by a single dominant gene, PhR10, that was mapped to an interval of 16.39Mb at the end of the long arm of chromosome 10. Integration of bulked segregant analysis (BSA and Specific Length Amplified Fragment sequencing (SLAF-seq provided an efficient genetic mapping strategy. Ten polymorphic Simple Sequence Repeat (SSR markers were found within this region and used to screen the genotypes of 636 BC1 plants, delimiting PhR10 to a 2.57 Mb interval between markers P52-11-21 (1.5 cM away and P52-11-41 (1.1 cM. A total of 163 genes were annotated within this region and 31 were predicted to be associated with disease resistance. PhR10 is a novel race specific gene for PRR, and this paper describes linked SSR markers suitable for marker-assisted selection of PRR resistant varieties, also laying a foundation for cloning the resistance gene.
Bar, Jair; Gorn-Hondermann, Ivan; Moretto, Patricia; Perkins, Theodore J; Niknejad, Nima; Stewart, David J; Goss, Glenwood D; Dimitroulakos, Jim
2015-11-01
To identify the mechanisms of cisplatin resistance, global microRNA (miR) expression was tested. The expression of miR-145 was consistently higher in resistant cells. The expression of cyclin-dependent kinase 6 (CDK6), a potential target of miR-145, was lower in resistant cells, and inhibition of CDK4/6 protected cells from cisplatin. Cell cycle inhibition, currently being tested in clinical trials, might be antagonistic to cisplatin and other cytotoxic drugs. Non-small-cell lung cancer (NSCLC) is the leading cause of cancer-related death. Platinum-based chemotherapeutic drugs are the most active agents in treating advanced disease. Resistance to these drugs is common and multifactorial; insight into the molecular mechanisms involved will likely enhance efficacy. A set of NSCLC platinum-resistant sublines was created from the Calu6 cell line. Cell viability was quantified using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay. Differentially expressed microRNAs (miRs) in these lines were identified using Affymetrix miR arrays. The potential genes targeted by these miRs were searched using the TargetScan algorithm. The expression levels of miRs and mRNA were tested using real-time polymerase chain reaction. miR-145 was reproducibly elevated in all the resistant sublines tested; however, modulation of miR-145 levels alone in these cells did not affect their response to cisplatin. A potential target of miR-145 is cyclin-dependent kinase 6 (CDK6), an important regulator of cell proliferation. The mRNA and protein levels of CDK6 were both downregulated in the resistant sublines. An inhibitor of CDK4/6 (PD0332991) protected parental NSCLC cells from cisplatin cytotoxicity. In the present study, we identified miRs differentially expressed in cisplatin-resistant cell lines, including miR-145. A predicted target of miR-145 is CDK6, and its expression was found to be downregulated in the resistant sublines, although not directly by miR-145. Inhibition
Wang, Hualiang; Wang, Jinghua; Yu, Peijuan; Ge, Ping; Jiang, Yanqun; Xu, Rong; Chen, Rong; Liu, Xuejie
2017-02-01
This study aimed to investigate antibiotic resistance genes in the multidrug-resistant (MDR) Acinetobacter baumannii (A. baumanii) strain, MDR-SHH02, using whole‑genome sequencing (WGS). The antibiotic resistance of MDR-SHH02 isolated from a patient with breast cancer to 19 types of antibiotics was determined using the Kirby‑Bauer method. WGS of MDR-SHH02 was then performed. Following quality control and transcriptome assembly, functional annotation of genes was conducted, and the phylogenetic tree of MDR-SHH02, along with another 5 A. baumanii species and 2 Acinetobacter species, was constructed using PHYLIP 3.695 and FigTree v1.4.2. Furthermore, pathogenicity islands (PAIs) were predicted by the pathogenicity island database. Potential antibiotic resistance genes in MDR-SHH02 were predicted based on the information in the Antibiotic Resistance Genes Database (ARDB). MDR-SHH02 was found to be resistant to all of the tested antibiotics. The total draft genome length of MDR-SHH02 was 4,003,808 bp. There were 74.25% of coding sequences to be annotated into 21 of the Clusters of Orthologous Groups (COGs) of protein terms, such as 'transcription' and 'amino acid transport and metabolism'. Furthermore, there were 45 PAIs homologous to the sequence MDRSHH02000806. Additionally, a total of 12 gene sequences in MDR-SHH02 were highly similar to the sequences of antibiotic resistance genes in ARDB, including genes encoding aminoglycoside‑modifying enzymes [e.g., aac(3)-Ia, ant(2'')‑Ia, aph33ib and aph(3')-Ia], β-lactamase genes (bl2b_tem and bl2b_tem1), sulfonamide-resistant dihydropteroate synthase genes (sul1 and sul2), catb3 and tetb. These results suggest that numerous genes mediate resistance to various antibiotics in MDR-SHH02, and provide a clinical guidance for the personalized therapy of A. baumannii-infected patients.
Karami, Solmaz; Maleki, Afshin; Karimi, Ebrahim; Poormazaheri, Helen; Zandi, Shiva; Davari, Behrooz; Salimi, Yahya Zand; Gharibi, Fardin; Kalantar, Enayatollah
2016-12-01
Recently, there has been increasing interest to clean up the soils contaminated with herbicide. Our aim was to determine the bioremediation of 2,4-dichlorophenoxyacetic acid (2,4-D) from wheat fields which have a long history of herbicide in Sanandaj. Based on our literature survey, this study is the first report to isolate and identify antimicrobial resistant bacteria from polluted wheat field soils in Sanandaj which has the capacity to degrade 2,4-D. From 150 2,4-D-exposed soil samples, five different bacteria were isolated and identified based on biochemical tests and 16S ribosomal RNA (rRNA). Pseudomonas has been the most frequently isolated genus. By sequencing the 16S rRNA gene of the isolated bacteria, the strains were detected and identified as a member of the genus Pseudomonas sp, Entrobacter sp, Bacillus sp, Seratia sp, and Staphylococcus sp. The sequence of Sanandaj 1 isolate displayed 87% similarity with the 16S rRNA gene of a Pseudomonas sp (HE995788). Similarly, all the isolates were compared to standard strains based on 16S rRNA. Small amounts of 2,4-D could be transmitted to a depth of 10-20 cm; however, in the depth of 20-40 cm, we could not detect the 2,4-D. The isolates were resistant to various antibiotics particularly, penicillin, ampicillin, and amoxicillin.
Li, Bei-Bei; Shen, Jian-Zhong; Cao, Xing-Yuan; Wang, Yang; Dai, Lei; Huang, Si-Yang; Wu, Cong-Ming
2010-07-01
Mycoplasma gallisepticum is a major etiological agent of chronic respiratory disease (CRD) in chickens and sinusitis in turkeys. The pleuromutilin antibiotics tiamulin and valnemulin are currently used in the treatment of M. gallisepticum infection. We studied the in vitro development of pleuromutilin resistance in M. gallisepticum and investigated the molecular mechanisms involved in this process. Pleuromutilin-resistant mutants were selected by serial passages of M. gallisepticum strains PG31 and S6 in broth medium containing subinhibitory concentrations of tiamulin or valnemulin. A portion of the gene encoding 23S rRNA gene (domain V) and the gene encoding ribosome protein L3 were amplified and sequenced. No mutation could be detected in ribosome protein L3. Mutations were found at nucleotide positions 2058, 2059, 2061, 2447 and 2503 of 23S rRNA gene (Escherichia coli numbering). Although a single mutation could cause elevation of tiamulin and valnemulin MICs, combinations of two or three mutations were necessary to produce high-level resistance. All the mutants were cross-resistant to lincomycin, chloramphenicol and florfenicol. Mutants with the A2058G or the A2059G mutation exhibited cross-resistance to macrolide antibiotics erythromycin, tilmicosin and tylosin.
Prediction of novel target genes and pathways involved in irinotecan-resistant colorectal cancer.
Directory of Open Access Journals (Sweden)
Precious Takondwa Makondi
Full Text Available Acquired drug resistance to the chemotherapeutic drug irinotecan (the active metabolite of which is SN-38 is one of the significant obstacles in the treatment of advanced colorectal cancer (CRC. The molecular mechanism or targets mediating irinotecan resistance are still unclear. It is urgent to find the irinotecan response biomarkers to improve CRC patients' therapy.Genetic Omnibus Database GSE42387 which contained the gene expression profiles of parental and irinotecan-resistant HCT-116 cell lines was used. Differentially expressed genes (DEGs between parental and irinotecan-resistant cells, protein-protein interactions (PPIs, gene ontologies (GOs and pathway analysis were performed to identify the overall biological changes. The most common DEGs in the PPIs, GOs and pathways were identified and were validated clinically by their ability to predict overall survival and disease free survival. The gene-gene expression correlation and gene-resistance correlation was also evaluated in CRC patients using The Cancer Genomic Atlas data (TCGA.The 135 DEGs were identified of which 36 were upregulated and 99 were down regulated. After mapping the PPI networks, the GOs and the pathways, nine genes (GNAS, PRKACB, MECOM, PLA2G4C, BMP6, BDNF, DLG4, FGF2 and FGF9 were found to be commonly enriched. Signal transduction was the most significant GO and MAPK pathway was the most significant pathway. The five genes (FGF2, FGF9, PRKACB, MECOM and PLA2G4C in the MAPK pathway were all contained in the signal transduction and the levels of those genes were upregulated. The FGF2, FGF9 and MECOM expression were highly associated with CRC patients' survival rate but not PRKACB and PLA2G4C. In addition, FGF9 was also associated with irinotecan resistance and poor disease free survival. FGF2, FGF9 and PRKACB were positively correlated with each other while MECOM correlated positively with FGF9 and PLA2G4C, and correlated negatively with FGF2 and PRKACB after doing gene-gene
Liu, Xin; Yang, Lihua; Zhou, Xianyao; Zhou, Miaoping; Lu, Yan; Ma, Lingjian; Ma, Hongxiang; Zhang, Zengyan
2013-05-01
The disease take-all, caused by the fungus Gaeumannomyces graminis, is one of the most destructive root diseases of wheat worldwide. Breeding resistant cultivars is an effective way to protect wheat from take-all. However, little progress has been made in improving the disease resistance level in commercial wheat cultivars. MYB transcription factors play important roles in plant responses to environmental stresses. In this study, an R2R3-MYB gene in Thinopyrum intermedium, TiMYB2R-1, was cloned and characterized. The gene sequence includes two exons and an intron. The expression of TiMYB2R-1 was significantly induced following G. graminis infection. An in vitro DNA binding assay proved that TiMYB2R-1 protein could bind to the MYB-binding site cis-element ACI. Subcellular localization assays revealed that TiMYB2R-1 was localized in the nucleus. TiMYB2R-1 transgenic wheat plants were generated, characterized molecularly, and evaluated for take-all resistance. PCR and Southern blot analyses confirmed that TiMYB2R-1 was integrated into the genomes of three independent transgenic wheat lines by distinct patterns and the transgene was heritable. Reverse transcription-PCR and western blot analyses revealed that TiMYB2R-1 was highly expressed in the transgenic wheat lines. Based on disease response assessments for three successive generations, the significantly enhanced resistance to take-all was observed in the three TiMYB2R-1-overexpressing transgenic wheat lines. Furthermore, the transcript levels of at least six wheat defence-related genes were significantly elevated in the TiMYB2R-1 transgenic wheat lines. These results suggest that engineering and overexpression of TiMYB2R-1 may be used for improving take-all resistance of wheat and other cereal crops.
Panwar, Preety; Jha, Anand Kumar; Pandey, P K; Gupta, Arun K; Kumar, Anil
2011-06-01
Magnaporthe grisea, the blast fungus is one of the main pathological threats to finger millet crop worldwide. A systematic search for the blast resistance gene analogs was carried out, using functional molecular markers. Three-fourths of the recognition-dependent disease resistance genes (R-genes) identified in plants encodes nucleotide binding site (NBS) leucine-rich repeat (LRR) proteins. NBS-LRR homologs have only been isolated on a limited scale from Eleusine coracana. Genomic DNA sequences sharing homology with NBS region of resistance gene analogs were isolated and characterized from resistant genotypes of finger millet using PCR based approach with primers designed from conserved regions of NBS domain. Attempts were made to identify molecular markers linked to the resistance gene and to differentiate the resistant bulk from the susceptible bulk. A total of 9 NBS-LRR and 11 EST-SSR markers generated 75.6 and 73.5% polymorphism respectively amongst 73 finger millet genotypes. NBS-5, NBS-9, NBS-3 and EST-SSR-04 markers showed a clear polymorphism which differentiated resistant genotypes from susceptible genotypes. By comparing the banding pattern of different resistant and susceptible genotypes, five DNA amplifications of NBS and EST-SSR primers (NBS-05(504,) NBS-09(711), NBS-07(688), NBS-03(509) and EST-SSR-04(241)) were identified as markers for the blast resistance in resistant genotypes. Principal coordinate plot and UPGMA analysis formed similar groups of the genotypes and placed most of the resistant genotypes together showing a high level of genetic relatedness and the susceptible genotypes were placed in different groups on the basis of differential disease score. Our results provided a clue for the cloning of finger millet blast resistance gene analogs which not only facilitate the process of plant breeding but also molecular characterization of blast resistance gene analogs from Eleusine coracana.
Gong, Youhui; Li, Ting; Zhang, Lee; Gao, Xiwu; Liu, Nannan
2013-01-01
The expression of some insect P450 genes can be induced by both exogenous and endogenous compounds and there is evidence to suggest that multiple constitutively overexpressed P450 genes are co-responsible for the development of resistance to permethrin in resistant mosquitoes. This study characterized the permethrin induction profiles of P450 genes known to be constitutively overexpressed in resistant mosquitoes, Culex quinquefasciatus. The gene expression in 7 of the 19 P450 genes CYP325K3v1, CYP4D42v2, CYP9J45, (CYP) CPIJ000926, CYP325G4, CYP4C38, CYP4H40 in the HAmCqG8 strain, increased more than 2-fold after exposure to permethrin at an LC50 concentration (10 ppm) compared to their acetone treated counterpart; no significant differences in the expression of these P450 genes in susceptible S-Lab mosquitoes were observed after permethrin treatment. Eleven of the fourteen P450 genes overexpressed in the MAmCqG6 strain, CYP9M10, CYP6Z12, CYP9J33, CYP9J43, CYP9J34, CYP306A1, CYP6Z15, CYP9J45, CYPPAL1, CYP4C52v1, CYP9J39, were also induced more than doubled after exposure to an LC50 (0.7 ppm) dose of permethrin. No significant induction in P450 gene expression was observed in the susceptible S-Lab mosquitoes after permethrin treatment except for CYP6Z15 and CYP9J39, suggesting that permethrin induction of these two P450 genes are common to both susceptible and resistant mosquitoes while the induction of the others are specific to insecticide resistant mosquitoes. These results demonstrate that multiple P450 genes are co-up-regulated in insecticide resistant mosquitoes through both constitutive overexpression and induction mechanisms, providing additional support for their involvement in the detoxification of insecticides and the development of insecticide resistance.
Enhanced 2,4-D Metabolism in Two Resistant Papaver rhoeas Populations from Spain
Directory of Open Access Journals (Sweden)
Joel Torra
2017-09-01
Full Text Available Corn poppy (Papaver rhoeas, the most problematic broadleaf weed in winter cereals in Southern Europe, has developed resistance to the widely-used herbicide, 2,4-D. The first reported resistance mechanism in this species to 2,4-D was reduced translocation from treated leaves to the rest of the plant. However, the presence of other non-target site resistance (NTSR mechanisms has not been investigated up to date. Therefore, the main objective of this research was to reveal if enhanced 2,4-D metabolism is also present in two Spanish resistant (R populations to synthetic auxins. With this aim, HPLC experiments at two 2,4-D rates (600 and 2,400 g ai ha−1 were conducted to identify and quantify the metabolites produced and evaluate possible differences in 2,4-D degradation between resistant (R and susceptible (S plants. Secondarily, to determine the role of cytochrome P450 in the resistance response, dose-response experiments were performed using malathion as its inhibitor. Three populations were used: S, only 2,4-D R (R-703 and multiple R to 2,4-D and ALS inhibitors (R-213. HPLC studies indicated the presence of two hydroxy metabolites in these R populations in shoots and roots, which were not detected in S plants, at both rates. Therefore, enhanced metabolism becomes a new NTSR mechanism in these two P. rhoeas populations from Spain. Results from the dose-response experiments also showed that pre-treatment of R plants with the cytochrome P450 (P450 inhibitor malathion reversed the phenotype to 2,4-D from resistant to susceptible in both R populations. Therefore, it could be hypothesized that a malathion inhibited P450 is responsible of the formation of the hydroxy metabolites detected in the metabolism studies. This and previous research indicate that two resistant mechanisms to 2,4-D could be present in populations R-703 and R-213: reduced translocation and enhanced metabolism. Future experiments are required to confirm these hypotheses
Antibiotic resistance and virulence genes in coliform water isolates.
Stange, C; Sidhu, J P S; Tiehm, A; Toze, S
2016-11-01
Widespread fecal pollution of surface water may present a major health risk and a significant pathway for dissemination of antibiotic resistance bacteria. The River Rhine is one of the longest and most important rivers in Europe and an important raw water source for drinking water production. A total of 100 coliform isolates obtained from River Rhine (Germany) were examined for their susceptibility to seven antimicrobial agents. Resistances against amoxicillin, trimethoprim/sulfamethoxazole and tetracycline were detected in 48%, 11% and 9% of isolates respectively. The antibiotic resistance could be traced back to the resistance genes bla TEM , bla SHV , ampC, sul1, sul2, dfrA1, tet(A) and tet(B). Whereby, the ampC gene represents a special case, because its presence is not inevitably linked to a phenotypic antibiotic resistance. Multiple antibiotics resistance was often accompanied by the occurrence of class 1 or 2 integrons. E. coli isolates belonging to phylogenetic groups A and B1 (commensal) were more predominant (57%) compared to B2 and D groups (43%) which are known to carry virulent genes. Additionally, six E. coli virulence genes were also detected. However, the prevalence of virulence genes in the E. coli isolates was low (not exceeding 4.3% per gene) and no diarrheagenic E. coli pathotypes were detected. This study demonstrates that surface water is an important reservoir of ARGs for a number of antibiotic classes such as sulfonamide, trimethoprim, beta-lactam-antibiotics and tetracycline. The occurrence of antibiotic resistance in coliform bacteria isolated from River Rhine provides evidence for the need to develop management strategies to limit the spread of antibiotic resistant bacteria in aquatic environment. Copyright © 2016 Elsevier GmbH. All rights reserved.
Drug Resistance Mechanisms of Mycoplasma pneumoniae to Macrolide Antibiotics
Directory of Open Access Journals (Sweden)
Xijie Liu
2014-01-01
Full Text Available Throat swabs from children with suspected Mycoplasma pneumoniae (M. pneumoniae infection were cultured for the presence of M. pneumoniae and its species specificity using the 16S rRNA gene. Seventy-six M. pneumoniae strains isolated from 580 swabs showed that 70 were erythromycin resistant with minimum inhibitory concentrations (MIC around 32–512 mg/L. Fifty M. pneumoniae strains (46 resistant, 4 sensitive were tested for sensitivity to tetracycline, ciprofloxacin, and gentamicin. Tetracycline and ciprofloxacin had some effect, and gentamicin had an effect on the majority of M. pneumoniae strains. Domains II and V of the 23S rRNA gene and the ribosomal protein L4 and L22 genes, both of which are considered to be associated with macrolide resistance, were sequenced and the sequences were compared with the corresponding sequences in M129 registered with NCBI and the FH strain. The 70 resistant strains all showed a 2063 or 2064 site mutation in domain V of the 23S rRNA but no mutations in domain II. Site mutations of L4 or L22 can be observed in either resistant or sensitive strains, although it is not known whether this is associated with drug resistance.
Directory of Open Access Journals (Sweden)
De-Kang Zhu
2018-03-01
Full Text Available To investigate tetracycline resistance and resistant genotype in Riemerella anatipestifer, the tetracycline susceptibility of 212 R. anatipestifer isolates from China between 2011 and 2017 was tested. The results showed that 192 of 212 (90.6% R. anatipestifer isolates exhibited resistance to tetracycline (the MICs ranged from 4 to 256 μg/ml. The results of PCR detection showed that, 170 of 212 (80.2% R. anatipestifer isolates possessed the tet(X gene. Other genes, including tet(A, tet(M, tet(Q, tet(O, tet(B, and tet(O/W/32/O, were found at frequencies of 20.8, 4.7, 1.4, 0.9, 0.9, and 0.5%, respectively. However, tet(C, tet(E, tet(G, tet(K, and tet(W were not detected in any isolate. In these tet gene positive strains, 31 (14.6%, 2 (0.9%, 5 (2.4%, 1 (0.5%, 3 (1.4% were detected containing tet(A/tet(X, tet(M/tet(O, tet(M/tet(X, tet(O/tet(X, and tet(Q/tet(X simultaneously, respectively. One isolates, R131, unexpectedly contained three tet genes, i.e., tet(M, tet(O, and tet(X. Sequence analysis of the tet gene ORFs cloned from R. anatipestifer isolates confirmed that tet(A, tet(B, tet(M, tet(O, tet(Q and an unusual mosaic tet gene tet(O/W/32/O were present in R. anatipestifer. The MIC results of R. anatipestifer ATCC 11845 transconjugants carrying tet(A, tet(B, tet(M, tet(O, tet(O/W/32/O, tet(Q, and tet(X genes exhibited tetracycline resistance with MIC values ranging from 4 to 64 μg/ml. Additionally, the tet(X gene could transfer into susceptible strain via natural transformation (transformation frequencies of ~10−6. In conclusion, the tet(A, tet(B, tet(M, tet(O, tet(O/W/32/O, tet(Q, and tet(X genes were found and conferred tetracycline resistance in R. anatipestifer isolates. Moreover, the tet(X is the main mechanism of tetracycline resistance in R. anatipestifer isolates. To our knowledge, this is the first report of tet(A, tet(B, tet(M, tet(O, tet(Q, and mosaic gene tet(O/W/32/O in R. anatipestifer.
Directory of Open Access Journals (Sweden)
Vassetzky Yegor S
2008-12-01
Full Text Available Abstract Background Introduction of new antibiotic resistance genes in the plasmids of interest is a frequent task in molecular cloning practice. Classical approaches involving digestion with restriction endonucleases and ligation are time-consuming. Findings We have created a set of insertion vectors (pINS carrying genes that provide resistance to various antibiotics (puromycin, blasticidin and G418 and containing a loxP site. Each vector (pINS-Puro, pINS-Blast or pINS-Neo contains either a chloramphenicol or a kanamycin resistance gene and is unable to replicate in most E. coli strains as it contains a conditional R6Kγ replication origin. Introduction of the antibiotic resistance genes into the vector of interest is achieved by Cre-mediated recombination between the replication-incompetent pINS and a replication-competent target vector. The recombination mix is then transformed into E. coli and selected by the resistance marker (kanamycin or chloramphenicol present in pINS, which allows to recover the recombinant plasmids with 100% efficiency. Conclusion Here we propose a simple strategy that allows to introduce various antibiotic-resistance genes into any plasmid containing a replication origin, an ampicillin resistance gene and a loxP site.
Occurrence of integrons and antimicrobial resistance genes among Salmonella enterica from Brazil
DEFF Research Database (Denmark)
Peirano, G.; Agersø, Yvonne; Aarestrup, Frank Møller
2006-01-01
= 13) sources. The gene cassette arrangements could be determined in 51 of the positive isolates, which harboured one [dfrA22, aadA1 or orf3 (putative trimethoprim resistance)], two [aadA1-dfrA1, aac(6)-lb-orf1 (unknown function) or aacA4-aadA1], three [dfrA15b-cmlA4-aadA2, orf2 (unknown function......Objectives: To determine the occurrence of antimicrobial resistance genes and role of integrons among 135 anti microbial-resistant Salmonella enterica from Brazil. Methods: The presence of antimicrobial resistance genes, class 1 and 2 integrons and gene cassettes was analysed by PCR and sequencing....... The genetic location of class 1 integrons was determined in 25 isolates by hybridization and plasmid transfer experiments. Results: Fifty-five of the isolates were positive for class I integrons. Integron-positive isolates represented 17 different serovars and were mainly from human (n = 28) and animal (n...
Holden, Todd; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Gadura, N.; Schneider, P.; Sullivan, R.; Flamholz, A.; Lieberman, D.; Cheung, T. D.
2009-08-01
The Single-Stranded DNA-Binding Protein (RPA) Genes in gamma ray radiation-resistant halophilic archaeon Halobacterium sp. NRC-1 were analyzed in terms of their nucleotide fluctuations. In an ATCG sequence, each base was assigned a number equal to its atomic number. The resulting numerical sequence was the basis of the statistical analysis in this study. Fractal analysis using the Higuchi method gave fractal dimensions of 2.04 and 2.06 for the gene sequences VNG2160 and VNG2162, respectively. The 16S rRNA sequence has a fractal dimension of 1.99. The di-nucleotide Shannon entropy values were found to be negatively correlated with the observed fractal dimensions (R2~ 0.992, N=3). Inclusion of Deinococcus radiodurans Rad-A in the regression analysis decreases the R2 slightly to 0.98 (N=4). A third VNG2163 RPA gene of unknown function but with upregulation activity under irradiation was found to have a fractal dimension of 2.05 and a Shannon entropy of 3.77 bits. The above results are similar to those found in bacterial Deinococcus radiodurans and suggest that their high radiation resistance property would have favored selection of CG di-nucleotide pairs. The two transcription factors TbpD (VNG7114) and TfbA (VNG 2184) were also studied. Using VNG7114, VNG2184, and VNG2163; the regression analysis of fractal dimension versus Shannon entropy shows that R2 ~ 0.997 for N =3. The VNG2163 unknown function may be related to the pathways with transcriptions closely regulated to sequences VNG7114 and VNG2184.
Directory of Open Access Journals (Sweden)
Rajagopalan Saranathan
2014-01-01
Full Text Available Background & objectives: The nosocomial human pathogen Acinetobacter baumannii has high propensity to develop resistance to antimicrobials and to become multidrug resistant (MDR, consequently complicating the treatment. This study was carried out to investigate the presence of resistant plasmids (R-plasmids among the clinical isolates of A. baumannii. In addition, the study was performed to check the presence of common β-lactamases encoding genes on these plasmids. Methods: A total of 55 clinical isolates of A. baumannii were included in the study and all were subjected to plasmid DNA isolation, followed by PCR to check the presence of resistance gene determinants such as blaOXA-23 , blaOXA-51, blaOXA-58 and blaIMP-1 on these plasmids that encode for oxacillinase (OXA and metallo-β-lactamase (MBL type of carbapenemases. Plasmid curing experiments were carried out on selected isolates using ethidium bromide and acridine orange as curing agents and the antibiotic resistance profiles were evaluated before and after curing. Results: All the isolates were identified as A. baumannii by 16SrDNA amplification and sequencing. Plasmid DNA isolated from these isolates showed the occurrence of multiple plasmids with size ranging from 500bp to ≥ 25 kb. The percentage of blaOXA-51 and blaOXA-23 on plasmids were found to be 78 and 42 per cent, respectively and 20 isolates (36% carried blaIMP-1 gene on plasmids. Significant difference was observed in the antibiograms of plasmid cured isolates when compared to their parental ones. The clinical isolates became susceptible to more than two antibiotic classes after curing of plasmids indicating plasmid borne resistance. Interpretation & conclusions: Our study determined the plasmid mediated resistance mechanisms and occurrence of different resistance genes on various plasmids isolated from MDR A. baumannii. The present findings showed the evidence for antibiotic resistance mediated through multiple plasmids in
Shen, K A; Meyers, B C; Islam-Faridi, M N; Chin, D B; Stelly, D M; Michelmore, R W
1998-08-01
The recent cloning of genes for resistance against diverse pathogens from a variety of plants has revealed that many share conserved sequence motifs. This provides the possibility of isolating numerous additional resistance genes by polymerase chain reaction (PCR) with degenerate oligonucleotide primers. We amplified resistance gene candidates (RGCs) from lettuce with multiple combinations of primers with low degeneracy designed from motifs in the nucleotide binding sites (NBSs) of RPS2 of Arabidopsis thaliana and N of tobacco. Genomic DNA, cDNA, and bacterial artificial chromosome (BAC) clones were successfully used as templates. Four families of sequences were identified that had the same similarity to each other as to resistance genes from other species. The relationship of the amplified products to resistance genes was evaluated by several sequence and genetic criteria. The amplified products contained open reading frames with additional sequences characteristic of NBSs. Hybridization of RGCs to genomic DNA and to BAC clones revealed large numbers of related sequences. Genetic analysis demonstrated the existence of clustered multigene families for each of the four RGC sequences. This parallels classical genetic data on clustering of disease resistance genes. Two of the four families mapped to known clusters of resistance genes; these two families were therefore studied in greater detail. Additional evidence that these RGCs could be resistance genes was gained by the identification of leucine-rich repeat (LRR) regions in sequences adjoining the NBS similar to those in RPM1 and RPS2 of A. thaliana. Fluorescent in situ hybridization confirmed the clustered genomic distribution of these sequences. The use of PCR with degenerate oligonucleotide primers is therefore an efficient method to identify numerous RGCs in plants.
Noda, Angel A; Matos, Nelvis; Blanco, Orestes; Rodríguez, Islay; Stamm, Lola Virginia
2016-05-01
This study aimed to assess the presence of macrolide-resistant Treponema pallidum subtypes in Havana, Cuba. Samples from 41 syphilis patients were tested for T. pallidum 23S rRNA gene mutations. Twenty-five patients (61%) harbored T. pallidum with the A2058G mutation, which was present in all 8 subtypes that were identified. The A2059G mutation was not detected.
Li, Jiaojiao; Mandal, Goutam; Rosen, Barry P
2016-06-01
The response of the obligate anaerobe Bacteroides vulgatus ATCC 8482, a common human gut microbiota, to arsenic was determined. B. vulgatus ATCC 8482 is highly resistant to pentavalent As(V) and methylarsenate (MAs(V)). It is somewhat more sensitive to trivalent inorganic As(III) but 100-fold more sensitive to methylarsenite (MAs(III)) than to As(III). B. vulgatus ATCC 8482 has eight continuous genes in its genome that we demonstrate form an arsenical-inducible transcriptional unit. The first gene of this ars operon, arsR, encodes a putative ArsR As(III)-responsive transcriptional repressor. The next three genes encode proteins of unknown function. The remaining genes, arsDABC, have well-characterized roles in detoxification of inorganic arsenic, but there are no known genes for MAs(III) resistance. Expression of each gene after exposure to trivalent and pentavalent inorganic and methylarsenicals was analyzed. MAs(III) was the most effective inducer. The arsD gene was the most highly expressed of the ars operon genes. These results demonstrate that this anaerobic microbiome bacterium has arsenic-responsive genes that confer resistance to inorganic arsenic and may be responsible for the organism's ability to maintain its prevalence in the gut following dietary exposure to inorganic arsenic. Copyright © 2016 Elsevier Ltd. All rights reserved.
Matus, José Tomás; Aquea, Felipe; Arce-Johnson, Patricio
2008-01-01
Background The MYB superfamily constitutes the most abundant group of transcription factors described in plants. Members control processes such as epidermal cell differentiation, stomatal aperture, flavonoid synthesis, cold and drought tolerance and pathogen resistance. No genome-wide characterization of this family has been conducted in a woody species such as grapevine. In addition, previous analysis of the recently released grape genome sequence suggested expansion events of several gene families involved in wine quality. Results We describe and classify 108 members of the grape R2R3 MYB gene subfamily in terms of their genomic gene structures and similarity to their putative Arabidopsis thaliana orthologues. Seven gene models were derived and analyzed in terms of gene expression and their DNA binding domain structures. Despite low overall sequence homology in the C-terminus of all proteins, even in those with similar functions across Arabidopsis and Vitis, highly conserved motif sequences and exon lengths were found. The grape epidermal cell fate clade is expanded when compared with the Arabidopsis and rice MYB subfamilies. Two anthocyanin MYBA related clusters were identified in chromosomes 2 and 14, one of which includes the previously described grape colour locus. Tannin related loci were also detected with eight candidate homologues in chromosomes 4, 9 and 11. Conclusion This genome wide transcription factor analysis in Vitis suggests that clade-specific grape R2R3 MYB genes are expanded while other MYB genes could be well conserved compared to Arabidopsis. MYB gene abundance, homology and orientation within particular loci also suggests that expanded MYB clades conferring quality attributes of grapes and wines, such as colour and astringency, could possess redundant, overlapping and cooperative functions. PMID:18647406
Occurrence of integrons and resistance genes among sulphonamide-resistant Shigella spp. from Brazil
DEFF Research Database (Denmark)
Peirano, G.; Agersø, Yvonne; Aarestrup, Frank Møller
2005-01-01
Objectives: To determine the occurrence of class 1 and 2 integrons and antimicrobial resistance genes among sulphonamide-resistant Shigella strains isolated in Brazil during 1999-2003. Methods: Sixty-two Shigella (Shigella flexneri, n = 47 and Shigella sonnei, n = 15) were tested against 21...... antimicrobial agents. The presence of integrons classes 1 and 2 and antimicrobial resistance genes was investigated by PCR using specific primers. Results: A total of eight antimicrobial resistance profiles were identified, with the profile of resistance to sulfamethoxazole, trimethoprim, spectinomycin...... of 2214 bp harbouring a gene cassette array conferring resistance to trimethoprim, streptothricin and spectinomycin/streptomycin. The genes coding for resistance to chloramphenicol (catA1), tetracycline [tet(A) and tet(B)] and ampicillin (bla(OXA) and bla(TEM)), were detected in resistant strains...
Narvaez, Isabel; Khayreddine, Titouh; Pliego, Clara; Cerezo, Sergio; Jiménez-Díaz, Rafael M.; Trapero-Casas, José L.; López-Herrera, Carlos; Arjona-Girona, Isabel; Martín, Carmen; Mercado, José A.; Pliego-Alfaro, Fernando
2018-01-01
The antifungal protein (AFP) produced by Aspergillus giganteus, encoded by the afp gene, has been used to confer resistance against a broad range of fungal pathogens in several crops. In this research, transgenic olive plants expressing the afp gene under the control of the constitutive promoter CaMV35S were generated and their disease response against two root infecting fungal pathogens, Verticillium dahliae and Rosellinia necatrix, was evaluated. Embryogenic cultures derived from a mature zygotic embryo of cv. ‘Picual’ were used for A. tumefaciens transformation. Five independent transgenic lines were obtained, showing a variable level of afp expression in leaves and roots. None of these transgenic lines showed enhanced resistance to Verticillium wilt. However, some of the lines displayed a degree of incomplete resistance to white root rot caused by R. necatrix compared with disease reaction of non-transformed plants or transgenic plants expressing only the GUS gene. The level of resistance to this pathogen correlated with that of the afp expression in root and leaves. Our results indicate that the afp gene can be useful for enhanced partial resistance to R. necatrix in olive, but this gene does not protect against V. dahliae. PMID:29875785
International Nuclear Information System (INIS)
Liu, Zhen; Cheng, Chao; Luo, Xiaojun; Xia, Qiong; Zhang, Yejie; Long, Xiaobing; Jiang, Qingping; Fang, Weiyi
2016-01-01
In previous investigation, we reported that stably knocking down cyclin-dependent kinase 4(CDK4) induced expression of let-7c, which further suppressed cell cycle transition and cell growth by modulating cell cycle signaling in nasopharyngeal carcinoma (NPC). In this study, we further explored the molecular function and mechanism of CDK4 modulating miRNAs to stimulate cell cycle transition, cell growth, and Cisplatin (DDP) -resistance on in NPC. We identified changes in miRNAs by miRNA array and real-time PCR and the effect on DDP after knocking down CDK4 in NPC cells. Further, we investigated the molecular mechanisms by which CDK4 modulated miR-15a in NPC. Moreover, we also explored the role of miR-15a and the effect on DDP in NPC. Finally, we analyzed the correlation of miR-15a and CDK4 expression in NPC tissues. In addition to let-7 family members, we observed that upregulated expression of miR-15a was significantly induced in CDK4-suppressed NPC cells. Further, we found that knocking down CDK4 suppressed c-Myc expression, and the latter directly suppressed the expression of miR-15a in NPC. Furthermore, miR-15a as a tumor suppressor antagonized CDK4 repressing cell cycle progression and cell growth in vitro and in vivo and induced the sensitivity of cells to DDP by regulating the c-Myc/CCND1/CDK4/E2F1 pathway in NPC. Finally, miR-15a was negatively weak correlated with the expression of CDK4 in NPC. Our studies demonstrate that CDK4 and miR-15a comprise an abnormal automodulatory feedback loop stimulating the pathogenesis and inducing chemotherapy resistance in NPC. The online version of this article (doi:10.1186/s12885-016-2277-2) contains supplementary material, which is available to authorized users
Development and mapping of SSR markers linked to resistance-gene homologue clusters in common bean
Institute of Scientific and Technical Information of China (English)
Luz; Nayibe; Garzon; Matthew; Wohlgemuth; Blair
2014-01-01
Common bean is an important but often a disease-susceptible legume crop of temperate,subtropical and tropical regions worldwide. The crop is affected by bacterial, fungal and viral pathogens. The strategy of resistance-gene homologue(RGH) cloning has proven to be an efficient tool for identifying markers and R(resistance) genes associated with resistances to diseases. Microsatellite or SSR markers can be identified by physical association with RGH clones on large-insert DNA clones such as bacterial artificial chromosomes(BACs). Our objectives in this work were to identify RGH-SSR in a BAC library from the Andean genotype G19833 and to test and map any polymorphic markers to identify associations with known positions of disease resistance genes. We developed a set of specific probes designed for clades of common bean RGH genes and then identified positive BAC clones and developed microsatellites from BACs having SSR loci in their end sequences. A total of 629 new RGH-SSRs were identified and named BMr(bean microsatellite RGH-associated markers). A subset of these markers was screened for detecting polymorphism in the genetic mapping population DOR364 × G19833. A genetic map was constructed with a total of 264 markers,among which were 80 RGH loci anchored to single-copy RFLP and SSR markers. Clusters of RGH-SSRs were observed on most of the linkage groups of common bean and in positions associated with R-genes and QTL. The use of these new markers to select for disease resistance is discussed.
DEFF Research Database (Denmark)
Laht, Mailis; Karkman, Antti; Voolaid, Veiko
2014-01-01
Antibiotics and antibiotic resistant bacteria enter wastewater treatment plants (WWTPs), an environment where resistance genes can potentially spread and exchange between microbes. Several antibiotic resistance genes (ARGs) were quantified using qPCR in three WWTPs of decreasing capacity located...... abundances with 16S rRNA gene abundances while assessing if the respective genes increased or decreased during treatment. ARGs were detected in most samples; sul1, sul2, and tetM were detected in all samples. Statistically significant differences (adjusted p... in the relative abundance of resistance genes, while the raw abundances fell by several orders of magnitude. Standard water quality variables (biological oxygen demand, total phosphorus and nitrogen, etc.) were weakly related or unrelated to the relative abundance of resistance genes. Based on our results we...
Directory of Open Access Journals (Sweden)
Tiane Martin de Moura
2012-10-01
Full Text Available INTRODUCTION: Staphylococcal species are pathogens that are responsible for outbreaks of foodborne diseases. The aim of this study was to investigate the prevalence of enterotoxin-genes and the antimicrobial resistance profile in staphylococcus coagulase-negative (CoNS and coagulasepositive (CoPS isolates from black pudding in southern Brazil. METHODS: Two hundred typical and atypical colonies from Baird-Parker agar were inoculated on mannitol salt agar. Eighty-two mannitol-positive staphylococci were submitted to conventional biochemical tests and antimicrobial susceptibility profiling. The presence of coagulase (coa and enterotoxin (se genes was investigated by polymerase chain reaction. RESULTS: The isolates were divided into 2 groups: 75.6% (62/82 were CoNS and 24.4% (20/82 were CoPS. The biochemical tests identified 9 species, of which Staphylococcus saprophyticus (37.8% and Staphylococcus carnosus (15.9% were the most prevalent. Antimicrobial susceptibility tests showed resistance phenotypes to antibiotics widely administered in humans, such as gentamicin, tetracycline, chloramphenicol, and erythromycin. The coa gene was detected in 19.5% (16/82 of the strains and 4 polymorphic DNA fragments were observed. Five CoNS isolates carrying the coa gene were submitted for 16S rRNA sequencing and 3 showed similarity with CoNS. Forty strains were positive for at least 1 enterotoxin-encoding gene, the genes most frequently detected were sea (28.6% and seb (27.5%. CONCLUSIONS: The presence of antimicrobial resistant and enterotoxin-encoding genes in staphylococci isolates from black pudding indicated that this fermented food may represent a potential health risk, since staphylococci present in food could cause foodborne diseases or be a possible route for the transfer of antimicrobial resistance to humans.
MiR-285 targets P450 (CYP6N23) to regulate pyrethroid resistance in Culex pipiens pallens.
Tian, Mengmeng; Liu, Bingqian; Hu, Hongxia; Li, Xixi; Guo, Qin; Zou, Feifei; Liu, Xianmiao; Hu, Mengxue; Guo, Juxin; Ma, Lei; Zhou, Dan; Sun, Yan; Shen, Bo; Zhu, Changliang
2016-12-01
MicroRNAs play critical roles in post-transcriptional regulation of gene expression, which participate in the modulation of almost all of the cellular processes. Although emerging evidence indicates that microRNAs are related with antineoplastic drugs resistance, whether microRNAs are responsible for insecticide resistance in mosquitos is poorly understood. In this paper, we found that miR-285 was significantly upregulated in the deltamethrin-resistant strain of Culex pipiens pallens, and overexpression miR-285 through microinjection increased mosquito survival rate against deltamethrin treatement. Using bioinformatic software, quantitative reverse transcription PCR, luciferase reporter assay and microinjection approaches, we conformed that CYP6N23 was the target of miR-285. Lower expression of CYP6N23 was observed in the deltamethrin-resistant strain. While, mosquito mortality rate was decreased after downregulating expression of CYP6N23 by dsRNA against CYP6N23 or miR-285 mimic microinjection. These findings revealed that miR-285 could target CYP6N23 to regulate pyrethroid resistance, providing new insights into mosquito insecticide resistance surveillance and control.
Intrasplicing coordinates alternative first exons with alternative splicing in the protein 4.1R gene
Energy Technology Data Exchange (ETDEWEB)
Conboy, John G.; Parra, Marilyn K.; Tan, Jeff S.; Mohandas, Narla; Conboy, John G.
2008-11-07
In the protein 4.1R gene, alternative first exons splice differentially to alternative 3' splice sites far downstream in exon 2'/2 (E2'/2). We describe a novel intrasplicing mechanism by which exon 1A (E1A) splices exclusively to the distal E2'/2 acceptor via two nested splicing reactions regulated by novel properties of exon 1B (E1B). E1B behaves as an exon in the first step, using its consensus 5' donor to splice to the proximal E2'/2 acceptor. A long region of downstream intron is excised, juxtaposing E1B with E2'/2 to generate a new composite acceptor containing the E1B branchpoint/pyrimidine tract and E2 distal 3' AG-dinucleotide. Next, the upstream E1A splices over E1B to this distal acceptor, excising the remaining intron plus E1B and E2' to form mature E1A/E2 product. We mapped branch points for both intrasplicing reactions and demonstrated that mutation of the E1B 5' splice site or branchpoint abrogates intrasplicing. In the 4.1R gene, intrasplicing ultimately determines N-terminal protein structure and function. More generally, intrasplicing represents a new mechanism whereby alternative promoters can be coordinated with downstream alternative splicing.
Directory of Open Access Journals (Sweden)
Wan Hongjian
2010-08-01
Full Text Available Abstract Background Due to the variation and mutation of the races of Pseudoperonospora cubensis, downy mildew has in recent years become the most devastating leaf disease of cucumber worldwide. Novel resistance to downy mildew has been identified in the wild Cucumis species, C. hystrix Chakr. After the successful hybridization between C. hystrix and cultivated cucumber (C. sativus L., an introgression line (IL5211S was identified as highly resistant to downy mildew. Nucleotide-binding site and leucine-rich repeat (NBS-LRR genes are the largest class of disease resistance genes cloned from plant with highly conserved domains, which can be used to facilitate the isolation of candidate genes associated with downy mildew resistance in IL5211S. Results Degenerate primers that were designed based on the conserved motifs in the NBS domain of resistance (R proteins were used to isolate NBS-type sequences from IL5211S. A total of 28 sequences were identified and named as cucumber (C. sativus = CS resistance gene analogs as CSRGAs. Polygenetic analyses separated these sequences into four different classes. Quantitative real-time polymerase chain reaction (qRT-PCR analysis showed that these CSRGAs expressed at different levels in leaves, roots, and stems. In addition, introgression from C. hystrix induced expression of the partial CSRGAs in cultivated cucumber, especially CSRGA23, increased four-fold when compared to the backcross parent CC3. Furthermore, the expression of CSRGA23 under P. cubensis infection and abiotic stresses was also analyzed at different time points. Results showed that the P. cubensis treatment and four tested abiotic stimuli, MeJA, SA, ABA, and H2O2, triggered a significant induction of CSRGA23 within 72 h of inoculation. The results indicate that CSRGA23 may play a critical role in protecting cucumber against P. cubensis through a signaling the pathway triggered by these molecules. Conclusions Four classes of NBS-type RGAs were
DEFF Research Database (Denmark)
Castberg, Dorte Heidi Højland; Kristensen, Michael
2017-01-01
strains differing significantly in their response to insecticides. High differential expression of P450s and genes coding for cuticle protein indicates a combination of factors involved in metabolic neonicotinoid and spinosad resistance. Conclusion Resistance in these strains is apparently not linked...... interesting in terms of neonicotinoid resistance, while cyp4d9 was overexpressed in 791spin compared to spinosad-susceptible strains. GSTs, ESTs and UGTs were mostly overexpressed, but not to the same degree as P450s. We present a comprehensive and comparative picture of gene expression in three housefly......Background The housefly is a global pest that has developed resistance to most insecticides applied against it. Resistance of the spinosad-resistant strain 791spin and the neonicotinoid-resistant 766b strain is believed to be due to metabolism. We investigate differentially expressed genes...
Organization of a resistance gene cluster linked to rhizomania resistance in sugar beet
Genetic resistance to rhizomania has been in use for over 40 years. Characterization of the molecular basis for susceptibility and resistance has proved challenging. Nucleotide-binding leucine-rich-repeat-containing (NB-LRR) genes have been implicated in numerous gene-for-gene resistance interaction...
The effect of vorinostat on the development of resistance to doxorubicin in neuroblastoma.
Directory of Open Access Journals (Sweden)
Timothy B Lautz
Full Text Available Histone deacetylase (HDAC inhibitors, especially vorinostat, are currently under investigation as potential adjuncts in the treatment of neuroblastoma. The effect of vorinostat co-treatment on the development of resistance to other chemotherapeutic agents is unknown. In the present study, we treated two human neuroblastoma cell lines [SK-N-SH and SK-N-Be(2C] with progressively increasing doses of doxorubicin under two conditions: with and without vorinsotat co-therapy. The resultant doxorubicin-resistant (DoxR and vorinostat-treated doxorubicin resistant (DoxR-v cells were equally resistant to doxorubicin despite significantly lower P-glycoprotein expression in the DoxR-v cells. Whole genome analysis was performed using the Ilumina Human HT-12 v4 Expression Beadchip to identify genes with differential expression unique to the DoxR-v cells. We uncovered a number of genes whose differential expression in the DoxR-v cells might contribute to their resistant phenotype, including hypoxia inducible factor-2. Finally, we used Gene Ontology to categorize the biological functions of the differentially expressed genes unique to the DoxR-v cells and found that genes involved in cellular metabolism were especially affected.
Glynn, Neil C; Comstock, Jack C; Sood, Sushma G; Dang, Phat M; Chaparro, Jose X
2008-01-01
Resistance gene analogues (RGAs) have been isolated from many crops and offer potential in breeding for disease resistance through marker-assisted selection, either as closely linked or as perfect markers. Many R-gene sequences contain kinase domains, and indeed kinase genes have been reported as being proximal to R-genes, making kinase analogues an additionally promising target. The first step towards utilizing RGAs as markers for disease resistance is isolation and characterization of the sequences. Sugarcane clone US01-1158 was identified as resistant to yellow leaf caused by the sugarcane yellow leaf virus (SCYLV) and moderately resistant to rust caused by Puccinia melanocephala Sydow & Sydow. Degenerate primers that had previously proved useful for isolating RGAs and kinase analogues in wheat and soybean were used to amplify DNA from sugarcane (Saccharum spp.) clone US-01-1158. Sequences generated from 1512 positive clones were assembled into 134 contigs of between two and 105 sequences. Comparison of the contig consensuses with the NCBI sequence database using BLASTx showed that 20 had sequence homology to nuclear binding site and leucine rich repeat (NBS-LRR) RGAs, and eight to kinase genes. Alignment of the deduced amino acid sequences with similar sequences from the NCBI database allowed the identification of several conserved domains. The alignment and resulting phenetic tree showed that many of the sequences had greater similarity to sequences from other species than to one another. The use of degenerate primers is a useful method for isolating novel sugarcane RGA and kinase gene analogues. Further studies are needed to evaluate the role of these genes in disease resistance.
Andreenkova, O V; Karpova, E K; Menshanov, P N; Rauschenbach, I Yu
2015-02-01
Hemolymph filtration in insects is performed by nephrocytes, additional cells of the circulatory system that are not connected to Malpighian vessels. Drosophila has two types of nephrocytes: the ventral ("garland"), which are situated around the connection site of the esophagus and proventriculus, and the pericardial, which are localized around the heart. In this study, we examined the role of the of insulin-like receptor (InR)gene in regulation of the function of ventral nephrocytes (VNC) in D. melanogaster females. Immunofluorescent analysis of female VNC with anti-InR antibodies revealed for the first time that the InR gene is expressed in VNC cells. To determine whether a change in the level of InR expression has an effect on VNC function in Drosophila females, we implemented an antisense suppressor of the InR gene, together with a driver that is expressed specifically in VNC. VNC function was evaluated by survival of the females exposed to toxic stress (treatment with AgNO3). This study has shown for the first time that suppression of InR expression in VNC leads to a rise in the survival of flies under conditions of toxic stress.
Fat mass and obesity (FTO) and melanocortin-4 receptor (MC4R) and are relevant genes associated with obesity. This could be through food intake, but results are contradictory. Modulation by diet or other lifestyle factors is also not well understood. To investigate whether MC4R and FTO associations ...
Genetic mapping of a major dominant gene for resistance to Ralstonia solanacearum in eggplant.
Lebeau, A; Gouy, M; Daunay, M C; Wicker, E; Chiroleu, F; Prior, P; Frary, A; Dintinger, J
2013-01-01
Resistance of eggplant against Ralstonia solanacearum phylotype I strains was assessed in a F(6) population of recombinant inbred lines (RILs) derived from a intra-specific cross between S. melongena MM738 (susceptible) and AG91-25 (resistant). Resistance traits were determined as disease score, percentage of wilted plants, and stem-based bacterial colonization index, as assessed in greenhouse experiments conducted in Réunion Island, France. The AG91-25 resistance was highly efficient toward strains CMR134, PSS366 and GMI1000, but only partial toward the highly virulent strain PSS4. The partial resistance found against PSS4 was overcome under high inoculation pressure, with heritability estimates from 0.28 to 0.53, depending on the traits and season. A genetic map was built with 119 AFLP, SSR and SRAP markers positioned on 18 linkage groups (LG), for a total length of 884 cM, and used for quantitative trait loci (QTL) analysis. A major dominant gene, named ERs1, controlled the resistance to strains CMR134, PSS366, and GMI1000. Against strain PSS4, this gene was not detected, but a significant QTL involved in delay of disease progress was detected on another LG. The possible use of the major resistance gene ERs1 in marker-assisted selection and the prospects offered for academic studies of a possible gene for gene system controlling resistance to bacterial wilt in solanaceous plants are discussed.
Directory of Open Access Journals (Sweden)
Axel eCloeckaert
2013-07-01
Full Text Available A screening for non-target mutations affecting fluoroquinolone susceptibility was conducted in epidemic multidrug-resistant Salmonella enterica serovar Kentucky ST198. Among a panel of representative isolates (n=30, covering the epidemic, only three showed distinct mutations in ramR resulting in enhanced expression of genes encoding the AcrAB-TolC efflux system and low increase in ciprofloxacin MIC. No mutations were detected in other regulatory regions of this efflux system. Ciprofloxacin resistance in serovar Kentucky ST198 is thus currently mainly due to multiple target gene mutations.
Assogba, Benoît S; Djogbénou, Luc S; Milesi, Pascal; Berthomieu, Arnaud; Perez, Julie; Ayala, Diego; Chandre, Fabrice; Makoutodé, Michel; Labbé, Pierrick; Weill, Mylène
2015-10-05
Widespread resistance to pyrethroids threatens malaria control in Africa. Consequently, several countries switched to carbamates and organophophates insecticides for indoor residual spraying. However, a mutation in the ace-1 gene conferring resistance to these compounds (ace-1(R) allele), is already present. Furthermore, a duplicated allele (ace-1(D)) recently appeared; characterizing its selective advantage is mandatory to evaluate the threat. Our data revealed that a unique duplication event, pairing a susceptible and a resistant copy of the ace-1 gene spread through West Africa. Further investigations revealed that, while ace-1(D) confers less resistance than ace-1(R), the high fitness cost associated with ace-1(R) is almost completely suppressed by the duplication for all traits studied. ace-1 duplication thus represents a permanent heterozygote phenotype, selected, and thus spreading, due to the mosaic nature of mosquito control. It provides malaria mosquito with a new evolutionary path that could hamper resistance management.
Purves, Joanne; Thomas, Jamie; Riboldi, Gustavo P.; Zapotoczna, Marta; Tarrant, Emma; Andrew, Peter W.; Londoño, Alejandra; Planet, Paul J.; Geoghegan, Joan A.; Waldron, Kevin J.
2018-01-01
Summary Excess copper is highly toxic and forms part of the host innate immune system's antibacterial arsenal, accumulating at sites of infection and acting within macrophages to kill engulfed pathogens. We show for the first time that a novel, horizontally gene transferred copper resistance locus (copXL), uniquely associated with the SCCmec elements of the highly virulent, epidemic, community acquired methicillin resistant Staphylococcus aureus (CA‐MRSA) USA300, confers copper hyper‐resistance. These genes are additional to existing core genome copper resistance mechanisms, and are not found in typical S. aureus lineages, but are increasingly identified in emerging pathogenic isolates. Our data show that CopX, a putative P1B‐3‐ATPase efflux transporter, and CopL, a novel lipoprotein, confer copper hyper‐resistance compared to typical S. aureus strains. The copXL genes form an operon that is tightly repressed in low copper environments by the copper regulator CsoR. Significantly, CopX and CopL are important for S. aureus USA300 intracellular survival within macrophages. Therefore, the emergence of new S. aureus clones with the copXL locus has significant implications for public health because these genes confer increased resistance to antibacterial copper toxicity, enhancing bacterial fitness by altering S. aureus interaction with innate immunity. PMID:29521441
Directory of Open Access Journals (Sweden)
Jing WANG,Chen CHENG,Yanru ZHOU,Yong YANG,Qiong MEI,Junmin LI,Ye CHENG,Chengqi YAN,Jianping CHEN
2015-09-01
Full Text Available Y73 is a progeny of asymmetric somatic hybridization between Oryza sativa cv. Dalixiang and the wild rice species Oryza meyeriana. Inoculation with a range of strains of Xanthomonas oryzae pv. oryzae showed that Y73 had inherited a high level of resistance to rice bacterial blight (BB from its wild parent. An F2 population of 7125 individuals was constructed from the cross between Y73 and a BB-susceptible cultivar IR24. After testing 615 SSR and STS markers covering the 12 rice chromosomes, 186 markers were selected that showed polymorphism between Y73 and IR24. Molecular markers linked to the BB resistance genes in Y73 were scanned using the F2 population and the polymorphic markers. The SSR marker RM128 on chromosome 1, the STS marker R03D159 on chromosome 3 and the STS marker R05D104 on chromosome 5 were found to be linked to the rice BB resistance genes in Y73.
Directory of Open Access Journals (Sweden)
Rosa Lozano-Durán
2013-03-01
Full Text Available The development of high-throughput technologies allows for evaluating gene expression at the whole-genome level. Together with proteomic and metabolomic studies, these analyses have resulted in the identification of plant genes whose function or expression is altered as a consequence of pathogen attacks. Members of the Tomato yellow leaf curl virus (TYLCV complex are among the most important pathogens impairing production of agricultural crops worldwide. To understand how these geminiviruses subjugate plant defenses, and to devise counter-measures, it is essential to identify the host genes affected by infection and to determine their role in susceptible and resistant plants. We have used a reverse genetics approach based on Tobacco rattle virus-induced gene silencing (TRV-VIGS to uncover genes involved in viral infection of susceptible plants, and to identify genes underlying virus resistance. To identify host genes with a role in geminivirus infection, we have engineered a Nicotiana benthamiana line, coined 2IRGFP, which over-expresses GFP upon virus infection. With this system, we have achieved an accurate description of the dynamics of virus replication in space and time. Upon silencing selected N. benthamiana genes previously shown to be related to host response to geminivirus infection, we have identified eighteen genes involved in a wide array of cellular processes. Plant genes involved in geminivirus resistance were studied by comparing two tomato lines: one resistant (R, the other susceptible (S to the virus. Sixty-nine genes preferentially expressed in R tomatoes were identified by screening cDNA libraries from infected and uninfected R and S genotypes. Out of the 25 genes studied so far, the silencing of five led to the total collapse of resistance, suggesting their involvement in the resistance gene network. This review of our results indicates that TRV-VIGS is an exquisite reverse genetics tool that may provide new insights into the
Xu, Jia; Tan, Xiao; Zhang, Xinyu; Xia, Xiaoli; Sun, Huaichang
2015-11-01
Staphylococci are the leading pathogens of bovine mastitis which is difficult to control. However, the published data on the prevalence of staphylococcal species, virulence and antibiotic resistance genes in bovine mastitis from China are limited. In this study, 104 out of 209 subclinical mastitis milk samples from a single Chinese dairy herd were cultured-positive for staphylococci (49.8%), which were further identified as coagulase-positive staphylococci (CPS) or coagulase-negative staphylococci (CNS). According to the partial tuf and/or 16S rRNA gene sequence, the 28 CPS isolates were confirmed to be Staphylococcus aureus (26.9%), and 76 CNS isolates were assigned to 13 different species (73.1%) with Staphylococcus arlettae, Staphylococcus sciuri, Staphylococcus xylosus and Staphylococcus chromogenes as the dominant species. In the 28 S. aureus isolates, the most prevalent general virulence genes were coa, Ig and eno (100%), followed by hla (96.4%), hlb (92.9%), fib (92.9%), clfA (89.3%), clfB (85.7%) and nuc (85.7%). Both exotoxin and biofilm-associated genes were significantly less prevalent than the previously reported. Although 19 different virulence gene patterns were found, only one was dominant (32.1%). The prevalence of blaZ (82.1%) or mecA gene (35.7%) was much higher than the previously reported. In the 76 CNS isolates, the virulence genes were significantly less prevalent than that in the S. aureus isolates. Among the 4 main CNS species, S. chromogenes (n = 12) was the only species with high percentage (75%) of blaZ gene, while S. sciuri (n = 12) was the only species with the high percentage (66.7%) of mecA gene. The most of antibiotic resistance genes were present as multi-resistance genes, and the antibiotic resistances were attributed by different resistance genes between resistant S. aureus and CNS isolates. These data suggest that the prevalence of staphylococcal species, virulence and antibiotic resistance in the mastitis milk from the Chinese
Directory of Open Access Journals (Sweden)
Fay E Dawes
Full Text Available This study characterizes the 21.4 kilobase plasmid pECTm80 isolated from Escherichia coli strain 80, an α hemolytic human clinical diarrhoeal isolate (serotype O108:H-. DNA sequence analysis of pECTm80 revealed it belonged to incompatibility group X1, and contained plasmid partition and toxin-antitoxin systems, an R6K-like triple origin (ori replication system, genes required for replication regulation, insertion sequences IS1R, ISEc37 and a truncated transposase gene (Tn3-like ΔtnpA of the Tn3 family, and carried a class 2 integron. The class 2 integron of pECTm80 contains an intact cassette array dfrA1-sat2, encoding resistance to trimethoprim and streptothricin, and an aadA1 gene cassette truncated by the insertion of IS1R. The complex plasmid replication system includes α, β and γ origins of replication. Pairwise BLASTn comparison of pECTm80 with plasmid pE001 reveals a conserved plasmid backbone suggestive of a common ancestral lineage. Plasmid pECTm80 is of potential clinical importance, as it carries multiple genes to ensure its stable maintenance through successive bacterial cell divisions and multiple antibiotic resistance genes.
International Nuclear Information System (INIS)
Jia, Yanhan; Zhang, Yan; Qiao, Chunxia; Liu, Guijun; Zhao, Qing; Zhou, Tingting; Chen, Guojiang; Li, Yali; Feng, Jiannan; Li, Yan; Zhang, Qiuping; Peng, Hui
2013-01-01
Highlights: •We established trastuzumab-resistant cell line SKOV3/T. •SKOV3/T enhances proliferation and in vivo carcinogenesis. •IGF-1R and HER3 genes were up-regulated in SKOV3/T based on microarray analysis. •Targeting IGF-1R and/or HER3 inhibited the proliferation of SKOV3/T. •Therapies targeting IGF-1R and HER3 might be effective in ovarian cancer. -- Abstract: Trastuzumab (Herceptin®) has demonstrated clinical potential in several types of HER2-overexpressing human cancers. However, primary and acquired resistance occurs in many HER2-positive patients with regimens. To investigate the possible mechanism of acquired therapeutic resistance to trastuzumab, we have developed a preclinical model of human ovarian cancer cells, SKOV3/T, with the distinctive feature of stronger carcinogenesis. The differences in gene expression between parental and the resistant cells were explored by microarray analysis, of which IGF-1R and HER3 were detected to be key molecules in action. Their correctness was validated by follow-up experiments of RT-PCR, shRNA-mediated knockdown, downstream signal activation, cell cycle distribution and survival. These results suggest that IGF-1R and HER3 differentially regulate trastuzumab resistance and could be promising targets for trastuzumab therapy in ovarian cancer
Energy Technology Data Exchange (ETDEWEB)
Jia, Yanhan [Department of Immunology, School of Basic Medical Sciences, Wuhan University, Wuhan, Hubei 430071 (China); Department of Immunology, Institute of Basic Medical Sciences, Beijing 100850 (China); Zhang, Yan [Department of Gynaecology and Obstetrics, PLA General Hospital, Beijing 100853 (China); Qiao, Chunxia; Liu, Guijun [Department of Immunology, Institute of Basic Medical Sciences, Beijing 100850 (China); Zhao, Qing [Department of Immunology, Institute of Basic Medical Sciences, Beijing 100850 (China); Department of Gynaecology and Obstetrics, PLA General Hospital, Beijing 100853 (China); Zhou, Tingting; Chen, Guojiang [Department of Immunology, Institute of Basic Medical Sciences, Beijing 100850 (China); Li, Yali [Department of Gynaecology and Obstetrics, PLA General Hospital, Beijing 100853 (China); Feng, Jiannan; Li, Yan [Department of Immunology, Institute of Basic Medical Sciences, Beijing 100850 (China); Zhang, Qiuping, E-mail: qpzhang@whu.edu.cn [Department of Immunology, School of Basic Medical Sciences, Wuhan University, Wuhan, Hubei 430071 (China); Peng, Hui, E-mail: p_h2002@hotmail.com [Department of Immunology, Institute of Basic Medical Sciences, Beijing 100850 (China); Cardiovascular Drug Research Center, Institute of Health and Environmental Medicine, Beijing 100850 (China)
2013-07-12
Highlights: •We established trastuzumab-resistant cell line SKOV3/T. •SKOV3/T enhances proliferation and in vivo carcinogenesis. •IGF-1R and HER3 genes were up-regulated in SKOV3/T based on microarray analysis. •Targeting IGF-1R and/or HER3 inhibited the proliferation of SKOV3/T. •Therapies targeting IGF-1R and HER3 might be effective in ovarian cancer. -- Abstract: Trastuzumab (Herceptin®) has demonstrated clinical potential in several types of HER2-overexpressing human cancers. However, primary and acquired resistance occurs in many HER2-positive patients with regimens. To investigate the possible mechanism of acquired therapeutic resistance to trastuzumab, we have developed a preclinical model of human ovarian cancer cells, SKOV3/T, with the distinctive feature of stronger carcinogenesis. The differences in gene expression between parental and the resistant cells were explored by microarray analysis, of which IGF-1R and HER3 were detected to be key molecules in action. Their correctness was validated by follow-up experiments of RT-PCR, shRNA-mediated knockdown, downstream signal activation, cell cycle distribution and survival. These results suggest that IGF-1R and HER3 differentially regulate trastuzumab resistance and could be promising targets for trastuzumab therapy in ovarian cancer.
Influence of silencing the MC4R gene by lentivirusmediated RNA ...
African Journals Online (AJOL)
Melanocortin receptor 4 (MC4R) is a key element in the mechanisms used to regulate both aspects of keeping the balance between energy uptake and energy expenditure. MC4R was knocked down by lentivirus-mediated shRNA expressing plasmids, which were controlled by the U6 promoter in bovine fibroblast cells, and ...
Directory of Open Access Journals (Sweden)
Arce-Johnson Patricio
2008-07-01
Full Text Available Abstract Background The MYB superfamily constitutes the most abundant group of transcription factors described in plants. Members control processes such as epidermal cell differentiation, stomatal aperture, flavonoid synthesis, cold and drought tolerance and pathogen resistance. No genome-wide characterization of this family has been conducted in a woody species such as grapevine. In addition, previous analysis of the recently released grape genome sequence suggested expansion events of several gene families involved in wine quality. Results We describe and classify 108 members of the grape R2R3 MYB gene subfamily in terms of their genomic gene structures and similarity to their putative Arabidopsis thaliana orthologues. Seven gene models were derived and analyzed in terms of gene expression and their DNA binding domain structures. Despite low overall sequence homology in the C-terminus of all proteins, even in those with similar functions across Arabidopsis and Vitis, highly conserved motif sequences and exon lengths were found. The grape epidermal cell fate clade is expanded when compared with the Arabidopsis and rice MYB subfamilies. Two anthocyanin MYBA related clusters were identified in chromosomes 2 and 14, one of which includes the previously described grape colour locus. Tannin related loci were also detected with eight candidate homologues in chromosomes 4, 9 and 11. Conclusion This genome wide transcription factor analysis in Vitis suggests that clade-specific grape R2R3 MYB genes are expanded while other MYB genes could be well conserved compared to Arabidopsis. MYB gene abundance, homology and orientation within particular loci also suggests that expanded MYB clades conferring quality attributes of grapes and wines, such as colour and astringency, could possess redundant, overlapping and cooperative functions.
Directory of Open Access Journals (Sweden)
MATHODIYIL S. MANJULA
2015-12-01
Full Text Available Plant disease resistance genes (R-genes are responsible for initiation of defense mechanism against various phytopathogens. The majority of plant R-genes are members of very large multi-gene families, which encode structurally related proteins containing nucleotide binding site domains (NBS and C-terminal leucine rich repeats (LRR. Other classes possess' an extracellular LRR domain, a transmembrane domain and sometimes, an intracellular serine/threonine kinase domain. R-proteins work in pathogen perception and/or the activation of conserved defense signaling networks. In the present study, sequences representing resistance gene analogues (RGAs of coconut, arecanut, oil palm and date palm were collected from NCBI, sorted based on domains and assembled into a database. The sequences were analyzed in PRINTS database to find out the conserved domains and their motifs present in the RGAs. Based on these domains, we have also developed a tool to predict the domains of palm R-genes using various machine learning algorithms. The model files were selected based on the performance of the best classifier in training and testing. All these information is stored and made available in the online ‘PRGpred' database and prediction tool.
International Nuclear Information System (INIS)
Li, Jipeng; Fu, Hanjiang; Xu, Chengwang; Tie, Yi; Xing, Ruiyun; Zhu, Jie; Qin, Yide; Sun, Zhixian; Zheng, Xiaofei
2010-01-01
In recent years, some miRNAs have been reported to be connected closely with the development of human hepatocellular carcinoma. In our previous studies, a set of miRNAs were revealed to be dysregulated in HCC tissues. However, the functions of these miRNAs in HCC remain largely undefined. The expression profiles of miR-183 were compared between HCC tissues and adjacent normal liver tissues using qRT-PCR method. This method was used to screen the potential target genes of miR-183. A luciferase reporter assay was conducted to confirm target association. Finally, the functional effect of miR-183 in hepatoma cells was examined. Among the 25 HCC samples analyzed, microRNA-183 was significantly up-regulated (twofold to 367-fold) in 17 samples compared with the matching nontumoral liver tissues. Programmed cell death 4 (PDCD4) was identified as the target gene of miR-183. Moreover, PDCD4 is a proapoptotic molecule involved in TGF-β1-induced apoptosis in human HCC cells, we found that miR-183 transfectants were resistant to apoptosis induced by TGF-β1. We conclude that miR-183 can inhibit apoptosis in human HCC cells by repressing the PDCD4 expression, and miR-183 may play an important role in HCC development
Jouet, Agathe; McMullan, Mark; van Oosterhout, Cock
2015-06-01
Plant immune genes, or resistance genes, are involved in a co-evolutionary arms race with a diverse range of pathogens. In agronomically important grasses, such R genes have been extensively studied because of their role in pathogen resistance and in the breeding of resistant cultivars. In this study, we evaluate the importance of recombination, mutation and selection on the evolution of the R gene complex Rp1 of Sorghum, Triticum, Brachypodium, Oryza and Zea. Analyses show that recombination is widespread, and we detected 73 independent instances of sequence exchange, involving on average 1567 of 4692 nucleotides analysed (33.4%). We were able to date 24 interspecific recombination events and found that four occurred postspeciation, which suggests that genetic introgression took place between different grass species. Other interspecific events seemed to have been maintained over long evolutionary time, suggesting the presence of balancing selection. Significant positive selection (i.e. a relative excess of nonsynonymous substitutions (dN /dS >1)) was detected in 17-95 codons (0.42-2.02%). Recombination was significantly associated with areas with high levels of polymorphism but not with an elevated dN /dS ratio. Finally, phylogenetic analyses show that recombination results in a general overestimation of the divergence time (mean = 14.3%) and an alteration of the gene tree topology if the tree is not calibrated. Given that the statistical power to detect recombination is determined by the level of polymorphism of the amplicon as well as the number of sequences analysed, it is likely that many studies have underestimated the importance of recombination relative to the mutation rate. © 2015 John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Lingmin eDai
2016-05-01
Full Text Available Pathogenesis-related proteins (PRs can lead to increased resistance of the whole plant to pathogen attack. Here, we isolate and characterize a PR-4 protein from a wild Chinese grape Vitis pseudoreticulata which shows greatly elevated transcription following powdery mildew infection. Its expression profiles under a number of abiotic stresses were also investigated. The PR-4 gene was overexpressed in regenerated V. vinifera cv. Red Globe via Agrobacterium tumefaciens-mediated transformation and verified by the Western blot. The transgenic grapevines exhibited higher expression levels of PR-4 protein content than wild-type vines and also repressed the growth of powdery mildew. The PR gene responds differently to different stresses in the PR-4 transformants. This study demonstrates that PR-4 protein in grapes plays a vital role in defense against powdery mildew invasion.
Rosengren, Leigh B.; Waldner, Cheryl L.; Reid-Smith, Richard J.
2009-01-01
Escherichia coli often carries linked antimicrobial resistance genes on transmissible genetic elements. Through coselection, antimicrobial use may select for unrelated but linked resistance or virulence genes. This study used unconditional statistical associations to investigate the relationships between antimicrobial resistance phenotypes and antimicrobial resistance genes in 151 E. coli isolates from healthy pigs. Phenotypic resistance to each drug was significantly associated with phenotyp...
SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD
Directory of Open Access Journals (Sweden)
Mehmet AYBEKE
2015-12-01
Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.
DEFF Research Database (Denmark)
Joshi, Tejal; Elias, Daniel; Stenvang, Jan
2016-01-01
and 14-3-3 family genes. Integrating the inferred miRNA-target relationships, we investigated the functional importance of 2 central genes, SNAI2 and FYN, which showed increased expression in TamR cells, while their corresponding regulatory miRNA were downregulated. Using specific chemical inhibitors......Tamoxifen is an effective anti-estrogen treatment for patients with estrogen receptor-positive (ER+) breast cancer, however, tamoxifen resistance is frequently observed. To elucidate the underlying molecular mechanisms of tamoxifen resistance, we performed a systematic analysis of miRNA......-mediated gene regulation in three clinically-relevant tamoxifen-resistant breast cancer cell lines (TamRs) compared to their parental tamoxifen-sensitive cell line. Alterations in the expression of 131 miRNAs in tamoxifen-resistant vs. parental cell lines were identified, 22 of which were common to all Tam...
Quijano, Carolina Diaz; Wichmann, Fabienne; Schlaich, Thomas; Fammartino, Alessandro; Huckauf, Jana; Schmidt, Kerstin; Unger, Christoph; Broer, Inge; Sautter, Christof
2016-09-01
Ustilago tritici causes loose smut, which is a seed-borne fungal disease of wheat, and responsible for yield losses up to 40%. Loose smut is a threat to seed production in developing countries where small scale farmers use their own harvest as seed material. The killer protein 4 (KP4) is a virally encoded toxin from Ustilago maydis and inhibits growth of susceptible races of fungi from the Ustilaginales. Enhanced resistance in KP4 wheat to stinking smut, which is caused by Tilletia caries, had been reported earlier. We show that KP4 in genetically engineered wheat increased resistance to loose smut up to 60% compared to the non-KP4 control under greenhouse conditions. This enhanced resistance is dose and race dependent. The overexpression of the transgene kp4 and its effect on fungal growth have indirect effects on the expression of endogenous pathogen defense genes.
Directory of Open Access Journals (Sweden)
Carolina Diaz Quijano
2016-09-01
Full Text Available Ustilago tritici causes loose smut, which is a seed-borne fungal disease of wheat, and responsible for yield losses up to 40%. Loose smut is a threat to seed production in developing countries where small scale farmers use their own harvest as seed material. The killer protein 4 (KP4 is a virally encoded toxin from Ustilago maydis and inhibits growth of susceptible races of fungi from the Ustilaginales. Enhanced resistance in KP4 wheat to stinking smut, which is caused by Tilletia caries, had been reported earlier. We show that KP4 in genetically engineered wheat increased resistance to loose smut up to 60% compared to the non-KP4 control under greenhouse conditions. This enhanced resistance is dose and race dependent. The overexpression of the transgene kp4 and its effect on fungal growth have indirect effects on the expression of endogenous pathogen defense genes.
Gong, Y-H; Ai, G-M; Li, M; Shi, X-Y; Diao, Q-Y; Gao, X-W
2017-12-01
Carboxylesterases (CarEs) play an important role in detoxifying insecticides in insects. Over-expression and structural modification of CarEs have been implicated in the development of organophosphate (OP) insecticide resistance in insects. A previous study identified four nonsynonymous mutations (resulting in four amino acid residue substitutions) in the open reading frame of the carboxylesterase gene of resistant cotton aphids compared to the omethoate susceptible strain, which has possibly influenced the development of resistance to omethoate (a systemic OP insecticide). The current study further characterized the function of these mutations, both alone and in combination, in the hydrolysis of OP insecticides. The metabolism results suggest that the combination of four mutations, mainly existing in the laboratory-selected OP-resistant cotton aphid population, increased the OP hydrolase activity (approximately twofold) at the cost of detectable carboxylesterase activity. The functional studies of single or multiple mutations suggest the positive effect of H104R, A128V and T333P on the acquisition of OP hydrolase activity, especially the combination of H104R with A128V or T333P. K484R substitution decreased both the OP hydrolase activity and the CarE activity, indicating that this mutation primarily drives the negative effect on the acquisition of OP hydrolase activity amongst these four mutations in the resistant strain. The modelling and docking results are basically consistent with the metabolic results, which strongly suggest that the structural gene modification is the molecular basis for the OP resistance in this laboratory-selected cotton aphid strain. © 2017 The Royal Entomological Society.
Noguchi, Yuji; Sano, Motoaki; Kanamaru, Kyoko; Ko, Taro; Takeuchi, Michio; Kato, Masashi; Kobayashi, Tetsuo
2009-11-01
XlnR is a Zn(II)2Cys6 transcriptional activator of xylanolytic and cellulolytic genes in Aspergillus. Overexpression of the aoxlnR gene in Aspergillus oryzae (A. oryzae xlnR gene) resulted in elevated xylanolytic and cellulolytic activities in the culture supernatant, in which nearly 40 secreted proteins were detected by two-dimensional electrophoresis. DNA microarray analysis to identify the transcriptional targets of AoXlnR led to the identification of 75 genes that showed more than fivefold increase in their expression in the AoXlnR overproducer than in the disruptant. Of these, 32 genes were predicted to encode a glycoside hydrolase, highlighting the biotechnological importance of AoXlnR in biomass degradation. The 75 genes included the genes previously identified as AoXlnR targets (xynF1, xynF3, xynG2, xylA, celA, celB, celC, and celD). Thirty-six genes were predicted to be extracellular, which was consistent with the number of proteins secreted, and 61 genes possessed putative XlnR-binding sites (5'-GGCTAA-3', 5'-GGCTAG-3', and 5'-GGCTGA-3') in their promoter regions. Functional annotation of the genes revealed that AoXlnR regulated the expression of hydrolytic genes for degradation of beta-1,4-xylan, arabinoxylan, cellulose, and xyloglucan and of catabolic genes for the conversion of D-xylose to xylulose-5-phosphate. In addition, genes encoding glucose-6-phosphate 1-dehydrogenase and L-arabinitol-4- dehydrogenase involved in D-glucose and L-arabinose catabolism also appeared to be targets of AoXlnR.
Directory of Open Access Journals (Sweden)
Dorte H Højland
Full Text Available Spinosad is important in pest management strategies of multiple insect pests. However, spinosad resistance is emerging in various pest species. Resistance has in some species been associated with alterations of the target-site receptor, but in others P450s seems to be involved. We test the possible importance of nine cytochrome P450 genes in the spinosad-resistant housefly strain 791spin and investigate the influence of spinosad on P450 expression in four other housefly strains.Significant differences in P450 expression of the nine P450 genes in the four strains after spinosad treatment were identified in 40% of cases, most of these as induction. The highly expressed CYP4G2 was induced 6.6-fold in the insecticide susceptible WHO-SRS females, but decreased 2-fold in resistant 791spin males. CYP6G4 was constitutively higher expressed in the resistant strain compared to the susceptible strain. Furthermore, CYP6G4 gene expression was increased in susceptible WHO-SRS flies by spinosad while the expression level did not alter significantly in resistant fly strains. Expression of CYP6A1 and male CYP6D3 was constitutively higher in the resistant strain compared to the susceptible. However, in both cases male expression was higher than female expression.CYP4G2, CYP6A1, CYP6D3 and CYP6G4 have expressions patterns approaching the expectations of a hypothesized sex specific spinosad resistance gene. CYP4G2 fit requirements of a spinosad resistance gene best, making it the most likely candidate. The overall high expression level of CYP4G2 throughout the strains also indicates importance of this gene. However, the data on 791spin are not conclusive concerning spinosad resistance and small contributions from multiple P450s with different enzymatic capabilities could be speculated to do the job in 791spin. Differential expression of P450s between sexes is more a rule than an exception. Noteworthy differences between spinosad influenced expression of P450 genes
2010-01-01
Background In the last decade, biochemical studies have revealed that epigenetic modifications including histone modifications, histone variants and DNA methylation form a complex network that regulate the state of chromatin and processes that depend on it including transcription and DNA replication. Currently, a large number of these epigenetic modifications are being mapped in a variety of cell lines at different stages of development using high throughput sequencing by members of the ENCODE consortium, the NIH Roadmap Epigenomics Program and the Human Epigenome Project. An extremely promising and underexplored area of research is the application of machine learning methods, which are designed to construct predictive network models, to these large-scale epigenomic data sets. Results Using a ChIP-Seq data set of 20 histone lysine and arginine methylations and histone variant H2A.Z in human CD4+ T-cells, we built predictive models of gene expression as a function of histone modification/variant levels using Multilinear (ML) Regression and Multivariate Adaptive Regression Splines (MARS). Along with extensive crosstalk among the 20 histone methylations, we found H4R3me2 was the most and second most globally repressive histone methylation among the 20 studied in the ML and MARS models, respectively. In support of our finding, a number of experimental studies show that PRMT5-catalyzed symmetric dimethylation of H4R3 is associated with repression of gene expression. This includes a recent study, which demonstrated that H4R3me2 is required for DNMT3A-mediated DNA methylation--a known global repressor of gene expression. Conclusion In stark contrast to univariate analysis of the relationship between H4R3me2 and gene expression levels, our study showed that the regulatory role of some modifications like H4R3me2 is masked by confounding variables, but can be elucidated by multivariate/systems-level approaches. PMID:20653935
Elevated toll-like receptor 4 expression and signaling in muscle from insulin-resistant subjects.
Reyna, Sara M; Ghosh, Sangeeta; Tantiwong, Puntip; Meka, C S Reddy; Eagan, Phyllis; Jenkinson, Christopher P; Cersosimo, Eugenio; Defronzo, Ralph A; Coletta, Dawn K; Sriwijitkamol, Apiradee; Musi, Nicolas
2008-10-01
OBJECTIVE- Tall-like receptor (TLR)4 has been implicated in the pathogenesis of free fatty acid (FFA)-induced insulin resistance by activating inflammatory pathways, including inhibitor of kappaB (IkappaB)/nuclear factor kappaB (NFkappaB). However, it is not known whether insulin-resistant subjects have abnormal TLR4 signaling. We examined whether insulin-resistant subjects have abnormal TLR4 expression and TLR4-driven (IkappaB/NFkappaB) signaling in skeletal muscle. RESEARCH DESIGN AND METHODS- TLR4 gene expression and protein content were measured in muscle biopsies in 7 lean, 8 obese, and 14 type 2 diabetic subjects. A primary human myotube culture system was used to examine whether FFAs stimulate IkappaB/NFkappaB via TLR4 and whether FFAs increase TLR4 expression/content in muscle. RESULTS- Obese and type 2 diabetic subjects had significantly elevated TLR4 gene expression and protein content in muscle. TLR4 muscle protein content correlated with the severity of insulin resistance. Obese and type 2 diabetic subjects also had lower IkappaBalpha content, an indication of elevated IkappaB/NFkappaB signaling. The increase in TLR4 and NFkappaB signaling was accompanied by elevated expression of the NFkappaB-regulated genes interleukin (IL)-6 and superoxide dismutase (SOD)2. In primary human myotubes, acute palmitate treatment stimulated IkappaB/NFkappaB, and blockade of TLR4 prevented the ability of palmitate to stimulate the IkappaB/NFkappaB pathway. Increased TLR4 content and gene expression observed in muscle from insulin-resistant subjects were reproduced by treating myotubes from lean, normal-glucose-tolerant subjects with palmitate. Palmitate also increased IL-6 and SOD2 gene expression, and this effect was prevented by inhibiting NFkappaB. CONCLUSIONS- Abnormal TLR4 expression and signaling, possibly caused by elevated plasma FFA levels, may contribute to the pathogenesis of insulin resistance in humans.
Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants
Somerville, Chris R [Portola Valley, CA; Scheible, Wolf [Golm, DE
2007-07-10
Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.
Antimicrobial resistance of F4+ Escherichia coli isolated from Swine in Italy.
Luppi, A; Bonilauri, P; Dottori, M; Gherpelli, Y; Biasi, G; Merialdi, G; Maioli, G; Martelli, P
2015-02-01
Four-hundred and forty-two F4+ pathogenic Escherichia coli were isolated in a period of 10 years (2002-2011), from pigs that were suffering from diarrhoea belonging to Italian swine herds. The strains were analysed for their susceptibility to 12 antimicrobials using the disc diffusion method. During the study period, a statistically significant proportion of isolates resistant to enrofloxacin (14.5-89.3%), marbofloxacin (5.4-60.7%), flumequine (49.1-92.9%), danofloxacin (21.6-80%), florfenicol (9.8-64.3%), thiamphenicol (50-92%) and cefquinome (3.8-44%) was recorded. An increase in resistance (not statistically significant) to gentamicin (63.6-85.7%), apramycin (61.8-82.1%), trimethoprim-sulphamethoxazole (75-89.3%), tetracycline (97-100%) and erythromycin (92.4-100%) was also observed. Based on antimicrobial multiresistance, the strains were collected into three groups: I. resistant to 2-5 antimicrobials; II. resistant to 6-8 antimicrobials; III. resistant to 9-12 antimicrobials. The number of isolates belonging to the first group showed a statistically significant decrease (P < 0.05; R(2) = 0.896; r = -0.9608), while the isolates belonging to the second and third groups showed a statistically significant increase in resistance (P < 0.05; R(2) = 0.753; r = 0.8890 and P < 0.05; R(2) = 0.727; r = 0.8701, respectively) over the period of study. The results of this study suggest the need for continued monitoring of the development of resistance. © 2013 Blackwell Verlag GmbH.
Effect of adrenomedullin gene delivery on insulin resistance in type 2 diabetic rats
Directory of Open Access Journals (Sweden)
Hoda Y. Henein
2011-01-01
Full Text Available Type 2 diabetes mellitus is one of the common metabolic disorders that ultimately afflicts large number of individuals. Adrenomedullin (AM is a potent vasodilator peptide; previous studies reported development of insulin resistance in aged AM deficient mice. In this study, we employed a gene delivery approach to explore its potential role in insulin resistance. Four groups were included: control, diabetic, non-diabetic injected with the AM gene and diabetic injected with the AM gene. One week following gene delivery, serum glucose, insulin, triglycerides, leptin, adiponectin and corticosterone were measured as well as the insulin resistance index (HOMA-IR. Soleus muscle glucose uptake and RT-PCR of both AM and glucose transporter-4 (GLUT 4 gene expressions were assessed. A single tail vein injection of adrenomedullin gene in type 2 diabetic rats improved skeletal muscle insulin responsiveness with significant improvement of soleus muscle glucose uptake, HOMA-IR, serum glucose, insulin and triglycerides and significant increase in muscle GLUT 4 gene expression (P < 0.05 compared with the non-injected diabetic rats. The beneficial effects of AM gene delivery were accompanied by a significant increase in the serum level of adiponectin (2.95 ± 0.09 versus 2.33 ± 0.17 μg/ml in the non-injected diabetic group as well as a significant decrease in leptin and corticosterone levels (7.51 ± 0.51 and 262.88 ± 10.34 versus 10.63 ± 1.4 and 275.86 ± 11.19 ng/ml respectively in the non-injected diabetic group. The conclusion of the study is that AM gene delivery can improve insulin resistance and may have significant therapeutic applications in type 2 diabetes mellitus.
DEFF Research Database (Denmark)
Jiang, Lu; Ingvardsen, Christina Rønn; Lübberstedt, Thomas
2008-01-01
the isolation and characterization of the Pic19R gene family members from the inbred line FAP1360A, which shows complete resistance to SCMV. Two primer pairs were designed based on the conserved regions among the known Pic19 paralogs and used for rapid amplification of cDNA ends of FAP1360A. Six full-length c...... of the Pic19R family indicated that the Pic19R-1 paralog is identical to the known Rxo1 gene conferring resistance to rice bacterial streak disease and none of the other Pic19R paralogs seems to be involved in resistance to SCMV...
Yuan, W; Sui, C G; Ma, X; Ma, J
2018-05-23
Objective: To explore new multidrug resistant genes of pancreatic cancer by establishment and characterization of chemo-resistant cell lines. Methods: The cisplatin-resistant cell line JF305/CDDP and the gemcitabine-resistant cell line PANC-1/GEM were induced by high-dose intermittent treatment. CCK-8 assay was used to detect the 50% inhibiting concentration (IC(50)), drug resistance index (R), cross-resistance, and growth difference of different cells. The changes of cell cycle and migration ability of drug-resistant cells were determined by flow cytometry and transwell assay, respectively. And then real-time fluorescence quantitative PCR was used to detect the expression of multidrug resistance-related genes. Results: The drug resistance indexes of JF305/CDDP and PANC-1/GEM were 15.3 and 27.31, respectively, and there was cross-resistance. Compared with the parental cells, the proliferation rate of JF305/CDDP was decreased by 40% on the fourth day ( P PANC-1 cells upregulated MRP2 level ( P PANC-1/GEM, were successfully established. MSX2 might be a new drug resistance related gene in pancreatic cancer cells by up-regulation of MRP2 expression.
Traverso, Lucila; Lavore, Andrés; Sierra, Ivana; Palacio, Victorio; Martinez-Barnetche, Jesús; Latorre-Estivalis, José Manuel; Mougabure-Cueto, Gaston; Francini, Flavio; Lorenzo, Marcelo G; Rodríguez, Mario Henry; Ons, Sheila; Rivera-Pomar, Rolando V
2017-02-01
Triatomine insects are vectors of Trypanosoma cruzi, a protozoan parasite that is the causative agent of Chagas' disease. This is a neglected disease affecting approximately 8 million people in Latin America. The existence of diverse pyrethroid resistant populations of at least two species demonstrates the potential of triatomines to develop high levels of insecticide resistance. Therefore, the incorporation of strategies for resistance management is a main concern for vector control programs. Three enzymatic superfamilies are thought to mediate xenobiotic detoxification and resistance: Glutathione Transferases (GSTs), Cytochromes P450 (CYPs) and Carboxyl/Cholinesterases (CCEs). Improving our knowledge of key triatomine detoxification enzymes will strengthen our understanding of insecticide resistance processes in vectors of Chagas' disease. The discovery and description of detoxification gene superfamilies in normalized transcriptomes of three triatomine species: Triatoma dimidiata, Triatoma infestans and Triatoma pallidipennis is presented. Furthermore, a comparative analysis of these superfamilies among the triatomine transcriptomes and the genome of Rhodnius prolixus, also a triatomine vector of Chagas' disease, and other well-studied insect genomes was performed. The expression pattern of detoxification genes in R. prolixus transcriptomes from key organs was analyzed. The comparisons reveal gene expansions in Sigma class GSTs, CYP3 in CYP superfamily and clade E in CCE superfamily. Moreover, several CYP families identified in these triatomines have not yet been described in other insects. Conversely, several groups of insecticide resistance related enzymes within each enzyme superfamily are reduced or lacking in triatomines. Furthermore, our qRT-PCR results showed an increase in the expression of a CYP4 gene in a T. infestans population resistant to pyrethroids. These results could point to an involvement of metabolic detoxification mechanisms on the high
Directory of Open Access Journals (Sweden)
Lucila Traverso
2017-02-01
Full Text Available Triatomine insects are vectors of Trypanosoma cruzi, a protozoan parasite that is the causative agent of Chagas' disease. This is a neglected disease affecting approximately 8 million people in Latin America. The existence of diverse pyrethroid resistant populations of at least two species demonstrates the potential of triatomines to develop high levels of insecticide resistance. Therefore, the incorporation of strategies for resistance management is a main concern for vector control programs. Three enzymatic superfamilies are thought to mediate xenobiotic detoxification and resistance: Glutathione Transferases (GSTs, Cytochromes P450 (CYPs and Carboxyl/Cholinesterases (CCEs. Improving our knowledge of key triatomine detoxification enzymes will strengthen our understanding of insecticide resistance processes in vectors of Chagas' disease.The discovery and description of detoxification gene superfamilies in normalized transcriptomes of three triatomine species: Triatoma dimidiata, Triatoma infestans and Triatoma pallidipennis is presented. Furthermore, a comparative analysis of these superfamilies among the triatomine transcriptomes and the genome of Rhodnius prolixus, also a triatomine vector of Chagas' disease, and other well-studied insect genomes was performed. The expression pattern of detoxification genes in R. prolixus transcriptomes from key organs was analyzed. The comparisons reveal gene expansions in Sigma class GSTs, CYP3 in CYP superfamily and clade E in CCE superfamily. Moreover, several CYP families identified in these triatomines have not yet been described in other insects. Conversely, several groups of insecticide resistance related enzymes within each enzyme superfamily are reduced or lacking in triatomines. Furthermore, our qRT-PCR results showed an increase in the expression of a CYP4 gene in a T. infestans population resistant to pyrethroids. These results could point to an involvement of metabolic detoxification mechanisms
DEFF Research Database (Denmark)
Thomsen, Thomas T; Madsen, Laura B; Hansson, Helle H
2013-01-01
Chloroquine (CQ) use in Mozambique was stopped in 2002 and artemether-lumefantrine (AL) was implemented in 2008. In light of no use of CQ and extensive use of AL, we determined the frequency of molecular markers of Plasmodium falciparum drug resistance/tolerance to CQ and AL in persons living...... in Linga-Linga, an isolated peninsula and in Furvela village, which is located 8 km inland. The P. falciparum chloroquine resistance transporter gene CVMNK wild type increased in frequency from 43.9% in 2009 to 66.4% in 2010 (P = 0.001), and combined P. falciparum multidrug resistance gene 1 N86-184F-D1246...... haplotype increased significantly between years (P = 0.039). The combination of P. falciparum chloroquine resistance transporter gene CVMNK and P. falciparum multidrug resistance gene NFD increased from 24.3% (2009) to 45.3% in (2010, P = 0.017). The rapid changes observed may largely be caused by decreased...
Etebari, K; Afrad, M H; Tang, B; Silva, R; Furlong, M J; Asgari, S
2018-03-24
The diamondback moth, Plutella xylostella, has developed extremely high levels of resistance to chlorantraniliprole and other classes of insecticides in the field. As microRNAs (miRNAs) play important roles in various biological processes through gene regulation, we examined the miRNA profile of P. xylostella in response to chlorantraniliprole exposure. RNA sequencing analysis showed that insecticide treatment caused significant changes in the abundance of some miRNAs. Increasing exposure time and insecticide concentration induced more dysregulated miRNAs in P. xylostella larvae. We also screened potential target genes for some of the differentially expressed miRNAs (such as miR-2b-3p, miR-14b-5p and let-7-5p), which may play important roles in insecticide resistance development. Exposure of P. xylostella larvae to chlorantraniliprole caused considerable overexpression in the transcript levels of potential target genes cytochrome P450 9f2 (CYP9F2) and 307a1 (CYP307a1). Application of miR-2b-3p and miR-14b-5p mimics significantly suppressed the relative transcript levels of CYP9F2 and CYP307a1, respectively, in a P. xylostella cell line. Furthermore, enrichment of P. xylostella diet with miR-2b-3p mimics significantly increased mortality in deltamethrin-resistant larvae when exposed to deltamethrin. The results suggest that miR-2b-3p may suppress CYP9F2 transcript levels in P. xylostella and consequently inhibit larval detoxification pathways. The findings provide an insight into possible role of miRNAs in regulation of metabolic resistance of insects to insecticides. © 2018 The Royal Entomological Society.
Directory of Open Access Journals (Sweden)
Qing-Bin Yuan
Full Text Available This study investigated fates of nine antibiotic-resistant bacteria as well as two series of antibiotic resistance genes in wastewater treated by various doses of chlorine (0, 15, 30, 60, 150 and 300 mg Cl2 min/L. The results indicated that chlorination was effective in inactivating antibiotic-resistant bacteria. Most bacteria were inactivated completely at the lowest dose (15 mg Cl2 min/L. By comparison, sulfadiazine- and erythromycin-resistant bacteria exhibited tolerance to low chlorine dose (up to 60 mg Cl2 min/L. However, quantitative real-time PCRs revealed that chlorination decreased limited erythromycin or tetracycline resistance genes, with the removal levels of overall erythromycin and tetracycline resistance genes at 0.42 ± 0.12 log and 0.10 ± 0.02 log, respectively. About 40% of erythromycin-resistance genes and 80% of tetracycline resistance genes could not be removed by chlorination. Chlorination was considered not effective in controlling antimicrobial resistance. More concern needs to be paid to the potential risk of antibiotic resistance genes in the wastewater after chlorination.
Directory of Open Access Journals (Sweden)
Xiaojuan Wang
2018-04-01
Full Text Available The spread of antibiotic resistance genes in river systems is an emerging environmental issue due to their potential threat to aquatic ecosystems and public health. In this study, we used droplet digital polymerase chain reaction (ddPCR to evaluate pollution with clinically relevant antibiotic resistance genes (ARGs at 13 monitoring sites along the main stream of the Weihe River in China. Six clinically relevant ARGs and a class I integron-integrase (intI1 gene were analyzed using ddPCR, and the bacterial community was evaluated based on the bacterial 16S rRNA V3–V4 regions using MiSeq sequencing. The results indicated Proteobacteria, Actinobacteria, Cyanobacteria, and Bacteroidetes as the dominant phyla in the water samples from the Weihe River. Higher abundances of blaTEM, strB, aadA, and intI1 genes (103 to 105 copies/mL were detected in the surface water samples compared with the relatively low abundances of strA, mecA, and vanA genes (0–1.94 copies/mL. Eight bacterial genera were identified as possible hosts of the intI1 gene and three ARGs (strA, strB, and aadA based on network analysis. The results suggested that the bacterial community structure and horizontal gene transfer were associated with the variations in ARGs.
Isolation of Resistance Gene Candidates (RGCs) and characterization of an RGC cluster in cassava.
López, C E; Zuluaga, A P; Cooke, R; Delseny, M; Tohme, J; Verdier, V
2003-08-01
Plant disease resistance genes (R genes) show significant similarity amongst themselves in terms of both their DNA sequences and structural motifs present in their protein products. Oligonucleotide primers designed from NBS (Nucleotide Binding Site) domains encoded by several R-genes have been used to amplify NBS sequences from the genomic DNA of various plant species, which have been called Resistance Gene Analogues (RGAs) or Resistance Gene Candidates (RGCs). Using specific primers from the NBS and TIR (Toll/Interleukin-1 Receptor) regions, we identified twelve classes of RGCs in cassava (Manihot esculenta Crantz). Two classes were obtained from the PCR-amplification of the TIR domain. The other 10 classes correspond to the NBS sequences and were grouped into two subfamilies. Classes RCa1 to RCa5 are part of the first subfamily and were linked to a TIR domain in the N terminus. Classes RCa6 to RCa10 corresponded to non-TIR NBS-LRR encoding sequences. BAC library screening with the 12 RGC classes as probes allowed the identification of 42 BAC clones that were assembled into 10 contigs and 19 singletons. Members of the two TIR and non-TIR NBS-LRR subfamilies occurred together within individual BAC clones. The BAC screening and Southern hybridization analyses showed that all RGCs were single copy sequences except RCa6 that represented a large and diverse gene family. One BAC contained five NBS sequences and sequence analysis allowed the identification of two complete RGCs encoding two highly similar proteins. This BAC was located on linkage group J with three other RGC-containing BACs. At least one of these genes, RGC2, is expressed constitutively in cassava tissues.
Chua, H N; Fan, S H; Say, Y H
2012-04-01
This study investigated the prevalence of the Melanocortin receptor 4 (MC4R) V1031 gene variant and its association with obesity among a cohort of 254 patients (101 males; 118 obese) attending the Kampar Health Clinic. Genotyping revealed the mutated I allele frequency of 0.02, no homozygous mutated (II), and similar distribution of V and I alleles across BMI groups, genders and ethnic groups. No significant difference was found for the means of anthropometric measurements between alleles. Prevalence of this gene variant among the Malaysian cohort was similar with previous populations (2-4% of mutated allele carrier), but was not associated with obesity.
DEFF Research Database (Denmark)
Lenman, Marit; Ali, Ashfaq; Mühlenbock, Per
2016-01-01
different P. infestans effectors, containing the conserved motif RXLR (for Arg, any amino acid, Leu, Arg), revealed a specific response to Avr2, which suggests that SW93-1015 might contain a functional homolog of the R2 resistance gene. We cloned eight R2 gene homologs from SW93-1015, whereof seven have...
Major Gene for Field Stem Rust Resistance Co-Locates with Resistance Gene Sr12 in 'Thatcher' Wheat.
Hiebert, Colin W; Kolmer, James A; McCartney, Curt A; Briggs, Jordan; Fetch, Tom; Bariana, Harbans; Choulet, Frederic; Rouse, Matthew N; Spielmeyer, Wolfgang
2016-01-01
Stem rust, caused by Puccinia graminis (Pgt), is a damaging disease of wheat that can be controlled by utilizing effective stem rust resistance genes. 'Thatcher' wheat carries complex resistance to stem rust that is enhanced in the presence of the resistance gene Lr34. The purpose of this study was to examine APR in 'Thatcher' and look for genetic interactions with Lr34. A RIL population was tested for stem rust resistance in field nurseries in Canada, USA, and Kenya. BSA was used to find SNP markers associated with reduced stem rust severity. A major QTL was identified on chromosome 3BL near the centromere in all environments. Seedling testing showed that Sr12 mapped to the same region as the QTL for APR. The SNP markers were physically mapped and the region carrying the resistance was searched for sequences with homology to members of the NB-LRR resistance gene family. SNP marker from one NB-LRR-like sequence, NB-LRR3 co-segregated with Sr12. Two additional populations, including one that lacked Lr34, were tested in field nurseries. NB-LRR3 mapped near the maximum LOD for reduction in stem rust severity in both populations. Lines from a population that segregated for Sr12 and Lr34 were tested for seedling Pgt biomass and infection type, as well as APR to field stem rust which showed an interaction between the genes. We concluded that Sr12, or a gene closely linked to Sr12, was responsible for 'Thatcher'-derived APR in several environments and this resistance was enhanced in the presence of Lr34.
Czekalski, Nadine; Sigdel, Radhika; Birtel, Julia; Matthews, Blake; Bürgmann, Helmut
2015-08-01
Antibiotic resistance genes (ARGs) are emerging environmental contaminants, known to be continuously discharged into the aquatic environment via human and animal waste. Freshwater aquatic environments represent potential reservoirs for ARG and potentially allow sewage-derived ARG to persist and spread in the environment. This may create increased opportunities for an eventual contact with, and gene transfer to, human and animal pathogens via the food chain or drinking water. However, assessment of this risk requires a better understanding of the level and variability of the natural resistance background and the extent of the human impact. We have analyzed water samples from 21 Swiss lakes, taken at sampling points that were not under the direct influence of local contamination sources and analyzed the relative abundance of ARG using quantitative real-time PCR. Copy numbers of genes mediating resistance to three different broad-spectrum antibiotic classes (sulfonamides: sul1, sul2, tetracyclines: tet(B), tet(M), tet(W) and fluoroquinolones: qnrA) were normalized to copy numbers of bacterial 16S rRNA genes. We used multiple linear regression to assess if ARG abundance is related to human activities in the catchment, microbial community composition and the eutrophication status of the lakes. Sul genes were detected in all sampled lakes, whereas only four lakes contained quantifiable numbers of tet genes, and qnrA remained below detection in all lakes. Our data indicate higher abundance of sul1 in lakes with increasing number and capacity of wastewater treatment plants (WWTPs) in the catchment. sul2 abundance was rather related to long water residence times and eutrophication status. Our study demonstrates the potential of freshwater lakes to preserve antibiotic resistance genes, and provides a reference for ARG abundance from lake systems with low human impact as a baseline for assessing ARG contamination in lake water. Copyright © 2015 Elsevier Ltd. All rights
Czech Academy of Sciences Publication Activity Database
Kyselková, Martina; Jirout, Jiří; Chroňáková, Alica; Vrchotová, Naděžda; Bradley, R.; Schmitt, H.; Elhottová, Dana
2013-01-01
Roč. 93, č. 10 (2013), s. 2413-2418 ISSN 0045-6535 R&D Projects: GA ČR GAP504/10/2077; GA MŠk(CZ) EE2.3.30.0032; GA MŠk(CZ) ED1.1.00/02.0073 Grant - others:OECD(FR) JA00054767 Institutional support: RVO:60077344 ; RVO:67179843 Keywords : cattle excrement * environmental risk assessment * manured soil * oxytetracycline * tetracycline resistance * tetracycline resistance gene Subject RIV: EE - Microbiology, Virology Impact factor: 3.499, year: 2013
He, Huagang; Zhu, Shanying; Jiang, Zhengning; Ji, Yaoyong; Wang, Feng; Zhao, Renhui; Bie, Tongde
2016-04-01
The powdery mildew resistance gene Pm21 was physically and comparatively mapped by newly developed markers. Seven candidate genes were verified to be required for Pm21 -mediated resistance to wheat powdery mildew. Pm21, a gene derived from wheat wild relative Dasypyrum villosum, has been transferred into common wheat and widely utilized in wheat resistance breeding for powdery mildew. Previously, Pm21 has been located to the bin FL0.45-0.58 of 6VS by using deletion stocks. However, its fine mapping is still a hard work. In the present study, 30 gene-derived 6VS-specific markers were obtained based on the collinearity among genomes of Brachypodium distachyon, Oryza and Triticeae, and then physically and comparatively mapped in the bin FL0.45-0.58 and its nearby chromosome region. According to the maps, the bin FL0.45-0.58 carrying Pm21 was closely flanked by the markers 6VS-03 and 6VS-23, which further narrowed the orthologous regions to 1.06 Mb in Brachypodium and 1.38 Mb in rice, respectively. Among the conserved genes shared by Brachypodium and rice, four serine/threonine protein kinase genes (DvMPK1, DvMLPK, DvUPK and DvPSYR1), one protein phosphatase gene (DvPP2C) and two transcription factor genes (DvGATA and DvWHY) were confirmed to be required for Pm21-mediated resistance to wheat powdery mildew by barley stripe mosaic virus-induced gene silencing (BSMV-VIGS) and transcriptional pattern analyses. In summary, this study gives new insights into the genetic basis of the Pm21 locus and the disease resistance pathways mediated by Pm21.
Expression of programmed cell death protein 4 (PDCD4) and miR-21 in urothelial carcinoma
Energy Technology Data Exchange (ETDEWEB)
Fischer, Nicolas, E-mail: simplissimus@gmx.de [Department of Urology, University of Bonn, Sigmund-Freud-Strasse 25, 53127 Bonn (Germany); Goeke, Friederike, E-mail: Friederike.goeke@ukb.uni-bonn.de [Department of Pathology, University of Bonn, Sigmund-Freud-Strasse 25, 53127 Bonn (Germany); Splittstoesser, Vera, E-mail: Veri.sp@web.de [Department of Urology, University of Bonn, Sigmund-Freud-Strasse 25, 53127 Bonn (Germany); Lankat-Buttgereit, Brigitte, E-mail: Lankatbu@staff.uni-marburg.de [Department of Internal Medicine, Philipps-University of Marburg, Baldingerstrasse, 35043 Marburg (Germany); Mueller, Stefan C., E-mail: Stefan.mueller@ukb.uni-bonn.de [Department of Urology, University of Bonn, Sigmund-Freud-Strasse 25, 53127 Bonn (Germany); Ellinger, Joerg, E-mail: Joerg.ellinger@ukb.uni-bonn.de [Department of Urology, University of Bonn, Sigmund-Freud-Strasse 25, 53127 Bonn (Germany)
2012-01-06
Highlights: Black-Right-Pointing-Pointer The tumor suppressor gene PDCD4 is down-regulated in many tumorous entities. Black-Right-Pointing-Pointer We investigate the impact of PDCD4 and its regulating factor miR-21 in urothelial carcinoma. Black-Right-Pointing-Pointer We confirm PDCD4 as a tumor suppressor gene and it could be a diagnostic marker for this tumor. -- Abstract: Background: We investigated the role of the programmed cell death 4 (PDCD4) tumor suppressor gene in specimens of transitional cell carcinoma and of healthy individuals. Methods: PDCD4 immunohistochemical expression was investigated in 294 cases in histologically proven transitional cell carcinoma in different tumorous stages (28 controls, 122 non-muscle invasive urothelial carcinoma, stages Tis-T1, 119 invasive transitional cell carcinoma stages T2-T4 and 25 metastases). MiR-21 expression, an important PDCD4 regulator, was assessed with real-time PCR analysis and showed inverse correlation to tissue PDCD4 expression. Results: Nuclear and cytoplasmatic PDCD4 immunostaining decreased significantly with histopathological progression of the tumor (p < 0001). Controls showed strong nuclear and cytoplasmatic immunohistochemical staining. MiR-21 up regulation in tissue corresponded to PDCD4 suppression. Conclusions: These data support a decisive role for PDCD4 down regulation in transitional cell carcinoma and confirm miR-21 as a negative regulator for PDCD4. Additionally, PDCD4 immunohistochemical staining turns out to be a possible diagnostic marker for transitional cell carcinoma.
Expression of programmed cell death protein 4 (PDCD4) and miR-21 in urothelial carcinoma
International Nuclear Information System (INIS)
Fischer, Nicolas; Göke, Friederike; Splittstößer, Vera; Lankat-Buttgereit, Brigitte; Müller, Stefan C.; Ellinger, Jörg
2012-01-01
Highlights: ► The tumor suppressor gene PDCD4 is down-regulated in many tumorous entities. ► We investigate the impact of PDCD4 and its regulating factor miR-21 in urothelial carcinoma. ► We confirm PDCD4 as a tumor suppressor gene and it could be a diagnostic marker for this tumor. -- Abstract: Background: We investigated the role of the programmed cell death 4 (PDCD4) tumor suppressor gene in specimens of transitional cell carcinoma and of healthy individuals. Methods: PDCD4 immunohistochemical expression was investigated in 294 cases in histologically proven transitional cell carcinoma in different tumorous stages (28 controls, 122 non-muscle invasive urothelial carcinoma, stages Tis-T1, 119 invasive transitional cell carcinoma stages T2–T4 and 25 metastases). MiR-21 expression, an important PDCD4 regulator, was assessed with real-time PCR analysis and showed inverse correlation to tissue PDCD4 expression. Results: Nuclear and cytoplasmatic PDCD4 immunostaining decreased significantly with histopathological progression of the tumor (p < 0001). Controls showed strong nuclear and cytoplasmatic immunohistochemical staining. MiR-21 up regulation in tissue corresponded to PDCD4 suppression. Conclusions: These data support a decisive role for PDCD4 down regulation in transitional cell carcinoma and confirm miR-21 as a negative regulator for PDCD4. Additionally, PDCD4 immunohistochemical staining turns out to be a possible diagnostic marker for transitional cell carcinoma.
Identification of rust resistance genes Lr10 and Sr9a in Pakistani ...
African Journals Online (AJOL)
Identification of rust resistance genes Lr10 and Sr9a in Pakistani wheat germplasm using PCR based molecular markers. M Babar, AF Mashhadi, A Mehvish, AN Zahra, R Waheed, A Hasnain, S ur-Rahman, N Hussain, M Ali, I Khaliq, A Aziz ...
Toor, Puneet Inder; Kaur, Satinder; Bansal, Mitaly; Yadav, Bharat; Chhuneja, Parveen
2016-12-01
A pair of stripe rust and leaf rust resistance genes was introgressed from Aegilops caudata, a nonprogenitor diploid species with the CC genome, to cultivated wheat. Inheritance and genetic mapping of stripe rust resistance gene in backcrossrecombinant inbred line (BC-RIL) population derived from the cross of a wheat-Ae. caudata introgression line (IL) T291- 2(pau16060) with wheat cv. PBW343 is reported here. Segregation of BC-RILs for stripe rust resistance depicted a single major gene conditioning adult plant resistance (APR) with stripe rust reaction varying from TR-20MS in resistant RILs signifying the presence of some minor genes as well. Genetic association with leaf rust resistance revealed that two genes are located at a recombination distance of 13%. IL T291-2 had earlier been reported to carry introgressions on wheat chromosomes 2D, 3D, 4D, 5D, 6D and 7D. Genetic mapping indicated the introgression of stripe rust resistance gene on wheat chromosome 5DS in the region carrying leaf rust resistance gene LrAc, but as an independent introgression. Simple sequence repeat (SSR) and sequence-tagged site (STS) markers designed from the survey sequence data of 5DS enriched the target region harbouring stripe and leaf rust resistance genes. Stripe rust resistance locus, temporarily designated as YrAc, mapped at the distal most end of 5DS linked with a group of four colocated SSRs and two resistance gene analogue (RGA)-STS markers at a distance of 5.3 cM. LrAc mapped at a distance of 9.0 cM from the YrAc and at 2.8 cM from RGA-STS marker Ta5DS_2737450, YrAc and LrAc appear to be the candidate genes for marker-assisted enrichment of the wheat gene pool for rust resistance.
Directory of Open Access Journals (Sweden)
Keith H Turner
2009-12-01
Full Text Available Phenotypic variation within an isogenic bacterial population is thought to ensure the survival of a subset of cells in adverse conditions. The opportunistic pathogen Pseudomonas aeruginosa variably expresses several phenotypes, including antibiotic resistance, biofilm formation, and the production of CupA fimbriae. Here we describe a previously unidentified bistable switch in P. aeruginosa. This switch controls the expression of a diverse set of genes, including aprA, which encodes the secreted virulence factor alkaline protease. We present evidence that bistable expression of PA2432, herein named bexR (bistable expression regulator, which encodes a LysR-type transcription regulator, controls this switch. In particular, using DNA microarrays, quantitative RT-PCR analysis, chromatin immunoprecipitation, and reporter gene fusions, we identify genes directly under the control of BexR and show that these genes are bistably expressed. Furthermore, we show that bexR is itself bistably expressed and positively autoregulated. Finally, using single-cell analyses of a GFP reporter fusion, we present evidence that positive autoregulation of bexR is necessary for bistable expression of the BexR regulon. Our findings suggest that a positive feedback loop involving a LysR-type transcription regulator serves as the basis for an epigenetic switch that controls virulence gene expression in P. aeruginosa.
DEFF Research Database (Denmark)
Ridderstråle, Martin; Carlsson, Emma; Klannemark, Mia
2002-01-01
with subcutaneous fat from obese subjects (12 +/- 4-fold; P = 0.0001), and there was a correlation between whole-body insulin sensitivity and FOXC2 mRNA levels in visceral fat (fS-insulin R = -0.64, P = 0.01, and homeostasis model assessment of insulin resistance [HOMA-IR] R = -0.68, P = 0.007) and skeletal muscle...... (fS-insulin R = -0.57, P = 0.03, and HOMA-IR R = -0.55, P = 0.04). Mutation screening of the FOXC2 gene identified a common polymorphism in the 5' untranslated region (C-512T). The T allele was associated with enhanced insulin sensitivity (HOMA-IR P = 0.007) and lower plasma triglyceride levels...
Brooks, John P; Adeli, Ardeshir; McLaughlin, Michael R
2014-06-15
The environmental influence of farm management in concentrated animal feeding operations (CAFO) can yield vast changes to the microbial biota and ecological structure of both the pig and waste manure lagoon wastewater. While some of these changes may not be negative, it is possible that CAFOs can enrich antibiotic resistant bacteria or pathogens based on farm type, thereby influencing the impact imparted by the land application of its respective wastewater. The purpose of this study was to measure the microbial constituents of swine-sow, -nursery, and -finisher farm manure lagoon wastewater and determine the changes induced by farm management. A total of 37 farms were visited in the Mid-South USA and analyzed for the genes 16S rRNA, spaQ (Salmonella spp.), Camp-16S (Campylobacter spp.), tetA, tetB, ermF, ermA, mecA, and intI using quantitative PCR. Additionally, 16S rRNA sequence libraries were created. Overall, it appeared that finisher farms were significantly different from nursery and sow farms in nearly all genes measured and in 16S rRNA clone libraries. Nearly all antibiotic resistance genes were detected in all farms. Interestingly, the mecA resistance gene (e.g. methicillin resistant Staphylococcus aureus) was below detection limits on most farms, and decreased as the pigs aged. Finisher farms generally had fewer antibiotic resistance genes, which corroborated previous phenotypic data; additionally, finisher farms produced a less diverse 16S rRNA sequence library. Comparisons of Camp-16S and spaQ GU (genomic unit) values to previous culture data demonstrated ratios from 10 to 10,000:1 depending on farm type, indicating viable but not cultivatable bacteria were dominant. The current study indicated that swine farm management schemes positively and negatively affect microbial and antibiotic resistant populations in CAFO wastewater which has future "downstream" implications from both an environmental and public health perspective. Published by Elsevier Ltd.
Directory of Open Access Journals (Sweden)
Hui eHuang
2016-04-01
Full Text Available The two-component signal transduction system CpxAR is especially widespread in Gram-negative bacteria. It has been reported that CpxAR contributes to the multidrug resistance (MDR in Escherichia coli. CpxR is a response regulator in the two-component CpxAR system. The aim of this study was to explore the role of cpxR in the MDR of S. enterica serovar Typhimurium. The minimal inhibitory concentrations (MICs of various antibiotics commonly used in veterinary medicine for strains JS (a multidrug-susceptible standard strain of S. enterica serovar Typhimurium, JS△cpxR, JS△cpxR/pcpxR, JS△cpxR/pcpxR*, JS△cpxR△acrB, JS△cpxR△acrB/pcpxR, JS△cpxR△acrB/pcpxR*, 9 S. enterica serovar Typhimurium isolates (SH1–9, and SH1–9△cpxR were determined by the 2-fold broth microdilution method. The relative mRNA expression levels of ompF, ompC, ompW, ompD, tolC, acrB, acrD, acrF, mdtA, marA, and soxS in strains JS, JS△cpxR, and JS△cpxR/pcpxR were detected by real-time PCR. The results showed 2- to 4-fold decreases in the MICs of amikacin (AMK, gentamycin (GEN, apramycin (APR, neomycin (NEO, ceftriaxone (CRO, ceftiofur (CEF, and cefquinome (CEQ for strain JS△cpxR, as compared to those for the parental strain JS. Likewise, SH1–9△cpxR were found to have 2- to 8-fold reduction in resistance to the above antibiotics, except for NEO, as compared to their parental strains SH1–9. Furthermore, 2- to 4-fold further decreases in the MICs of AMK, GEN, APR, and CEF for strain JS△cpxR△acrB were observed, as compared to those for strain JS△acrB. In addition, CpxR overproduction in strain JS△cpxR led to significant decreases in the mRNA expression levels of ompF, ompC, ompW, ompD, tolC, acrB, marA, and soxS, and significant increases in those of stm3031 and stm1530. Notably, after all strains were induced simultaneously by GEN to the 15th passage at subinhibitory concentrations, strain JS△cpxR/pcpxR showed significant increases in m
Genetic background of resistance to gall mite in Ribes species
Directory of Open Access Journals (Sweden)
Ingrida Mazeikiene
2017-06-01
Full Text Available Resistance to gall mite is an important genetic trait of Ribes. P and Ce genes, responsible for gall mite resistance, were established in Ribes species and interspecific hybrids using molecular markers. Resistance in R. americanum is determined by P gene and in R. sanguineum by Ce gene. Both molecular markers were absent in R. dikuscha genome. Molecular markers related to P and Ce genes were identified in the genome of R. aureum. Resistance to gall mite in the field conditions in R. nigrum x R. americanum, R. nigrum x R. aureum and R. nigrum x R. sanguineum F3 hybrids fitted an expected Mendelian segregation ratio of 1:1, 3:1 and 1:1, respectively. 75.0% of hybrids with a pyramidal resistance to gall mite carrying markers related to Ce and P genes were obtained in the cross combination R. nigrum x R. aureum and will be included in the future breeding programs.
Genome Wide Analysis of Nucleotide-Binding Site Disease Resistance Genes in Brachypodium distachyon
Directory of Open Access Journals (Sweden)
Shenglong Tan
2012-01-01
Full Text Available Nucleotide-binding site (NBS disease resistance genes play an important role in defending plants from a variety of pathogens and insect pests. Many R-genes have been identified in various plant species. However, little is known about the NBS-encoding genes in Brachypodium distachyon. In this study, using computational analysis of the B. distachyon genome, we identified 126 regular NBS-encoding genes and characterized them on the bases of structural diversity, conserved protein motifs, chromosomal locations, gene duplications, promoter region, and phylogenetic relationships. EST hits and full-length cDNA sequences (from Brachypodium database of 126 R-like candidates supported their existence. Based on the occurrence of conserved protein motifs such as coiled-coil (CC, NBS, leucine-rich repeat (LRR, these regular NBS-LRR genes were classified into four subgroups: CC-NBS-LRR, NBS-LRR, CC-NBS, and X-NBS. Further expression analysis of the regular NBS-encoding genes in Brachypodium database revealed that these genes are expressed in a wide range of libraries, including those constructed from various developmental stages, tissue types, and drought challenged or nonchallenged tissue.
Directory of Open Access Journals (Sweden)
Sayed Rashad Ali Shah
2015-09-01
Full Text Available Resistance (R genes against plant pathogens often have age-related resistance (ARR effects. However, the mechanism involved in this phenomenon remains unknown. In this paper, Solanum lycopersicum ‘CLN2037B’ and S. pimpinellifolium ‘L3708’ harboring the Ph-3 gene, as well as S. habrochaites ‘LA2099’, ‘LA1777’ and ‘LA1033’ harboring quantitative trait loci (QTLs, were tested to investigate age-related resistance against late blight (LB; caused by Phytophthora infestans in the three-leaf stage of the plants. The results demonstrated that the QTL-related LB resistance showed the same age-related resistance as the Ph-3-mediated resistance at the six- and nine-leaf stages compared with the three-leaf stage. This indicated that there is a common defense mechanism in tomatoes against P. infestans via ARR. In addition, we combined ethylene (ET, salicylic acid (SA and jasmonic acid (JA mutants with virus-induced gene silencing (VIGS to study the Ph-3-dependent resistance signaling pathway. The results showed that ethylene and salicylic acid, but not jasmonic acid, are involved in the LB resistance mediated by the Ph-3 gene.
Determination of rust resistance genes in pakistani bread wheats
International Nuclear Information System (INIS)
Qamar, M.; Ahmad, S.D.; Rabbani, M.A.; Shinwari, Z.K.
2014-01-01
Stripe and leaf rusts are the major constraints to bread wheat production in Pakistan. Molecular markers were used to investigate the presence of leaf rust and stripe rust resistance gene cluster Lr34/Yr18 and stem rust resistance gene Sr2 in 52 Pakistani bread wheat cultivars/lines. PCR amplification of DNA fragments using DNA marker csLV-34 showed that 13 of the studied cultivars/lines, namely 03FJ26, NR 337, NR 339, NR 347, NR 350, Manthar, Margalla 99, Iqbal 2000, Saleem 2000, Wafaq 2001, Marwat 2001, Pirsabak 2004 and Fareed 2006 carry leaf rust and stripe rust resistance genes Lr34/Yr18. Stem rust resistance gene Sr2 was observed in 36 Pakistani spring wheat cultivars/lines using stm560.3tgag marker. The slow rusting gene Sr2 needs to be combined with additional stem rust resistance genes to establish durable resistance against Ug99 in modern wheat cultivars. Low frequency of Lr34/Yr18 was found in Pakistani wheats. This gene cluster needs to be incorporated into Pakistani wheats for durable rust resistance. (author)
Directory of Open Access Journals (Sweden)
Bukina Y.V.
2016-06-01
of the results of amplification was performed using the program Bio-Rad CFX Manager 3.0 under the "Guidelines on the application of Fluoropol format sets - PB." Results and discussion. During the study of 474 cultures of microorganisms - representatives of the Enterobacteriaceae family, KPC - in 7,81% and OXA-48 - in 8,44%, VIM detected in 14,14% of the strains, NDM – 8,23% in the studied crops. These genes were detected in E.coli strains (6,74%, 7,87%, 14,61%, 4,49%, respectively, from microorganisms of the genus Klebsiella (13,85%, 1,54%, 15,38% , 12,31%, Salmonella (7,03%, 10,16%, 13,28%, 8,59%, Enterobacter (4,76%, 14,29%, 15,87%, 4,76 %, Proteus (7,89%, 10,53%, 14,47%, 6,58% and Shigella (7,55%, 3,77%, 11,32%, 15,09%. In the study of Bacteroides (Bacteroides spp. Genes KPC, OXA-48, the VIM and NDM were identified in 9,86 %, 4,23%, 9,86 % and 12,68% of the strains, respectively. PCR study of 39 isolates of P.aeruginosae showed the presence of only VIM gene and only 15,38% of the cultures. In the family Enterococaceae and Peptostreptococaceae these genes were not found. According to Russian researchers have identified strains of Enterobacteriaceae only genes OXA-48 (43,7% and VIM (17,6%, and VIM gene detection rate in P.aeruginosae was 62.9%. CTX-M gene was detected in 10,97% of the strains of the family Enterobacteriaceae (Klebsiella spp. - 13,85%, Salmonella spp. - 14,6%, Enterobacter spp. - 7,93%, Proteus spp. - 6,58% , Shigella spp. - 13,21%, Bacteroidaceae - 15,49%, Peptostreptococcaceae - 6,25%. In Pseudomonas and Enterococcus CTX-M is not revealed. At the same time, according to the literature, the frequency of detection of gene CTX-M in the family Enterobacteriaceae strains circulating in the Russian Federation, in some regions reaches 100%, thus, the gene is not detected in enterococci and Pseudomonas. In Enterococcaceae phenotypically resistant strains of microorganisms of the family genes in identifying Van A and Van B 11,46% and 6,25% causing
DEFF Research Database (Denmark)
Sandvang, Dorthe; Diggle, M.; Platt, D.J.
2002-01-01
to determinate the genetic content. Translocation to R751 and R388 was associated with the loss of the indigenous trimethoprim cassette to both plasmids and also acquisition of sulfonamide resistance by R751 and RP4::Tn7, which indicated movement of the 3' terminus of one or both of the DT104 integrons......Salmonella enterica Typhimurium DT104, 961368, a veterinary field isolate that encodes a chromosomal cluster of resistance genes as well as two integrons, was used to study the mobility of resistance cassettes (aadA2 and pse-1) and nonintegron-associated resistance determinants (chloramphenicol...... and tetracycline). A range of natural plasmids was used as targets for the translocation of resistance. Plasmids that acquired resistance from the DT104 chromosome were segregated by conjugation into Escherichia coli K12. Plasmids R751, R388, and RP4::Tn7 acquired several combinations of resistance determinant...
Background: Horizontal gene transfer is a mechanism for movement of antibiotic resistance genes among bacteria. Some small kanamycin resistance (KanR) ColE1-like plasmids isolated from different serotypes of Salmonella enterica were shown to carry mobilization genes; although not self-transmissibl...
International Nuclear Information System (INIS)
Su Haochang; Ying Guangguo; Tao Ran; Zhang Ruiquan; Zhao Jianliang; Liu Yousheng
2012-01-01
Antibiotic susceptibility, detection of sul gene types and presence of class 1, 2 and 3 integrons and gene cassettes using PCR assays were investigated in 3456 Escherichia coli isolates obtained from 38 sampling sites of the Dongjiang River catchment in the dry and wet seasons. 89.1% of the isolates were resistant and 87.5% showed resistance to at least three antibiotics. sul2 was detected most frequently in 89.2% of 1403 SXT-resistant isolates. The presence of integrons (class 1 and 2) was frequently observed (82.3%) while no class 3 integron was found. In these integrons, 21 resistance genes of 14 gene cassette arrays and 10 different families of resistance genes were identified. Three gene cassette arrays, aac(6')-Ib-cr-aar-3-dfrA27-aadA16, aacA4-catB3-dfrA1 and aadA2-lnuF, were detected for the first time in surface water. The results showed that bacterial resistance in the catchment was seriously influenced by human activities, especially discharge of wastewater. Highlights: ► Antibiotic resistance was investigated for a river catchment of southern China. ► 87.5% of E coli isolates showed resistance to at least three antibiotics. ► The presence of integrons (class 1 and 2) was frequently observed (82.3%). ► Bacterial resistance in the catchment was seriously influenced by human activities. - Bacterial resistance to antibiotics in a catchment is related to the discharge of wastewater into the aquatic environment.
Directory of Open Access Journals (Sweden)
Roderick M. Card
2018-06-01
Full Text Available Brachyspira hyodysenteriae is the aetiological agent of swine dysentery, a globally distributed disease that causes profound economic loss, impedes the free trade and movement of animals, and has significant impact on pig health. Infection is generally treated with antibiotics of which pleuromutilins, such as tiamulin, are widely used for this purpose, but reports of resistance worldwide threaten continued effective control. In Brachyspira hyodysenteriae pleuromutilin resistance has been associated with mutations in chromosomal genes encoding ribosome-associated functions, however the dynamics of resistance acquisition are poorly understood, compromising stewardship efforts to preserve pleuromutilin effectiveness. In this study we undertook whole genome sequencing (WGS and phenotypic susceptibility testing of 34 UK field isolates and 3 control strains to investigate pleuromutilin resistance in Brachyspira hyodysenteriae. Genome-wide association studies identified a new pleuromutilin resistance gene, tva(A (tiamulin valnemulin antibiotic resistance, encoding a predicted ABC-F transporter. In vitro culture of isolates in the presence of inhibitory or sub-inhibitory concentrations of tiamulin showed that tva(A confers reduced pleuromutilin susceptibility that does not lead to clinical resistance but facilitates the development of higher-level resistance via mutations in genes encoding ribosome-associated functions. Genome sequencing of antibiotic-exposed isolates identified both new and previously described mutations in chromosomal genes associated with reduced pleuromutilin susceptibility, including the 23S rRNA gene and rplC, which encodes the L3 ribosomal protein. Interesting three antibiotic-exposed isolates harboured mutations in fusA, encoding Elongation Factor G, a gene not previously associated with pleuromutilin resistance. A longitudinal molecular epidemiological examination of two episodes of swine dysentery at the same farm indicated
Burch, Tucker R; Sadowsky, Michael J; LaPara, Timothy M
2015-10-19
This study investigated the use of thermophilic anaerobic digestion for removing antibiotic resistance genes (ARGs) from residual municipal wastewater solids. Four laboratory-scale anaerobic digesters were operated in 8-day batch cycles at temperatures of 40, 56, 60, and 63 °C. Two tetracycline resistance genes (tet(W) and tet(X)), a fluoroquinolone resistance gene (qnrA), the integrase gene of class 1 integrons (intI1), 16S rRNA genes of all Bacteria, and 16S rRNA genes of methanogens were quantified using real-time quantitative PCR. ARG and intI1 quantities decreased at all temperatures and were described well by a modified form of the Collins-Selleck disinfection kinetic model. The magnitudes of Collins-Selleck kinetic parameters were significantly greater at thermophilic temperatures compared to 40 °C, but few statistically significant differences were observed among these parameters for the thermophilic anaerobic digesters. This model allows for the direct comparison of different operating conditions (e.g., temperature) on anaerobic digestion performance in mitigating the quantity of ARGs in wastewater solids and could be used to design full-scale anaerobic digesters to specifically treat for ARGs as a "pollutant" of concern.
Engineering HIV-resistant human CD4+ T cells with CXCR4-specific zinc-finger nucleases.
Directory of Open Access Journals (Sweden)
Craig B Wilen
2011-04-01
Full Text Available HIV-1 entry requires the cell surface expression of CD4 and either the CCR5 or CXCR4 coreceptors on host cells. Individuals homozygous for the ccr5Δ32 polymorphism do not express CCR5 and are protected from infection by CCR5-tropic (R5 virus strains. As an approach to inactivating CCR5, we introduced CCR5-specific zinc-finger nucleases into human CD4+ T cells prior to adoptive transfer, but the need to protect cells from virus strains that use CXCR4 (X4 in place of or in addition to CCR5 (R5X4 remains. Here we describe engineering a pair of zinc finger nucleases that, when introduced into human T cells, efficiently disrupt cxcr4 by cleavage and error-prone non-homologous DNA end-joining. The resulting cells proliferated normally and were resistant to infection by X4-tropic HIV-1 strains. CXCR4 could also be inactivated in ccr5Δ32 CD4+ T cells, and we show that such cells were resistant to all strains of HIV-1 tested. Loss of CXCR4 also provided protection from X4 HIV-1 in a humanized mouse model, though this protection was lost over time due to the emergence of R5-tropic viral mutants. These data suggest that CXCR4-specific ZFNs may prove useful in establishing resistance to CXCR4-tropic HIV for autologous transplant in HIV-infected individuals.
Directory of Open Access Journals (Sweden)
Ehlers Jeffrey D
2011-01-01
Full Text Available Abstract Background Macrophomina phaseolina is an emerging and devastating fungal pathogen that causes significant losses in crop production under high temperatures and drought stress. An increasing number of disease incidence reports highlight the wide prevalence of the pathogen around the world and its contribution toward crop yield suppression. In cowpea [Vigna unguiculata (L Walp.], limited sources of low-level host resistance have been identified, the genetic basis of which is unknown. In this study we report on the identification of strong sources of host resistance to M. phaseolina and the genetic mapping of putative resistance loci on a cowpea genetic map comprised of gene-derived single nucleotide polymorphisms (SNPs and amplified fragment length polymorphisms (AFLPs. Results Nine quantitative trait loci (QTLs, accounting for between 6.1 and 40.0% of the phenotypic variance (R2, were identified using plant mortality data taken over three years in field experiments and disease severity scores taken from two greenhouse experiments. Based on annotated genic SNPs as well as synteny with soybean (Glycine max and Medicago truncatula, candidate resistance genes were found within mapped QTL intervals. QTL Mac-2 explained the largest percent R2 and was identified in three field and one greenhouse experiments where the QTL peak co-located with a SNP marker derived from a pectin esterase inhibitor encoding gene. Maturity effects on the expression of resistance were indicated by the co-location of Mac-6 and Mac-7 QTLs with maturity-related senescence QTLs Mat-2 and Mat-1, respectively. Homologs of the ELF4 and FLK flowering genes were found in corresponding syntenic soybean regions. Only three Macrophomina resistance QTLs co-located with delayed drought-induced premature senescence QTLs previously mapped in the same population, suggesting that largely different genetic mechanisms mediate cowpea response to drought stress and Macrophomina infection
DEFF Research Database (Denmark)
Elias, D; (Hansen) Vever, Henriette; Lænkholm, A-V
2015-01-01
To elucidate the molecular mechanisms of tamoxifen resistance in breast cancer, we performed gene array analyses and identified 366 genes with altered expression in four unique tamoxifen-resistant (TamR) cell lines vs the parental tamoxifen-sensitive MCF-7/S0.5 cell line. Most of these genes were...
Zhu, Fang; Li, Ting; Zhang, Lee; Liu, Nannan
2008-09-25
Insects may use various biochemical pathways to enable them to tolerate the lethal action of insecticides. For example, increased cytochrome P450 detoxification is known to play an important role in many insect species. Both constitutively increased expression (overexpression) and induction of P450s are thought to be responsible for increased levels of detoxification of insecticides. However, unlike constitutively overexpressed P450 genes, whose expression association with insecticide resistance has been extensively studied, the induction of P450s is less well characterized in insecticide resistance. The current study focuses on the characterization of individual P450 genes that are induced in response to permethrin treatment in permethrin resistant house flies. The expression of 3 P450 genes, CYP4D4v2, CYP4G2, and CYP6A38, was co-up-regulated by permethrin treatment in permethrin resistant ALHF house flies in a time and dose-dependent manner. Comparison of the deduced protein sequences of these three P450s from resistant ALHF and susceptible aabys and CS house flies revealed identical protein sequences. Genetic linkage analysis located CYP4D4v2 and CYP6A38 on autosome 5, corresponding to the linkage of P450-mediated resistance in ALHF, whereas CYP4G2 was located on autosome 3, where the major insecticide resistance factor(s) for ALHF had been mapped but no P450 genes reported prior to this study. Our study provides the first direct evidence that multiple P450 genes are co-up-regulated in permethrin resistant house flies through the induction mechanism, which increases overall expression levels of P450 genes in resistant house flies. Taken together with the significant induction of CYP4D4v2, CYP4G2, and CYP6A38 expression by permethrin only in permethrin resistant house flies and the correlation of the linkage of the genes with resistance and/or P450-mediated resistance in resistant ALHF house flies, this study sheds new light on the functional importance of P450
Directory of Open Access Journals (Sweden)
Cheema Abdul
2008-11-01
Full Text Available Abstract Background Hereditary cataracts are most frequently inherited as autosomal dominant traits, but can also be inherited in an autosomal recessive or X-linked fashion. To date, 12 loci for autosomal recessive cataracts have been mapped including a locus on chromosome 16q22 containing the disease-causing gene HSF4 (Genbank accession number NM_001040667. Here, we describe a family from Pakistan with the first nonsense mutation in HSF4 thus expanding the mutational spectrum of this heat shock transcription factor gene. Methods A large consanguineous Pakistani family with autosomal recessive cataracts was collected from Quetta. Genetic linkage analysis was performed for the common known autosomal recessive cataracts loci and linkage to a locus containing HSF4 (OMIM 602438 was found. All exons and adjacent splice sites of the heat shock transcription factor 4 gene (HSF4 were sequenced. A mutation-specific restriction enzyme digest (HphI was performed for all family members and unrelated controls. Results The disease phenotype perfectly co-segregated with markers flanking the known cataract gene HSF4, whereas other autosomal recessive loci were excluded. A maximum two-point LOD score with a Zmax = 5.6 at θ = 0 was obtained for D16S421. Direct sequencing of HSF4 revealed the nucleotide exchange c.1213C > T in this family predicting an arginine to stop codon exchange (p.R405X. Conclusion We identified the first nonsense mutation (p.R405X in exon 11 of HSF4 in a large consanguineous Pakistani family with autosomal recessive cataract.
Doublet, Benoît; Boyd, David; Douard, Gregory; Praud, Karine; Cloeckaert, Axel; Mulvey, Michael R
2012-10-01
To determine the complete nucleotide sequence of the multidrug resistance IncA/C plasmid pR55 from a clinical Klebsiella pneumoniae strain that was isolated from a urinary tract infection in 1969 in a French hospital and compare it with those of contemporary emerging IncA/C plasmids. The plasmid was purified and sequenced using a 454 sequencing approach. After draft assembly, additional PCRs and walking reads were performed for gap closure. Sequence comparisons and multiple alignments with other IncA/C plasmids were done using the BLAST algorithm and CLUSTAL W, respectively. Plasmid pR55 (170 810 bp) revealed a shared plasmid backbone (>99% nucleotide identity) with current members of the IncA/C(2) multidrug resistance plasmid family that are widely disseminating antibiotic resistance genes. Nevertheless, two specific multidrug resistance gene arrays probably acquired from other genetic elements were identified inserted at conserved hotspot insertion sites in the IncA/C backbone. A novel transposon named Tn6187 showed an atypical mixed transposon configuration composed of two mercury resistance operons and two transposition modules that are related to Tn21 and Tn1696, respectively, and an In0-type integron. IncA/C(2) multidrug resistance plasmids have a broad host range and have been implicated in the dissemination of antibiotic resistance among Enterobacteriaceae from humans and animals. This typical IncA/C(2) genetic scaffold appears to carry various multidrug resistance gene arrays and is now also a successful vehicle for spreading AmpC-like cephalosporinase and metallo-β-lactamase genes, such as bla(CMY) and bla(NDM), respectively.
Liu, Yang; Wu, Haoyang; Xie, Qiang; Bu, Wenjun
2015-01-01
Erthesina fullo (Thunberg, 1783) is an economically important heteropteran species in China. Since only three nucleotide sequences of this species (COI, 16S rRNA, and 18S rRNA) appear in the GenBank database so far, no analysis of the molecular mechanisms underlying E. fullo's resistance to insecticide and environmental stress has been accomplished. We reported a de novo assembled and annotated transcriptome for adult E. fullo using the Illumina sequence system. A total of 53,359,458 clean reads of 4.8 billion nucleotides (nt) were assembled into 27,488 unigenes with an average length of 750 bp, of which 17,743 (64.55%) were annotated. In the present study, we identified 88 putative cytochrome P450 sequences and analyzed the evolution of cytochrome P450 superfamilies, genes of the CYP3 clan related to metabolizing xenobiotics and plant natural compounds, in E. fullo, increasing the candidate genes for the molecular mechanisms of insecticide resistance in P450. The sequenced transcriptome greatly expands the available genomic information and could allow a better understanding of the mechanisms of insecticide resistance at the systems biology level.
Control of sulfate concentration by miR395-targeted APS genes in Arabidopsis thaliana
Directory of Open Access Journals (Sweden)
Qin Ai
2016-04-01
Full Text Available Sulfur nutrition is crucial for plant growth and development, as well as crop yield and quality. Inorganic sulfate in the soil is the major sulfur source for plants. After uptake, sulfate is activated by ATP sulfurylase, and then gets assimilated into sulfur-containing metabolites. However, the mechanism of regulation of sulfate levels by ATP sulfurylase is unclear. Here, we investigated the control of sulfate levels by miR395-mediated regulation of APS1/3/4. Sulfate was over-accumulated in the shoots of miR395 over-expression plants in which the expression of the APS1, APS3, and APS4 genes was suppressed. Accordingly, reduced expression of miR395 caused a decline of sulfate concentration. In agreement with these results, over-expression of the APS1, APS3, and APS4 genes led to the reduction of sulfate levels. Differential expression of these three APS genes in response to sulfate starvation implied that they have different functions. Further investigation revealed that the regulation of sulfate levels mediated by miR395 depends on the repression of its APS targets. Unlike the APS1, APS3, and APS4 genes, which encode plastid-localized ATP sulfurylases, the APS2 gene encodes a cytosolic version of ATP sulfurylase. Genetic analysis indicated that APS2 has no significant effect on sulfate levels. Our data suggest that miR395-targeted APS genes are key regulators of sulfate concentration in leaves.
Directory of Open Access Journals (Sweden)
Lars G. Kamphuis
2016-07-01
Full Text Available Resistance to the Australian pea aphid (PA; Acyrthosiphon pisum biotype in cultivar Jester of the model legume Medicago truncatula is mediated by a single dominant gene and is phloem-mediated. The genetic map position for this resistance gene, APR (Acyrthosiphon pisum resistance, is provided and shows that APR maps 39 centiMorgans (cM distal of the A. kondoi resistance (AKR locus, which mediates resistance to a closely related species of the same genus bluegreen aphid (A. kondoi. The APR region on chromosome 3 is dense in classical nucleotide binding site leucine-rich repeats (NLRs and overlaps with the region harbouring the RAP1 gene which confers resistance to a European PA biotype in the accession Jemalong A17. Further screening of a core collection of M. truncatula accessions identified seven lines with strong resistance to PA. Allelism experiments showed that the single dominant resistance to PA in M. truncatula accessions SA10481 and SA1516 are allelic to SA10733, the donor of the APR locus in cultivar Jester. While it remains unclear whether there are multiple PA resistance genes in an R-gene cluster or the resistance loci identified in the other M. truncatula accessions are allelic to APR, the introgression of APR into current M. truncatula cultivars will provide more durable resistance to PA.
Major Gene for Field Stem Rust Resistance Co-Locates with Resistance Gene Sr12 in ‘Thatcher’ Wheat
Hiebert, Colin W.; Kolmer, James A.; McCartney, Curt A.; Briggs, Jordan; Fetch, Tom; Bariana, Harbans; Choulet, Frederic; Rouse, Matthew N.; Spielmeyer, Wolfgang
2016-01-01
Stem rust, caused by Puccinia graminis (Pgt), is a damaging disease of wheat that can be controlled by utilizing effective stem rust resistance genes. ‘Thatcher’ wheat carries complex resistance to stem rust that is enhanced in the presence of the resistance gene Lr34. The purpose of this study was to examine APR in ‘Thatcher’ and look for genetic interactions with Lr34. A RIL population was tested for stem rust resistance in field nurseries in Canada, USA, and Kenya. BSA was used to find SNP markers associated with reduced stem rust severity. A major QTL was identified on chromosome 3BL near the centromere in all environments. Seedling testing showed that Sr12 mapped to the same region as the QTL for APR. The SNP markers were physically mapped and the region carrying the resistance was searched for sequences with homology to members of the NB-LRR resistance gene family. SNP marker from one NB-LRR-like sequence, NB-LRR3 co-segregated with Sr12. Two additional populations, including one that lacked Lr34, were tested in field nurseries. NB-LRR3 mapped near the maximum LOD for reduction in stem rust severity in both populations. Lines from a population that segregated for Sr12 and Lr34 were tested for seedling Pgt biomass and infection type, as well as APR to field stem rust which showed an interaction between the genes. We concluded that Sr12, or a gene closely linked to Sr12, was responsible for ‘Thatcher’-derived APR in several environments and this resistance was enhanced in the presence of Lr34. PMID:27309724
Identification of bacterial blight resistance genes Xa4 in Pakistani ...
African Journals Online (AJOL)
SERVER
2008-03-04
Mar 4, 2008 ... Bacterial blight (BB) caused by Xanthomonas oryzae pv oryzae (Xoo) is a major biotic constraint in the irrigated rice belts. Genetic resistance is the most effective and economical control for bacterial blight. Molecular survey was conducted to identify the rice germplasm/lines for the presence of Xa4, a.
Directory of Open Access Journals (Sweden)
O.I. Chub
2014-10-01
Full Text Available Increased multidrug resistance of extended-spectrum beta-lactamases (ESBLs compromises the efficacy of treatment of urinary tract infections. The objective of this study is to determine the prevalence of ESBL-producing uropathogens from patients with chronic pyelonephritis (CP and to evaluate the risk factors of these types of infections. Screening for the presence of plasmid-mediated ESBL was performed by polymerase chain reaction. Out of 105 patients, 22 (20.9% revealed strains with resistance genes: 11 (36.7%, 11 (36.7% and 8 (26.7% were identified to carry bla(TEM, bla(SHV and bla(CTX-M beta-lactamase genes, respectively. We have demonstrated that prevalence of the resistance among patients with CP combined with type 2 DM was 31.3%, while among patients with CP without type 2 DM was 27.4%; however the difference between these groups was not significant. The main factors related with appearance of plasmid-mediated resistance genes were age range above 55 years, Chronic Kidney Disease stage ІІІ and ІV, in-patient treatment history, history of using antibiotics last year. Isolation and detection of ESBL-producing strains are essential fоr the sеlection оf the mоst effеctive antibiоtic for the empiric trеatment.
Identification of a third protein 4.1 tumor suppressor, protein 4.1R, in meningioma pathogenesis
Energy Technology Data Exchange (ETDEWEB)
Robb, Victoria A.; Li, Wen; Gascard, Philippe; Perry, Arie; Mohandas, Narla; Gutmann, David H.
2003-06-11
Meningiomas are common tumors of the central nervous system, however, the mechanisms under lying their pathogenesis are largely undefined. Two members of the Protein 4.1 super family, the neuro fibromatosis 2 (NF2) gene product (merlin/schwannomin) and Protein 4.1B have been implicated as meningioma tumor suppressors. In this report, we demonstrate that another Protein 4.1 family member, Protein 4.1R, also functions as a meningioma tumor suppressor. Based on the assignment of the Protein 4.1R gene to chromosome 1p32-36, a common region of deletion observed in meningiomas, we analyzed Protein 4.1R expression in meningioma cell lines and surgical tumor specimens. We observed loss of Protein 4.1R protein expression in two meningioma cell lines (IOMM-Lee, CH157-MN) by Western blotting as well as in 6 of 15 sporadic meningioma as by immuno histo chemistry (IHC). Analysis of a subset of these sporadic meningiomas by fluorescent in situ hybridization (FISH) with a Protein 4.1R specific probe demonstrated 100 percent concordance with the IHC results. In support of a meningioma tumor suppressor function, over expression of Protein 4.1R resulted in suppression of IOMM-Lee and CH157MN cell proliferation. Similar to the Protein 4.1B and merlin meningioma tumor suppressors, Protein 4.1R localization in the membrane fraction increased significantly under conditions of growth arrest in vitro. Lastly, Protein 4.1R interacted with some known merlin/Protein 4.1B interactors such as CD44 and bII-spectrin, but did not associate with the Protein 4.1B interactors 14-3-3 and PRMT3 or the merlin binding proteins SCHIP-1 and HRS. Collectively, these results suggest that Protein 4.1R functions as an important tumor suppressor important in the molecular pathogenesis of meningioma.
Du, Jing; Geng, Jinju; Ren, Hongqiang; Ding, Lili; Xu, Ke; Zhang, Yan
2015-03-01
The variation of five antibiotic resistance genes (ARGs)-tetG, tetW, tetX, sul1, and intI1-in a full-scale municipal wastewater treatment plant with A(2)O-MBR system was studied. The concentrations of five resistance genes both in influent and in membrane bioreactor (MBR) effluent decreased as sul1 > intI1 > tetX > tetG > tetW, and an abundance of sul1 was statistically higher than three other tetracycline resistance genes (tetG, tetW, and tetX) (p MBR effluent. The reduction of tetW, intI1, and sul1 was all significantly positively correlated with the reduction of 16S ribosomal DNA (rDNA) in the wastewater treatment process (p MBR was observed for all ARGs.
Qi, L L; Talukder, Z I; Hulke, B S; Foley, M E
2017-06-01
Diagnostic DNA markers are an invaluable resource in breeding programs for successful introgression and pyramiding of disease resistance genes. Resistance to downy mildew (DM) disease in sunflower is mediated by Pl genes which are known to be effective against the causal fungus, Plasmopara halstedii. Two DM resistance genes, Pl Arg and Pl 8 , are highly effective against P. halstedii races in the USA, and have been previously mapped to the sunflower linkage groups (LGs) 1 and 13, respectively, using simple sequence repeat (SSR) markers. In this study, we developed high-density single nucleotide polymorphism (SNP) maps encompassing the Pl arg and Pl 8 genes and identified diagnostic SNP markers closely linked to these genes. The specificity of the diagnostic markers was validated in a highly diverse panel of 548 sunflower lines. Dissection of a large marker cluster co-segregated with Pl Arg revealed that the closest SNP markers NSA_007595 and NSA_001835 delimited Pl Arg to an interval of 2.83 Mb on the LG1 physical map. The SNP markers SFW01497 and SFW06597 delimited Pl 8 to an interval of 2.85 Mb on the LG13 physical map. We also developed sunflower lines with homozygous, three gene pyramids carrying Pl Arg , Pl 8 , and the sunflower rust resistance gene R 12 using the linked SNP markers from a segregating F 2 population of RHA 340 (carrying Pl 8 )/RHA 464 (carrying Pl Arg and R 12 ). The high-throughput diagnostic SNP markers developed in this study will facilitate marker-assisted selection breeding, and the pyramided sunflower lines will provide durable resistance to downy mildew and rust diseases.
Expression Study of Banana Pathogenic Resistance Genes
Directory of Open Access Journals (Sweden)
Fenny M. Dwivany
2016-10-01
Full Text Available Banana is one of the world's most important trade commodities. However, infection of banana pathogenic fungi (Fusarium oxysporum race 4 is one of the major causes of decreasing production in Indonesia. Genetic engineering has become an alternative way to control this problem by isolating genes that involved in plant defense mechanism against pathogens. Two of the important genes are API5 and ChiI1, each gene encodes apoptosis inhibitory protein and chitinase enzymes. The purpose of this study was to study the expression of API5 and ChiI1 genes as candidate pathogenic resistance genes. The amplified fragments were then cloned, sequenced, and confirmed with in silico studies. Based on sequence analysis, it is showed that partial API5 gene has putative transactivation domain and ChiI1 has 9 chitinase family GH19 protein motifs. Data obtained from this study will contribute in banana genetic improvement.
Oxidant resistance in a yeast mutant deficient in the Sit4 phosphatase
DEFF Research Database (Denmark)
López-Mirabal, H Reynaldo; Winther, Jakob R; Kielland-Brandt, Morten C
2008-01-01
Resistance to thiol oxidation can arise from mutations altering redox homeostasis. A Saccharomyces cerevisiae sit4-110 mutant is here described, which was isolated as resistant to the thiol-specific oxidant dipyridyl disulfide (DPS) and which contains a single-residue substitution in the SIT4 gene...
Directory of Open Access Journals (Sweden)
Yuanman Tang
2017-11-01
Full Text Available Various classes of plant pathogenesis-related proteins have been identified in the past several decades. PR-Q, a member of the PR3 family encoding chitinases, has played an important role in regulating plant resistance and preventing pathogen infection. In this paper, we functionally characterized NtPR-Q in tobacco plants and found that the overexpression of NtPR-Q in tobacco Yunyan87 resulted in higher resistance to Ralstonia solanacearum inoculation. Surprisingly, overexpression of NtPR-Q led to the activation of many defense-related genes, such as salicylic acid (SA-responsive genes NtPR1a/c, NtPR2 and NtCHN50, JA-responsive gene NtPR1b and ET production-associated genes NtACC Oxidase and NtEFE26. Consistent with the role of NtPR-Q in multiple stress responses, NtPR-Q transcripts were induced by the exogenous hormones SA, ethylene and methyl jasmonate, which could enhance the resistance of tobacco to R. solanacearum. Collectively, our results suggested that NtPR-Q overexpression led to the up-regulation of defense-related genes and enhanced plant resistance to R. solanacearum infection.
Huang, D; Qiu, Y; Zhang, Y; Huang, F; Meng, J; Wei, S; Li, R; Chen, B
2013-01-01
The brown planthopper (Nilaparvata lugens Stål; BPH) is one of the most serious rice pests worldwide. Growing resistant varieties is the most effective way to manage this insect, and wild rice species are a valuable source of resistance genes for developing resistant cultivars. BPH27 derived from an accession of Guangxi wild rice, Oryza rufipogon Griff. (Accession no. 2183, hereafter named GX2183), was primarily mapped to a 17-cM region on the long arm of the chromosome four. In this study, fine mapping of BPH27 was conducted using two BC(1)F(2) populations derived from introgression lines of GX2183. Insect resistance was evaluated in the BC(1)F(2) populations with 6,010 individual offsprings, and 346 resistance extremes were obtained and employed for fine mapping of BPH27. High-resolution linkage analysis defined the BPH27 locus to an 86.3-kb region in Nipponbare. Regarding the sequence information of rice cultivars, Nipponbare and 93-11, all predicted open reading frames (ORFs) in the fine-mapping region have been annotated as 11 types of proteins, and three ORFs encode disease-related proteins. Moreover, the average BPH numbers showed significant differences in 96-120 h after release in comparisons between the preliminary near-isogenic lines (pre-NILs, lines harboring resistance genes) and BaiR54. BPH growth and development were inhibited and survival rates were lower in the pre-NIL plants compared with the recurrent parent BaiR54. The pre-NIL exhibited 50.7% reductions in population growth rates (PGR) compared to BaiR54. The new development in fine mapping of BPH27 will facilitate the efforts to clone this important resistant gene and to use it in BPH-resistance rice breeding.
Frequency of antiseptic resistance genes in clinical staphycocci and enterococci isolates in Turkey
Directory of Open Access Journals (Sweden)
Seyda Ignak
2017-08-01
Full Text Available Abstract Background Disinfectants and antiseptics are biocides widely used in hospitals to prevent spread of pathogens. It has been reported that antiseptic resistance genes, qac’s, caused tolerance to a variety of biocidal agents, such as benzalkonium chloride (BAC and chlorhexidine digluconate (CHDG in Staphylococcus spp. isolates. We aimed to search the frequency of antiseptic resistance genes in clinical Staphylococcus spp. and Enterococcus spp. isolates to investigate the possible association with antiseptic tolerance and antibiotic resistance. Methods Antiseptic resistance genes (qacA/B, smr, qacG, qacH, and qacJ isolated from Gram-positive cocci (69 Staphylococcus spp. and 69 Enterococcus spp. were analyzed by PCR method. The minimum inhibitory concentrations (MICs of BAC and CHDG were determined by agar dilution method, whereas antibiotic susceptibility was analyzed by disk diffusion method according to Clinical and Laboratory Standards Institute (CLSI criteria. Results The frequency of antiseptic resistance genes was found to be high (49/69; 71.0% in our clinical staphylococci isolates but absent (0/69; 0% in enterococci isolates. The frequency of qacA/B and smr genes was higher (25/40; 62.5% and 7/40; 17.5%, respectively in coagulase negative staphylococci (CNS when compared to Staphylococcus aureus strains (3/29; 10.3%, and 4/29; 13.8%, respectively. In contrast, the frequency of qacG and qacJ genes was higher (11/29; 37.9% and 8/29; 27.5%, respectively in S. aureus than those of CNS (5/40; 12.5%, 10/40; 25.0% strains. qacH was not identified in none of the strains. We found an association between presence of antiseptic resistance genes and increased MIC values of BAC (>4 μg/mL in staphylococci and it was found to be statistically statistically significant (p < 0.01. We also showed that MICs of BAC and CHDG of vancomycin-resistant enterococci (VRE isolates were significantly higher than those of vancomycin
Jiang, Shu-Mei; Hu, Jun; Yin, Wei-Bo; Chen, Yu-Hong; Wang, Richard R-C; Hu, Zan-Min
2005-09-01
Homology-based gene/gene-analog cloning method has been extensively applied in isolation of RGAs (resistance gene analogs) in various plant species. However, serious interference of sequences on homoeologous chromosomes in polyploidy species usually occurred when cloning RGAs in a specific chromosome. In this research, the techniques of chromosome microdissection combined with homology-based cloning were used to clone RGAs from a specific chromosome of Wheat-Thinopyrum alien addition line TAi-27, which was derived from common wheat and Thinopyrum intermedium with a pair of chromosomes from Th. intermedium. The alien chromosomes carry genes for resistance to BYDV. The alien chromosome in TAi-27 was isolated by a glass needle and digested with proteinase K. The DNA of the alien chromosome was amplified by two rounds of Sau3A linker adaptor-mediated PCR. RGAs were amplified by PCR with the degenerated primers designed based on conserved domains of published resistance genes (R genes) by using the alien chromosome DNA, genomic DNA and cDNA of Th. intermedium, TAi-27 and 3B-2 (a parent of TAi-27) as templates. A total of seven RGAs were obtained and sequenced. Of which, a constitutively expressed single-copy NBS-LRR type RGA ACR 3 was amplified from the dissected alien chromosome of TAi-27, TcDR 2 and TcDR 3 were from cDNA of Th. intermedium, AcDR 3 was from cDNA of TAi-27, FcDR 2 was from cDNA of 3B-2, AR 2 was from genomic DNA of TAi-27 and TR 2 was from genomic DNA of Th. intermedium. Sequence homology analyses showed that the above RGAs were highly homologous with known resistance genes or resistance gene analogs and belonged to NBS-LRR type of R genes. ACR 3 was recovered by PCR from genomic DNA and cDNA of Th. intermedium and TAi-27, but not from 3B-2. Southern hybridization using the digested genomic DNA of Th. intermedium, TAi-27 and 3B-2 as the template and ACR 3 as the probe showed that there is only one copy of ACR 3 in the genome of Th. intermedium and TAi
Directory of Open Access Journals (Sweden)
Salvador eMirete
2015-10-01
Full Text Available Hypersaline environments are considered one of the most extreme habitats on earth and microorganisms have developed diverse molecular mechanisms of adaptation to withstand these conditions. The present study was aimed at identifying novel genes involved in salt resistance from the microbial communities of brines and the rhizosphere from the Es Trenc saltern (Mallorca, Spain. The microbial diversity assessed by pyrosequencing of 16S rRNA gene libraries revealed the presence of communities that are typical in such environments. Metagenomic libraries from brine and rhizosphere samples, were transferred to the osmosensitive strain Escherichia coli MKH13, and screened for salt resistance. As a result, eleven genes that conferred salt resistance were identified, some encoding for well known proteins previously related to osmoadaptation as a glycerol and a proton pump, whereas others encoded for proteins not previously related to this function in microorganisms as DNA/RNA helicases, an endonuclease III (Nth and hypothetical proteins of unknown function. Furthermore, four of the retrieved genes were cloned and expressed in Bacillus subtilis and they also exhibited salt resistance in this bacterium, broadening the spectrum of bacterial species where these genes can operate. This is the first report of salt resistance genes recovered from metagenomes of a hypersaline environment.
Skorczyk, A; Flisikowski, K; Szydlowski, M; Cieslak, J; Fries, R; Switonski, M
2011-02-01
There are five genes encoding melanocortin receptors. Among canids, the genes have mainly been studied in the dog (MC1R, MC2R and MC4R). The MC4R gene has also been analysed in the red fox. In this report, we present a study of chromosome localization, comparative sequence analysis and polymorphism of the MC3R gene in the dog, red fox, arctic fox and Chinese raccoon dog. The gene was localized by FISH to the following chromosome: 24q24-25 in the dog, 14p16 in the red fox, 18q13 in the arctic fox and NPP4p15 in the Chinese raccoon dog. A high identity level of the MC3R gene sequences was observed among the species, ranging from 96.0% (red fox--Chinese raccoon dog) to 99.5% (red fox--arctic fox). Altogether, eight polymorphic sites were found in the red fox, six in the Chinese raccoon dog and two in the dog, while the arctic fox appeared to be monomorphic. In addition, association of several polymorphisms with body weight was analysed in red foxes (the number of genotyped animals ranged from 319 to 379). Two polymorphisms in the red fox, i.e. a silent substitution c.957A>C and c.*185C>T in the 3'-flanking sequence, showed a significant association (P < 0.01) with body weight. © 2010 The Authors, Animal Genetics © 2010 Stichting International Foundation for Animal Genetics.
R gene stacking by trans- and cisgenesis to achieve durable late blight resistance in potato
Zhu, S.
2014-01-01
Among the many diseases of potato (Solanum tuberosum L.), which is the third food crop in the world after wheat and rice, late blight caused by the oomycete pathogen Phytophthora infestans, is one of the most serious diseases. In the last century, major resistance (R)
Directory of Open Access Journals (Sweden)
Lisbeth E de Vries
Full Text Available The microbiota in the human gastrointestinal tract (GIT is highly exposed to antibiotics, and may be an important reservoir of resistant strains and transferable resistance genes. Maternal GIT strains can be transmitted to the offspring, and resistances could be acquired from birth. This is a case study using a metagenomic approach to determine the diversity of microorganisms conferring tetracycline resistance (Tc(r in the guts of a healthy mother-infant pair one month after childbirth, and to investigate the potential for horizontal transfer and maternal transmission of Tc(r genes. Fecal fosmid libraries were functionally screened for Tc(r, and further PCR-screened for specific Tc(r genes. Tc(r fosmid inserts were sequenced at both ends to establish bacterial diversity. Mother and infant libraries contained Tc(r, although encoded by different genes and organisms. Tc(r organisms in the mother consisted mainly of Firmicutes and Bacteroidetes, and the main gene detected was tet(O, although tet(W and tet(X were also found. Identical Tc(r gene sequences were present in different bacterial families and even phyla, which may indicate horizontal transfer within the maternal GIT. In the infant library, Tc(r was present exclusively in streptococci carrying tet(M, tet(L and erm(T within a novel composite transposon, Tn6079. This transposon belongs to a family of broad host range conjugative elements, implying a potential for the joint spread of tetracycline and erythromycin resistance within the infant's gut. In addition, although not found in the infant metagenomic library, tet(O and tet(W could be detected in the uncloned DNA purified from the infant fecal sample. This is the first study to reveal the diversity of Tc(r bacteria in the human gut, to detect a likely transmission of antibiotic resistance from mother to infant GITs and to indicate the possible occurrence of gene transfers among distantly related bacteria coinhabiting the GIT of the same
Xie, Yi; Chen, Jiazhen; He, Junlin; Miao, Xinyu; Xu, Meng; Wu, Xingwen; Xu, Beiyun; Yu, Liying; Zhang, Wenhong
2014-02-01
This study attempts to determine the antimicrobial resistance profiles of obligate anaerobic bacteria that were isolated from a periodontal abscess and to evaluate the prevalence of resistance genes in these bacteria. Forty-one periodontal abscess samples were cultivated on selective and non-selective culture media to isolate the oral anaerobes. Their antibiotic susceptibilities to clindamycin, doxycycline, amoxicillin, imipenem, cefradine, cefixime, roxithromycin, and metronidazole were determined using the agar dilution method, and polymerase chain reaction assays were performed to detect the presence of the ermF, tetQ, nim, and cfxA drug resistance genes. A total of 60 different bacterial colonies was isolated and identified. All of the isolates were sensitive to imipenem. Of the strains, 6.7%, 13.3%, 16.7%, and 25% were resistant to doxycycline, metronidazole, cefixime, and amoxicillin, respectively. The resistance rate for both clindamycin and roxithromycin was 31.7%. Approximately 60.7% of the strains had the ermF gene, and 53.3% of the amoxicillin-resistant strains were found to have the cfxA gene. Two nim genes that were found in eight metronidazole-resistant strains were identified as nimB. In the present study, the Prevotella species are the most frequently isolated obligate anaerobes from periodontal abscesses. The current results show their alarmingly high resistance rate against clindamycin and roxithromycin; thus, the use of these antibiotics is unacceptable for the empirical therapy of periodontal abscesses. A brief prevalence of four resistance genes in the anaerobic bacteria that were isolated was also demonstrated.
The wheat Lr34 multipathogen resistance gene confers resistance to anthracnose and rust in sorghum.
Schnippenkoetter, Wendelin; Lo, Clive; Liu, Guoquan; Dibley, Katherine; Chan, Wai Lung; White, Jodie; Milne, Ricky; Zwart, Alexander; Kwong, Eunjung; Keller, Beat; Godwin, Ian; Krattinger, Simon G; Lagudah, Evans
2017-11-01
The ability of the wheat Lr34 multipathogen resistance gene (Lr34res) to function across a wide taxonomic boundary was investigated in transgenic Sorghum bicolor. Increased resistance to sorghum rust and anthracnose disease symptoms following infection with the biotrophic pathogen Puccinia purpurea and the hemibiotroph Colletotrichum sublineolum, respectively, occurred in transgenic plants expressing the Lr34res ABC transporter. Transgenic sorghum lines that highly expressed the wheat Lr34res gene exhibited immunity to sorghum rust compared to the low-expressing single copy Lr34res genotype that conferred partial resistance. Pathogen-induced pigmentation mediated by flavonoid phytoalexins was evident on transgenic sorghum leaves following P. purpurea infection within 24-72 h, which paralleled Lr34res gene expression. Elevated expression of flavone synthase II, flavanone 4-reductase and dihydroflavonol reductase genes which control the biosynthesis of flavonoid phytoalexins characterized the highly expressing Lr34res transgenic lines 24-h post-inoculation with P. purpurea. Metabolite analysis of mesocotyls infected with C. sublineolum showed increased levels of 3-deoxyanthocyanidin metabolites were associated with Lr34res expression, concomitant with reduced symptoms of anthracnose. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
The diversity of antimicrobial resistance genes among staphylococci of animal origin.
Wendlandt, Sarah; Feßler, Andrea T; Monecke, Stefan; Ehricht, Ralf; Schwarz, Stefan; Kadlec, Kristina
2013-08-01
Staphylococci of animal origin harbor a wide variety of resistance genes. So far, more than 40 different resistance genes have been identified in staphylococci from animals. This includes genes that confer resistance to virtually all classes of antimicrobial agents approved for use in animals, such as penicillins, cephalosporins, tetracyclines, macrolides, lincosamides, phenicols, aminoglycosides, aminocyclitols, pleuromutilins, and diaminopyrimidines. The gene products of some of these resistance genes confer resistance to only specific members of a class of antimicrobial agents, whereas others confer resistance to the entire class or even to members of different classes of antimicrobial agents. The resistance mechanisms specified by the resistance genes fall into three major categories: (i) enzymatic inactivation, (ii) active efflux, or (iii) protection/modification/replacement of the cellular target sites of the antimicrobial agents. Mobile genetic elements, in particular plasmids and transposons, play a major role as carriers of antimicrobial resistance genes in animal staphylococci. They facilitate the exchange of resistance genes with staphylococci of human origin but also with other Gram-positive bacteria. Copyright © 2013 Elsevier GmbH. All rights reserved.
Directory of Open Access Journals (Sweden)
Leyre Lavilla Lerma
Full Text Available The distribution and quantification of tetracycline, sulfonamide and beta-lactam resistance genes were assessed in slaughterhouse zones throughout meat chain production and the meat products; this study represents the first to report quantitatively monitor antibiotic resistance genes (ARG in goat and lamb slaughterhouse using a culture independent approach, since most studies focused on individual bacterial species and their specific resistance types. Quantitative PCR (qPCR revealed a high prevalence of tetracycline resistance genes tetA and tetB in almost all slaughterhouse zones. Sulfonamide resistance genes were largely distributed, while beta-lactam resistance genes were less predominant. Statistical analysis revealed that resistant bacteria, in most cases, were spread by the same route in almost all slaughterhouse zones, except for tetB, blaCTX and blaTEM genes, which occurred in few zones as isolated 'hot spots.' The sum of all analyzed ARG indicated that slaughterhouse surfaces and end products act as reservoirs of ARG, mainly tet genes, which were more prevalent in slaughtering room (SR, cutting room (CR and commercial meat products (MP. Resistance gene patterns suggest they were disseminated throughout slaughterhouse zones being also detected in commercial meat products, with significant correlations between different sampling zones/end products and total resistance in SR, CR and white room (WR zones, and also refrigerator 4 (F4 and MP were observed. Strategically controlling key zones in slaughterhouse (SR, CR and WR by adequate disinfection methods could strategically reduce the risks of ARG transmission and minimize the issues of food safety and environment contamination.
Lavilla Lerma, Leyre; Benomar, Nabil; Knapp, Charles W; Correa Galeote, David; Gálvez, Antonio; Abriouel, Hikmate
2014-01-01
The distribution and quantification of tetracycline, sulfonamide and beta-lactam resistance genes were assessed in slaughterhouse zones throughout meat chain production and the meat products; this study represents the first to report quantitatively monitor antibiotic resistance genes (ARG) in goat and lamb slaughterhouse using a culture independent approach, since most studies focused on individual bacterial species and their specific resistance types. Quantitative PCR (qPCR) revealed a high prevalence of tetracycline resistance genes tetA and tetB in almost all slaughterhouse zones. Sulfonamide resistance genes were largely distributed, while beta-lactam resistance genes were less predominant. Statistical analysis revealed that resistant bacteria, in most cases, were spread by the same route in almost all slaughterhouse zones, except for tetB, blaCTX and blaTEM genes, which occurred in few zones as isolated 'hot spots.' The sum of all analyzed ARG indicated that slaughterhouse surfaces and end products act as reservoirs of ARG, mainly tet genes, which were more prevalent in slaughtering room (SR), cutting room (CR) and commercial meat products (MP). Resistance gene patterns suggest they were disseminated throughout slaughterhouse zones being also detected in commercial meat products, with significant correlations between different sampling zones/end products and total resistance in SR, CR and white room (WR) zones, and also refrigerator 4 (F4) and MP were observed. Strategically controlling key zones in slaughterhouse (SR, CR and WR) by adequate disinfection methods could strategically reduce the risks of ARG transmission and minimize the issues of food safety and environment contamination.
Census of solo LuxR genes in prokaryotic genomes.
Hudaiberdiev, Sanjarbek; Choudhary, Kumari S; Vera Alvarez, Roberto; Gelencsér, Zsolt; Ligeti, Balázs; Lamba, Doriano; Pongor, Sándor
2015-01-01
luxR genes encode transcriptional regulators that control acyl homoserine lactone-based quorum sensing (AHL QS) in Gram negative bacteria. On the bacterial chromosome, luxR genes are usually found next or near to a luxI gene encoding the AHL signal synthase. Recently, a number of luxR genes were described that have no luxI genes in their vicinity on the chromosome. These so-called solo luxR genes may either respond to internal AHL signals produced by a non-adjacent luxI in the chromosome, or can respond to exogenous signals. Here we present a survey of solo luxR genes found in complete and draft bacterial genomes in the NCBI databases using HMMs. We found that 2698 of the 3550 luxR genes found are solos, which is an unexpectedly high number even if some of the hits may be false positives. We also found that solo LuxR sequences form distinct clusters that are different from the clusters of LuxR sequences that are part of the known luxR-luxI topological arrangements. We also found a number of cases that we termed twin luxR topologies, in which two adjacent luxR genes were in tandem or divergent orientation. Many of the luxR solo clusters were devoid of the sequence motifs characteristic of AHL binding LuxR proteins so there is room to speculate that the solos may be involved in sensing hitherto unknown signals. It was noted that only some of the LuxR clades are rich in conserved cysteine residues. Molecular modeling suggests that some of the cysteines may be involved in disulfide formation, which makes us speculate that some LuxR proteins, including some of the solos may be involved in redox regulation.
Gerzova, Lenka; Babak, Vladimir; Sedlar, Karel; Faldynova, Marcela; Videnska, Petra; Cejkova, Darina; Jensen, Annette Nygaard; Denis, Martine; Kerouanton, Annaelle; Ricci, Antonia; Cibin, Veronica; Österberg, Julia; Rychlik, Ivan
2015-01-01
One of the recent trends in animal production is the revival of interest in organic farming. The increased consumer interest in organic animal farming is mainly due to concerns about animal welfare and the use of antibiotics in conventional farming. On the other hand, providing animals with a more natural lifestyle implies their increased exposure to environmental sources of different microorganisms including pathogens. To address these concerns, we determined the abundance of antibiotic resistance and diversity within fecal microbiota in pigs kept under conventional and organic farming systems in Sweden, Denmark, France and Italy. The abundance of sul1, sul2, strA, tet(A), tet(B) and cat antibiotic resistance genes was determined in 468 samples by real-time PCR and the fecal microbiota diversity was characterized in 48 selected samples by pyrosequencing of V3/V4 regions of 16S rRNA. Contrary to our expectations, there were no extensive differences between the abundance of tested antibiotic resistance genes in microbiota originating from organic or conventionally housed pigs within individual countries. There were also no differences in the microbiota composition of organic and conventional pigs. The only significant difference was the difference in the abundance of antibiotic resistance genes in the samples from different countries. Fecal microbiota in the samples originating from southern European countries (Italy, France) exhibited significantly higher antibiotic resistance gene abundance than those from northern parts of Europe (Denmark, Sweden). Therefore, the geographical location of the herd influenced the antibiotic resistance in the fecal microbiota more than farm's status as organic or conventional.
Background Generally drug resistant bacteria carry antibiotic resistance genes and heavy metal and biocide resistance genes on large conjugative plasmids. The presence of these metal and biocide resistance genes in susceptible bacteria are not assessed comprehensively. Hence, WGS data of susceptib...
Candidate genes for cross-resistance against DNA-damaging drugs
DEFF Research Database (Denmark)
Wittig, Rainer; Nessling, Michelle; Will, Rainer D
2002-01-01
Drug resistance of tumor cells leads to major drawbacks in the treatment of cancer. To identify candidate genes for drug resistance, we compared the expression patterns of the drug-sensitive human malignant melanoma cell line MeWo and three derived sublines with acquired resistance to the DNA...... as several apoptosis-related genes, in particular STK17A and CRYAB. As MPP1 and CRYAB are also among the 14 genes differentially expressed in all three of the drug-resistant sublines, they represent the strongest candidates for resistance against DNA-damaging drugs....
Erythromycin-resistant genes in group A β-haemolytic Streptococci in Chengdu, Southwestern China
Directory of Open Access Journals (Sweden)
W Zhou
2014-01-01
Full Text Available Context: The management of Group A β-haemolytic Streptococci (Streptococcus pyogenes or GAS infection include the use of penicillins, cephalosporins or macrolides for treatment. A general increase in macrolides resistance in GAS has been observed in recent years. Differences in rates of resistance to these agents have existed according to geographical location and investigators. Aims: To investigate the antibiotic pattern and erythromycin-resistant genes of GAS isolates associated with acute tonsillitis and scarlet fever in Chengdu, southwestern China. Settings and Design: To assess the macrolide resistance, phenotype, and genotypic characterization of GAS isolated from throat swabs of children suffering from different acute tonsillitis or scarlet fever between 2004 and 2011 in the city of Chengdu, located in the southwestern region of China. Materials and Methods: Minimal inhibitory concentration with seven antibiotics was performed on 127 GAS isolates. Resistance phenotypes of erythromycin-resistant GAS isolates were determined by the double-disk test. Their macrolide-resistant genes (mefA, ermB and ermTR were amplified by PCR. Results: A total of 98.4% (125/127 of the isolates exhibited resistance to erythromycin, clindamycin and tetracycline. All isolates were sensitive to penicillin G and cefotaxime. Moreover, 113 ermB-positive isolates demonstrating the cMLS phenotype of erythromycin resistance were predominant (90.4% and these isolates showed high-level resistance to both erythromycin and clindamycin (MIC 90 > 256 μg/ml; 12 (9.6% isolates demonstrating the MLS phenotype of erythromycin resistance carried the mefA gene, which showed low-level resistance to both erythromycin (MIC 90 = 8 μg/ml and clindamycin (MIC 90 = 0.5 μg/ml; and none of the isolates exhibited the M phenotype. Conclusions: The main phenotype is cMLS, and the ermB gene code is the main resistance mechanism against macrolides in GAS. Penicillin is the most beneficial
Directory of Open Access Journals (Sweden)
Vineeth Rajan
2014-01-01
Full Text Available Background & objectives: Linezolid, a member of the oxazolidinone class of antibiotics, has been an effective therapeutic option to treat severe infections caused by multidrug resistant Gram positive bacteria. Emergence of linezolid resistant clinical strains is a serious issue in the healthcare settings worldwide. We report here the molecular characterization of a linezolid resistant clinical isolate of Staphylococcus haemolyticus from India. Methods: The species of the clinical isolate was identified by 16S rRNA gene sequencing. The minimum inhibitory concentrations (MICs of linezolid, clindamycin, chloramphenicol and oxacillin were determined by E-test method. To elucidate the mechanism of linezolid-resistance, presence of cfr gene (chloramphenicol florfenicol resistance and mutations in 23S rRNA and ribosomal proteins (L3, L4 and L22 were investigated. Staphylococcal Cassette Chromosome mec (SCCmec typing was performed by multiplex PCR. Results: The study documented a rare clinical S. haemolyticus strain with three independent mechanisms of linezolid-resistance. The strain carried cfr gene, the only known transmissible mechanism of linezolid-resistance. The strain also possessed resistance-conferring mutations such as G 2576 T in domain V of 23S rRNA gene and Met 156 Thr in L3 ribosomal protein. The other ribosomal proteins (L4 and L22 did not exhibit mutations accountable for linezolid-resistance. Restriction digestion by NheI revealed that all the alleles of 23S rRNA gene were mutated. The isolate showed elevated MIC values (>256 ΅g ml -[1] of linezolid, clindamycin, chloramphenicol and oxacillin. Methicillin resistance was conferred by type I SCCmec element. The strain also harboured lsa(B gene which encodes an ABC transporter that can efflux clindamycin. Interpretation & conclusions: The present study reports the first clinical strain from India with transmissible and multiple mechanisms of linezolid-resistance. Judicious use of
Variation in the MC4R gene is associated with bone phenotypes in elderly Swedish women.
Directory of Open Access Journals (Sweden)
Gaurav Garg
Full Text Available Osteoporosis is characterized by reduced bone mineral density (BMD and increased fracture risk. Fat mass is a determinant of bone strength and both phenotypes have a strong genetic component. In this study, we examined the association between obesity associated polymorphisms (SNPs with body composition, BMD, Ultrasound (QUS, fracture and biomarkers (Homocysteine (Hcy, folate, Vitamin D and Vitamin B12 for obesity and osteoporosis. Five common variants: rs17782313 and rs1770633 (melanocortin 4 receptor (MC4R; rs7566605 (insulin induced gene 2 (INSIG2; rs9939609 and rs1121980 (fat mass and obesity associated (FTO were genotyped in 2 cohorts of Swedish women: PEAK-25 (age 25, n = 1061 and OPRA (age 75, n = 1044. Body mass index (BMI, total body fat and lean mass were strongly positively correlated with QUS and BMD in both cohorts (r(2 = 0.2-0.6. MC4R rs17782313 was associated with QUS in the OPRA cohort and individuals with the minor C-allele had higher values compared to T-allele homozygotes (TT vs. CT vs.100 vs. 103 vs. 103; p = 0.002; (SOS: 1521 vs. 1526 vs. 1524; p = 0.008; (Stiffness index: 69 vs. 73 vs. 74; p = 0.0006 after adjustment for confounders. They also had low folate (18 vs. 17 vs. 16; p = 0.03 and vitamin D (93 vs. 91 vs. 90; p = 0.03 and high Hcy levels (13.7 vs 14.4 vs. 14.5; p = 0.06. Fracture incidence was lower among women with the C-allele, (52% vs. 58%; p = 0.067. Variation in MC4R was not associated with BMD or body composition in either OPRA or PEAK-25. SNPs close to FTO and INSIG2 were not associated with any bone phenotypes in either cohort and FTO SNPs were only associated with body composition in PEAK-25 (p≤0.001. Our results suggest that genetic variation close to MC4R is associated with quantitative ultrasound and risk of fracture.
Genetic variation at Exon2 of TLR4 gene and its association with ...
African Journals Online (AJOL)
This study was conducted to analyze the polymorphisms of chicken Toll-like receptors 4(TLR4) gene and aimed to provide a theoretical foundation for a further research on correlation between chicken TLR4 gene and disease resistance. Genetic variations at exon 2 of TLR4 gene in 14 chicken breeds and the red jungle ...
Study of rNIS as a reporter gene monitoring rBMSC transplanted to rat myocardium
International Nuclear Information System (INIS)
Hu Shou; Lan Xiaoli; Cao Wei; Cao Guoxiang; Zhang Guopeng; Zhang Binqing; Wu Tao; Chang Wei; Zhang Yongxue
2010-01-01
Objective: To investigate the feasibility of rat sodium/iodide symporter (rNIS) as a reporter gene monitoring rat bone marrow mesenchymal cells (rBMSC) transplanted to rat myocardium in vivo. Methods: Recombinated adenovirus vector was constructed by rNIS/enhanced green fluorescence protein (EGFP) (Ad-rNIS/EGFP). rBMSC transfected by Ad-rNIS/EGFP were studied using fluorescence microscope. Fifteen rats were transplanted with rBMSC and randomly divided into three groups: rNIS group (with rNIS transfection), blocked group (with rNIS transfection) by oral intake of perchloric sodium before planar imaging (GE Millennium MPR SPECT), and control group (without rNIS transfection). All rats underwent 99 Tc m -pertechnetate planar imaging. The biological distribution of 99 Tc m -pertechnetate was studied. The expressions of rNIS gene and protein in myocardium were measured by real time polymerase chain reaction (PCR) and western blot, respectively. The expressions of CD 29 , CD 44 , CD 90 , CD 11 b, CD 34 and CD 45 were measured by immunohistochemistry. Results: rBMSC transfected by Ad-rNIS/EGFP showed EGFP expression under fluorescence microscope. The transplanted rat myocardium could be visualized on 99 Tc m -pertechnetate planar imaging in rNIS group. The relative uptake ratio (R heart /R hmb , RUR) was 6.7 ±0.4. RUR in control group (3.0 ±0.2) was lower than that in rNIS group (t =2.78, P=0.03). The percentage injection dose per gram of tissue (% ID/g) of the transplanted myocardium was 60.2 ± 20.8 in rNIS group, which was higher than that (2.5 ± 0.4) % ID/g of control group ( t = 7.13, P 29 , CD 44 and CD 90 were positive, CD 45 and CD 45 negative CD 11 b mildly positive in the myocardium transplanted with infective rBMSC. Conclusion: rNIS can efficiently monitor rBMSC transplanted to rat myocardium. (authors)
Kalajdzic, Predrag; Markaki, Maria; Oehler, Stefan; Savakis, Charalambos
2013-10-01
Certain xenobiotics have the capacity to induce the expression of genes involved in various biological phenomena, including insecticide resistance. The induction potential of different chemicals, among them different insecticides, has been documented for a number of insect species. In this study, we have analyzed the induction potential of Imidacloprid, a widely used member of the neonicotinoid insecticide family. Genes Cyp6g1 and Cyp6a2, known to be involved in the resistance of mutant Drosophila melanogaster line MiT[W⁻]3R2 to Imidacloprid and DDT were included in the analyzed sample. We find that Imidacloprid does not induce expression of the analyzed genes. Copyright © 2013 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Marlon López
2015-09-01
Full Text Available Potato Genebank of the Universidad Austral de Chile (UACh is an important gene bank in Chile. The accessions collected all over the country possess high genetic diversity, present interesting agronomic and cooking traits, and show resistance to biotic and abiotic stress. A particularly interesting subgroup of the gene bank includes the accessions collected in the South of Chile, the Chilota Potato Genebank. The focus of this study is the identification of virus and nematode resistant genes in potatoes (Solatium tuberosum L., using the RYSC3 and YES3-3B molecular markers. The Potato virus Y(PVY resistance genes Ry adg and Ry sto were identified. Furthermore, the CP60 marker was used to assess the Rx resistance gene that confers resistance to Potato virus X (PVX. In addition, the HC and GRO1-4 markers were utilized to identify the GpaVvrn_QTL and Gro1-4, resistance genes of Globodera pallida and Globodera rostochiensis, respectively. Both G. pallida and G. rostochiensis are Potato Cyst Nematodes (PCN. The plant material used in this study included leaves from 271 accessions of the gene bank. These samples were collected in the field where natural pathogen pressure of potential viruses and diseases exists. ELISA assays were run for field detection of PVY and PVX. However, there have been no previous reports of nematode presence in the plant material. The results herein presented indicate presence of virus and nematode resistance genes in accessions of the Chilota Potato Genebank. In terms of virus resistance, 99 accessions out of the 271 tested possess the Ry adg resistance gene and 17 accessions of these 271 tested have the Ry sto resistance gene. Also, 10 accessions showed positive amplification of the Rxl resistant gene marker. As to nematode resistance, 99 accessions have possible resistance to G. pallida and 54 accessions show potential resistance to G. rostochiensis as detected using the available molecular markers.
Directory of Open Access Journals (Sweden)
Yuichiro Iida
Full Text Available Leaf mold of tomato is caused by the biotrophic fungus Cladosporium fulvum which complies with the gene-for-gene system. The disease was first reported in Japan in the 1920s and has since been frequently observed. Initially only race 0 isolates were reported, but since the consecutive introduction of resistance genes Cf-2, Cf-4, Cf-5 and Cf-9 new races have evolved. Here we first determined the virulence spectrum of 133 C. fulvum isolates collected from 22 prefectures in Japan, and subsequently sequenced the avirulence (Avr genes Avr2, Avr4, Avr4E, Avr5 and Avr9 to determine the molecular basis of overcoming Cf genes. Twelve races of C. fulvum with a different virulence spectrum were identified, of which races 9, 2.9, 4.9, 4.5.9 and 4.9.11 occur only in Japan. The Avr genes in many of these races contain unique mutations not observed in races identified elsewhere in the world including (i frameshift mutations and (ii transposon insertions in Avr2, (iii point mutations in Avr4 and Avr4E, and (iv deletions of Avr4E, Avr5 and Avr9. New races have developed by selection pressure imposed by consecutive introductions of Cf-2, Cf-4, Cf-5 and Cf-9 genes in commercially grown tomato cultivars. Our study shows that molecular variations to adapt to different Cf genes in an isolated C. fulvum population in Japan are novel but overall follow similar patterns as those observed in populations from other parts of the world. Implications for breeding of more durable C. fulvum resistant varieties are discussed.
Antimicrobial resistance and virulence genes in enterococci from wild game meat in Spain.
Guerrero-Ramos, Emilia; Cordero, Jorge; Molina-González, Diana; Poeta, Patrícia; Igrejas, Gilberto; Alonso-Calleja, Carlos; Capita, Rosa
2016-02-01
A total of 55 enterococci (45 Enterococcus faecium, 7 Enterococcus faecalis, and three Enterococcus durans) isolated from the meat of wild game animals (roe deer, boar, rabbit, pheasant, and pigeon) in North-Western Spain were tested for susceptibility to 14 antimicrobials by the disc diffusion method. All strains showed a multi-resistant phenotype (resistance to between three and 10 antimicrobials). The strains exhibited high percentages of resistance to erythromycin (89.1%), tetracycline (67.3%), ciprofloxacin (92.7%), nitrofurantoin (67.3%), and quinupristin-dalfopristin (81.8%). The lowest values (9.1%) were observed for high-level resistance to gentamicin, kanamycin, and streptomycin. The average number of resistances per strain was 5.8 for E. faecium isolates, 7.9 for E. faecalis, and 5.7 for E. durans. Genes encoding antimicrobial resistance and virulence were studied by polymerase chain reaction. A total of 15 (57.7%) of the 26 vancomycin-resistant isolates harboured the vanA gene. Other resistance genes detected included vanB, erm(B) and/or erm(C), tet(L) and/or tet(M), acc(6')-aph(2″), and aph(3')-IIIa in strains resistant to vancomycin, erythromycin, tetracycline, gentamicin, and kanamycin, respectively. Specific genes of the Tn5397 transposon were detected in 54.8% of the tet(M)-positive enterococci. Nine virulence factors (gelE, agg, ace, cpd, frs, esp, hyl, efaAfs and efaAfm) were studied. All virulence genes, with the exception of the frs gene, were found to be present in the enterococcal isolates. At least one virulence gene was detected in 20.0% of E. faecium, 71.4% of E. faecalis and 33.3% of E. durans isolates, with ace and cpd being the most frequently detected genes (6 isolates each). This suggests that wild game meat might play a role in the spreading through the food chain of enterococci with antimicrobial resistance and virulence determinants to humans. Copyright © 2015 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Mailis Laht
Full Text Available Antibiotics and antibiotic resistant bacteria enter wastewater treatment plants (WWTPs, an environment where resistance genes can potentially spread and exchange between microbes. Several antibiotic resistance genes (ARGs were quantified using qPCR in three WWTPs of decreasing capacity located in Helsinki, Tallinn, and Tartu, respectively: sulphonamide resistance genes (sul1 and sul2, tetracycline resistance genes (tetM and tetC, and resistance genes for extended spectrum beta-lactams (blaoxa-58, blashv-34, and blactx-m-32. To avoid inconsistencies among qPCR assays we normalised the ARG abundances with 16S rRNA gene abundances while assessing if the respective genes increased or decreased during treatment. ARGs were detected in most samples; sul1, sul2, and tetM were detected in all samples. Statistically significant differences (adjusted p<0.01 between the inflow and effluent were detected in only four cases. Effluent values for blaoxa-58 and tetC decreased in the two larger plants while tetM decreased in the medium-sized plant. Only blashv-34 increased in the effluent from the medium-sized plant. In all other cases the purification process caused no significant change in the relative abundance of resistance genes, while the raw abundances fell by several orders of magnitude. Standard water quality variables (biological oxygen demand, total phosphorus and nitrogen, etc. were weakly related or unrelated to the relative abundance of resistance genes. Based on our results we conclude that there is neither considerable enrichment nor purification of antibiotic resistance genes in studied conventional WWTPs.
Directory of Open Access Journals (Sweden)
Tan Wenbin
2011-11-01
Full Text Available Abstract Background Insecticide resistance jeopardizes the control of mosquito populations and mosquito-borne disease control, which creates a major public health concern. Two-dimensional electrophoresis identified one protein segment with high sequence homology to part of Aedes aegypti iron-responsive element binding protein (IRE-BP. Method RT-PCR and RACE (rapid amplification of cDNA end were used to clone a cDNA encoding full length IRE-BP 1. Real-time quantitative RT-PCR was used to evaluate the transcriptional level changes in the Cr-IRE strain Aedes aegypti compared to the susceptible strain of Cx. pipiens pallens. The expression profile of the gene was established in the mosquito life cycle. Methyl tritiated thymidine (3H-TdR was used to observe the cypermethrin resistance changes in C6/36 cells containing the stably transfected IRE-BP 1 gene of Cx. pipiens pallens. Results The complete sequence of iron responsive element binding protein 1 (IRE-BP 1 has been cloned from the cypermethrin-resistant strain of Culex pipiens pallens (Cr-IRE strain. Quantitative RT-PCR analysis indicated that the IRE-BP 1 transcription level was 6.7 times higher in the Cr-IRE strain than in the susceptible strain of 4th instar larvae. The IRE-BP 1 expression was also found to be consistently higher throughout the life cycle of the Cr-IRE strain. A protein of predicted size 109.4 kDa has been detected by Western blotting in IRE-BP 1-transfected mosquito C6/36 cells. These IRE-BP 1-transfected cells also showed enhanced cypermethrin resistance compared to null-transfected or plasmid vector-transfected cells as determined by 3H-TdR incorporation. Conclusion IRE-BP 1 is expressed at higher levels in the Cr-IRE strain, and may confer some insecticide resistance in Cx. pipiens pallens.
Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants
Energy Technology Data Exchange (ETDEWEB)
Somerville, Chris R.; Scieble, Wolf
2000-10-11
Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.
Rice blast is a recurring and devastating disease in the USA and worldwide. In the USA, the blast-resistance (R) genes found in a tropical japonica cultivar, Katy, reduce blast damages from 1990 to present. The cultivar is still used as a principal donor of blast R genes in developing numerous elit...
Yu, Dan-Dan; Wu, Ying; Zhang, Xiao-Hui; Lv, Meng-Meng; Chen, Wei-Xian; Chen, Xiu; Yang, Su-Jin; Shen, Hongyu; Zhong, Shan-Liang; Tang, Jin-Hai; Zhao, Jian-Hua
2016-03-01
Breast cancer (BCa) is one of the major deadly cancers in women. However, treatment of BCa is still hindered by the acquired-drug resistance. It is increasingly reported that exosomes take part in the development, metastasis, and drug resistance of BCa. However, the specific role of exosomes in drug resistance of BCa is poorly understood. In this study, we investigate whether exosomes transmit drug resistance through delivering miR-222. We established an adriamycin-resistant variant of Michigan Cancer Foundation-7 (MCF-7) breast cancer cell line (MCF-7/Adr) from a drug-sensitive variant (MCF-7/S). Exosomes were isolated from cell supernatant by ultracentrifugation. Cell viability was assessed by MTT assay and apoptosis assay. Individual miR-222 molecules in BCa cells were detected by fluorescence in situ hybridization (FISH). Then, FISH was combined with locked nucleic acid probes and enzyme-labeled fluorescence (LNA-ELF-FISH). Individual miR-222 could be detected as bright photostable fluorescent spots and then the quantity of miR-222 per cell could be counted. Stained exosomes were taken in by the receipt cells. MCF-7/S acquired drug resistance after co-culture with exosomes from MCF-7/Adr (A/exo) but did not after co-culture with exosomes from MCF-7/S (S/exo). The quantity of miR-222 in A/exo-treated MCF-7/S was significantly greater than in S/exo-treated MCF-7/S. MCF-7/S transfected with miR-222 mimics acquired adriamycin resistance while MCF-7/S transfected with miR-222 inhibitors lost resistance. In conclusion, exosomes are effective in transmitting drug resistance and the delivery of miR-222 via exosomes may be a mechanism.
Hsam, Sai L K; Mohler, Volker; Zeller, Friedrich J
2014-05-01
The genetics of resistance to powdery mildew caused by Blumeria graminis f. sp. avenae of four cultivated oats was studied using monosomic analysis. Cultivar 'Bruno' carries a gene (Pm6) that shows a recessive mode of inheritance and is located on chromosome 10D. Cultivar 'Jumbo' possesses a dominant resistance gene (Pm1) on chromosome 1C. In cultivar 'Rollo', in addition to the gene Pm3 on chromosome 17A, a second dominant resistance gene (Pm8) was identified and assigned to chromosome 4C. In breeding line APR 122, resistance was conditioned by a dominant resistance gene (Pm7) that was allocated to chromosome 13A. Genetic maps established for resistance genes Pm1, Pm6 and Pm7 employing amplified fragment length polymorphism (AFLP) markers indicated that these genes are independent of each other, supporting the results from monosomic analysis.
Directory of Open Access Journals (Sweden)
Ghassan Khudhair Ismaeel
2017-07-01
Full Text Available None response to the treatment by an antibiotic called antibiotics resistance result from some genes called resistance genes .This mechanism is widespread in most of the bacteria, like E.coli . All of the extended resistance genes called (ESBIS is a typical example for study of some genes that resistance beta-lactam antibiotic is subject of this research. Fifty feces sample were collected from cattle suffering from diarrhea in alqaissiyah city were cultured on selective media for E.coli , then DNA was extracted from all E.coli isolates for antibiotic resistance gene detection by PCR ; The results of this study revealed the prevalence of B-lactamase gene four B-lactamases genes in E.coli blaAmpc gene were (91.4%, the blactx-m gene were (80%, blaTem were (62.8% and finally and blaSHV gene were (22% among isolates E.coli ; blaAMPC gene has high prevalence than others genes while blaSHV was a lower percentage than other genes
The expression of antibiotic resistance genes in antibiotic-producing bacteria.
Mak, Stefanie; Xu, Ye; Nodwell, Justin R
2014-08-01
Antibiotic-producing bacteria encode antibiotic resistance genes that protect them from the biologically active molecules that they produce. The expression of these genes needs to occur in a timely manner: either in advance of or concomitantly with biosynthesis. It appears that there have been at least two general solutions to this problem. In many cases, the expression of resistance genes is tightly linked to that of antibiotic biosynthetic genes. In others, the resistance genes can be induced by their cognate antibiotics or by intermediate molecules from their biosynthetic pathways. The regulatory mechanisms that couple resistance to antibiotic biosynthesis are mechanistically diverse and potentially relevant to the origins of clinical antibiotic resistance. © 2014 John Wiley & Sons Ltd.
Qi, L L; Long, Y M; Jan, C C; Ma, G J; Gulya, T J
2015-04-01
Pl 17, a novel downy mildew resistance gene independent of known downy mildew resistance genes in sunflowers, was genetically mapped to linkage group 4 of the sunflower genome. Downy mildew (DM), caused by Plasmopara halstedii (Farl.). Berl. et de Toni, is one of the serious sunflower diseases in the world due to its high virulence and the variability of the pathogen. DM resistance in the USDA inbred line, HA 458, has been shown to be effective against all virulent races of P. halstedii currently identified in the USA. To determine the chromosomal location of this resistance, 186 F 2:3 families derived from a cross of HA 458 with HA 234 were phenotyped for their resistance to race 734 of P. halstedii. The segregation ratio of the population supported that the resistance was controlled by a single dominant gene, Pl 17. Simple sequence repeat (SSR) and single nucleotide polymorphism (SNP) primers were used to identify molecular markers linked to Pl 17. Bulked segregant analysis using 849 SSR markers located Pl 17 to linkage group (LG) 4, which is the first DM gene discovered in this linkage group. An F2 population of 186 individuals was screened with polymorphic SSR and SNP primers from LG4. Two flanking markers, SNP SFW04052 and SSR ORS963, delineated Pl 17 in an interval of 3.0 cM. The markers linked to Pl 17 were validated in a BC3 population. A search for the physical location of flanking markers in sunflower genome sequences revealed that the Pl 17 region had a recombination frequency of 0.59 Mb/cM, which was a fourfold higher recombination rate relative to the genomic average. This region can be considered amenable to molecular manipulation for further map-based cloning of Pl 17.
Liu, Jingjing; Zhang, Di; Kimata, Jason T.; Zhou, Paul
2014-01-01
CCR5, a coreceptor for HIV-1 entry, is a major target for drug and genetic intervention against HIV-1. Genetic intervention strategies have knocked down CCR5 expression levels by shRNA or disrupted the CCR5 gene using zinc finger nucleases (ZFN) or Transcription activator-like effector nuclease (TALEN). In the present study, we silenced CCR5 via CRISPR associated protein 9 (Cas9) and single guided RNAs (sgRNAs). We constructed lentiviral vectors expressing Cas9 and CCR5 sgRNAs. We show that a single round transduction of lentiviral vectors expressing Cas9 and CCR5 sgRNAs into HIV-1 susceptible human CD4+ cells yields high frequencies of CCR5 gene disruption. CCR5 gene-disrupted cells are not only resistant to R5-tropic HIV-1, including transmitted/founder (T/F) HIV-1 isolates, but also have selective advantage over CCR5 gene-undisrupted cells during R5-tropic HIV-1 infection. Importantly, using T7 endonuclease I assay we did not detect genome mutations at potential off-target sites that are highly homologous to these CCR5 sgRNAs in stably transduced cells even at 84 days post transduction. Thus we conclude that silencing of CCR5 via Cas9 and CCR5-specific sgRNAs could be a viable alternative strategy for engineering resistance against HIV-1. PMID:25541967
Molecular Scree ning of Blast Resistance Genes in Rice Germplasms Resistant to Magnaporthe oryzae
Directory of Open Access Journals (Sweden)
Liang Yan
2017-01-01
Full Text Available Molecular screening of major rice blast resistance genes was determined with molecular markers, which showed close-set linkage to 11 major rice blast resistance genes (Pi-d2, Pi-z, Piz-t, Pi-9, Pi-36, Pi-37, Pi5, Pi-b, Pik-p, Pik-h and Pi-ta2, in a collection of 32 accessions resistant to Magnaporthe oryzae. Out of the 32 accessions, the Pi-d2 and Pi-z appeared to be omnipresent and gave positive express. As the second dominant, Pi-b and Piz-t gene frequencies were 96.9% and 87.5%. And Pik-h and Pik-p gene frequencies were 43.8% and 28.1%, respectively. The molecular marker linkage to Pi-ta2 produced positive bands in eleven accessions, while the molecular marker linkage to Pi-36 and Pi-37 in only three and four accessions, respectively. The natural field evaluation analysis showed that 30 of the 32 accessions were resistant, one was moderately resistant and one was susceptible. Infection types were negatively correlated with the genotype scores of Pi-9, Pi5, Pi-b, Pi-ta2 and Pik-p, although the correlation coefficients were very little. These results are useful in identification and incorporation of functional resistance genes from these germplasms into elite cultivars through marker-assisted selection for improved blast resistance in China and worldwide.
Marathe, Nachiket P; Pal, Chandan; Gaikwad, Swapnil S; Jonsson, Viktor; Kristiansson, Erik; Larsson, D G Joakim
2017-11-01
Efficient sewage treatment is critical for limiting environmental transmission of antibiotic-resistant bacteria. In many low and middle income countries, however, large proportions of sewage are still released untreated into receiving water bodies. In-depth knowledge of how such discharges of untreated urban waste influences the environmental resistome is largely lacking. Here, we highlight the impact of uncontrolled discharge of partially treated and/or untreated wastewater on the structure of bacterial communities and resistome of sediments collected from Mutha river flowing through Pune city in India. Using shotgun metagenomics, we found a wide array (n = 175) of horizontally transferable antibiotic resistance genes (ARGs) including carbapenemases such as NDM, VIM, KPC, OXA-48 and IMP types. The relative abundance of total ARGs was 30-fold higher in river sediments within the city compared to upstream sites. Forty four ARGs, including the tet(X) gene conferring resistance to tigecycline, OXA-58 and GES type carbapenemases, were significantly more abundant in city sediments, while two ARGs were more common at upstream sites. The recently identified mobile colistin resistance gene mcr-1 was detected only in one of the upstream samples, but not in city samples. In addition to ARGs, higher abundances of various mobile genetic elements were found in city samples, including integron-associated integrases and ISCR transposases, as well as some biocide/metal resistance genes. Virulence toxin genes as well as bacterial genera comprising many pathogens were more abundant here; the genus Acinetobacter, which is often associated with multidrug resistance and nosocomial infections, comprised up to 29% of the 16S rRNA reads, which to our best knowledge is unmatched in any other deeply sequenced metagenome. There was a strong correlation between the abundance of Acinetobacter and the OXA-58 carbapenemase gene. Our study shows that uncontrolled discharge of untreated urban
Adelowo, Olawale O; Fagade, Obasola E; Agersø, Yvonne
2014-09-12
This study investigated the mechanisms of resistance in 36 E. coli isolated from waste, litter, soil and water samples collected from poultry farms in Southwestern Nigeria. Minimum inhibitory concentration (MIC) distributions of the isolates were determined using the methods of the Clinical and Laboratory Standard Institute and resistance genes detected by PCR. A total of 30 isolates (94%) showed resistance to more than one antimicrobial. Percentage resistance was: tetracycline 81%, sulphamethoxazole 67%, streptomycin 56%, trimethoprim 47 %, ciprofloxacin 42%, ampicillin 36%, spectinomycin 28%, nalidixic acid 25%, chloramphenicol 22%, neomycin 14%, gentamicin 8%, amoxicillin-clavulanate, ceftiofur, cefotaxime, colistin, florfenicol and apramycin 0%. Resistance genes found among the isolates include bla-TEM (85%), sul2 (67%), sul3 (17%), aadA (65%), strA (70%), strB (61%), catA1 (25%), cmlA1 (13%), tetA (21%) and tetB (17%). Class 1 and 2 integrons were found in five (14%) and six (17%) isolates, respectively, while one isolate was positive for both classes of integrons. Seven out of eight isolates with resistance to ciprofloxacin and MIC ≤ 32 mg/L to nalidixic acid contained qnrS genes. Our findings provided additional evidence that the poultry production environment in Nigeria represents an important reservoir of antibiotic resistance genes such as qnrS that may spread from livestock production farms to human populations via manure and water.
PKC-alpha modulation by miR-483-3p in platinum-resistant ovarian carcinoma cells
Energy Technology Data Exchange (ETDEWEB)
Arrighetti, Noemi, E-mail: Noemi.Arrighetti@istitutotumori.mi.it [Molecular Pharmacology Unit, Fondazione IRCCS Istituto Nazionale dei Tumori, via Amadeo 42, Milan 20133 (Italy); Cossa, Giacomo, E-mail: Gia.Cossa@gmail.com [Molecular Pharmacology Unit, Fondazione IRCCS Istituto Nazionale dei Tumori, via Amadeo 42, Milan 20133 (Italy); De Cecco, Loris, E-mail: Loris.Dececco@istitutotumori.mi.it [Functional Genomics and Bioinformatics, Fondazione IRCCS Istituto Nazionale dei Tumori, via Amadeo 42, Milan 20133 (Italy); Stucchi, Simone, E-mail: Simone.Stucchi@istitutotumori.mi.it [Molecular Pharmacology Unit, Fondazione IRCCS Istituto Nazionale dei Tumori, via Amadeo 42, Milan 20133 (Italy); Carenini, Nives, E-mail: Nives.Carenini@istitutotumori.mi.it [Molecular Pharmacology Unit, Fondazione IRCCS Istituto Nazionale dei Tumori, via Amadeo 42, Milan 20133 (Italy); Corna, Elisabetta, E-mail: Elisabetta.Corna@istitutotumori.mi.it [Molecular Pharmacology Unit, Fondazione IRCCS Istituto Nazionale dei Tumori, via Amadeo 42, Milan 20133 (Italy); Gandellini, Paolo, E-mail: Paolo.Gandellini@istitutotumori.mi.it [Molecular Pharmacology Unit, Fondazione IRCCS Istituto Nazionale dei Tumori, via Amadeo 42, Milan 20133 (Italy); Zaffaroni, Nadia, E-mail: Nadia.Zaffaroni@istitutotumori.mi.it [Molecular Pharmacology Unit, Fondazione IRCCS Istituto Nazionale dei Tumori, via Amadeo 42, Milan 20133 (Italy); Perego, Paola, E-mail: paola.perego@istitutotumori.mi.it [Molecular Pharmacology Unit, Fondazione IRCCS Istituto Nazionale dei Tumori, via Amadeo 42, Milan 20133 (Italy); Gatti, Laura, E-mail: Laura.Gatti@istitutotumori.mi.it [Molecular Pharmacology Unit, Fondazione IRCCS Istituto Nazionale dei Tumori, via Amadeo 42, Milan 20133 (Italy)
2016-11-01
The occurrence of drug resistance limits the efficacy of platinum compounds in the cure of ovarian carcinoma. Since microRNAs (miRNAs) may contribute to this phenomenon by regulating different aspects of tumor cell response, the aim of this study was to exploit the analysis of expression of miRNAs in platinum sensitive/resistant cells in an attempt to identify potential regulators of drug response. MiR-483-3p, which may participate in apoptosis and cell proliferation regulation, was found up-regulated in 4 platinum resistant variants, particularly in the IGROV-1/Pt1 subline, versus parental cells. Transfection of a synthetic precursor of miR-483-3p in IGROV-1 parental cells elicited a marked up-regulation of the miRNA levels. Growth-inhibition and colony-forming assays indicated that miR-483-3p over-expression reduced cell growth and conferred mild levels of cisplatin resistance in IGROV-1 cells, by interference with their proliferative potential. Predicted targets of miR-483-3p included PRKCA (encoding PKC-alpha), previously reported to be associated to platinum-resistance in ovarian carcinoma. We found that miR-483-3p directly targeted PRKCA in IGROV-1 cells. In keeping with this finding, cisplatin sensitivity of IGROV-1 cells decreased upon molecular/pharmacological inhibition of PKC-alpha. Overall, our results suggest that overexpression of miR-483-3p by ovarian carcinoma platinum-resistant cells may interfere with their proliferation, thus protecting them from DNA damage induced by platinum compounds and ultimately representing a drug-resistance mechanism. The impairment of cell growth may account for low levels of drug resistance that could be relevant in the clinical setting. - Highlights: • miR-483-3p is up-regulated in ovarian carcinoma cells resistant to platinum drugs. • Ectopic expression of miR-483-3p in IGROV-1 confers mild levels of Pt-resistance. • Overexpression of miR-483-3p down-regulates PRKCA levels in ovarian carcinoma cells. • miR 483
International Nuclear Information System (INIS)
Jing Zhao; Gong Ling; Xie Congying; Zhang Li; Su Huafang; Deng Xia; Wu Shixiu
2009-01-01
Background and purpose: The purpose of our study is to examine the capacity of cetuximab to reverse radiation resistance and investigate molecular mechanisms in human radiation-resistant esophageal carcinoma cell line KYSE-150R. Materials and methods: The radioresistant cell line KYSE-150R was established by using fractionated irradiation (FIR). The KYSE-150R cell line was exposed to radiation, treatment with cetuximab, and combined treatment. Cell cycle distribution and apoptosis were analyzed using flow cytometry. Radiation survival was analyzed using clonogenic assays. RT 2 profiler TM PCR array was performed to analyze EGF/PDGF signaling pathway genes. Results: The established esophageal carcinoma cell line KYSE-150R showed higher radioresistance than parental cell line. Cetuximab could reverse the radiation resistance of KYSE-150R cells. Cell cycle analysis showed that combination with radiation and cetuximab resulted in the accumulation of cells in G1 and G2/M phases, with the reduction of cells within the S phase. Cetuximab enhanced the apoptosis induced by radiation. RT 2 profiler TM array showed that some intracellular signaling genes deriving from EGF/PDGF signaling pathway regulated by cetuximab. Conclusions: Irradiation combined with EGFR blocked by cetuximab may reverse the resistance to radiation in radioresistant esophageal carcinoma cell. The mechanisms may include cell cycle perturbation and enhancement of radiation-induced apoptosis. Further studies are needed to evaluate the role of cetuximab in combination with radiotherapy in the management of esophageal carcinoma.
Directory of Open Access Journals (Sweden)
Rubens Monte-Neto
2015-02-01
Full Text Available Antimony resistance complicates the treatment of infections caused by the parasite Leishmania.Using next generation sequencing, we sequenced the genome of four independent Leishmania guyanensis antimony-resistant (SbR mutants and found different chromosomal alterations including aneuploidy, intrachromosomal gene amplification and gene deletion. A segment covering 30 genes on chromosome 19 was amplified intrachromosomally in three of the four mutants. The gene coding for the multidrug resistance associated protein A involved in antimony resistance was also amplified in the four mutants, most likely through chromosomal translocation. All mutants also displayed a reduced accumulation of antimony mainly due to genomic alterations at the level of the subtelomeric region of chromosome 31 harboring the gene coding for the aquaglyceroporin 1 (LgAQP1. Resistance involved the loss of LgAQP1 through subtelomeric deletions in three mutants. Interestingly, the fourth mutant harbored a single G133D point mutation in LgAQP1 whose role in resistance was functionality confirmed through drug sensitivity and antimony accumulation assays. In contrast to the Leishmania subspecies that resort to extrachromosomal amplification, the Viannia strains studied here used intrachromosomal amplification and locus deletion.This is the first report of a naturally occurred point mutation in AQP1 in antimony resistant parasites.
Detection of genetic mutations associated with macrolide resistance of Mycoplasma pneumoniae
Directory of Open Access Journals (Sweden)
Chi Eun Oh
2010-02-01
Full Text Available Purpose : The aim of this study was to identify mutations associated with macrolide resistance in Mycoplasma pneumoniae (MP and to establish a cultural method to determine antimicrobial susceptibility. Methods : Nasopharyngeal aspirates (NPAs were collected from 62 children diagnosed with MP pneumonia by a serologic method or polymerase chain reaction. The 23S rRNA and L4 ribosomal protein genes of MP were amplified and sequenced. To identify mutations in these 2 genes, their nucleotide sequences were compared to those of the reference strain M129. MP cultivation was carried out for 32 (28 frozen and 5 refrigerated NPAs and M129 strain using Chanock’s glucose broth and agar plate in a 5% CO2 incubator at 37?#608;and examined at 2-3 day intervals for 6 weeks. Results : Among the 62 specimens, 17 had M144V mutations in ribosomal protein L4. The A2064G mutation was observed in 1 specimen; its 23S rRNA gene was successfully sequenced. Culture for MP was successful from the M129 strain and 2 of the 5 NPAs that were refrigerated for no longer than 3 days. However, MP did not grow from the 28 NPAs that were kept frozen at -80?#608;since 2003. Conclusion : We found the M144V mutation of L4 protein to be common and that of domain V of 23S rRNA gene was relatively rare among MP. Studies on the prevalence of macrolide-resistant MP and the relationship between the mutations of 23S rRNA gene and ribosomal protein L4 will aid in understanding the mechanism of macrolide resistance in MP.
Qu, L.; Li, Y.; Zhu, P.
2013-12-01
One hundred and thirty-five bacteria from maricultural environments were tested for sensitivity to tetracycline and sulfa. Result show that 72% of the bacteria were sulfa-resistant, 36% of the bacteria were tetracycline-resistant, and 16.5% of bacteria showed resistance to both tetracyclines and sulfa ,indicating that the proportion of sulfa and tetracycline resistance bacteria isvery large in the maricultural environments. PCR methods were used to detect if these resistant bacteria carry tetracycline and sulfa resistance genes. Out of the 33 tetracycline-resistant bacteria screened, 3 were positive for tetA, 6 were positive for tetB and no isolate wasboth positive for tetA and tetB. Of the 97 sulfa-resistant bacteria screened, 9 were positive for sul2, 6 were positive for sul1, 1 isolate was positive for bothsul1 and sul2. The minimum inhibitory concentration (MIC) of tetracycline for tetA-carrying isolates were higher than those tetB-carrying isolates.while The MIC of sulfa for sul2-carrying isolates were higher than those sul1-carrying isolates. Indicating that tetA and sul2 gene may play ubknown roles in resisting tetracycline and sulfa than tetB and sul1 genes. The results showed the 4 kinds of genes (tetA,tetB,sul1,sul2) has no host specificity. All these 16S sequence are from the isolates which are positive for the above genes, it indicated the above antibiotic resistance genes are widespread in the environment regardless of the host. While the DNA sequence of these four genes showed tetA, sul1, sul2 genes are conservative in different bacteria , etB gene conserved poorly. The research aim is to get a preliminary understanding of resistance mechanism related to the resistant bacteria and the resistance genes in marine aquaculture environment through the analysis of resistant genes, providing research base for the prevention and treatment of drug-resistant bacteria so as to reduce the threat to the ecological environment, aquaculture and human health.
Mutation spectrum of genes associated with steroid-resistant nephrotic syndrome in Chinese children.
Wang, Ying; Dang, Xiqiang; He, Qingnan; Zhen, Yan; He, Xiaoxie; Yi, Zhuwen; Zhu, Kuichun
2017-08-20
Approximately 20% of children with idiopathic nephrotic syndrome do not respond to steroid therapy. More than 30 genes have been identified as disease-causing genes for the steroid-resistant nephrotic syndrome (SRNS). Few reports were from the Chinese population. The coding regions of genes commonly associated with SRNS were analyzed to characterize the gene mutation spectrum in children with SRNS in central China. The first phase study involved 38 children with five genes (NPHS1, NPHS2, PLCE1, WT1, and TRPC6) by Sanger sequencing. The second phase study involved 33 children with 17 genes by next generation DNA sequencing (NGS. 22 new patients, and 11 patients from first phase study but without positive findings). Overall deleterious or putatively deleterious gene variants were identified in 19 patients (31.7%), including four NPHS1 variants among five patients and three PLCE1 variants among four other patients. Variants in COL4A3, COL4A4, or COL4A5 were found in six patients. Eight novel variants were identified, including two in NPHS1, two in PLCE1, one in NPHS2, LAMB2, COL4A3, and COL4A4, respectively. 55.6% of the children with variants failed to respond to immunosuppressive agent therapy, while the resistance rate in children without variants was 44.4%. Our results show that screening for deleterious variants in some common genes in children clinically suspected with SRNS might be helpful for disease diagnosis as well as prediction of treatment efficacy and prognosis. Copyright © 2017 Elsevier B.V. All rights reserved.
Lack of death receptor 4 (DR4) expression through gene promoter methylation in gastric carcinoma.
Lee, Kyung Hwa; Lim, Sang Woo; Kim, Ho Gun; Kim, Dong Yi; Ryu, Seong Yeob; Joo, Jae Kyun; Kim, Jung Chul; Lee, Jae Hyuk
2009-07-01
To determine the underlying mechanism for the differential expression, the extent of promoter methylation in tumor necrosis factor-related apoptosis-inducing ligand (TRAIL)-related genes acting downstream of TRAIL was examined in early and advanced gastric carcinomas. The extent of promoter methylation in the DR4, DR5, DcR1, DcR2, and CASP8 genes was quantified using bisulfite modification and methylation-specific polymerase chain reaction. The promoters for DcR1, DcR2, and CASP8 were largely unmethylated in early gastric carcinoma, advanced gastric carcinoma, and controls, with no significant difference among them. Protein levels of DR4, DcR1, and DcR2 as revealed by immunohistochemistry correlated with the extent of the respective promoter methylation (P < 0.05 in all cases). Hypomethylation, rather than hypermethylation, of the DR4 promoter was noted in invasive gastric malignancies, with statistical significance (P = 0.003). The promoter methylation status of TRAIL receptors in gastric carcinoma may have clinical implications for improving therapeutic strategies in patients with gastric carcinoma.
Identification and mapping of two powdery mildew resistance genes in Triticum boeoticum L.
Chhuneja, Parveen; Kumar, Krishan; Stirnweis, Daniel; Hurni, Severine; Keller, Beat; Dhaliwal, Harcharan S; Singh, Kuldeep
2012-04-01
Powdery mildew (PM) caused by Blumeria graminis f. sp. tritici (Bgt), is one of the important foliar diseases of wheat that can cause serious yield losses. Breeding for cultivars with diverse resources of resistance is the most promising approach for combating this disease. The diploid A genome progenitor species of wheat are an important resource for new variability for disease resistance genes. An accession of Triticum boeoticum (A(b)A(b)) showed resistance against a number of Bgt isolates, when tested using detached leaf segments. Inheritance studies in a recombinant inbred line population (RIL), developed from crosses of PM resistant T. boeoticum acc. pau5088 with a PM susceptible T. monococcum acc. pau14087, indicated the presence of two powdery mildew resistance genes in T. boeoticum acc. pau5088. Analysis of powdery mildew infection and molecular marker data of the RIL population revealed that both powdery mildew resistance genes are located on the long arm of chromosome 7A. Mapping was conducted using an integrated linkage map of 7A consisting of SSR, RFLP, STS, and DArT markers. These powdery mildew resistance genes are tentatively designated as PmTb7A.1 and PmTb7A.2. The PmTb7A.2 is closely linked to STS markers MAG2185 and MAG1759 derived from RFLP probes which are linked to powdery mildew resistance gene Pm1. This indicated that PmTb7A.2 might be allelic to Pm1. The PmTb7A.1, flanked by a DArT marker wPt4553 and an SSR marker Xcfa2019 in a 4.3 cM interval, maps proximal to PmT7A.2. PmTb7A.1 is putatively a new powdery mildew resistance gene. The powdery mildew resistance genes from T. boeoticum are currently being transferred to cultivated wheat background through marker-assisted backcrossing, using T. durum as bridging species.
Bakour, Sofiane; Alsharapy, Samer Ahmed; Touati, Abdelaziz; Rolain, Jean-Marc
2014-12-01
The aim of this study was to investigate the molecular support of resistance to carbapenems, aminoglycosides, and fluoroquinolones in Acinetobacter baumannii clinical isolates collected from Yemen hospital. Three A. baumannii were isolated in February 2013 from three patients hospitalized at Al-Thawra University Hospital in Sana'a, Yemen. Antibiotic susceptibility testing was performed using the disk diffusion and E-test methods. Carbapenemase production was carried out by the modified Hodge test (MHT) and imipenem-ethylenediaminetetraacetic acid (EDTA) methods. Carbapenem, aminoglycoside, and fluoroquinolone resistance determinants were studied by polymerase chain reaction and sequencing. The epidemiological relatedness of the three strains was studied using multilocus sequence typing (MLST). The isolates were resistant to almost all antibiotics tested with very high imipenem, amikacin, and ciprofloxacin minimum inhibitory concentrations (>32, >256, and >32 mg/L, respectively). The microbiological tests showed that the three A. baumannii were MHT positive, besides, the activity of β-lactamases was not inhibited by EDTA. All the three isolates contained the naturally occurring bla(OXA-51)-like gene and the bla(OXA-23)-like carbapenemase-encoding gene. The 16S rRNA methylase armA gene was detected in the three isolates. In addition, screening for genes encoding the aminoglycoside-modifying enzymes (AMEs) demonstrated that one isolate contained the acetyltransferase gene aac(6')-Ib. Fluoroquinolone resistance was associated with a single mutation Ser83Leu in the quinolone resistance determining region of the gyrA gene in all isolates. The MLST showed that the sequence type (ST) obtained corresponds to ST2 for the three strains. Here we report the first identification of multidrug-resistant A. baumannii isolates harboring the bla(OXA-23)-like gene, AMEs [aac(6')-Ib], and the 16S rRNA methylase (armA) in the Yemen hospital.
Pollen-Mediated Movement of Herbicide Resistance Genes in Lolium rigidum.
Directory of Open Access Journals (Sweden)
Iñigo Loureiro
Full Text Available The transfer of herbicide resistance genes by pollen is a major concern in cross-pollinated species such as annual ryegrass (Lolium rigidum. A two-year study was conducted in the greenhouse, under favorable conditions for pollination, to generate information on potential maximum cross-pollination. This maximum cross-pollination rate was 56.1%. A three-year field trial was also conducted to study the cross-pollination rates in terms of distance and orientation to an herbicide-resistant pollen source. Under field conditions, cross-pollination rates varied from 5.5% to 11.6% in plants adjacent to the pollen source and decreased with increasing distances (1.5 to 8.9% at 15 m distance and up to 4.1% at 25 m in the downwind direction. Environmental conditions influenced the cross-pollination both under greenhouse and field conditions. Data were fit to an exponential decay model to predict gene flow at increasing distances. This model predicted an average gene flow of 7.1% when the pollen donor and recipient plants were at 0 m distance from each other. Pollen-mediated gene flow declined by 50% at 16.7 m from the pollen source, yet under downwind conditions gene flow of 5.2% was predicted at 25 m, the farthest distance studied. Knowledge of cross-pollination rates will be useful for assessing the spread of herbicide resistance genes in L. rigidum and in developing appropriate strategies for its mitigation.
International Nuclear Information System (INIS)
Pelfrey, C.M.; Waxman, F.J.; Whitacre, C.C.
1989-01-01
Experimental autoimmune encephalomyelitis (EAE) is a cell-mediated autoimmune disease of the central nervous system that has been extensively studied in the rat. The Lewis rat is highly susceptible to the induction of EAE, while the Lewis resistant (LeR) rat is known to be resistant. In this paper, we demonstrate that the LeR rat, which was derived from the Lewis strain by inbreeding of fully resistant animals, is histocompatible with the Lewis strain. Radiation chimeras, a tool for distinguishing between immunologic and nonimmunologic resistance mechanisms, were utilized to analyze the cellular mechanisms involved in genetic resistance to EAE. By transplanting bone marrow cells from LeR rats into irradiated Lewis recipients, Lewis rats were rendered resistant to EAE induction. Likewise, transplanting Lewis bone marrow cells into irradiated LeR recipients rendered LeR rats susceptible. Mixed lymphoid cell chimeras using bone marrow, spleen, and thymus cells in Lewis recipient rats revealed individual lymphoid cell types and cell interactions that significantly affected the incidence and severity of EAE. Our results suggest that LeR resistance is mediated by hematopoietic/immune cells, and that cells located in the spleen appear to play a critical role in the resistance/susceptibility to EAE induction. Depletion of splenic adherent cells did not change the patterns of EAE resistance. In vivo cell mixing studies suggested the presence of a suppressor cell population in the LeR spleen preparations which exerted an inhibitory effect on Lewis autoimmune responses. Thus, the mechanism of LeR resistance appears to be different from that in other EAE-resistant animals
Dopamine genes (DRD2/ANKK1-TaqA1 and DRD4-7R and executive function: their interaction with obesity.
Directory of Open Access Journals (Sweden)
Mar Ariza
Full Text Available Obesity is a multifactorial disease caused by the interaction between genotype and environment, and it is considered to be a type of addictive alteration. The A1 allele of the DRD2/ANKK1-TaqIA gene has been associated with addictive disorders, with obesity and with the performance in executive functions. The 7 repeat allele of the DRD4 gene has likewise been associated with the performance in executive functions, as well as with addictive behaviors and impulsivity. Participants were included in the obesity group (N = 42 if their body mass index (BMI was equal to or above 30, and in the lean group (N = 42 if their BMI was below 25. The DRD2/ANKK1-TaqIA and DRD4 VNTR polymorphisms were obtained. All subjects underwent neuropsychological assessment. Eating behavior traits were evaluated. The 'DRD2/ANKK1-TaqIA A1-allele status' had a significant effect on almost all the executive variables, but no significant 'DRD4 7R-allele status' effects were observed for any of the executive variables analyzed. There was a significant 'group' x 'DRD2/ANKK1-TaqIA A1-allele status' interaction effect on LN and 'group' x 'DRD4 7R-allele status' interaction effect on TMT B-A score. Being obese and a carrier of the A1 allele of DRD2/ANKK1-TaqIA or the 7R allele of DRD4 VNTR polymorphisms could confer a weakness as regards the performance of executive functions.
Mei, Yu; Xu, Yufang; Wang, Shipeng; Qiu, Lihong; Zheng, Mingqi
2018-04-01
The resistance levels to glyphosate and target-site based resistance mechanisms in susceptible (S) and resistant (R) Conyza canadensis (L.) populations, which were collected from apple orchards around areas of Bohai seas and Loess Plateau in China, were investigated. Among forty C. canadensis populations, eighteen populations (45%) were still susceptible; fourteen populations (35%) evolved low resistance levels resistance to glyphosate with resistance index (RI) of 2.02 to 3.90. In contrast, eight populations (20%) evolved medium resistance levels with RI of 4.35 to 8.38. The shikimic acid concentrations in R populations were highly negative relative with the glyphosate resistance levels in C. canadensis, the Pearson correlation coefficient was -0.82 treated by glyphosate at 1.8mg/L. Three 5-enoylpyruvylshikimate 3'-phosphate synthase genes (EPSPS1, EPSPS2 and EPSPS3) were cloned in all S and glyphosate-resistant C. canadensis populations. No amino acid substitution was identified at site of 102 and 106 in three EPSPS genes, which were reported to confer glyphosate resistance in other weed species. The relative expression level of EPSPS mRNA in R populations (SD07, LN05, SHX06 and SD09) was 4.5 to 13.2 times higher than in S biotype. The Pearson correlation coefficient between EPSPS expression levels and RI was 0.79, which indicated the over expression of EPSPS mRNA may cause these R populations evolve higher resistance level to glyphosate. Copyright © 2018 Elsevier Inc. All rights reserved.
Isolation and identification of differentially expressed genes between ...
African Journals Online (AJOL)
Plants have evolved sophisticated molecular defense mechanisms in order to survive disease conditions. So far, a number of pathogen resistance (R) genes have been reported in plants. These R genes are thought to be involved in activating the signals that lead to disease resistance. The structural specificity of R genes ...
Yu, Guohua; Cui, Zhenling; Sun, Xian; Peng, Jinfu; Jiang, Jun; Wu, Wei; Huang, Wenhua; Chu, Kaili; Zhang, Lu; Ge, Baoxue; Li, Yao
2015-05-01
Global analysis of expression profiles using DNA microarrays was performed between a reference strain H37Rv and two clinical extensively drug-resistant isolates in response to three anti-tuberculosis drug exposures (isoniazid, capreomycin, and rifampicin). A deep analysis was then conducted using a combination of genome sequences of the resistant isolates, resistance information, and related public microarray data. Certain known resistance-associated gene sets were significantly overrepresented in upregulated genes in the resistant isolates relative to that observed in H37Rv, which suggested a link between resistance and expression levels of particular genes. In addition, isoniazid and capreomycin response genes, but not rifampicin, either obtained from published works or our data, were highly consistent with the differentially expressed genes of resistant isolates compared to those of H37Rv, indicating a strong association between drug resistance of the isolates and genes differentially regulated by isoniazid and capreomycin exposures. Based on these results, 92 genes of the studied isolates were identified as candidate resistance genes, 10 of which are known resistance-related genes. Regulatory network analysis of candidate resistance genes using published networks and literature mining showed that three two-component regulatory systems and regulator CRP play significant roles in the resistance of the isolates by mediating the production of essential envelope components. Finally, drug sensitivity testing indicated strong correlations between expression levels of these regulatory genes and sensitivity to multiple anti-tuberculosis drugs in Mycobacterium tuberculosis. These findings may provide novel insights into the mechanism underlying the emergence and development of drug resistance in resistant tuberculosis isolates and useful clues for further studies on this issue. Copyright © 2015 Elsevier Ltd. All rights reserved.
Kathiria, Palak; Sidler, Corinne; Woycicki, Rafal; Yao, Youli; Kovalchuk, Igor
2013-07-01
The role of resistance (R) genes in plant pathogen interaction has been studied extensively due to its economical impact on agriculture. Interaction between tobacco mosaic virus (TMV) and the N protein from tobacco is one of the most widely used models to understand various aspects of pathogen resistance. The transcription activity governed by N gene promoter is one of the least understood elements of the model. In this study, the N gene promoter was cloned and fused with two different reporter genes, one encoding β-glucuronidase (N::GUS) and another, luciferase (N::LUC). Tobacco plants transformed with the N::GUS or N::LUC reporter constructs were screened for homozygosity and stable expression. Histochemical analysis of N::GUS tobacco plants revealed that the expression is organ specific and developmentally regulated. Whereas two week old plants expressed GUS in midveins only, 6-wk-old plants also expressed GUS in leaf lamella. Roots did not show GUS expression at any time during development. Experiments to address effects of external stress were performed using N::LUC tobacco plants. These experiments showed that N gene promoter expression was suppressed when plants were exposed to high but not low temperatures. Expression was also upregulated in response to TMV, but no changes were observed in plants treated with SA.
Mao, Daqing; Yu, Shuai; Rysz, Michal; Luo, Yi; Yang, Fengxia; Li, Fengxiang; Hou, Jie; Mu, Quanhua; Alvarez, P J J
2015-11-15
The propagation of antibiotic resistance genes (ARGs) is an emerging health concern worldwide. Thus, it is important to understand and mitigate their occurrence in different systems. In this study, 30 ARGs that confer resistance to tetracyclines, sulfonamides, quinolones or macrolides were detected in two activated sludge wastewater treatment plants (WWTPs) in northern China. Bacteria harboring ARGs persisted through all treatment units, and survived disinfection by chlorination in greater percentages than total Bacteria (assessed by 16S rRNA genes). Although the absolute abundances of ARGs were reduced from the raw influent to the effluent by 89.0%-99.8%, considerable ARG levels [(1.0 ± 0.2) × 10(3) to (9.5 ± 1.8) × 10(5) copies/mL)] were found in WWTP effluent samples. ARGs were concentrated in the waste sludge (through settling of bacteria and sludge dewatering) at (1.5 ± 2.3) × 10(9) to (2.2 ± 2.8) × 10(11) copies/g dry weight. Twelve ARGs (tetA, tetB, tetE, tetG, tetH, tetS, tetT, tetX, sul1, sul2, qnrB, ermC) were discharged through the dewatered sludge and plant effluent at higher rates than influent values, indicating overall proliferation of resistant bacteria. Significant antibiotic concentrations (2%-50% of raw influent concentrations) remained throughout all treatment units. This apparently contributed selective pressure for ARG replication since the relative abundance of resistant bacteria (assessed by ARG/16S rRNA gene ratios) was significantly correlated to the corresponding effluent antibiotic concentrations. Similarly, the concentrations of various heavy metals (which induce a similar bacterial resistance mechanism as antibiotics - efflux pumps) were also correlated to the enrichment of some ARGs. Thus, curtailing the release of antibiotics and heavy metals to sewage systems (or enhancing their removal in pre-treatment units) may alleviate their selective pressure and mitigate ARG proliferation in WWTPs. Copyright © 2015 Elsevier Ltd. All
The receptor locus for escherichia coli F4ab/F4ac in the pig maps distal to the MUC4-LMLN region
DEFF Research Database (Denmark)
Rampoldi, Antonio; Jacobsen, Mette Juul; Bertschinger, Hans U.
2011-01-01
antigenic variants, F4ab, F4ac, and F4ad, of which F4ac is the most common. Resistance to ETEC F4ab/F4ac adhesion in pigs has been shown to be inherited as an autosomal recessive trait. In previous studies the ETEC F4ab/F4ac receptor locus (F4bcR) was mapped to the q41 region on pig chromosome 13....... A polymorphism within an intron of the mucin 4 (MUC4) gene, which is one of the possible candidate genes located in this region, was shown earlier to cosegregate with the F4bcR alleles. Recently, we discovered a Large White boar from a Swiss experimental herd with a recombination between F4bcR and MUC4. A three...... a newly detected SNP in the leishmanolysin-like gene (LMLN g.15920) and SNP ALGA0072075. In this study the six SNPs ALGA0072075, ALGA0106330, MUC13-226, MUC13-813, DIA0000584, and MARC0006918 were in complete linkage disequilibrium with F4bcR. Based on this finding and earlier investigations, we suggest...
Molecular mechanisms of plasmid-determined mercury and cadmium resistances in bacteria
International Nuclear Information System (INIS)
Nucifora, G.
1989-01-01
The structural basis for induction of the broad spectrum mercurial resistance operon of pDU1358 with inorganic mercury and with phenylmercury acetate was addressed by DNA sequencing analysis (that showed that a major difference occurred in the 3' 29 base pairs of the ital merR gene compared to the merR genes of Tn501 and R100) and by lac-fusion transcription experiments regulated by merR in trans. The lac-fusion results were compared with those from a narrow spectrum operon, and the pDU1358 merR deleted at the 3' end. A hybrid mer operon containing the merR gene from pDU1358 and lacking the merB gene was inducible by both phenylmercury and inorganic Hg 2+ , showing that organomercurial lyase is not needed for induction by organomercurials. A mutant form of pDU1358 merR missing the C-terminal 17 amino acids responded to inorganic Hg 2+ but not to phenylmercury, indicating that the C-terminal region of the MerR protein of the pDU1358 mer operon is required for the recognition of phenylmercury acetate. The down regulation of the mer operon by the merD gene was also measured in trans with complementing mer operons of pDU1358 or R100 or merD - mutants. In the presence of the merD gene, beta-galactosidase activity was lowered by 2 to 4 fold. The merD gene gene product was visualized by autoradiography. The Cd 2+ resistance determinant cadA of S. aureus was investigated. The nucleotide sequence of the DNA fragment containing the cadA determinant revealed two open reading frames the larger one of which is essential for expression of cadmium resistance
Directory of Open Access Journals (Sweden)
Norman Hembach
2017-07-01
Full Text Available Seven wastewater treatment plants (WWTPs with different population equivalents and catchment areas were screened for the prevalence of the colistin resistance gene mcr-1 mediating resistance against last resort antibiotic polymyxin E. The abundance of the plasmid-associated mcr-1 gene in total microbial populations during water treatment processes was quantitatively analyzed by qPCR analyses. The presence of the colistin resistance gene was documented for all of the influent wastewater samples of the seven WWTPs. In some cases the mcr-1 resistance gene was also detected in effluent samples of the WWTPs after conventional treatment reaching the aquatic environment. In addition to the occurrence of mcr-1 gene, CTX-M-32, blaTEM, CTX-M, tetM, CMY-2, and ermB genes coding for clinically relevant antibiotic resistances were quantified in higher abundances in all WWTPs effluents. In parallel, the abundances of Acinetobacter baumannii, Klebsiella pneumoniae, and Escherichia coli were quantified via qPCR using specific taxonomic gene markers which were detected in all influent and effluent wastewaters in significant densities. Hence, opportunistic pathogens and clinically relevant antibiotic resistance genes in wastewaters of the analyzed WWTPs bear a risk of dissemination to the aquatic environment. Since many of the antibiotic resistance gene are associated with mobile genetic elements horizontal gene transfer during wastewater treatment can't be excluded.
Directory of Open Access Journals (Sweden)
AmirPoyan Afzali
2016-07-01
Full Text Available Background:during recent years, the incidence and spread of drug resistance in Mycobacterium tuberculosis, the bacterium causing tuberculosis, has set this disease in World Health Organizationpriorities alignment of diseases like AIDS and hepatitis. Study of close examination of resistant and susceptible clinical strains genotypes is necessary to overcome drug resistance. Among the numerous repair systems, only there are limited number of encoding genes of DNA repair enzymes in Mycobacterium tuberculosis. Commonly these genes have been conserved and any changes among them likely increasethe mutation occurance due to the impossibility of correctionof spontaneous mutations insensitive strains of this bacteria.mut genes encodeDNA repairable enzymes.This study investigated the mutations in these genes and the effect of these mutations on tuberculosis drug resistance. Materials&Methods: In this study,of 29 available specimens,we were selected 8 susceptible strains and 21 resistantstrains andafter ordering appropriate primers and performing the proliferation reaction two types of amplicons produced which includingfragments of genes mut T2 and mut T4 and they were sent inorder to sequencing. Results:The results of chain reactionprimer represents an appropriate choice of primerswhich were investigated. Sequencing results showed that overall 73% of resistant strains that had been selected for study of mutT4gene, have no mutations in codons 48of mutT4 gene, and 70% of resistant strains have no GGA >>> CGA mutation at codon 58 of mutT2 gene. Conclusion: One of the strategies to overcome tuberculosis drug resistance is a close examination of genotypes of resistant and susceptible clinical strains. Results of this study was performedby examining changes in mut T2 and mut T4 gene sequence. The mutation in mut T2 always associated with mutation in mut T4, in this way, the first mutation may occurs in mut T4and after that, the second mutationmay occurs in mut T
Wang, Na; Yang, Xiaohong; Jiao, Shaojun; Zhang, Jun; Ye, Boping; Gao, Shixiang
2014-01-01
Antibiotic-resistant bacteria and genes are recognized as new environmental pollutants that warrant special concern. There were few reports on veterinary antibiotic-resistant bacteria and genes in China. This work systematically analyzed the prevalence and distribution of sulfonamide resistance genes in soils from the environments around poultry and livestock farms in Jiangsu Province, Southeastern China. The results showed that the animal manure application made the spread and abundance of antibiotic resistance genes (ARGs) increasingly in the soil. The frequency of sulfonamide resistance genes was sul1 > sul2 > sul3 in pig-manured soil DNA and sul2 > sul1 > sul3 in chicken-manured soil DNA. Further analysis suggested that the frequency distribution of the sul genes in the genomic DNA and plasmids of the SR isolates from manured soil was sul2 > sul1 > sul3 overall (psulfonamide resistance genes. The present study also indicated that Bacillus, Pseudomonas and Shigella were the most prevalent sul-positive genera in the soil, suggesting a potential human health risk. The above results could be important in the evaluation of antibiotic-resistant bacteria and genes from manure as sources of agricultural soil pollution; the results also demonstrate the necessity and urgency of the regulation and supervision of veterinary antibiotics in China.
Sengupta, Subhadipa; Chakraborti, Dipankar; Mondal, Hossain A; Das, Sampa
2010-03-01
Rice, the major food crop of world is severely affected by homopteran sucking pests. We introduced coding sequence of Allium sativum leaf agglutinin, ASAL, in rice cultivar IR64 to develop sustainable resistance against sap-sucking planthoppers as well as eliminated the selectable antibiotic-resistant marker gene hygromycin phosphotransferase (hpt) exploiting cre/lox site-specific recombination system. An expression vector was constructed containing the coding sequence of ASAL, a potent controlling agent against green leafhoppers (GLH, Nephotettix virescens) and brown planthopper (BPH, Nilaparvata lugens). The selectable marker (hpt) gene cassette was cloned within two lox sites of the same vector. Alongside, another vector was developed with chimeric cre recombinase gene cassette. Reciprocal crosses were performed between three single-copy T(0) plants with ASAL- lox-hpt-lox T-DNA and three single-copy T(0) plants with cre-bar T-DNA. Marker gene excisions were detected in T(1) hybrids through hygromycin sensitivity assay. Molecular analysis of T(1) plants exhibited 27.4% recombination efficiency. T(2) progenies of L03C04(1) hybrid parent showed 25% cre negative ASAL-expressing plants. Northern blot, western blot and ELISA showed significant level of ASAL expression in five marker-free T(2) progeny plants. In planta bioassay of GLH and BPH performed on these T(2) progenies exhibited radical reduction in survivability and fecundity compared with the untransformed control plants.
Directory of Open Access Journals (Sweden)
Ivonne Wobst
2016-12-01
Full Text Available R-flurbiprofen is the non-COX-inhibiting enantiomer of flurbiprofen and is not converted to S-flurbiprofen in human cells. Nevertheless, it reduces extracellular prostaglandin E2 (PGE2 in cancer or immune cell cultures and human extracellular fluid. Here, we show that R-flurbiprofen acts through a dual mechanism: (i it inhibits the translocation of cPLA2α to the plasma membrane and thereby curtails the availability of arachidonic acid and (ii R-flurbiprofen traps PGE2 inside of the cells by inhibiting multidrug resistance–associated protein 4 (MRP4, ABCC4, which acts as an outward transporter for prostaglandins. Consequently, the effects of R-flurbiprofen were mimicked by RNAi-mediated knockdown of MRP4. Our data show a novel mechanism by which R-flurbiprofen reduces extracellular PGs at physiological concentrations, particularly in cancers with high levels of MRP4, but the mechanism may also contribute to its anti-inflammatory and immune-modulating properties and suggests that it reduces PGs in a site- and context-dependent manner.
Tang, Mei; Dou, Xiaomin; Wang, Chunyan; Tian, Zhe; Yang, Min; Zhang, Yu
2017-12-01
The occurrence of antibiotic-resistant bacteria and antibiotic resistance genes (ARGs) has been intensively investigated for wastewater treatment systems treating single class of antibiotic in recent years. However, the impacts of alternately occurring antibiotics in antibiotic production wastewater on the behavior of ARGs in biological treatment systems were not well understood yet. Herein, techniques including high-capacity quantitative PCR and quantitative PCR (qPCR) were used to investigate the behavior of ARGs in an anaerobic-aerobic full-scale system. The system alternately treated three kinds of antibiotic production wastewater including ribostamycin, spiramycin and paromomycin, which referred to stages 1, 2 and 3. The aminoglycoside ARGs (52.1-79.3%) determined using high-capacity quantitative PCR were the most abundant species in all sludge samples of the three stages. The total relative abundances of macrolide-lincosamide-streptogramin (MLS) resistance genes and aminoglycoside resistance genes measured using qPCR were significantly higher (P 0.05) in both aerobic and anaerobic sludge samples. In aerobic sludge, one acetyltransferase gene (aacA4) and the other three nucleotidyltransferase genes (aadB, aadA and aadE) exhibited positive correlations with intI1 (r 2 = 0.83-0.94; P < 0.05), implying the significance of horizontal transfer in their proliferation. These results and facts will be helpful to understand the abundance and distribution of ARGs from antibiotic production wastewater treatment systems.
Directory of Open Access Journals (Sweden)
Ana Belén Flórez
2014-01-01
Full Text Available Large antibiotic resistance gene pools in the microbiota of foods may ultimately pose a risk for human health. This study reports the identification and quantification of tetracycline- and erythromycin-resistant populations, resistance genes, and gene diversity in traditional Spanish and Italian cheeses, via culturing, conventional PCR, real-time quantitative PCR (qPCR, and denaturing gradient gel electrophoresis (DGGE. The numbers of resistant bacteria varied widely among the antibiotics and the different cheese varieties; in some cheeses, all the bacterial populations seemed to be resistant. Up to eight antibiotic resistance genes were sought by gene-specific PCR, six with respect to tetracycline, that is, tet(K, tet(L, tet(M, tet(O, tet(S, and tet(W, and two with respect to erythromycin, that is, erm(B and erm(F. The most common resistance genes in the analysed cheeses were tet(S, tet(W, tet(M, and erm(B. The copy numbers of these genes, as quantified by qPCR, ranged widely between cheeses (from 4.94 to 10.18log10/g. DGGE analysis revealed distinct banding profiles and two polymorphic nucleotide positions for tet(W-carrying cheeses, though the similarity of the sequences suggests this tet(W to have a monophyletic origin. Traditional cheeses would therefore appear to act as reservoirs for large numbers of many types of antibiotic resistance determinants.
Zhuge, Baozhong; Li, Guohong
2017-12-16
The prevalence of Non-alcoholic fatty liver diseases (NAFLD) increased rapidly in the world. However, the pathogenesis of is still unclear. Hepatic steatosis and insulin resistance are considered to be central to the pathophysiology of NAFLD. MicroRNAs are short non-coding RNAs and has been reported to be involved in pathogenesis of NAFLD and related metabolic diseases. Here, we investigated the mechanisms by which miR-150 regulate hepatic steatosis and insulin resistance in high fat diet (HFD) induced NAFLD model. The expression of miR-150 was up-regulated dramatically in both human NAFLD patients and HFD mice model, as well as in hepatocytes treated with oleic acid. miR-150 deficiency ameliorated the hepatic steatosis and insulin resistance significantly in NAFLD mice. miR-150 deficiency decreased the expression of genes related to fatty acid uptake, synthesis and gluconeogenesis, while increased the expression of genes related to fatty acid β-oxidation. Further, we identified that CFLAR is a direct downstream target of miR-150. Overexpression of miR-150 reduced both the mRNA and protein levels of CFLAR in vitro. And overexpression of miR-150 significantly inhibited the luciferase activity of CFLAR 3'-UTR, while the effect of miR-150 was blocked when the binding site of miR-150 within the CFLAR 3'-UTR was mutated. We also found that miR-150 deficiency decreased the expression of p-Jnk1 and p-Ask1, while the effect of miR-150 on steatosis and insulin signaling was blocked by CFLAR overexpression. In conclusion, our data indicated that miR-150 potentially contributes to the hepatic steatosis and insulin resistance in NAFLD. miR-150/CFLAR pathway may be a new therapeutic strategy against NAFLD. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Ana Teresa P. Carvalho
2014-01-01
Full Text Available OBJECTIVES: Conflicting data from studies on the potential role of multidrug resistance 1 gene polymorphisms in inflammatory bowel disease may result from the analysis of genetically and geographically distinct populations. Here, we investigated whether multidrug resistance 1 gene polymorphisms are associated with inflammatory bowel diseases in patients from Rio de Janeiro. METHODS: We analyzed 123 Crohn's disease patients and 83 ulcerative colitis patients to determine the presence of the multidrug resistance 1 gene polymorphisms C1236T, G2677T and C3435T. In particular, the genotype frequencies of Crohn's disease and ulcerative colitis patients were analyzed. Genotype-phenotype associations with major clinical characteristics were established, and estimated risks were calculated for the mutations. RESULTS: No significant difference was observed in the genotype frequencies of the multidrug resistance 1 G2677T/A and C3435T polymorphisms between Crohn's disease and ulcerative colitis patients. In contrast, the C1236T polymorphism was significantly more common in Crohn's disease than in ulcerative colitis (p = 0.047. A significant association was also found between the multidrug resistance 1 C3435T polymorphism and the stricturing form of Crohn's disease (OR: 4.13; p = 0.009, whereas no association was found with penetrating behavior (OR: 0.33; p = 0.094. In Crohn's disease, a positive association was also found between the C3435T polymorphism and corticosteroid resistance/refractoriness (OR: 4.14; p = 0.010. However, no significant association was found between multidrug resistance 1 gene polymorphisms and UC subphenotypic categories. CONCLUSION: The multidrug resistance 1 gene polymorphism C3435T is associated with the stricturing phenotype and an inappropriate response to therapy in Crohn's disease. This association with Crohn's disease may support additional pathogenic roles for the multidrug resistance 1 gene in regulating gut
Rinaldo, Amy; Gilbert, Brian; Boni, Rainer; Krattinger, Simon G; Singh, Davinder; Park, Robert F; Lagudah, Evans; Ayliffe, Michael
2017-07-01
The hexaploid wheat (Triticum aestivum) adult plant resistance gene, Lr34/Yr18/Sr57/Pm38/Ltn1, provides broad-spectrum resistance to wheat leaf rust (Lr34), stripe rust (Yr18), stem rust (Sr57) and powdery mildew (Pm38) pathogens, and has remained effective in wheat crops for many decades. The partial resistance provided by this gene is only apparent in adult plants and not effective in field-grown seedlings. Lr34 also causes leaf tip necrosis (Ltn1) in mature adult plant leaves when grown under field conditions. This D genome-encoded bread wheat gene was transferred to tetraploid durum wheat (T. turgidum) cultivar Stewart by transformation. Transgenic durum lines were produced with elevated gene expression levels when compared with the endogenous hexaploid gene. Unlike nontransgenic hexaploid and durum control lines, these transgenic plants showed robust seedling resistance to pathogens causing wheat leaf rust, stripe rust and powdery mildew disease. The effectiveness of seedling resistance against each pathogen correlated with the level of transgene expression. No evidence of accelerated leaf necrosis or up-regulation of senescence gene markers was apparent in these seedlings, suggesting senescence is not required for Lr34 resistance, although leaf tip necrosis occurred in mature plant flag leaves. Several abiotic stress-response genes were up-regulated in these seedlings in the absence of rust infection as previously observed in adult plant flag leaves of hexaploid wheat. Increasing day length significantly increased Lr34 seedling resistance. These data demonstrate that expression of a highly durable, broad-spectrum adult plant resistance gene can be modified to provide seedling resistance in durum wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Grima-Pettenati Jacqueline
2007-03-01
Full Text Available Abstract Background Several members of the R2R3-MYB family of transcription factors act as regulators of lignin and phenylpropanoid metabolism during wood formation in angiosperm and gymnosperm plants. The angiosperm Arabidopsis has over one hundred R2R3-MYBs genes; however, only a few members of this family have been discovered in gymnosperms. Results We isolated and characterised full-length cDNAs encoding R2R3-MYB genes from the gymnosperms white spruce, Picea glauca (13 sequences, and loblolly pine, Pinus taeda L. (five sequences. Sequence similarities and phylogenetic analyses placed the spruce and pine sequences in diverse subgroups of the large R2R3-MYB family, although several of the sequences clustered closely together. We searched the highly variable C-terminal region of diverse plant MYBs for conserved amino acid sequences and identified 20 motifs in the spruce MYBs, nine of which have not previously been reported and three of which are specific to conifers. The number and length of the introns in spruce MYB genes varied significantly, but their positions were well conserved relative to angiosperm MYB genes. Quantitative RTPCR of MYB genes transcript abundance in root and stem tissues revealed diverse expression patterns; three MYB genes were preferentially expressed in secondary xylem, whereas others were preferentially expressed in phloem or were ubiquitous. The MYB genes expressed in xylem, and three others, were up-regulated in the compression wood of leaning trees within 76 hours of induction. Conclusion Our survey of 18 conifer R2R3-MYB genes clearly showed a gene family structure similar to that of Arabidopsis. Three of the sequences are likely to play a role in lignin metabolism and/or wood formation in gymnosperm trees, including a close homolog of the loblolly pine PtMYB4, shown to regulate lignin biosynthesis in transgenic tobacco.
International Nuclear Information System (INIS)
Zhang, Jing; Shen, Chengwu; Wang, Lin; Ma, Quanping; Xia, Pingtian; Qi, Mei; Yang, Muyi; Han, Bo
2014-01-01
Highlights: • Metformin inhibits TGF-β-induced EMT in prostate cancer (PCa) cells. • Metformin upregulates tumor suppressor miR30a and downregulates SOX4 in PCa cells. • SOX4 is a target gene of miR30a. - Abstract: Tumor metastasis is the leading cause of mortality and morbidity of prostate cancer (PCa) patients. Epithelial–mesenchymal transition (EMT) plays a critical role in cancer progression and metastasis. Recent evidence suggested that diabetic patients treated with metformin have lower PCa risk and better prognosis. This study was aimed to investigate the effects of metformin on EMT in PCa cells and the possible microRNA (miRNA)-based mechanisms. MiRNAs have been shown to regulate various processes of cancer metastasis. We herein showed that metformin significantly inhibits proliferation of Vcap and PC-3 cells, induces G0/G1 cell cycle arrest and inhibits invasiveness and motility capacity of Vcap cells. Metformin could inhibit TGF-β-induced EMT in Vcap cells, as manifested by inhibition of the increase of N-cadherin (p = 0.013), Vimentin (p = 0.002) and the decrease of E-cadherin (p = 0.0023) and β-catenin (p = 0.034) at mRNA and protein levels. Notably, we demonstrated significant upregulation of miR30a levels by metformin (P < 0.05) and further experiments indicated that miR30a significantly inhibits proliferation and EMT process of Vcap cells. Interestingly, we identified that SOX4, a previously reported oncogenic transcriptional factor and modulator of EMT, is a direct target gene of miR30a. Finally, we screened the expression of miR30a and SOX4 in 84 PCa cases with radical prostatectomy. Of note, SOX4 overexpression is significantly associated with decreased levels of miR30a in PCa cases. In all, our study suggested that inhibition of EMT by metformin in PCa cells may involve upregulation of miR30a and downregulation of SOX4
Ngo, The D; Malone, Jenna M; Boutsalis, Peter; Gill, Gurjeet; Preston, Christopher
2018-05-01
Five glyphosate-resistant populations of Chloris truncata originally collected from New South Wales were compared with one susceptible (S) population from South Australia to confirm glyphosate resistance and elucidate possible mechanisms of resistance. Based on the amounts of glyphosate required to kill 50% of treated plants (LD 50 ), glyphosate resistance (GR) was confirmed in five populations of C. truncata (A536, A528, T27, A534 and A535.1). GR plants were 2.4-8.7-fold more resistant and accumulated less shikimate after glyphosate treatment than S plants. There was no difference in glyphosate absorption and translocation between GR and S plants. The EPSPS gene did not contain any point mutation that had previously been associated with resistance to glyphosate. The resistant plants (A528 and A536) contained up to 32-48 more copies of the EPSPS gene than the susceptible plants. This study has identified EPSPS gene amplification contributing to glyphosate resistance in C. truncata. In addition, a Glu-91-Ala mutation within EPSPS was identified that may contribute to glyphosate resistance in this species. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
DEFF Research Database (Denmark)
Liu, Hongliang; Zhuang, Weiping; Zhang, Shengzhe
2015-01-01
Antimonial compounds can be found as a toxic contaminant in the environment. Knowledge on mechanisms of microbial Sb oxidation and its role in microbial tolerance are limited. Previously, we found that Comamonas testosteroni S44 was resistant to multiple heavy metals and was able to oxidize the t...... and Sb(III) oxidation via Fe-S cluster biogenesis and oxidative stress protection. Bacterial Sb(III) oxidation is a detoxification reaction.......Antimonial compounds can be found as a toxic contaminant in the environment. Knowledge on mechanisms of microbial Sb oxidation and its role in microbial tolerance are limited. Previously, we found that Comamonas testosteroni S44 was resistant to multiple heavy metals and was able to oxidize...... the toxic antimonite [Sb(III)] to the much less toxic antimonate [Sb(V)]. In this study, transposon mutagenesis was performed in C. testosteroni S44 to isolate genes responsible for Sb(III) resistance and oxidation. An insertion mutation into iscR, which regulates genes involved in the biosynthesis of Fe...
Zhu, Y. G.
2015-12-01
In addition to material and energy flows, the dynamics and functions of the Earth's critical zone are intensively mediated by biological actions performed by diverse organisms. These biological actions are modulated by the expression of functional genes and their translation into enzymes that catalyze geochemical reactions, such as nutrient turnover and pollutant biodegradation. Although geobiology, as an interdisciplinary research area, is playing and vital role in linking biological and geochemical processes at different temporal and spatial scales, the distribution and transport of functional genes have rarely been investigated from the Earth's critical zone perspectives. To illustrate the framework of studies on the transport and transformation of genetic information in the critical zone, antibiotic resistance is taken as an example. Antibiotic resistance genes are considered as a group of emerging contaminants, and their emergence and spread within the critical zone on one hand are induced by anthropogenic activities, and on other hand are threatening human health worldwide. The transport and transformation of antibiotic resistance genes are controlled by both horizontal gene transfer between bacterial cells and the movement of bacteria harboring antibiotic resistance genes. In this paper, the fate and behavior of antibiotic resistance genes will be discussed in the following aspects: 1) general overview of environmental antibiotic resistance; 2) high through quantification of the resistome in various environmental media; 3) pathways of resistance gene flow within the critical zone; and 4) potential strategies in mitigating antibiotic resistance, particularly from the critical zone perspectives.
Chajęcka-Wierzchowska, Wioleta; Zadernowska, Anna; Nalepa, Beata; Sierpińska, Magda; Laniewska-Trokenheim, Lucja
2014-06-01
Ready-to-eat (RTE) food, which does not need thermal processing before consumption, could be a vehicle for the spread of antibiotic-resistant microorganisms. As part of general microbiological safety checks, staphylococci are routinely enumerated in these kinds of foods. However, the presence of antibiotic-resistant staphylococci in RTE food is not routinely investigated, and data are only available from a small number of studies. The present study evaluated the pheno- and genotypical antimicrobial resistance profile of Staphylococcus spp. isolated from 858 RTE foods (cheeses, cured meats, sausages, smoked fishes, salads). Of 113 strains isolated, S. aureus was the most prevalent species, followed by S. xylosus, S. saprophyticus, and S. epidermidis. More than half (54.9%) of the isolates were resistant to at least one class of tested antibiotic; of these, 35.4% of the strains were classified as multidrug resistant. Most of the isolates were resistant to cefoxitin (49.6%), followed by clindamycin (39.3%), tigecycline (27.4%), quinupristin-dalfopristin (22.2%), rifampin (20.5%), tetracycline (17.9%), and erythromycin (8.5%). All methicillin-resistant staphylococci harbored the mecA gene. Among the isolates resistant to at least one antibiotic, 38 harbored tetracycline resistance determinant tet (M), 24 harbored tet (L), and 9 harbored tet (K). Of the isolates positive for tet (M) genes, 34.2% were positive for the Tn916-Tn1545-like integrase family gene. Our results indicated that retail RTE food could be considered an important route for the transmission of antibiotic-resistant bacteria harboring multiple antibiotic resistance genes.
International Nuclear Information System (INIS)
Akamatsu, T.; Yoshida, M.; Shiga, T.
1990-01-01
Full text: In order to transfer the Fusarium resistant gene from the wild species into eggplants, asymmetric fusions were done between Solanum integrifolium and S. melongena. Protoplasts of S. melongena were isolated from hypocotyIes, and protoplasts of S. integrifolium were isolated from young leaves. Protoplasts of S. integrifolium were irradiated by soft x-rays (40-60kR), and fused with protoplasts of S. melongena by electric pulses. Fused protoplasts were cultured using TM-2 basal medium supplemented with 2,4-D (0.5 mg/l), NAA (0.35mg/l), and BA (2mg/l). After 30 days, calli of 1-2 mm in diameter were subcultured on agar medium supplemented with IAA (0.2mg/l) and Zeatin (4mg/l). After 15-30 days, shoots were regenerated from green calli. Regenerated plants were transplanted to the greenhouse and 382 plants were inoculated with Fusarium oxysporum. Thirty-two plants were resistant or tolerant, their chromosome numbers varied in the range of 35-42 (S. integrifolium, S. melongena 2n=2x=24). (author)
Kuppan Gokulan; Katherine Williams; Sangeeta Khare
2017-01-01
Limited antibacterial activity of silver ions leached from silver-impregnated food contact materials could be due to: 1) the presence of silver resistance genes in tested bacteria; or 2) lack of susceptibility to silver ion-mediated killing in the bacterial strain (K. Williams, L. Valencia, K. Gokulan, R. Trbojevich, S. Khare, 2016 [1]). This study contains data to address the specificity of silver resistance genes in Salmonella Typhimurium during the real time PCR using melting curve analysi...
Dong, Fang; Xu, Xi-wei; Song, Wen-qi; Lü, Ping; Yang, Yong-hong; Shen, Xu-zhuang
2008-11-18
To analyze the antibiotic resistance of the Pseudomonas aeruginosa (PA) isolated from pediatric patients and the resistant genes of beta-lactam antibiotics thereof. 146 PA strains were isolated from pediatric patients. Agar dilution method recommended by the Clinical and Laboratory Standards Institute was used to examine the minimum inhibitory concentrations (MICs) of 12 antimicrobial agents, including the penicillins, third and fourth genet ration cephalosporins, carbapenemase, Aztreonam, beta-lactamase inhibitors, quinolones, and aminoglycosides. PCR was used to detect the expression of the genes TEM, SHV, OXA, PER, GES, CTX-M, IMP, VIM, DHA, MIR, FOX, and oprD2. The multi-drug resistance rates against different antibiotic were high among the 146 PA strains. The rates of imipenem and meropenem resistance were 41.1% and 35.6% respectively. Among the 146 PA strains, 46 (31.5%) were positive for the MBL genotype; 38 (82.6%) carried the blaIMP gene, 8 (17.4%) carried the blaVIM gene, and 114 (78.1%) were oprD2 negative. The genes TEM, SHV, OXA, CTX-M, PER, VEB, GES, FOX, MIR, and DHA were not found in all strains. Many PA isolated from pediatric patients carry the genes IMP or VIM and losses oprD2 gene related to the expression of the outer membrane porin OprD2. The loss of the gene oprD2 is essential mechanism of beta-lactam antibiotics resistance in PA.
Sponge microbiota are a reservoir of functional antibiotic resistance genes
Directory of Open Access Journals (Sweden)
Dennis Versluis
2016-11-01
Full Text Available Wide application of antibiotics has contributed to the evolution of multi-drug resistant human pathogens, resulting in poorer treatment outcomes for infections. In the marine environment, seawater samples have been investigated as a resistance reservoir; however, no studies have methodically examined sponges as a reservoir of antibiotic resistance. Sponges could be important in this respect because they often contain diverse microbial communities that have the capacity to produce bioactive metabolites. Here, we applied functional metagenomics to study the presence and diversity of functional resistance genes in the sponges Aplysina aerophoba, Petrosia ficiformis and Corticium candelabrum. We obtained 37 insert sequences facilitating resistance to D-cycloserine (n=6, gentamicin (n=1, amikacin (n=7, trimethoprim (n=17, chloramphenicol (n=1, rifampicin (n=2 and ampicillin (n=3. Fifteen of 37 inserts harboured resistance genes that shared <90% amino acid identity with known gene products, whereas on 13 inserts no resistance gene could be identified with high confidence, in which case we predicted resistance to be mainly mediated by antibiotic efflux. One marine-specific ampicillin-resistance-conferring β-lactamase was identified in the genus Pseudovibrio with 41% global amino acid identity to the closest β-lactamase with demonstrated functionality, and subsequently classified into a new family termed PSV. Taken together, our results show that sponge microbiota host diverse and novel resistance genes that may be harnessed by phylogenetically distinct bacteria.
Mechanisms of ouabain resistance
International Nuclear Information System (INIS)
Schulz, J.T. III.
1987-01-01
Experiments were designed to investigate the mechanism of ouabain resistance in two distinct types of transfected cells derived from ouabain-sensitive CV-1 cell parents. The first type of transfectant is the recipient of a gene encoding the alpha subunit of the rodent renal Na,K-ATPase (R-alphal gene); the second type of transfectant is the recipient of the mouse ouabain resistance gene. Measurements of 86 Rb + uptake and Na,K=ATPase activity in R-alphal gene transfectant cells and CV-1 parent cells indicate that the ouabain-resistant phenotype of the transfectants is due to expression of a relatively ouabain-insensitive Na,K=ATPase. CV-1 parent cells express one component of ouabain sensitive 86 Rb + uptake and one component of ouabain-sensitive Na, K-ATPase activity. R-alpha 1 gene transfectants express the parental forms of ouabain-sensitive 86 Rb + uptake and Na,K-ATPase activity, but in addition express new,relatively ouabain-insensitive forms of 86 Rb + uptake activity and Na,K-ATPase activity
Directory of Open Access Journals (Sweden)
Li Chun-yu
2012-08-01
Full Text Available Abstract Background Fusarium wilt, caused by the fungal pathogen Fusarium oxysporum f. sp. cubense tropical race 4 (Foc TR4, is considered the most lethal disease of Cavendish bananas in the world. The disease can be managed in the field by planting resistant Cavendish plants generated by somaclonal variation. However, little information is available on the genetic basis of plant resistance to Foc TR4. To a better understand the defense response of resistant banana plants to the Fusarium wilt pathogen, the transcriptome profiles in roots of resistant and susceptible Cavendish banana challenged with Foc TR4 were compared. Results RNA-seq analysis generated more than 103 million 90-bp clean pair end (PE reads, which were assembled into 88,161 unigenes (mean size = 554 bp. Based on sequence similarity searches, 61,706 (69.99% genes were identified, among which 21,273 and 50,410 unigenes were assigned to gene ontology (GO categories and clusters of orthologous groups (COG, respectively. Searches in the Kyoto Encyclopedia of Genes and Genomes Pathway database (KEGG mapped 33,243 (37.71% unigenes to 119 KEGG pathways. A total of 5,008 genes were assigned to plant-pathogen interactions, including disease defense and signal transduction. Digital gene expression (DGE analysis revealed large differences in the transcriptome profiles of the Foc TR4-resistant somaclonal variant and its susceptible wild-type. Expression patterns of genes involved in pathogen-associated molecular pattern (PAMP recognition, activation of effector-triggered immunity (ETI, ion influx, and biosynthesis of hormones as well as pathogenesis-related (PR genes, transcription factors, signaling/regulatory genes, cell wall modification genes and genes with other functions were analyzed and compared. The results indicated that basal defense mechanisms are involved in the recognition of PAMPs, and that high levels of defense-related transcripts may contribute to Foc TR4 resistance in
Peng, Fred Y; Yang, Rong-Cai
2017-06-20
The resistance to leaf rust (Lr) caused by Puccinia triticina in wheat (Triticum aestivum L.) has been well studied over the past decades with over 70 Lr genes being mapped on different chromosomes and numerous QTLs (quantitative trait loci) being detected or mapped using DNA markers. Such resistance is often divided into race-specific and race-nonspecific resistance. The race-nonspecific resistance can be further divided into resistance to most or all races of the same pathogen and resistance to multiple pathogens. At the molecular level, these three types of resistance may cover across the whole spectrum of pathogen specificities that are controlled by genes encoding different protein families in wheat. The objective of this study is to predict and analyze genes in three such families: NBS-LRR (nucleotide-binding sites and leucine-rich repeats or NLR), START (Steroidogenic Acute Regulatory protein [STaR] related lipid-transfer) and ABC (ATP-Binding Cassette) transporter. The focus of the analysis is on the patterns of relationships between these protein-coding genes within the gene families and QTLs detected for leaf rust resistance. We predicted 526 ABC, 1117 NLR and 144 START genes in the hexaploid wheat genome through a domain analysis of wheat proteome. Of the 1809 SNPs from leaf rust resistance QTLs in seedling and adult stages of wheat, 126 SNPs were found within coding regions of these genes or their neighborhood (5 Kb upstream from transcription start site [TSS] or downstream from transcription termination site [TTS] of the genes). Forty-three of these SNPs for adult resistance and 18 SNPs for seedling resistance reside within coding or neighboring regions of the ABC genes whereas 14 SNPs for adult resistance and 29 SNPs for seedling resistance reside within coding or neighboring regions of the NLR gene. Moreover, we found 17 nonsynonymous SNPs for adult resistance and five SNPs for seedling resistance in the ABC genes, and five nonsynonymous SNPs for
Multidrug Resistance Protein-4 Influences Aspirin Toxicity in Human Cell Line
Directory of Open Access Journals (Sweden)
Isabella Massimi
2015-01-01
Full Text Available Overexpression of efflux transporters, in human cells, is a mechanism of resistance to drug and also to chemotherapy. We found that multidrug resistance protein-4 (MRP4 overexpression has a role in reducing aspirin action in patients after bypass surgery and, very recently, we found that aspirin enhances platelet MRP4 levels through peroxisome proliferator activated receptor-α (PPARα. In the present paper, we verified whether exposure of human embryonic kidney-293 cells (Hek-293 to aspirin modifies MRP4 gene expression and its correlation with drug elimination and cell toxicity. We first investigated the effect of high-dose aspirin in Hek-293 and we showed that aspirin is able to increase cell toxicity dose-dependently. Furthermore, aspirin effects, induced at low dose, already enhance MRP4 gene expression. Based on these findings, we compared cell viability in Hek-293, after high-dose aspirin treatment, in MRP4 overexpressing cells, either after aspirin pretreatment or in MRP4 transfected cells; in both cases, a decrease of selective aspirin cell growth inhibition was observed, in comparison with the control cultures. Altogether, these data suggest that exposing cells to low nontoxic aspirin dosages can induce gene expression alterations that may lead to the efflux transporter protein overexpression, thus increasing cellular detoxification of aspirin.
Arnardottir, Erna S; Nikonova, Elena V; Shockley, Keith R; Podtelezhnikov, Alexei A; Anafi, Ron C; Tanis, Keith Q; Maislin, Greg; Stone, David J; Renger, John J; Winrow, Christopher J; Pack, Allan I
2014-10-01
To address whether changes in gene expression in blood cells with sleep loss are different in individuals resistant and sensitive to sleep deprivation. Blood draws every 4 h during a 3-day study: 24-h normal baseline, 38 h of continuous wakefulness and subsequent recovery sleep, for a total of 19 time-points per subject, with every 2-h psychomotor vigilance task (PVT) assessment when awake. Sleep laboratory. Fourteen subjects who were previously identified as behaviorally resistant (n = 7) or sensitive (n = 7) to sleep deprivation by PVT. Thirty-eight hours of continuous wakefulness. We found 4,481 unique genes with a significant 24-h diurnal rhythm during a normal sleep-wake cycle in blood (false discovery rate [FDR] sleep. After accounting for circadian effects, two genes (SREBF1 and CPT1A, both involved in lipid metabolism) exhibited small, but significant, linear changes in expression with the duration of sleep deprivation (FDR sleep deprivation was a reduction in the amplitude of the diurnal rhythm of expression of normally cycling probe sets. This reduction was noticeably higher in behaviorally resistant subjects than sensitive subjects, at any given P value. Furthermore, blood cell type enrichment analysis showed that the expression pattern difference between sensitive and resistant subjects is mainly found in cells of myeloid origin, such as monocytes. Individual differences in behavioral effects of sleep deprivation are associated with differences in diurnal amplitude of gene expression for genes that show circadian rhythmicity. © 2014 Associated Professional Sleep Societies, LLC.
Pyramiding for Resistance Durability: Theory and Practice.
Mundt, Chris
2018-04-12
Durable disease resistance is a key component of global food security, and combining resistance genes into "pyramids" is an important way to increase durability of resistance. The mechanisms by which pyramids impact durability are not well known. The traditional view of resistance pyramids considers the use of major resistance gene (R-gene) combinations deployed against pathogens that are primarily asexual. Interestingly, published examples of the successful use of pyramids in the traditional sense are rare. In contrast, most published descriptions of durable pyramids in practice are for cereal rusts, and tend to indicate an association between durability and cultivars combining major R-genes with incompletely expressed, adult plant resistance genes. Pyramids have been investigated experimentally for a diversity of pathogens, and many reduce disease levels below that of the single best gene. Resistance gene combinations have been identified through phenotypic reactions, molecular markers, and challenge against effector genes. As resistance genes do not express equally in all genetic backgrounds, however, a combination of genetic information and phenotypic analyses provide the ideal scenario for testing of putative pyramids. Not all resistance genes contribute equally to pyramids, and approaches have been suggested to identify the best genes and combinations of genes for inclusion. Combining multiple resistance genes into a single plant genotype quickly is a challenge that is being addressed through alternative breeding approaches, as well as through genomics tools such as resistance gene cassettes and gene editing. Experimental and modeling tests of pyramid durability are in their infancy, but have promise to help direct future studies of pyramids. Several areas for further work on resistance gene pyramids are suggested.
DEFF Research Database (Denmark)
Monshupanee, Tanakarn; Gregory, Steven T; Douthwaite, Stephen
2008-01-01
of previously reported capreomycin resistance base substitutions. Capreomycin resistance in other bacteria has been shown to result from inactivation of the TlyA methyltransferase which 2'-O methylates C1920 of 23S rRNA. Inactivation of the tlyA gene in T. thermophilus does not affect its sensitivity...... for resistance to the tuberactinomycin antibiotic capreomycin. Two base substitutions, A1913U and mU1915G, and a single base deletion, DeltamU1915, were identified in helix 69 of 23S rRNA, a structural element that forms part of an interribosomal subunit bridge with the decoding center of 16S rRNA, the site...... to capreomycin. Finally, none of the mutations in helix 69 interferes with methylation at C1920 or with pseudouridylation at positions 1911 and 1917. We conclude that the resistance phenotype is a consequence of structural changes introduced by the mutations....
Alteration of gene expression and DNA methylation in drug-resistant gastric cancer.
Maeda, Osamu; Ando, Takafumi; Ohmiya, Naoki; Ishiguro, Kazuhiro; Watanabe, Osamu; Miyahara, Ryoji; Hibi, Yoko; Nagai, Taku; Yamada, Kiyofumi; Goto, Hidemi
2014-04-01
The mechanisms of drug resistance in cancer are not fully elucidated. To study the drug resistance of gastric cancer, we analyzed gene expression and DNA methylation profiles of 5-fluorouracil (5-FU)- and cisplatin (CDDP)-resistant gastric cancer cells and biopsy specimens. Drug-resistant gastric cancer cells were established with culture for >10 months in a medium containing 5-FU or CDDP. Endoscopic biopsy specimens were obtained from gastric cancer patients who underwent chemotherapy with oral fluoropyrimidine S-1 and CDDP. Gene expression and DNA methylation analyses were performed using microarray, and validated using real-time PCR and pyrosequencing, respectively. Out of 17,933 genes, 541 genes commonly increased and 569 genes decreased in both 5-FU- and CDDP-resistant AGS cells. Genes with expression changed by drugs were related to GO term 'extracellular region' and 'p53 signaling pathway' in both 5-FU- and CDDP-treated cells. Expression of 15 genes including KLK13 increased and 12 genes including ETV7 decreased, in both drug-resistant cells and biopsy specimens of two patients after chemotherapy. Out of 10,365 genes evaluated with both expression microarray and methylation microarray, 74 genes were hypermethylated and downregulated, or hypomethylated and upregulated in either 5-FU-resistant or CDDP-resistant cells. Of these genes, expression of 21 genes including FSCN1, CPT1C and NOTCH3, increased from treatment with a demethylating agent. There are alterations of gene expression and DNA methylation in drug-resistant gastric cancer; they may be related to mechanisms of drug resistance and may be useful as biomarkers of gastric cancer drug sensitivity.
Role of RBP2-Induced ER and IGF1R-ErbB Signaling in Tamoxifen Resistance in Breast Cancer.
Choi, Hee-Joo; Joo, Hyeong-Seok; Won, Hee-Young; Min, Kyueng-Whan; Kim, Hyung-Yong; Son, Taekwon; Oh, Young-Ha; Lee, Jeong-Yeon; Kong, Gu
2018-04-01
Despite the benefit of endocrine therapy, acquired resistance during or after treatment still remains a major challenge in estrogen receptor (ER)-positive breast cancer. We investigated the potential role of histone demethylase retinoblastoma-binding protein 2 (RBP2) in endocrine therapy resistance of breast cancer. Survival of breast cancer patients according to RBP2 expression was analyzed in three different breast cancer cohorts including METABRIC (n = 1980) and KM plotter (n = 1764). RBP2-mediated tamoxifen resistance was confirmed by invitro sulforhodamine B (SRB) colorimetric, colony-forming assays, and invivo xenograft models (n = 8 per group). RNA-seq analysis and receptor tyrosine kinase assay were performed to identify the tamoxifen resistance mechanism by RBP2. All statistical tests were two-sided. RBP2 was associated with poor prognosis to tamoxifen therapy in ER-positive breast cancer (P = .04 in HYU cohort, P = .02 in KM plotter, P = .007 in METABRIC, log-rank test). Furthermore, RBP2 expression was elevated in patients with tamoxifen-resistant breast cancer (P = .04, chi-square test). Knockdown of RBP2 conferred tamoxifen sensitivity, whereas overexpression of RBP2 induced tamoxifen resistance invitro and invivo (MCF7 xenograft: tamoxifen-treated control, mean [SD] tumor volume = 70.8 [27.9] mm3, vs tamoxifen-treated RBP2, mean [SD] tumor volume = 387.9 [85.1] mm3, P < .001). Mechanistically, RBP2 cooperated with ER co-activators and corepressors and regulated several tamoxifen resistance-associated genes, including NRIP1, CCND1, and IGFBP4 and IGFBP5. Furthermore, epigenetic silencing of IGFBP4/5 by RBP2-ER-NRIP1-HDAC1 complex led to insulin-like growth factor-1 receptor (IGF1R) activation. RBP2 also increased IGF1R-ErbB crosstalk and subsequent PI3K-AKT activation via demethylase activity-independent ErbB protein stabilization. Combinational treatment with tamoxifen and PI3K inhibitor could overcome RBP2-mediated tamoxifen
Sütterlin, S; Dahlö, M; Tellgren-Roth, C; Schaal, W; Melhus, Å
2017-07-01
Silver-based products have been marketed as an alternative to antibiotics, and their consumption has increased. Bacteria may, however, develop resistance to silver. To study the presence of genes encoding silver resistance (silE, silP, silS) over time in three clinically important Enterobacteriaceae genera. Using polymerase chain reaction (PCR), 752 bloodstream isolates from the years 1990-2010 were investigated. Age, gender, and ward of patients were registered, and the susceptibility to antibiotics and silver nitrate was tested. Clonality and single nucleotide polymorphism were assessed with repetitive element sequence-based PCR, multi-locus sequence typing, and whole-genome sequencing. Genes encoding silver resistance were detected most frequently in Enterobacter spp. (48%), followed by Klebsiella spp. (41%) and Escherichia coli 4%. Phenotypical resistance to silver nitrate was found in Enterobacter (13%) and Klebsiella (3%) isolates. The lowest carriage rate of sil genes was observed in blood isolates from the neonatology ward (24%), and the highest in blood isolates from the oncology/haematology wards (66%). Presence of sil genes was observed in international high-risk clones. Sequences of the sil and pco clusters indicated that a single mutational event in the silS gene could have caused the phenotypic resistance. Despite a restricted consumption of silver-based products in Swedish health care, silver resistance genes are widely represented in clinical isolates of Enterobacter and Klebsiella species. To avoid further selection and spread of silver-resistant bacteria with a high potential for healthcare-associated infections, the use of silver-based products needs to be controlled and the silver resistance monitored. Copyright © 2017 The Healthcare Infection Society. Published by Elsevier Ltd. All rights reserved.
Puinean, Alin M; Foster, Stephen P; Oliphant, Linda; Denholm, Ian; Field, Linda M; Millar, Neil S; Williamson, Martin S; Bass, Chris
2010-06-24
The aphid Myzus persicae is a globally significant crop pest that has evolved high levels of resistance to almost all classes of insecticide. To date, the neonicotinoids, an economically important class of insecticides that target nicotinic acetylcholine receptors (nAChRs), have remained an effective control measure; however, recent reports of resistance in M. persicae represent a threat to the long-term efficacy of this chemical class. In this study, the mechanisms underlying resistance to the neonicotinoid insecticides were investigated using biological, biochemical, and genomic approaches. Bioassays on a resistant M. persicae clone (5191A) suggested that P450-mediated detoxification plays a primary role in resistance, although additional mechanism(s) may also contribute. Microarray analysis, using an array populated with probes corresponding to all known detoxification genes in M. persicae, revealed constitutive over-expression (22-fold) of a single P450 gene (CYP6CY3); and quantitative PCR showed that the over-expression is due, at least in part, to gene amplification. This is the first report of a P450 gene amplification event associated with insecticide resistance in an agriculturally important insect pest. The microarray analysis also showed over-expression of several gene sequences that encode cuticular proteins (2-16-fold), and artificial feeding assays and in vivo penetration assays using radiolabeled insecticide provided direct evidence of a role for reduced cuticular penetration in neonicotinoid resistance. Conversely, receptor radioligand binding studies and nucleotide sequencing of nAChR subunit genes suggest that target-site changes are unlikely to contribute to resistance to neonicotinoid insecticides in M. persicae.
Huang, Haining; Chen, Yinguang; Zheng, Xiong; Su, Yinglong; Wan, Rui; Yang, Shouye
2016-10-01
Although pH value has been widely regarded as an important factor that affects resource recovery of waste sludge, the potential influence of diverse pHs on the distribution of tetracycline resistance genes (TRGs) during sludge anaerobic treatment is largely unknown. Here we reported that in the range of pH 4-10, 0.58-1.18 log unit increase of target TRGs was observed at pH 4, compared with that at pH 7, while 0.70-1.31 log unit further removal were obtained at pH 10. Mechanism study revealed that varied pHs not only altered the community structures of tetracycline resistant bacteria (TRB), but also changed their relative abundances, benefitting the propagation (acidic pHs) or attenuation (alkaline pHs) of TRB. Further investigation indicated that the amount and gene-possessing abilities of key genetic vectors for horizontal TRGs transfer were greatly promoted at acidic pHs but restricted under alkaline conditions. Copyright © 2016 Elsevier Ltd. All rights reserved.
Grunseich, Christopher; Wang, Isabel X; Watts, Jason A; Burdick, Joshua T; Guber, Robert D; Zhu, Zhengwei; Bruzel, Alan; Lanman, Tyler; Chen, Kelian; Schindler, Alice B; Edwards, Nancy; Ray-Chaudhury, Abhik; Yao, Jianhua; Lehky, Tanya; Piszczek, Grzegorz; Crain, Barbara; Fischbeck, Kenneth H; Cheung, Vivian G
2018-02-01
R-loops are three-stranded nucleic acid structures found abundantly and yet often viewed as by-products of transcription. Studying cells from patients with a motor neuron disease (amyotrophic lateral sclerosis 4 [ALS4]) caused by a mutation in senataxin, we uncovered how R-loops promote transcription. In ALS4 patients, the senataxin mutation depletes R-loops with a consequent effect on gene expression. With fewer R-loops in ALS4 cells, the expression of BAMBI, a negative regulator of transforming growth factor β (TGF-β), is reduced; that then leads to the activation of the TGF-β pathway. We uncovered that genome-wide R-loops influence promoter methylation of over 1,200 human genes. DNA methyl-transferase 1 favors binding to double-stranded DNA over R-loops. Thus, in forming R-loops, nascent RNA blocks DNA methylation and promotes further transcription. Hence, our results show that nucleic acid structures, in addition to sequences, influence the binding and activity of regulatory proteins. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Diaoguo An
Full Text Available Rye (Secale cereale L. possesses many valuable genes that can be used for improving disease resistance, yield and environment adaptation of wheat (Triticum aestivum L.. However, the documented resistance stocks derived from rye is faced severe challenge due to the variation of virulent isolates in the pathogen populations. Therefore, it is necessary to develop desirable germplasm and search for novel resistance gene sources against constantly accumulated variation of the virulent isolates. In the present study, a new wheat-rye line designated as WR49-1 was produced through distant hybridization and chromosome engineering protocols between common wheat cultivar Xiaoyan 6 and rye cultivar German White. Using sequential GISH (genomic in situ hybridization, mc-FISH (multicolor fluorescence in situ hybridization, mc-GISH (multicolor GISH and EST (expressed sequence tag-based marker analysis, WR49-1 was proved to be a new wheat-rye 6R disomic addition line. As expected, WR49-1 showed high levels of resistance to wheat powdery mildew (Blumeria graminis f. sp. tritici, Bgt pathogens prevalent in China at the adult growth stage and 19 of 23 Bgt isolates tested at the seedling stage. According to its reaction pattern to different Bgt isolates, WR49-1 may possess new resistance gene(s for powdery mildew, which differed from the documented powdery mildew gene, including Pm20 on chromosome arm 6RL of rye. Additionally, WR49-1 was cytologically stable, had improved agronomic characteristics and therefore could serve as an important bridge for wheat breeding and chromosome engineering.
Directory of Open Access Journals (Sweden)
Juan J. González-Plaza
2018-01-01
Full Text Available Environments polluted by direct discharges of effluents from antibiotic manufacturing are important reservoirs for antibiotic resistance genes (ARGs, which could potentially be transferred to human pathogens. However, our knowledge about the identity and diversity of ARGs in such polluted environments remains limited. We applied functional metagenomics to explore the resistome of two Croatian antibiotic manufacturing effluents and sediments collected upstream of and at the effluent discharge sites. Metagenomic libraries built from an azithromycin-production site were screened for resistance to macrolide antibiotics, whereas the libraries from a site producing veterinary antibiotics were screened for resistance to sulfonamides, tetracyclines, trimethoprim, and beta-lactams. Functional analysis of eight libraries identified a total of 82 unique, often clinically relevant ARGs, which were frequently found in clusters and flanked by mobile genetic elements. The majority of macrolide resistance genes identified from matrices exposed to high levels of macrolides were similar to known genes encoding ribosomal protection proteins, macrolide phosphotransferases, and transporters. Potentially novel macrolide resistance genes included one most similar to a 23S rRNA methyltransferase from Clostridium and another, derived from upstream unpolluted sediment, to a GTPase HflX from Emergencia. In libraries deriving from sediments exposed to lower levels of veterinary antibiotics, we found 8 potentially novel ARGs, including dihydrofolate reductases and beta-lactamases from classes A, B, and D. In addition, we detected 7 potentially novel ARGs in upstream sediment, including thymidylate synthases, dihydrofolate reductases, and class D beta-lactamase. Taken together, in addition to finding known gene types, we report the discovery of novel and diverse ARGs in antibiotic-polluted industrial effluents and sediments, providing a qualitative basis for monitoring the
González-Plaza, Juan J.; Šimatović, Ana; Milaković, Milena; Bielen, Ana; Wichmann, Fabienne; Udiković-Kolić, Nikolina
2018-01-01
Environments polluted by direct discharges of effluents from antibiotic manufacturing are important reservoirs for antibiotic resistance genes (ARGs), which could potentially be transferred to human pathogens. However, our knowledge about the identity and diversity of ARGs in such polluted environments remains limited. We applied functional metagenomics to explore the resistome of two Croatian antibiotic manufacturing effluents and sediments collected upstream of and at the effluent discharge sites. Metagenomic libraries built from an azithromycin-production site were screened for resistance to macrolide antibiotics, whereas the libraries from a site producing veterinary antibiotics were screened for resistance to sulfonamides, tetracyclines, trimethoprim, and beta-lactams. Functional analysis of eight libraries identified a total of 82 unique, often clinically relevant ARGs, which were frequently found in clusters and flanked by mobile genetic elements. The majority of macrolide resistance genes identified from matrices exposed to high levels of macrolides were similar to known genes encoding ribosomal protection proteins, macrolide phosphotransferases, and transporters. Potentially novel macrolide resistance genes included one most similar to a 23S rRNA methyltransferase from Clostridium and another, derived from upstream unpolluted sediment, to a GTPase HflX from Emergencia. In libraries deriving from sediments exposed to lower levels of veterinary antibiotics, we found 8 potentially novel ARGs, including dihydrofolate reductases and beta-lactamases from classes A, B, and D. In addition, we detected 7 potentially novel ARGs in upstream sediment, including thymidylate synthases, dihydrofolate reductases, and class D beta-lactamase. Taken together, in addition to finding known gene types, we report the discovery of novel and diverse ARGs in antibiotic-polluted industrial effluents and sediments, providing a qualitative basis for monitoring the dispersal of ARGs
Directory of Open Access Journals (Sweden)
Sihui Li
2018-04-01
Full Text Available Summary: The arginine methylation status of histones dynamically changes during many cellular processes, including hematopoietic stem/progenitor cell (HSPC development. The arginine methyltransferases and the readers that transduce the histone codes have been defined. However, whether arginine demethylation actively occurs in cells and what enzyme demethylates the methylarginine residues during various cellular processes are unknown. We report that JMJD1B, previously identified as a lysine demethylase for H3K9me2, mediates arginine demethylation of H4R3me2s and its intermediate, H4R3me1. We show that demethylation of H4R3me2s and H3K9me2s in promoter regions is correlated with active gene expression. Furthermore, knockout of JMJD1B blocks demethylation of H4R3me2s and/or H3K9me2 at distinct clusters of genes and impairs the activation of genes important for HSPC differentiation and development. Consequently, JMJD1B−/− mice show defects in hematopoiesis. Altogether, our study demonstrates that demethylase-mediated active arginine demethylation process exists in eukaryotes and that JMJD1B demethylates both H4R3me2s and H3K9me2 for epigenetic programming during hematopoiesis. : Li et al. identify the arginine demethylase (RDM activity of JMJD1B, a known lysine demethylase (KDM. They reveal that JMJD1B actively mediates demethylation of histone markers H4R3me2s and H3K9me2 in hematopoietic stem/progenitor cells (HSPCs. Keywords: JMJD1B, KDM3B, PRMT5, arginine demethylase, histone, epigenetic programming, gene expression, hematopoiesis
Li, Fangwei; Shi, Wenhua; Wan, Yixin; Wang, Qingting; Feng, Wei; Yan, Xin; Wang, Jian; Chai, Limin; Zhang, Qianqian; Li, Manxiang
2017-12-01
The expression of microRNA (miR)-140-5p is known to be reduced in both pulmonary arterial hypertension (PAH) patients and monocrotaline-induced PAH models in rat. Identification of target genes for miR-140-5p with bioinformatics analysis may reveal new pathways and connections in PAH. This study aimed to explore downstream target genes and relevant signaling pathways regulated by miR-140-5p to provide theoretical evidences for further researches on role of miR-140-5p in PAH. Multiple downstream target genes and upstream transcription factors (TFs) of miR-140-5p were predicted in the analysis. Gene ontology (GO) enrichment analysis indicated that downstream target genes of miR-140-5p were enriched in many biological processes, such as biological regulation, signal transduction, response to chemical stimulus, stem cell proliferation, cell surface receptor signaling pathways. Kyoto Encyclopedia of Genes and Genome (KEGG) pathway analysis found that downstream target genes were mainly located in Notch, TGF-beta, PI3K/Akt, and Hippo signaling pathway. According to TF-miRNA-mRNA network, the important downstream target genes of miR-140-5p were PPI, TGF-betaR1, smad4, JAG1, ADAM10, FGF9, PDGFRA, VEGFA, LAMC1, TLR4, and CREB. After thoroughly reviewing published literature, we found that 23 target genes and seven signaling pathways were truly inhibited by miR-140-5p in various tissues or cells; most of these verified targets were in accordance with our present prediction. Other predicted targets still need further verification in vivo and in vitro .
Kirac, Deniz; Kasimay Cakir, Ozgur; Avcilar, Tuba; Deyneli, Oguzhan; Kurtel, Hizir; Yazici, Dilek; Kaspar, Elif Cigdem; Celik, Nurgul; Guney, Ahmet Ilter
2016-10-01
Obesity is a major contributory factor of morbidity and mortality. It has been suggested that biological systems may be involved in the tendency to be and to remain physically inactive also behaviors such as food and beverage preferences and nutrient intake may at least partially genetically determined. Consequently, besides environment, genetic factors may also contribute to the level of physical activity and eating behaviors thus effect obesity. Therefore the aim of this study is to investigate the effect of various gene mutations on obesity, physical activity levels and eating behavior phenotypes. One hundred patients and 100 controls were enrolled to the study. Physical activity levels were measured with an actical acceloremeter device. Eating behaviors were evaluated using Three-Factor Eating questionnaire (TFEQ). Associations between eating behavior scores and physical characteristics were also evaluated. The information about other obesity risk factors were also collected. Mutations were investigated with PCR, direct sequencing and Real-Time PCR. rs1051168, rs8050146 -2778C > T mutations were found statistically significant in patients, rs1121980 was found statistically significant in controls. 21 mutations were found in MC4R and near MC4R of which 18 of them are novel and 8 of them cause amino acid change. In addition, it was found that, some obesity related factors and questions of TFEQ are associated with various investigated gene mutations. Any relation between gene mutations and physical activity levels were not detected. It is thought that, due to the genotype data and eating behaviors, it may be possible to recommend patients for proper eating patterns to prevent obesity. © 2016 IUBMB Life, 68(10):806-816, 2016. © 2016 International Union of Biochemistry and Molecular Biology.
Zhu, Y B; Xie, X Q; Li, Z Y; Bai, H; Dong, L; Dong, Z P; Dong, J G
2014-08-28
The nucleotide-binding site (NBS) disease-resistance genes are the largest category of plant disease-resistance gene analogs. The complete set of disease-resistant candidate genes, which encode the NBS sequence, was filtered in the genomes of two varieties of foxtail millet (Yugu1 and 'Zhang gu'). This study investigated a number of characteristics of the putative NBS genes, such as structural diversity and phylogenetic relationships. A total of 269 and 281 NBS-coding sequences were identified in Yugu1 and 'Zhang gu', respectively. When the two databases were compared, 72 genes were found to be identical and 164 genes showed more than 90% similarity. Physical positioning and gene family analysis of the NBS disease-resistance genes in the genome revealed that the number of genes on each chromosome was similar in both varieties. The eighth chromosome contained the largest number of genes and the ninth chromosome contained the lowest number of genes. Exactly 34 gene clusters containing the 161 genes were found in the Yugu1 genome, with each cluster containing 4.7 genes on average. In comparison, the 'Zhang gu' genome possessed 28 gene clusters, which had 151 genes, with an average of 5.4 genes in each cluster. The largest gene cluster, located on the eighth chromosome, contained 12 genes in the Yugu1 database, whereas it contained 16 genes in the 'Zhang gu' database. The classification results showed that the CC-NBS-LRR gene made up the largest part of each chromosome in the two databases. Two TIR-NBS genes were also found in the Yugu1 genome.
Directory of Open Access Journals (Sweden)
Bin He
Full Text Available Oryza meyeriana (O. meyeriana, with a GG genome type (2n = 24, accumulated plentiful excellent characteristics with respect to resistance to many diseases such as rice shade and blast, even immunity to bacterial blight. It is very important to know if the diseases-resistant genes exist and express in this wild rice under native conditions. However, limited genomic or transcriptomic data of O. meyeriana are currently available. In this study, we present the first comprehensive characterization of the O. meyeriana transcriptome using RNA-seq and obtained 185,323 contigs with an average length of 1,692 bp and an N50 of 2,391 bp. Through differential expression analysis, it was found that there were most tissue-specifically expressed genes in roots, and next to stems and leaves. By similarity search against protein databases, 146,450 had at least a significant alignment to existed gene models. Comparison with the Oryza sativa (japonica-type Nipponbare and indica-type 93-11 genomes revealed that 13% of the O. meyeriana contigs had not been detected in O. sativa. Many diseases-resistant genes, such as bacterial blight resistant, blast resistant, rust resistant, fusarium resistant, cyst nematode resistant and downy mildew gene, were mined from the transcriptomic database. There are two kinds of rice bacterial blight-resistant genes (Xa1 and Xa26 differentially or specifically expressed in O. meyeriana. The 4 Xa1 contigs were all only expressed in root, while three of Xa26 contigs have the highest expression level in leaves, two of Xa26 contigs have the highest expression profile in stems and one of Xa26 contigs was expressed dominantly in roots. The transcriptomic database of O. meyeriana has been constructed and many diseases-resistant genes were found to express under native condition, which provides a foundation for future discovery of a number of novel genes and provides a basis for studying the molecular mechanisms associated with disease
Montes, Maria Jesus; Andrés, María Fe; Sin, E.; Lopez Braña, Isidoro; Martín-Sánchez, J.A.; Romero, M.D.; Delibes Castro, Angeles
2008-01-01
Cereal cyst nematode (CCN; Heterodera avenae Woll.) is a root pathogen of cereal crops that can cause severe yield losses in wheat (Triticum aestivum). Differential host–nematode interactions occur in wheat cultivars carrying different CCN resistance (Cre) genes. The objective of this study was to determine the CCN resistance conferred by the Cre7 gene from Aegilops triuncialis in a 42-chromosome introgression line and to assess the effects of the Cre1, Cre3, Cre4, and Cre8 genes present in A...
Obesity genes and insulin resistance.
Belkina, Anna C; Denis, Gerald V
2010-10-01
The exploding prevalence of insulin resistance and Type 2 diabetes (T2D) linked to obesity has become an alarming public health concern. Worldwide, approximately 171 million people suffer from obesity-induced diabetes and public health authorities expect this situation to deteriorate rapidly. An interesting clinical population of 'metabolically healthy but obese' (MHO) cases is relatively protected from T2D and its associated cardiovascular risk. The molecular basis for this protection is not well understood but is likely to involve reduced inflammatory responses. The inflammatory cells and pathways that respond to overnutrition are the primary subject matter for this review. The chance discovery of a genetic mutation in the Brd2 gene, which is located in the class II major histocompatibility complex and makes mice enormously fat but protects them from diabetes, offers revolutionary new insights into the cellular mechanisms that link obesity to insulin resistance and T2D. These Brd2-hypomorphic mice have reduced inflammation in fat that is normally associated with insulin resistance, and resemble MHO patients, suggesting novel therapeutic pathways for obese patients at risk for T2D. Deeper understanding of the functional links between genes that control inflammatory responses to diet-induced obesity is crucial to the development of therapies for obese, insulin-resistant patients.
Pardos de la Gandara, Maria; Borges, Vitor; Chung, Marilyn; Milheiriço, Catarina; Gomes, João Paulo; de Lencastre, Herminia; Tomasz, Alexander
2018-06-01
Methicillin-resistant Staphylococcus aureus (MRSA) strains carry either a mecA - or a mecC -mediated mechanism of resistance to beta-lactam antibiotics, and the phenotypic expression of resistance shows extensive strain-to-strain variation. In recent communications, we identified the genetic determinants associated with the stringent stress response that play a major role in the antibiotic resistant phenotype of the historically earliest "archaic" clone of MRSA and in the mecC -carrying MRSA strain LGA251. Here, we sought to test whether or not the same genetic determinants also contribute to the resistant phenotype of highly and homogeneously resistant (H*R) derivatives of a major contemporary MRSA clone, USA300. We found that the resistance phenotype was linked to six genes ( fruB , gmk , hpt , purB , prsA , and relA ), which were most frequently targeted among the analyzed 20 H*R strains (one mutation per clone in 19 of the 20 H*R strains). Besides the strong parallels with our previous findings (five of the six genes matched), all but one of the repeatedly targeted genes were found to be linked to guanine metabolism, pointing to the key role that this pathway plays in defining the level of antibiotic resistance independent of the clonal type of MRSA. Copyright © 2018 American Society for Microbiology.
Presence of antiseptic resistance genes in porcine methicillin-resistant Staphylococcus aureus.
Wong, T Z; Zhang, M; O'Donoghue, M; Boost, M
2013-03-23
Numerous studies have documented the presence of methicillin-resistant Staphylococcus aureus (MRSA) in meat-producing animals, which has led to concern about its spread into the community. Disinfectants play an important role in reduction of contamination in both animal husbandry and food-preparation, helping control spread of organisms from foodstuffs, including raw meat. Plasmid-borne antiseptic resistance (AR) genes increasing tolerance to several disinfectants have been reported in S. aureus of human origin (qacA/B and smr) and from bovine, equine, and caprine staphylococcal isolates (qacG, qacH, and qacJ). This study investigated the presence of AR genes in porcine MRSA isolates. Plasmid DNA from 100 MRSA ST9 strains isolated from pig carcasses was amplified for the presence of AR genes. Minimum inhibitory concentrations (MICs) and minimum bactericidal concentrations (MBCs) to benzalkonium chloride (BC) and chlorhexidine gluconate (CHX) were determined in AR gene-positive isolates. qacG was present in 45 strains, eight of which also harbored smr. No strains carried qacA/B, qacH or qacJ. Presence of smr increased MICs to both BC and CHX and MBCs of CHX, but qacG presence only resulted in elevated MBC for CHX. This is the first report of AR genes from a porcine source. AR gene positivity has previously been associated with methicillin resistance and AR gene presence in these strains may increase their ability to persist in the environment. Improved implementation of hygiene measures during transportation and pre- and post-slaughter should be considered to prevent spread in the community. Copyright © 2012 Elsevier B.V. All rights reserved.
DNA tagging of blast resistant gene(s in three Brazilian rice cultivars
Directory of Open Access Journals (Sweden)
S.S. Sandhu
2003-12-01
Full Text Available Rice blast is the most important fungal disease of rice and is caused by Pyricularia oryzae Sacc. (Telomorph Magnoporthe grisea Barr.. Seven randomly amplified polymorphic DNA (RAPD markers OPA5, OPG17, OPG18, OPG19, OPF9, OPF17 and OPF19 showed very clear polymorphism in resistant cultivar lines which differed from susceptible lines. By comparing different susceptible lines, nine DNA amplifications of seven primers (OPA5(1000, OPA5(1200, OPG17(700, OPG18(850, OPG19(500, OPG19(600, OPF9(600, OPF17(1200 and OPF19(600 were identified as dominant markers for the blast resistant gene in resistant cultivar lines. These loci facilitate the indirect scoring of blast resistant and blast susceptible genotypes. The codomine RAPDs markers will facilitate marker-assisted selection of the blast resistant gene in two blast resistant genotypes of rice (Labelle and Line 11 and will be useful in rice breeding programs.
Hu, Hanqing; Wang, Meng; Guan, Xu; Yuan, Ziming; Liu, Zheng; Zou, Chaoxia; Wang, Guiyu; Gao, Xu; Wang, Xishan
2018-02-28
The adenosine triphosphate-binding cassette (ABC) is a large group of proteins involved in material transportation, cellular homeostasis, and closely associated with chemoresistance. ATP-binding cassette protein B4 (ABCB4) is a member of ABCs which has a similar structure to ABCB1, but fewer researches were performed. The present study is aimed to investigate the putative mechanism of ABCB4 in 5-fluorouracil (5-Fu) resistance. Then, we found that ABCB4 was significantly down-regulated in the 5-Fu resistant HCT8 cell lines by polymerase chain reaction (PCR) and Western blot. The knockdown of ABCB4 by small interfering RNA decreased the apoptosis by 5-Fu in resistant HCT8R cell lines without influencing the proliferation. Also, we found a lower expression of cleaved caspase and PARP by Western blot after the knockdown of ABCB4. However, the knockdown of ABCB4 did not influence the proliferation and apoptosis. Furthermore, the histological detection of ABCB4 mRNA level in human colorectal cancer tissues and even in the recurrent tissues after 5-Fu single-agent chemotherapy was employed to provide more concrete evidence that ABCB4 may be a tumor suppressor gene to regulate chemoresistance in colorectal cancer. Moreover, a 109-patient cohort revealed that ABCB4 predicted a poor recurrence-free survival and overall survival. In summary, ABCB4 was down-regulated in the 5-Fu resistant cells and knockdown of ABCB4 alleviated the cell apoptosis and predicts a shorter recurrence-free survival and overall survival. © 2018 The Author(s).
Matsui, Mariko; Soupé, Marie-Estelle; Becam, Jérôme; Goarant, Cyrille
2012-09-01
Transcripts of Leptospira 16S rRNA, FlaB, LigB, LipL21, LipL32, LipL36, LipL41, and OmpL37 were quantified in the blood of susceptible (hamsters) and resistant (mice) animal models of leptospirosis. We first validated adequate reference genes and then evaluated expression patterns in vivo compared to in vitro cultures. LipL32 expression was downregulated in vivo and differentially regulated in resistant and susceptible animals. FlaB expression was also repressed in mice but not in hamsters. In contrast, LigB and OmpL37 were upregulated in vivo. Thus, we demonstrated that a virulent strain of Leptospira differentially adapts its gene expression in the blood of infected animals.
International Nuclear Information System (INIS)
Wang Wei; Li Hongmin; Wu Xueqiong; Wang Ansheng; Ye Yixiu; Wang Zhongyuan; Liu Jinwei; Chen Hongbing; Lin Minggui; Wang Jinhe; Li Sumei; Jiang Ping; Feng Bai; Chen Dongjing
2004-01-01
To investigate drug resistance of mycobacterium tuberculosis in different age group, compare detecting effect of two methods and evaluate their the clinical application value, all of the strains of mycobacterium tuberculosis were tested for resistance to RFP, INH SM PZA and EMB by the absolute concentration method on Lowenstein-Jensen medium and the mutation of the rpoB, katG, rpsL, pncA and embB resistance genes in M. tuberculosis was tested by PCR-SSCP. In youth, middle and old age group, the rate of acquired drug resistance was 89.2%, 85.3% and 67.6% respectively, the gene mutation rate was 76.2%, 81.3% and 63.2% respectively. The rate of acquired drug resistance and multiple drug resistance in youth group was much higher than those in other groups. The gene mutation was correlated with drug resistance level of mycobacterium tuberculosis. The gene mutation rate was higher in strains isolated from high concentration resistance than those in strains isolated from low concentration resistance. The more irregular treatment was longer, the rate of drug resistance was higher. Acquired drug resistance varies in different age group. It suggested that surveillance of drug resistence in different age group should be taken seriously, especially in youth group. PCR - SSCP is a sensitive and specific method for rapid detecting rpoB, katG, rpsL, pncA and embB genes mutations of MTB. (authors)
Rhodnius prolixus supergene families of enzymes potentially associated with insecticide resistance.
Schama, Renata; Pedrini, Nicolás; Juárez, M Patricia; Nelson, David R; Torres, André Q; Valle, Denise; Mesquita, Rafael D
2016-02-01
Chagas disease or American trypanosomiasis, is a potentially life-threatening illness caused by the protozoan parasite, Trypanosoma cruzi. Once known as an endemic health problem of poor rural populations in Latin American countries, it has now spread worldwide. The parasite is transmitted by triatomine bugs, of which Rhodnius prolixus (Hemiptera, Reduviidae, Triatominae) is one of the vectors and a model organism. This species occurs mainly in Central and South American countries where the disease is endemic. Disease prevention focuses on vector control programs that, in general, rely intensely on insecticide use. However, the massive use of chemical insecticides can lead to resistance. One of the major mechanisms is known as metabolic resistance that is associated with an increase in the expression or activity of detoxification genes. Three of the enzyme families that are involved in this process - carboxylesterases (CCE), glutathione s-transferases (GST) and cytochrome P450s (CYP) - are analyzed in the R. prolixus genome. A similar set of detoxification genes to those of the Hemipteran Acyrthosiphon pisum but smaller than in most dipteran species was found in R. prolixus genome. All major CCE classes (43 genes found) are present but the pheromone/hormone processing class had fewer genes than usual. One main expansion was detected on the detoxification/dietary class. The phosphotriesterase family, recently associated with insecticide resistance, was also represented with one gene. One microsomal GST gene was found and the cytosolic GST gene count (14 genes) is extremely low when compared to the other hemipteran species with sequenced genomes. However, this is similar to Apis mellifera, a species known for its deficit in detoxification genes. In R. prolixus 88 CYP genes were found, with representatives in the four clans (CYP2, CYP3, CYP4 and mitochondrial) usually found in insects. R. prolixus seems to have smaller species-specific expansions of CYP genes than
Directory of Open Access Journals (Sweden)
Yunping Shen
2013-05-01
Full Text Available In the plant Arabidopsis thaliana, multiple quantitative trait loci (QTLs, including RFO2, account for the strong resistance of accession Columbia-0 (Col-0 and relative susceptibility of Taynuilt-0 (Ty-0 to the vascular wilt fungus Fusarium oxysporum forma specialis matthioli. We find that RFO2 corresponds to diversity in receptor-like protein (RLP genes. In Col-0, there is a tandem pair of RLP genes: RFO2/At1g17250 confers resistance while RLP2 does not. In Ty-0, the highly diverged RFO2 locus has one RLP gene conferring weaker resistance. While the endogenous RFO2 makes a modest contribution to resistance, transgenic RFO2 provides strong pathogen-specific resistance. The extracellular leucine-rich repeats (eLRRs in RFO2 and RLP2 are interchangeable for resistance and remarkably similar to eLRRs in the receptor-like kinase PSY1R, which perceives tyrosine-sulfated peptide PSY1. Reduced infection in psy1r and mutants of related phytosulfokine (PSK receptor genes PSKR1 and PSKR2 shows that tyrosine-sulfated peptide signaling promotes susceptibility. The related eLRRs in RFO2 and PSY1R are not interchangeable; and expression of the RLP nPcR, in which eLRRs in RFO2 are replaced with eLRRs in PSY1R, results in constitutive resistance. Counterintuitively, PSY1 signaling suppresses nPcR because psy1r nPcR is lethal. The fact that PSK signaling does not similarly affect nPcR argues that PSY1 signaling directly downregulates the expression of nPcR. Our results support a speculative but intriguing model to explain RFO2's role in resistance. We propose that F. oxysporum produces an effector that inhibits the normal negative feedback regulation of PSY1R, which stabilizes PSY1 signaling and induces susceptibility. However, RFO2, acting as a decoy receptor for PSY1R, is also stabilized by the effector and instead induces host immunity. Overall, the quantitative resistance of RFO2 is reminiscent of the better-studied monogenic resistance traits.
Directory of Open Access Journals (Sweden)
Sylwia Okoń
2012-10-01
Full Text Available The aim of the present study was to characterize and identify powdery mildew resistance genes in Polish common oat cultivars using host-pathogen tests. A differential set of six Blumeria graminis f.sp. avenae isolates virulent or avirulent to four cultivars and one line that has known resistance to powdery mildew were used. Among the investigated cultivars, only four of them (13.3% had resistance patterns similar to genotypes belonging to the differential set. The resistance of OMR group 1 was found in the cultivar ‘Dragon’, while that of OMR2 in the cultivar ‘Skrzat’. The cultivars ‘Deresz’ and ‘Hetman’ showed a resistance pattern that corresponded with OMR group 3. The resistance corresponding to OMR4 was not found, which suggests that until now this gene has not been used in Polish oat breeding programmes. The cultivar ‘Canyon’ had a different pat- tern of resistance than the genotypes that have already known OMR genes, which indicates that the resistance of this cultivar is determined by a new gene or a combination of known genes.
Beauparlant, Marc A; Drouin, Guy
2014-02-01
Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.
Methylation of WTH3, a possible drug resistant gene, inhibits p53 regulated expression
International Nuclear Information System (INIS)
Tian, Kegui; Wang, Yuezeng; Huang, Yu; Sun, Boqiao; Li, Yuxin; Xu, Haopeng
2008-01-01
Previous results showed that over-expression of the WTH3 gene in MDR cells reduced MDR1 gene expression and converted their resistance to sensitivity to various anticancer drugs. In addition, the WTH3 gene promoter was hypermethylated in the MCF7/AdrR cell line and primary drug resistant breast cancer epithelial cells. WTH3 was also found to be directly targeted and up regulated by the p53 gene. Furthermore, over expression of the WTH3 gene promoted the apoptotic phenotype in various host cells. To further confirm WTH3's drug resistant related characteristics, we recently employed the small hairpin RNA (shRNA) strategy to knockdown its expression in HEK293 cells. In addition, since the WTH3 promoter's p53-binding site was located in a CpG island that was targeted by methylation, we were interested in testing the possible effect this epigenetic modification had on the p53 transcription factor relative to WTH3 expression. To do so, the in vitro methylation method was utilized to examine the p53 transgene's influence on either the methylated or non-methylated WTH3 promoter. The results generated from the gene knockdown strategy showed that reduction of WTH3 expression increased MDR1 expression and elevated resistance to Doxorubicin as compared to the original control cells. Data produced from the methylation studies demonstrated that DNA methylation adversely affected the positive impact of p53 on WTH3 promoter activity. Taken together, our studies provided further evidence that WTH3 played an important role in MDR development and revealed one of its transcription regulatory mechanisms, DNA methylation, which antagonized p53's positive impact on WTH3 expression
Su, Hao-Chang; Ying, Guang-Guo; Tao, Ran; Zhang, Rui-Quan; Fogarty, Lisa R.; Kolpin, Dana W.
2011-01-01
Antibiotics are still widely applied in animal husbandry to prevent diseases and used as feed additives to promote animal growth. This could result in antibiotic resistance to bacteria and antibiotic residues in animals. In this paper, Enterobacteriaceae isolated from four integrated fish farms in Zhongshan, South China were tested for antibiotic resistance, tetracycline resistance genes, sulfonamide resistance genes, and class 1 integrons. The Kirby-Bauer disk diffusion method and polymerase chain reaction (PCR) assays were carried out to test antibiotic susceptibility and resistance genes, respectively. Relatively high antibiotic resistance frequencies were found, especially for ampicillin (80%), tetracycline (52%), and trimethoprim (50%). Out of 203 Enterobacteriaceae isolates, 98.5% were resistant to one or more antibiotics tested. Multiple antibiotic resistance (MAR) was found highest in animal manures with a MAR index of 0.56. Tetracycline resistance genes (tet(A), tet(C)) and sulfonamide resistance genes (sul2) were detected in more than 50% of the isolates. The intI1 gene was found in 170 isolates (83.7%). Both classic and non-classic class 1 integrons were found. Four genes, aadA5, aadA22, dfr2, and dfrA17, were detected. To our knowledge, this is the first report for molecular characterization of antibiotic resistance genes in Enterobacteriaceae isolated from integrated fish farms in China and the first time that gene cassette array dfrA17-aadA5 has been detected in such fish farms. Results of this study indicated that fish farms may be a reservoir of highly diverse and abundant antibiotic resistant genes and gene cassettes. Integrons may play a key role in multiple antibiotic resistances posing potential health risks to the general public and aquaculture.
Tong, Mengsha; Zheng, Weicheng; Lu, Xingrong; Ao, Lu; Li, Xiangyu; Guan, Qingzhou; Cai, Hao; Li, Mengyao; Yan, Haidan; Guo, You; Chi, Pan; Guo, Zheng
2015-12-01
Until recently, few molecular signatures of drug resistance identified in drug-induced resistant cancer cell models can be translated into clinical practice. Here, we defined differentially expressed genes (DEGs) between pre-chemotherapy colorectal cancer (CRC) tissue samples of non-responders and responders for 5-fluorouracil and oxaliplatin-based therapy as clinically relevant drug resistance genes (CRG5-FU/L-OHP). Taking CRG5-FU/L-OHP as reference, we evaluated the clinical relevance of several types of genes derived from HCT116 CRC cells with resistance to 5-fluorouracil and oxaliplatin, respectively. The results revealed that DEGs between parental and resistant cells, when both were treated with the corresponding drug for a certain time, were significantly consistent with the CRG5-FU/L-OHP as well as the DEGs between the post-chemotherapy CRC specimens of responders and non-responders. This study suggests a novel strategy to extract clinically relevant drug resistance genes from both drug-induced resistant cell models and post-chemotherapy cancer tissue specimens.
Directory of Open Access Journals (Sweden)
Wan Hongjian
2012-09-01
Full Text Available Abstract Background Pepper (Capsicum annuum L. is one of the most important vegetable crops worldwide. However, its yield and fruit quality can be severely threatened by several pathogens. The plant nucleotide-binding site (NBS-leucine-rich repeat (LRR gene family is the largest class of known disease resistance genes (R genes effective against such pathogens. Therefore, the isolation and identification of such R gene homologues from pepper will provide a critical foundation for improving disease resistance breeding programs. Results A total of 78 R gene analogues (CaRGAs were identified in pepper by degenerate PCR amplification and database mining. Phylogenetic tree analysis of the deduced amino acid sequences for 51 of these CaRGAs with typically conserved motifs ( P-loop, kinase-2 and GLPL along with some known R genes from Arabidopsis and tomato grouped these CaRGAs into the non-Toll interleukin-1 receptor (TIR-NBS-LRR (CaRGAs I to IV and TIR-NBS-LRR (CaRGAs V to VII subfamilies. The presence of consensus motifs (i.e. P-loop, kinase-2 and hydrophobic domain is typical of the non-TIR- and TIR-NBS-LRR gene subfamilies. This finding further supports the view that both subfamilies are widely distributed in dicot species. Functional divergence analysis provided strong statistical evidence of altered selective constraints during protein evolution between the two subfamilies. Thirteen critical amino acid sites involved in this divergence were also identified using DIVERGE version 2 software. Analyses of non-synonymous and synonymous substitutions per site showed that purifying selection can play a critical role in the evolutionary processes of non-TIR- and TIR-NBS-LRR RGAs in pepper. In addition, four specificity-determining positions were predicted to be responsible for functional specificity. qRT-PCR analysis showed that both salicylic and abscisic acids induce the expression of CaRGA genes, suggesting that they may primarily be involved in
Upadhyaya, Hari D; Wang, Yi-Hong; Sharma, Rajan; Sharma, Shivali
2013-06-01
Anthracnose in sorghum caused by Colletotrichum sublineolum is one of the most destructive diseases affecting sorghum production under warm and humid conditions. Markers and genes linked to resistance to the disease are important for plant breeding. Using 14,739 SNP markers, we have mapped eight loci linked to resistance in sorghum through association analysis of a sorghum mini-core collection consisting of 242 diverse accessions evaluated for anthracnose resistance for 2 years in the field. The mini-core was representative of the International Crops Research Institute for the Semi-Arid Tropics' world-wide sorghum landrace collection. Eight marker loci were associated with anthracnose resistance in both years. Except locus 8, disease resistance-related genes were found in all loci based on their physical distance from linked SNP markers. These include two NB-ARC class of R genes on chromosome 10 that were partially homologous to the rice blast resistance gene Pib, two hypersensitive response-related genes: autophagy-related protein 3 on chromosome 1 and 4 harpin-induced 1 (Hin1) homologs on chromosome 8, a RAV transcription factor that is also part of R gene pathway, an oxysterol-binding protein that functions in the non-specific host resistance, and homologs of menthone:neomenthol reductase (MNR) that catalyzes a menthone reduction to produce the antimicrobial neomenthol. These genes and markers may be developed into molecular tools for genetic improvement of anthracnose resistance in sorghum.
Mefloquine resistance in Plasmodium falciparum and increased pfmdr1 gene copy number.
Price, Ric N; Uhlemann, Anne-Catrin; Brockman, Alan; McGready, Rose; Ashley, Elizabeth; Phaipun, Lucy; Patel, Rina; Laing, Kenneth; Looareesuwan, Sornchai; White, Nicholas J; Nosten, François; Krishna, Sanjeev
The borders of Thailand harbour the world's most multidrug resistant Plasmodium falciparum parasites. In 1984 mefloquine was introduced as treatment for uncomplicated falciparum malaria, but substantial resistance developed within 6 years. A combination of artesunate with mefloquine now cures more than 95% of acute infections. For both treatment regimens, the underlying mechanisms of resistance are not known. The relation between polymorphisms in the P falciparum multidrug resistant gene 1 (pfmdr1) and the in-vitro and in-vivo responses to mefloquine were assessed in 618 samples from patients with falciparum malaria studied prospectively over 12 years. pfmdr1 copy number was assessed by a robust real-time PCR assay. Single nucleotide polymorphisms of pfmdr1, P falciparum chloroquine resistance transporter gene (pfcrt) and P falciparum Ca2+ ATPase gene (pfATP6) were assessed by PCR-restriction fragment length polymorphism. Increased copy number of pfmdr1 was the most important determinant of in-vitro and in-vivo resistance to mefloquine, and also to reduced artesunate sensitivity in vitro. In a Cox regression model with control for known confounders, increased pfmdr1 copy number was associated with an attributable hazard ratio (AHR) for treatment failure of 6.3 (95% CI 2.9-13.8, p<0.001) after mefloquine monotherapy and 5.4 (2.0-14.6, p=0.001) after artesunate-mefloquine therapy. Single nucleotide polymorphisms in pfmdr1 were associated with increased mefloquine susceptibility in vitro, but not in vivo. Amplification in pfmdr1 is the main cause of resistance to mefloquine in falciparum malaria. Multidrug resistant P falciparum malaria is common in southeast Asia, but difficult to identify and treat. Genes that encode parasite transport proteins maybe involved in export of drugs and so cause resistance. In this study we show that increase in copy number of pfmdr1, a gene encoding a parasite transport protein, is the best overall predictor of treatment failure with
Piekarska, Katarzyna; Zacharczuk, Katarzyna; Wołkowicz, Tomasz; Rzeczkowska, Magdalena; Bareja, Elżbieta; Olak, Monika; Gierczyński, Rafał
2016-01-01
Aminoglycosides are a group of antimicrobial agents still the most commonly used in the treatment of life-threatening bacterial infections in human and animals. The emergence and spread of 16S rRNA methylases, which confer high-level resistance to the majority of clinically relevant aminoglycosides, constitute a major public health concern. Our goal was to evaluate the distribution of 16S rRNA methylases among different species of Enterobacteriaceae during a five month-long survey in a tertiary hospital in Warszawa, Poland. In the survey, a total of 1770 non-duplicate clinical isolates were collected from all hospital wards in a tertiary hospital in Warszawa, Poland. The survey was conducted between 19 April and 19 September 2010. The ability to produce 16S rRNA methylase was examined by determining MICs for gentamicin, kanamycin, amikacin by means of the agar dilution method. The isolates resistant to high concentration of aminoglycosides were PCR tested for genes: armA, rmtA, rmtB and rmtC. PCR products were subjected to DNA sequencing by the Sanger method. The genetic similarity of the ArmA-producing isolates was analysed by pulsed-filed gel electrophoresis (PFGE). ArmA was the only 16S rRNA methylase detected in 20 of 1770 tested isolates. The overall prevalence rate of ArmA was 1.13%. In K. pneumoniae (n = 742), P. mirabilis (n = 130), and E. cloacae (n = 253) collected in the survey, the prevalence of ArmA was 0.4%, 0.8% and 5.9%, respectively. The PFGE revealed both horizontal and clonal spread of the armA gene in the hospital. The prevalence of 16S rRNA methylase ArmA reported in this study is significantly higher than observed in other countries in Europe.
Widana Gamage, Shirani M K; McGrath, Desmond J; Persley, Denis M; Dietzgen, Ralf G
2016-01-01
Capsicum chlorosis virus (CaCV) is an emerging pathogen of capsicum, tomato and peanut crops in Australia and South-East Asia. Commercial capsicum cultivars with CaCV resistance are not yet available, but CaCV resistance identified in Capsicum chinense is being introgressed into commercial Bell capsicum. However, our knowledge of the molecular mechanisms leading to the resistance response to CaCV infection is limited. Therefore, transcriptome and expression profiling data provide an important resource to better understand CaCV resistance mechanisms. We assembled capsicum transcriptomes and analysed gene expression using Illumina HiSeq platform combined with a tag-based digital gene expression system. Total RNA extracted from CaCV/mock inoculated CaCV resistant (R) and susceptible (S) capsicum at the time point when R line showed a strong hypersensitive response to CaCV infection was used in transcriptome assembly. Gene expression profiles of R and S capsicum in CaCV- and buffer-inoculated conditions were compared. None of the genes were differentially expressed (DE) between R and S cultivars when mock-inoculated, while 2484 genes were DE when inoculated with CaCV. Functional classification revealed that the most highly up-regulated DE genes in R capsicum included pathogenesis-related genes, cell death-associated genes, genes associated with hormone-mediated signalling pathways and genes encoding enzymes involved in synthesis of defense-related secondary metabolites. We selected 15 genes to confirm DE expression levels by real-time quantitative PCR. DE transcript profiling data provided comprehensive gene expression information to gain an understanding of the underlying CaCV resistance mechanisms. Further, we identified candidate CaCV resistance genes in the CaCV-resistant C. annuum x C. chinense breeding line. This knowledge will be useful in future for fine mapping of the CaCV resistance locus and potential genetic engineering of resistance into Ca
Kaur, Surleen; Archer, Kellie J; Devi, M Gouri; Kriplani, Alka; Strauss, Jerome F; Singh, Rita
2012-10-01
Polycystic ovary syndrome (PCOS) is a heterogeneous, genetically complex, endocrine disorder of uncertain etiology in women. Our aim was to compare the gene expression profiles in stimulated granulosa cells of PCOS women with and without insulin resistance vs. matched controls. This study included 12 normal ovulatory women (controls), 12 women with PCOS without evidence for insulin resistance (PCOS non-IR), and 16 women with insulin resistance (PCOS-IR) undergoing in vitro fertilization. Granulosa cell gene expression profiling was accomplished using Affymetrix Human Genome-U133 arrays. Differentially expressed genes were classified according to gene ontology using ingenuity pathway analysis tools. Microarray results for selected genes were confirmed by real-time quantitative PCR. A total of 211 genes were differentially expressed in PCOS non-IR and PCOS-IR granulosa cells (fold change≥1.5; P≤0.001) vs. matched controls. Diabetes mellitus and inflammation genes were significantly increased in PCOS-IR patients. Real-time quantitative PCR confirmed higher expression of NCF2 (2.13-fold), TCF7L2 (1.92-fold), and SERPINA1 (5.35-fold). Increased expression of inflammation genes ITGAX (3.68-fold) and TAB2 (1.86-fold) was confirmed in PCOS non-IR. Different cardiometabolic disease genes were differentially expressed in the two groups. Decreased expression of CAV1 (-3.58-fold) in PCOS non-IR and SPARC (-1.88-fold) in PCOS-IR was confirmed. Differential expression of genes involved in TGF-β signaling (IGF2R, increased; and HAS2, decreased), and oxidative stress (TXNIP, increased) was confirmed in both groups. Microarray analysis demonstrated differential expression of genes linked to diabetes mellitus, inflammation, cardiovascular diseases, and infertility in the granulosa cells of PCOS women with and without insulin resistance. Because these dysregulated genes are also involved in oxidative stress, lipid metabolism, and insulin signaling, we hypothesize that these
Directory of Open Access Journals (Sweden)
Na Wang
Full Text Available Antibiotic-resistant bacteria and genes are recognized as new environmental pollutants that warrant special concern. There were few reports on veterinary antibiotic-resistant bacteria and genes in China. This work systematically analyzed the prevalence and distribution of sulfonamide resistance genes in soils from the environments around poultry and livestock farms in Jiangsu Province, Southeastern China. The results showed that the animal manure application made the spread and abundance of antibiotic resistance genes (ARGs increasingly in the soil. The frequency of sulfonamide resistance genes was sul1 > sul2 > sul3 in pig-manured soil DNA and sul2 > sul1 > sul3 in chicken-manured soil DNA. Further analysis suggested that the frequency distribution of the sul genes in the genomic DNA and plasmids of the SR isolates from manured soil was sul2 > sul1 > sul3 overall (p<0.05. The combination of sul1 and sul2 was the most frequent, and the co-existence of sul1 and sul3 was not found either in the genomic DNA or plasmids. The sample type, animal type and sampling time can influence the prevalence and distribution pattern of sulfonamide resistance genes. The present study also indicated that Bacillus, Pseudomonas and Shigella were the most prevalent sul-positive genera in the soil, suggesting a potential human health risk. The above results could be important in the evaluation of antibiotic-resistant bacteria and genes from manure as sources of agricultural soil pollution; the results also demonstrate the necessity and urgency of the regulation and supervision of veterinary antibiotics in China.
Overexpression of antibiotic resistance genes in hospital effluents over time.
Rowe, Will P M; Baker-Austin, Craig; Verner-Jeffreys, David W; Ryan, Jim J; Micallef, Christianne; Maskell, Duncan J; Pearce, Gareth P
2017-06-01
Effluents contain a diverse abundance of antibiotic resistance genes that augment the resistome of receiving aquatic environments. However, uncertainty remains regarding their temporal persistence, transcription and response to anthropogenic factors, such as antibiotic usage. We present a spatiotemporal study within a river catchment (River Cam, UK) that aims to determine the contribution of antibiotic resistance gene-containing effluents originating from sites of varying antibiotic usage to the receiving environment. Gene abundance in effluents (municipal hospital and dairy farm) was compared against background samples of the receiving aquatic environment (i.e. the catchment source) to determine the resistome contribution of effluents. We used metagenomics and metatranscriptomics to correlate DNA and RNA abundance and identified differentially regulated gene transcripts. We found that mean antibiotic resistance gene and transcript abundances were correlated for both hospital ( ρ = 0.9, two-tailed P hospital effluent samples. High β-lactam resistance gene transcript abundance was related to hospital antibiotic usage over time and hospital effluents contained antibiotic residues. We conclude that effluents contribute high levels of antibiotic resistance genes to the aquatic environment; these genes are expressed at significant levels and are possibly related to the level of antibiotic usage at the effluent source. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy.
Taxonomic resolutions based on 18S rRNA genes: a case study of subclass copepoda.
Directory of Open Access Journals (Sweden)
Shu Wu
Full Text Available Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1-9 within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%; and could aid in species-level analyses, but with some limitations; 2 nearly-whole-length sequences and some partial regions (around V2, V4, and V9 of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%; 3 compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%; and 4 V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy.
Strain-specific impact of PsaR of Streptococcus pneumoniae on global gene expression and virulence
Hendriksen, Wouter T.; Bootsma, Hester J.; van Diepen, Angela; Estevao, Silvia; Kuipers, Oscar P.; de Groot, Ronald; Hermans, Peter W. M.
2009-01-01
Previous studies have indicated that PsaR of Streptococcus pneumoniae is a manganese-dependent regulator, negatively affecting the expression of at least seven genes. Here, we extended these observations by transcriptome and proteome analysis of psaR mutants in strains D39 and TIGR4. The microarray analysis identified three shared PsaR targets: the psa operon, pcpA and prtA. In addition, we found 31 genes to be regulated by PsaR in D39 only, most strikingly a cellobiose-specific phosphotrains...
Molecular characterization of the CRa gene conferring clubroot resistance in Brassica rapa.
Ueno, Hiroki; Matsumoto, Etsuo; Aruga, Daisuke; Kitagawa, Satoshi; Matsumura, Hideo; Hayashida, Nobuaki
2012-12-01
Clubroot disease is one of the major diseases affecting Brassicaceae crops, and a number of these crops grown commercially, such as Chinese cabbage (Brassica rapa L. ssp. pekinensis), are known to be highly susceptible to clubroot disease. To provide protection from this disease, plant breeders have introduced genes for resistance to clubroot from the European turnip into susceptible lines. The CRa gene confers specific resistance to the clubroot pathogen Plasmodiophora brassicae isolate M85. Fine mapping of the CRa locus using synteny to the Arabidopsis thaliana genome and partial genome sequences of B. rapa revealed a candidate gene encoding a TIR-NBS-LRR protein. Several structural differences in this candidate gene were found between susceptible and resistant lines, and CRa expression was observed only in the resistant line. Four mutant lines lacking clubroot resistance were obtained by the UV irradiation of pollen from a resistant line, and all of these mutant lines carried independent mutations in the candidate TIR-NBS-LRR gene. This genetic and molecular evidence strongly suggests that the identified gene is CRa. This is the first report on the molecular characterization of a clubroot Resistance gene in Brassicaceae and of the disease resistance gene in B. rapa.
Gene Profiling in Late Blight Resistance in Potato Genotype SD20
Directory of Open Access Journals (Sweden)
Xiaohui Yang
2018-06-01
Full Text Available Late blight caused by the oomycete fungus Phytophthora infestans (Pi is the most serious obstacle to potato (Solanum tuberosum production in the world. A super race isolate, CN152, which was identified from Sichuan Province, China, could overcome nearly all known late blight resistance genes and caused serious damage in China. The potato genotype SD20 was verified to be highly resistant to CN152; however, the molecular regulation network underlying late blight resistance pathway remains unclear in SD20. Here, we performed a time-course experiment to systematically profile the late blight resistance response genes using RNA-sequencing in SD20. We identified 3354 differentially expressed genes (DEGs, which mainly encoded transcription factors and protein kinases, and also included four NBS-LRR genes. The late blight responsive genes showed time-point-specific induction/repression. Multi-signaling pathways of salicylic acid, jasmonic acid, and ethylene signaling pathways involved in resistance and defense against Pi in SD20. Gene Ontology and KEGG analyses indicated that the DEGs were significantly enriched in metabolic process, protein serine/threonine kinase activity, and biosynthesis of secondary metabolites. Forty-three DEGs were involved in immune response, of which 19 were enriched in hypersensitive response reaction, which could play an important role in broad-spectrum resistance to Pi infection. Experimental verification confirmed the induced expression of the responsive genes in the late blight resistance signaling pathway, such as WRKY, ERF, MAPK, and NBS-LRR family genes. Our results provided valuable information for understanding late blight resistance mechanism of potato.
Tao, Bo; Shao, Bai-Hui; Qiao, Yu-Xin; Wang, Xiao-Qin; Chang, Shu-Jun; Qiu, Li-Juan
2017-08-01
Glyphosate is a widely used broad spectrum herbicide; however, this limits its use once crops are planted. If glyphosate-resistant crops are grown, glyphosate can be used for weed control in crops. While several glyphosate resistance genes are used in commercial glyphosate tolerant crops, there is interest in identifying additional genes for glyphosate tolerance. This research constructed a high-quality cDNA library form the glyphosate-resistant fungus Aspergillus oryzae RIB40 to identify genes that may confer resistance to glyphosate. Using a medium containing glyphosate (120mM), we screened several clones from the library. Based on a nucleotide sequence analysis, we identified a gene of unknown function (GenBank accession number: XM_001826835.2) that encoded a hypothetical 344-amino acid protein. The gene was named MFS40. Its ORF was amplified to construct an expression vector, pGEX-4T-1-MFS40, to express the protein in Escherichia coli BL21. The gene conferred glyphosate tolerance to E. coli ER2799 cells. Copyright © 2017 Elsevier B.V. All rights reserved.
Stam, Remco; Scheikl, Daniela; Tellier, Aurélien
2016-01-01
Nod-like receptors (NLRs) are nucleotide-binding domain and leucine-rich repeats containing proteins that are important in plant resistance signaling. Many of the known pathogen resistance (R) genes in plants are NLRs and they can recognize pathogen molecules directly or indirectly. As such, divergence and copy number variants at these genes are found to be high between species. Within populations, positive and balancing selection are to be expected if plants coevolve with their pathogens. In order to understand the complexity of R-gene coevolution in wild nonmodel species, it is necessary to identify the full range of NLRs and infer their evolutionary history. Here we investigate and reveal polymorphism occurring at 220 NLR genes within one population of the partially selfing wild tomato species Solanum pennellii. We use a combination of enrichment sequencing and pooling ten individuals, to specifically sequence NLR genes in a resource and cost-effective manner. We focus on the effects which different mapping and single nucleotide polymorphism calling software and settings have on calling polymorphisms in customized pooled samples. Our results are accurately verified using Sanger sequencing of polymorphic gene fragments. Our results indicate that some NLRs, namely 13 out of 220, have maintained polymorphism within our S. pennellii population. These genes show a wide range of πN/πS ratios and differing site frequency spectra. We compare our observed rate of heterozygosity with expectations for this selfing and bottlenecked population. We conclude that our method enables us to pinpoint NLR genes which have experienced natural selection in their habitat. PMID:27189991
Hou, Liyuan; Zhang, Xiaojun; Li, Xin; Jia, Juqing; Yang, Huizhen; Zhan, Haixian; Qiao, Linyi; Guo, Huijuan; Chang, Zhijian
2015-07-28
Powdery mildew, caused by Blumeria graminis f. sp. tritici (Bgt), is a globally serious disease adversely affecting wheat production. The Bgt-resistant wheat breeding line CH09W89 was derived after backcrossing a Bgt resistant wheat-Thinopyrum intermedium partial amphiploid TAI7045 with susceptible wheat cultivars. At the seedling stage, CH09W89 exhibited immunity or high resistance to Bgt pathotypes E09, E20, E21, E23, E26, Bg1, and Bg2, similar to its donor line TAI7045 and Th. intermedium. No Th. intermedium chromatin was detected based on genomic in situ hybridization of mitotic chromosomes. To determine the mode of inheritance of the Bgt resistance and the chromosomal location of the resistance gene, CH09W89 was crossed with two susceptible wheat cultivars. The results of the genetic analysis showed that the adult resistance to Bgt E09 in CH09W89 was controlled by a single recessive gene, which was tentatively designated as pmCH89. Two polymorphic SSR markers, Xwmc310 and Xwmc125, were linked to the resistance gene with genetic distances 3.1 and 2.7 cM, respectively. Using the Chinese Spring aneuploid and deletion lines, the resistance gene and its linked markers were assigned to chromosome arm 4BL in the bin 0.68-0.78. Due to its unique position on chromosome 4BL, pmCH89 appears to be a new locus for resistance to powdery mildew. These results will be of benefit for improving powdery mildew resistance in wheat breeding programs.
Uddin, M J; Ahn, J
2017-12-01
This study was designed to delineate the relationship between resistance phenotypes and gene expression in wild-type (SA WT ), oxacillin-induced (SA OXA ), ciprofloxacin-induced (SA CIP ) and clinically acquired antibiotic-resistant Staphylococcus aureus (SA CA ) exposed to oxacillin (β-lactam) and ciprofloxacin (fluoroquinolone). The phenotypic response and gene expression were varied with the antibiotic exposure. SA WT was highly resistant to oxacillin (MIC = 8 μg ml -1 ) after serial exposure to oxacillin, while the oxacillin susceptibility was not changed in SA WT when exposed to ciprofloxacin (MIC = 0·25 μg ml -1 ). The clinical isolate, SA CA , was highly resistant to all classes of antibiotics used in this study. The increased resistance of SA OXA and SA CIP to penicillinase-labile penicillins was attributed to the production of β-lactamase, which is in good agreement with the overexpression of blaZ (>2-fold). The overexpression of efflux pump-related genes (norA, norB, norC, mdeA, mepR, mgrA and lmrS) was associated with the increased resistance of SA CIP and SA CA to aminoglycosides and quinolones. This study confirmed that the linkage between resistance phenotypes and molecular genotypes highly varied depending on intrinsic resistance profile, response to antibiotic exposure and genes conferring resistance. This study provides useful information for understanding the mechanisms of methicillin resistance in S. aureus in association with phenotypic and genotypic resistance determinants. The improvement in current standards is essential to accurately detect methicillin-resistant Staphylococcus aureus in consideration of various resistance phenotypes and genotypes. The varied and distinctive expression patterns of antibiotic resistance-related genes were observed in S. aureus exposed to oxacillin and ciprofloxacin. It is worth noting the relationship between resistance phenotype and resistance genotype in terms of MIC values and expression of
Wang, Na; Yang, Xiaohong; Jiao, Shaojun; Zhang, Jun; Ye, Boping; Gao, Shixiang
2014-01-01
Antibiotic-resistant bacteria and genes are recognized as new environmental pollutants that warrant special concern. There were few reports on veterinary antibiotic-resistant bacteria and genes in China. This work systematically analyzed the prevalence and distribution of sulfonamide resistance genes in soils from the environments around poultry and livestock farms in Jiangsu Province, Southeastern China. The results showed that the animal manure application made the spread and abundance of a...
Wu, Peipei; Xie, Jingzhong; Hu, Jinghuang; Qiu, Dan; Liu, Zhiyong; Li, Jingting; Li, Miaomiao; Zhang, Hongjun; Yang, Li; Liu, Hongwei; Zhou, Yang; Zhang, Zhongjun; Li, Hongjie
2018-01-01
Powdery mildew resistance gene Pm4b , originating from Triticum persicum , is effective against the prevalent Blumeria graminis f. sp. tritici ( Bgt ) isolates from certain regions of wheat production in China. The lack of tightly linked molecular markers with the target gene prevents the precise identification of Pm4b during the application of molecular marker-assisted selection (MAS). The strategy that combines the RNA-Seq technique and the bulked segregant analysis (BSR-Seq) was applied in an F 2:3 mapping population (237 families) derived from a pair of isogenic lines VPM1/7 ∗ Bainong 3217 F 4 (carrying Pm4b ) and Bainong 3217 to develop more closely linked molecular markers. RNA-Seq analysis of the two phenotypically contrasting RNA bulks prepared from the representative F 2:3 families generated 20,745,939 and 25,867,480 high-quality read pairs, and 82.8 and 80.2% of them were uniquely mapped to the wheat whole genome draft assembly for the resistant and susceptible RNA bulks, respectively. Variant calling identified 283,866 raw single nucleotide polymorphisms (SNPs) and InDels between the two bulks. The SNPs that were closely associated with the powdery mildew resistance were concentrated on chromosome 2AL. Among the 84 variants that were potentially associated with the disease resistance trait, 46 variants were enriched in an about 25 Mb region at the distal end of chromosome arm 2AL. Four Pm4b -linked SNP markers were developed from these variants. Based on the sequences of Chinese Spring where these polymorphic SNPs were located, 98 SSR primer pairs were designed to develop distal markers flanking the Pm4b gene. Three SSR markers, Xics13 , Xics43 , and Xics76 , were incorporated in the new genetic linkage map, which located Pm4b in a 3.0 cM genetic interval spanning a 6.7 Mb physical genomic region. This region had a collinear relationship with Brachypodium distachyon chromosome 5, rice chromosome 4, and sorghum chromosome 6. Seven genes associated with
Directory of Open Access Journals (Sweden)
Peipei Wu
2018-02-01
Full Text Available Powdery mildew resistance gene Pm4b, originating from Triticum persicum, is effective against the prevalent Blumeria graminis f. sp. tritici (Bgt isolates from certain regions of wheat production in China. The lack of tightly linked molecular markers with the target gene prevents the precise identification of Pm4b during the application of molecular marker-assisted selection (MAS. The strategy that combines the RNA-Seq technique and the bulked segregant analysis (BSR-Seq was applied in an F2:3 mapping population (237 families derived from a pair of isogenic lines VPM1/7∗Bainong 3217 F4 (carrying Pm4b and Bainong 3217 to develop more closely linked molecular markers. RNA-Seq analysis of the two phenotypically contrasting RNA bulks prepared from the representative F2:3 families generated 20,745,939 and 25,867,480 high-quality read pairs, and 82.8 and 80.2% of them were uniquely mapped to the wheat whole genome draft assembly for the resistant and susceptible RNA bulks, respectively. Variant calling identified 283,866 raw single nucleotide polymorphisms (SNPs and InDels between the two bulks. The SNPs that were closely associated with the powdery mildew resistance were concentrated on chromosome 2AL. Among the 84 variants that were potentially associated with the disease resistance trait, 46 variants were enriched in an about 25 Mb region at the distal end of chromosome arm 2AL. Four Pm4b-linked SNP markers were developed from these variants. Based on the sequences of Chinese Spring where these polymorphic SNPs were located, 98 SSR primer pairs were designed to develop distal markers flanking the Pm4b gene. Three SSR markers, Xics13, Xics43, and Xics76, were incorporated in the new genetic linkage map, which located Pm4b in a 3.0 cM genetic interval spanning a 6.7 Mb physical genomic region. This region had a collinear relationship with Brachypodium distachyon chromosome 5, rice chromosome 4, and sorghum chromosome 6. Seven genes associated with
ANTIBIOTIC RESISTANCE IN LACTIC ACID BACTERIA ISOLATED FROM FERMENTED DAIRY PRODUCTS AND BOZA
Directory of Open Access Journals (Sweden)
Gamze Başbülbül
2015-06-01
Full Text Available In this study, the resistance of 83 strains of lactic acid bacteria isolated from Turkish cheese, yogurt, kefir and boza samples to 6 antibiotics (gentamicin, tetracycline, chloramphenicol, erythromycin, vancomycin and ciprofloxacin was evaluated. The 83 isolates were identified by 16S rRNA gene sequencing and according to BLAST comparisons with sequences in the data banks, those strains showing the highest similarities with the isolates were Enterococcus faecium (10, Lactococcus lactis subsp. Lactis (10, Lactobacillus fermentum (6, Lactobacillus plantarum (6, Lactobacillus coryniformis (7, Lactobacillus casei (13, Leuconostoc mesenteroides (14, Pediococcus pentosaceus (10, Weisella confusa (7. Antimicrobial resistance of strains to 6 antibiotics was determined using the agar dilution method. The antibiotic resistance among all the isolates was detected against chloramphenicol (31,3 % of the isolates, tetracycline (30,1 %, erythromycin (2,4 %, ciprofloxacin (2,41%, vancomycin (73,5 %, intrinsic resistance. Overall 19,3 % of the isolates showed resistance against multiple antibiotics. Antibiotic resistance genes were studied by PCR and the following genes were detected; tet(M gene in Lactobacillus fermentum (1, Lactobacillus plantarum (1, Pediococcus pentosaceus (5, Enterococcus faecium (2, Weisella confusa (4 and the vancomycin resistance gene van(A in one Weisella confusa strain.
Wang, Yang; Zhang, Wanjiang; Wang, Juan; Wu, Congming; Shen, Zhangqi; Fu, Xiao; Yan, Yang; Zhang, Qijing; Schwarz, Stefan; Shen, Jianzhong
2012-03-01
A total of 149 porcine Staphylococcus isolates with florfenicol MICs of ≥ 16 μg/ml were screened for the presence of the multiresistance gene cfr, its location on plasmids, and its genetic environment. In total, 125 isolates carried either cfr (16 isolates), fexA (92 isolates), or both genes (17 isolates). The 33 cfr-carrying staphylococci, which included isolates of the species Staphylococcus cohnii, S. arlettae, and S. saprophyticus in which the cfr gene has not been described before, exhibited a wide variety of SmaI pulsed-field gel electrophoresis patterns. In 18 cases, the cfr gene was located on plasmids. Four different types of cfr-carrying plasmids--pSS-01 (n = 2; 40 kb), pSS-02 (n = 3; 35.4 kb), pSS-03 (n = 10; 7.1 kb), and pBS-01 (n = 3; 16.4 kb)--were differentiated on the basis of their sizes, restriction patterns, and additional resistance genes. Sequence analysis revealed that in plasmid pSS-01, the cfr gene was flanked in the upstream part by a complete aacA-aphD-carrying Tn4001-like transposon and in the downstream part by a complete fexA-carrying transposon Tn558. In plasmid pSS-02, an insertion sequence IS21-558 and the cfr gene were integrated into transposon Tn558 and thereby truncated the tnpA and tnpB genes. The smallest cfr-carrying plasmid pSS-03 carried the macrolide-lincosamide-streptogramin B resistance gene erm(C). Plasmid pBS-01, previously described in Bacillus spp., harbored a Tn917-like transposon, including the macrolide-lincosamide-streptogramin B resistance gene erm(B) in the cfr downstream region. Plasmids, which in part carry additional resistance genes, seem to play an important role in the dissemination of the gene cfr among porcine staphylococci.
AMINOGLYCOSIDE RESISTANCE GENES IN Pseudomonas aeruginosa ISOLATES FROM CUMANA, VENEZUELA
Directory of Open Access Journals (Sweden)
Bertinellys TEIXEIRA
2016-01-01
Full Text Available The enzymatic modification of aminoglycosides by aminoglycoside-acetyltransferases (AAC, aminoglycoside-adenyltransferases (AAD, and aminoglycoside-phosphotransferases (APH, is the most common resistance mechanism in P. aeruginosa and these enzymes can be coded on mobile genetic elements that contribute to their dispersion. One hundred and thirty seven P. aeruginosa isolates from the University Hospital, Cumana, Venezuela (HUAPA were evaluated. Antimicrobial susceptibility was determined by the disk diffusion method and theaac, aadB and aph genes were detected by PCR. Most of the P. aeruginosa isolates (33/137 were identified from the Intensive Care Unit (ICU, mainly from discharges (96/137. The frequency of resistant P. aeruginosaisolates was found to be higher for the aminoglycosides tobramycin and amikacin (30.7 and 29.9%, respectively. Phenotype VI, resistant to these antibiotics, was the most frequent (14/49, followed by phenotype I, resistant to all the aminoglycosides tested (12/49. The aac(6´-Ib,aphA1 and aadB genes were the most frequently detected, and the simultaneous presence of several resistance genes in the same isolate was demonstrated. Aminoglycoside resistance in isolates ofP. aeruginosa at the HUAPA is partly due to the presence of the aac(6´-Ib, aphA1 andaadB genes, but the high rates of antimicrobial resistance suggest the existence of several mechanisms acting together. This is the first report of aminoglycoside resistance genes in Venezuela and one of the few in Latin America.
AMINOGLYCOSIDE RESISTANCE GENES IN Pseudomonas aeruginosa ISOLATES FROM CUMANA, VENEZUELA.
Teixeira, Bertinellys; Rodulfo, Hectorina; Carreño, Numirin; Guzmán, Militza; Salazar, Elsa; De Donato, Marcos
2016-01-01
The enzymatic modification of aminoglycosides by aminoglycoside-acetyltransferases (AAC), aminoglycoside-adenyltransferases (AAD), and aminoglycoside-phosphotransferases (APH), is the most common resistance mechanism in P. aeruginosa and these enzymes can be coded on mobile genetic elements that contribute to their dispersion. One hundred and thirty seven P. aeruginosa isolates from the University Hospital, Cumana, Venezuela (HUAPA) were evaluated. Antimicrobial susceptibility was determined by the disk diffusion method and theaac, aadB and aph genes were detected by PCR. Most of the P. aeruginosa isolates (33/137) were identified from the Intensive Care Unit (ICU), mainly from discharges (96/137). The frequency of resistant P. aeruginosaisolates was found to be higher for the aminoglycosides tobramycin and amikacin (30.7 and 29.9%, respectively). Phenotype VI, resistant to these antibiotics, was the most frequent (14/49), followed by phenotype I, resistant to all the aminoglycosides tested (12/49). The aac(6´)-Ib,aphA1 and aadB genes were the most frequently detected, and the simultaneous presence of several resistance genes in the same isolate was demonstrated. Aminoglycoside resistance in isolates ofP. aeruginosa at the HUAPA is partly due to the presence of the aac(6´)-Ib, aphA1 andaadB genes, but the high rates of antimicrobial resistance suggest the existence of several mechanisms acting together. This is the first report of aminoglycoside resistance genes in Venezuela and one of the few in Latin America.
Lin, F; Chen, X M
2007-05-01
Stripe rust, caused by Puccinia striiformis f. sp. tritici, is one of the most widespread and destructive wheat diseases worldwide. Growing resistant cultivars is the preferred control of the disease. The spring wheat cultivar 'Alpowa' has both race-specific, all-stage resistance and non-race-specific, high-temperature adult-plant (HTAP) resistances to stripe rust. To identify genes for the stripe rust resistances, Alpowa was crossed with 'Avocet Susceptible' (AVS). Seedlings of the parents, and F(1), F(2) and F(3) progeny were tested with races PST-1 and PST-21 of P. striiformis f. sp. tritici under controlled greenhouse conditions. Alpowa has a single partially dominant gene, designated as YrAlp, conferring all-stage resistance. Resistance gene analog polymorphism (RGAP) and simple sequence repeat (SSR) techniques were used to identify molecular markers linked to YrAlp. A linkage group of five RGAP markers and two SSR markers was constructed for YrAlp using 136 F(3) lines. Amplification of a set of nulli-tetrasomic Chinese Spring lines with RGAP markers Xwgp47 and Xwgp48 and the two SSR markers indicated that YrAlp is located on the short arm of chromosome 1B. To map quantitative trait loci (QTLs) for the non-race-specific HTAP resistance, the parents and 136 F(3) lines were tested at two sites near Pullman and one site near Mount Vernon, Washington, under naturally infected conditions. A major HTAP QTL was consistently detected across environments and was located on chromosome 7BL. Because of its chromosomal location and the non-race-specific nature of the HTAP resistance, this gene is different from previously described genes for adult-plant resistance, and is therefore designated Yr39. The gene contributed to 64.2% of the total variation of relative area under disease progress curve (AUDPC) data and 59.1% of the total variation of infection type data recorded at the heading-flowering stages. Two RGAP markers, Xwgp36 and Xwgp45 with the highest R (2) values
Miller, Jennifer H; Novak, John T; Knocke, William R; Pruden, Amy
2016-01-01
Understanding fate of antibiotic resistant bacteria (ARB) vs. their antibiotic resistance genes (ARGs) during wastewater sludge treatment is critical in order to reduce the spread of antibiotic resistance through process optimization. Here, we spiked high concentrations of tetracycline-resistant bacteria, isolated from mesophilic (Iso M1-1-a Pseudomonas sp.) and thermophilic (Iso T10-a Bacillus sp.) anaerobic digested sludge, into batch digesters and monitored their fate by plate counts and quantitative polymerase chain reaction (QPCR) of their corresponding tetracycline ARGs. In batch studies, spiked ARB plate counts returned to baseline (thermophilic) or 1-log above baseline (mesophilic) while levels of the ARG present in the spiked isolate [tet(G)] remained high in mesophilic batch reactors. To compare results under semi-continuous flow conditions with natural influent variation, tet(O), tet(W), and sul1 ARGs, along with the intI1 integrase gene, were monitored over a 9-month period in the raw feed sludge and effluent sludge of lab-scale thermophilic and mesophilic anaerobic digesters. sul1 and intI1 in mesophilic and thermophilic digesters correlated positively (Spearman rho = 0.457-0.829, P < 0.05) with the raw feed sludge. There was no correlation in tet(O) or tet(W) ratios in raw sludge and mesophilic digested sludge or thermophilic digested sludge (Spearman rho = 0.130-0.486, P = 0.075-0.612). However, in the thermophilic digester, the tet(O) and tet(W) ratios remained consistently low over the entire monitoring period. We conclude that the influent sludge microbial composition can influence the ARG content of a digester, apparently as a result of differential survival or death of ARBs or horizontal gene transfer of genes between raw sludge ARBs and the digester microbial community. Notably, mesophilic digestion was more susceptible to ARG intrusion than thermophilic digestion, which may be attributed to a higher rate of ARB survival and/or horizontal gene
Directory of Open Access Journals (Sweden)
Lu Xu
Full Text Available BACKGROUND: The small brown planthopper (SBPH, Laodelphax striatellus (Fallén, is one of the major rice pests in Asia and has developed resistance to multiple classes of insecticides. Understanding resistance mechanisms is essential to the management of this pest. Biochemical and molecular assays were performed in this study to systematically characterize deltamethrin resistance mechanisms with laboratory-selected resistant and susceptible strains of SBPH. METHODOLOGY/PRINCIPAL FINDINGS: Deltamethrin resistant strains of SBPH (JH-del were derived from a field population by continuously selections (up to 30 generations in the laboratory, while a susceptible strain (JHS was obtained from the same population by removing insecticide pressure for 30 generations. The role of detoxification enzymes in the resistance was investigated using synergism and enzyme activity assays with strains of different resistant levels. Furthermore, 71 cytochrome P450, 93 esterases and 12 glutathione-S-transferases cDNAs were cloned based on transcriptome data of a field collected population. Semi-quantitative RT-PCR screening analysis of 176 identified detoxification genes demonstrated that multiple P450 and esterase genes were overexpressed (>2-fold in JH-del strains (G4 and G30 when compared to that in JHS, and the results of quantitative PCR coincided with the semi-quantitative RT-PCR results. Target mutation at IIS3-IIS6 regions encoded by the voltage-gated sodium channel gene was ruled out for conferring the observed resistance. CONCLUSION/SIGNIFICANCE: As the first attempt to discover genes potentially involved in SBPH pyrethroid resistance, this study putatively identified several candidate genes of detoxification enzymes that were significantly overexpressed in the resistant strain, which matched the synergism and enzyme activity testing. The biochemical and molecular evidences suggest that the high level pyrethroid resistance in L. striatellus could be due to
Molecular detection of disease resistance genes to powdery mildew ...
African Journals Online (AJOL)
A study was conducted to detect the presence of disease resistance genes to infection of wheat powdery mildew (Blumeria graminis f. sp. tritici) in selected wheat cultivars from China using molecular markers. Genomic DNA of sixty cultivars was extracted and tested for the presence of selected prominent resistance genes to ...
Qiu, Yongfu; Guo, Jianping; Jing, Shengli; Zhu, Lili; He, Guangcun
2012-02-01
The brown planthopper (Nilaparvata lugens Stål; BPH) has become a severe constraint on rice production. Identification and pyramiding BPH-resistance genes is an economical and effective solution to increase the resistance level of rice varieties. All the BPH-resistance genes identified to date have been from indica rice or wild species. The BPH12 gene in the indica rice accession B14 is derived from the wild species Oryza latifolia. Using an F(2) population from a cross between the indica cultivar 93-11 and B14, we mapped the BPH12 gene to a 1.9-cM region on chromosome 4, flanked by the markers RM16459 and RM1305. In this population, BPH12 appeared to be partially dominant and explained 73.8% of the phenotypic variance in BPH resistance. A near-isogenic line (NIL) containing the BPH12 locus in the background of the susceptible japonica variety Nipponbare was developed and crossed with a NIL carrying BPH6 to generate a pyramid line (PYL) with both genes. BPH insects showed significant differences in non-preference in comparisons between the lines harboring resistance genes (NILs and PYL) and Nipponbare. BPH growth and development were inhibited and survival rates were lower on the NIL-BPH12 and NIL-BPH6 plants compared to the recurrent parent Nipponbare. PYL-BPH6 + BPH12 exhibited 46.4, 26.8 and 72.1% reductions in population growth rates (PGR) compared to NIL-BPH12, NIL-BPH6 and Nipponbare, respectively. Furthermore, insect survival rates were the lowest on the PYL-BPH6 + BPH12 plants. These results demonstrated that pyramiding different BPH-resistance genes resulted in stronger antixenotic and antibiotic effects on the BPH insects. This gene pyramiding strategy should be of great benefit for the breeding of BPH-resistant japonica rice varieties.
Directory of Open Access Journals (Sweden)
Osman Birol Ozgumus
2008-12-01
Full Text Available The extended-spectrum β-lactamase (ESBL-producing bacteria have been isolated at increasing frequency worldwide. Expression of ESBL is often associated with multidrug resistance and dissemination by resistance plasmids. During a two-month period in 2000, 133 clinical isolates of enterobacterial strains were randomly collected from outpatients and inpatients at a university hospital in Turkey. The ESBL producing strains were determined by double-disk synergy (DDS testing. Twenty ESBL producing strains (15% including Escherichia coli (n = 9, Klebsiella pneumoniae (n = 7, Klebsiella oxytoca (n = 2 and Enterobacter aerogenes (n = 2 were detected and further analyzed for their resistance transfer features, plasmid profile and nature of the resistance genes. Plasmid transfer assays were performed using broth mating techniques. TEM- and SHV- genes were analyzed by polymerase chain reaction (PCR and hybridization using specific probes. EcoRI restriction enzyme analyses of R plasmids were used in the detection of epidemic plasmids. Fourteen plasmid profiles (A, B1, B2, C1, and C2 to L were obtained with EcoRI restriction enzyme analysis. Most of these plasmids were detected to carry both TEM- and SHV-derived genes by PCR, and confirmed by localizing each gene by hybridization assay. Epidemiological evidence indicated that there was an apparent horizontal dissemination of conjugative R plasmids among multidrug-resistant enterobacterial genera and species in this hospitalO isolamento de bactérias produtoras de beta-lactamases de espectro expandido (ESBL está aumentando no mundo todo. Freqüentemente, a expressão de ESBL está associada com resistência a múltiplas drogas e disseminação por plasmídios de resistência. Durante um período de dois meses em 2000, 133 isolados clínicos de cepas de enterobactérias foram obtidos aleatoriamente de pacientes internos e externos de um hospital universitário na Turquia. As cepas produtoras de ESBL foram
Directory of Open Access Journals (Sweden)
Kuppan Gokulan
2017-04-01
Full Text Available Limited antibacterial activity of silver ions leached from silver-impregnated food contact materials could be due to: 1 the presence of silver resistance genes in tested bacteria; or 2 lack of susceptibility to silver ion-mediated killing in the bacterial strain (K. Williams, L. Valencia, K. Gokulan, R. Trbojevich, S. Khare, 2016 [1]. This study contains data to address the specificity of silver resistance genes in Salmonella Typhimurium during the real time PCR using melting curve analysis and an assessment of the minimum inhibitory concentration of silver ions for Salmonella.
Gokulan, Kuppan; Williams, Katherine; Khare, Sangeeta
2017-04-01
Limited antibacterial activity of silver ions leached from silver-impregnated food contact materials could be due to: 1) the presence of silver resistance genes in tested bacteria ; or 2) lack of susceptibility to silver ion-mediated killing in the bacterial strain (K. Williams, L. Valencia, K. Gokulan, R. Trbojevich, S. Khare, 2016 [1]). This study contains data to address the specificity of silver resistance genes in Salmonella Typhimurium during the real time PCR using melting curve analysis and an assessment of the minimum inhibitory concentration of silver ions for Salmonella .
Tagging of resistance gene(s) to rhizomania disease in sugar beet ...
African Journals Online (AJOL)
SERVER
2008-02-19
Feb 19, 2008 ... plasmodiophoride-like fungus, Polymyxa betae Keskin. (1964) (Tamada and Richard, 1992). Source of resistance to rhizomania were found in Holly sugar beet company source (Lewellen, 1987). Resistance in Holly is simply inherited by a single dominant gene(Rz1). (Lewellen et al., 1987; Scholten et al., ...
Comparative genome analysis and resistance gene mapping in grain legumes
International Nuclear Information System (INIS)
Young, N.D.
1998-01-01
Using, DNA markers and genome organization, several important disease resistance genes have been analyzed in mungbean (Vigna radiata), cowpea (Vigna unguiculata), common bean (Phaseolus vulgaris), and soybean (Glycine max). In the process, medium-density linkage maps consisting of restriction fragment length polymorphism (RFLP) markers were constructed for both mungbean and cowpea. Comparisons between these maps, as well as the maps of soybean and common bean, indicate that there is significant conservation of DNA marker order, though the conserved blocks in soybean are much shorter than in the others. DNA mapping results also indicate that a gene for seed weight may be conserved between mungbean and cowpea. Using the linkage maps, genes that control bruchid (genus Callosobruchus) and powdery mildew (Erysiphe polygoni) resistance in mungbean, aphid resistance in cowpea (Aphis craccivora), and cyst nematode (Heterodera glycines) resistance in soybean have all been mapped and characterized. For some of these traits resistance was found to be oligogenic and DNA mapping uncovered multiple genes involved in the phenotype. (author)
Prevalence, antibiotic-resistance properties and enterotoxin gene ...
African Journals Online (AJOL)
Prevalence, antibiotic-resistance properties and enterotoxin gene profile of Bacillus cereus strains isolated from milk-based baby foods. ... Conclusion: Considerable prevalence of resistant and toxigenic B. cereus and high consumption of milk-based infant foods in Iran, represent an important public health issue which ...
Timraz, Kenda Hussain Hassan
2016-12-15
This study aims to evaluate the removal efficiency of microbial contaminants, including total cell counts, antibiotic-resistant bacteria (ARB), antibiotic resistance genes (ARGs, e.g. tetO, tetZ, sul1 and sul2) and integrase genes (e.g. intl1 and intl2), by wastewater treatment plants (WWTPs) operated on-site of two hospitals (i.e., SH WWTP and IH WWTP). Both SH and IH WWTPs utilize the conventional activated sludge process but differences in the removal efficiencies were observed. Over the 2 week sampling period, IH WWTP outperformed SH WWTP, and achieved an approximate 0.388 to 2.49-log log removal values (LRVs) for total cell counts compared to the 0.010 to 0.162-log removal in SH WWTP. Although ARB were present in the hospital influent, the treatment process of both hospitals effectively removed ARB from most of the effluent samples. In instances where ARB were recovered in the effluent, none of the viable isolates were identified to be opportunistic pathogenic species based on 16S rRNA gene sequencing. However, sul1 and intl1 genes remained detectable at up to 105 copies per mL or 8 x 10(-1) copies per 16S rRNA gene in the treated effluent, with an LRV of less than 1.2. When the treated effluent is discharged from hospital WWTPs into the public sewer for further treatment as per requirement in many countries, the detected amount of ARGs and integrase genes in the hospital effluent can become a potential source of horizontal gene dissemination in the municipal WWTP. Proper on-site wastewater treatment and surveillance of the effluent quality for emerging contaminants are therefore highly recommended.
An efficient rHSV-based complementation system for the production of multiple rAAV vector serotypes.
Kang, W; Wang, L; Harrell, H; Liu, J; Thomas, D L; Mayfield, T L; Scotti, M M; Ye, G J; Veres, G; Knop, D R
2009-02-01
Recombinant herpes simplex virus type 1 (rHSV)-assisted recombinant adeno-associated virus (rAAV) vector production provides a highly efficient and scalable method for manufacture of clinical grade rAAV vectors. Here, we present an rHSV co-infection system for rAAV production, which uses two ICP27-deficient rHSV constructs, one bearing the rep2 and cap (1, 2 or 9) genes of rAAV, and the second bearing an AAV2 ITR-gene of interest (GOI) cassette. The optimum rAAV production parameters were defined by producing rAAV2/GFP in HEK293 cells, yielding greater than 9000 infectious particles per cell with a 14:1 DNase resistance particle to infectious particle (DRP/ip) ratio. The optimized co-infection parameters were then used to generate large-scale stocks of rAAV1/AAT, which encode the human alpha-1-antitrypsin (hAAT) protein, and purified by column chromatography. The purified vector was extensively characterized by rAAV- and rHSV-specific assays and compared to transfection-made vector for in vivo efficacy in mice through intramuscular injection. The co-infection method was also used to produce rAAV9/AAT for comparison to rAAV1/AAT in vivo. Intramuscular administration of 1 x 10(11) DRP per animal of rHSV-produced rAAV1/AAT and rAAV9/AAT resulted in hAAT protein expression of 5.4 x 10(4) and 9.4 x 10(5) ng ml(-1) serum respectively, the latter being clinically relevant.
Guo, Huiling; Pan, Lin; Li, Lina; Lu, Jie; Kwok, Laiyu; Menghe, Bilige; Zhang, Heping; Zhang, Wenyi
2017-03-01
Lactobacilli are widely used as starter cultures or probiotics in yoghurt, cheese, beer, wine, pickles, preserved food, and silage. They are generally recognized as safe (GRAS). However, recent studies have shown that some lactic acid bacteria (LAB) strains carry antibiotic resistance genes and are resistant to antibiotics. Some of them may even transfer their intrinsic antibiotic resistance genes to other LAB or pathogens via horizontal gene transfer, thus threatening human health. A total of 33 Lactobacillus strains was isolated from fermented milk collected from different areas of China. We analyzed (1) their levels of antibiotic resistance using a standardized dilution method, (2) their antibiotic resistance gene profiles by polymerase chain reaction (PCR) using gene-specific primers, and (3) the transferability of some of the detected resistance markers by a filter mating assay. All Lactobacillus strains were found to be resistant to vancomycin, but susceptible to gentamicin, linezolid, neomycin, erythromycin, and clindamycin. Their susceptibilities to tetracycline, kanamycin, ciprofloxacin, streptomycin, quinupristin/dalfopristin, trimethoprim, ampicillin, rifampicin, and chloramphenicol was different. Results from our PCR analysis revealed 19 vancomycin, 10 ciprofloxacin, and 1 tetracycline-resistant bacteria that carried the van(X), van(E), gyr(A), and tet(M) genes, respectively. Finally, no transferal of the monitored antibiotic resistance genes was observed in the filter mating assay. Taken together, our study generated the antibiotic resistance profiles of some milk-originated lactobacilli isolates and preliminarily assessed their risk of transferring antibiotic gene to other bacteria. The study may provide important data concerning the safe use of LAB. © 2017 Institute of Food Technologists®.
Directory of Open Access Journals (Sweden)
Qin X
2017-05-01
Full Text Available Xiaobing Qin,1,2,* Shaorong Yu,1,3,* Leilei Zhou,1,4 Meiqi Shi,3 Yong Hu,1 Xiaoyue Xu,1 Bo Shen,1 Siwen Liu,1 Dali Yan,1 Jifeng Feng1,3 1Research Center for Clinical Oncology, Affiliated Cancer Hospital of Nanjing Medical University, Jiangsu Cancer Hospital and Jiangsu Institute of Cancer Research, Nanjing, 2Department of Oncology, Xuzhou First People’s Hospital, Xuzhou, 3Department of Oncology, Affiliated Cancer Hospital of Nanjing Medical University, Jiangsu Cancer Hospital and Jiangsu Institute of Cancer Research, Nanjing, 4Department of Oncology, Affiliated Huai’an Hospital of Nanjing Medical University, Huai’an, Jiangsu, China *These authors have contributed equally to this work Abstract: Exosomes derived from lung cancer cells confer cisplatin (DDP resistance to other cancer cells. However, the underlying mechanism is still unknown. A549 resistance to DDP (A549/DDP was established. Microarray was used to analyze microRNA (miRNA expression profiles of A549 cells, A549/DDP cells, A549 exosomes, and A549/DDP exosomes. There was a strong correlation of miRNA profiles between exosomes and their maternal cells. A total of 11 miRNAs were significantly upregulated both in A549/DDP cells compared with A549 cells and in exosomes derived from A549/DDP cells in contrast to exosomes from A549 cells. A total of 31 downregulated miRNAs were also observed. miR-100–5p was the most prominent decreased miRNA in DDP-resistant exosomes compared with the corresponding sensitive ones. Downregulated miR-100–5p was proved to be involved in DDP resistance in A549 cells, and mammalian target of rapamycin (mTOR expression was reverse regulated by miR-100–5p. Exosomes confer recipient cells’ resistance to DDP in an exosomal miR-100–5p-dependent manner with mTOR as its potential target both in vitro and in vivo. Exosomes from DDP-resistant lung cancer cells A549 can alter other lung cancer cells’ sensitivity to DDP in exosomal miR-100–5p
Ingham, Victoria A; Jones, Christopher M; Pignatelli, Patricia; Balabanidou, Vasileia; Vontas, John; Wagstaff, Simon C; Moore, Jonathan D; Ranson, Hilary
2014-11-25
The elevated expression of enzymes with insecticide metabolism activity can lead to high levels of insecticide resistance in the malaria vector, Anopheles gambiae. In this study, adult female mosquitoes from an insecticide susceptible and resistant strain were dissected into four different body parts. RNA from each of these samples was used in microarray analysis to determine the enrichment patterns of the key detoxification gene families within the mosquito and to identify additional candidate insecticide resistance genes that may have been overlooked in previous experiments on whole organisms. A general enrichment in the transcription of genes from the four major detoxification gene families (carboxylesterases, glutathione transferases, UDP glucornyltransferases and cytochrome P450s) was observed in the midgut and malpighian tubules. Yet the subset of P450 genes that have previously been implicated in insecticide resistance in An gambiae, show a surprisingly varied profile of tissue enrichment, confirmed by qPCR and, for three candidates, by immunostaining. A stringent selection process was used to define a list of 105 genes that are significantly (p ≤0.001) over expressed in body parts from the resistant versus susceptible strain. Over half of these, including all the cytochrome P450s on this list, were identified in previous whole organism comparisons between the strains, but several new candidates were detected, notably from comparisons of the transcriptomes from dissected abdomen integuments. The use of RNA extracted from the whole organism to identify candidate insecticide resistance genes has a risk of missing candidates if key genes responsible for the phenotype have restricted expression within the body and/or are over expression only in certain tissues. However, as transcription of genes implicated in metabolic resistance to insecticides is not enriched in any one single organ, comparison of the transcriptome of individual dissected body parts cannot
Watanabe, Takahito; Fujihara, Hidehiko; Furukawa, Kensuke
2003-01-01
Pseudomonas pseudoalcaligenes KF707 possesses a biphenyl-catabolic (bph) gene cluster consisting of bphR1A1A2-(orf3)-bphA3A4BCX0X1X2X3D. The bphR1 (formerly orf0) gene product, which belongs to the GntR family, is a positive regulator for itself and bphX0X1X2X3D. Further analysis in this study revealed that a second regulator belonging to the LysR family (designated bphR2) is involved in the regulation of the bph genes in KF707. The bphR2 gene was not located near the bph gene cluster, and it...
Genome scanning for identification of resistance gene analogs (RGAs)
African Journals Online (AJOL)
Disease resistance in plants is a desirable economic trait. Many disease resistance genes from various plants have been cloned so far. The gene products of some of these can be distinguished by the presence of an N terminal nucleotide binding site and a C-terminal stretch of leucine-rich repeats. Oligonucleotides already ...
The antimicrobial resistance crisis: management through gene monitoring
2016-01-01
Antimicrobial resistance (AMR) is an acknowledged crisis for humanity. Its genetic origins and dire potential outcomes are increasingly well understood. However, diagnostic techniques for monitoring the crisis are currently largely limited to enumerating the increasing incidence of resistant pathogens. Being the end-stage of the evolutionary process that produces antimicrobial resistant pathogens, these measurements, while diagnostic, are not prognostic, and so are not optimal in managing this crisis. A better test is required. Here, using insights from an understanding of evolutionary processes ruling the changing abundance of genes under selective pressure, we suggest a predictive framework for the AMR crisis. We then discuss the likely progression of resistance for both existing and prospective antimicrobial therapies. Finally, we suggest that by the environmental monitoring of resistance gene frequency, resistance may be detected and tracked presumptively, and how this tool may be used to guide decision-making in the local and global use of antimicrobials. PMID:27831476