WorldWideScience

Sample records for resistance gene pi9

  1. Natural variation of rice blast resistance gene Pi-d2

    Science.gov (United States)

    Studying natural variation of rice resistance (R) genes in cultivated and wild rice relatives can predict resistance stability to rice blast fungus. In the present study, the protein coding regions of rice R gene Pi-d2 in 35 rice accessions of subgroups, aus (AUS), indica (IND), temperate japonica (...

  2. Molecular Scree ning of Blast Resistance Genes in Rice Germplasms Resistant to Magnaporthe oryzae

    Directory of Open Access Journals (Sweden)

    Liang Yan

    2017-01-01

    Full Text Available Molecular screening of major rice blast resistance genes was determined with molecular markers, which showed close-set linkage to 11 major rice blast resistance genes (Pi-d2, Pi-z, Piz-t, Pi-9, Pi-36, Pi-37, Pi5, Pi-b, Pik-p, Pik-h and Pi-ta2, in a collection of 32 accessions resistant to Magnaporthe oryzae. Out of the 32 accessions, the Pi-d2 and Pi-z appeared to be omnipresent and gave positive express. As the second dominant, Pi-b and Piz-t gene frequencies were 96.9% and 87.5%. And Pik-h and Pik-p gene frequencies were 43.8% and 28.1%, respectively. The molecular marker linkage to Pi-ta2 produced positive bands in eleven accessions, while the molecular marker linkage to Pi-36 and Pi-37 in only three and four accessions, respectively. The natural field evaluation analysis showed that 30 of the 32 accessions were resistant, one was moderately resistant and one was susceptible. Infection types were negatively correlated with the genotype scores of Pi-9, Pi5, Pi-b, Pi-ta2 and Pik-p, although the correlation coefficients were very little. These results are useful in identification and incorporation of functional resistance genes from these germplasms into elite cultivars through marker-assisted selection for improved blast resistance in China and worldwide.

  3. A novel blast resistance gene, Pi54rh cloned from wild species of rice, Oryza rhizomatis confers broad spectrum resistance to Magnaporthe oryzae.

    Science.gov (United States)

    Das, Alok; Soubam, D; Singh, P K; Thakur, S; Singh, N K; Sharma, T R

    2012-06-01

    The dominant rice blast resistance gene, Pi54 confers resistance to Magnaporthe oryzae in different parts of India. In our effort to identify more effective forms of this gene, we isolated an orthologue of Pi54 named as Pi54rh from the blast-resistant wild species of rice, Oryza rhizomatis, using allele mining approach and validated by complementation. The Pi54rh belongs to CC-NBS-LRR family of disease resistance genes with a unique Zinc finger (C(3)H type) domain. The 1,447 bp Pi54rh transcript comprises of 101 bp 5'-UTR, 1,083 bp coding region and 263 bp 3'-UTR, driven by pathogen inducible promoter. We showed the extracellular localization of Pi54rh protein and the presence of glycosylation, myristoylation and phosphorylation sites which implicates its role in signal transduction process. This is in contrast to other blast resistance genes that are predicted to be intracellular NBS-LRR-type resistance proteins. The Pi54rh was found to express constitutively at basal level in the leaves, but upregulates 3.8-fold at 96 h post-inoculation with the pathogen. Functional validation of cloned Pi54rh gene using complementation test showed high degree of resistance to seven isolates of M. oryzae collected from different geographical locations of India. In this study, for the first time, we demonstrated that a rice blast resistance gene Pi54rh cloned from wild species of rice provides broad spectrum resistance to M. oryzae hence can be used in rice improvement breeding programme.

  4. Introgression of Blast Resistance Genes (Putative Pi-b and Pi-kh) into Elite Rice Cultivar MR219 through Marker-Assisted Selection

    Science.gov (United States)

    Tanweer, Fatah A.; Rafii, Mohd Y.; Sijam, Kamaruzaman; Rahim, Harun A.; Ahmed, Fahim; Ashkani, Sadegh; Latif, Mohammad A.

    2015-01-01

    Blast is the most common biotic stress leading to the reduction of rice yield in many rice-growing areas of the world, including Malaysia. Improvement of blast resistance of rice varieties cultivated in blast endemic areas is one of the most important objectives of rice breeding programs. In this study, the marker-assisted backcrossing strategy was applied to improve the blast resistance of the most popular Malaysian rice variety MR219 by introgressing blast resistance genes from the Pongsu Seribu 2 variety. Two blast resistance genes, Pi-b and Pi-kh, were pyramided into MR219. Foreground selection coupled with stringent phenotypic selection identified 15 plants homozygous for the Pi-b and Pi-kh genes, and background selection revealed more than 95% genome recovery of MR219 in advanced blast resistant lines. Phenotypic screening against blast disease indicated that advanced homozygous blast resistant lines were strongly resistant against pathotype P7.2 in the blast disease endemic areas. The morphological, yield, grain quality, and yield-contributing characteristics were significantly similar to those of MR219. The newly developed blast resistant improved lines will retain the high adoptability of MR219 by farmers. The present results will also play an important role in sustaining the rice production of Malaysia. PMID:26734013

  5. Molecular evolution of the rice blast resistance gene Pi-ta in invasive weedy rice in the USA.

    Directory of Open Access Journals (Sweden)

    Seonghee Lee

    Full Text Available The Pi-ta gene in rice has been effectively used to control rice blast disease caused by Magnaporthe oryzae worldwide. Despite a number of studies that reported the Pi-ta gene in domesticated rice and wild species, little is known about how the Pi-ta gene has evolved in US weedy rice, a major weed of rice. To investigate the genome organization of the Pi-ta gene in weedy rice and its relationship to gene flow between cultivated and weedy rice in the US, we analyzed nucleotide sequence variation at the Pi-ta gene and its surrounding 2 Mb region in 156 weedy, domesticated and wild rice relatives. We found that the region at and around the Pi-ta gene shows very low genetic diversity in US weedy rice. The patterns of molecular diversity in weeds are more similar to cultivated rice (indica and aus, which have never been cultivated in the US, rather than the wild rice species, Oryza rufipogon. In addition, the resistant Pi-ta allele (Pi-ta found in the majority of US weedy rice belongs to the weedy group strawhull awnless (SH, suggesting a single source of origin for Pi-ta. Weeds with Pi-ta were resistant to two M. oryzae races, IC17 and IB49, except for three accessions, suggesting that component(s required for the Pi-ta mediated resistance may be missing in these accessions. Signatures of flanking sequences of the Pi-ta gene and SSR markers on chromosome 12 suggest that the susceptible pi-ta allele (pi-ta, not Pi-ta, has been introgressed from cultivated to weedy rice by out-crossing.

  6. Molecular Evolution of the Rice Blast Resistance Gene Pi-ta in Invasive Weedy Rice in the USA

    Science.gov (United States)

    Lee, Seonghee; Jia, Yulin; Jia, Melissa; Gealy, David R.; Olsen, Kenneth M.; Caicedo, Ana L.

    2011-01-01

    The Pi-ta gene in rice has been effectively used to control rice blast disease caused by Magnaporthe oryzae worldwide. Despite a number of studies that reported the Pi-ta gene in domesticated rice and wild species, little is known about how the Pi-ta gene has evolved in US weedy rice, a major weed of rice. To investigate the genome organization of the Pi-ta gene in weedy rice and its relationship to gene flow between cultivated and weedy rice in the US, we analyzed nucleotide sequence variation at the Pi-ta gene and its surrounding 2 Mb region in 156 weedy, domesticated and wild rice relatives. We found that the region at and around the Pi-ta gene shows very low genetic diversity in US weedy rice. The patterns of molecular diversity in weeds are more similar to cultivated rice (indica and aus), which have never been cultivated in the US, rather than the wild rice species, Oryza rufipogon. In addition, the resistant Pi-ta allele (Pi-ta) found in the majority of US weedy rice belongs to the weedy group strawhull awnless (SH), suggesting a single source of origin for Pi-ta. Weeds with Pi-ta were resistant to two M. oryzae races, IC17 and IB49, except for three accessions, suggesting that component(s) required for the Pi-ta mediated resistance may be missing in these accessions. Signatures of flanking sequences of the Pi-ta gene and SSR markers on chromosome 12 suggest that the susceptible pi-ta allele (pi-ta), not Pi-ta, has been introgressed from cultivated to weedy rice by out-crossing. PMID:22043312

  7. Characterization of Pm59, a novel powdery mildew resistance gene in Afghanistan wheat landrace PI 181356.

    Science.gov (United States)

    Tan, Chengcheng; Li, Genqiao; Cowger, Christina; Carver, Brett F; Xu, Xiangyang

    2018-05-01

    A new powdery mildew resistance gene, designated Pm59, was identified in Afghanistan wheat landrace PI 181356, and mapped in the terminal region of the long arm of chromosome 7A. Powdery mildew, caused by Blumeria graminis f. sp. tritici (Bgt), is an important foliar disease of wheat worldwide. In the Great Plains of the USA, Bgt isolates virulent to widely used powdery mildew resistance genes, such as Pm3a, were previously identified. The objectives of this study were to characterize the powdery mildew resistance gene in Afghanistan landrace PI 181356, which exhibited high resistance to Bgt isolates collected in southern Great Plains, and identify molecular markers for marker-assisted selection. An F 2 population and F 2:3 lines derived from a cross between PI 181356 and OK1059060-126135-3 were used in this study. Genetic analysis indicated that PI 181356 carries a single dominant gene, designated Pm59, in the terminal region of the long arm of chromosome 7A. Pm59 was mapped to an interval between sequence tag site (STS) markers Xmag1759 and Xmag1714 with genetic distances of 0.4 cM distal to Xmag1759 and 5.7 cM proximal to Xmag1714. Physical mapping suggested that Pm59 is in the distal bin 7AL 0.99-1.00. Pm59 is a novel powdery mildew resistance gene, and confers resistance to Bgt isolates collected from the Great Plains and the state of Montana. Therefore, Pm59 can be used to breed powdery mildew-resistant cultivars in these regions. Xmag1759 is ideal for marker-assisted selection of Pm59 in wheat breeding.

  8. Transcriptome analysis highlights defense and signaling pathways mediated by rice pi21 gene with partial resistance to Magnaporthe oryzae

    Directory of Open Access Journals (Sweden)

    Yu Zhang

    2016-12-01

    Full Text Available Rice blast disease is one of the most destructive rice diseases worldwide. The pi21 gene confers partial and durable resistance to Magnaporthe oryzae. However, little is known regarding the molecular mechanisms of resistance mediated by the loss-of-function of Pi21. In this study, comparative transcriptome profiling of the Pi21-RNAi transgenic rice line and Nipponbare with M. oryzae infection at different time points (0, 12, 24, 48, and 72 hpi were investigated using RNA sequencing. The results generated 43,222 unique genes mapped to the rice genome. In total, 1,109 differentially expressed genes (DEGs were identified between the Pi21-RNAi line and Nipponbare with M. oryzae infection, with 103, 281, 209, 69, and 678 DEGs at 0, 12, 24, 48, and 72 hpi, respectively. Functional analysis showed that most of the DEGs were involved in metabolism, transport, signaling, and defense. Among the genes assigned to plant–pathogen interaction, we identified 43 receptor kinase genes associated with pathogen-associated molecular pattern recognition and calcium ion influx. The expression levels of brassinolide-insensitive 1, flagellin sensitive 2 and elongation factor Tu receptor, ethylene (ET biosynthesis and signaling genes, were higher in the Pi21-RNAi line than Nipponbare. This suggested that there was a more robust PTI response in Pi21-RNAi plants and that ET signaling was important to rice blast resistance. We also identified 53 transcription factor genes, including WRKY, NAC, DOF, and ERF families that show differential expression between the two genotypes. This study highlights possible candidate genes that may serve a function in the partial rice blast resistance mediated by the loss-of-function of Pi21 and increase our understanding of the molecular mechanisms involved in partial resistance against M. oryzae.

  9. Mapping genes for resistance to stripe rust in spring wheat landrace PI 480035.

    Directory of Open Access Journals (Sweden)

    Jinita Sthapit Kandel

    Full Text Available Stripe rust caused by Puccinia striiformis Westend. f. sp. tritici Erikks. is an economically important disease of wheat (Triticum aestivum L.. Hexaploid spring wheat landrace PI 480035 was highly resistant to stripe rust in the field in Washington during 2011 and 2012. The objective of this research was to identify quantitative trait loci (QTL for stripe rust resistance in PI 480035. A spring wheat, "Avocet Susceptible" (AvS, was crossed with PI 480035 to develop a biparental population of 110 recombinant inbred lines (RIL. The population was evaluated in the field in 2013 and 2014 and seedling reactions were examined against three races (PSTv-14, PSTv-37, and PSTv-40 of the pathogen under controlled conditions. The population was genotyped with genotyping-by-sequencing and microsatellite markers across the whole wheat genome. A major QTL, QYr.wrsggl1-1BS was identified on chromosome 1B. The closest flanking markers were Xgwm273, Xgwm11, and Xbarc187 1.01 cM distal to QYr.wrsggl1-1BS, Xcfd59 0.59 cM proximal and XA365 3.19 cM proximal to QYr.wrsggl1-1BS. Another QTL, QYr.wrsggl1-3B, was identified on 3B, which was significant only for PSTv-40 and was not significant in the field, indicating it confers a race-specific resistance. Comparison with markers associated with previously reported Yr genes on 1B (Yr64, Yr65, and YrH52 indicated that QYr.wrsggl1-1BS is potentially a novel stripe rust resistance gene that can be incorporated into modern breeding materials, along with other all-stage and adult-plant resistance genes to develop cultivars that can provide durable resistance.

  10. Systematic Functional Characterization of Resistance to PI3K Inhibition in Breast Cancer.

    Science.gov (United States)

    Le, Xiuning; Antony, Rajee; Razavi, Pedram; Treacy, Daniel J; Luo, Flora; Ghandi, Mahmoud; Castel, Pau; Scaltriti, Maurizio; Baselga, Jose; Garraway, Levi A

    2016-10-01

    PIK3CA (which encodes the PI3K alpha isoform) is the most frequently mutated oncogene in breast cancer. Small-molecule PI3K inhibitors have shown promise in clinical trials; however, intrinsic and acquired resistance limits their utility. We used a systematic gain-of-function approach to identify genes whose upregulation confers resistance to the PI3K inhibitor BYL719 in breast cancer cells. Among the validated resistance genes, Proviral Insertion site in Murine leukemia virus (PIM) kinases conferred resistance by maintaining downstream PI3K effector activation in an AKT-independent manner. Concurrent pharmacologic inhibition of PIM and PI3K overcame this resistance mechanism. We also observed increased PIM expression and activity in a subset of breast cancer biopsies with clinical resistance to PI3K inhibitors. PIM1 overexpression was mutually exclusive with PIK3CA mutation in treatment-naïve breast cancers, suggesting downstream functional redundancy. Together, these results offer new insights into resistance to PI3K inhibitors and support clinical studies of combined PIM/PI3K inhibition in a subset of PIK3CA-mutant cancers. PIM kinase overexpression confers resistance to small-molecule PI3K inhibitors. Combined inhibition of PIM and PI3K may therefore be warranted in a subset of breast cancers. Cancer Discov; 6(10); 1134-47. ©2016 AACR.This article is highlighted in the In This Issue feature, p. 1069. ©2016 American Association for Cancer Research.

  11. Collinearity Analysis and High-Density Genetic Mapping of the Wheat Powdery Mildew Resistance Gene Pm40 in PI 672538

    Science.gov (United States)

    Fatima, Syeda Akash; Yang, Jiezhi; Chen, Wanquan; Liu, Taiguo; Hu, Yuting; Li, Qing; Guo, Jingwei; Zhang, Min; Lei, Li; Li, Xin; Tang, Shengwen; Luo, Peigao

    2016-01-01

    The wheat powdery mildew resistance gene Pm40, which is located on chromosomal arm 7BS, is effective against nearly all prevalent races of Blumeria graminis f. sp tritici (Bgt) in China and is carried by the common wheat germplasm PI 672538. A set of the F1, F2 and F2:3 populations from the cross of the resistant PI 672538 with the susceptible line L1034 were used to conduct genetic analysis of powdery mildew resistance and construct a high-density linkage map of the Pm40 gene. We constructed a high-density linkage genetic map with a total length of 6.18 cM and average spacing between markers of 0.48 cM.Pm40 is flanked by Xwmc335 and BF291338 at genetic distances of 0.58 cM and 0.26 cM, respectively, in deletion bin C-7BS-1-0.27. Comparative genomic analysis based on EST-STS markers established a high level of collinearity of the Pm40 genomic region with a 1.09-Mbp genomic region on Brachypodium chromosome 3, a 1.16-Mbp genomic region on rice chromosome 8, and a 1.62-Mbp genomic region on sorghum chromosome 7. We further anchored the Pm40 target intervals to the wheat genome sequence. A putative linear index of 85 wheat contigs containing 97 genes on 7BS was constructed. In total, 9 genes could be considered as candidates for the resistances to powdery mildew in the target genomic regions, which encoded proteins that were involved in the plant defense and response to pathogen attack. These results will facilitate the development of new markers for map-based cloning and marker-assisted selection of Pm40 in wheat breeding programs. PMID:27755575

  12. Characterization of Novel Gene Yr79 and Four Additional Quantitative Trait Loci for All-Stage and High-Temperature Adult-Plant Resistance to Stripe Rust in Spring Wheat PI 182103.

    Science.gov (United States)

    Feng, Junyan; Wang, Meinan; See, Deven R; Chao, Shiaoman; Zheng, Youliang; Chen, Xianming

    2018-06-01

    Stripe rust, caused by Puccinia striiformis f. sp. tritici, is an important disease of wheat worldwide. Exploring new resistance genes is essential for breeding resistant wheat cultivars. PI 182103, a spring wheat landrace originally from Pakistan, has shown a high level of resistance to stripe rust in fields for many years, but genes for resistance to stripe rust in the variety have not been studied. To map the resistance gene(s) in PI 182103, 185 recombinant inbred lines (RILs) were developed from a cross with Avocet Susceptible (AvS). The RIL population was genotyped with simple sequence repeat (SSR) and single nucleotide polymorphism markers and tested with races PST-100 and PST-114 at the seedling stage under controlled greenhouse conditions and at the adult-plant stage in fields at Pullman and Mt. Vernon, Washington under natural infection by the stripe rust pathogen in 2011, 2012, and 2013. A total of five quantitative trait loci (QTL) were detected. QyrPI182103.wgp-2AS and QyrPI182103.wgp-3AL were detected at the seedling stage, QyrPI182103.wgp-4DL was detected only in Mt. Vernon field tests, and QyrPI182103.wgp-5BS was detected in both seedling and field tests. QyrPI182103.wgp-7BL was identified as a high-temperature adult-plant resistance gene and detected in all field tests. Interactions among the QTL were mostly additive, but some negative interactions were detected. The 7BL QTL was mapped in chromosomal bin 7BL 0.40 to 0.45 and identified as a new gene, permanently designated as Yr79. SSR markers Xbarc72 and Xwmc335 flanking the Yr79 locus were highly polymorphic in various wheat genotypes, indicating that the molecular markers are useful for incorporating the new gene for potentially durable stripe rust resistance into new wheat cultivars.

  13. Loss of activating EGFR mutant gene contributes to acquired resistance to EGFR tyrosine kinase inhibitors in lung cancer cells.

    Directory of Open Access Journals (Sweden)

    Keisuke Tabara

    Full Text Available Non-small-cell lung cancer harboring epidermal growth factor receptor (EGFR mutations attains a meaningful response to EGFR-tyrosine kinase inhibitors (TKIs. However, acquired resistance to EGFR-TKIs could affect long-term outcome in almost all patients. To identify the potential mechanisms of resistance, we established cell lines resistant to EGFR-TKIs from the human lung cancer cell lines PC9 and11-18, which harbored activating EGFR mutations. One erlotinib-resistant cell line from PC9 and two erlotinib-resistant cell lines and two gefitinib-resistant cell lines from 11-18 were independently established. Almost complete loss of mutant delE746-A750 EGFR gene was observed in the erlotinib-resistant cells isolated from PC9, and partial loss of the mutant L858R EGFR gene copy was specifically observed in the erlotinib- and gefitinib-resistant cells from 11-18. However, constitutive activation of EGFR downstream signaling, PI3K/Akt, was observed even after loss of the mutated EGFR gene in all resistant cell lines even in the presence of the drug. In the erlotinib-resistant cells from PC9, constitutive PI3K/Akt activation was effectively inhibited by lapatinib (a dual TKI of EGFR and HER2 or BIBW2992 (pan-TKI of EGFR family proteins. Furthermore, erlotinib with either HER2 or HER3 knockdown by their cognate siRNAs also inhibited PI3K/Akt activation. Transfection of activating mutant EGFR complementary DNA restored drug sensitivity in the erlotinib-resistant cell line. Our study indicates that loss of addiction to mutant EGFR resulted in gain of addiction to both HER2/HER3 and PI3K/Akt signaling to acquire EGFR-TKI resistance.

  14. Molecular mapping of Yr53, a new gene for stripe rust resistance in durum wheat accession PI 480148 and its transfer to common wheat

    Science.gov (United States)

    Stripe rust, caused by Puccinia striiformis f. sp. tritici (Pst), is one of the most damaging diseases of wheat worldwide. It is essential to identify new genes for effective resistance against the disease. Durum wheat PI 480148, originally from Ethiopia, was resistant in all seedling tests with s...

  15. Gene Profiling in Late Blight Resistance in Potato Genotype SD20

    Directory of Open Access Journals (Sweden)

    Xiaohui Yang

    2018-06-01

    Full Text Available Late blight caused by the oomycete fungus Phytophthora infestans (Pi is the most serious obstacle to potato (Solanum tuberosum production in the world. A super race isolate, CN152, which was identified from Sichuan Province, China, could overcome nearly all known late blight resistance genes and caused serious damage in China. The potato genotype SD20 was verified to be highly resistant to CN152; however, the molecular regulation network underlying late blight resistance pathway remains unclear in SD20. Here, we performed a time-course experiment to systematically profile the late blight resistance response genes using RNA-sequencing in SD20. We identified 3354 differentially expressed genes (DEGs, which mainly encoded transcription factors and protein kinases, and also included four NBS-LRR genes. The late blight responsive genes showed time-point-specific induction/repression. Multi-signaling pathways of salicylic acid, jasmonic acid, and ethylene signaling pathways involved in resistance and defense against Pi in SD20. Gene Ontology and KEGG analyses indicated that the DEGs were significantly enriched in metabolic process, protein serine/threonine kinase activity, and biosynthesis of secondary metabolites. Forty-three DEGs were involved in immune response, of which 19 were enriched in hypersensitive response reaction, which could play an important role in broad-spectrum resistance to Pi infection. Experimental verification confirmed the induced expression of the responsive genes in the late blight resistance signaling pathway, such as WRKY, ERF, MAPK, and NBS-LRR family genes. Our results provided valuable information for understanding late blight resistance mechanism of potato.

  16. Mapping genes for resistance to stripe rust in spring wheat landrace PI 480035

    Science.gov (United States)

    Stripe rust caused by Puccinia striiformis Westend. f. sp. tritici Erikks. is an economically important disease of wheat (Triticum aestivum L.). Hexaploid spring wheat landrace PI 480035 was highly resistant to stripe rust in the field in Washington during 2011 and 2012. The objective of this resear...

  17. Tagging of blast resistance gene(s) to DNA markers and marker-assisted selection (MAS) in rice improvement

    International Nuclear Information System (INIS)

    Zhuang, J.Y.; Lu, J.; Qian, H.R.; Lin, H.X.; Zheng, K.L.

    1998-01-01

    This paper reports progress made on the tagging of blast resistance gene(s) to DNA markers and on the initiation of marker-assisted selection (MAS) for blast resistance in rice improvement. A pair of near isogenic lines, K8OR and K79S, were developed using a Chinese landrace Hong-jiao-zhan as the resistance donor. Ten putatively positive markers were identified by screening 177 mapped DNA markers. Using the F 2 population of 143 plants and the derived F 3 lines, three Restriction Fragment Length Polymorphism (RFLP) markers (RG81, RG869 and RZ397) on chromosome 12 of rice were identified to be closely linked to the blast resistance gene Pi-12(t). The genetic distance between Pi-12(t) and the closest marker RG869 was 5.1 cM. By employing the bulk segregant analysis (BSA) procedure, six of 199 arbitrary primers were found to produce positive Randomly Amplified Polymorphic DNA (RAPD) bands. Tight linkage between Pi-12(t) and three RAPD bands, each from a different primer, was confirmed after amplification of DNA of all F 2 individuals. Two fragments were cloned and sequenced, and two sequence characterised amplified re-ion (SCAR) markers were established. In two other F 3 populations, Xian-feng I/Tetep and Xian-feng, 1/Hong-jiao-zhan, the blast resistance was found to be controlled by interactions of two or more genes. One resistance gene was located in the vicinity of RG81 in both populations. Work to identify other gene(s) is currently under way. Marker assisted selection for blast resistance was initiated. Crosses were made between elite varieties and blast resistance donors to develop populations for DNA marker-assisted selection of blast resistance. In addition, 48 varieties widely used in current rice breeding programs were provided by rice breeders. DNA marker-based polymorphism among, these varieties and resistance donors were analysed to produce a database for future MAS program. (author)

  18. Generation of Newly Discovered Resistance Gene mcr-1 Knockout in Escherichia coli Using the CRISPR/Cas9 System.

    Science.gov (United States)

    Sun, Lichang; He, Tao; Zhang, Lili; Pang, Maoda; Zhang, Qiaoyan; Zhou, Yan; Bao, Hongduo; Wang, Ran

    2017-07-28

    The mcr-1 gene is a new "superbug" gene discoverd in China in 2016 that makes bacteria highly resistant to the last-resort class of antibiotics. The mcr-1 gene raised serious concern about its possible global dissemination and spread. Here, we report a potential anti-resistant strategy using the CRISPR/Cas9-mediated approach that can efficiently induce mcr-1 gene knockout in Escherichia coli . Our findings suggested that using the CRISPR/Cas9 system to knock out the resistance gene mcr-1 might be a potential anti-resistant strategy. Bovine myeloid antimicrobial peptide-27 could help deliver plasmid pCas::mcr targeting specific DNA sequences of the mcr-1 gene into microbial populations.

  19. Use of molecular markers in identification and characterization of resistance to rice blast in India.

    Directory of Open Access Journals (Sweden)

    Manoj Kumar Yadav

    Full Text Available Rice blast disease caused by Magnaporthe oryzae is one of the most destructive disease causing huge losses to rice yield in different parts of the world. Therefore, an attempt has been made to find out the resistance by screening and studying the genetic diversity of eighty released rice varieties by National Rice Research Institute, Cuttack (NRVs using molecular markers linked to twelve major blast resistance (R genes viz Pib, Piz, Piz-t, Pik, Pik-p, Pikm Pik-h, Pita/Pita-2, Pi2, Pi9, Pi1 and Pi5. Out of which, nineteen varieties (23.75% showed resistance, twenty one were moderately resistant (26.25% while remaining forty varieties (50% showed susceptible in uniform blast nursery. Rice varieties possessing blast resistance genes varied from four to twelve and the frequencies of the resistance genes ranged from 0 to 100%. The cluster analysis grouped the eighty NRVs into two major clusters at 63% level of genetic similarity coefficient. The PIC value for seventeen markers varied from 0 to 0.37 at an average of 0.20. Out of seventeen markers, only five markers, 195R-1, Pi9-i, Pita3, YL155/YL87 and 40N23r corresponded to three broad spectrum R genes viz. Pi9, Pita/Pita2 and Pi5 were found to be significantly associated with the blast disease with explaining phenotypic variance from 3.5% to 7.7%. The population structure analysis and PCoA divided the entire 80 NRVs into two sub-groups. The outcome of this study would help to formulate strategies for improving rice blast resistance through genetic studies, plant-pathogen interaction, identification of novel R genes, development of new resistant varieties through marker-assisted breeding for improving rice blast resistance in India and worldwide.

  20. Use of molecular markers in identification and characterization of resistance to rice blast in India.

    Science.gov (United States)

    Yadav, Manoj Kumar; S, Aravindan; Ngangkham, Umakanta; Shubudhi, H N; Bag, Manas Kumar; Adak, Totan; Munda, Sushmita; Samantaray, Sanghamitra; Jena, Mayabini

    2017-01-01

    Rice blast disease caused by Magnaporthe oryzae is one of the most destructive disease causing huge losses to rice yield in different parts of the world. Therefore, an attempt has been made to find out the resistance by screening and studying the genetic diversity of eighty released rice varieties by National Rice Research Institute, Cuttack (NRVs) using molecular markers linked to twelve major blast resistance (R) genes viz Pib, Piz, Piz-t, Pik, Pik-p, Pikm Pik-h, Pita/Pita-2, Pi2, Pi9, Pi1 and Pi5. Out of which, nineteen varieties (23.75%) showed resistance, twenty one were moderately resistant (26.25%) while remaining forty varieties (50%) showed susceptible in uniform blast nursery. Rice varieties possessing blast resistance genes varied from four to twelve and the frequencies of the resistance genes ranged from 0 to 100%. The cluster analysis grouped the eighty NRVs into two major clusters at 63% level of genetic similarity coefficient. The PIC value for seventeen markers varied from 0 to 0.37 at an average of 0.20. Out of seventeen markers, only five markers, 195R-1, Pi9-i, Pita3, YL155/YL87 and 40N23r corresponded to three broad spectrum R genes viz. Pi9, Pita/Pita2 and Pi5 were found to be significantly associated with the blast disease with explaining phenotypic variance from 3.5% to 7.7%. The population structure analysis and PCoA divided the entire 80 NRVs into two sub-groups. The outcome of this study would help to formulate strategies for improving rice blast resistance through genetic studies, plant-pathogen interaction, identification of novel R genes, development of new resistant varieties through marker-assisted breeding for improving rice blast resistance in India and worldwide.

  1. Evolution of resistance against CRISPR/Cas9 gene drive

    OpenAIRE

    Clark, Andrew; Unckless, Robert; Messer, Philipp

    2016-01-01

    CRISPR/Cas9 gene drive (CGD) promises to be a highly adaptable approach for spreading genetically engineered alleles throughout a species, even if those alleles impair reproductive success. CGD has been shown to be effective in laboratory crosses of insects, yet it remains unclear to what extent potential resistance mechanisms will affect the dynamics of this process in large natural populations. Here we develop a comprehensive population genetic framework for modeling CGD dynamics, which inc...

  2. The Effect of Tianmai Xiaoke Pian on Insulin Resistance through PI3-K/AKT Signal Pathway

    Directory of Open Access Journals (Sweden)

    Nana Wang

    2016-01-01

    Full Text Available In the clinical setting, given the potential adverse effects of thiazolidinediones and biguanides, we often have difficulty in treatment that no other insulin sensitizers are available for use in type 2 diabetic mellitus (T2DM patients. Tianmai Xiaoke Pian (TMXKP is a traditional Chinese medicine tablet, which is comprised of chromium picolinate, Tianhuafen, Maidong, and Wuweizi. To understand its mechanism of action on insulin resistance, TMXKP (50 mg/kg orally was tested in T2DM rats (induced by a high-fat diet and streptozotocin. Eight weeks later, fasting blood glucose (FBG and oral glucose tolerance tests (OGTT were performed. Area under the curve (AUC and homeostatic model assessment of insulin resistance (HOMA-IR were calculated, and PI3-K/AKT signal pathway-related genes and proteins were tested by reverse transcription-polymerase chain reaction (RT-PCR and western blot analysis in muscle, adipose, and liver tissues, respectively. TMXKP significantly reduced FBG, OGTT, AUC, and HOMA-IR in diabetic rats P<0.05. Furthermore, we also observed that TMXKP could significantly decrease IRS-1, IRS-2, PI3-K p85α, and AKT2 gene expression and also IRS-1, IRS-2, PI3-K, AKT2, and p-AKT2 protein expression levels P<0.05 in diabetic rats. These findings confirm that TMXKP can alleviate insulin resistance in T2DM rats through the PI3K/AKT pathway. Thus TMXKP appears to be a promising insulin sensitizer.

  3. Characterization of hypersensitive resistance to bacterial spot race T3 (Xanthomonas perforans) from tomato accession PI 128216.

    Science.gov (United States)

    Robbins, Matthew D; Darrigues, Audrey; Sim, Sung-Chur; Masud, Mohammed Abu Taher; Francis, David M

    2009-09-01

    Bacterial spot of tomato is caused by four species of Xanthomonas. The accession PI 128216 (Solanum pimpinellifolium) displays a hypersensitive reaction (HR) to race T3 strains (predominantely Xanthomonas perforans). We developed an inbred backcross (IBC) population (BC(2)S(5), 178 families) derived from PI 128216 and OH88119 (S. lycopersicum) as the susceptible recurrent parent for simultaneous introgression and genetic analysis of the HR response. These IBC families were evaluated in the greenhouse for HR to race T3 strain Xcv761. The IBC population was genotyped with molecular markers distributed throughout the genome in order to identify candidate loci conferring resistance. We treated the IBC population as a hypothesis forming generation to guide validation in subsequent crosses. Nonparametric analysis identified an association between HR and markers clustered on chromosome 11 (P P > 0.002). Further analysis of the IBC population suggested that markers on chromosome 6 and 11 failed to assort independently, a phenomenon known as gametic phase disequilibrium. Therefore, to validate marker-trait linkages, resistant IBC plants were crossed with OH88119 and BC(3)F(2) progeny were evaluated for HR in the greenhouse. In these subsequent populations, the HR response was associated with the chromosome 11 markers (P 0.25). Independent F(2) families were developed by crossing resistant IBC lines to OH8245, OH88119, and OH7530. These populations were genotyped, organized into classes based on chromosome 11 markers, and evaluated for resistance in the field. The PI 128216 locus on chromosome 11 provided resistance that was dependent on gene dosage and genetic background. These results define a single locus, Rx-4, from PI 128216, which provides resistance to bacterial spot race T3, has additive gene action, and is located on chromosome 11.

  4. Diverse Rice Landraces of North-East India Enables the Identification of Novel Genetic Resources for Magnaporthe Resistance.

    Science.gov (United States)

    Umakanth, Bangale; Vishalakshi, Balija; Sathish Kumar, P; Rama Devi, S J S; Bhadana, Vijay Pal; Senguttuvel, P; Kumar, Sudhir; Sharma, Susheel Kumar; Sharma, Pawan Kumar; Prasad, M S; Madhav, Maganti S

    2017-01-01

    North-East (NE) India, the probable origin of rice has diverse genetic resources. Many rice landraces of NE India were not yet characterized for blast resistance. A set of 232 landraces of NE India, were screened for field resistance at two different hotspots of rice blast, viz., IIRR-UBN, Hyderabad and ICAR-NEH, Manipur in two consecutive seasons. The phenotypic evaluation as well as gene profiling for 12 major blast resistance genes ( Pitp , Pi33 , Pi54 , Pib , Pi20 , Pi38 , Pita2 , Pi1 , Piz , Pi9 , Pizt , and Pi40 ) with linked as well as gene-specific markers, identified 84 resistant landraces possessing different gene(s) either in singly or in combinations and also identified seven resistant landraces which do not have the tested genes, indicating the valuable genetic resources for blast resistance. To understand the molecular diversity existing in the population, distance and model based analysis were performed using 120 SSR markers. Results of both analyses are highly correlated by forming two distinct subgroups and the existence of high diversity (24.9% among the subgroups; 75.1% among individuals of each subgroup) was observed. To practically utilize the diversity in the breeding program, a robust core set having an efficiency index of 0.82 which consists of 33 landraces were identified through data of molecular, blast phenotyping, and important agro-morphological traits. The association of eight novel SSR markers for important agronomic traits which includes leaf and neck blast resistance was determined using genome-wide association analysis. The current study focuses on identifying novel resources having field resistance to blast as well as markers which can be explored in rice improvement programs. It also entails the development of a core set which can aid in representing the entire diversity for efficiently harnessing its properties to broaden the gene pool of rice.

  5. Abrogating endocrine resistance by targeting ERα and PI3K in breast cancer

    International Nuclear Information System (INIS)

    Fox, Emily M.; Arteaga, Carlos L.; Miller, Todd W.

    2012-01-01

    Antiestrogen therapies targeting estrogen receptor α (ER) signaling are a mainstay for patients with ER+ breast cancer. While many cancers exhibit resistance to antiestrogen therapies, a large body of clinical and experimental evidence indicates that hyperactivation of the phosphatidylinositol 3-kinase (PI3K) pathway promotes antiestrogen resistance. In addition, continued ligand-independent ER signaling in the setting of estrogen deprivation may contribute to resistance to endocrine therapy. PI3K activates several proteins which promote cell cycle progression and survival. In ER+ breast cancer cells, PI3K promotes ligand-dependent and -independent ER transcriptional activity. Models of antiestrogen-resistant breast cancer often remain sensitive to estrogen stimulation and PI3K inhibition, suggesting that clinical trials with combinations of drugs targeting both the PI3K and ER pathways are warranted. Herein, we review recent findings on the roles of PI3K and ER in antiestrogen resistance, and clinical trials testing drug combinations which target both pathways. We also discuss the need for clinical investigation of ER downregulators in combination with PI3K inhibitors.

  6. Marker-assisted introgression of broad-spectrum blast resistance genes into the cultivated MR219 rice variety.

    Science.gov (United States)

    Miah, Gous; Rafii, Mohd Y; Ismail, Mohd R; Puteh, Adam B; Rahim, Harun A; Latif, Mohammad A

    2017-07-01

    The rice cultivar MR219 is famous for its better yield and long and fine grain quality; however, it is susceptible to blast disease. The main objective of this study was to introgress blast resistance genes into MR219 through marker-assisted selection (MAS). The rice cultivar MR219 was used as the recurrent parent, and Pongsu Seribu 1 was used as the donor. Marker-assisted foreground selection was performed using RM6836 and RM8225 to identify plants possessing blast resistance genes. Seventy microsatellite markers were used to estimate recurrent parent genome (RPG) recovery. Our analysis led to the development of 13 improved blast resistant lines with Piz, Pi2 and Pi9 broad-spectrum blast resistance genes and an MR219 genetic background. The RPG recovery of the selected improved lines was up to 97.70% with an average value of 95.98%. Selected improved lines showed a resistance response against the most virulent blast pathogen pathotype, P7.2. The selected improved lines did not express any negative effect on agronomic traits in comparison with MR219. The research findings of this study will be a conducive approach for the application of different molecular techniques that may result in accelerating the development of new disease-resistant rice varieties, which in turn will match rising demand and food security worldwide. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  7. Pyrethroid Resistance in Malaysian Populations of Dengue Vector Aedes aegypti Is Mediated by CYP9 Family of Cytochrome P450 Genes.

    Science.gov (United States)

    Ishak, Intan H; Kamgang, Basile; Ibrahim, Sulaiman S; Riveron, Jacob M; Irving, Helen; Wondji, Charles S

    2017-01-01

    Dengue control and prevention rely heavily on insecticide-based interventions. However, insecticide resistance in the dengue vector Aedes aegypti, threatens the continued effectiveness of these tools. The molecular basis of the resistance remains uncharacterised in many endemic countries including Malaysia, preventing the design of evidence-based resistance management. Here, we investigated the underlying molecular basis of multiple insecticide resistance in Ae. aegypti populations across Malaysia detecting the major genes driving the metabolic resistance. Genome-wide microarray-based transcription analysis was carried out to detect the genes associated with metabolic resistance in these populations. Comparisons of the susceptible New Orleans strain to three non-exposed multiple insecticide resistant field strains; Penang, Kuala Lumpur and Kota Bharu detected 2605, 1480 and 425 differentially expressed transcripts respectively (fold-change>2 and p-value ≤ 0.05). 204 genes were commonly over-expressed with monooxygenase P450 genes (CYP9J27, CYP6CB1, CYP9J26 and CYP9M4) consistently the most up-regulated detoxification genes in all populations, indicating that they possibly play an important role in the resistance. In addition, glutathione S-transferases, carboxylesterases and other gene families commonly associated with insecticide resistance were also over-expressed. Gene Ontology (GO) enrichment analysis indicated an over-representation of GO terms linked to resistance such as monooxygenases, carboxylesterases, glutathione S-transferases and heme-binding. Polymorphism analysis of CYP9J27 sequences revealed a high level of polymorphism (except in Joho Bharu), suggesting a limited directional selection on this gene. In silico analysis of CYP9J27 activity through modelling and docking simulations suggested that this gene is involved in the multiple resistance in Malaysian populations as it is predicted to metabolise pyrethroids, DDT and bendiocarb. The predominant

  8. Transgenic Expression of the piRNA-Resistant Masculinizer Gene Induces Female-Specific Lethality and Partial Female-to-Male Sex Reversal in the Silkworm, Bombyx mori.

    Science.gov (United States)

    Sakai, Hiroki; Sumitani, Megumi; Chikami, Yasuhiko; Yahata, Kensuke; Uchino, Keiro; Kiuchi, Takashi; Katsuma, Susumu; Aoki, Fugaku; Sezutsu, Hideki; Suzuki, Masataka G

    2016-08-01

    In Bombyx mori (B. mori), Fem piRNA originates from the W chromosome and is responsible for femaleness. The Fem piRNA-PIWI complex targets and cleaves mRNAs transcribed from the Masc gene. Masc encodes a novel CCCH type zinc-finger protein and is required for male-specific splicing of B. mori doublesex (Bmdsx) transcripts. In the present study, several silkworm strains carrying a transgene, which encodes a Fem piRNA-resistant Masc mRNA (Masc-R), were generated. Forced expression of the Masc-R transgene caused female-specific lethality during the larval stages. One of the Masc-R strains weakly expressed Masc-R in various tissues. Females heterozygous for the transgene expressed male-specific isoform of the Bombyx homolog of insulin-like growth factor II mRNA-binding protein (ImpM) and Bmdsx. All examined females showed a lower inducibility of vitellogenin synthesis and exhibited abnormalities in the ovaries. Testis-like tissues were observed in abnormal ovaries and, notably, the tissues contained considerable numbers of sperm bundles. Homozygous expression of the transgene resulted in formation of the male-specific abdominal segment in adult females and caused partial male differentiation in female genitalia. These results strongly suggest that Masc is an important regulatory gene of maleness in B. mori.

  9. Dissection of the multigenic wheat stem rust resistance present in the Montenegrin spring wheat accession PI 362698

    Science.gov (United States)

    Research to identify and characterize stem rust resistance genes in common wheat, Triticum aestivum, has been stimulated by the emergence of Ug99-lineage races of the wheat stem rust pathogen, Puccinia graminis f. sp. tritici (Pgt), in Eastern Africa. The Montenegrin spring wheat landrace PI 362698 ...

  10. Identification of rust resistance genes Lr10 and Sr9a in Pakistani ...

    African Journals Online (AJOL)

    Identification of rust resistance genes Lr10 and Sr9a in Pakistani wheat germplasm using PCR based molecular markers. M Babar, AF Mashhadi, A Mehvish, AN Zahra, R Waheed, A Hasnain, S ur-Rahman, N Hussain, M Ali, I Khaliq, A Aziz ...

  11. PI3K inhibition to overcome endocrine resistance in breast cancer.

    Science.gov (United States)

    Keegan, Niamh M; Gleeson, Jack P; Hennessy, Bryan T; Morris, Patrick G

    2018-01-01

    Activation of the phosphatidylinositol-3 kinase (PI3K) pathway is a critical step in oncogenesis and plays a role in the development of treatment resistance for both estrogen receptor (ER) positive and human epidermal growth factor receptor 2 (HER2) positive breast cancers. Hence, there have been efforts to therapeutically inhibit this pathway. Areas covered: Several inhibitors of PI3K are now progressing through clinical trials with varying degrees of efficacy and toxicity to date. Numerous unresolved questions remain concerning the optimal isoform selectivity of PI3K inhibitors and use of predictive biomarkers. This review examines the most important PI3K inhibitors in ER positive breast cancer to date, with a particular focus on their role in overcoming endocrine therapy resistance and the possible use of PIK3CA mutations as a predictive biomarker. Expert opinion: We discuss some of the emerging challenges and questions encountered during the development of PI3K inhibitors from preclinical to phase III studies, including other novel biomarkers and future combinations to overcome endocrine resistance.

  12. Characterization and evaluation of rice blast resistance of Chinese indica hybrid rice parental lines

    Directory of Open Access Journals (Sweden)

    Yunyu Wu

    2017-12-01

    Full Text Available The development of resistant varieties and hybrid combinations has been the most effective and economical strategy to control blast disease caused by Magnaporthe oryzae. However, the distribution of major R genes and blast resistance characterization in hybrid rice parents has not been well investigated, resulting in their limited use in hybrid rice blast-resistance breeding. In the present study, 88 elite indica hybrid rice parental lines were evaluated with 30 isolates of M. oryzae collected from the main planting area of indica hybrid rice in China and were characterized for the presence of 11 major resistance genes using molecular markers. The pathogenicity assays showed that four types of hybrid rice parent line showed some resistance to M. oryzae. However, the proportions of highly resistant lines and the mean resistance frequency (RF varied among the four types, with resistance in decreasing order shown by three-line restorer lines, three-line maintainer lines, two-line sterile lines, and two-line restorer lines. All 88 hybrid rice parental lines carried more than one R gene, but none carried the R genes Pi1 and Pi2. Although Pid3 and Pi9 were present only in three-line restorer lines and Pigm only in three-line maintainer lines, the remaining six R genes (Pib, Pid2, Pi5, Pia, Pi54, and Pita were present in the four types of hybrid rice parent with significantly different distribution frequencies. The correlation between R genes and resistance reactions was investigated. The results are expected to provide useful information for rational utilization of major R genes in hybrid rice breeding programs. Keywords: Hybrid rice parental lines, Magnaporthe oryzae, Pi genes, Resistance evaluation, Molecular markers

  13. Evaluation of RNA extraction methods in rice and their application in expression analysis of resistance genes against Magnaporthe oryzae

    Directory of Open Access Journals (Sweden)

    Parisa Azizi

    2017-01-01

    Full Text Available Extraction of RNA of high quality and integrity is essential for gene expression studies and all downstream RNA-based techniques. The leaves of 16 merit Malaysian rice varieties were used to isolate total RNA using five different methods. The quantity, quality and integrity of extracted RNA were confirmed using three different means. The ratios of A260/280 ranged from 2.12 to 2.20. Electrophoresis (1.5% agarose gel was performed, illustrating intact and sharp bands representing the 28S, 18S, 5.8S and 5S ribosomal subunits of RNA, presenting intact RNA. RNA quality was verified using semi-quantitative polymerase chain reaction (sqPCR. The objective of this study was to identify different genes involved in the resistance of rice plants using high-quality RNA extracted 31 h after inoculation of Magnaporthe oryzae pathotype P7.2. The expression levels of eight blast resistance genes, Pikh, Pib, Pita, Pi21, Pi9, Os11gRGA8, OsWRKY22 and OsWRKY45, were evaluated by real-time PCR (RT-PCR. Real-time PCR was performed to identify candidate genes using RNA extracted by the TRIzol method, which showed the highest score compared with other methods in terms of RNA quantity, purity and integrity. In addition, the results of real-time PCR confirmed that the up-regulation of seven blast resistance genes may confer stronger resistance for the MR 276 variety against M. oryzae pathotype P7.2.

  14. Survey of rice blast race identity for blast resistance gene identification in the USA and Puerto Rico

    Science.gov (United States)

    Rice blast disease is a significant threat to stable rice production in the USA and worldwide. The major resistance gene (Pi-ta) located within a cluster of resistance genes on rice chromosome 12 has been demonstrated to confer resistance to the rice blast disease. Katy, a rice cultivar released in ...

  15. CCR9-CCL25 interactions promote cisplatin resistance in breast cancer cell through Akt activation in a PI3K-dependent and FAK-independent fashion

    Directory of Open Access Journals (Sweden)

    Lillard James W

    2011-05-01

    Full Text Available Abstract Background Chemotherapy heavily relies on apoptosis to kill breast cancer (BrCa cells. Many breast tumors respond to chemotherapy, but cells that survive this initial response gain resistance to subsequent treatments. This leads to aggressive cell variants with an enhanced ability to migrate, invade and survive at secondary sites. Metastasis and chemoresistance are responsible for most cancer-related deaths; hence, therapies designed to minimize both are greatly needed. We have recently shown that CCR9-CCL25 interactions promote BrCa cell migration and invasion, while others have shown that this axis play important role in T cell survival. In this study we have shown potential role of CCR9-CCL25 axis in breast cancer cell survival and therapeutic efficacy of cisplatin. Methods Bromodeoxyuridine (BrdU incorporation, Vybrant apoptosis and TUNEL assays were performed to ascertain the role of CCR9-CCL25 axis in cisplatin-induced apoptosis of BrCa cells. Fast Activated Cell-based ELISA (FACE assay was used to quantify In situ activation of PI3Kp85, AktSer473, GSK-3βSer9 and FKHRThr24 in breast cancer cells with or without cisplatin treatment in presence or absence of CCL25. Results CCR9-CCL25 axis provides survival advantage to BrCa cells and inhibits cisplatin-induced apoptosis in a PI3K-dependent and focal adhesion kinase (FAK-independent fashion. Furthermore, CCR9-CCL25 axis activates cell-survival signals through Akt and subsequent glycogen synthase kinase-3 beta (GSK-3β and forkhead in human rhabdomyosarcoma (FKHR inactivation. These results show that CCR9-CCL25 axis play important role in BrCa cell survival and low chemotherapeutic efficacy of cisplatin primarily through PI3K/Akt dependent fashion.

  16. Inheritance and Gene Mapping of Resistance to Soybean Mosaic Virus Strain SC14 in Soybean

    Institute of Scientific and Technical Information of China (English)

    Hai-Chao Li; Hai-Jian Zhi; Jun-Yi Gai; Dong-Quan Guo; Yan-Wei Wang; Kai Li; Li Bai; Hua Yang

    2006-01-01

    Soybean mosaic virus (SMV) is one of the most broadly distributed diseases worldwide. It causes severe yield loss and seed quality deficiency in soybean (Glycine max (L.) Merr.). SMV Strain SC14 isolated from Shanxi Province, China, was a newly identified virulent strain and can infect Kefeng No. 1, a source with wide spectrum resistance. In the present study, soybean accessions, PI96983, Qihuang No. 1 and Qihuang No. 22 were identified to be resistant (R) and Nannong 1138-2, Pixianchadou susceptible (S) to SC14. Segregation analysis of PI96983 × Nannong 1138-2 indicated that a single dominant gene (designated as Rsc14) controlled the resistance to SC14 at both V2 and R1 developmental stages. The same results were obtained for the crosses of Qihuang No. 1 × Nannong 1138-2 and Qihuang No. 22 × Nannong 1138-2 as in PI96983 × Nannong 1138-2 at V2 stage, but at R1 stage,the F1 performed as necrosis (a susceptible symptom other than mosaic), F2 segregated in a ratio of 1R:2N:1S,and the progenies of necrotic (N) F2 individuals segregated also in R, N and S. It indicated that a single gene (designated as Rsc14o, to be different from that of PI96983) controlled the resistance to SC14, its dominance was the same as in PI96983 × Nannong 1138-2 (without symptoms) at V2 stage and not the same at R1 stage. The tightly linked co-dominant simple sequence repeat (SSR) marker Satt334 indicated that all the heterozygous bands were completely corresponding to the necrotic F2 individuals, or all the necrotic F2 individuals were heterozygotes.It was inferred that necrosis might be due to the interaction among SMV strains, resistance genes, genetic background of the resistance genes, and plant development stage. Furthermore, the bulked segregant analysis (BSA) of SSR markers was conducted to map the resistance genes. In F2 of PI96983 × Nannong 1138-2, five SSR markers, Sat_297, Sat_234, Sat_154, Sct_033 and Sat_120, were found closely linked to Rsc14, with genetic distances of 14

  17. CCR9 interactions support ovarian cancer cell survival and resistance to cisplatin-induced apoptosis in a PI3K-dependent and FAK-independent fashion

    Directory of Open Access Journals (Sweden)

    Johnson Erica L

    2010-06-01

    Full Text Available Abstract Background Cisplatin is more often used to treat ovarian cancer (OvCa, which provides modest survival advantage primarily due to chemo-resistance and up regulated anti-apoptotic machineries in OvCa cells. Therefore, targeting the mechanisms responsible for cisplatin resistance in OvCa cell may improve therapeutic outcomes. We have shown that ovarian cancer cells express CC chemokine receptor-9 (CCR9. Others have also shown that CCL25, the only natural ligand for CCR9, up regulates anti-apoptotic proteins in immature T lymphocytes. Hence, it is plausible that CCR9-mediated cell signals might be involved in OvCa cell survival and inhibition of cisplatin-induced apoptosis. In this study, we investigated the potential role and molecular mechanisms of CCR9-mediated inhibition of cisplatin-induced apoptosis in OvCa cells. Methods Cell proliferation, vibrant apoptosis, and TUNEL assays were performed with or without cisplatin treatment in presence or absence of CCL25 to determine the role of the CCR9-CCL25 axis in cisplatin resistance. In situ Fast Activated cell-based ELISA (FACE assays were performed to determine anti-apoptotic signaling molecules responsible for CCL25-CCR9 mediated survival. Results Our results show interactions between CCR9 and CCL25 increased anti-apoptotic signaling cascades in OvCa cells, which rescued cells from cisplatin-induced cell death. Specifically, CCL25-CCR9 interactions mediated Akt, activation as well as GSK-3β and FKHR phosphorylation in a PI3K-dependent and FAK-independent fashion. Conclusions Our results suggest the CCR9-CCL25 axis plays an important role in reducing cisplatin-induced apoptosis of OvCa cells.

  18. Heat Stress Affects Pi-related Genes Expression and Inorganic Phosphate Deposition/Accumulation in Barley

    DEFF Research Database (Denmark)

    Pacak, Andrzej; Barciszewska-Pacak, Maria; Swida-Barteczka, Aleksandra

    2016-01-01

    Phosphorus (P) in plants is taken from soil as an inorganic phosphate (Pi) and is one of the most important macroelements in growth and development. Plants actively react to Pi starvation by the induced expression of Pi transporters, MIR399, MIR827, and miR399 molecular sponge - IPS1 genes...... and by the decreased expression of the ubiquitin-conjugating enzyme E2 (PHOSPHATE2 - PHO2) and Pi sensing and transport SPX-MFS genes. The PHO2 protein is involved in the degradation of Pi transporters PHT1;1 (from soil to roots) and PHO1 (from roots to shoots). The decreased expression of PHO2 leads to Pi....... In shoots, the PHO2 mRNA level is decreased, leading to an increased Pi level. We concluded that Pi homeostasis in barley during heat stress is maintained by dynamic changes in Pi-related genes expression....

  19. Genetic alteration with variable intron/exon organization amongst five PI-homoeologous genes in Platanus acerifolia.

    Science.gov (United States)

    Zhang, Jiaqi; Guo, Cong; Liu, Guofeng; Li, Zhineng; Li, Xiaomei; Bao, Manzhu

    2011-03-01

    Flower development has been extensively characterized in the model species Arabidopsis thaliana and Antirrhinum majus. However, there have been few studies in woody species. Here, we report the isolation and characterization of five PISTILLATA (PI) homoeologous genes (PaPI1-to-5) from the London Plane tree (Platanus acerifolia Willd). PaPI1 and PaPI2 show a similar genomic structure to other known PI homoeologs, but PaPI3/4/5 lack intron sequences. In addition, PaPI5 lacks the third, fourth and fifth exons which encode the K-domain. These altered gene copies may have originated as 'processed' retrogenes. PaPI2 appears micro-regulated by alternative splicing, displaying three splice forms (PaPI2a, PaPI2b and PaPI2c). RT-PCR analysis showed different expression profiles and transcript abundance for the five PaPI genes. PaPI transcripts encoding full-length polypeptides were expressed predominantly in male/female inflorescences and PaPI2a was the most abundant transcript (59%) indicating that PaPI2 may be the major functional PI-homoeolog in London Plane. Phenotypic characterization in a heterologous expression system demonstrated that the full-length PaPI product functions as a B class gene. By contrast the PaPI5 form, which lacks the K-domain, had no apparent effect on flower development. In vitro studies also demonstrated that the K-domain is required to form PaPI/PaAP3 heterodimers. Copyright © 2010 Elsevier B.V. All rights reserved.

  20. Gene mutation in ATM/PI3K region of nasopharyngeal carcinoma cell lines

    International Nuclear Information System (INIS)

    Wang Hongmei; Wu Xinyao; Xia Yunfei

    2002-01-01

    Objective: To define the correlation between nasopharyngeal carcinoma (NPC) cell radiosensitivity and gene mutation in the ATM/PI3K coding region. Methods: The gene mutation in the ATM/PI3K region of nasopharyngeal carcinoma cell lines which vary in radiosensitivity, was monitored by reverse transcription-polymerase chain reaction (RT-PCR) and fluorescence-marked ddNTP cycle sequencing technique. Results: No gene mutation was detected in the ATM/PI3K region of either CNE1 or CNE2. Conclusion: Disparity in intrinsic radiosensitivity between different NPC cell lines depends on some other factors and mechanism without being related to ATM/PI3K mutations

  1. Genotyping-by-sequencing targeting of a novel downy mildew resistance gene Pl 20 from wild Helianthus argophyllus for sunflower (Helianthus annuus L.).

    Science.gov (United States)

    Ma, G J; Markell, S G; Song, Q J; Qi, L L

    2017-07-01

    Genotyping-by-sequencing revealed a new downy mildew resistance gene, Pl 20 , from wild Helianthus argophyllus located on linkage group 8 of the sunflower genome and closely linked to SNP markers that facilitate the marker-assisted selection of resistance genes. Downy mildew (DM), caused by Plasmopara halstedii, is one of the most devastating and yield-limiting diseases of sunflower. Downy mildew resistance identified in wild Helianthus argophyllus accession PI 494578 was determined to be effective against the predominant and virulent races of P. halstedii occurring in the United States. The evaluation of 114 BC 1 F 2:3 families derived from the cross between HA 89 and PI 494578 against P. halstedii race 734 revealed that single dominant gene controls downy mildew resistance in the population. Genotyping-by-sequencing analysis conducted in the BC 1 F 2 population indicated that the DM resistance gene derived from wild H. argophyllus PI 494578 is located on the upper end of the linkage group (LG) 8 of the sunflower genome, as was determined single nucleotide polymorphism (SNP) markers associated with DM resistance. Analysis of 11 additional SNP markers previously mapped to this region revealed that the resistance gene, named Pl 20 , co-segregated with four markers, SFW02745, SFW09076, S8_11272025, and S8_11272046, and is flanked by SFW04358 and S8_100385559 at an interval of 1.8 cM. The newly discovered P. halstedii resistance gene has been introgressed from wild species into cultivated sunflower to provide a novel gene with DM resistance. The homozygous resistant individuals were selected from BC 2 F 2 progenies with the use of markers linked to the Pl 20 gene, and these lines should benefit the sunflower community for Helianthus improvement.

  2. Allelic Tests and Sequence Analysis of Three Genes for Resistance to Xanthomonas perforans Race T3 in Tomato

    Institute of Scientific and Technical Information of China (English)

    ZHAO Baimei; CAO Haipeng; DUAN Junjie; YANG Wencai

    2015-01-01

    Three crosses,Hawaii7981×PI128216,Hawaii7981×LA1589,and PI128216×LA1589,were made to develop F2 populations for testing allelism among three genes Xv3,Rx4,and RxLA1589 conferring resistance to bacterial spot caused by Xanthomonas perforans race T3 in tomato. Each population consisted of 535–1 655 individuals. An infiltration method was used to inoculate the leaves of the parental and F2 plants as well as the susceptible control OH88119 for detecting hypersensitive resistance(HR). The results showed that all the tomato plants except OH88119 had HR to race T3,indicating that Xv3,Rx4,and RxLA1589 were allelic genes. Genomic DNA fragments of the Rx4 alleles from Hawaii7981,PI128216,and LA1589 were amplified using gene-specific primers and sequenced. No sequence variation was observed in the coding region of Rx4 in the three resistant lines. Based on the published map positions of these loci as well as the allelic tests and sequence data obtained in this study,we speculated that Xv3,Rx4,and RxLA1589 were the same gene. The results will provide useful information for understanding the mechanism of resistance to race T3 and developing resistant tomato varieties.

  3. Functional analysis of PI-like gene in relation to flower development ...

    Indian Academy of Sciences (India)

    lying flower development in bamboo, a petal-identity gene was identified as a ... 35S::BoPI fully rescued the defective petal forma- tion in the ... Arabidopsis converted sepals to petals; BoPI-C interacted with BoAP3 on yeast two-hybrid assay, just like the full-length ... PI homologue function in regulating perianth organ forma-.

  4. Influences of the disease resistance conferred by the individual ...

    African Journals Online (AJOL)

    To research possible influences of the disease resistance conferred by different trans-resistance genes on the transgenic rice plants in their yields and grain quality, three transgenic rice lines, including two with the resistance genes Pi-d2 and Pi-d3, respectively, for rice blast, and one with the resistance gene Xa21 for rice ...

  5. A Novel Phytophthora sojae Resistance Rps12 Gene Mapped to a Genomic Region That Contains Several Rps Genes.

    Science.gov (United States)

    Sahoo, Dipak K; Abeysekara, Nilwala S; Cianzio, Silvia R; Robertson, Alison E; Bhattacharyya, Madan K

    2017-01-01

    Phytophthora sojae Kaufmann and Gerdemann, which causes Phytophthora root rot, is a widespread pathogen that limits soybean production worldwide. Development of Phytophthora resistant cultivars carrying Phytophthora resistance Rps genes is a cost-effective approach in controlling this disease. For this mapping study of a novel Rps gene, 290 recombinant inbred lines (RILs) (F7 families) were developed by crossing the P. sojae resistant cultivar PI399036 with the P. sojae susceptible AR2 line, and were phenotyped for responses to a mixture of three P. sojae isolates that overcome most of the known Rps genes. Of these 290 RILs, 130 were homozygous resistant, 12 heterzygous and segregating for Phytophthora resistance, and 148 were recessive homozygous and susceptible. From this population, 59 RILs homozygous for Phytophthora sojae resistance and 61 susceptible to a mixture of P. sojae isolates R17 and Val12-11 or P7074 that overcome resistance encoded by known Rps genes mapped to Chromosome 18 were selected for mapping novel Rps gene. A single gene accounted for the 1:1 segregation of resistance and susceptibility among the RILs. The gene encoding the Phytophthora resistance mapped to a 5.8 cM interval between the SSR markers BARCSOYSSR_18_1840 and Sat_064 located in the lower arm of Chromosome 18. The gene is mapped 2.2 cM proximal to the NBSRps4/6-like sequence that was reported to co-segregate with the Phytophthora resistance genes Rps4 and Rps6. The gene is mapped to a highly recombinogenic, gene-rich genomic region carrying several nucleotide binding site-leucine rich repeat (NBS-LRR)-like genes. We named this novel gene as Rps12, which is expected to be an invaluable resource in breeding soybeans for Phytophthora resistance.

  6. A Novel Phytophthora sojae Resistance Rps12 Gene Mapped to a Genomic Region That Contains Several Rps Genes.

    Directory of Open Access Journals (Sweden)

    Dipak K Sahoo

    Full Text Available Phytophthora sojae Kaufmann and Gerdemann, which causes Phytophthora root rot, is a widespread pathogen that limits soybean production worldwide. Development of Phytophthora resistant cultivars carrying Phytophthora resistance Rps genes is a cost-effective approach in controlling this disease. For this mapping study of a novel Rps gene, 290 recombinant inbred lines (RILs (F7 families were developed by crossing the P. sojae resistant cultivar PI399036 with the P. sojae susceptible AR2 line, and were phenotyped for responses to a mixture of three P. sojae isolates that overcome most of the known Rps genes. Of these 290 RILs, 130 were homozygous resistant, 12 heterzygous and segregating for Phytophthora resistance, and 148 were recessive homozygous and susceptible. From this population, 59 RILs homozygous for Phytophthora sojae resistance and 61 susceptible to a mixture of P. sojae isolates R17 and Val12-11 or P7074 that overcome resistance encoded by known Rps genes mapped to Chromosome 18 were selected for mapping novel Rps gene. A single gene accounted for the 1:1 segregation of resistance and susceptibility among the RILs. The gene encoding the Phytophthora resistance mapped to a 5.8 cM interval between the SSR markers BARCSOYSSR_18_1840 and Sat_064 located in the lower arm of Chromosome 18. The gene is mapped 2.2 cM proximal to the NBSRps4/6-like sequence that was reported to co-segregate with the Phytophthora resistance genes Rps4 and Rps6. The gene is mapped to a highly recombinogenic, gene-rich genomic region carrying several nucleotide binding site-leucine rich repeat (NBS-LRR-like genes. We named this novel gene as Rps12, which is expected to be an invaluable resource in breeding soybeans for Phytophthora resistance.

  7. Backward rho /sup -/ production in the reaction pi /sup -/p to p pi /sup -/ pi /sup 0/ at 9 GeV/c and 12 GeV/c

    CERN Document Server

    Benkheiri, P; D'Almagne, B; De Rosny, G; Eisenstein, B I; Ferrer, A; Fleury, P; Jacholkowski, A; Petroff, P; Richard, F; Rivet, P; Roudeau, P; Rougé, A; Six, J; Thénard, J M; Treille, D; Volte, A; Yoshida, H

    1977-01-01

    The backward production of mesons is studied in the reaction pi /sup - /p to p rho /sup -/. The differential cross section and the rho /sup - / density matrix are obtained using a Monte Carlo analysis of high statistics CERN experimental data on pi /sup -/p to p pi /sup -/ pi /sup 0/ reactions at 9 and 12 GeV/c. (10 refs).

  8. No impact of HIV-1 protease minority resistant variants on the virological response to a first-line PI-based regimen containing darunavir or atazanavir.

    Science.gov (United States)

    Perrier, Marine; Visseaux, Benoit; Landman, Roland; Joly, Véronique; Todesco, Eve; Yazdanpanah, Yazdan; Calvez, Vincent; Marcelin, Anne-Geneviève; Descamps, Diane; Charpentier, Charlotte

    2018-01-01

    To evaluate, in a clinical cohort of HIV-1-infected patients, the prevalence of PI minority resistant variants (MRV) at ART baseline and their impact on the virological response to a first-line PI-based regimen. In an observational single-centre cohort, we assessed all ART-naive patients initiating a first-line regimen including two NRTI and one boosted PI, darunavir/ritonavir or atazanavir/ritonavir, between January 2012 and March 2015. Ultra-deep sequencing of the pol gene was performed using Illumina® technology. Protease mutations were identified using the WHO transmitted drug resistance list and major PI resistance mutations (IAS-USA drug resistance mutations list). Ninety-four and 16 patients initiating a darunavir/ritonavir-based regimen and an atazanavir/ritonavir-based regimen, respectively, were assessed. Twenty-eight percent of the patients were HIV-1 subtype B, 39% CRF02_AG and 33% other non-B subtypes. Thirteen patients (13.8%) in the darunavir group and three patients (18.8%) in the atazanavir group experienced a virological failure (VF). Overall, 13 (11.8%) subjects had PI MRV at baseline in the median proportion of 1.3% (IQR = 1.1-1.7). The most prevalent PI MRV were G73C (n = 5) and M46I (n = 3). The proportion of patients harbouring baseline PI MRV was similar between those with virological success (10.6%) and those experiencing VF (18.8%) (P = 0.40). No difference was observed in the rate of PI MRV by viral subtype (P = 0.51) or by PI drug (P = 0.40). This study showed a prevalence of 11.8% of PI MRV among 110 ART-naive subjects, without significant impact on the virological response to a first-line PI-based regimen containing darunavir or atazanavir. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  9. Identification of the IGF1/PI3K/NF κB/ERK gene signalling networks associated with chemotherapy resistance and treatment response in high-grade serous epithelial ovarian cancer

    International Nuclear Information System (INIS)

    Koti, Madhuri; Evans, Kenneth; Feilotter, Harriet E; Park, Paul C; Squire, Jeremy A; Gooding, Robert J; Nuin, Paulo; Haslehurst, Alexandria; Crane, Colleen; Weberpals, Johanne; Childs, Timothy; Bryson, Peter; Dharsee, Moyez

    2013-01-01

    Resistance to platinum-based chemotherapy remains a major impediment in the treatment of serous epithelial ovarian cancer. The objective of this study was to use gene expression profiling to delineate major deregulated pathways and biomarkers associated with the development of intrinsic chemotherapy resistance upon exposure to standard first-line therapy for ovarian cancer. The study cohort comprised 28 patients divided into two groups based on their varying sensitivity to first-line chemotherapy using progression free survival (PFS) as a surrogate of response. All 28 patients had advanced stage, high-grade serous ovarian cancer, and were treated with standard platinum-based chemotherapy. Twelve patient tumours demonstrating relative resistance to platinum chemotherapy corresponding to shorter PFS (< eight months) were compared to sixteen tumours from platinum-sensitive patients (PFS > eighteen months). Whole transcriptome profiling was performed using an Affymetrix high-resolution microarray platform to permit global comparisons of gene expression profiles between tumours from the resistant group and the sensitive group. Microarray data analysis revealed a set of 204 discriminating genes possessing expression levels which could influence differential chemotherapy response between the two groups. Robust statistical testing was then performed which eliminated a dependence on the normalization algorithm employed, producing a restricted list of differentially regulated genes, and which found IGF1 to be the most strongly differentially expressed gene. Pathway analysis, based on the list of 204 genes, revealed enrichment in genes primarily involved in the IGF1/PI3K/NF κB/ERK gene signalling networks. This study has identified pathway specific prognostic biomarkers possibly underlying a differential chemotherapy response in patients undergoing standard platinum-based treatment of serous epithelial ovarian cancer. In addition, our results provide a pathway context for

  10. Avirulence (AVR) Gene-Based Diagnosis Complements Existing Pathogen Surveillance Tools for Effective Deployment of Resistance (R) Genes Against Rice Blast Disease.

    Science.gov (United States)

    Selisana, S M; Yanoria, M J; Quime, B; Chaipanya, C; Lu, G; Opulencia, R; Wang, G-L; Mitchell, T; Correll, J; Talbot, N J; Leung, H; Zhou, B

    2017-06-01

    Avirulence (AVR) genes in Magnaporthe oryzae, the fungal pathogen that causes the devastating rice blast disease, have been documented to be major targets subject to mutations to avoid recognition by resistance (R) genes. In this study, an AVR-gene-based diagnosis tool for determining the virulence spectrum of a rice blast pathogen population was developed and validated. A set of 77 single-spore field isolates was subjected to pathotype analysis using differential lines, each containing a single R gene, and classified into 20 virulent pathotypes, except for 4 isolates that lost pathogenicity. In all, 10 differential lines showed low frequency (95%), inferring the effectiveness of R genes present in the respective differential lines. In addition, the haplotypes of seven AVR genes were determined by polymerase chain reaction amplification and sequencing, if applicable. The calculated frequency of different AVR genes displayed significant variations in the population. AVRPiz-t and AVR-Pii were detected in 100 and 84.9% of the isolates, respectively. Five AVR genes such as AVR-Pik-D (20.5%) and AVR-Pik-E (1.4%), AVRPiz-t (2.7%), AVR-Pita (0%), AVR-Pia (0%), and AVR1-CO39 (0%) displayed low or even zero frequency. The frequency of AVR genes correlated almost perfectly with the resistance frequency of the cognate R genes in differential lines, except for International Rice Research Institute-bred blast-resistant lines IRBLzt-T, IRBLta-K1, and IRBLkp-K60. Both genetic analysis and molecular marker validation revealed an additional R gene, most likely Pi19 or its allele, in these three differential lines. This can explain the spuriously higher resistance frequency of each target R gene based on conventional pathotyping. This study demonstrates that AVR-gene-based diagnosis provides a precise, R-gene-specific, and differential line-free assessment method that can be used for determining the virulence spectrum of a rice blast pathogen population and for predicting the

  11. Inheritance of Resistance to Powdery Mildew Race 1W in Watermelon.

    Science.gov (United States)

    Ben-Naim, Yariv; Cohen, Yigal

    2015-11-01

    Powdery mildew caused by Podosphaera xanthii is a major disease of watermelon in Israel. In this study, 291 accessions of Citrullus spp. were evaluated for resistance against P. xanthii race 1W. Only eight accessions exhibited high level of resistance. Inheritance of resistance against P. xanthii race 1W was studied by crossing three resistant accession of Citrullus lanatus var. citroides BIU 119, PI 189225, or PI 482312 with the susceptible cultivar 'Malali' or 'Sugar Baby'. Parents, F1, F2, and back cross progenies were evaluated for resistance in growth chambers at the cotyledon stage and the 4-leaf stage and in the field, at the 15-leaf stage. Resistance at the cotyledon stage was controlled by a single, partially dominant gene, whereas at the 4-leaf stage or the 15-leaf stage resistance was controlled by three complimentary, partially dominant genes. Crosses made among these resistant accessions revealed that BIU 119 and PI 189225 carry the same genes for resistance, whereas PI 482312 shares two out of three genes with both BIU 119 and PI 189225. A breeding line with high resistance level and good fruit qualities was developed from BIU 119 × HA5500.

  12. Novel CRISPR/Cas9 gene drive constructs reveal insights into mechanisms of resistance allele formation and drive efficiency in genetically diverse populations.

    Directory of Open Access Journals (Sweden)

    Jackson Champer

    2017-07-01

    Full Text Available A functioning gene drive system could fundamentally change our strategies for the control of vector-borne diseases by facilitating rapid dissemination of transgenes that prevent pathogen transmission or reduce vector capacity. CRISPR/Cas9 gene drive promises such a mechanism, which works by converting cells that are heterozygous for the drive construct into homozygotes, thereby enabling super-Mendelian inheritance. Although CRISPR gene drive activity has already been demonstrated, a key obstacle for current systems is their propensity to generate resistance alleles, which cannot be converted to drive alleles. In this study, we developed two CRISPR gene drive constructs based on the nanos and vasa promoters that allowed us to illuminate the different mechanisms by which resistance alleles are formed in the model organism Drosophila melanogaster. We observed resistance allele formation at high rates both prior to fertilization in the germline and post-fertilization in the embryo due to maternally deposited Cas9. Assessment of drive activity in genetically diverse backgrounds further revealed substantial differences in conversion efficiency and resistance rates. Our results demonstrate that the evolution of resistance will likely impose a severe limitation to the effectiveness of current CRISPR gene drive approaches, especially when applied to diverse natural populations.

  13. Efficacy of an adapted granzyme B-based anti-CD30 cytolytic fusion protein against PI-9-positive classical Hodgkin lymphoma cells in a murine model

    International Nuclear Information System (INIS)

    Schiffer, S; Hansen, H P; Hehmann-Titt, G; Huhn, M; Fischer, R; Barth, S; Thepen, T

    2013-01-01

    Tumors develop when infiltrating immune cells contribute growth stimuli, and cancer cells are selected to survive within such a cytotoxic microenvironment. One possible immune-escape mechanism is the upregulation of PI-9 (Serpin B9) within cancer cells. This serine proteinase inhibitor selectively inactivates apoptosis-inducing granzyme B (GrB) from cytotoxic granules of innate immune cells. We demonstrate that most classical Hodgkin lymphoma (cHL)-derived cell lines express PI-9, which protects them against the GrB attack and thereby renders them resistant against GrB-based immunotherapeutics. To circumvent this disadvantage, we developed PI-9-insensitive human GrB mutants as fusion proteins to target the Hodgkin-selective receptor CD30. In contrast to the wild-type GrB, a R201K point-mutated GrB construct most efficiently killed PI-9-positive and -negative cHL cells. This was tested in vitro and also in vivo whereby a novel optical imaging-based tumor model with HL cell line L428 was applied. Therefore, this variant, as part of the next generation immunotherapeutics, also named cytolytic fusion proteins showing reduced immunogenicity, is a promising molecule for (targeted) therapy of patients with relapsing malignancies, such as cHL, and possibly other PI-9-positive malignancies, such as breast or lung carcinoma

  14. Dietary Lycium barbarum Polysaccharide Induces Nrf2/ARE Pathway and Ameliorates Insulin Resistance Induced by High-Fat via Activation of PI3K/AKT Signaling

    Directory of Open Access Journals (Sweden)

    Yi Yang

    2014-01-01

    Full Text Available Lycium barbarum polysaccharide (LBP, an antioxidant from wolfberry, displays the antioxidative and anti-inflammatory effects on experimental models of insulin resistance in vivo. However, the effective mechanism of LBP on high-fat diet-induced insulin resistance is still unknown. The objective of the study was to investigate the mechanism involved in LBP-mediated phosphatidylinositol 3-kinase (PI3K/AKT/Nrf2 axis against high-fat-induced insulin resistance. HepG2 cells were incubated with LBP for 12 hrs in the presence of palmitate. C57BL/6J mice were fed a high-fat diet supplemented with LBP for 24 weeks. We analyzed the expression of nuclear factor-E2-related factor 2 (Nrf2, Jun N-terminal kinases (JNK, and glycogen synthase kinase 3β (GSK3β involved in insulin signaling pathway in vivo and in vitro. First, LBP significantly induced phosphorylation of Nrf2 through PI3K/AKT signaling. Second, LBP obviously increased detoxification and antioxidant enzymes expression and reduced reactive oxygen species (ROS levels via PI3K/AKT/Nrf2 axis. Third, LBP also regulated phosphorylation levels of GSK3β and JNK through PI3K/AKT signaling. Finally, LBP significantly reversed glycolytic and gluconeogenic genes expression via the activation of Nrf2-mediated cytoprotective effects. In summary, LBP is novel antioxidant against insulin resistance induced by high-fat diet via activation of PI3K/AKT/Nrf2 pathway.

  15. Search for direct CP violating charge asymmetries in $K^\\pm\\to\\pi^\\pm\\pi^+\\pi^-$ and $K^\\pm\\to\\pi^\\pm\\pi^0\\pi^0$ decays

    CERN Document Server

    Batley, J Richard; Kalmus, George Ernest; Lazzeroni, C; Munday, D J; Slater, M W; Wotton, S A; Arcidiacono, R; Bocquet, G; Cabibbo, Nicola; Ceccucci, A; Cundy, Donald C; Falaleev, V; Fidecaro, Maria; Gatignon, L; Gonidec, A; Kubischta, Werner; Norton, A; Maier, A; Patel, M; Peters, A; Balev, S; Frabetti, P L; Goudzovski, E; Khristov, P Z; Kekelidze, V D; Kozhuharov, V; Litov, L; Madigozhin, D T; Marinova, E; Molokanova, N A; Polenkevich, I; Potrebenikov, Yu K; Stoynev, S; Zinchenko, A I; Monnier, E; Swallow, E; Winston, R; Rubin, P; Walker, A; Baldini, W; Cotta-Ramusino, A; Dalpiaz, P; Damiani, C; Fiorini, M; Gianoli, A; Martini, M; Petrucci, F; Savrié, M; Scarpa, M; Wahle, H; Bizzeti, A; Calvetti, M; Celeghini, E; Iacopini, E; Lenti, M; Martelli, F; Ruggiero, G; Veltri, M; Behler, M; Eppard, K; Kleinknecht, K; Marouelli, P; Masetti, L; Moosbrugger, U; Morales-Morales, C; Renk, B; Wache, M; Wanke, R; Winhart, A; Coward, D; Dabrowski, A; Fonseca-Martin, T; Shieh, M; Szleper, M; Velasco, M; Wood, M D; Anzivino, Giuseppina; Cenci, P; Imbergamo, E; Nappi, A; Pepé, M; Petrucci, M C; Piccini, M; Raggi, M; Valdata-Nappi, M; Cerri, C; Collazuol, G; Costantini, F; Di Lella, L; Doble, N; Fantechi, R; Fiorini, L; Giudici, S; Lamanna, G; Mannelli, I; Michetti, A; Pierazzini, G M; Sozzi, M; Bloch-Devaux, B; Cheshkov, C; Chèze, J B; De Beer, M; Derré, J; Marel, Gérard; Mazzucato, E; Peyaud, B; Vallage, B; Holder, M; Ziolkowski, M; Bifani, S; Biino, C; Cartiglia, N; Clemencic, M; Goy-Lopez, S; Marchetto, F; Dibon, Heinz; Jeitler, Manfred; Markytan, Manfred; Mikulec, I; Neuhofer, G; Widhalm, L

    2007-01-01

    A measurement of the direct CP violating charge asymmetries of the Dalitz plot linear slopes $A_g=(g^+-g^-)/(g^++g^-)$ in $K^\\pm\\to\\pi^\\pm\\pi^+\\pi^-$ and $K^\\pm\\to\\pi^\\pm\\pi^0\\pi^0$ decays by the NA48/2 experiment at CERN SPS is presented. A new technique of asymmetry measurement involving simultaneous $K^+$ and $K^-$ beams and a large data sample collected allowed a result of an unprecedented precision. The charge asymmetries were measured to be $A^c_g=(-1.5\\pm2.1)\\times10^{-4}$ with $3.11\\times 10^9$ $K^{\\pm}\\to\\pi^\\pm\\pi^+\\pi^-$ decays, and $A^n_g=(1.8\\pm1.8)\\times10^{-4}$ with $9.13\\times 10^7$ $K^{\\pm}\\to\\pi^\\pm\\pi^0\\pi^0$ decays. The precision of the results is limited mainly by the size of the data sample.

  16. Inheritance and Bulked Segregant Analysis of Leaf Rust and Stem Rust Resistance in Durum Wheat Genotypes.

    Science.gov (United States)

    Aoun, Meriem; Kolmer, James A; Rouse, Matthew N; Chao, Shiaoman; Bulbula, Worku Denbel; Elias, Elias M; Acevedo, Maricelis

    2017-12-01

    Leaf rust, caused by Puccinia triticina, and stem rust, caused by P. graminis f. sp. tritici, are important diseases of durum wheat. This study determined the inheritance and genomic locations of leaf rust resistance (Lr) genes to P. triticina race BBBQJ and stem rust resistance (Sr) genes to P. graminis f. sp. tritici race TTKSK in durum accessions. Eight leaf-rust-resistant genotypes were used to develop biparental populations. Accessions PI 192051 and PI 534304 were also resistant to P. graminis f. sp. tritici race TTKSK. The resulting progenies were phenotyped for leaf rust and stem rust response at seedling stage. The Lr and Sr genes were mapped in five populations using single-nucleotide polymorphisms and bulked segregant analysis. Five leaf-rust-resistant genotypes carried single dominant Lr genes whereas, in the remaining accessions, there was deviation from the expected segregation ratio of a single dominant Lr gene. Seven genotypes carried Lr genes different from those previously characterized in durum. The single dominant Lr genes in PI 209274, PI 244061, PI387263, and PI 313096 were mapped to chromosome arms 6BS, 2BS, 6BL, and 6BS, respectively. The Sr gene in PI 534304 mapped to 6AL and is most likely Sr13, while the Sr gene in PI 192051 could be uncharacterized in durum.

  17. Discovery and introgression of the wild sunflower-derived novel downy mildew resistance gene Pl 19 in confection sunflower (Helianthus annuus L.).

    Science.gov (United States)

    Zhang, Z W; Ma, G J; Zhao, J; Markell, S G; Qi, L L

    2017-01-01

    A new downy mildew resistance gene, Pl 19 , was identified from wild Helianthus annuus accession PI 435414, introduced to confection sunflower, and genetically mapped to linkage group 4 of the sunflower genome. Wild Helianthus annuus accession PI 435414 exhibited resistance to downy mildew, which is one of the most destructive diseases to sunflower production globally. Evaluation of the 140 BC 1 F 2:3 families derived from the cross of CMS CONFSCLB1 and PI 435414 against Plasmopara halstedii race 734 revealed that a single dominant gene controls downy mildew resistance in the population. Bulked segregant analysis conducted in the BC 1 F 2 population with 860 simple sequence repeat (SSR) markers indicated that the resistance derived from wild H. annuus was associated with SSR markers located on linkage group (LG) 4 of the sunflower genome. To map and tag this resistance locus, designated Pl 19 , 140 BC 1 F 2 individuals were used to construct a linkage map of the gene region. Two SSR markers, ORS963 and HT298, were linked to Pl 19 within a distance of 4.7 cM. After screening 27 additional single nucleotide polymorphism (SNP) markers previously mapped to this region, two flanking SNP markers, NSA_003564 and NSA_006089, were identified as surrounding the Pl 19 gene at a distance of 0.6 cM from each side. Genetic analysis indicated that Pl 19 is different from Pl 17 , which had previously been mapped to LG4, but is closely linked to Pl 17 . This new gene is highly effective against the most predominant and virulent races of P. halstedii currently identified in North America and is the first downy mildew resistance gene that has been transferred to confection sunflower. The selected resistant germplasm derived from homozygous BC 2 F 3 progeny provides a novel gene for use in confection sunflower breeding programs.

  18. First observation of the decays $\\overline{B}^0 \\to D^+ K^- \\pi^+ \\pi^-$ and $B^- \\to D^0 K^- \\pi^+ \\pi^-$

    CERN Document Server

    Aaij, R; Adeva, B; Adinolfi, M; Adrover, C; Affolder, A; Ajaltouni, Z; Albrecht, J; Alessio, F; Alexander, M; Alkhazov, G; Alvarez Cartelle, P; Alves Jr, A A; Amato, S; Amhis, Y; Anderson, J; Appleby, R B; Aquines Gutierrez, O; Archilli, F; Arrabito, L; Artamonov, A; Artuso, M; Aslanides, E; Auriemma, G; Bachmann, S; Back, J J; Bailey, D S; Balagura, V; Baldini, W; Barlow, R J; Barschel, C; Barsuk, S; Barter, W; Bates, A; Bauer, C; Bauer, Th; Bay, A; Bediaga, I; Belogurov, S; Belous, K; Belyaev, I; Ben-Haim, E; Benayoun, M; Bencivenni, G; Benson, S; Benton, J; Bernet, R; Bettler, M -O; van Beuzekom, M; Bien, A; Bifani, S; Bird, T; Bizzeti, A; Bjørnstad, P M; Blake, T; Blanc, F; Blanks, C; Blouw, J; Blusk, S; Bobrov, A; Bocci, V; Bondar, A; Bondar, N; Bonivento, W; Borghi, S; Borgia, A; Bowcock, T J V; Bozzi, C; Brambach, T; van den Brand, J; Bressieux, J; Brett, D; Britsch, M; Britton, T; Brook, N H; Brown, H; Büchler-Germann, A; Burducea, I; Bursche, A; Buytaert, J; Cadeddu, S; Callot, O; Calvi, M; Calvo Gomez, M; Camboni, A; Campana, P; Carbone, A; Carboni, G; Cardinale, R; Cardini, A; Carson, L; Carvalho Akiba, K; Casse, G; Cattaneo, M; Cauet, Ch; Charles, M; Charpentier, Ph; Chiapolini, N; Ciba, K; Cid Vidal, X; Ciezarek, G; Clarke, P E L; Clemencic, M; Cliff, H V; Closier, J; Coca, C; Coco, V; Cogan, J; Collins, P; Comerma-Montells, A; Constantin, F; Contu, A; Cook, A; Coombes, M; Corti, G; Couturier, B; Cowan, G A; Currie, R; D'Ambrosio, C; David, P; David, P N Y; De Bonis, I; De Capua, S; De Cian, M; De Lorenzi, F; De Miranda, J M; De Paula, L; De Simone, P; Decamp, D; Deckenhoff, M; Degaudenzi, H; Del Buono, L; Deplano, C; Derkach, D; Deschamps, O; Dettori, F; Dickens, J; Dijkstra, H; Diniz Batista, P; Domingo Bonal, F; Donleavy, S; Dordei, F; Dosil Suárez, A; Dossett, D; Dovbnya, A; Dupertuis, F; Dzhelyadin, R; Dziurda, A; Easo, S; Egede, U; Egorychev, V; Eidelman, S; van Eijk, D; Eisele, F; Eisenhardt, S; Ekelhof, R; Eklund, L; Elsasser, Ch; Elsby, D; Esperante Pereira, D; Estève, L; Falabella, A; Fanchini, E; Färber, C; Fardell, G; Farinelli, C; Farry, S; Fave, V; Fernandez Albor, V; Ferro-Luzzi, M; Filippov, S; Fitzpatrick, C; Fontana, M; Fontanelli, F; Forty, R; Francisco, O; Frank, M; Frei, C; Frosini, M; Furcas, S; Gallas Torreira, A; Galli, D; Gandelman, M; Gandini, P; Gao, Y; Garnier, J-C; Garofoli, J; Garra Tico, J; Garrido, L; Gascon, D; Gaspar, C; Gauvin, N; Gersabeck, M; Gershon, T; Ghez, Ph; Gibson, V; Gligorov, V V; Göbel, C; Golubkov, D; Golutvin, A; Gomes, A; Gordon, H; Grabalosa Gándara, M; Graciani Diaz, R; Granado Cardoso, L A; Graugés, E; Graziani, G; Grecu, A; Greening, E; Gregson, S; Gui, B; Gushchin, E; Guz, Yu; Gys, T; Haefeli, G; Haen, C; Haines, S C; Hampson, T; Hansmann-Menzemer, S; Harji, R; Harnew, N; Harrison, J; Harrison, P F; Hartmann, T; He, J; Heijne, V; Hennessy, K; Henrard, P; Hernando Morata, J A; van Herwijnen, E; Hicks, E; Holubyev, K; Hopchev, P; Hulsbergen, W; Hunt, P; Huse, T; Huston, R S; Hutchcroft, D; Hynds, D; Iakovenko, V; Ilten, P; Imong, J; Jacobsson, R; Jaeger, A; Jahjah Hussein, M; Jans, E; Jansen, F; Jaton, P; Jean-Marie, B; Jing, F; John, M; Johnson, D; Jones, C R; Jost, B; Kaballo, M; Kandybei, S; Karacson, M; Karbach, T M; Keaveney, J; Kenyon, I R; Kerzel, U; Ketel, T; Keune, A; Khanji, B; Kim, Y M; Knecht, M; Koopman, R F; Koppenburg, P; Korolev, M; Kozlinskiy, A; Kravchuk, L; Kreplin, K; Kreps, M; Krocker, G; Krokovny, P; Kruse, F; Kruzelecki, K; Kucharczyk, M; Kvaratskheliya, T; La Thi, V N; Lacarrere, D; Lafferty, G; Lai, A; Lambert, D; Lambert, R W; Lanciotti, E; Lanfranchi, G; Langenbruch, C; Latham, T; Lazzeroni, C; Le Gac, R; van Leerdam, J; Lees, J -P; Lefèvre, R; Leflat, A; Lefrançois, J; Leroy, O; Lesiak, T; Li, L; Li Gioi, L; Lieng, M; Liles, M; Lindner, R; Linn, C; Liu, B; Liu, G; von Loeben, J; Lopes, J H; Lopez Asamar, E; Lopez-March, N; Lu, H; Luisier, J; Mac Raighne, A; Machefert, F; Machikhiliyan, I V; Maciuc, F; Maev, O; Magnin, J; Malde, S; Mamunur, R M D; Manca, G; Mancinelli, G; Mangiafave, N; Marconi, U; Märki, R; Marks, J; Martellotti, G; Martens, A; Martin, L; Martín Sánchez, A; Martinez Santos, D; Massafferri, A; Mathe, Z; Matteuzzi, C; Matveev, M; Maurice, E; Maynard, B; Mazurov, A; McGregor, G; McNulty, R; Meissner, M; Merk, M; Merkel, J; Messi, R; Miglioranzi, S; Milanes, D A; Minard, M -N; Molina Rodriguez, J; Monteil, S; Moran, D; Morawski, P; Mountain, R; Mous, I; Muheim, F; Müller, K; Muresan, R; Muryn, B; Muster, B; Musy, M; Mylroie-Smith, J; Naik, P; Nakada, T; Nandakumar, R; Nasteva, I; Nedos, M; Needham, M; Neufeld, N; Nguyen-Mau, C; Nicol, M; Niess, V; Nikitin, N; Nikodem, T; Nomerotski, A; Novoselov, A; Oblakowska-Mucha, A; Obraztsov, V; Oggero, S; Ogilvy, S; Okhrimenko, O; Oldeman, R; Orlandea, M; Otalora Goicochea, J M; Owen, P; Pal, B K; Palacios, J; Palano, A; Palutan, M; Panman, J; Papanestis, A; Pappagallo, M; Parkes, C; Parkinson, C J; Passaleva, G; Patel, G D; Patel, M; Paterson, S K; Patrick, G N; Patrignani, C; Pavel-Nicorescu, C; Pazos Alvarez, A; Pellegrino, A; Penso, G; Pepe Altarelli, M; Perazzini, S; Perego, D L; Perez Trigo, E; Pérez-Calero Yzquierdo, A; Perret, P; Perrin-Terrin, M; Pessina, G; Petrella, A; Petrolini, A; Phan, A; Picatoste Olloqui, E; Pie Valls, B; Pietrzyk, B; Pilař, T; Pinci, D; Plackett, R; Playfer, S; Plo Casasus, M; Polok, G; Poluektov, A; Polycarpo, E; Popov, D; Popovici, B; Potterat, C; Powell, A; Prisciandaro, J; Pugatch, V; Puig Navarro, A; Qian, W; Rademacker, J H; Rakotomiaramanana, B; Rangel, M S; Raniuk, I; Raven, G; Redford, S; Reid, M M; dos Reis, A C; Ricciardi, S; Rinnert, K; Roa Romero, D A; Robbe, P; Rodrigues, E; Rodrigues, F; Rodriguez Perez, P; Rogers, G J; Roiser, S; Romanovsky, V; Rosello, M; Rouvinet, J; Ruf, T; Ruiz, H; Sabatino, G; Saborido Silva, J J; Sagidova, N; Sail, P; Saitta, B; Salzmann, C; Sannino, M; Santacesaria, R; Santamarina Rios, C; Santinelli, R; Santovetti, E; Sapunov, M; Sarti, A; Satriano, C; Satta, A; Savrie, M; Savrina, D; Schaack, P; Schiller, M; Schleich, S; Schlupp, M; Schmelling, M; Schmidt, B; Schneider, O; Schopper, A; Schune, M -H; Schwemmer, R; Sciascia, B; Sciubba, A; Seco, M; Semennikov, A; Senderowska, K; Sepp, I; Serra, N; Serrano, J; Seyfert, P; Shapkin, M; Shapoval, I; Shatalov, P; Shcheglov, Y; Shears, T; Shekhtman, L; Shevchenko, O; Shevchenko, V; Shires, A; Silva Coutinho, R; Skwarnicki, T; Smith, A C; Smith, N A; Smith, E; Sobczak, K; Soler, F J P; Solomin, A; Soomro, F; Souza De Paula, B; Spaan, B; Sparkes, A; Spradlin, P; Stagni, F; Stahl, S; Steinkamp, O; Stoica, S; Stone, S; Storaci, B; Straticiuc, M; Straumann, U; Subbiah, V K; Swientek, S; Szczekowski, M; Szczypka, P; Szumlak, T; T'Jampens, S; Teodorescu, E; Teubert, F; Thomas, C; Thomas, E; van Tilburg, J; Tisserand, V; Tobin, M; Tolk, S; Topp-Joergensen, S; Torr, N; Tournefier, E; Tran, M T; Tsaregorodtsev, A; Tuning, N; Ubeda Garcia, M; Ukleja, A; Urquijo, P; Uwer, U; Vagnoni, V; Valenti, G; Vazquez Gomez, R; Vazquez Regueiro, P; Vecchi, S; Velthuis, J J; Veltri, M; Viaud, B; Videau, I; Vieira, D; Vilasis-Cardona, X; Visniakov, J; Vollhardt, A; Volyanskyy, D; Voong, D; Vorobyev, A; Voss, H; Wandernoth, S; Wang, J; Ward, D R; Watson, N K; Webber, A D; Websdale, D; Whitehead, M; Wiedner, D; Wiggers, L; Wilkinson, G; Williams, M P; Williams, M; Wilson, F F; Wishahi, J; Witek, M; Witzeling, W; Wotton, S A; Wyllie, K; Xie, Y; Xing, F; Xing, Z; Yang, Z; Young, R; Yushchenko, O; Zangoli, M; Zavertyaev, M; Zhang, F; Zhang, L; Zhang, W C; Zhang, Y; Zhelezov, A; Zhong, L; Zvyagin, A

    2012-01-01

    First observations of the Cabibbo suppressed decays $\\bar{B}^0\\to D^+K^-\\pi^+\\pi^-$ and $B^-\\to D^0K^-\\pi^+\\pi^-$ are reported using 35~pb$^{-1}$ of data collected with the LHCb detector. Their branching fractions are measured with respect to the corresponding Cabibbo favored decays, from which we obtain ${\\cal{B}}(\\bar{B}^0\\to D^+K^-\\pi^+\\pi^-)/{\\cal{B}}(\\bar{B}^0\\to D^+\\pi^-\\pi^+\\pi^-)=(5.9\\pm1.1\\pm0.5)\\times10^{-2}$ and ${\\cal{B}}(B^-\\to D^0K^-\\pi^+\\pi^-)/{\\cal{B}}(B^-\\to D^0\\pi^-\\pi^+\\pi^-)=(9.4\\pm1.3\\pm0.9)\\times10^{-2}$, where the uncertainties are statistical and systematic, respectively. The $B^-\\to D^0K^-\\pi^+\\pi^-$ decay is particularly interesting, as it can be used in a similar way to $B^-\\to D^0K^-$ to measure the CKM phase $\\gamma$.

  19. Synergistic Interactions with PI3K Inhibition that Induce Apoptosis. | Office of Cancer Genomics

    Science.gov (United States)

    Activating mutations involving the PI3K pathway occur frequently in human cancers. However, PI3K inhibitors primarily induce cell cycle arrest, leaving a significant reservoir of tumor cells that may acquire or exhibit resistance. We searched for genes that are required for the survival of PI3K mutant cancer cells in the presence of PI3K inhibition by conducting a genome scale shRNA-based apoptosis screen in a PIK3CA mutant human breast cancer cell. We identified 5 genes (PIM2, ZAK, TACC1, ZFR, ZNF565) whose suppression induced cell death upon PI3K inhibition.

  20. Preclinical rationale for PI3K/Akt/mTOR pathway inhibitors as therapy for epidermal growth factor receptor inhibitor-resistant non-small-cell lung cancer.

    Science.gov (United States)

    Gadgeel, Shirish M; Wozniak, Antoinette

    2013-07-01

    Mutations in the epidermal growth factor receptor gene (EGFR) are frequently observed in non-small-cell lung cancer (NSCLC), occurring in about 40% to 60% of never-smokers and in about 17% of patients with adenocarcinomas. EGFR tyrosine kinase inhibitors (TKIs), such as gefitinib and erlotinib, have transformed therapy for patients with EGFR-mutant NSCLC and have proved superior to chemotherapy as first-line treatment for this patient group. Despite these benefits, there are currently 2 key challenges associated with EGFR inhibitor therapy for patients with NSCLC. First, only 85% to 90% of patients with the EGFR mutation derive clinical benefit from EGFR TKIs, with the remainder demonstrating innate resistance to therapy. Second, acquired resistance to EGFR TKIs inevitably occurs in patients who initially respond to therapy, with a median duration of response of about 10 months. Mutant EGFR activates various subcellular signaling cascades, including the phosphatidylinositol 3-kinase (PI3K)/Akt/mammalian target of rapamycin (mTOR) pathway, which demonstrates maintained activity in a variety of TKI-resistant cancers. Given the fundamental role of the PI3K/Akt/mTOR pathway in tumor oncogenesis, proliferation, and survival, PI3K pathway inhibitors have emerged as a possible solution to the problem of EGFR TKI resistance. However resistance to EGFR TKIs is associated with considerable heterogeneity and complexity. Preclinical experiments investigating these phenomena suggest that in some patients, PI3K inhibitors will have to be paired with other targeted agents if they are to be effective. This review discusses the preclinical data supporting PI3K/Akt/mTOR pathway inhibitor combinations in EGFR TKI-resistant NSCLC from the perspective of the various agents currently being investigated in clinical trials. Copyright © 2013 Elsevier Inc. All rights reserved.

  1. The small RNA content of human sperm reveals pseudogene-derived piRNAs complementary to protein-coding genes

    DEFF Research Database (Denmark)

    Pantano, Lorena; Jodar, Meritxell; Bak, Mads

    2015-01-01

    -specific genes. The most abundant class of small noncoding RNAs in sperm are PIWI-interacting RNAs (piRNAs). Surprisingly, we found that human sperm cells contain piRNAs processed from pseudogenes. Clusters of piRNAs from human testes contain pseudogenes transcribed in the antisense strand and processed...... into small RNAs. Several human protein-coding genes contain antisense predicted targets of pseudogene-derived piRNAs in the male germline and these piRNAs are still found in mature sperm. Our study provides the most extensive data set and annotation of human sperm small RNAs to date and is a resource...... for further functional studies on the roles of sperm small RNAs. In addition, we propose that some of the pseudogene-derived human piRNAs may regulate expression of their parent gene in the male germline....

  2. Channel separation using the transversity parameter in the pi /sup +/n to p pi /sup +/ pi /sup -/ reaction at 9 GeV/c

    CERN Document Server

    Armenise, N

    1978-01-01

    To solve the problem of separating competitive channels in a multiparticle final state the use of a parameter, called A(*), measuring the 'event transversity' has been suggested. The A parameter is found to be as powerful as prism plot analysis in separating different channels and economic with respect to the computer time. The transversity method is applied to the three-body reaction p/sup +/n to p pi /sup +/ pi /sup -/ at 9 TeV/c selected in pi /sup +/d interactions obtained in 2m-DBC exposed at CERN-PS. The main contributions in the final state are rho /sup 0/, f, g/sup 0/ (a dipion mass resonance) resonance production and neutron diffraction dissociation. (5 refs).

  3. DNA tagging of blast resistant gene(s in three Brazilian rice cultivars

    Directory of Open Access Journals (Sweden)

    S.S. Sandhu

    2003-12-01

    Full Text Available Rice blast is the most important fungal disease of rice and is caused by Pyricularia oryzae Sacc. (Telomorph Magnoporthe grisea Barr.. Seven randomly amplified polymorphic DNA (RAPD markers OPA5, OPG17, OPG18, OPG19, OPF9, OPF17 and OPF19 showed very clear polymorphism in resistant cultivar lines which differed from susceptible lines. By comparing different susceptible lines, nine DNA amplifications of seven primers (OPA5(1000, OPA5(1200, OPG17(700, OPG18(850, OPG19(500, OPG19(600, OPF9(600, OPF17(1200 and OPF19(600 were identified as dominant markers for the blast resistant gene in resistant cultivar lines. These loci facilitate the indirect scoring of blast resistant and blast susceptible genotypes. The codomine RAPDs markers will facilitate marker-assisted selection of the blast resistant gene in two blast resistant genotypes of rice (Labelle and Line 11 and will be useful in rice breeding programs.

  4. QTL mapping of downy and powdery mildew resistances in PI 197088 cucumber with genotyping-by-sequencing in RIL population.

    Science.gov (United States)

    Wang, Yuhui; VandenLangenberg, Kyle; Wen, Changlong; Wehner, Todd C; Weng, Yiqun

    2018-03-01

    Host resistances in PI 197088 cucumber to downy and powdery mildew pathogens are conferred by 11 (3 with major effect) and 4 (1 major effect) QTL, respectively, and three of which are co-localized. The downy mildew (DM) and powdery mildew (PM) are the two most important foliar diseases of cucurbit crops worldwide. The cucumber accession PI 197088 exhibits high-level resistances to both pathogens. Here, we reported QTL mapping results for DM and PM resistances with 148 recombinant inbred lines from a cross between PI 197088 and the susceptible line 'Coolgreen'. Phenotypic data on responses to natural DM and PM infection were collected in multi-year and multi-location replicated field trials. A high-density genetic map with 2780 single nucleotide polymorphisms (SNPs) from genotyping-by-sequencing and 55 microsatellite markers was developed, which revealed genomic regions with segregation distortion and mis-assemblies in the '9930' cucumber draft genome. QTL analysis identified 11 and 4 QTL for DM and PM resistances accounting for more than 73.5 and 63.0% total phenotypic variance, respectively. Among the 11 DM resistance QTL, dm5.1, dm5.2, and dm5.3 were major-effect contributing QTL, whereas dm1.1, dm2.1, and dm6.2 conferred susceptibility. Of the 4 QTL for PM resistance, pm5.1 was the major-effect QTL explaining 32.4% phenotypic variance and the minor-effect QTL pm6.1 contributed to disease susceptibility. Three PM QTL, pm2.1, pm5.1, and pm6.1, were co-localized with DM QTL dm2.1, dm5.2, and dm6.1, respectively, which was consistent with the observed linkage of PM and DM resistances in PI 197088. The genetic architecture of DM resistance in PI 197088 and another resistant line WI7120 (PI 330628) was compared, and the potential of using PI 197088 in cucumber breeding for downy and powdery mildew resistances is discussed.

  5. CCR5 Gene Disruption via Lentiviral Vectors Expressing Cas9 and Single Guided RNA Renders Cells Resistant to HIV-1 Infection

    Science.gov (United States)

    Liu, Jingjing; Zhang, Di; Kimata, Jason T.; Zhou, Paul

    2014-01-01

    CCR5, a coreceptor for HIV-1 entry, is a major target for drug and genetic intervention against HIV-1. Genetic intervention strategies have knocked down CCR5 expression levels by shRNA or disrupted the CCR5 gene using zinc finger nucleases (ZFN) or Transcription activator-like effector nuclease (TALEN). In the present study, we silenced CCR5 via CRISPR associated protein 9 (Cas9) and single guided RNAs (sgRNAs). We constructed lentiviral vectors expressing Cas9 and CCR5 sgRNAs. We show that a single round transduction of lentiviral vectors expressing Cas9 and CCR5 sgRNAs into HIV-1 susceptible human CD4+ cells yields high frequencies of CCR5 gene disruption. CCR5 gene-disrupted cells are not only resistant to R5-tropic HIV-1, including transmitted/founder (T/F) HIV-1 isolates, but also have selective advantage over CCR5 gene-undisrupted cells during R5-tropic HIV-1 infection. Importantly, using T7 endonuclease I assay we did not detect genome mutations at potential off-target sites that are highly homologous to these CCR5 sgRNAs in stably transduced cells even at 84 days post transduction. Thus we conclude that silencing of CCR5 via Cas9 and CCR5-specific sgRNAs could be a viable alternative strategy for engineering resistance against HIV-1. PMID:25541967

  6. Identification of a single gene for seed coat impermeability in soybean PI 594619.

    Science.gov (United States)

    Kebede, Hirut; Smith, James R; Ray, Jeffery D

    2014-09-01

    Inheritance studies and molecular mapping identified a single dominant gene that conditions seed coat impermeability in soybean PI 594619. High temperatures during seed fill increase the occurrence of soybeans with impermeable seed coat, which is associated with non-uniform and delayed germination and emergence. This can be an issue in soybean production areas with excessively high-temperature environments. The objectives of the present study were to investigate the inheritance of impermeable seed coat under a high-temperature environment in the midsouthern United States and to map the gene(s) that affect this trait in a germplasm line with impermeable seed coat (PI 594619). Crosses were made between PI 594619 and an accession with permeable seed coat at Stoneville, MS in 2008. The parental lines and the segregating populations from reciprocal crosses were grown in Stoneville in 2009. Ninety-nine F2:3 families and parents were also grown at Stoneville, MS in 2011. Seeds were assayed for percent impermeable seed coat using the standard germination test. Genetic analysis of the F2 populations and F2:3 families indicated that seed coat impermeability in PI 594619 is controlled by a single major gene, with impermeable seed coat being dominant to permeable seed coat. Molecular mapping positioned this gene on CHR 2 between markers Sat_202 and Satt459. The designation of Isc (impermeable seed coat) for this single gene has been approved by the Soybean Genetics Committee. Selection of the recessive form (isc) may be important in developing cultivars with permeable seed coat for high-heat production environments. The single-gene nature of impermeable seed coat may also have potential for being utilized in reducing seed damage caused by weathering and mold.

  7. Dual PI3K/mTOR inhibitor BEZ235 as a promising therapeutic strategy against paclitaxel-resistant gastric cancer via targeting PI3K/Akt/mTOR pathway.

    Science.gov (United States)

    Chen, Dongshao; Lin, Xiaoting; Zhang, Cheng; Liu, Zhentao; Chen, Zuhua; Li, Zhongwu; Wang, Jingyuan; Li, Beifang; Hu, Yanting; Dong, Bin; Shen, Lin; Ji, Jiafu; Gao, Jing; Zhang, Xiaotian

    2018-01-26

    Paclitaxel (PTX) is widely used in the front-line chemotherapy for gastric cancer (GC), but resistance limits its use. Due to the lack of proper models, mechanisms underlying PTX resistance in GC were not well studied. Using established PTX-resistant GC cell sublines HGC-27R, we for the first time integrated biological traits and molecular mechanisms of PTX resistance in GC. Data revealed that PTX-resistant GC cells were characterized by microtubular disorders, an EMT phenotype, reduced responses to antimitotic drugs, and resistance to apoptosis (marked by upregulated β-tubulin III, vimentin, attenuated changes in G 2 /M molecules or pro-apoptotic factors in response to antimitotic drugs or apoptotic inducers, respectively). Activation of the phosphoinositide 3-kinase, the serine/threonine kinase Akt and mammalian target of rapamycin (PI3K/Akt/mTOR) and mitogen-activated protein kinase (MAPK) pathways were also observed, which might be the reason for above phenotypic alternations. In vitro data suggested that targeting these pathways were sufficient to elicit antitumor responses in PTX-resistant GC, in which the dual PI3K/mTOR inhibitor BEZ235 displayed higher therapeutic efficiency than the mTOR inhibitor everolimus or the MEK inhibitor AZD6244. Antitumor effects of BEZ235 were also confirmed in mice bearing HGC-27R tumors. Thus, these data suggest that PI3K/Akt/mTOR and MAPK pathway inhibition, especially PI3K/mTOR dual blockade, might be a promising therapeutic strategy against PTX-resistant GC.

  8. Embryonic transcription factor SOX9 drives breast cancer endocrine resistance.

    Science.gov (United States)

    Jeselsohn, Rinath; Cornwell, MacIntosh; Pun, Matthew; Buchwalter, Gilles; Nguyen, Mai; Bango, Clyde; Huang, Ying; Kuang, Yanan; Paweletz, Cloud; Fu, Xiaoyong; Nardone, Agostina; De Angelis, Carmine; Detre, Simone; Dodson, Andrew; Mohammed, Hisham; Carroll, Jason S; Bowden, Michaela; Rao, Prakash; Long, Henry W; Li, Fugen; Dowsett, Mitchell; Schiff, Rachel; Brown, Myles

    2017-05-30

    The estrogen receptor (ER) drives the growth of most luminal breast cancers and is the primary target of endocrine therapy. Although ER blockade with drugs such as tamoxifen is very effective, a major clinical limitation is the development of endocrine resistance especially in the setting of metastatic disease. Preclinical and clinical observations suggest that even following the development of endocrine resistance, ER signaling continues to exert a pivotal role in tumor progression in the majority of cases. Through the analysis of the ER cistrome in tamoxifen-resistant breast cancer cells, we have uncovered a role for an RUNX2-ER complex that stimulates the transcription of a set of genes, including most notably the stem cell factor SOX9, that promote proliferation and a metastatic phenotype. We show that up-regulation of SOX9 is sufficient to cause relative endocrine resistance. The gain of SOX9 as an ER-regulated gene associated with tamoxifen resistance was validated in a unique set of clinical samples supporting the need for the development of improved ER antagonists.

  9. Effective genes for resistance to stripe rust and virulence of Puccinia ...

    African Journals Online (AJOL)

    The results revealed that stripe rust resistance genes Yr3, Yr5, Yr10, Yr15, Yr26, YrSP and YrCV were resistant, while Yr18 showed moderate susceptibility at all locations. Genes YrA-, Yr2, Yr6, Yr7, Yr8, Yr9, Yr17, Yr27 and gene combinations Opata (Yr27+Yr18) and Super Kauz (Yr9, Yr27, Yr18) were found susceptible.

  10. Mapping and characterization of wheat stem rust resistance genes SrTm5 and Sr60 from Triticum monococcum.

    Science.gov (United States)

    Chen, Shisheng; Guo, Yan; Briggs, Jordan; Dubach, Felix; Chao, Shiaoman; Zhang, Wenjun; Rouse, Matthew N; Dubcovsky, Jorge

    2018-03-01

    The new stem rust resistance gene Sr60 was fine-mapped to the distal region of chromosome arm 5A m S, and the TTKSK-effective gene SrTm5 could be a new allele of Sr22. The emergence and spread of new virulent races of the wheat stem rust pathogen (Puccinia graminis f. sp. tritici; Pgt), including the Ug99 race group, is a serious threat to global wheat production. In this study, we mapped and characterized two stem rust resistance genes from diploid wheat Triticum monococcum accession PI 306540. We mapped SrTm5, a previously postulated gene effective to Ug99, on chromosome arm 7A m L, completely linked to Sr22. SrTm5 displayed a different race specificity compared to Sr22 indicating that they are distinct. Sequencing of the Sr22 homolog in PI 306540 revealed a novel haplotype. Characterization of the segregating populations with Pgt race QFCSC revealed an additional resistance gene on chromosome arm 5A m S that was assigned the official name Sr60. This gene was also effective against races QTHJC and SCCSC but not against TTKSK (a Ug99 group race). Using two large mapping populations (4046 gametes), we mapped Sr60 within a 0.44 cM interval flanked by sequenced-based markers GH724575 and CJ942731. These two markers delimit a 54.6-kb region in Brachypodium distachyon chromosome 4 and a 430-kb region in the Chinese Spring reference genome. Both regions include a leucine-rich repeat protein kinase (LRRK123.1) that represents a potential candidate gene. Three CC-NBS-LRR genes were found in the colinear Brachypodium region but not in the wheat genome. We are currently developing a Bacterial Artificial Chromosome library of PI 306540 to determine which of these candidate genes are present in the T. monococcum genome and to complete the cloning of Sr60.

  11. The Effect of Sanggua Drink Extract on Insulin Resistance through the PI3K/AKT Signaling Pathway

    Directory of Open Access Journals (Sweden)

    Yu Cai

    2018-01-01

    Full Text Available Treating type 2 diabetes mellitus (T2DM using thiazolidinediones and biguanides can present several challenges for patients. Sanggua Drink (SGD is a commonly used agent in traditional Chinese medicine, and it consists of Folium Mori, Fructus Momordicae Charantiae, Radix Puerariae Lobatae, and Rhizoma Dioscorea. The hypoglycemic effects and mechanisms of SGD extracts on insulin resistance in diabetic rats were investigated. SGD (1.24 g/kg orally was verified in T2DM rats induced by a high-fat diet and streptozotocin. The results showed that SGD treatment was observed to reduce fasting blood glucose, water and food intake, total cholesterol triglycerides, and LDL, OGTT, FINS, HOMA-IR, GHb, and MDA and increase hepatic glycogen, HDL, SOD, CAT, and GSH-Px in diabetic rats. Simultaneously, SGD treatment by T2DM showed significantly ameliorated pathological changes and reduced inflammation in the pancreas. Treatment was also observed to increase gene and protein expressions of InsR, IRS-2, PI3K, AKT, and Glut4 in the livers of diabetic treated rats. These results suggest that SGD extracts have hypoglycemic properties and may alleviate insulin resistance in T2DM rats through the PI3K/AKT pathway. Therefore, SGD appears to be a promising insulin sensitizer.

  12. Permethrin induction of multiple cytochrome P450 genes in insecticide resistant mosquitoes, Culex quinquefasciatus.

    Science.gov (United States)

    Gong, Youhui; Li, Ting; Zhang, Lee; Gao, Xiwu; Liu, Nannan

    2013-01-01

    The expression of some insect P450 genes can be induced by both exogenous and endogenous compounds and there is evidence to suggest that multiple constitutively overexpressed P450 genes are co-responsible for the development of resistance to permethrin in resistant mosquitoes. This study characterized the permethrin induction profiles of P450 genes known to be constitutively overexpressed in resistant mosquitoes, Culex quinquefasciatus. The gene expression in 7 of the 19 P450 genes CYP325K3v1, CYP4D42v2, CYP9J45, (CYP) CPIJ000926, CYP325G4, CYP4C38, CYP4H40 in the HAmCqG8 strain, increased more than 2-fold after exposure to permethrin at an LC50 concentration (10 ppm) compared to their acetone treated counterpart; no significant differences in the expression of these P450 genes in susceptible S-Lab mosquitoes were observed after permethrin treatment. Eleven of the fourteen P450 genes overexpressed in the MAmCqG6 strain, CYP9M10, CYP6Z12, CYP9J33, CYP9J43, CYP9J34, CYP306A1, CYP6Z15, CYP9J45, CYPPAL1, CYP4C52v1, CYP9J39, were also induced more than doubled after exposure to an LC50 (0.7 ppm) dose of permethrin. No significant induction in P450 gene expression was observed in the susceptible S-Lab mosquitoes after permethrin treatment except for CYP6Z15 and CYP9J39, suggesting that permethrin induction of these two P450 genes are common to both susceptible and resistant mosquitoes while the induction of the others are specific to insecticide resistant mosquitoes. These results demonstrate that multiple P450 genes are co-up-regulated in insecticide resistant mosquitoes through both constitutive overexpression and induction mechanisms, providing additional support for their involvement in the detoxification of insecticides and the development of insecticide resistance.

  13. Identifying resistance gene analogs associated with resistances to different pathogens in common bean.

    Science.gov (United States)

    López, Camilo E; Acosta, Iván F; Jara, Carlos; Pedraza, Fabio; Gaitán-Solís, Eliana; Gallego, Gerardo; Beebe, Steve; Tohme, Joe

    2003-01-01

    ABSTRACT A polymerase chain reaction approach using degenerate primers that targeted the conserved domains of cloned plant disease resistance genes (R genes) was used to isolate a set of 15 resistance gene analogs (RGAs) from common bean (Phaseolus vulgaris). Eight different classes of RGAs were obtained from nucleotide binding site (NBS)-based primers and seven from not previously described Toll/Interleukin-1 receptor-like (TIR)-based primers. Putative amino acid sequences of RGAs were significantly similar to R genes and contained additional conserved motifs. The NBS-type RGAs were classified in two subgroups according to the expected final residue in the kinase-2 motif. Eleven RGAs were mapped at 19 loci on eight linkage groups of the common bean genetic map constructed at Centro Internacional de Agricultura Tropical. Genetic linkage was shown for eight RGAs with partial resistance to anthracnose, angular leaf spot (ALS) and Bean golden yellow mosaic virus (BGYMV). RGA1 and RGA2 were associated with resistance loci to anthracnose and BGYMV and were part of two clusters of R genes previously described. A new major cluster was detected by RGA7 and explained up to 63.9% of resistance to ALS and has a putative contribution to anthracnose resistance. These results show the usefulness of RGAs as candidate genes to detect and eventually isolate numerous R genes in common bean.

  14. Inheritance and molecular mapping of anthracnose resistance gene present in the differential line PI533918

    Science.gov (United States)

    Anthracnose (Collectrotichum sublineolum) is considered one of the most destructive diseases of sorghum (Sorghum bicolor L. Moench) because it infects all aerial tissues of the plant. The best strategy to control the disease is the incorporation of resistance genes. At present, eighteen sorghum line...

  15. Mapping of novel powdery mildew resistance gene(s) from Agropyron cristatum chromosome 2P.

    Science.gov (United States)

    Li, Huanhuan; Jiang, Bo; Wang, Jingchang; Lu, Yuqing; Zhang, Jinpeng; Pan, Cuili; Yang, Xinming; Li, Xiuquan; Liu, Weihua; Li, Lihui

    2017-01-01

    A physical map of Agropyron cristatum 2P chromosome was constructed for the first time and the novel powdery mildew resistance gene(s) from chromosome 2P was(were) also mapped. Agropyron cristatum (L.) Gaertn. (2n = 28, PPPP), a wild relative of common wheat, is highly resistant to powdery mildew. Previous studies showed that wheat-A. cristatum 2P disomic addition line II-9-3 displayed high resistance to powdery mildew, and the resistance was attributable to A. cristatum chromosome 2P. To utilize and physically map the powdery mildew resistance gene(s), 15 wheat-A. cristatum 2P translocation lines and three A. cristatum 2P deletion lines with different chromosomal segment sizes, obtained from II-9-3 using 60 Co-γ ray irradiation, were characterized using cytogenetic and molecular marker analysis. A. cristatum 2P chromosomal segments in the translocations were translocated to different wheat chromosomes, including 1A, 4A, 5A, 6A, 7A, 1B, 2B, 3B, 7B, 3D, 4D, and 6D. A physical map of the 2P chromosome was constructed with 82 STS markers, consisting of nine bins with 34 markers on 2PS and eight bins with 48 markers on 2PL. The BC 1 F 2 populations of seven wheat-A. cristatum 2P translocation lines (2PT-3, 2PT-4, 2PT-5, 2PT-6, 2PT-8, 2PT-9, and 2PT-10) were developed by self-pollination, tested with powdery mildew and genotyped with 2P-specific STS markers. From these results, the gene(s) conferring powdery mildew resistance was(were) located on 2PL bin FL 0.66-0.86 and 19 2P-specific markers were identified in this bin. Moreover, two new powdery mildew-resistant translocation lines (2PT-4 and 2PT-5) with small 2PL chromosome segments were obtained. The newly developed wheat lines with powdery mildew resistance and the closely linked molecular markers will be valuable for wheat disease breeding in the future.

  16. Removal of antibiotic-resistant bacteria and antibiotic resistance genes affected by varying degrees of fouling on anaerobic microfiltration membranes

    KAUST Repository

    Cheng, Hong; Hong, Pei-Ying

    2017-01-01

    An anaerobic membrane bioreactor was retrofitted with polyvinylidene fluoride (PVDF) microfiltration membrane units, each of which was fouled to a different extent. The membranes with different degrees of fouling were evaluated for their efficiencies in removing three antibiotic-resistant bacteria (ARB), namely, blaNDM-1-positive Escherichia coli PI-7, blaCTX-M-15-positive Klebsiella pneumoniae L7, and blaOXA-48-positive E. coli UPEC-RIY-4, as well as their associated plasmid-borne antibiotic resistance genes (ARGs). The results showed that the log removal values (LRVs) of ARGs correlated positively with the extent of membrane fouling and ranged from 1.9 to 3.9. New membranes with a minimal foulant layer could remove more than 5 log units of ARB. However, as the membranes progressed to subcritical fouling, the LRVs of ARB decreased at increasing operating transmembrane pressures (TMPs). The LRV recovered back to 5 when the membrane was critically fouled, and the achieved LRV remained stable at different operating TMPs. Furthermore, characterization of the surface attributed the removal of both the ARB and ARGs to adsorption, which was facilitated by an increasing hydrophobicity and a decreasing surface ζ potential as the membranes fouled. Our results indicate that both the TMP and the foulant layer synergistically affected ARB removal, but the foulant layer was the main factor that contributed to ARG removal.

  17. Removal of Antibiotic-Resistant Bacteria and Antibiotic Resistance Genes Affected by Varying Degrees of Fouling on Anaerobic Microfiltration Membranes.

    Science.gov (United States)

    Cheng, Hong; Hong, Pei-Ying

    2017-11-07

    An anaerobic membrane bioreactor was retrofitted with polyvinylidene fluoride (PVDF) microfiltration membrane units, each of which was fouled to a different extent. The membranes with different degrees of fouling were evaluated for their efficiencies in removing three antibiotic-resistant bacteria (ARB), namely, bla NDM-1 -positive Escherichia coli PI-7, bla CTX-M-15 -positive Klebsiella pneumoniae L7, and bla OXA-48 -positive E. coli UPEC-RIY-4, as well as their associated plasmid-borne antibiotic resistance genes (ARGs). The results showed that the log removal values (LRVs) of ARGs correlated positively with the extent of membrane fouling and ranged from 1.9 to 3.9. New membranes with a minimal foulant layer could remove more than 5 log units of ARB. However, as the membranes progressed to subcritical fouling, the LRVs of ARB decreased at increasing operating transmembrane pressures (TMPs). The LRV recovered back to 5 when the membrane was critically fouled, and the achieved LRV remained stable at different operating TMPs. Furthermore, characterization of the surface attributed the removal of both the ARB and ARGs to adsorption, which was facilitated by an increasing hydrophobicity and a decreasing surface ζ potential as the membranes fouled. Our results indicate that both the TMP and the foulant layer synergistically affected ARB removal, but the foulant layer was the main factor that contributed to ARG removal.

  18. Removal of antibiotic-resistant bacteria and antibiotic resistance genes affected by varying degrees of fouling on anaerobic microfiltration membranes

    KAUST Repository

    Cheng, Hong

    2017-09-28

    An anaerobic membrane bioreactor was retrofitted with polyvinylidene fluoride (PVDF) microfiltration membrane units, each of which was fouled to a different extent. The membranes with different degrees of fouling were evaluated for their efficiencies in removing three antibiotic-resistant bacteria (ARB), namely, blaNDM-1-positive Escherichia coli PI-7, blaCTX-M-15-positive Klebsiella pneumoniae L7, and blaOXA-48-positive E. coli UPEC-RIY-4, as well as their associated plasmid-borne antibiotic resistance genes (ARGs). The results showed that the log removal values (LRVs) of ARGs correlated positively with the extent of membrane fouling and ranged from 1.9 to 3.9. New membranes with a minimal foulant layer could remove more than 5 log units of ARB. However, as the membranes progressed to subcritical fouling, the LRVs of ARB decreased at increasing operating transmembrane pressures (TMPs). The LRV recovered back to 5 when the membrane was critically fouled, and the achieved LRV remained stable at different operating TMPs. Furthermore, characterization of the surface attributed the removal of both the ARB and ARGs to adsorption, which was facilitated by an increasing hydrophobicity and a decreasing surface ζ potential as the membranes fouled. Our results indicate that both the TMP and the foulant layer synergistically affected ARB removal, but the foulant layer was the main factor that contributed to ARG removal.

  19. QTL mapping and transcriptome analysis of cowpea reveals candidate genes for root-knot nematode resistance.

    Science.gov (United States)

    Santos, Jansen Rodrigo Pereira; Ndeve, Arsenio Daniel; Huynh, Bao-Lam; Matthews, William Charles; Roberts, Philip Alan

    2018-01-01

    Cowpea is one of the most important food and forage legumes in drier regions of the tropics and subtropics. However, cowpea yield worldwide is markedly below the known potential due to abiotic and biotic stresses, including parasitism by root-knot nematodes (Meloidogyne spp., RKN). Two resistance genes with dominant effect, Rk and Rk2, have been reported to provide resistance against RKN in cowpea. Despite their description and use in breeding for resistance to RKN and particularly genetic mapping of the Rk locus, the exact genes conferring resistance to RKN remain unknown. In the present work, QTL mapping using recombinant inbred line (RIL) population 524B x IT84S-2049 segregating for a newly mapped locus and analysis of the transcriptome changes in two cowpea near-isogenic lines (NIL) were used to identify candidate genes for Rk and the newly mapped locus. A major QTL, designated QRk-vu9.1, associated with resistance to Meloidogyne javanica reproduction, was detected and mapped on linkage group LG9 at position 13.37 cM using egg production data. Transcriptome analysis on resistant and susceptible NILs 3 and 9 days after inoculation revealed up-regulation of 109 and 98 genes and down-regulation of 110 and 89 genes, respectively, out of 19,922 unique genes mapped to the common bean reference genome. Among the differentially expressed genes, four and nine genes were found within the QRk-vu9.1 and QRk-vu11.1 QTL intervals, respectively. Six of these genes belong to the TIR-NBS-LRR family of resistance genes and three were upregulated at one or more time-points. Quantitative RT-PCR validated gene expression to be positively correlated with RNA-seq expression pattern for eight genes. Future functional analysis of these cowpea genes will enhance our understanding of Rk-mediated resistance and identify the specific gene responsible for the resistance.

  20. Functional study of the novel multidrug resistance gene HA117 and its comparison to multidrug resistance gene 1

    Directory of Open Access Journals (Sweden)

    Chen Tingfu

    2010-07-01

    Full Text Available Abstract Background The novel gene HA117 is a multidrug resistance (MDR gene expressed by all-trans retinoic acid-resistant HL-60 cells. In the present study, we compared the multidrug resistance of the HA117 with that of the classical multidrug resistance gene 1 (MDR1 in breast cancer cell line 4T1. Methods Transduction of the breast cancer cell line 4T1 with adenoviral vectors encoding the HA117 gene and the green fluorescence protein gene (GFP (Ad-GFP-HA117, the MDR1 and GFP (Ad-GFP-MDR1 or GFP (Ad-GFP was respectively carried out. The transduction efficiency and the multiplicity of infection (MOI were detected by fluorescence microscope and flow cytometry. The transcription of HA117 gene and MDR1 gene were detected by reverse transcription polymerase chain reaction (RT-PCR. Western blotting analysis was used to detect the expression of P-glycoprotein (P-gp but the expression of HA117 could not be analyzed as it is a novel gene and its antibody has not yet been synthesized. The drug-excretion activity of HA117 and MDR1 were determined by daunorubicin (DNR efflux assay. The drug sensitivities of 4T1/HA117 and 4T1/MDR1 to chemotherapeutic agents were detected by Methyl-Thiazolyl-Tetrazolium (MTT assay. Results The transducted efficiency of Ad-GFP-HA117 and Ad-GFP-MDR1 were 75%-80% when MOI was equal to 50. The transduction of Ad-GFP-HA117 and Ad-GFP-MDR1 could increase the expression of HA117 and MDR1. The drug resistance index to Adriamycin (ADM, vincristine (VCR, paclitaxel (Taxol and bleomycin (BLM increased to19.8050, 9.0663, 9.7245, 3.5650 respectively for 4T1/HA117 and 24.2236, 11.0480, 11.3741, 0.9630 respectively for 4T1/MDR1 as compared to the control cells. There were no significant differences in drug sensitivity between 4T1/HA117 and 4T1/MDR1 for the P-gp substrates (ADM, VCR and Taxol (P Conclusions These results confirm that HA117 is a strong MDR gene in both HL-60 and 4T1 cells. Furthermore, our results indicate that the MDR

  1. Prediction of novel target genes and pathways involved in irinotecan-resistant colorectal cancer.

    Directory of Open Access Journals (Sweden)

    Precious Takondwa Makondi

    Full Text Available Acquired drug resistance to the chemotherapeutic drug irinotecan (the active metabolite of which is SN-38 is one of the significant obstacles in the treatment of advanced colorectal cancer (CRC. The molecular mechanism or targets mediating irinotecan resistance are still unclear. It is urgent to find the irinotecan response biomarkers to improve CRC patients' therapy.Genetic Omnibus Database GSE42387 which contained the gene expression profiles of parental and irinotecan-resistant HCT-116 cell lines was used. Differentially expressed genes (DEGs between parental and irinotecan-resistant cells, protein-protein interactions (PPIs, gene ontologies (GOs and pathway analysis were performed to identify the overall biological changes. The most common DEGs in the PPIs, GOs and pathways were identified and were validated clinically by their ability to predict overall survival and disease free survival. The gene-gene expression correlation and gene-resistance correlation was also evaluated in CRC patients using The Cancer Genomic Atlas data (TCGA.The 135 DEGs were identified of which 36 were upregulated and 99 were down regulated. After mapping the PPI networks, the GOs and the pathways, nine genes (GNAS, PRKACB, MECOM, PLA2G4C, BMP6, BDNF, DLG4, FGF2 and FGF9 were found to be commonly enriched. Signal transduction was the most significant GO and MAPK pathway was the most significant pathway. The five genes (FGF2, FGF9, PRKACB, MECOM and PLA2G4C in the MAPK pathway were all contained in the signal transduction and the levels of those genes were upregulated. The FGF2, FGF9 and MECOM expression were highly associated with CRC patients' survival rate but not PRKACB and PLA2G4C. In addition, FGF9 was also associated with irinotecan resistance and poor disease free survival. FGF2, FGF9 and PRKACB were positively correlated with each other while MECOM correlated positively with FGF9 and PLA2G4C, and correlated negatively with FGF2 and PRKACB after doing gene-gene

  2. Model-independent search for $CP$ violation in $D^{0} \\to K^{-}K^{+}\\pi^{-}\\pi^{+}$ and $D^{0} \\to \\pi^{-}\\pi^{+}\\pi^{+}\\pi^{-}$ decays

    CERN Document Server

    Aaij, R; Adinolfi, M; Adrover, C; Affolder, A; Ajaltouni, Z; Albrecht, J; Alessio, F; Alexander, M; Ali, S; Alkhazov, G; Alvarez Cartelle, P; Alves Jr, A A; Amato, S; Amerio, S; Amhis, Y; Anderlini, L; Anderson, J; Andreassen, R; Andrews, J E; Appleby, R B; Aquines Gutierrez, O; Archilli, F; Artamonov, A; Artuso, M; Aslanides, E; Auriemma, G; Baalouch, M; Bachmann, S; Back, J J; Baesso, C; Balagura, V; Baldini, W; Barlow, R J; Barschel, C; Barsuk, S; Barter, W; Bauer, Th; Bay, A; Beddow, J; Bedeschi, F; Bediaga, I; Belogurov, S; Belous, K; Belyaev, I; Ben-Haim, E; Bencivenni, G; Benson, S; Benton, J; Berezhnoy, A; Bernet, R; Bettler, M -O; van Beuzekom, M; Bien, A; Bifani, S; Bird, T; Bizzeti, A; Bjørnstad, P M; Blake, T; Blanc, F; Blouw, J; Blusk, S; Bocci, V; Bondar, A; Bondar, N; Bonivento, W; Borghi, S; Borgia, A; Bowcock, T J V; Bowen, E; Bozzi, C; Brambach, T; van den Brand, J; Bressieux, J; Brett, D; Britsch, M; Britton, T; Brook, N H; Brown, H; Burducea, I; Bursche, A; Busetto, G; Buytaert, J; Cadeddu, S; Callot, O; Calvi, M; Calvo Gomez, M; Camboni, A; Campana, P; Campora Perez, D; Carbone, A; Carboni, G; Cardinale, R; Cardini, A; Carranza-Mejia, H; Carson, L; Carvalho Akiba, K; Casse, G; Castillo Garcia, L; Cattaneo, M; Cauet, Ch; Cenci, R; Charles, M; Charpentier, Ph; Chen, P; Chiapolini, N; Chrzaszcz, M; Ciba, K; Cid Vidal, X; Ciezarek, G; Clarke, P E L; Clemencic, M; Cliff, H V; Closier, J; Coca, C; Coco, V; Cogan, J; Cogneras, E; Collins, P; Comerma-Montells, A; Contu, A; Cook, A; Coombes, M; Coquereau, S; Corti, G; Couturier, B; Cowan, G A; Cowie, E; Craik, D C; Cunliffe, S; Currie, R; D'Ambrosio, C; David, P; David, P N Y; Davis, A; De Bonis, I; De Bruyn, K; De Capua, S; De Cian, M; De Miranda, J M; De Paula, L; De Silva, W; De Simone, P; Decamp, D; Deckenhoff, M; Del Buono, L; Déléage, N; Derkach, D; Deschamps, O; Dettori, F; Di Canto, A; Dijkstra, H; Dogaru, M; Donleavy, S; Dordei, F; Dosil Suárez, A; Dossett, D; Dovbnya, A; Dupertuis, F; Durante, P; Dzhelyadin, R; Dziurda, A; Dzyuba, A; Easo, S; Egede, U; Egorychev, V; Eidelman, S; van Eijk, D; Eisenhardt, S; Eitschberger, U; Ekelhof, R; Eklund, L; El Rifai, I; Elsasser, Ch; Falabella, A; Färber, C; Fardell, G; Farinelli, C; Farry, S; Ferguson, D; Fernandez Albor, V; Ferreira Rodrigues, F; Ferro-Luzzi, M; Filippov, S; Fiore, M; Fitzpatrick, C; Fontana, M; Fontanelli, F; Forty, R; Francisco, O; Frank, M; Frei, C; Frosini, M; Furcas, S; Furfaro, E; Gallas Torreira, A; Galli, D; Gandelman, M; Gandini, P; Gao, Y; Garofoli, J; Garosi, P; Garra Tico, J; Garrido, L; Gaspar, C; Gauld, R; Gersabeck, E; Gersabeck, M; Gershon, T; Ghez, Ph; Gibson, V; Giubega, L; Gligorov, V V; Göbel, C; Golubkov, D; Golutvin, A; Gomes, A; Gorbounov, P; Gordon, H; Gotti, C; Grabalosa Gándara, M; Graciani Diaz, R; Granado Cardoso, L A; Graugés, E; Graziani, G; Grecu, A; Greening, E; Gregson, S; Griffith, P; Grünberg, O; Gui, B; Gushchin, E; Guz, Yu; Gys, T; Hadjivasiliou, C; Haefeli, G; Haen, C; Haines, S C; Hall, S; Hamilton, B; Hampson, T; Hansmann-Menzemer, S; Harnew, N; Harnew, S T; Harrison, J; Hartmann, T; He, J; Head, T; Heijne, V; Hennessy, K; Henrard, P; Hernando Morata, J A; van Herwijnen, E; Hess, M; Hicheur, A; Hicks, E; Hill, D; Hoballah, M; Hombach, C; Hopchev, P; Hulsbergen, W; Hunt, P; Huse, T; Hussain, N; Hutchcroft, D; Hynds, D; Iakovenko, V; Idzik, M; Ilten, P; Jacobsson, R; Jaeger, A; Jans, E; Jaton, P; Jawahery, A; Jing, F; John, M; Johnson, D; Jones, C R; Joram, C; Jost, B; Kaballo, M; Kandybei, S; Kanso, W; Karacson, M; Karbach, T M; Kenyon, I R; Ketel, T; Keune, A; Khanji, B; Kochebina, O; Komarov, I; Koopman, R F; Koppenburg, P; Korolev, M; Kozlinskiy, A; Kravchuk, L; Kreplin, K; Kreps, M; Krocker, G; Krokovny, P; Kruse, F; Kucharczyk, M; Kudryavtsev, V; Kurek, K; Kvaratskheliya, T; La Thi, V N; Lacarrere, D; Lafferty, G; Lai, A; Lambert, D; Lambert, R W; Lanciotti, E; Lanfranchi, G; Langenbruch, C; Latham, T; Lazzeroni, C; Le Gac, R; van Leerdam, J; Lees, J -P; Lefèvre, R; Leflat, A; Lefrançois, J; Leo, S; Leroy, O; Lesiak, T; Leverington, B; Li, Y; Li Gioi, L; Liles, M; Lindner, R; Linn, C; Liu, B; Liu, G; Lohn, S; Longstaff, I; Lopes, J H; Lopez-March, N; Lu, H; Lucchesi, D; Luisier, J; Luo, H; Machefert, F; Machikhiliyan, I V; Maciuc, F; Maev, O; Malde, S; Manca, G; Mancinelli, G; Maratas, J; Marconi, U; Marino, P; Märki, R; Marks, J; Martellotti, G; Martens, A; Martín Sánchez, A; Martinelli, M; Martinez Santos, D; Martins Tostes, D; Martynov, A; Massafferri, A; Matev, R; Mathe, Z; Matteuzzi, C; Maurice, E; Mazurov, A; McCarthy, J; McNab, A; McNulty, R; McSkelly, B; Meadows, B; Meier, F; Meissner, M; Merk, M; Milanes, D A; Minard, M -N; Molina Rodriguez, J; Monteil, S; Moran, D; Morawski, P; Mordà, A; Morello, M J; Mountain, R; Mous, I; Muheim, F; Müller, K; Muresan, R; Muryn, B; Muster, B; Naik, P; Nakada, T; Nandakumar, R; Nasteva, I; Needham, M; Neubert, S; Neufeld, N; Nguyen, A D; Nguyen, T D; Nguyen-Mau, C; Nicol, M; Niess, V; Niet, R; Nikitin, N; Nikodem, T; Nomerotski, A; Novoselov, A; Oblakowska-Mucha, A; Obraztsov, V; Oggero, S; Ogilvy, S; Okhrimenko, O; Oldeman, R; Orlandea, M; Otalora Goicochea, J M; Owen, P; Oyanguren, A; Pal, B K; Palano, A; Palczewski, T; Palutan, M; Panman, J; Papanestis, A; Pappagallo, M; Parkes, C; Parkinson, C J; Passaleva, G; Patel, G D; Patel, M; Patrick, G N; Patrignani, C; Pavel-Nicorescu, C; Pazos Alvarez, A; Pellegrino, A; Penso, G; Pepe Altarelli, M; Perazzini, S; Perez Trigo, E; Pérez-Calero Yzquierdo, A; Perret, P; Perrin-Terrin, M; Pescatore, L; Pesen, E; Petridis, K; Petrolini, A; Phan, A; Picatoste Olloqui, E; Pietrzyk, B; Pilař, T; Pinci, D; Playfer, S; Plo Casasus, M; Polci, F; Polok, G; Poluektov, A; Polycarpo, E; Popov, A; Popov, D; Popovici, B; Potterat, C; Powell, A; Prisciandaro, J; Pritchard, A; Prouve, C; Pugatch, V; Puig Navarro, A; Punzi, G; Qian, W; Rademacker, J H; Rakotomiaramanana, B; Rangel, M S; Raniuk, I; Rauschmayr, N; Raven, G; Redford, S; Reid, M M; dos Reis, A C; Ricciardi, S; Richards, A; Rinnert, K; Rives Molina, V; Roa Romero, D A; Robbe, P; Roberts, D A; Rodrigues, E; Rodriguez Perez, P; Roiser, S; Romanovsky, V; Romero Vidal, A; Rouvinet, J; Ruf, T; Ruffini, F; Ruiz, H; Ruiz Valls, P; Sabatino, G; Saborido Silva, J J; Sagidova, N; Sail, P; Saitta, B; Salustino Guimaraes, V; Sanmartin Sedes, B; Sannino, M; Santacesaria, R; Santamarina Rios, C; Santovetti, E; Sapunov, M; Sarti, A; Satriano, C; Satta, A; Savrie, M; Savrina, D; Schaack, P; Schiller, M; Schindler, H; Schlupp, M; Schmelling, M; Schmidt, B; Schneider, O; Schopper, A; Schune, M -H; Schwemmer, R; Sciascia, B; Sciubba, A; Seco, M; Semennikov, A; Senderowska, K; Sepp, I; Serra, N; Serrano, J; Seyfert, P; Shapkin, M; Shapoval, I; Shatalov, P; Shcheglov, Y; Shears, T; Shekhtman, L; Shevchenko, O; Shevchenko, V; Shires, A; Silva Coutinho, R; Sirendi, M; Skidmore, N; Skwarnicki, T; Smith, N A; Smith, E; Smith, J; Smith, M; Sokoloff, M D; Soler, F J P; Soomro, F; Souza, D; Souza De Paula, B; Spaan, B; Sparkes, A; Spradlin, P; Stagni, F; Stahl, S; Steinkamp, O; Stevenson, S; Stoica, S; Stone, S; Storaci, B; Straticiuc, M; Straumann, U; Subbiah, V K; Sun, L; Swientek, S; Syropoulos, V; Szczekowski, M; Szczypka, P; Szumlak, T; T'Jampens, S; Teklishyn, M; Teodorescu, E; Teubert, F; Thomas, C; Thomas, E; van Tilburg, J; Tisserand, V; Tobin, M; Tolk, S; Tonelli, D; Topp-Joergensen, S; Torr, N; Tournefier, E; Tourneur, S; Tran, M T; Tresch, M; Tsaregorodtsev, A; Tsopelas, P; Tuning, N; Ubeda Garcia, M; Ukleja, A; Urner, D; Ustyuzhanin, A; Uwer, U; Vagnoni, V; Valenti, G; Vallier, A; Van Dijk, M; Vazquez Gomez, R; Vazquez Regueiro, P; Vázquez Sierra, C; Vecchi, S; Velthuis, J J; Veltri, M; Veneziano, G; Vesterinen, M; Viaud, B; Vieira, D; Vilasis-Cardona, X; Vollhardt, A; Volyanskyy, D; Voong, D; Vorobyev, A; Vorobyev, V; Voß, C; Voss, H; Waldi, R; Wallace, C; Wallace, R; Wandernoth, S; Wang, J; Ward, D R; Watson, N K; Webber, A D; Websdale, D; Whitehead, M; Wicht, J; Wiechczynski, J; Wiedner, D; Wiggers, L; Wilkinson, G; Williams, M P; Williams, M; Wilson, F F; Wimberley, J; Wishahi, J; Wislicki, W; Witek, M; Wotton, S A; Wright, S; Wu, S; Wyllie, K; Xie, Y; Xing, Z; Yang, Z; Young, R; Yuan, X; Yushchenko, O; Zangoli, M; Zavertyaev, M; Zhang, F; Zhang, L; Zhang, W C; Zhang, Y; Zhelezov, A; Zhokhov, A; Zhong, L; Zvyagin, A

    2013-11-04

    A search for $CP$ violation in the phase-space structures of $D^{0}$ and $\\bar{D^{0}}$ decays to the final states $K^{-}K^{+}\\pi^{-}\\pi^{+}$ and $\\pi^{-}\\pi^{+}\\pi^{+}\\pi^{-}$ is presented. The search is carried out with a data set corresponding to an integrated luminosity of 1.0 fb$^{−1}$ collected in 2011 by the LHCb experiment in $pp$ collisions at a centre-of-mass energy of 7 TeV. For the $K^{-}K^{+}\\pi^{-}\\pi^{+}$ final state, the four-body phase space is divided into 32 bins, each bin with approximately 1800 decays. The $p$-value under the hypothesis of no $CP$ violation is 9.1 %, and in no bin is a $CP$ asymmetry greater than 6.5 % observed. The phase space of the $\\pi^{-}\\pi^{+}\\pi^{+}\\pi^{-}$ final state is partitioned into 128 bins, each bin with approximately 2500 decays. The p-value under the hypothesis of no $CP$ violation is 41 %, and in no bin is a $CP$ asymmetry greater than 5.5 % observed. All results are consistent with the hypothesis of no $CP$ violation at the current sensitivity.

  3. Pyramids of QTLs enhance host-plant resistance and Bt-mediated resistance to leaf-chewing insects in soybean.

    Science.gov (United States)

    Ortega, María A; All, John N; Boerma, H Roger; Parrott, Wayne A

    2016-04-01

    QTL-M and QTL-E enhance soybean resistance to insects. Pyramiding these QTLs with cry1Ac increases protection against Bt-tolerant pests, presenting an opportunity to effectively deploy Bt with host-plant resistance genes. Plant resistance to leaf-chewing insects minimizes the need for insecticide applications, reducing crop production costs and pesticide concerns. In soybean [Glycine max (L.) Merr.], resistance to a broad range of leaf-chewing insects is found in PI 229358 and PI 227687. PI 229358's resistance is conferred by three quantitative trait loci (QTLs): M, G, and H. PI 227687's resistance is conferred by QTL-E. The letters indicate the soybean Linkage groups (LGs) on which the QTLs are located. This study aimed to determine if pyramiding PI 229358 and PI 227687 QTLs would enhance soybean resistance to leaf-chewing insects, and if pyramiding these QTLs with Bt (cry1Ac) enhances resistance against Bt-tolerant pests. The near-isogenic lines (NILs): Benning(ME), Benning(MGHE), and Benning(ME+cry1Ac) were developed. Benning(ME) and Benning(MGHE) were evaluated in detached-leaf and greenhouse assays with soybean looper [SBL, Chrysodeixis includens (Walker)], corn earworm [CEW, Helicoverpa zea (Boddie)], fall armyworm [FAW, Spodoptera frugiperda (J.E. Smith)], and velvetbean caterpillar [VBC, Anticarsia gemmatalis (Hübner)]; and in field-cage assays with SBL. Benning(ME+cry1Ac) was tested in detached-leaf assays against SBL, VBC, and Southern armyworm [SAW, Spodoptera eridania (Cramer)]. In the detached-leaf assay, Benning(ME) showed the strongest antibiosis against CEW, FAW, and VBC. In field-cage conditions, Benning(ME) and Benning(MGHE) suffered 61 % less defoliation than Benning. Benning(ME+cry1Ac) was more resistant than Benning(ME) and Benning (cry1Ac) against SBL and SAW. Agriculturally relevant levels of resistance in soybean can be achieved with just two loci, QTL-M and QTL-E. ME+cry1Ac could present an opportunity to protect the durability of Bt

  4. Identification and characterization of two novel bla(KLUC resistance genes through large-scale resistance plasmids sequencing.

    Directory of Open Access Journals (Sweden)

    Teng Xu

    Full Text Available Plasmids are important antibiotic resistance determinant carriers that can disseminate various drug resistance genes among species or genera. By using a high throughput sequencing approach, two groups of plasmids of Escherichia coli (named E1 and E2, each consisting of 160 clinical E. coli strains isolated from different periods of time were sequenced and analyzed. A total of 20 million reads were obtained and mapped onto the known resistance gene sequences. As a result, a total of 9 classes, including 36 types of antibiotic resistant genes, were identified. Among these genes, 25 and 27 single nucleotide polymorphisms (SNPs appeared, of which 9 and 12 SNPs are nonsynonymous substitutions in the E1 and E2 samples. It is interesting to find that a novel genotype of bla(KLUC, whose close relatives, bla(KLUC-1 and bla(KLUC-2, have been previously reported as carried on the Kluyvera cryocrescens chromosome and Enterobacter cloacae plasmid, was identified. It shares 99% and 98% amino acid identities with Kluc-1 and Kluc-2, respectively. Further PCR screening of 608 Enterobacteriaceae family isolates yielded a second variant (named bla(KLUC-4. It was interesting to find that Kluc-3 showed resistance to several cephalosporins including cefotaxime, whereas bla(KLUC-4 did not show any resistance to the antibiotics tested. This may be due to a positively charged residue, Arg, replaced by a neutral residue, Leu, at position 167, which is located within an omega-loop. This work represents large-scale studies on resistance gene distribution, diversification and genetic variation in pooled multi-drug resistance plasmids, and provides insight into the use of high throughput sequencing technology for microbial resistance gene detection.

  5. NVP-BEZ235 overcomes gefitinib-acquired resistance by down-regulating PI3K/AKT/ mTOR phosphorylation

    Directory of Open Access Journals (Sweden)

    Sun ZH

    2015-01-01

    Full Text Available Zhihua Sun,2,* Qiuhui li,1,* Sheng Zhang,1 Jing Chen,1 Lili Huang,3 Jinghua Ren,1 Yu Chang,1 Yichen Liang,1 Gang Wu1 1Cancer Center, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, Hubei, People’s Republic of China; 2Oncology department, Xiangyang central Hospital, Xiangyang, Hubei, People’s Republic of China; 3Radiation Oncology Department, Fifth Affiliated Hospital of Sun Yat-sen University, Zhuhai, Guangdong, People's Republic of China *These authors contributed equally to this work Background: Patients harboring activating mutations in epidermal growth factor receptors (EGFR are particularly sensitive to EGFR tyrosine kinase inhibitors (TKIs. However, most patients develop an acquired resistance after a period of about 10 months. This study focuses on the therapeutic effect of NVP-BEZ235, a dual inhibitor of phosphatidylinositol- 3-kinase/mammalian target of rapamycin (PI3K/mTOR, in gefitinib-resistant non-small cell lung cancer. Methods: H1975 cell line was validated as a gefitinib-resistant cell model by the nucleotide-sequence analysis. We used the 3-(4,5-Dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT assay to detect the growth of H1975 cell line in vitro. H1975 cells' migration was detected by the migration assay. Xenograft models were used to investigate the growth of gefitinib-resistant non-small cell lung cancer in vivo. Western blot and immunohistochemical analysis were used to investigate the level of PI3K/protein kinase B(AKT/mTOR signaling pathway proteins. Results: We show that NVP-BEZ235 effectively inhibited the growth of H1975 cells in vivo as well as in vitro. Similarly, H1975 cell migration was reduced by NVP-BEZ235. Further experiments revealed that NVP-BEZ235 attenuated the phosphorylation of PI3K/AKT/mTOR signaling pathway proteins. Conclusion: Taken together, we suggest that NVP-BEZ235 inhibits gefitinib-resistant tumor growth by downregulating PI3K

  6. [Study on gene differential expressions of substance and energy metabolism in chronic superficial gastritis patients of Pi deficiency syndrome and of pi-wei hygropyrexia syndrome].

    Science.gov (United States)

    Yang, Ze-Min; Chen, Wei-Wen; Wang, Ying-Fang

    2012-09-01

    To analyze the metabolic levels of energy and substance in chronic superficial gastritis (CSG) patients of Pi deficiency syndrome (PDS) and of Pi-Wei hygropyrexia syndrome (PWHS), including lipid, protein, nucleic acid, carbohydrate, trace element, and energy metabolism, and to study the pathogenesis mechanism of PDS from substance and energy metabolisms. Recruited were 8 CSG patients who visited at First Affiliated Hospital of Guangzhou University of Traditional Chinese Medicine and Guangdong Provincial Hospital of Traditional Chinese Medicine from June 2004 to March 2005, including 4 patients of PDS and 4 of PWHS. Their gastric mucosae were used for experiments of DNA microarray. The dual-channel DNA microarray data were bioinformatically analyzed by BRB ArrayTools and IPA Software. Obtained were fifty-six differentially expressed genes involved in substance and energy metabolisms with the expression fold more than 2, including 11 genes up-regulated and 45 genes down-regulated. Of them, genes correlated to lipid metabolism included CRLS1, LRP11, FUT9, GPCPD1, PIGL, SULT1A4, B3GNT1, ST8SIA4, and ACADVL, mainly involved in the metabolic processes of fatty acid, cholesterol, phospholipids, and glycolipid. Genes correlated to protein metabolism included ASRGL1, AARSD1, EBNA1BP2, PUM2, MRPL52, C120RF65, PSMB8, PSME2, UBA7, RNF11, FBXO44, ZFYVE26, CHMP2A, SSR4, SNX4, RAB3B, RABL2A, GOLGA2, KDELR1, PHPT1, ACPP, PTPRF, CRKL, HDAC7, ADPRHL2, B3GNT1, ST8SIA4, DDOST, and FUT9, mainly involved in the biosynthesis processes of protein, ubiquitination, targeted transport and post-translation modification. Genes correlated to nucleic acid metabolism included DFFB, FLJ35220, TOP2A, SF3A3, CREB3, CRTC2, NR1D2, MED6, GTF2IRD1, C1ORF83, ZNF773, and ZMYND11, mainly involved in DNA replication and repair, transcription regulation. Genes correlated to carbohydrate metabolism included AGL, B3GNT1, FUT9, ST8SIA4, SULT1A4, DDOST, and PIGL, mainly involved in glucogen degradation and

  7. QTL mapping and transcriptome analysis of cowpea reveals candidate genes for root-knot nematode resistance.

    Directory of Open Access Journals (Sweden)

    Jansen Rodrigo Pereira Santos

    Full Text Available Cowpea is one of the most important food and forage legumes in drier regions of the tropics and subtropics. However, cowpea yield worldwide is markedly below the known potential due to abiotic and biotic stresses, including parasitism by root-knot nematodes (Meloidogyne spp., RKN. Two resistance genes with dominant effect, Rk and Rk2, have been reported to provide resistance against RKN in cowpea. Despite their description and use in breeding for resistance to RKN and particularly genetic mapping of the Rk locus, the exact genes conferring resistance to RKN remain unknown. In the present work, QTL mapping using recombinant inbred line (RIL population 524B x IT84S-2049 segregating for a newly mapped locus and analysis of the transcriptome changes in two cowpea near-isogenic lines (NIL were used to identify candidate genes for Rk and the newly mapped locus. A major QTL, designated QRk-vu9.1, associated with resistance to Meloidogyne javanica reproduction, was detected and mapped on linkage group LG9 at position 13.37 cM using egg production data. Transcriptome analysis on resistant and susceptible NILs 3 and 9 days after inoculation revealed up-regulation of 109 and 98 genes and down-regulation of 110 and 89 genes, respectively, out of 19,922 unique genes mapped to the common bean reference genome. Among the differentially expressed genes, four and nine genes were found within the QRk-vu9.1 and QRk-vu11.1 QTL intervals, respectively. Six of these genes belong to the TIR-NBS-LRR family of resistance genes and three were upregulated at one or more time-points. Quantitative RT-PCR validated gene expression to be positively correlated with RNA-seq expression pattern for eight genes. Future functional analysis of these cowpea genes will enhance our understanding of Rk-mediated resistance and identify the specific gene responsible for the resistance.

  8. ICAM-3, radiation resistance gene, activates PI3K/Akt-CREB-MMPs pathway and promotes migration/invasion of the human non-small cell lung cancer cell NCI-H1299

    International Nuclear Information System (INIS)

    Park, Jong Kuk; Park, Seon Ho; Hong, Sung Hee; Um, Hong Duck; Yoo, Young Do

    2008-01-01

    Cancer cell is characterized by various distinctive functions difference from normal cell. The one of specific properties of cancer is invasion and metastasis. Invasion and metastasis is a multi-step process involving over-expression of proteolytic enzymes such as matrix metalloproteinases (MMPs) and critically dependent on the ability of cells to move away from the primary tumor to gain access to the vascular or lymphatic systems which disperses cells to distant sites, where they can grow in a permissive microenvironment at a secondary location. All of these processes are critically dependent upon the ability of cancer cells to breach the basement membrane and to migrate through neighboring tissues. Cancer cell invasion is an important, tightly regulated process that is related with development, immune response and wound healing. This invasive response is dependent on activation of signaling pathways that result in both short-term and long-term cellular responses. The gene expressions of the cancer cell invasion related-proteolytic enzymes are regulated at the transcriptional level (through AP-1 and NF-kB via mitogen activated protein kinases (MAPKs) and PI3K-Akt pathways) and post-transcriptional levels, and the protein level via their activators or inhibitors, and their cell surface localization. Therefore, the related proteins such as MMPs, MAPK, PI3K, Akt and their regulatory pathway have been considered as promising targets for anti-cancer drugs. In previous reports, Intercellular adherin molecule-3 (ICAM-3) showed increase of radio-resistance and proliferation. We have made ICAM-3 overexpressed cancer cells which shows elevated level of invasion compared with normal cancer cells and its invasion capacity was down regulated with treatment of specific inhibitor for PI3K. These results suggest that ICAM-3 related invasion is associated with PI3K signaling pathway

  9. Direct identification of antibiotic resistance genes on single plasmid molecules using CRISPR/Cas9 in combination with optical DNA mapping

    Science.gov (United States)

    Müller, Vilhelm; Rajer, Fredrika; Frykholm, Karolin; Nyberg, Lena K.; Quaderi, Saair; Fritzsche, Joachim; Kristiansson, Erik; Ambjörnsson, Tobias; Sandegren, Linus; Westerlund, Fredrik

    2016-12-01

    Bacterial plasmids are extensively involved in the rapid global spread of antibiotic resistance. We here present an assay, based on optical DNA mapping of single plasmids in nanofluidic channels, which provides detailed information about the plasmids present in a bacterial isolate. In a single experiment, we obtain the number of different plasmids in the sample, the size of each plasmid, an optical barcode that can be used to identify and trace the plasmid of interest and information about which plasmid that carries a specific resistance gene. Gene identification is done using CRISPR/Cas9 loaded with a guide-RNA (gRNA) complementary to the gene of interest that linearizes the circular plasmids at a specific location that is identified using the optical DNA maps. We demonstrate the principle on clinically relevant extended spectrum beta-lactamase (ESBL) producing isolates. We discuss how the gRNA sequence can be varied to obtain the desired information. The gRNA can either be very specific to identify a homogeneous group of genes or general to detect several groups of genes at the same time. Finally, we demonstrate an example where we use a combination of two gRNA sequences to identify carbapenemase-encoding genes in two previously not characterized clinical bacterial samples.

  10. Measurements of B{sup 0} Decays to pi{sup +}pi{sup -}pi{sup 0}

    Energy Technology Data Exchange (ETDEWEB)

    Harrison, Paul F.

    2001-07-30

    We present preliminary results of searches for exclusive B{sup 0} decays to {pi}{sup +}{pi}{sup -} {pi}{sup 0} among 22.7 million b{bar b} pairs collected by the BABAR experiment from electron-positron collisions near the {Upsilon}(4S) resonance. We measure {Beta}(B{sup 0} {yields} {pi}{sup {+-}}) = (28.9 {+-} 5.4 {+-} 4.3) x 10{sup 6}, and find no evidence for the presence of any other decay mode in the {pi}{sup +}{pi}{sup -} {pi}{sup 0} Dalitz plot. Upper limits are determined for the branching fractions of B{sup 0} {yields} {sup 0}{pi}{sup 0}, non-resonant B{sup 0} decays to {pi}{sup +}{pi}{sup -} {pi}{sup 0} and of several discrete regions of {pi}{sup +}{pi}{sup -} {pi}{sup 0} phase-space. We also measure the direct CP-violating asymmetry between the rates of untagged {sup +}{pi}{sup -} and {sup -}{pi}{sup +}, finding no significant evidence for an effect.

  11. Co-evolutionary interactions between host resistance and pathogen avirulence genes in rice-Magnaporthe oryzae pathosystem.

    Science.gov (United States)

    Singh, Pankaj Kumar; Ray, Soham; Thakur, Shallu; Rathour, Rajeev; Sharma, Vinay; Sharma, Tilak Raj

    2018-06-01

    Rice and Magnaporthe oryzae constitutes an ideal pathosystem for studying host-pathogen interaction in cereals crops. There are two alternative hypotheses, viz. Arms race and Trench warfare, which explain the co-evolutionary dynamics of hosts and pathogens which are under continuous confrontation. Arms race proposes that both R- and Avr- genes of host and pathogen, respectively, undergo positive selection. Alternatively, trench warfare suggests that either R- or Avr- gene in the pathosystem is under balanced selection intending to stabilize the genetic advantage gained over the opposition. Here, we made an attempt to test the above-stated hypotheses in rice-M. oryzae pathosystem at loci of three R-Avr gene pairs, Piz-t-AvrPiz-t, Pi54-AvrPi54 and Pita-AvrPita using allele mining approach. Allele mining is an efficient way to capture allelic variants existing in the population and to study the selective forces imposed on the variants during evolution. Results of nucleotide diversity, neutrality statistics and phylogenetic analyses reveal that Piz-t, Pi54 and AvrPita are diversified and under positive selection at their corresponding loci, while their counterparts, AvrPiz-t, AvrPi54 and Pita are conserved and under balancing selection, in nature. These results imply that rice-M. oryzae populations are engaged in a trench warfare at least at the three R/Avr loci studied. It is a maiden attempt to study the co-evolution of three R-Avr gene pairs in this pathosystem. Knowledge gained from this study will help in understanding the evolutionary dynamics of host-pathogen interaction in a better way and will also aid in developing new durable blast resistant rice varieties in future. Copyright © 2018 Elsevier Inc. All rights reserved.

  12. The small RNA content of human sperm reveals pseudogene-derived piRNAs complementary to protein-coding genes

    Science.gov (United States)

    Pantano, Lorena; Jodar, Meritxell; Bak, Mads; Ballescà, Josep Lluís; Tommerup, Niels; Oliva, Rafael; Vavouri, Tanya

    2015-01-01

    At the end of mammalian sperm development, sperm cells expel most of their cytoplasm and dispose of the majority of their RNA. Yet, hundreds of RNA molecules remain in mature sperm. The biological significance of the vast majority of these molecules is unclear. To better understand the processes that generate sperm small RNAs and what roles they may have, we sequenced and characterized the small RNA content of sperm samples from two human fertile individuals. We detected 182 microRNAs, some of which are highly abundant. The most abundant microRNA in sperm is miR-1246 with predicted targets among sperm-specific genes. The most abundant class of small noncoding RNAs in sperm are PIWI-interacting RNAs (piRNAs). Surprisingly, we found that human sperm cells contain piRNAs processed from pseudogenes. Clusters of piRNAs from human testes contain pseudogenes transcribed in the antisense strand and processed into small RNAs. Several human protein-coding genes contain antisense predicted targets of pseudogene-derived piRNAs in the male germline and these piRNAs are still found in mature sperm. Our study provides the most extensive data set and annotation of human sperm small RNAs to date and is a resource for further functional studies on the roles of sperm small RNAs. In addition, we propose that some of the pseudogene-derived human piRNAs may regulate expression of their parent gene in the male germline. PMID:25904136

  13. Kaempferol increases apoptosis in human acute promyelocytic leukemia cells and inhibits multidrug resistance genes.

    Science.gov (United States)

    Moradzadeh, Maliheh; Tabarraei, Alijan; Sadeghnia, Hamid Reza; Ghorbani, Ahmad; Mohamadkhani, Ashraf; Erfanian, Saiedeh; Sahebkar, Amirhossein

    2018-02-01

    Acute promyelocytic leukemia (APL) is one of the most life-threatening hematological malignancies. Defects in the cell growth and apoptotic pathways are responsible for both disease pathogenesis and treatment resistance. Therefore, pro-apoptotic agents are potential candidates for APL treatment. Kaempferol is a flavonoid with antioxidant and anti-tumor properties. This study was designed to investigate the cytotoxic, pro-apoptotic, and differentiation-inducing effects of kaempferol on HL-60 and NB4 leukemia cells. Resazurin assay was used to determine cell viability following treatment with kaempferol (12.5-100 μM) and all-trans retinoic acid (ATRA; 10 μM; used as a positive control). Apoptosis and differentiation were also detected using propidium iodide and NBT staining techniques, respectively. Furthermore, the expression levels of genes involved in apoptosis (PI3 K, AKT, BCL2, BAX, p53, p21, PTEN, CASP3, CASP8, and CASP9), differentiation (PML-RAR and HDAC1), and multi-drug resistance (ABCB1 and ABCC1) were determined using quantitative real-time PCR. The protein expressions of Bax/Bcl2 and casp3 were confirmed using Western blot. The results showed that kaempferol decreased cell viability and increased subG1 population in the tested leukemic cells. This effect was associated with decreased expression of Akt, BCL2, ABCB1, and ABCC1 genes, while the expression of CASP3 and BAX/BCL-2 ratio were significantly increased at both gene and protein levels. Kaempferol promoted apoptosis and inhibited multidrug resistance in a concentration-dependent manner, without any differential effect on leukemic cells. In conclusion, this study suggested that kaempferol may be utilized as an appropriate alternative for ATRA in APL patients. © 2017 Wiley Periodicals, Inc.

  14. Observation of f sub 1 (1285) yields. pi. sup +. pi. sup -. pi. sup +. pi. sup - in radiative J/. psi. decays

    Energy Technology Data Exchange (ETDEWEB)

    Bolton, T; Bunnell, K O; Cassell, R E; Coward, D H; Labs, J; Odian, A; Pitman, D; Schindler, R H; Toki, W [Stanford Linear Accelerator Centre, Stanford Univ., CA (United States); Brown, J S; Burnett, T H; Li, A; Mir, R; Mockett, P M; Parrish, L; Willutzki, H J [Dept. of Physics, Univ. Washington, Seattle, WA (United States); Burchell, M; Drinkard, J; Gatto, C; Heusch, C A; Lockman, W S; Sadrozinski, H F.W.; Scarlatella, M; Schalk, T L; Seiden, A; Weinstein, A J; Xu, R [Santa Cruz Inst. for Particle Physics, Univ. California, CA (United States); Coffman, D; DeJongh, F; Dubois, G P; Eigen, G; Hitlin, D G; Matthews, C G; Richman, J D; Wisniewski, W J; Zhu, Y [Dept. of Physics, California Inst. of Tech., Pasadena, CA (United States); Eisenstein, B I; Freese, T; Gladding, G; Izen, J M; Kim, P C; Stockdale, I E; Tripsas, B [Dept. of Physics, Univ. of Illinois at Urbana-Champaign, Urbana, IL (United States); Mallik, U; Wang, M Z [Dept. of; Mark III Collaboration

    1992-04-02

    We present an analysis of J/{psi}{yields}{gamma}f{sub 1}(1285), f{sub 1}(1285){yields}{pi}{sup +}{pi}{sup -}{pi}{sup +}{pi}{sup -}, using the Mark III detector at SPEAR, based on 5.8x10{sup 6} produced J/{psi} events. We measure B(J/{psi}{yields}{gamma}f{sub 1}(1285), f{sub 1}(1285){yields}{pi}{sup +}{pi}{sup -}{pi}{sup +}{pi}{sup -})=(4.8{+-}1.3{+-}0.9)x10{sup -5}. We obtain a new measurement of the absolute branching ratio of J/{psi}{yields}{gamma}f{sub 1}(1285). The mixing angle of the f{sub 1}(1285) and the f{sub 1}(1420) in the 1{sup ++} nonet is determined. (orig.).

  15. Allelic diversity in an NLR gene BPH9 enables rice to combat planthopper variation.

    Science.gov (United States)

    Zhao, Yan; Huang, Jin; Wang, Zhizheng; Jing, Shengli; Wang, Yang; Ouyang, Yidan; Cai, Baodong; Xin, Xiu-Fang; Liu, Xin; Zhang, Chunxiao; Pan, Yufang; Ma, Rui; Li, Qiaofeng; Jiang, Weihua; Zeng, Ya; Shangguan, Xinxin; Wang, Huiying; Du, Bo; Zhu, Lili; Xu, Xun; Feng, Yu-Qi; He, Sheng Yang; Chen, Rongzhi; Zhang, Qifa; He, Guangcun

    2016-10-24

    Brown planthopper (BPH), Nilaparvata lugens Stål, is one of the most devastating insect pests of rice (Oryza sativa L.). Currently, 30 BPH-resistance genes have been genetically defined, most of which are clustered on specific chromosome regions. Here, we describe molecular cloning and characterization of a BPH-resistance gene, BPH9, mapped on the long arm of rice chromosome 12 (12L). BPH9 encodes a rare type of nucleotide-binding and leucine-rich repeat (NLR)-containing protein that localizes to the endomembrane system and causes a cell death phenotype. BPH9 activates salicylic acid- and jasmonic acid-signaling pathways in rice plants and confers both antixenosis and antibiosis to BPH. We further demonstrated that the eight BPH-resistance genes that are clustered on chromosome 12L, including the widely used BPH1, are allelic with each other. To honor the priority in the literature, we thus designated this locus as BPH1/9 These eight genes can be classified into four allelotypes, BPH1/9-1, -2, -7, and -9 These allelotypes confer varying levels of resistance to different biotypes of BPH. The coding region of BPH1/9 shows a high level of diversity in rice germplasm. Homologous fragments of the nucleotide-binding (NB) and leucine-rich repeat (LRR) domains exist, which might have served as a repository for generating allele diversity. Our findings reveal a rice plant strategy for modifying the genetic information to gain the upper hand in the struggle against insect herbivores. Further exploration of natural allelic variation and artificial shuffling within this gene may allow breeding to be tailored to control emerging biotypes of BPH.

  16. The prevalence of antiretroviral multidrug resistance in highly active antiretroviral therapy-treated patients with HIV/AIDS between 2004 and 2009 in South Korea.

    Science.gov (United States)

    Choi, Ju-yeon; Kwon, Oh-Kyung; Choi, Byeong-Sun; Kee, Mee-Kyung; Park, Mina; Kim, Sung Soon

    2014-06-01

    Highly active antiretroviral therapy (HAART) including protease inhibitors (PIs) has been used in South Korea since 1997. Currently, more than 20 types of antiretroviral drugs are used in the treatment of human immunodeficiency virus-infected/acquired immune deficiency syndrome patients in South Korea. Despite the rapid development of various antiretroviral drugs, many drug-resistant variants have been reported after initiating HAART, and the efficiency of HAART is limited by these variants. To investigate and estimate the annual antiretroviral drug resistance and prevalence of antiretroviral multi-class drug resistance in Korean patients with experience of treatment. The amplified HIV-1 pol gene in 535 patients requested for genotypic drug resistance testing from 2004 to 2009 by the Korea Centers for Disease Control and Prevention was sequenced and analyzed annually and totally. The prevalence of antiretroviral drug resistance was estimated based on "SIR" interpretation of the Stanford sequence database. Of viruses derived from 787 specimens, 380 samples (48.3%) showed at least one drug class-related resistance. Predicted NRTI drug resistance was highest at 41.9%. NNRTI showed 27.2% resistance with 23.3% for PI. The percent of annual drug resistance showed similar pattern and slightly declined except 2004 and 2005. The prevalence of multi-class drug resistance against each drug class was: NRTI/NNRTI/PI, 9.8%; NRTI/PI, 21.9%; NNRTI/PI, 10.4%; and NRTI/NNRTI, 21.5%. About 50% and less than 10% of patients infected with HIV-1 have multidrug and multiclass resistance linked to 16 antiretroviral drugs, respectively. The significance of this study lies in its larger-scale examination of the prevalence of drug-resistant variants and multidrug resistance in HAART-experienced patients in South Korea. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. Involvement of Three Esterase Genes from Panonychus citri (McGregor in Fenpropathrin Resistance

    Directory of Open Access Journals (Sweden)

    Xiao-Min Shen

    2016-08-01

    Full Text Available The citrus red mite, Panonychus citri (McGregor, is a major citrus pest with a worldwide distribution and an extensive record of pesticide resistance. However, the underlying molecular mechanism associated with fenpropathrin resistance in this species have not yet been reported. In this study, synergist triphenyl phosphate (TPP dramatically increased the toxicity of fenpropathrin, suggesting involvement of carboxylesterases (CarEs in the metabolic detoxification of this insecticide. The subsequent spatiotemporal expression pattern analysis of PcE1, PcE7 and PcE9 showed that three CarEs genes were all over-expressed after insecticide exposure and higher transcripts levels were observed in different field resistant strains of P. citri. Heterologous expression combined with 3-(4,5-dimethyl-thiazol-2-yl-2,5-diphenyltetra-zolium bromide (MTT cytotoxicity assay in Spodoptera frugiperda (Sf9 cells revealed that PcE1-, PcE7- or PcE9-expressing cells showed significantly higher cytoprotective capability than parental Sf9 cells against fenpropathrin, demonstrating that PcEs probably detoxify fenpropathrin. Moreover, gene silencing through the method of leaf-mediated dsRNA feeding followed by insecticide bioassay increased the mortalities of fenpropathrin-treated mites by 31% (PcE1, 27% (PcE7 and 22% (PcE9, respectively, after individual PcE gene dsRNA treatment. In conclusion, this study provides evidence that PcE1, PcE7 and PcE9 are functional genes mediated in fenpropathrin resistance in P. citri and enrich molecular understanding of CarEs during the resistance development of the mite.

  18. Antimicrobial susceptibility and occurrence of resistance genes among Salmonella enterica serovar Weltevreden from different countries

    DEFF Research Database (Denmark)

    Aarestrup, Frank Møller; Lertworapreecha, M.; Evans, M.C.

    2003-01-01

    and gentamicin. All nine ampicillin-resistant isolates contained a sequence similar to the bla(TEM-1b) gene, one of the eight chloramphenicol-resistant isolates a sequence similar to the catA1 gene, all three neomycin-resistant isolates a sequence similar to the aphA-2 gene, 16 (73%) of the 22 streptomycin...... isolates were examined for susceptibility to antimicrobial agents, and resistant isolates were examined for the presence of selected resistance genes by PCR. Results: Only 48 (9.5%) of the isolates were resistant to one or more of the antimicrobial agents tested. A low frequency of resistance was found...

  19. Multiple Cytochrome P450 genes: their constitutive overexpression and permethrin induction in insecticide resistant mosquitoes, Culex quinquefasciatus.

    Science.gov (United States)

    Liu, Nannan; Li, Ting; Reid, William R; Yang, Ting; Zhang, Lee

    2011-01-01

    Four cytochrome P450 cDNAs, CYP6AA7, CYP9J40, CYP9J34, and CYP9M10, were isolated from mosquitoes, Culex quinquefasciatus. The P450 gene expression and induction by permethrin were compared for three different mosquito populations bearing different resistance phenotypes, ranging from susceptible (S-Lab), through intermediate (HAmCq(G0), the field parental population) to highly resistant (HAmCq(G8), the 8(th) generation of permethrin selected offspring of HAmCq(G0)). A strong correlation was found for P450 gene expression with the levels of resistance and following permethrin selection at the larval stage of mosquitoes, with the highest expression levels identified in HAmCq(G8), suggesting the importance of CYP6AA7, CYP9J40, CYP9J34, and CYP9M10 in the permethrin resistance of larva mosquitoes. Only CYP6AA7 showed a significant overexpression in HAmCq(G8) adult mosquitoes. Other P450 genes had similar expression levels among the mosquito populations tested, suggesting different P450 genes may be involved in the response to insecticide pressure in different developmental stages. The expression of CYP6AA7, CYP9J34, and CYP9M10 was further induced by permethrin in resistant mosquitoes. Taken together, these results indicate that multiple P450 genes are up-regulated in insecticide resistant mosquitoes through both constitutive overexpression and induction mechanisms, thus increasing the overall expression levels of P450 genes.

  20. Novel drug-resistance mechanisms of pemetrexed-treated non-small cell lung cancer.

    Science.gov (United States)

    Tanino, Ryosuke; Tsubata, Yukari; Harashima, Nanae; Harada, Mamoru; Isobe, Takeshi

    2018-03-30

    Pemetrexed (PEM) improves the overall survival of patients with advanced non-small cell lung cancer (NSCLC) when administered as maintenance therapy. However, PEM resistance often appears during the therapy. Although thymidylate synthase is known to be responsible for PEM resistance, no other mechanisms have been investigated in detail. In this study, we explored new drug resistance mechanisms of PEM-treated NSCLC using two combinations of parental and PEM-resistant NSCLC cell lines from PC-9 and A549. PEM increased the apoptosis cells in parental PC-9 and the senescent cells in parental A549. However, such changes were not observed in the respective PEM-resistant cell lines. Quantitative RT-PCR analysis revealed that, besides an increased gene expression of thymidylate synthase in PEM-resistant PC-9 cells, the solute carrier family 19 member1 ( SLC19A1) gene expression was markedly decreased in PEM-resistant A549 cells. The siRNA-mediated knockdown of SLC19A1 endowed the parental cell lines with PEM resistance. Conversely, PEM-resistant PC-9 cells carrying an epidermal growth factor receptor (EGFR) mutation acquired resistance to a tyrosine kinase inhibitor erlotinib. Although erlotinib can inhibit the phosphorylation of EGFR and Erk, it is unable to suppress the phosphorylation of Akt in PEM-resistant PC-9 cells. Additionally, PEM-resistant PC-9 cells were less sensitive to the PI3K inhibitor LY294002 than parental PC-9 cells. These results indicate that SLC19A1 negatively regulates PEM resistance in NSCLC, and that EGFR-tyrosine-kinase-inhibitor resistance was acquired with PEM resistance through Akt activation in NSCLC harboring EGFR mutations.

  1. Overexpression of antibiotic resistance genes in hospital effluents over time.

    Science.gov (United States)

    Rowe, Will P M; Baker-Austin, Craig; Verner-Jeffreys, David W; Ryan, Jim J; Micallef, Christianne; Maskell, Duncan J; Pearce, Gareth P

    2017-06-01

    Effluents contain a diverse abundance of antibiotic resistance genes that augment the resistome of receiving aquatic environments. However, uncertainty remains regarding their temporal persistence, transcription and response to anthropogenic factors, such as antibiotic usage. We present a spatiotemporal study within a river catchment (River Cam, UK) that aims to determine the contribution of antibiotic resistance gene-containing effluents originating from sites of varying antibiotic usage to the receiving environment. Gene abundance in effluents (municipal hospital and dairy farm) was compared against background samples of the receiving aquatic environment (i.e. the catchment source) to determine the resistome contribution of effluents. We used metagenomics and metatranscriptomics to correlate DNA and RNA abundance and identified differentially regulated gene transcripts. We found that mean antibiotic resistance gene and transcript abundances were correlated for both hospital ( ρ  = 0.9, two-tailed P  hospital effluent samples. High β-lactam resistance gene transcript abundance was related to hospital antibiotic usage over time and hospital effluents contained antibiotic residues. We conclude that effluents contribute high levels of antibiotic resistance genes to the aquatic environment; these genes are expressed at significant levels and are possibly related to the level of antibiotic usage at the effluent source. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy.

  2. Genetics and mapping of a novel downy mildew resistance gene, Pl(18), introgressed from wild Helianthus argophyllus into cultivated sunflower (Helianthus annuus L.).

    Science.gov (United States)

    Qi, L L; Foley, M E; Cai, X W; Gulya, T J

    2016-04-01

    A novel downy mildew resistance gene, Pl(18), was introgressed from wild Helianthus argophyllus into cultivated sunflower and genetically mapped to linkage group 2 of the sunflower genome. The new germplasm, HA-DM1, carrying Pl(18) has been released to the public. Sunflower downy mildew (DM) is considered to be the most destructive foliar disease that has spread to every major sunflower-growing country of the world, except Australia. A new dominant downy mildew resistance gene (Pl 18) transferred from wild Helianthus argophyllus (PI 494573) into cultivated sunflower was mapped to linkage group (LG) 2 of the sunflower genome using bulked segregant analysis with 869 simple sequence repeat (SSR) markers. Phenotyping 142 BC1F2:3 families derived from the cross of HA 89 and H. argophyllus confirmed the single gene inheritance of resistance. Since no other Pl gene has been mapped to LG2, this gene was novel and designated as Pl (18). SSR markers CRT214 and ORS203 flanked Pl(18) at a genetic distance of 1.1 and 0.4 cM, respectively. Forty-six single nucleotide polymorphism (SNP) markers that cover the Pl(18) region were surveyed for saturation mapping of the region. Six co-segregating SNP markers were 1.2 cM distal to Pl(18), and another four co-segregating SNP markers were 0.9 cM proximal to Pl(18). The new BC2F4-derived germplasm, HA-DM1, carrying Pl(18) has been released to the public. This new line is highly resistant to all Plasmopara halstedii races identified in the USA providing breeders with an effective new source of resistance against downy mildew in sunflower. The molecular markers that were developed will be especially useful in marker-assisted selection and pyramiding of Pl resistance genes because of their close proximity to the gene and the availability of high-throughput SNP detection assays.

  3. Presence of antiseptic resistance genes in porcine methicillin-resistant Staphylococcus aureus.

    Science.gov (United States)

    Wong, T Z; Zhang, M; O'Donoghue, M; Boost, M

    2013-03-23

    Numerous studies have documented the presence of methicillin-resistant Staphylococcus aureus (MRSA) in meat-producing animals, which has led to concern about its spread into the community. Disinfectants play an important role in reduction of contamination in both animal husbandry and food-preparation, helping control spread of organisms from foodstuffs, including raw meat. Plasmid-borne antiseptic resistance (AR) genes increasing tolerance to several disinfectants have been reported in S. aureus of human origin (qacA/B and smr) and from bovine, equine, and caprine staphylococcal isolates (qacG, qacH, and qacJ). This study investigated the presence of AR genes in porcine MRSA isolates. Plasmid DNA from 100 MRSA ST9 strains isolated from pig carcasses was amplified for the presence of AR genes. Minimum inhibitory concentrations (MICs) and minimum bactericidal concentrations (MBCs) to benzalkonium chloride (BC) and chlorhexidine gluconate (CHX) were determined in AR gene-positive isolates. qacG was present in 45 strains, eight of which also harbored smr. No strains carried qacA/B, qacH or qacJ. Presence of smr increased MICs to both BC and CHX and MBCs of CHX, but qacG presence only resulted in elevated MBC for CHX. This is the first report of AR genes from a porcine source. AR gene positivity has previously been associated with methicillin resistance and AR gene presence in these strains may increase their ability to persist in the environment. Improved implementation of hygiene measures during transportation and pre- and post-slaughter should be considered to prevent spread in the community. Copyright © 2012 Elsevier B.V. All rights reserved.

  4. Functional markers based molecular characterization and cloning of resistance gene analogs encoding NBS-LRR disease resistance proteins in finger millet (Eleusine coracana).

    Science.gov (United States)

    Panwar, Preety; Jha, Anand Kumar; Pandey, P K; Gupta, Arun K; Kumar, Anil

    2011-06-01

    Magnaporthe grisea, the blast fungus is one of the main pathological threats to finger millet crop worldwide. A systematic search for the blast resistance gene analogs was carried out, using functional molecular markers. Three-fourths of the recognition-dependent disease resistance genes (R-genes) identified in plants encodes nucleotide binding site (NBS) leucine-rich repeat (LRR) proteins. NBS-LRR homologs have only been isolated on a limited scale from Eleusine coracana. Genomic DNA sequences sharing homology with NBS region of resistance gene analogs were isolated and characterized from resistant genotypes of finger millet using PCR based approach with primers designed from conserved regions of NBS domain. Attempts were made to identify molecular markers linked to the resistance gene and to differentiate the resistant bulk from the susceptible bulk. A total of 9 NBS-LRR and 11 EST-SSR markers generated 75.6 and 73.5% polymorphism respectively amongst 73 finger millet genotypes. NBS-5, NBS-9, NBS-3 and EST-SSR-04 markers showed a clear polymorphism which differentiated resistant genotypes from susceptible genotypes. By comparing the banding pattern of different resistant and susceptible genotypes, five DNA amplifications of NBS and EST-SSR primers (NBS-05(504,) NBS-09(711), NBS-07(688), NBS-03(509) and EST-SSR-04(241)) were identified as markers for the blast resistance in resistant genotypes. Principal coordinate plot and UPGMA analysis formed similar groups of the genotypes and placed most of the resistant genotypes together showing a high level of genetic relatedness and the susceptible genotypes were placed in different groups on the basis of differential disease score. Our results provided a clue for the cloning of finger millet blast resistance gene analogs which not only facilitate the process of plant breeding but also molecular characterization of blast resistance gene analogs from Eleusine coracana.

  5. Analysis of differentially expressed genes related to resistance in spinosad- and neonicotinoid-resistant Musca domestica L. (Diptera: Muscidae) strains

    DEFF Research Database (Denmark)

    Castberg, Dorte Heidi Højland; Kristensen, Michael

    2017-01-01

    strains differing significantly in their response to insecticides. High differential expression of P450s and genes coding for cuticle protein indicates a combination of factors involved in metabolic neonicotinoid and spinosad resistance. Conclusion Resistance in these strains is apparently not linked...... interesting in terms of neonicotinoid resistance, while cyp4d9 was overexpressed in 791spin compared to spinosad-susceptible strains. GSTs, ESTs and UGTs were mostly overexpressed, but not to the same degree as P450s. We present a comprehensive and comparative picture of gene expression in three housefly......Background The housefly is a global pest that has developed resistance to most insecticides applied against it. Resistance of the spinosad-resistant strain 791spin and the neonicotinoid-resistant 766b strain is believed to be due to metabolism. We investigate differentially expressed genes...

  6. Antibiotic resistance and virulence genes in coliform water isolates.

    Science.gov (United States)

    Stange, C; Sidhu, J P S; Tiehm, A; Toze, S

    2016-11-01

    Widespread fecal pollution of surface water may present a major health risk and a significant pathway for dissemination of antibiotic resistance bacteria. The River Rhine is one of the longest and most important rivers in Europe and an important raw water source for drinking water production. A total of 100 coliform isolates obtained from River Rhine (Germany) were examined for their susceptibility to seven antimicrobial agents. Resistances against amoxicillin, trimethoprim/sulfamethoxazole and tetracycline were detected in 48%, 11% and 9% of isolates respectively. The antibiotic resistance could be traced back to the resistance genes bla TEM , bla SHV , ampC, sul1, sul2, dfrA1, tet(A) and tet(B). Whereby, the ampC gene represents a special case, because its presence is not inevitably linked to a phenotypic antibiotic resistance. Multiple antibiotics resistance was often accompanied by the occurrence of class 1 or 2 integrons. E. coli isolates belonging to phylogenetic groups A and B1 (commensal) were more predominant (57%) compared to B2 and D groups (43%) which are known to carry virulent genes. Additionally, six E. coli virulence genes were also detected. However, the prevalence of virulence genes in the E. coli isolates was low (not exceeding 4.3% per gene) and no diarrheagenic E. coli pathotypes were detected. This study demonstrates that surface water is an important reservoir of ARGs for a number of antibiotic classes such as sulfonamide, trimethoprim, beta-lactam-antibiotics and tetracycline. The occurrence of antibiotic resistance in coliform bacteria isolated from River Rhine provides evidence for the need to develop management strategies to limit the spread of antibiotic resistant bacteria in aquatic environment. Copyright © 2016 Elsevier GmbH. All rights reserved.

  7. Antimicrobial resistance and resistance genes in Salmonella strains isolated from broiler chickens along the slaughtering process in China.

    Science.gov (United States)

    Zhu, Yuanting; Lai, Haimei; Zou, Likou; Yin, Sheng; Wang, Chengtao; Han, Xinfeng; Xia, Xiaolong; Hu, Kaidi; He, Li; Zhou, Kang; Chen, Shujuan; Ao, Xiaolin; Liu, Shuliang

    2017-10-16

    A total of 189 Salmonella isolates were recovered from 627 samples which were collected from cecal contents of broilers, chicken carcasses, chicken meat after cutting step and frozen broiler chicken products along the slaughtering process at a slaughterhouse in Sichuan province of China. The Salmonella isolates were subjected to antimicrobial susceptibility testing to 10 categories of antimicrobial agents using the Kirby-Bauer disk diffusion method. Those antibiotics-resistant isolates were further investigated for the occurrence of resistance genes, the presence of class 1 integron as well as the associated gene cassettes, and the mutations within the gyrA and parC genes. Consequently, the prevalence of Salmonella was 30.14% (47.96% for cecal content, 18.78% for chicken carcasses, 31.33% for cutting meat and 14.00% for frozen meat, respectively). The predominant serotypes were S. Typhimurium (15.34%) and S. Enteritidis (69.84%). High resistance rates to the following drugs were observed: nalidixic acid (99.5%), ampicillin (87.8%), tetracycline (51.9%), ciprofloxacin (48.7%), trimethoprim/sulfamethoxazole (48.1%), and spectinomycin (34.4%). Antimicrobial resistance profiling showed that 60.8% of isolates were multidrug resistant (MDR), and MDR strains increased from 44.7% to 78.6% along the slaughtering line. 94.6% (n=157) of beta-lactam-resistant isolates harbored at least one resistance gene of bla TEM or bla CTX-M . The relatively low prevalence of aminoglycoside resistance genes (aac(3)-II, aac(3)-IV, and ant(2″)-I) was found in 49 (66.2%) of antibiotic-resistant isolates. The tetracycline resistance genes (tet(A), tet(B), tet(C), and tet(G) and sulfonamide resistance genes (sul1, sul2, and sul3) were identified in 84 (85.7%) and 89 (97.8%) antibiotic-resistant isolates respectively. floR was identified in 44 (97.8%) florfenicol-resistant isolates. Class 1 integron was detected in 37.4% (n=43) of the MDR isolates. Two different gene cassettes, bla OXA-30 -aad

  8. Carbapenem-resistant Pseudomonas aeruginosa: association with virulence genes and biofilm formation

    Directory of Open Access Journals (Sweden)

    Iara Rossi Gonçalves

    Full Text Available Abstract Pseudomonas aeruginosa is an opportunistic pathogen that causes frequently nosocomial infections, currently becoming more difficult to treat due to the various resistance mechanisms and different virulence factors. The purpose of this study was to determine the risk factors independently associated with the development of bacteremia by carbapenem-resistant P. aeruginosa, the frequency of virulence genes in metallo-β-lactamases producers and to evaluate their ability to produce biofilm. We conducted a case–control study in the Uberlândia Federal University – Hospital Clinic, Brazil. Polymerase Chain Reaction was performed for metallo-β-lactamases and virulence genes. Adhesion and biofilm assays were done by quantitative tests. Among the 157 strains analyzed, 73.9% were multidrug-resistant, 43.9% were resistant to carbapenems, 16.1% were phenotypically positive for metallo-β-lactamases, and of these, 10.7% were positive for blaSPM gene and 5.3% positive for blaVIM. The multivariable analysis showed that mechanical ventilation, enteral/nasogastric tubes, primary bacteremia with unknown focus, and inappropriate therapy were independent risk factors associated with bacteremia. All tested strains were characterized as strongly biofilm producers. A higher mortality was found among patients with bacteremia by carbapenem-resistant P. aeruginosa strains, associated independently with extrinsic risk factors, however it was not evident the association with the presence of virulence and metallo-β-lactamases genes.

  9. AMINOGLYCOSIDE RESISTANCE GENES IN Pseudomonas aeruginosa ISOLATES FROM CUMANA, VENEZUELA

    Directory of Open Access Journals (Sweden)

    Bertinellys TEIXEIRA

    2016-01-01

    Full Text Available The enzymatic modification of aminoglycosides by aminoglycoside-acetyltransferases (AAC, aminoglycoside-adenyltransferases (AAD, and aminoglycoside-phosphotransferases (APH, is the most common resistance mechanism in P. aeruginosa and these enzymes can be coded on mobile genetic elements that contribute to their dispersion. One hundred and thirty seven P. aeruginosa isolates from the University Hospital, Cumana, Venezuela (HUAPA were evaluated. Antimicrobial susceptibility was determined by the disk diffusion method and theaac, aadB and aph genes were detected by PCR. Most of the P. aeruginosa isolates (33/137 were identified from the Intensive Care Unit (ICU, mainly from discharges (96/137. The frequency of resistant P. aeruginosaisolates was found to be higher for the aminoglycosides tobramycin and amikacin (30.7 and 29.9%, respectively. Phenotype VI, resistant to these antibiotics, was the most frequent (14/49, followed by phenotype I, resistant to all the aminoglycosides tested (12/49. The aac(6´-Ib,aphA1 and aadB genes were the most frequently detected, and the simultaneous presence of several resistance genes in the same isolate was demonstrated. Aminoglycoside resistance in isolates ofP. aeruginosa at the HUAPA is partly due to the presence of the aac(6´-Ib, aphA1 andaadB genes, but the high rates of antimicrobial resistance suggest the existence of several mechanisms acting together. This is the first report of aminoglycoside resistance genes in Venezuela and one of the few in Latin America.

  10. AMINOGLYCOSIDE RESISTANCE GENES IN Pseudomonas aeruginosa ISOLATES FROM CUMANA, VENEZUELA.

    Science.gov (United States)

    Teixeira, Bertinellys; Rodulfo, Hectorina; Carreño, Numirin; Guzmán, Militza; Salazar, Elsa; De Donato, Marcos

    2016-01-01

    The enzymatic modification of aminoglycosides by aminoglycoside-acetyltransferases (AAC), aminoglycoside-adenyltransferases (AAD), and aminoglycoside-phosphotransferases (APH), is the most common resistance mechanism in P. aeruginosa and these enzymes can be coded on mobile genetic elements that contribute to their dispersion. One hundred and thirty seven P. aeruginosa isolates from the University Hospital, Cumana, Venezuela (HUAPA) were evaluated. Antimicrobial susceptibility was determined by the disk diffusion method and theaac, aadB and aph genes were detected by PCR. Most of the P. aeruginosa isolates (33/137) were identified from the Intensive Care Unit (ICU), mainly from discharges (96/137). The frequency of resistant P. aeruginosaisolates was found to be higher for the aminoglycosides tobramycin and amikacin (30.7 and 29.9%, respectively). Phenotype VI, resistant to these antibiotics, was the most frequent (14/49), followed by phenotype I, resistant to all the aminoglycosides tested (12/49). The aac(6´)-Ib,aphA1 and aadB genes were the most frequently detected, and the simultaneous presence of several resistance genes in the same isolate was demonstrated. Aminoglycoside resistance in isolates ofP. aeruginosa at the HUAPA is partly due to the presence of the aac(6´)-Ib, aphA1 andaadB genes, but the high rates of antimicrobial resistance suggest the existence of several mechanisms acting together. This is the first report of aminoglycoside resistance genes in Venezuela and one of the few in Latin America.

  11. Antimicrobial resistance and virulence genes in enterococci from wild game meat in Spain.

    Science.gov (United States)

    Guerrero-Ramos, Emilia; Cordero, Jorge; Molina-González, Diana; Poeta, Patrícia; Igrejas, Gilberto; Alonso-Calleja, Carlos; Capita, Rosa

    2016-02-01

    A total of 55 enterococci (45 Enterococcus faecium, 7 Enterococcus faecalis, and three Enterococcus durans) isolated from the meat of wild game animals (roe deer, boar, rabbit, pheasant, and pigeon) in North-Western Spain were tested for susceptibility to 14 antimicrobials by the disc diffusion method. All strains showed a multi-resistant phenotype (resistance to between three and 10 antimicrobials). The strains exhibited high percentages of resistance to erythromycin (89.1%), tetracycline (67.3%), ciprofloxacin (92.7%), nitrofurantoin (67.3%), and quinupristin-dalfopristin (81.8%). The lowest values (9.1%) were observed for high-level resistance to gentamicin, kanamycin, and streptomycin. The average number of resistances per strain was 5.8 for E. faecium isolates, 7.9 for E. faecalis, and 5.7 for E. durans. Genes encoding antimicrobial resistance and virulence were studied by polymerase chain reaction. A total of 15 (57.7%) of the 26 vancomycin-resistant isolates harboured the vanA gene. Other resistance genes detected included vanB, erm(B) and/or erm(C), tet(L) and/or tet(M), acc(6')-aph(2″), and aph(3')-IIIa in strains resistant to vancomycin, erythromycin, tetracycline, gentamicin, and kanamycin, respectively. Specific genes of the Tn5397 transposon were detected in 54.8% of the tet(M)-positive enterococci. Nine virulence factors (gelE, agg, ace, cpd, frs, esp, hyl, efaAfs and efaAfm) were studied. All virulence genes, with the exception of the frs gene, were found to be present in the enterococcal isolates. At least one virulence gene was detected in 20.0% of E. faecium, 71.4% of E. faecalis and 33.3% of E. durans isolates, with ace and cpd being the most frequently detected genes (6 isolates each). This suggests that wild game meat might play a role in the spreading through the food chain of enterococci with antimicrobial resistance and virulence determinants to humans. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. Identificação e validação de marcadores microssatélites ligados ao gene Rpp5 de resistência à ferrugem-asiática-da-soja Identification and validation of microsatellite markers linked to the Rpp5 gene conferring resistance to Asian soybean rust

    Directory of Open Access Journals (Sweden)

    Thaiza Galhardo Silva Morceli

    2008-11-01

    Full Text Available O objetivo deste trabalho foi identificar novos marcadores microssatélites, ligados ao gene Rpp5 de resistência à ferrugem-da-soja, e validar os marcadores previamente mapeados, para que possam ser utilizados em programas de seleção assistida por marcadores moleculares (SAM. Para tanto, uma população F2 com 100 indivíduos, derivada do cruzamento entre a PI 200526 e a cultivar Coodetec 208, suscetível à ferrugem, foi artificialmente infectada e avaliada quanto à sua reação de resistência à ferrugem. Marcadores microssatélites foram testados nos genitores e em dois "bulks" contrastantes, para a identificação de marcadores ligados. Dois novos marcadores, potencialmente associados à resistência, foram testados em plantas individuais, e se constatou que eles estão ligados ao gene Rpp5 e estão presentes no grupo de ligação N da soja. A eficiência de seleção foi determinada em relação a todos os marcadores ligados ao gene Rpp5, e a combinação entre os marcadores Sat_275+Sat_280 foi de 100%.The main objective of this work was to identify new microsatellite markers, linked to the Rpp5 resistance gene to Asian soybean rust, and to validate previously mapped markers for use in marker-assisted selection (MAS programs. To this end, a F2 population with 100 individuals, derived from crossing between PI 200526 and cultivar Coodetec 208, susceptible to rust, was artificially infected and evaluated for its reaction of resistance to rust. Microsatellite markers were tested on parents and in the two contrasting bulks to identifying linked markers. Two new markers, potentially associated with resistance, were tested in individual plants, and they were found to be linked to gene Rpp5 and to be present in the N linkage group of soybean. The selection efficiencies were determined for all markers linked to gene Rpp5, and the combination of the markers Sat_275+Sat_280 was 100%.

  13. Transcriptome and Small RNAome Dynamics during a Resistant and Susceptible Interaction between Cucumber and Downy Mildew

    Directory of Open Access Journals (Sweden)

    Alyssa Burkhardt

    2016-03-01

    Full Text Available Cucumber ( L. downy mildew, caused by the obligate oomycete pathogen (Berk. and Curt. Rostov., is the primary factor limiting cucumber production. Although sources of resistance have been identified, such as plant introduction line PI 197088, the genes and processes involved in mediating resistance are still unknown. In the current study, we conducted a comprehensive transcriptome and small RNAome analysis of a resistant (PI 197088 and susceptible (‘Vlaspik’ cucumber during a time course of infection using Illumina sequencing. We identified significantly differentially expressed (DE genes within and between resistant and susceptible cucumber leaves over a time course of infection. Weighted gene correlation network analyses (WGCNA created coexpression modules containing genes with unique expression patterns between Vlaspik and PI 197088. Recurring data trends indicated that resistance to cucumber downy mildew is associated with earlier response to the pathogen, hormone signaling, and regulation of nutrient supply. Candidate resistance genes were identified from multiple transcriptome analyses and literature support. Additionally, parallel sequencing of small RNAs (sRNAs from cucumber and during the infection time course was used to identify and quantify novel and existing microRNA (miRNA in both species. Predicted miRNA targets of cucumber transcripts suggest a complex interconnectedness of gene expression regulation in this plant–pathogen system. This work bioinformatically uncovered gene expression patterns involved in the mediation of or response to resistance. Herein, we provide the foundation for future work to validate candidate resistance genes and miRNA-based regulation proposed in this study.

  14. Transfer of Downy Mildew Resistance from Wild Basil (Ocimum americanum) to Sweet Basil (O. basilicum).

    Science.gov (United States)

    Ben-Naim, Yariv; Falach, Lidan; Cohen, Yigal

    2018-01-01

    Sweet basil (Ocimum basilicum) is susceptible to downy mildew caused by the oomycete foliar pathogen Peronospora belbahrii. No resistant varieties of sweet basil are commercially available. Here, we report on the transfer of resistance gene Pb1 from the highly resistant tetraploid wild basil O. americanum var. americanum (PI 500945, 2n = 4x = 48) to the tetraploid susceptible O. basilicum 'Sweet basil' (2n = 4x = 48). F1 progeny plants derived from the interspecific hybridization PI 500945 × Sweet basil were resistant, indicating that the gene controlling resistance (Pb1) is dominant, but sterile due to the genetic distance between the parents. Despite their sterility, F1 plants were pollinated with the susceptible parent and 115 first backcross generation to the susceptible parent (BCs1) embryos were rescued in vitro. The emerging BCs1 plants segregated, upon inoculation, 5:1 resistant/susceptible, suggesting that resistance in F1 was controlled by a pair of dominant genes (Pb1A and Pb1A'). Thirty-one partially fertile BCs1 plants were self-pollinated to obtain BCs1-F2 or were backcrossed to Sweet basil to obtain the second backcross generation to the susceptible parent (BCs2). In total, 1 BCs1-F2 and 22 BCs2 progenies were obtained. The BCs1-F2 progeny segregated 35:1 resistant/susceptible, as expected from a tetraploid parent with two dominant resistant genes. The 22 BCs2 progenies segregated 1:1 resistant/susceptible (for a BCs1 parent that carried one dominant gene for resistance) or 5:1 (for a BCs1 parent that carried two dominant genes for resistance) at a ratio of 4:1. The data suggest that a pair of dominant genes (Pb1A and Pb1A') residing on a two homeologous chromosomes is responsible for resistance of PI 500945 against P. belbahrii.

  15. Novel Mutations Detected in Avirulence Genes Overcoming Tomato Cf Resistance Genes in Isolates of a Japanese Population of Cladosporium fulvum.

    Directory of Open Access Journals (Sweden)

    Yuichiro Iida

    Full Text Available Leaf mold of tomato is caused by the biotrophic fungus Cladosporium fulvum which complies with the gene-for-gene system. The disease was first reported in Japan in the 1920s and has since been frequently observed. Initially only race 0 isolates were reported, but since the consecutive introduction of resistance genes Cf-2, Cf-4, Cf-5 and Cf-9 new races have evolved. Here we first determined the virulence spectrum of 133 C. fulvum isolates collected from 22 prefectures in Japan, and subsequently sequenced the avirulence (Avr genes Avr2, Avr4, Avr4E, Avr5 and Avr9 to determine the molecular basis of overcoming Cf genes. Twelve races of C. fulvum with a different virulence spectrum were identified, of which races 9, 2.9, 4.9, 4.5.9 and 4.9.11 occur only in Japan. The Avr genes in many of these races contain unique mutations not observed in races identified elsewhere in the world including (i frameshift mutations and (ii transposon insertions in Avr2, (iii point mutations in Avr4 and Avr4E, and (iv deletions of Avr4E, Avr5 and Avr9. New races have developed by selection pressure imposed by consecutive introductions of Cf-2, Cf-4, Cf-5 and Cf-9 genes in commercially grown tomato cultivars. Our study shows that molecular variations to adapt to different Cf genes in an isolated C. fulvum population in Japan are novel but overall follow similar patterns as those observed in populations from other parts of the world. Implications for breeding of more durable C. fulvum resistant varieties are discussed.

  16. Genotypic and Phenotypic Markers of Livestock-Associated Methicillin-Resistant Staphylococcus aureus CC9 in Humans.

    Science.gov (United States)

    Ye, Xiaohua; Wang, Xiaolin; Fan, Yanping; Peng, Yang; Li, Ling; Li, Shunming; Huang, Jingya; Yao, Zhenjiang; Chen, Sidong

    2016-07-01

    Use of antimicrobials in industrial food animal production is associated with the presence of multidrug-resistant Staphylococcus aureus among animals and humans. The livestock-associated (LA) methicillin-resistant S. aureus (MRSA) clonal complex 9 (CC9) is associated with animals and related workers in Asia. This study aimed to explore the genotypic and phenotypic markers of LA-MRSA CC9 in humans. We conducted a cross-sectional study of livestock workers and controls in Guangdong, China. The study participants responded to a questionnaire and provided a nasal swab for S. aureus analysis. The resulting isolates were assessed for antibiotic susceptibility, multilocus sequence type, and immune evasion cluster (IEC) genes. Livestock workers had significantly higher rates of S. aureus CC9 (odds ratio [OR] = 30.98; 95% confidence interval [CI], 4.06 to 236.39) and tetracycline-resistant S. aureus (OR = 3.26; 95% CI, 2.12 to 5.00) carriage than controls. All 19 S. aureus CC9 isolates from livestock workers were MRSA isolates and also exhibited the characteristics of resistance to several classes of antibiotics and absence of the IEC genes. Notably, the interaction analyses indicated phenotype-phenotype (OR = 525.7; 95% CI, 60.0 to 4,602.1) and gene-environment (OR = 232.3; 95% CI, 28.7 to 1,876.7) interactions associated with increased risk for livestock-associated S. aureus CC9 carriage. These findings suggest that livestock-associated S. aureus and MRSA (CC9, IEC negative, and tetracycline resistant) in humans are associated with occupational livestock contact, raising questions about the potential for occupational exposure to opportunistic S. aureus This study adds to existing knowledge by giving insight into the genotypic and phenotypic markers of LA-MRSA. Our findings suggest that livestock-associated S. aureus and MRSA (CC9, IEC negative, and tetracycline resistant) in humans are associated with occupational livestock contact. Future studies should direct more

  17. Identification of acquired antimicrobial resistance genes

    DEFF Research Database (Denmark)

    Zankari, Ea; Hasman, Henrik; Cosentino, Salvatore

    2012-01-01

    ObjectivesIdentification of antimicrobial resistance genes is important for understanding the underlying mechanisms and the epidemiology of antimicrobial resistance. As the costs of whole-genome sequencing (WGS) continue to decline, it becomes increasingly available in routine diagnostic laborato......ObjectivesIdentification of antimicrobial resistance genes is important for understanding the underlying mechanisms and the epidemiology of antimicrobial resistance. As the costs of whole-genome sequencing (WGS) continue to decline, it becomes increasingly available in routine diagnostic...... laboratories and is anticipated to substitute traditional methods for resistance gene identification. Thus, the current challenge is to extract the relevant information from the large amount of generated data.MethodsWe developed a web-based method, ResFinder that uses BLAST for identification of acquired...... antimicrobial resistance genes in whole-genome data. As input, the method can use both pre-assembled, complete or partial genomes, and short sequence reads from four different sequencing platforms. The method was evaluated on 1862 GenBank files containing 1411 different resistance genes, as well as on 23 de...

  18. Rapid selection of Plasmodium falciparum chloroquine resistance transporter gene and multidrug resistance gene-1 haplotypes associated with past chloroquine and present artemether-lumefantrine use in Inhambane District, southern Mozambique

    DEFF Research Database (Denmark)

    Thomsen, Thomas T; Madsen, Laura B; Hansson, Helle H

    2013-01-01

    Chloroquine (CQ) use in Mozambique was stopped in 2002 and artemether-lumefantrine (AL) was implemented in 2008. In light of no use of CQ and extensive use of AL, we determined the frequency of molecular markers of Plasmodium falciparum drug resistance/tolerance to CQ and AL in persons living...... in Linga-Linga, an isolated peninsula and in Furvela village, which is located 8 km inland. The P. falciparum chloroquine resistance transporter gene CVMNK wild type increased in frequency from 43.9% in 2009 to 66.4% in 2010 (P = 0.001), and combined P. falciparum multidrug resistance gene 1 N86-184F-D1246...... haplotype increased significantly between years (P = 0.039). The combination of P. falciparum chloroquine resistance transporter gene CVMNK and P. falciparum multidrug resistance gene NFD increased from 24.3% (2009) to 45.3% in (2010, P = 0.017). The rapid changes observed may largely be caused by decreased...

  19. Observation of an Anomalous Line Shape of the eta 'pi(+)pi(-) Mass Spectrum near the p(p)over-bar Mass Threshold in J/psi -> gamma eta 'pi(+)pi(-)

    NARCIS (Netherlands)

    Ablikim, M.; Achasov, M. N.; Ahmed, S.; Ai, X. C.; Albayrak, O.; Albrecht, M.; Ambrose, D. J.; Amoroso, A.; An, F. F.; An, Q.; Bai, J. Z.; Ferroli, R. Baldini; Ban, Y.; Bennett, D. W.; Bennett, J. V.; Berger, N.; Bertani, M.; Bettoni, D.; Bian, J. M.; Bianchi, F.; Boger, E.; Boyko, I.; Briere, R. A.; Cai, H.; Cai, X.; Cakir, O.; Calcaterra, A.; Cao, G. F.; Cetin, S. A.; Chang, J. F.; Chelkov, G.; Chen, G.; Chen, H. S.; Chen, H. Y.; Chen, J. C.; Chen, M. L.; Chen, S.; Chen, S. J.; Chen, X.; Chen, X. R.; Chen, Y. B.; Cheng, H. P.; Chu, X. K.; Cibinetto, G.; Dai, H. L.; Dai, J. P.; Dbeyssi, A.; Dedovich, D.; Deng, Z. Y.; Denig, A.; Denysenko, I.; Destefanis, M.; De Mori, F.; Ding, Y.; Dong, C.; Dong, J.; Dong, L. Y.; Dong, M. Y.; Dou, Z. L.; Du, S. X.; Duan, P. F.; Fan, J. Z.; Fang, J.; Fang, S. S.; Fang, X.; Fang, Y.; Farinelli, R.; Fava, L.; Fedorov, O.; Feldbauer, F.; Felici, G.; Feng, C. Q.; Fioravanti, E.; Fritsch, M.; Fu, C. D.; Gao, Q.; Gao, X. L.; Gao, X. Y.; Gao, Y.; Gao, Z.; Garzia, I.; Goetzen, K.; Gong, L.; Gong, W. X.; Gradl, W.; Greco, M.; Gu, M. H.; Gu, Y. T.; Guan, Y. H.; Guo, A. Q.; Guo, L. B.; Guo, R. P.; Guo, Y.; Guo, Y. P.; Haddadi, Z.; Hafner, A.; Han, S.; Hao, X. Q.; Harris, F. A.; He, K. L.; Heinsius, F. H.; Held, T.; Heng, Y. K.; Holtmann, T.; Hou, Z. L.; Hu, C.; Hu, H. M.; Hu, J. F.; Hu, T.; Hu, Y.; Huang, G. S.; Huang, Y. P.; Huang, J. S.; Huang, X. T.; Huang, X. Z.; Huang, Y.; Huang, Z. L.; Hussain, T.; Ji, Q.; Ji, Q. P.; Ji, X. B.; Ji, X. L.; Jiang, L. W.; Jiang, X. S.; Jiang, X. Y.; Jiao, J. B.; Jiao, Z.; Jin, D. P.; Jin, S.; Johansson, T.; Julin, A.; Kalantar-Nayestanaki, N.; Kang, X. L.; Kang, X. S.; Kavatsyuk, M.; Ke, B. C.; Kiese, P.; Kliemt, R.; Kloss, B.; Kolcu, O. B.; Kopf, B.; Kornicer, M.; Kupsc, A.; Kuehn, W.; Lange, J. S.; Lara, M.; Larin, P.; Leithoff, H.; Leng, C.; Li, C.; Li, Cheng; Li, D. M.; Li, F.; Li, F. Y.; Li, G.; Li, H. B.; Li, H. J.; Li, J. C.; Li, Jin; Li, K.; Li, K.; Li, Lei; Li, P. R.; Li, Q. Y.; Li, T.; Li, W. D.; Li, W. G.; Li, X. L.; Li, X. N.; Li, X. Q.; Li, Y. B.; Li, Z. B.; Liang, H.; Liang, Y. F.; Liang, Y. T.; Liao, G. R.; Lin, D. X.; Liu, B.; Liu, B. J.; Liu, C. X.; Liu, D.; Liu, F. H.; Liu, Fang; Liu, Feng; Liu, H. B.; Liu, H. H.; Liu, H. H.; Liu, H. M.; Liu, J.; Liu, J. B.; Liu, J. P.; Liu, J. Y.; Liu, K.; Liu, K. Y.; Liu, L. D.; Liu, P. L.; Liu, Q.; Liu, S. B.; Liu, X.; Liu, Y. B.; Liu, Y. Y.; Liu, Z. A.; Liu, Zhiqing; Loehner, H.; Lou, X. C.; Lu, H. J.; Lu, J. G.; Lu, Y.; Lu, Y. P.; Luo, C. L.; Luo, M. X.; Luo, T.; Luo, X. L.; Lyu, X. R.; Ma, F. C.; Ma, H. L.; Ma, L. L.; Ma, M. M.; Ma, Q. M.; Ma, T.; Ma, X. N.; Ma, X. Y.; Ma, Y. M.; Maas, F. E.; Maggiora, M.; Malik, Q. A.; Mao, Y. J.; Mao, Z. P.; Marcello, S.; Messchendorp, J. G.; Mezzadri, G.; Min, J.; Min, T. J.; Mitchell, R. E.; Mo, X. H.; Mo, Y. J.; Morales, C. Morales; Muchnoi, N. Yu.; Muramatsu, H.; Musiol, P.; Nefedov, Y.; Nerling, F.; Nikolaev, I. B.; Ning, Z.; Nisar, S.; Niu, S. L.; Niu, X. Y.; Olsen, S. L.; Ouyang, Q.; Pacetti, S.; Pan, Y.; Patteri, P.; Pelizaeus, M.; Peng, H. P.; Peters, K.; Pettersson, J.; Ping, J. L.; Ping, R. G.; Poling, R.; Prasad, V.; Qi, H. R.; Qi, M.; Qian, S.; Qiao, C. F.; Qin, L. Q.; Qin, N.; Qin, X. S.; Qin, Z. H.; Qiu, J. F.; Rashid, K. H.; Redmer, C. F.; Ripka, M.; Rong, G.; Rosner, C. H.; Ruan, X. D.; Sarantsev, A.; Savrie, M.; Schnier, C.; Schoenning, K.; Schumann, S.; Shan, W.; Shao, M.; Shen, C. P.; Shen, P. X.; Shen, X. Y.; Sheng, H. Y.; Shi, M.; Song, W. M.; Song, X. Y.; Sosio, S.; Spataro, S.; Sun, G. X.; Sun, J. F.; Sun, S. S.; Sun, X. H.; Sun, Y. J.; Sun, Y. Z.; Sun, Z. J.; Sun, Z. T.; Tang, C. J.; Tang, X.; Tapan, I.; Thorndike, E. H.; Tiemens, M.; Uman, I.; Varner, G. S.; Wang, B.; Wang, B. L.; Wang, D.; Wang, D. Y.; Wang, K.; Wang, L. L.; Wang, L. S.; Wang, M.; Wang, P.; Wang, P. L.; Wang, S. G.; Wang, W.; Wang, W. P.; Wang, X. F.; Wang, Y.; Wang, Y. D.; Wang, Y. F.; Wang, Y. Q.; Wang, Z.; Wang, Z. G.; Wang, Z. H.; Wang, Z. Y.; Wang, Z. Y.; Weber, T.; Wei, D. H.; Wei, J. B.; Weidenkaff, P.; Wen, S. P.; Wiedner, U.; Wolke, M.; Wu, L. H.; Wu, L. J.; Wu, Z.; Xia, L.; Xia, L. G.; Xia, Y.; Xiao, D.; Xiao, H.; Xiao, Z. J.; Xie, Y. G.; Xiu, Q. L.; Xu, G. F.; Xu, J. J.; Xu, L.; Xu, Q. J.; Xu, Q. N.; Xu, X. P.; Yan, L.; Yan, W. B.; Yan, W. C.; Yan, Y. H.; Yang, H. J.; Yang, H. X.; Yang, L.; Yang, Y. X.; Ye, M.; Ye, M. H.; Yin, J. H.; Yu, B. X.; Yu, C. X.; Yu, J. S.; Yuan, C. Z.; Yuan, W. L.; Yuan, Y.; Yuncu, A.; Zafar, A. A.; Zallo, A.; Zeng, Y.; Zeng, Z.; Zhang, B. X.; Zhang, B. Y.; Zhang, C.; Zhang, C. C.; Zhang, D. H.; Zhang, H. H.; Zhang, H. Y.; Zhang, J.; Zhang, J. J.; Zhang, J. L.; Zhang, J. Q.; Zhang, J. W.; Zhang, J. Y.; Zhang, J. Z.; Zhang, K.; Zhang, L.; Zhang, S. Q.; Zhang, X. Y.; Zhang, Y.; Zhang, Y. H.; Zhang, Y. N.; Zhang, Y. T.; Zhang, Yu; Zhang, Z. H.; Zhang, Z. P.; Zhang, Z. Y.; Zhao, G.; Zhao, J. W.; Zhao, J. Y.; Zhao, J. Z.; Zhao, Lei; Zhao, Ling; Zhao, M. G.; Zhao, Q.; Zhao, Q. W.; Zhao, S. J.; Zhao, T. C.; Zhao, Y. B.; Zhao, Z. G.; Zhemchugov, A.; Zheng, B.; Zheng, J. P.; Zheng, W. J.; Zheng, Y. H.; Zhong, B.; Zhou, L.; Zhou, X.; Zhou, X. K.; Zhou, X. R.; Zhou, X. Y.; Zhu, K.; Zhu, K. J.; Zhu, S.; Zhu, S. H.; Zhu, X. L.; Zhu, Y. C.; Zhu, Y. S.; Zhu, Z. A.; Zhuang, J.; Zotti, L.; Zou, B. S.; Zou, J. H.

    2016-01-01

    Using 1.09 x 10(9) J/psi events collected by the BESIII experiment in 2012, we study the J / psi -> gamma eta'pi(+)pi(-) process and observe a significant abrupt change in the slope of the eta'pi(+)pi(-) invariant mass distribution at the proton-antiproton (p (p) over bar) mass threshold. We use two

  20. Cisplatin induces expression of drug resistance-related genes through c-jun N-terminal kinase pathway in human lung cancer cells.

    Science.gov (United States)

    Xu, Li; Fu, Yingya; Li, Youlun; Han, Xiaoli

    2017-08-01

    Change of multidrug resistance-related genes (e.g., lung resistance protein, LRP) and overexpression of anti-apoptotic genes (Bcl-2, Bcl-Xl, XIAP, Survivin) are responsible for cisplatin resistance. In our study, we investigated the mechanism by which cisplatin induces LRP, Bcl-2, Bcl-xL, XIAP, and Survivin expression in human lung adenocarcinoma A549 cells and human H446 small cell lung cancer cells at mRNA and protein levels. In our study, cell proliferation was assessed with CCK-8 assays, and cell apoptosis was assessed with flow cytometric analysis and Annexin-V/PI staining. qPCR was used to complete RNA experiments. Protein expression was assessed with Western blotting. Cisplatin increased Bcl-2, LRP, and Survivin expression, but decreased Bcl-xL and XIAP expression in a dose-dependent manner. Preincubation with JNK-specific inhibitor, SP600125, significantly inhibited these genes' expression at mRNA and protein levels, enhanced chemosensitivity of lung cancer cells to cisplatin, and promoted cisplatin-induced apoptosis. Our data suggest that the JNK signaling pathway plays an important role in cisplatin resistance. Lung resistance protein (LRP) and anti-apoptotic genes (Bcl-2, Bcl-Xl, XIAP, Survivin) are involved in the process. The results reminded us of a novel therapy target for lung cancer treatment.

  1. Survival of Antibiotic Resistant Bacteria and Horizontal Gene Transfer Control Antibiotic Resistance Gene Content in Anaerobic Digesters.

    Science.gov (United States)

    Miller, Jennifer H; Novak, John T; Knocke, William R; Pruden, Amy

    2016-01-01

    Understanding fate of antibiotic resistant bacteria (ARB) vs. their antibiotic resistance genes (ARGs) during wastewater sludge treatment is critical in order to reduce the spread of antibiotic resistance through process optimization. Here, we spiked high concentrations of tetracycline-resistant bacteria, isolated from mesophilic (Iso M1-1-a Pseudomonas sp.) and thermophilic (Iso T10-a Bacillus sp.) anaerobic digested sludge, into batch digesters and monitored their fate by plate counts and quantitative polymerase chain reaction (QPCR) of their corresponding tetracycline ARGs. In batch studies, spiked ARB plate counts returned to baseline (thermophilic) or 1-log above baseline (mesophilic) while levels of the ARG present in the spiked isolate [tet(G)] remained high in mesophilic batch reactors. To compare results under semi-continuous flow conditions with natural influent variation, tet(O), tet(W), and sul1 ARGs, along with the intI1 integrase gene, were monitored over a 9-month period in the raw feed sludge and effluent sludge of lab-scale thermophilic and mesophilic anaerobic digesters. sul1 and intI1 in mesophilic and thermophilic digesters correlated positively (Spearman rho = 0.457-0.829, P < 0.05) with the raw feed sludge. There was no correlation in tet(O) or tet(W) ratios in raw sludge and mesophilic digested sludge or thermophilic digested sludge (Spearman rho = 0.130-0.486, P = 0.075-0.612). However, in the thermophilic digester, the tet(O) and tet(W) ratios remained consistently low over the entire monitoring period. We conclude that the influent sludge microbial composition can influence the ARG content of a digester, apparently as a result of differential survival or death of ARBs or horizontal gene transfer of genes between raw sludge ARBs and the digester microbial community. Notably, mesophilic digestion was more susceptible to ARG intrusion than thermophilic digestion, which may be attributed to a higher rate of ARB survival and/or horizontal gene

  2. Production of {pi}{sup 0}{pi}{sup 0} and {pi}{sup +}{pi}{sup +} pairs in proton-proton collisions

    Energy Technology Data Exchange (ETDEWEB)

    Skorodko, Tatiana

    2009-07-17

    The {pi}{sup 0}{pi}{sup 0} production in proton-proton collisions has been measured in the energy range from threshold up to 1.3 GeV using the WASA 4{pi} detector setup with an internal pellet target at the CELSIUS storage ring in Uppsala. In addition the {pi}{sup +}{pi}{sup +} production has been measured at an incident energy of 1.1 GeV. The {pi}{sup 0}{pi}{sup 0} and {pi}{sup +}{pi}{sup +} data taken at WASA constitute the first exclusively measured samples of solid statistics in the considered energy range. Total and differential cross sections for the pp{yields}pp{pi}{sup 0}{pi}{sup 0} and pp{yields}nn{pi}{sup +}{pi}{sup +} reactions are systematically compared to the Valencia model predictions. At incident energies close to threshold, i.e. up to 0.9 GeV, the {pi}{sup 0}{pi}{sup 0} data can be successfully explained by excitation and decay of the Roper resonance. Its direct decay into the N{sigma} channel is found to be by far the dominating two-pion decay process. in favor of a monopole excitation of the Roper resonance. At energy T{sub p}>1 GeV, i.e. in the energy region, which is beyond the Roper excitation but at the onset of {delta}{delta} excitation, a behavior is observed which is different from the theoretical prediction both in differential and total cross sections. The differential cross sections for {pi}{sup 0}{pi}{sup 0} channel in the {delta}{delta} region can be described, if the special configuration ({delta}{delta}){sub 0} is assumed. Moreover, the {pi}{sup 0}{pi}{sup 0} data exhibit a small systematic low-mass enhancement in the {pi}{sup 0}{pi}{sup 0} invariant mass spectrum. The total pp{pi}{sup 0}{pi}{sup 0} cross sections fall behind theoretical predictions, whereas the nn{pi}{sup +}{pi}{sup +} cross section is a factor of five larger that expected. A model-unconstrained isospin decomposition of the total cross sections points to a s-channel-like energy dependence of the Roper excitation as well as to a significant contribution of an

  3. Characterization and Mapping of Leaf Rust and Stripe Rust Resistance Loci in Hexaploid Wheat Lines UC1110 and PI610750 under Mexican Environments.

    Science.gov (United States)

    Lan, Caixia; Hale, Iago L; Herrera-Foessel, Sybil A; Basnet, Bhoja R; Randhawa, Mandeep S; Huerta-Espino, Julio; Dubcovsky, Jorge; Singh, Ravi P

    2017-01-01

    Growing resistant wheat varieties is a key method of minimizing the extent of yield losses caused by the globally important wheat leaf rust (LR) and stripe rust (YR) diseases. In this study, a population of 186 F 8 recombinant inbred lines (RILs) derived from a cross between a synthetic wheat derivative (PI610750) and an adapted common wheat line (cv. "UC1110") were phenotyped for LR and YR response at both seedling and adult plant stages over multiple seasons. Using a genetic linkage map consisting of single sequence repeats and diversity arrays technology markers, in combination with inclusive composite interval mapping analysis, we detected a new LR adult plant resistance (APR) locus, QLr.cim-2DS , contributed by UC1110. One co-located resistance locus to both rusts, QLr.cim-3DC/QYr.cim-3DC , and the known seedling resistance gene Lr26 were also mapped. QLr.cim-2DS and QLr.cim-3DC showed a marginally significant interaction for LR resistance in the adult plant stage. In addition, two previously reported YR APR loci, QYr.ucw-3BS and Yr48 , were found to exhibit stable performances in rust environments in both Mexico and the United States and showed a highly significant interaction in the field. Yr48 was also observed to confer intermediate seedling resistance against Mexican YR races, thus suggesting it should be re-classified as an all-stage resistance gene. We also identified 5 and 2 RILs that possessed all detected YR and LR resistance loci, respectively. With the closely linked molecular markers reported here, these RILs could be used as donors for multiple resistance loci to both rusts in wheat breeding programs.

  4. A measurement of the ratio of branching fractions: $\\frac{\\mathcal{B}(B^{\\pm}\\rightarrow D K^{\\pm})}{\\mathcal{B}(B^{\\pm}\\rightarrow D\\pi^{\\pm})}$ for $D\\rightarrow K\\pi$, $KK$, $K\\pi\\pi\\pi$ and $K^0_S\\pi\\pi$

    CERN Document Server

    The LHCb Collaboration

    2011-01-01

    Using the 36.5~pb$^{-1}$ of data collected by the LHCb experiment in 2010, the ratio of two $B_u$ hadronic branching fractions: ${\\cal B}(B^{\\pm}\\rightarrow D K^{\\pm})\\ /\\ {\\cal B}(B^{\\pm}\\rightarrow D \\pi^{\\pm})$ is measured for events in which the $D$ meson is reconstructed in one of four final states. In the Cabibbo-favoured decays $D^0\\rightarrow K^{-}\\pi^{+}$ and $D^{0}\\rightarrow K^{-}\\pi^{+}\\pi^{-}\\pi^{+}$, this ratio is measured as $(6.30\\pm0.38\\pm0.40)\\%$. It is determined to be $(9.31\\pm1.89\\pm0.53)\\%$ in the $CP$ eigenstate mode $D\\rightarrow K^{+} K^{-}$ and $(12\\,^{+6}_{-5}\\pm1)\\%$ in the $D\\rightarrow K^0_{\\rm\\scriptscriptstyle S}\\pi^{+}\\pi^{-}$ channel. From this work, two observables are measured: \\begin{eqnarray*} R_{CP+} &=& 1.48 \\pm 0.31 (stat.) \\pm 0.12 (syst.)\\\\ A_{CP+} &=& 0.07 \\pm 0.18 (stat.) \\pm 0.07 (syst.) \\end{eqnarray*}

  5. Mapping resistance to the Ug99 race group of the stem rust pathogen in a spring wheat landrace.

    Science.gov (United States)

    Babiker, E M; Gordon, T C; Chao, S; Newcomb, M; Rouse, M N; Jin, Y; Wanyera, R; Acevedo, M; Brown-Guedira, G; Williamson, S; Bonman, J M

    2015-04-01

    A new gene for Ug99 resistance from wheat landrace PI 374670 was detected on the long arm of chromosome 7A. Wheat landrace PI 374670 has seedling and field resistance to stem rust caused by Puccinia graminis f. sp tritici Eriks. & E. Henn (Pgt) race TTKSK. To elucidate the inheritance of resistance, 216 BC1F2 families, 192 double haploid (DH) lines, and 185 recombinant inbred lines (RILs) were developed by crossing PI 374670 and the susceptible line LMPG-6. The parents and progeny were evaluated for seedling resistance to Pgt races TTKSK, MCCFC, and TPMKC. The DH lines were tested in field stem rust nurseries in Kenya and Ethiopia. The DH lines were genotyped with the 90K wheat iSelect SNP genotyping platform. Goodness-of-fit tests indicated that a single dominant gene in PI 374670 conditioned seedling resistance to the three Pgt races. The seedling resistance locus mapped to the long arm of chromosome 7A and this result was verified in the RIL population screened with the flanking SNP markers using KASP assays. In the same region, a major QTL for field resistance was detected in a 7.7 cM interval and explained 34-54 and 29-36% of the variation in Kenya and Ethiopia, respectively. Results from tests with specific Pgt races and the csIH81 marker showed that the resistance was not due to Sr22. Thus, a new stem rust resistance gene or allele, either closely linked or allelic to Sr15, is responsible for the seedling and field resistance of PI 374670 to Ug99.

  6. Multidrug-Resistant CTX-M-(15, 9, 2)- and KPC-2-Producing Enterobacter hormaechei and Enterobacter asburiae Isolates Possessed a Set of Acquired Heavy Metal Tolerance Genes Including a Chromosomal sil Operon (for Acquired Silver Resistance).

    Science.gov (United States)

    Andrade, Leonardo N; Siqueira, Thiago E S; Martinez, Roberto; Darini, Ana Lucia C

    2018-01-01

    Bacterial resistance to antibiotics is concern in healthcare-associated infections. On the other hand, bacterial tolerance to other antimicrobials, like heavy metals, has been neglected and underestimated in hospital pathogens. Silver has long been used as an antimicrobial agent and it seems to be an important indicator of heavy metal tolerance. To explore this perspective, we searched for the presence of acquired silver resistance genes ( sil operon: silE, silS, silR, silC, silF, silB, silA , and silP ) and acquired extended-spectrum cephalosporin and carbapenem resistance genes ( bla CTX-M and bla KPC ) in Enterobacter cloacae Complex (EcC) ( n = 27) and Enterobacter aerogenes ( n = 8) isolated from inpatients at a general hospital. Moreover, the genetic background of the silA (silver-efflux pump) and the presence of other acquired heavy metal tolerance genes, pcoD (copper-efflux pump), arsB (arsenite-efflux pump), terF (tellurite resistance protein), and merA (mercuric reductase) were also investigated. Outstandingly, 21/27 (78%) EcC isolates harbored silA gene located in the chromosome. Complete sil operon was found in 19/21 silA -positive EcC isolates. Interestingly, 8/20 (40%) E. hormaechei and 5/6 (83%) E. asburiae co-harbored silA/pcoD genes and bla CTX-M-(15,2,or9) and/or bla KPC-2 genes. Frequent occurrences of arsB, terF , and merA genes were detected, especially in silA/pcoD -positive, multidrug-resistant (MDR) and/or CTX-M-producing isolates. Our study showed co-presence of antibiotic and heavy metal tolerance genes in MDR EcC isolates. In our viewpoint, there are few studies regarding to bacterial heavy metal tolerance and we call attention for more investigations and discussion about this issue in different hospital pathogens.

  7. Multidrug-Resistant CTX-M-(15, 9, 2- and KPC-2-Producing Enterobacter hormaechei and Enterobacter asburiae Isolates Possessed a Set of Acquired Heavy Metal Tolerance Genes Including a Chromosomal sil Operon (for Acquired Silver Resistance

    Directory of Open Access Journals (Sweden)

    Leonardo N. Andrade

    2018-03-01

    Full Text Available Bacterial resistance to antibiotics is concern in healthcare-associated infections. On the other hand, bacterial tolerance to other antimicrobials, like heavy metals, has been neglected and underestimated in hospital pathogens. Silver has long been used as an antimicrobial agent and it seems to be an important indicator of heavy metal tolerance. To explore this perspective, we searched for the presence of acquired silver resistance genes (sil operon: silE, silS, silR, silC, silF, silB, silA, and silP and acquired extended-spectrum cephalosporin and carbapenem resistance genes (blaCTX−M and blaKPC in Enterobacter cloacae Complex (EcC (n = 27 and Enterobacter aerogenes (n = 8 isolated from inpatients at a general hospital. Moreover, the genetic background of the silA (silver-efflux pump and the presence of other acquired heavy metal tolerance genes, pcoD (copper-efflux pump, arsB (arsenite-efflux pump, terF (tellurite resistance protein, and merA (mercuric reductase were also investigated. Outstandingly, 21/27 (78% EcC isolates harbored silA gene located in the chromosome. Complete sil operon was found in 19/21 silA-positive EcC isolates. Interestingly, 8/20 (40% E. hormaechei and 5/6 (83% E. asburiae co-harbored silA/pcoD genes and blaCTX−M−(15,2,or9 and/or blaKPC−2 genes. Frequent occurrences of arsB, terF, and merA genes were detected, especially in silA/pcoD-positive, multidrug-resistant (MDR and/or CTX-M-producing isolates. Our study showed co-presence of antibiotic and heavy metal tolerance genes in MDR EcC isolates. In our viewpoint, there are few studies regarding to bacterial heavy metal tolerance and we call attention for more investigations and discussion about this issue in different hospital pathogens.

  8. Retail ready-to-eat food as a potential vehicle for Staphylococcus spp. harboring antibiotic resistance genes.

    Science.gov (United States)

    Chajęcka-Wierzchowska, Wioleta; Zadernowska, Anna; Nalepa, Beata; Sierpińska, Magda; Laniewska-Trokenheim, Lucja

    2014-06-01

    Ready-to-eat (RTE) food, which does not need thermal processing before consumption, could be a vehicle for the spread of antibiotic-resistant microorganisms. As part of general microbiological safety checks, staphylococci are routinely enumerated in these kinds of foods. However, the presence of antibiotic-resistant staphylococci in RTE food is not routinely investigated, and data are only available from a small number of studies. The present study evaluated the pheno- and genotypical antimicrobial resistance profile of Staphylococcus spp. isolated from 858 RTE foods (cheeses, cured meats, sausages, smoked fishes, salads). Of 113 strains isolated, S. aureus was the most prevalent species, followed by S. xylosus, S. saprophyticus, and S. epidermidis. More than half (54.9%) of the isolates were resistant to at least one class of tested antibiotic; of these, 35.4% of the strains were classified as multidrug resistant. Most of the isolates were resistant to cefoxitin (49.6%), followed by clindamycin (39.3%), tigecycline (27.4%), quinupristin-dalfopristin (22.2%), rifampin (20.5%), tetracycline (17.9%), and erythromycin (8.5%). All methicillin-resistant staphylococci harbored the mecA gene. Among the isolates resistant to at least one antibiotic, 38 harbored tetracycline resistance determinant tet (M), 24 harbored tet (L), and 9 harbored tet (K). Of the isolates positive for tet (M) genes, 34.2% were positive for the Tn916-Tn1545-like integrase family gene. Our results indicated that retail RTE food could be considered an important route for the transmission of antibiotic-resistant bacteria harboring multiple antibiotic resistance genes.

  9. Novel plasmids and resistance phenotypes in Yersinia pestis: unique plasmid inventory of strain Java 9 mediates high levels of arsenic resistance.

    Science.gov (United States)

    Eppinger, Mark; Radnedge, Lyndsay; Andersen, Gary; Vietri, Nicholas; Severson, Grant; Mou, Sherry; Ravel, Jacques; Worsham, Patricia L

    2012-01-01

    Growing evidence suggests that the plasmid repertoire of Yersinia pestis is not restricted to the three classical virulence plasmids. The Java 9 strain of Y. pestis is a biovar Orientalis isolate obtained from a rat in Indonesia. Although it lacks the Y. pestis-specific plasmid pMT, which encodes the F1 capsule, it retains virulence in mouse and non-human primate animal models. While comparing diverse Y. pestis strains using subtractive hybridization, we identified sequences in Java 9 that were homologous to a Y. enterocolitica strain carrying the transposon Tn2502, which is known to encode arsenic resistance. Here we demonstrate that Java 9 exhibits high levels of arsenic and arsenite resistance mediated by a novel promiscuous class II transposon, named Tn2503. Arsenic resistance was self-transmissible from Java 9 to other Y. pestis strains via conjugation. Genomic analysis of the atypical plasmid inventory of Java 9 identified pCD and pPCP plasmids of atypical size and two previously uncharacterized cryptic plasmids. Unlike the Tn2502-mediated arsenic resistance encoded on the Y. enterocolitica virulence plasmid; the resistance loci in Java 9 are found on all four indigenous plasmids, including the two novel cryptic plasmids. This unique mobilome introduces more than 105 genes into the species gene pool. The majority of these are encoded by the two entirely novel self-transmissible plasmids, which show partial homology and synteny to other enterics. In contrast to the reductive evolution in Y. pestis, this study underlines the major impact of a dynamic mobilome and lateral acquisition in the genome evolution of the plague bacterium.

  10. Novel plasmids and resistance phenotypes in Yersinia pestis: unique plasmid inventory of strain Java 9 mediates high levels of arsenic resistance.

    Directory of Open Access Journals (Sweden)

    Mark Eppinger

    Full Text Available Growing evidence suggests that the plasmid repertoire of Yersinia pestis is not restricted to the three classical virulence plasmids. The Java 9 strain of Y. pestis is a biovar Orientalis isolate obtained from a rat in Indonesia. Although it lacks the Y. pestis-specific plasmid pMT, which encodes the F1 capsule, it retains virulence in mouse and non-human primate animal models. While comparing diverse Y. pestis strains using subtractive hybridization, we identified sequences in Java 9 that were homologous to a Y. enterocolitica strain carrying the transposon Tn2502, which is known to encode arsenic resistance. Here we demonstrate that Java 9 exhibits high levels of arsenic and arsenite resistance mediated by a novel promiscuous class II transposon, named Tn2503. Arsenic resistance was self-transmissible from Java 9 to other Y. pestis strains via conjugation. Genomic analysis of the atypical plasmid inventory of Java 9 identified pCD and pPCP plasmids of atypical size and two previously uncharacterized cryptic plasmids. Unlike the Tn2502-mediated arsenic resistance encoded on the Y. enterocolitica virulence plasmid; the resistance loci in Java 9 are found on all four indigenous plasmids, including the two novel cryptic plasmids. This unique mobilome introduces more than 105 genes into the species gene pool. The majority of these are encoded by the two entirely novel self-transmissible plasmids, which show partial homology and synteny to other enterics. In contrast to the reductive evolution in Y. pestis, this study underlines the major impact of a dynamic mobilome and lateral acquisition in the genome evolution of the plague bacterium.

  11. Backward K*/sup 0/ production in the reaction pi /sup -/p to Lambda /sup 0/K/sup +/ pi /sup -/ at 9 and 12 GeV/c

    CERN Document Server

    Ferrer, A; Bouquet, B; D'Almagne, B; De Rosny, G; Nguyen, H; Petroff, P; Richard, F; Rivet, P; Roudeau, P; Rougé, A; Six, J; Treille, D; Volte, A; Yoshida, H

    1981-01-01

    The authors have analysed about 85000 fast Lambda /sup 0/ events, obtained in a fast proton triggered experiment performed at the CERN- Omega spectrometer at 9 and 12 GeV/c incident pi /sup -/ beam. Nearly 2500 Lambda /sup 0/K/sup +/ pi /sup -/ events have been isolated. They find strong production of quasi-two-body processes Lambda /sup 0/K* /sup 0/ and Sigma */sup -/K/sup +/ consistent with u-channel hyperon exchange. Results on Lambda /sup 0/ polarization, K*/sup 0/ decay parameters and differential cross sections are given for Lambda /sup 0 /K*/sup 0/(892) and Lambda /sup 0/K*/sup 0/(1430) final states. A comparison is made with the associated backward Lambda /sup 0/(1520)K* /sup 0/ production seen in the four-prong reaction pi /sup -/p to pK /sup -/K/sup +/ pi /sup -/ obtained in the same experiment. (13 refs).

  12. Mapping of stripe rust resistance gene in an Aegilops caudate introgression line in wheat and its genetic association with leaf rust resistance.

    Science.gov (United States)

    Toor, Puneet Inder; Kaur, Satinder; Bansal, Mitaly; Yadav, Bharat; Chhuneja, Parveen

    2016-12-01

    A pair of stripe rust and leaf rust resistance genes was introgressed from Aegilops caudata, a nonprogenitor diploid species with the CC genome, to cultivated wheat. Inheritance and genetic mapping of stripe rust resistance gene in backcrossrecombinant inbred line (BC-RIL) population derived from the cross of a wheat-Ae. caudata introgression line (IL) T291- 2(pau16060) with wheat cv. PBW343 is reported here. Segregation of BC-RILs for stripe rust resistance depicted a single major gene conditioning adult plant resistance (APR) with stripe rust reaction varying from TR-20MS in resistant RILs signifying the presence of some minor genes as well. Genetic association with leaf rust resistance revealed that two genes are located at a recombination distance of 13%. IL T291-2 had earlier been reported to carry introgressions on wheat chromosomes 2D, 3D, 4D, 5D, 6D and 7D. Genetic mapping indicated the introgression of stripe rust resistance gene on wheat chromosome 5DS in the region carrying leaf rust resistance gene LrAc, but as an independent introgression. Simple sequence repeat (SSR) and sequence-tagged site (STS) markers designed from the survey sequence data of 5DS enriched the target region harbouring stripe and leaf rust resistance genes. Stripe rust resistance locus, temporarily designated as YrAc, mapped at the distal most end of 5DS linked with a group of four colocated SSRs and two resistance gene analogue (RGA)-STS markers at a distance of 5.3 cM. LrAc mapped at a distance of 9.0 cM from the YrAc and at 2.8 cM from RGA-STS marker Ta5DS_2737450, YrAc and LrAc appear to be the candidate genes for marker-assisted enrichment of the wheat gene pool for rust resistance.

  13. Expression Study of Banana Pathogenic Resistance Genes

    Directory of Open Access Journals (Sweden)

    Fenny M. Dwivany

    2016-10-01

    Full Text Available Banana is one of the world's most important trade commodities. However, infection of banana pathogenic fungi (Fusarium oxysporum race 4 is one of the major causes of decreasing production in Indonesia. Genetic engineering has become an alternative way to control this problem by isolating genes that involved in plant defense mechanism against pathogens. Two of the important genes are API5 and ChiI1, each gene encodes apoptosis inhibitory protein and chitinase enzymes. The purpose of this study was to study the expression of API5 and ChiI1 genes as candidate pathogenic resistance genes. The amplified fragments were then cloned, sequenced, and confirmed with in silico studies. Based on sequence analysis, it is showed that partial API5 gene has putative transactivation domain and ChiI1 has 9 chitinase family GH19 protein motifs. Data obtained from this study will contribute in banana genetic improvement.

  14. Characterization of the sterol and phosphatidylinositol 4-phosphate binding properties of Golgi-associated OSBP-related protein 9 (ORP9.

    Directory of Open Access Journals (Sweden)

    Xinwei Liu

    Full Text Available Oxysterol binding protein (OSBP and OSBP-related proteins (ORPS have a conserved lipid-binding fold that accommodates cholesterol, oxysterols and/or phospholipids. The diversity of OSBP/ORPs and their potential ligands has complicated the analysis of transfer and signalling properties of this mammalian gene family. In this study we explored the use of the fluorescent sterol cholestatrienol (CTL to measure sterol binding by ORP9 and competition by other putative ligands. Relative to cholesterol, CTL and dehydroergosterol (DHE were poor ligands for OSBP. In contrast, both long (ORP9L and short (ORP9S variants of ORP9 rapidly extracted CTL, and to a lesser extent DHE, from liposomes. ORP9L and ORP9S also extracted [32P]phosphatidylinositol 4-phosphate (PI-4P from liposomes, which was inhibited by mutating two conserved histidine residues (HH488,489AA at the entrance to the binding pocket but not by a mutation in the lid region that inhibited cholesterol binding. Results of direct binding and competition assays showed that phosphatidylserine was poorly extracted from liposomes by ORP9 compared to CTL and PI-4P. ORP9L and PI-4P did not co-localize in the trans-Golgi/TGN of HeLa cells, and siRNA silencing of ORP9L expression did not affect PI-4P distribution in the Golgi apparatus. However, transient overexpression of ORP9L or ORP9S in CHO cells, but not the corresponding PI-4P binding mutants, prevented immunostaining of Golgi-associated PI-4P. The apparent sequestration of Golgi PI-4P by ORP9S was identified as a possible mechanism for its growth inhibitory effects. These studies identify ORP9 as a dual sterol/PI-4P binding protein that could regulate PI-4P in the Golgi apparatus.

  15. Characterization of the sterol and phosphatidylinositol 4-phosphate binding properties of Golgi-associated OSBP-related protein 9 (ORP9).

    Science.gov (United States)

    Liu, Xinwei; Ridgway, Neale D

    2014-01-01

    Oxysterol binding protein (OSBP) and OSBP-related proteins (ORPS) have a conserved lipid-binding fold that accommodates cholesterol, oxysterols and/or phospholipids. The diversity of OSBP/ORPs and their potential ligands has complicated the analysis of transfer and signalling properties of this mammalian gene family. In this study we explored the use of the fluorescent sterol cholestatrienol (CTL) to measure sterol binding by ORP9 and competition by other putative ligands. Relative to cholesterol, CTL and dehydroergosterol (DHE) were poor ligands for OSBP. In contrast, both long (ORP9L) and short (ORP9S) variants of ORP9 rapidly extracted CTL, and to a lesser extent DHE, from liposomes. ORP9L and ORP9S also extracted [32P]phosphatidylinositol 4-phosphate (PI-4P) from liposomes, which was inhibited by mutating two conserved histidine residues (HH488,489AA) at the entrance to the binding pocket but not by a mutation in the lid region that inhibited cholesterol binding. Results of direct binding and competition assays showed that phosphatidylserine was poorly extracted from liposomes by ORP9 compared to CTL and PI-4P. ORP9L and PI-4P did not co-localize in the trans-Golgi/TGN of HeLa cells, and siRNA silencing of ORP9L expression did not affect PI-4P distribution in the Golgi apparatus. However, transient overexpression of ORP9L or ORP9S in CHO cells, but not the corresponding PI-4P binding mutants, prevented immunostaining of Golgi-associated PI-4P. The apparent sequestration of Golgi PI-4P by ORP9S was identified as a possible mechanism for its growth inhibitory effects. These studies identify ORP9 as a dual sterol/PI-4P binding protein that could regulate PI-4P in the Golgi apparatus.

  16. Phenotypic and genotypic antimicrobial resistance and virulence genes of Salmonella enterica isolated from pet dogs and cats

    Science.gov (United States)

    Srisanga, Songsak; Angkititrakul, Sunpetch; Sringam, Patcharee; Le Ho, Phuong T.; Vo, An T. T.

    2017-01-01

    Salmonella enterica isolates (n = 122), including 32 serotypes from 113 dogs and 9 cats, were obtained from household dogs (n = 250) and cats (n = 50) during 2012–2015. The isolates were characterized by serotyping, antimicrobial resistance phenotyping and genotyping, and virulence gene screening. Serovars Weltevreden (15.6%) and Typhimurium (13.9%) were the most common. The majority (43%) of the isolates were multidrug resistant. The dog isolates (12.3%) harbored class 1 integrons, of which the dfrA12-aadA2 cassette was most frequent (66.7%). The only class integron in serovar Albany was located on a conjugative plasmid. Two ESBL-producing isolates (i.e., a serovar Krefeld and a serovar Enteritridis) carried blaTEM and blaCTX-M, and the blaTEM gene in both was horizontally transferred. Of the plasmid-mediated quinolone resistance genes tested, only qnrS (4.9%) was detected. Most Salmonella isolates harbored invA (100%), prgH (91.8%), and sipB (91%). Positive associations between resistance and virulence genes were observed for blaPSE-1/orgA, cmlA/spaN, tolC, and sul1/tolC (p resistance and virulence genes and that antimicrobial use in companion animals may select for the examined Salmonella virulence factors. PMID:27586467

  17. Transcriptome profiling and digital gene expression analysis of genes associated with salinity resistance in peanut

    Directory of Open Access Journals (Sweden)

    Jiongming Sui

    2018-03-01

    Full Text Available Background: Soil salinity can significantly reduce crop production, but the molecular mechanism of salinity tolerance in peanut is poorly understood. A mutant (S1 with higher salinity resistance than its mutagenic parent HY22 (S3 was obtained. Transcriptome sequencing and digital gene expression (DGE analysis were performed with leaves of S1 and S3 before and after plants were irrigated with 250 mM NaCl. Results: A total of 107,725 comprehensive transcripts were assembled into 67,738 unigenes using TIGR Gene Indices clustering tools (TGICL. All unigenes were searched against the euKaryotic Ortholog Groups (KOG, gene ontology (GO and Kyoto Encyclopedia of Genes and Genomes (KEGG databases, and these unigenes were assigned to 26 functional KOG categories, 56 GO terms, 32 KEGG groups, respectively. In total 112 differentially expressed genes (DEGs between S1 and S3 after salinity stress were screened, among them, 86 were responsive to salinity stress in S1 and/or S3. These 86 DEGs included genes that encoded the following kinds of proteins that are known to be involved in resistance to salinity stress: late embryogenesis abundant proteins (LEAs, major intrinsic proteins (MIPs or aquaporins, metallothioneins (MTs, lipid transfer protein (LTP, calcineurin B-like protein-interacting protein kinases (CIPKs, 9-cis-epoxycarotenoid dioxygenase (NCED and oleosins, etc. Of these 86 DEGs, 18 could not be matched with known proteins. Conclusion: The results from this study will be useful for further research on the mechanism of salinity resistance and will provide a useful gene resource for the variety breeding of salinity resistance in peanut. Keywords: Digital gene expression, Gene, Mutant, NaCl, Peanut (Arachis hypogaea L., RNA-seq, Salinity stress, Salinity tolerance, Soil salinity, Transcripts, Unigenes

  18. DETERMINATION OF THE SPECTRUM OF ANTIBIOTIC RESISTANCE GENES HAVE PHENOTYPIC RESISTANT STRAINS OF PARIETAL INTESTINAL MICROBIOTA IN RATS BY RT-PCR

    Directory of Open Access Journals (Sweden)

    Bukina Y.V.

    2016-06-01

    of the results of amplification was performed using the program Bio-Rad CFX Manager 3.0 under the "Guidelines on the application of Fluoropol format sets - PB." Results and discussion. During the study of 474 cultures of microorganisms - representatives of the Enterobacteriaceae family, KPC - in 7,81% and OXA-48 - in 8,44%, VIM detected in 14,14% of the strains, NDM – 8,23% in the studied crops. These genes were detected in E.coli strains (6,74%, 7,87%, 14,61%, 4,49%, respectively, from microorganisms of the genus Klebsiella (13,85%, 1,54%, 15,38% , 12,31%, Salmonella (7,03%, 10,16%, 13,28%, 8,59%, Enterobacter (4,76%, 14,29%, 15,87%, 4,76 %, Proteus (7,89%, 10,53%, 14,47%, 6,58% and Shigella (7,55%, 3,77%, 11,32%, 15,09%. In the study of Bacteroides (Bacteroides spp. Genes KPC, OXA-48, the VIM and NDM were identified in 9,86 %, 4,23%, 9,86 % and 12,68% of the strains, respectively. PCR study of 39 isolates of P.aeruginosae showed the presence of only VIM gene and only 15,38% of the cultures. In the family Enterococaceae and Peptostreptococaceae these genes were not found. According to Russian researchers have identified strains of Enterobacteriaceae only genes OXA-48 (43,7% and VIM (17,6%, and VIM gene detection rate in P.aeruginosae was 62.9%. CTX-M gene was detected in 10,97% of the strains of the family Enterobacteriaceae (Klebsiella spp. - 13,85%, Salmonella spp. - 14,6%, Enterobacter spp. - 7,93%, Proteus spp. - 6,58% , Shigella spp. - 13,21%, Bacteroidaceae - 15,49%, Peptostreptococcaceae - 6,25%. In Pseudomonas and Enterococcus CTX-M is not revealed. At the same time, according to the literature, the frequency of detection of gene CTX-M in the family Enterobacteriaceae strains circulating in the Russian Federation, in some regions reaches 100%, thus, the gene is not detected in enterococci and Pseudomonas. In Enterococcaceae phenotypically resistant strains of microorganisms of the family genes in identifying Van A and Van B 11,46% and 6,25% causing

  19. Genome-wide investigation and expression analysis suggest diverse roles and genetic redundancy of Pht1 family genes in response to Pi deficiency in tomato.

    Science.gov (United States)

    Chen, Aiqun; Chen, Xiao; Wang, Huimin; Liao, Dehua; Gu, Mian; Qu, Hongye; Sun, Shubin; Xu, Guohua

    2014-03-11

    Phosphorus (P) deficiency is one of the major nutrient stresses limiting plant growth. The uptake of P by plants is well considered to be mediated by a number of high-affinity phosphate (Pi) transporters belonging to the Pht1 family. Although the Pht1 genes have been extensively identified in several plant species, there is a lack of systematic analysis of the Pht1 gene family in any solanaceous species thus far. Here, we report the genome-wide analysis, phylogenetic evolution and expression patterns of the Pht1 genes in tomato (Solanum lycopersicum). A total of eight putative Pht1 genes (LePT1 to 8), distributed on three chromosomes (3, 6 and 9), were identified through extensive searches of the released tomato genome sequence database. Chromosomal organization and phylogenetic tree analysis suggested that the six Pht1 paralogues, LePT1/3, LePT2/6 and LePT4/5, which were assigned into three pairs with very close physical distance, were produced from recent tandem duplication events that occurred after Solanaceae splitting with other dicot families. Expression analysis of these Pht1 members revealed that except LePT8, of which the transcript was undetectable in all tissues, the other seven paralogues showed differential but partial-overlapping expression patterns. LePT1 and LePT7 were ubiquitously expressed in all tissues examined, and their transcripts were induced abundantly in response to Pi starvation; LePT2 and LePT6, the two paralogues harboring identical coding sequence, were predominantly expressed in Pi-deficient roots; LePT3, LePT4 and LePT5 were strongly activated in the roots colonized by arbuscular mycorrhizal fungi under low-P, but not high-P condition. Histochemical analysis revealed that a 1250-bp LePT3 promoter fragment and a 471-bp LePT5 promoter fragment containing the two elements, MYCS and P1BS, were sufficient to direct the GUS reporter expression in mycorrhizal roots and were limited to distinct cells harboring AM fungal structures

  20. Resistance gene candidates identified by PCR with degenerate oligonucleotide primers map to clusters of resistance genes in lettuce.

    Science.gov (United States)

    Shen, K A; Meyers, B C; Islam-Faridi, M N; Chin, D B; Stelly, D M; Michelmore, R W

    1998-08-01

    The recent cloning of genes for resistance against diverse pathogens from a variety of plants has revealed that many share conserved sequence motifs. This provides the possibility of isolating numerous additional resistance genes by polymerase chain reaction (PCR) with degenerate oligonucleotide primers. We amplified resistance gene candidates (RGCs) from lettuce with multiple combinations of primers with low degeneracy designed from motifs in the nucleotide binding sites (NBSs) of RPS2 of Arabidopsis thaliana and N of tobacco. Genomic DNA, cDNA, and bacterial artificial chromosome (BAC) clones were successfully used as templates. Four families of sequences were identified that had the same similarity to each other as to resistance genes from other species. The relationship of the amplified products to resistance genes was evaluated by several sequence and genetic criteria. The amplified products contained open reading frames with additional sequences characteristic of NBSs. Hybridization of RGCs to genomic DNA and to BAC clones revealed large numbers of related sequences. Genetic analysis demonstrated the existence of clustered multigene families for each of the four RGC sequences. This parallels classical genetic data on clustering of disease resistance genes. Two of the four families mapped to known clusters of resistance genes; these two families were therefore studied in greater detail. Additional evidence that these RGCs could be resistance genes was gained by the identification of leucine-rich repeat (LRR) regions in sequences adjoining the NBS similar to those in RPM1 and RPS2 of A. thaliana. Fluorescent in situ hybridization confirmed the clustered genomic distribution of these sequences. The use of PCR with degenerate oligonucleotide primers is therefore an efficient method to identify numerous RGCs in plants.

  1. Observation of the CP-conserving $K_{S} \\rightarrow \\pi^{+}\\pi^{- }\\pi^{0}$ decay amplitude

    CERN Document Server

    Adler, R; Angelopoulos, Angelos; Aspostolakis, A; Aslanides, Elie; Backenstoss, Gerhard; Bee, C P; Behnke, O; Benelli, A; Bennet, J; Bertin, V; Bienlein, J K; Blanc, F; Bloch, P; Bula, C; Carlson, P J; Carroll, M; Carvalho, J; Cawley, E; Charalambous, S; Chardin, G; Chertok, M B; Cody, A; Danielsson, M; Dejardin, M; Derré, J; Dodgson, M; Duclos, J; Ealet, A; Eckart, B; Eleftheriadis, C; Evangelou, I; Faravel, L; Fassnacht, P; Faure, J L; Felder, C; Ferreira-Marques, R; Fetscher, W; Fidecaro, Maria; Filipcic, A; Francis, D; Fry, J; Fuglesang, C; Gabathuler, Erwin; Gamet, R; Garreta, D; Geralis, T; Gerber, H J; Go, A; Gumplinger, P; Guyot, C; Harrison, P F; Haselden, A; Hayman, P J; Henry-Coüannier, F; Heyes, W G; Hollander, R W; Hubert, E; Jansson, K; Johner, H U; Jon-And, K; Kettle, P R; Kochowski, Claude; Kokkas, P; Kreuger, R; Lawry, T; Le Gac, R; Leimgruber, F; Liolios, A; Machado, E; Maley, P; Mandic, I; Manthos, N; Marel, Gérard; Mikuz, M; Miller, J; Montanet, François; Nakada, Tatsuya; Onofre, A; Pagels, B; Papadopoulos, I M; Pavlopoulos, P; Pelucchi, F; Pinto da Cunha, J; Policarpo, Armando; Polivka, G; Postma, H; Rickenbach, R; Roberts, B L; Rozaki, E; Ruf, T; Sacks, L; Sakelliou, L; Sanders, P; Santoni, C; Sarigiannis, K; Schäfer, M; Schaller, L A; Schietinger, T; Schopper, A; Schune, P; Soares, A; Tauscher, Ludwig; Thibault, C; Touchard, F; Touramanis, C; Triantis, F A; Tröster, D A; Van Beveren, E; van Eijk, C W E; Varner, G S; Vlachos, S; Weber, P; Wigger, O; Witzig, C; Wolter, M; Yéche, C; Zavrtanik, D; Zimmerman, D

    1996-01-01

    The interference between CP-conserving $\\ks$ and $\\kl \\rightarrow \\threepi$ decay amplitudes was observed by studying the decay rate asymmetries between initial $\\ko$ and $\\kob$ separately for the phase space regions $E_{\\mbox{\\rm \\scriptsize CM}}(\\pi^+)> E_{\\mbox{\\rm \\scriptsize CM}}(\\pi^-)$ and $E_{\\mbox{\\rm \\scriptsize CM}}(\\pi^+)< E_{\\mbox{\\rm \\scriptsize CM}}(\\pi^-)$. For the parameter $\\lambda$ we found $\\mbox{\\rm Re}(\\lambda )=0.036\\pm0.010(\\mbox{\\rm stat.}) ^{+0.002}_{-0.003} (\\mbox{\\rm syst.)}$ and $\\mbox{Im}(\\lambda)$ consistent with zero, leading for the CP-conserving $\\ks \\rightarrow \\threepi$ decay, to a branching ratio $\\mbox{\\rm B} = \\left[4.1 ^{+2.5}_{-1.9 } (\\mbox{\\rm stat.}) ^{+0.5} _{-0.6} (\\mbox{\\rm syst.)}\\right] \\times 10^{-7}$.

  2. Investigation of $K_{L,S} \\rightarrow \\pi^{+}\\pi^{-}e^{+}e^{-}$ decays

    CERN Document Server

    Lai, A; Arcidiacono, R; Barr, G; Becker, H G; Bevan, A; Biino, C; Bizzeti, A; Bocquet, G; Calvetti, M; Cartiglia, N; Casali, R; Ceccucci, Augusto; Cenci, P; Cerri, C; Cheshkov, C; Chollet, J C; Chèze, J B; Cirilli, M; Clemencic, M; Cogan, J; Collazuol, G; Contalbrigo, M; Costantini, F; Cundy, Donald C; Dalpiaz, Pietro; De Beer, M; Debu, P; Doble, Niels T; Dosanjh, R S; Duclos, J; Eppard, M; Falaleev, V P; Fantechi, R; Fayard, Louis; Fischer, G; Formica, A; Fox, H; Frabetti, P L; Gaponenko, A N; Gatignon, L; Gershon, T J; Gianoli, A; Giudici, Sergio; Gonidec, A; Gorini, B; Govi, G; Grafström, P; Granier de Cassagnac, R; Graziani, G; Hay, B; Holder, M; Holtz, K; Iacopini, E; Iconomidou-Fayard, L; Imbergamo, E; Jeitler, Manfred; Kalmus, George Ernest; Kalter, A; Kekelidze, V D; Khristov, P Z; Kleinknecht, K; Knowles, I; Koch, U; Kubischta, Werner; Köpke, L; Lazzeroni, C; Lenti, M; Lopes da Silva, P; Lubrano, P; Luitz, S; Madigozhin, D T; Maier, A; Mannelli, I; Marchetto, F; Markytan, Manfred; Marouelli, P; Marras, D; Martin, V; Martini, M; Masetti, L; Mazzucato, E; Menichetti, E; Mestvirishvili, A; Mikulec, I; Munday, D J; Nappi, A; Nassalski, J P; Needham, M D; Neuhofer, Günther; Norton, A; Ocariz, J; Olaiya, E; Palestini, S; Panzer-Steindel, B; Parker, M A; Pellmann, I A; Pepé, M; Pernicka, Manfred; Peters, A; Petrucci, F; Peyaud, B; Piccini, M; Pierazzini, G M; Potrebenikov, Yu K; Rondio, Ewa; Sacco, R; Savrié, M; Schmidt, S; Schué, Yu; Schönharting, V; Sozzi, M; Szleper, M; Tatishvili, G T; Taureg, Hans; Taurok, Anton; Turlay, René; Unal, G; Vallage, B; Velasco, M; Veltri, M; Wahl, H; Walker, A; Wanke, R; White, T O; Widhalm, L; Wingerter-Seez, I; Winhart, A; Wislicki, W; Wittgen, M; Wotton, S A; Wronka, S; Zinchenko, A I; Ziolkowski, M

    2003-01-01

    The K_L -> pi+pi-e+e- and K_S -> pi+pi-e+e- decay modes have been studied in detail using the NA48 detector at CERN SPS. Based on the data collected during the 1998 and 1999 run periods, a sample of 1162 K_L -> pi+pi-e+e- candidates has been observed with an expected background level of 36.9 events, yielding the branching ratio measurement BR(K_L -> pi+pi-e+e-)=(3.08+-0.20)x10^-7. The distribution of events in the sin\\phicos\\phi variable, where \\phi is the angle between the pi+pi- and the e+e- decay planes in the kaon centre of mass, is found to exhibit a large CP-violating asymmetry with the value A_\\phi(14.2+-3.6)%. For the K_S -> pi+pi-e+e- decay channel, 621 candidates have been identified in the 1999 data sample with an estimated background contribution of 0.7 event. The corresponding branching ratio has been determined to be BR(K_S -> pi+pi-e+e-)=(4.71+-0.32)x10^-5. The combined value of this measurement with the published 1998 result id BR(K_S -> pi+pi-e+e-)=4.69+-0.30)x10^-5. No asymmetry is observed ...

  3. Occurrence of integrons and resistance genes among sulphonamide-resistant Shigella spp. from Brazil

    DEFF Research Database (Denmark)

    Peirano, G.; Agersø, Yvonne; Aarestrup, Frank Møller

    2005-01-01

    Objectives: To determine the occurrence of class 1 and 2 integrons and antimicrobial resistance genes among sulphonamide-resistant Shigella strains isolated in Brazil during 1999-2003. Methods: Sixty-two Shigella (Shigella flexneri, n = 47 and Shigella sonnei, n = 15) were tested against 21...... antimicrobial agents. The presence of integrons classes 1 and 2 and antimicrobial resistance genes was investigated by PCR using specific primers. Results: A total of eight antimicrobial resistance profiles were identified, with the profile of resistance to sulfamethoxazole, trimethoprim, spectinomycin...... of 2214 bp harbouring a gene cassette array conferring resistance to trimethoprim, streptothricin and spectinomycin/streptomycin. The genes coding for resistance to chloramphenicol (catA1), tetracycline [tet(A) and tet(B)] and ampicillin (bla(OXA) and bla(TEM)), were detected in resistant strains...

  4. Organization of a resistance gene cluster linked to rhizomania resistance in sugar beet

    Science.gov (United States)

    Genetic resistance to rhizomania has been in use for over 40 years. Characterization of the molecular basis for susceptibility and resistance has proved challenging. Nucleotide-binding leucine-rich-repeat-containing (NB-LRR) genes have been implicated in numerous gene-for-gene resistance interaction...

  5. The Role of piRNA-Mediated Epigenetic Silencing in the Population Dynamics of Transposable Elements in Drosophila melanogaster.

    Directory of Open Access Journals (Sweden)

    Yuh Chwen G Lee

    2015-06-01

    Full Text Available The piwi-interacting RNAs (piRNA are small RNAs that target selfish transposable elements (TEs in many animal genomes. Until now, piRNAs' role in TE population dynamics has only been discussed in the context of their suppression of TE transposition, which alone is not sufficient to account for the skewed frequency spectrum and stable containment of TEs. On the other hand, euchromatic TEs can be epigenetically silenced via piRNA-dependent heterochromatin formation and, similar to the widely known "Position-effect variegation", heterochromatin induced by TEs can "spread" into nearby genes. We hypothesized that the piRNA-mediated spread of heterochromatin from TEs into adjacent genes has deleterious functional effects and leads to selection against individual TEs. Unlike previously identified deleterious effects of TEs due to the physical disruption of DNA, the functional effect we investigated here is mediated through the epigenetic influences of TEs. We found that the repressive chromatin mark, H3K9me, is elevated in sequences adjacent to euchromatic TEs at multiple developmental stages in Drosophila melanogaster. Furthermore, the heterochromatic states of genes depend not only on the number of and distance from adjacent TEs, but also on the likelihood that their nearest TEs are targeted by piRNAs. These variations in chromatin status probably have functional consequences, causing genes near TEs to have lower expression. Importantly, we found stronger selection against TEs that lead to higher H3K9me enrichment of adjacent genes, demonstrating the pervasive evolutionary consequences of TE-induced epigenetic silencing. Because of the intrinsic biological mechanism of piRNA amplification, spread of TE heterochromatin could result in the theoretically required synergistic deleterious effects of TE insertions for stable containment of TE copy number. The indirect deleterious impact of piRNA-mediated epigenetic silencing of TEs is a previously

  6. Analysis of genes involved in the PI3K/Akt pathway in radiation- and MNU-induced rat mammary carcinomas.

    Science.gov (United States)

    Showler, Kaye; Nishimura, Mayumi; Daino, Kazuhiro; Imaoka, Tatsuhiko; Nishimura, Yukiko; Morioka, Takamitsu; Blyth, Benjamin J; Kokubo, Toshiaki; Takabatake, Masaru; Fukuda, Maki; Moriyama, Hitomi; Kakinuma, Shizuko; Fukushi, Masahiro; Shimada, Yoshiya

    2017-03-01

    The PI3K/AKT pathway is one of the most important signaling networks in human breast cancer, and since it was potentially implicated in our preliminary investigations of radiation-induced rat mammary carcinomas, our aim here was to verify its role. We included mammary carcinomas induced by the chemical carcinogen 1-methyl-1-nitrosourea to determine whether any changes were radiation-specific. Most carcinomas from both groups showed activation of the PI3K/AKT pathway, but phosphorylation of AKT1 was often heterogeneous and only present in a minority of carcinoma cells. The negative pathway regulator Inpp4b was significantly downregulated in both groups, compared with in normal mammary tissue, and radiation-induced carcinomas also showed a significant decrease in Pten expression, while the chemically induced carcinomas showed a decrease in Pik3r1 and Pdk1. Significant upregulation of the positive regulators Erbb2 and Pik3ca was observed only in chemically induced carcinomas. However, no genes showed clear correlations with AKT phosphorylation levels, except in individual carcinomas. Only rare carcinomas showed mutations in PI3K/AKT pathway genes, yet these carcinomas did not exhibit stronger AKT phosphorylation. Thus, while AKT phosphorylation is a common feature of rat mammary carcinomas induced by radiation or a canonical chemical carcinogen, the mutation of key genes in the pathways or permanent changes to gene expression of particular signaling proteins do not explain the pathway activation in the advanced cancers. Although AKT signaling likely facilitates cancer development and growth in rat mammary carcinomas, it is unlikely that permanent disruption of the PI3K/AKT pathway genes is a major causal event in radiation carcinogenesis. © The Author 2016. Published by Oxford University Press on behalf of The Japan Radiation Research Society and Japanese Society for Radiation Oncology.

  7. A gene encoding maize caffeoyl-CoA O-methyltransferase confers quantitative resistance to multiple pathogens.

    Science.gov (United States)

    Yang, Qin; He, Yijian; Kabahuma, Mercy; Chaya, Timothy; Kelly, Amy; Borrego, Eli; Bian, Yang; El Kasmi, Farid; Yang, Li; Teixeira, Paulo; Kolkman, Judith; Nelson, Rebecca; Kolomiets, Michael; L Dangl, Jeffery; Wisser, Randall; Caplan, Jeffrey; Li, Xu; Lauter, Nick; Balint-Kurti, Peter

    2017-09-01

    Alleles that confer multiple disease resistance (MDR) are valuable in crop improvement, although the molecular mechanisms underlying their functions remain largely unknown. A quantitative trait locus, qMdr 9.02 , associated with resistance to three important foliar maize diseases-southern leaf blight, gray leaf spot and northern leaf blight-has been identified on maize chromosome 9. Through fine-mapping, association analysis, expression analysis, insertional mutagenesis and transgenic validation, we demonstrate that ZmCCoAOMT2, which encodes a caffeoyl-CoA O-methyltransferase associated with the phenylpropanoid pathway and lignin production, is the gene within qMdr 9.02 conferring quantitative resistance to both southern leaf blight and gray leaf spot. We suggest that resistance might be caused by allelic variation at the level of both gene expression and amino acid sequence, thus resulting in differences in levels of lignin and other metabolites of the phenylpropanoid pathway and regulation of programmed cell death.

  8. Fine Mapping of the Dominant Potyvirus Resistance Gene Pvr7 Reveals a Relationship with Pvr4 in Capsicum annuum.

    Science.gov (United States)

    Venkatesh, Jelli; An, Jeongtak; Kang, Won-Hee; Jahn, Molly; Kang, Byoung-Cheorl

    2018-01-01

    Pepper mottle virus (PepMoV) is the most common potyvirus infection of pepper plants and causes significant yield losses. The Pvr7 gene from Capsicum chinense PI159236 and the Pvr4 gene from C. annuum CM334 both have been reported to confer dominant resistance to PepMoV. The Pvr7 locus conferring resistance to PepMoV in C. annuum '9093' was previously mapped to chromosome 10. To develop a high-resolution map of the Pvr7 locus in 9093, we constructed an intraspecific F 2 mapping population consisting of 916 individuals by crossing PepMoV-resistant C. annuum '9093' and the PepMoV-susceptible C. annuum 'Jeju'. To delimit the Pvr7 target region, single-nucleotide polymorphism (SNP) markers derived from the Pvr4 region were used for genotyping the F 2 population. Molecular mapping delimited the Pvr7 locus to a physical interval of 258 kb, which was the same region as Pvr4 on chromosome 10. Three SNP markers derived from Pvr4 mapping perfectly cosegregated with PepMoV resistance. Sequencing analyses of the Pvr7 flanking markers and the Pvr4-specific gene indicated that Pvr7 and Pvr4 are the same gene. Resistance spectrum analysis of 9093 against pepper potyviruses showed that 9093 has a resistance spectrum similar to that of cultivar CM334. These combined results demonstrate that, unlike previously thought, the dominant PepMoV resistance in 9093 could be derived from C. annuum 'CM334', and that Pvr4 and Pvr7 should be considered as the same locus.

  9. Genetic and physical mapping of homologues of the virus resistance gene Rx1 and the cyst nematode resistance gene Gpa2 in potato.

    Science.gov (United States)

    Bakker, E; Butterbach, P; Rouppe van der Voort, J; van der Vossen, E; van Vliet, J; Bakker, J; Goverse, A

    2003-05-01

    Nine resistance gene homologues (RGHs) were identified in two diploid potato clones (SH and RH), with a specific primer pair based on conserved motifs in the LRR domain of the potato cyst nematode resistance gene Gpa2 and the potato virus X resistance gene Rx1. A modified AFLP method was used to facilitate the genetic mapping of the RGHs in the four haplotypes under investigation. All nine RGHs appeared to be located in the Gpa2/ Rx1 cluster on chromosome XII. Construction of a physical map using bacterial artificial chromosome (BAC) clones for both the Solanum tuberosum ssp. tuberosum and the S. tuberosum ssp. andigena haplotype of SH showed that the RGHs are located within a stretch of less than 200 kb. Sequence analysis of the RGHs revealed that they are highly similar (93 to 95%) to Gpa2 and Rx1. The sequence identities among all RGHs range from 85 to 100%. Two pairs of RGHs are identical, or nearly so (100 and 99.9%), with each member located in a different genotype. Southern-blot analysis on genomic DNA revealed no evidence for additional homologues outside the Gpa2/ Rx1 cluster on chromosome XII.

  10. Co-occurrence of colistin-resistance genes mcr-1 and mcr-3 among multidrug-resistant Escherichia coli isolated from cattle, Spain, September 2015.

    Science.gov (United States)

    Hernández, Marta; Iglesias, M Rocío; Rodríguez-Lázaro, David; Gallardo, Alejandro; Quijada, Narciso; Miguela-Villoldo, Pedro; Campos, Maria Jorge; Píriz, Segundo; López-Orozco, Gema; de Frutos, Cristina; Sáez, José Luis; Ugarte-Ruiz, María; Domínguez, Lucas; Quesada, Alberto

    2017-08-03

    Colistin resistance genes mcr-3 and mcr-1 have been detected in an Escherichia coli isolate from cattle faeces in a Spanish slaughterhouse in 2015. The sequences of both genes hybridised to same plasmid band of ca 250 kb, although colistin resistance was non-mobilisable. The isolate was producing extended-spectrum beta-lactamases and belonged to serotype O9:H10 and sequence type ST533. Here we report an mcr-3 gene detected in Europe following earlier reports from Asia and the United States. This article is copyright of The Authors, 2017.

  11. Observation of the Decay B sup+- -> pi sup+- pi sup 0 , study of B sup+- -> K sup+- pi sup 0 , and search for B sup 0 -> pi sup 0 pi sup 0

    CERN Document Server

    Roodman, A

    2003-01-01

    The present results for the branching fractions and charge asymmetries in B sup+- -> h sup+- pi sup 0 (where h sup+- = pi sup+-, K sup+-) and a search for the decay B sup 0 -> pi sup 0 pi sup 0 using a sample of approximately 88 million B(bar B) pairs collected by the BABAR detector at the PEP-II asymmetric-energy B Factor at SLAC. They measure BETA(B sup+- -> pi sup+- pi sup 0) = (5.5 sub - sub 0 sub . sub 9 sup + sup 1 sup . sup 0 +- 0.6) x 10 sup - sup 6 , where the first error is statistical and the second is systematic. The B sup+- -> pi sup+- pi sup 0 signal has a significance of 7.7 sigma including systematic uncertainties. The simultaneously measure the K sup+- pi sup 0 branching fraction to be BETA(B sup+- -> K sup+- pi sup 0) = (12.8 sub - sub 1 sub . sub 1 sup + sup 1 sup . sup 2 +- 1.0) x 10 sup - sup 6. The charge asymmetries are ALPHA subpi subsup sub+- sub ) subpi subsup 0 = -0.03 sub - sub 0 sub . sub 1 sub 7 sup + sup 0 sup . sup 1 sup 8 +- 0.02 and ALPHA subKappa subsup sub+- sub ) subpi sub...

  12. Altered expression of testis-specific genes, piRNAs, and transposons in the silkworm ovary masculinized by a W chromosome mutation

    Science.gov (United States)

    2012-01-01

    Background In the silkworm, Bombyx mori, femaleness is strongly controlled by the female-specific W chromosome. Originally, it was presumed that the W chromosome encodes female-determining gene(s), accordingly called Fem. However, to date, neither Fem nor any protein-coding gene has been identified from the W chromosome. Instead, the W chromosome is occupied with numerous transposon-related sequences. Interestingly, the silkworm W chromosome is a source of female-enriched PIWI-interacting RNAs (piRNAs). piRNAs are small RNAs of 23-30 nucleotides in length, which are required for controlling transposon activity in animal gonads. A recent study has identified a novel mutant silkworm line called KG, whose mutation in the W chromosome causes severe female masculinization. However, the molecular nature of KG line has not been well characterized yet. Results Here we molecularly characterize the KG line. Genomic PCR analyses using currently available W chromosome-specific PCR markers indicated that no large deletion existed in the KG W chromosome. Genetic analyses demonstrated that sib-crosses within the KG line suppressed masculinization. Masculinization reactivated when crossing KG females with wild type males. Importantly, the KG ovaries exhibited a significantly abnormal transcriptome. First, the KG ovaries misexpressed testis-specific genes. Second, a set of female-enriched piRNAs was downregulated in the KG ovaries. Third, several transposons were overexpressed in the KG ovaries. Conclusions Collectively, the mutation in the KG W chromosome causes broadly altered expression of testis-specific genes, piRNAs, and transposons. To our knowledge, this is the first study that describes a W chromosome mutant with such an intriguing phenotype. PMID:22452797

  13. Inactivation and Gene Expression of a Virulent WastewaterEscherichia coliStrain and the Nonvirulent CommensalEscherichia coliDSM1103 Strain upon Solar Irradiation

    KAUST Repository

    Aljassim, Nada I.; Mantilla-Calderon, David; Wang, Tiannyu; Hong, Pei-Ying

    2017-01-01

    This study examined the decay kinetics and molecular responses of two Escherichia coli strains upon solar irradiation. The first is E. coli PI-7, a virulent and antibiotic-resistant strain that was isolated from wastewater and carries the emerging NDM-1 antibiotic resistance gene. The other strain, E. coli DSM1103, displayed lower virulence and antibiotic resistance than E. coli PI-7. In a buffer solution, E. coli PI-7 displayed a longer lag phase prior to decay and a longer half-life compared with E. coli DSM1103 (6.64 ± 0.63 h and 2.85 ± 0.46 min vs 1.33 ± 0.52 h and 2.04 ± 0.36 min). In wastewater, both E. coli strains decayed slower than they did in buffer. Although solar irradiation remained effective in reducing the numbers of both strains by more than 5-log10 in <24 h, comparative genomics and transcriptomics revealed differences in the genomes and overall regulation of genes between the two E. coli strains. A wider arsenal of genes related to oxidative stress, cellular repair and protective mechanisms were upregulated in E. coli PI-7. Subpopulations of E. coli PI-7 expressed genes related to dormancy and persister cell formation during the late decay phase, which may have accounted for its prolonged persistence. Upon prolonged solar irradiation, both E. coli strains displayed upregulation of genes related to horizontal gene transfer and antibiotic resistance. Virulence functions unique to E. coli PI-7 were also upregulated. Our findings collectively indicated that, whereas solar irradiation is able to reduce total cell numbers, viable E. coli remained and expressed genes that enable survival despite solar treatment. There remains a need for heightened levels of concern regarding risks arising from the dissemination of E. coli that may remain viable in wastewater after solar irradiation.

  14. Inactivation and Gene Expression of a Virulent WastewaterEscherichia coliStrain and the Nonvirulent CommensalEscherichia coliDSM1103 Strain upon Solar Irradiation

    KAUST Repository

    Aljassim, Nada I.

    2017-03-06

    This study examined the decay kinetics and molecular responses of two Escherichia coli strains upon solar irradiation. The first is E. coli PI-7, a virulent and antibiotic-resistant strain that was isolated from wastewater and carries the emerging NDM-1 antibiotic resistance gene. The other strain, E. coli DSM1103, displayed lower virulence and antibiotic resistance than E. coli PI-7. In a buffer solution, E. coli PI-7 displayed a longer lag phase prior to decay and a longer half-life compared with E. coli DSM1103 (6.64 ± 0.63 h and 2.85 ± 0.46 min vs 1.33 ± 0.52 h and 2.04 ± 0.36 min). In wastewater, both E. coli strains decayed slower than they did in buffer. Although solar irradiation remained effective in reducing the numbers of both strains by more than 5-log10 in <24 h, comparative genomics and transcriptomics revealed differences in the genomes and overall regulation of genes between the two E. coli strains. A wider arsenal of genes related to oxidative stress, cellular repair and protective mechanisms were upregulated in E. coli PI-7. Subpopulations of E. coli PI-7 expressed genes related to dormancy and persister cell formation during the late decay phase, which may have accounted for its prolonged persistence. Upon prolonged solar irradiation, both E. coli strains displayed upregulation of genes related to horizontal gene transfer and antibiotic resistance. Virulence functions unique to E. coli PI-7 were also upregulated. Our findings collectively indicated that, whereas solar irradiation is able to reduce total cell numbers, viable E. coli remained and expressed genes that enable survival despite solar treatment. There remains a need for heightened levels of concern regarding risks arising from the dissemination of E. coli that may remain viable in wastewater after solar irradiation.

  15. A comparative study of ATPase subunit 9 (Atp9) gene between ...

    African Journals Online (AJOL)

    ATPase subunit 9 gene (Atp9) is an important functional gene in mitochondria, and is closely related with energy supply. RNA editing of atp9 gene was associated with male sterility in plants. In this study, the atp9 gene in soybeans was cloned from a soybean cytoplasmic male sterile line NJCMS2A and its maintainer line ...

  16. Molecular characterization of insulin resistance and glycolytic metabolism in the rat uterus

    Science.gov (United States)

    Zhang, Yuehui; Sun, Xue; Sun, Xiaoyan; Meng, Fanci; Hu, Min; Li, Xin; Li, Wei; Wu, Xiao-Ke; Brännström, Mats; Shao, Ruijin; Billig, Håkan

    2016-01-01

    Peripheral insulin resistance and hyperandrogenism are the primary features of polycystic ovary syndrome (PCOS). However, how insulin resistance and hyperandrogenism affect uterine function and contribute to the pathogenesis of PCOS are open questions. We treated rats with insulin alone or in combination with human chorionic gonadotropin (hCG) and showed that peripheral insulin resistance and hyperandrogenism alter uterine morphology, cell phenotype, and cell function, especially in glandular epithelial cells. These defects are associated with an aberration in the PI3K/Akt signaling pathway that is used as an indicator for the onset of insulin resistance in classical metabolic tissues. Concomitantly, increased GSK3β (Ser-9) phosphorylation and decreased ERK1/2 phosphorylation in rats treated with insulin and hCG were also observed. We also profiled the expression of glucose transporter (Glut) isoform genes in the uterus under conditions of insulin resistance and/or hyperandrogenism. Finally, we determined the expression pattern of glycolytic enzymes and intermediates during insulin resistance and hyperandrogenism in the uterus. These findings suggest that the PI3K/Akt and MAPK/ERK signaling pathways play a role in the onset of uterine insulin resistance, and they also suggest that changes in specific Glut isoform expression and alterations to glycolytic metabolism contribute to the endometrial dysfunction observed in PCOS patients. PMID:27461373

  17. Associations between Antimicrobial Resistance Phenotypes, Antimicrobial Resistance Genes, and Virulence Genes of Fecal Escherichia coli Isolates from Healthy Grow-Finish Pigs ▿

    OpenAIRE

    Rosengren, Leigh B.; Waldner, Cheryl L.; Reid-Smith, Richard J.

    2009-01-01

    Escherichia coli often carries linked antimicrobial resistance genes on transmissible genetic elements. Through coselection, antimicrobial use may select for unrelated but linked resistance or virulence genes. This study used unconditional statistical associations to investigate the relationships between antimicrobial resistance phenotypes and antimicrobial resistance genes in 151 E. coli isolates from healthy pigs. Phenotypic resistance to each drug was significantly associated with phenotyp...

  18. Dissection of Resistance Genes to Pseudomonas syringae pv. phaseolicola in UI3 Common Bean Cultivar.

    Science.gov (United States)

    González, Ana M; Godoy, Luís; Santalla, Marta

    2017-11-23

    Few quantitative trait loci have been mapped for resistance to Pseudomonas syringae pv. phaseolicola in common bean. Two F₂ populations were developed from the host differential UI3 cultivar. The objective of this study was to further characterize the resistance to races 1, 5, 7 and 9 of Psp included in UI3. Using a QTL mapping approach, 16 and 11 main-effect QTLs for pod and primary leaf resistance were located on LG10, explaining up to 90% and 26% of the phenotypic variation, respectively. The homologous genomic region corresponding to primary leaf resistance QTLs detected tested positive for the presence of resistance-associated gene cluster encoding nucleotide-binding and leucine-rich repeat (NL), Natural Resistance Associated Macrophage (NRAMP) and Pentatricopeptide Repeat family (PPR) proteins. It is worth noting that the main effect QTLs for resistance in pod were located inside a 3.5 Mb genomic region that included the Phvul.010G021200 gene, which encodes a protein that has the highest sequence similarity to the RIN4 gene of Arabidopsis, and can be considered an important candidate gene for the organ-specific QTLs identified here. These results support that resistance to Psp from UI3 might result from the immune response activated by combinations of R proteins, and suggest the guard model as an important mechanism in pod resistance to halo blight. The candidate genes identified here warrant functional studies that will help in characterizing the actual defense gene(s) in UI3 genotype.

  19. Insulin utilizes the PI 3-kinase pathway to inhibit SP-A gene expression in lung epithelial cells

    Directory of Open Access Journals (Sweden)

    Snyder Jeanne M

    2002-10-01

    Full Text Available Abstract Background It has been proposed that high insulin levels may cause delayed lung development in the fetuses of diabetic mothers. A key event in lung development is the production of adequate amounts of pulmonary surfactant. Insulin inhibits the expression of surfactant protein A (SP-A, the major surfactant-associated protein, in lung epithelial cells. In the present study, we investigated the signal transduction pathways involved in insulin inhibition of SP-A gene expression. Methods H441 cells, a human lung adenocarcinoma cell line, or human fetal lung explants were incubated with or without insulin. Transcription run-on assays were used to determine SP-A gene transcription rates. Northern blot analysis was used to examine the effect of various signal transduction inhibitors on SP-A gene expression. Immunoblot analysis was used to evaluate the levels and phosphorylation states of signal transduction protein kinases. Results Insulin decreased SP-A gene transcription in human lung epithelial cells within 1 hour. Insulin did not affect p44/42 mitogen-activated protein kinase (MAPK phosphorylation and the insulin inhibition of SP-A mRNA levels was not affected by PD98059, an inhibitor of the p44/42 MAPK pathway. In contrast, insulin increased p70 S6 kinase Thr389 phosphorylation within 15 minutes. Wortmannin or LY294002, both inhibitors of phosphatidylinositol 3-kinase (PI 3-kinase, or rapamycin, an inhibitor of the activation of p70 S6 kinase, a downstream effector in the PI 3-kinase pathway, abolished or attenuated the insulin-induced inhibition of SP-A mRNA levels. Conclusion Insulin inhibition of SP-A gene expression in lung epithelial cells probably occurs via the rapamycin-sensitive PI 3-kinase signaling pathway.

  20. Genetic analysis and location of a resistance gene to Puccinia ...

    Indian Academy of Sciences (India)

    Administrator

    the wheat production in Asia, North America, Europe and other wheat growing areas. China is the largest ..... A history of wheat breeding. ... and Yr65 for stripe rust resistance in hexaploid derivatives of durum wheat accessions PI 331260.

  1. Analysis of the $\\pi^+ \\pi^- \\pi^+ \\pi-$ and $\\pi^+ \\pi^{0}\\pi^- \\pi^{0}$ final states in quasi-real two-photon collisions at LEP

    CERN Document Server

    Achard, P.; Aguilar-Benitez, M.; Alcaraz, J.; Alemanni, G.; Allaby, J.; Aloisio, A.; Alviggi, M.G.; Anderhub, H.; Andreev, Valery P.; Anselmo, F.; Arefiev, A.; Azemoon, T.; Aziz, T.; Bagnaia, P.; Bajo, A.; Baksay, G.; Baksay, L.; Baldew, S.V.; Banerjee, S.; Banerjee, Sw.; Barczyk, A.; Barillere, R.; Bartalini, P.; Basile, M.; Batalova, N.; Battiston, R.; Bay, A.; Becattini, F.; Becker, U.; Behner, F.; Bellucci, L.; Berbeco, R.; Berdugo, J.; Berges, P.; Bertucci, B.; Betev, B.L.; Biasini, M.; Biglietti, M.; Biland, A.; Blaising, J.J.; Blyth, S.C.; Bobbink, G.J.; Bohm, A.; Boldizsar, L.; Borgia, B.; Bottai, S.; Bourilkov, D.; Bourquin, M.; Braccini, S.; Branson, J.G.; Brochu, F.; Burger, J.D.; Burger, W.J.; Cai, X.D.; Capell, M.; Cara Romeo, G.; Carlino, G.; Cartacci, A.; Casaus, J.; Cavallari, F.; Cavallo, N.; Cecchi, C.; Cerrada, M.; Chamizo, M.; Chang, Y.H.; Chemarin, M.; Chen, A.; Chen, G.; Chen, G.M.; Chen, H.F.; Chen, H.S.; Chiefari, G.; Cifarelli, L.; Cindolo, F.; Clare, I.; Clare, R.; Coignet, G.; Colino, N.; Costantini, S.; de la Cruz, B.; Cucciarelli, S.; de Asmundis, R.; Deglon, P.; Debreczeni, J.; Degre, A.; Dehmelt, K.; Deiters, K.; della Volpe, D.; Delmeire, E.; Denes, P.; DeNotaristefani, F.; De Salvo, A.; Diemoz, M.; Dierckxsens, M.; Dionisi, C.; Dittmar, M.; Doria, A.; Dova, M.T.; Duchesneau, D.; Duda, M.; Echenard, B.; Eline, A.; El Hage, A.; El Mamouni, H.; Engler, A.; Eppling, F.J.; Extermann, P.; Falagan, M.A.; Falciano, S.; Favara, A.; Fay, J.; Fedin, O.; Felcini, M.; Ferguson, T.; Fesefeldt, H.; Fiandrini, E.; Field, J.H.; Filthaut, F.; Fisher, P.H.; Fisher, W.; Forconi, G.; Freudenreich, K.; Furetta, C.; Galaktionov, Iouri; Ganguli, S.N.; Garcia-Abia, Pablo; Gataullin, M.; Gentile, S.; Giagu, S.; Gong, Z.F.; Grenier, Gerald Jean; Grimm, O.; Gruenewald, M.W.; Guida, M.; Gupta, V.K.; Gurtu, A.; Gutay, L.J.; Haas, D.; Hatzifotiadou, D.; Hebbeker, T.; Herve, Alain; Hirschfelder, J.; Hofer, H.; Hohlmann, M.; Holzner, G.; Hou, S.R.; Jin, B.N.; Jindal, P.; Jones, Lawrence W.; de Jong, P.; Josa-Mutuberria, I.; Kaur, M.; Kienzle-Focacci, M.N.; Kim, J.K.; Kirkby, J.; Kittel, W.; Klimentov, A.; Konig, A.C.; Kopal, M.; Koutsenko, V.; Kraber, M.; Kraemer, R.W.; Kruger, A.; Kunin, A.; Ladron de Guevara, P.; Laktineh, I.; Landi, G.; Lebeau, M.; Lebedev, A.; Lebrun, P.; Lecomte, P.; Lecoq, P.; Le Coultre, P.; Le Goff, J.M.; Leiste, R.; Levtchenko, M.; Levtchenko, P.; Li, C.; Likhoded, S.; Lin, C.H.; Lin, W.T.; Linde, F.L.; Lista, L.; Liu, Z.A.; Lohmann, W.; Longo, E.; Lu, Y.S.; Luci, C.; Luminari, L.; Lustermann, W.; Ma, W.G.; Malgeri, L.; Malinin, A.; Mana, C.; Mans, J.; Martin, J.P.; Marzano, F.; Mazumdar, K.; McNeil, R.R.; Mele, S.; Merola, L.; Meschini, M.; Metzger, W.J.; Mihul, A.; Milcent, H.; Mirabelli, G.; Mnich, J.; Mohanty, G.B.; Muanza, G.S.; Muijs, A.J.M.; Musy, M.; Nagy, S.; Natale, S.; Napolitano, M.; Nessi-Tedaldi, F.; Nesterov, S.; Newmann, H.; Nisati, A.; Novak, T.; Kluge, Hannelies; Ofierzynski, R.; Organtini, G.; Pal, I.; Palomares, C.; Paolucci, P.; Paramatti, R.; Passaleva, G.; Patricelli, S.; Paul, Thomas Cantzon; Pauluzzi, M.; Paus, C.; Pauss, F.; Pedace, M.; Pensotti, S.; Perret-Gallix, D.; Piccolo, D.; Pierella, F.; Pieri, M.; Pioppi, M.; Piroue, P.A.; Pistolesi, E.; Plyaskin, V.; Pohl, M.; Pojidaev, V.; Pothier, J.; Prokofiev, D.; Rahal-Callot, G.; Rahaman, Mohammad Azizur; Raics, P.; Raja, N.; Ramelli, R.; Rancoita, P.G.; Ranieri, R.; Raspereza, A.; Razis, P.; Rembeczki, S.; Ren, D.; Rescigno, M.; Reucroft, S.; Riemann, S.; Riles, Keith; Roe, B.P.; Romero, L.; Rosca, A.; Rosemann, C.; Rosenbleck, C.; Rosier-Lees, S.; Roth, Stefan; Rubio, J.A.; Ruggiero, G.; Rykaczewski, H.; Sakharov, A.; Saremi, S.; Sarkar, S.; Salicio, J.; Sanchez, E.; Schafer, C.; Schopper, H.; Schotanus, D.J.; Sciacca, C.; Servoli, L.; Shevchenko, S.; Shivarov, N.; Shoutko, V.; Shumilov, E.; Shvorob, A.; Son, D.; Souga, C.; Spillantini, P.; Steuer, M.; Stickland, D.P.; Stoyanov, B.; Straessner, A.; Sudhakar, K.; Sultanov, G.; Sun, L.Z.; Sushkov, S.; Suter, H.; Swain, J.D.; Szillasi, Z.; Tang, X.W.; Tarjan, P.; Tauscher, L.; Taylor, L.; Tellili, B.; Teyssier, D.; Timmermans, Charles; Ting, Samuel C.C.; Ting, S.M.; Tonwar, S.C.; Toth, J.; Tully, C.; Tung, K.L.; Ulbricht, J.; Valente, E.; Van de Walle, R.T.; Vasquez, R.; Vesztergombi, G.; Vetlitsky, I.; Viertel, G.; Vivargent, M.; Vlachos, S.; Vodopianov, I.; Vogel, H.; Vogt, H.; Vorobiev, I.; Vorobyov, A.A.; Wadhwa, M.; Wang, Q.; Wang, X.L.; Wang, Z.M.; Weber, M.; Wynhoff, S.; Xia, L.; Xu, Z.Z.; Yamamoto, J.; Yang, B.Z.; Yang, C.G.; Yang, H.J.; Yang, M.; Yeh, S.C.; Zalite, An.; Zalite, Yu.; Zhang, Z.P.; Zhao, J.; Zhu, G.Y.; Zhu, R.Y.; Zhuang, H.L.; Zichichi, A.; Zimmermann, B.; Zoller., M.

    2006-01-01

    The reactions gamma gamma -> pi^+pi^-pi^+pi^- and gamma gamma -> pi^+pi^0pi^-pi^0 are studied with the L3 detector at LEP in a data sample collected at centre-of-mass energies from 161GeV to 209GeV with a total integrated luminosity of 698/pb. A spin-parity-helicity analysis of the rho^0 rho^0 and rho^+ rho^- systems for two-photon centre-of-mass energies between 1GeV and 3GeV shows the dominance of the spin-parity state 2+ with helicity 2. The contribution of 0+ and 0- spin-parity states is also observed, whereas contributions of 2- states and of a state with spin-parity 2+ and zero helicity are found to be negligible.

  2. Pollen-Mediated Movement of Herbicide Resistance Genes in Lolium rigidum.

    Directory of Open Access Journals (Sweden)

    Iñigo Loureiro

    Full Text Available The transfer of herbicide resistance genes by pollen is a major concern in cross-pollinated species such as annual ryegrass (Lolium rigidum. A two-year study was conducted in the greenhouse, under favorable conditions for pollination, to generate information on potential maximum cross-pollination. This maximum cross-pollination rate was 56.1%. A three-year field trial was also conducted to study the cross-pollination rates in terms of distance and orientation to an herbicide-resistant pollen source. Under field conditions, cross-pollination rates varied from 5.5% to 11.6% in plants adjacent to the pollen source and decreased with increasing distances (1.5 to 8.9% at 15 m distance and up to 4.1% at 25 m in the downwind direction. Environmental conditions influenced the cross-pollination both under greenhouse and field conditions. Data were fit to an exponential decay model to predict gene flow at increasing distances. This model predicted an average gene flow of 7.1% when the pollen donor and recipient plants were at 0 m distance from each other. Pollen-mediated gene flow declined by 50% at 16.7 m from the pollen source, yet under downwind conditions gene flow of 5.2% was predicted at 25 m, the farthest distance studied. Knowledge of cross-pollination rates will be useful for assessing the spread of herbicide resistance genes in L. rigidum and in developing appropriate strategies for its mitigation.

  3. PCR-based detection of resistance genes in anaerobic bacteria isolated from intra-abdominal infections.

    Science.gov (United States)

    Tran, Chau Minh; Tanaka, Kaori; Watanabe, Kunitomo

    2013-04-01

    Little information is available on the distribution of antimicrobial resistance genes in anaerobes in Japan. To understand the background of antimicrobial resistance in anaerobes involved in intra-abdominal infections, we investigated the distribution of eight antimicrobial resistance genes (cepA, cfiA, cfxA, ermF, ermB, mefA, tetQ, and nim) and a mutation in the gyrA gene in a total of 152 organisms (Bacteroides spp., Prevotella spp., Fusobacterium spp., Porphyromonas spp., Bilophila wadsworthia, Desulfovibrio desulfuricans, Veillonella spp., gram-positive cocci, and non-spore-forming gram-positive bacilli) isolated between 2003 and 2004 in Japan. The cepA gene was distributed primarily in Bacteroides fragilis. Gene cfxA was detected in about 9 % of the Bacteroides isolates and 75 % of the Prevotella spp. isolates and did not appear to contribute to cephamycin resistance. Two strains of B. fragilis contained the metallo-β-lactamase gene cfiA, but they did not produce the protein product. Gene tetQ was detected in about 81, 44, and 63 % of B. fragilis isolates, other Bacteroides spp., and Prevotella spp. isolates, respectively. The ermF gene was detected in 25, 13, 56, 64, and 16 % of Bacteroides spp., Prevotella spp., Fusobacterium spp., B. wadsworthia, and anaerobic cocci, respectively. Gene mefA was found in only 10 % of the B. fragilis strains and 3 % of the non-B. fragilis strains. Genes nim and ermB were not detected in any isolate. Substitution at position 82 (Ser to Phe) in gyrA was detected in B. fragilis isolates that were less susceptible or resistant to moxifloxacin. This study is the first report on the distribution of resistance genes in anaerobes isolated from intra-abdominal infections in Japan. We expect that the results might help in understanding the resistance mechanisms of specific anaerobes.

  4. Fate of antibiotic resistant bacteria and genes during wastewater chlorination: implication for antibiotic resistance control.

    Directory of Open Access Journals (Sweden)

    Qing-Bin Yuan

    Full Text Available This study investigated fates of nine antibiotic-resistant bacteria as well as two series of antibiotic resistance genes in wastewater treated by various doses of chlorine (0, 15, 30, 60, 150 and 300 mg Cl2 min/L. The results indicated that chlorination was effective in inactivating antibiotic-resistant bacteria. Most bacteria were inactivated completely at the lowest dose (15 mg Cl2 min/L. By comparison, sulfadiazine- and erythromycin-resistant bacteria exhibited tolerance to low chlorine dose (up to 60 mg Cl2 min/L. However, quantitative real-time PCRs revealed that chlorination decreased limited erythromycin or tetracycline resistance genes, with the removal levels of overall erythromycin and tetracycline resistance genes at 0.42 ± 0.12 log and 0.10 ± 0.02 log, respectively. About 40% of erythromycin-resistance genes and 80% of tetracycline resistance genes could not be removed by chlorination. Chlorination was considered not effective in controlling antimicrobial resistance. More concern needs to be paid to the potential risk of antibiotic resistance genes in the wastewater after chlorination.

  5. Population-specific gene expression in the plant pathogenic nematode Heterodera glycines exists prior to infection and during the onset of a resistant or susceptible reaction in the roots of the Glycine max genotype Peking

    Directory of Open Access Journals (Sweden)

    Alkharouf Nadim W

    2009-03-01

    Full Text Available Abstract Background A single Glycine max (soybean genotype (Peking reacts differently to two different populations of Heterodera glycines (soybean cyst nematode within the first twelve hours of infection during resistant (R and susceptible (S reactions. This suggested that H. glycines has population-specific gene expression signatures. A microarray analysis of 7539 probe sets representing 7431 transcripts on the Affymetrix® soybean GeneChip® were used to identify population-specific gene expression signatures in pre-infective second stage larva (pi-L2 prior to their infection of Peking. Other analyses focused on the infective L2 at 12hours post infection (i-L212h, and the infective sedentary stages at 3days post infection (i-L23d and 8days post infection (i-L2/L38d. Results Differential expression and false discovery rate (FDR analyses comparing populations of pi-L2 (i.e., incompatible population, NL1-RHg to compatible population, TN8 identified 71 genes that were induced in NL1-RHg as compared to TN8. These genes included putative gland protein G23G12, putative esophageal gland protein Hgg-20 and arginine kinase. The comparative analysis of pi-L2 identified 44 genes that were suppressed in NL1-RHg as compared to TN8. These genes included a different Hgg-20 gene, an EXPB1 protein and a cuticular collagen. By 12 h, there were 7 induced genes and 0 suppressed genes in NL1-RHg. By 3d, there were 9 induced and 10 suppressed genes in NL1-RHg. Substantial changes in gene expression became evident subsequently. At 8d there were 13 induced genes in NL1-RHg. This included putative gland protein G20E03, ubiquitin extension protein, putative gland protein G30C02 and β-1,4 endoglucanase. However, 1668 genes were found to be suppressed in NL1-RHg. These genes included steroid alpha reductase, serine proteinase and a collagen protein. Conclusion These analyses identify a genetic expression signature for these two populations both prior to and subsequently

  6. Major Gene for Field Stem Rust Resistance Co-Locates with Resistance Gene Sr12 in 'Thatcher' Wheat.

    Science.gov (United States)

    Hiebert, Colin W; Kolmer, James A; McCartney, Curt A; Briggs, Jordan; Fetch, Tom; Bariana, Harbans; Choulet, Frederic; Rouse, Matthew N; Spielmeyer, Wolfgang

    2016-01-01

    Stem rust, caused by Puccinia graminis (Pgt), is a damaging disease of wheat that can be controlled by utilizing effective stem rust resistance genes. 'Thatcher' wheat carries complex resistance to stem rust that is enhanced in the presence of the resistance gene Lr34. The purpose of this study was to examine APR in 'Thatcher' and look for genetic interactions with Lr34. A RIL population was tested for stem rust resistance in field nurseries in Canada, USA, and Kenya. BSA was used to find SNP markers associated with reduced stem rust severity. A major QTL was identified on chromosome 3BL near the centromere in all environments. Seedling testing showed that Sr12 mapped to the same region as the QTL for APR. The SNP markers were physically mapped and the region carrying the resistance was searched for sequences with homology to members of the NB-LRR resistance gene family. SNP marker from one NB-LRR-like sequence, NB-LRR3 co-segregated with Sr12. Two additional populations, including one that lacked Lr34, were tested in field nurseries. NB-LRR3 mapped near the maximum LOD for reduction in stem rust severity in both populations. Lines from a population that segregated for Sr12 and Lr34 were tested for seedling Pgt biomass and infection type, as well as APR to field stem rust which showed an interaction between the genes. We concluded that Sr12, or a gene closely linked to Sr12, was responsible for 'Thatcher'-derived APR in several environments and this resistance was enhanced in the presence of Lr34.

  7. Comparative mapping of powdery mildew resistance gene Pm21 and functional characterization of resistance-related genes in wheat.

    Science.gov (United States)

    He, Huagang; Zhu, Shanying; Jiang, Zhengning; Ji, Yaoyong; Wang, Feng; Zhao, Renhui; Bie, Tongde

    2016-04-01

    The powdery mildew resistance gene Pm21 was physically and comparatively mapped by newly developed markers. Seven candidate genes were verified to be required for Pm21 -mediated resistance to wheat powdery mildew. Pm21, a gene derived from wheat wild relative Dasypyrum villosum, has been transferred into common wheat and widely utilized in wheat resistance breeding for powdery mildew. Previously, Pm21 has been located to the bin FL0.45-0.58 of 6VS by using deletion stocks. However, its fine mapping is still a hard work. In the present study, 30 gene-derived 6VS-specific markers were obtained based on the collinearity among genomes of Brachypodium distachyon, Oryza and Triticeae, and then physically and comparatively mapped in the bin FL0.45-0.58 and its nearby chromosome region. According to the maps, the bin FL0.45-0.58 carrying Pm21 was closely flanked by the markers 6VS-03 and 6VS-23, which further narrowed the orthologous regions to 1.06 Mb in Brachypodium and 1.38 Mb in rice, respectively. Among the conserved genes shared by Brachypodium and rice, four serine/threonine protein kinase genes (DvMPK1, DvMLPK, DvUPK and DvPSYR1), one protein phosphatase gene (DvPP2C) and two transcription factor genes (DvGATA and DvWHY) were confirmed to be required for Pm21-mediated resistance to wheat powdery mildew by barley stripe mosaic virus-induced gene silencing (BSMV-VIGS) and transcriptional pattern analyses. In summary, this study gives new insights into the genetic basis of the Pm21 locus and the disease resistance pathways mediated by Pm21.

  8. PI3 kinase inhibition improves vascular malformations in mouse models of hereditary haemorrhagic telangiectasia.

    Science.gov (United States)

    Ola, Roxana; Dubrac, Alexandre; Han, Jinah; Zhang, Feng; Fang, Jennifer S; Larrivée, Bruno; Lee, Monica; Urarte, Ana A; Kraehling, Jan R; Genet, Gael; Hirschi, Karen K; Sessa, William C; Canals, Francesc V; Graupera, Mariona; Yan, Minhong; Young, Lawrence H; Oh, Paul S; Eichmann, Anne

    2016-11-29

    Activin receptor-like kinase 1 (ALK1) is an endothelial serine-threonine kinase receptor for bone morphogenetic proteins (BMPs) 9 and 10. Inactivating mutations in the ALK1 gene cause hereditary haemorrhagic telangiectasia type 2 (HHT2), a disabling disease characterized by excessive angiogenesis with arteriovenous malformations (AVMs). Here we show that inducible, endothelial-specific homozygous Alk1 inactivation and BMP9/10 ligand blockade both lead to AVM formation in postnatal retinal vessels and internal organs including the gastrointestinal (GI) tract in mice. VEGF and PI3K/AKT signalling are increased on Alk1 deletion and BMP9/10 ligand blockade. Genetic deletion of the signal-transducing Vegfr2 receptor prevents excessive angiogenesis but does not fully revert AVM formation. In contrast, pharmacological PI3K inhibition efficiently prevents AVM formation and reverts established AVMs. Thus, Alk1 deletion leads to increased endothelial PI3K pathway activation that may be a novel target for the treatment of vascular lesions in HHT2.

  9. Gene Expression Analysis of Plum pox virus (Sharka) Susceptibility/Resistance in Apricot (Prunus armeniaca L.).

    Science.gov (United States)

    Rubio, Manuel; Ballester, Ana Rosa; Olivares, Pedro Manuel; Castro de Moura, Manuel; Dicenta, Federico; Martínez-Gómez, Pedro

    2015-01-01

    RNA-Seq has proven to be a very powerful tool in the analysis of the Plum pox virus (PPV, sharka disease)/Prunus interaction. This technique is an important complementary tool to other means of studying genomics. In this work an analysis of gene expression of resistance/susceptibility to PPV in apricot is performed. RNA-Seq has been applied to analyse the gene expression changes induced by PPV infection in leaves from two full-sib apricot genotypes, "Rojo Pasión" and "Z506-7", resistant and susceptible to PPV, respectively. Transcriptomic analyses revealed the existence of more than 2,000 genes related to the pathogen response and resistance to PPV in apricot. These results showed that the response to infection by the virus in the susceptible genotype is associated with an induction of genes involved in pathogen resistance such as the allene oxide synthase, S-adenosylmethionine synthetase 2 and the major MLP-like protein 423. Over-expression of the Dicer protein 2a may indicate the suppression of a gene silencing mechanism of the plant by PPV HCPro and P1 PPV proteins. On the other hand, there were 164 genes involved in resistance mechanisms that have been identified in apricot, 49 of which are located in the PPVres region (scaffold 1 positions from 8,050,804 to 8,244,925), which is responsible for PPV resistance in apricot. Among these genes in apricot there are several MATH domain-containing genes, although other genes inside (Pleiotropic drug resistance 9 gene) or outside (CAP, Cysteine-rich secretory proteins, Antigen 5 and Pathogenesis-related 1 protein; and LEA, Late embryogenesis abundant protein) PPVres region could also be involved in the resistance.

  10. Discovery and Characterization of piRNAs in the Human Fetal Ovary

    Directory of Open Access Journals (Sweden)

    Zev Williams

    2015-10-01

    Full Text Available Piwi-interacting RNAs (piRNAs, a class of 26- to 32-nt non-coding RNAs (ncRNAs, function in germline development, transposon silencing, and epigenetic regulation. We performed deep sequencing and annotation of untreated and periodate-treated small RNA cDNA libraries from human fetal and adult germline and reference somatic tissues. This revealed abundant piRNAs originating from 150 piRNA-encoding genes, including some exhibiting gender-specific expression, in fetal ovary and adult testis—developmental periods coinciding with mitotic cell divisions expanding fetal germ cells prior to meiotic divisions. The absence of reads mapping uniquely to annotated piRNA genes demonstrated their paucity in fetal testis and adult ovary and absence in somatic tissues. We curated human piRNA-expressing regions and defined their precise borders and observed piRNA-guided cleavage of transcripts antisense to some piRNA-producing genes. This study provides insights into sex-specific mammalian piRNA expression and function and serves as a reference for human piRNA analysis and annotation.

  11. Identification of QTLs for resistance to sclerotinia stem rot and BnaC.IGMT5.a as a candidate gene of the major resistant QTL SRC6 in Brassica napus.

    Directory of Open Access Journals (Sweden)

    Jian Wu

    Full Text Available Stem rot caused by Sclerotinia sclerotiorum in many important dicotyledonous crops, including oilseed rape (Brassica napus, is one of the most devastating fungal diseases and imposes huge yield loss each year worldwide. Currently, breeding for Sclerotinia resistance in B. napus, as in other crops, can only rely on germplasms with quantitative resistance genes. Thus, the identification of quantitative trait locus (QTL for S. sclerotiorum resistance/tolerance in this crop holds immediate promise for the genetic improvement of the disease resistance. In this study, ten QTLs for stem resistance (SR at the mature plant stage and three QTLs for leaf resistance (LR at the seedling stage in multiple environments were mapped on nine linkage groups (LGs of a whole genome map for B. napus constructed with SSR markers. Two major QTLs, LRA9 on LG A9 and SRC6 on LG C6, were repeatedly detected across all environments and explained 8.54-15.86% and 29.01%-32.61% of the phenotypic variations, respectively. Genotypes containing resistant SRC6 or LRA9 allele showed a significant reduction in disease lesion after pathogen infection. Comparative mapping with Arabidopsis and data mining from previous gene profiling experiments identified that the Arabidopsis homologous gene of IGMT5 (At1g76790 was related to the SRC6 locus. Four copies of the IGMT5 gene in B. napus were isolated through homologous cloning, among which, only BnaC.IGMT5.a showed a polymorphism between parental lines and can be associated with the SRC6. Furthermore, two parental lines exhibited a differential expression pattern of the BnaC.IGMT5.a gene in responding to pathogen inoculation. Thus, our data suggested that BnaC.IGMT5.a was very likely a candidate gene of this major resistance QTL.

  12. Interactions of Phytophthora capsici with Resistant and Susceptible Pepper Roots and Stems.

    Science.gov (United States)

    Dunn, Amara R; Smart, Christine D

    2015-10-01

    Using host resistance is an important strategy for managing pepper root and crown rot caused by Phytophthora capsici. An isolate of P. capsici constitutively expressing a gene for green fluorescent protein was used to investigate pathogen interactions with roots, crowns, and stems of Phytophthora-susceptible bell pepper 'Red Knight', Phytophthora-resistant bell pepper 'Paladin', and Phytophthora-resistant landrace Criollos de Morelos 334 (CM-334). In this study, the same number of zoospores attached to and germinated on roots of all cultivars 30 and 120 min postinoculation (pi), respectively. At 3 days pi, significantly more secondary roots had necrotic lesions on Red Knight than on Paladin and CM-334 plants. By 4 days pi, necrotic lesions had formed on the taproot of Red Knight but not Paladin or CM-334 plants. Although hyphae were visible in the crowns and stems of all Red Knight plants observed at 4 days pi, hyphae were observed in crowns of only a few Paladin and in no CM-334 plants, and never in stems of either resistant cultivar at 4 days pi. These results improve our understanding of how P. capsici infects plants and may contribute to the use of resistant pepper cultivars for disease management and the development of new cultivars.

  13. Silencing of the PiAvr3a effector-encoding gene from Phytophthora infestans by transcriptional fusion to a short interspersed element.

    Science.gov (United States)

    Vetukuri, Ramesh R; Tian, Zhendong; Avrova, Anna O; Savenkov, Eugene I; Dixelius, Christina; Whisson, Stephen C

    2011-12-01

    Phytophthora infestans is the notorious oomycete causing late blight of potato and tomato. A large proportion of the P. infestans genome is composed of transposable elements, the activity of which may be controlled by RNA silencing. Accumulation of small RNAs is one of the hallmarks of RNA silencing. Here we demonstrate the presence of small RNAs corresponding to the sequence of a short interspersed retrotransposable element (SINE) suggesting that small RNAs might be involved in silencing of SINEs in P. infestans. This notion was exploited to develop novel tools for gene silencing in P. infestans by engineering transcriptional fusions of the PiAvr3a gene, encoding an RXLR avirulence effector, to the infSINEm retroelement. Transgenic P. infestans lines expressing either 5'-infSINEm::PiAvr3a-3' or 5'-PiAvr3a::SINEm-3' chimeric transcripts initially exhibited partial silencing of PiAvr3a. Over time, PiAvr3a either recovered wild type transcript levels in some lines, or became fully silenced in others. Introduction of an inverted repeat construct was also successful in yielding P. infestans transgenic lines silenced for PiAvr3a. In contrast, constructs expressing antisense or aberrant RNA transcripts failed to initiate silencing of PiAvr3a. Lines exhibiting the most effective silencing of PiAvr3a were either weakly or non-pathogenic on susceptible potato cv. Bintje. This study expands the repertoire of reverse genetics tools available for P. infestans research, and provides insights into a possible mode of variation in effector expression through spread of silencing from adjacent retroelements. Crown Copyright © 2011. Published by Elsevier Ltd. All rights reserved.

  14. Detection and Characterizations of Genes Resistant to Tetracycline and Sulfa among the Bacteria in Mariculture Water

    Science.gov (United States)

    Qu, L.; Li, Y.; Zhu, P.

    2013-12-01

    One hundred and thirty-five bacteria from maricultural environments were tested for sensitivity to tetracycline and sulfa. Result show that 72% of the bacteria were sulfa-resistant, 36% of the bacteria were tetracycline-resistant, and 16.5% of bacteria showed resistance to both tetracyclines and sulfa ,indicating that the proportion of sulfa and tetracycline resistance bacteria isvery large in the maricultural environments. PCR methods were used to detect if these resistant bacteria carry tetracycline and sulfa resistance genes. Out of the 33 tetracycline-resistant bacteria screened, 3 were positive for tetA, 6 were positive for tetB and no isolate wasboth positive for tetA and tetB. Of the 97 sulfa-resistant bacteria screened, 9 were positive for sul2, 6 were positive for sul1, 1 isolate was positive for bothsul1 and sul2. The minimum inhibitory concentration (MIC) of tetracycline for tetA-carrying isolates were higher than those tetB-carrying isolates.while The MIC of sulfa for sul2-carrying isolates were higher than those sul1-carrying isolates. Indicating that tetA and sul2 gene may play ubknown roles in resisting tetracycline and sulfa than tetB and sul1 genes. The results showed the 4 kinds of genes (tetA,tetB,sul1,sul2) has no host specificity. All these 16S sequence are from the isolates which are positive for the above genes, it indicated the above antibiotic resistance genes are widespread in the environment regardless of the host. While the DNA sequence of these four genes showed tetA, sul1, sul2 genes are conservative in different bacteria , etB gene conserved poorly. The research aim is to get a preliminary understanding of resistance mechanism related to the resistant bacteria and the resistance genes in marine aquaculture environment through the analysis of resistant genes, providing research base for the prevention and treatment of drug-resistant bacteria so as to reduce the threat to the ecological environment, aquaculture and human health.

  15. Prevalence of transmitted drug resistance and impact of transmitted resistance on treatment success in the German HIV-1 Seroconverter Cohort.

    Directory of Open Access Journals (Sweden)

    Barbara Bartmeyer

    Full Text Available BACKGROUND: The aim of this study is to analyse the prevalence of transmitted drug resistance, TDR, and the impact of TDR on treatment success in the German HIV-1 Seroconverter Cohort. METHODS: Genotypic resistance analysis was performed in treatment-naïve study patients whose sample was available 1,312/1,564 (83.9% October 2008. A genotypic resistance result was obtained for 1,276/1,312 (97.3%. The resistance associated mutations were identified according to the surveillance drug resistance mutations list recommended for drug-naïve patients. Treatment success was determined as viral suppression below 500 copies/ml. RESULTS: Prevalence of TDR was stable at a high level between 1996 and 2007 in the German HIV-1 Seroconverter Cohort (N = 158/1,276; 12.4%; CI(wilson 10.7-14.3; p(for trend = 0.25. NRTI resistance was predominant (7.5% but decreased significantly over time (CI(Wilson: 6.2-9.1, p(for trend = 0.02. NNRTI resistance tended to increase over time (NNRTI: 3.5%; CI(Wilson: 2.6-4.6; p(for trend= 0.07, whereas PI resistance remained stable (PI: 3.0%; CI(Wilson: 2.1-4.0; p(for trend = 0.24. Resistance to all drug classes was frequently caused by singleton resistance mutations (NRTI 55.6%, PI 68.4%, NNRTI 99.1%. The majority of NRTI-resistant strains (79.8% carried resistance-associated mutations selected by the thymidine analogues zidovudine and stavudine. Preferably 2NRTI/1PIr combinations were prescribed as first line regimen in patients with resistant HIV as well as in patients with susceptible strains (susceptible 45.3%; 173/382 vs. resistant 65.5%; 40/61. The majority of patients in both groups were treated successfully within the first year after ART-initiation (susceptible: 89.9%; 62/69; resistant: 7/9; 77.8%. CONCLUSION: Overall prevalence of TDR remained stable at a high level but trends of resistance against drug classes differed over time. The significant decrease of NRTI-resistance in patients newly infected

  16. Dissection of Resistance Genes to Pseudomonas syringae pv. phaseolicola in UI3 Common Bean Cultivar

    Directory of Open Access Journals (Sweden)

    Ana M. González

    2017-11-01

    Full Text Available Few quantitative trait loci have been mapped for resistance to Pseudomonas syringae pv. phaseolicola in common bean. Two F2 populations were developed from the host differential UI3 cultivar. The objective of this study was to further characterize the resistance to races 1, 5, 7 and 9 of Psp included in UI3. Using a QTL mapping approach, 16 and 11 main-effect QTLs for pod and primary leaf resistance were located on LG10, explaining up to 90% and 26% of the phenotypic variation, respectively. The homologous genomic region corresponding to primary leaf resistance QTLs detected tested positive for the presence of resistance-associated gene cluster encoding nucleotide-binding and leucine-rich repeat (NL, Natural Resistance Associated Macrophage (NRAMP and Pentatricopeptide Repeat family (PPR proteins. It is worth noting that the main effect QTLs for resistance in pod were located inside a 3.5 Mb genomic region that included the Phvul.010G021200 gene, which encodes a protein that has the highest sequence similarity to the RIN4 gene of Arabidopsis, and can be considered an important candidate gene for the organ-specific QTLs identified here. These results support that resistance to Psp from UI3 might result from the immune response activated by combinations of R proteins, and suggest the guard model as an important mechanism in pod resistance to halo blight. The candidate genes identified here warrant functional studies that will help in characterizing the actual defense gene(s in UI3 genotype.

  17. Determination of rust resistance genes in pakistani bread wheats

    International Nuclear Information System (INIS)

    Qamar, M.; Ahmad, S.D.; Rabbani, M.A.; Shinwari, Z.K.

    2014-01-01

    Stripe and leaf rusts are the major constraints to bread wheat production in Pakistan. Molecular markers were used to investigate the presence of leaf rust and stripe rust resistance gene cluster Lr34/Yr18 and stem rust resistance gene Sr2 in 52 Pakistani bread wheat cultivars/lines. PCR amplification of DNA fragments using DNA marker csLV-34 showed that 13 of the studied cultivars/lines, namely 03FJ26, NR 337, NR 339, NR 347, NR 350, Manthar, Margalla 99, Iqbal 2000, Saleem 2000, Wafaq 2001, Marwat 2001, Pirsabak 2004 and Fareed 2006 carry leaf rust and stripe rust resistance genes Lr34/Yr18. Stem rust resistance gene Sr2 was observed in 36 Pakistani spring wheat cultivars/lines using stm560.3tgag marker. The slow rusting gene Sr2 needs to be combined with additional stem rust resistance genes to establish durable resistance against Ug99 in modern wheat cultivars. Low frequency of Lr34/Yr18 was found in Pakistani wheats. This gene cluster needs to be incorporated into Pakistani wheats for durable rust resistance. (author)

  18. Modification of barley powdery mildew resistance controlled by the gene M1-a212

    International Nuclear Information System (INIS)

    Torp, J.; Joergensen, J.H.

    1989-01-01

    Full text: The barley line Sultan 5 carries resistance gene M1-a12. Seeds were treated with EMS or NaN 3 . Among 10381 M 1 -spike progenies inoculated with M1-a12 a-virulent isolates of Erysiphe graminis, 25 segregated for less resistant infection type. Among 10 mutants analyzed, 9 had mutant allels of M1-a12 and one had a recessive mutant gene in a different locus acting as a ''suppressor'' of M1-a12. (author)

  19. Differential Gene Expression in Response to Papaya ringspot virus Infection in Cucumis metuliferus Using cDNA- Amplified Fragment Length Polymorphism Analysis

    Science.gov (United States)

    Lin, Chia-Wei; Chung, Chien-Hung; Chen, Jo-Chu; Yeh, Shy-Dong; Ku, Hsin-Mei

    2013-01-01

    A better understanding of virus resistance mechanisms can offer more effective strategies to control virus diseases. Papaya ringspot virus (PRSV), Potyviridae, causes severe economical losses in papaya and cucurbit production worldwide. However, no resistance gene against PRSV has been identified to date. This study aimed to identify candidate PRSV resistance genes using cDNA-AFLP analysis and offered an open architecture and transcriptomic method to study those transcripts differentially expressed after virus inoculation. The whole genome expression profile of Cucumis metuliferus inoculated with PRSV was generated using cDNA-amplified fragment length polymorphism (cDNA-AFLP) method. Transcript derived fragments (TDFs) identified from the resistant line PI 292190 may represent genes involved in the mechanism of PRSV resistance. C. metuliferus susceptible Acc. 2459 and resistant PI 292190 lines were inoculated with PRSV and subsequently total RNA was isolated for cDNA-AFLP analysis. More than 400 TDFs were expressed specifically in resistant line PI 292190. A total of 116 TDFs were cloned and their expression patterns and putative functions in the PRSV-resistance mechanism were further characterized. Subsequently, 28 out of 116 candidates which showed two-fold higher expression levels in resistant PI 292190 than those in susceptible Acc. 2459 after virus inoculation were selected from the reverse northern blot and bioinformatic analysis. Furthermore, the time point expression profiles of these candidates by northern blot analysis suggested that they might play roles in resistance against PRSV and could potentially provide valuable information for controlling PRSV disease in the future. PMID:23874746

  20. A common variation of the PTEN gene is associated with peripheral insulin resistance

    DEFF Research Database (Denmark)

    Grinder-Hansen, L; Ribel-Madsen, R; Wojtaszewski, Jørgen

    2016-01-01

    . RESULTS: The minor G allele of PTEN rs11202614 was associated with elevated fasting plasma insulin levels and a decreased peripheral glucose disposal rate, but not with the hepatic insulin resistance index or insulin secretion measured as the first-phase insulin response and disposition index. The single...... nucleotide polymorphism was not associated with either PI3K or Akt activities. CONCLUSION: A common PTEN variation is associated with peripheral insulin resistance and subsequent risk of developing T2D. However, the association with insulin resistance is not explained by decreased proximal insulin signalling......AIM: Phosphatase and tensin homologue (PTEN) reduces insulin sensitivity by inhibiting the phosphatidylinositol 3-kinase (PI3K)/v-akt murine thymoma viral oncogene homologue (Akt) pathway. This study investigated how a common single nucleotide polymorphism near PTEN, previously associated...

  1. Mapping of the minimal inorganic phosphate transporting unit of human PiT2 suggests a structure universal to PiT-related proteins from all kingdoms of life

    DEFF Research Database (Denmark)

    Bøttger, Pernille; Pedersen, Lene

    2011-01-01

    -keeping functions. Alignment of protein sequences representing PiT family members from all kingdoms reveals the presence of conserved amino acids and that bacterial phosphate permeases and putative phosphate permeases from archaea lack substantial parts of the protein sequence when compared to the mammalian Pi...... PiT2 histidine, H502, and the human PiT1 glutamate, E70, - both conserved in eukaryotic PiT family members - are critical for Pi transport function. Noticeably, human PiT2 H502 is located in the C-terminal PiT family signature sequence, and human PiT1 E70 is located in ProDom domains characteristic....... Conclusions The results suggest that the overall structure of the Pi-transporting unit of the PiT family proteins has remained unchanged during evolution. Moreover, in combination, our studies of the gene structure of the human PiT1 and PiT2 genes (SLC20A1 and SLC20A2, respectively) and alignment of protein...

  2. INPP4B reverses docetaxel resistance and epithelial-to-mesenchymal transition via the PI3K/Akt signaling pathway in prostate cancer

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Haiwen; Li, Hongliang, E-mail: honglianglity@sina.com; Chen, Qi

    2016-08-26

    Docetaxel efficiency in the therapy of prostate cancer (PCa) patients is limited due to the development of chemoresistance. Recent studies have implied a role of INPP4B in tumor chemoresistance, while the effects of INPP4B on docetaxel resistance in PCa have not been elucidated. In the present study, the docetaxel-resistant human PCa cell lines PC3-DR and DU-145-DR were established from the parental cell lines PC3 and DU-145, and the expression and role of INPP4B in docetaxel-resistant PCa cells were investigated. The results demonstrated that INPP4B expression was significantly downregulated in docetaxel-resistant cells. Overexpression of INPP4B increased the sensitivity to docetaxel and promoted cell apoptosis in PC3-DR and DU-145-DR cells. In addition, INPP4B overexpression downregulated the expression of the mesenchymal markers fibronectin, N-cadherin, and vimentin, and upregulated the expression level of the epithelial maker E-cadherin. Furthermore, INPP4B overexpression markedly inhibited the PI3K/Akt pathway. We also found that IGF-1, the inhibitor of PI3K/Akt, markedly blocked the change in EMT markers induced by overexpression of INPP4B, and reversed the resistance of PC3-DR and DU-145-DR cells to docetaxel, which is sensitized by Flag-INPP4B. In summary, the presented data indicate that INPP4B is crucial for docetaxel-resistant PCa cell survival, potentially by regulating EMT through the PI3K/Akt signaling pathway. - Highlights: • INPP4B is downregulated in docetaxel-resistant PCa cells. • INPP4B inhibits cell proliferation. • INPP4B induces cell apoptosis. • INPP4B inhibits PCa cell EMT.

  3. $\\tau^{-} \\to (\\pi \\pi \\pi )^{-} \

    CERN Document Server

    Gómez-Dumm, D; Portolés, J; 10.1016/j.nuclphysbps.2004.04.166

    2004-01-01

    We analyse tau to pi pi pi nu /sub tau / decays within the framework of the resonance effective theory of QCD. We have worked out the relevant Lagrangian that describes the axial-vector current hadronization contributing to these processes, and the new coupling constants that arise have been constrained by imposing the asymptotic behaviour of the corresponding spectral function within QCD. Hence we compare the theoretical framework with the experimental data, obtaining a good quality fit from the ALEPH spectral function and branching ratio. We also get values for the mass and on-shell width of the a/sub 1/(1260) resonance, and provide the tau to pi pi pi nu /sub tau / structure functions that have been measured by OPAL and CLEO-II finding an excellent agreement.

  4. Expansion of genes encoding piRNA-associated argonaute proteins in the pea aphid: diversification of expression profiles in different plastic morphs.

    Directory of Open Access Journals (Sweden)

    Hsiao-Ling Lu

    Full Text Available Piwi-interacting RNAs (piRNAs are known to regulate transposon activity in germ cells of several animal models that propagate sexually. However, the role of piRNAs during asexual reproduction remains almost unknown. Aphids that can alternate sexual and asexual reproduction cycles in response to seasonal changes of photoperiod provide a unique opportunity to study piRNAs and the piRNA pathway in both reproductive modes. Taking advantage of the recently sequenced genome of the pea aphid Acyrthosiphon pisum, we found an unusually large lineage-specific expansion of genes encoding the Piwi sub-clade of Argonaute proteins. In situ hybridisation showed differential expressions between the duplicated piwi copies: while Api-piwi2 and Api-piwi6 are "specialised" in germ cells their most closely related copy, respectively Api-piwi5 and Api-piwi3, are expressed in the somatic cells. The differential expression was also identified in duplicated ago3: Api-ago3a in germ cells and Api-ago3b in somatic cells. Moreover, analyses of expression profiles of the expanded piwi and ago3 genes by semi-quantitative RT-PCR showed that expressions varied according to the reproductive types. These specific expression patterns suggest that expanded aphid piwi and ago3 genes have distinct roles in asexual and sexual reproduction.

  5. Resistance to Downy Mildew in Lettuce 'La Brillante' is Conferred by Dm50 Gene and Multiple QTL.

    Science.gov (United States)

    Simko, Ivan; Ochoa, Oswaldo E; Pel, Mathieu A; Tsuchida, Cayla; Font I Forcada, Carolina; Hayes, Ryan J; Truco, Maria-Jose; Antonise, Rudie; Galeano, Carlos H; Michelmore, Richard W

    2015-09-01

    Many cultivars of lettuce (Lactuca sativa L.) are susceptible to downy mildew, a nearly globally ubiquitous disease caused by Bremia lactucae. We previously determined that Batavia type cultivar 'La Brillante' has a high level of field resistance to the disease in California. Testing of a mapping population developed from a cross between 'Salinas 88' and La Brillante in multiple field and laboratory experiments revealed that at least five loci conferred resistance in La Brillante. The presence of a new dominant resistance gene (designated Dm50) that confers complete resistance to specific isolates was detected in laboratory tests of seedlings inoculated with multiple diverse isolates. Dm50 is located in the major resistance cluster on linkage group 2 that contains at least eight major, dominant Dm genes conferring resistance to downy mildew. However, this Dm gene is ineffective against the isolates of B. lactucae prevalent in the field in California and the Netherlands. A quantitative trait locus (QTL) located at the Dm50 chromosomal region (qDM2.2) was detected, though, when the amount of disease was evaluated a month before plants reached harvest maturity. Four additional QTL for resistance to B. lactucae were identified on linkage groups 4 (qDM4.1 and qDM4.2), 7 (qDM7.1), and 9 (qDM9.2). The largest effect was associated with qDM7.1 (up to 32.9% of the total phenotypic variance) that determined resistance in multiple field experiments. Markers identified in the present study will facilitate introduction of these resistance loci into commercial cultivars of lettuce.

  6. Gene Expression Analysis of Plum pox virus (Sharka Susceptibility/Resistance in Apricot (Prunus armeniaca L..

    Directory of Open Access Journals (Sweden)

    Manuel Rubio

    Full Text Available RNA-Seq has proven to be a very powerful tool in the analysis of the Plum pox virus (PPV, sharka disease/Prunus interaction. This technique is an important complementary tool to other means of studying genomics. In this work an analysis of gene expression of resistance/susceptibility to PPV in apricot is performed. RNA-Seq has been applied to analyse the gene expression changes induced by PPV infection in leaves from two full-sib apricot genotypes, "Rojo Pasión" and "Z506-7", resistant and susceptible to PPV, respectively. Transcriptomic analyses revealed the existence of more than 2,000 genes related to the pathogen response and resistance to PPV in apricot. These results showed that the response to infection by the virus in the susceptible genotype is associated with an induction of genes involved in pathogen resistance such as the allene oxide synthase, S-adenosylmethionine synthetase 2 and the major MLP-like protein 423. Over-expression of the Dicer protein 2a may indicate the suppression of a gene silencing mechanism of the plant by PPV HCPro and P1 PPV proteins. On the other hand, there were 164 genes involved in resistance mechanisms that have been identified in apricot, 49 of which are located in the PPVres region (scaffold 1 positions from 8,050,804 to 8,244,925, which is responsible for PPV resistance in apricot. Among these genes in apricot there are several MATH domain-containing genes, although other genes inside (Pleiotropic drug resistance 9 gene or outside (CAP, Cysteine-rich secretory proteins, Antigen 5 and Pathogenesis-related 1 protein; and LEA, Late embryogenesis abundant protein PPVres region could also be involved in the resistance.

  7. $\\pi \\pi $ phase-shifts in the reaction $\\pi p\\rightarrow p \\pi ^{+} \\pi ^{+} \\pi ^{-} $ at 8 GeV/c and $K \\pi $ Chew-Low anlysis in the reaction $\\K ^{-}p \\rightarrow pK ^{-} \\pi ^{+} \\pi ^{-}$ at 10 GeV

    CERN Document Server

    CERN. Geneva

    1971-01-01

    $\\pi \\pi $ phase-shifts in the reaction $\\pi p\\rightarrow p \\pi ^{+} \\pi ^{+} \\pi ^{-} $ at 8 GeV/c and $K \\pi $ Chew-Low anlysis in the reaction $\\K ^{-}p \\rightarrow pK ^{-} \\pi ^{+} \\pi ^{-}$ at 10 GeV

  8. Resistance Genes in Global Crop Breeding Networks.

    Science.gov (United States)

    Garrett, K A; Andersen, K F; Asche, F; Bowden, R L; Forbes, G A; Kulakow, P A; Zhou, B

    2017-10-01

    Resistance genes are a major tool for managing crop diseases. The networks of crop breeders who exchange resistance genes and deploy them in varieties help to determine the global landscape of resistance and epidemics, an important system for maintaining food security. These networks function as a complex adaptive system, with associated strengths and vulnerabilities, and implications for policies to support resistance gene deployment strategies. Extensions of epidemic network analysis can be used to evaluate the multilayer agricultural networks that support and influence crop breeding networks. Here, we evaluate the general structure of crop breeding networks for cassava, potato, rice, and wheat. All four are clustered due to phytosanitary and intellectual property regulations, and linked through CGIAR hubs. Cassava networks primarily include public breeding groups, whereas others are more mixed. These systems must adapt to global change in climate and land use, the emergence of new diseases, and disruptive breeding technologies. Research priorities to support policy include how best to maintain both diversity and redundancy in the roles played by individual crop breeding groups (public versus private and global versus local), and how best to manage connectivity to optimize resistance gene deployment while avoiding risks to the useful life of resistance genes. [Formula: see text] Copyright © 2017 The Author(s). This is an open access article distributed under the CC BY 4.0 International license .

  9. Study of the Rare Decay B0 to pi0 pi0 at BaBar

    Energy Technology Data Exchange (ETDEWEB)

    Bowerman, Daniel

    2003-08-20

    The BABAR experiment operating at the PEP-II e{sup +}e{sup -} collider is designed to study CP violation effects in the B-meson system. From May 1999 to June 2002 approximately 81 fb{sup -1} of data have been collected at the {Upsilon}(4S) resonance, containing (87.9 {+-} 1.4) Million BB pairs. From this data sample the branching fraction for the decay B{sup 0} {yields} {pi}{sup 0}{pi}{sup 0} has been extracted using a multi-dimensional maximum likelihood technique. With an efficiency of 20.4%, we find 36{sub -14-1}{sup +15+1} B{sup 0} {yields} {pi}{sup 0}{pi}{sup 0} events and measure the branching fraction to be {Beta}(B{sup 0} {yields} {pi}{sup 0}{pi}{sup 0}) = (2.0{sub -0.8-0.2}{sup +0.9+0.3}) x 10{sup -6} where the first error is statistical and the second systematic. The statistical significance is 3.1{sigma} and we report an upper limit of {Beta}(B{sup 0} {yields} {pi}{sup 0}{pi}{sup 0}) < 3.6 x 10{sup -6} (90%CL). The results of the fit are confirmed using a simple cut based analysis technique.

  10. Identification of Differentially-Expressed Genes in Response to Mycosphaerella fijiensis in the Resistant Musa Accession 'Calcutta-4' Using Suppression Subtractive Hybridization.

    Science.gov (United States)

    Sánchez Timm, Eduardo; Hidalgo Pardo, Lisette; Pacheco Coello, Ricardo; Chávez Navarrete, Tatiana; Navarrete Villegas, Oscar; Santos Ordóñez, Efrén

    2016-01-01

    Bananas and plantains are considered an important crop around the world. Banana production is affected by several constraints, of which Black Sigatoka Disease, caused by the fungus Mycosphaerella fijiensis, is considered one of the most important diseases in banana plantations. The banana accession 'Calcutta-4' has a natural resistance to Black Sigatoka; however, the fruit is not valuable for commercialization. Gene identification and expression studies in 'Calcutta-4' might reveal possible gene candidates for resistant to the disease and elucidate mechanisms for resistance. A subtracted cDNA library was generated from leaves after 6, 9 and 12 days inoculated with M. fijiensis conidia on greenhouse banana plants of the accession 'Calcutta-4'. Bioinformatic analysis revealed 99 good quality sequences. Blast2go analysis revealed that 31% of the sequences could not be categorized and, according to the Biological Process Category, 32 and 28 ESTs are related to general metabolic and cellular processes, respectively; while 10 ESTs response to stimulus. Seven sequences were redundant and one was similar to genes that may be involved in pathogen resistance including the putative disease resistance protein RGA1. Genes encoding zinc finger domains were identified and may play an important role in pathogen resistance by inducing the expression of downstream genes. Expression analysis of four selected genes was performed using RT-qPCR during the early stage of the disease development at 6, 9, 12 and 15 days post inoculation showing a peak of up regulation at 9 or 12 days post inoculation. Three of the four genes showed an up-regulation of expression in 'Calcutta-4' when compared to 'Williams' after inoculation with M. fijiensis, suggesting a fine regulation of specific gene candidates that may lead to a resistance response. The genes identified in early responses in a plant-pathogen interaction may be relevant for the resistance response of 'Calcutta-4' to Black Sigatoka

  11. Identification of Differentially-Expressed Genes in Response to Mycosphaerella fijiensis in the Resistant Musa Accession 'Calcutta-4' Using Suppression Subtractive Hybridization.

    Directory of Open Access Journals (Sweden)

    Eduardo Sánchez Timm

    Full Text Available Bananas and plantains are considered an important crop around the world. Banana production is affected by several constraints, of which Black Sigatoka Disease, caused by the fungus Mycosphaerella fijiensis, is considered one of the most important diseases in banana plantations. The banana accession 'Calcutta-4' has a natural resistance to Black Sigatoka; however, the fruit is not valuable for commercialization. Gene identification and expression studies in 'Calcutta-4' might reveal possible gene candidates for resistant to the disease and elucidate mechanisms for resistance. A subtracted cDNA library was generated from leaves after 6, 9 and 12 days inoculated with M. fijiensis conidia on greenhouse banana plants of the accession 'Calcutta-4'. Bioinformatic analysis revealed 99 good quality sequences. Blast2go analysis revealed that 31% of the sequences could not be categorized and, according to the Biological Process Category, 32 and 28 ESTs are related to general metabolic and cellular processes, respectively; while 10 ESTs response to stimulus. Seven sequences were redundant and one was similar to genes that may be involved in pathogen resistance including the putative disease resistance protein RGA1. Genes encoding zinc finger domains were identified and may play an important role in pathogen resistance by inducing the expression of downstream genes. Expression analysis of four selected genes was performed using RT-qPCR during the early stage of the disease development at 6, 9, 12 and 15 days post inoculation showing a peak of up regulation at 9 or 12 days post inoculation. Three of the four genes showed an up-regulation of expression in 'Calcutta-4' when compared to 'Williams' after inoculation with M. fijiensis, suggesting a fine regulation of specific gene candidates that may lead to a resistance response. The genes identified in early responses in a plant-pathogen interaction may be relevant for the resistance response of 'Calcutta-4' to

  12. Study of $B^{0} \\rightarrow D^{*-}\\pi^{+}\\pi^{-}\\pi^{+}$ and $B^{0} \\rightarrow D^{*-}K^{+}\\pi^{-}\\pi^{+}$ decays

    CERN Document Server

    Aaij, R; Adametz, A; Adeva, B; Adinolfi, M; Adrover, C; Affolder, A; Ajaltouni, Z; Albrecht, J; Alessio, F; Alexander, M; Ali, S; Alkhazov, G; Alvarez Cartelle, P; Alves Jr, A A; Amato, S; Amhis, Y; Anderlini, L; Anderson, J; Andreassen, R; Appleby, R B; Aquines Gutierrez, O; Archilli, F; Artamonov, A; Artuso, M; Aslanides, E; Auriemma, G; Bachmann, S; Back, J J; Baesso, C; Balagura, V; Baldini, W; Barlow, R J; Barschel, C; Barsuk, S; Barter, W; Bauer, Th; Bay, A; Beddow, J; Bediaga, I; Belogurov, S; Belous, K; Belyaev, I; Ben-Haim, E; Benayoun, M; Bencivenni, G; Benson, S; Benton, J; Berezhnoy, A; Bernet, R; Bettler, M -O; van Beuzekom, M; Bien, A; Bifani, S; Bird, T; Bizzeti, A; Bjørnstad, P M; Blake, T; Blanc, F; Blanks, C; Blouw, J; Blusk, S; Bobrov, A; Bocci, V; Bondar, A; Bondar, N; Bonivento, W; Borghi, S; Borgia, A; Bowcock, T J V; Bowen, E; Bozzi, C; Brambach, T; van den Brand, J; Bressieux, J; Brett, D; Britsch, M; Britton, T; Brook, N H; Brown, H; Burducea, I; Bursche, A; Buytaert, J; Cadeddu, S; Callot, O; Calvi, M; Calvo Gomez, M; Camboni, A; Campana, P; Carbone, A; Carboni, G; Cardinale, R; Cardini, A; Carranza-Mejia, H; Carson, L; Carvalho Akiba, K; Casse, G; Cattaneo, M; Cauet, Ch; Charles, M; Charpentier, Ph; Chen, P; Chiapolini, N; Chrzaszcz, M; Ciba, K; Cid Vidal, X; Ciezarek, G; Clarke, P E L; Clemencic, M; Cliff, H V; Closier, J; Coca, C; Coco, V; Cogan, J; Cogneras, E; Collins, P; Comerma-Montells, A; Contu, A; Cook, A; Coombes, M; Coquereau, S; Corti, G; Couturier, B; Cowan, G A; Craik, D; Cunliffe, S; Currie, R; D'Ambrosio, C; David, P; David, P N Y; De Bonis, I; De Bruyn, K; De Capua, S; De Cian, M; De Miranda, J M; De Paula, L; De Silva, W; De Simone, P; Decamp, D; Deckenhoff, M; Degaudenzi, H; Del Buono, L; Deplano, C; Derkach, D; Deschamps, O; Dettori, F; Di Canto, A; Dickens, J; Dijkstra, H; Dogaru, M; Domingo Bonal, F; Donleavy, S; Dordei, F; Dosil Suárez, A; Dossett, D; Dovbnya, A; Dupertuis, F; Dzhelyadin, R; Dziurda, A; Dzyuba, A; Easo, S; Egede, U; Egorychev, V; Eidelman, S; van Eijk, D; Eisenhardt, S; Eitschberger, U; Ekelhof, R; Eklund, L; El Rifai, I; Elsasser, Ch; Elsby, D; Falabella, A; Färber, C; Fardell, G; Farinelli, C; Farry, S; Fave, V; Ferguson, D; Fernandez Albor, V; Ferreira Rodrigues, F; Ferro-Luzzi, M; Filippov, S; Fitzpatrick, C; Fontana, M; Fontanelli, F; Forty, R; Francisco, O; Frank, M; Frei, C; Frosini, M; Furcas, S; Furfaro, E; Gallas Torreira, A; Galli, D; Gandelman, M; Gandini, P; Gao, Y; Garofoli, J; Garosi, P; Garra Tico, J; Garrido, L; Gaspar, C; Gauld, R; Gersabeck, E; Gersabeck, M; Gershon, T; Ghez, Ph; Gibson, V; Gligorov, V V; Göbel, C; Golubkov, D; Golutvin, A; Gomes, A; Gordon, H; Grabalosa Gándara, M; Graciani Diaz, R; Granado Cardoso, L A; Graugés, E; Graziani, G; Grecu, A; Greening, E; Gregson, S; Grünberg, O; Gui, B; Gushchin, E; Guz, Yu; Gys, T; Hadjivasiliou, C; Haefeli, G; Haen, C; Haines, S C; Hall, S; Hampson, T; Hansmann-Menzemer, S; Harnew, N; Harnew, S T; Harrison, J; Harrison, P F; Hartmann, T; He, J; Heijne, V; Hennessy, K; Henrard, P; Hernando Morata, J A; van Herwijnen, E; Hicks, E; Hill, D; Hoballah, M; Hombach, C; Hopchev, P; Hulsbergen, W; Hunt, P; Huse, T; Hussain, N; Hutchcroft, D; Hynds, D; Iakovenko, V; Ilten, P; Jacobsson, R; Jaeger, A; Jans, E; Jansen, F; Jaton, P; Jing, F; John, M; Johnson, D; Jones, C R; Jost, B; Kaballo, M; Kandybei, S; Karacson, M; Karbach, T M; Kenyon, I R; Kerzel, U; Ketel, T; Keune, A; Khanji, B; Kochebina, O; Komarov, I; Koopman, R F; Koppenburg, P; Korolev, M; Kozlinskiy, A; Kravchuk, L; Kreplin, K; Kreps, M; Krocker, G; Krokovny, P; Kruse, F; Kucharczyk, M; Kudryavtsev, V; Kvaratskheliya, T; La Thi, V N; Lacarrere, D; Lafferty, G; Lai, A; Lambert, D; Lambert, R W; Lanciotti, E; Lanfranchi, G; Langenbruch, C; Latham, T; Lazzeroni, C; Le Gac, R; van Leerdam, J; Lees, J -P; Lefèvre, R; Leflat, A; Lefrançois, J; Leroy, O; Li, Y; Li Gioi, L; Liles, M; Lindner, R; Linn, C; Liu, B; Liu, G; von Loeben, J; Lopes, J H; Lopez Asamar, E; Lopez-March, N; Lu, H; Luisier, J; Luo, H; Machefert, F; Machikhiliyan, I V; Maciuc, F; Maev, O; Malde, S; Manca, G; Mancinelli, G; Mangiafave, N; Marconi, U; Märki, R; Marks, J; Martellotti, G; Martens, A; Martin, L; Martín Sánchez, A; Martinelli, M; Martinez Santos, D; Martins Tostes, D; Massafferri, A; Matev, R; Mathe, Z; Matteuzzi, C; Matveev, M; Maurice, E; Mazurov, A; McCarthy, J; McNulty, R; Meadows, B; Meier, F; Meissner, M; Merk, M; Milanes, D A; Minard, M -N; Molina Rodriguez, J; Monteil, S; Moran, D; Morawski, P; Mountain, R; Mous, I; Muheim, F; Müller, K; Muresan, R; Muryn, B; Muster, B; Naik, P; Nakada, T; Nandakumar, R; Nasteva, I; Needham, M; Neufeld, N; Nguyen, A D; Nguyen, T D; Nguyen-Mau, C; Nicol, M; Niess, V; Niet, R; Nikitin, N; Nikodem, T; Nisar, S; Nomerotski, A; Novoselov, A; Oblakowska-Mucha, A; Obraztsov, V; Oggero, S; Ogilvy, S; Okhrimenko, O; Oldeman, R; Orlandea, M; Otalora Goicochea, J M; Owen, P; Pal, B K; Palano, A; Palutan, M; Panman, J; Papanestis, A; Pappagallo, M; Parkes, C; Parkinson, C J; Passaleva, G; Patel, G D; Patel, M; Patrick, G N; Patrignani, C; Pavel-Nicorescu, C; Pazos Alvarez, A; Pellegrino, A; Penso, G; Pepe Altarelli, M; Perazzini, S; Perego, D L; Perez Trigo, E; Pérez-Calero Yzquierdo, A; Perret, P; Perrin-Terrin, M; Pessina, G; Petridis, K; Petrolini, A; Phan, A; Picatoste Olloqui, E; Pietrzyk, B; Pilař, T; Pinci, D; Playfer, S; Plo Casasus, M; Polci, F; Polok, G; Poluektov, A; Polycarpo, E; Popov, D; Popovici, B; Potterat, C; Powell, A; Prisciandaro, J; Pugatch, V; Puig Navarro, A; Qian, W; Rademacker, J H; Rakotomiaramanana, B; Rangel, M S; Raniuk, I; Rauschmayr, N; Raven, G; Redford, S; Reid, M M; dos Reis, A C; Ricciardi, S; Richards, A; Rinnert, K; Rives Molina, V; Roa Romero, D A; Robbe, P; Rodrigues, E; Rodriguez Perez, P; Rogers, G J; Roiser, S; Romanovsky, V; Romero Vidal, A; Rouvinet, J; Ruf, T; Ruiz, H; Sabatino, G; Saborido Silva, J J; Sagidova, N; Sail, P; Saitta, B; Salzmann, C; Sanmartin Sedes, B; Sannino, M; Santacesaria, R; Santamarina Rios, C; Santovetti, E; Sapunov, M; Sarti, A; Satriano, C; Satta, A; Savrie, M; Savrina, D; Schaack, P; Schiller, M; Schindler, H; Schleich, S; Schlupp, M; Schmelling, M; Schmidt, B; Schneider, O; Schopper, A; Schune, M -H; Schwemmer, R; Sciascia, B; Sciubba, A; Seco, M; Semennikov, A; Senderowska, K; Sepp, I; Serra, N; Serrano, J; Seyfert, P; Shapkin, M; Shapoval, I; Shatalov, P; Shcheglov, Y; Shears, T; Shekhtman, L; Shevchenko, O; Shevchenko, V; Shires, A; Silva Coutinho, R; Skwarnicki, T; Smith, N A; Smith, E; Smith, M; Sobczak, K; Sokoloff, M D; Soler, F J P; Soomro, F; Souza, D; Souza De Paula, B; Spaan, B; Sparkes, A; Spradlin, P; Stagni, F; Stahl, S; Steinkamp, O; Stoica, S; Stone, S; Storaci, B; Straticiuc, M; Straumann, U; Subbiah, V K; Swientek, S; Syropoulos, V; Szczekowski, M; Szczypka, P; Szumlak, T; T'Jampens, S; Teklishyn, M; Teodorescu, E; Teubert, F; Thomas, C; Thomas, E; van Tilburg, J; Tisserand, V; Tobin, M; Tolk, S; Tonelli, D; Topp-Joergensen, S; Torr, N; Tournefier, E; Tourneur, S; Tran, M T; Tresch, M; Tsaregorodtsev, A; Tsopelas, P; Tuning, N; Ubeda Garcia, M; Ukleja, A; Urner, D; Uwer, U; Vagnoni, V; Valenti, G; Vazquez Gomez, R; Vazquez Regueiro, P; Vecchi, S; Velthuis, J J; Veltri, M; Veneziano, G; Vesterinen, M; Viaud, B; Vieira, D; Vilasis-Cardona, X; Vollhardt, A; Volyanskyy, D; Voong, D; Vorobyev, A; Vorobyev, V; Voß, C; Voss, H; Waldi, R; Wallace, R; Wandernoth, S; Wang, J; Ward, D R; Watson, N K; Webber, A D; Websdale, D; Whitehead, M; Wicht, J; Wiechczynski, J; Wiedner, D; Wiggers, L; Wilkinson, G; Williams, M P; Williams, M; Wilson, F F; Wishahi, J; Witek, M; Wotton, S A; Wright, S; Wu, S; Wyllie, K; Xie, Y; Xing, F; Xing, Z; Yang, Z; Young, R; Yuan, X; Yushchenko, O; Zangoli, M; Zavertyaev, M; Zhang, F; Zhang, L; Zhang, W C; Zhang, Y; Zhelezov, A; Zhong, L; Zvyagin, A

    2013-01-01

    Using proton-proton collision data collected by the LHCb experiment at $\\sqrt{s} =$ 7 TeV, corresponding to an integrated luminosity of 1.0 fb$^{-1}$, the ratio of branching fractions of the $B^{0}\\rightarrow D^{*-}\\pi^{+}\\pi^{-}\\pi^{+}$ decay relative to the $B^{0} \\rightarrow D^{*-}\\pi^{+}$ decay is measured to be \\begin{equation*} \\frac{\\mathcal{B}(B^{0}\\rightarrow D^{*-}\\pi^{+}\\pi^{-}\\pi^{+})}{\\mathcal{B}(B^{0} \\rightarrow D^{*-}\\pi^{+})} = 2.64 \\pm 0.04\\,(\\text{stat.}) \\pm 0.13\\,(\\text{syst.})\\, . \\label{eq:CF_BF_ratio_result} \\end{equation*} The Cabibbo-suppressed decay $B^{0}\\rightarrow D^{*-}K^{+}\\pi^{-}\\pi^{+}$ is observed for the first time and the measured ratio of branching fractions is \\begin{equation*} \\frac{\\mathcal{B}(B^{0}\\rightarrow D^{*-}K^{+}\\pi^{-}\\pi^{+})}{\\mathcal{B}(B^{0} \\rightarrow D^{*-}\\pi^{+}\\pi^{-}\\pi^{+})} = (6.47 \\pm 0.37\\,(\\text{stat.}) \\pm 0.35\\,(\\text{syst.})) \\times 10^{-2} \\label{eq:CS_BF_ratio_result}\\, . \\end{equation*} A search for orbital excitations of charm mesons co...

  13. Major Gene for Field Stem Rust Resistance Co-Locates with Resistance Gene Sr12 in ‘Thatcher’ Wheat

    Science.gov (United States)

    Hiebert, Colin W.; Kolmer, James A.; McCartney, Curt A.; Briggs, Jordan; Fetch, Tom; Bariana, Harbans; Choulet, Frederic; Rouse, Matthew N.; Spielmeyer, Wolfgang

    2016-01-01

    Stem rust, caused by Puccinia graminis (Pgt), is a damaging disease of wheat that can be controlled by utilizing effective stem rust resistance genes. ‘Thatcher’ wheat carries complex resistance to stem rust that is enhanced in the presence of the resistance gene Lr34. The purpose of this study was to examine APR in ‘Thatcher’ and look for genetic interactions with Lr34. A RIL population was tested for stem rust resistance in field nurseries in Canada, USA, and Kenya. BSA was used to find SNP markers associated with reduced stem rust severity. A major QTL was identified on chromosome 3BL near the centromere in all environments. Seedling testing showed that Sr12 mapped to the same region as the QTL for APR. The SNP markers were physically mapped and the region carrying the resistance was searched for sequences with homology to members of the NB-LRR resistance gene family. SNP marker from one NB-LRR-like sequence, NB-LRR3 co-segregated with Sr12. Two additional populations, including one that lacked Lr34, were tested in field nurseries. NB-LRR3 mapped near the maximum LOD for reduction in stem rust severity in both populations. Lines from a population that segregated for Sr12 and Lr34 were tested for seedling Pgt biomass and infection type, as well as APR to field stem rust which showed an interaction between the genes. We concluded that Sr12, or a gene closely linked to Sr12, was responsible for ‘Thatcher’-derived APR in several environments and this resistance was enhanced in the presence of Lr34. PMID:27309724

  14. Search for Long-Lived States of $\\pi^+\\pi^-$ Atoms Addendum to the DIRAC Proposal

    CERN Document Server

    Adeva, B; Amsler, C; Anania, A; Aogaki, S; Augsten, K; Benelli, A; Brekhovskikh, V; Cechak, T; Chiba, M; Ciortea, C; Ciocarlan, C; Constantinescu, S; Curceanu, C; Doskarova, P; Dudarev, A; Dumitriu, D; Drijard, D; Enulescu, A; Fluerasu, D; Gortchakov, O; Gritsay, K; Guaraldo, C; Gugiu, M; Hansroul, M; Hosek, R; Hons, Z; Karpukhin, V; Kluson, J; Kobayashi, M; Kulikov, A; Kulish, E; Kuptsov, A; Kruglov, V; Kruglova, L; Kuroda, K; Lamberto, A; Lednicky, R; Martincik, J; Nemenov, L; Nikitin, M; Okada, K; Pentia, M; Plo, M; Prusa, P; Rappazzo, G; Ryazantsev, A; Romero, A; Ronzhin, V; Rykalin, V; Saborido, J; Schacher, J; Shlyapnikov, P; Smolik, J; Takeutchi, F; Tarasov, A; Trojek, T; Urban, T; Vrba, T; Vazquez, P; Yazkov, V; Yoshimura, Y; Zhabitsky, M; Zrelov, P

    2011-01-01

    The proposed experiment is a further development of the DIRAC experiment already running at CERN PS. Up to now more than 21000 $\\pi^+\\pi^-$ pairs originated from the $\\pi^+\\pi^-$ atom ($A_{2\\pi}$) breakup were identified and the overall accuracy of the $A_{2\\pi}$ lifetime is about 9% in accordance with the DIRAC proposal. This measurement allowed to extract the difference $|a_0-a_2|$ of $s$-wave $\\pi\\pi$-scattering length with accuracy of 4.3%. The observation of long-lived (metastable) $A_{2\\pi}$ states will be performed with the same setup. This observation opens a possibility to measure the energy difference between $ns$ and $np$ states and to determine the value of another combination $2a_0+a_2$ of $\\pi\\pi$ scattering length in a model-independent way. In combination with the first measurement it allows to get $a_0$ and $a_2$ separately. An additional measurement of the multiple scattering angles in different materials with accuracy better than 1% will be performed in parallel with the observation. This m...

  15. First determination of the $CP$ content of $D \\to \\pi^+\\pi^-\\pi^+\\pi^-$ and updated determination of the $CP$ contents of $D \\to \\pi^+\\pi^-\\pi^0$ and $D \\to K^+K^-\\pi^0$

    CERN Document Server

    Malde, S; Wilkinson, G; Naik, P; Prouve, C; Rademacker, J; Libby, J; Nayak, M; Gershon, T; Briere, R A

    2015-01-01

    Quantum-correlated $\\psi(3770) \\to D\\bar{D}$ decays collected by the CLEO-c experiment are used to perform a first measurement of $F_+^{4\\pi}$, the fractional $CP$-even content of the self-conjugate decay $D \\to \\pi^+\\pi^-\\pi^+\\pi^-$, obtaining a value of $0.737 \\pm 0.028$. An important input to the measurement comes from the use of $D \\to K^0_{\\rm S}\\pi^+\\pi^-$ and $D \\to K^0_{\\rm L}\\pi^+\\pi^-$ decays to tag the signal mode. This same technique is applied to the channels $D \\to\\pi^+\\pi^-\\pi^0$ and $D \\to K^+K^-\\pi^0$, yielding $F_+^{\\pi\\pi\\pi^0} = 1.014 \\pm 0.045 \\pm 0.022$ and $F_+^{KK\\pi^0} = 0.734 \\pm 0.106 \\pm 0.054$, where the first uncertainty is statistical and the second systematic. These measurements are consistent with those of an earlier analysis, based on $CP$-eigenstate tags, and can be combined to give values of $F_+^{\\pi\\pi\\pi^0} = 0.973 \\pm 0.017$ and $F_+^{KK\\pi^0} = 0.732 \\pm 0.055$. The results will enable the three modes to be included in a model-independent manner in measurements of the ...

  16. Influence of ethacrynic acid on glutathione S-transferase pi transcript and protein half-lives in human colon cancer cells.

    Science.gov (United States)

    Shen, H; Ranganathan, S; Kuzmich, S; Tew, K D

    1995-10-12

    Ethacrynic acid (EA) is a plant phenolic acid that is both an inhibitor and an inducer of glutathione S-transferase (GST) activity. To determine contributory factors in the increased GST activity caused by EA treatment, human colon carcinoma HT29 cells were compared with a cloned EA-resistant population (HT6-8) maintained in medium containing 72 microM EA. Several factors are involved in the increased expression of GST pi in HT6-8. For example, nuclear run-on experiments showed an approximately 2-fold increase in the rate of transcription of GST pi. In addition, the half-life of GST pi transcript was increased from 4.1 (wild type, HT29, HT4-1) to 8.4 hr. The half-life of GST pi protein was 1-2 hr in HT4-1 cells versus 8-9 hr in HT6-8 cells. When either human ovarian carcinoma cells (SKOV3) or human prostatic carcinoma cells (DU145) were treated with EA, the half-life of the GST pi transcript was also increased. The transcript half-lives of another thiol-metabolism enzyme, gamma-glutamylcysteine synthetase (gamma-GCS), and a phase II detoxification enzyme, dihydrodiol dehydrogenase (DDH), were also increased in HT6-8, SKOV3 and DU145 cells treated with EA. However, the half-lives of transcripts from "housekeeping genes," such as glyceraldehyde 3-phosphate dehydrogenase (G3PDH), beta-actin and beta-tubulin, were not changed in these cell lines following EA. Apparently, a number of coordinated factors are involved in EA-enhanced expression of GST pi and other detoxification enzymes.

  17. Adventures in Raspberry Pi

    CERN Document Server

    Philbin, Carrie Anne

    2015-01-01

    Start programming quickly with this super-fun guide to Raspberry Pi Adventures in Raspberry Pi, 2nd Edition includes 9 cool projects that show you how to set up and start developing on your Raspberry Pi. Updated for the release of the Rev 3 board, this second edition covers all the latest features and tells you everything you need to know. Written specifically for 11-15 year-olds, this book uses the wildly successful, Raspberry Pi to explain the fundamentals of computing. You'll have a blast learning basic programming and system administration skills, beginning with the very basics of how to p

  18. Observation of B+ -> J/psi 3 pi(+)2 pi(-) and B+ -> psi (2S)pi(+)pi(+)pi(-) decays

    OpenAIRE

    Aaij, R.; Adeva, B.; Adinolfi, M.; Ajaltouni, Z.; Akar, S.; Albrecht, J.; Alessio, F.; Alexander, M. H.; Ali, S.; Alkhazov, G.; Cartelle, P. Alvarez; Alves, A. A. Jr; Amato, S.; Amerio, S.; Amhis, Y.

    2017-01-01

    The decays B+-> J/psi 3 pi(+)2 pi(-) and B+ -> psi(2S)pi(+)pi(+)pi(-) are observed for the first time using a data sample corresponding to an integrated luminosity of 3.0 fb(-1), collected by the LHCb experiment in proton- proton collisions at the centre-of-mass energies of 7 and 8 TeV. The branching fractions relative to that of B+ -> psi(2S)K+ are measured to be B(B+-> J/psi 3 pi(+)2 pi(-))/B(B+ -> psi (2S)K+) = (1.88 +/- 0.17 +/- 0.09)x10(-2). B(B+ -> psi(2S)pi(+)pi(+)pi(-))/B(B+ -> psi (2...

  19. Identification of a rice gene (Bph 1) conferring resistance to brown planthopper (Nilaparvata lugens Stal) using STS markers.

    Science.gov (United States)

    Kim, Suk-Man; Sohn, Jae-Keun

    2005-08-31

    This study was carried out to identify a high-resolution marker for a gene conferring resistance to brown planthopper (BPH) biotype 1, using japonica type resistant lines. Bulked segregant analyses were conducted using 520 RAPD primers to identify RAPD fragments linked to the BPH resistance gene. Eleven RAPDs were shown to be polymorphic amplicons between resistant and susceptible progeny. One of these primers, OPE 18, which amplified a 923 bp band tightly linked to resistance, was converted into a sequence-tagged-site (STS) marker. The STS marker, BpE18-3, was easily detectable as a dominant band with tight linkage (3.9cM) to Bph1. It promises to be useful as a marker for assisted selection of resistant progeny in backcross breeding programs to introgress the resistance gene into elite japonica cultivars.

  20. Measurement of the ratios of branching fractions B(B0s --> Ds- pi+ pi+ pi-)/B(B0-->D- pi+ pi+ pi-) and B(B0s --> Ds- pi+)/B(B0-->D- pi+).

    Science.gov (United States)

    Abulencia, A; Adelman, J; Affolder, T; Akimoto, T; Albrow, M G; Ambrose, D; Amerio, S; Amidei, D; Anastassov, A; Anikeev, K; Annovi, A; Antos, J; Aoki, M; Apollinari, G; Arguin, J-F; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Azfar, F; Azzi-Bacchetta, P; Azzurri, P; Bacchetta, N; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Baroiant, S; Bartsch, V; Bauer, G; Bedeschi, F; Behari, S; Belforte, S; Bellettini, G; Bellinger, J; Belloni, A; Benjamin, D; Beretvas, A; Beringer, J; Berry, T; Bhatti, A; Binkley, M; Bisello, D; Blair, R E; Blocker, C; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bolla, G; Bolshov, A; Bortoletto, D; Boudreau, J; Boveia, A; Brau, B; Brigliadori, L; Bromberg, C; Brubaker, E; Budagov, J; Budd, H S; Budd, S; Budroni, S; Burkett, K; Busetto, G; Bussey, P; Byrum, K L; Cabrera, S; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carillo, S; Carlsmith, D; Carosi, R; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chang, S H; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, I; Cho, K; Chokheli, D; Chou, J P; Choudalakis, G; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Ciljak, M; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Coca, M; Compostella, G; Convery, M E; Conway, J; Cooper, B; Copic, K; Cordelli, M; Cortiana, G; Crescioli, F; Cuenca Almenar, C; Cuevas, J; Culbertson, R; Cully, J C; Cyr, D; DaRonco, S; D'Auria, S; Davies, T; D'Onofrio, M; Dagenhart, D; de Barbaro, P; De Cecco, S; Deisher, A; De Lentdecker, G; Dell'Orso, M; Delli Paoli, F; Demortier, L; Deng, J; Deninno, M; De Pedis, D; Derwent, P F; Di Giovanni, G P; Dionisi, C; Di Ruzza, B; Dittmann, J R; Dituro, P; Dörr, C; Donati, S; Donega, M; Dong, P; Donini, J; Dorigo, T; Dube, S; Efron, J; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, I; Fedorko, W T; Feild, R G; Feindt, M; Fernandez, J P; Field, R; Flanagan, G; Foland, A; Forrester, S; Foster, G W; Franklin, M; Freeman, J C; Furic, I; Gallinaro, M; Galyardt, J; Garcia, J E; Garberson, F; Garfinkel, A F; Gay, C; Gerberich, H; Gerdes, D; Giagu, S; Giannetti, P; Gibson, A; Gibson, K; Gimmell, J L; Ginsburg, C; Giokaris, N; Giordani, M; Giromini, P; Giunta, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Goldstein, J; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Goulianos, K; Gresele, A; Griffiths, M; Grinstein, S; Grosso-Pilcher, C; Grundler, U; Guimaraes da Costa, J; Gunay-Unalan, Z; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Hamilton, A; Han, B-Y; Han, J Y; Handler, R; Happacher, F; Hara, K; Hare, M; Harper, S; Harr, R F; Harris, R M; Hartz, M; Hatakeyama, K; Hauser, J; Heijboer, A; Heinemann, B; Heinrich, J; Henderson, C; Herndon, M; Heuser, J; Hidas, D; Hill, C S; Hirschbuehl, D; Hocker, A; Holloway, A; Hou, S; Houlden, M; Hsu, S-C; Huffman, B T; Hughes, R E; Husemann, U; Huston, J; Incandela, J; Introzzi, G; Iori, M; Ishizawa, Y; Ivanov, A; Iyutin, B; James, E; Jang, D; Jayatilaka, B; Jeans, D; Jensen, H; Jeon, E J; Jindariani, S; Jones, M; Joo, K K; Jun, S Y; Jung, J E; Junk, T R; Kamon, T; Karchin, P E; Kato, Y; Kemp, Y; Kephart, R; Kerzel, U; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kimura, N; Kirsch, L; Klimenko, S; Klute, M; Knuteson, B; Ko, B R; Kondo, K; Kong, D J; Konigsberg, J; Korytov, A; Kotwal, A V; Kovalev, A; Kraan, A C; Kraus, J; Kravchenko, I; Kreps, M; Kroll, J; Krumnack, N; Kruse, M; Krutelyov, V; Kubo, T; Kuhlmann, S E; Kuhr, T; Kusakabe, Y; Kwang, S; Laasanen, A T; Lai, S; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; LeCompte, T; Lee, J; Lee, J; Lee, Y J; Lee, S W; Lefèvre, R; Leonardo, N; Leone, S; Levy, S; Lewis, J D; Lin, C; Lin, C S; Lindgren, M; Lipeles, E; Lister, A; Litvintsev, D O; Liu, T; Lockyer, N S; Loginov, A; Loreti, M; Loverre, P; Lu, R-S; Lucchesi, D; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Lytken, E; Mack, P; MacQueen, D; Madrak, R; Maeshima, K; Makhoul, K; Maki, T; Maksimovic, P; Malde, S; Manca, G; Margaroli, F; Marginean, R; Marino, C; Marino, C P; Martin, A; Martin, M; Martin, V; Martínez, M; Maruyama, T; Mastrandrea, P; Masubuchi, T; Matsunaga, H; Mattson, M E; Mazini, R; Mazzanti, P; McFarland, K S; McIntyre, P; McNulty, R; Mehta, A; Mehtala, P; Menzemer, S; Menzione, A; Merkel, P; Mesropian, C; Messina, A; Miao, T; Miladinovic, N; Miles, J; Miller, R; Mills, C; Milnik, M; Mitra, A; Mitselmakher, G; Miyamoto, A; Moed, S; Moggi, N; Mohr, B; Moore, R; Morello, M; Movilla Fernandez, P; Mülmenstädt, J; Mukherjee, A; Muller, Th; Mumford, R; Murat, P; Nachtman, J; Nagano, A; Naganoma, J; Nakano, I; Napier, A; Necula, V; Neu, C; Neubauer, M S; Nielsen, J; Nigmanov, T; Nodulman, L; Norniella, O; Nurse, E; Oh, S H; Oh, Y D; Oksuzian, I; Okusawa, T; Oldeman, R; Orava, R; Osterberg, K; Pagliarone, C; Palencia, E; Papadimitriou, V; Paramonov, A A; Parks, B; Pashapour, S; Patrick, J; Pauletta, G; Paulini, M; Paus, C; Pellett, D E; Penzo, A; Phillips, T J; Piacentino, G; Piedra, J; Pinera, L; Pitts, K; Plager, C; Pondrom, L; Portell, X; Poukhov, O; Pounder, N; Prakoshyn, F; Pronko, A; Proudfoot, J; Ptohos, F; Punzi, G; Pursley, J; Rademacker, J; Rahaman, A; Ranjan, N; Rappoccio, S; Reisert, B; Rekovic, V; Renton, P; Rescigno, M; Richter, S; Rimondi, F; Ristori, L; Robson, A; Rodrigo, T; Rogers, E; Rolli, S; Roser, R; Rossi, M; Rossin, R; Ruiz, A; Russ, J; Rusu, V; Saarikko, H; Sabik, S; Safonov, A; Sakumoto, W K; Salamanna, G; Saltó, O; Saltzberg, D; Sánchez, C; Santi, L; Sarkar, S; Sartori, L; Sato, K; Savard, P; Savoy-Navarro, A; Scheidle, T; Schlabach, P; Schmidt, E E; Schmidt, M P; Schmitt, M; Schwarz, T; Scodellaro, L; Scott, A L; Scribano, A; Scuri, F; Sedov, A; Seidel, S; Seiya, Y; Semenov, A; Sexton-Kennedy, L; Sfyrla, A; Shapiro, M D; Shears, T; Shepard, P F; Sherman, D; Shimojima, M; Shochet, M; Shon, Y; Shreyber, I; Sidoti, A; Sinervo, P; Sisakyan, A; Sjolin, J; Slaughter, A J; Slaunwhite, J; Sliwa, K; Smith, J R; Snider, F D; Snihur, R; Soderberg, M; Soha, A; Somalwar, S; Sorin, V; Spalding, J; Spinella, F; Spreitzer, T; Squillacioti, P; Stanitzki, M; Staveris-Polykalas, A; St Denis, R; Stelzer, B; Stelzer-Chilton, O; Stentz, D; Strologas, J; Stuart, D; Suh, J S; Sukhanov, A; Sun, H; Suzuki, T; Taffard, A; Takashima, R; Takeuchi, Y; Takikawa, K; Tanaka, M; Tanaka, R; Tecchio, M; Teng, P K; Terashi, K; Thom, J; Thompson, A S; Thomson, E; Tipton, P; Tiwari, V; Tkaczyk, S; Toback, D; Tokar, S; Tollefson, K; Tomura, T; Tonelli, D; Torre, S; Torretta, D; Tourneur, S; Trischuk, W; Tsuchiya, R; Tsuno, S; Turini, N; Ukegawa, F; Unverhau, T; Uozumi, S; Usynin, D; Vallecorsa, S; van Remortel, N; Varganov, A; Vataga, E; Vázquez, F; Velev, G; Veramendi, G; Veszpremi, V; Vidal, R; Vila, I; Vilar, R; Vine, T; Vollrath, I; Volobouev, I; Volpi, G; Würthwein, F; Wagner, P; Wagner, R G; Wagner, R L; Wagner, J; Wagner, W; Wallny, R; Wang, S M; Warburton, A; Waschke, S; Waters, D; Wester, W C; Whitehouse, B; Whiteson, D; Wicklund, A B; Wicklund, E; Williams, G; Williams, H H; Wilson, P; Winer, B L; Wittich, P; Wolbers, S; Wolfe, C; Wright, T; Wu, X; Wynne, S M; Yagil, A; Yamamoto, K; Yamaoka, J; Yamashita, T; Yang, C; Yang, U K; Yang, Y C; Yao, W M; Yeh, G P; Yoh, J; Yorita, K; Yoshida, T; Yu, G B; Yu, I; Yu, S S; Yun, J C; Zanello, L; Zanetti, A; Zaw, I; Zhang, X; Zhou, J; Zucchelli, S

    2007-02-09

    Using 355 pb;{-1} of data collected by the CDF II detector in pp[over ] collisions at sqrt[s]=1.96 TeV at the Fermilab Tevatron, we study the fully reconstructed hadronic decays B_{(s)};{0}-->D_{(s)};{-}pi;{+} and B_{(s)};{0}-->D_{(s)};{-}pi;{+}pi;{+}pi;{-}. We present the first measurement of the ratio of branching fractions B(B_{s};{0}-->D_{s};{-}pi;{+}pi;{+}pi;{-})/B(B;{0}-->D;{-}pi;{+}pi;{+}pi;{-})=1.05+/-0.10(stat)+/-0.22(syst). We also update our measurement of B(B_{s};{0}-->D_{s};{-}pi;{+})/B(B;{0}-->D;{-}pi;{+}) to 1.13+/-0.08(stat)+/-0.23(syst), improving the statistical uncertainty by more than a factor of 2. We find B(B_{s};{0}-->D_{s};{-}pi;{+})=[3.8+/-0.3(stat)+/-1.3(syst)]x10;{-3} and B(B_{s};{0}-->D_{s};{-}pi;{+}pi;{+}pi;{-})=[8.4+/-0.8(stat)+/-3.2(syst)]x10;{-3}.

  1. Association between antimicrobial resistance and virulence genes in Escherichia coli obtained from blood and faeces

    DEFF Research Database (Denmark)

    Bagger-Skjøt, Line; Sandvang, Dorthe; Frimodt-Møller, Niels

    2007-01-01

    Escherichia coli isolates obtained from faeces (n = 85) and blood (n = 123) were susceptibility tested against 17 antimicrobial agents and the presence of 9 virulence genes was determined by PCR. Positive associations between several antimicrobial resistances and 2 VF genes (iutA and traT) were...

  2. High-resolution mapping of the brown planthopper resistance gene Bph6 in rice and characterizing its resistance in the 9311 and Nipponbare near isogenic backgrounds.

    Science.gov (United States)

    Qiu, Yongfu; Guo, Jianping; Jing, Shengli; Zhu, Lili; He, Guangcun

    2010-11-01

    Brown planthopper (Nilaparvata lugens Stål, BPH) is one of the most destructive insect pests of rice. Exploring resistance genes from diverse germplasms and incorporating them into cultivated varieties are critical for controlling this insect. The rice variety Swarnalata was reported to carry a resistance gene (designated Bph6), which has not yet been assigned to a chromosome location and the resistance mechanism is still unknown. In this study, we identified and mapped this gene using the F(2) and backcrossing populations and characterized its resistance in indica 9311 and japonica Nipponbare using near isogenic lines (NILs). In analysis of 9311/Swarnalata F(2) population, the Bph6 gene was located on the long arm of chromosome 4 between the SSR markers RM6997 and RM5742. The gene was further mapped precisely to a 25-kb region delimited between the STS markers Y19 and Y9; and the distance between these markers is 25-kb in Nipponbare genome. The Bph6 explained 77.5% of the phenotypic variance of BPH resistance in F(2) population and 84.9% in BC(2)F(2) population. Allele from Swarnalata significantly increased resistance to the BPH, resulted in a reduced damage score. In characterization of Bph6-mediated resistance, the BPH insects showed significant preference between NIL-9311 and 9311 in 3 h and between NIL-NIP and Nipponbare in 120 h after release. BPH growth and development were inhibited, and the insect's survival rates were lower on Bph6-NIL plants, compared with the parents 9311 and Nipponbare. The results indicate that the Bph6 exerted prolonged antixenotic and antibiotic effects in Bph6-NIL plants, and NIL-9311 plants showed a quicker and stronger effect toward BPH than NIL-NIP plants.

  3. Study of the Rare Decay B0 to pi0 pi0 at BaBar

    CERN Document Server

    Bowerman, D A

    2003-01-01

    The BABAR experiment operating at the PEP-II e sup + e sup - collider is designed to study CP violation effects in the B-meson system. From May 1999 to June 2002 approximately 81 fb sup - sup 1 of data have been collected at the UPSILON(4S) resonance, containing (87.9 +- 1.4) Million BB pairs. From this data sample the branching fraction for the decay B sup 0 -> pi sup 0 pi sup 0 has been extracted using a multi-dimensional maximum likelihood technique. With an efficiency of 20.4%, we find 36 sub - sub 1 sub 4 sub - sub 1 sup + sup 1 sup 5 sup + sup 1 B sup 0 -> pi sup 0 pi sup 0 events and measure the branching fraction to be BETA(B sup 0 -> pi sup 0 pi sup 0) = (2.0 sub - sub 0 sub . sub 8 sub - sub 0 sub . sub 2 sup + sup 0 sup . sup 9 sup + sup 0 sup . sup 3) x 10 sup - sup 6 where the first error is statistical and the second systematic. The statistical significance is 3.1 sigma and we report an upper limit of BETA(B sup 0 -> pi sup 0 pi sup 0) < 3.6 x 10 sup - sup 6 (90%CL). The results of the fit ar...

  4. Separation of S-wave pseudoscalar and pseudovector amplitudes in {pi}{sup -}p{yields}{pi}{sup +}{pi}{sup -}n reaction on polarized target

    Energy Technology Data Exchange (ETDEWEB)

    Kaminski, R.; Lesniak, L.; Rybicki, K. [Institute of Nuclear Physics, Cracow (Poland)

    1996-06-01

    A new analysis of S-wave production amplitudes for the reaction {pi}{sup -}p{yields}{pi}{sup +}{pi}{sup -}n on a transversely polarized target is performed. It is based on the results obtained by CERN-Cracow-Munich collaboration in the {pi}{pi} energy range from 600 MeV to 1600 MeV at 17.2 GeV/c {pi}{sup -} momentum. Energy-independent separation of the S-wave pseudoscalar amplitude ({pi} exchange) from the pseudovector amplitude (a{sub 1} exchange) is carried out using assumptions much weaker than those in all previous analyses. We show that, especially around 1000 MeV and around 1500 MeV, the a{sub 1} exchange amplitude cannot be neglected. The scalar-isoscalar {pi}{pi} phase shift are calculated using fairly weak assumptions. Our results are consistent both with the so called ``up`` and the well-known ``down`` solution, provided we choose those in which the S-wave phases increase slower with the effective {pi}{pi} mass than the P-wave phases. Above 1420 MeV both sets of phase shifts increase with energy faster than in the experiment on an unpolarized target. This fact can be related to the presence of scalar resonance f{sub o}(1500). (author). 41 refs, 9 figs, 1 tab.

  5. Antimicrobial resistance and prevalence of resistance genes of obligate anaerobes isolated from periodontal abscesses.

    Science.gov (United States)

    Xie, Yi; Chen, Jiazhen; He, Junlin; Miao, Xinyu; Xu, Meng; Wu, Xingwen; Xu, Beiyun; Yu, Liying; Zhang, Wenhong

    2014-02-01

    This study attempts to determine the antimicrobial resistance profiles of obligate anaerobic bacteria that were isolated from a periodontal abscess and to evaluate the prevalence of resistance genes in these bacteria. Forty-one periodontal abscess samples were cultivated on selective and non-selective culture media to isolate the oral anaerobes. Their antibiotic susceptibilities to clindamycin, doxycycline, amoxicillin, imipenem, cefradine, cefixime, roxithromycin, and metronidazole were determined using the agar dilution method, and polymerase chain reaction assays were performed to detect the presence of the ermF, tetQ, nim, and cfxA drug resistance genes. A total of 60 different bacterial colonies was isolated and identified. All of the isolates were sensitive to imipenem. Of the strains, 6.7%, 13.3%, 16.7%, and 25% were resistant to doxycycline, metronidazole, cefixime, and amoxicillin, respectively. The resistance rate for both clindamycin and roxithromycin was 31.7%. Approximately 60.7% of the strains had the ermF gene, and 53.3% of the amoxicillin-resistant strains were found to have the cfxA gene. Two nim genes that were found in eight metronidazole-resistant strains were identified as nimB. In the present study, the Prevotella species are the most frequently isolated obligate anaerobes from periodontal abscesses. The current results show their alarmingly high resistance rate against clindamycin and roxithromycin; thus, the use of these antibiotics is unacceptable for the empirical therapy of periodontal abscesses. A brief prevalence of four resistance genes in the anaerobic bacteria that were isolated was also demonstrated.

  6. Antimicrobial resistance and antimicrobial resistance genes in marine bacteria from salmon aquaculture and non-aquaculture sites.

    Science.gov (United States)

    Shah, Syed Q A; Cabello, Felipe C; L'abée-Lund, Trine M; Tomova, Alexandra; Godfrey, Henry P; Buschmann, Alejandro H; Sørum, Henning

    2014-05-01

    Antimicrobial resistance (AR) detected by disc diffusion and antimicrobial resistance genes detected by DNA hybridization and polymerase chain reaction with amplicon sequencing were studied in 124 marine bacterial isolates from a Chilean salmon aquaculture site and 76 from a site without aquaculture 8 km distant. Resistance to one or more antimicrobials was present in 81% of the isolates regardless of site. Resistance to tetracycline was most commonly encoded by tetA and tetG; to trimethoprim, by dfrA1, dfrA5 and dfrA12; to sulfamethizole, by sul1 and sul2; to amoxicillin, by blaTEM ; and to streptomycin, by strA-strB. Integron integrase intl1 was detected in 14 sul1-positive isolates, associated with aad9 gene cassettes in two from the aquaculture site. intl2 Integrase was only detected in three dfrA1-positive isolates from the aquaculture site and was not associated with gene cassettes in any. Of nine isolates tested for conjugation, two from the aquaculture site transferred AR determinants to Escherichia coli. High levels of AR in marine sediments from aquaculture and non-aquaculture sites suggest that dispersion of the large amounts of antimicrobials used in Chilean salmon aquaculture has created selective pressure in areas of the marine environment far removed from the initial site of use of these agents. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

  7. The diversity of antimicrobial resistance genes among staphylococci of animal origin.

    Science.gov (United States)

    Wendlandt, Sarah; Feßler, Andrea T; Monecke, Stefan; Ehricht, Ralf; Schwarz, Stefan; Kadlec, Kristina

    2013-08-01

    Staphylococci of animal origin harbor a wide variety of resistance genes. So far, more than 40 different resistance genes have been identified in staphylococci from animals. This includes genes that confer resistance to virtually all classes of antimicrobial agents approved for use in animals, such as penicillins, cephalosporins, tetracyclines, macrolides, lincosamides, phenicols, aminoglycosides, aminocyclitols, pleuromutilins, and diaminopyrimidines. The gene products of some of these resistance genes confer resistance to only specific members of a class of antimicrobial agents, whereas others confer resistance to the entire class or even to members of different classes of antimicrobial agents. The resistance mechanisms specified by the resistance genes fall into three major categories: (i) enzymatic inactivation, (ii) active efflux, or (iii) protection/modification/replacement of the cellular target sites of the antimicrobial agents. Mobile genetic elements, in particular plasmids and transposons, play a major role as carriers of antimicrobial resistance genes in animal staphylococci. They facilitate the exchange of resistance genes with staphylococci of human origin but also with other Gram-positive bacteria. Copyright © 2013 Elsevier GmbH. All rights reserved.

  8. Study of $B^{-}\\to DK^-\\pi^+\\pi^-$ and $B^-\\to D\\pi^-\\pi^+\\pi^-$ decays and determination of the CKM angle $\\gamma$

    CERN Document Server

    Aaij, Roel; Adinolfi, Marco; Affolder, Anthony; Ajaltouni, Ziad; Akar, Simon; Albrecht, Johannes; Alessio, Federico; Alexander, Michael; Ali, Suvayu; Alkhazov, Georgy; Alvarez Cartelle, Paula; Alves Jr, Antonio Augusto; Amato, Sandra; Amerio, Silvia; Amhis, Yasmine; An, Liupan; Anderlini, Lucio; Anderson, Jonathan; Andreotti, Mirco; Andrews, Jason; Appleby, Robert; Aquines Gutierrez, Osvaldo; Archilli, Flavio; d'Argent, Philippe; Artamonov, Alexander; Artuso, Marina; Aslanides, Elie; Auriemma, Giulio; Baalouch, Marouen; Bachmann, Sebastian; Back, John; Badalov, Alexey; Baesso, Clarissa; Baldini, Wander; Barlow, Roger; Barschel, Colin; Barsuk, Sergey; Barter, William; Batozskaya, Varvara; Battista, Vincenzo; Bay, Aurelio; Beaucourt, Leo; Beddow, John; Bedeschi, Franco; Bediaga, Ignacio; Bel, Lennaert; Belyaev, Ivan; Ben-Haim, Eli; Bencivenni, Giovanni; Benson, Sean; Benton, Jack; Berezhnoy, Alexander; Bernet, Roland; Bertolin, Alessandro; Bettler, Marc-Olivier; van Beuzekom, Martinus; Bien, Alexander; Bifani, Simone; Bird, Thomas; Birnkraut, Alex; Bizzeti, Andrea; Blake, Thomas; Blanc, Frédéric; Blouw, Johan; Blusk, Steven; Bocci, Valerio; Bondar, Alexander; Bondar, Nikolay; Bonivento, Walter; Borghi, Silvia; Borsato, Martino; Bowcock, Themistocles; Bowen, Espen Eie; Bozzi, Concezio; Braun, Svende; Brett, David; Britsch, Markward; Britton, Thomas; Brodzicka, Jolanta; Brook, Nicholas; Bursche, Albert; Buytaert, Jan; Cadeddu, Sandro; Calabrese, Roberto; Calvi, Marta; Calvo Gomez, Miriam; Campana, Pierluigi; Campora Perez, Daniel; Capriotti, Lorenzo; Carbone, Angelo; Carboni, Giovanni; Cardinale, Roberta; Cardini, Alessandro; Carniti, Paolo; Carson, Laurence; Carvalho Akiba, Kazuyoshi; Casanova Mohr, Raimon; Casse, Gianluigi; Cassina, Lorenzo; Castillo Garcia, Lucia; Cattaneo, Marco; Cauet, Christophe; Cavallero, Giovanni; Cenci, Riccardo; Charles, Matthew; Charpentier, Philippe; Chefdeville, Maximilien; Chen, Shanzhen; Cheung, Shu-Faye; Chiapolini, Nicola; Chrzaszcz, Marcin; Cid Vidal, Xabier; Ciezarek, Gregory; Clarke, Peter; Clemencic, Marco; Cliff, Harry; Closier, Joel; Coco, Victor; Cogan, Julien; Cogneras, Eric; Cogoni, Violetta; Cojocariu, Lucian; Collazuol, Gianmaria; Collins, Paula; Comerma-Montells, Albert; Contu, Andrea; Cook, Andrew; Coombes, Matthew; Coquereau, Samuel; Corti, Gloria; Corvo, Marco; Couturier, Benjamin; Cowan, Greig; Craik, Daniel Charles; Crocombe, Andrew; Cruz Torres, Melissa Maria; Cunliffe, Samuel; Currie, Robert; D'Ambrosio, Carmelo; Dalseno, Jeremy; David, Pieter; Davis, Adam; De Bruyn, Kristof; De Capua, Stefano; De Cian, Michel; De Miranda, Jussara; De Paula, Leandro; De Silva, Weeraddana; De Simone, Patrizia; Dean, Cameron Thomas; Decamp, Daniel; Deckenhoff, Mirko; Del Buono, Luigi; Déléage, Nicolas; Derkach, Denis; Deschamps, Olivier; Dettori, Francesco; Dey, Biplab; Di Canto, Angelo; Di Ruscio, Francesco; Dijkstra, Hans; Donleavy, Stephanie; Dordei, Francesca; Dorigo, Mirco; Dosil Suárez, Alvaro; Dossett, David; Dovbnya, Anatoliy; Dreimanis, Karlis; Dufour, Laurent; Dujany, Giulio; Dupertuis, Frederic; Durante, Paolo; Dzhelyadin, Rustem; Dziurda, Agnieszka; Dzyuba, Alexey; Easo, Sajan; Egede, Ulrik; Egorychev, Victor; Eidelman, Semen; Eisenhardt, Stephan; Eitschberger, Ulrich; Ekelhof, Robert; Eklund, Lars; El Rifai, Ibrahim; Elsasser, Christian; Ely, Scott; Esen, Sevda; Evans, Hannah Mary; Evans, Timothy; Falabella, Antonio; Färber, Christian; Farinelli, Chiara; Farley, Nathanael; Farry, Stephen; Fay, Robert; Ferguson, Dianne; Fernandez Albor, Victor; Ferrari, Fabio; Ferreira Rodrigues, Fernando; Ferro-Luzzi, Massimiliano; Filippov, Sergey; Fiore, Marco; Fiorini, Massimiliano; Firlej, Miroslaw; Fitzpatrick, Conor; Fiutowski, Tomasz; Fohl, Klaus; Fol, Philip; Fontana, Marianna; Fontanelli, Flavio; Forty, Roger; Francisco, Oscar; Frank, Markus; Frei, Christoph; Frosini, Maddalena; Fu, Jinlin; Furfaro, Emiliano; Gallas Torreira, Abraham; Galli, Domenico; Gallorini, Stefano; Gambetta, Silvia; Gandelman, Miriam; Gandini, Paolo; Gao, Yuanning; García Pardiñas, Julián; Garofoli, Justin; Garra Tico, Jordi; Garrido, Lluis; Gascon, David; Gaspar, Clara; Gastaldi, Ugo; Gauld, Rhorry; Gavardi, Laura; Gazzoni, Giulio; Geraci, Angelo; Gerick, David; Gersabeck, Evelina; Gersabeck, Marco; Gershon, Timothy; Ghez, Philippe; Gianelle, Alessio; Gianì, Sebastiana; Gibson, Valerie; Girard, Olivier Göran; Giubega, Lavinia-Helena; Gligorov, V.V.; Göbel, Carla; Golubkov, Dmitry; Golutvin, Andrey; Gomes, Alvaro; Gotti, Claudio; Grabalosa Gándara, Marc; Graciani Diaz, Ricardo; Granado Cardoso, Luis Alberto; Graugés, Eugeni; Graverini, Elena; Graziani, Giacomo; Grecu, Alexandru; Greening, Edward; Gregson, Sam; Griffith, Peter; Grillo, Lucia; Grünberg, Oliver; Gui, Bin; Gushchin, Evgeny; Guz, Yury; Gys, Thierry; Hadjivasiliou, Christos; Haefeli, Guido; Haen, Christophe; Haines, Susan; Hall, Samuel; Hamilton, Brian; Hampson, Thomas; Han, Xiaoxue; Hansmann-Menzemer, Stephanie; Harnew, Neville; Harnew, Samuel; Harrison, Jonathan; He, Jibo; Head, Timothy; Heijne, Veerle; Hennessy, Karol; Henrard, Pierre; Henry, Louis; Hernando Morata, Jose Angel; van Herwijnen, Eric; Heß, Miriam; Hicheur, Adlène; Hill, Donal; Hoballah, Mostafa; Hombach, Christoph; Hulsbergen, Wouter; Humair, Thibaud; Hussain, Nazim; Hutchcroft, David; Hynds, Daniel; Idzik, Marek; Ilten, Philip; Jacobsson, Richard; Jaeger, Andreas; Jalocha, Pawel; Jans, Eddy; Jawahery, Abolhassan; Jing, Fanfan; John, Malcolm; Johnson, Daniel; Jones, Christopher; Joram, Christian; Jost, Beat; Jurik, Nathan; Kandybei, Sergii; Kanso, Walaa; Karacson, Matthias; Karbach, Moritz; Karodia, Sarah; Kelsey, Matthew; Kenyon, Ian; Kenzie, Matthew; Ketel, Tjeerd; Khanji, Basem; Khurewathanakul, Chitsanu; Klaver, Suzanne; Klimaszewski, Konrad; Kochebina, Olga; Kolpin, Michael; Komarov, Ilya; Koopman, Rose; Koppenburg, Patrick; Korolev, Mikhail; Kravchuk, Leonid; Kreplin, Katharina; Kreps, Michal; Krocker, Georg; Krokovny, Pavel; Kruse, Florian; Kucewicz, Wojciech; Kucharczyk, Marcin; Kudryavtsev, Vasily; Kuonen, Axel Kevin; Kurek, Krzysztof; Kvaratskheliya, Tengiz; La Thi, Viet Nga; Lacarrere, Daniel; Lafferty, George; Lai, Adriano; Lambert, Dean; Lambert, Robert W; Lanfranchi, Gaia; Langenbruch, Christoph; Langhans, Benedikt; Latham, Thomas; Lazzeroni, Cristina; Le Gac, Renaud; van Leerdam, Jeroen; Lees, Jean-Pierre; Lefèvre, Regis; Leflat, Alexander; Lefrançois, Jacques; Leroy, Olivier; Lesiak, Tadeusz; Leverington, Blake; Li, Yiming; Likhomanenko, Tatiana; Liles, Myfanwy; Lindner, Rolf; Linn, Christian; Lionetto, Federica; Liu, Bo; Liu, Xuesong; Lohn, Stefan; Longstaff, Iain; Lopes, Jose; Lucchesi, Donatella; Lucio Martinez, Miriam; Luo, Haofei; Lupato, Anna; Luppi, Eleonora; Lupton, Oliver; Machefert, Frederic; Maciuc, Florin; Maev, Oleg; Maguire, Kevin; Malde, Sneha; Malinin, Alexander; Manca, Giulia; Mancinelli, Giampiero; Manning, Peter Michael; Mapelli, Alessandro; Maratas, Jan; Marchand, Jean François; Marconi, Umberto; Marin Benito, Carla; Marino, Pietro; Märki, Raphael; Marks, Jörg; Martellotti, Giuseppe; Martinelli, Maurizio; Martinez Santos, Diego; Martinez Vidal, Fernando; Martins Tostes, Danielle; Massafferri, André; Matev, Rosen; Mathad, Abhijit; Mathe, Zoltan; Matteuzzi, Clara; Matthieu, Kecke; Mauri, Andrea; Maurin, Brice; Mazurov, Alexander; McCann, Michael; McCarthy, James; McNab, Andrew; McNulty, Ronan; Meadows, Brian; Meier, Frank; Meissner, Marco; Merk, Marcel; Milanes, Diego Alejandro; Minard, Marie-Noelle; Mitzel, Dominik Stefan; Molina Rodriguez, Josue; Monteil, Stephane; Morandin, Mauro; Morawski, Piotr; Mordà, Alessandro; Morello, Michael Joseph; Moron, Jakub; Morris, Adam Benjamin; Mountain, Raymond; Muheim, Franz; Müller, Janine; Müller, Katharina; Müller, Vanessa; Mussini, Manuel; Muster, Bastien; Naik, Paras; Nakada, Tatsuya; Nandakumar, Raja; Nasteva, Irina; Needham, Matthew; Neri, Nicola; Neubert, Sebastian; Neufeld, Niko; Neuner, Max; Nguyen, Anh Duc; Nguyen, Thi-Dung; Nguyen-Mau, Chung; Niess, Valentin; Niet, Ramon; Nikitin, Nikolay; Nikodem, Thomas; Ninci, Daniele; Novoselov, Alexey; O'Hanlon, Daniel Patrick; Oblakowska-Mucha, Agnieszka; Obraztsov, Vladimir; Ogilvy, Stephen; Okhrimenko, Oleksandr; Oldeman, Rudolf; Onderwater, Gerco; Osorio Rodrigues, Bruno; Otalora Goicochea, Juan Martin; Otto, Adam; Owen, Patrick; Oyanguren, Maria Aranzazu; Palano, Antimo; Palombo, Fernando; Palutan, Matteo; Panman, Jacob; Papanestis, Antonios; Pappagallo, Marco; Pappalardo, Luciano; Parkes, Christopher; Passaleva, Giovanni; Patel, Girish; Patel, Mitesh; Patrignani, Claudia; Pearce, Alex; Pellegrino, Antonio; Penso, Gianni; Pepe Altarelli, Monica; Perazzini, Stefano; Perret, Pascal; Pescatore, Luca; Petridis, Konstantinos; Petrolini, Alessandro; Petruzzo, Marco; Picatoste Olloqui, Eduardo; Pietrzyk, Boleslaw; Pilař, Tomas; Pinci, Davide; Pistone, Alessandro; Piucci, Alessio; Playfer, Stephen; Plo Casasus, Maximo; Poikela, Tuomas; Polci, Francesco; Poluektov, Anton; Polyakov, Ivan; Polycarpo, Erica; Popov, Alexander; Popov, Dmitry; Popovici, Bogdan; Potterat, Cédric; Price, Eugenia; Price, Joseph David; Prisciandaro, Jessica; Pritchard, Adrian; Prouve, Claire; Pugatch, Valery; Puig Navarro, Albert; Punzi, Giovanni; Qian, Wenbin; Quagliani, Renato; Rachwal, Bartolomiej; Rademacker, Jonas; Rakotomiaramanana, Barinjaka; Rama, Matteo; Rangel, Murilo; Raniuk, Iurii; Rauschmayr, Nathalie; Raven, Gerhard; Redi, Federico; Reichert, Stefanie; Reid, Matthew; dos Reis, Alberto; Ricciardi, Stefania; Richards, Sophie; Rihl, Mariana; Rinnert, Kurt; Rives Molina, Vincente; Robbe, Patrick; Rodrigues, Ana Barbara; Rodrigues, Eduardo; Rodriguez Lopez, Jairo Alexis; Rodriguez Perez, Pablo; Roiser, Stefan; Romanovsky, Vladimir; Romero Vidal, Antonio; Rotondo, Marcello; Rouvinet, Julien; Ruf, Thomas; Ruiz, Hugo; Ruiz Valls, Pablo; Saborido Silva, Juan Jose; Sagidova, Naylya; Sail, Paul; Saitta, Biagio; Salustino Guimaraes, Valdir; Sanchez Mayordomo, Carlos; Sanmartin Sedes, Brais; Santacesaria, Roberta; Santamarina Rios, Cibran; Santimaria, Marco; Santovetti, Emanuele; Sarti, Alessio; Satriano, Celestina; Satta, Alessia; Saunders, Daniel Martin; Savrina, Darya; Schiller, Manuel; Schindler, Heinrich; Schlupp, Maximilian; Schmelling, Michael; Schmelzer, Timon; Schmidt, Burkhard; Schneider, Olivier; Schopper, Andreas; Schubiger, Maxime; Schune, Marie Helene; Schwemmer, Rainer; Sciascia, Barbara; Sciubba, Adalberto; Semennikov, Alexander; Sepp, Indrek; Serra, Nicola; Serrano, Justine; Sestini, Lorenzo; Seyfert, Paul; Shapkin, Mikhail; Shapoval, Illya; Shcheglov, Yury; Shears, Tara; Shekhtman, Lev; Shevchenko, Vladimir; Shires, Alexander; Silva Coutinho, Rafael; Simi, Gabriele; Sirendi, Marek; Skidmore, Nicola; Skillicorn, Ian; Skwarnicki, Tomasz; Smith, Edmund; Smith, Eluned; Smith, Iwan Thomas; Smith, Jackson; Smith, Mark; Snoek, Hella; Sokoloff, Michael; Soler, Paul; Soomro, Fatima; Souza, Daniel; Souza De Paula, Bruno; Spaan, Bernhard; Spradlin, Patrick; Sridharan, Srikanth; Stagni, Federico; Stahl, Marian; Stahl, Sascha; Steinkamp, Olaf; Stenyakin, Oleg; Sterpka, Christopher Francis; Stevenson, Scott; Stoica, Sabin; Stone, Sheldon; Storaci, Barbara; Stracka, Simone; Straticiuc, Mihai; Straumann, Ulrich; Sun, Liang; Sutcliffe, William; Swientek, Krzysztof; Swientek, Stefan; Syropoulos, Vasileios; Szczekowski, Marek; Szczypka, Paul; Szumlak, Tomasz; T'Jampens, Stephane; Tekampe, Tobias; Teklishyn, Maksym; Tellarini, Giulia; Teubert, Frederic; Thomas, Christopher; Thomas, Eric; van Tilburg, Jeroen; Tisserand, Vincent; Tobin, Mark; Todd, Jacob; Tolk, Siim; Tomassetti, Luca; Tonelli, Diego; Topp-Joergensen, Stig; Torr, Nicholas; Tournefier, Edwige; Tourneur, Stephane; Trabelsi, Karim; Tran, Minh Tâm; Tresch, Marco; Trisovic, Ana; Tsaregorodtsev, Andrei; Tsopelas, Panagiotis; Tuning, Niels; Ukleja, Artur; Ustyuzhanin, Andrey; Uwer, Ulrich; Vacca, Claudia; Vagnoni, Vincenzo; Valenti, Giovanni; Vallier, Alexis; Vazquez Gomez, Ricardo; Vazquez Regueiro, Pablo; Vázquez Sierra, Carlos; Vecchi, Stefania; Velthuis, Jaap; Veltri, Michele; Veneziano, Giovanni; Vesterinen, Mika; Viaud, Benoit; Vieira, Daniel; Vieites Diaz, Maria; Vilasis-Cardona, Xavier; Vollhardt, Achim; Volyanskyy, Dmytro; Voong, David; Vorobyev, Alexey; Vorobyev, Vitaly; Voß, Christian; de Vries, Jacco; Waldi, Roland; Wallace, Charlotte; Wallace, Ronan; Walsh, John; Wandernoth, Sebastian; Wang, Jianchun; Ward, David; Watson, Nigel; Websdale, David; Weiden, Andreas; Whitehead, Mark; Wiedner, Dirk; Wilkinson, Guy; Wilkinson, Michael; Williams, Mark Richard James; Williams, Matthew; Williams, Mike; Williams, Timothy; Wilson, Fergus; Wimberley, Jack; Wishahi, Julian; Wislicki, Wojciech; Witek, Mariusz; Wormser, Guy; Wotton, Stephen; Wright, Simon; Wyllie, Kenneth; Xie, Yuehong; Xu, Zhirui; Yang, Zhenwei; Yu, Jiesheng; Yuan, Xuhao; Yushchenko, Oleg; Zangoli, Maria; Zavertyaev, Mikhail; Zhang, Liming; Zhang, Yanxi; Zhelezov, Alexey; Zhokhov, Anatoly; Zhong, Liang

    2015-12-17

    We report a study of the suppressed $B^{-}\\to DK^-\\pi^+\\pi^-$ and favored $B^-\\to D\\pi^-\\pi^+\\pi^-$ decays, where the neutral $D$ meson is detected through its decays to the $K^{\\mp}\\pi^{\\pm}$ and $CP$-even $K^+K^-$ and $\\pi^+\\pi^-$ final states. The measurement is carried out using a proton-proton collision data sample collected by the LHCb experiment, corresponding to an integrated luminosity of 3.0 fb$^{-1}$. We observe the first significant signals in the $CP$-even final states of the $D$ meson for both the suppressed $B^{-}\\to DK^-\\pi^+\\pi^-$ and favored $B^-\\to D\\pi^-\\pi^+\\pi^-$ modes, as well as in the doubly Cabibbo-suppressed $D\\to K^+\\pi^-$ final state of the $B^-\\to D\\pi^-\\pi^+\\pi^-$ decay. Evidence for the ADS suppressed decay $B^{-}\\to DK^-\\pi^+\\pi^-$, with $D\\to K^+\\pi^-$, is also presented. From the observed yields in the $B^{-}\\to DK^-\\pi^+\\pi^-$, $B^-\\to D\\pi^-\\pi^+\\pi^-$ and their charge conjugate decay modes, we measure the value of the weak phase to be $\\gamma=(74^{+20}_{-18})^{\\rm o}$. Th...

  9. Minotaur is critical for primary piRNA biogenesis.

    Science.gov (United States)

    Vagin, Vasily V; Yu, Yang; Jankowska, Anna; Luo, Yicheng; Wasik, Kaja A; Malone, Colin D; Harrison, Emily; Rosebrock, Adam; Wakimoto, Barbara T; Fagegaltier, Delphine; Muerdter, Felix; Hannon, Gregory J

    2013-08-01

    Piwi proteins and their associated small RNAs are essential for fertility in animals. In part, this is due to their roles in guarding germ cell genomes against the activity of mobile genetic elements. piRNA populations direct Piwi proteins to silence transposon targets and, as such, form a molecular code that discriminates transposons from endogenous genes. Information ultimately carried by piRNAs is encoded within genomic loci, termed piRNA clusters. These give rise to long, single-stranded, primary transcripts that are processed into piRNAs. Despite the biological importance of this pathway, neither the characteristics that define a locus as a source of piRNAs nor the mechanisms that catalyze primary piRNA biogenesis are well understood. We searched an EMS-mutant collection annotated for fertility phenotypes for genes involved in the piRNA pathway. Twenty-seven homozygous sterile strains showed transposon-silencing defects. One of these, which strongly impacted primary piRNA biogenesis, harbored a causal mutation in CG5508, a member of the Drosophila glycerol-3-phosphate O-acetyltransferase (GPAT) family. These enzymes catalyze the first acylation step on the path to the production of phosphatidic acid (PA). Though this pointed strongly to a function for phospholipid signaling in the piRNA pathway, a mutant form of CG5508, which lacks the GPAT active site, still functions in piRNA biogenesis. We have named this new biogenesis factor Minotaur.

  10. Minotaur is critical for primary piRNA biogenesis

    Science.gov (United States)

    Vagin, Vasily V.; Yu, Yang; Jankowska, Anna; Luo, Yicheng; Wasik, Kaja A.; Malone, Colin D.; Harrison, Emily; Rosebrock, Adam; Wakimoto, Barbara T.; Fagegaltier, Delphine; Muerdter, Felix; Hannon, Gregory J.

    2013-01-01

    Piwi proteins and their associated small RNAs are essential for fertility in animals. In part, this is due to their roles in guarding germ cell genomes against the activity of mobile genetic elements. piRNA populations direct Piwi proteins to silence transposon targets and, as such, form a molecular code that discriminates transposons from endogenous genes. Information ultimately carried by piRNAs is encoded within genomic loci, termed piRNA clusters. These give rise to long, single-stranded, primary transcripts that are processed into piRNAs. Despite the biological importance of this pathway, neither the characteristics that define a locus as a source of piRNAs nor the mechanisms that catalyze primary piRNA biogenesis are well understood. We searched an EMS-mutant collection annotated for fertility phenotypes for genes involved in the piRNA pathway. Twenty-seven homozygous sterile strains showed transposon-silencing defects. One of these, which strongly impacted primary piRNA biogenesis, harbored a causal mutation in CG5508, a member of the Drosophila glycerol-3-phosphate O-acetyltransferase (GPAT) family. These enzymes catalyze the first acylation step on the path to the production of phosphatidic acid (PA). Though this pointed strongly to a function for phospholipid signaling in the piRNA pathway, a mutant form of CG5508, which lacks the GPAT active site, still functions in piRNA biogenesis. We have named this new biogenesis factor Minotaur. PMID:23788724

  11. Analysis of metal and biocides resistance genes in drug resistance and susceptible Salmonella enterica from food animals

    Science.gov (United States)

    Background Generally drug resistant bacteria carry antibiotic resistance genes and heavy metal and biocide resistance genes on large conjugative plasmids. The presence of these metal and biocide resistance genes in susceptible bacteria are not assessed comprehensively. Hence, WGS data of susceptib...

  12. Candidate genes for cross-resistance against DNA-damaging drugs

    DEFF Research Database (Denmark)

    Wittig, Rainer; Nessling, Michelle; Will, Rainer D

    2002-01-01

    Drug resistance of tumor cells leads to major drawbacks in the treatment of cancer. To identify candidate genes for drug resistance, we compared the expression patterns of the drug-sensitive human malignant melanoma cell line MeWo and three derived sublines with acquired resistance to the DNA...... as several apoptosis-related genes, in particular STK17A and CRYAB. As MPP1 and CRYAB are also among the 14 genes differentially expressed in all three of the drug-resistant sublines, they represent the strongest candidates for resistance against DNA-damaging drugs....

  13. Updated studies of determining gamma at LHCb with the decays $B^{+-} \\to D(K\\pi,KK,\\pi\\pi)K^{+-}$

    CERN Document Server

    Patel, M

    2009-01-01

    The selection efficiencies and backgrounds for the decays B+- -> DK+-, where the D denotes a D0bar or D0 which decays into the two-body final states Kpi, KK, pipi, are determined from simulation studies. These are used to estimate the precision with which LHCb will be able to measure the CKM angle gamma. With a data set corresponding to an intergrated luminosity of 2fb-1, a precision of 9.9-11.3 degrees is expected, depending on the strong phase difference between D0 -> K+pi- and D0->K-pi+ decays.

  14. Molecular study on some antibiotic resistant genes in Salmonella spp. isolates

    Science.gov (United States)

    Nabi, Ari Q.

    2017-09-01

    Studying the genes related with antimicrobial resistance in Salmonella spp. is a crucial step toward a correct and faster treatment of infections caused by the pathogen. In this work Integron mediated antibiotic resistant gene IntI1 (Class I Integrase IntI1) and some plasmid mediated antibiotic resistance genes (Qnr) were scanned among the isolated non-Typhoid Salmonellae strains with known resistance to some important antimicrobial drugs using Sybr Green real time PCR. The aim of the study was to correlate the multiple antibiotics and antimicrobial resistance of Salmonella spp. with the presence of integrase (IntI1) gene and plasmid mediated quinolone resistant genes. Results revealed the presence of Class I Integrase gene in 76% of the isolates with confirmed multiple antibiotic resistances. Moreover, about 32% of the multiple antibiotic resistant serotypes showed a positive R-PCR for plasmid mediated qnrA gene encoding for nalidixic acid and ciprofloxacin resistance. No positive results could be revealed form R-PCRs targeting qnrB or qnrS. In light of these results we can conclude that the presence of at least one of the qnr genes and/or the presence of Integrase Class I gene were responsible for the multiple antibiotic resistance to for nalidixic acid and ciprofloxacin from the studied Salmonella spp. and further studies required to identify the genes related with multiple antibiotic resistance of the pathogen.

  15. Frequency of antiseptic resistance genes in clinical staphycocci and enterococci isolates in Turkey

    Directory of Open Access Journals (Sweden)

    Seyda Ignak

    2017-08-01

    Full Text Available Abstract Background Disinfectants and antiseptics are biocides widely used in hospitals to prevent spread of pathogens. It has been reported that antiseptic resistance genes, qac’s, caused tolerance to a variety of biocidal agents, such as benzalkonium chloride (BAC and chlorhexidine digluconate (CHDG in Staphylococcus spp. isolates. We aimed to search the frequency of antiseptic resistance genes in clinical Staphylococcus spp. and Enterococcus spp. isolates to investigate the possible association with antiseptic tolerance and antibiotic resistance. Methods Antiseptic resistance genes (qacA/B, smr, qacG, qacH, and qacJ isolated from Gram-positive cocci (69 Staphylococcus spp. and 69 Enterococcus spp. were analyzed by PCR method. The minimum inhibitory concentrations (MICs of BAC and CHDG were determined by agar dilution method, whereas antibiotic susceptibility was analyzed by disk diffusion method according to Clinical and Laboratory Standards Institute (CLSI criteria. Results The frequency of antiseptic resistance genes was found to be high (49/69; 71.0% in our clinical staphylococci isolates but absent (0/69; 0% in enterococci isolates. The frequency of qacA/B and smr genes was higher (25/40; 62.5% and 7/40; 17.5%, respectively in coagulase negative staphylococci (CNS when compared to Staphylococcus aureus strains (3/29; 10.3%, and 4/29; 13.8%, respectively. In contrast, the frequency of qacG and qacJ genes was higher (11/29; 37.9% and 8/29; 27.5%, respectively in S. aureus than those of CNS (5/40; 12.5%, 10/40; 25.0% strains. qacH was not identified in none of the strains. We found an association between presence of antiseptic resistance genes and increased MIC values of BAC (>4 μg/mL in staphylococci and it was found to be statistically statistically significant (p < 0.01. We also showed that MICs of BAC and CHDG of vancomycin-resistant enterococci (VRE isolates were significantly higher than those of vancomycin

  16. Study of CP violation in B--/+ -> Dh(-/+) (h = K,pi) with the modes D -> K--/+pi(+/-)pi(0), D -> pi(+)pi(-)pi(0) and D -> K+K-pi(0)

    NARCIS (Netherlands)

    Aaij, R.; Adeva, B.; Adinolfi, M.; Affolder, A.; Ajaltouni, Z.; Akar, S.; Albrecht, J.; Alessio, F.; Alexander, M.; Ali, S.; Alkhazov, G.; Alvarez Cartelle, P.; Alves, A. A.; Amato, S.; Amerio, S.; Amhis, Y.; An, L.; Anderlini, L.; Andreotti, M.; Andrews, J. E.; Appleby, R. B.; Aquines Gutierrez, O.; Archilli, F.; d'Argent, P.; Artamonov, A.; Artuso, M.; Aslanides, E.; Auriemma, G.; Baalouch, M.; Bachmann, S.; Back, J. J.; Badalov, A.; Baesso, C.; Baldini, W.; Barlow, R. J.; Barschel, C.; Barsuk, S.; Barter, W.; Batozskaya, V.; Battista, V.; Beaucourt, L.; Beddow, J.; Bedeschi, F.; Bediaga, I.; Bel, L. J.; Belyaev, I.; Ben-Haim, E.; Onderwater, C. J. G.; Pellegrino, A.; Tolk, S.

    2015-01-01

    An analysis of the decays of B--/+ -> DK -/+ and B--/+ -> D pi(-/+) is presented in which the D meson is reconstructed in the three-body final states K--/+pi(+/-)pi(0), pi(+)pi(-)pi(0) and K+K-pi(0). Using data from LHCb corresponding to an integrated luminosity of 3.0 fb(-1) of pp collisions,

  17. Molecular tagging of a novel rust resistance gene R(12) in sunflower (Helianthus annuus L.).

    Science.gov (United States)

    Gong, L; Hulke, B S; Gulya, T J; Markell, S G; Qi, L L

    2013-01-01

    Sunflower production in North America has recently suffered economic losses in yield and seed quality from sunflower rust (Puccinia helianthi Schwein.) because of the increasing incidence and lack of resistance to new rust races. RHA 464, a newly released sunflower male fertility restorer line, is resistant to both of the most predominant and most virulent rust races identified in the Northern Great Plains of the USA. The gene conditioning rust resistance in RHA 464 originated from wild Helianthus annuus L., but has not been molecularly marked or determined to be independent from other rust loci. The objectives of this study are to identify molecular markers linked to the rust resistance gene and to investigate the allelism of this gene with the unmapped rust resistance genes present in HA-R6, HA-R8 and RHA 397. Virulence phenotypes of seedlings for the F(2) population and F(2:3) families suggested that a single dominant gene confers rust resistance in RHA 464, and this gene was designated as R(12). Bulked segregant analysis identified ten markers polymorphic between resistant and susceptible bulks. In subsequent genetic mapping, the ten markers covered 33.4 cM of genetic distance on linkage group 11 of sunflower. A co-dominant marker CRT275-11 is the closest marker distal to R(12) with a genetic distance of 1.0 cM, while ZVG53, a dominant marker linked in the repulsion phase, is proximal to R(12) with a genetic distance of 9.6 cM. The allelism test demonstrated that R(12) is not allelic to the rust resistance genes in HA-R6, HA-R8 and RHA 397, and it is also not linked to any previously mapped rust resistance genes. Discovery of the R(12) novel rust resistance locus in sunflower and associated markers will potentially support the molecular marker-assisted introgression and pyramiding of R(12) into sunflower breeding lines.

  18. Identification of distinct specificity determinants in resistance protein Cf-4 allows construction of a Cf-9 mutant that confers recognition of avirulence protein AVR4

    NARCIS (Netherlands)

    Hoorn, Van der R.A.L.; Roth, R.; Wit, De P.J.G.M.

    2001-01-01

    The tomato resistance genes Cf-4 and Cf-9 confer specific, hypersensitive response-associated recognition of Cladosporium carrying the avirulence genes Avr4 and Avr9, respectively. Cf-4 and Cf-9 encode type I transmembrane proteins with extracellular leucine-rich repeats (LRRs). Compared with Cf-9,

  19. Screening of gamma radiation-induced pathogen resistance rice lines against Xanthomonas oryzae pv. oryzae

    Energy Technology Data Exchange (ETDEWEB)

    Lim, Chan Ju; Lee, Ha Yeon; Kim, Woong Bom; Ahmad, Raza; Moon, Jae Sun; Kwon, Suk Yoon [Korea Research Institute of Beoscience and Biotechnology, Daejeon (Korea, Republic of); Kim, Dong Sub [Korea Atomic Energy Research Institute, Jeongeup (Korea, Republic of)

    2010-09-15

    Bacterial blight is one of the most serious diseases of rice (Oryza sativa L.), and it has been known that Xanthomonas oryzae pv. oryzae (Xoo) causes this disease symptom. To develop resistance rice cultivars against Xoo, 3,000 lines of M{sub 3}, which were irradiated with gamma ray, were tested by 'scissor-dip method' primarily, and 191 putative resistant lines were selected. In M{sub 4} generation, these lines were screened again with various ways such as measuring of symptom of bacterial blight in leaf, number of tiller, fresh weight, and phenotypic segregation ratio in next generation. Finally, six resistance lines were selected. RT-PCR analysis revealed that these lines displayed high level of R-genes such as Xa21, Pi36, and Pi-ta. These results indicate that mutations by gamma ray cause disruptions of regulatory signal transduction systems of these R-genes. Furthermore, these selected mutants could be useful for the development of rice cultivar resistant to Xoo.

  20. Trueperella pyogenes isolated from dairy cows with endometritis in Inner Mongolia, China: Tetracycline susceptibility and tetracycline-resistance gene distribution.

    Science.gov (United States)

    Zhang, Dexian; Zhao, Jingcui; Wang, Qiuxia; Liu, Yaochuan; Tian, Chunlian; Zhao, Yujun; Yu, Lihui; Liu, Mingchun

    2017-04-01

    Trueperella pyogenes plays a crucial role in endometritis pathogenesis and is also associated with many infections, including metritis, mastitis, arthritis and liver abscessation, in many domestic animals. In this study, we investigated the prevalence of tetracycline resistance in T. pyogenes isolated from dairy cows with endometritis in Inner Mongolia, China, and we assessed tetracycline-resistance gene distribution among the isolates. Our results indicated that 68.7% and 62.5% of the isolates were resistant to tetracycline and doxycycline, respectively, and the rate of resistance to metacycline was 18.8%. The tetracycline resistance gene tetK was present in all isolates (n = 32), whereas the tetM gene was identified in 12.5% and 9.4% of the isolates, in the chromosome and plasmid, respectively. Strains carrying tetW were also common in the chromosome and plasmid, with abundances of 53.1% and 46.9%, respectively. However, tetO and otrA were absent in all isolates. The resistance phenotype analysis indicated that 6.3% of strains were susceptible to all tetracyclines, while 3.1% showed resistance to all tetracyclines. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Development of 25 near-isogenic lines (NILs) with ten BPH resistance genes in rice (Oryza sativa L.): production, resistance spectrum, and molecular analysis.

    Science.gov (United States)

    Jena, Kshirod K; Hechanova, Sherry Lou; Verdeprado, Holden; Prahalada, G D; Kim, Sung-Ryul

    2017-11-01

    A first set of 25 NILs carrying ten BPH resistance genes and their pyramids was developed in the background of indica variety IR24 for insect resistance breeding in rice. Brown planthopper (Nilaparvata lugens Stal.) is one of the most destructive insect pests in rice. Development of near-isogenic lines (NILs) is an important strategy for genetic analysis of brown planthopper (BPH) resistance (R) genes and their deployment against diverse BPH populations. A set of 25 NILs with 9 single R genes and 16 multiple R gene combinations consisting of 11 two-gene pyramids and 5 three-gene pyramids in the genetic background of the susceptible indica rice cultivar IR24 was developed through marker-assisted selection. The linked DNA markers for each of the R genes were used for foreground selection and confirming the introgressed regions of the BPH R genes. Modified seed box screening and feeding rate of BPH were used to evaluate the spectrum of resistance. BPH reaction of each of the NILs carrying different single genes was variable at the antibiosis level with the four BPH populations of the Philippines. The NILs with two- to three-pyramided genes showed a stronger level of antibiosis (49.3-99.0%) against BPH populations compared with NILs with a single R gene NILs (42.0-83.5%) and IR24 (10.0%). Background genotyping by high-density SNPs markers revealed that most of the chromosome regions of the NILs (BC 3 F 5 ) had IR24 genome recovery of 82.0-94.2%. Six major agronomic data of the NILs showed a phenotypically comparable agronomic performance with IR24. These newly developed NILs will be useful as new genetic resources for BPH resistance breeding and are valuable sources of genes in monitoring against the emerging BPH biotypes in different rice-growing countries.

  2. Mefloquine resistance in Plasmodium falciparum and increased pfmdr1 gene copy number.

    Science.gov (United States)

    Price, Ric N; Uhlemann, Anne-Catrin; Brockman, Alan; McGready, Rose; Ashley, Elizabeth; Phaipun, Lucy; Patel, Rina; Laing, Kenneth; Looareesuwan, Sornchai; White, Nicholas J; Nosten, François; Krishna, Sanjeev

    The borders of Thailand harbour the world's most multidrug resistant Plasmodium falciparum parasites. In 1984 mefloquine was introduced as treatment for uncomplicated falciparum malaria, but substantial resistance developed within 6 years. A combination of artesunate with mefloquine now cures more than 95% of acute infections. For both treatment regimens, the underlying mechanisms of resistance are not known. The relation between polymorphisms in the P falciparum multidrug resistant gene 1 (pfmdr1) and the in-vitro and in-vivo responses to mefloquine were assessed in 618 samples from patients with falciparum malaria studied prospectively over 12 years. pfmdr1 copy number was assessed by a robust real-time PCR assay. Single nucleotide polymorphisms of pfmdr1, P falciparum chloroquine resistance transporter gene (pfcrt) and P falciparum Ca2+ ATPase gene (pfATP6) were assessed by PCR-restriction fragment length polymorphism. Increased copy number of pfmdr1 was the most important determinant of in-vitro and in-vivo resistance to mefloquine, and also to reduced artesunate sensitivity in vitro. In a Cox regression model with control for known confounders, increased pfmdr1 copy number was associated with an attributable hazard ratio (AHR) for treatment failure of 6.3 (95% CI 2.9-13.8, p<0.001) after mefloquine monotherapy and 5.4 (2.0-14.6, p=0.001) after artesunate-mefloquine therapy. Single nucleotide polymorphisms in pfmdr1 were associated with increased mefloquine susceptibility in vitro, but not in vivo. Amplification in pfmdr1 is the main cause of resistance to mefloquine in falciparum malaria. Multidrug resistant P falciparum malaria is common in southeast Asia, but difficult to identify and treat. Genes that encode parasite transport proteins maybe involved in export of drugs and so cause resistance. In this study we show that increase in copy number of pfmdr1, a gene encoding a parasite transport protein, is the best overall predictor of treatment failure with

  3. Initial-State Radiation Measurement of the e+e- -> pi+pi-pi+pi- Cross Section

    CERN Document Server

    Lees, J.P.; Tisserand, V.; Garra Tico, J.; Grauges, E.; Martinelli, M.; Milanes, D.A.; Palano, A.; Pappagallo, M.; Eigen, G.; Stugu, B.; Brown, David Nathan; Kerth, L.T.; Kolomensky, Yu.G.; Lynch, G.; Koch, H.; Schroeder, T.; Asgeirsson, D.J.; Hearty, C.; Mattison, T.S.; McKenna, J.A.; Khan, A.; Blinov, V.E.; Buzykaev, A.R.; Druzhinin, V.P.; Golubev, V.B.; Kravchenko, E.A.; Onuchin, A.P.; Serednyakov, S.I.; Skovpen, Yu.I.; Solodov, E.P.; Todyshev, K.Yu.; Yushkov, A.N.; Bondioli, M.; Kirkby, D.; Lankford, A.J.; Mandelkern, M.; Stoker, D.P.; Atmacan, H.; Gary, J.W.; Liu, F.; Long, O.; Vitug, G.M.; Campagnari, C.; Hong, T.M.; Kovalskyi, D.; Richman, J.D.; West, C.A.; Eisner, A.M.; Kroseberg, J.; Lockman, W.S.; Martinez, A.J.; Schalk, T.; Schumm, B.A.; Seiden, A.; Cheng, C.H.; Doll, D.A.; Echenard, B.; Flood, K.T.; Hitlin, D.G.; Ongmongkolkul, P.; Porter, F.C.; Rakitin, A.Y.; Andreassen, R.; Dubrovin, M.S.; Huard, Z.; Meadows, B.T.; Sokoloff, M.D.; Sun, L.; Bloom, P.C.; Ford, W.T.; Gaz, A.; Nagel, M.; Nauenberg, U.; Smith, J.G.; Wagner, S.R.; Ayad, R.; Toki, W.H.; Spaan, B.; Kobel, M.J.; Schubert, K.R.; Schwierz, R.; Bernard, D.; Verderi, M.; Clark, P.J.; Playfer, S.; Bettoni, D.; Bozzi, C.; Calabrese, R.; Cibinetto, G.; Fioravanti, E.; Garzia, I.; Luppi, E.; Munerato, M.; Negrini, M.; Piemontese, L.; Santoro, V.; Baldini-Ferroli, R.; Calcaterra, A.; de Sangro, R.; Finocchiaro, G.; Nicolaci, M.; Patteri, P.; Peruzzi, I.M.; Piccolo, M.; Rama, M.; Zallo, A.; Contri, R.; Guido, E.; Lo Vetere, M.; Monge, M.R.; Passaggio, S.; Patrignani, C.; Robutti, E.; Bhuyan, B.; Prasad, V.; Lee, C.L.; Morii, M.; Edwards, A.J.; Adametz, A.; Marks, J.; Uwer, U.; Bernlochner, F.U.; Ebert, M.; Lacker, H.M.; Lueck, T.; Dauncey, P.D.; Tibbetts, M.; Behera, P.K.; Mallik, U.; Chen, C.; Cochran, J.; Meyer, W.T.; Prell, S.; Rosenberg, E.I.; Rubin, A.E.; Gritsan, A.V.; Guo, Z.J.; Arnaud, N.; Davier, M.; Grosdidier, G.; Le Diberder, F.; Lutz, A.M.; Malaescu, B.; Roudeau, P.; Schune, M.H.; Stocchi, A.; Wormser, G.; Lange, D.J.; Wright, D.M.; Bingham, I.; Chavez, C.A.; Coleman, J.P.; Fry, J.R.; Gabathuler, E.; Hutchcroft, D.E.; Payne, D.J.; Touramanis, C.; Bevan, A.J.; Di Lodovico, F.; Sacco, R.; Sigamani, M.; Cowan, G.; Brown, David Norvil; Davis, C.L.; Denig, A.G.; Fritsch, M.; Gradl, W.; Hafner, A.; Prencipe, E.; Alwyn, K.E.; Bailey, D.; Barlow, R.J.; Jackson, G.; Lafferty, G.D.; Behn, E.; Cenci, R.; Hamilton, B.; Jawahery, A.; Roberts, D.A.; Simi, G.; Dallapiccola, C.; Cowan, R.; Dujmic, D.; Sciolla, G.; Lindemann, D.; Patel, P.M.; Robertson, S.H.; Schram, M.; Biassoni, P.; Lazzaro, A.; Lombardo, V.; Neri, N.; Palombo, F.; Stracka, S.; Cremaldi, L.; Godang, R.; Kroeger, R.; Sonnek, P.; Summers, D.J.; Nguyen, X.; Taras, P.; De Nardo, G.; Monorchio, D.; Onorato, G.; Sciacca, C.; Raven, G.; Snoek, H.L.; Jessop, C.P.; Knoepfel, K.J.; LoSecco, J.M.; Wang, W.F.; Honscheid, K.; Kass, R.; Brau, J.; Frey, R.; Sinev, N.B.; Strom, D.; Torrence, E.; Feltresi, E.; Gagliardi, N.; Margoni, M.; Morandin, M.; Posocco, M.; Rotondo, M.; Simonetto, F.; Stroili, R.; Akar, S.; Ben-Haim, E.; Bomben, M.; Bonneaud, G.R.; Briand, H.; Calderini, G.; Chauveau, J.; Hamon, O.; Leruste, Ph.; Marchiori, G.; Ocariz, J.; Sitt, S.; Biasini, M.; Manoni, E.; Pacetti, S.; Rossi, A.; Angelini, C.; Batignani, G.; Bettarini, S.; Carpinelli, M.; Casarosa, G.; Cervelli, A.; Forti, F.; Giorgi, M.A.; Lusiani, A.; Oberhof, B.; Paoloni, E.; Perez, A.; Rizzo, G.; Walsh, J.J.; Lopes Pegna, D.; Lu, C.; Olsen, J.; Smith, A.J.S.; Telnov, A.V.; Anulli, F.; Cavoto, G.; Faccini, R.; Ferrarotto, F.; Ferroni, F.; Gaspero, M.; Li Gioi, L.; Mazzoni, M.A.; Piredda, G.; Bunger, C.; Grunberg, O.; Hartmann, T.; Leddig, T.; Schroder, H.; Waldi, R.; Adye, T.; Olaiya, E.O.; Wilson, F.F.; Emery, S.; de Monchenault, G.Hamel; Vasseur, G.; Y\\`, Ch.; Aston, D.; Bard, D.J.; Bartoldus, R.; Cartaro, C.; Convery, M.R.; Dorfan, J.; Dubois-Felsmann, G.P.; Dunwoodie, W.; Field, R.C.; Franco Sevilla, M.; Fulsom, B.G.; Gabareen, A.M.; Graham, M.T.; Grenier, P.; Hast, C.; Innes, W.R.; Kelsey, M.H.; Kim, H.; Kim, P.; Kocian, M.L.; Leith, D.W.G.S.; Lewis, P.; Li, S.; Lindquist, B.; Luitz, S.; Luth, V.; Lynch, H.L.; MacFarlane, D.B.; Muller, D.R.; Neal, H.; Nelson, S.; Ofte, I.; Perl, M.; Pulliam, T.; Ratcliff, B.N.; Roodman, A.; Salnikov, A.A.; Schindler, R.H.; Snyder, A.; Su, D.; Sullivan, M.K.; Va'vra, J.; Wagner, A.P.; Weaver, M.; Wisniewski, W.J.; Wittgen, M.; Wright, D.H.; Wulsin, H.W.; Yarritu, A.K.; Young, C.C.; Ziegler, V.; Park, W.; Purohit, M.V.; White, R.M.; Wilson, J.R.; Randle-Conde, A.; Sekula, S.J.; Bellis, M.; Benitez, J.F.; Burchat, P.R.; Miyashita, T.S.; Alam, M.S.; Ernst, J.A.; Gorodeisky, R.; Guttman, N.; Peimer, D.R.; Soffer, A.; Lund, P.; Spanier, S.M.; Eckmann, R.; Ritchie, J.L.; Ruland, A.M.; Schilling, C.J.; Schwitters, R.F.; Wray, B.C.; Izen, J.M.; Lou, X.C.; Bianchi, F.; Gamba, D.; Lanceri, L.; Vitale, L.; Martinez-Vidal, F.; Oyanguren, A.; Ahmed, H.; Albert, J.; Banerjee, Sw.; Choi, H.H.F.; King, G.J.; Kowalewski, R.; Lewczuk, M.J.; Nugent, I.M.; Roney, J.M.; Sobie, R.J.; Tasneem, N.; Gershon, T.J.; Harrison, P.F.; Latham, T.E.; Puccio, E.M.T.; Band, H.R.; Dasu, S.; Pan, Y.; Prepost, R.; Wu, S.L.

    2012-01-01

    We study the process e+e- -> pi+pi-pi+pi-gamma, with a photon emitted from the initial-state electron or positron, using 454.3 fb^-1 of data collected with the BABAR detector at SLAC, corresponding to approximately 260,000 signal events. We use these data to extract the non-radiative sigma(e+e- ->pi+pi-pi+pi-) cross section in the energy range from 0.6 to 4.5 Gev. The total uncertainty of the cross section measurement in the peak region is less than 3%, higher in precision than the corresponding results obtained from energy scan data.

  4. Erythromycin-resistant genes in group A β-haemolytic Streptococci in Chengdu, Southwestern China

    Directory of Open Access Journals (Sweden)

    W Zhou

    2014-01-01

    Full Text Available Context: The management of Group A β-haemolytic Streptococci (Streptococcus pyogenes or GAS infection include the use of penicillins, cephalosporins or macrolides for treatment. A general increase in macrolides resistance in GAS has been observed in recent years. Differences in rates of resistance to these agents have existed according to geographical location and investigators. Aims: To investigate the antibiotic pattern and erythromycin-resistant genes of GAS isolates associated with acute tonsillitis and scarlet fever in Chengdu, southwestern China. Settings and Design: To assess the macrolide resistance, phenotype, and genotypic characterization of GAS isolated from throat swabs of children suffering from different acute tonsillitis or scarlet fever between 2004 and 2011 in the city of Chengdu, located in the southwestern region of China. Materials and Methods: Minimal inhibitory concentration with seven antibiotics was performed on 127 GAS isolates. Resistance phenotypes of erythromycin-resistant GAS isolates were determined by the double-disk test. Their macrolide-resistant genes (mefA, ermB and ermTR were amplified by PCR. Results: A total of 98.4% (125/127 of the isolates exhibited resistance to erythromycin, clindamycin and tetracycline. All isolates were sensitive to penicillin G and cefotaxime. Moreover, 113 ermB-positive isolates demonstrating the cMLS phenotype of erythromycin resistance were predominant (90.4% and these isolates showed high-level resistance to both erythromycin and clindamycin (MIC 90 > 256 μg/ml; 12 (9.6% isolates demonstrating the MLS phenotype of erythromycin resistance carried the mefA gene, which showed low-level resistance to both erythromycin (MIC 90 = 8 μg/ml and clindamycin (MIC 90 = 0.5 μg/ml; and none of the isolates exhibited the M phenotype. Conclusions: The main phenotype is cMLS, and the ermB gene code is the main resistance mechanism against macrolides in GAS. Penicillin is the most beneficial

  5. Resistance gene pool to co-trimoxazole in non-susceptible Nocardia strains.

    Directory of Open Access Journals (Sweden)

    Sylvia eValdezate

    2015-04-01

    Full Text Available The soil-borne pathogen Nocardia spp. causes severe cutaneous, pulmonary and central nervous system infections. Against them, co-trimoxazole (SXT constitutes the mainstay of antimicrobial therapy. However, some Nocardia strains show resistance to SXT, but the underlying genetic basis is unknown. We investigated the presence of genetic resistance determinants and class 1-3 integrons in 76 SXT-resistant Nocardia strains by PCR and sequencing. By E-test, these clinical strains showed SXT MICs of ≥32:608 mg/L (ratio of 1:19 for trimethoprim: sulfamethoxazole. They belonged to 12 species, being the main representatives N. farcinica (32%, followed by N. flavorosea (6.5%, N. nova (11.8%, N. carnea (10.5%, N. transvalensis (10.5% and Nocardia spp. (6.5%. The prevalence of resistance genes in the SXT-resistant strains was as follows: sul1 and sul2 93.4% and 78.9% respectively, dfrA(S1 14.7%, blaTEM-1 and blaZ 2.6% and 2.6% respectively, VIM-2 1.3%, aph(3´-IIIa 40.8%, ermA, ermB, mefA and msrD 2.6%, 77.6%, 14.4%, and 5.2% respectively, and tet(O, tet(M, and tet(L 48.6%, 25.0% and 3.9% respectively. Detected amino acid changes in GyrA were not related to fluoroquinolone resistance, but probably linked to species polymorphism. Class 1 and 3 integrons were found in 93.42% and 56.57% strains, respectively. Class 2 integrons and sul3 genes were not detected. Other mechanisms, different than dfrA(S1, dfrD, dfrF, dfrG and dfrK, could explain the strong trimethoprim resistance shown by the other 64 strains. For first time, resistance determinants commonly found in clinically important bacteria were detected in Nocardia spp. sul1, sul2, erm(B and tet(O were the most prevalent in the SXT-resistant strains. The similarity in their resistome could be due to a common genetic platform, in which these determinants are co-transferred

  6. High chlorpyrifos resistance in Culex pipiens mosquitoes: strong synergy between resistance genes

    Science.gov (United States)

    Alout, H; Labbé, P; Berthomieu, A; Makoundou, P; Fort, P; Pasteur, N; Weill, M

    2016-01-01

    We investigated the genetic determinism of high chlorpyrifos resistance (HCR), a phenotype first described in 1999 in Culex pipiens mosquitoes surviving chlorpyrifos doses ⩾1 mg l−1 and more recently found in field samples from Tunisia, Israel or Indian Ocean islands. Through chlorpyrifos selection, we selected several HCR strains that displayed over 10 000-fold resistance. All strains were homozygous for resistant alleles at two main loci: the ace-1 gene, with the resistant ace-1R allele expressing the insensitive G119S acetylcholinesterase, and a resistant allele of an unknown gene (named T) linked to the sex and ace-2 genes. We constructed a strain carrying only the T-resistant allele and studied its resistance characteristics. By crossing this strain with strains harboring different alleles at the ace-1 locus, we showed that the resistant ace-1R and the T alleles act in strong synergy, as they elicited a resistance 100 times higher than expected from a simple multiplicative effect. This effect was specific to chlorpyrifos and parathion and was not affected by synergists. We also examined how HCR was expressed in strains carrying other ace-1-resistant alleles, such as ace-1V or the duplicated ace-1D allele, currently spreading worldwide. We identified two major parameters that influenced the level of resistance: the number and the nature of the ace-1-resistant alleles and the number of T alleles. Our data fit a model that predicts that the T allele acts by decreasing chlorpyrifos concentration in the compartment targeted in insects. PMID:26463842

  7. Photoactivation of GLUT4 translocation promotes glucose uptake via PI3-K/Akt2 signaling in 3T3-L1 adipocytes

    Directory of Open Access Journals (Sweden)

    Lei Huang

    2014-05-01

    Full Text Available Insulin resistance is a hallmark of the metabolic syndrome and type 2 diabetes. Dysfunction of PI-3K/Akt signaling was involved in insulin resistance. Glucose transporter 4 (GLUT4 is a key factor for glucose uptake in muscle and adipose tissues, which is closely regulated by PI-3K/Akt signaling in response to insulin treatment. Low-power laser irradiation (LPLI has been shown to regulate various physiological processes and induce the synthesis or release of multiple molecules such as growth factors, which (especially red and near infrared light is mainly through the activation of mitochondrial respiratory chain and the initiation of intracellular signaling pathways. Nevertheless, it is unclear whether LPLI could promote glucose uptake through activation of PI-3K/Akt/GLUT4 signaling in 3T3L-1 adipocytes. In this study, we investigated how LPLI promoted glucose uptake through activation of PI-3K/Akt/GLUT4 signaling pathway. Here, we showed that GLUT4 was localized to the Golgi apparatus and translocated from cytoplasm to cytomembrane upon LPLI treatment in 3T3L-1 adipocytes, which enhanced glucose uptake. Moreover, we found that glucose uptake was mediated by the PI3-K/Akt2 signaling, but not Akt1 upon LPLI treatment with Akt isoforms gene silence and PI3-K/Akt inhibitors. Collectively, our results indicate that PI3-K/Akt2/GLUT4 signaling act as the key regulators for improvement of glucose uptake under LPLI treatment in 3T3L-1 adipocytes. More importantly, our findings suggest that activation of PI3-K/Akt2/GLUT4 signaling by LPLI may provide guidance in practical applications for promotion of glucose uptake in insulin-resistant adipose tissue.

  8. The expression of antibiotic resistance genes in antibiotic-producing bacteria.

    Science.gov (United States)

    Mak, Stefanie; Xu, Ye; Nodwell, Justin R

    2014-08-01

    Antibiotic-producing bacteria encode antibiotic resistance genes that protect them from the biologically active molecules that they produce. The expression of these genes needs to occur in a timely manner: either in advance of or concomitantly with biosynthesis. It appears that there have been at least two general solutions to this problem. In many cases, the expression of resistance genes is tightly linked to that of antibiotic biosynthetic genes. In others, the resistance genes can be induced by their cognate antibiotics or by intermediate molecules from their biosynthetic pathways. The regulatory mechanisms that couple resistance to antibiotic biosynthesis are mechanistically diverse and potentially relevant to the origins of clinical antibiotic resistance. © 2014 John Wiley & Sons Ltd.

  9. Up-regulation of HOXB cluster genes are epigenetically regulated in tamoxifen-resistant MCF7 breast cancer cells.

    Science.gov (United States)

    Yang, Seoyeon; Lee, Ji-Yeon; Hur, Ho; Oh, Ji Hoon; Kim, Myoung Hee

    2018-05-28

    Tamoxifen (TAM) is commonly used to treat estrogen receptor (ER)-positive breast cancer. Despite the remarkable benefits, resistance to TAM presents a serious therapeutic challenge. Since several HOX transcription factors have been proposed as strong candidates in the development of resistance to TAM therapy in breast cancer, we generated an in vitro model of acquired TAM resistance using ER-positive MCF7 breast cancer cells (MCF7-TAMR), and analyzed the expression pattern and epigenetic states of HOX genes. HOXB cluster genes were uniquely up-regulated in MCF7-TAMR cells. Survival analysis of in slico data showed the correlation of high expression of HOXB genes with poor response to TAM in ER-positive breast cancer patients treated with TAM. Gain- and loss-of-function experiments showed that the overexpression of multi HOXB genes in MCF7 renders cancer cells more resistant to TAM, whereas the knockdown restores TAM sensitivity. Furthermore, activation of HOXB genes in MCF7-TAMR was associated with histone modifications, particularly the gain of H3K9ac. These findings imply that the activation of HOXB genes mediate the development of TAM resistance, and represent a target for development of new strategies to prevent or reverse TAM resistance.

  10. Molecular mapping and candidate gene analysis for resistance to powdery mildew in Cucumis sativus stem.

    Science.gov (United States)

    Liu, P N; Miao, H; Lu, H W; Cui, J Y; Tian, G L; Wehner, T C; Gu, X F; Zhang, S P

    2017-08-31

    Powdery mildew (PM) of cucumber (Cucumis sativus), caused by Podosphaera xanthii, is a major foliar disease worldwide and resistance is one of the main objectives in cucumber breeding programs. The resistance to PM in cucumber stem is important to the resistance for the whole plant. In this study, genetic analysis and gene mapping were implemented with cucumber inbred lines NCG-122 (with resistance to PM in the stem) and NCG-121 (with susceptibility in the stem). Genetic analysis showed that resistance to PM in the stem of NCG-122 was qualitative and controlled by a single-recessive nuclear gene (pm-s). Susceptibility was dominant to resistance. In the initial genetic mapping of the pm-s gene, 10 SSR markers were discovered to be linked to pm-s, which was mapped to chromosome 5 (Chr.5) of cucumber. The pm-s gene's closest flanking markers were SSR20486 and SSR06184/SSR13237 with genetic distances of 0.9 and 1.8 cM, respectively. One hundred and fifty-seven pairs of new SSR primers were exploited by the sequence information in the initial mapping region of pm-s. The analysis on the F 2 mapping population using the new molecular markers showed that 17 SSR markers were confirmed to be linked to the pm-s gene. The two closest flanking markers, pmSSR27and pmSSR17, were 0.1 and 0.7 cM from pm-s, respectively, confirming the location of this gene on Chr.5. The physical length of the genomic region containing pm-s was 135.7 kb harboring 21 predicted genes. Among these genes, the gene Csa5G623470 annotated as encoding Mlo-related protein was defined as the most probable candidate gene for the pm-s. The results of this study will provide a basis for marker-assisted selection, and make the benefit for the cloning of the resistance gene.

  11. The diversities of staphylococcal species, virulence and antibiotic resistance genes in the subclinical mastitis milk from a single Chinese cow herd.

    Science.gov (United States)

    Xu, Jia; Tan, Xiao; Zhang, Xinyu; Xia, Xiaoli; Sun, Huaichang

    2015-11-01

    Staphylococci are the leading pathogens of bovine mastitis which is difficult to control. However, the published data on the prevalence of staphylococcal species, virulence and antibiotic resistance genes in bovine mastitis from China are limited. In this study, 104 out of 209 subclinical mastitis milk samples from a single Chinese dairy herd were cultured-positive for staphylococci (49.8%), which were further identified as coagulase-positive staphylococci (CPS) or coagulase-negative staphylococci (CNS). According to the partial tuf and/or 16S rRNA gene sequence, the 28 CPS isolates were confirmed to be Staphylococcus aureus (26.9%), and 76 CNS isolates were assigned to 13 different species (73.1%) with Staphylococcus arlettae, Staphylococcus sciuri, Staphylococcus xylosus and Staphylococcus chromogenes as the dominant species. In the 28 S. aureus isolates, the most prevalent general virulence genes were coa, Ig and eno (100%), followed by hla (96.4%), hlb (92.9%), fib (92.9%), clfA (89.3%), clfB (85.7%) and nuc (85.7%). Both exotoxin and biofilm-associated genes were significantly less prevalent than the previously reported. Although 19 different virulence gene patterns were found, only one was dominant (32.1%). The prevalence of blaZ (82.1%) or mecA gene (35.7%) was much higher than the previously reported. In the 76 CNS isolates, the virulence genes were significantly less prevalent than that in the S. aureus isolates. Among the 4 main CNS species, S. chromogenes (n = 12) was the only species with high percentage (75%) of blaZ gene, while S. sciuri (n = 12) was the only species with the high percentage (66.7%) of mecA gene. The most of antibiotic resistance genes were present as multi-resistance genes, and the antibiotic resistances were attributed by different resistance genes between resistant S. aureus and CNS isolates. These data suggest that the prevalence of staphylococcal species, virulence and antibiotic resistance in the mastitis milk from the Chinese

  12. Role of reduced pi-pi stacking in the charge transport in polyfluorene

    International Nuclear Information System (INIS)

    Bajpai, Manisha; Srivastava, Ritu; Dhar, Ravindra; Tiwari, R.S.

    2016-01-01

    Highlights: • Role of bulky copolymer on the hole transport properties of polyfluorene thin films has been studied. • Photophysical measurement shows that the introduction of a SY in PFO effectively suppresses pi-stacking/aggregation of conjugated polymers in the solid state. • Current density decreases on blending for a given applied bias. - Abstract: We investigated the effect of blending of a bulky copolymer on the hole transport properties of poly (9,9-dihexyl fluorenyl-2,7-diyl)(PFO) thin films (∼120 nm) at different temperatures by obtaining the current density-voltage measurement. The poly (phenylenevinylene) based copolymer ‘‘Super Yellow” (SY) has been used as a blending component. Such polymer blending matrix is useful as it combines the host polymer (PFO) with the guest polymer of bulky side groups where pi-pi stacking is hindered by bulky side groups. This makes polyflorene much interesting and versatile material for lighting application. It has been found that the current density decreases on blending for a given applied bias. We demonstrated that the current conduction mechanism is bulk limited. It has been analyzed by trapped charge limited currents (TCLC) with electric field. We conclude that the relatively low hole mobility in blends as compared to pristine PFO would result due to increase in the pi-pi stacking distance and disorder.

  13. Role of reduced pi-pi stacking in the charge transport in polyfluorene

    Energy Technology Data Exchange (ETDEWEB)

    Bajpai, Manisha, E-mail: mansa83@gmail.com [Soft Materials Research Laboratory, Centre of Material Sciences, Institute of Interdisciplinary Studies, University of Allahabad, Allahabad 211002 (India); Department of Physics, Banaras Hindu University, Varanasi 221005 (India); Srivastava, Ritu [Centre for Organic Electronics, National Physical Laboratory (Council of Scientific and Industrial Research), Dr. K. S. Krishnan Road, New Delhi 110012 (India); Dhar, Ravindra [Soft Materials Research Laboratory, Centre of Material Sciences, Institute of Interdisciplinary Studies, University of Allahabad, Allahabad 211002 (India); Tiwari, R.S. [Department of Physics, Banaras Hindu University, Varanasi 221005 (India)

    2016-10-15

    Highlights: • Role of bulky copolymer on the hole transport properties of polyfluorene thin films has been studied. • Photophysical measurement shows that the introduction of a SY in PFO effectively suppresses pi-stacking/aggregation of conjugated polymers in the solid state. • Current density decreases on blending for a given applied bias. - Abstract: We investigated the effect of blending of a bulky copolymer on the hole transport properties of poly (9,9-dihexyl fluorenyl-2,7-diyl)(PFO) thin films (∼120 nm) at different temperatures by obtaining the current density-voltage measurement. The poly (phenylenevinylene) based copolymer ‘‘Super Yellow” (SY) has been used as a blending component. Such polymer blending matrix is useful as it combines the host polymer (PFO) with the guest polymer of bulky side groups where pi-pi stacking is hindered by bulky side groups. This makes polyflorene much interesting and versatile material for lighting application. It has been found that the current density decreases on blending for a given applied bias. We demonstrated that the current conduction mechanism is bulk limited. It has been analyzed by trapped charge limited currents (TCLC) with electric field. We conclude that the relatively low hole mobility in blends as compared to pristine PFO would result due to increase in the pi-pi stacking distance and disorder.

  14. Short communication: Phenotypic protease inhibitor resistance and cross-resistance in the clinic from 2006 to 2008 and mutational prevalences in HIV from patients with discordant tipranavir and darunavir susceptibility phenotypes.

    Science.gov (United States)

    Bethell, Richard; Scherer, Joseph; Witvrouw, Myriam; Paquet, Agnes; Coakley, Eoin; Hall, David

    2012-09-01

    To test tipranavir (TPV) or darunavir (DRV) as treatment options for patients with phenotypic resistance to protease inhibitors (PIs), including lopinavir, saquinavir, atazanavir, and fosamprenavir, the PhenoSense GT database was analyzed for susceptibility to DRV or TPV among PI-resistant isolates. The Monogram Biosciences HIV database (South San Francisco, CA) containing 7775 clinical isolates (2006-2008) not susceptible to at least one first-generation PI was analyzed. Phenotypic responses [resistant (R), partially susceptible (PS), or susceptible (S)] were defined by upper and lower clinical cut-offs to each PI. Genotypes were screened for amino acid substitutions associated with TPV-R/DRV-S and TPV-S/DRV-R phenotypes. In all, 4.9% (378) of isolates were resistant to all six PIs and 31.0% (2407) were resistant to none. Among isolates resistant to all four first-generation PIs, DRV resistance increased from 21.2% to 41.9% from 2006 to 2008, respectively, and resistance to TPV remained steady (53.9 to 57.3%, respectively). Higher prevalence substitutions in DRV-S/TPV-R isolates versus DRV-R/TPV-S isolates, respectively, were 82L/T (44.4% vs. 0%) and 83D (5.8% vs. 0%). Higher prevalence substitutions in DRV-R/TPV-S virus were 50V (0.0% vs. 28.9%), 54L (1.0% vs. 36.1%), and 76V (0.4% vs. 15.5%). Mutations to help predict discordant susceptibility to DRV and TPV in isolates with reduced susceptibility to other PIs were identified. DRV resistance mutations associated with improved virologic response to TPV were more prevalent in DRV-R/TPV-S isolates. TPV resistance mutations were more prevalent in TPV-R and DRV-S isolates. These results confirm the impact of genotype on phenotype, illustrating how HIV genotype and phenotype data assist regimen optimization.

  15. Genome-wide analysis of SU(VAR)3-9 distribution in chromosomes of Drosophila melanogaster.

    Science.gov (United States)

    Maksimov, Daniil A; Laktionov, Petr P; Posukh, Olga V; Belyakin, Stepan N; Koryakov, Dmitry E

    2018-03-01

    Histone modifications represent one of the key factors contributing to proper genome regulation. One of histone modifications involved in gene silencing is methylation of H3K9 residue. Present in the chromosomes across different eukaryotes, this epigenetic mark is controlled by SU(VAR)3-9 and its orthologs. Despite SU(VAR)3-9 was discovered over two decades ago, little is known about the details of its chromosomal distribution pattern. To fill in this gap, we used DamID-seq approach and obtained high-resolution genome-wide profiles for SU(VAR)3-9 in two somatic (salivary glands and brain ganglia) and two germline (ovarian nurse cells and testes) tissues of Drosophila melanogaster. Analysis of tissue and developmental expression of SU(VAR)3-9-bound genes indicates that in the somatic tissues tested, as well as in the ovarian nurse cells, SU(VAR)3-9 tends to associate with transcriptionally silent genes. In contrast, in the testes, SU(VAR)3-9 shows preferential association with testis-specific genes, and its binding appears dynamic during spermatogenesis. In somatic cells, the mere presence/absence of SU(VAR)3-9 binding correlates with lower/higher expression. No such correlation is found in the male germline. Interestingly, transcription units in piRNA clusters (particularly flanks thereof) are frequently targeted by SU(VAR)3-9, and Su(var)3-9 mutation affects the expression of select piRNA species. Our analyses suggest a context-dependent role of SU(VAR)3-9. In euchromatin, SU(VAR)3-9 may serve to fine-tune the expression of individual genes, whereas in heterochromatin, chromosome 4, and piRNA clusters, it may act more broadly over large chromatin domains.

  16. Recessive Resistance to Plant Viruses: Potential Resistance Genes Beyond Translation Initiation Factors

    Directory of Open Access Journals (Sweden)

    Masayoshi Hashimoto

    2016-10-01

    Full Text Available The ability of plant viruses to propagate their genomes in host cells depends on many host factors. In the absence of an agrochemical that specifically targets plant viral infection cycles, one of the most effective methods for controlling viral diseases in plants is taking advantage of the host plant’s resistance machinery. Recessive resistance is conferred by a recessive gene mutation that encodes a host factor critical for viral infection. It is a branch of the resistance machinery and, as an inherited characteristic, is very durable. Moreover, recessive resistance may be acquired by a deficiency in a negative regulator of plant defense responses, possibly due to the autoactivation of defense signaling. Eukaryotic translation initiation factor (eIF 4E and eIF4G and their isoforms are the most widely exploited recessive resistance genes in several crop species, and they are effective against a subset of viral species. However, the establishment of efficient, recessive resistance-type antiviral control strategies against a wider range of plant viral diseases requires genetic resources other than eIF4Es. In this review, we focus on recent advances related to antiviral recessive resistance genes evaluated in model plants and several crop species. We also address the roles of next-generation sequencing and genome editing technologies in improving plant genetic resources for recessive resistance-based antiviral breeding in various crop species.

  17. In silico binding affinity studies of N-9 substituted 6-(4-(4-propoxyphenylpiperazin-1-yl-9H-purine derivatives-Target for P70-S6K1 & PI3K-δ kinases

    Directory of Open Access Journals (Sweden)

    Manjunath G. Sunagar

    2018-03-01

    Full Text Available P70-S6K1 & PI3K-δ kinases are identified to be involved in many physiological processes associated with cancer, therefore many of the inhibitors being designed to target these kinases are in clinical trials. In the current study we have exploited the N-9 substituted 6-(4-(4-propoxyphenyl piperazin-1-yl-9H-purine derivatives for their inhibitory properties with the above kinases. We have used an in silico docking study with seventeen purine derivatives for their binding affinity calculations. The binding affinities of these small molecules with P70-S6K1 & PI3K-δ were performed using AutoDock Vina. Among all the compounds, PP16 showed highest binding affinity of −14.7 kcal/mol with P70-S6K1 kinase & −17.2 kcal/mol with PI3K-δ kinases as compared to the molecules under clinical trials (PF-4708671 & IC-87114. Docking studies revealed that N-9 coumarine substituted purine derivative could be one of the potential ligands for the inhibition of P70-S6K1 & PI3K-δ kinases. Hence, this compound can be further investigated by in vitro and in vivo experiments for further validation.

  18. Observation of B+ -> J/psi 3 pi(+)2 pi(-) and B+ -> psi (2S)pi(+)pi(+)pi(-) decays

    NARCIS (Netherlands)

    Aaij, R.; Adeva, B.; Adinolfi, M.; Ajaltouni, Z.; Akar, S.; Albrecht, J.; Alessio, F.; Alexander, M. H.; Ali, S.; Alkhazov, G.; Cartelle, P. Alvarez; Alves, A. A. Jr; Amato, S.; Amerio, S.; Amhis, Y.; BEACH, LA; Anderlini, L.; Andreassi, G.; Andreotti, M.; Andrews, J.E.; Appleby, R.B.; Archilli, F.; d'Argent, P.; Romeu, J. Arnau; Artamonov, AY; Artuso, M.; Aslanides, E.; Auriemma, G.; Baalouch, M.; Babuschkin, I.; Bachmann, S; Back, Jaap Willem; Badalov, A.; Baesso, C.; Baker, S; Baldini, W.; Barlow, R.J.; Barschel, C.; Barsuk, S.; Barter, W.; Baszczyk, M.; Batozskaya, V.; Batsukh, B.; Battista, V.; Bay, A.; Beaucourt, L.; Beddow, J.; Bedeschi, F.; Bediaga, I.; Bel, L. J.; Bellee, V.; Belloli, N.; Belous, K.; Belyaev, I.; Ben-Haim, E.; Bencivenni, G.; Benson, S; Benton, J.; Berezhnoy, A.; Bernet, R.; Bertolin, A.; Castano-Betancourt, Martha; Betti, F.; Bettler, M.O.; van Beuzekom, MG; Bezshyiko, Ia; Bifani, S.; Billoir, P.; Bird, T.; Birnkraut, A.; Bitadze, A.; Bizzeti, A.; Blake, T.; Blanc, F.; Blouw, J.; Blusk, S.; Bocci, V.; Boettcher, Thomas; Bondar, A.; Bondar, N.; Bonivento, W.; Bordyuzhin, I.; Borgheresi, A.; Borghi, S.; Borisyak, M.; Borsato, M.; Bossu, F.; Boubdir, M.; Bowcock, T. J. V.; Bowen, D.E.; Bozzi, C.; Braun, S.; Britsch, M.; Britton, T.; Brodzicka, J.; Buchanan, E.; Burr, C.; Bursche, A.; Buytaert, R. J.; Cadeddu, S.; Calabrese, J. R.; Calvi, M.; Gomez, M. Calvo; Camboni, A.; Campana, P.; Perez, D. H. Campora; Capriotti, L.; Carbone, A.; Carboni, G.; Cardinale, R.; Cardini, A.; Carniti, P.; Carson, L.; Akiba, K. Carvalho; Casse, G.; Cassina, L.; Garcia, L. Castillo; Cattaneo, M.; Cauet, Ch.; Cavallero, G.; Cenci, R.; Charles, M; Charpentier, Ph.; Chatzikonstantinidis, G.; Chefdeville, M.; Chen, S.; Cheung, T.F.S.; Chobanova, V.; Chrzaszcz, M.; Vidal, X. Cid; Ciezarek, G.; Clarke, P. E. L.; Clemencic, M.; Cliff, H. V.; Closier, J.; Coco, V.; Cogan, J.; Cogneras, E.; Cogoni, V.; Cojocariu, L.; Collazuol, G.; Collins, P.; Comerma-Montells, A.; Contu, A.; COOK, AM; Coombs, Geoffrey W.; Coquereau, S.; Corti, G.; Corvo, M.; Sobral, C. M. Costa; Couturier, B.; Cowan, G. A.; Craik, D. C.; Crocombe, A. C.; Torres, M. Cruz; Cunliffe, S.; Currie, R.; D'Ambrosio, C.; Marinho, F. Da Cunha; Dall'Occo, E.; Dalseno, J.; David, P. N. Y.; Davis, A.; Francisco, O. De Aguiar; De Bruyn, K.; De Capua, S.; De Cian, M.; Miranda, J. M.; De Paula, L.; De Serio, M.; De Simone, Paolo; Dean, C. -T.; Decamp, D.; Deckenhoff, M.; Del Buono, L.; Demmer, M.; Dendek, A.; Derkach, D.; Deschamps, O.; Dettori, F.; Dey, B.; Di Canto, A.; Dijkstra, H.; Dordei, F.; Dorigo, M.; Suarez, A. Dosil; Dovbnya, A.; Dreimanis, K.; Dufour, L.; Dujany, G.; Dungs, K.; Durante, P.; Dzhelyadin, R.; Dziurda, A.; Dzyuba, A.; Deleage, N.; Easo, S.; Ebert, Martin A.; Egede, U.; Egorychev, V.; Eidelman, S.; Eisenhardt, S.; Eitschberger, U.; Ekelhof, R.; Eklund, L.; Ely, SIdi Ould; Esen, S.; Evans, Helen M.; Evans, T.; Falabella, A.; Farley, N.; Farry, S.; Fay, R. F.; Fazzini, D.; FERGUSON, D; Prieto, A. Fernandez; Ferrari, F; Rodrigues, F. Ferreira; Ferro-Luzzi, M.; Filippov, S.; Fini, R. A.; Fiore, M; Fiorini, M.; Firlej, M.; Fitzpatrick, C.; Fiutowski, T.; Fleuret, F.; Fohl, K; Fontana, M.; Fontanelli, F.; Forshaw, D. C.; Forty, R.; Lima, V. Franco; Frank, M.; Frei, C.; Fu, J.; Furfaro, E.; Farber, CR; Torreira, A. Gallas; Galli, D.; Gallorini, S.; Gambetta, S.; Gandelman, M.; Gandini, P.; Gao, Y.; Martin, L. M. Garcia; Pardinas, J. Garcia; Tico, J. Garra; Garrido, L.; Garsed, P. J.; Gascon, D.; Gaspar, C; Gavardi, L.; Gazzoni, G.; Gerick, D.; Gersabeck, E. G; Gersabeck, M.; Gershon, T.; Ghez, Ph.; Giani', S.; Gibson, V.; Girard, O. G.; Giubega, L.; Gizdov, K.; Gligorov, V. V.; Golubkov, D.; Golutvin, A.; Gomes, A.; Gorelov, I. V.; Gotti, C.; Govorkova, E.; Gandara, M. Grabalosa; Diaz, R. Graciani; Cardoso, L. A. Granado; Grauges, E.; Graverini, E.; Graziani, G.; Grecu, A.; Griffith, P.; Grillo, L.; Cazon, B. R. Gruberg; Grunberg, O.; Gushchin, EM; Guz, Yu.; Gys, T.; Gobel, C.; Hadavizadeh, T.; Hadjivasiliou, C.; Haefeli, G.; Haen, C.; Haines, S. C.; Hall, S.; Hamilton, D.B.; Han, Xiaoyan; Hansmann-Menzemer, S.; Harnew, N.; Harnew, S. T.; Harrison, Christine J.; Hatch, M.; He, J. J.; Head, T.; Heister, J. A.; Hennessy, K.; Henrard, P.; Henry, Lee; Morata, J. A. Hernando; Van Herwijnen, E.; Hess, M.; Hicheur, A.; HILL, D; Hombach, C.; Hopchev, H.; Hulsbergen, W.; Humair, T.; Hushchyn, M.; Hussain, Sabah N. A.; Hutchcroft, D.; Idzik, M.; Ilten, P.; Jacobsson, R.; Jaeger, A.; Jalocha, J.; Jans, E.; Jawahery, A.; Jiang, Fuman; John, Jestinah M. Mahachie; Johnson, D; Jones, Jonathan C. R.; Joram, C.; Jost, B.; Jurik, N.; Kandybei, S.; Kanso, W.; Karacson, M.; Kariuki, J. M.; Karodia, S.; Kecke, M.; Kelsey, M.; Kenyon, I. R.; Kenzie, M.; Ketel, T. J.; Khairullin, E.; Khanji, B.; Khurewathanakul, C.; Kirn, T.; Klaver, N. S.; Klimaszewski, K.; Koliiev, S.; Kolpin, M.; Komarov, I.; Koopman, R. F.; Koppenburg, P.; Kosmyntseva, A.; Kozachuk, A.; Kozeiha, M.; Kravchuk, Vladimir Leonidovich; Kreplin, K.; Kreps, M.; Krokovny, P.; Kruse, F.; Krzemien, W.; Kucewicz, W.; Kucharczyk, M.; Kudryavtsev, V.; Kuonen, A. K.; Kurek, K.; Kvaratskheliya, T.; Lacarrere, D.; Lafferty, G.; Lai, A.; Lanfranchi, G.; Langenbruch, C.; Latham, T.; Lazzeroni, C.; Le Gac, R.; Van Leerdam, J.; Lees, J. -P.; Leflat, A.; Lefrancois, J.; Lefevre, R.; Lemaitre, F.; Cid, E. Lemos; Leroy, O.; Lesiak, T.; Leverington, B.; Li, Y; Likhomanenko, T.; Lindner, R.; Linn, C.; Lionetto, F.; Liu, B.; Liu, X.; Loh, D.; Longstaff, I.; Lopes, J. H.; Lucchesi, D.; Lucio Martinez, M.; Luo, Haibin; Lupato, A.; Luppi, E.; Lupton, O.; Lusiani, A.; Lyu, X. R.; Machefert, F.; Maciuc, F.; Maev, O.; Maguire, Kate; Malde, S.; Malinin, A.; Maltsev, T.; Manca, G.; Mancinelli, G.; Manning, P.; Maratas, J.; Marchand, J. F.; Marconi, U.; Benito, C. Marin; Marino, Paolo; Marks, J. D.; Martellotti, G.; Martin, M.; Martinelli, M.; Santos, D. Martinez; Vidal, F. Martinez; Tostes, D. Martins; Massacrier, L. M.; Massafferri, A.; Matev, R.; Mathad, A.; Mathe, Z.; Matteuzzi, C.; Mauri, A.; Maurin, B.; Mazurov, A.; McCann, Linda M.; McCarthy, Patrick J.; McNab, A.; McNulty, R.; Meadows, B.; Meier, F.; Meissner, M.; Melnychuk, D.; Merk, M.; Merli, A.; Michielin, E.; Milanes, D. A.; Minard, M. -N.; Mitzel, D. S.; Mogini, A.; Rodriguez, J. Molina; Moreno-Monroy, Ana I.; Monteil, S.; Morandin, M.; Morawski, P.; Morda, A.; Morello, M. J.; Moron, J.; Morris, A. -B.; Mountain, R.; Muheim, F.; Mulder, M; Mussini, M.; Muller, D.; Muller, J.; Muller, K; Muller, V; Naik, P.; Nakada, T.; Nandakumar, R.; Nandi, A.; Nasteva, I.; Needham, M.; Neri, N.; Neubert, S.; Neufeld, N.; Neuner, M.; Nguyen, A. D.; Nguyen, T. D.; Nguyen-Mau, C.; Nieswand, S.; Niet, R.; Nikitin, N.; Nikodem, T.; Novoselov, A.; O'Hanlon, D. P.; Oblakowska-Mucha, A.; Obraztsov, V.; Ogilvy, S.; Oldeman, R.; Onderwater, C. J. G.; Goicochea, J. M. Otalora; Otto, A.; Owen, Randall P.; Oyanguren, A.; Pais, P. R.; Palano, A.; Palombo, F.; Palutan, M.; Panman, J.; Papanestis, A.; Pappagallo, M.; Pappalardo, L.; Parker, Anthony W.; Parkes, C.; Passaleva, G.; Pastore, A.; Patel, G. D.; Patel, M.; Patrignani, C.; Pearce, A.; Pellegrino, A.; Penso, G.; Altarelli, M. Pepe; Perazzini, S.; Perret, P.; Pescatore, L.; Petridis, K.; Petrolini, A.; Petrov, A. D.; Petruzzo, M.; Olloqui, E. Picatoste; Pietrzyk, B.; Pikies, M.; Pinci, D.; Pistone, A.; Piucci, A.; Playfer, S.; Casasus, M. Plo; Poikela, T.; Polci, F.; Poluektov, A.; Polyakov, I.; Polycarpo, E.; Pomery, G. J.; Popov, A.; Popov, D.; Popovici, B.; Poslavskii, S.; Potterat, C.; Price, P. E.; Price, Daniel J.; Prisciandaro, J.; Pritchard, A.; Prouve, C.; Pugatch, V.; Navarro, A. Puig; Punzi, G.; Qian, S. W.; Quagliani, R.; Rachwal, B.; Rademacker, J. H.; Rama, M.; Pernas, M. Ramos; Rangel, M. S.; Raniuk, I.; Ratnikov, F.; Raven, G.; Redi, F.; Reichert, Andreas S.; Dos Reis, A. C.; Alepuz, C. Remon; Renaudin, V.; Ricciardi, S.; Richards, S.; Rihl, M.; Rinnert, K.; Molina, V. Rives; Robbe, P.; Rodrigues, A. B.; Rodrigues, Eliane R.; Lopez, J. A. Rodriguez; Perez, P. Rodriguez; Rogozhnikov, A.; Roiser, S.; Rollings, A.; Romanovskiy, V.; Vidal, A. Romero; Ronayne, J. W.; Rotondo, M.; Ruf, Thomas; Valls, P. Ruiz; Silva, J. J. Saborido; Sadykhov, E.; Sagidova, N.; Saitta, B.; Guimaraes, V. Salustino; Mayordomo, C. Sanchez; Sedes, B. Sanmartin; Santacesaria, R.; Rios, C. Santamarina; Santimaria, M.; Santovetti, E.; Sarti, A.; Satriano, C.; Satta, A.; Saunders, D. M.; Savrina, D.; Schael, S.; Schellenberg, M.; Schiller, M.; Schindler, H.; Schlupp, M.; Schmelling, M.; Schmelzer, T.; Schmidt, B.; Schneider, O.; Schopper, A.; Schubert, K.; Schubiger, M.; Schune, M. -H.; Schwemmer, R.; Sciascia, B.; Sciubba, A.; Semennikov, A.; Sergi, A.; Serra, N.; Gonzalez-Serrano, J.; Sestini, L.; Seyfert, P.; Shapkin, M.; Shapoval, I.; Shcheglov, Y.; Shears, T.; Shekhtman, L.; Shevchenko, V.; Siddi, B. G.; Coutinho, R. Silva; Oliveira, L. Silva de; Simi, G.; Simone Doolaard, [No Value; Sirendi, M.; Skidmore, N.; Skwarnicki, T.; Smith, E.; Smith, I. T.; Smith, J; Smith, M; Snoek, H.; Sokoloff, M. D.; Soler, F. J. P.; De Paula, B. Souza; Spaan, B.; Spradlin, P.; Sridharan, S.; Stagni, F.; Stahl, M.; Stahl, Sherin S.; Stefko, P.; Stefkova, S.; Steinkamp, O.; Stemmle, S.; Stenyakin, O.; Stevenson, S.; Stoica, S.; Stone, Ian S.; Storaci, B.; Stracka, S.; Straticiuc, M.; Straumann, U.; Sun, L.; Sutcliffe, W.; Swientek, K.; Syropoulos, V.; Szczekowski, M.; Szumlak, T.; T'Jampens, S.; Tayduganov, A.; Tekampe, T.; Tellarini, G.; Teubert, F.; Thomas, E.; Tilburg, Jeroen J H C; Tilley, M. J.; Tisserand, V.; Tobin, M; Tolk, S.; Tomassetti, L.; Tonelli, D.; Topp-Joergensen, S.; Toriello, F.; Tournefier, E.; Tourneur, S.; Trabelsi, K.; Traill, M.; Tran, M. T.; Tresch, M.; Trisovic, A.; Tsaregorodtsev, A.; Tsopelas, P.; Tully, A.; Tuning, N.; Ukleja, A.; Ustyuzhanin, A.; Uwer, U.; Vacca, C.; Vagnoni, V.; Valassi, A.; Valat, S.; Valenti, G.; Vallier, A.; Gomez, R. Vazquez; Regueiro, P. Vazquez; Vecchi, S.; van Veghel, M.; Velthuis, Miranda J.; Veltri, M.; Veneziano, G.; Venkateswaran, A.; Vernet, M.; Vesterinen, M.; Viaud, B.; VIEIRA, DF; Diaz, M. Vieites; Viemann, H.; Vilasis-Cardona, X.; Vitti, M.; Volkov, V.; Vollhardt, A.; Voneki, B.; Vorobyev, A.; Vorobyev, V.; Voss, C.; de Vries, J. A.; Sierra, C. Vazquez; Waldi, R.; Wallace, C.; Wallace, R; Walsh, J.; Wang, J; Ward, D. R.; Wark, H. M.; Watson, N. K.; Websdale, D.; Weiden, A.; Whitehead, M.; Wicht, J.; Wilkinson, G.; Wilkinson, M.; Williams, M.; Williams, M.; Williams, M.; Williams, Tishan; Wilson, F. Perry; Wimberley, J.; Wishahi, J.; Wislicki, W.; Witek, M.; Wormser, G.; Wotton, S. A.; Wraight, K.; Wyllie, K.; Xie, Y; Xing, Zhe; Xu, Z.; Yang, Z.; Yin, H.; Yu, J.; Yuan, X.-L.; Yushchenko, O.; Zarebski, K. A.; Zavertyaev, M.; Zhang, L; Zhang, Y.; Zhang, Y.; Zhelezov, A.; Zheng, Y.; Zhokhov, A.; Zhu, X.; Zhukov, V.; Zucchelli, S.; Rudolph, M.S.

    2017-01-01

    The decays B+-> J/psi 3 pi(+)2 pi(-) and B+ -> psi(2S)pi(+)pi(+)pi(-) are observed for the first time using a data sample corresponding to an integrated luminosity of 3.0 fb(-1), collected by the LHCb experiment in proton- proton collisions at the centre-of-mass energies of 7 and 8 TeV. The

  19. Antibiotic resistance and resistance genes in Escherichia coli from poultry farms, southwest Nigeria.

    Science.gov (United States)

    Adelowo, Olawale O; Fagade, Obasola E; Agersø, Yvonne

    2014-09-12

    This study investigated the mechanisms of resistance in 36 E. coli isolated from waste, litter, soil and water samples collected from poultry farms in Southwestern Nigeria. Minimum inhibitory concentration (MIC) distributions of the isolates were determined using the methods of the Clinical and Laboratory Standard Institute and resistance genes detected by PCR. A total of 30 isolates (94%) showed resistance to more than one antimicrobial. Percentage resistance was: tetracycline 81%, sulphamethoxazole 67%, streptomycin 56%, trimethoprim 47 %, ciprofloxacin 42%, ampicillin 36%, spectinomycin 28%, nalidixic acid 25%, chloramphenicol 22%, neomycin 14%, gentamicin 8%, amoxicillin-clavulanate, ceftiofur, cefotaxime, colistin, florfenicol and apramycin 0%. Resistance genes found among the isolates include bla-TEM (85%), sul2 (67%), sul3 (17%), aadA (65%), strA (70%), strB (61%), catA1 (25%), cmlA1 (13%), tetA (21%) and tetB (17%). Class 1 and 2 integrons were found in five (14%) and six (17%) isolates, respectively, while one isolate was positive for both classes of integrons. Seven out of eight isolates with resistance to ciprofloxacin and MIC ≤ 32 mg/L to nalidixic acid contained qnrS genes. Our findings provided additional evidence that the poultry production environment in Nigeria represents an important reservoir of antibiotic resistance genes such as qnrS that may spread from livestock production farms to human populations via manure and water.

  20. Trends in darunavir resistance-associated mutations and phenotypic resistance in commercially tested United States clinical samples between 2006 and 2012.

    Science.gov (United States)

    Lathouwers, Erkki; Gupta, Soumi; Haddad, Mojgan; Paquet, Agnes; de Meyer, Sandra; Baugh, Bryan

    2015-06-01

    HIV-1 samples submitted by clinicians from the United States for routine drug susceptibility testing (PhenoSense GT) were evaluated for genotypic and phenotypic resistance to darunavir and other protease inhibitors (PIs). Among these samples (Monogram Biosciences database January 2006-June 2012; N=78,843), isolates harboring zero IAS-USA darunavir resistance-associated mutations (RAMs) increased from 77.7% in 2006 to 92.8% through the first half of 2012 (H1 2012; upward trend, p=0.0008); a downward trend seen for samples with three or more darunavir RAMs (7.5% in 2006 and 2.6% in H1 2012; p=0.002). Among samples with any PI resistance (N=15,932), samples harboring zero darunavir RAMs gradually increased (39.9% in 2006 vs. 55.0% in H1 2012; upward trend, p=0.005), but three or more darunavir RAMs did not change over time (21.7% in 2006 and 19.2% in H1 2012; p=0.27). During this period, the frequency of the 11 individual darunavir RAMs (IAS-USA 2011 list) decreased among all samples. The frequency of each darunavir RAM in PI-resistant samples decreased or remained relatively stable. The prevalence of samples with phenotypic resistance to darunavir (partial-to-full) decreased over time in all samples (8.2% in 2006 vs. 2.3% in H1 2012), as did resistance to other PIs (p<0.006 for all PIs). Phenotypic resistance to darunavir and other PIs also decreased in PI-resistant samples (darunavir: 23.9% in 2006 vs. 17.1% in H1 2012; p<0.013 for all PIs). Since approval of darunavir in 2006, there was a significant decrease in prevalence of samples with genotypic and phenotypic resistance to darunavir in commercially tested HIV-1 isolates. Furthermore, the prevalence of phenotypic resistance to darunavir was lower than all other PIs.

  1. Simple description of the Jsup(P)=1/sup +/K/sup + -/. pi. /sup +/. pi. /sup -/ system in the reactions K/sup + -/p. -->. K/sup + -/. pi. /sup +/. pi. /sup -/p

    Energy Technology Data Exchange (ETDEWEB)

    Carnegie, R K; Cashmore, R J; Davier, M; Dunwoodie, W M; Lasinski, T A; Leith, D W.G.S.; Williams, S H [Stanford Linear Accelerator Center, Calif. (USA)

    1977-09-12

    A model in which Q/sub 1/ and Q/sub 2/ resonance contributions add coherently to a Gaussian background is shown to reproduce the mass dependence of the Jsup(P)=1/sup +/K*..pi.. and rhoK partial waves in K/sup + -/p..-->..K/sup + -/..pi../sup +/..pi../sup -/p at 13 GeV/c. Through a fit to the data, the mass and total width for Q/sub 1/ are found to be m=1289+-3+-(25) MeV, GAMMA=150+-9(+-70) MeV and for Q/sub 2/, m=1404+-3(+-10) MeV, GAMMA=142+-4(+-15) MeV, where estimated systematic errors are given in parentheses. While a significant background is required for the 1/sup +/K*..pi.. system, none is needed for the 1/sup +/rhoK system.

  2. Measurements of the Branching fractions for $B_{(s)} \\to D_{(s)}\\pi\\pi\\pi$ and $\\Lambda_b^0 \\to \\Lambda_c^+\\pi\\pi\\pi$

    CERN Document Server

    INSPIRE-00258707; Adeva, B.; Adinolfi, M.; Adrover, C.; Affolder, A.; Ajaltouni, Z.; Albrecht, J.; Alessio, F.; Alexander, M.; Alkhazov, G.; Alvarez Cartelle, P.; Alves, A.A.; Amato, S.; Amhis, Y.; Anderson, J.; Appleby, R.B.; Aquines Gutierrez, O.; Archilli, F.; Arrabito, L.; Artamonov, A.; Artuso, M.; Aslanides, E.; Auriemma, G.; Bachmann, S.; Back, J.J.; Bailey, D.S.; Balagura, V.; Baldini, W.; Barlow, R.J.; Barschel, C.; Barsuk, S.; Barter, W.; Bates, A.; Bauer, C.; Bauer, Th.; Bay, A.; Bediaga, I.; Belous, K.; Belyaev, I.; Ben-Haim, E.; Benayoun, M.; Bencivenni, G.; Benson, S.; Benton, J.; Bernet, R.; Bettler, M.O.; van Beuzekom, M.; Bien, A.; Bifani, S.; Bizzeti, A.; Bjornstad, P.M.; Blake, T.; Blanc, F.; Blanks, C.; Blouw, J.; Blusk, S.; Bobrov, A.; Bocci, V.; Bondar, A.; Bondar, N.; Bonivento, W.; Borghi, S.; Borgia, A.; Bowcock, T.J.V.; Bozzi, C.; Brambach, T.; van den Brand, J.; Bressieux, J.; Brett, D.; Brisbane, S.; Britsch, M.; Britton, T.; Brook, N.H.; Brown, H.; Buchler-Germann, A.; Burducea, I.; Bursche, A.; Buytaert, J.; Cadeddu, S.; Caicedo Carvajal, J.M.; Callot, O.; Calvi, M.; Calvo Gomez, M.; Camboni, A.; Campana, P.; Carbone, A.; Carboni, G.; Cardinale, R.; Cardini, A.; Carson, L.; Carvalho Akiba, K.; Casse, G.; Cattaneo, M.; Charles, M.; Charpentier, Ph.; Chiapolini, N.; Ciba, K.; Cid Vidal, X.; Ciezarek, G.; Clarke, P.E.L.; Clemencic, M.; Cliff, H.V.; Closier, J.; Coca, C.; Coco, V.; Cogan, J.; Collins, P.; Constantin, F.; Conti, G.; Contu, A.; Cook, A.; Coombes, M.; Corti, G.; Cowan, G.A.; Currie, R.; D'Almagne, B.; D'Ambrosio, C.; David, P.; De Bonis, I.; De Capua, S.; De Cian, M.; De Lorenzi, F.; De Miranda, J.M.; De Paula, L.; De Simone, P.; Decamp, D.; Deckenhoff, M.; Degaudenzi, H.; Deissenroth, M.; Del Buono, L.; Deplano, C.; Deschamps, O.; Dettori, F.; Dickens, J.; Dijkstra, H.; Diniz Batista, P.; Donleavy, S.; Dosil Suarez, A.; Dossett, D.; Dovbnya, A.; Dupertuis, F.; Dzhelyadin, R.; Eames, C.; Easo, S.; Egede, U.; Egorychev, V.; Eidelman, S.; van Eijk, D.; Eisele, F.; Eisenhardt, S.; Ekelhof, R.; Eklund, L.; Elsasser, Ch.; d'Enterria, D.G.; Esperante Pereira, D.; Esteve, L.; Falabella, A.; Fanchini, E.; Farber, C.; Fardell, G.; Farinelli, C.; Farry, S.; Fave, V.; Fernandez Albor, V.; Ferro-Luzzi, M.; Filippov, S.; Fitzpatrick, C.; Fontana, M.; Fontanelli, F.; Forty, R.; Frank, M.; Frei, C.; Frosini, M.; Furcas, S.; Gallas Torreira, A.; Galli, D.; Gandelman, M.; Gandini, P.; Gao, Y.; Garnier, J-C.; Garofoli, J.; Garra Tico, J.; Garrido, L.; Gaspar, C.; Gauvin, N.; Gersabeck, M.; Gershon, T.; Ghez, Ph.; Gibson, V.; Gligorov, V.V.; Gobel, C.; Golubkov, D.; Golutvin, A.; Gomes, A.; Gordon, H.; Grabalosa Gandara, M.; Graciani Diaz, R.; Granado Cardoso, L.A.; Grauges, E.; Graziani, G.; Grecu, A.; Gregson, S.; Gui, B.; Gushchin, E.; Guz, Yu.; Gys, T.; Haefeli, G.; Haen, C.; Haines, S.C.; Hampson, T.; Hansmann-Menzemer, S.; Harji, R.; Harnew, N.; Harrison, J.; Harrison, P.F.; He, J.; Heijne, V.; Hennessy, K.; Henrard, P.; Hernando Morata, J.A.; van Herwijnen, E.; Hicks, E.; Hofmann, W.; Holubyev, K.; Hopchev, P.; Hulsbergen, W.; Hunt, P.; Huse, T.; Huston, R.S.; Hutchcroft, D.; Hynds, D.; Iakovenko, V.; Ilten, P.; Imong, J.; Jacobsson, R.; Jaeger, A.; Jahjah Hussein, M.; Jans, E.; Jansen, F.; Jaton, P.; Jean-Marie, B.; Jing, F.; John, M.; Johnson, D.; Jones, C.R.; Jost, B.; Kandybei, S.; Karacson, M.; Karbach, T.M.; Keaveney, J.; Kerzel, U.; Ketel, T.; Keune, A.; Khanji, B.; Kim, Y.M.; Knecht, M.; Koblitz, S.; Koppenburg, P.; Kozlinskiy, A.; Kravchuk, L.; Kreplin, K.; Kreps, M.; Krocker, G.; Krokovny, P.; Kruse, F.; Kruzelecki, K.; Kucharczyk, M.; Kukulak, S.; Kumar, R.; Kvaratskheliya, T.; La Thi, V.N.; Lacarrere, D.; Lafferty, G.; Lai, A.; Lambert, D.; Lambert, R.W.; Lanciotti, E.; Lanfranchi, G.; Langenbruch, C.; Latham, T.; Le Gac, R.; van Leerdam, J.; Lees, J.P.; Lefevre, R.; Leflat, A.; Lefrancois, J.; Leroy, O.; Lesiak, T.; Li, L.; Li Gioi, L.; Lieng, M.; Liles, M.; Lindner, R.; Linn, C.; Liu, B.; Liu, G.; Lopes, J.H.; Lopez Asamar, E.; Lopez-March, N.; Luisier, J.; Machefert, F.; Machikhiliyan, I.V.; Maciuc, F.; Maev, O.; Magnin, J.; Malde, S.; Mamunur, R.M.D.; Manca, G.; Mancinelli, G.; Mangiafave, N.; Marconi, U.; Marki, R.; Marks, J.; Martellotti, G.; Martens, A.; Martin, L.; Martin Sanchez, A.; Martinez Santos, D.; Massafferri, A.; Mathe, Z.; Matteuzzi, C.; Matveev, M.; Maurice, E.; Maynard, B.; Mazurov, A.; McGregor, G.; McNulty, R.; Mclean, C.; Meissner, M.; Merk, M.; Merkel, J.; Messi, R.; Miglioranzi, S.; Milanes, D.A.; Minard, M.N.; Monteil, S.; Moran, D.; Morawski, P.; Mountain, R.; Mous, I.; Muheim, F.; Muller, K.; Muresan, R.; Muryn, B.; Musy, M.; Mylroie-Smith, J.; Naik, P.; Nakada, T.; Nandakumar, R.; Nardulli, J.; Nasteva, I.; Nedos, M.; Needham, M.; Neufeld, N.; Nguyen-Mau, C.; Nicol, M.; Nies, S.; Niess, V.; Nikitin, N.; Oblakowska-Mucha, A.; Obraztsov, V.; Oggero, S.; Ogilvy, S.; Okhrimenko, O.; Oldeman, R.; Orlandea, M.; Otalora Goicochea, J.M.; Owen, P.; Pal, B.; Palacios, J.; Palutan, M.; Panman, J.; Papanestis, A.; Pappagallo, M.; Parkes, C.; Parkinson, C.J.; Passaleva, G.; Patel, G.D.; Patel, M.; Paterson, S.K.; Patrick, G.N.; Patrignani, C.; Pavel-Nicorescu, C.; Pazos Alvarez, A.; Pellegrino, A.; Penso, G.; Pepe Altarelli, M.; Perazzini, S.; Perego, D.L.; Perez Trigo, E.; Perez-Calero Yzquierdo, A.; Perret, P.; Perrin-Terrin, M.; Pessina, G.; Petrella, A.; Petrolini, A.; Pie Valls, B.; Pietrzyk, B.; Pilar, T.; Pinci, D.; Plackett, R.; Playfer, S.; Plo Casasus, M.; Polok, G.; Poluektov, A.; Polycarpo, E.; Popov, D.; Popovici, B.; Potterat, C.; Powell, A.; du Pree, T.; Prisciandaro, J.; Pugatch, V.; Puig Navarro, A.; Qian, W.; Rademacker, J.H.; Rakotomiaramanana, B.; Rangel, M.S.; Raniuk, I.; Raven, G.; Redford, S.; Reid, M.M.; dos Reis, A.C.; Ricciardi, S.; Rinnert, K.; Roa Romero, D.A.; Robbe, P.; Rodrigues, E.; Rodrigues, F.; Rodriguez Perez, P.; Rogers, G.J.; Roiser, S.; Romanovsky, V.; Rouvinet, J.; Ruf, T.; Ruiz, H.; Sabatino, G.; Saborido Silva, J.J.; Sagidova, N.; Sail, P.; Saitta, B.; Salzmann, C.; Sannino, M.; Santacesaria, R.; Santinelli, R.; Santovetti, E.; Sapunov, M.; Sarti, A.; Satriano, C.; Satta, A.; Savrie, M.; Savrina, D.; Schaack, P.; Schiller, M.; Schleich, S.; Schmelling, M.; Schmidt, B.; Schneider, O.; Schopper, A.; Schune, M.H.; Schwemmer, R.; Sciubba, A.; Seco, M.; Semennikov, A.; Senderowska, K.; Sepp, I.; Serra, N.; Serrano, J.; Seyfert, P.; Shao, B.; Shapkin, M.; Shapoval, I.; Shatalov, P.; Shcheglov, Y.; Shears, T.; Shekhtman, L.; Shevchenko, O.; Shevchenko, V.; Shires, A.; Silva Coutinho, R.; Skottowe, H.P.; Skwarnicki, T.; Smith, A.C.; Smith, N.A.; Sobczak, K.; Soler, F.J.P.; Solomin, A.; Soomro, F.; Souza De Paula, B.; Spaan, B.; Sparkes, A.; Spradlin, P.; Stagni, F.; Stahl, S.; Steinkamp, O.; Stoica, S.; Stone, S.; Storaci, B.; Straticiuc, M.; Straumann, U.; Styles, N.; Subbiah, V.K.; Swientek, S.; Szczekowski, M.; Szczypka, P.; Szumlak, T.; T'Jampens, S.; Teodorescu, E.; Teubert, F.; Thomas, C.; Thomas, E.; van Tilburg, J.; Tisserand, V.; Tobin, M.; Topp-Joergensen, S.; Tran, M.T.; Tsaregorodtsev, A.; Tuning, N.; Ukleja, A.; Urquijo, P.; Uwer, U.; Vagnoni, V.; Valenti, G.; Vazquez Gomez, R.; Vazquez Regueiro, P.; Vecchi, S.; Velthuis, J.J.; Veltri, M.; Vervink, K.; Viaud, B.; Videau, I.; Vilasis-Cardona, X.; Visniakov, J.; Vollhardt, A.; Voong, D.; Vorobyev, A.; Voss, H.; Wacker, K.; Wandernoth, S.; Wang, J.; Ward, D.R.; Webber, A.D.; Websdale, D.; Whitehead, M.; Wiedner, D.; Wiggers, L.; Wilkinson, G.; Williams, M.P.; Williams, M.; Wilson, F.F.; Wishahi, J.; Witek, M.; Witzeling, W.; Wotton, S.A.; Wyllie, K.; Xie, Y.; Xing, F.; Yang, Z.; Young, R.; Yushchenko, O.; Zavertyaev, M.; Zhang, L.; Zhang, W.C.; Zhang, Y.; Zhelezov, A.; Zhong, L.; Zverev, E.; Zvyagin, A.

    2011-01-01

    Branching fractions of the decays $H_b\\to H_c\\pi^-\\pi^+\\pi^-$ relative to $H_b\\to H_c\\pi^-$ are presented, where $H_b$ ($H_c$) represents $\\overline{B^0}$ ($D^+$), $B^-$ ($D^0$), $\\overline{B_s^0}$ ($D_s^+$) and $\\Lambda_b^0$ ($\\Lambda_c^+$). The measurements are performed with the LHCb detector using 35~${\\rm pb^{-1}}$ of data collected at $\\sqrt{s}=7$~TeV. The ratios of branching fractions are measured to be \\begin{eqnarray*} {{\\cal{B}}(\\overline{B^0}\\to D^+\\pi^-\\pi^+\\pi^-)\\over{\\cal{B}}(\\overline{B^0}\\to D^+\\pi^-)} = 2.38\\pm0.11\\pm0.21 \

  3. Next-generation sequencing to identify candidate genes and develop diagnostic markers for a novel Phytophthora resistance gene, RpsHC18, in soybean.

    Science.gov (United States)

    Zhong, Chao; Sun, Suli; Li, Yinping; Duan, Canxing; Zhu, Zhendong

    2018-03-01

    A novel Phytophthora sojae resistance gene RpsHC18 was identified and finely mapped on soybean chromosome 3. Two NBS-LRR candidate genes were identified and two diagnostic markers of RpsHC18 were developed. Phytophthora root rot caused by Phytophthora sojae is a destructive disease of soybean. The most effective disease-control strategy is to deploy resistant cultivars carrying Phytophthora-resistant Rps genes. The soybean cultivar Huachun 18 has a broad and distinct resistance spectrum to 12 P. sojae isolates. Quantitative trait loci sequencing (QTL-seq), based on the whole-genome resequencing (WGRS) of two extreme resistant and susceptible phenotype bulks from an F 2:3 population, was performed, and one 767-kb genomic region with ΔSNP-index ≥ 0.9 on chromosome 3 was identified as the RpsHC18 candidate region in Huachun 18. The candidate region was reduced to a 146-kb region by fine mapping. Nonsynonymous SNP and haplotype analyses were carried out in the 146-kb region among ten soybean genotypes using WGRS. Four specific nonsynonymous SNPs were identified in two nucleotide-binding sites-leucine-rich repeat (NBS-LRR) genes, RpsHC18-NBL1 and RpsHC18-NBL2, which were considered to be the candidate genes. Finally, one specific SNP marker in each candidate gene was successfully developed using a tetra-primer ARMS-PCR assay, and the two markers were verified to be specific for RpsHC18 and to effectively distinguish other known Rps genes. In this study, we applied an integrated genomic-based strategy combining WGRS with traditional genetic mapping to identify RpsHC18 candidate genes and develop diagnostic markers. These results suggest that next-generation sequencing is a precise, rapid and cost-effective way to identify candidate genes and develop diagnostic markers, and it can accelerate Rps gene cloning and marker-assisted selection for breeding of P. sojae-resistant soybean cultivars.

  4. Lower genetic variability of HIV-1 and antiretroviral drug resistance in pregnant women from the state of Pará, Brazil.

    Science.gov (United States)

    Machado, Luiz Fernando Almeida; Costa, Iran Barros; Folha, Maria Nazaré; da Luz, Anderson Levy Bessa; Vallinoto, Antonio Carlos Rosário; Ishak, Ricardo; Ishak, Marluisa Oliveira Guimarães

    2017-04-12

    The present study aimed to describe the genetic diversity of HIV-1, as well as the resistance profile of the viruses identified in HIV-1 infected pregnant women under antiretroviral therapy in the state of Pará, Northern Brazil. Blood samples were collected from 45 HIV-1 infected pregnant to determine the virus subtypes according to the HIV-1 protease (PR) gene and part of the HIV-1 reverse transcriptase (RT) gene by sequencing the nucleotides of these regions. Drug resistance mutations and susceptibility to antiretroviral drugs were analyzed by the Stanford HIV Drug Resistance Database. Out of 45 samples, only 34 could be amplified for PR and 30 for RT. Regarding the PR gene, subtypes B (97.1%) and C (2.9%) were identified; for the RT gene, subtypes B (90.0%), F (6.7%), and C (3.3%) were detected. Resistance to protease inhibitors (PI) was identified in 5.8% of the pregnant, and mutations conferring resistance to nucleoside reverse transcriptase inhibitors were found in 3.3%, while mutations conferring resistance to non-nucleoside reverse transcriptase inhibitors were found in 3.3%. These results showed a low frequency of strains resistant to antiretroviral drugs, the prevalence of subtypes B and F, and the persistent low transmission of subtype C in pregnant of the state of Pará, Brazil.

  5. Regeneration of multiple shoots from transgenic potato events facilitates the recovery of phenotypically normal lines: assessing a cry9Aa2 gene conferring insect resistance

    Directory of Open Access Journals (Sweden)

    Jacobs Jeanne ME

    2011-10-01

    Full Text Available Abstract Background The recovery of high performing transgenic lines in clonal crops is limited by the occurrence of somaclonal variation during the tissue culture phase of transformation. This is usually circumvented by developing large populations of transgenic lines, each derived from the first shoot to regenerate from each transformation event. This study investigates a new strategy of assessing multiple shoots independently regenerated from different transformed cell colonies of potato (Solanum tuberosum L.. Results A modified cry9Aa2 gene, under the transcriptional control of the CaMV 35S promoter, was transformed into four potato cultivars using Agrobacterium-mediated gene transfer using a nptII gene conferring kanamycin resistance as a selectable marker gene. Following gene transfer, 291 transgenic lines were grown in greenhouse experiments to assess somaclonal variation and resistance to potato tuber moth (PTM, Phthorimaea operculella (Zeller. Independently regenerated lines were recovered from many transformed cell colonies and Southern analysis confirmed whether they were derived from the same transformed cell. Multiple lines regenerated from the same transformed cell exhibited a similar response to PTM, but frequently exhibited a markedly different spectrum of somaclonal variation. Conclusions A new strategy for the genetic improvement of clonal crops involves the regeneration and evaluation of multiple shoots from each transformation event to facilitate the recovery of phenotypically normal transgenic lines. Most importantly, regenerated lines exhibiting the phenotypic appearance most similar to the parental cultivar are not necessarily derived from the first shoot regenerated from a transformed cell colony, but can frequently be a later regeneration event.

  6. Extraction of the $\\pi^+\\pi^-$ Subsystem in Diffractively Produced $\\pi^-\\pi^+\\pi^-$ at COMPASS

    CERN Document Server

    Krinner, Fabian

    2017-01-01

    The COMPASS experiment at CERN has collected a large data sample of 50 million diffractively produced $\\pi^-\\pi^+\\pi^-$ events using a $190\\,$GeV$/c$ negatively charged hadron beam. The partial-wave analysis (PWA) of these high-precision data reveals previously unseen details. The PWA, which is currently limited by systematic uncertainties, is based on an isobar model, where multi-particle decays are described as subsequent two-body decays and where a prior-knowledge parametrization for the intermediate two-pion resonances has to be assumed -- usually a Breit-Wigner amplitude -- thus increasing systematic uncertainties, due to the concrete choice of the parametrization. We present a novel method, which allows to extract isobar amplitudes directly from the data in a less biased way. The focus lies on the scalar $\\pi^+\\pi^-$ subsystem, where a previous analysis found a signal for a new axial-vector state $a_1(1420)$ decaying into $f_0(980)\\pi$.

  7. First Measurement of Chiral Dynamics in $\\pi^-\\gamma \\to \\pi^-\\pi^-\\pi^+$

    CERN Document Server

    Adolph, C; Alexakhin, V Yu; Alexandrov, Yu; Alexeev, G D; Amoroso, A; Antonov, A A; Austregesilo, A; Badelek, B; Balestra, F; Barth, J; Baum, G; Bedfer, Y; Bernhard, J; Bertini, R; Bettinelli, M; Bicker, K A; Birsa, R; Bisplinghoff, J; Bordalo, P; Bradamante, F; Braun, C; Bravar, A; Bressan, A; Burtin, E; Chaberny, D; Chiosso, M; Chung, S U; Cicuttin, A; Crespo, M L; Dalla Torre, S; Das, S; Dasgupta, S S; Denisov, O Yu; Dhara, L; Donskov, S V; Doshita, N; Duic, V; Dunnweber, W; Dziewiecki, M; Efremov, A; Elia, C; Eversheim, P D; Eyrich, W; Faessler, M; Ferrero, A; Filin, A; Finger, M; Finger, M; Fischer, H; Franco, C; du Fresne von Hohenesche, N; Friedrich, J M; Garfagnini, R; Gautheron, F; Gavrichtchouk, O P; Gazda, R; Gerassimov, S; Geyer, R; Giorgi, M; Gnesi, I; Gobbo, B; Goertz, S; Grabmuller, S; Grasso, A; Grube, B; Gushterski, R; Guskov, A; Haas, F; von Harrach, D; Hasegawa, T; Heinsius, F H; Herrmann, F; Hess, C; Hinterberger, F; Horikawa, N; Hoppner, Ch; d'Hose, N; Huber, S; Ishimoto, S; Ivanov, O; Ivanshin, Yu; Iwata, T; Jahn, R; Jasinski, P; Jegou, G; Joosten, R; Kabuss, E; Kang, D; Ketzer, B; Khaustov, G V; Khokhlov, Yu A; Kisselev, Yu; Klein, F; Klimaszewski, K; Koblitz, S; Koivuniemi, J H; Kolosov, V N; Kondo, K; Konigsmann, K; Konorov, I; Konstantinov, V F; Korzenev, A; Kotzinian, A M; Kouznetsov, O; Kramer, M; Kroumchtein, Z V; Kunne, F; Kurek, K; Lauser, L; Lednev, A A; Lehmann, A; Levorato, S; Lichtenstadt, J; Maggiora, A; Magnon, A; Makke, N; Mallot, G K; Mann, A; Marchand, C; Martin, A; Marzec, J; Massmann, F; Matsuda, T; Meyer, W; Michigami, T; Mikhailov, Yu V; Moinester, M A; Morreale, A; Mutter, A; Nagaytsev, A; Nagel, T; Nerling, F; Neubert, S; Neyret, D; Nikolaenko, V I; Nowak, W D; Nunes, A S; Olshevsky, A G; Ostrick, M; Padee, A; Panknin, R; Panzieri, D; Parsamyan, B; Paul, S; Perevalova, E; Pesaro, G; Peshekhonov, D V; Piragino, G; Platchkov, S; Pochodzalla, J; Polak, J; Polyakov, V A; Pontecorvo, G; Pretz, J; Quintans, C; Rajotte, J F; Ramos, S; Rapatsky, V; Reicherz, G; Richter, A; Rocco, E; Rondio, E; Rossiyskaya, N S; Ryabchikov, D I; Samoylenko, V D; Sandacz, A; Sapozhnikov, M G; Sarkar, S; Savin, I A; Sbrizzai, G; Schiavon, P; Schill, C; Schluter, T; Schmitt, L; Schonning, K; Schopferer, S; Schroder, W; Shevchenko, O Yu; Siebert, H W; Silva, L; Sinha, L; Sissakian, A N; Slunecka, M; Smirnov, G I; Sosio, S; Sozzi, F; Srnka, A; Stolarski, M; Sulc, M; Sulej, R; Sznajder, P; Takekawa, S; Ter Wolbeek, J; Tessaro, S; Tessarotto, F; Teufel, A; Tkatchev, L G; Uhl, S; Uman, I; Vandenbroucke, M; Virius, M; Vlassov, N V; Windmolders, R; Wislicki, W; Wollny, H; Zaremba, K; Zavertyaev, M; Zemlyanichkina, E; Ziembicki, M; Zhuravlev, N; Zvyagin, A

    2012-01-01

    The COMPASS collaboration at CERN has investigated the $\\pi^-\\gamma \\to \\pi^-\\pi^-\\pi^+$ reaction at center-of-momentum energy below five pion masses, $\\sqrt{s} \\lt 5m_\\pi$ , embedded in the Primakoff reaction of 190 GeV pions impinging on a lead target. Exchange of quasi-real photons is selected by isolating the sharp Coulomb peak observed at smallest momentum transfers, $t' \\lt 0.001 GeV^2/c^2$. Using partial-wave analysis techniques, the scattering intensity of Coulomb production described in terms of chiral dynamics and its dependence on the 3pi-invariant mass $m_{3\\pi} = \\sqrt{s}$ were extracted. The absolute cross section was determined in seven bins of $\\sqrt{s}$ with an overall precision of 20%. At leading order, the result is found to be in good agreement with the prediction of chiral perturbation theory over the whole energy range investigated.

  8. Zeros of the pi /sup +/ pi /sup -/ to pi /sup +/ pi /sup -/ amplitude (from data on pp to pi /sup -/ pi /sup +/)

    CERN Document Server

    Bugg, D V

    1974-01-01

    Recent data on the reaction pp to pi /sup -/ pi /sup +/ show four conspicuous dips in the angular distribution at fixed values of nu =t- u. The conjecture is made that the channel pi /sup -/ pi /sup +/ to pi /sup -/ pi /sup +/ has zeros at the same nu values. Using data of the CERN-Munich group, one can follow the zeros through the whole Mandelstam plane. The zeros pass through the intersections of s and t channel poles, as the Veneziano model predicts; however, away from these intersections, they propagate in a fashion systematically quite different from Veneziano's ansatz. (10 refs).

  9. Gene expression analysis of two extensively drug-resistant tuberculosis isolates show that two-component response systems enhance drug resistance.

    Science.gov (United States)

    Yu, Guohua; Cui, Zhenling; Sun, Xian; Peng, Jinfu; Jiang, Jun; Wu, Wei; Huang, Wenhua; Chu, Kaili; Zhang, Lu; Ge, Baoxue; Li, Yao

    2015-05-01

    Global analysis of expression profiles using DNA microarrays was performed between a reference strain H37Rv and two clinical extensively drug-resistant isolates in response to three anti-tuberculosis drug exposures (isoniazid, capreomycin, and rifampicin). A deep analysis was then conducted using a combination of genome sequences of the resistant isolates, resistance information, and related public microarray data. Certain known resistance-associated gene sets were significantly overrepresented in upregulated genes in the resistant isolates relative to that observed in H37Rv, which suggested a link between resistance and expression levels of particular genes. In addition, isoniazid and capreomycin response genes, but not rifampicin, either obtained from published works or our data, were highly consistent with the differentially expressed genes of resistant isolates compared to those of H37Rv, indicating a strong association between drug resistance of the isolates and genes differentially regulated by isoniazid and capreomycin exposures. Based on these results, 92 genes of the studied isolates were identified as candidate resistance genes, 10 of which are known resistance-related genes. Regulatory network analysis of candidate resistance genes using published networks and literature mining showed that three two-component regulatory systems and regulator CRP play significant roles in the resistance of the isolates by mediating the production of essential envelope components. Finally, drug sensitivity testing indicated strong correlations between expression levels of these regulatory genes and sensitivity to multiple anti-tuberculosis drugs in Mycobacterium tuberculosis. These findings may provide novel insights into the mechanism underlying the emergence and development of drug resistance in resistant tuberculosis isolates and useful clues for further studies on this issue. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. Observation of the suppressed ADS modes $B^\\pm \\to [\\pi^\\pm K^\\mp \\pi^+\\pi^-]_D K^\\pm$ and $B^\\pm \\to [\\pi^\\pm K^\\mp \\pi^+\\pi^-]_D \\pi^\\pm$

    CERN Document Server

    INSPIRE-00258707; Abellan Beteta, C; Adeva, B; Adinolfi, M; Adrover, C; Affolder, A; Ajaltouni, Z; Albrecht, J; Alessio, F; Alexander, M; Ali, S; Alkhazov, G; Alvarez Cartelle, P; Alves Jr, A A; Amato, S; Amerio, S; Amhis, Y; Anderlini, L; Anderson, J; Andreassen, R; Appleby, R B; Aquines Gutierrez, O; Archilli, F; Artamonov, A; Artuso, M; Aslanides, E; Auriemma, G; Bachmann, S; Back, J J; Baesso, C; Balagura, V; Baldini, W; Barlow, R J; Barschel, C; Barsuk, S; Barter, W; Bauer, Th; Bay, A; Beddow, J; Bedeschi, F; Bediaga, I; Belogurov, S; Belous, K; Belyaev, I; Ben-Haim, E; Benayoun, M; Bencivenni, G; Benson, S; Benton, J; Berezhnoy, A; Bernet, R; Bettler, M -O; van Beuzekom, M; Bien, A; Bifani, S; Bird, T; Bizzeti, A; Bjørnstad, P M; Blake, T; Blanc, F; Blouw, J; Blusk, S; Bocci, V; Bondar, A; Bondar, N; Bonivento, W; Borghi, S; Borgia, A; Bowcock, T J V; Bowen, E; Bozzi, C; Brambach, T; van den Brand, J; Bressieux, J; Brett, D; Britsch, M; Britton, T; Brook, N H; Brown, H; Burducea, I; Bursche, A; Busetto, G; Buytaert, J; Cadeddu, S; Callot, O; Calvi, M; Calvo Gomez, M; Camboni, A; Campana, P; Carbone, A; Carboni, G; Cardinale, R; Cardini, A; Carranza-Mejia, H; Carson, L; Carvalho Akiba, K; Casse, G; Cattaneo, M; Cauet, Ch; Charles, M; Charpentier, Ph; Chen, P; Chiapolini, N; Chrzaszcz, M; Ciba, K; Cid Vidal, X; Ciezarek, G; Clarke, P E L; Clemencic, M; Cliff, H V; Closier, J; Coca, C; Coco, V; Cogan, J; Cogneras, E; Collins, P; Comerma-Montells, A; Contu, A; Cook, A; Coombes, M; Coquereau, S; Corti, G; Couturier, B; Cowan, G A; Craik, D; Cunliffe, S; Currie, R; D'Ambrosio, C; David, P; David, P N Y; De Bonis, I; De Bruyn, K; De Capua, S; De Cian, M; De Miranda, J M; De Oyanguren Campos, M; De Paula, L; De Silva, W; De Simone, P; Decamp, D; Deckenhoff, M; Del Buono, L; Derkach, D; Deschamps, O; Dettori, F; Di Canto, A; Dijkstra, H; Dogaru, M; Donleavy, S; Dordei, F; Dosil Suárez, A; Dossett, D; Dovbnya, A; Dupertuis, F; Dzhelyadin, R; Dziurda, A; Dzyuba, A; Easo, S; Egede, U; Egorychev, V; Eidelman, S; van Eijk, D; Eisenhardt, S; Eitschberger, U; Ekelhof, R; Eklund, L; El Rifai, I; Elsasser, Ch; Elsby, D; Falabella, A; Färber, C; Fardell, G; Farinelli, C; Farry, S; Fave, V; Ferguson, D; Fernandez Albor, V; Ferreira Rodrigues, F; Ferro-Luzzi, M; Filippov, S; Fitzpatrick, C; Fontana, M; Fontanelli, F; Forty, R; Francisco, O; Frank, M; Frei, C; Frosini, M; Furcas, S; Furfaro, E; Gallas Torreira, A; Galli, D; Gandelman, M; Gandini, P; Gao, Y; Garofoli, J; Garosi, P; Garra Tico, J; Garrido, L; Gaspar, C; Gauld, R; Gersabeck, E; Gersabeck, M; Gershon, T; Ghez, Ph; Gibson, V; Gligorov, V V; Göbel, C; Golubkov, D; Golutvin, A; Gomes, A; Gordon, H; Grabalosa Gándara, M; Graciani Diaz, R; Granado Cardoso, L A; Graugés, E; Graziani, G; Grecu, A; Greening, E; Gregson, S; Grünberg, O; Gui, B; Gushchin, E; Guz, Yu; Gys, T; Hadjivasiliou, C; Haefeli, G; Haen, C; Haines, S C; Hall, S; Hampson, T; Hansmann-Menzemer, S; Harnew, N; Harnew, S T; Harrison, J; Hartmann, T; He, J; Heijne, V; Hennessy, K; Henrard, P; Hernando Morata, J A; van Herwijnen, E; Hicks, E; Hill, D; Hoballah, M; Hombach, C; Hopchev, P; Hulsbergen, W; Hunt, P; Huse, T; Hussain, N; Hutchcroft, D; Hynds, D; Iakovenko, V; Idzik, M; Ilten, P; Jacobsson, R; Jaeger, A; Jans, E; Jaton, P; Jing, F; John, M; Johnson, D; Jones, C R; Jost, B; Kaballo, M; Kandybei, S; Karacson, M; Karbach, T M; Kenyon, I R; Kerzel, U; Ketel, T; Keune, A; Khanji, B; Kochebina, O; Komarov, I; Koopman, R F; Koppenburg, P; Korolev, M; Kozlinskiy, A; Kravchuk, L; Kreplin, K; Kreps, M; Krocker, G; Krokovny, P; Kruse, F; Kucharczyk, M; Kudryavtsev, V; Kvaratskheliya, T; La Thi, V N; Lacarrere, D; Lafferty, G; Lai, A; Lambert, D; Lambert, R W; Lanciotti, E; Lanfranchi, G; Langenbruch, C; Latham, T; Lazzeroni, C; Le Gac, R; van Leerdam, J; Lees, J -P; Lefèvre, R; Leflat, A; Lefrançois, J; Leo, S; Leroy, O; Leverington, B; Li, Y; Li Gioi, L; Liles, M; Lindner, R; Linn, C; Liu, B; Liu, G; von Loeben, J; Lohn, S; Lopes, J H; Lopez Asamar, E; Lopez-March, N; Lu, H; Lucchesi, D; Luisier, J; Luo, H; Machefert, F; Machikhiliyan, I V; Maciuc, F; Maev, O; Malde, S; Manca, G; Mancinelli, G; Marconi, U; Märki, R; Marks, J; Martellotti, G; Martens, A; Martin, L; Martín Sánchez, A; Martinelli, M; Martinez Santos, D; Martins Tostes, D; Massafferri, A; Matev, R; Mathe, Z; Matteuzzi, C; Maurice, E; Mazurov, A; McCarthy, J; McNulty, R; Mcnab, A; Meadows, B; Meier, F; Meissner, M; Merk, M; Milanes, D A; Minard, M -N; Molina Rodriguez, J; Monteil, S; Moran, D; Morawski, P; Morello, M J; Mountain, R; Mous, I; Muheim, F; Müller, K; Muresan, R; Muryn, B; Muster, B; Naik, P; Nakada, T; Nandakumar, R; Nasteva, I; Needham, M; Neufeld, N; Nguyen, A D; Nguyen, T D; Nguyen-Mau, C; Nicol, M; Niess, V; Niet, R; Nikitin, N; Nikodem, T; Nomerotski, A; Novoselov, A; Oblakowska-Mucha, A; Obraztsov, V; Oggero, S; Ogilvy, S; Okhrimenko, O; Oldeman, R; Orlandea, M; Otalora Goicochea, J M; Owen, P; Pal, B K; Palano, A; Palutan, M; Panman, J; Papanestis, A; Pappagallo, M; Parkes, C; Parkinson, C J; Passaleva, G; Patel, G D; Patel, M; Patrick, G N; Patrignani, C; Pavel-Nicorescu, C; Pazos Alvarez, A; Pellegrino, A; Penso, G; Pepe Altarelli, M; Perazzini, S; Perego, D L; Perez Trigo, E; Pérez-Calero Yzquierdo, A; Perret, P; Perrin-Terrin, M; Pessina, G; Petridis, K; Petrolini, A; Phan, A; Picatoste Olloqui, E; Pietrzyk, B; Pilař, T; Pinci, D; Playfer, S; Plo Casasus, M; Polci, F; Polok, G; Poluektov, A; Polycarpo, E; Popov, D; Popovici, B; Potterat, C; Powell, A; Prisciandaro, J; Pugatch, V; Puig Navarro, A; Punzi, G; Qian, W; Rademacker, J H; Rakotomiaramanana, B; Rangel, M S; Raniuk, I; Rauschmayr, N; Raven, G; Redford, S; Reid, M M; dos Reis, A C; Ricciardi, S; Richards, A; Rinnert, K; Rives Molina, V; Roa Romero, D A; Robbe, P; Rodrigues, E; Rodriguez Perez, P; Roiser, S; Romanovsky, V; Romero Vidal, A; Rouvinet, J; Ruf, T; Ruffini, F; Ruiz, H; Ruiz Valls, P; Sabatino, G; Saborido Silva, J J; Sagidova, N; Sail, P; Saitta, B; Salzmann, C; Sanmartin Sedes, B; Sannino, M; Santacesaria, R; Santamarina Rios, C; Santovetti, E; Sapunov, M; Sarti, A; Satriano, C; Satta, A; Savrie, M; Savrina, D; Schaack, P; Schiller, M; Schindler, H; Schlupp, M; Schmelling, M; Schmidt, B; Schneider, O; Schopper, A; Schune, M -H; Schwemmer, R; Sciascia, B; Sciubba, A; Seco, M; Semennikov, A; Senderowska, K; Sepp, I; Serra, N; Serrano, J; Seyfert, P; Shapkin, M; Shapoval, I; Shatalov, P; Shcheglov, Y; Shears, T; Shekhtman, L; Shevchenko, O; Shevchenko, V; Shires, A; Silva Coutinho, R; Skwarnicki, T; Smith, N A; Smith, E; Smith, M; Sokoloff, M D; Soler, F J P; Soomro, F; Souza, D; Souza De Paula, B; Spaan, B; Sparkes, A; Spradlin, P; Stagni, F; Stahl, S; Steinkamp, O; Stoica, S; Stone, S; Storaci, B; Straticiuc, M; Straumann, U; Subbiah, V K; Swientek, S; Syropoulos, V; Szczekowski, M; Szczypka, P; Szumlak, T; T'Jampens, S; Teklishyn, M; Teodorescu, E; Teubert, F; Thomas, C; Thomas, E; van Tilburg, J; Tisserand, V; Tobin, M; Tolk, S; Tonelli, D; Topp-Joergensen, S; Torr, N; Tournefier, E; Tourneur, S; Tran, M T; Tresch, M; Tsaregorodtsev, A; Tsopelas, P; Tuning, N; Ubeda Garcia, M; Ukleja, A; Urner, D; Uwer, U; Vagnoni, V; Valenti, G; Vazquez Gomez, R; Vazquez Regueiro, P; Vecchi, S; Velthuis, J J; Veltri, M; Veneziano, G; Vesterinen, M; Viaud, B; Vieira, D; Vilasis-Cardona, X; Vollhardt, A; Volyanskyy, D; Voong, D; Vorobyev, A; Vorobyev, V; Voß, C; Voss, H; Waldi, R; Wallace, R; Wandernoth, S; Wang, J; Ward, D R; Watson, N K; Webber, A D; Websdale, D; Whitehead, M; Wicht, J; Wiechczynski, J; Wiedner, D; Wiggers, L; Wilkinson, G; Williams, M P; Williams, M; Wilson, F F; Wishahi, J; Witek, M; Wotton, S A; Wright, S; Wu, S; Wyllie, K; Xie, Y; Xing, F; Xing, Z; Yang, Z; Young, R; Yuan, X; Yushchenko, O; Zangoli, M; Zavertyaev, M; Zhang, F; Zhang, L; Zhang, W C; Zhang, Y; Zhelezov, A; Zhokhov, A; Zhong, L; Zvyagin, A

    2013-01-01

    An analysis of $B^{\\pm}\\to DK^{\\pm}$ and $B^{\\pm}\\to D\\pi^{\\pm}$ decays is presented where the $D$ meson is reconstructed in the four-body final state $K^{\\pm}\\pi^{\\mp} \\pi^+ \\pi^-$. Using LHCb data corresponding to an integrated luminosity of $1.0{\\rm \\,fb}^{-1}$, first observations are made of the suppressed ADS modes $B^{\\pm}\\to [\\pi^{\\pm} K^{\\mp}\\pi^+\\pi^-]_D K^{\\pm}$ and $B^{\\pm}\\to [\\pi^{\\pm} K^{\\mp} \\pi^+\\pi^- ]_D\\pi^{\\pm}$ with a significance of $5.1\\sigma$ and greater than $10\\sigma$, respectively. Measurements of $CP$ asymmetries and $CP$-conserving ratios of partial widths from this family of decays are also performed. The magnitude of the ratio between the suppressed and favoured $B^{\\pm}\\to DK^{\\pm}$ amplitudes is determined to be $r^K_B = 0.097 \\pm{0.011}$.

  11. Occurrence of the mcr-1 Colistin Resistance Gene and other Clinically Relevant Antibiotic Resistance Genes in Microbial Populations at Different Municipal Wastewater Treatment Plants in Germany

    Directory of Open Access Journals (Sweden)

    Norman Hembach

    2017-07-01

    Full Text Available Seven wastewater treatment plants (WWTPs with different population equivalents and catchment areas were screened for the prevalence of the colistin resistance gene mcr-1 mediating resistance against last resort antibiotic polymyxin E. The abundance of the plasmid-associated mcr-1 gene in total microbial populations during water treatment processes was quantitatively analyzed by qPCR analyses. The presence of the colistin resistance gene was documented for all of the influent wastewater samples of the seven WWTPs. In some cases the mcr-1 resistance gene was also detected in effluent samples of the WWTPs after conventional treatment reaching the aquatic environment. In addition to the occurrence of mcr-1 gene, CTX-M-32, blaTEM, CTX-M, tetM, CMY-2, and ermB genes coding for clinically relevant antibiotic resistances were quantified in higher abundances in all WWTPs effluents. In parallel, the abundances of Acinetobacter baumannii, Klebsiella pneumoniae, and Escherichia coli were quantified via qPCR using specific taxonomic gene markers which were detected in all influent and effluent wastewaters in significant densities. Hence, opportunistic pathogens and clinically relevant antibiotic resistance genes in wastewaters of the analyzed WWTPs bear a risk of dissemination to the aquatic environment. Since many of the antibiotic resistance gene are associated with mobile genetic elements horizontal gene transfer during wastewater treatment can't be excluded.

  12. Observation and study of baryonic B decays: B -> D(*) p pbar, D(*) p pbar pi, and D(*) p pbar pi pi

    Energy Technology Data Exchange (ETDEWEB)

    Aubert, B.; Karyotakis, Y.; Lees, J.P.; Poireau, V.; Prencipe, E.; Prudent, X.; Tisserand, V.; /Annecy, LAPP; Garra Tico, J.; Grauges, E.; /Barcelona U., ECM; Martinelli, M.; Palano, A.; Pappagallo, M.; /INFN, Bari /Bari U.; Eigen, G.; Stugu, B.; Sun, L.; /Bergen U.; Battaglia, M.; Brown, D.N.; Hooberman, B.; Kerth, L.T.; Kolomensky, Yu.G.; Lynch, G. /LBL, Berkeley /UC, Berkeley /Birmingham U. /Ruhr U., Bochum /British Columbia U. /Brunel U. /Novosibirsk, IYF /UC, Irvine /UC, Riverside /UC, San Diego /UC, Santa Barbara /UC, Santa Cruz /Caltech /Cincinnati U. /Colorado U. /Colorado State U. /Dortmund U. /Dresden, Tech. U. /Ecole Polytechnique /Edinburgh U. /INFN, Ferrara /Ferrara U. /INFN, Ferrara /INFN, Ferrara /Ferrara U. /INFN, Ferrara /INFN, Ferrara /Ferrara U. /Frascati /INFN, Genoa /Genoa U. /INFN, Genoa /INFN, Genoa /Genoa U. /INFN, Genoa /INFN, Genoa /Genoa U. /Harvard U. /Heidelberg U. /Humboldt U., Berlin /Imperial Coll., London /Iowa U. /Iowa State U. /Johns Hopkins U. /Orsay, LAL /LLNL, Livermore /Liverpool U. /Queen Mary, U. of London /Royal Holloway, U. of London /Louisville U. /Mainz U., Inst. Kernphys. /Manchester U. /Maryland U. /Massachusetts U., Amherst /MIT, LNS /McGill U. /INFN, Milan /Milan U. /INFN, Milan /INFN, Milan /Milan U. /Mississippi U. /Montreal U. /Mt. Holyoke Coll. /INFN, Naples /Naples U. /INFN, Naples /INFN, Naples /Naples U. /NIKHEF, Amsterdam /Notre Dame U. /Ohio State U. /Oregon U. /INFN, Padua /Padua U. /INFN, Padua /INFN, Padua /Padua U. /Paris U., VI-VII /Pennsylvania U. /INFN, Perugia /Perugia U. /INFN, Pisa /Pisa U. /INFN, Pisa /Pisa, Scuola Normale Superiore /INFN, Pisa /Pisa U. /INFN, Pisa /Princeton U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /Rostock U. /Rutherford /DAPNIA, Saclay /SLAC /South Carolina U. /Stanford U., Phys. Dept. /SUNY, Albany /Tel Aviv U. /Tennessee U. /Texas U. /Texas U., Dallas /INFN, Turin /Turin U. /INFN, Trieste /Trieste U. /Valencia U., IFIC /Victoria U. /Warwick U. /Wisconsin U., Madison

    2009-10-17

    We present a study of ten B-meson decays to a D{sup (*)}, a proton-antiproton pair, and a system of up to two pions using BABAR's data set of 455 x 10{sup 6} B{bar B} pairs. Four of the modes {bar B}{sup 0} {yields} D{sup 0}p{bar p}, {bar B}{sup 0} {yields} D*{sup 0}p{bar p}, {bar B}{sup 0} {yields} D{sup +}p{bar p}{pi}{sup -}, {bar B}{sup 0} {yields} D{sup ast+}p{bar p}{pi}{sup -} are studied with improved statistics compared to previous measurements; six of the modes (B{sup -} {yields} D{sup 0}p{bar p}{pi}{sup -}, B{sup -} {yields} D*{sup 0}p{bar p}{pi}{sup -}, {bar B}{sup 0} {yields} D{sup 0}p{bar p}{pi}{sup -}{pi}{sup +}, {bar B}{sup 0} {yields} D*{sup 0}p{bar p}{pi}{sup -}{pi}{sup +}, B{sup -} {yields} D{sup +}p{bar p}{pi}{sup -}{pi}{sup -}, B{sup -} {yields} D{sup ast+}p{bar p}{pi}{sup -}{pi}{sup -}) are first observations. The branching fractions for 3- and 5-body decays are suppressed compared to 4-body decays. Kinematic distributions for 3-body decays show non-overlapping threshold enhancements in m(p{bar p}) and m(D{sup (*)0}p) in the Dalitz plots. For 4-body decays, m(p{pi}{sup -}) mass projections show a narrow peak with mass and full width of (1497.4 {+-} 3.0 {+-} 0.9)MeV/c{sup 2} and (47 {+-} 12 {+-} 4)MeV/c{sup 2}, respectively, where the first (second) errors are statistical (systematic). For 5-body decays, mass projections are similar to phase space expectations. All results are preliminary.

  13. Sulfonamide-resistant bacteria and their resistance genes in soils fertilized with manures from Jiangsu Province, Southeastern China.

    Science.gov (United States)

    Wang, Na; Yang, Xiaohong; Jiao, Shaojun; Zhang, Jun; Ye, Boping; Gao, Shixiang

    2014-01-01

    Antibiotic-resistant bacteria and genes are recognized as new environmental pollutants that warrant special concern. There were few reports on veterinary antibiotic-resistant bacteria and genes in China. This work systematically analyzed the prevalence and distribution of sulfonamide resistance genes in soils from the environments around poultry and livestock farms in Jiangsu Province, Southeastern China. The results showed that the animal manure application made the spread and abundance of antibiotic resistance genes (ARGs) increasingly in the soil. The frequency of sulfonamide resistance genes was sul1 > sul2 > sul3 in pig-manured soil DNA and sul2 > sul1 > sul3 in chicken-manured soil DNA. Further analysis suggested that the frequency distribution of the sul genes in the genomic DNA and plasmids of the SR isolates from manured soil was sul2 > sul1 > sul3 overall (psulfonamide resistance genes. The present study also indicated that Bacillus, Pseudomonas and Shigella were the most prevalent sul-positive genera in the soil, suggesting a potential human health risk. The above results could be important in the evaluation of antibiotic-resistant bacteria and genes from manure as sources of agricultural soil pollution; the results also demonstrate the necessity and urgency of the regulation and supervision of veterinary antibiotics in China.

  14. Determination of the S-wave $\\pi \\pi$ scattering lengths from a study of $K^{\\pm} \\to \\pi^{\\pm} \\pi^{0} \\pi^{0}$ decays

    CERN Document Server

    Batley, J R; Kalmus, G; Lazzeroni, C; Munday, D J; Slater, M W; Wotton, S A; Arcidiacono, R; Bocquet, G; Cabibbo, N; Ceccucci, A; Cundy, D; Falaleev, V; Fidecaro, Maria; Gatignon, L; Gonidec, A; Kubischta, W; Norton, A; Maier, A; Patel, M; Peters, A; Balev, S; Frabetti, P L; Goudzovski, E; Khristov, P Z; Kekelidze, V; Kozhuharov, V; Litov, L; Madigozhin, D T; Marinova, E; Molokanova, N; Polenkevich, I; Potrebenikov, Yu; Stoynev, S; Zinchenko, A; Monnier, E; Swallow, E; Winston, R; Rubin, P; Walker, A; Baldini, W; Cotta-Ramusino, A; Dalpiaz, P; Damiani, C; Fiorini, M; Gianoli, A; Martini, M; Petrucci, F; Savrié, M; Scarpa, M; Wahl, H; Calvetti, M; Iacopini, E; Ruggiero, G; Bizzeti, A; Lenti, M; Veltri, M; Behler, M; Eppard, K; Kleinknecht, K; Marouelli, P; Masetti, L; Moosbrugger, U; Morales-Morales, C; Renk, B; Wache, M; Wanke, R; Winhart, A; Coward, D; Dabrowski, A; Fonseca-Martin, T; Shieh, M; Szleper, M; Velasco, M; Wood, M D; Anzivino, G; Imbergamo, E; Nappi, A; Piccini, M; Raggi, M; Valdata-Nappi, M; Cenci, P; Pepé, M; Pettrucci, M C; Cerri, C; Fantechi, R; Collazuol, G; Di Lella, L; Lamanna, G; Mannelli, I; Michetti, A; Costantini, F; Doble, N; Fiorini, L; Giudici, S; Pierazzini, G; Sozzi, M; Venditti, S; Bloch-Devaux, B; Cheshkov, C; Chèze, J B; De Beer, M; Derré, J; Marel, G; Mazzucato, E; Peyaud, B; Vallage, B; Holder, M; Ziolkowski, M; Bifani, S; Biino, C; Cartiglia, N; Marchetto, F; Bifani, S; Clemencic, M; Goy-Lopez, S; Dibon, H; Jeitler, M; Markytan, M; Mikulec, I; Neuhofer, G; Widhalm, L

    2009-01-01

    We report the results from a study of the full sample of $~6.031 x 10^{7} K^{\\pm} \\to \\pi^{\\pm} \\pi^{0} \\pi^{0}$ decays recorded by the NA48/2 experiment at the CERN SPS. As first observed in this experiment, the $\\pi^{0} \\pi^{0}$ invariant mass (M_00) distribution shows a cusp-like anomaly in the region around $M_{00} = 2m_{+}$, where m_{+} is the charged pion mass. This anomaly has been interpreted as an effect due mainly to the final state charge exchange scattering process $\\pi^{+}\\pi^{-} \\to \\pi^{0} \\pi^{0}$ in $K^{\\pm} \\to \\pi^{\\pm} \\pi^{+} \\pi^{-}$ decay. Fits to the M_{00} distribution using two different theoretical models provide the presently most precise determination of $a_{0}-a_{2}$, the difference between the pi pi S-wave scattering lengths in the isospin I = 0 and I = 2 states. Higher-order pi pi rescattering terms, included in the two models, allow also an independent, though less precise, determination of a_2.

  15. Mouse Rad9b is essential for embryonic development and promotes resistance to DNA damage

    Science.gov (United States)

    Leloup, Corinne; Hopkins, Kevin M.; Wang, Xiangyuan; Zhu, Aiping; Wolgemuth, Debra J.; Lieberman, Howard B.

    2010-01-01

    RAD9 participates in promoting resistance to DNA damage, cell cycle checkpoint control, DNA repair, apoptosis, embryogenesis, and regulation of transcription. A paralogue of RAD9 (named RAD9B) has been identified. To define the function of mouse Rad9b (Mrad9b), embryonic stem (ES) cells with a targeted gene deletion were constructed and used to generate Mrad9b mutant mice. Mrad9b−/− embryos are resorbed after E7.5 while some of the heterozygotes die between E12.5 and a few days after birth. Mrad9b is expressed in embryonic brain and Mrad9b+/− embryos exhibit abnormal neural tube closure. Mrad9b−/− mouse embryonic fibroblasts are not viable. Mrad9b−/− ES cells are more sensitive to gamma rays and mitomycin C than Mrad9b+/+ controls, but show normal gamma-ray-induced G2/M checkpoint control. There is no evidence of spontaneous genomic instability in Mrad9b−/− cells. Our findings thus indicate that Mrad9b is essential for embryonic development and mediates resistance to certain DNA damaging agents. PMID:20842695

  16. Observation of $B^+\\rightarrow J/\\psi 3\\pi^+ 2\\pi^-$ and $B^+\\rightarrow \\psi(2S) \\pi^+\\pi^+\\pi^-$ decays

    CERN Document Server

    Aaij, Roel; Adinolfi, Marco; Ajaltouni, Ziad; Akar, Simon; Albrecht, Johannes; Alessio, Federico; Alexander, Michael; Ali, Suvayu; Alkhazov, Georgy; Alvarez Cartelle, Paula; Alves Jr, Antonio Augusto; Amato, Sandra; Amerio, Silvia; Amhis, Yasmine; An, Liupan; Anderlini, Lucio; Andreassi, Guido; Andreotti, Mirco; Andrews, Jason; Appleby, Robert; Archilli, Flavio; d'Argent, Philippe; Arnau Romeu, Joan; Artamonov, Alexander; Artuso, Marina; Aslanides, Elie; Auriemma, Giulio; Baalouch, Marouen; Babuschkin, Igor; Bachmann, Sebastian; Back, John; Badalov, Alexey; Baesso, Clarissa; Baker, Sophie; Baldini, Wander; Barlow, Roger; Barschel, Colin; Barsuk, Sergey; Barter, William; Baszczyk, Mateusz; Batozskaya, Varvara; Batsukh, Baasansuren; Battista, Vincenzo; Bay, Aurelio; Beaucourt, Leo; Beddow, John; Bedeschi, Franco; Bediaga, Ignacio; Bel, Lennaert; Bellee, Violaine; Belloli, Nicoletta; Belous, Konstantin; Belyaev, Ivan; Ben-Haim, Eli; Bencivenni, Giovanni; Benson, Sean; Benton, Jack; Berezhnoy, Alexander; Bernet, Roland; Bertolin, Alessandro; Betancourt, Christopher; Betti, Federico; Bettler, Marc-Olivier; van Beuzekom, Martinus; Bezshyiko, Iaroslava; Bifani, Simone; Billoir, Pierre; Bird, Thomas; Birnkraut, Alex; Bitadze, Alexander; Bizzeti, Andrea; Blake, Thomas; Blanc, Frederic; Blouw, Johan; Blusk, Steven; Bocci, Valerio; Boettcher, Thomas; Bondar, Alexander; Bondar, Nikolay; Bonivento, Walter; Bordyuzhin, Igor; Borgheresi, Alessio; Borghi, Silvia; Borisyak, Maxim; Borsato, Martino; Bossu, Francesco; Boubdir, Meriem; Bowcock, Themistocles; Bowen, Espen Eie; Bozzi, Concezio; Braun, Svende; Britsch, Markward; Britton, Thomas; Brodzicka, Jolanta; Buchanan, Emma; Burr, Christopher; Bursche, Albert; Buytaert, Jan; Cadeddu, Sandro; Calabrese, Roberto; Calvi, Marta; Calvo Gomez, Miriam; Camboni, Alessandro; Campana, Pierluigi; Campora Perez, Daniel Hugo; Capriotti, Lorenzo; Carbone, Angelo; Carboni, Giovanni; Cardinale, Roberta; Cardini, Alessandro; Carniti, Paolo; Carson, Laurence; Carvalho Akiba, Kazuyoshi; Casse, Gianluigi; Cassina, Lorenzo; Castillo Garcia, Lucia; Cattaneo, Marco; Cauet, Christophe; Cavallero, Giovanni; Cenci, Riccardo; Charles, Matthew; Charpentier, Philippe; Chatzikonstantinidis, Georgios; Chefdeville, Maximilien; Chen, Shanzhen; Cheung, Shu-Faye; Chobanova, Veronika; Chrzaszcz, Marcin; Cid Vidal, Xabier; Ciezarek, Gregory; Clarke, Peter; Clemencic, Marco; Cliff, Harry; Closier, Joel; Coco, Victor; Cogan, Julien; Cogneras, Eric; Cogoni, Violetta; Cojocariu, Lucian; Collazuol, Gianmaria; Collins, Paula; Comerma-Montells, Albert; Contu, Andrea; Cook, Andrew; Coombs, George; Coquereau, Samuel; Corti, Gloria; Corvo, Marco; Costa Sobral, Cayo Mar; Couturier, Benjamin; Cowan, Greig; Craik, Daniel Charles; Crocombe, Andrew; Cruz Torres, Melissa Maria; Cunliffe, Samuel; Currie, Robert; D'Ambrosio, Carmelo; Da Cunha Marinho, Franciole; Dall'Occo, Elena; Dalseno, Jeremy; David, Pieter; Davis, Adam; De Aguiar Francisco, Oscar; De Bruyn, Kristof; De Capua, Stefano; De Cian, Michel; De Miranda, Jussara; De Paula, Leandro; De Serio, Marilisa; De Simone, Patrizia; Dean, Cameron Thomas; Decamp, Daniel; Deckenhoff, Mirko; Del Buono, Luigi; Demmer, Moritz; Dendek, Adam; Derkach, Denis; Deschamps, Olivier; Dettori, Francesco; Dey, Biplab; Di Canto, Angelo; Dijkstra, Hans; Dordei, Francesca; Dorigo, Mirco; Dosil Suárez, Alvaro; Dovbnya, Anatoliy; Dreimanis, Karlis; Dufour, Laurent; Dujany, Giulio; Dungs, Kevin; Durante, Paolo; Dzhelyadin, Rustem; Dziurda, Agnieszka; Dzyuba, Alexey; Déléage, Nicolas; Easo, Sajan; Ebert, Marcus; Egede, Ulrik; Egorychev, Victor; Eidelman, Semen; Eisenhardt, Stephan; Eitschberger, Ulrich; Ekelhof, Robert; Eklund, Lars; Ely, Scott; Esen, Sevda; Evans, Hannah Mary; Evans, Timothy; Falabella, Antonio; Farley, Nathanael; Farry, Stephen; Fay, Robert; Fazzini, Davide; Ferguson, Dianne; Fernandez Prieto, Antonio; Ferrari, Fabio; Ferreira Rodrigues, Fernando; Ferro-Luzzi, Massimiliano; Filippov, Sergey; Fini, Rosa Anna; Fiore, Marco; Fiorini, Massimiliano; Firlej, Miroslaw; Fitzpatrick, Conor; Fiutowski, Tomasz; Fleuret, Frederic; Fohl, Klaus; Fontana, Marianna; Fontanelli, Flavio; Forshaw, Dean Charles; Forty, Roger; Franco Lima, Vinicius; Frank, Markus; Frei, Christoph; Fu, Jinlin; Furfaro, Emiliano; Färber, Christian; Gallas Torreira, Abraham; Galli, Domenico; Gallorini, Stefano; Gambetta, Silvia; Gandelman, Miriam; Gandini, Paolo; Gao, Yuanning; Garcia Martin, Luis Miguel; García Pardiñas, Julián; Garra Tico, Jordi; Garrido, Lluis; Garsed, Philip John; Gascon, David; Gaspar, Clara; Gavardi, Laura; Gazzoni, Giulio; Gerick, David; Gersabeck, Evelina; Gersabeck, Marco; Gershon, Timothy; Ghez, Philippe; Gianì, Sebastiana; Gibson, Valerie; Girard, Olivier Göran; Giubega, Lavinia-Helena; Gizdov, Konstantin; Gligorov, V.V.; Golubkov, Dmitry; Golutvin, Andrey; Gomes, Alvaro; Gorelov, Igor Vladimirovich; Gotti, Claudio; Govorkova, Ekaterina; Grabalosa Gándara, Marc; Graciani Diaz, Ricardo; Granado Cardoso, Luis Alberto; Graugés, Eugeni; Graverini, Elena; Graziani, Giacomo; Grecu, Alexandru; Griffith, Peter; Grillo, Lucia; Gruberg Cazon, Barak Raimond; Grünberg, Oliver; Gushchin, Evgeny; Guz, Yury; Gys, Thierry; Göbel, Carla; Hadavizadeh, Thomas; Hadjivasiliou, Christos; Haefeli, Guido; Haen, Christophe; Haines, Susan; Hall, Samuel; Hamilton, Brian; Han, Xiaoxue; Hansmann-Menzemer, Stephanie; Harnew, Neville; Harnew, Samuel; Harrison, Jonathan; Hatch, Mark; He, Jibo; Head, Timothy; Heister, Arno; Hennessy, Karol; Henrard, Pierre; Henry, Louis; Hernando Morata, Jose Angel; van Herwijnen, Eric; Heß, Miriam; Hicheur, Adlène; Hill, Donal; Hombach, Christoph; Hopchev, P H; Hulsbergen, Wouter; Humair, Thibaud; Hushchyn, Mikhail; Hussain, Nazim; Hutchcroft, David; Idzik, Marek; Ilten, Philip; Jacobsson, Richard; Jaeger, Andreas; Jalocha, Pawel; Jans, Eddy; Jawahery, Abolhassan; Jiang, Feng; John, Malcolm; Johnson, Daniel; Jones, Christopher; Joram, Christian; Jost, Beat; Jurik, Nathan; Kandybei, Sergii; Kanso, Walaa; Karacson, Matthias; Kariuki, James Mwangi; Karodia, Sarah; Kecke, Matthieu; Kelsey, Matthew; Kenyon, Ian; Kenzie, Matthew; Ketel, Tjeerd; Khairullin, Egor; Khanji, Basem; Khurewathanakul, Chitsanu; Kirn, Thomas; Klaver, Suzanne; Klimaszewski, Konrad; Koliiev, Serhii; Kolpin, Michael; Komarov, Ilya; Koopman, Rose; Koppenburg, Patrick; Kosmyntseva, Alena; Kozachuk, Anastasiia; Kozeiha, Mohamad; Kravchuk, Leonid; Kreplin, Katharina; Kreps, Michal; Krokovny, Pavel; Kruse, Florian; Krzemien, Wojciech; Kucewicz, Wojciech; Kucharczyk, Marcin; Kudryavtsev, Vasily; Kuonen, Axel Kevin; Kurek, Krzysztof; Kvaratskheliya, Tengiz; Lacarrere, Daniel; Lafferty, George; Lai, Adriano; Lanfranchi, Gaia; Langenbruch, Christoph; Latham, Thomas; Lazzeroni, Cristina; Le Gac, Renaud; van Leerdam, Jeroen; Lees, Jean-Pierre; Leflat, Alexander; Lefrançois, Jacques; Lefèvre, Regis; Lemaitre, Florian; Lemos Cid, Edgar; Leroy, Olivier; Lesiak, Tadeusz; Leverington, Blake; Li, Yiming; Likhomanenko, Tatiana; Lindner, Rolf; Linn, Christian; Lionetto, Federica; Liu, Bo; Liu, Xuesong; Loh, David; Longstaff, Iain; Lopes, Jose; Lucchesi, Donatella; Lucio Martinez, Miriam; Luo, Haofei; Lupato, Anna; Luppi, Eleonora; Lupton, Oliver; Lusiani, Alberto; Lyu, Xiao-Rui; Machefert, Frederic; Maciuc, Florin; Maev, Oleg; Maguire, Kevin; Malde, Sneha; Malinin, Alexander; Maltsev, Timofei; Manca, Giulia; Mancinelli, Giampiero; Manning, Peter Michael; Maratas, Jan; Marchand, Jean François; Marconi, Umberto; Marin Benito, Carla; Marino, Pietro; Marks, Jörg; Martellotti, Giuseppe; Martin, Morgan; Martinelli, Maurizio; Martinez Santos, Diego; Martinez Vidal, Fernando; Martins Tostes, Danielle; Massacrier, Laure Marie; Massafferri, André; Matev, Rosen; Mathad, Abhijit; Mathe, Zoltan; Matteuzzi, Clara; Mauri, Andrea; Maurin, Brice; Mazurov, Alexander; McCann, Michael; McCarthy, James; McNab, Andrew; McNulty, Ronan; Meadows, Brian; Meier, Frank; Meissner, Marco; Melnychuk, Dmytro; Merk, Marcel; Merli, Andrea; Michielin, Emanuele; Milanes, Diego Alejandro; Minard, Marie-Noelle; Mitzel, Dominik Stefan; Mogini, Andrea; Molina Rodriguez, Josue; Monroy, Ignacio Alberto; Monteil, Stephane; Morandin, Mauro; Morawski, Piotr; Mordà, Alessandro; Morello, Michael Joseph; Moron, Jakub; Morris, Adam Benjamin; Mountain, Raymond; Muheim, Franz; Mulder, Mick; Mussini, Manuel; Müller, Dominik; Müller, Janine; Müller, Katharina; Müller, Vanessa; Naik, Paras; Nakada, Tatsuya; Nandakumar, Raja; Nandi, Anita; Nasteva, Irina; Needham, Matthew; Neri, Nicola; Neubert, Sebastian; Neufeld, Niko; Neuner, Max; Nguyen, Anh Duc; Nguyen, Thi Dung; Nguyen-Mau, Chung; Nieswand, Simon; Niet, Ramon; Nikitin, Nikolay; Nikodem, Thomas; Novoselov, Alexey; O'Hanlon, Daniel Patrick; Oblakowska-Mucha, Agnieszka; Obraztsov, Vladimir; Ogilvy, Stephen; Oldeman, Rudolf; Onderwater, Gerco; Otalora Goicochea, Juan Martin; Otto, Adam; Owen, Patrick; Oyanguren, Maria Aranzazu; Pais, Preema Rennee; Palano, Antimo; Palombo, Fernando; Palutan, Matteo; Panman, Jacob; Papanestis, Antonios; Pappagallo, Marco; Pappalardo, Luciano; Parker, William; Parkes, Christopher; Passaleva, Giovanni; Pastore, Alessandra; Patel, Girish; Patel, Mitesh; Patrignani, Claudia; Pearce, Alex; Pellegrino, Antonio; Penso, Gianni; Pepe Altarelli, Monica; Perazzini, Stefano; Perret, Pascal; Pescatore, Luca; Petridis, Konstantinos; Petrolini, Alessandro; Petrov, Aleksandr; Petruzzo, Marco; Picatoste Olloqui, Eduardo; Pietrzyk, Boleslaw; Pikies, Malgorzata; Pinci, Davide; Pistone, Alessandro; Piucci, Alessio; Playfer, Stephen; Plo Casasus, Maximo; Poikela, Tuomas; Polci, Francesco; Poluektov, Anton; Polyakov, Ivan; Polycarpo, Erica; Pomery, Gabriela Johanna; Popov, Alexander; Popov, Dmitry; Popovici, Bogdan; Poslavskii, Stanislav; Potterat, Cédric; Price, Eugenia; Price, Joseph David; Prisciandaro, Jessica; Pritchard, Adrian; Prouve, Claire; Pugatch, Valery; Puig Navarro, Albert; Punzi, Giovanni; Qian, Wenbin; Quagliani, Renato; Rachwal, Bartolomiej; Rademacker, Jonas; Rama, Matteo; Ramos Pernas, Miguel; Rangel, Murilo; Raniuk, Iurii; Ratnikov, Fedor; Raven, Gerhard; Redi, Federico; Reichert, Stefanie; dos Reis, Alberto; Remon Alepuz, Clara; Renaudin, Victor; Ricciardi, Stefania; Richards, Sophie; Rihl, Mariana; Rinnert, Kurt; Rives Molina, Vicente; Robbe, Patrick; Rodrigues, Ana Barbara; Rodrigues, Eduardo; Rodriguez Lopez, Jairo Alexis; Rodriguez Perez, Pablo; Rogozhnikov, Alexey; Roiser, Stefan; Rollings, Alexandra Paige; Romanovskiy, Vladimir; Romero Vidal, Antonio; Ronayne, John William; Rotondo, Marcello; Rudolph, Matthew Scott; Ruf, Thomas; Ruiz Valls, Pablo; Saborido Silva, Juan Jose; Sadykhov, Elnur; Sagidova, Naylya; Saitta, Biagio; Salustino Guimaraes, Valdir; Sanchez Mayordomo, Carlos; Sanmartin Sedes, Brais; Santacesaria, Roberta; Santamarina Rios, Cibran; Santimaria, Marco; Santovetti, Emanuele; Sarti, Alessio; Satriano, Celestina; Satta, Alessia; Saunders, Daniel Martin; Savrina, Darya; Schael, Stefan; Schellenberg, Margarete; Schiller, Manuel; Schindler, Heinrich; Schlupp, Maximilian; Schmelling, Michael; Schmelzer, Timon; Schmidt, Burkhard; Schneider, Olivier; Schopper, Andreas; Schubert, Konstantin; Schubiger, Maxime; Schune, Marie Helene; Schwemmer, Rainer; Sciascia, Barbara; Sciubba, Adalberto; Semennikov, Alexander; Sergi, Antonino; Serra, Nicola; Serrano, Justine; Sestini, Lorenzo; Seyfert, Paul; Shapkin, Mikhail; Shapoval, Illya; Shcheglov, Yury; Shears, Tara; Shekhtman, Lev; Shevchenko, Vladimir; Siddi, Benedetto Gianluca; Silva Coutinho, Rafael; Silva de Oliveira, Luiz Gustavo; Simi, Gabriele; Simone, Saverio; Sirendi, Marek; Skidmore, Nicola; Skwarnicki, Tomasz; Smith, Eluned; Smith, Iwan Thomas; Smith, Jackson; Smith, Mark; Snoek, Hella; Sokoloff, Michael; Soler, Paul; Souza De Paula, Bruno; Spaan, Bernhard; Spradlin, Patrick; Sridharan, Srikanth; Stagni, Federico; Stahl, Marian; Stahl, Sascha; Stefko, Pavol; Stefkova, Slavorima; Steinkamp, Olaf; Stemmle, Simon; Stenyakin, Oleg; Stevenson, Scott; Stoica, Sabin; Stone, Sheldon; Storaci, Barbara; Stracka, Simone; Straticiuc, Mihai; Straumann, Ulrich; Sun, Liang; Sutcliffe, William; Swientek, Krzysztof; Syropoulos, Vasileios; Szczekowski, Marek; Szumlak, Tomasz; T'Jampens, Stephane; Tayduganov, Andrey; Tekampe, Tobias; Tellarini, Giulia; Teubert, Frederic; Thomas, Eric; van Tilburg, Jeroen; Tilley, Matthew James; Tisserand, Vincent; Tobin, Mark; Tolk, Siim; Tomassetti, Luca; Tonelli, Diego; Topp-Joergensen, Stig; Toriello, Francis; Tournefier, Edwige; Tourneur, Stephane; Trabelsi, Karim; Traill, Murdo; Tran, Minh Tâm; Tresch, Marco; Trisovic, Ana; Tsaregorodtsev, Andrei; Tsopelas, Panagiotis; Tully, Alison; Tuning, Niels; Ukleja, Artur; Ustyuzhanin, Andrey; Uwer, Ulrich; Vacca, Claudia; Vagnoni, Vincenzo; Valassi, Andrea; Valat, Sebastien; Valenti, Giovanni; Vallier, Alexis; Vazquez Gomez, Ricardo; Vazquez Regueiro, Pablo; Vecchi, Stefania; van Veghel, Maarten; Velthuis, Jaap; Veltri, Michele; Veneziano, Giovanni; Venkateswaran, Aravindhan; Vernet, Maxime; Vesterinen, Mika; Viaud, Benoit; Vieira, Daniel; Vieites Diaz, Maria; Viemann, Harald; Vilasis-Cardona, Xavier; Vitti, Marcela; Volkov, Vladimir; Vollhardt, Achim; Voneki, Balazs; Vorobyev, Alexey; Vorobyev, Vitaly; Voß, Christian; de Vries, Jacco; Vázquez Sierra, Carlos; Waldi, Roland; Wallace, Charlotte; Wallace, Ronan; Walsh, John; Wang, Jianchun; Ward, David; Wark, Heather Mckenzie; Watson, Nigel; Websdale, David; Weiden, Andreas; Whitehead, Mark; Wicht, Jean; Wilkinson, Guy; Wilkinson, Michael; Williams, Mark Richard James; Williams, Matthew; Williams, Mike; Williams, Timothy; Wilson, Fergus; Wimberley, Jack; Wishahi, Julian; Wislicki, Wojciech; Witek, Mariusz; Wormser, Guy; Wotton, Stephen; Wraight, Kenneth; Wyllie, Kenneth; Xie, Yuehong; Xing, Zhou; Xu, Zhirui; Yang, Zhenwei; Yin, Hang; Yu, Jiesheng; Yuan, Xuhao; Yushchenko, Oleg; Zarebski, Kristian Alexander; Zavertyaev, Mikhail; Zhang, Liming; Zhang, Yanxi; Zhang, Yu; Zhelezov, Alexey; Zheng, Yangheng; Zhokhov, Anatoly; Zhu, Xianglei; Zhukov, Valery; Zucchelli, Stefano

    2017-02-06

    The decays $B^+\\rightarrow J/\\psi 3\\pi^+ 2\\pi^-$ and $B^+\\rightarrow \\psi(2S) \\pi^+\\pi^+\\pi^-$ are observed for the first time using a data sample corresponding to an integrated luminosity of $3.0fb^{-1}$, collected by the LHCb experiment in proton-proton collisions at the centre-of-mass energies of 7 and 8 TeV. The branching fractions relative to that of $B^+ \\rightarrow \\psi(2S)K^+$ are measured to be \\begin{eqnarray*} \\frac {\\mathcal{B}\\left( B^+\\rightarrow J/\\psi 3\\pi^+ 2\\pi^- \\right)} {\\mathcal{B}\\left( B^+ \\rightarrow \\psi(2S)K^+ \\right)} & = & \\left( 1.88\\pm0.17\\pm0.09\\right)\\times10^{-2}, \\\\ \\frac {\\mathcal{B}\\left( B^+\\rightarrow \\psi(2S) \\pi^+\\pi^+\\pi^- \\right)} {\\mathcal{B}\\left( B^+ \\rightarrow \\psi(2S)K^+ \\right) } & = & \\left( 3.04\\pm0.50\\pm0.26\\right)\\times10^{-2}, \\end{eqnarray*} where the first uncertainties are statistical and the second are systematic.

  17. Investigation of K sub L , sub S-> pi sup +pi sup - e sup + e sup - decays

    CERN Document Server

    Lai, A; Bevan, A

    2003-01-01

    The K sub L-> pi sup +pi sup - e sup + e sup - and K sub S-> pi sup +pi sup - e sup + e sup - decay modes have been studied in detail using the NA48 detector at the CERN SPS. Based on the data collected during the 1998 and 1999 run periods, a sample of 1162 K sub L-> pi sup +pi sup - e sup + e sup - candidates has been observed with an expected background level of 36.9 events, yielding the branching ratio measurement BR(K sub L -> pi sup +pi sup - e sup + e sup -)=(3.08+-0.20) x 10 sup - sup 7. The distribution of events in the sin phi cos phi variable, where phi is the angle between the pi sup +pi sup - and the e sup + e sup - decay planes in the kaon centre of mass, is found to exhibit a large CP-violating asymmetry with the value A subphi=(14.2+-3.6)%. For the K sub S-> pi sup +pi sup - e sup + e sup - decay channel, 621 candidates have been identified in the 1999 data sample with an estimated background contribution of 0.7 event. The corresponding branching ratio has been determined to be BR(K sub S-> pi ...

  18. The Lr34 adult plant rust resistance gene provides seedling resistance in durum wheat without senescence.

    Science.gov (United States)

    Rinaldo, Amy; Gilbert, Brian; Boni, Rainer; Krattinger, Simon G; Singh, Davinder; Park, Robert F; Lagudah, Evans; Ayliffe, Michael

    2017-07-01

    The hexaploid wheat (Triticum aestivum) adult plant resistance gene, Lr34/Yr18/Sr57/Pm38/Ltn1, provides broad-spectrum resistance to wheat leaf rust (Lr34), stripe rust (Yr18), stem rust (Sr57) and powdery mildew (Pm38) pathogens, and has remained effective in wheat crops for many decades. The partial resistance provided by this gene is only apparent in adult plants and not effective in field-grown seedlings. Lr34 also causes leaf tip necrosis (Ltn1) in mature adult plant leaves when grown under field conditions. This D genome-encoded bread wheat gene was transferred to tetraploid durum wheat (T. turgidum) cultivar Stewart by transformation. Transgenic durum lines were produced with elevated gene expression levels when compared with the endogenous hexaploid gene. Unlike nontransgenic hexaploid and durum control lines, these transgenic plants showed robust seedling resistance to pathogens causing wheat leaf rust, stripe rust and powdery mildew disease. The effectiveness of seedling resistance against each pathogen correlated with the level of transgene expression. No evidence of accelerated leaf necrosis or up-regulation of senescence gene markers was apparent in these seedlings, suggesting senescence is not required for Lr34 resistance, although leaf tip necrosis occurred in mature plant flag leaves. Several abiotic stress-response genes were up-regulated in these seedlings in the absence of rust infection as previously observed in adult plant flag leaves of hexaploid wheat. Increasing day length significantly increased Lr34 seedling resistance. These data demonstrate that expression of a highly durable, broad-spectrum adult plant resistance gene can be modified to provide seedling resistance in durum wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  19. $\\pi \\pi$ phase-shift analysis from an experiment $\\pi^{-}p \\rightarrow \\pi^{-} \\pi^{+} n$ at 17.2 GeV/c

    CERN Document Server

    Grayer, G; Dietl, H; Hyams, Bernard David; Jones, C; Koch, W; Lorenz, E; Lütjens, G; Männer, W; Meissburger, J; Ochs, W; Schlein, P E; Stierlin, U; Weilhammer, P

    1972-01-01

    The pi pi phase-shifts have been determined by a Chew-Low extrapolation in the pi pi mass region from 500 to 1500 MeV using data of a spark chamber experiment on pi /sup -/p to pi /sup -/ pi /sup +/n at 17.2 GeV/c, which yielded 318000 events. The authors find an I=0 s- wave phase shift which increases slowly, passing through 90 degrees near 900 MeV, and then rises very rapidly. The old 'up' solution is eliminated on the basis of fits in the mass region from 900-1000 MeV. (13 refs).

  20. Identification of Differentially-Expressed Genes in Response to Mycosphaerella fijiensis in the Resistant Musa Accession ‘Calcutta-4’ Using Suppression Subtractive Hybridization

    Science.gov (United States)

    Pacheco Coello, Ricardo; Chávez Navarrete, Tatiana; Navarrete Villegas, Oscar; Santos Ordóñez, Efrén

    2016-01-01

    Bananas and plantains are considered an important crop around the world. Banana production is affected by several constraints, of which Black Sigatoka Disease, caused by the fungus Mycosphaerella fijiensis, is considered one of the most important diseases in banana plantations. The banana accession ‘Calcutta-4’ has a natural resistance to Black Sigatoka; however, the fruit is not valuable for commercialization. Gene identification and expression studies in ‘Calcutta-4’ might reveal possible gene candidates for resistant to the disease and elucidate mechanisms for resistance. A subtracted cDNA library was generated from leaves after 6, 9 and 12 days inoculated with M. fijiensis conidia on greenhouse banana plants of the accession ‘Calcutta-4’. Bioinformatic analysis revealed 99 good quality sequences. Blast2go analysis revealed that 31% of the sequences could not be categorized and, according to the Biological Process Category, 32 and 28 ESTs are related to general metabolic and cellular processes, respectively; while 10 ESTs response to stimulus. Seven sequences were redundant and one was similar to genes that may be involved in pathogen resistance including the putative disease resistance protein RGA1. Genes encoding zinc finger domains were identified and may play an important role in pathogen resistance by inducing the expression of downstream genes. Expression analysis of four selected genes was performed using RT-qPCR during the early stage of the disease development at 6, 9, 12 and 15 days post inoculation showing a peak of up regulation at 9 or 12 days post inoculation. Three of the four genes showed an up-regulation of expression in ‘Calcutta-4’ when compared to ‘Williams’ after inoculation with M. fijiensis, suggesting a fine regulation of specific gene candidates that may lead to a resistance response. The genes identified in early responses in a plant-pathogen interaction may be relevant for the resistance response of ‘Calcutta-4

  1. Relocation of a rust resistance gene R 2 and its marker-assisted gene pyramiding in confection sunflower (Helianthus annuus L.).

    Science.gov (United States)

    Qi, L L; Ma, G J; Long, Y M; Hulke, B S; Gong, L; Markell, S G

    2015-03-01

    The rust resistance gene R 2 was reassigned to linkage group 14 of the sunflower genome. DNA markers linked to R 2 were identified and used for marker-assisted gene pyramiding in a confection type genetic background. Due to the frequent evolution of new pathogen races, sunflower rust is a recurring threat to sunflower production worldwide. The inbred line Morden Cross 29 (MC29) carries the rust resistance gene, R 2 , conferring resistance to numerous races of rust fungus in the US, Canada, and Australia, and can be used as a broad-spectrum resistance resource. Based on phenotypic assessments and SSR marker analyses on the 117 F2 individuals derived from a cross of HA 89 with MC29 (USDA), R 2 was mapped to linkage group (LG) 14 of the sunflower, and not to the previously reported location on LG9. The closest SSR marker HT567 was located at 4.3 cM distal to R 2 . Furthermore, 36 selected SNP markers from LG14 were used to saturate the R 2 region. Two SNP markers, NSA_002316 and SFW01272, flanked R 2 at a genetic distance of 2.8 and 1.8 cM, respectively. Of the three closely linked markers, SFW00211 amplified an allele specific for the presence of R 2 in a marker validation set of 46 breeding lines, and SFW01272 was also shown to be diagnostic for R 2 . These newly developed markers, together with the previously identified markers linked to the gene R 13a , were used to screen 524 F2 individuals from a cross of a confection R 2 line and HA-R6 carrying R 13a . Eleven homozygous double-resistant F2 plants with the gene combination of R 2 and R 13a were obtained. This double-resistant line will be extremely useful in confection sunflower, where few rust R genes are available, risking evolution of new virulence phenotypes and further disease epidemics.

  2. Sponge microbiota are a reservoir of functional antibiotic resistance genes

    Directory of Open Access Journals (Sweden)

    Dennis Versluis

    2016-11-01

    Full Text Available Wide application of antibiotics has contributed to the evolution of multi-drug resistant human pathogens, resulting in poorer treatment outcomes for infections. In the marine environment, seawater samples have been investigated as a resistance reservoir; however, no studies have methodically examined sponges as a reservoir of antibiotic resistance. Sponges could be important in this respect because they often contain diverse microbial communities that have the capacity to produce bioactive metabolites. Here, we applied functional metagenomics to study the presence and diversity of functional resistance genes in the sponges Aplysina aerophoba, Petrosia ficiformis and Corticium candelabrum. We obtained 37 insert sequences facilitating resistance to D-cycloserine (n=6, gentamicin (n=1, amikacin (n=7, trimethoprim (n=17, chloramphenicol (n=1, rifampicin (n=2 and ampicillin (n=3. Fifteen of 37 inserts harboured resistance genes that shared <90% amino acid identity with known gene products, whereas on 13 inserts no resistance gene could be identified with high confidence, in which case we predicted resistance to be mainly mediated by antibiotic efflux. One marine-specific ampicillin-resistance-conferring β-lactamase was identified in the genus Pseudovibrio with 41% global amino acid identity to the closest β-lactamase with demonstrated functionality, and subsequently classified into a new family termed PSV. Taken together, our results show that sponge microbiota host diverse and novel resistance genes that may be harnessed by phylogenetically distinct bacteria.

  3. Putative resistance gene markers associated with quantitative trait loci for fire blight resistance in Malus ‘Robusta 5’ accessions

    Science.gov (United States)

    2012-01-01

    Background Breeding of fire blight resistant scions and rootstocks is a goal of several international apple breeding programs, as options are limited for management of this destructive disease caused by the bacterial pathogen Erwinia amylovora. A broad, large-effect quantitative trait locus (QTL) for fire blight resistance has been reported on linkage group 3 of Malus ‘Robusta 5’. In this study we identified markers derived from putative fire blight resistance genes associated with the QTL by integrating further genetic mapping studies with bioinformatics analysis of transcript profiling data and genome sequence databases. Results When several defined E.amylovora strains were used to inoculate three progenies from international breeding programs, all with ‘Robusta 5’ as a common parent, two distinct QTLs were detected on linkage group 3, where only one had previously been mapped. In the New Zealand ‘Malling 9’ X ‘Robusta 5’ population inoculated with E. amylovora ICMP11176, the proximal QTL co-located with SNP markers derived from a leucine-rich repeat, receptor-like protein ( MxdRLP1) and a closely linked class 3 peroxidase gene. While the QTL detected in the German ‘Idared’ X ‘Robusta 5’ population inoculated with E. amylovora strains Ea222_JKI or ICMP11176 was approximately 6 cM distal to this, directly below a SNP marker derived from a heat shock 90 family protein gene ( HSP90). In the US ‘Otawa3’ X ‘Robusta5’ population inoculated with E. amylovora strains Ea273 or E2002a, the position of the LOD score peak on linkage group 3 was dependent upon the pathogen strains used for inoculation. One of the five MxdRLP1 alleles identified in fire blight resistant and susceptible cultivars was genetically associated with resistance and used to develop a high resolution melting PCR marker. A resistance QTL detected on linkage group 7 of the US population co-located with another HSP90 gene-family member and a WRKY transcription factor

  4. Avaliação da resistência a tobamovirus em acessos de Capsicum spp. Evaluation of resistance of Capsicum spp. genotypes to tobamovirus

    Directory of Open Access Journals (Sweden)

    Márcia Aparecida Cezar

    2009-02-01

    Full Text Available A resistência em Capsicum spp a tobamovírus é governada pelos genes L¹ a L4. Baseado na capacidade de alguns isolados suplantarem a resistência destes genes, os tobamovírus podem ser classificados nos patótipos P0, P1, P1-2 e P1-2-3. No Brasil, até o momento as três espécies de tobamovírus conhecidas são: Tobacco mosaic virus (TMV, Tomato mosaic virus (ToMV, pertencentes aos patótipos P0 e Pepper mild mottle virus (PMMoV pertencente ao patótipo P1-2, respectivamente e podem infectar pimentas e pimentões. Oitenta e seis genótipos de pimentão e pimenta foram avaliados quanto à resistência a tobamovírus, sendo 62 de Capsicum annuum, 18 de C. baccatum e seis de C. chinense. Oito acessos de C. annuum, seis de C. baccatum e os acessos ICA #39, Pimenta de cheiro e PI 152225 de C. chinense apresentaram reação de hipersensibilidade ao ToMV, enquanto que o acesso Ancho de C. annuum foi considerado tolerante, permanecendo assintomático, porém permitindo a recuperação do vírus quando inoculado em Nicotiana glutinosa. Para o PMMoV patótipo P1,2 foram avaliados os acessos de pimentão e pimenta considerados resistentes ao ToMV. Somente o PI 152225 de C. chinense desencadeou reação de hipersensibilidade ao PMMoV, sendo fonte potencial de resistência para programas de melhoramento a este vírus no Brasil.The resistance of Capsicum spp to tobamoviruses is conferred by the genes series L¹ to L4. Based on the ability of some isolates to overcome the resistance genes, the tobamovirus can be classificated in the pathotypes P0, P1, P1-2 and P1-2-3. In Brazil, at this moment there are three species of tobamovirus: Tobacco mosaic virus (TMV, Tomato mosaic virus (ToMV, belonging to pathotype P0 and Pepper mild mottle virus (PMMoV belonging to pathotype P1-2 respectively, that can infect sweet and hot peppers. Eighty-six genotypes of sweet and hot pepper were evaluated for the resistance to tobamovirus. Eigth genotypes of C. annuum, five

  5. Precision measurement of the branching fractions of J/psi -> pi(+)pi(-)pi(0) and psi ' -> pi(+)pi(-)pi(0)

    NARCIS (Netherlands)

    Ablikim, M.; Achasov, M. N.; Albertoa, D.; Ambrose, D. J.; An, F. F.; An, Q.; An, Z. H.; Bai, J. Z.; Ferroli, R. B. F. Baldini; Ban, Y.; Becker, J.; Berger, N.; Bertani, M. B.; Bian, J. M.; Boger, E.; Bondarenko, O.; Boyko, I.; Briere, R. A.; Bytev, V.; Cai, X.; Calcaterra, A. C.; Cao, G. F.; Chang, J. F.; Chelkov, G.; Chen, G.; Chen, H. S.; Chen, J. C.; Chen, M. L.; Chen, S. J.; Chen, Y.; Chen, Y. B.; Cheng, H. P.; Chu, Y. P.; Cronin-Hennessy, D.; Dai, H. L.; Dai, J. P.; Dedovich, D.; Deng, Z. Y.; Denysenko, I.; Destefanis, M.; Ding, W. M.; Ding, Y.; Dong, L. Y.; Dong, M. Y.; Du, S. X.; Fang, J.; Fang, S. S.; Feng, C. Q.; Fu, C. D.; Fu, J. L.; Gao, Y.; Geng, C.; Goetzen, K.; Gong, W. X.; Greco, M.; Gu, M. H.; Gu, Y. T.; Guan, Y. H.; Guo, A. Q.; Guo, L. B.; Guo, Y. R.; Han, Y. L.; Hao, X. Q.; Harris, F. A.; He, K. L.; He, M.; He, Z. Y.; Heng, Y. K.; Hou, Z. L.; Hu, H. M.; Hu, J. F.; Hu, T.; Huang, B.; Huang, G. M.; Huang, J. S.; Huang, X. T.; Huang, Y. P.; Hussain, T.; Ji, C. S.; Ji, Q.; Ji, X. B.; Ji, X. L.; Jia, L. K.; Jiang, L. L.; Jiang, X. S.; Jiao, J. B.; Jiao, Z.; Jin, D. P.; Jin, S.; Jing, F. F.; Kalantar-Nayestanaki, N.; Kavatsyuk, M.; Kuehn, W.; Lai, W.; Lange, J. S.; Leung, J. K. C.; Li, C. H.; Li, Cheng; Li, Cui; Li, D. M.; Li, F.; Li, G.; Li, H. B.; Li, J. C.; Li, K.; Li, Lei; Li, N. B.; Li, Q. J.; Li, S. L.; Li, W. D.; Li, W. G.; Li, X. L.; Li, X. N.; Li, X. Q.; Li, X. R.; Li, Z. B.; Liang, H.; Liang, Y. F.; Liang, Y. T.; Liao, G. R.; Liao, X. T.; Liu, B. J.; Liu, B. J.; Liu, C. L.; Liu, C. X.; Liu, C. Y.; Liu, F. H.; Liu, Fang; Liu, Feng; Liu, H.; Liu, H. B.; Liu, H. H.; Liu, H. M.; Liu, H. W.; Liu, J. P.; Liu, K.; Liu, K.; Liu, K. Y.; Liu, Q.; Liu, S. B.; Liu, X.; Liu, X. H.; Liu, Y. B.; Liu, Yong; Liu, Z. A.; Liu, Zhiqiang; Liu, Zhiqing; Loehner, H.; Lu, G. R.; Lu, H. J.; Lu, J. G.; Lu, Q. W.; Lu, X. R.; Lu, Y. P.; Luo, C. L.; Luo, M. X.; Luo, T.; Luo, X. L.; Lv, M.; Ma, C. L.; Ma, F. C.; Ma, H. L.; Ma, Q. M.; Ma, S.; Ma, T.; Ma, X. Y.; Maggiora, M.; Malik, Q. A.; Mao, H.; Mao, Y. J.; Mao, Z. P.; Messchendorp, J. G.; Min, J.; Min, T. J.; Mitchell, R. E.; Mo, X. H.; Muchnoi, N. Yu.; Nefedov, Y.; Nikolaev, I. B.; Ning, Z.; Olsen, S. L.; Ouyang, Q.; Pacetti, S. P.; Park, J. W.; Pelizaeus, M.; Peters, K.; Ping, J. L.; Ping, R. G.; Poling, R.; Pun, C. S. J.; Qi, M.; Qian, S.; Qiao, C. F.; Qin, X. S.; Qin, Z. H.; Qiu, J. F.; Rashid, K. H.; Rong, G.; Ruan, X. D.; Sarantsev, A.; Schulze, J.; Shao, M.; Shen, C. P.; Shen, X. Y.; Sheng, H. Y.; Shepherd, M. R.; Song, X. Y.; Spataro, S.; Spruck, B.; Sun, D. H.; Sun, G. X.; Sun, J. F.; Sun, S. S.; Sun, X. D.; Sun, Y. J.; Sun, Y. Z.; Sun, Z. J.; Sun, Z. T.; Tang, C. J.; Tang, X.; Thorndike, E. H.; Tian, H. L.; Toth, D.; Ulrich, M. U.; Varner, G. S.; Wang, B.; Wang, B. Q.; Wang, K.; Wang, L. L.; Wang, L. S.; Wang, M.; Wang, P.; Wang, P. L.; Wang, Q.; Wang, Q. J.; Wang, S. G.; Wang, X. F.; Wang, X. L.; Wang, Y. D.; Wang, Y. F.; Wang, Y. Q.; Wang, Z.; Wang, Z. G.; Wang, Z. Y.; Wei, D. H.; Wen, Q. G.; Wen, S. P.; Werner, M. W.; Wiedner, U.; Wu, L. H.; Wu, N.; Wu, W.; Wu, Z.; Xia, L. G.; Xiao, Z. J.; Xie, Y. G.; Xiu, Q. L.; Xu, G. F.; Xu, G. M.; Xu, H.; Xu, Q. J.; Xu, X. P.; Xu, Y.; Xu, Z. R.; Xue, F.; Xue, Z.; Yan, L.; Yan, W. B.; Yan, Y. H.; Yang, H. X.; Yang, T.; Yang, Y.; Yang, Y. X.; Ye, H.; Ye, M.; Ye, M. H.; Yu, B. X.; Yu, C. X.; Yu, S. P.; Yuan, C. Z.; Yuan, W. L.; Yuan, Y.; Zafar, A. A.; Zallo, A. Z.; Zeng, Y.; Zhang, B. X.; Zhang, B. Y.; Zhang, C. C.; Zhang, D. H.; Zhang, H. H.; Zhang, H. Y.; Zhang, J.; Zhang, J. Q.; Zhang, J. W.; Zhang, J. Y.; Zhang, J. Z.; Zhang, L.; Zhang, S. H.; Zhang, T. R.; Zhang, X. J.; Zhang, X. Y.; Zhang, Y.; Zhang, Y. H.; Zhang, Y. S.; Zhang, Z. P.; Zhang, Z. Y.; Zhao, G.; Zhao, H. S.; Zhao, Jingwei; Zhao, Lei; Zhao, Ling; Zhao, M. G.; Zhao, Q.; Zhao, S. J.; Zhao, T. C.; Zhao, X. H.; Zhao, Y. B.; Zhao, Z. G.; Zhemchugov, A.; Zheng, B.; Zheng, J. P.; Zheng, Y. H.; Zheng, Z. P.; Zhong, B.; Zhong, J.; Zhou, L.; Zhou, X. K.; Zhou, X. R.; Zhua, C.; Zhu, K.; Zhu, K. J.; Zhu, S. H.; Zhu, X. L.; Zhu, X. W.; Zhu, Y. S.; Zhu, Z. A.; Zhuang, J.; Zou, B. S.; Zou, J. H.; Zuo, J. X.

    2012-01-01

    We study the decays of the J/psi and psi' mesons to pi(+)pi(-)pi(0) using data samples at both resonances collected with the BES III detector in 2009. We measure the corresponding branching fractions with unprecedented precision and provide mass spectra and Dalitz plots. The branching fraction for

  6. The dual PI3K/mTOR inhibitor PKI-587 enhances sensitivity to cetuximab in EGFR-resistant human head and neck cancer models.

    Science.gov (United States)

    D'Amato, V; Rosa, R; D'Amato, C; Formisano, L; Marciano, R; Nappi, L; Raimondo, L; Di Mauro, C; Servetto, A; Fusciello, C; Veneziani, B M; De Placido, S; Bianco, R

    2014-06-10

    Cetuximab is the only targeted agent approved for the treatment of head and neck squamous cell carcinomas (HNSCC), but low response rates and disease progression are frequently reported. As the phosphoinositide 3-kinase (PI3K) and the mammalian target of rapamycin (mTOR) pathways have an important role in the pathogenesis of HNSCC, we investigated their involvement in cetuximab resistance. Different human squamous cancer cell lines sensitive or resistant to cetuximab were tested for the dual PI3K/mTOR inhibitor PF-05212384 (PKI-587), alone and in combination, both in vitro and in vivo. Treatment with PKI-587 enhances sensitivity to cetuximab in vitro, even in the condition of epidermal growth factor receptor (EGFR) resistance. The combination of the two drugs inhibits cells survival, impairs the activation of signalling pathways and induces apoptosis. Interestingly, although significant inhibition of proliferation is observed in all cell lines treated with PKI-587 in combination with cetuximab, activation of apoptosis is evident in sensitive but not in resistant cell lines, in which autophagy is pre-eminent. In nude mice xenografted with resistant Kyse30 cells, the combined treatment significantly reduces tumour growth and prolongs mice survival. Phosphoinositide 3-kinase/mammalian target of rapamycin inhibition has an important role in the rescue of cetuximab resistance. Different mechanisms of cell death are induced by combined treatment depending on basal anti-EGFR responsiveness.

  7. Search for the $C\\!P$-violating strong decays $\\eta \\to \\pi^+\\pi^-$ and $\\eta^\\prime(958) \\to \\pi^+\\pi^-$

    CERN Document Server

    Aaij, Roel; Adinolfi, Marco; Ajaltouni, Ziad; Akar, Simon; Albrecht, Johannes; Alessio, Federico; Alexander, Michael; Ali, Suvayu; Alkhazov, Georgy; Alvarez Cartelle, Paula; Alves Jr, Antonio Augusto; Amato, Sandra; Amerio, Silvia; Amhis, Yasmine; An, Liupan; Anderlini, Lucio; Andreassi, Guido; Andreotti, Mirco; Andrews, Jason; Appleby, Robert; Archilli, Flavio; d'Argent, Philippe; Arnau Romeu, Joan; Artamonov, Alexander; Artuso, Marina; Aslanides, Elie; Auriemma, Giulio; Baalouch, Marouen; Babuschkin, Igor; Bachmann, Sebastian; Back, John; Badalov, Alexey; Baesso, Clarissa; Baker, Sophie; Baldini, Wander; Barlow, Roger; Barschel, Colin; Barsuk, Sergey; Barter, William; Baszczyk, Mateusz; Batozskaya, Varvara; Batsukh, Baasansuren; Battista, Vincenzo; Bay, Aurelio; Beaucourt, Leo; Beddow, John; Bedeschi, Franco; Bediaga, Ignacio; Bel, Lennaert; Bellee, Violaine; Belloli, Nicoletta; Belous, Konstantin; Belyaev, Ivan; Ben-Haim, Eli; Bencivenni, Giovanni; Benson, Sean; Benton, Jack; Berezhnoy, Alexander; Bernet, Roland; Bertolin, Alessandro; Betancourt, Christopher; Betti, Federico; Bettler, Marc-Olivier; van Beuzekom, Martinus; Bezshyiko, Iaroslava; Bifani, Simone; Billoir, Pierre; Bird, Thomas; Birnkraut, Alex; Bitadze, Alexander; Bizzeti, Andrea; Blake, Thomas; Blanc, Frederic; Blouw, Johan; Blusk, Steven; Bocci, Valerio; Boettcher, Thomas; Bondar, Alexander; Bondar, Nikolay; Bonivento, Walter; Bordyuzhin, Igor; Borgheresi, Alessio; Borghi, Silvia; Borisyak, Maxim; Borsato, Martino; Bossu, Francesco; Boubdir, Meriem; Bowcock, Themistocles; Bowen, Espen Eie; Bozzi, Concezio; Braun, Svende; Britsch, Markward; Britton, Thomas; Brodzicka, Jolanta; Buchanan, Emma; Burr, Christopher; Bursche, Albert; Buytaert, Jan; Cadeddu, Sandro; Calabrese, Roberto; Calvi, Marta; Calvo Gomez, Miriam; Camboni, Alessandro; Campana, Pierluigi; Campora Perez, Daniel Hugo; Capriotti, Lorenzo; Carbone, Angelo; Carboni, Giovanni; Cardinale, Roberta; Cardini, Alessandro; Carniti, Paolo; Carson, Laurence; Carvalho Akiba, Kazuyoshi; Casse, Gianluigi; Cassina, Lorenzo; Castillo Garcia, Lucia; Cattaneo, Marco; Cauet, Christophe; Cavallero, Giovanni; Cenci, Riccardo; Chamont, David; Charles, Matthew; Charpentier, Philippe; Chatzikonstantinidis, Georgios; Chefdeville, Maximilien; Chen, Shanzhen; Cheung, Shu-Faye; Chobanova, Veronika; Chrzaszcz, Marcin; Cid Vidal, Xabier; Ciezarek, Gregory; Clarke, Peter; Clemencic, Marco; Cliff, Harry; Closier, Joel; Coco, Victor; Cogan, Julien; Cogneras, Eric; Cogoni, Violetta; Cojocariu, Lucian; Collazuol, Gianmaria; Collins, Paula; Comerma-Montells, Albert; Contu, Andrea; Cook, Andrew; Coombs, George; Coquereau, Samuel; Corti, Gloria; Corvo, Marco; Costa Sobral, Cayo Mar; Couturier, Benjamin; Cowan, Greig; Craik, Daniel Charles; Crocombe, Andrew; Cruz Torres, Melissa Maria; Cunliffe, Samuel; Currie, Robert; D'Ambrosio, Carmelo; Da Cunha Marinho, Franciole; Dall'Occo, Elena; Dalseno, Jeremy; David, Pieter; Davis, Adam; De Aguiar Francisco, Oscar; De Bruyn, Kristof; De Capua, Stefano; De Cian, Michel; De Miranda, Jussara; De Paula, Leandro; De Serio, Marilisa; De Simone, Patrizia; Dean, Cameron Thomas; Decamp, Daniel; Deckenhoff, Mirko; Del Buono, Luigi; Demmer, Moritz; Dendek, Adam; Derkach, Denis; Deschamps, Olivier; Dettori, Francesco; Dey, Biplab; Di Canto, Angelo; Dijkstra, Hans; Dordei, Francesca; Dorigo, Mirco; Dosil Suárez, Alvaro; Dovbnya, Anatoliy; Dreimanis, Karlis; Dufour, Laurent; Dujany, Giulio; Dungs, Kevin; Durante, Paolo; Dzhelyadin, Rustem; Dziurda, Agnieszka; Dzyuba, Alexey; Déléage, Nicolas; Easo, Sajan; Ebert, Marcus; Egede, Ulrik; Egorychev, Victor; Eidelman, Semen; Eisenhardt, Stephan; Eitschberger, Ulrich; Ekelhof, Robert; Eklund, Lars; Ely, Scott; Esen, Sevda; Evans, Hannah Mary; Evans, Timothy; Falabella, Antonio; Farley, Nathanael; Farry, Stephen; Fay, Robert; Fazzini, Davide; Ferguson, Dianne; Fernandez Prieto, Antonio; Ferrari, Fabio; Ferreira Rodrigues, Fernando; Ferro-Luzzi, Massimiliano; Filippov, Sergey; Fini, Rosa Anna; Fiore, Marco; Fiorini, Massimiliano; Firlej, Miroslaw; Fitzpatrick, Conor; Fiutowski, Tomasz; Fleuret, Frederic; Fohl, Klaus; Fontana, Marianna; Fontanelli, Flavio; Forshaw, Dean Charles; Forty, Roger; Franco Lima, Vinicius; Frank, Markus; Frei, Christoph; Fu, Jinlin; Furfaro, Emiliano; Färber, Christian; Gallas Torreira, Abraham; Galli, Domenico; Gallorini, Stefano; Gambetta, Silvia; Gandelman, Miriam; Gandini, Paolo; Gao, Yuanning; Garcia Martin, Luis Miguel; García Pardiñas, Julián; Garra Tico, Jordi; Garrido, Lluis; Garsed, Philip John; Gascon, David; Gaspar, Clara; Gavardi, Laura; Gazzoni, Giulio; Gerick, David; Gersabeck, Evelina; Gersabeck, Marco; Gershon, Timothy; Ghez, Philippe; Gianì, Sebastiana; Gibson, Valerie; Girard, Olivier Göran; Giubega, Lavinia-Helena; Gizdov, Konstantin; Gligorov, V.V.; Golubkov, Dmitry; Golutvin, Andrey; Gomes, Alvaro; Gorelov, Igor Vladimirovich; Gotti, Claudio; Grabalosa Gándara, Marc; Graciani Diaz, Ricardo; Granado Cardoso, Luis Alberto; Graugés, Eugeni; Graverini, Elena; Graziani, Giacomo; Grecu, Alexandru; Griffith, Peter; Grillo, Lucia; Gruberg Cazon, Barak Raimond; Grünberg, Oliver; Gushchin, Evgeny; Guz, Yury; Gys, Thierry; Göbel, Carla; Hadavizadeh, Thomas; Hadjivasiliou, Christos; Haefeli, Guido; Haen, Christophe; Haines, Susan; Hall, Samuel; Hamilton, Brian; Han, Xiaoxue; Hansmann-Menzemer, Stephanie; Harnew, Neville; Harnew, Samuel; Harrison, Jonathan; Hatch, Mark; He, Jibo; Head, Timothy; Heister, Arno; Hennessy, Karol; Henrard, Pierre; Henry, Louis; Hernando Morata, Jose Angel; van Herwijnen, Eric; Heß, Miriam; Hicheur, Adlène; Hill, Donal; Hombach, Christoph; Hopchev, P H; Hulsbergen, Wouter; Humair, Thibaud; Hushchyn, Mikhail; Hussain, Nazim; Hutchcroft, David; Idzik, Marek; Ilten, Philip; Jacobsson, Richard; Jaeger, Andreas; Jalocha, Pawel; Jans, Eddy; Jawahery, Abolhassan; Jiang, Feng; John, Malcolm; Johnson, Daniel; Jones, Christopher; Joram, Christian; Jost, Beat; Jurik, Nathan; Kandybei, Sergii; Kanso, Walaa; Karacson, Matthias; Kariuki, James Mwangi; Karodia, Sarah; Kecke, Matthieu; Kelsey, Matthew; Kenyon, Ian; Kenzie, Matthew; Ketel, Tjeerd; Khairullin, Egor; Khanji, Basem; Khurewathanakul, Chitsanu; Kirn, Thomas; Klaver, Suzanne; Klimaszewski, Konrad; Koliiev, Serhii; Kolpin, Michael; Komarov, Ilya; Koopman, Rose; Koppenburg, Patrick; Kosmyntseva, Alena; Kozachuk, Anastasiia; Kozeiha, Mohamad; Kravchuk, Leonid; Kreplin, Katharina; Kreps, Michal; Krokovny, Pavel; Kruse, Florian; Krzemien, Wojciech; Kucewicz, Wojciech; Kucharczyk, Marcin; Kudryavtsev, Vasily; Kuonen, Axel Kevin; Kurek, Krzysztof; Kvaratskheliya, Tengiz; Lacarrere, Daniel; Lafferty, George; Lai, Adriano; Lanfranchi, Gaia; Langenbruch, Christoph; Latham, Thomas; Lazzeroni, Cristina; Le Gac, Renaud; van Leerdam, Jeroen; Lees, Jean-Pierre; Leflat, Alexander; Lefrançois, Jacques; Lefèvre, Regis; Lemaitre, Florian; Lemos Cid, Edgar; Leroy, Olivier; Lesiak, Tadeusz; Leverington, Blake; Li, Tenglin; Li, Yiming; Likhomanenko, Tatiana; Lindner, Rolf; Linn, Christian; Lionetto, Federica; Liu, Bo; Liu, Xuesong; Loh, David; Longstaff, Iain; Lopes, Jose; Lucchesi, Donatella; Lucio Martinez, Miriam; Luo, Haofei; Lupato, Anna; Luppi, Eleonora; Lupton, Oliver; Lusiani, Alberto; Lyu, Xiao-Rui; Machefert, Frederic; Maciuc, Florin; Maev, Oleg; Maguire, Kevin; Malde, Sneha; Malinin, Alexander; Maltsev, Timofei; Manca, Giulia; Mancinelli, Giampiero; Manning, Peter Michael; Maratas, Jan; Marchand, Jean François; Marconi, Umberto; Marin Benito, Carla; Marino, Pietro; Marks, Jörg; Martellotti, Giuseppe; Martin, Morgan; Martinelli, Maurizio; Martinez Santos, Diego; Martinez Vidal, Fernando; Martins Tostes, Danielle; Massacrier, Laure Marie; Massafferri, André; Matev, Rosen; Mathad, Abhijit; Mathe, Zoltan; Matteuzzi, Clara; Mauri, Andrea; Maurin, Brice; Mazurov, Alexander; McCann, Michael; McCarthy, James; McNab, Andrew; McNulty, Ronan; Meadows, Brian; Meier, Frank; Meissner, Marco; Melnychuk, Dmytro; Merk, Marcel; Merli, Andrea; Michielin, Emanuele; Milanes, Diego Alejandro; Minard, Marie-Noelle; Mitzel, Dominik Stefan; Mogini, Andrea; Molina Rodriguez, Josue; Monroy, Ignacio Alberto; Monteil, Stephane; Morandin, Mauro; Morawski, Piotr; Mordà, Alessandro; Morello, Michael Joseph; Moron, Jakub; Morris, Adam Benjamin; Mountain, Raymond; Muheim, Franz; Mulder, Mick; Mussini, Manuel; Müller, Dominik; Müller, Janine; Müller, Katharina; Müller, Vanessa; Naik, Paras; Nakada, Tatsuya; Nandakumar, Raja; Nandi, Anita; Nasteva, Irina; Needham, Matthew; Neri, Nicola; Neubert, Sebastian; Neufeld, Niko; Neuner, Max; Nguyen, Anh Duc; Nguyen, Thi Dung; Nguyen-Mau, Chung; Nieswand, Simon; Niet, Ramon; Nikitin, Nikolay; Nikodem, Thomas; Novoselov, Alexey; O'Hanlon, Daniel Patrick; Oblakowska-Mucha, Agnieszka; Obraztsov, Vladimir; Ogilvy, Stephen; Oldeman, Rudolf; Onderwater, Gerco; Otalora Goicochea, Juan Martin; Otto, Adam; Owen, Patrick; Oyanguren, Maria Aranzazu; Pais, Preema Rennee; Palano, Antimo; Palombo, Fernando; Palutan, Matteo; Panman, Jacob; Papanestis, Antonios; Pappagallo, Marco; Pappalardo, Luciano; Parker, William; Parkes, Christopher; Passaleva, Giovanni; Pastore, Alessandra; Patel, Girish; Patel, Mitesh; Patrignani, Claudia; Pearce, Alex; Pellegrino, Antonio; Penso, Gianni; Pepe Altarelli, Monica; Perazzini, Stefano; Perret, Pascal; Pescatore, Luca; Petridis, Konstantinos; Petrolini, Alessandro; Petrov, Aleksandr; Petruzzo, Marco; Picatoste Olloqui, Eduardo; Pietrzyk, Boleslaw; Pikies, Malgorzata; Pinci, Davide; Pistone, Alessandro; Piucci, Alessio; Playfer, Stephen; Plo Casasus, Maximo; Poikela, Tuomas; Polci, Francesco; Poluektov, Anton; Polyakov, Ivan; Polycarpo, Erica; Pomery, Gabriela Johanna; Popov, Alexander; Popov, Dmitry; Popovici, Bogdan; Poslavskii, Stanislav; Potterat, Cédric; Price, Eugenia; Price, Joseph David; Prisciandaro, Jessica; Pritchard, Adrian; Prouve, Claire; Pugatch, Valery; Puig Navarro, Albert; Punzi, Giovanni; Qian, Wenbin; Quagliani, Renato; Rachwal, Bartolomiej; Rademacker, Jonas; Rama, Matteo; Ramos Pernas, Miguel; Rangel, Murilo; Raniuk, Iurii; Ratnikov, Fedor; Raven, Gerhard; Redi, Federico; Reichert, Stefanie; dos Reis, Alberto; Remon Alepuz, Clara; Renaudin, Victor; Ricciardi, Stefania; Richards, Sophie; Rihl, Mariana; Rinnert, Kurt; Rives Molina, Vicente; Robbe, Patrick; Rodrigues, Ana Barbara; Rodrigues, Eduardo; Rodriguez Lopez, Jairo Alexis; Rodriguez Perez, Pablo; Rogozhnikov, Alexey; Roiser, Stefan; Rollings, Alexandra Paige; Romanovskiy, Vladimir; Romero Vidal, Antonio; Ronayne, John William; Rotondo, Marcello; Rudolph, Matthew Scott; Ruf, Thomas; Ruiz Valls, Pablo; Saborido Silva, Juan Jose; Sadykhov, Elnur; Sagidova, Naylya; Saitta, Biagio; Salustino Guimaraes, Valdir; Sanchez Mayordomo, Carlos; Sanmartin Sedes, Brais; Santacesaria, Roberta; Santamarina Rios, Cibran; Santimaria, Marco; Santovetti, Emanuele; Sarti, Alessio; Satriano, Celestina; Satta, Alessia; Saunders, Daniel Martin; Savrina, Darya; Schael, Stefan; Schellenberg, Margarete; Schiller, Manuel; Schindler, Heinrich; Schlupp, Maximilian; Schmelling, Michael; Schmelzer, Timon; Schmidt, Burkhard; Schneider, Olivier; Schopper, Andreas; Schubert, Konstantin; Schubiger, Maxime; Schune, Marie Helene; Schwemmer, Rainer; Sciascia, Barbara; Sciubba, Adalberto; Semennikov, Alexander; Sergi, Antonino; Serra, Nicola; Serrano, Justine; Sestini, Lorenzo; Seyfert, Paul; Shapkin, Mikhail; Shapoval, Illya; Shcheglov, Yury; Shears, Tara; Shekhtman, Lev; Shevchenko, Vladimir; Siddi, Benedetto Gianluca; Silva Coutinho, Rafael; Silva de Oliveira, Luiz Gustavo; Simi, Gabriele; Simone, Saverio; Sirendi, Marek; Skidmore, Nicola; Skwarnicki, Tomasz; Smith, Eluned; Smith, Iwan Thomas; Smith, Jackson; Smith, Mark; Snoek, Hella; Sokoloff, Michael; Soler, Paul; Souza De Paula, Bruno; Spaan, Bernhard; Spradlin, Patrick; Sridharan, Srikanth; Stagni, Federico; Stahl, Marian; Stahl, Sascha; Stefko, Pavol; Stefkova, Slavorima; Steinkamp, Olaf; Stemmle, Simon; Stenyakin, Oleg; Stevenson, Scott; Stoica, Sabin; Stone, Sheldon; Storaci, Barbara; Stracka, Simone; Straticiuc, Mihai; Straumann, Ulrich; Sun, Liang; Sutcliffe, William; Swientek, Krzysztof; Syropoulos, Vasileios; Szczekowski, Marek; Szumlak, Tomasz; T'Jampens, Stephane; Tayduganov, Andrey; Tekampe, Tobias; Tellarini, Giulia; Teubert, Frederic; Thomas, Eric; van Tilburg, Jeroen; Tilley, Matthew James; Tisserand, Vincent; Tobin, Mark; Tolk, Siim; Tomassetti, Luca; Tonelli, Diego; Topp-Joergensen, Stig; Toriello, Francis; Tournefier, Edwige; Tourneur, Stephane; Trabelsi, Karim; Traill, Murdo; Tran, Minh Tâm; Tresch, Marco; Trisovic, Ana; Tsaregorodtsev, Andrei; Tsopelas, Panagiotis; Tully, Alison; Tuning, Niels; Ukleja, Artur; Ustyuzhanin, Andrey; Uwer, Ulrich; Vacca, Claudia; Vagnoni, Vincenzo; Valassi, Andrea; Valat, Sebastien; Valenti, Giovanni; Vallier, Alexis; Vazquez Gomez, Ricardo; Vazquez Regueiro, Pablo; Vecchi, Stefania; van Veghel, Maarten; Velthuis, Jaap; Veltri, Michele; Veneziano, Giovanni; Venkateswaran, Aravindhan; Vernet, Maxime; Vesterinen, Mika; Viaud, Benoit; Vieira, Daniel; Vieites Diaz, Maria; Viemann, Harald; Vilasis-Cardona, Xavier; Vitti, Marcela; Volkov, Vladimir; Vollhardt, Achim; Voneki, Balazs; Vorobyev, Alexey; Vorobyev, Vitaly; Voß, Christian; de Vries, Jacco; Vázquez Sierra, Carlos; Waldi, Roland; Wallace, Charlotte; Wallace, Ronan; Walsh, John; Wang, Jianchun; Ward, David; Wark, Heather Mckenzie; Watson, Nigel; Websdale, David; Weiden, Andreas; Whitehead, Mark; Wicht, Jean; Wilkinson, Guy; Wilkinson, Michael; Williams, Mark Richard James; Williams, Matthew; Williams, Mike; Williams, Timothy; Wilson, Fergus; Wimberley, Jack; Wishahi, Julian; Wislicki, Wojciech; Witek, Mariusz; Wormser, Guy; Wotton, Stephen; Wraight, Kenneth; Wyllie, Kenneth; Xie, Yuehong; Xing, Zhou; Xu, Zhirui; Yang, Zhenwei; Yao, Yuezhe; Yin, Hang; Yu, Jiesheng; Yuan, Xuhao; Yushchenko, Oleg; Zarebski, Kristian Alexander; Zavertyaev, Mikhail; Zhang, Liming; Zhang, Yanxi; Zhang, Yu; Zhelezov, Alexey; Zheng, Yangheng; Zhokhov, Anatoly; Zhu, Xianglei; Zhukov, Valery; Zucchelli, Stefano

    2017-01-10

    A search for the $C\\!P$-violating strong decays $\\eta \\to \\pi^+\\pi^-$ and $\\eta^\\prime(958) \\to \\pi^+\\pi^-$ has been performed using approximately $2.5 \\times 10^{7}$ events of each of the decays $D^+ \\to \\pi^+\\pi^+\\pi^-$ and $D_s^+ \\to \\pi^+\\pi^+\\pi^-$, recorded by the LHCb experiment. The data set corresponds to an integrated luminosity of 3.0 fb$^{-1}$ of $pp$ collision data recorded during LHC Run 1 and 0.3 fb$^{-1}$ recorded in Run 2. No evidence is seen for $D^+_{(s)} \\to \\pi^+ \\eta^{(\\prime)}$ with $\\eta^{(\\prime)} \\to \\pi^+\\pi^-$, and upper limits at 90% confidence level are set on the branching fractions, $\\mathcal{B}(\\eta \\to \\pi^+\\pi^-) < 1.6 \\times 10^{-5}$ and $\\mathcal{B}(\\eta^\\prime \\to \\pi^+\\pi^-) < 1.8 \\times 10^{-5}$. The limit for the $\\eta$ decay is comparable with the existing one, while that for the $\\eta^\\prime$ is a factor of three smaller than the previous limit.

  8. SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

    Directory of Open Access Journals (Sweden)

    Mehmet AYBEKE

    2015-12-01

    Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

  9. P3N-PIPO, a Frameshift Product from the P3 Gene, Pleiotropically Determines the Virulence of Clover Yellow Vein Virus in both Resistant and Susceptible Peas

    Science.gov (United States)

    Suzuki, Haruka; Miyashita, Yuri; Choi, Sun Hee; Hisa, Yusuke; Rihei, Shunsuke; Shimada, Ryoko; Jeon, Eun Jin; Abe, Junya; Uyeda, Ichiro

    2016-01-01

    ABSTRACT Peas carrying the cyv1 recessive resistance gene are resistant to clover yellow vein virus (ClYVV) isolates No.30 (Cl-No.30) and 90-1 (Cl-90-1) but can be infected by a derivative of Cl-90-1 (Cl-90-1 Br2). The main determinant for the breaking of cyv1 resistance by Cl-90-1 Br2 is P3N-PIPO produced from the P3 gene via transcriptional slippage, and the higher level of P3N-PIPO produced by Cl-90-1 Br2 than by Cl-No.30 contributes to the breaking of resistance. Here we show that P3N-PIPO is also a major virulence determinant in susceptible peas that possess another resistance gene, Cyn1, which does not inhibit systemic infection with ClYVV but causes hypersensitive reaction-like lethal systemic cell death. We previously assumed that the susceptible pea cultivar PI 226564 has a weak allele of Cyn1. Cl-No.30 did not induce cell death, but Cl-90-1 Br2 killed the plants. Our results suggest that P3N-PIPO is recognized by Cyn1 and induces cell death. Unexpectedly, heterologously strongly expressed P3N-PIPO of Cl-No.30 appears to be recognized by Cyn1 in PI 226564. The level of P3N-PIPO accumulation from the P3 gene of Cl-No.30 was significantly lower than that of Cl-90-1 Br2 in a Nicotiana benthamiana transient assay. Therefore, Cyn1-mediated cell death also appears to be determined by the level of P3N-PIPO. The more efficiently a ClYVV isolate broke cyv1 resistance, the more it induced cell death systemically (resulting in a loss of the environment for virus accumulation) in susceptible peas carrying Cyn1, suggesting that antagonistic pleiotropy of P3N-PIPO controls the resistance breaking of ClYVV. IMPORTANCE Control of plant viral disease has relied on the use of resistant cultivars; however, emerging mutant viruses have broken many types of resistance. Recently, we revealed that Cl-90-1 Br2 breaks the recessive resistance conferred by cyv1, mainly by accumulating a higher level of P3N-PIPO than that of the nonbreaking isolate Cl-No.30. Here we show that a

  10. Evaluation of hyaluronic acid-combined ternary complexes for serum-resistant and targeted gene delivery system.

    Science.gov (United States)

    Hong, Woong-Gil; Jeong, Gyeong-Won; Nah, Jae-Woon

    2018-04-19

    Branched polyethylenimine (bPEI) was well known as high transfection agent, which has many amine group. However, utilization of bPEI was limited due to high toxicity. To solve these problems, bPEI was introduced to low molecular weight water-soluble chitosan (LMWSC) with coupling agent. In addition, hyaluronic acid (HA), one of natural anion polymer, was introduced to binary complex of pDNA/bPEI-grafted LMWSC (LMPEI) to target the specific cancer cell and impart the serum resistant. Ternary complexes of pDNA/LMPEI/HA were prepared by electrostatic charge interaction and their binding affinity and DNase protection assay were conducted by gel retardation assay. Particle size of ternary complexes showed that had each 482 ± 245.4 (pDNA/LMPEI2%/HA, 1:16:1, w/w/w) and 410 ± 78.5 nm (pDNA/LMPEI4%/HA, 1:16:2, w/w/w). Moreover, to demonstrate serum-resistant effect of ternary complexes, particle size of them was measured according to incubated time (0-10 h) under serum condition. Transfection assay of ternary complexes showed that their transfection efficiency in CD44-receptor overexpressed HCT116 cell was higher than CD44-receptor negative CT26 cell. Additionally, intracellular uptake of ternary complexes with propidium iodide (PI)-labeled pDNA was observed to confirm targeting effect and cellular internalization by fluorescence microscopy. These results suggest that ternary complexes are superb gene carrier with excellent serum-resistant and high gene transfection. Copyright © 2017. Published by Elsevier B.V.

  11. A Gene Homologous to rRNA Methylase Genes Confers Erythromycin and Clindamycin Resistance in Bifidobacterium breve.

    Science.gov (United States)

    Martínez, Noelia; Luque, Roberto; Milani, Christian; Ventura, Marco; Bañuelos, Oscar; Margolles, Abelardo

    2018-05-15

    Bifidobacteria are mutualistic intestinal bacteria, and their presence in the human gut has been associated with health-promoting activities. The presence of antibiotic resistance genes in this genus is controversial, since, although bifidobacteria are nonpathogenic microorganisms, they could serve as reservoirs of resistance determinants for intestinal pathogens. However, until now, few antibiotic resistance determinants have been functionally characterized in this genus. In this work, we show that Bifidobacterium breve CECT7263 displays atypical resistance to erythromycin and clindamycin. In order to delimit the genomic region responsible for the observed resistance phenotype, a library of genomic DNA was constructed and a fragment of 5.8 kb containing a gene homologous to rRNA methylase genes was able to confer erythromycin resistance in Escherichia coli This genomic region seems to be very uncommon, and homologs of the gene have been detected in only one strain of Bifidobacterium longum and two other strains of B. breve In this context, analysis of shotgun metagenomics data sets revealed that the gene is also uncommon in the microbiomes of adults and infants. The structural gene and its upstream region were cloned into a B. breve -sensitive strain, which became resistant after acquiring the genetic material. In vitro conjugation experiments did not allow us to detect gene transfer to other recipients. Nevertheless, prediction of genes potentially acquired through horizontal gene transfer events revealed that the gene is located in a putative genomic island. IMPORTANCE Bifidobacterium breve is a very common human intestinal bacterium. Often described as a pioneer microorganism in the establishment of early-life intestinal microbiota, its presence has been associated with several beneficial effects for the host, including immune stimulation and protection against infections. Therefore, some strains of this species are considered probiotics. In relation to this

  12. An analysis of the contribution of isospin two $\\pi \\pi$ resonant states in the n.bar.p to $\\pi^{+}\\pi^{+}\\pi^{-}$ annihilation reaction

    CERN Document Server

    Filippi, A; Astrua, M; Botta, E; Bressani, Tullio; Calvo, D; Costa, S; D'Isep, F; Feliciello, A; Iazzi, F; Marcello, S; Minetti, B; Mirfakhraee, N; Balestra, F; Busso, L; Denisov, O Yu; Ferrero, L; Garfagnini, R; Grasso, A; Maggiora, A; Panzarasa, A; Panzieri, D; Tosello, F; Bertin, A; Bruschi, M; Cannata, F; Capponi, M; De Castro, S; Donà, R; Galli, D; Giacobbe, B; Marconi, U; Massa, I; Piccinini, M; Poli, M; Cesari, N S; Spighi, R; Vagnoni, V M; Vecchi, S; Villa, M; Vitale, A; Zoccoli, A; Bianconi, A; Bonomi, G; Bussa, M P; Lodi-Rizzini, E; Venturelli, L; Zenoni, A; Cicalò, C; De Falco, A; Masoni, A; Puddu, G; Serci, S; Usai, G L; Gorchakov, O E; Prakhov, S N; Rozhdestvensky, A M; Tretyak, V I; Gianotti, P; Guaraldo, C; Lanaro, A; Lucherini, V; Petrascu, C; Filippini, V; Fontana, A; Montagna, P; Rotondi, A; Salvini, P; Tessaro, S

    2000-01-01

    The results of a search for a possible evidence of a pi /sup +/ pi /sup +/ resonant state in the np to pi /sup +/ pi /sup +/ pi /sup -/ annihilation reaction with data collected by the OBELIX Experiment are presented. The study has been performed by means of a partial wave analysis in the frame of the isobar model. Production fractions for a possible pi /sup +/ pi /sup +/ resonance have been evaluated. The observed effects at the pi /sup +/ pi /sup +/ threshold may be described reasonably well by the contributions of f/sub 2/(1270), f /sub 0/(1500), f/sub 2/(1565) and rho (1450) states and their interferences, but a meaningful statistical indication for a pi /sup +/ pi /sup +/ scalar state at about 1400 MeV emerges from the analysis. (14 refs).

  13. Alteration of gene expression and DNA methylation in drug-resistant gastric cancer.

    Science.gov (United States)

    Maeda, Osamu; Ando, Takafumi; Ohmiya, Naoki; Ishiguro, Kazuhiro; Watanabe, Osamu; Miyahara, Ryoji; Hibi, Yoko; Nagai, Taku; Yamada, Kiyofumi; Goto, Hidemi

    2014-04-01

    The mechanisms of drug resistance in cancer are not fully elucidated. To study the drug resistance of gastric cancer, we analyzed gene expression and DNA methylation profiles of 5-fluorouracil (5-FU)- and cisplatin (CDDP)-resistant gastric cancer cells and biopsy specimens. Drug-resistant gastric cancer cells were established with culture for >10 months in a medium containing 5-FU or CDDP. Endoscopic biopsy specimens were obtained from gastric cancer patients who underwent chemotherapy with oral fluoropyrimidine S-1 and CDDP. Gene expression and DNA methylation analyses were performed using microarray, and validated using real-time PCR and pyrosequencing, respectively. Out of 17,933 genes, 541 genes commonly increased and 569 genes decreased in both 5-FU- and CDDP-resistant AGS cells. Genes with expression changed by drugs were related to GO term 'extracellular region' and 'p53 signaling pathway' in both 5-FU- and CDDP-treated cells. Expression of 15 genes including KLK13 increased and 12 genes including ETV7 decreased, in both drug-resistant cells and biopsy specimens of two patients after chemotherapy. Out of 10,365 genes evaluated with both expression microarray and methylation microarray, 74 genes were hypermethylated and downregulated, or hypomethylated and upregulated in either 5-FU-resistant or CDDP-resistant cells. Of these genes, expression of 21 genes including FSCN1, CPT1C and NOTCH3, increased from treatment with a demethylating agent. There are alterations of gene expression and DNA methylation in drug-resistant gastric cancer; they may be related to mechanisms of drug resistance and may be useful as biomarkers of gastric cancer drug sensitivity.

  14. Identification of genes differentially expressed in association with acquired cisplatin resistance

    Science.gov (United States)

    Johnsson, A; Zeelenberg, I; Min, Y; Hilinski, J; Berry, C; Howell, S B; Los, G

    2000-01-01

    The goal of this study was to identify genes whose mRNA levels are differentially expressed in human cells with acquired cisplatin (cDDP) resistance. Using the parental UMSCC10b head and neck carcinoma cell line and the 5.9-fold cDDP-resistant subline, UMSCC10b/Pt-S15, two suppressive subtraction hybridization (SSH) cDNA libraries were prepared. One library represented mRNAs whose levels were increased in the cDDP resistant variant (the UP library), the other one represented mRNAs whose levels were decreased in the resistant cells (the DOWN library). Arrays constructed with inserts recovered from these libraries were hybridized with SSH products to identify truly differentially expressed elements. A total of 51 cDNA fragments present in the UP library and 16 in the DOWN library met the criteria established for differential expression. The sequences of 87% of these cDNA fragments were identified in Genbank. Among the mRNAs in the UP library that were frequently isolated and that showed high levels of differential expression were cytochrome oxidase I, ribosomal protein 28S, elongation factor 1α, α-enolase, stathmin, and HSP70. The approach taken in this study permitted identification of many genes never before linked to the cDDP-resistant phenotype. © 2000 Cancer Research Campaign PMID:10993653

  15. Gene Inactivation by CRISPR-Cas9 in Nicotiana tabacum BY-2 Suspension Cells.

    Science.gov (United States)

    Mercx, Sébastien; Tollet, Jérémie; Magy, Bertrand; Navarre, Catherine; Boutry, Marc

    2016-01-01

    Plant suspension cells are interesting hosts for the heterologous production of pharmacological proteins such as antibodies. They have the advantage to facilitate the containment and the application of good manufacturing practices. Furthermore, antibodies can be secreted to the extracellular medium, which makes the purification steps much simpler. However, improvements are still to be made regarding the quality and the production yield. For instance, the inactivation of proteases and the humanization of glycosylation are both important targets which require either gene silencing or gene inactivation. To this purpose, CRISPR-Cas9 is a very promising technique which has been used recently in a series of plant species, but not yet in plant suspension cells. Here, we sought to use the CRISPR-Cas9 system for gene inactivation in Nicotiana tabacum BY-2 suspension cells. We transformed a transgenic line expressing a red fluorescent protein (mCherry) with a binary vector containing genes coding for Cas9 and three guide RNAs targeting mCherry restriction sites, as well as a bialaphos-resistant (bar) gene for selection. To demonstrate gene inactivation in the transgenic lines, the mCherry gene was PCR-amplified and analyzed by electrophoresis. Seven out of 20 transformants displayed a shortened fragment, indicating that a deletion occurred between two target sites. We also analyzed the transformants by restriction fragment length polymorphism and observed that the three targeted restriction sites were hit. DNA sequencing of the PCR fragments confirmed either deletion between two target sites or single nucleotide deletion. We therefore conclude that CRISPR-Cas9 can be used in N. tabacum BY2 cells.

  16. Detection and linkage to mobile genetic elements of tetracycline resistance gene tet(M) in Escherichia coli isolates from pigs

    DEFF Research Database (Denmark)

    Jurado-Rabadan, Sonia; de la Fuente, Ricardo; Ruiz-Santa-Quiteria, Jose A.

    2014-01-01

    Background: In Escherichia coli the genes involved in the acquisition of tetracycline resistance are mainly tet(A) and tet(B). In addition, tet(M) is the most common tetracycline resistance determinant in enterococci and it is associated with conjugative transposons and plasmids. Although tet......(M) has been identified in E. coli, to our knowledge, there are no previous reports studying the linkage of the tet(M) gene in E. coli to different mobile genetic elements. The aim of this study was to determine the occurrence of tet(A), tet(B), and tet(M) genes in doxycycline-resistant E. coli isolates...... from pigs, as well as the detection of mobile genetic elements linked to tet(M) in E. coli and its possible transfer from enterococci. Results: tet(A) was the most frequently detected gene (87.9%) in doxycycline-resistant isolates. tet(M) was found in 13.1% E. coli isolates. The tet(M) gene...

  17. pi-pi correlations in photon-induced reactions

    NARCIS (Netherlands)

    Messchendorp, J

    2003-01-01

    Differential cross sections of the-reactions A(gamma,pi(0) pi(0)) and A(gamma, pi(0) pi(+) + pi(0) pi(-)) with A=H-1, C-12, and Pb-nat are presented. A significant. nuclear-mass dependence of the pipi invariant-mass distribution is found in the pi(0) pi(0) channel. The dependence is not observed in

  18. Alpha-1 antitrypsin Pi*Z gene frequency and Pi*ZZ genotype numbers worldwide: an update.

    Science.gov (United States)

    Blanco, Ignacio; Bueno, Patricia; Diego, Isidro; Pérez-Holanda, Sergio; Casas-Maldonado, Francisco; Esquinas, Cristina; Miravitlles, Marc

    2017-01-01

    In alpha-1 antitrypsin deficiency (AATD), the Z allele is present in 98% of cases with severe disease, and knowledge of the frequency of this allele is essential from a public health perspective. However, there is a remarkable lack of epidemiological data on AATD worldwide, and many of the data currently used are outdated. Therefore, the objective of this study was to update the knowledge of the frequency of the Z allele to achieve accurate estimates of the prevalence and number of Pi*ZZ genotypes worldwide based on studies performed according to the following criteria: 1) samples representative of the general population, 2) AAT phenotyping characterized by adequate methods, and 3) measurements performed using a coefficient of variation calculated from the sample size and 95% confidence intervals. Studies fulfilling these criteria were used to develop maps with an inverse distance weighted (IDW)-interpolation method, providing numerical and graphical information of Pi*Z distribution worldwide. A total of 224 cohorts from 65 countries were included in the study. With the data provided by these cohorts, a total of 253,404 Pi*ZZ were estimated worldwide: 119,594 in Europe, 91,490 in America and Caribbean, 3,824 in Africa, 32,154 in Asia, 4,126 in Australia, and 2,216 in New Zealand. In addition, the IDW-interpolation maps predicted Pi*Z frequencies throughout the world even in some areas that lack real data. In conclusion, the inclusion of new well-designed studies and the exclusion of the low-quality ones have significantly improved the reliability of results, which may be useful to plan strategies for future research and diagnosis and to rationalize the therapeutic resources available.

  19. Obesity genes and insulin resistance.

    Science.gov (United States)

    Belkina, Anna C; Denis, Gerald V

    2010-10-01

    The exploding prevalence of insulin resistance and Type 2 diabetes (T2D) linked to obesity has become an alarming public health concern. Worldwide, approximately 171 million people suffer from obesity-induced diabetes and public health authorities expect this situation to deteriorate rapidly. An interesting clinical population of 'metabolically healthy but obese' (MHO) cases is relatively protected from T2D and its associated cardiovascular risk. The molecular basis for this protection is not well understood but is likely to involve reduced inflammatory responses. The inflammatory cells and pathways that respond to overnutrition are the primary subject matter for this review. The chance discovery of a genetic mutation in the Brd2 gene, which is located in the class II major histocompatibility complex and makes mice enormously fat but protects them from diabetes, offers revolutionary new insights into the cellular mechanisms that link obesity to insulin resistance and T2D. These Brd2-hypomorphic mice have reduced inflammation in fat that is normally associated with insulin resistance, and resemble MHO patients, suggesting novel therapeutic pathways for obese patients at risk for T2D. Deeper understanding of the functional links between genes that control inflammatory responses to diet-induced obesity is crucial to the development of therapies for obese, insulin-resistant patients.

  20. Determination of {pi}{pi} scattering lengths from measurement of {pi}{sup +{pi}-} atom lifetime

    Energy Technology Data Exchange (ETDEWEB)

    Adeva, B. [Santiago de Compostela University (Spain); Afanasyev, L. [JINR Dubna (Russian Federation); Benayoun, M. [LPNHE des Universites Paris VI/VII, IN2P3-CNRS (France); Benelli, A. [Zurich University (Switzerland); Berka, Z. [Czech Technical University in Prague, Prague (Czech Republic); Brekhovskikh, V. [IHEP Protvino (Russian Federation); Caragheorgheopol, G. [IFIN-HH, National Institute for Physics and Nuclear Engineering, Bucharest (Romania); Cechak, T. [Czech Technical University in Prague, Prague (Czech Republic); Chiba, M. [Tokyo Metropolitan University (Japan); Chliapnikov, P.V. [IHEP Protvino (Russian Federation); Ciocarlan, C.; Constantinescu, S. [IFIN-HH, National Institute for Physics and Nuclear Engineering, Bucharest (Romania); Costantini, S. [Basel University (Switzerland); Curceanu, C. [IFIN-HH, National Institute for Physics and Nuclear Engineering, Bucharest (Romania); Doskarova, P. [Czech Technical University in Prague, Prague (Czech Republic); Dreossi, D. [INFN, Sezione di Trieste and Trieste University, Trieste (Italy); Drijard, D., E-mail: Daniel.Drijard@cern.ch [CERN, Geneva (Switzerland); Dudarev, A. [JINR Dubna (Russian Federation); Ferro-Luzzi, M. [CERN, Geneva (Switzerland); Fungueirino Pazos, J.L. [Santiago de Compostela University (Spain)

    2011-10-05

    The DIRAC experiment at CERN has achieved a sizeable production of {pi}{sup +{pi}-} atoms and has significantly improved the precision on its lifetime determination. From a sample of 21 227 atomic pairs, a 4% measurement of the S-wave {pi}{pi} scattering length difference |a{sub 0}-a{sub 2}|=(0.2533{sub -0.0078}{sup +0.0080}|{sub stat}{sup +0.0078}{sub -0.0073}|{sub syst})M{sub {pi}}{sup +-1} has been attained, providing an important test of Chiral Perturbation Theory.

  1. Study on drug resistance of mycobacterium tuberculosis in patients with pulmonary tuberculosis by drug resistance gene detecting

    International Nuclear Information System (INIS)

    Wang Wei; Li Hongmin; Wu Xueqiong; Wang Ansheng; Ye Yixiu; Wang Zhongyuan; Liu Jinwei; Chen Hongbing; Lin Minggui; Wang Jinhe; Li Sumei; Jiang Ping; Feng Bai; Chen Dongjing

    2004-01-01

    To investigate drug resistance of mycobacterium tuberculosis in different age group, compare detecting effect of two methods and evaluate their the clinical application value, all of the strains of mycobacterium tuberculosis were tested for resistance to RFP, INH SM PZA and EMB by the absolute concentration method on Lowenstein-Jensen medium and the mutation of the rpoB, katG, rpsL, pncA and embB resistance genes in M. tuberculosis was tested by PCR-SSCP. In youth, middle and old age group, the rate of acquired drug resistance was 89.2%, 85.3% and 67.6% respectively, the gene mutation rate was 76.2%, 81.3% and 63.2% respectively. The rate of acquired drug resistance and multiple drug resistance in youth group was much higher than those in other groups. The gene mutation was correlated with drug resistance level of mycobacterium tuberculosis. The gene mutation rate was higher in strains isolated from high concentration resistance than those in strains isolated from low concentration resistance. The more irregular treatment was longer, the rate of drug resistance was higher. Acquired drug resistance varies in different age group. It suggested that surveillance of drug resistence in different age group should be taken seriously, especially in youth group. PCR - SSCP is a sensitive and specific method for rapid detecting rpoB, katG, rpsL, pncA and embB genes mutations of MTB. (authors)

  2. P-glycoprotein-9 and macrocyclic lactone resistance status in selected strains of the ovine gastrointestinal nematode, Teladorsagia circumcincta.

    Science.gov (United States)

    Turnbull, Frank; Jonsson, Nicholas N; Kenyon, Fiona; Skuce, Philip J; Bisset, Stewart A

    2018-04-01

    The Teladorsagia circumcincta P-glycoprotein-9 (Tci-pgp-9) gene has previously been implicated in multiple-anthelmintic resistance in this parasite. Here we further characterise genetic diversity in Tci-pgp-9 and its possible role in ivermectin (IVM) and multi-drug resistance using two UK field isolates of T. circumcincta, one susceptible to anthelmintics (MTci2) and the other resistant to most available anthelmintics including IVM (MTci5). A comparison of full-length Tci-pgp-9 cDNA transcripts from the MTci2 and MTci5 isolates (∼3.8 kb in both cases) indicated that they shared 95.6% and 99.5% identity at the nucleotide and amino acid levels, respectively. Nine non-synonymous SNPs were found in the MTci5 sequences relative to their MTci2 counterparts. Twelve genomic sequence variants of the first internucleotide binding domain of Tci-pgp-9 were identified and up to 10 of these were present in some individual worms, strongly supporting previous evidence that amplification of this gene has occurred in T. circumcincta. On average, fewer distinct sequence variants of Tci-pgp-9 were present in individual worms of the MTci5 isolate than in those of the MTci2 isolate. A further reduction in the number of sequence variants was observed in individuals derived from an IVM-treated sub-population of MTci5. These findings suggest that Tci-pgp-9 was under purifying selection in the face of IVM treatment in T. circumcincta, with some sequence variants being selected against. Copyright © 2018. Published by Elsevier Ltd.

  3. Clusters of Antibiotic Resistance Genes Enriched Together Stay Together in Swine Agriculture.

    Science.gov (United States)

    Johnson, Timothy A; Stedtfeld, Robert D; Wang, Qiong; Cole, James R; Hashsham, Syed A; Looft, Torey; Zhu, Yong-Guan; Tiedje, James M

    2016-04-12

    Antibiotic resistance is a worldwide health risk, but the influence of animal agriculture on the genetic context and enrichment of individual antibiotic resistance alleles remains unclear. Using quantitative PCR followed by amplicon sequencing, we quantified and sequenced 44 genes related to antibiotic resistance, mobile genetic elements, and bacterial phylogeny in microbiomes from U.S. laboratory swine and from swine farms from three Chinese regions. We identified highly abundant resistance clusters: groups of resistance and mobile genetic element alleles that cooccur. For example, the abundance of genes conferring resistance to six classes of antibiotics together with class 1 integrase and the abundance of IS6100-type transposons in three Chinese regions are directly correlated. These resistance cluster genes likely colocalize in microbial genomes in the farms. Resistance cluster alleles were dramatically enriched (up to 1 to 10% as abundant as 16S rRNA) and indicate that multidrug-resistant bacteria are likely the norm rather than an exception in these communities. This enrichment largely occurred independently of phylogenetic composition; thus, resistance clusters are likely present in many bacterial taxa. Furthermore, resistance clusters contain resistance genes that confer resistance to antibiotics independently of their particular use on the farms. Selection for these clusters is likely due to the use of only a subset of the broad range of chemicals to which the clusters confer resistance. The scale of animal agriculture and its wastes, the enrichment and horizontal gene transfer potential of the clusters, and the vicinity of large human populations suggest that managing this resistance reservoir is important for minimizing human risk. Agricultural antibiotic use results in clusters of cooccurring resistance genes that together confer resistance to multiple antibiotics. The use of a single antibiotic could select for an entire suite of resistance genes if

  4. Integrated analysis of DNA methylation and gene expression reveals specific signaling pathways associated with platinum resistance in ovarian cancer

    Directory of Open Access Journals (Sweden)

    Chung Jae

    2009-06-01

    Full Text Available Abstract Background Cisplatin and carboplatin are the primary first-line therapies for the treatment of ovarian cancer. However, resistance to these platinum-based drugs occurs in the large majority of initially responsive tumors, resulting in fully chemoresistant, fatal disease. Although the precise mechanism(s underlying the development of platinum resistance in late-stage ovarian cancer patients currently remains unknown, CpG-island (CGI methylation, a phenomenon strongly associated with aberrant gene silencing and ovarian tumorigenesis, may contribute to this devastating condition. Methods To model the onset of drug resistance, and investigate DNA methylation and gene expression alterations associated with platinum resistance, we treated clonally derived, drug-sensitive A2780 epithelial ovarian cancer cells with increasing concentrations of cisplatin. After several cycles of drug selection, the isogenic drug-sensitive and -resistant pairs were subjected to global CGI methylation and mRNA expression microarray analyses. To identify chemoresistance-associated, biological pathways likely impacted by DNA methylation, promoter CGI methylation and mRNA expression profiles were integrated and subjected to pathway enrichment analysis. Results Promoter CGI methylation revealed a positive association (Spearman correlation of 0.99 between the total number of hypermethylated CGIs and GI50 values (i.e., increased drug resistance following successive cisplatin treatment cycles. In accord with that result, chemoresistance was reversible by DNA methylation inhibitors. Pathway enrichment analysis revealed hypermethylation-mediated repression of cell adhesion and tight junction pathways and hypomethylation-mediated activation of the cell growth-promoting pathways PI3K/Akt, TGF-beta, and cell cycle progression, which may contribute to the onset of chemoresistance in ovarian cancer cells. Conclusion Selective epigenetic disruption of distinct biological

  5. TFII-I regulates target genes in the PI-3K and TGF-β signaling pathways through a novel DNA binding motif.

    Science.gov (United States)

    Segura-Puimedon, Maria; Borralleras, Cristina; Pérez-Jurado, Luis A; Campuzano, Victoria

    2013-09-25

    General transcription factor (TFII-I) is a multi-functional protein involved in the transcriptional regulation of critical developmental genes, encoded by the GTF2I gene located on chromosome 7q11.23. Haploinsufficiency at GTF2I has been shown to play a major role in the neurodevelopmental features of Williams-Beuren syndrome (WBS). Identification of genes regulated by TFII-I is thus critical to detect molecular determinants of WBS as well as to identify potential new targets for specific pharmacological interventions, which are currently absent. We performed a microarray screening for transcriptional targets of TFII-I in cortex and embryonic cells from Gtf2i mutant and wild-type mice. Candidate genes with altered expression were verified using real-time PCR. A novel motif shared by deregulated genes was found and chromatin immunoprecipitation assays in embryonic fibroblasts were used to document in vitro TFII-I binding to this motif in the promoter regions of deregulated genes. Interestingly, the PI3K and TGFβ signaling pathways were over-represented among TFII-I-modulated genes. In this study we have found a highly conserved DNA element, common to a set of genes regulated by TFII-I, and identified and validated novel in vivo neuronal targets of this protein affecting the PI3K and TGFβ signaling pathways. Overall, our data further contribute to unravel the complexity and variability of the different genetic programs orchestrated by TFII-I. © 2013 Elsevier B.V. All rights reserved.

  6. Evolution of Regions Containing Antibiotic Resistance Genes in FII-2-FIB-1 ColV-Colla Virulence Plasmids.

    Science.gov (United States)

    Moran, Robert A; Hall, Ruth M

    2018-05-01

    Three ColV virulence plasmids carrying antibiotic resistance genes were assembled from draft genome sequences of commensal ST95, ST131, and ST2705 Escherichia coli isolates from healthy Australians. Plasmids pCERC4, pCERC5, and pCERC9 include almost identical backbones containing FII-2 and FIB-1 replicons and the conserved ColV virulence region with an additional ColIa determinant. Only pCERC5 includes a complete, uninterrupted F-like transfer region and was able to conjugate. pCERC5 and pCERC9 contain Tn1721, carrying the tet(A) tetracycline resistance determinant in the same location, with Tn2 (bla TEM ; ampicillin resistance) interrupting the Tn1721 in pCERC5. pCERC4 has a Tn1721/Tn21 hybrid transposon carrying dfrA5 (trimethoprim resistance) and sul1 (sulfamethoxazole resistance) in a class 1 integron. Four FII-2:FIB-1 ColV-ColIa plasmids in the GenBank nucleotide database have a related transposon in the same position, but an IS26 has reshaped the resistance gene region, deleting 2,069 bp of the integron 3'-CS, including sul1, and serving as a target for IS26 translocatable units containing bla TEM , sul2 and strAB (streptomycin resistance), or aphA1 (kanamycin/neomycin resistance). Another ColV-ColIa plasmid containing a related resistance gene region has lost the FII replicon and acquired a unique transfer region via recombination within the resistance region and at oriT. Eighteen further complete ColV plasmid sequences in GenBank contained FIB-1, but the FII replicons were of three types, FII-24, FII-18, and a variant of FII-36.

  7. Light isovector resonances in $\\pi^- p \\to \\pi^-\\pi^-\\pi^+ p$ at 190 GeV/${\\it c}$

    CERN Document Server

    Akhunzyanov, R.; The COMPASS collaboration; Alexeev, G.D.; Amoroso, A.; Andrieux, V.; Anfimov, N.V.; Anosov, V.; Antoshkin, A.; Augsten, K.; Augustyniak, W.; Austregesilo, A.; Azevedo, C.D.R.; Badełek, B.; Balestra, F.; Ball, M.; Barth, J.; Beck, R.; Bedfer, Y.; Bernhard, J.; Bicker, K.; Bielert, E.R.; Birsa, R.; Bodlak, M.; Bordalo, P.; Bradamante, F.; Bressan, A.; Büchele, M.; Burtsev, V.E.; Chang, W.-C.; Chatterjee, C.; Chiosso, M.; Chumakov, A.G.; Chung, S.-U.; Cicuttin, A.; Crespo, M.L.; Dalla Torre, S.; Dasgupta, S.S.; Dasgupta, S.; Denisov, O.Yu.; Dhara, L.; Donskov, S.V.; Doshita, N.; Dreisbach, Ch.; Dünnweber, W.; Dusaev, R.R.; Dziewiecki, M.; Efremov, A.; Eversheim, P.D.; Faessler, M.; Ferrero, A.; Finger, M.; Finger, M., jr.; Fischer, H.; Franco, C.; du Fresne von Hohenesche, N.; Friedrich, J.M.; Frolov, V.; Gautheron, F.; Gavrichtchouk, O.P.; Gerassimov, S.; Giarra, J.; Gnesi, I.; Gorzellik, M.; Grasso, A.; Gridin, A.; Grosse Perdekamp, M.; Grube, B.; Guskov, A.; Hahne, D.; Hamar, G.; von Harrach, D.; Heitz, R.; Herrmann, F.; Horikawa, N.; d'Hose, N.; Hsieh, C.-Y.; Huber, S.; Ishimoto, S.; Ivanov, A.; Ivanshin, Yu.; Iwata, T.; Jary, V.; Joosten, R.; Jörg, P.; Kabuß, E.; Kerbizi, A.; Ketzer, B.; Khaustov, G.V.; Khokhlov, Yu.A.; Kisselev, Yu.; Klein, F.; Koivuniemi, J.H.; Kolosov, V.N.; Kondo, K.; Konorov, I.; Konstantinov, V.F.; Kotzinian, A.M.; Kouznetsov, O.M.; Kral, Z.; Krämer, M.; Krinner, F.; Kroumchtein, Z.V.; Kulinich, Y.; Kunne, F.; Kurek, K.; Kurjata, R.P.; Kuznetsov, I.I.; Kveton, A.; Lednev, A.A.; Levchenko, E.A.; Levorato, S.; Lian, Y.-S.; Lichtenstadt, J.; Longo, R.; Lyubovitskij, V.E.; Maggiora, A.; Magnon, A.; Makins, N.; Makke, N.; Mallot, G.K.; Mamon, S.A.; Marianski, B.; Martin, A.; Marzec, J.; Matoušek, J.; Matsuda, H.; Matsuda, T.; Meshcheryakov, G.V.; Meyer, M.; Meyer, W.; Mikhailov, Yu.V.; Mikhasenko, M.; Mitrofanov, E.; Mitrofanov, N.; Miyachi, Y.; Moretti, A.; Nagaytsev, A.; Nerling, F.; Neyret, D.; Nový, J.; Nowak, W.-D.; Nukazuka, G.; Nunes, A.S.; Olshevsky, A.G.; Orlov, I.; Ostrick, M.; Panzieri, D.; Parsamyan, B.; Paul, S.; Peng, J.-C.; Pereira, F.; Pešek, M.; Pešková, M.; Peshekhonov, D.V.; Pierre, N.; Platchkov, S.; Pochodzalla, J.; Polyakov, V.A.; Pretz, J.; Quaresma, M.; Quintans, C.; Ramos, S.; Regali, C.; Reicherz, G.; Riedl, C.; Ryabchikov, D.I.; Rybnikov, A.; Rychter, A.; Salac, R.; Samoylenko, V.D.; Sandacz, A.; Sarkar, S.; Savin, I.A.; Sawada, T.; Sbrizzai, G.; Schmieden, H.; Seder, E.; Selyunin, A.; Silva, L.; Sinha, L.; Sirtl, S.; Slunecka, M.; Smolik, J.; Srnka, A.; Steffen, D.; Stolarski, M.; Subrt, O.; Sulc, M.; Suzuki, H.; Szabelski, A.; Szameitat, T.; Sznajder, P.; Tasevsky, M.; Tessaro, S.; Tessarotto, F.; Thiel, A.; Tomsa, J.; Tosello, F.; Tskhay, V.; Uhl, S.; Vasilishin, B.I.; Vauth, A.; Veit, B.M.; Veloso, J.; Vidon, A.; Virius, M.; Wallner, S.; Wilfert, M.; Zaremba, K.; Zavada, P.; Zavertyaev, M.; Zemlyanichkina, E.; Zhuravlev, N.; Ziembicki, M.

    2018-01-01

    We have performed the most comprehensive resonance-model fit of $ \\pi^-\\pi^-\\pi^+$ states using the results of our previously published partial-wave analysis (PWA) of a large data set of diffractive-dissociation events from the reaction $\\pi^- +p \\to \\pi^-\\pi^-\\pi^+ +p_{recoil}$ with a 190 GeV/${\\it c}$ pion beam. The PWA results, which were obtained in 100~bins of three-pion mass, 0.5 < ~$m_{3\\pi}$ < 2.5 GeV/${\\it c}$$^2$, and simultaneously in 11~bins of the reduced four-momentum transfer squared, 0.1 < $t'$ < 1.0 (GeV/${\\it c}$)$^2$, are subjected to a resonance-model fit using Breit-Wigner amplitudes to simultaneously describe a subset of 14~selected waves using 11~isovector light-meson states with $J^{PC} = 0^{-+}$, $1^{++}$, $2^{++}$, $2^{-+}$, $4^{++}$, and spin-exotic $1^{-+}$ quantum numbers. The model contains the well-known resonances $\\pi$(1800), $a_1$(1260), $a_2$(1320), $\\pi_2$(1670), $\\pi_2$(1880), and $a_4$(2040). In addition, it includes the dispute...

  8. Antimicrobial Resistance and Resistance Genes in Aerobic Bacteria Isolated from Pork at Slaughter.

    Science.gov (United States)

    Li, Lili; Heidemann Olsen, Rikke; Ye, Lei; Yan, He; Nie, Qing; Meng, Hecheng; Shi, Lei

    2016-04-01

    The aim of this study was to investigate the phenotypic and genotypic antimicrobial resistance, integrons, and transferability of resistance markers in 243 aerobic bacteria recovered from pork at slaughter in the People's Republic of China. The organisms belonged to 22 genera of gram-negative bacteria (92.2%) and gram-positive bacteria (7.8%). High levels of resistance were detected to tetracycline, trimethoprim-sulfamethoxazole, and ampicillin (36.2 to 54.3%), and lower levels were detected to nitrofurantoin, cefotaxime, gentamicin, ciprofloxacin, and chloramphenicol (7.8 to 29.2%). Across species, genes conferring antimicrobial resistance were observed with the following frequencies: blaTEM, 40.7%; blaCMY-2, 15.2%; blaCTX-M, 11.5%; sul2, 27.2%; sul1, 14.4%; tet(A), 5.4%; tet(L), 5.4%; tet(M), 5.0%; tet(E), 3.7%; tet(C), 3.3%; tet(S), 2.5%; and tet(K), 0.8%. Various antimicrobial resistance genes were found in new carriers: blaTEM in Lactococcus garvieae, Myroides odoratimimus, Aeromonas hydrophila, Staphylococcus sciuri, Raoultella terrigena, Macrococcus caseolyticus, Acinetobacter ursingii, Sphingobacterium sp., and Oceanobacillus sp.; blaCMY-2 in Lactococcus lactis, Klebsiella oxytoca, Serratia marcescens, Acinetobacter baumannii, and Myroides phaeus; tet(L) in M. caseolyticus; sul1 in Vibrio cincinnatiensis; sul2 in Acinetobacter bereziniae, Acinetobacter johnsonii, and V. cincinnatiensis; and the class 1 integron and gene cassette aadA2 in V. cincinnatiensis. Approximately 6.6% of isolates contained class 1 integrons, and one isolate harbored class 2 integrons. Plasmid associated intI1 and androgen receptor- encoding genes were transferred into Escherichia coli J53 and E. coli DH5α by conjugation and transformation experiments, respectively. Our study highlights the importance of aerobic bacteria from pork as reservoirs for antimicrobial resistance genes and mobile genetic elements that can readily be transferred intra- and interspecies.

  9. A maize resistance gene functions against bacterial streak disease in rice.

    Science.gov (United States)

    Zhao, Bingyu; Lin, Xinghua; Poland, Jesse; Trick, Harold; Leach, Jan; Hulbert, Scot

    2005-10-25

    Although cereal crops all belong to the grass family (Poacea), most of their diseases are specific to a particular species. Thus, a given cereal species is typically resistant to diseases of other grasses, and this nonhost resistance is generally stable. To determine the feasibility of transferring nonhost resistance genes (R genes) between distantly related grasses to control specific diseases, we identified a maize R gene that recognizes a rice pathogen, Xanthomonas oryzae pv. oryzicola, which causes bacterial streak disease. Bacterial streak is an important disease of rice in Asia, and no simply inherited sources of resistance have been identified in rice. Although X. o. pv. oryzicola does not cause disease on maize, we identified a maize gene, Rxo1, that conditions a resistance reaction to a diverse collection of pathogen strains. Surprisingly, Rxo1 also controls resistance to the unrelated pathogen Burkholderia andropogonis, which causes bacterial stripe of sorghum and maize. The same gene thus controls resistance reactions to both pathogens and nonpathogens of maize. Rxo1 has a nucleotide-binding site-leucine-rich repeat structure, similar to many previously identified R genes. Most importantly, Rxo1 functions after transfer as a transgene to rice, demonstrating the feasibility of nonhost R gene transfer between cereals and providing a valuable tool for controlling bacterial streak disease.

  10. Occurrence of antibiotic resistance and characterization of resistant genes and integrons in Enterobacteriaceae isolated from integrated fish farms south China

    Science.gov (United States)

    Su, Hao-Chang; Ying, Guang-Guo; Tao, Ran; Zhang, Rui-Quan; Fogarty, Lisa R.; Kolpin, Dana W.

    2011-01-01

    Antibiotics are still widely applied in animal husbandry to prevent diseases and used as feed additives to promote animal growth. This could result in antibiotic resistance to bacteria and antibiotic residues in animals. In this paper, Enterobacteriaceae isolated from four integrated fish farms in Zhongshan, South China were tested for antibiotic resistance, tetracycline resistance genes, sulfonamide resistance genes, and class 1 integrons. The Kirby-Bauer disk diffusion method and polymerase chain reaction (PCR) assays were carried out to test antibiotic susceptibility and resistance genes, respectively. Relatively high antibiotic resistance frequencies were found, especially for ampicillin (80%), tetracycline (52%), and trimethoprim (50%). Out of 203 Enterobacteriaceae isolates, 98.5% were resistant to one or more antibiotics tested. Multiple antibiotic resistance (MAR) was found highest in animal manures with a MAR index of 0.56. Tetracycline resistance genes (tet(A), tet(C)) and sulfonamide resistance genes (sul2) were detected in more than 50% of the isolates. The intI1 gene was found in 170 isolates (83.7%). Both classic and non-classic class 1 integrons were found. Four genes, aadA5, aadA22, dfr2, and dfrA17, were detected. To our knowledge, this is the first report for molecular characterization of antibiotic resistance genes in Enterobacteriaceae isolated from integrated fish farms in China and the first time that gene cassette array dfrA17-aadA5 has been detected in such fish farms. Results of this study indicated that fish farms may be a reservoir of highly diverse and abundant antibiotic resistant genes and gene cassettes. Integrons may play a key role in multiple antibiotic resistances posing potential health risks to the general public and aquaculture.

  11. Identifying clinically relevant drug resistance genes in drug-induced resistant cancer cell lines and post-chemotherapy tissues.

    Science.gov (United States)

    Tong, Mengsha; Zheng, Weicheng; Lu, Xingrong; Ao, Lu; Li, Xiangyu; Guan, Qingzhou; Cai, Hao; Li, Mengyao; Yan, Haidan; Guo, You; Chi, Pan; Guo, Zheng

    2015-12-01

    Until recently, few molecular signatures of drug resistance identified in drug-induced resistant cancer cell models can be translated into clinical practice. Here, we defined differentially expressed genes (DEGs) between pre-chemotherapy colorectal cancer (CRC) tissue samples of non-responders and responders for 5-fluorouracil and oxaliplatin-based therapy as clinically relevant drug resistance genes (CRG5-FU/L-OHP). Taking CRG5-FU/L-OHP as reference, we evaluated the clinical relevance of several types of genes derived from HCT116 CRC cells with resistance to 5-fluorouracil and oxaliplatin, respectively. The results revealed that DEGs between parental and resistant cells, when both were treated with the corresponding drug for a certain time, were significantly consistent with the CRG5-FU/L-OHP as well as the DEGs between the post-chemotherapy CRC specimens of responders and non-responders. This study suggests a novel strategy to extract clinically relevant drug resistance genes from both drug-induced resistant cell models and post-chemotherapy cancer tissue specimens.

  12. Frozen White-Leg Shrimp (Litopenaeus vannamei) in Korean Markets as a Source of Aeromonas spp. Harboring Antibiotic and Heavy Metal Resistance Genes.

    Science.gov (United States)

    De Silva, Benthotage C J; Hossain, Sabrina; Dahanayake, Pasan S; Heo, Gang-Joon

    2018-05-24

    As the most consumed shrimp variety, white-leg shrimp (Litopenaeus vannamei) owns a high market demand in Korea. This study sought to screen the frozen white-leg shrimp for Aeromonas spp. harboring antimicrobial and heavy metal resistance characteristics. A total of 44 Aeromonas spp. strains were isolated and tested for antibiotic susceptibility and heavy metal tolerance followed by PCR-based detection of resistance genes and integrons. It was observed that resistance to ampicillin and oxacillin was 100% among isolates. Besides, 95%, 89%, 86%, 80%, 66%, and 43% of the isolates were resistant to nalidixic acid, tetracycline, cephalothin, streptomycin, trimethoprim-sulfamethoxazole, and imipenem, respectively, and less resistance to other antibiotics was also observed. Cr resistance was the highest (91%) among five heavy metals tested, whereas 57%, 32%, 20%, and 9% of the isolates were tolerant to Cu, Pb, Cd, and Hg, respectively. The PCR assays implied the presence of qnrB, qnrS, tetA, tetE, aac(6')-Ib, and aphAI-IAB, and intI1 genes among 80%, 77%, 18%, 30%, 9%, 0.25%, and 82% of the isolates, respectively. There were 35 (80%) integron 1-positive isolates harboring qacE2, dfrA1, orfC, orfD, aadB, catB3, oxa-10, and aadA1 genes in varying combinations. In addition, heavy metal resistance genes, CopA, merA, and CzcA were positive in 9%, 7%, and 27% of the isolates, respectively. According to these outcomes, the frozen white-leg shrimp in Korean markets can be suggested as a source of multidrug and heavy metal-resistant Aeromonas spp. that carries genetic determinants.

  13. Pediatric fecal microbiota harbor diverse and novel antibiotic resistance genes.

    Directory of Open Access Journals (Sweden)

    Aimée M Moore

    Full Text Available Emerging antibiotic resistance threatens human health. Gut microbes are an epidemiologically important reservoir of resistance genes (resistome, yet prior studies indicate that the true diversity of gut-associated resistomes has been underestimated. To deeply characterize the pediatric gut-associated resistome, we created metagenomic recombinant libraries in an Escherichia coli host using fecal DNA from 22 healthy infants and children (most without recent antibiotic exposure, and performed functional selections for resistance to 18 antibiotics from eight drug classes. Resistance-conferring DNA fragments were sequenced (Illumina HiSeq 2000, and reads assembled and annotated with the PARFuMS computational pipeline. Resistance to 14 of the 18 antibiotics was found in stools of infants and children. Recovered genes included chloramphenicol acetyltransferases, drug-resistant dihydrofolate reductases, rRNA methyltransferases, transcriptional regulators, multidrug efflux pumps, and every major class of beta-lactamase, aminoglycoside-modifying enzyme, and tetracycline resistance protein. Many resistance-conferring sequences were mobilizable; some had low identity to any known organism, emphasizing cryptic organisms as potentially important resistance reservoirs. We functionally confirmed three novel resistance genes, including a 16S rRNA methylase conferring aminoglycoside resistance, and two tetracycline-resistance proteins nearly identical to a bifidobacterial MFS transporter (B. longum s. longum JDM301. We provide the first report to our knowledge of resistance to folate-synthesis inhibitors conferred by a predicted Nudix hydrolase (part of the folate synthesis pathway. This functional metagenomic survey of gut-associated resistomes, the largest of its kind to date, demonstrates that fecal resistomes of healthy children are far more diverse than previously suspected, that clinically relevant resistance genes are present even without recent selective

  14. Sulfonamide-resistant bacteria and their resistance genes in soils fertilized with manures from Jiangsu Province, Southeastern China.

    Directory of Open Access Journals (Sweden)

    Na Wang

    Full Text Available Antibiotic-resistant bacteria and genes are recognized as new environmental pollutants that warrant special concern. There were few reports on veterinary antibiotic-resistant bacteria and genes in China. This work systematically analyzed the prevalence and distribution of sulfonamide resistance genes in soils from the environments around poultry and livestock farms in Jiangsu Province, Southeastern China. The results showed that the animal manure application made the spread and abundance of antibiotic resistance genes (ARGs increasingly in the soil. The frequency of sulfonamide resistance genes was sul1 > sul2 > sul3 in pig-manured soil DNA and sul2 > sul1 > sul3 in chicken-manured soil DNA. Further analysis suggested that the frequency distribution of the sul genes in the genomic DNA and plasmids of the SR isolates from manured soil was sul2 > sul1 > sul3 overall (p<0.05. The combination of sul1 and sul2 was the most frequent, and the co-existence of sul1 and sul3 was not found either in the genomic DNA or plasmids. The sample type, animal type and sampling time can influence the prevalence and distribution pattern of sulfonamide resistance genes. The present study also indicated that Bacillus, Pseudomonas and Shigella were the most prevalent sul-positive genera in the soil, suggesting a potential human health risk. The above results could be important in the evaluation of antibiotic-resistant bacteria and genes from manure as sources of agricultural soil pollution; the results also demonstrate the necessity and urgency of the regulation and supervision of veterinary antibiotics in China.

  15. A study of $CP$ violation in $B^\\mp \\rightarrow Dh^\\mp$ ($h=K,\\pi$) with the modes $D \\rightarrow K^\\mp \\pi^\\pm \\pi^0$, $D \\rightarrow \\pi^+\\pi^-\\pi^0$ and $D \\rightarrow K^+K^-\\pi^0$

    CERN Document Server

    Aaij, Roel; Adinolfi, Marco; Affolder, Anthony; Ajaltouni, Ziad; Akar, Simon; Albrecht, Johannes; Alessio, Federico; Alexander, Michael; Ali, Suvayu; Alkhazov, Georgy; Alvarez Cartelle, Paula; Alves Jr, Antonio Augusto; Amato, Sandra; Amerio, Silvia; Amhis, Yasmine; An, Liupan; Anderlini, Lucio; Anderson, Jonathan; Andreotti, Mirco; Andrews, Jason; Appleby, Robert; Aquines Gutierrez, Osvaldo; Archilli, Flavio; d'Argent, Philippe; Artamonov, Alexander; Artuso, Marina; Aslanides, Elie; Auriemma, Giulio; Baalouch, Marouen; Bachmann, Sebastian; Back, John; Badalov, Alexey; Baesso, Clarissa; Baldini, Wander; Barlow, Roger; Barschel, Colin; Barsuk, Sergey; Barter, William; Batozskaya, Varvara; Battista, Vincenzo; Bay, Aurelio; Beaucourt, Leo; Beddow, John; Bedeschi, Franco; Bediaga, Ignacio; Bel, Lennaert; Belyaev, Ivan; Ben-Haim, Eli; Bencivenni, Giovanni; Benson, Sean; Benton, Jack; Berezhnoy, Alexander; Bernet, Roland; Bertolin, Alessandro; Bettler, Marc-Olivier; van Beuzekom, Martinus; Bien, Alexander; Bifani, Simone; Bird, Thomas; Birnkraut, Alex; Bizzeti, Andrea; Blake, Thomas; Blanc, Frédéric; Blouw, Johan; Blusk, Steven; Bocci, Valerio; Bondar, Alexander; Bondar, Nikolay; Bonivento, Walter; Borghi, Silvia; Borsato, Martino; Bowcock, Themistocles; Bowen, Espen Eie; Bozzi, Concezio; Braun, Svende; Brett, David; Britsch, Markward; Britton, Thomas; Brodzicka, Jolanta; Brook, Nicholas; Bursche, Albert; Buytaert, Jan; Cadeddu, Sandro; Calabrese, Roberto; Calvi, Marta; Calvo Gomez, Miriam; Campana, Pierluigi; Campora Perez, Daniel; Capriotti, Lorenzo; Carbone, Angelo; Carboni, Giovanni; Cardinale, Roberta; Cardini, Alessandro; Carniti, Paolo; Carson, Laurence; Carvalho Akiba, Kazuyoshi; Casanova Mohr, Raimon; Casse, Gianluigi; Cassina, Lorenzo; Castillo Garcia, Lucia; Cattaneo, Marco; Cauet, Christophe; Cavallero, Giovanni; Cenci, Riccardo; Charles, Matthew; Charpentier, Philippe; Chefdeville, Maximilien; Chen, Shanzhen; Cheung, Shu-Faye; Chiapolini, Nicola; Chrzaszcz, Marcin; Cid Vidal, Xabier; Ciezarek, Gregory; Clarke, Peter; Clemencic, Marco; Cliff, Harry; Closier, Joel; Coco, Victor; Cogan, Julien; Cogneras, Eric; Cogoni, Violetta; Cojocariu, Lucian; Collazuol, Gianmaria; Collins, Paula; Comerma-Montells, Albert; Contu, Andrea; Cook, Andrew; Coombes, Matthew; Coquereau, Samuel; Corti, Gloria; Corvo, Marco; Couturier, Benjamin; Cowan, Greig; Craik, Daniel Charles; Crocombe, Andrew; Cruz Torres, Melissa Maria; Cunliffe, Samuel; Currie, Robert; D'Ambrosio, Carmelo; Dalseno, Jeremy; David, Pieter; Davis, Adam; De Bruyn, Kristof; De Capua, Stefano; De Cian, Michel; De Miranda, Jussara; De Paula, Leandro; De Silva, Weeraddana; De Simone, Patrizia; Dean, Cameron Thomas; Decamp, Daniel; Deckenhoff, Mirko; Del Buono, Luigi; Déléage, Nicolas; Derkach, Denis; Deschamps, Olivier; Dettori, Francesco; Dey, Biplab; Di Canto, Angelo; Di Ruscio, Francesco; Dijkstra, Hans; Donleavy, Stephanie; Dordei, Francesca; Dorigo, Mirco; Dosil Suárez, Alvaro; Dossett, David; Dovbnya, Anatoliy; Dreimanis, Karlis; Dufour, Laurent; Dujany, Giulio; Dupertuis, Frederic; Durante, Paolo; Dzhelyadin, Rustem; Dziurda, Agnieszka; Dzyuba, Alexey; Easo, Sajan; Egede, Ulrik; Egorychev, Victor; Eidelman, Semen; Eisenhardt, Stephan; Eitschberger, Ulrich; Ekelhof, Robert; Eklund, Lars; El Rifai, Ibrahim; Elsasser, Christian; Ely, Scott; Esen, Sevda; Evans, Hannah Mary; Evans, Timothy; Falabella, Antonio; Färber, Christian; Farinelli, Chiara; Farley, Nathanael; Farry, Stephen; Fay, Robert; Ferguson, Dianne; Fernandez Albor, Victor; Ferrari, Fabio; Ferreira Rodrigues, Fernando; Ferro-Luzzi, Massimiliano; Filippov, Sergey; Fiore, Marco; Fiorini, Massimiliano; Firlej, Miroslaw; Fitzpatrick, Conor; Fiutowski, Tomasz; Fol, Philip; Fontana, Marianna; Fontanelli, Flavio; Forty, Roger; Francisco, Oscar; Frank, Markus; Frei, Christoph; Frosini, Maddalena; Fu, Jinlin; Furfaro, Emiliano; Gallas Torreira, Abraham; Galli, Domenico; Gallorini, Stefano; Gambetta, Silvia; Gandelman, Miriam; Gandini, Paolo; Gao, Yuanning; García Pardiñas, Julián; Garofoli, Justin; Garra Tico, Jordi; Garrido, Lluis; Gascon, David; Gaspar, Clara; Gastaldi, Ugo; Gauld, Rhorry; Gavardi, Laura; Gazzoni, Giulio; Geraci, Angelo; Gerick, David; Gersabeck, Evelina; Gersabeck, Marco; Gershon, Timothy; Ghez, Philippe; Gianelle, Alessio; Gianì, Sebastiana; Gibson, Valerie; Giubega, Lavinia-Helena; Gligorov, V.V.; Göbel, Carla; Golubkov, Dmitry; Golutvin, Andrey; Gomes, Alvaro; Gotti, Claudio; Grabalosa Gándara, Marc; Graciani Diaz, Ricardo; Granado Cardoso, Luis Alberto; Graugés, Eugeni; Graverini, Elena; Graziani, Giacomo; Grecu, Alexandru; Greening, Edward; Gregson, Sam; Griffith, Peter; Grillo, Lucia; Grünberg, Oliver; Gui, Bin; Gushchin, Evgeny; Guz, Yury; Gys, Thierry; Hadjivasiliou, Christos; Haefeli, Guido; Haen, Christophe; Haines, Susan; Hall, Samuel; Hamilton, Brian; Hampson, Thomas; Han, Xiaoxue; Hansmann-Menzemer, Stephanie; Harnew, Neville; Harnew, Samuel; Harrison, Jonathan; He, Jibo; Head, Timothy; Heijne, Veerle; Hennessy, Karol; Henrard, Pierre; Henry, Louis; Hernando Morata, Jose Angel; van Herwijnen, Eric; Heß, Miriam; Hicheur, Adlène; Hill, Donal; Hoballah, Mostafa; Hombach, Christoph; Hulsbergen, Wouter; Humair, Thibaud; Hussain, Nazim; Hutchcroft, David; Hynds, Daniel; Idzik, Marek; Ilten, Philip; Jacobsson, Richard; Jaeger, Andreas; Jalocha, Pawel; Jans, Eddy; Jawahery, Abolhassan; Jing, Fanfan; John, Malcolm; Johnson, Daniel; Jones, Christopher; Joram, Christian; Jost, Beat; Jurik, Nathan; Kandybei, Sergii; Kanso, Walaa; Karacson, Matthias; Karbach, Moritz; Karodia, Sarah; Kelsey, Matthew; Kenyon, Ian; Kenzie, Matthew; Ketel, Tjeerd; Khanji, Basem; Khurewathanakul, Chitsanu; Klaver, Suzanne; Klimaszewski, Konrad; Kochebina, Olga; Kolpin, Michael; Komarov, Ilya; Koopman, Rose; Koppenburg, Patrick; Korolev, Mikhail; Kravchuk, Leonid; Kreplin, Katharina; Kreps, Michal; Krocker, Georg; Krokovny, Pavel; Kruse, Florian; Kucewicz, Wojciech; Kucharczyk, Marcin; Kudryavtsev, Vasily; Kurek, Krzysztof; Kvaratskheliya, Tengiz; La Thi, Viet Nga; Lacarrere, Daniel; Lafferty, George; Lai, Adriano; Lambert, Dean; Lambert, Robert W; Lanfranchi, Gaia; Langenbruch, Christoph; Langhans, Benedikt; Latham, Thomas; Lazzeroni, Cristina; Le Gac, Renaud; van Leerdam, Jeroen; Lees, Jean-Pierre; Lefèvre, Regis; Leflat, Alexander; Lefrançois, Jacques; Leroy, Olivier; Lesiak, Tadeusz; Leverington, Blake; Li, Yiming; Likhomanenko, Tatiana; Liles, Myfanwy; Lindner, Rolf; Linn, Christian; Lionetto, Federica; Liu, Bo; Lohn, Stefan; Longstaff, Iain; Lopes, Jose; Lowdon, Peter; Lucchesi, Donatella; Luo, Haofei; Lupato, Anna; Luppi, Eleonora; Lupton, Oliver; Machefert, Frederic; Maciuc, Florin; Maev, Oleg; Maguire, Kevin; Malde, Sneha; Malinin, Alexander; Manca, Giulia; Mancinelli, Giampiero; Manning, Peter Michael; Mapelli, Alessandro; Maratas, Jan; Marchand, Jean François; Marconi, Umberto; Marin Benito, Carla; Marino, Pietro; Märki, Raphael; Marks, Jörg; Martellotti, Giuseppe; Martinelli, Maurizio; Martinez Santos, Diego; Martinez Vidal, Fernando; Martins Tostes, Danielle; Massafferri, André; Matev, Rosen; Mathad, Abhijit; Mathe, Zoltan; Matteuzzi, Clara; Mauri, Andrea; Maurin, Brice; Mazurov, Alexander; McCann, Michael; McCarthy, James; McNab, Andrew; McNulty, Ronan; Meadows, Brian; Meier, Frank; Meissner, Marco; Merk, Marcel; Milanes, Diego Alejandro; Minard, Marie-Noelle; Mitzel, Dominik Stefan; Molina Rodriguez, Josue; Monteil, Stephane; Morandin, Mauro; Morawski, Piotr; Mordà, Alessandro; Morello, Michael Joseph; Moron, Jakub; Morris, Adam Benjamin; Mountain, Raymond; Muheim, Franz; Müller, Janine; Müller, Katharina; Müller, Vanessa; Mussini, Manuel; Muster, Bastien; Naik, Paras; Nakada, Tatsuya; Nandakumar, Raja; Nasteva, Irina; Needham, Matthew; Neri, Nicola; Neubert, Sebastian; Neufeld, Niko; Neuner, Max; Nguyen, Anh Duc; Nguyen, Thi-Dung; Nguyen-Mau, Chung; Niess, Valentin; Niet, Ramon; Nikitin, Nikolay; Nikodem, Thomas; Ninci, Daniele; Novoselov, Alexey; O'Hanlon, Daniel Patrick; Oblakowska-Mucha, Agnieszka; Obraztsov, Vladimir; Ogilvy, Stephen; Okhrimenko, Oleksandr; Oldeman, Rudolf; Onderwater, Gerco; Osorio Rodrigues, Bruno; Otalora Goicochea, Juan Martin; Otto, Adam; Owen, Patrick; Oyanguren, Maria Aranzazu; Palano, Antimo; Palombo, Fernando; Palutan, Matteo; Panman, Jacob; Papanestis, Antonios; Pappagallo, Marco; Pappalardo, Luciano; Parkes, Christopher; Passaleva, Giovanni; Patel, Girish; Patel, Mitesh; Patrignani, Claudia; Pearce, Alex; Pellegrino, Antonio; Penso, Gianni; Pepe Altarelli, Monica; Perazzini, Stefano; Perret, Pascal; Pescatore, Luca; Petridis, Konstantinos; Petrolini, Alessandro; Petruzzo, Marco; Picatoste Olloqui, Eduardo; Pietrzyk, Boleslaw; Pilař, Tomas; Pinci, Davide; Pistone, Alessandro; Playfer, Stephen; Plo Casasus, Maximo; Poikela, Tuomas; Polci, Francesco; Poluektov, Anton; Polyakov, Ivan; Polycarpo, Erica; Popov, Alexander; Popov, Dmitry; Popovici, Bogdan; Potterat, Cédric; Price, Eugenia; Price, Joseph David; Prisciandaro, Jessica; Pritchard, Adrian; Prouve, Claire; Pugatch, Valery; Puig Navarro, Albert; Punzi, Giovanni; Qian, Wenbin; Quagliani, Renato; Rachwal, Bartolomiej; Rademacker, Jonas; Rakotomiaramanana, Barinjaka; Rama, Matteo; Rangel, Murilo; Raniuk, Iurii; Rauschmayr, Nathalie; Raven, Gerhard; Redi, Federico; Reichert, Stefanie; Reid, Matthew; dos Reis, Alberto; Ricciardi, Stefania; Richards, Sophie; Rihl, Mariana; Rinnert, Kurt; Rives Molina, Vincente; Robbe, Patrick; Rodrigues, Ana Barbara; Rodrigues, Eduardo; Rodriguez Lopez, Jairo Alexis; Rodriguez Perez, Pablo; Roiser, Stefan; Romanovsky, Vladimir; Romero Vidal, Antonio; Rotondo, Marcello; Rouvinet, Julien; Ruf, Thomas; Ruiz, Hugo; Ruiz Valls, Pablo; Saborido Silva, Juan Jose; Sagidova, Naylya; Sail, Paul; Saitta, Biagio; Salustino Guimaraes, Valdir; Sanchez Mayordomo, Carlos; Sanmartin Sedes, Brais; Santacesaria, Roberta; Santamarina Rios, Cibran; Santimaria, Marco; Santovetti, Emanuele; Sarti, Alessio; Satriano, Celestina; Satta, Alessia; Saunders, Daniel Martin; Savrina, Darya; Schiller, Manuel; Schindler, Heinrich; Schlupp, Maximilian; Schmelling, Michael; Schmelzer, Timon; Schmidt, Burkhard; Schneider, Olivier; Schopper, Andreas; Schune, Marie Helene; Schwemmer, Rainer; Sciascia, Barbara; Sciubba, Adalberto; Semennikov, Alexander; Sepp, Indrek; Serra, Nicola; Serrano, Justine; Sestini, Lorenzo; Seyfert, Paul; Shapkin, Mikhail; Shapoval, Illya; Shcheglov, Yury; Shears, Tara; Shekhtman, Lev; Shevchenko, Vladimir; Shires, Alexander; Silva Coutinho, Rafael; Simi, Gabriele; Sirendi, Marek; Skidmore, Nicola; Skillicorn, Ian; Skwarnicki, Tomasz; Smith, Edmund; Smith, Eluned; Smith, Jackson; Smith, Mark; Snoek, Hella; Sokoloff, Michael; Soler, Paul; Soomro, Fatima; Souza, Daniel; Souza De Paula, Bruno; Spaan, Bernhard; Spradlin, Patrick; Sridharan, Srikanth; Stagni, Federico; Stahl, Marian; Stahl, Sascha; Steinkamp, Olaf; Stenyakin, Oleg; Sterpka, Christopher Francis; Stevenson, Scott; Stoica, Sabin; Stone, Sheldon; Storaci, Barbara; Stracka, Simone; Straticiuc, Mihai; Straumann, Ulrich; Stroili, Roberto; Sun, Liang; Sutcliffe, William; Swientek, Krzysztof; Swientek, Stefan; Syropoulos, Vasileios; Szczekowski, Marek; Szczypka, Paul; Szumlak, Tomasz; T'Jampens, Stephane; Tekampe, Tobias; Teklishyn, Maksym; Tellarini, Giulia; Teubert, Frederic; Thomas, Christopher; Thomas, Eric; van Tilburg, Jeroen; Tisserand, Vincent; Tobin, Mark; Todd, Jacob; Tolk, Siim; Tomassetti, Luca; Tonelli, Diego; Topp-Joergensen, Stig; Torr, Nicholas; Tournefier, Edwige; Tourneur, Stephane; Trabelsi, Karim; Tran, Minh Tâm; Tresch, Marco; Trisovic, Ana; Tsaregorodtsev, Andrei; Tsopelas, Panagiotis; Tuning, Niels; Ukleja, Artur; Ustyuzhanin, Andrey; Uwer, Ulrich; Vacca, Claudia; Vagnoni, Vincenzo; Valenti, Giovanni; Vallier, Alexis; Vazquez Gomez, Ricardo; Vazquez Regueiro, Pablo; Vázquez Sierra, Carlos; Vecchi, Stefania; Velthuis, Jaap; Veltri, Michele; Veneziano, Giovanni; Vesterinen, Mika; Viaud, Benoit; Vieira, Daniel; Vieites Diaz, Maria; Vilasis-Cardona, Xavier; Vollhardt, Achim; Volyanskyy, Dmytro; Voong, David; Vorobyev, Alexey; Vorobyev, Vitaly; Voß, Christian; de Vries, Jacco; Waldi, Roland; Wallace, Charlotte; Wallace, Ronan; Walsh, John; Wandernoth, Sebastian; Wang, Jianchun; Ward, David; Watson, Nigel; Websdale, David; Weiden, Andreas; Whitehead, Mark; Wiedner, Dirk; Wilkinson, Guy; Wilkinson, Michael; Williams, Mark Richard James; Williams, Matthew; Williams, Mike; Wilson, Fergus; Wimberley, Jack; Wishahi, Julian; Wislicki, Wojciech; Witek, Mariusz; Wormser, Guy; Wotton, Stephen; Wright, Simon; Wyllie, Kenneth; Xie, Yuehong; Xu, Zhirui; Yang, Zhenwei; Yuan, Xuhao; Yushchenko, Oleg; Zangoli, Maria; Zavertyaev, Mikhail; Zhang, Liming; Zhang, Yanxi; Zhelezov, Alexey; Zhokhov, Anatoly; Zhong, Liang

    2015-06-26

    An analysis of the decays of $B^\\mp \\rightarrow D K^\\mp$ and $B^\\mp \\rightarrow D \\pi^\\mp $ is presented in which the $D$ meson is reconstructed in the three-body final states $K^\\mp \\pi^\\pm \\pi^0$, $\\pi^+ \\pi^- \\pi^0$ and $K^+ K^- \\pi^0$. Using data from LHCb corresponding to an integrated luminosity of 3.0~fb$^{-1}$ of $pp$ collisions, measurements of several $CP$ observables are performed. First observations are obtained of the suppressed ADS decay $B^\\mp \\rightarrow [\\pi^\\mp K^\\pm \\pi^0]_D \\pi^\\mp$ and the quasi-GLW decay $B^\\mp \\rightarrow [K^+ K^- \\pi^0]_D \\pi^\\mp$. The results are interpreted in the context of the unitarity triangle angle $\\gamma$ and related parameters.

  16. Antibiosis in Soybean Genotypes and the Resistance Levels to Spodoptera eridania (Cramer) (Lepidoptera: Noctuidae).

    Science.gov (United States)

    Souza, B H S; Silva, A G; Janini, J C; Boica Júnior, A L

    2014-12-01

    The southern armyworm (SAW) Spodoptera eridania (Cramer) is one of the most common armyworm species defoliating soybeans. Preliminary screening trials have indicated that some soybean genotypes exhibit resistance to SAW. Therefore, in this study, we evaluated the development of SAW larvae fed on ten soybean genotypes in order to identify genotypes with antibiosis-type resistance. Neonate SAW larvae were daily fed with young leaves collected from plants at the vegetative growth stages V4-V5. Larval development and survival were recorded. Genotypes PI 227687 and PI 227682 delayed larval, pupal, and larva-adult development and yielded larvae with the lowest weight and survival and pupae with the lowest weight. Genotypes IAC 100 and DM 339 also negatively affected larval and pupal development and larval survival but at a lower level. Based on our results, the soybean lines PI 227687 and PI 227682 could be used as sources of genes for soybean breeding programs aiming to develop high yield, SAW-resistant cultivars. Moreover, further trials must be carried out under field conditions to validate if the commercial cultivars IAC 100 and DM 339, which expressed moderate levels of antibiosis-type resistance in the laboratory, are effective in suppressing SAW larvae populations.

  17. Molecular characterization of the CRa gene conferring clubroot resistance in Brassica rapa.

    Science.gov (United States)

    Ueno, Hiroki; Matsumoto, Etsuo; Aruga, Daisuke; Kitagawa, Satoshi; Matsumura, Hideo; Hayashida, Nobuaki

    2012-12-01

    Clubroot disease is one of the major diseases affecting Brassicaceae crops, and a number of these crops grown commercially, such as Chinese cabbage (Brassica rapa L. ssp. pekinensis), are known to be highly susceptible to clubroot disease. To provide protection from this disease, plant breeders have introduced genes for resistance to clubroot from the European turnip into susceptible lines. The CRa gene confers specific resistance to the clubroot pathogen Plasmodiophora brassicae isolate M85. Fine mapping of the CRa locus using synteny to the Arabidopsis thaliana genome and partial genome sequences of B. rapa revealed a candidate gene encoding a TIR-NBS-LRR protein. Several structural differences in this candidate gene were found between susceptible and resistant lines, and CRa expression was observed only in the resistant line. Four mutant lines lacking clubroot resistance were obtained by the UV irradiation of pollen from a resistant line, and all of these mutant lines carried independent mutations in the candidate TIR-NBS-LRR gene. This genetic and molecular evidence strongly suggests that the identified gene is CRa. This is the first report on the molecular characterization of a clubroot Resistance gene in Brassicaceae and of the disease resistance gene in B. rapa.

  18. Analysis of physiological and miRNA responses to Pi deficiency in alfalfa (Medicago sativa L.).

    Science.gov (United States)

    Li, Zhenyi; Xu, Hongyu; Li, Yue; Wan, Xiufu; Ma, Zhao; Cao, Jing; Li, Zhensong; He, Feng; Wang, Yufei; Wan, Liqiang; Tong, Zongyong; Li, Xianglin

    2018-03-01

    The induction of miR399 and miR398 and the inhibition of miR156, miR159, miR160, miR171, miR2111, and miR2643 were observed under Pi deficiency in alfalfa. The miRNA-mediated genes involved in basic metabolic process, root and shoot development, stress response and Pi uptake. Inorganic phosphate (Pi) deficiency is known to be a limiting factor in plant development and growth. However, the underlying miRNAs associated with the Pi deficiency-responsive mechanism in alfalfa are unclear. To elucidate the molecular mechanism at the miRNA level, we constructed four small RNA (sRNA) libraries from the roots and shoots of alfalfa grown under normal or Pi-deficient conditions. In the present study, alfalfa plants showed reductions in biomass, photosynthesis, and Pi content and increases in their root-to-shoot ratio and citric, malic, and succinic acid contents under Pi limitation. Sequencing results identified 47 and 44 differentially expressed miRNAs in the roots and shoots, respectively. Furthermore, 909 potential target genes were predicted, and some targets were validated by RLM-RACE assays. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses showed prominent enrichment in signal transducer activity, binding and basic metabolic pathways for carbohydrates, fatty acids and amino acids; cellular response to hormone stimulus and response to auxin pathways were also enriched. qPCR results verified that the differentially expressed miRNA profile was consistent with sequencing results, and putative target genes exhibited opposite expression patterns. In this study, the miRNAs associated with the response to Pi limitation in alfalfa were identified. In addition, there was an enrichment of miRNA-targeted genes involved in biological regulatory processes such as basic metabolic pathways, root and shoot development, stress response, Pi transportation and citric acid secretion.

  19. First observation of decay $B_c^+\\to J/\\psi \\pi^+\\pi^-\\pi^+$

    CERN Document Server

    Aaij, R; Adeva, B; Adinolfi, M; Adrover, C; Affolder, A; Ajaltouni, Z; Albrecht, J; Alessio, F; Alexander, M; Ali, S; Alkhazov, G; Alvarez Cartelle, P; Alves Jr, A A; Amato, S; Amhis, Y; Anderson, J; Appleby, R B; Aquines Gutierrez, O; Archilli, F; Artamonov, A; Artuso, M; Aslanides, E; Auriemma, G; Bachmann, S; Back, J J; Balagura, V; Baldini, W; Barlow, R J; Barschel, C; Barsuk, S; Barter, W; Bates, A; Bauer, C; Bauer, Th; Bay, A; Bediaga, I; Belogurov, S; Belous, K; Belyaev, I; Ben-Haim, E; Benayoun, M; Bencivenni, G; Benson, S; Benton, J; Bernet, R; Bettler, M-O; van Beuzekom, M; Bien, A; Bifani, S; Bird, T; Bizzeti, A; Bjørnstad, P M; Blake, T; Blanc, F; Blanks, C; Blouw, J; Blusk, S; Bobrov, A; Bocci, V; Bondar, A; Bondar, N; Bonivento, W; Borghi, S; Borgia, A; Bowcock, T J V; Bozzi, C; Brambach, T; van den Brand, J; Bressieux, J; Brett, D; Britsch, M; Britton, T; Brook, N H; Brown, H; Büchler-Germann, A; Burducea, I; Bursche, A; Buytaert, J; Cadeddu, S; Callot, O; Calvi, M; Calvo Gomez, M; Camboni, A; Campana, P; Carbone, A; Carboni, G; Cardinale, R; Cardini, A; Carson, L; Carvalho Akiba, K; Casse, G; Cattaneo, M; Cauet, Ch; Charles, M; Charpentier, Ph; Chiapolini, N; Ciba, K; Cid Vidal, X; Ciezarek, G; Clarke, P E L; Clemencic, M; Cliff, H V; Closier, J; Coca, C; Coco, V; Cogan, J; Collins, P; Comerma-Montells, A; Contu, A; Cook, A; Coombes, M; Corti, G; Couturier, B; Cowan, G A; Currie, R; D'Ambrosio, C; David, P; David, P N Y; De Bonis, I; De Bruyn, K; De Capua, S; De Cian, M; De Miranda, J M; De Paula, L; De Simone, P; Decamp, D; Deckenhoff, M; Degaudenzi, H; Del Buono, L; Deplano, C; Derkach, D; Deschamps, O; Dettori, F; Dickens, J; Dijkstra, H; Diniz Batista, P; Domingo Bonal, F; Donleavy, S; Dordei, F; Dosil Suárez, A; Dossett, D; Dovbnya, A; Dupertuis, F; Dzhelyadin, R; Dziurda, A; Easo, S; Egede, U; Egorychev, V; Eidelman, S; van Eijk, D; Eisele, F; Eisenhardt, S; Ekelhof, R; Eklund, L; Elsasser, Ch; Elsby, D; Esperante Pereira, D; Falabella, A; Färber, C; Fardell, G; Farinelli, C; Farry, S; Fave, V; Fernandez Albor, V; Ferro-Luzzi, M; Filippov, S; Fitzpatrick, C; Fontana, M; Fontanelli, F; Forty, R; Francisco, O; Frank, M; Frei, C; Frosini, M; Furcas, S; Gallas Torreira, A; Galli, D; Gandelman, M; Gandini, P; Gao, Y; Garnier, J-C; Garofoli, J; Garra Tico, J; Garrido, L; Gascon, D; Gaspar, C; Gauld, R; Gauvin, N; Gersabeck, M; Gershon, T; Ghez, Ph; Gibson, V; Gligorov, V V; Göbel, C; Golubkov, D; Golutvin, A; Gomes, A; Gordon, H; Grabalosa Gándara, M; Graciani Diaz, R; Granado Cardoso, L A; Graugés, E; Graziani, G; Grecu, A; Greening, E; Gregson, S; Gui, B; Gushchin, E; Guz, Yu; Gys, T; Hadjivasiliou, C; Haefeli, G; Haen, C; Haines, S C; Hampson, T; Hansmann-Menzemer, S; Harji, R; Harnew, N; Harrison, J; Harrison, P F; Hartmann, T; He, J; Heijne, V; Hennessy, K; Henrard, P; Hernando Morata, J A; van Herwijnen, E; Hicks, E; Holubyev, K; Hopchev, P; Hulsbergen, W; Hunt, P; Huse, T; Huston, R S; Hutchcroft, D; Hynds, D; Iakovenko, V; Ilten, P; Imong, J; Jacobsson, R; Jaeger, A; Jahjah Hussein, M; Jans, E; Jansen, F; Jaton, P; Jean-Marie, B; Jing, F; John, M; Johnson, D; Jones, C R; Jost, B; Kaballo, M; Kandybei, S; Karacson, M; Karbach, T M; Keaveney, J; Kenyon, I R; Kerzel, U; Ketel, T; Keune, A; Khanji, B; Kim, Y M; Knecht, M; Koopman, R F; Koppenburg, P; Korolev, M; Kozlinskiy, A; Kravchuk, L; Kreplin, K; Kreps, M; Krocker, G; Krokovny, P; Kruse, F; Kruzelecki, K; Kucharczyk, M; Kudryavtsev, V; Kvaratskheliya, T; La Thi, V N; Lacarrere, D; Lafferty, G; Lai, A; Lambert, D; Lambert, R W; Lanciotti, E; Lanfranchi, G; Langenbruch, C; Latham, T; Lazzeroni, C; Le Gac, R; van Leerdam, J; Lees, J-P; Lefèvre, R; Leflat, A; Lefrançois, J; Leroy, O; Lesiak, T; Li, L; Li Gioi, L; Lieng, M; Liles, M; Lindner, R; Linn, C; Liu, B; Liu, G; von Loeben, J; Lopes, J H; Lopez Asamar, E; Lopez-March, N; Lu, H; Luisier, J; Mac Raighne, A; Machefert, F; Machikhiliyan, I V; Maciuc, F; Maev, O; Magnin, J; Malde, S; Mamunur, R M D; Manca, G; Mancinelli, G; Mangiafave, N; Marconi, U; Märki, R; Marks, J; Martellotti, G; Martens, A; Martin, L; Martín Sánchez, A; Martinelli, M; Martinez Santos, D; Massafferri, A; Mathe, Z; Matteuzzi, C; Matveev, M; Maurice, E; Maynard, B; Mazurov, A; McGregor, G; McNulty, R; Meissner, M; Merk, M; Merkel, J; Miglioranzi, S; Milanes, D A; Minard, M-N; Molina Rodriguez, J; Monteil, S; Moran, D; Morawski, P; Mountain, R; Mous, I; Muheim, F; Müller, K; Muresan, R; Muryn, B; Muster, B; Mylroie-Smith, J; Naik, P; Nakada, T; Nandakumar, R; Nasteva, I; Needham, M; Neufeld, N; Nguyen, A D; Nguyen-Mau, C; Nicol, M; Niess, V; Nikitin, N; Nikodem, T; Nomerotski, A; Novoselov, A; Oblakowska-Mucha, A; Obraztsov, V; Oggero, S; Ogilvy, S; Okhrimenko, O; Oldeman, R; Orlandea, M; Otalora Goicochea, J M; Owen, P; Pal, B K; Palacios, J; Palano, A; Palutan, M; Panman, J; Papanestis, A; Pappagallo, M; Parkes, C; Parkinson, C J; Passaleva, G; Patel, G D; Patel, M; Paterson, S K; Patrick, G N; Patrignani, C; Pavel-Nicorescu, C; Pazos Alvarez, A; Pellegrino, A; Penso, G; Pepe Altarelli, M; Perazzini, S; Perego, D L; Perez Trigo, E; Pérez-Calero Yzquierdo, A; Perret, P; Perrin-Terrin, M; Pessina, G; Petrolini, A; Phan, A; Picatoste Olloqui, E; Pie Valls, B; Pietrzyk, B; Pilař, T; Pinci, D; Plackett, R; Playfer, S; Plo Casasus, M; Polok, G; Poluektov, A; Polycarpo, E; Popov, D; Popovici, B; Potterat, C; Powell, A; Prisciandaro, J; Pugatch, V; Puig Navarro, A; Qian, W; Rademacker, J H; Rakotomiaramanana, B; Rangel, M S; Raniuk, I; Raven, G; Redford, S; Reid, M M; dos Reis, A C; Ricciardi, S; Richards, A; Rinnert, K; Roa Romero, D A; Robbe, P; Rodrigues, E; Rodrigues, F; Rodriguez Perez, P; Rogers, G J; Roiser, S; Romanovsky, V; Rosello, M; Rouvinet, J; Ruf, T; Ruiz, H; Sabatino, G; Saborido Silva, J J; Sagidova, N; Sail, P; Saitta, B; Salzmann, C; Sannino, M; Santacesaria, R; Santamarina Rios, C; Santinelli, R; Santovetti, E; Sapunov, M; Sarti, A; Satriano, C; Satta, A; Savrie, M; Savrina, D; Schaack, P; Schiller, M; Schindler, H; Schleich, S; Schlupp, M; Schmelling, M; Schmidt, B; Schneider, O; Schopper, A; Schune, M-H; Schwemmer, R; Sciascia, B; Sciubba, A; Seco, M; Semennikov, A; Senderowska, K; Sepp, I; Serra, N; Serrano, J; Seyfert, P; Shapkin, M; Shapoval, I; Shatalov, P; Shcheglov, Y; Shears, T; Shekhtman, L; Shevchenko, O; Shevchenko, V; Shires, A; Silva Coutinho, R; Skwarnicki, T; Smith, N A; Smith, E; Sobczak, K; Soler, F J P; Solomin, A; Soomro, F; Souza De Paula, B; Spaan, B; Sparkes, A; Spradlin, P; Stagni, F; Stahl, S; Steinkamp, O; Stoica, S; Stone, S; Storaci, B; Straticiuc, M; Straumann, U; Subbiah, V K; Swientek, S; Szczekowski, M; Szczypka, P; Szumlak, T; T'Jampens, S; Teodorescu, E; Teubert, F; Thomas, C; Thomas, E; van Tilburg, J; Tisserand, V; Tobin, M; Tolk, S; Topp-Joergensen, S; Torr, N; Tournefier, E; Tourneur, S; Tran, M T; Tsaregorodtsev, A; Tuning, N; Ubeda Garcia, M; Ukleja, A; Uwer, U; Vagnoni, V; Valenti, G; Vazquez Gomez, R; Vazquez Regueiro, P; Vecchi, S; Velthuis, J J; Veltri, M; Viaud, B; Videau, I; Vieira, D; Vilasis-Cardona, X; Visniakov, J; Vollhardt, A; Volyanskyy, D; Voong, D; Vorobyev, A; Vorobyev, V; Voss, H; Waldi, R; Wandernoth, S; Wang, J; Ward, D R; Watson, N K; Webber, A D; Websdale, D; Whitehead, M; Wiedner, D; Wiggers, L; Wilkinson, G; Williams, M P; Williams, M; Wilson, F F; Wishahi, J; Witek, M; Witzeling, W; Wotton, S A; Wyllie, K; Xie, Y; Xing, F; Xing, Z; Yang, Z; Young, R; Yushchenko, O; Zangoli, M; Zavertyaev, M; Zhang, F; Zhang, L; Zhang, W C; Zhang, Y; Zhelezov, A; Zhong, L; Zvyagin, A

    2012-01-01

    The decay $B_c^+\\to J/\\psi \\pi^+\\pi^-\\pi^+$ is observed for the first time, using 0.8 fb$^{-1}$ of $pp$ collisions at $\\sqrt{s}=7$ TeV collected by the LHCb experiment. The ratio of branching fractions ${\\cal B}(B_c^+\\to J/\\psi \\pi^+\\pi^-\\pi^+)/{\\cal B}(B_c^+\\to J/\\psi \\pi^+)$ is measured to be $2.41\\pm0.30\\pm0.33$, where the first uncertainty is statistical and the second systematic. The result is in agreement with theoretical predictions.

  20. Staphylococcus aureus nasal carriage in Ukraine: antibacterial resistance and virulence factor encoding genes.

    Science.gov (United States)

    Netsvyetayeva, Irina; Fraczek, Mariusz; Piskorska, Katarzyna; Golas, Marlena; Sikora, Magdalena; Mlynarczyk, Andrzej; Swoboda-Kopec, Ewa; Marusza, Wojciech; Palmieri, Beniamino; Iannitti, Tommaso

    2014-03-05

    The number of studies regarding the incidence of multidrug resistant strains and distribution of genes encoding virulence factors, which have colonized the post-Soviet states, is considerably limited. The aim of the study was (1) to assess the Staphylococcus (S.) aureus nasal carriage rate, including Methicillin Resistant S. aureus (MRSA) strains in adult Ukrainian population, (2) to determine antibiotic resistant pattern and (3) the occurrence of Panton Valentine Leukocidine (PVL)-, Fibronectin-Binding Protein A (FnBPA)- and Exfoliative Toxin (ET)-encoding genes. Nasal samples for S. aureus culture were obtained from 245 adults. The susceptibility pattern for several classes of antibiotics was determined by disk diffusion method according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines. The virulence factor encoding genes, mecA, lukS-lukF, eta, etb, etd, fnbA, were detected by Polymerase Chain Reaction (PCR). The S. aureus nasal carriage rate was 40%. The prevalence of nasal MRSA carriage in adults was 3.7%. LukS-lukF genes were detected in over 58% of the strains. ET-encoding genes were detected in over 39% of the strains and the most prevalent was etd. The fnbA gene was detected in over 59% of the strains. All MRSA isolates tested were positive for the mecA gene. LukS-lukF genes and the etd gene were commonly co-present in MRSA, while lukS-lukF genes and the fnbA gene were commonly co-present in Methicillin Sensitive S. aureus (MSSA) isolates. No significant difference was detected between the occurrence of lukS-lukF genes (P > 0.05) and the etd gene (P > 0.05) when comparing MRSA and MSSA. The occurrence of the fnbA gene was significantly more frequent in MSSA strains (P aureus is a common cause of infection. The prevalence of S. aureus nasal carriage in our cohort of patients from Ukraine was 40.4%. We found that 9.1% of the strains were classified as MRSA and all MRSA isolates tested positive for the mecA gene

  1. LHC as {pi}p and {pi}{pi} collider

    Energy Technology Data Exchange (ETDEWEB)

    Petrov, V.A.; Ryutin, R.A.; Sobol, A.E. [Institute for High Energy Physics, Protvino (Russian Federation)

    2010-02-15

    We propose an experiment at the LHC with leading neutron production. The latter can be used to extract from it the total {pi}{sup +} p cross-sections. With two leading neutrons we can get access to the total {pi}{sup +}{pi}{sup +} cross-sections. In this note we give some estimates and discuss related problems and prospects. (orig.)

  2. Antibiotic resistance genes in anaerobic bacteria isolated from primary dental root canal infections.

    Science.gov (United States)

    Rôças, Isabela N; Siqueira, José F

    2012-12-01

    Fourty-one bacterial strains isolated from infected dental root canals and identified by 16S rRNA gene sequence were screened for the presence of 14 genes encoding resistance to beta-lactams, tetracycline and macrolides. Thirteen isolates (32%) were positive for at least one of the target antibiotic resistance genes. These strains carrying at least one antibiotic resistance gene belonged to 11 of the 26 (42%) infected root canals sampled. Two of these positive cases had two strains carrying resistance genes. Six out of 7 Fusobacterium strains harbored at least one of the target resistance genes. One Dialister invisus strain was positive for 3 resistance genes, and 4 other strains carried two of the target genes. Of the 6 antibiotic resistance genes detected in root canal strains, the most prevalent were blaTEM (17% of the strains), tetW (10%), and ermC (10%). Some as-yet-uncharacterized Fusobacterium and Prevotella isolates were positive for blaTEM, cfxA and tetM. Findings demonstrated that an unexpectedly large proportion of dental root canal isolates, including as-yet-uncharacterized strains previously regarded as uncultivated phylotypes, can carry antibiotic resistance genes. Copyright © 2012 Elsevier Ltd. All rights reserved.

  3. Sulfonamide-Resistant Bacteria and Their Resistance Genes in Soils Fertilized with Manures from Jiangsu Province, Southeastern China

    OpenAIRE

    Wang, Na; Yang, Xiaohong; Jiao, Shaojun; Zhang, Jun; Ye, Boping; Gao, Shixiang

    2014-01-01

    Antibiotic-resistant bacteria and genes are recognized as new environmental pollutants that warrant special concern. There were few reports on veterinary antibiotic-resistant bacteria and genes in China. This work systematically analyzed the prevalence and distribution of sulfonamide resistance genes in soils from the environments around poultry and livestock farms in Jiangsu Province, Southeastern China. The results showed that the animal manure application made the spread and abundance of a...

  4. Introgression and pyramiding into common bean market class fabada of genes conferring resistance to anthracnose and potyvirus.

    Science.gov (United States)

    Ferreira, Juan José; Campa, Ana; Pérez-Vega, Elena; Rodríguez-Suárez, Cristina; Giraldez, Ramón

    2012-03-01

    Anthracnose and bean common mosaic (BCM) are considered major diseases in common bean crop causing severe yield losses worldwide. This work describes the introgression and pyramiding of genes conferring genetic resistance to BCM and anthracnose local races into line A25, a bean genotype classified as market class fabada. Resistant plants were selected using resistance tests or combining resistance tests and marker-assisted selection. Lines A252, A321, A493, Sanilac BC6-Are, and BRB130 were used as resistance sources. Resistance genes to anthracnose (Co-2 ( C ), Co-2 ( A252 ) and Co-3/9) and/or BCM (I and bc-3) were introgressed in line A25 through six parallel backcrossing programs, and six breeding lines showing a fabada seed phenotype were obtained after six backcross generations: line A1258 from A252; A1231 from A321; A1220 from A493; A1183 and A1878 from Sanilac BC6-Are; and line A2418 from BRB130. Pyramiding of different genes were developed using the pedigree method from a single cross between lines obtained in the introgression step: line A1699 (derived from cross A1258 × A1220), A2438 (A1220 × A1183), A2806 (A1878 × A2418), and A3308 (A1699 × A2806). A characterization based on eight morpho-agronomic traits revealed a limited differentiation among the obtained breeding lines and the recurrent line A25. However, using a set of seven molecular markers linked to the loci used in the breeding programs it was possible to differentiate the 11 fabada lines. Considering the genetic control of the resistance in resistant donor lines, the observed segregations in the last backcrossing generation, the reaction against the pathogens, and the expression of the molecular markers it was also possible to infer the genotype conferring resistance in the ten fabada breeding lines obtained. As a result of these breeding programs, genetic resistance to three anthracnose races controlled by genes included in clusters Co-2 and Co-3/9, and genetic resistance to BCM controlled

  5. Rootstock-regulated gene expression patterns associated with fire blight resistance in apple

    Directory of Open Access Journals (Sweden)

    Jensen Philip J

    2012-01-01

    Full Text Available Abstract Background Desirable apple varieties are clonally propagated by grafting vegetative scions onto rootstocks. Rootstocks influence many phenotypic traits of the scion, including resistance to pathogens such as Erwinia amylovora, which causes fire blight, the most serious bacterial disease of apple. The purpose of the present study was to quantify rootstock-mediated differences in scion fire blight susceptibility and to identify transcripts in the scion whose expression levels correlated with this response. Results Rootstock influence on scion fire blight resistance was quantified by inoculating three-year old, orchard-grown apple trees, consisting of 'Gala' scions grafted to a range of rootstocks, with E. amylovora. Disease severity was measured by the extent of shoot necrosis over time. 'Gala' scions grafted to G.30 or MM.111 rootstocks showed the lowest rates of necrosis, while 'Gala' on M.27 and B.9 showed the highest rates of necrosis. 'Gala' scions on M.7, S.4 or M.9F56 had intermediate necrosis rates. Using an apple DNA microarray representing 55,230 unique transcripts, gene expression patterns were compared in healthy, un-inoculated, greenhouse-grown 'Gala' scions on the same series of rootstocks. We identified 690 transcripts whose steady-state expression levels correlated with the degree of fire blight susceptibility of the scion/rootstock combinations. Transcripts known to be differentially expressed during E. amylovora infection were disproportionately represented among these transcripts. A second-generation apple microarray representing 26,000 transcripts was developed and was used to test these correlations in an orchard-grown population of trees segregating for fire blight resistance. Of the 690 transcripts originally identified using the first-generation array, 39 had expression levels that correlated with fire blight resistance in the breeding population. Conclusions Rootstocks had significant effects on the fire blight

  6. Molecular detection of disease resistance genes to powdery mildew ...

    African Journals Online (AJOL)

    A study was conducted to detect the presence of disease resistance genes to infection of wheat powdery mildew (Blumeria graminis f. sp. tritici) in selected wheat cultivars from China using molecular markers. Genomic DNA of sixty cultivars was extracted and tested for the presence of selected prominent resistance genes to ...

  7. In vitro antiproliferative activity of 2,3-dihydroxy-9,10-anthraquinone induced apoptosis against COLO320 cells through cytochrome c release caspase mediated pathway with PI3K/AKT and COX-2 inhibition.

    Science.gov (United States)

    Balachandran, C; Emi, N; Arun, Y; Yamamoto, N; Duraipandiyan, V; Inaguma, Yoko; Okamoto, Akinao; Ignacimuthu, S; Al-Dhabi, N A; Perumal, P T

    2016-04-05

    The present study investigated the anticancer activity of 2,3-dihydroxy-9,10-anthraquinone against different cancer cells such as MCF-7, COLO320, HepG-2, Skov-3, MOLM-14, NB-4, CEM, K562, Jurkat, HL-60, U937, IM-9 and Vero. 2,3-dihydroxy-9,10-anthraquinone showed good antiproliferative activity against COLO320 cells when compared to other tested cells. The cytotoxicity results showed 79.8% activity at the dose of 2.07 μM with IC50 value of 0.13 μM at 24 h in COLO320 cells. So we chose COLO320 cells for further anticancer studies. mRNA expression was confirmed by qPCR analysis using SYBR green method. Treatment with 2,3-dihydroxy-9,10-anthraquinone was found to trigger intrinsic apoptotic pathway as indicated by down regulation of Bcl-2, Bcl-xl; up regulation of Bim, Bax, Bad; release of cytochrome c and pro-caspases cleaving to caspases. Furthermore, 2,3-dihydroxy-9,10-anthraquinone stopped at G0/G1 phase with modulation in protein levels of cyclins. On the other hand PI3K/AKT signaling plays an important role in cell metabolism. We found that 2,3-dihydroxy-9,10-anthraquinone inhibits PI3K/AKT activity after treatment. Also, COX-2 enzyme plays a major role in colorectal cancer. Our results showed that the treatment significantly reduced COX-2 enzyme in COLO320 cells. These results indicated antiproliferative activity of 2,3-dihydroxy-9,10-anthraquinone involving apoptotic pathways, mitochondrial functions, cell cycle checkpoint and controlling the over expression genes during the colorectal cancer. Molecular docking studies showed that the compound bound stably to the active sites of Bcl-2, COX-2, PI3K and AKT. This is the first report of anticancer mechanism involving 2,3-dihydroxy-9,10-anthraquinone in COLO320 cells. The present results might provide helpful suggestions for the design of antitumor drugs toward colorectal cancer treatment. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  8. Gene Expression Analysis of Four Radiation-resistant Bacteria

    OpenAIRE

    Gao, Na; Ma, Bin-Guang; Zhang, Yu-Sheng; Song, Qin; Chen, Ling-Ling; Zhang, Hong-Yu

    2009-01-01

    To investigate the general radiation-resistant mechanisms of bacteria, bioinformatic method was employed to predict highly expressed genes for four radiation-resistant bacteria, i.e. Deinococcus geothermalis (D. geo), Deinococcus radiodurans (D. rad), Kineococcus radiotolerans (K. rad) and Rubrobacter xylanophilus (R. xyl). It is revealed that most of the three reference gene sets, i.e. ribosomal proteins, transcription factors and major chaperones, are generally highly expressed in the four ...

  9. Prevalence and proliferation of antibiotic resistance genes in two municipal wastewater treatment plants.

    Science.gov (United States)

    Mao, Daqing; Yu, Shuai; Rysz, Michal; Luo, Yi; Yang, Fengxia; Li, Fengxiang; Hou, Jie; Mu, Quanhua; Alvarez, P J J

    2015-11-15

    The propagation of antibiotic resistance genes (ARGs) is an emerging health concern worldwide. Thus, it is important to understand and mitigate their occurrence in different systems. In this study, 30 ARGs that confer resistance to tetracyclines, sulfonamides, quinolones or macrolides were detected in two activated sludge wastewater treatment plants (WWTPs) in northern China. Bacteria harboring ARGs persisted through all treatment units, and survived disinfection by chlorination in greater percentages than total Bacteria (assessed by 16S rRNA genes). Although the absolute abundances of ARGs were reduced from the raw influent to the effluent by 89.0%-99.8%, considerable ARG levels [(1.0 ± 0.2) × 10(3) to (9.5 ± 1.8) × 10(5) copies/mL)] were found in WWTP effluent samples. ARGs were concentrated in the waste sludge (through settling of bacteria and sludge dewatering) at (1.5 ± 2.3) × 10(9) to (2.2 ± 2.8) × 10(11) copies/g dry weight. Twelve ARGs (tetA, tetB, tetE, tetG, tetH, tetS, tetT, tetX, sul1, sul2, qnrB, ermC) were discharged through the dewatered sludge and plant effluent at higher rates than influent values, indicating overall proliferation of resistant bacteria. Significant antibiotic concentrations (2%-50% of raw influent concentrations) remained throughout all treatment units. This apparently contributed selective pressure for ARG replication since the relative abundance of resistant bacteria (assessed by ARG/16S rRNA gene ratios) was significantly correlated to the corresponding effluent antibiotic concentrations. Similarly, the concentrations of various heavy metals (which induce a similar bacterial resistance mechanism as antibiotics - efflux pumps) were also correlated to the enrichment of some ARGs. Thus, curtailing the release of antibiotics and heavy metals to sewage systems (or enhancing their removal in pre-treatment units) may alleviate their selective pressure and mitigate ARG proliferation in WWTPs. Copyright © 2015 Elsevier Ltd. All

  10. Tagging of resistance gene(s) to rhizomania disease in sugar beet ...

    African Journals Online (AJOL)

    SERVER

    2008-02-19

    Feb 19, 2008 ... plasmodiophoride-like fungus, Polymyxa betae Keskin. (1964) (Tamada and Richard, 1992). Source of resistance to rhizomania were found in Holly sugar beet company source (Lewellen, 1987). Resistance in Holly is simply inherited by a single dominant gene(Rz1). (Lewellen et al., 1987; Scholten et al., ...

  11. Comparative genome analysis and resistance gene mapping in grain legumes

    International Nuclear Information System (INIS)

    Young, N.D.

    1998-01-01

    Using, DNA markers and genome organization, several important disease resistance genes have been analyzed in mungbean (Vigna radiata), cowpea (Vigna unguiculata), common bean (Phaseolus vulgaris), and soybean (Glycine max). In the process, medium-density linkage maps consisting of restriction fragment length polymorphism (RFLP) markers were constructed for both mungbean and cowpea. Comparisons between these maps, as well as the maps of soybean and common bean, indicate that there is significant conservation of DNA marker order, though the conserved blocks in soybean are much shorter than in the others. DNA mapping results also indicate that a gene for seed weight may be conserved between mungbean and cowpea. Using the linkage maps, genes that control bruchid (genus Callosobruchus) and powdery mildew (Erysiphe polygoni) resistance in mungbean, aphid resistance in cowpea (Aphis craccivora), and cyst nematode (Heterodera glycines) resistance in soybean have all been mapped and characterized. For some of these traits resistance was found to be oligogenic and DNA mapping uncovered multiple genes involved in the phenotype. (author)

  12. Prevalence, antibiotic-resistance properties and enterotoxin gene ...

    African Journals Online (AJOL)

    Prevalence, antibiotic-resistance properties and enterotoxin gene profile of Bacillus cereus strains isolated from milk-based baby foods. ... Conclusion: Considerable prevalence of resistant and toxigenic B. cereus and high consumption of milk-based infant foods in Iran, represent an important public health issue which ...

  13. Sensible interventions: Cultural resistance post-9/11

    NARCIS (Netherlands)

    Chao, J.

    2013-01-01

    'Sensible interventions: Cultural resistance post-9/11' is anchored in the September 11, 2001 terrorist attacks in America and their cultural legacies, most prominently in the forms of cultural resistance. By investigating a multimedia assemblage of creative objects - hip hop album, TV sit-com,

  14. Characterization of Antibiotic Resistance Genes from Lactobacillus Isolated from Traditional Dairy Products.

    Science.gov (United States)

    Guo, Huiling; Pan, Lin; Li, Lina; Lu, Jie; Kwok, Laiyu; Menghe, Bilige; Zhang, Heping; Zhang, Wenyi

    2017-03-01

    Lactobacilli are widely used as starter cultures or probiotics in yoghurt, cheese, beer, wine, pickles, preserved food, and silage. They are generally recognized as safe (GRAS). However, recent studies have shown that some lactic acid bacteria (LAB) strains carry antibiotic resistance genes and are resistant to antibiotics. Some of them may even transfer their intrinsic antibiotic resistance genes to other LAB or pathogens via horizontal gene transfer, thus threatening human health. A total of 33 Lactobacillus strains was isolated from fermented milk collected from different areas of China. We analyzed (1) their levels of antibiotic resistance using a standardized dilution method, (2) their antibiotic resistance gene profiles by polymerase chain reaction (PCR) using gene-specific primers, and (3) the transferability of some of the detected resistance markers by a filter mating assay. All Lactobacillus strains were found to be resistant to vancomycin, but susceptible to gentamicin, linezolid, neomycin, erythromycin, and clindamycin. Their susceptibilities to tetracycline, kanamycin, ciprofloxacin, streptomycin, quinupristin/dalfopristin, trimethoprim, ampicillin, rifampicin, and chloramphenicol was different. Results from our PCR analysis revealed 19 vancomycin, 10 ciprofloxacin, and 1 tetracycline-resistant bacteria that carried the van(X), van(E), gyr(A), and tet(M) genes, respectively. Finally, no transferal of the monitored antibiotic resistance genes was observed in the filter mating assay. Taken together, our study generated the antibiotic resistance profiles of some milk-originated lactobacilli isolates and preliminarily assessed their risk of transferring antibiotic gene to other bacteria. The study may provide important data concerning the safe use of LAB. © 2017 Institute of Food Technologists®.

  15. Identification of Gene Resistance to Avian InfluenzaVirus (Mx Gene among Wild Waterbirds

    Directory of Open Access Journals (Sweden)

    Dewi Elfidasari

    2013-04-01

    Full Text Available The Mx gene is an antiviral gene used to determine the resistance or the susceptibility to different types of viruses, including the Avian Influenza (AI virus subtype H5N1. The AI virus subtype H5N1 infection in chickens causes Mx gene polymorphism. The Mx+ gene shows resistant to the AIvirus subtype H5N1, whereas the Mx-gene shows signs of susceptible. The objective of thisresearch was to detect the Mxgene in wild aquatic birds using the Polymerase Chain Reaction Restriction Fragment Length Polymorphism (PCR-RFLP method with the primer pairs F2 and NE-R2/R and the RsaI restriction enzyme. DNA samples were obtained from eight species of wild waterbirds with positive and negative exposure to the AI virus subtype H5N1. DNA amplification results showed that the Mxgene in wild aquatic birds is found in a 100 bp fragment, which is the same as the Mx gene found in chickens. However, unlike chickens, the Mxgene in wild aquatic birds did not show any polymorphism. This study proves that Mx- based resistance to AI virus subtype H5N1 in different in wild birds than in chickens.

  16. Dissecting the organ specificity of insecticide resistance candidate genes in Anopheles gambiae: known and novel candidate genes.

    Science.gov (United States)

    Ingham, Victoria A; Jones, Christopher M; Pignatelli, Patricia; Balabanidou, Vasileia; Vontas, John; Wagstaff, Simon C; Moore, Jonathan D; Ranson, Hilary

    2014-11-25

    The elevated expression of enzymes with insecticide metabolism activity can lead to high levels of insecticide resistance in the malaria vector, Anopheles gambiae. In this study, adult female mosquitoes from an insecticide susceptible and resistant strain were dissected into four different body parts. RNA from each of these samples was used in microarray analysis to determine the enrichment patterns of the key detoxification gene families within the mosquito and to identify additional candidate insecticide resistance genes that may have been overlooked in previous experiments on whole organisms. A general enrichment in the transcription of genes from the four major detoxification gene families (carboxylesterases, glutathione transferases, UDP glucornyltransferases and cytochrome P450s) was observed in the midgut and malpighian tubules. Yet the subset of P450 genes that have previously been implicated in insecticide resistance in An gambiae, show a surprisingly varied profile of tissue enrichment, confirmed by qPCR and, for three candidates, by immunostaining. A stringent selection process was used to define a list of 105 genes that are significantly (p ≤0.001) over expressed in body parts from the resistant versus susceptible strain. Over half of these, including all the cytochrome P450s on this list, were identified in previous whole organism comparisons between the strains, but several new candidates were detected, notably from comparisons of the transcriptomes from dissected abdomen integuments. The use of RNA extracted from the whole organism to identify candidate insecticide resistance genes has a risk of missing candidates if key genes responsible for the phenotype have restricted expression within the body and/or are over expression only in certain tissues. However, as transcription of genes implicated in metabolic resistance to insecticides is not enriched in any one single organ, comparison of the transcriptome of individual dissected body parts cannot

  17. Backward omega /sup 0/ and eta /sup 0/ production in pi p interactions at 9 and 12 GeV/c

    CERN Document Server

    Benkheiri, P; D'Almagne, B; De Rosny, G; Eisenstein, B I; Ferrer, A; Fleury, P; Grossetête, B; Jacholkowski, A; Nguyen, H; Petroff, P; Richard, F; Rivet, P; Roudeau, P; Rougé, A; Six, J; Treille, D; Volte, A; Yiou, T P; Yoshida, H

    1979-01-01

    The backward production of omega /sup 0/ mesons in the u-channel I/sub u/=/sup 1///sub 2/ exchange reaction pi /sup -/p to N/sup 0/ (1680) omega /sup 0/ has been studied at 9 GeV/c and 12 GeV/c incident momenta. The data comes from an experiment performed at the CERN Omega Spectrometer using a fast proton trigger device. The backward production of the eta /sup 0/ meson has also been observed and the coupling constant ratio g/sub eta NN//g/sub pi NN/ has been estimated. (21 refs).

  18. Host range of antibiotic resistance genes in wastewater treatment plant influent and effluent.

    Science.gov (United States)

    Hultman, Jenni; Tamminen, Manu; Pärnänen, Katariina; Cairns, Johannes; Karkman, Antti; Virta, Marko

    2018-04-01

    Wastewater treatment plants (WWTPs) collect wastewater from various sources for a multi-step treatment process. By mixing a large variety of bacteria and promoting their proximity, WWTPs constitute potential hotspots for the emergence of antibiotic resistant bacteria. Concerns have been expressed regarding the potential of WWTPs to spread antibiotic resistance genes (ARGs) from environmental reservoirs to human pathogens. We utilized epicPCR (Emulsion, Paired Isolation and Concatenation PCR) to detect the bacterial hosts of ARGs in two WWTPs. We identified the host distribution of four resistance-associated genes (tetM, int1, qacEΔ1and blaOXA-58) in influent and effluent. The bacterial hosts of these resistance genes varied between the WWTP influent and effluent, with a generally decreasing host range in the effluent. Through 16S rRNA gene sequencing, it was determined that the resistance gene carrying bacteria include both abundant and rare taxa. Our results suggest that the studied WWTPs mostly succeed in decreasing the host range of the resistance genes during the treatment process. Still, there were instances where effluent contained resistance genes in bacterial groups not carrying these genes in the influent. By permitting exhaustive profiling of resistance-associated gene hosts in WWTP bacterial communities, the application of epicPCR provides a new level of precision to our resistance gene risk estimates.

  19. Isolation of NBS-LRR class resistant gene (I2 gene) from tomato ...

    African Journals Online (AJOL)

    aghomotsegin

    2013-10-16

    Oct 16, 2013 ... type of F. oxysporum f. sp. lycopersici observed commonly which require presence of I1 gene in tomato plant for the incompatibility ... Key words: Fusarium wilt, race, R-gene, resistance, tomato. ... MATERIALS AND METHODS.

  20. Prevalence of enterotoxin-encoding genes and antimicrobial resistance in coagulase-negative and coagulase-positive Staphylococcus isolates from black pudding

    Directory of Open Access Journals (Sweden)

    Tiane Martin de Moura

    2012-10-01

    Full Text Available INTRODUCTION: Staphylococcal species are pathogens that are responsible for outbreaks of foodborne diseases. The aim of this study was to investigate the prevalence of enterotoxin-genes and the antimicrobial resistance profile in staphylococcus coagulase-negative (CoNS and coagulasepositive (CoPS isolates from black pudding in southern Brazil. METHODS: Two hundred typical and atypical colonies from Baird-Parker agar were inoculated on mannitol salt agar. Eighty-two mannitol-positive staphylococci were submitted to conventional biochemical tests and antimicrobial susceptibility profiling. The presence of coagulase (coa and enterotoxin (se genes was investigated by polymerase chain reaction. RESULTS: The isolates were divided into 2 groups: 75.6% (62/82 were CoNS and 24.4% (20/82 were CoPS. The biochemical tests identified 9 species, of which Staphylococcus saprophyticus (37.8% and Staphylococcus carnosus (15.9% were the most prevalent. Antimicrobial susceptibility tests showed resistance phenotypes to antibiotics widely administered in humans, such as gentamicin, tetracycline, chloramphenicol, and erythromycin. The coa gene was detected in 19.5% (16/82 of the strains and 4 polymorphic DNA fragments were observed. Five CoNS isolates carrying the coa gene were submitted for 16S rRNA sequencing and 3 showed similarity with CoNS. Forty strains were positive for at least 1 enterotoxin-encoding gene, the genes most frequently detected were sea (28.6% and seb (27.5%. CONCLUSIONS: The presence of antimicrobial resistant and enterotoxin-encoding genes in staphylococci isolates from black pudding indicated that this fermented food may represent a potential health risk, since staphylococci present in food could cause foodborne diseases or be a possible route for the transfer of antimicrobial resistance to humans.

  1. Genome scanning for identification of resistance gene analogs (RGAs)

    African Journals Online (AJOL)

    Disease resistance in plants is a desirable economic trait. Many disease resistance genes from various plants have been cloned so far. The gene products of some of these can be distinguished by the presence of an N terminal nucleotide binding site and a C-terminal stretch of leucine-rich repeats. Oligonucleotides already ...

  2. The antimicrobial resistance crisis: management through gene monitoring

    Science.gov (United States)

    2016-01-01

    Antimicrobial resistance (AMR) is an acknowledged crisis for humanity. Its genetic origins and dire potential outcomes are increasingly well understood. However, diagnostic techniques for monitoring the crisis are currently largely limited to enumerating the increasing incidence of resistant pathogens. Being the end-stage of the evolutionary process that produces antimicrobial resistant pathogens, these measurements, while diagnostic, are not prognostic, and so are not optimal in managing this crisis. A better test is required. Here, using insights from an understanding of evolutionary processes ruling the changing abundance of genes under selective pressure, we suggest a predictive framework for the AMR crisis. We then discuss the likely progression of resistance for both existing and prospective antimicrobial therapies. Finally, we suggest that by the environmental monitoring of resistance gene frequency, resistance may be detected and tracked presumptively, and how this tool may be used to guide decision-making in the local and global use of antimicrobials. PMID:27831476

  3. Precision calculation of the {pi}{sup -}d scattering length and its impact on threshold {pi}N scattering

    Energy Technology Data Exchange (ETDEWEB)

    Baru, V. [Institut fuer Kernphysik and Juelich Center for Hadron Physics, Forschungszentrum Juelich, D-52425 Juelich (Germany); Institute for Theoretical and Experimental Physics, B. Cheremushinskaya 25, 117218 Moscow (Russian Federation); Hanhart, C. [Institut fuer Kernphysik and Juelich Center for Hadron Physics, Forschungszentrum Juelich, D-52425 Juelich (Germany); Institute for Advanced Simulation, Forschungszentrum Juelich, D-52425 Juelich (Germany); Hoferichter, M.; Kubis, B. [Helmholtz-Institut fuer Strahlen- und Kernphysik and Bethe Center for Theoretical Physics, Universitaet Bonn, D-53115 Bonn (Germany); Nogga, A. [Institut fuer Kernphysik and Juelich Center for Hadron Physics, Forschungszentrum Juelich, D-52425 Juelich (Germany); Institute for Advanced Simulation, Forschungszentrum Juelich, D-52425 Juelich (Germany); Phillips, D.R., E-mail: phillips@phy.ohiou.ed [Helmholtz-Institut fuer Strahlen- und Kernphysik and Bethe Center for Theoretical Physics, Universitaet Bonn, D-53115 Bonn (Germany); Institute of Nuclear and Particle Physics and Department of Physics and Astronomy, Ohio University, Athens, OH 45701 (United States)

    2011-01-03

    We present a calculation of the {pi}{sup -}d scattering length with an accuracy of a few percent using chiral perturbation theory. For the first time isospin-violating corrections are included consistently. Using data on pionic deuterium and pionic hydrogen atoms, we extract the isoscalar and isovector pion-nucleon scattering lengths and obtain a{sup +}=(7.6{+-}3.1).10{sup -3}M{sub {pi}}{sup -1} and a{sup -}=(86.1{+-}0.9).10{sup -3}M{sub {pi}}{sup -1}. Via the Goldberger-Miyazawa-Oehme sum rule, this leads to a charged-pion-nucleon coupling constant g{sub c}{sup 2}/4{pi}=13.69{+-}0.20.

  4. Development and characterization of japonica rice lines carrying the brown planthopper-resistance genes BPH12 and BPH6.

    Science.gov (United States)

    Qiu, Yongfu; Guo, Jianping; Jing, Shengli; Zhu, Lili; He, Guangcun

    2012-02-01

    The brown planthopper (Nilaparvata lugens Stål; BPH) has become a severe constraint on rice production. Identification and pyramiding BPH-resistance genes is an economical and effective solution to increase the resistance level of rice varieties. All the BPH-resistance genes identified to date have been from indica rice or wild species. The BPH12 gene in the indica rice accession B14 is derived from the wild species Oryza latifolia. Using an F(2) population from a cross between the indica cultivar 93-11 and B14, we mapped the BPH12 gene to a 1.9-cM region on chromosome 4, flanked by the markers RM16459 and RM1305. In this population, BPH12 appeared to be partially dominant and explained 73.8% of the phenotypic variance in BPH resistance. A near-isogenic line (NIL) containing the BPH12 locus in the background of the susceptible japonica variety Nipponbare was developed and crossed with a NIL carrying BPH6 to generate a pyramid line (PYL) with both genes. BPH insects showed significant differences in non-preference in comparisons between the lines harboring resistance genes (NILs and PYL) and Nipponbare. BPH growth and development were inhibited and survival rates were lower on the NIL-BPH12 and NIL-BPH6 plants compared to the recurrent parent Nipponbare. PYL-BPH6 + BPH12 exhibited 46.4, 26.8 and 72.1% reductions in population growth rates (PGR) compared to NIL-BPH12, NIL-BPH6 and Nipponbare, respectively. Furthermore, insect survival rates were the lowest on the PYL-BPH6 + BPH12 plants. These results demonstrated that pyramiding different BPH-resistance genes resulted in stronger antixenotic and antibiotic effects on the BPH insects. This gene pyramiding strategy should be of great benefit for the breeding of BPH-resistant japonica rice varieties.

  5. Identification of antimicrobial resistance genes in multidrug-resistant clinical Bacteroides fragilis isolates by whole genome shotgun sequencing

    DEFF Research Database (Denmark)

    Sydenham, Thomas Vognbjerg; Sóki, József; Hasman, Henrik

    2015-01-01

    Bacteroides fragilis constitutes the most frequent anaerobic bacterium causing bacteremia in humans. The genetic background for antimicrobial resistance in B. fragilis is diverse with some genes requiring insertion sequence (IS) elements inserted upstream for increased expression. To evaluate whole...... genome shotgun sequencing as a method for predicting antimicrobial resistance properties, one meropenem resistant and five multidrug-resistant blood culture isolates were sequenced and antimicrobial resistance genes and IS elements identified using ResFinder 2.1 (http...

  6. SSTAR, a Stand-Alone Easy-To-Use Antimicrobial Resistance Gene Predictor.

    Science.gov (United States)

    de Man, Tom J B; Limbago, Brandi M

    2016-01-01

    We present the easy-to-use Sequence Search Tool for Antimicrobial Resistance, SSTAR. It combines a locally executed BLASTN search against a customizable database with an intuitive graphical user interface for identifying antimicrobial resistance (AR) genes from genomic data. Although the database is initially populated from a public repository of acquired resistance determinants (i.e., ARG-ANNOT), it can be customized for particular pathogen groups and resistance mechanisms. For instance, outer membrane porin sequences associated with carbapenem resistance phenotypes can be added, and known intrinsic mechanisms can be included. Unique about this tool is the ability to easily detect putative new alleles and truncated versions of existing AR genes. Variants and potential new alleles are brought to the attention of the user for further investigation. For instance, SSTAR is able to identify modified or truncated versions of porins, which may be of great importance in carbapenemase-negative carbapenem-resistant Enterobacteriaceae. SSTAR is written in Java and is therefore platform independent and compatible with both Windows and Unix operating systems. SSTAR and its manual, which includes a simple installation guide, are freely available from https://github.com/tomdeman-bio/Sequence-Search-Tool-for-Antimicrobial-Resistance-SSTAR-. IMPORTANCE Whole-genome sequencing (WGS) is quickly becoming a routine method for identifying genes associated with antimicrobial resistance (AR). However, for many microbiologists, the use and analysis of WGS data present a substantial challenge. We developed SSTAR, software with a graphical user interface that enables the identification of known AR genes from WGS and has the unique capacity to easily detect new variants of known AR genes, including truncated protein variants. Current software solutions do not notify the user when genes are truncated and, therefore, likely nonfunctional, which makes phenotype predictions less accurate. SSTAR

  7. Detection of antibiotic resistance and tetracycline resistance genes in Enterobacteriaceae isolated from the Pearl rivers in South China

    International Nuclear Information System (INIS)

    Tao Ran; Ying Guangguo; Su Haochang; Zhou Hongwei; Sidhu, Jatinder P.S.

    2010-01-01

    This study investigated antibiotic resistance profiles and tetracycline resistance genes in Enterobacteriaceae family isolates from the Pearl rivers. The Enterobacteriaceae isolates were tested for susceptibility to seven antibiotics ampicillin, chloramphenicol, ciprofloxacin, levofloxacin, sulphamethoxazole/trimethoprim, tetracycline and trimethoprim. In Liuxi reservoir, with an exception to ampicillin resistant strains (11%) no other antibiotic resistance bacterial strains were detected. However, multiple drug resistance in bacterial isolates from the other sites of Pearl rivers was observed which is possibly due to sewage discharge and input from other anthropogenic sources along the rivers. Four tetracycline resistance genes tet A, tet B, tet C and tet D were detected in the isolates from the rivers. The genes tet A and tet B were widely detected with the detection frequencies of 43% and 40% respectively. Ciprofloxacin and levofloxacin resistant enteric bacteria were also isolated from the pig and duck manures which suggest a wider distribution of human specific drugs in the environment. This investigation provided a baseline data on antibiotic resistance profiles and tetracycline resistance genes in the Pearl rivers delta. - High rates of antibiotic resistance in Enterobacteriaceae from river water are attributed to wastewater contamination.

  8. Detection of antibiotic resistance and tetracycline resistance genes in Enterobacteriaceae isolated from the Pearl rivers in South China

    Energy Technology Data Exchange (ETDEWEB)

    Tao Ran [State Key Laboratory of Organic Geochemistry, Guangzhou Institute of Geochemistry, Chinese Academy of Sciences, 511 Kehua Street, Tianhe District, Guangzhou 510640 (China); Ying Guangguo, E-mail: guangguo.ying@gmail.co [State Key Laboratory of Organic Geochemistry, Guangzhou Institute of Geochemistry, Chinese Academy of Sciences, 511 Kehua Street, Tianhe District, Guangzhou 510640 (China); Su Haochang [State Key Laboratory of Organic Geochemistry, Guangzhou Institute of Geochemistry, Chinese Academy of Sciences, 511 Kehua Street, Tianhe District, Guangzhou 510640 (China); Zhou Hongwei [Department of Environmental Health, School of Public Health and Tropical Medicine, Southern Medical University, 1838 North Guangzhou Street, Baiyun District, Guangzhou 510515 (China); Sidhu, Jatinder P.S. [CSIRO Land and Water, Queensland Bioscience Precinct, 306 Carmody Road, St Lucia QLD 4067 (Australia)

    2010-06-15

    This study investigated antibiotic resistance profiles and tetracycline resistance genes in Enterobacteriaceae family isolates from the Pearl rivers. The Enterobacteriaceae isolates were tested for susceptibility to seven antibiotics ampicillin, chloramphenicol, ciprofloxacin, levofloxacin, sulphamethoxazole/trimethoprim, tetracycline and trimethoprim. In Liuxi reservoir, with an exception to ampicillin resistant strains (11%) no other antibiotic resistance bacterial strains were detected. However, multiple drug resistance in bacterial isolates from the other sites of Pearl rivers was observed which is possibly due to sewage discharge and input from other anthropogenic sources along the rivers. Four tetracycline resistance genes tet A, tet B, tet C and tet D were detected in the isolates from the rivers. The genes tet A and tet B were widely detected with the detection frequencies of 43% and 40% respectively. Ciprofloxacin and levofloxacin resistant enteric bacteria were also isolated from the pig and duck manures which suggest a wider distribution of human specific drugs in the environment. This investigation provided a baseline data on antibiotic resistance profiles and tetracycline resistance genes in the Pearl rivers delta. - High rates of antibiotic resistance in Enterobacteriaceae from river water are attributed to wastewater contamination.

  9. Preparation and properties of thin films used in activity determinations with a 4 {pi} counter; Preparation et proprietes des films minces utilises dans les determinations d'activite au compteur 4 {pi}

    Energy Technology Data Exchange (ETDEWEB)

    Jannez, M; Le Gallic, Y; Thenard, M [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

    1958-07-01

    Comparative study of various methods of preparing thin films, for use as source holders in the 4 {pi} counter, and of measuring their thickness. Comparative study of various properties: mechanical resistance; heat resistance; ageing; resistance of rhodopas, polystyrene, formvar and cellulose acetate films to the action of various chemical agents. (author) [French] Etude comparee de divers procedes de preparation de films minces, destines a etre utilises comme supports de sources dans le compteur 4 {pi} et de la mesure de leur epaisseur. Etude comparee de diverses proprietes: resistance mecanique; resistance a la chaleur; vieillissement; resistance a l'action de divers agents chimiques de films de rhodopas, polystyrene, formvar et acetate de cellulose. (auteur)

  10. Study of K. pi. scattering using the reactions K/sup + -/p. -->. K/sup + -/. pi. /sup +/n and K/sup + -/p. -->. K/sup + -/. pi. /sup -/. delta. /sup + +/ at 13 GeV/c

    Energy Technology Data Exchange (ETDEWEB)

    Estabrooks, P [McGill Univ., Montreal, Quebec (Canada); Carnegie, R K [Carleton Univ., Ottawa, Ontario (Canada); Martin, A D [Durham Univ. (UK); Dunwoodie, W M; Lasinski, T A; Leith, D W.G.S. [Stanford Linear Accelerator Center, Calif. (USA)

    1978-02-27

    An elastic K..pi.. partial-wave analysis is presented. It is based on high-statistics data for the reactions K/sup + -/p ..-->.. K/sup + -/..pi../sup +/n and K/sup + -/p ..-->.. K/sup + -/..pi../sup -/..delta../sup + +/ at 13 GeV obtained in a spectrometer experiment performed at SLAC. For each reaction, a t-dependent parametrization of the production amplitudes provides information on both the K..pi.. mass dependence of the production mechanisms and on K..pi.. scattering. Knowledge of the t-dependence then allows a calculation of the K..pi.. partial-wave amplitudes for K..pi.. masses from 0.7 to 1.9 GeV. The results of such analyses using data for (i) the neutral recoil reactions, (ii) the ..delta../sup + +/ recoil reactions, and (iii) both neutron and ..delta../sup + +/ recoil reactions simultaneously are presented.

  11. Mutations inside rifampicin-resistance determining region of rpoB gene associated with rifampicin-resistance in Mycobacterium tuberculosis.

    Science.gov (United States)

    Zaw, Myo T; Emran, Nor A; Lin, Zaw

    2018-04-26

    Rifampicin (RIF) plays a pivotal role in the treatment of tuberculosis due to its bactericidal effects. Because the action of RIF is on rpoB gene encoding RNA polymerase β subunit, 95% of RIF resistant mutations are present in rpoB gene. The majority of the mutations in rpoB gene are found within an 81bp RIF-resistance determining region (RRDR). Literatures on RIF resistant mutations published between 2010 and 2016 were thoroughly reviewed. The most commonly mutated codons in RRDR of rpoB gene are 531, 526 and 516. The possibilities of absence of mutation in RRDR of rpoB gene in MDR-TB isolates in few studies was due to existence of other rare rpoB mutations outside RRDR or different mechanism of rifampicin resistance. Molecular methods which can identify extensive mutations associated with multiple anti-tuberculous drugs are in urgent need so that the research on drug resistant mutations should be extended. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  12. Coincidence in map positions between pathogen-induced defense-responsive genes and quantitative resistance loci in rice

    Institute of Scientific and Technical Information of China (English)

    熊敏; 王石平; 张启发

    2002-01-01

    Quantitative disease resistance conferred by quantitative trait loci (QTLs) is presumably of wider spectrum and durable. Forty-four cDNA clones, representing 44 defense-responsive genes, were fine mapped to 56 loci distributed on 9 of the 12 rice chromosomes. The locations of 32 loci detected by 27 cDNA clones were associated with previously identified resistance QTLs for different rice diseases, including blast, bacterial blight, sheath blight and yellow mottle virus. The loci detected by the same multiple-copy cDNA clones were frequently located on similar locations of different chromosomes. Some of the multiple loci detected by the same clones were all associated with resistance QTLs. These results suggest that some of the genes may be important components in regulation of defense responses against pathogen invasion and they may be the candidates for studying the mechanism of quantitative disease resistance in rice.

  13. Deinococcus geothermalis: The Pool of Extreme Radiation Resistance Genes Shrinks

    Energy Technology Data Exchange (ETDEWEB)

    Makarova, Kira S.; Omelchenko, Marina V.; Gaidamakova, Elena K.; Matrosova, Vera Y.; Vasilenko, Alexander; Zhai, Min; Lapidus, Alla; Copeland, Alex; Kim, Edwin; Land, Miriam; Mavrommatis, Konstantinos; Pitluck, Samuel; Richardson, Paul M.; Detter, Chris; Brettin, Thomas; Saunders, Elizabeth; Lai, Barry; Ravel, Bruce; Kemner, Kenneth M.; Wolf, Yuri I.; Sorokin, Alexander; Gerasimova, Anna V.; Gelfand, Mikhail S.; Fredrickson, James K.; Koonin, Eugene V.; Daly, Michael J.

    2007-07-24

    Bacteria of the genus Deinococcus are extremely resistant to ionizing radiation (IR), ultraviolet light (UV) and desiccation. The mesophile Deinococcus radiodurans was the first member of this group whose genome was completely sequenced. Analysis of the genome sequence of D. radiodurans, however, failed to identify unique DNA repair systems. To further delineate the genes underlying the resistance phenotypes, we report the whole-genome sequence of a second Deinococcus species, the thermophile Deinococcus geothermalis, which at itsoptimal growth temperature is as resistant to IR, UV and desiccation as D. radiodurans, and a comparative analysis of the two Deinococcus genomes. Many D. radiodurans genes previously implicated in resistance, but for which no sensitive phenotype was observed upon disruption, are absent in D. geothermalis. In contrast, most D. radiodurans genes whose mutants displayed a radiation-sensitive phenotype in D. radiodurans are conserved in D. geothermalis. Supporting the existence of a Deinococcus radiation response regulon, a common palindromic DNA motif was identified in a conserved set of genes associated with resistance, and a dedicated transcriptional regulator was predicted. We present the case that these two species evolved essentially the same diverse set of gene families, and that the extreme stress-resistance phenotypes of the Deinococcus lineage emerged progressively by amassing cell-cleaning systems from different sources, but not by acquisition of novel DNA repair systems. Our reconstruction of the genomic evolution of the Deinococcus-Thermus phylum indicates that the corresponding set of enzymes proliferated mainly in the common ancestor of Deinococcus. Results of the comparative analysis weaken the arguments for a role of higher-order chromosome alignment structures in resistance; more clearly define and substantially revise downward the number of uncharacterized genes that might participate in DNA repair and contribute to

  14. Suppression of the auxin response pathway enhances susceptibility to Phytophthora cinnamomi while phosphite-mediated resistance stimulates the auxin signalling pathway

    Science.gov (United States)

    2014-01-01

    Background Phytophthora cinnamomi is a devastating pathogen worldwide and phosphite (Phi), an analogue of phosphate (Pi) is highly effective in the control of this pathogen. Phi also interferes with Pi starvation responses (PSR), of which auxin signalling is an integral component. In the current study, the involvement of Pi and the auxin signalling pathways in host and Phi-mediated resistance to P. cinnamomi was investigated by screening the Arabidopsis thaliana ecotype Col-0 and several mutants defective in PSR and the auxin response pathway for their susceptibility to this pathogen. The response to Phi treatment was also studied by monitoring its effect on Pi- and the auxin response pathways. Results Here we demonstrate that phr1-1 (phosphate starvation response 1), a mutant defective in response to Pi starvation was highly susceptible to P. cinnamomi compared to the parental background Col-0. Furthermore, the analysis of the Arabidopsis tir1-1 (transport inhibitor response 1) mutant, deficient in the auxin-stimulated SCF (Skp1 − Cullin − F-Box) ubiquitination pathway was also highly susceptible to P. cinnamomi and the susceptibility of the mutants rpn10 and pbe1 further supported a role for the 26S proteasome in resistance to P. cinnamomi. The role of auxin was also supported by a significant (P < 0.001) increase in susceptibility of blue lupin (Lupinus angustifolius) to P. cinnamomi following treatment with the inhibitor of auxin transport, TIBA (2,3,5-triiodobenzoic acid). Given the apparent involvement of auxin and PSR signalling in the resistance to P. cinnamomi, the possible involvement of these pathways in Phi mediated resistance was also investigated. Phi (especially at high concentrations) attenuates the response of some Pi starvation inducible genes such as AT4, AtACP5 and AtPT2 in Pi starved plants. However, Phi enhanced the transcript levels of PHR1 and the auxin responsive genes (AUX1, AXR1and AXR2), suppressed the primary root

  15. Spread of tetracycline resistance genes at a conventional dairy farm

    Directory of Open Access Journals (Sweden)

    Martina eKyselkova

    2015-05-01

    Full Text Available The use of antibiotics in animal husbandry contributes to the worldwide problem of increasing antibiotic resistance in animal and human pathogens. Intensive animal production is considered an important source of antibiotic resistance genes released to the environment, while the contribution of smaller farms remains to be evaluated. Here we monitor the spread of tetracycline resistance (TC-r genes at a middle-size conventional dairy farm, where chlortetracycline (CTC, as intrauterine suppository is prophylactically used after each calving. Our study has shown that animals at the farm acquired the TC-r genes in their early age (1-2 weeks, likely due to colonization with TC-resistant bacteria from their mothers and/or the farm environment. The relative abundance of the TC-r genes tet(W, tet(Q and tet(M in fresh excrements of calves was about 1-2 orders of magnitude higher compared to heifers and dairy cows, possibly due to the presence of antibiotic residues in milk fed to calves. The occurrence and abundance of TC-r genes in fresh excrements of heifers and adult cows remained unaffected by intrauterine CTC applications, with tet(O, tet(Q and tet(W representing a ‘core TC-resistome’ of the farm, and tet(A, tet(M, tet(Y and tet(X occurring occasionally. The genes tet(A, tet(M, tet(Y and tet(X were shown to be respectively harbored by Shigella, Lactobacillus and Clostridium, Acinetobacter, and Wautersiella. Soil in the farm proximity, as well as field soil to which manure from the farm was applied, was contaminated with TC-r genes occurring in the farm, and some of the TC-r genes persisted in the field over 3 months following the manure application. Concluding, our study shows that antibiotic resistance genes may be a stable part of the intestinal metagenome of cattle even if antibiotics are not used for growth stimulation, and that smaller dairy farms may also contribute to environmental pollution with antibiotic resistance genes.

  16. Over-expression of multiple cytochrome P450 genes in fenvalerate-resistant field strains of Helicoverpa armigera from north of China.

    Science.gov (United States)

    Xu, Li; Li, Dongzhi; Qin, Jianying; Zhao, Weisong; Qiu, Lihong

    2016-09-01

    Pyrethroid resistance was one of the main reasons for control failure of cotton bollworm Helicoverpa armigera (Hübner) in China. The promotion of Bt crops decreased the application of chemical insecticides in controlling H.armigera. However, the cotton bollworm still kept high levels of resistance to fenvalerate. In this study, the resistance levels of 8 field-collected strains of H. armigera from north of China to 4 insecticides, as well as the expression levels of related P450 genes were investigated. The results of bioassay indicated that the resistance levels to fenvalerate in the field strains varied from 5.4- to 114.7-fold, while the resistance levels to lambda-cyhalothrin, phoxim and methomyl were low, which were ranged from 1.5- to 5.2-, 0.2- to 1.6-, and 2.9- to 8.3- fold, respectively, compared to a susceptible strain. Synergistic experiment showed that PBO was the most effective synergist in increasing the sensitivity of H. armigera to fenvalerate, suggesting that P450 enzymes were involved in the pyrethroid resistance in the field strains. The results of quantitative RT-PCR indicated that eight P450 genes (CYP332A1, CYP4L11, CYP4L5, CYP4M6, CYP4M7, CYP6B7, CYP9A12, CYP9A14) were all significantly overexpressed in Hejian1 and Xiajin1 strains of H. armigera collected in 2013, and CYP4L5 was significantly overexpressed in all the 6 field strains collected in 2014. CYP332A1, CYP6B7 and CYP9A12 had very high overexpression levels in all the field strains, indicating their important roles in fenvalerate resistance. The results suggested that multiple P450 genes were involved in the high-level fenvalerate-resistance in different field strains of H. armigera collected from north of China. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Occurrence and Distribution of Antibiotic-resistant Bacteria and Transfer of Resistance Genes in Lake Taihu

    Science.gov (United States)

    Yin, Qian; Yue, Dongmei; Peng, Yuke; Liu, Ying; Xiao, Lin

    2013-01-01

    The overuse of antibiotics has accelerated antibiotic resistance in the natural environment, especially fresh water, generating a potential risk for public health around the world. In this study, antibiotic resistance in Lake Taihu was investigated and this was the first thorough data obtained through culture-dependent methods. High percentages of resistance to streptomycin and ampicillin among bacterial isolates were detected, followed by tetracycline and chloramphenicol. Especially high levels of ampicillin resistance in the western and northern regions were illustrated. Bacterial identification of the isolates selected for further study indicated the prevalence of some opportunistic pathogens and 62.0% of the 78 isolates exhibited multiple antibiotic resistance. The presence of ESBLs genes was in the following sequence: blaTEM > blaSHV > blaCTMX and 38.5% of the isolates had a class I integrase gene. Of all tested strains, 80.8% were able to transfer antibiotic resistance through conjugation. We also concluded that some new families of human-associated ESBLs and AmpC genes can be found in natural environmental isolates. The prevalence of antibiotic resistance and the dissemination of transferable antibiotic resistance in bacterial isolates (especially in opportunistic pathogens) was alarming and clearly indicated the urgency of realizing the health risks of antibiotic resistance to human and animal populations who are dependent on Lake Taihu for water consumption. PMID:24240317

  18. Antibiotic Resistance and Antibiotic Resistance Genes in Escherichia coli Isolates from Hospital Wastewater in Vietnam.

    Science.gov (United States)

    Lien, La Thi Quynh; Lan, Pham Thi; Chuc, Nguyen Thi Kim; Hoa, Nguyen Quynh; Nhung, Pham Hong; Thoa, Nguyen Thi Minh; Diwan, Vishal; Tamhankar, Ashok J; Stålsby Lundborg, Cecilia

    2017-06-29

    The environmental spread of antibiotic-resistant bacteria has been recognised as a growing public health threat for which hospitals play a significant role. The aims of this study were to investigate the prevalence of antibiotic resistance and antibiotic resistance genes (ARGs) in Escherichia coli isolates from hospital wastewater in Vietnam. Wastewater samples before and after treatment were collected using continuous sampling every month over a year. Standard disk diffusion and E-test were used for antibiotic susceptibility testing. Extended-spectrum beta-lactamase (ESBL) production was tested using combined disk diffusion. ARGs were detected by polymerase chain reactions. Resistance to at least one antibiotic was detected in 83% of isolates; multidrug resistance was found in 32%. The highest resistance prevalence was found for co-trimoxazole (70%) and the lowest for imipenem (1%). Forty-three percent of isolates were ESBL-producing, with the bla TEM gene being more common than bla CTX-M . Co-harbouring of the bla CTX-M , bla TEM and qepA genes was found in 46% of isolates resistant to ciprofloxacin. The large presence of antibiotic-resistant E. coli isolates combined with ARGs in hospital wastewater, even post-treatment, poses a threat to public health. It highlights the need to develop effective processes for hospital wastewater treatment plants to eliminate antibiotic resistant bacteria and ARGs.

  19. Characterization of antimicrobial resistance genes in Haemophilus parasuis isolated from pigs in China.

    Science.gov (United States)

    Zhao, Yongda; Guo, Lili; Li, Jie; Huang, Xianhui; Fang, Binghu

    2018-01-01

    Haemophilus parasuis is a common porcine respiratory pathogen that causes high rates of morbidity and mortality in farmed swine. We performed a molecular characterization of antimicrobial resistance genes harbored by H. parasuis from pig farms in China. We screened 143 H. parasuis isolates for antimicrobial susceptibility against six fluoroquinolone antibiotics testing by the broth microdilution method, and the presence of 64 antimicrobial resistance genes by PCR amplification and DNA sequence analysis. We determined quinolone resistance determining region mutations of DNA gyrase ( gyrA and gyrB ) and topoisomerase IV ( parC and parE ). The genetic relatedness among the strains was analyzed by pulsed-field gel electrophoresis. Susceptibility test showed that all isolates were low resistance to lomefloxacin (28.67%), levofloxacin (20.28%), norfloxacin (22.38%), ciprofloxacin (23.78%), however, high resistance levels were found to nalidixic acid (82.52%) and enrofloxacin (55.94%). In addition, we found 14 antimicrobial resistance genes were present in these isolates, including bla TEM-1 , bla ROB-1 , ermB, ermA, flor, catl, tetB, tetC, rmtB, rmtD, aadA1, aac(3')-llc, sul1, and sul2 genes. Interestingly, one isolate carried five antibiotic resistance genes ( tetB, tetC, flor, rmtB, sul1 ). The genes tetB , rmtB, and flor were the most prevalent resistance genes in H. parasuis in China. Alterations in the gyrA gene (S83F/Y, D87Y/N/H/G) were detected in 81% of the strains and parC mutations were often accompanied by a gyrA mutation. Pulsed-field gel electrophoresis typing revealed 51 unique patterns in the isolates carrying high-level antibiotic resistance genes, indicating considerable genetic diversity and suggesting that the genes were spread horizontally. The current study demonstrated that the high antibiotic resistance of H. parasuis in piglets is a combination of transferable antibiotic resistance genes and multiple target gene mutations. These data provide novel

  20. Two whitebacked planthopper resistance genes in rice share the same loci with those for brown planthopper resistance.

    Science.gov (United States)

    Tan, G X; Weng, Q M; Ren, X; Huang, Z; Zhu, L L; He, G C

    2004-03-01

    The whitebacked planthopper (WBPH), Sogatella furcifera, and brown planthopper (BPH) Nilaparvata lugens Stål are important sucking insects of rice (Oryza sativa L.) crops throughout the world. Rice 'B5', which has derived its resistance genes from the wild rice O. officinalis Wall ex Watt, is a line that is highly resistant to both WBPH and BPH. Previously, two resistance genes against BPH, Qbp1, and Qbp2 in 'B5' had been mapped onto chromosome 3 and chromosome 4, respectively. In this study, we employed a mapping population composed of 187 recombinant inbred lines (RILs), produced from a cross between 'B5' and susceptible variety 'Minghui63', to locate the WBPH and BPH resistance genes. A RFLP survey of the bulked extremes from the RIL population identified two genomic regions, one on chromosome 3 and the other on chromosome 4, likely containing the resistance genes to planthoppers. QTL analysis of the RILs further confirmed that two WBPH resistance genes were mapped on the same loci as Qbp1 and Qbp2, using a linkage map with 242 molecular markers distributed on 12 rice chromosomes. Of the two WBPH resistance genes, one designated Wbph7(t) was located within a 1.1-cM region between R1925 and G1318 on chromosome 3, the other designated Wbph8(t) was within a 0.3-cM region flanked by R288 and S11182 on chromosome 4. A two-way analysis of variance showed that two loci acted independently with each other in determining WBPH resistance. The results have significant implications in studying the interactions between sucking insects and plants and in breeding programs of resistance to rice planthoppers.

  1. Antimicrobial-Resistant Bacterial Populations and Antimicrobial Resistance Genes Obtained from Environments Impacted by Livestock and Municipal Waste.

    Directory of Open Access Journals (Sweden)

    Getahun E Agga

    Full Text Available This study compared the populations of antimicrobial-resistant bacteria and the repertoire of antimicrobial resistance genes in four environments: effluent of three municipal wastewater treatment facilities, three cattle feedlot runoff catchment ponds, three swine waste lagoons, and two "low impact" environments (an urban lake and a relict prairie. Multiple liquid and solid samples were collected from each environment. The prevalences and concentrations of antimicrobial-resistant (AMR Gram-negative (Escherichia coli and Salmonella enterica and Gram-positive (enterococci bacteria were determined from individual samples (n = 174. The prevalences of 84 antimicrobial resistance genes in metagenomic DNA isolated from samples pooled (n = 44 by collection date, location, and sample type were determined. The prevalences and concentrations of AMR E. coli and Salmonella were similar among the livestock and municipal sample sources. The levels of erythromycin-resistant enterococci were significantly higher in liquid samples from cattle catchment ponds and swine waste lagoons than in liquid samples from municipal wastewater treatment facilities, but solid samples from these environments did not differ significantly. Similarly, trimethoprim/sulfamethoxazole-resistant E. coli concentrations were significantly higher in swine liquid than in municipal liquid samples, but there was no difference in solid samples. Multivariate analysis of the distribution of antimicrobial resistance genes using principal coordinate analysis showed distinct clustering of samples with livestock (cattle and swine, low impact environment and municipal samples forming three separate clusters. The numbers of class A beta-lactamase, class C beta-lactamase, and fluoroquinolone resistance genes detected were significantly higher (P < 0.05 in municipal samples than in cattle runoff or swine lagoon samples. In conclusion, we report that AMR is a very widespread phenomenon and that similar

  2. Resonance formation in the $\\pi^+\\pi^-\\pi^0$ final state in two-photon collisions

    CERN Document Server

    Acciarri, M; Aguilar-Benítez, M; Ahlen, S P; Alcaraz, J; Alemanni, G; Allaby, James V; Aloisio, A; Alverson, G; Alviggi, M G; Ambrosi, G; Anderhub, H; Andreev, V P; Angelescu, T; Anselmo, F; Arefev, A; Azemoon, T; Aziz, T; Bagnaia, P; Baksay, L; Ball, R C; Banerjee, S; Banerjee, Sw; Banicz, K; Barczyk, A; Barillère, R; Barone, L; Bartalini, P; Baschirotto, A; Basile, M; Battiston, R; Bay, A; Becattini, F; Becker, U; Behner, F; Berdugo, J; Berges, P; Bertucci, B; Betev, B L; Bhattacharya, S; Biasini, M; Biland, A; Bilei, G M; Blaising, J J; Blyth, S C; Bobbink, Gerjan J; Böck, R K; Böhm, A; Boldizsar, L; Borgia, B; Boucham, A; Bourilkov, D; Bourquin, Maurice; Boutigny, D; Braccini, S; Branson, J G; Brigljevic, V; Brock, I C; Buffini, A; Buijs, A; Burger, J D; Burger, W J; Busenitz, J K; Cai, X D; Campanelli, M; Capell, M; Cara Romeo, G; Carlino, G; Cartacci, A M; Casaus, J; Castellini, G; Cavallari, F; Cavallo, N; Cecchi, C; Cerrada-Canales, M; Cesaroni, F; Chamizo-Llatas, M; Chang, Y H; Chaturvedi, U K; Chekanov, S V; Chemarin, M; Chen, A; Chen, G; Chen, G M; Chen, H F; Chen, H S; Chen, M; Chiefari, G; Chien, C Y; Cifarelli, Luisa; Cindolo, F; Civinini, C; Clare, I; Clare, R; Cohn, H O; Coignet, G; Colijn, A P; Colino, N; Commichau, V; Costantini, S; Cotorobai, F; de la Cruz, B; Csilling, Akos; Dai, T S; D'Alessandro, R; De Asmundis, R; Degré, A; Deiters, K; Denes, P; De Notaristefani, F; DiBitonto, Daryl; Diemoz, M; Van Dierendonck, D N; Di Lodovico, F; Dionisi, C; Dittmar, Michael; Dominguez, A; Doria, A; Dorne, I; Dova, M T; Drago, E; Duchesneau, D; Duinker, P; Durán, I; Dutta, S; Easo, S; Efremenko, Yu V; El-Mamouni, H; Engler, A; Eppling, F J; Erné, F C; Ernenwein, J P; Extermann, Pierre; Fabre, M; Faccini, R; Falciano, S; Favara, A; Fay, J; Fedin, O; Felcini, Marta; Fenyi, B; Ferguson, T; Ferroni, F; Fesefeldt, H S; Fiandrini, E; Field, J H; Filthaut, Frank; Fisher, P H; Fisk, I; Forconi, G; Fredj, L; Freudenreich, Klaus; Furetta, C; Galaktionov, Yu; Ganguli, S N; García-Abia, P; Gau, S S; Gentile, S; Gerald, J; Gheordanescu, N; Giagu, S; Goldfarb, S; Goldstein, J; Gong, Z F; Gougas, Andreas; Gratta, Giorgio; Grünewald, M W; Gupta, V K; Gurtu, A; Gutay, L J; Hartmann, B; Hasan, A; Hatzifotiadou, D; Hebbeker, T; Hervé, A; Van Hoek, W C; Hofer, H; Hong, S J; Hoorani, H; Hou, S R; Hu, G; Innocente, Vincenzo; Janssen, H; Jenkes, K; Jin, B N; Jones, L W; de Jong, P; Josa-Mutuberria, I; Kasser, A; Khan, R A; Kamrad, D; Kamyshkov, Yu A; Kapustinsky, J S; Karyotakis, Yu; Kaur, M; Kienzle-Focacci, M N; Kim, D; Kim, D H; Kim, J K; Kim, S C; Kim, Y G; Kinnison, W W; Kirkby, A; Kirkby, D; Kirkby, Jasper; Kiss, D; Kittel, E W; Klimentov, A; König, A C; Kopp, A; Korolko, I; Koutsenko, V F; Krämer, R W; Krenz, W; Kunin, A; Ladrón de Guevara, P; Landi, G; Lapoint, C; Lassila-Perini, K M; Laurikainen, P; Lebeau, M; Lebedev, A; Lebrun, P; Lecomte, P; Lecoq, P; Le Coultre, P; Leggett, C; Le Goff, J M; Leiste, R; Leonardi, E; Levchenko, P M; Li Chuan; Lin, C H; Lin, W T; Linde, Frank L; Lista, L; Liu, Z A; Lohmann, W; Longo, E; Lu, W; Lü, Y S; Lübelsmeyer, K; Luci, C; Luckey, D; Luminari, L; Lustermann, W; Ma Wen Gan; Maity, M; Majumder, G; Malgeri, L; Malinin, A; Maña, C; Mangeol, D J J; Mangla, S; Marchesini, P A; Marin, A; Martin, J P; Marzano, F; Massaro, G G G; McNally, D; Mele, S; Merola, L; Meschini, M; Metzger, W J; Von der Mey, M; Mi, Y; Mihul, A; Van Mil, A J W; Mirabelli, G; Mnich, J; Molnár, P; Monteleoni, B; Moore, R; Morganti, S; Moulik, T; Mount, R; Müller, S; Muheim, F; Muijs, A J M; Nahn, S; Napolitano, M; Nessi-Tedaldi, F; Newman, H; Niessen, T; Nippe, A; Nisati, A; Nowak, H; Oh, Yu D; Opitz, H; Organtini, G; Ostonen, R; Palomares, C; Pandoulas, D; Paoletti, S; Paolucci, P; Park, H K; Park, I H; Pascale, G; Passaleva, G; Patricelli, S; Paul, T; Pauluzzi, M; Paus, C; Pauss, Felicitas; Peach, D; Pei, Y J; Pensotti, S; Perret-Gallix, D; Petersen, B; Petrak, S; Pevsner, A; Piccolo, D; Pieri, M; Pinto, J C; Piroué, P A; Pistolesi, E; Plyaskin, V; Pohl, M; Pozhidaev, V; Postema, H; Produit, N; Prokofev, D; Prokofiev, D O; Rahal-Callot, G; Raja, N; Rancoita, P G; Rattaggi, M; Raven, G; Razis, P A; Read, K; Ren, D; Rescigno, M; Reucroft, S; Van Rhee, T; Riemann, S; Riles, K; Robohm, A; Rodin, J; Roe, B P; Romero, L; Rosier-Lees, S; Rosselet, P; Van Rossum, W; Roth, S; Rubio, Juan Antonio; Ruschmeier, D; Rykaczewski, H; Salicio, J; Sánchez, E; Sanders, M P; Sarakinos, M E; Sarkar, S; Sassowsky, M; Sauvage, G; Schäfer, C; Shchegelskii, V; Schmidt-Kärst, S; Schmitz, D; Schmitz, P; Schneegans, M; Scholz, N; Schopper, Herwig Franz; Schotanus, D J; Schwenke, J; Schwering, G; Sciacca, C; Sciarrino, D; Servoli, L; Shevchenko, S; Shivarov, N; Shoutko, V; Shukla, J; Shumilov, E; Shvorob, A V; Siedenburg, T; Son, D; Sopczak, André; Soulimov, V; Smith, B; Spillantini, P; Steuer, M; Stickland, D P; Stone, H; Stoyanov, B; Strässner, A; Strauch, K; Sudhakar, K; Sultanov, G G; Sun, L Z; Susinno, G F; Suter, H; Swain, J D; Tang, X W; Tauscher, Ludwig; Taylor, L; Ting, Samuel C C; Ting, S M; Tonutti, M; Tonwar, S C; Tóth, J; Tully, C; Tuchscherer, H; Tung, K L; Uchida, Y; Ulbricht, J; Uwer, U; Valente, E; Van de Walle, R T; Vesztergombi, G; Vetlitskii, I; Viertel, Gert M; Vivargent, M; Völkert, R; Vogel, H; Vogt, H; Vorobev, I; Vorobyov, A A; Vorvolakos, A; Wadhwa, M; Wallraff, W; Wang, J C; Wang, X L; Wang, Z M; Weber, A; Wittgenstein, F; Wu, S X; Wynhoff, S; Xu, J; Xu, Z Z; Yang, B Z; Yang, C G; Yao, X Y; Ye, J B; Yeh, S C; You, J M; Zalite, A; Zalite, Yu; Zemp, P; Zeng, Y; Zhang, Z; Zhang, Z P; Zhou, B; Zhou, Y; Zhu, G Y; Zhu, R Y; Zichichi, Antonino; Ziegler, F

    1997-01-01

    A study of resonance formation is presented in the $\\pi^+\\pi^-\\pi^0$ final state in two-photon collisions at LEP. The $a_2(1320)$ radiative width is measured to be $\\Gamma_{\\gamma\\gamma}=0.98\\pm0.05\\pm0.09$ keV{}. The helicity 2 production is dominant. Exclusive $\\pi^+\\pi^-\\pi^0$ production has also been studied in the mass region above the $a_2$ in the $\\rho\\pi$ and $f_2\\pi$ channels. This region is dominated by a $\\rm J^P$=$2^+$ helicity 2 wave.

  3. Defended to the Nines: 25 Years of Resistance Gene Cloning Identifies Nine Mechanisms for R Protein Function[OPEN

    Science.gov (United States)

    2018-01-01

    Plants have many, highly variable resistance (R) gene loci, which provide resistance to a variety of pathogens. The first R gene to be cloned, maize (Zea mays) Hm1, was published over 25 years ago, and since then, many different R genes have been identified and isolated. The encoded proteins have provided clues to the diverse molecular mechanisms underlying immunity. Here, we present a meta-analysis of 314 cloned R genes. The majority of R genes encode cell surface or intracellular receptors, and we distinguish nine molecular mechanisms by which R proteins can elevate or trigger disease resistance: direct (1) or indirect (2) perception of pathogen-derived molecules on the cell surface by receptor-like proteins and receptor-like kinases; direct (3) or indirect (4) intracellular detection of pathogen-derived molecules by nucleotide binding, leucine-rich repeat receptors, or detection through integrated domains (5); perception of transcription activator-like effectors through activation of executor genes (6); and active (7), passive (8), or host reprogramming-mediated (9) loss of susceptibility. Although the molecular mechanisms underlying the functions of R genes are only understood for a small proportion of known R genes, a clearer understanding of mechanisms is emerging and will be crucial for rational engineering and deployment of novel R genes. PMID:29382771

  4. Defended to the Nines: 25 Years of Resistance Gene Cloning Identifies Nine Mechanisms for R Protein Function.

    Science.gov (United States)

    Kourelis, Jiorgos; van der Hoorn, Renier A L

    2018-02-01

    Plants have many, highly variable resistance ( R ) gene loci, which provide resistance to a variety of pathogens. The first R gene to be cloned, maize ( Zea mays ) Hm1 , was published over 25 years ago, and since then, many different R genes have been identified and isolated. The encoded proteins have provided clues to the diverse molecular mechanisms underlying immunity. Here, we present a meta-analysis of 314 cloned R genes. The majority of R genes encode cell surface or intracellular receptors, and we distinguish nine molecular mechanisms by which R proteins can elevate or trigger disease resistance: direct (1) or indirect (2) perception of pathogen-derived molecules on the cell surface by receptor-like proteins and receptor-like kinases; direct (3) or indirect (4) intracellular detection of pathogen-derived molecules by nucleotide binding, leucine-rich repeat receptors, or detection through integrated domains (5); perception of transcription activator-like effectors through activation of executor genes (6); and active (7), passive (8), or host reprogramming-mediated (9) loss of susceptibility. Although the molecular mechanisms underlying the functions of R genes are only understood for a small proportion of known R genes, a clearer understanding of mechanisms is emerging and will be crucial for rational engineering and deployment of novel R genes. © 2018 American Society of Plant Biologists. All rights reserved.

  5. Expression Analysis of Genes Related to Rice Resistance Against Brown Planthopper, Nilaparvata lugens

    Directory of Open Access Journals (Sweden)

    Panatda Jannoey

    2017-05-01

    Full Text Available Brown planthopper (BPH is an insect species that feeds on the vascular system of rice plants. To examine the defence mechanism of rice plants against BPH, the pathogenesis-related genes (PR1a, PR2, PR3, PR4, PR6, PR9, PR10a, PR13, PR15 and PRpha, signaling molecule synthesis genes (AOS, AXR, ACO and LOX, antioxidant-related genes (CAT, TRX, GST and SOD and lignin biosynthesis-related genes (CHS, CHI and C4H were investigated in a resistant rice variety. AOS, PR6, PR9 and PR15 genes showed significantly increased relative expression levels at 24.38-, 19.17-, 14.71-, and 12.74-fold compared to the control. Moderate increased relative expression levels of lignin biosynthesis-related gene (C4H, pathogenesis-related genes (PR4, PR10a and PRpha, and antioxidant-related gene (GST were found, while CHI, LOX, SOD, TRX1 and AXR showed decreased relative expression levels. It was thus clearly shown that wound-induced response genes were activated in rice plants after BPH attacks through AOS activation. Jasmonic acid signaling molecule may activate PR6, PR15, GST and CAT subsequently increasing their expression for H2O2 detoxification. PR6 were expressed at the highest relative level among the PR genes. These genes therefore have also a considerable synergistic role with the other genes against BPH by interfered their digestion tract system.

  6. Tagging of resistance gene(s) to rhizomania disease in sugar beet ...

    African Journals Online (AJOL)

    The rhizomania disease is one of the most important diseases in Iran and some other parts of the world which potentially could play a role in decreasing sugar yield in fields. One approach to combat with this disease is the use of resistance varieties. This varieties have been identified which are having resistance genes to ...

  7. A maize resistance gene functions against bacterial streak disease in rice

    OpenAIRE

    Zhao, Bingyu; Lin, Xinghua; Poland, Jesse; Trick, Harold; Leach, Jan; Hulbert, Scot

    2005-01-01

    Although cereal crops all belong to the grass family (Poacea), most of their diseases are specific to a particular species. Thus, a given cereal species is typically resistant to diseases of other grasses, and this nonhost resistance is generally stable. To determine the feasibility of transferring nonhost resistance genes (R genes) between distantly related grasses to control specific diseases, we identified a maize R gene that recognizes a rice pathogen, Xanthomonas oryzae pv. oryzicola, wh...

  8. Preparation and properties of thin films used in activity determinations with a 4 {pi} counter; Preparation et proprietes des films minces utilises dans les determinations d'activite au compteur 4 {pi}

    Energy Technology Data Exchange (ETDEWEB)

    Jannez, M.; Le Gallic, Y.; Thenard, M. [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

    1958-07-01

    Comparative study of various methods of preparing thin films, for use as source holders in the 4 {pi} counter, and of measuring their thickness. Comparative study of various properties: mechanical resistance; heat resistance; ageing; resistance of rhodopas, polystyrene, formvar and cellulose acetate films to the action of various chemical agents. (author) [French] Etude comparee de divers procedes de preparation de films minces, destines a etre utilises comme supports de sources dans le compteur 4 {pi} et de la mesure de leur epaisseur. Etude comparee de diverses proprietes: resistance mecanique; resistance a la chaleur; vieillissement; resistance a l'action de divers agents chimiques de films de rhodopas, polystyrene, formvar et acetate de cellulose. (auteur)

  9. CRISPR/Cas9-Mediated Gene Editing in Rice (Oryza sativa L. japonica cv. Katy) for Stable Resistance against Blast Fungus (Magnaporthe oryzae)

    Science.gov (United States)

    Rice blast is a recurring and devastating disease in the USA and worldwide. In the USA, the blast-resistance (R) genes found in a tropical japonica cultivar, Katy, reduce blast damages from 1990 to present. The cultivar is still used as a principal donor of blast R genes in developing numerous elit...

  10. Characterization of Vibrio parahaemolyticus isolated from oysters in Korea: Resistance to various antibiotics and prevalence of virulence genes.

    Science.gov (United States)

    Kang, Chang-Ho; Shin, YuJin; Jang, SeokCheol; Yu, HongSik; Kim, SuKyung; An, Sera; Park, Kunbawui; So, Jae-Seong

    2017-05-15

    Vibrio parahaemolyticus, found frequently in oysters, is the most prevalent gastroenteritis-causing pathogen in Korea and in several other Asian countries. This study monitored changes in the environmental parameters and occurrence of V. parahaemolyticus in oyster aquaculture sites. Of the 44 presumed V. parahaemolyticus isolates obtained, when tested against 16 antibiotics, 90.9, 86.4, and 75.0% of the 44 isolates exhibited resistance to vancomycin, ampicillin, and streptomycin, respectively. PCR analysis for the presence of the toxR gene confirmed 31 of the 44 isolates as being positive V. parahaemolyticus strains. The toxR positive isolates were tested for the presence of thermostable direct hemolysin (tdh) and tdh-related hemolysin (trh) virulence genes. Only 9.1% toxR positive isolate exhibit the trh gene and none of the isolates were tested positive for tdh. The occurrence of multi drug resistance strains in the environment could be an indication of excessive usage of antibiotics in agriculture and aquaculture fields. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Putative resistance genes in the CitEST database

    Directory of Open Access Journals (Sweden)

    Simone Guidetti-Gonzalez

    2007-01-01

    Full Text Available Disease resistance in plants is usually associated with the activation of a wide variety of defense responses to prevent pathogen replication and/or movement. The ability of the host plant to recognize the pathogen and to activate defense responses is regulated by direct or indirect interaction between the products of plant resistance (R and pathogen avirulence (Avr genes. Attempted infection of plants by avirulent pathogens elicits a battery of defenses often followed by the collapse of the challenged host cells. Localized host cell death may help to prevent the pathogen from spreading to uninfected tissues, known as hypersensitive response (HR. When either the plant or the pathogen lacks its cognate gene, activation of the plant’s defense responses fails to occur or is delayed and does not prevent pathogen colonization. In the CitEST database, we identified 1,300 reads related to R genes in Citrus which have been reported in other plant species. These reads were translated in silico, and alignments of their amino acid sequences revealed the presence of characteristic domains and motifs that are specific to R gene classes. The description of the reads identified suggests that they function as resistance genes in citrus.

  12. Observation of photon polarization in $B^\\pm \\to K^\\pm\\pi^\\mp\\pi^\\pm\\gamma$ decays

    CERN Multimedia

    Veneziano, G

    2014-01-01

    A study of the flavor-changing neutral current radiative $B^{\\pm} \\to K^{\\pm}\\pi^{\\mp}\\pi^{\\pm}\\gamma$ decays performed using data collected in proton-proton collisions with the LHCb detector at $7$ and $8\\,$TeV center-of-mass energies is presented. In this sample, corresponding to an integrated luminosity of $3\\,\\text{fb}^{-1}$, nearly $14\\,000$ signal events are reconstructed and selected, containing all possible intermediate resonances with a $K^{\\pm}\\pi^{\\mp}\\pi^{\\pm}$ final state in the $[1.1, 1.9]$\\,GeV/$c^{2}$ mass range. The distribution of the angle of the photon direction with respect to the plane defined by the final-state hadrons in their rest frame is studied in intervals of $K^{\\pm}\\pi^{\\mp}\\pi^{\\pm}$ mass and the asymmetry between the number of signal events found on each side of the plane is obtained. The first direct observation of the photon polarization in the $b \\to s\\gamma$ transition is reported with a significance of $5.2\\,\\sigma$.

  13. Pyramiding, alternating or mixing: comparative performances of deployment strategies of nematode resistance genes to promote plant resistance efficiency and durability.

    Science.gov (United States)

    Djian-Caporalino, Caroline; Palloix, Alain; Fazari, Ariane; Marteu, Nathalie; Barbary, Arnaud; Abad, Pierre; Sage-Palloix, Anne-Marie; Mateille, Thierry; Risso, Sabine; Lanza, Roger; Taussig, Catherine; Castagnone-Sereno, Philippe

    2014-02-22

    Resistant cultivars are key elements for pathogen control and pesticide reduction, but their repeated use may lead to the emergence of virulent pathogen populations, able to overcome the resistance. Increased research efforts, mainly based on theoretical studies, explore spatio-temporal deployment strategies of resistance genes in order to maximize their durability. We evaluated experimentally three of these strategies to control root-knot nematodes: cultivar mixtures, alternating and pyramiding resistance genes, under controlled and field conditions over a 3-years period, assessing the efficiency and the durability of resistance in a protected crop rotation system with pepper as summer crop and lettuce as winter crop. The choice of the resistance gene and the genetic background in which it is introgressed, affected the frequency of resistance breakdown. The pyramiding of two different resistance genes in one genotype suppressed the emergence of virulent isolates. Alternating different resistance genes in rotation was also efficient to decrease virulent populations in fields due to the specificity of the virulence and the trapping effect of resistant plants. Mixing resistant cultivars together appeared as a less efficient strategy to control nematodes. This work provides experimental evidence that, in a cropping system with seasonal sequences of vegetable species, pyramiding or alternating resistance genes benefit yields in the long-term by increasing the durability of resistant cultivars and improving the long-term control of a soil-borne pest. To our knowledge, this result is the first one obtained for a plant-nematode interaction, which helps demonstrate the general applicability of such strategies for breeding and sustainable management of resistant cultivars against pathogens.

  14. [Mechanisms of endogenous drug resistance acquisition by spontaneous chromosomal gene mutation].

    Science.gov (United States)

    Fukuda, H; Hiramatsu, K

    1997-05-01

    Endogenous resistance in bacteria is caused by a change or loss of function and generally genetically recessive. However, this type of resistance acquisition are now prevalent in clinical setting. Chromosomal genes that afford endogenous resistance are the genes correlated with the target of the drug, the drug inactivating enzymes, and permeability of the molecules including the antibacterial agents. Endogenous alteration of the drug target are mediated by the spontaneous mutation of their structural gene. This mutation provides much lower affinity of the drugs for the target. Gene expression of the inactivating enzymes, such as class C beta-lactamase, is generally regulated by regulatory genes. Spontaneous mutations in the regulatory genes cause constitutive enzyme production and provides the resistant to the agent which is usually stable for such enzymes. Spontaneous mutation in the structural gene gives the enzyme extra-spectrum substrate specificity, like ESBL (Extra-Spectrum-beta-Lactamase). Expression of structural genes encoding the permeability systems are also regulated by some regulatory genes. The spontaneous mutation of the regulatory genes reduce an amount of porin protein. This mutation causes much lower influx of the drug in the cell. Spontaneous mutation in promoter region of the structural gene of efflux protein was observed. This mutation raised the gene transcription and overproduced efflux protein. This protein progresses the drug efflux from the cell.

  15. Identification of antibiotic resistance genes in the multidrug-resistant Acinetobacter baumannii strain, MDR-SHH02, using whole-genome sequencing.

    Science.gov (United States)

    Wang, Hualiang; Wang, Jinghua; Yu, Peijuan; Ge, Ping; Jiang, Yanqun; Xu, Rong; Chen, Rong; Liu, Xuejie

    2017-02-01

    This study aimed to investigate antibiotic resistance genes in the multidrug-resistant (MDR) Acinetobacter baumannii (A. baumanii) strain, MDR-SHH02, using whole‑genome sequencing (WGS). The antibiotic resistance of MDR-SHH02 isolated from a patient with breast cancer to 19 types of antibiotics was determined using the Kirby‑Bauer method. WGS of MDR-SHH02 was then performed. Following quality control and transcriptome assembly, functional annotation of genes was conducted, and the phylogenetic tree of MDR-SHH02, along with another 5 A. baumanii species and 2 Acinetobacter species, was constructed using PHYLIP 3.695 and FigTree v1.4.2. Furthermore, pathogenicity islands (PAIs) were predicted by the pathogenicity island database. Potential antibiotic resistance genes in MDR-SHH02 were predicted based on the information in the Antibiotic Resistance Genes Database (ARDB). MDR-SHH02 was found to be resistant to all of the tested antibiotics. The total draft genome length of MDR-SHH02 was 4,003,808 bp. There were 74.25% of coding sequences to be annotated into 21 of the Clusters of Orthologous Groups (COGs) of protein terms, such as 'transcription' and 'amino acid transport and metabolism'. Furthermore, there were 45 PAIs homologous to the sequence MDRSHH02000806. Additionally, a total of 12 gene sequences in MDR-SHH02 were highly similar to the sequences of antibiotic resistance genes in ARDB, including genes encoding aminoglycoside‑modifying enzymes [e.g., aac(3)-Ia, ant(2'')‑Ia, aph33ib and aph(3')-Ia], β-lactamase genes (bl2b_tem and bl2b_tem1), sulfonamide-resistant dihydropteroate synthase genes (sul1 and sul2), catb3 and tetb. These results suggest that numerous genes mediate resistance to various antibiotics in MDR-SHH02, and provide a clinical guidance for the personalized therapy of A. baumannii-infected patients.

  16. The genetic makeup of the Drosophila piRNA pathway.

    Science.gov (United States)

    Handler, Dominik; Meixner, Katharina; Pizka, Manfred; Lauss, Kathrin; Schmied, Christopher; Gruber, Franz Sebastian; Brennecke, Julius

    2013-06-06

    The piRNA (PIWI-interacting RNA) pathway is a small RNA silencing system that acts in animal gonads and protects the genome against the deleterious influence of transposons. A major bottleneck in the field is the lack of comprehensive knowledge of the factors and molecular processes that constitute this pathway. We conducted an RNAi screen in Drosophila and identified ~50 genes that strongly impact the ovarian somatic piRNA pathway. Many identified genes fall into functional categories that indicate essential roles for mitochondrial metabolism, RNA export, the nuclear pore, transcription elongation, and chromatin regulation in the pathway. Follow-up studies on two factors demonstrate that components acting at distinct hierarchical levels of the pathway were identified. Finally, we define CG2183/Gasz as an essential primary piRNA biogenesis factor in somatic and germline cells. Based on the similarities between insect and vertebrate piRNA pathways, our results have far-reaching implications for the understanding of this conserved genome defense system. Copyright © 2013 Elsevier Inc. All rights reserved.

  17. SERPINA1 PiZ and PiS heterozygotes and lung function decline in the SAPALDIA cohort.

    Directory of Open Access Journals (Sweden)

    Gian-Andri Thun

    Full Text Available BACKGROUND: Severe alpha1-antitrypsin (AAT deficiency is a strong risk factor for COPD. But the impact of gene variants resulting in mild or intermediate AAT deficiency on the longitudinal course of respiratory health remains controversial. There is indication from experimental studies that pro-inflammatory agents like cigarette smoke can interact with these variants and thus increase the risk of adverse respiratory health effects. Therefore, we tested the effect of the presence of a protease inhibitor (Pi S or Z allele (PiMS and PiMZ on the change in lung function in different inflammation-exposed subgroups of a large, population-based cohort study. METHODOLOGY AND PRINCIPAL FINDINGS: The SAPALDIA population includes over 4600 subjects from whom SERPINA1 genotypes for S and Z alleles, spirometry and respiratory symptoms at baseline and after 11 years follow-up, as well as proxies for inflammatory conditions, such as detailed smoking history, obesity and high sensitivity C-reactive protein (hs-CRP, were available. All analyses were performed by applying multivariate regression models. There was no overall unfavourable effect of PiMS or PiMZ genotype on lung function change. We found indication that PiZ heterozygosity interacted with inflammatory stimuli leading to an accelerated decline in measures in use as indices for assessing mild airway obstruction. Obese individuals with genotype PiMM had an average annual decline in the forced mid expiratory flow (ΔFEF25-75% of 58.4 ml whereas in obese individuals with PiMZ it amounted to 92.2 ml (p = 0.03. Corresponding numbers for persistent smokers differed even more strongly (66.8 ml (PiMM vs. 108.2 ml (PiMZ, p = 0.005. Equivalent, but less strong associations were observed for the change in the FEV1/FVC ratio. CONCLUSIONS: We suggest that, in addition to the well established impact of the rare PiZZ genotype, one Z allele may be sufficient to accelerate lung function decline in population subgroups

  18. Postnatal Cardiac Gene Editing Using CRISPR/Cas9 With AAV9-Mediated Delivery of Short Guide RNAs Results in Mosaic Gene Disruption.

    Science.gov (United States)

    Johansen, Anne Katrine; Molenaar, Bas; Versteeg, Danielle; Leitoguinho, Ana Rita; Demkes, Charlotte; Spanjaard, Bastiaan; de Ruiter, Hesther; Akbari Moqadam, Farhad; Kooijman, Lieneke; Zentilin, Lorena; Giacca, Mauro; van Rooij, Eva

    2017-10-27

    CRISPR/Cas9 (clustered regularly interspaced palindromic repeats/CRISPR-associated protein 9)-based DNA editing has rapidly evolved as an attractive tool to modify the genome. Although CRISPR/Cas9 has been extensively used to manipulate the germline in zygotes, its application in postnatal gene editing remains incompletely characterized. To evaluate the feasibility of CRISPR/Cas9-based cardiac genome editing in vivo in postnatal mice. We generated cardiomyocyte-specific Cas9 mice and demonstrated that Cas9 expression does not affect cardiac function or gene expression. As a proof-of-concept, we delivered short guide RNAs targeting 3 genes critical for cardiac physiology, Myh6 , Sav1 , and Tbx20 , using a cardiotropic adeno-associated viral vector 9. Despite a similar degree of DNA disruption and subsequent mRNA downregulation, only disruption of Myh6 was sufficient to induce a cardiac phenotype, irrespective of short guide RNA exposure or the level of Cas9 expression. DNA sequencing analysis revealed target-dependent mutations that were highly reproducible across mice resulting in differential rates of in- and out-of-frame mutations. Finally, we applied a dual short guide RNA approach to effectively delete an important coding region of Sav1 , which increased the editing efficiency. Our results indicate that the effect of postnatal CRISPR/Cas9-based cardiac gene editing using adeno-associated virus serotype 9 to deliver a single short guide RNA is target dependent. We demonstrate a mosaic pattern of gene disruption, which hinders the application of the technology to study gene function. Further studies are required to expand the versatility of CRISPR/Cas9 as a robust tool to study novel cardiac gene functions in vivo. © 2017 American Heart Association, Inc.

  19. Gene Expression Profiling and Identification of Resistance Genes to Aspergillus flavus Infection in Peanut through EST and Microarray Strategies

    Directory of Open Access Journals (Sweden)

    Baozhu Guo

    2011-06-01

    Full Text Available Aspergillus flavus and A. parasiticus infect peanut seeds and produce aflatoxins, which are associated with various diseases in domestic animals and humans throughout the world. The most cost-effective strategy to minimize aflatoxin contamination involves the development of peanut cultivars that are resistant to fungal infection and/or aflatoxin production. To identify peanut Aspergillus-interactive and peanut Aspergillus-resistance genes, we carried out a large scale peanut Expressed Sequence Tag (EST project which we used to construct a peanut glass slide oligonucleotide microarray. The fabricated microarray represents over 40% of the protein coding genes in the peanut genome. For expression profiling, resistant and susceptible peanut cultivars were infected with a mixture of Aspergillus flavus and parasiticus spores. The subsequent microarray analysis identified 62 genes in resistant cultivars that were up-expressed in response to Aspergillus infection. In addition, we identified 22 putative Aspergillus-resistance genes that were constitutively up-expressed in the resistant cultivar in comparison to the susceptible cultivar. Some of these genes were homologous to peanut, corn, and soybean genes that were previously shown to confer resistance to fungal infection. This study is a first step towards a comprehensive genome-scale platform for developing Aspergillus-resistant peanut cultivars through targeted marker-assisted breeding and genetic engineering.

  20. N{sub 33}{sup *++} isobar production and isospin 2 {pi}{pi} interaction studied in the reaction {pi}{sup -} p {yields} p {pi}{sup +}{pi}{sup -}{pi}{sup -} at 2.75 GeV/c; Production de l'isobare N{sub 33}{sup *++} et interaction {pi}{pi} dans l'etat d'isospin I = 2, etudiees dans la reaction {pi}{sup -} p {yields} p {pi}{sup +}{pi}{sup -}{pi}{sup -} a 2.75 GeV/c

    Energy Technology Data Exchange (ETDEWEB)

    Alitti, J [Commissariat a l' Energie Atomique, Centre d' Etudes Nucleaires de Saclay, 91 - Gif-sur-Yvette (France)

    1967-07-01

    A study of the reaction {pi}{sup -} p {yields} p {pi}{sup +}{pi}{sup -}{pi}{sup -} at 2.75 GeV/c was carried out in an 81 cm liquid hydrogen bubble chamber at the CERN proton synchrotron. One observes that the abundant N{sub 33}{sup *++} (1236 MeV) isobar production occurs predominantly backwards in the center of mass of the reaction. This feature suggests a peripheral production mechanism with {pi} exchange. The validity of this hypothesis, which allows the study of the {pi}{sup -}{pi}{sup -} interaction within the frame of the Chew and Low model, is verified. Among other results one finds for the isospin-2 state the values of the elastic {pi}{pi} cross section and of the S and D wave phase shifts. (author) [French] Etude de la reaction {pi}{sup -} p {yields} p {pi}{sup +}{pi}{sup -}{pi}{sup -} a 2.75 GeV/c, effectuee a l'aide de la chambre a bulles a hydrogene liquide de 81 cm de Saclay exposee aupres du synchrotron a protons du CERN. On observe une abondante production de l'isobare N{sub 33}{sup *++} a 1236 MeV, lequel est emis de preference vers l'arriere dans le centre de masse de la reaction. Ceci suggere un mecanisme de production peripherique avec echange d'un {pi}. Cette hypothese dont on a mis a l'epreuve la validite permet l'etude de l'interaction {pi}{sup -}{pi}{sup -} dans le cadre du modele de Chew et Low. Entre autres resultats, on donne, pour l'etat d'isospin I = 2, les valeurs de la section efficace de diffusion elastique {pi}{pi} et les dephasages des ondes S et D. (auteur)

  1. Lunar EVA Dosimetry: Microdosimeter-Dosimeter Instrument (PI Ziegler)

    Data.gov (United States)

    National Aeronautics and Space Administration — NOTE: Former PI Vincent Pisacane retired as of 9/30/2011; James Ziegler is new PI effective 10/1/2011 and project continues, per NSBRI. See Pisacane for FY2011 and...

  2. Drosophila PAF1 Modulates PIWI/piRNA Silencing Capacity.

    Science.gov (United States)

    Clark, Josef P; Rahman, Reazur; Yang, Nachen; Yang, Linda H; Lau, Nelson C

    2017-09-11

    To test the directness of factors in initiating PIWI-directed gene silencing, we employed a Piwi-interacting RNA (piRNA)-targeted reporter assay in Drosophila ovary somatic sheet (OSS) cells [1]. This assay confirmed direct silencing roles for piRNA biogenesis factors and PIWI-associated factors [2-12] but suggested that chromatin-modifying proteins may act downstream of the initial silencing event. Our data also revealed that RNA-polymerase-II-associated proteins like PAF1 and RTF1 antagonize PIWI-directed silencing. PAF1 knockdown enhances PIWI silencing of reporters when piRNAs target the transcript region proximal to the promoter. Loss of PAF1 suppresses endogenous transposable element (TE) transcript maturation, whereas a subset of gene transcripts and long-non-coding RNAs adjacent to TE insertions are affected by PAF1 knockdown in a similar fashion to piRNA-targeted reporters. Additionally, transcription activation at specific TEs and TE-adjacent loci during PIWI knockdown is suppressed when PIWI and PAF1 levels are both reduced. Our study suggests a mechanistic conservation between fission yeast PAF1 repressing AGO1/small interfering RNA (siRNA)-directed silencing [13, 14] and Drosophila PAF1 opposing PIWI/piRNA-directed silencing. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Characterization of antimicrobial resistance genes in Haemophilus parasuis isolated from pigs in China

    Directory of Open Access Journals (Sweden)

    Yongda Zhao

    2018-04-01

    Full Text Available Background Haemophilus parasuis is a common porcine respiratory pathogen that causes high rates of morbidity and mortality in farmed swine. We performed a molecular characterization of antimicrobial resistance genes harbored by H. parasuis from pig farms in China. Methods We screened 143 H. parasuis isolates for antimicrobial susceptibility against six fluoroquinolone antibiotics testing by the broth microdilution method, and the presence of 64 antimicrobial resistance genes by PCR amplification and DNA sequence analysis. We determined quinolone resistance determining region mutations of DNA gyrase (gyrA and gyrB and topoisomerase IV (parC and parE. The genetic relatedness among the strains was analyzed by pulsed-field gel electrophoresis. Results Susceptibility test showed that all isolates were low resistance to lomefloxacin (28.67%, levofloxacin (20.28%, norfloxacin (22.38%, ciprofloxacin (23.78%, however, high resistance levels were found to nalidixic acid (82.52% and enrofloxacin (55.94%. In addition, we found 14 antimicrobial resistance genes were present in these isolates, including blaTEM-1, blaROB-1, ermB, ermA, flor, catl, tetB, tetC, rmtB, rmtD, aadA1, aac(3′-llc, sul1, and sul2 genes. Interestingly, one isolate carried five antibiotic resistance genes (tetB, tetC, flor, rmtB, sul1. The genes tetB, rmtB, and flor were the most prevalent resistance genes in H. parasuis in China. Alterations in the gyrA gene (S83F/Y, D87Y/N/H/G were detected in 81% of the strains and parC mutations were often accompanied by a gyrA mutation. Pulsed-field gel electrophoresis typing revealed 51 unique patterns in the isolates carrying high-level antibiotic resistance genes, indicating considerable genetic diversity and suggesting that the genes were spread horizontally. Discussion The current study demonstrated that the high antibiotic resistance of H. parasuis in piglets is a combination of transferable antibiotic resistance genes and multiple target

  4. The effect of Liuwei Dihuang decoction on PI3K/Akt signaling pathway in liver of type 2 diabetes mellitus (T2DM) rats with insulin resistance.

    Science.gov (United States)

    Dai, Bing; Wu, Qinxuan; Zeng, Chengxi; Zhang, Jiani; Cao, Luting; Xiao, Zizeng; Yang, Menglin

    2016-11-04

    Liuwei Dihaung decoction (LWDHT) is a well-known classic traditional Chinese medicine formula, consists of six herbs including Rehmannia glutinosa Libosch.(family: Scrophulariaceae), Cornus officinalis Sieb.(family: Cornaceae), Dioscorea opposite Thunb.(family: Dioscoreaceae), Alisma orientale(G. Samuelsson) Juz (family: Alismataceae), Poria cocos (Schw.) Wolf (family: Polyporaceae) and Paeonia suffruticosa Andrews (family: Paeoniaceae). It has been used in the treatment of many types of diseases with signs of deficiency of Yin in the kidneys in China clinically. This study is aimed at investigating the effect of Liuwei dihuang decoction on PI3K/Akt signaling pathway in liver of T2DM rats with insulin resistance. T2DM model was induced in male Sprague-Dawley (SD) rats by high sugar and high fat diets combined with small dose of streptozocin (STZ) injection. The successful T2DM rats were randomly allocated three group--vehicle group, positive control group and Liuwei Dihuang decoction group. After 12-weeks treatment with distilled water, rosiglitazone and LWDHT by intragastric administration respectively, the rats were put to death in batches. The variance of fasting blood glucose (FBG) and fasting insulin (FINS) in serum were determined, the pathological changes of each rats' liver were observed by hematoxylin-eosin (HE) staining, the expression of insulin receptor substrate 2(IRS2), phosphatidylinositol 3-kinase (PI3K) and protein kinas B (Akt) involving the canonical PI3K/Akt signaling pathway were detected by Real-time fluorescent quantitative PCR (RT-PCR), and the expression level of IRS2, PI3K, Akt protein and phosphorylated IRS2, PI3K, Akt protein were evaluated by Western Blot. All the data were analyzed by SPSS 17.0. Four weeks of treatment with LWDHT could significantly decrease the level of FBG and FINS in serum, improve the cellular morphology of liver, kidney, pancreas tissue, and the expression of IRS2, PI3K, Akt mRNA and phosphorylated IRS2, PI3K, Akt

  5. Study of the reaction {pi}{sup -}p {yields} {pi}{sup +}{pi}{sup -}n at 870 MeV; Etude de la reaction {pi}{sup -}p {yields} {pi}{sup +}{pi}{sup -}n a 870 MeV

    Energy Technology Data Exchange (ETDEWEB)

    Zsembery, J [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

    1969-07-01

    In the reaction {pi}{sup -}p {yields}{pi}{sup +}{pi}{sup -}n, we have measured the {pi}{sup +} momentum spectrum at various angles, from which the distributions (d{sup 2}{sigma}/dMd{omega}) of the ({pi}{sup -}n) system have been deduced. These distributions are compared with those obtained by a phenomenological model. This comparison allows a determination of the amplitude of the inelastic waves. It is found that the resonant waves D15 and F15 are no strongly coupled to the channel {delta}(1238) + {pi}. (author) [French] Dans la reaction {pi}{sup -}p {yields} {pi}{sup +}{pi}{sup -}n, nous avons mesure le spectre en impulsion des {pi}{sup +} a differents angles. Les distributions (d{sup 2}{sigma}/dMd{omega}) du systeme ({pi}{sup -}n) en ont ete deduites. Ces distributions sont comparees a celles obtenues par un modele phenomenologique. De la comparaison on determine l'amplitude des ondes inelastiques. Les ondes resonnantes D15 et FIS ne sont pas liees fortement a la voie {delta}(1238) + {pi}. (auteur)

  6. Are duplicated genes responsible for anthracnose resistance in common bean?

    Science.gov (United States)

    Costa, Larissa Carvalho; Nalin, Rafael Storto; Ramalho, Magno Antonio Patto; de Souza, Elaine Aparecida

    2017-01-01

    The race 65 of Colletotrichum lindemuthianum, etiologic agent of anthracnose in common bean, is distributed worldwide, having great importance in breeding programs for anthracnose resistance. Several resistance alleles have been identified promoting resistance to this race. However, the variability that has been detected within race has made it difficult to obtain cultivars with durable resistance, because cultivars may have different reactions to each strain of race 65. Thus, this work aimed at studying the resistance inheritance of common bean lines to different strains of C. lindemuthianum, race 65. We used six C. lindemuthianum strains previously characterized as belonging to the race 65 through the international set of differential cultivars of anthracnose and nine commercial cultivars, adapted to the Brazilian growing conditions and with potential ability to discriminate the variability within this race. To obtain information on the resistance inheritance related to nine commercial cultivars to six strains of race 65, these cultivars were crossed two by two in all possible combinations, resulting in 36 hybrids. Segregation in the F2 generations revealed that the resistance to each strain is conditioned by two independent genes with the same function, suggesting that they are duplicated genes, where the dominant allele promotes resistance. These results indicate that the specificity between host resistance genes and pathogen avirulence genes is not limited to races, it also occurs within strains of the same race. Further research may be carried out in order to establish if the alleles identified in these cultivars are different from those described in the literature.

  7. A novel Capsicum gene inhibits host-specific disease resistance to Phytophthora capsici.

    Science.gov (United States)

    Reeves, Gregory; Monroy-Barbosa, Ariadna; Bosland, Paul W

    2013-05-01

    A novel disease resistance inhibitor gene (inhibitor of P. capsici resistance [Ipcr]), found in the chile pepper (Capsicum annuum) variety 'New Mexico Capsicum Accession 10399' (NMCA10399), inhibits resistance to Phytophthora capsici but not to other species of Phytophthora. When a highly P. capsici-resistant variety was hybridized with NMCA10399, the resultant F1 populations, when screened, were completely susceptible to P. capsici for root rot and foliar blight disease syndromes, despite the dominance inheritance of P. capsici resistance in chile pepper. The F2 population displayed a 3:13 resistant-to-susceptible (R:S) ratio. The testcross population displayed a 1:1 R:S ratio, and a backcross population to NMCA10399 displayed complete susceptibility. These results demonstrate the presence of a single dominant inhibitor gene affecting P. capsici resistance in chile pepper. Moreover, when lines carrying the Ipcr gene were challenged against six Phytophthora spp., the nonhost resistance was not overcome. Therefore, the Ipcr gene is interfering with host-specific resistance but not the pathogen- or microbe-associated molecular pattern nonhost responses.

  8. Adipose tissue gene expression analysis reveals changes in inflammatory, mitochondrial respiratory and lipid metabolic pathways in obese insulin-resistant subjects

    Directory of Open Access Journals (Sweden)

    Soronen Jarkko

    2012-04-01

    Full Text Available Abstract Background To get insight into molecular mechanisms underlying insulin resistance, we compared acute in vivo effects of insulin on adipose tissue transcriptional profiles between obese insulin-resistant and lean insulin-sensitive women. Methods Subcutaneous adipose tissue biopsies were obtained before and after 3 and 6 hours of intravenously maintained euglycemic hyperinsulinemia from 9 insulin-resistant and 11 insulin-sensitive females. Gene expression was measured using Affymetrix HG U133 Plus 2 microarrays and qRT-PCR. Microarray data and pathway analyses were performed with Chipster v1.4.2 and by using in-house developed nonparametric pathway analysis software. Results The most prominent difference in gene expression of the insulin-resistant group during hyperinsulinemia was reduced transcription of nuclear genes involved in mitochondrial respiration (mitochondrial respiratory chain, GO:0001934. Inflammatory pathways with complement components (inflammatory response, GO:0006954 and cytokines (chemotaxis, GO:0042330 were strongly up-regulated in insulin-resistant as compared to insulin-sensitive subjects both before and during hyperinsulinemia. Furthermore, differences were observed in genes contributing to fatty acid, cholesterol and triglyceride metabolism (FATP2, ELOVL6, PNPLA3, SREBF1 and in genes involved in regulating lipolysis (ANGPTL4 between the insulin-resistant and -sensitive subjects especially during hyperinsulinemia. Conclusions The major finding of this study was lower expression of mitochondrial respiratory pathway and defective induction of lipid metabolism pathways by insulin in insulin-resistant subjects. Moreover, the study reveals several novel genes whose aberrant regulation is associated with the obese insulin-resistant phenotype.

  9. miRNA778 and SUVH6 are involved in phosphate homeostasis in Arabidopsis.

    Science.gov (United States)

    Wang, Lei; ZengJ, Hou Qing; Song, Jun; Feng, Sheng Jun; Yang, Zhi Min

    2015-09-01

    microRNAs (miRNAs) play an important role in plant adaptation to phosphate (Pi) starvation. Histone methylation can remodel chromatin structure and mediate gene expression. This study identified Arabidopsis miR778, a Pi-responsive miRNA, and its target gene Su(var) 3-9 homologs 6 (SUVH6) encoding a histone H3 lysine 9 (H3K9) methyltransferase. Overexpression of miR778 moderately enhanced primary and lateral root growth, free phosphate accumulation in shoots, and accumulation of anthocyanin under Pi deficient conditions. miR778 overexpression relieved the arrest of columella cell development under Pi starvation. Conversely, transgenic plants overexpressing a miR778-target mimic (35S::MIM778), that act as a sponge and sequesters miR778, showed opposite phenotypes of 35S::miR778 plants under Pi deficiency. Expression of several Pi deficiency-responsive genes such as miR399, Phosphate Transporter (PHT1;4), Low Phosphate-Resistant1 (LPR1) and Production of Anthocyanin Pigment 1 (PAP1) were elevated in the miR778 overexpressing plants, suggesting that both miR778 and SUVH6 are involved in phosphate homeostasis in plants. This study has provided a basis for further investigation on how SUVH6 regulates its downstream genes through chromatin remodeling and DNA methylation in plants stressed by Pi deficiency. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  10. The Plasmid Complement of Lactococcus lactis UC509.9 Encodes Multiple Bacteriophage Resistance Systems

    Science.gov (United States)

    Ainsworth, Stuart; Mahony, Jennifer

    2014-01-01

    Lactococcus lactis subsp. cremoris strains are used globally for the production of fermented dairy products, particularly hard cheeses. Believed to be of plant origin, L. lactis strains that are used as starter cultures have undergone extensive adaptation to the dairy environment, partially through the acquisition of extrachromosomal DNA in the form of plasmids that specify technologically important phenotypic traits. Here, we present a detailed analysis of the eight plasmids of L. lactis UC509.9, an Irish dairy starter strain. Key industrial phenotypes were mapped, and genes that are typically associated with lactococcal plasmids were identified. Four distinct, plasmid-borne bacteriophage resistance systems were identified, including two abortive infection systems, AbiB and AbiD1, thereby supporting the observed phage resistance of L. lactis UC509.9. AbiB escape mutants were generated for phage sk1, which were found to carry mutations in orf6, which encodes the major capsid protein of this phage. PMID:24814781

  11. CXCL12 gene silencing down-regulates metastatic potential via blockage of MAPK/PI3K/AP-1 signaling pathway in colon cancer.

    Science.gov (United States)

    Ma, J; Su, H; Yu, B; Guo, T; Gong, Z; Qi, J; Zhao, X; Du, J

    2018-01-05

    To investigate the effect of CXCL12 gene silencing on proliferation,invasion, angiogenesis and the relationship of MAPK/PI3K/AP-1 signaling pathway in colon cancer cells. RT-PCR and Western-blot were used to detect the expression of CXCL12 mRNA and protein in four colon cancer cell lines. Human colon cancer cells were transfected with CXCL12 siRNA carrying by Lipofectamine 2000. The expression of CXCL12 protein was confirmed by immunoblotting. WST-1, invasion and angiogenesis assay were used to examine the effect on proliferation, invasion and angiogenesis in colon cancer cells after CXCL12 siRNA silence, respectively. The phosphorylation of MAPK/PI3K/AP-1 protein levels was detected by Western blotting in CXCL12 siRNA suppression DLD-1 cell. CXCL12 mRNA and proteins were only expressed in DLD-1 colon cancer cell lines. CXCL12 siRNA were transfected into DLD-1 cells, the expression CXCL12 proteins was significantly inhibited (P colon cancer cell. The silencing CXCL12 gene significantly inhibits the proliferation, invasion and angiogenesis ability of some types colon carcinoma cells through down-regulation of MAPK/PI3K/AP-1 signaling pathway.

  12. Environmental cycle of antibiotic resistance encoded genes: A systematic review

    Directory of Open Access Journals (Sweden)

    R. ghanbari

    2017-12-01

    Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.

  13. Precision measurement of the ratio BR(K{sub S{yields}{pi}}{sup +{pi}-}e{sup +}e{sup -})/BR(K{sub L{yields}{pi}}{sup +{pi}-{pi}}{sub D}{sup 0})

    Energy Technology Data Exchange (ETDEWEB)

    Batley, J.R. [Cavendish Laboratory, University of Cambridge, Cambridge, CB3 0HE (United Kingdom); Kalmus, G.E. [Cavendish Laboratory, University of Cambridge, Cambridge, CB3 0HE (United Kingdom); Rutherford Appleton Laboratory, Chilton, Didcot, OX11 0QX (United Kingdom); Lazzeroni, C. [Cavendish Laboratory, University of Cambridge, Cambridge, CB3 0HE (United Kingdom); School of Physics and Astronomy, University of Birmingham, Birmingham B15 2TT (United Kingdom); Munday, D.J. [Cavendish Laboratory, University of Cambridge, Cambridge, CB3 0HE (United Kingdom); Patel, M. [Cavendish Laboratory, University of Cambridge, Cambridge, CB3 0HE (United Kingdom); Imperial College London, Blackett Laboratory, Physics Department, Prince Consort Road, London SW7 2AZ (United Kingdom); Slater, M.W. [Cavendish Laboratory, University of Cambridge, Cambridge, CB3 0HE (United Kingdom); School of Physics and Astronomy, University of Birmingham, Birmingham B15 2TT (United Kingdom); Wotton, S.A. [Cavendish Laboratory, University of Cambridge, Cambridge, CB3 0HE (United Kingdom); Arcidiacono, R. [CERN, CH-1211 Geneve 23 (Switzerland); Sezione dell' INFN di Torino, I-10125 Torino (Italy); Dipartimento di Fisica Sperimentale dell' Universita, I-10125 Torino (Italy); Bocquet, G.; Ceccucci, A. [CERN, CH-1211 Geneve 23 (Switzerland); Cundy, D. [CERN, CH-1211 Geneve 23 (Switzerland); Istituto di Cosmogeofisica del CNR di Torino, I-10133 Torino (Italy); Doble, N. [CERN, CH-1211 Geneve 23 (Switzerland); Sezione dell' INFN di Pisa, I-56100 Pisa (Italy); Dipartimento di Fisica dell' Universita, I-56100 Pisa (Italy); Falaleev, V.; Gatignon, L.; Gonidec, A.; Grafstroem, P.; Kubischta, W. [CERN, CH-1211 Geneve 23 (Switzerland); Marchetto, F. [CERN, CH-1211 Geneve 23 (Switzerland); Sezione dell' INFN di Torino, I-10125 Torino (Italy); Mikulec, I. [CERN, CH-1211 Geneve 23 (Switzerland); Osterreichische Akademie der Wissenschaften, Institut fuer Hochenergiephysik, A-10560 Wien (Austria)

    2011-01-03

    The K{sub S{yields}{pi}}{sup +{pi}-}e{sup +}e{sup -} decay mode was investigated using the data collected in 2002 by the NA48/1 Collaboration. With about 23 k K{sub S{yields}{pi}}{sup +{pi}-}e{sup +}e{sup -} events and 59 k K{sub L{yields}{pi}}{sup +{pi}-{pi}}{sub D}{sup 0} normalization decays, the K{sub S{yields}{pi}}{sup +{pi}-}e{sup +}e{sup -} branching ratio relative to the K{sub L{yields}{pi}}{sup +{pi}-{pi}}{sub D}{sup 0} one was determined to be BR(K{sub S{yields}{pi}}{sup +{pi}-}e{sup +}e{sup -})/BR(K{sub L{yields}{pi}}{sup +{pi}-{pi}}{sub D}{sup 0})=(3.28{+-}0.06{sub stat{+-}}0.04{sub syst})x10{sup -2}. This result was used to set the upper limit |g{sub E1}/g{sub BR}|<3.0 at 90% CL on the presence, in the decay amplitude, of an E1 direct emission (g{sub E1}) term relative to the dominant inner bremsstrahlung (g{sub BR}) term. The CP-violating asymmetry A{sub {phi}} in the sin{phi}cos{phi} distribution of K{sub S{yields}{pi}}{sup +{pi}-}e{sup +}e{sup -} events, where {phi} is the angle between the {pi}{sup +{pi}-} and the e{sup +}e{sup -} decay planes in the kaon centre of mass, was found to be A{sub {phi}=}(-0.4{+-}0.8)%, consistent with zero. These results are in good agreement with a description of the K{sub S{yields}{pi}}{sup +{pi}-}e{sup +}e{sup -} decay amplitude dominated by the CP-even inner bremsstrahlung process.

  14. The relationship between codon usage bias and cold resistant genes

    International Nuclear Information System (INIS)

    Barozai, M.Y.; Din, M.

    2014-01-01

    This research is based on synonymous codon usage which has been well-known as a feature that affects typical expression level of protein in an organism. Different organisms prefer different codons for same amino acid and this is called Codon Usage Bias (CUB). The codon usage directly affects the level or even direction of changes in protein expression in responses to environmental stimuli. Cold stress is a major abiotic factor that limits the agricultural productivity of plants. In the recent study CUB has been studied in Arabidopsis thaliana cold resistant and housekeeping genes and their homologs in rice (Oryza sativa) to understand the cold stress and housekeeping genes relation with CUB. Six cold resistant and three housekeeping genes in Arabidopsis thaliana and their homologs in rice, were subjected to CUB analysis. The three cold resistant genes (DREB1B, RCI and MYB15) showed more than 50% (52%, 61% and 66% respectively) similar codon usage bias for Arabidopsis thaliana and rice. On the other hand three cold resistant genes (MPK3, ICE1 and ZAT12) showed less than 50% (38%, 38% and 47% respectively) similar codon usage bias for Arabidopsis thaliana and rice. The three housekeeping genes (Actin, Tubulin and Ubiquitin) showed 76% similar codon usage bias for Arabidopsis thaliana and rice. This study will help to manage the plant gene expression through codon optimization under the cold stress. (author)

  15. Observation of the decay B-s(0) -> phi pi(+)pi(-) and evidence for B-0 -> phi pi(+)pi(-)

    NARCIS (Netherlands)

    Aaij, R.; Adeva, B.; Adinolfi, M.; Ajaltouni, Z.; Akar, S.; Albrecht, J.; Alessio, F.; Alexander, M.; Ali, S.; Alkhazov, G.; Cartelle, P. Alvarez; Alves, A. A.; Amato, S.; Amerio, S.; Amhis, Y.; An, L.; Anderlini, L.; Andreassi, G.; Andreotti, M.; Andrews, J. E.; Appleby, R. B.; Archilli, F.; d'Argent, P.; Romeu, J. Arnau; Artamonov, A.; Artuso, M.; Aslanides, E.; Auriemma, G.; Baalouch, M.; Babuschkin, I.; Bachmann, S.; Back, J. J.; Badalov, A.; Baesso, C.; Baker, S.; Baldini, W.; Barlow, R. J.; Barschel, C.; Barsuk, S.; Barter, W.; Baszczyk, M.; Batozskaya, V.; Batsukh, B.; Battista, V.; Beaucourt, L.; Beddow, J.; Dufour, L.; Onderwater, C. J. G.; Pellegrino, A.; Tolk, S.

    2017-01-01

    The first observation of the rare decay B-s(0) -> phi pi(+) pi(-) and evidence for B-0 -> phi pi(+) pi(-) are reported, using pp collision data recorded by the LHCb detector at center-of-mass energies root s = 7 and 8 TeV, corresponding to an integrated luminosity of 3 fb(-1). The branching

  16. Housefly Larva Vermicomposting Efficiently Attenuates Antibiotic Resistance Genes in Swine Manure, with Concomitant Bacterial Population Changes.

    Science.gov (United States)

    Wang, Hang; Li, Hongyi; Gilbert, Jack A; Li, Haibo; Wu, Longhua; Liu, Meng; Wang, Liling; Zhou, Qiansheng; Yuan, Junxiang; Zhang, Zhijian

    2015-11-01

    Manure from swine treated with antimicrobials as feed additives is a major source for the expansion of the antibiotic resistance gene (ARG) reservoir in the environment. Vermicomposting via housefly larvae (Musca domestica) can be efficiently used to treat manure and regenerate biofertilizer, but few studies have investigated its effect on ARG attenuation. Here, we tracked the abundances of 9 ARGs and the composition and structure of the bacterial communities in manure samples across 6 days of full-scale manure vermicomposting. On day 6, the abundances of genes encoding tetracycline resistance [tet(M), tet(O), tet(Q), and tet(W)] were reduced (P biofertilizer in agroecosystems. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  17. Distribution of different efflux pump genes in clinical isolates of multidrug-resistant Acinetobacter baumannii and their correlation with antimicrobial resistance.

    Science.gov (United States)

    Lin, Ming-Feng; Lin, Yun-You; Tu, Chi-Chao; Lan, Chung-Yu

    2017-04-01

    Efflux pumps are one of the major mechanisms of antimicrobial resistance in Acinetobacter baumannii. This study aimed to understand the distribution of different types of pump genes in clinical isolates of multidrug-resistant A. baumannii (MDRAB) and to reveal the relationship between their presence and expression with antimicrobial resistance. MDRAB isolates were collected from five hospitals in Taiwan. Different categories of pump genes, including adeB, adeJ, macB, abeM, abeS, emrA-like, emrB-like, and craA, were chosen, and their presence in the collected isolates was determined. Three induced resistant strains of A. baumannii ATCC 17978 to tigecycline, imipenem, and amikacin were also included. The expressions of the selected pump genes were determined using quantitative reverse transcription-polymerase chain reaction. Twenty-one MDRAB clinical isolates were obtained from five hospitals. All of the studied pump genes were present in the collected MDRAB isolates except one isolate that lacked the emrA-like gene. The gene expression of these efflux pumps was variable among the strains. The upregulation of the adeB, adeJ, and macB genes was responsible for tigecycline resistance, and the increased abeS expression was strongly related to amikacin resistance. Of all the antibiotics studied, tigecycline was the strongest inducer of gene expression for many efflux pumps in A. baumannii. Efflux pump genes are universally present in the collected clinical MDRAB isolates. The upregulation of the adeB, adeJ, macB and abeS genes is more related with antibiotic resistance. Copyright © 2015. Published by Elsevier B.V.

  18. Dual effects of the PI3K inhibitor ZSTK474 on multidrug efflux pumps in resistant cancer cells.

    Science.gov (United States)

    Muthiah, Divya; Callaghan, Richard

    2017-11-15

    ZSTK474 is a potent phosphoinositide 3-kinase (PI3K) inhibitor that reduces cell proliferation via G 1 -arrest. However, there is little information on the susceptibility of this anticancer drug to resistance conferred by the multidrug pumps P-glycoprotein (ABCB1) and ABCG2. We have demonstrated that ZSTK474 generated cytotoxicity in cells over-expressing either pump with potency similar to that in drug sensitive cells. In addition, the co-administration of ZSTK474 with the cytotoxic anti-cancer drugs vinblastine and mitoxantrone caused a potentiated cytotoxic effect in both drug sensitive and efflux pump expressing cells. These observations suggest that ZSTK474 is unaffected by the presence of multidrug efflux pumps and may circumvent their activities. Indeed, ZSTK474 increased the cellular accumulation of calcein-AM and mitoxantrone in cells expressing ABCB1 and ABCG2, respectively. ZSTK474 treatment also resulted in reduced expression of both efflux pumps in multidrug resistant cancer cells. Measurement of ABCB1 or ABCG2 mRNA levels demonstrated that the reduction was not due to altered transcription. Similarly, inhibitor studies showed that the proteasomal degradation pathway for ABCB1 and the lysosomal route for ABCG2 degradation were unaffected by ZSTK474. Thus the mechanism underlying reduced ABCB1 and ABCG2 levels caused by ZSTK474 was due to a reduction in overall protein synthesis; a process influenced by the PI3K pathway. In summary, ZSTK474 is not susceptible to efflux by the resistance mediators ABCB1 and ABCG2. Moreover, it inhibits the drug transport function of the pumps and leads to a reduction in their cellular expression levels. Our observations demonstrate that ZSTK474 is a powerful anticancer drug. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Search Engine for Antimicrobial Resistance: A Cloud Compatible Pipeline and Web Interface for Rapidly Detecting Antimicrobial Resistance Genes Directly from Sequence Data.

    Science.gov (United States)

    Rowe, Will; Baker, Kate S; Verner-Jeffreys, David; Baker-Austin, Craig; Ryan, Jim J; Maskell, Duncan; Pearce, Gareth

    2015-01-01

    Antimicrobial resistance remains a growing and significant concern in human and veterinary medicine. Current laboratory methods for the detection and surveillance of antimicrobial resistant bacteria are limited in their effectiveness and scope. With the rapidly developing field of whole genome sequencing beginning to be utilised in clinical practice, the ability to interrogate sequencing data quickly and easily for the presence of antimicrobial resistance genes will become increasingly important and useful for informing clinical decisions. Additionally, use of such tools will provide insight into the dynamics of antimicrobial resistance genes in metagenomic samples such as those used in environmental monitoring. Here we present the Search Engine for Antimicrobial Resistance (SEAR), a pipeline and web interface for detection of horizontally acquired antimicrobial resistance genes in raw sequencing data. The pipeline provides gene information, abundance estimation and the reconstructed sequence of antimicrobial resistance genes; it also provides web links to additional information on each gene. The pipeline utilises clustering and read mapping to annotate full-length genes relative to a user-defined database. It also uses local alignment of annotated genes to a range of online databases to provide additional information. We demonstrate SEAR's application in the detection and abundance estimation of antimicrobial resistance genes in two novel environmental metagenomes, 32 human faecal microbiome datasets and 126 clinical isolates of Shigella sonnei. We have developed a pipeline that contributes to the improved capacity for antimicrobial resistance detection afforded by next generation sequencing technologies, allowing for rapid detection of antimicrobial resistance genes directly from sequencing data. SEAR uses raw sequencing data via an intuitive interface so can be run rapidly without requiring advanced bioinformatic skills or resources. Finally, we show that SEAR

  20. The cfr and cfr-like multiple resistance genes

    DEFF Research Database (Denmark)

    Vester, Birte

    2018-01-01

    . The cfr gene is found in various bacteria in many geographical locations and placed on plasmids or associated with transposons. Cfr-related genes providing similar resistance have been identified in Bacillales, and now also in the pathogens Clostridium difficile and Enterococcus faecium. In addition......, the presence of the cfr gene has been detected in harbours and food markets....

  1. Study of B{sup {+-}} {yields} K{sup {+-}}{pi}{sup 0} and B{sup {+-}} {yields} {pi}{sup {+-}}{pi}{sup 0} decay modes with the BABAR detector and constraints from B {yields} {pi}{pi}, K{pi}, KK modes on the CKM matrix; Etude des desintegrations B{sup {+-}} {yields} K{sup {+-}}{pi}{sup 0} et B{sup {+-}} {yields} {pi}{sup {+-}}{pi}{sup 0} avec le detecteur BABAR et contraintes des modes B {yields} {pi}{pi}, K{pi}, KK sur la matrice CKM

    Energy Technology Data Exchange (ETDEWEB)

    Malcles, J

    2006-04-15

    The analysis of B{sup {+-}} {yields} pi{sup {+-}}{pi}{sup 0} and B{sup {+-}} {yields} K{sup {+-}}{pi}{sup 0} modes has been done with a sample of 227 millions of B pairs corresponding to 205 fb{sup -1} of data collected between october 1999 and july 2004 with the BABAR detector. The branching ratios and CP asymmetries obtained are: Br({pi}{pi}{sup 0}) = (5.57 {+-} 0.60 {+-} 0.33)*10{sup -6}; Br(K{pi}{sup 0}) (11.50 {+-} 0.65 {+-} 0.57)*10{sup -6}; A({pi}{pi}{sup 0}) = (-0.007 {+-} 0.104 {+-} 0.023); and A(K{pi}{sup 0}) = (0.066 {+-} 0.055 {+-} 0.010). The constraints on the angle alpha of the unitarity triangle have been derived from the isospin analysis of B {yields} {pi}{pi} modes. The isospin symmetry has also been used to relate B {yields} K{pi} modes in order to constraint the CKM matrix. More significant constraints have been obtained with the SU(3) symmetry for B, Bs {yields} {pi}{pi}/ K{pi}/ KK modes. They are in good agreement with the Standard CKM fit. It has been shown that such an analysis will be competitive with the Standard CKM fit in the future and will allow to determine SU(3) breaking or New Physics parameters from data. (author)

  2. Search for the Rare Decay B to pi l+ l-

    Energy Technology Data Exchange (ETDEWEB)

    Aubert, B.

    2006-09-26

    The authors present results of a search for the rare flavor-changing neutral-current decay B {yields} {pi}{ell}{sup +}{ell}{sup -}, based on a data sample corresponding to 209 fb{sup -1} of integrated luminosity collected with the BABAR detector at the PEP-II B Factory. They reconstruct the four exclusive B decay modes B{sup +} {yields} {pi}{sup +}{ell}{sup +}{ell}{sup -} and B{sup 0} {yields} {pi}{sup 0}{ell}{sup +}{ell}{sup -}, where {ell} is either an e or {mu}. They find no evidence for a signal, and they obtain the upper limit at 90% confidence level on the lepton-flavor-averaged branching fraction to be {Beta}(B{sup +} {yields} {pi}{sup +}{ell}{sup +}{ell}{sup -}) = 2 x {tau}B{sup +}/{tau}B{sup 0} {Beta}(B{sup 0} {yields} {pi}{sup 0}{ell}{sup +}{ell}{sup -}) < 7.9 x 10{sup -8}. The authors also obtain an upper limit at 90% confidence level on the lepton-flavor-violating decay B {yields} {pi}e{mu} of {Beta}(B {yields} {pi}e{mu}) < 9.8 x 10{sup -8}.

  3. Empirical parameterization of the $K^{\\pm} \\to \\pi^{\\pm}\\pi^{0}\\pi^{0}$ decay Dalitz plot

    CERN Document Server

    Batley, J R

    2010-01-01

    As first observed by the NA48/2 experiment at the CERN SPS, the $\\pi^{0}\\pi^{0}$ invariant mass ($M_{00}$) distribution from $K^{\\pm} \\rightarrow \\pi^{\\pm}\\pi^{0}\\pi^{0}$ decay shows a cusp-like anomaly at $M_{00}=2m_{+}$, where $m_{+}$ is the charged pion mass. An analysis to extract the $\\pi\\pi$ scattering lengths in the isospin $I=0$ and $I=2$ states, $a_{0}$ and $a_{2}$, respectively, has been recently reported. In the present work the Dalitz plot of this decay is fitted to a new empirical parameterization suitable for practical purposes, such as Monte Carlo simulations of $K^{\\pm} \\rightarrow \\pi^{\\pm}\\pi^{0}\\pi^{0}$ decays.

  4. Activation of Pathogenesis-related Genes by the Rhizobacterium, Bacillus sp. JS, Which Induces Systemic Resistance in Tobacco Plants.

    Science.gov (United States)

    Kim, Ji-Seong; Lee, Jeongeun; Lee, Chan-Hui; Woo, Su Young; Kang, Hoduck; Seo, Sang-Gyu; Kim, Sun-Hyung

    2015-06-01

    Plant growth promoting rhizobacteria (PGPR) are known to confer disease resistance to plants. Bacillus sp. JS demonstrated antifungal activities against five fungal pathogens in in vitro assays. To verify whether the volatiles of Bacillus sp. JS confer disease resistance, tobacco leaves pre-treated with the volatiles were damaged by the fungal pathogen, Rhizoctonia solani and oomycete Phytophthora nicotianae. Pre-treated tobacco leaves had smaller lesion than the control plant leaves. In pathogenesis-related (PR) gene expression analysis, volatiles of Bacillus sp. JS caused the up-regulation of PR-2 encoding β-1,3-glucanase and acidic PR-3 encoding chitinase. Expression of acidic PR-4 encoding chitinase and acidic PR-9 encoding peroxidase increased gradually after exposure of the volatiles to Bacillus sp. JS. Basic PR-14 encoding lipid transfer protein was also increased. However, PR-1 genes, as markers of salicylic acid (SA) induced resistance, were not expressed. These results suggested that the volatiles of Bacillus sp. JS confer disease resistance against fungal and oomycete pathogens through PR genes expression.

  5. Mapping and marker-assisted selection of a brown planthopper resistance gene bph2 in rice (Oryza sativa L.).

    Science.gov (United States)

    Sun, Li-Hong; Wang, Chun-Ming; Su, Chang-Chao; Liu, Yu-Qiang; Zhai, Hu-Qu; Wan, Jian-Min

    2006-08-01

    Nilaparvata lugens Stål (brown planthopper, BPH), is one of the major insect pests of rice (Oryza sativa L.) in the temperate rice-growing region. In this study, ASD7 harboring a BPH resistance gene bph2 was crossed to a susceptible cultivar C418, a japonica restorer line. BPH resistance was evaluated using 134 F2:3 lines derived from the cross between "ASD7" and "C418". SSR assay and linkage analysis were carried out to detect bph2. As a result, the resistant gene bph2 in ASD7 was successfully mapped between RM7102 and RM463 on the long arm of chromosome 12, with distances of 7.6 cM and 7.2 cM, respectively. Meanwhile, both phenotypic selection and marker-assisted selection (MAS) were conducted in the BC1F1 and BC2F1 populations. Selection efficiencies of RM7102 and RM463 were determined to be 89.9% and 91.2%, respectively. It would be very beneficial for BPH resistance improvement by using MAS of this gene.

  6. Tagging and mapping of SSR marker for rust resistance gene in lentil (Lens culinaris Medikus subsp. culinaris).

    Science.gov (United States)

    Dikshit, H K; Singh, Akanksha; Singh, D; Aski, M; Jain, Neelu; Hegde, V S; Basandrai, A K; Basandrai, D; Sharma, T R

    2016-06-01

    Lentil, as an economical source of protein, minerals and vitamins, plays important role in nutritional security of the common man. Grown mainly in West Asia, North Africa (WANA) region and South Asia, it suffers from several biotic stresses such as wilt, rust, blight and broomrape. Lentil rust caused by autoecious fungus Uromyces viciae fabae (Pers.) Schroet is a serious lentil disease in Algeria, Bangladesh, Ethiopia, India, Italy, Morocco, Pakistan and Nepal. The disease symptoms are observed during flowering and early podding stages. Rust causes severe yield losses in lentil. It can only be effectively controlled by identifying the resistant source, understanding its inheritance and breeding for host resistance. The obligate parasitic nature of pathogen makes it difficult to maintain the pathogen in culture and to apply it to screen segregating progenies under controlled growth conditions. Hence, the use of molecular markers will compliment in identification of resistant types in different breeding programs. Here, we studied the inheritance of resistance to rust in lentil using F₁, F₂ and F₂:₃ from cross PL 8 (susceptible) x L 4149 (resistant) varieties. The phenotyping of lentil population was carried out at Sirmour, India. The result of genetic analysis revealed that a single dominant gene controls rust resistance in lentil genotype L 4149. The F2 population from this cross was used to tag and map the rust resistance gene using SSR and SRAP markers. Markers such as 270 SRAP and 162 SSR were studied for polymorphism and 101 SRAP and 33 SSRs were found to be polymorphic between the parents. Two SRAP and two SSR markers differentiated the resistant and susceptible bulks. SSR marker Gllc 527 was estimated to be linked to rust resistant locus at a distance of 5.9 cM. The Gllc 527 marker can be used for marker assisted selection for rust resistance; however, additional markers closer to rust resistant locus are required. The markers linked to the rust

  7. Alterations of the genes involved in the PI3K and estrogen-receptor pathways influence outcome in human epidermal growth factor receptor 2-positive and hormone receptor-positive breast cancer patients treated with trastuzumab-containing neoadjuvant chemotherapy

    International Nuclear Information System (INIS)

    Takada, Mamoru; Miyazaki, Masaru; Sato-Otsubo, Aiko; Ogawa, Seishi; Kaneko, Yasuhiko; Higuchi, Toru; Tozuka, Katsunori; Takei, Hiroyuki; Haruta, Masayuki; Watanabe, Junko; Kasai, Fumio; Inoue, Kenichi; Kurosumi, Masafumi

    2013-01-01

    Chemotherapy with trastuzumab is widely used for patients with human epidermal growth factor receptor 2-positive (HER2+) breast cancer, but a significant number of patients with the tumor fail to respond, or relapse. The mechanisms of recurrence and biomarkers that indicate the response to the chemotherapy and outcome are not fully investigated. Genomic alterations were analyzed using single-nucleotide polymorphism arrays in 46 HER2 immunohistochemistry (IHC) 3+ or 2+/fluorescent in situ hybridization (FISH)+ breast cancers that were treated with neoadjuvant chemotherapy with paclitaxel, cyclophosphamid, epirubicin, fluorouracil, and trastuzumab. Patients were classified into two groups based on presence or absence of alterations of 65 cancer-associated genes, and the two groups were further classified into four groups based on genomic HER2 copy numbers or hormone receptor status (HR+/−). Pathological complete response (pCR) and relapse-free survival (RFS) rates were compared between any two of the groups. The pCR rate was 54% in 37 patients, and the RFS rate at 3 years was 72% (95% CI, 0.55-0.89) in 42 patients. The analysis disclosed 8 tumors with nonamplified HER2 and 38 tumors with HER2 amplification, indicating the presence of discordance in tumors diagnosed using current HER2 testing. The 8 patients showed more difficulty in achieving pCR (P=0.019), more frequent relapse (P=0.018), and more frequent alterations of genes in the PI3K pathway (P=0.009) than the patients with HER2 amplification. The alterations of the PI3K and estrogen receptor (ER) pathway genes generally indicated worse RFS rates. The prognostic significance of the alterations was shown in patients with a HR+ tumor, but not in patients with a HR- tumor when divided. Alterations of the PI3K and ER pathway genes found in patients with a HR+ tumor with poor outcome suggested that crosstalk between the two pathways may be involved in resistance to the current chemotherapy with trastuzumab. We

  8. Cas9-triggered chain ablation of cas9 as a gene drive brake

    OpenAIRE

    Wu, Bing; Luo, Liqun; Gao, Xiaojing J.

    2016-01-01

    With the advent of clustered, regularly interspaced, short palindromic repeats (CRISPR)–CRISPR-associated protein 9 (Cas9) technology, researchers can construct gene drives that can bias the inheritance of edited alleles to alter entire populations. As demonstrated with the mutagenic chain reaction in Drosophila4, the CRISPR-Cas9 system can propagate genomic modification together with the genome-editing machinery itself. Although gene drives might have the potential to control insect-borne di...

  9. New insights into Notch1 regulation of the PI3K-AKT-mTOR1 signaling axis: targeted therapy of γ-secretase inhibitor resistant T-cell acute lymphoblastic leukemia.

    Science.gov (United States)

    Hales, Eric C; Taub, Jeffrey W; Matherly, Larry H

    2014-01-01

    T-cell acute lymphoblastic leukemia (T-ALL) is characterized as a high-risk stratified disease associated with frequent relapse, chemotherapy resistance, and a poorer prognostic outlook than B-precursor ALL. Many of the challenges in treating T-ALL reflect the lack of prognostic cytogenetic or molecular abnormalities on which to base therapy, including targeted therapy. Notch1 activating mutations were identified in more than 50% of T-ALL cases and can be therapeutically targeted with γ-secretase inhibitors (GSIs). Mutant Notch1 can activate cMyc and PI3K-AKT-mTOR1 signaling in T-ALL. In T-ALLs with wild-type phosphatase and tensin homolog deleted on chromosome ten (PTEN), Notch1 transcriptionally represses PTEN, an effect reversible by GSIs. Notch1 also promotes growth factor receptor (IGF1R and IL7Rα) signaling to PI3K-AKT. Loss of PTEN is common in primary T-ALLs due to mutation or posttranslational inactivation and results in chronic activation of PI3K-AKT-mTOR1 signaling, GSI-resistance, and repression of p53-mediated apoptosis. Notch1 itself might regulate posttranslational inactivation of PTEN. PP2A is activated by Notch1 in PTEN-null T-ALL cells, and GSIs reduce PP2A activity and increase phosphorylation of AKT, AMPK, and p70S6K. This review focuses on the central role of the PI3K-AKT-mTOR1 signaling in T-ALL, including its regulation by Notch1 and potential therapeutic interventions, with emphasis on GSI-resistant T-ALL. © 2013.

  10. Antibiotic resistance and resistance genes in Escherichia coli from poultry farms, southwest Nigeria

    OpenAIRE

    Adelowo, Olawale O.; Fagade, Obasola E.; Agersø, Yvonne

    2014-01-01

    Introduction: This study investigated the mechanisms of resistance in 36 E. coli isolated from waste, litter, soil and water samples collected from poultry farms in Southwestern Nigeria. Methodology: Minimum inhibitory concentration (MIC) distributions of the isolates were determined using the methods of the Clinical and Laboratory Standard Institute and resistance genes detected by PCR. Results: A total of 30 isolates (94%) showed resistance to more than one antimicrobial. Percentage resista...

  11. In vitro and intra-macrophage gene expression by Rhodococcus equi strain 103.

    Science.gov (United States)

    Rahman, Md Tanvir; Parreira, Valeria; Prescott, John F

    2005-09-30

    Rhodococcus equi is a facultative intracellular respiratory pathogen of foals that persists and multiplies within macrophages. In foals, virulence is associated with 80-90 kb plasmids, which include a pathogenicity island (PI) containing the virulence-associated protein (vap) gene family, but detailed understanding of the basis of virulence is still poor. A 60 spot-based DNA microarray was developed containing eight PI genes and 42 chromosomal putative virulence or virulence-associated genes selected from a recent partial genome sequence in order to study transcription of these genes by R. equi grown inside macrophages and under in vitro conditions thought to simulate those of macrophages. In addition to seven PI genes, nine chromosomal genes involved in fatty acid and lipid metabolism (choD, fadD13, fbpB), heme biosynthesis (hemE), iron utilization (mbtF), heat shock resistance and genes encoding chaperones (clpB, groEL), a sigma factor (sigK), and a transcriptional regulator (moxR) were significantly induced in R. equi growing inside macrophages. The pattern of R. equi chromosomal genes significantly transcribed inside macrophages largely differed from those transcribed under in vitro conditions (37 degrees C, pH 5.0 or 50mM H2O2 for 30 min). This study has identified genes, other than those of the virulence plasmid, the transcription of which is enhanced within equine macrophages. These genes should be investigated further to improve understanding of how this organism survives intracellularly.

  12. Resistência de soja a insetos: IV. Comportamento de cultivares e linhagens em relação a Hedilepta indicata (Fabr. Resistance of soybean to insects: IV. Performance of cultivars and lines in relation to Hedilepta indicata (Fabr.

    Directory of Open Access Journals (Sweden)

    André Luiz Lourenção

    1985-01-01

    Full Text Available Em condições de campo e de telado, estudou-se o comportamento das seguintes linhagens e cultivares de soja em relação à lagarta-enroladeira, Hedilepta indicata (Fabr., 1775: PI 227687, IAC 73-228, IAC 79-1823, 'Santa Rosa', IAC 80-596-2, 'IAC 12', 'IAC 8', IAC 78-2318, D 72-9601-1, PI 171451, 'IAC São Carlos' e PI 229358, quanto ao número de pontos de ataque do inseto. Tanto no campo como em telado, IAC 73-228 e PI 229358 apresentaram, respectivamente, o menor e o maior valor. Em condições de campo, PI 227687 e IAC 73-228 sofreram as menores perdas de área foliar devidas ao ataque de H. indicata, enquanto 'IAC São Carlos', PI 171451 e PI 229358 se mostraram como os mais suscetíveis. Em outro experimento conduzido em campo, utilizando-se PI 274454, PI 274453, IAC 73-228, 'IAC 12', IAC 80-596-2, 'UFV-1', IAC 78-2318 e 'Paraná', os dois primeiros apresentaram alto nível de resistência ao inseto, superior ao exibido por IAC 73-228, sendo que 'Paraná' teve a maior perda de área foliar. Ainda em condições de campo, em área de seleção de plantas F2 descendentes do cruzamento de 'Paraná' com PI 274453, foram avaliadas, individualmente, plantas quanto à área foliar comida: os resultados obtidos sugerem que a resistência da PI 274453 a H. indicata seja devida a um gene dominante.Performance of soybean cultivars and lines in relation to H. indicata was studied under field and screen house conditions. Differences in the number of points of attack (characterized by the rolling or junction of the folioles by means of silk secretion were evaluated in PI 227687, IAC 73-228, IAC 79-1823, 'Santa Rosa', IAC 80-596-2, 'IAC 12', 'IAC 8', IAC 78-2318, D 72-9601-1, PI 171451, 'IAC São Carlos' and PI 229358; in both, field and screen house conditions, IAC 73-228 and PI 229358 showed, respectively, the lowest and the highest values. In the field, PI 227687 and IAC 73-228 presented low defoliation, while 'IAC São Carlos', PI 171451 and PI

  13. Measurement of angular and $C\\!P$ asymmetries in $D^0 \\to \\pi^+\\pi^-\\mu^+\\mu^-$ and $D^0 \\to K^+K^-\\mu^+\\mu^-$ decays

    CERN Document Server

    Aaij, Roel; LHCb Collaboration; Adinolfi, Marco; Aidala, Christine Angela; Ajaltouni, Ziad; Akar, Simon; Albicocco, Pietro; Albrecht, Johannes; Alessio, Federico; Alexander, Michael; Alfonso Albero, Alejandro; Ali, Suvayu; Alkhazov, Georgy; Alvarez Cartelle, Paula; Alves Jr, Antonio Augusto; Amato, Sandra; Amerio, Silvia; Amhis, Yasmine; An, Liupan; Anderlini, Lucio; Andreassi, Guido; Andreotti, Mirco; Andrews, Jason; Appleby, Robert; Archilli, Flavio; d'Argent, Philippe; Arnau Romeu, Joan; Artamonov, Alexander; Artuso, Marina; Arzymatov, Kenenbek; Aslanides, Elie; Atzeni, Michele; Audurier, Benjamin; Bachmann, Sebastian; Back, John; Baker, Sophie; Balagura, Vladislav; Baldini, Wander; Baranov, Alexander; Barlow, Roger; Barsuk, Sergey; Barter, William; Baryshnikov, Fedor; Batozskaya, Varvara; Batsukh, Baasansuren; Battista, Vincenzo; Bay, Aurelio; Beddow, John; Bedeschi, Franco; Bediaga, Ignacio; Beiter, Andrew; Bel, Lennaert; Beliy, Nikita; Bellee, Violaine; Belloli, Nicoletta; Belous, Konstantin; Belyaev, Ivan; Ben-Haim, Eli; Bencivenni, Giovanni; Benson, Sean; Beranek, Sarah; Berezhnoy, Alexander; Bernet, Roland; Berninghoff, Daniel; Bertholet, Emilie; Bertolin, Alessandro; Betancourt, Christopher; Betti, Federico; Bettler, Marc-Olivier; van Beuzekom, Martinus; Bezshyiko, Iaroslava; Bhasin, Srishti; Bhom, Jihyun; Bian, Lingzhu; Bifani, Simone; Billoir, Pierre; Birnkraut, Alex; Bizzeti, Andrea; Bjørn, Mikkel; Blago, Michele Piero; Blake, Thomas; Blanc, Frederic; Blusk, Steven; Bobulska, Dana; Bocci, Valerio; Boente Garcia, Oscar; Boettcher, Thomas; Bondar, Alexander; Bondar, Nikolay; Borghi, Silvia; Borisyak, Maxim; Borsato, Martino; Bossu, Francesco; Boubdir, Meriem; Bowcock, Themistocles; Bozzi, Concezio; Braun, Svende; Brodski, Michael; Brodzicka, Jolanta; Brossa Gonzalo, Arnau; Brundu, Davide; Buchanan, Emma; Buonaura, Annarita; Burr, Christopher; Bursche, Albert; Buytaert, Jan; Byczynski, Wiktor; Cadeddu, Sandro; Cai, Hao; Calabrese, Roberto; Calladine, Ryan; Calvi, Marta; Calvo Gomez, Miriam; Camboni, Alessandro; Campana, Pierluigi; Campora Perez, Daniel Hugo; Capriotti, Lorenzo; Carbone, Angelo; Carboni, Giovanni; Cardinale, Roberta; Cardini, Alessandro; Carniti, Paolo; Carson, Laurence; Carvalho Akiba, Kazuyoshi; Casse, Gianluigi; Cassina, Lorenzo; Cattaneo, Marco; Cavallero, Giovanni; Cenci, Riccardo; Chamont, David; Chapman, Matthew George; Charles, Matthew; Charpentier, Philippe; Chatzikonstantinidis, Georgios; Chefdeville, Maximilien; Chekalina, Viktoriia; Chen, Chen; Chen, Shanzhen; Chitic, Stefan-Gabriel; Chobanova, Veronika; Chrzaszcz, Marcin; Chubykin, Alexsei; Ciambrone, Paolo; Cid Vidal, Xabier; Ciezarek, Gregory; Clarke, Peter; Clemencic, Marco; Cliff, Harry; Closier, Joel; Coco, Victor; Coelho, Joao A B; Cogan, Julien; Cogneras, Eric; Cojocariu, Lucian; Collins, Paula; Colombo, Tommaso; Comerma-Montells, Albert; Contu, Andrea; Coombs, George; Coquereau, Samuel; Corti, Gloria; Corvo, Marco; Costa Sobral, Cayo Mar; Couturier, Benjamin; Cowan, Greig; Craik, Daniel Charles; Crocombe, Andrew; Cruz Torres, Melissa Maria; Currie, Robert; D'Ambrosio, Carmelo; Da Cunha Marinho, Franciole; Da Silva, Cesar Luiz; Dall'Occo, Elena; Dalseno, Jeremy; Danilina, Anna; Davis, Adam; De Aguiar Francisco, Oscar; De Bruyn, Kristof; De Capua, Stefano; De Cian, Michel; De Miranda, Jussara; De Paula, Leandro; De Serio, Marilisa; De Simone, Patrizia; Dean, Cameron Thomas; Decamp, Daniel; Del Buono, Luigi; Delaney, Blaise; Dembinski, Hans Peter; Demmer, Moritz; Dendek, Adam; Derkach, Denis; Deschamps, Olivier; Desse, Fabrice; Dettori, Francesco; Dey, Biplab; Di Canto, Angelo; Di Nezza, Pasquale; Didenko, Sergey; Dijkstra, Hans; Dordei, Francesca; Dorigo, Mirco; Dosil Suárez, Alvaro; Douglas, Lauren; Dovbnya, Anatoliy; Dreimanis, Karlis; Dufour, Laurent; Dujany, Giulio; Durante, Paolo; Durham, John Matthew; Dutta, Deepanwita; Dzhelyadin, Rustem; Dziewiecki, Michal; Dziurda, Agnieszka; Dzyuba, Alexey; Easo, Sajan; Egede, Ulrik; Egorychev, Victor; Eidelman, Semen; Eisenhardt, Stephan; Eitschberger, Ulrich; Ekelhof, Robert; Eklund, Lars; Ely, Scott; Ene, Alexandru; Escher, Stephan; Esen, Sevda; Evans, Timothy; Falabella, Antonio; Farley, Nathanael; Farry, Stephen; Fazzini, Davide; Federici, Luca; Fernandez Declara, Placido; Fernandez Prieto, Antonio; Ferrari, Fabio; Ferreira Lopes, Lino; Ferreira Rodrigues, Fernando; Ferro-Luzzi, Massimiliano; Filippov, Sergey; Fini, Rosa Anna; Fiorini, Massimiliano; Firlej, Miroslaw; Fitzpatrick, Conor; Fiutowski, Tomasz; Fleuret, Frederic; Fontana, Marianna; Fontanelli, Flavio; Forty, Roger; Franco Lima, Vinicius; Frank, Markus; Frei, Christoph; Fu, Jinlin; Funk, Wolfgang; Färber, Christian; Féo Pereira Rivello Carvalho, Mauricio; Gabriel, Emmy; Gallas Torreira, Abraham; Galli, Domenico; Gallorini, Stefano; Gambetta, Silvia; Gan, Yuyue; Gandelman, Miriam; Gandini, Paolo; Gao, Yuanning; Garcia Martin, Luis Miguel; Garcia Plana, Beatriz; García Pardiñas, Julián; Garra Tico, Jordi; Garrido, Lluis; Gascon, David; Gaspar, Clara; Gavardi, Laura; Gazzoni, Giulio; Gerick, David; Gersabeck, Evelina; Gersabeck, Marco; Gershon, Timothy; Gerstel, Dawid; Ghez, Philippe; Gianì, Sebastiana; Gibson, Valerie; Girard, Olivier Göran; Giubega, Lavinia-Helena; Gizdov, Konstantin; Gligorov, Vladimir; Golubkov, Dmitry; Golutvin, Andrey; Gomes, Alvaro; Gorelov, Igor Vladimirovich; Gotti, Claudio; Govorkova, Ekaterina; Grabowski, Jascha Peter; Graciani Diaz, Ricardo; Granado Cardoso, Luis Alberto; Graugés, Eugeni; Graverini, Elena; Graziani, Giacomo; Grecu, Alexandru; Greim, Roman; Griffith, Peter; Grillo, Lucia; Gruber, Lukas; Gruberg Cazon, Barak Raimond; Grünberg, Oliver; Gu, Chenxi; Gushchin, Evgeny; Guz, Yury; Gys, Thierry; Göbel, Carla; Hadavizadeh, Thomas; Hadjivasiliou, Christos; Haefeli, Guido; Haen, Christophe; Haines, Susan; Hamilton, Brian; Han, Xiaoxue; Hancock, Thomas Henry; Hansmann-Menzemer, Stephanie; Harnew, Neville; Harnew, Samuel; Harrison, Thomas; Hasse, Christoph; Hatch, Mark; He, Jibo; Hecker, Malte; Heinicke, Kevin; Heister, Arno; Hennessy, Karol; Henry, Louis; van Herwijnen, Eric; Heß, Miriam; Hicheur, Adlène; Hidalgo Charman, Raoul; Hill, Donal; Hilton, Martha; Hopchev, Plamen Hristov; Hu, Wenhua; Huang, Wenqian; Huard, Zachary; Hulsbergen, Wouter; Humair, Thibaud; Hushchyn, Mikhail; Hutchcroft, David; Hynds, Daniel; Ibis, Philipp; Idzik, Marek; Ilten, Philip; Ivshin, Kuzma; Jacobsson, Richard; Jalocha, Pawel; Jans, Eddy; Jawahery, Abolhassan; Jiang, Feng; John, Malcolm; Johnson, Daniel; Jones, Christopher; Joram, Christian; Jost, Beat; Jurik, Nathan; Kandybei, Sergii; Karacson, Matthias; Kariuki, James Mwangi; Karodia, Sarah; Kazeev, Nikita; Kecke, Matthieu; Keizer, Floris; Kelsey, Matthew; Kenzie, Matthew; Ketel, Tjeerd; Khairullin, Egor; Khanji, Basem; Khurewathanakul, Chitsanu; Kim, Kyung Eun; Kirn, Thomas; Klaver, Suzanne; Klimaszewski, Konrad; Klimkovich, Tatsiana; Koliiev, Serhii; Kolpin, Michael; Kopecna, Renata; Koppenburg, Patrick; Kostiuk, Igor; Kotriakhova, Sofia; Kozeiha, Mohamad; Kravchuk, Leonid; Kreps, Michal; Kress, Felix Johannes; Krokovny, Pavel; Krupa, Wojciech; Krzemien, Wojciech; Kucewicz, Wojciech; Kucharczyk, Marcin; Kudryavtsev, Vasily; Kuonen, Axel Kevin; Kvaratskheliya, Tengiz; Lacarrere, Daniel; Lafferty, George; Lai, Adriano; Lancierini, Davide; Lanfranchi, Gaia; Langenbruch, Christoph; Latham, Thomas; Lazzeroni, Cristina; Le Gac, Renaud; Leflat, Alexander; Lefrançois, Jacques; Lefèvre, Regis; Lemaitre, Florian; Leroy, Olivier; Lesiak, Tadeusz; Leverington, Blake; Li, Pei-Rong; Li, Tenglin; Li, Zhuoming; Liang, Xixin; Likhomanenko, Tatiana; Lindner, Rolf; Lionetto, Federica; Lisovskyi, Vitalii; Liu, Xuesong; Loh, David; Loi, Angelo; Longstaff, Iain; Lopes, Jose; Lovell, George Holger; Lucchesi, Donatella; Lucio Martinez, Miriam; Lupato, Anna; Luppi, Eleonora; Lupton, Oliver; Lusiani, Alberto; Lyu, Xiao-Rui; Machefert, Frederic; Maciuc, Florin; Macko, Vladimir; Mackowiak, Patrick; Maddrell-Mander, Samuel; Maev, Oleg; Maguire, Kevin; Maisuzenko, Dmitrii; Majewski, Maciej Witold; Malde, Sneha; Malecki, Bartosz; Malinin, Alexander; Maltsev, Timofei; Manca, Giulia; Mancinelli, Giampiero; Marangotto, Daniele; Maratas, Jan; Marchand, Jean François; Marconi, Umberto; Marin Benito, Carla; Marinangeli, Matthieu; Marino, Pietro; Marks, Jörg; Marshall, Phillip John; Martellotti, Giuseppe; Martin, Morgan; Martinelli, Maurizio; Martinez Santos, Diego; Martinez Vidal, Fernando; Massafferri, André; Materok, Marcel; Matev, Rosen; Mathad, Abhijit; Mathe, Zoltan; Matteuzzi, Clara; Mauri, Andrea; Maurice, Emilie; Maurin, Brice; Mazurov, Alexander; McCann, Michael; McNab, Andrew; McNulty, Ronan; Mead, James Vincent; Meadows, Brian; Meaux, Cedric; Meier, Frank; Meinert, Nis; Melnychuk, Dmytro; Merk, Marcel; Merli, Andrea; Michielin, Emanuele; Milanes, Diego Alejandro; Millard, Edward James; Minard, Marie-Noelle; Minzoni, Luca; Mitzel, Dominik Stefan; Mogini, Andrea; Molina Rodriguez, Josue; Mombächer, Titus; Monroy, Igancio Alberto; Monteil, Stephane; Morandin, Mauro; Morello, Gianfranco; Morello, Michael Joseph; Morgunova, Olga; Moron, Jakub; Morris, Adam Benjamin; Mountain, Raymond; Muheim, Franz; Mulder, Mick; Murphy, Colm Harold; Murray, Donal; Mödden, Antje; Müller, Dominik; Müller, Janine; Müller, Katharina; Müller, Vanessa; Naik, Paras; Nakada, Tatsuya; Nandakumar, Raja; Nandi, Anita; Nanut, Tara; Nasteva, Irina; Needham, Matthew; Neri, Nicola; Neubert, Sebastian; Neufeld, Niko; Neuner, Max; Nguyen, Thi Dung; Nguyen-Mau, Chung; Nieswand, Simon; Niet, Ramon; Nikitin, Nikolay; Nogay, Alla; O'Hanlon, Daniel Patrick; Oblakowska-Mucha, Agnieszka; Obraztsov, Vladimir; Ogilvy, Stephen; Oldeman, Rudolf; Onderwater, Gerco; Ossowska, Anna; Otalora Goicochea, Juan Martin; Owen, Patrick; Oyanguren, Maria Aranzazu; Pais, Preema Rennee; Pajero, Tommaso; Palano, Antimo; Palutan, Matteo; Panshin, Gennady; Papanestis, Antonios; Pappagallo, Marco; Pappalardo, Luciano; Parker, William; Parkes, Christopher; Passaleva, Giovanni; Pastore, Alessandra; Patel, Mitesh; Patrignani, Claudia; Pearce, Alex; Pellegrino, Antonio; Penso, Gianni; Pepe Altarelli, Monica; Perazzini, Stefano; Pereima, Dmitrii; Perret, Pascal; Pescatore, Luca; Petridis, Konstantinos; Petrolini, Alessandro; Petrov, Aleksandr; Petrucci, Stefano; Petruzzo, Marco; Pietrzyk, Boleslaw; Pietrzyk, Guillaume; Pikies, Malgorzata; Pili, Martina; Pinci, Davide; Pinzino, Jacopo; Pisani, Flavio; Piucci, Alessio; Placinta, Vlad-Mihai; Playfer, Stephen; Plews, Jonathan; Plo Casasus, Maximo; Polci, Francesco; Poli Lener, Marco; Poluektov, Anton; Polukhina, Natalia; Polyakov, Ivan; Polycarpo, Erica; Pomery, Gabriela Johanna; Ponce, Sebastien; Popov, Alexander; Popov, Dmitry; Poslavskii, Stanislav; Potterat, Cédric; Price, Eugenia; Prisciandaro, Jessica; Prouve, Claire; Pugatch, Valery; Puig Navarro, Albert; Pullen, Hannah Louise; Punzi, Giovanni; Qian, Wenbin; Qin, Jia-Jia; Quagliani, Renato; Quintana, Boris; Rachwal, Bartlomiej; Rademacker, Jonas; Rama, Matteo; Ramos Pernas, Miguel; Rangel, Murilo; Ratnikov, Fedor; Raven, Gerhard; Ravonel Salzgeber, Melody; Reboud, Meril; Redi, Federico; Reichert, Stefanie; dos Reis, Alberto; Reiss, Florian; Remon Alepuz, Clara; Ren, Zan; Renaudin, Victor; Ricciardi, Stefania; Richards, Sophie; Rinnert, Kurt; Robbe, Patrick; Robert, Arnaud; Rodrigues, Ana Barbara; Rodrigues, Eduardo; Rodriguez Lopez, Jairo Alexis; Roehrken, Markus; Rogozhnikov, Alexey; Roiser, Stefan; Rollings, Alexandra Paige; Romanovskiy, Vladimir; Romero Vidal, Antonio; Rotondo, Marcello; Rudolph, Matthew Scott; Ruf, Thomas; Ruiz Vidal, Joan; Saborido Silva, Juan Jose; Sagidova, Naylya; Saitta, Biagio; Salustino Guimaraes, Valdir; Sanchez Gras, Cristina; Sanchez Mayordomo, Carlos; Sanmartin Sedes, Brais; Santacesaria, Roberta; Santamarina Rios, Cibran; Santimaria, Marco; Santovetti, Emanuele; Sarpis, Gediminas; Sarti, Alessio; Satriano, Celestina; Satta, Alessia; Saur, Miroslav; Savrina, Darya; Schael, Stefan; Schellenberg, Margarete; Schiller, Manuel; Schindler, Heinrich; Schmelling, Michael; Schmelzer, Timon; Schmidt, Burkhard; Schneider, Olivier; Schopper, Andreas; Schreiner, HF; Schubiger, Maxime; Schune, Marie Helene; Schwemmer, Rainer; Sciascia, Barbara; Sciubba, Adalberto; Semennikov, Alexander; Sepulveda, Eduardo Enrique; Sergi, Antonino; Serra, Nicola; Serrano, Justine; Sestini, Lorenzo; Seuthe, Alex; Seyfert, Paul; Shapkin, Mikhail; Shcheglov, Yury; Shears, Tara; Shekhtman, Lev; Shevchenko, Vladimir; Shmanin, Evgenii; Siddi, Benedetto Gianluca; Silva Coutinho, Rafael; Silva de Oliveira, Luiz Gustavo; Simi, Gabriele; Simone, Saverio; Skidmore, Nicola; Skwarnicki, Tomasz; Smeaton, John Gordon; Smith, Eluned; Smith, Iwan Thomas; Smith, Mark; Soares, Marcelo; Soares Lavra, Lais; Sokoloff, Michael; Soler, Paul; Souza De Paula, Bruno; Spaan, Bernhard; Spradlin, Patrick; Stagni, Federico; Stahl, Marian; Stahl, Sascha; Stefko, Pavol; Stefkova, Slavomira; Steinkamp, Olaf; Stemmle, Simon; Stenyakin, Oleg; Stepanova, Margarita; Stevens, Holger; Stone, Sheldon; Storaci, Barbara; Stracka, Simone; Stramaglia, Maria Elena; Straticiuc, Mihai; Straumann, Ulrich; Strokov, Sergey; Sun, Jiayin; Sun, Liang; Swientek, Krzysztof; Syropoulos, Vasileios; Szumlak, Tomasz; Szymanski, Maciej Pawel; T'Jampens, Stephane; Tang, Zhipeng; Tayduganov, Andrey; Tekampe, Tobias; Tellarini, Giulia; Teubert, Frederic; Thomas, Eric; van Tilburg, Jeroen; Tilley, Matthew James; Tisserand, Vincent; Tobin, Mark; Tolk, Siim; Tomassetti, Luca; Tonelli, Diego; Tou, Da Yu; Tourinho Jadallah Aoude, Rafael; Tournefier, Edwige; Traill, Murdo; Tran, Minh Tâm; Trisovic, Ana; Tsaregorodtsev, Andrei; Tuci, Giulia; Tully, Alison; Tuning, Niels; Ukleja, Artur; Usachov, Andrii; Ustyuzhanin, Andrey; Uwer, Ulrich; Vacca, Claudia; Vagner, Alexander; Vagnoni, Vincenzo; Valassi, Andrea; Valat, Sebastien; Valenti, Giovanni; Vazquez Gomez, Ricardo; Vazquez Regueiro, Pablo; Vecchi, Stefania; van Veghel, Maarten; Velthuis, Jaap; Veltri, Michele; Veneziano, Giovanni; Venkateswaran, Aravindhan; Verlage, Tobias Anton; Vernet, Maxime; Veronesi, Michele; Veronika, Naomi; Vesterinen, Mika; Viana Barbosa, Joao Vitor; Vieira, Daniel; Vieites Diaz, Maria; Viemann, Harald; Vilasis-Cardona, Xavier; Vitkovskiy, Arseniy; Vitti, Marcela; Volkov, Vladimir; Vollhardt, Achim; Voneki, Balazs; Vorobyev, Alexey; Vorobyev, Vitaly; de Vries, Jacco; Vázquez Sierra, Carlos; Waldi, Roland; Walsh, John; Wang, Jianchun; Wang, Mengzhen; Wang, Yilong; Wang, Zhenzi; Ward, David; Wark, Heather Mckenzie; Watson, Nigel; Websdale, David; Weiden, Andreas; Weisser, Constantin; Whitehead, Mark; Wicht, Jean; Wilkinson, Guy; Wilkinson, Michael; Williams, Ifan; Williams, Mark Richard James; Williams, Mike; Williams, Timothy; Wilson, Fergus; Wimberley, Jack; Winn, Michael Andreas; Wishahi, Julian; Wislicki, Wojciech; Witek, Mariusz; Wormser, Guy; Wotton, Stephen; Wyllie, Kenneth; Xiao, Dong; Xie, Yuehong; Xu, Ao; Xu, Menglin; Xu, Qingnian; Xu, Zehua; Xu, Zhirui; Yang, Zhenwei; Yang, Zishuo; Yao, Yuezhe; Yeomans, Lauren Emma; Yin, Hang; Yu, Jiesheng; Yuan, Xuhao; Yushchenko, Oleg; Zarebski, Kristian Alexander; Zavertyaev, Mikhail; Zhang, Dongliang; Zhang, Liming; Zhang, Wen Chao; Zhang, Yanxi; Zhelezov, Alexey; Zheng, Yangheng; Zhu, Xianglei; Zhukov, Valery; Zonneveld, Jennifer Brigitta; Zucchelli, Stefano

    2018-01-01

    The first measurements of the forward-backward asymmetry of the dimuon pair ($A_{FB}$), the triple-product asymmetry ($A_{2\\phi}$), and the charge-parity-conjugation asymmetry ($A_{CP}$), in $D^0\\to\\pi^+\\pi^-\\mu^+\\mu^-$ and $D^0\\to K^+K^-\\mu^+\\mu^-$ decays are reported. They are performed using data from proton-proton collisions collected with the LHCb experiment from 2011 to 2016, corresponding to a total integrated luminosity of 5 fb$^{-1}$. The asymmetries are measured to be \\begin{align*} A_{FB}(D^0\\to\\pi^+\\pi^-\\mu^+\\mu^-) &= (\\phantom{-}3.3\\pm3.7\\pm0.6)\\%,\\\\ A_{2\\phi}(D^0\\to\\pi^+\\pi^-\\mu^+\\mu^-)&= (-0.6\\pm3.7\\pm0.6)\\%,\\\\ A_{CP}(D^0\\to\\pi^+\\pi^-\\mu^+\\mu^-) &= (\\phantom{-}4.9\\pm3.8\\pm0.7)\\%,\\\\ A_{FB}(D^0\\to K^+K^-\\mu^+\\mu^-) &= (0\\pm11\\pm2)\\%,\\\\ A_{2\\phi}(D^0\\to K^+K^-\\mu^+\\mu^-)&= (9\\pm11\\pm1)\\%,\\\\ A_{CP}(D^0\\to K^+K^-\\mu^+\\mu^-) &= (0\\pm11\\pm2)\\%, \\end{align*} where the first uncertainty is statistical and the second systematic. The asymmetries are also measured as a function of t...

  14. Antiretroviral drug resistance in HIV-1 therapy-naive patients in Cuba.

    Science.gov (United States)

    Pérez, Lissette; Kourí, Vivian; Alemán, Yoan; Abrahantes, Yeisel; Correa, Consuelo; Aragonés, Carlos; Martínez, Orlando; Pérez, Jorge; Fonseca, Carlos; Campos, Jorge; Álvarez, Delmis; Schrooten, Yoeri; Dekeersmaeker, Nathalie; Imbrechts, Stijn; Beheydt, Gertjan; Vinken, Lore; Soto, Yudira; Álvarez, Alina; Vandamme, Anne-Mieke; Van Laethem, Kristel

    2013-06-01

    In Cuba, antiretroviral therapy rollout started in 2001 and antiretroviral therapy coverage has reached almost 40% since then. The objectives of this study were therefore to analyze subtype distribution, and level and patterns of drug resistance in therapy-naive HIV-1 patients. Four hundred and one plasma samples were collected from HIV-1 therapy-naive patients in 2003 and in 2007-2011. HIV-1 drug resistance genotyping was performed in the pol gene and drug resistance was interpreted according to the WHO surveillance drug-resistance mutations list, version 2009. Potential impact on first-line therapy response was estimated using genotypic drug resistance interpretation systems HIVdb version 6.2.0 and Rega version 8.0.2. Phylogenetic analysis was performed using Neighbor-Joining. The majority of patients were male (84.5%), men who have sex with men (78.1%) and from Havana City (73.6%). Subtype B was the most prevalent subtype (39.3%), followed by CRF20-23-24_BG (19.5%), CRF19_cpx (18.0%) and CRF18_cpx (10.3%). Overall, 29 patients (7.2%) had evidence of drug resistance, with 4.0% (CI 1.6%-4.8%) in 2003 versus 12.5% (CI 7.2%-14.5%) in 2007-2011. A significant increase in drug resistance was observed in recently HIV-1 diagnosed patients, i.e. 14.8% (CI 8.0%-17.0%) in 2007-2011 versus 3.8% (CI 0.9%-4.7%) in 2003 (OR 3.9, CI 1.5-17.0, p=0.02). The majority of drug resistance was restricted to a single drug class (75.8%), with 55.2% patients displaying nucleoside reverse transcriptase inhibitor (NRTI), 10.3% non-NRTI (NNRTI) and 10.3% protease inhibitor (PI) resistance mutations. Respectively, 20.7% and 3.4% patients carried viruses containing drug resistance mutations against NRTI+NNRTI and NRTI+NNRTI+PI. The first cases of resistance towards other drug classes than NRTI were only detected from 2008 onwards. The most frequent resistance mutations were T215Y/rev (44.8%), M41L (31.0%), M184V (17.2%) and K103N (13.8%). The median genotypic susceptibility score for the

  15. TaEDS1 genes positively regulate resistance to powdery mildew in wheat.

    Science.gov (United States)

    Chen, Guiping; Wei, Bo; Li, Guoliang; Gong, Caiyan; Fan, Renchun; Zhang, Xiangqi

    2018-04-01

    Three EDS1 genes were cloned from common wheat and were demonstrated to positively regulate resistance to powdery mildew in wheat. The EDS1 proteins play important roles in plant basal resistance and TIR-NB-LRR protein-triggered resistance in dicots. Until now, there have been very few studies on EDS1 in monocots, and none in wheat. Here, we report on three common wheat orthologous genes of EDS1 family (TaEDS1-5A, 5B and 5D) and their function in powdery mildew resistance. Comparisons of these genes with their orthologs in diploid ancestors revealed that EDS1 is a conserved gene family in Triticeae. The cDNA sequence similarity among the three TaEDS1 genes was greater than 96.5%, and they shared sequence similarities of more than 99.6% with the respective orthologs from diploid ancestors. The phylogenetic analysis revealed that the EDS1 family originated prior to the differentiation of monocots and dicots, and EDS1 members have since undergone clear structural differentiation. The transcriptional levels of TaEDS1 genes in the leaves were obviously higher than those of the other organs, and they were induced by Blumeria graminis f. sp. tritici (Bgt) infection and salicylic acid (SA) treatment. The BSMV-VIGS experiments indicated that knock-down the transcriptional levels of the TaEDS1 genes in a powdery mildew-resistant variety of common wheat compromised resistance. Contrarily, transient overexpression of TaEDS1 genes in a susceptible common wheat variety significantly reduced the haustorium index and attenuated the growth of Bgt. Furthermore, the expression of TaEDS1 genes in the Arabidopsis mutant eds1-1 complemented its susceptible phenotype to powdery mildew. The above evidences strongly suggest that TaEDS1 acts as a positive regulator and confers resistance against powdery mildew in common wheat.

  16. Class 1 and 2 integrons, sul resistance genes and antibiotic resistance in Escherichia coli isolated from Dongjiang River, South China

    International Nuclear Information System (INIS)

    Su Haochang; Ying Guangguo; Tao Ran; Zhang Ruiquan; Zhao Jianliang; Liu Yousheng

    2012-01-01

    Antibiotic susceptibility, detection of sul gene types and presence of class 1, 2 and 3 integrons and gene cassettes using PCR assays were investigated in 3456 Escherichia coli isolates obtained from 38 sampling sites of the Dongjiang River catchment in the dry and wet seasons. 89.1% of the isolates were resistant and 87.5% showed resistance to at least three antibiotics. sul2 was detected most frequently in 89.2% of 1403 SXT-resistant isolates. The presence of integrons (class 1 and 2) was frequently observed (82.3%) while no class 3 integron was found. In these integrons, 21 resistance genes of 14 gene cassette arrays and 10 different families of resistance genes were identified. Three gene cassette arrays, aac(6')-Ib-cr-aar-3-dfrA27-aadA16, aacA4-catB3-dfrA1 and aadA2-lnuF, were detected for the first time in surface water. The results showed that bacterial resistance in the catchment was seriously influenced by human activities, especially discharge of wastewater. Highlights: ► Antibiotic resistance was investigated for a river catchment of southern China. ► 87.5% of E coli isolates showed resistance to at least three antibiotics. ► The presence of integrons (class 1 and 2) was frequently observed (82.3%). ► Bacterial resistance in the catchment was seriously influenced by human activities. - Bacterial resistance to antibiotics in a catchment is related to the discharge of wastewater into the aquatic environment.

  17. A novel gene of Kalanchoe daigremontiana confers plant drought resistance.

    Science.gov (United States)

    Wang, Li; Zhu, Chen; Jin, Lin; Xiao, Aihua; Duan, Jie; Ma, Luyi

    2018-02-07

    Kalanchoe (K.) daigremontiana is important for studying asexual reproduction under different environmental conditions. Here, we describe a novel KdNOVEL41 (KdN41) gene that may confer drought resistance and could thereby affect K. daigremontiana development. The detected subcellular localization of a KdN41/Yellow Fluorescent Protein (YFP) fusion protein was in the nucleus and cell membrane. Drought, salt, and heat stress treatment in tobacco plants containing the KdN41 gene promoter driving β-glucuronidase (GUS) gene transcription revealed that only drought stress triggered strong GUS staining in the vascular tissues. Overexpression (OE) of the KdN41 gene conferred improved drought resistance in tobacco plants compared to wild-type and transformed with empty vector plants by inducing higher antioxidant enzyme activities, decreasing cell membrane damage, increasing abscisic acid (ABA) content, causing reinforced drought resistance related gene expression profiles. The 3,3'-diaminobenzidine (DAB) and nitroblue tetrazolium (NBT) staining results also showed less relative oxygen species (ROS) content in KdN41-overexpressing tobacco leaf during drought stress. Surprisingly, by re-watering after drought stress, KdN41-overexpressing tobacco showed earlier flowering. Overall, the KdN41 gene plays roles in ROS scavenging and osmotic damage reduction to improve tobacco drought resistance, which may increase our understanding of the molecular network involved in developmental manipulation under drought stress in K. daigremontiana.

  18. The Arabidopsis thaliana lectin receptor kinase LecRK-I.9 is required for full resistance to Pseudomonas syringae and affects jasmonate signalling.

    Science.gov (United States)

    Balagué, Claudine; Gouget, Anne; Bouchez, Olivier; Souriac, Camille; Haget, Nathalie; Boutet-Mercey, Stéphanie; Govers, Francine; Roby, Dominique; Canut, Hervé

    2017-09-01

    On microbial attack, plants can detect invaders and activate plant innate immunity. For the detection of pathogen molecules or cell wall damage, plants employ receptors that trigger the activation of defence responses. Cell surface proteins that belong to large families of lectin receptor kinases are candidates to function as immune receptors. Here, the function of LecRK-I.9 (At5g60300), a legume-type lectin receptor kinase involved in cell wall-plasma membrane contacts and in extracellular ATP (eATP) perception, was studied through biochemical, gene expression and reverse genetics approaches. In Arabidopsis thaliana, LecRK-I.9 expression is rapidly, highly and locally induced on inoculation with avirulent strains of Pseudomonas syringae pv. tomato (Pst). Two allelic lecrk-I.9 knock-out mutants showed decreased resistance to Pst. Conversely, over-expression of LecRK-I.9 led to increased resistance to Pst. The analysis of defence gene expression suggests an alteration of both the salicylic acid (SA) and jasmonic acid (JA) signalling pathways. In particular, LecRK-I.9 expression during plant-pathogen interaction was dependent on COI1 (CORONATINE INSENSITIVE 1) and JAR1 (JASMONATE RESISTANT 1) components, and JA-responsive transcription factors (TFs) showed altered levels of expression in plants over-expressing LecRK-I.9. A similar misregulation of these TFs was obtained by JA treatment. This study identified LecRK-I.9 as necessary for full resistance to Pst and demonstrated its involvement in the control of defence against pathogens through a regulation of JA signalling components. The role of LecRK-I.9 is discussed with regard to the potential molecular mechanisms linking JA signalling to cell wall damage and/or eATP perception. © 2016 BSPP AND JOHN WILEY & SONS LTD.

  19. RNA-Seq analysis reveals candidate genes for ontogenic resistance in Malus-Venturia pathosystem.

    Directory of Open Access Journals (Sweden)

    Michele Gusberti

    Full Text Available Ontogenic scab resistance in apple leaves and fruits is a horizontal resistance against the plant pathogen Venturia inaequalis and is expressed as a decrease in disease symptoms and incidence with the ageing of the leaves. Several studies at the biochemical level tried to unveil the nature of this resistance; however, no conclusive results were reported. We decided therefore to investigate the genetic origin of this phenomenon by performing a full quantitative transcriptome sequencing and comparison of young (susceptible and old (ontogenic resistant leaves, infected or not with the pathogen. Two time points at 72 and 96 hours post-inoculation were chosen for RNA sampling and sequencing. Comparison between the different conditions (young and old leaves, inoculated or not should allow the identification of differentially expressed genes which may represent different induced plant defence reactions leading to ontogenic resistance or may be the cause of a constitutive (uninoculated with the pathogen shift toward resistance in old leaves. Differentially expressed genes were then characterised for their function by homology to A. thaliana and other plant genes, particularly looking for genes involved in pathways already suspected of appertaining to ontogenic resistance in apple or other hosts, or to plant defence mechanisms in general. IN THIS WORK, FIVE CANDIDATE GENES PUTATIVELY INVOLVED IN THE ONTOGENIC RESISTANCE OF APPLE WERE IDENTIFIED: a gene encoding an "enhanced disease susceptibility 1 protein" was found to be down-regulated in both uninoculated and inoculated old leaves at 96 hpi, while the other four genes encoding proteins (metallothionein3-like protein, lipoxygenase, lipid transfer protein, and a peroxidase 3 were found to be constitutively up-regulated in inoculated and uninoculated old leaves. The modulation of the five candidate genes has been validated using the real-time quantitative PCR. Thus, ontogenic resistance may be the result

  20. Genetic mapping of the rice resistance-breaking gene of the brown planthopper Nilaparvata lugens.

    Science.gov (United States)

    Kobayashi, Tetsuya; Yamamoto, Kimiko; Suetsugu, Yoshitaka; Kuwazaki, Seigo; Hattori, Makoto; Jairin, Jirapong; Sanada-Morimura, Sachiyo; Matsumura, Masaya

    2014-07-22

    Host plant resistance has been widely used for controlling the major rice pest brown planthopper (BPH, Nilaparvata lugens). However, adaptation of the wild BPH population to resistance limits the effective use of resistant rice varieties. Quantitative trait locus (QTL) analysis was conducted to identify resistance-breaking genes against the anti-feeding mechanism mediated by the rice resistance gene Bph1. QTL analysis in iso-female BPH lines with single-nucleotide polymorphism (SNP) markers detected a single region on the 10th linkage group responsible for the virulence. The QTL explained from 57 to 84% of the total phenotypic variation. Bulked segregant analysis with next-generation sequencing in F2 progenies identified five SNPs genetically linked to the virulence. These analyses showed that virulence to Bph1 was controlled by a single recessive gene. In contrast to previous studies, the gene-for-gene relationship between the major resistance gene Bph1 and virulence gene of BPH was confirmed. Identified markers are available for map-based cloning of the major gene controlling BPH virulence to rice resistance. © 2014 The Author(s) Published by the Royal Society. All rights reserved.

  1. Measurement of Branching Fractions and CP-violating Charge Asymmetries in B sup + -> rho sup +pi sup 0 and B sup + -> rho sup 0 pi sup + decays, and search for B sup 0 -> rho sup 0 pi sup 0

    CERN Document Server

    Yu, Z

    2003-01-01

    The present preliminary measurements of branching fractions and CP-violating charge asymmetries in B-meson decays to rho pi. The data sample comprises 89 million UPSILON(4S) -> B(bar B) decays collected with the BABAR detector at the PEP-II asymmetric-energy B Factor at SLAC. They find the charge-averaged branching fractions BETA(B sup + -> rho sup +pi sup 0) = (11.0 +- 1.9(stat.) +- 1.9(syst.)) x 10 sup - sup 6 and BETA(B sup + -> rho sup 0 pi sup +) = (9.3 +- 1.0(stat.) +- 0.8(syst.)) x 10 sup - sup 6; they set a 90% confidence-level upper limit of BETA(B sup 0 -> rho sup 0 pi sup 0) < 2.5 x 10 sup - sup 6. They measure the CP-violating charge asymmetries A sub C sub P suprho sup + suppi sup 0 = 0.23 +- 0.16(stat.) +- 0.06(syst.) and A sub C sub P suprho sup 0 suppi sup + = -0.17 +- 0.11(stat.) +- 0.02(syst.).

  2. Observation of $\\pi^- K^+$ and $\\pi^+ K^-$ atoms

    CERN Document Server

    Adeva, B; The PS212 collaboration; Allkofer, Y.; Amsler, C.; Anania, A.; Aogaki, S.; Benelli, A.; Brekhovskikh, V.; Cechak, T.; Chiba, M.; Chliapnikov, P.; Doskarova, P.; Drijard, D.; Dudarev, A.; Dumitriu, D.; Fluerasu, D.; Gorin, A.; Gorchakov, O.; Gritsay, K.; Guaraldo, C.; Gugiu, M.; Hansroul, M.; Hons, Z.; Horikawa, S.; Iwashita, Y.; Karpukhin, V.; Kluson, J.; Kobayashi, M.; Kruglov, V.; Kruglova, L.; Kulikov, A.; Kulish, E.; Kuptsov, A.; Lamberto, A.; Lanaro, A.; Lednicky, R.; Marinas, C.; Martincik, J.; Nikitin, M.; Okada, K.; Olchevskii, V.; Pentia, M.; Penzo, A.; Plo, M.; Prusa, P.; Rappazzo, G.; Vidal, A.Romero; Ryazantsev, A.; Rykalin, V.; Saborido, J.; Sidorov, A.; Smolik, J.; Takeutchi, F.; Tauscher, L.; Trojek, T.; Trusov, S.; Urban, T.; Vrba, T.; Yazkov, V.; Yoshimura, Y.; Zhabitsky, M.; Zrelov, P.

    2016-01-01

    The observation of hydrogen-like $\\pi K$ atoms, consisting of $\\pi^- K^+$ or $\\pi^+ K^-$ mesons, is presented. The atoms have been produced by 24 GeV/$c$ protons from the CERN PS accelerator, interacting with platinum or nickel foil targets. The breakup (ionisation) of $\\pi K$ atoms in the same targets yields characteristic $\\pi K$ pairs, called ``atomic pairs'', with small relative momenta in the pair centre-of-mass system. The upgraded DIRAC experiment has observed $349\\pm62$ such atomic $\\pi K$ pairs, corresponding to a signal of 5.6 standard deviations.

  3. Using SNP genetic markers to elucidate the linkage of the Co-34/Phg-3 anthracnose and angular leaf spot resistance gene cluster with the Ur-14 resistance gene

    Science.gov (United States)

    The Ouro Negro common bean cultivar contains the Co-34/Phg-3 gene cluster that confers resistance to the anthracnose (ANT) and angular leaf spot (ALS) pathogens. These genes are tightly linked on chromosome 4. Ouro Negro also has the Ur-14 rust resistance gene, reportedly in the vicinity of Co- 34; ...

  4. Acquired resistance to cetuximab is associated with the overexpression of Ras family members and the loss of radiosensitization in head and neck cancer cells

    International Nuclear Information System (INIS)

    Saki, Mohammad; Toulany, Mahmoud; Rodemann, H. Peter

    2013-01-01

    Purpose: Cetuximab in combination with radiation therapy is used to treat patients with head and neck squamous cell carcinoma (HNSCC). In the present study, the mechanism of acquired resistance to cetuximab in HNSCC cells was investigated in vitro. Material and methods: The HNSCC cell lines UT5 and SAS and UT5 cells with acquired resistance to cetuximab (UT5R9) were used. The radiotoxicity potentials of cetuximab and inhibitors of PI3K, MAPK and farnesylation were tested using a clonogenic survival assay. Western blotting was used to evaluate protein expression. The levels of EGFR ligands were detected by ELISA. Results: Cetuximab inhibited proliferation and induced radiosensitization in UT5 cells but not in SAS cells. In comparison with UT5 cells, cetuximab-resistant SAS cells markedly overexpressed the K-Ras, H-Ras and N-Ras proteins, as detected by Western blotting. Resistance in UT5R9 cells was associated with the overexpression of the K-Ras, H-Ras and N-Ras proteins as well as an increase in the autocrine production of the EGFR ligands amphiregulin and transforming growth factor α (TGFα). UT5R9 cells were significantly more radioresistant than UT5 cells. Radioresistant UT5R9 cells were not radiosensitized by cetuximab, but knocking down H-RAS and N-RAS with siRNA and targeting Ras farnesylation using the farnesyltransferase inhibitor lonafarnib induced radiosensitization in these cells. Targeting PI3K and MEK revealed that the activation of the PI3K/Akt pathway but not the MAPK/ERK pathway is associated with radioresistance in UT5R9 cells. Conclusion: Targeting Ras and PI3K activity improves the outcome of irradiation in cetuximab-resistant HNSCC cell lines in vitro

  5. Experimental study of the time-dependent rate of $K^{0} \\rightarrow \\pi^{+} \\pi^{-} \\pi^{0}$

    CERN Document Server

    Metcalf, M; Bartl, Walter; de Bouard, X; Lepeltier, V; Massonnet, Louis; Neuhofer, G; Niebergall, F; Pessard, H; Regler, Meinhard; Steuer, M; Stier, H E; Vivargent, M; Willitts, T R; Winter, Klaus; Yvert, M

    1972-01-01

    The time-dependence of the decay rate of initially pure K/sup 0/ into the final state ( pi /sup +/ pi /sup -/ pi /sup 0/) has been studied in search for the decay K/sup 0//sub S/ to pi /sup +/ pi /sup -/ pi /sup 0/. No evidence is found in a sample of 384 observed events. The ratio of the CP-violating K/sup 0//sub S/ amplitude and the K/sup 0 //sub L/ amplitude is eta /sub +-0/=(0.13(+0.17-0.20))+i(0.17 (+0.27-0.26)); the ratio of the CP-conserving K/sup 0//sub S/ amplitude and K/sup 0//sub L/ amplitude is mod rho mod <0.4. The energy dependence of the K/sup 0/ to pi /sup +/ pi /sup -/ pi /sup 0/ matrix element is found to be a/sub +-0/=-0.31+or-0.03. (12 refs).

  6. Regulation of PI-2b Pilus Expression in Hypervirulent Streptococcus agalactiae ST-17 BM110.

    Directory of Open Access Journals (Sweden)

    Bruno Périchon

    Full Text Available The widely spread Streptococcus agalactiae (also known as Group B Streptococcus, GBS "hypervirulent" ST17 clone is strongly associated with neonatal meningitis. The PI-2b locus is mainly found in ST17 strains but is also present in a few non ST17 human isolates such as the ST-7 prototype strain A909. Here, we analysed the expression of the PI-2b pilus in the ST17 strain BM110 as compared to the non ST17 A909. Comparative genome analyses revealed the presence of a 43-base pair (bp hairpin-like structure in the upstream region of PI-2b operon in all 26 ST17 genomes, which was absent in the 8 non-ST17 strains carrying the PI-2b locus. Deletion of this 43-bp sequence in strain BM110 resulted in a 3- to 5-fold increased transcription of PI-2b. Characterization of PI-2b promoter region in A909 and BM110 strains was carried out by RNAseq, primer extension, qRT-PCR and transcriptional fusions with gfp as reporter gene. Our results indicate the presence of a single promoter (Ppi2b with a transcriptional start site (TSS mapped 37 bases upstream of the start codon of the first PI-2b gene. The large operon of 16 genes located upstream of PI-2b codes for the group B carbohydrate (also known as antigen B, a major constituent of the bacterial cell wall. We showed that the hairpin sequence located between antigen B and PI-2b operons is a transcriptional terminator. In A909, increased expression of PI-2b probably results from read-through transcription from antigen B operon. In addition, we showed that an extended 5' promoter region is required for maximal transcription of gfp as a reporter gene in S. agalactiae from Ppi2b promoter. Gene reporter assays performed in Lactococcus lactis strain NZ9000, a related non-pathogenic Gram-positive species, revealed that GBS-specific regulatory factors are required to drive PI-2b transcription. PI-2b expression is up-regulated in the BM110ΔcovR mutant as compared to the parental BM110 strain, but this effect is probably

  7. Global spread and genetic variants of the two CYP9M10 haplotype forms associated with insecticide resistance in Culex quinquefasciatus Say.

    Science.gov (United States)

    Itokawa, K; Komagata, O; Kasai, S; Kawada, H; Mwatele, C; Dida, G O; Njenga, S M; Mwandawiro, C; Tomita, T

    2013-09-01

    Insecticide resistance develops as a genetic factor (allele) conferring lower susceptibility to insecticides proliferates within a target insect population under strong positive selection. Intriguingly, a resistance allele pre-existing in a population often bears a series of further adaptive allelic variants through new mutations. This phenomenon occasionally results in replacement of the predominating resistance allele by fitter new derivatives, and consequently, development of greater resistance at the population level. The overexpression of the cytochrome P450 gene CYP9M10 is associated with pyrethroid resistance in the southern house mosquito Culex quinquefasciatus. Previously, we have found two genealogically related overexpressing CYP9M10 haplotypes, which differ in gene copy number (duplicated and non-duplicated). The duplicated haplotype was derived from the non-duplicated overproducer probably recently. In the present study, we investigated allelic series of CYP9M10 involved in three C. quinquefasciatus laboratory colonies recently collected from three different localities. Duplicated and non-duplicated overproducing haplotypes coexisted in African and Asian colonies indicating a global distribution of both haplotype lineages. The duplicated haplotypes both in the Asian and African colonies were associated with higher expression levels and stronger resistance than non-duplicated overproducing haplotypes. There were slight variation in expression level among the non-duplicated overproducing haplotypes. The nucleotide sequences in coding and upstream regions among members of this group also showed a little diversity. Non-duplicated overproducing haplotypes with relatively higher expression were genealogically closer to the duplicated haplotypes than the other non-duplicated overproducing haplotypes, suggesting multiple cis-acting mutations before duplication.

  8. Fine mapping and identification of a candidate gene for the barley Un8 true loose smut resistance gene.

    Science.gov (United States)

    Zang, Wen; Eckstein, Peter E; Colin, Mark; Voth, Doug; Himmelbach, Axel; Beier, Sebastian; Stein, Nils; Scoles, Graham J; Beattie, Aaron D

    2015-07-01

    The candidate gene for the barley Un8 true loose smut resistance gene encodes a deduced protein containing two tandem protein kinase domains. In North America, durable resistance against all known isolates of barley true loose smut, caused by the basidiomycete pathogen Ustilago nuda (Jens.) Rostr. (U. nuda), is under the control of the Un8 resistance gene. Previous genetic studies mapped Un8 to the long arm of chromosome 5 (1HL). Here, a population of 4625 lines segregating for Un8 was used to delimit the Un8 gene to a 0.108 cM interval on chromosome arm 1HL, and assign it to fingerprinted contig 546 of the barley physical map. The minimal tilling path was identified for the Un8 locus using two flanking markers and consisted of two overlapping bacterial artificial chromosomes. One gene located close to a marker co-segregating with Un8 showed high sequence identity to a disease resistance gene containing two kinase domains. Sequence of the candidate gene from the parents of the segregating population, and in an additional 19 barley lines representing a broader spectrum of diversity, showed there was no intron in alleles present in either resistant or susceptible lines, and fifteen amino acid variations unique to the deduced protein sequence in resistant lines differentiated it from the deduced protein sequences in susceptible lines. Some of these variations were present within putative functional domains which may cause a loss of function in the deduced protein sequences within susceptible lines.

  9. Candidate genes revealed by a genome scan for mosquito resistance to a bacterial insecticide: sequence and gene expression variations

    Directory of Open Access Journals (Sweden)

    David Jean-Philippe

    2009-11-01

    Full Text Available Abstract Background Genome scans are becoming an increasingly popular approach to study the genetic basis of adaptation and speciation, but on their own, they are often helpless at identifying the specific gene(s or mutation(s targeted by selection. This shortcoming is hopefully bound to disappear in the near future, thanks to the wealth of new genomic resources that are currently being developed for many species. In this article, we provide a foretaste of this exciting new era by conducting a genome scan in the mosquito Aedes aegypti with the aim to look for candidate genes involved in resistance to Bacillus thuringiensis subsp. israelensis (Bti insecticidal toxins. Results The genome of a Bti-resistant and a Bti-susceptible strains was surveyed using about 500 MITE-based molecular markers, and the loci showing the highest inter-strain genetic differentiation were sequenced and mapped on the Aedes aegypti genome sequence. Several good candidate genes for Bti-resistance were identified in the vicinity of these highly differentiated markers. Two of them, coding for a cadherin and a leucine aminopeptidase, were further examined at the sequence and gene expression levels. In the resistant strain, the cadherin gene displayed patterns of nucleotide polymorphisms consistent with the action of positive selection (e.g. an excess of high compared to intermediate frequency mutations, as well as a significant under-expression compared to the susceptible strain. Conclusion Both sequence and gene expression analyses agree to suggest a role for positive selection in the evolution of this cadherin gene in the resistant strain. However, it is unlikely that resistance to Bti is conferred by this gene alone, and further investigation will be needed to characterize other genes significantly associated with Bti resistance in Ae. aegypti. Beyond these results, this article illustrates how genome scans can build on the body of new genomic information (here, full

  10. Characterization of resistance to tetracyclines and aminoglycosides of sheep mastitis pathogens: study of the effect of gene content on resistance.

    Science.gov (United States)

    Lollai, S A; Ziccheddu, M; Duprè, I; Piras, D

    2016-10-01

    Mastitis causes economic losses and antimicrobials are frequently used for mastitis treatment. Antimicrobial resistance surveys are still rare in the ovine field and characterization of strains is important in order to acquire information about resistance and for optimization of therapy. Bacterial pathogens recovered in milk samples from mastitis-affected ewes were characterized for resistance to tetracyclines and aminoglycosides, members of which are frequently used antimicrobials in small ruminants. A total of 185 strains of staphylococci, streptococci, and enterococci, common mastitis pathogens, were tested for minimal inhibitory concentration (MIC) to tetracycline, doxycycline, minocycline, gentamicin, kanamycin, streptomycin, and for resistance genes by PCR. Effects of different tet genes arrangements on MICs were also investigated. Staphylococci expressed the lowest MIC for tetracycline and tet(K) was the most common gene recovered; tet(M) and tet(O) were also found. Gene content was shown to influence the tetracycline MIC values. Enterococci and streptococci showed higher MICs to tetracyclines and nonsusceptible strains always harboured at least one ribosomal protection gene (MIC above 8 μg ml(-1) ). Streptococci often harboured two or more tet determinants. As regards the resistance to aminoglycosides, staphylococci showed the lowest gentamicin and kanamycin median MIC along with streptomycin high level resistant (HLR) strains (MIC >1024 μg ml(-1) ) all harbouring str gene. The resistance determinant aac(6')-Ie-aph(2″)-Ia was present in few strains. Streptococci were basically nonsusceptible to aminoglycosides but neither HLR isolates nor resistance genes were detected. Enterococci revealed the highest MICs for gentamicin; two str harbouring isolates were shown to be HLR to streptomycin. Evidence was obtained for the circulation of antimicrobial-resistant strains and genes in sheep dairy farming. Tetracycline MIC of 64 μg ml(-1) and high

  11. Natural Resistance Associated Macrophage Protein 1 Gene Polymorphism is Associated with Chronic Periodontitis Not Peri-Implantitis in an Iranian Population: A Cross Sectional Study

    Directory of Open Access Journals (Sweden)

    Mahdi Kadkhodazadeh

    2016-05-01

    Full Text Available In inflammatory diseases such as peri-implantitis (PI and chronic periodontitis (CP both adaptive and innate immunity play a part. Natural resistance associated macrophage protein 1 (NRAMP1 has considerable effects on macrophage function (phagocytosis and host innate immune response against infections. The present study was to investigate the relationship of NRAMP1 gene polymorphisms with PI and CP in an Iranian population. In this cross sectional study 79 patients with CP, 38 patients with PI and 84 healthy controls presenting to the Periodontology Department of Shahid Beheshti University of Medical Sciences were enrolled. DNA was extracted from fresh blood samples of arm vein of participants and transferred to KBiosience institute (United Kingdom for genotyping. X2 and Fisher’s exact tests were used by SPSS software v.19 for statistical analyzes. Significant differences were detected in the distribution of genotypes between control and CP groups both for rs17235409 and rs2276631 polymorphisms (P:0.044 and P:0.028 respectively. Distribution of genotypes differed insignificantly in comparison of PI and control groups for rs2276631 (P:0.623 and either rs17235409 (P:1 polymorphisms. Based on our results, we conclude that presence of G allele in both rs2276631 and rs17235409 location may be a protective factor against CP. More studies with a larger sample size in different populations are required for confirming NRAMP1 as a genetic determinant in periodontal disorders.

  12. LHCb: Evidence of CP violation in charmless three-body decays $B^\\pm\\rightarrow K^\\pm\\pi^+\\pi^-$, $B^\\pm\\rightarrow K^\\pm K^+K^-$, $B^\\pm\\rightarrow K^+ K^-\\pi^\\pm$ and $B^\\pm\\rightarrow \\pi^\\pm\\pi^+\\pi^-$

    CERN Multimedia

    Lopes, J H

    2013-01-01

    Evidence of CP violation in charmless three-body decays $B^\\pm\\rightarrow K^\\pm\\pi^+\\pi^-$, $B^\\pm\\rightarrow K^\\pm K^+K^-$, $B^\\pm\\rightarrow K^+ K^-\\pi^\\pm$ and $B^\\pm\\rightarrow \\pi^\\pm\\pi^+\\pi^-$

  13. Mapping of Leaf Rust Resistance Genes and Molecular Characterization of the 2NS/2AS Translocation in the Wheat Cultivar Jagger.

    Science.gov (United States)

    Xue, Shulin; Kolmer, James A; Wang, Shuwen; Yan, Liuling

    2018-04-19

    Winter wheat cultivar 'Jagger' was recently found to have an alien chromosomal segment 2NS that has Lr37 , a gene conferring resistance against leaf rust caused by Puccinia triticina The objective of this study was to map and characterize the gene(s) for seedling leaf rust resistance in Jagger. The recombinant inbred line (RIL) population of Jagger × '2174' was inoculated with leaf rust pathogen THBJG and BBBDB, and evaluated for infection type (IT) response. A major quantitative trait locus (QTL) for THBJG and BBBDB was coincidently mapped to chromosome arm 2AS, and the QTL accounted for 56.6% - 66.2% of total phenotypic variation in infection type (IT) response to THBJG, and 72.1% - 86.9% to BBBDB. The causal gene for resistance to these rust races was mapped to the 2NS segment in Jagger. The 2NS segment was located in a region of approximately 27.8 Mb starting from the telomere of chromosome arm 2AS, based on the sequences of the A genome in tetraploid wheat. The Lr17a gene on chromosome arm 2AS was delimited to 3.1 Mb in the genomic region, which was orthologous to the 2NS segment. Therefore, the Lr37 gene in the 2NS segment can be pyramided with other effective resistance genes, rather than Lr17a in wheat, to improve resistance to rust diseases. Copyright © 2018, G3: Genes, Genomes, Genetics.

  14. PI3K-AKT signaling pathway is involved in hypoxia/thermal-induced immunosuppression of small abalone Haliotis diversicolor.

    Science.gov (United States)

    Sun, Yulong; Zhang, Xin; Wang, Guodong; Lin, Shi; Zeng, Xinyang; Wang, Yilei; Zhang, Ziping

    2016-12-01

    The PI3K-AKT signal pathway has been found to be involved in many important physiological and pathological processes of the innate immune system of vertebrates and invertebrates. In this study, the AKT (HdAKT) and PI3K (HdPI3K) gene of small abalone Haliotis diversicolor were cloned and characterized for the important status of PI3K and AKT protein in PI3K-AKT signaling pathway. The full length cDNAs of HdAKT and HdPI3K are 2126 bp and 6052 bp respectively, encoding proteins of 479 amino acids and 1097 amino acids, respectively. The mRNA expression level of fourteen genes in the PI3K-AKT signaling pathway were detected by quantitative real-time PCR. The results showed that all these fourteen genes were ubiquitously expressed in seven selected tissues. Meanwhile, HdAKT was expressed in haemocytes with the highest expression level (p abalone. The mRNA expression of these genes in gills, haemocytes and hepatopancreas was significantly down-regulated after the Vibrio parahaemolyticus stimulation with environment stimulation (thermal, hypoxia and thermal & hypoxia). These results indicate that the dual/multiple stresses defeat the immune system and lead to immunosuppression in abalone. PI3K-AKT signaling pathway may be involved in hypoxia/thermal-induced immunosuppression of small abalone Haliotis diversicolor. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. The role of Cercospora zeae-maydis homologs of Rhodobacter sphaeroides 1O2-resistance genes in resistance to the photoactivated toxin cercosporin.

    Science.gov (United States)

    Beseli, Aydin; Goulart da Silva, Marilia; Daub, Margaret E

    2015-01-01

    The photosynthetic bacterium Rhodobacter sphaeroides and plant pathogenic fungus Cercospora nicotianae have been used as models for understanding resistance to singlet oxygen ((1)O(2)), a highly toxic reactive oxygen species. In Rhodobacter and Cercospora, (1)O(2) is derived, respectively, from photosynthesis and from the (1)O(2)-generating toxin cercosporin which the fungus produces to parasitize plants. We identified common genes recovered in transcriptome studies of putative (1)O(2)-resistance genes in these two systems, suggesting common (1)O(2)-resistance mechanisms. To determine if the Cercospora homologs of R. sphaeroides (1)O(2)-resistance genes are involved in resistance to cercosporin, we expressed the genes in the cercosporin-sensitive fungus Neurospora crassa and assayed for increases in cercosporin resistance. Neurospora crassa transformants expressing genes encoding aldo/keto reductase, succinyl-CoA ligase, O-acetylhomoserine (thiol) lyase, peptide methionine sulphoxide reductase and glutathione S-transferase did not have elevated levels of cercosporin resistance. Several transformants expressing aldehyde dehydrogenase were significantly more resistant to cercosporin. Expression of the transgene and enzyme activity did not correlate with resistance, however. We conclude that although the genes tested in this study are important in (1)O(2) resistance in R. sphaeroides, their Cercospora homologs are not involved in resistance to (1)O(2) generated from cercosporin. © FEMS 2014. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  16. Chaetominine reduces MRP1-mediated drug resistance via inhibiting PI3K/Akt/Nrf2 signaling pathway in K562/Adr human leukemia cells

    Energy Technology Data Exchange (ETDEWEB)

    Yao, Jingyun; Wei, Xing [State Key Laboratory of Bioreactor Engineering, East China University of Science and Technology, 130 Meilong Road, Shanghai (China); Shanghai Collaborative Innovation Center for Biomanufacturing Technology, 130 Meilong Road, Shanghai (China); Lu, Yanhua, E-mail: luyanhua@ecust.edu.cn [State Key Laboratory of Bioreactor Engineering, East China University of Science and Technology, 130 Meilong Road, Shanghai (China); Shanghai Collaborative Innovation Center for Biomanufacturing Technology, 130 Meilong Road, Shanghai (China)

    2016-05-13

    Drug resistance limits leukemia treatment and chaetominine, a cytotoxic alkaloid that promotes apoptosis in a K562 human leukemia cell line via the mitochondrial pathway was studied with respect to chemoresistance in a K562/Adr human resistant leukemia cell line. Cytotoxicity assays indicated that K562/Adr resistance to adriamycin (ADR) did not occur in the presence of chaetominine and that chaetominine increased chemosensitivity of K562/Adr to ADR. Data show that chaetominine enhanced ADR-induced apoptosis and intracellular ADR accumulation in K562/Adr cells. Accordingly, chaetominine induced apoptosis by upregulating ROS, pro-apoptotic Bax and downregulating anti-apoptotic Bcl-2. RT-PCR and western-blot confirmed that chaetominine suppressed highly expressed MRP1 at mRNA and protein levels. But little obvious alternation of another drug transporter MDR1 mRNA was observed. Furthermore, inhibition of MRP1 by chaetominine relied on inhibiting Akt phosphorylation and nuclear Nrf2. In summary, chaetominine strongly reverses drug resistance by interfering with the PI3K/Akt/Nrf2 signaling, resulting in reduction of MRP1-mediated drug efflux and induction of Bax/Bcl-2-dependent apoptosis in an ADR-resistant K562/Adr leukemia cell line. - Highlights: • Chaetominine enhanced chemosensitivity of ADR against K562/Adr cells. • Chaetominine increased intracellular ADR levels via inhibiting MRP1. • Chaetominine induced apoptosis of K562/Adr cells through upregulation of ROS and modulation of Bax/Bcl-2. • Inhibition of MRP1 and Nrf2 by chaetominine treatment was correlative with blockade of PI3K/Akt signaling.

  17. Mapping fusiform rust resistance genes within a complex mating design of loblolly pine

    Science.gov (United States)

    Tania Quesada; Marcio F.R. Resende Jr.; Patricio Munoz; Jill L. Wegrzyn; David B. Neale; Matias Kirst; Gary F. Peter; Salvador A. Gezan; C.Dana Nelson; John M. Davis

    2014-01-01

    Fusiform rust resistance can involve gene-for-gene interactions where resistance (Fr) genes in the host interact with corresponding avirulence genes in the pathogen, Cronartium quercuum f.sp. fusiforme (Cqf). Here, we identify trees with Fr genes in a loblolly pine population derived from a complex mating design challenged with two Cqf inocula (one gall and 10 gall...

  18. Characterization of Soybean WRKY Gene Family and Identification of Soybean WRKY Genes that Promote Resistance to Soybean Cyst Nematode.

    Science.gov (United States)

    Yang, Yan; Zhou, Yuan; Chi, Yingjun; Fan, Baofang; Chen, Zhixiang

    2017-12-19

    WRKY proteins are a superfamily of plant transcription factors with important roles in plants. WRKY proteins have been extensively analyzed in plant species including Arabidopsis and rice. Here we report characterization of soybean WRKY gene family and their functional analysis in resistance to soybean cyst nematode (SCN), the most important soybean pathogen. Through search of the soybean genome, we identified 174 genes encoding WRKY proteins that can be classified into seven groups as established in other plants. WRKY variants including a WRKY-related protein unique to legumes have also been identified. Expression analysis reveals both diverse expression patterns in different soybean tissues and preferential expression of specific WRKY groups in certain tissues. Furthermore, a large number of soybean WRKY genes were responsive to salicylic acid. To identify soybean WRKY genes that promote soybean resistance to SCN, we first screened soybean WRKY genes for enhancing SCN resistance when over-expressed in transgenic soybean hairy roots. To confirm the results, we transformed five WRKY genes into a SCN-susceptible soybean cultivar and generated transgenic soybean lines. Transgenic soybean lines overexpressing three WRKY transgenes displayed increased resistance to SCN. Thus, WRKY genes could be explored to develop new soybean cultivars with enhanced resistance to SCN.

  19. Antibiotic-resistant genes and antibiotic-resistant bacteria in the effluent of urban residential areas, hospitals, and a municipal wastewater treatment plant system.

    Science.gov (United States)

    Li, Jianan; Cheng, Weixiao; Xu, Like; Strong, P J; Chen, Hong

    2015-03-01

    In this study, we determined the abundance of 8 antibiotics (3 tetracyclines, 4 sulfonamides, and 1 trimethoprim), 12 antibiotic-resistant genes (10 tet, 2 sul), 4 antibiotic-resistant bacteria (tetracycline, sulfamethoxazole, and combined resistance), and class 1 integron integrase gene (intI1) in the effluent of residential areas, hospitals, and municipal wastewater treatment plant (WWTP) systems. The concentrations of total/individual targets (antibiotics, genes, and bacteria) varied remarkably among different samples, but the hospital samples generally had a lower abundance than the residential area samples. The WWTP demonstrated removal efficiencies of 50.8% tetracyclines, 66.8% sulfonamides, 0.5 logs to 2.5 logs tet genes, and less than 1 log of sul and intI1 genes, as well as 0.5 log to 1 log removal for target bacteria. Except for the total tetracycline concentration and the proportion of tetracycline-resistant bacteria (R (2) = 0.330, P antibiotics and the corresponding resistant bacteria (P > 0.05). In contrast, various relationships were identified between antibiotics and antibiotic resistance genes (P antibiotic-resistant bacteria (P < 0.01).

  20. Virulence Genes Profile of Multidrug Resistant Pseudomonas aeruginosa Isolated from Iranian Children with UTIs

    Directory of Open Access Journals (Sweden)

    Zohreh Heidary

    2016-04-01

    Full Text Available Virulent and resistant strains Pseudomonas aeruginosa (P. aeruginosa is one of the most important cause of UTIs in pediatrics. The present study was carried to investigate the frequency of virulence factors in the multi-drug resistant strains of P. aeruginosa isolated from pediatrics hospitalized due to the UTIs. One - hundred and forty three urine samples were collected from pediatric patients suffered from UTIs. Samples were cultured and those that were P. aeruginosa positive were analyzed for the presence of putative virulence genes. Seventy one out of 143 samples (49.65% were positive for P. aeruginosa. Monthly, sex and age-dependent prevalence were seen for P. aeruginosa. Bacterial strains had the highest levels of resistance against ampicillin (95.77%, gentamicin (92.95% and ciprofloxacin (81.69%. Of 71 P. aeruginosa isolates, 12 strains were resistant to more than 9 antibiotics (16.90%. The most commonly detected virulence factors in the cases of urethral infections were exoU and plcH while those of pyelonephritis and cystitis were were exoS and lasB. Our findings should raise awareness about antibiotic resistance in hospitalized pediatrics with UTIs in Iran. Clinicians should exercise caution in prescribing antibiotics, especially in cases of UTIs. Such information can help in identifying these virulence genes as useful diagnostic markers for clinical P. aeruginosa strains isolated from UTIs.

  1. The NB-LRR gene Pm60 confers powdery mildew resistance in wheat.

    Science.gov (United States)

    Zou, Shenghao; Wang, Huan; Li, Yiwen; Kong, Zhaosheng; Tang, Dingzhong

    2018-04-01

    Powdery mildew is one of the most devastating diseases of wheat. To date, few powdery mildew resistance genes have been cloned from wheat due to the size and complexity of the wheat genome. Triticum urartu is the progenitor of the A genome of wheat and is an important source for powdery mildew resistance genes. Using molecular markers designed from scaffolds of the sequenced T. urartu accession and standard map-based cloning, a powdery mildew resistance locus was mapped to a 356-kb region, which contains two nucleotide-binding and leucine-rich repeat domain (NB-LRR) protein-encoding genes. Virus-induced gene silencing, single-cell transient expression, and stable transformation assays demonstrated that one of these two genes, designated Pm60, confers resistance to powdery mildew. Overexpression of full-length Pm60 and two allelic variants in Nicotiana benthamiana leaves induced hypersensitive cell death response, but expression of the coiled-coil domain alone was insufficient to induce hypersensitive response. Yeast two-hybrid, bimolecular fluorescence complementation and luciferase complementation imaging assays showed that Pm60 protein interacts with its neighboring NB-containing protein, suggesting that they might be functionally related. The identification and cloning of this novel wheat powdery mildew resistance gene will facilitate breeding for disease resistance in wheat. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

  2. Heterogeneous stock mice are susceptible to encephalomyelitis and antibody-initiated arthritis but not to collagen- and G6PI-induced arthritis.

    Science.gov (United States)

    Klaczkowska, D; Raposo, B; Nandakumar, K S

    2011-01-01

    The strategy of using heterogeneous stock (HS) mice has proven to be successful in fine mapping of quantitative trait loci in complex diseases. However, whether these mice can be used for arthritis, encephalomyelitis and autoimmune phenotypes has not been addressed. Here, we screened the Northport HS mice for arthritis phenotypes using three different models: collagen-induced arthritis (CIA), using rat, bovine or chicken collagen type II (CII); recombinant human glucose-6-phosphate isomerase (G6PI)-induced arthritis; and collagen antibody-induced arthritis (CAIA). Irrespective of the origin of collagen, we found HS mice to be fairly resistant to CIA and G6PI-induced arthritis, despite the development of antibodies against the respective antigens. On the other hand, HS mice were found to be susceptible for CAIA. Similarly, these mice developed encephalomyelitis (EAE) induced either with mouse or rat spinal cord homogenate (SCH), or with recombinant rat myelin oligodendrocyte glycoprotein, with elevated antibody levels against CNS proteins. Accordingly, we conclude that the use of HS mice for fine mapping and positional cloning of gene(s) involved in CAIA and EAE is possible, but not for collagen- and G6PI-induced arthritis. © 2011 The Authors. Scandinavian Journal of Immunology © 2011 Blackwell Publishing Ltd.

  3. An AFLP marker linked to the Pm-1 gene that confers resistance to Podosphaera xanthii race 1 in Cucumis melo

    Directory of Open Access Journals (Sweden)

    Ana Paula Matoso Teixeira

    2008-01-01

    Full Text Available Brazil produced 330,000 metric tons of melons in 2005, principally in the Northeast region where one of the most important melon pathogens is the powdery mildew fungus Podosphaera xanthii. The disease is controlled mainly by incorporating single dominant resistance genes into commercial hybrids. We report on linkage analysis of the Pm-1 resistance gene, introgressed from the AF125Pm-1 Cantalupensis Charentais-type breeding line into the yellow-fleshed melon (Group Inodorus breeding line AF426-S by backcrossing to produce the resistant line AF426-R, and the amplified fragment length polymorphism (AFLP marker M75/H35_155 reported to be polymorphic between AF426-S and AF426-R. Segregation analysis of M75/H35_155 using a backcross population of 143 plants derived from [AF426-R x AF426-S] x AF426-S and screened for resistance to P. xanthii race 1 produced a recombination frequency of 4.9%, indicating close linkage between M75/H35_155 and Pm-1. Using the same segregating population, the M75/H35_155 marker had previously been reported to be distantly linked to Prv¹, a gene conferring resistance to papaya ringspot virus-type W. Since M75/H35_155 is linked to Prv¹ at a distance of 40.9 cM it is possible that Pm-1 and Prv¹ are also linked.

  4. Production of $3\\pi^{0}$ and $\\eta2\\pi^{0}$ from $\\pi^{-}p$ collision in GAMS experiment

    CERN Document Server

    Kobayashi, Masaaki; Takamatsu, Kunio; Ishida, Shin; Komada, Toshihiko; Wakabayashi, Ayumu; Ishida, Muneyuki; Kobayashi, Masaaki; Tsuru, Tsuneaki; Takamatsu, Kunio; Ishida, Shin; Komada, Toshihiko; Wakabayashi, Ayumu; Ishida, Muneyuki

    2000-01-01

    The data on the pi- p --> M0 n, with M0 = pi0 pi0 pi0 or pi0 pi0 eta obtained in the GAMS experiment may be useful to study the sigma(400--700) and a_1^chi (1000), which can be taken as chiral partners of pi and rho, respectively. A preliminary analysis for 3pi0 invariant mass spectra gives a support for the assumed a_1^chi with a mass of 930 MeV and Gamma = 170 MeV.

  5. Low prevalence of primary HIV resistance in western Massachusetts.

    Science.gov (United States)

    Iarikov, Dmitri E; Irizarry-Acosta, Melina; Martorell, Claudia; Hoffman, Robert P; Skiest, Daniel J

    2010-01-01

    Most studies of primary antiretroviral (ARV) resistance have been conducted in large metropolitan areas with reported rates of 8% to 25%. We collected data on 99 HIV-1-infected antiretroviral-naive patients from several sites in Springfield, MA, who underwent genotypic resistance assay between 2004 and 2008. Only major resistance mutations per International AIDS Society-USA (IAS-USA) drug resistance mutations list were considered. The prevalence of resistance was 5% (5 of 99). Three patients had one nonnucleoside reverse transcriptase inhibitor (NNRTI) mutation: 103N, 103N, and 190A, 1 patient had a protease inhibitor (PI) mutation: 90M; and 1 patient had 3-class resistance with NNRTI: 181C, 190A, PI: 90M, and nucleoside analogue reverse transcriptase inhibitor (NRTI): 41L, 210W. Mean time from HIV diagnosis to resistance testing was shorter in patients with resistance versus those without: 9 (range 0.3-42 months) versus 27 (range 0.1-418 months), P = .11. There was a trend to lower mean CD4 count in those with resistance, 170 versus 318 cells/mm(3), P = .06. No differences were noted in gender, age, HIV risk category, or HIV RNA level. The low prevalence of primary resistance may be explained by differences in demographic and risk factors or may reflect the time from infection to resistance testing. Our findings emphasize the importance of continued resistance surveillance.

  6. Identification and characterization of antibiotic resistance genes in Lactobacillus reuteri and Lactobacillus plantarum.

    Science.gov (United States)

    Egervärn, M; Roos, S; Lindmark, H

    2009-11-01

    The study aimed to identify the resistance genes mediating atypical minimum inhibitory concentrations (MICs) for tetracycline, erythromycin, clindamycin and chloramphenicol within two sets of representative strains of the species Lactobacillus reuteri and Lactobacillus plantarum and to characterize identified genes by means of gene location and sequencing of flanking regions. A tet(W) gene was found in 24 of the 28 Lact. reuteri strains with atypical MIC for tetracycline, whereas four of the six strains with atypical MIC for erythromycin were positive for erm(B) and one strain each was positive for erm(C) and erm(T). The two Lact. plantarum strains with atypical MIC for tetracycline harboured a plasmid-encoded tet(M) gene. The majority of the tet(W)-positive Lact. reuteri strains and all erm-positive Lact. reuteri strains carried the genes on plasmids, as determined by Southern blot and a real-time PCR method developed in this study. Most of the antibiotic-resistant strains of Lact. reuteri and Lact. plantarum harboured known plasmid-encoded resistance genes. Examples of putative transfer machineries adjacent to both plasmid- and chromosome-located resistance genes were also demonstrated. These data provide some of the knowledge required for assessing the possible risk of using Lact. reuteri and Lact. plantarum strains carrying antibiotic resistance genes as starter cultures and probiotics.

  7. Paradoxical DNA repair and peroxide resistance gene conservation in Bacillus pumilus SAFR-032.

    Directory of Open Access Journals (Sweden)

    Jason Gioia

    Full Text Available BACKGROUND: Bacillus spores are notoriously resistant to unfavorable conditions such as UV radiation, gamma-radiation, H2O2, desiccation, chemical disinfection, or starvation. Bacillus pumilus SAFR-032 survives standard decontamination procedures of the Jet Propulsion Lab spacecraft assembly facility, and both spores and vegetative cells of this strain exhibit elevated resistance to UV radiation and H2O2 compared to other Bacillus species. PRINCIPAL FINDINGS: The genome of B. pumilus SAFR-032 was sequenced and annotated. Lists of genes relevant to DNA repair and the oxidative stress response were generated and compared to B. subtilis and B. licheniformis. Differences in conservation of genes, gene order, and protein sequences are highlighted because they potentially explain the extreme resistance phenotype of B. pumilus. The B. pumilus genome includes genes not found in B. subtilis or B. licheniformis and conserved genes with sequence divergence, but paradoxically lacks several genes that function in UV or H2O2 resistance in other Bacillus species. SIGNIFICANCE: This study identifies several candidate genes for further research into UV and H2O2 resistance. These findings will help explain the resistance of B. pumilus and are applicable to understanding sterilization survival strategies of microbes.

  8. High prevalence of multidrug-resistant tuberculosis among patients with rifampicin resistance using GeneXpert Mycobacterium tuberculosis/rifampicin in Ghana.

    Science.gov (United States)

    Boakye-Appiah, Justice K; Steinmetz, Alexis R; Pupulampu, Peter; Ofori-Yirenkyi, Stephen; Tetteh, Ishmael; Frimpong, Michael; Oppong, Patrick; Opare-Sem, Ohene; Norman, Betty R; Stienstra, Ymkje; van der Werf, Tjip S; Wansbrough-Jones, Mark; Bonsu, Frank; Obeng-Baah, Joseph; Phillips, Richard O

    2016-06-01

    Drug-resistant strains of tuberculosis (TB) represent a major threat to global TB control. In low- and middle-income countries, resource constraints make it difficult to identify and monitor cases of resistance using drug susceptibility testing and culture. Molecular assays such as the GeneXpert Mycobacterium tuberculosis/rifampicin may prove to be a cost-effective solution to this problem in these settings. The objective of this study is to evaluate the use of GeneXpert in the diagnosis of pulmonary TB since it was introduced into two tertiary hospitals in Ghana in 2013. A 2-year retrospective audit of clinical cases involving patients who presented with clinically suspected TB or documented TB not improving on standard therapy and had samples sent for GeneXpert testing. GeneXpert identified 169 cases of TB, including 17 cases of rifampicin-resistant TB. Of the seven cases with final culture and drug susceptibility testing results, six demonstrated further drug resistance and five of these were multidrug-resistant TB. These findings call for a scale-up of TB control in Ghana and provide evidence that the expansion of GeneXpert may be an optimal means to improve case finding and guide treatment of drug-resistant TB in this setting. Copyright © 2016. Published by Elsevier Ltd.

  9. {pi}{pi}-correlations in hot and dense matter; {pi}{pi}-Korrelationen in heisser und dichter Materie

    Energy Technology Data Exchange (ETDEWEB)

    Isselhorst, C.

    2006-07-01

    Properties of the {pi}{pi}-interactions in hot and dense matter are studied within a nonperturbative and symmetry conserving approach. The pion and its chiral partner, the {sigma}-meson, are described within the linear {sigma} model and special attention is given to the conservation of the underlying chiral symmetry. The first part deals with the properties of pion and {sigma} in the vacuum, the further being the ''Goldstone''-boson of the theory, while the latter is a broad resonance. The results in the vacuum are tested against experimental results like {pi}{pi}-phase shifts as well as the mass and the width of the {sigma}-meson. Besides the propagator of the {sigma}-meson, the preservation of the chiral symmetry is explicitly examined and chiral Ward identities for the n-point functions of the theory are fulfilled. Furthermore the {pi}{pi}-scattering matrix is calculated and shown to be consistent with predictions from chiral perturbation theory. In the second part of this work the model is extended to finite temperature with special emphasis on the chiral phase transition. The transition temperature and the critical exponent {beta} are determined, and the influence of the temperature on the propagator of the s-meson as well as on the {pi}{pi}-scattering matrix is examined. The third part deals with the properties of pion and {sigma} in dense matter. Additional couplings like the ones to particle-hole excitations and short range repulsion have to be included to ensure stability at nuclear matter density. At zero three momentum one observes a strong downward shift of the {sigma}-mass accompanied by an accumulation of strength near the two-pion threshhold in the spectral function. Taking into account a finite three momentum for the {pi}{pi}-pair, respectively the {sigma}-meson, one observes a weakening of the aforementioned effect. Having thus developed a model for the {pi}{pi}-interaction at finite temperature and density, we try to describe

  10. Genome-Wide Distribution, Organisation and Functional Characterization of Disease Resistance and Defence Response Genes across Rice Species

    Science.gov (United States)

    Singh, Sangeeta; Chand, Suresh; Singh, N. K.; Sharma, Tilak Raj

    2015-01-01

    The resistance (R) genes and defense response (DR) genes have become very important resources for the development of disease resistant cultivars. In the present investigation, genome-wide identification, expression, phylogenetic and synteny analysis was done for R and DR-genes across three species of rice viz: Oryza sativa ssp indica cv 93-11, Oryza sativa ssp japonica and wild rice species, Oryza brachyantha. We used the in silico approach to identify and map 786 R -genes and 167 DR-genes, 672 R-genes and 142 DR-genes, 251 R-genes and 86 DR-genes in the japonica, indica and O. brachyanth a genomes, respectively. Our analysis showed that 60.5% and 55.6% of the R-genes are tandemly repeated within clusters and distributed over all the rice chromosomes in indica and japonica genomes, respectively. The phylogenetic analysis along with motif distribution shows high degree of conservation of R- and DR-genes in clusters. In silico expression analysis of R-genes and DR-genes showed more than 85% were expressed genes showing corresponding EST matches in the databases. This study gave special emphasis on mechanisms of gene evolution and duplication for R and DR genes across species. Analysis of paralogs across rice species indicated 17% and 4.38% R-genes, 29% and 11.63% DR-genes duplication in indica and Oryza brachyantha, as compared to 20% and 26% duplication of R-genes and DR-genes in japonica respectively. We found that during the course of duplication only 9.5% of R- and DR-genes changed their function and rest of the genes have maintained their identity. Syntenic relationship across three genomes inferred that more orthology is shared between indica and japonica genomes as compared to brachyantha genome. Genome wide identification of R-genes and DR-genes in the rice genome will help in allele mining and functional validation of these genes, and to understand molecular mechanism of disease resistance and their evolution in rice and related species. PMID:25902056

  11. On Puzzles and Non-Puzzles in $B \\to \\pi \\pi, \\pi K$ Decays

    CERN Document Server

    Fleischer, Robert; Schwab, F; Fleischer, Robert; Recksiegel, Stefan; Schwab, Felix

    2007-01-01

    Recently, we have seen interesting progress in the exploration of CP violation in B^0_d -> pi^+ pi^-: the measurements of mixing-induced CP violation by the BaBar and Belle collaborations are now in good agreement with each other, whereas the picture of direct CP violation is still unclear. Using the branching ratio and direct CP asymmetry of B^0_d -> pi^- K^+, this situation can be clarified. We predict A_CP^dir(B_d -> pi^+ pi^-) = -0.24+-0.04, which favours the BaBar result, and extract gamma=(70.0^{+3.8}_{-4.3})deg, which agrees with the unitarity triangle fits. Extending our analysis to other B -> pi K modes and B^0_s -> K^+ K^- with the help of the SU(3) flavour symmetry and plausible dynamical assumptions, we find that all observables with colour-suppressed electroweak penguin contributions are measured in excellent agreement with the Standard Model. As far as the ratios R_{c,n} of the charged and neutral B -> pi K branching ratios are concerned, which are sizeably affected by electroweak penguin contri...

  12. Resistance genes in barley (Hordeum vulgare L.) and their identification with molecular markers.

    Science.gov (United States)

    Chełkowski, Jerzy; Tyrka, Mirosław; Sobkiewicz, Andrzej

    2003-01-01

    Current information on barley resistance genes available from scientific papers and on-line databases is summarised. The recent literature contains information on 107 major resistance genes (R genes) against fungal pathogens (excluding powdery mildew), pathogenic viruses and aphids identified in Hordeum vulgare accessions. The highest number of resistance genes was identified against Puccinia hordei, Rhynchosporium secalis, and the viruses BaYMV and BaMMV, with 17, 14 and 13 genes respectively. There is still a lot of confusion regarding symbols for R genes against powdery mildew. Among the 23 loci described to date, two regions Mla and Mlo comprise approximately 31 and 25 alleles. Over 50 R genes have already been localised and over 30 mapped on 7 barley chromosomes. Four barley R genes have been cloned recently: Mlo, Rpg1, Mla1 and Mla6, and their structures (sequences) are available. The paper presents a catalogue of barley resistance gene symbols, their chromosomalocation and the list of available DNA markers useful in characterising cultivars and breeding accessions.

  13. Identification and characterization of potential NBS-encoding resistance genes and induction kinetics of a putative candidate gene associated with downy mildew resistance in Cucumis

    Directory of Open Access Journals (Sweden)

    Wan Hongjian

    2010-08-01

    Full Text Available Abstract Background Due to the variation and mutation of the races of Pseudoperonospora cubensis, downy mildew has in recent years become the most devastating leaf disease of cucumber worldwide. Novel resistance to downy mildew has been identified in the wild Cucumis species, C. hystrix Chakr. After the successful hybridization between C. hystrix and cultivated cucumber (C. sativus L., an introgression line (IL5211S was identified as highly resistant to downy mildew. Nucleotide-binding site and leucine-rich repeat (NBS-LRR genes are the largest class of disease resistance genes cloned from plant with highly conserved domains, which can be used to facilitate the isolation of candidate genes associated with downy mildew resistance in IL5211S. Results Degenerate primers that were designed based on the conserved motifs in the NBS domain of resistance (R proteins were used to isolate NBS-type sequences from IL5211S. A total of 28 sequences were identified and named as cucumber (C. sativus = CS resistance gene analogs as CSRGAs. Polygenetic analyses separated these sequences into four different classes. Quantitative real-time polymerase chain reaction (qRT-PCR analysis showed that these CSRGAs expressed at different levels in leaves, roots, and stems. In addition, introgression from C. hystrix induced expression of the partial CSRGAs in cultivated cucumber, especially CSRGA23, increased four-fold when compared to the backcross parent CC3. Furthermore, the expression of CSRGA23 under P. cubensis infection and abiotic stresses was also analyzed at different time points. Results showed that the P. cubensis treatment and four tested abiotic stimuli, MeJA, SA, ABA, and H2O2, triggered a significant induction of CSRGA23 within 72 h of inoculation. The results indicate that CSRGA23 may play a critical role in protecting cucumber against P. cubensis through a signaling the pathway triggered by these molecules. Conclusions Four classes of NBS-type RGAs were

  14. Naturally occurring hepatitis C virus protease inhibitors resistance-associated mutations among chronic hepatitis C genotype 1b patients with or without HIV co-infection.

    Science.gov (United States)

    Cao, Ying; Zhang, Yu; Bao, Yi; Zhang, Renwen; Zhang, Xiaxia; Xia, Wei; Wu, Hao; Xu, Xiaoyuan

    2016-05-01

    The aim of this study was to measure the frequency of natural mutations in hepatitis C virus (HCV) mono-infected and HIV/HCV co-infected protease inhibitor (PI)-naive patients. Population sequence of the non-structural (NS)3 protease gene was evaluated in 90 HCV mono-infected and 96 HIV/HCV co-infected PI treatment-naive patients. The natural prevalence of PI resistance mutations in both groups was compared. Complete HCV genotype 1b NS3 sequence information was obtained for 152 (81.72%) samples. Seven sequences (8.33%) of the 84 HCV mono-infected patients and 21 sequences (30.88%) of the 68 HIV/HCV co-infected patients showed amino acid substitutions associated with HCV PI resistance. There was a significant difference in the natural prevalence of PI resistance mutations between these two groups (P = 0.000). The mutations T54S, R117H and N174F were observed in 1.19%, 5.95% and 1.19% of HCV mono-infected patients. The mutations F43S, T54S, Q80K/R, R155K, A156G/V, D168A/E/G and V170A were found in 1.47%, 4.41%, 1.47%/1.47%, 2.94%, 23.53%/1.47%, 1.47%/1.47%/1.47% and 1.47% of HIV/HCV co-infected patients, respectively. In addition, the combination mutations in the NS3 region were detected only in HIV/HCV genotype 1b co-infected patients. Naturally occurring HCV PI resistance mutations existed in HCV mono-infected and HIV/HCV co-infected genotype 1b PI-naive patients. HIV co-infection was associated with a greater frequency of PI resistance mutations. The impact of HIV infection on baseline HCV PI resistance mutations and treatment outcome in chronic hepatitis C (CHC) patients should be further analyzed. © 2015 The Japan Society of Hepatology.

  15. A novel resistance gene, lnu(H), conferring resistance to lincosamides in Riemerella anatipestifer CH-2.

    Science.gov (United States)

    Luo, Hong-Yan; Liu, Ma-Feng; Wang, Ming-Shu; Zhao, Xin-Xin; Jia, Ren-Yong; Chen, Shun; Sun, Kun-Feng; Yang, Qiao; Wu, Ying; Chen, Xiao-Yue; Biville, Francis; Zou, Yuan-Feng; Jing, Bo; Cheng, An-Chun; Zhu, De-Kang

    2018-01-01

    The Gram-negative bacterium Riemerella anatipestifer CH-2 is resistant to lincosamides, having a lincomycin (LCM) minimum inhibitory concentration (MIC) of 128 µg/mL. The G148_1775 gene of R. anatipestifer CH-2, designated lnu(H), encodes a 260-amino acid protein with ≤41% identity to other reported lincosamide nucleotidylyltransferases. Escherichia coli Rosetta TM (DE3) containing the pBAD24-lnu(H) plasmid showed four- and two-fold increases in the MICs of LCM and clindamycin (CLI), respectively. A kinetic assay of the purified Lnu(H) enzyme for LCM and CLI showed that the protein could inactive lincosamides. Mass spectrometry analysis demonstrated that the Lnu(H) enzyme catalysed adenylylation of lincosamides. In addition, an lnu(H) gene deletion strain exhibited 512- and 32-fold decreases in LCM and CLI MICs, respectively. The wild-type level of lincosamide resistance could be restored by complementation with a shuttle plasmid carrying the lnu(H) gene. The transformant R. anatipestifer ATCC 11845 [lnu(H)] acquired by natural transformation also exhibited high-level lincosamide resistance. Moreover, among 175 R. anatipestifer field isolates, 56 (32.0%) were positive for the lnu(H) gene by PCR. In conclusion, Lnu(H) is a novel lincosamide nucleotidylyltransferase that inactivates LCM and CLI by nucleotidylylation, thus conferring high-level lincosamide resistance to R. anatipestifer CH-2. Copyright © 2017. Published by Elsevier B.V.

  16. Elastic {pi}{sup +}p and {pi}{sup +}{pi}{sup +} scattering at LHC

    Energy Technology Data Exchange (ETDEWEB)

    Sobol, A.E.; Ryutin, R.A.; Petrov, V.A. [Institute for High Energy Physics, Protvino (Russian Federation); Murray, M.J. [University of Kansas, Lawrence (United States)

    2010-10-15

    We discuss the possibility of measuring leading neutron production at the LHC. These data could be used to extract from it {pi}{sup +}p and {pi}{sup +}{pi}{sup +} cross sections. In this note we give some estimates for the case of elastic cross sections and discuss related problems and prospects. (orig.)

  17. Engineering Plants for Geminivirus Resistance with CRISPR/Cas9 System

    KAUST Repository

    Zaidi, Syed Shan-e-Ali; Mansoor, Shahid; Ali, Zahir; Tashkandi, Manal; Mahfouz, Magdy M.

    2016-01-01

    The CRISPR/Cas9 system is an efficient genome-editing platform for diverse eukaryotic species, including plants. Recent work harnessed CRISPR/Cas9 technology to engineer resistance to geminiviruses. Here, we discuss opportunities, emerging developments, and potential pitfalls for using this technology to engineer resistance against single and multiple geminivirus infections in plants.

  18. Engineering Plants for Geminivirus Resistance with CRISPR/Cas9 System

    KAUST Repository

    Zaidi, Syed Shan-e-Ali

    2016-02-14

    The CRISPR/Cas9 system is an efficient genome-editing platform for diverse eukaryotic species, including plants. Recent work harnessed CRISPR/Cas9 technology to engineer resistance to geminiviruses. Here, we discuss opportunities, emerging developments, and potential pitfalls for using this technology to engineer resistance against single and multiple geminivirus infections in plants.

  19. Induced mutations of rust resistance genes in wheat

    International Nuclear Information System (INIS)

    McIntosh, R.A.

    1983-01-01

    Induced mutations are being used as a tool to study genes for resistance in wheat. It was found that Pm1 can be separated from Lr20 and Sr15, but these two react like a single pleiotropic gene. Mutants were further examined in crosses and backmutations have been attempted. (author)

  20. Overexpression of antibiotic resistance genes in hospital effluents over time

    OpenAIRE

    Rowe, Will P. M.; Baker-Austin, Craig; Verner-Jeffreys, David W.; Ryan, Jim J.; Micallef, Christianne; Maskell, Duncan J.; Pearce, Gareth P.

    2017-01-01

    $\\textbf{Objectives}$: Effluents contain a diverse abundance of antibiotic resistance genes that augment the resistome of receiving aquatic environments. However, uncertainty remains regarding their temporal persistence, transcription and response to anthropogenic factors, such as antibiotic usage. We present a spatiotemporal study within a river catchment (River Cam, UK) that aims to determine the contribution of antibiotic resistance gene-containing effluents originating from sites of varyi...

  1. Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants

    Science.gov (United States)

    Somerville, Chris R [Portola Valley, CA; Scheible, Wolf [Golm, DE

    2007-07-10

    Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  2. Removal of antibiotics and antibiotic resistance genes from domestic sewage by constructed wetlands: Optimization of wetland substrates and hydraulic loading.

    Science.gov (United States)

    Chen, Jun; Wei, Xiao-Dong; Liu, You-Sheng; Ying, Guang-Guo; Liu, Shuang-Shuang; He, Liang-Ying; Su, Hao-Chang; Hu, Li-Xin; Chen, Fan-Rong; Yang, Yong-Qiang

    2016-09-15

    This study aimed to assess removal potential of antibiotics and antibiotic resistance genes (ARGs) in raw domestic wastewater by various mesocosm-scale horizontal subsurface-flow constructed wetlands (CWs) planted Cyperus alternifolius L. with different design parameters. Twelve CWs with three hydraulic loading rates (HLR 10, 20 and 30cm/day) and four substrates (oyster shell, zeolite, medical stone and ceramic) were set up in order to select the best optimized wetland. The result showed that 7 target antibiotics compounds including erythromycin-H2O, lincomycin, monensin, ofloxacin, sulfamerazine, sulfamethazine and novobiocin were detected, and all selected 18 genes (three sulfonamide resistance genes (sul1, sul2 and sul3), four tetracycline resistance genes (tetG, tetM, tetO and tetX), two macrolide resistance genes (ermB and ermC), three quinolone resistance genes (qnrB, qnrD and qnrS) and four chloramphenicol resistance genes (cmlA, fexA, fexB and floR)) and two integrase genes (int1 and int2) were positively detected in the domestic wastewaters. The aqueous removal rates of the total antibiotics ranged from17.9 to 98.5%, while those for the total ARGs varied between 50.0 and 85.8% by the mesocosm-scale CWs. After considering their aqueous removal rates in combination with their mass removals, the CW with zeolite as the substrate and HLR of 20cm/day was selected as the best choice. Combined chemical and biological analyses indicate that both microbial degradation and physical sorption processes were responsible for the fate of antibiotics and ARGs in the wetlands. The findings from this study suggest constructed wetlands could be a promising technology for the removal of emerging contaminants such as antibiotics and ARGs in domestic wastewater. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. Measurement of $\\omega$ meson parameters in $\\pi^{+}\\pi^{-}\\pi^{0}$ decay mode with CMD-2

    CERN Document Server

    Akhmetshin, R R; Aulchenko, V M; Banzarov, V S; Barkov, L M; Baru, S E; Bashtovoy, N S; Bondar, A E; Bondarev, D V; Chernyak, D V; Dhawan, S K; Eidelman, S I; Fedotovich, G V; Gabyshev, N I; Grebeniuk, A A; Grigoriev, D N; Hughes, V W; Khazin, B I; Koop, I A; Kurdadze, L M; Kuzmin, A S; Logashenko, I B; Lukin, P A; Lysenko, A P; Nesterenko, I N; Okhapkin, V S; Perevedentsev, E A; Polunin, A A; Purlatz, T A; Root, N I; Ruban, A A; Ryskulov, N M; Shamov, A G; Shatunov, Yu M; Shekhtman, A I; Sher, A E; Shwartz, B A; Sidorov, V A; Skrinsky, A N; Smakhtin, V P; Snopkov, I G; Solodov, E P; Stepanov, P Yu; Sukhanov, A Yu; Thompson, J A; Titov, V M; Valishev, A A; Yudin, Yu V; Zverev, S G

    2000-01-01

    About 11 200 $ e^+e^- \\to \\omega \\to \\pi^+\\pi^-\\pi^0$ events selected in the center of mass energy range from 760 to 810 MeV were used for the measurement of the $\\omega$ meson parameters. The following results have been obtained: $\\sigma _{0}=(1457 \\pm 23 \\pm 19 )$ nb, $m_{\\omega }=(782.71 \\pm 0.07 \\pm 0.04)$ MeV/c$^{2}$, $\\Gamma _{\\omega }=(8.68 \\pm 0.23 \\pm 0.10 )$ MeV, $\\Gamma _{e^+e^-}\\cdot$Br$(ømega \\to \\pi^+\\pi^-\\pi^0)= (0.528 \\pm 0.012 \\pm 0.007) \\cdot 10^{-3}$ MeV.

  4. SolRgene: an online database to explore disease resistance genes in tuber-bearing Solanum species

    Directory of Open Access Journals (Sweden)

    Vleeshouwers Vivianne GAA

    2011-08-01

    Full Text Available Abstract Background The cultivated potato (Solanum tuberosum L. is an important food crop, but highly susceptible to many pathogens. The major threat to potato production is the Irish famine pathogen Phytophthora infestans, which causes the devastating late blight disease. Potato breeding makes use of germplasm from wild relatives (wild germplasm to introduce resistances into cultivated potato. The Solanum section Petota comprises tuber-bearing species that are potential donors of new disease resistance genes. The aim of this study was to explore Solanum section Petota for resistance genes and generate a widely accessible resource that is useful for studying and implementing disease resistance in potato. Description The SolRgene database contains data on resistance to P. infestans and presence of R genes and R gene homologues in Solanum section Petota. We have explored Solanum section Petota for resistance to late blight in high throughput disease tests under various laboratory conditions and in field trials. From resistant wild germplasm, segregating populations were generated and assessed for the presence of resistance genes. All these data have been entered into the SolRgene database. To facilitate genetic and resistance gene evolution studies, phylogenetic data of the entire SolRgene collection are included, as well as a tool for generating phylogenetic trees of selected groups of germplasm. Data from resistance gene allele-mining studies are incorporated, which enables detection of R gene homologs in related germplasm. Using these resources, various resistance genes have been detected and some of these have been cloned, whereas others are in the cloning pipeline. All this information is stored in the online SolRgene database, which allows users to query resistance data, sequences, passport data of the accessions, and phylogenic classifications. Conclusion Solanum section Petota forms the basis of the SolRgene database, which contains a

  5. Studies of the resonance structure in $D^{0} \\to K^\\mp \\pi^\\pm \\pi^\\pm \\pi^\\mp$ decays

    CERN Document Server

    Aaij, Roel; LHCb Collaboration; Adinolfi, Marco; Ajaltouni, Ziad; Akar, Simon; Albrecht, Johannes; Alessio, Federico; Alexander, Michael; Alfonso Albero, Alejandro; Ali, Suvayu; Alkhazov, Georgy; Alvarez Cartelle, Paula; Alves Jr, Antonio Augusto; Amato, Sandra; Amerio, Silvia; Amhis, Yasmine; An, Liupan; Anderlini, Lucio; Andreassi, Guido; Andreotti, Mirco; Andrews, Jason; Appleby, Robert; Archilli, Flavio; d'Argent, Philippe; Arnau Romeu, Joan; Artamonov, Alexander; Artuso, Marina; Aslanides, Elie; Atzeni, Michele; Auriemma, Giulio; Baalouch, Marouen; Babuschkin, Igor; Bachmann, Sebastian; Back, John; Badalov, Alexey; Baesso, Clarissa; Baker, Sophie; Balagura, Vladislav; Baldini, Wander; Baranov, Alexander; Barlow, Roger; Barschel, Colin; Barsuk, Sergey; Barter, William; Baryshnikov, Fedor; Batozskaya, Varvara; Battista, Vincenzo; Bay, Aurelio; Beaucourt, Leo; Beddow, John; Bedeschi, Franco; Bediaga, Ignacio; Beiter, Andrew; Bel, Lennaert; Beliy, Nikita; Bellee, Violaine; Belloli, Nicoletta; Belous, Konstantin; Belyaev, Ivan; Ben-Haim, Eli; Bencivenni, Giovanni; Benson, Sean; Beranek, Sarah; Berezhnoy, Alexander; Bernet, Roland; Berninghoff, Daniel; Bertholet, Emilie; Bertolin, Alessandro; Betancourt, Christopher; Betti, Federico; Bettler, Marc-Olivier; van Beuzekom, Martinus; Bezshyiko, Iaroslava; Bifani, Simone; Billoir, Pierre; Birnkraut, Alex; Bizzeti, Andrea; Bjørn, Mikkel; Blake, Thomas; Blanc, Frederic; Blusk, Steven; Bocci, Valerio; Boettcher, Thomas; Bondar, Alexander; Bondar, Nikolay; Bordyuzhin, Igor; Borghi, Silvia; Borisyak, Maxim; Borsato, Martino; Bossu, Francesco; Boubdir, Meriem; Bowcock, Themistocles; Bowen, Espen Eie; Bozzi, Concezio; Braun, Svende; Brodzicka, Jolanta; Brundu, Davide; Buchanan, Emma; Burr, Christopher; Bursche, Albert; Buytaert, Jan; Byczynski, Wiktor; Cadeddu, Sandro; Cai, Hao; Calabrese, Roberto; Calladine, Ryan; Calvi, Marta; Calvo Gomez, Miriam; Camboni, Alessandro; Campana, Pierluigi; Campora Perez, Daniel Hugo; Capriotti, Lorenzo; Carbone, Angelo; Carboni, Giovanni; Cardinale, Roberta; Cardini, Alessandro; Carniti, Paolo; Carson, Laurence; Carvalho Akiba, Kazuyoshi; Casse, Gianluigi; Cassina, Lorenzo; Cattaneo, Marco; Cavallero, Giovanni; Cenci, Riccardo; Chamont, David; Chapman, Matthew George; Charles, Matthew; Charpentier, Philippe; Chatzikonstantinidis, Georgios; Chefdeville, Maximilien; Chen, Shanzhen; Cheung, Shu Faye; Chitic, Stefan-Gabriel; Chobanova, Veronika; Chrzaszcz, Marcin; Chubykin, Alexsei; Ciambrone, Paolo; Cid Vidal, Xabier; Ciezarek, Gregory; Clarke, Peter; Clemencic, Marco; Cliff, Harry; Closier, Joel; Coco, Victor; Cogan, Julien; Cogneras, Eric; Cogoni, Violetta; Cojocariu, Lucian; Collins, Paula; Colombo, Tommaso; Comerma-Montells, Albert; Contu, Andrea; Coombs, George; Coquereau, Samuel; Corti, Gloria; Corvo, Marco; Costa Sobral, Cayo Mar; Couturier, Benjamin; Cowan, Greig; Craik, Daniel Charles; Crocombe, Andrew; Cruz Torres, Melissa Maria; Currie, Robert; D'Ambrosio, Carmelo; Da Cunha Marinho, Franciole; Da Silva, Cesar Luiz; Dall'Occo, Elena; Dalseno, Jeremy; Davis, Adam; De Aguiar Francisco, Oscar; De Bruyn, Kristof; De Capua, Stefano; De Cian, Michel; De Miranda, Jussara; De Paula, Leandro; De Serio, Marilisa; De Simone, Patrizia; Dean, Cameron Thomas; Decamp, Daniel; Del Buono, Luigi; Dembinski, Hans Peter; Demmer, Moritz; Dendek, Adam; Derkach, Denis; Deschamps, Olivier; Dettori, Francesco; Dey, Biplab; Di Canto, Angelo; Di Nezza, Pasquale; Dijkstra, Hans; Dordei, Francesca; Dorigo, Mirco; Dosil Suárez, Alvaro; Douglas, Lauren; Dovbnya, Anatoliy; Dreimanis, Karlis; Dufour, Laurent; Dujany, Giulio; Durante, Paolo; Durham, John Matthew; Dutta, Deepanwita; Dzhelyadin, Rustem; Dziewiecki, Michal; Dziurda, Agnieszka; Dzyuba, Alexey; Easo, Sajan; Ebert, Marcus; Egede, Ulrik; Egorychev, Victor; Eidelman, Semen; Eisenhardt, Stephan; Eitschberger, Ulrich; Ekelhof, Robert; Eklund, Lars; Ely, Scott; Esen, Sevda; Evans, Hannah Mary; Evans, Timothy; Falabella, Antonio; Farley, Nathanael; Farry, Stephen; Fazzini, Davide; Federici, Luca; Ferguson, Dianne; Fernandez, Gerard; Fernandez Declara, Placido; Fernandez Prieto, Antonio; Ferrari, Fabio; Ferreira Lopes, Lino; Ferreira Rodrigues, Fernando; Ferro-Luzzi, Massimiliano; Filippov, Sergey; Fini, Rosa Anna; Fiorini, Massimiliano; Firlej, Miroslaw; Fitzpatrick, Conor; Fiutowski, Tomasz; Fleuret, Frederic; Fontana, Marianna; Fontanelli, Flavio; Forty, Roger; Franco Lima, Vinicius; Frank, Markus; Frei, Christoph; Fu, Jinlin; Funk, Wolfgang; Furfaro, Emiliano; Färber, Christian; Gabriel, Emmy; Gallas Torreira, Abraham; Galli, Domenico; Gallorini, Stefano; Gambetta, Silvia; Gandelman, Miriam; Gandini, Paolo; Gao, Yuanning; Garcia Martin, Luis Miguel; García Pardiñas, Julián; Garra Tico, Jordi; Garrido, Lluis; Garsed, Philip John; Gascon, David; Gaspar, Clara; Gavardi, Laura; Gazzoni, Giulio; Gerick, David; Gersabeck, Evelina; Gersabeck, Marco; Gershon, Timothy; Ghez, Philippe; Gianì, Sebastiana; Gibson, Valerie; Girard, Olivier Göran; Giubega, Lavinia-Helena; Gizdov, Konstantin; Gligorov, Vladimir; Golubkov, Dmitry; Golutvin, Andrey; Gomes, Alvaro; Gorelov, Igor Vladimirovich; Gotti, Claudio; Govorkova, Ekaterina; Grabowski, Jascha Peter; Graciani Diaz, Ricardo; Granado Cardoso, Luis Alberto; Graugés, Eugeni; Graverini, Elena; Graziani, Giacomo; Grecu, Alexandru; Greim, Roman; Griffith, Peter; Grillo, Lucia; Gruber, Lukas; Gruberg Cazon, Barak Raimond; Grünberg, Oliver; Gushchin, Evgeny; Guz, Yury; Gys, Thierry; Göbel, Carla; Hadavizadeh, Thomas; Hadjivasiliou, Christos; Haefeli, Guido; Haen, Christophe; Haines, Susan; Hamilton, Brian; Han, Xiaoxue; Hancock, Thomas Henry; Hansmann-Menzemer, Stephanie; Harnew, Neville; Harnew, Samuel; Hasse, Christoph; Hatch, Mark; He, Jibo; Hecker, Malte; Heinicke, Kevin; Heister, Arno; Hennessy, Karol; Henrard, Pierre; Henry, Louis; van Herwijnen, Eric; Heß, Miriam; Hicheur, Adlène; Hill, Donal; Hopchev, Plamen Hristov; Hu, Wenhua; Huang, Wenqian; Huard, Zachary; Hulsbergen, Wouter; Humair, Thibaud; Hushchyn, Mikhail; Hutchcroft, David; Ibis, Philipp; Idzik, Marek; Ilten, Philip; Jacobsson, Richard; Jalocha, Pawel; Jans, Eddy; Jawahery, Abolhassan; Jiang, Feng; John, Malcolm; Johnson, Daniel; Jones, Christopher; Joram, Christian; Jost, Beat; Jurik, Nathan; Kandybei, Sergii; Karacson, Matthias; Kariuki, James Mwangi; Karodia, Sarah; Kazeev, Nikita; Kecke, Matthieu; Keizer, Floris; Kelsey, Matthew; Kenzie, Matthew; Ketel, Tjeerd; Khairullin, Egor; Khanji, Basem; Khurewathanakul, Chitsanu; Kirn, Thomas; Klaver, Suzanne; Klimaszewski, Konrad; Klimkovich, Tatsiana; Koliiev, Serhii; Kolpin, Michael; Kopecna, Renata; Koppenburg, Patrick; Kosmyntseva, Alena; Kotriakhova, Sofia; Kozeiha, Mohamad; Kravchuk, Leonid; Kreps, Michal; Kress, Felix Johannes; Krokovny, Pavel; Krzemien, Wojciech; Kucewicz, Wojciech; Kucharczyk, Marcin; Kudryavtsev, Vasily; Kuonen, Axel Kevin; Kvaratskheliya, Tengiz; Lacarrere, Daniel; Lafferty, George; Lai, Adriano; Lanfranchi, Gaia; Langenbruch, Christoph; Latham, Thomas; Lazzeroni, Cristina; Le Gac, Renaud; Leflat, Alexander; Lefrançois, Jacques; Lefèvre, Regis; Lemaitre, Florian; Lemos Cid, Edgar; Leroy, Olivier; Lesiak, Tadeusz; Leverington, Blake; Li, Pei-Rong; Li, Tenglin; Li, Yiming; Li, Zhuoming; Likhomanenko, Tatiana; Lindner, Rolf; Lionetto, Federica; Lisovskyi, Vitalii; Liu, Xuesong; Loh, David; Loi, Angelo; Longstaff, Iain; Lopes, Jose; Lucchesi, Donatella; Lucio Martinez, Miriam; Luo, Haofei; Lupato, Anna; Luppi, Eleonora; Lupton, Oliver; Lusiani, Alberto; Lyu, Xiao-Rui; Machefert, Frederic; Maciuc, Florin; Macko, Vladimir; Mackowiak, Patrick; Maddrell-Mander, Samuel; Maev, Oleg; Maguire, Kevin; Maisuzenko, Dmitrii; Majewski, Maciej Witold; Malde, Sneha; Malecki, Bartosz; Malinin, Alexander; Maltsev, Timofei; Manca, Giulia; Mancinelli, Giampiero; Marangotto, Daniele; Maratas, Jan; Marchand, Jean François; Marconi, Umberto; Marin Benito, Carla; Marinangeli, Matthieu; Marino, Pietro; Marks, Jörg; Martellotti, Giuseppe; Martin, Morgan; Martinelli, Maurizio; Martinez Santos, Diego; Martinez Vidal, Fernando; Massafferri, André; Matev, Rosen; Mathad, Abhijit; Mathe, Zoltan; Matteuzzi, Clara; Mauri, Andrea; Maurice, Emilie; Maurin, Brice; Mazurov, Alexander; McCann, Michael; McNab, Andrew; McNulty, Ronan; Mead, James Vincent; Meadows, Brian; Meaux, Cedric; Meier, Frank; Meinert, Nis; Melnychuk, Dmytro; Merk, Marcel; Merli, Andrea; Michielin, Emanuele; Milanes, Diego Alejandro; Millard, Edward James; Minard, Marie-Noelle; Minzoni, Luca; Mitzel, Dominik Stefan; Mogini, Andrea; Molina Rodriguez, Josue; Mombächer, Titus; Monroy, Igancio Alberto; Monteil, Stephane; Morandin, Mauro; Morello, Michael Joseph; Morgunova, Olga; Moron, Jakub; Morris, Adam Benjamin; Mountain, Raymond; Muheim, Franz; Mulder, Mick; Müller, Dominik; Müller, Janine; Müller, Katharina; Müller, Vanessa; Naik, Paras; Nakada, Tatsuya; Nandakumar, Raja; Nandi, Anita; Nasteva, Irina; Needham, Matthew; Neri, Nicola; Neubert, Sebastian; Neufeld, Niko; Neuner, Max; Nguyen, Thi Dung; Nguyen-Mau, Chung; Nieswand, Simon; Niet, Ramon; Nikitin, Nikolay; Nikodem, Thomas; Nogay, Alla; O'Hanlon, Daniel Patrick; Oblakowska-Mucha, Agnieszka; Obraztsov, Vladimir; Ogilvy, Stephen; Oldeman, Rudolf; Onderwater, Gerco; Ossowska, Anna; Otalora Goicochea, Juan Martin; Owen, Patrick; Oyanguren, Maria Aranzazu; Pais, Preema Rennee; Palano, Antimo; Palutan, Matteo; Papanestis, Antonios; Pappagallo, Marco; Pappalardo, Luciano; Parker, William; Parkes, Christopher; Passaleva, Giovanni; Pastore, Alessandra; Patel, Mitesh; Patrignani, Claudia; Pearce, Alex; Pellegrino, Antonio; Penso, Gianni; Pepe Altarelli, Monica; Perazzini, Stefano; Pereima, Dmitrii; Perret, Pascal; Pescatore, Luca; Petridis, Konstantinos; Petrolini, Alessandro; Petrov, Aleksandr; Petruzzo, Marco; Picatoste Olloqui, Eduardo; Pietrzyk, Boleslaw; Pietrzyk, Guillaume; Pikies, Malgorzata; Pinci, Davide; Pisani, Flavio; Pistone, Alessandro; Piucci, Alessio; Placinta, Vlad-Mihai; Playfer, Stephen; Plo Casasus, Maximo; Polci, Francesco; Poli Lener, Marco; Poluektov, Anton; Polyakov, Ivan; Polycarpo, Erica; Pomery, Gabriela Johanna; Ponce, Sebastien; Popov, Alexander; Popov, Dmitry; Poslavskii, Stanislav; Potterat, Cédric; Price, Eugenia; Prisciandaro, Jessica; Prouve, Claire; Pugatch, Valery; Puig Navarro, Albert; Pullen, Hannah Louise; Punzi, Giovanni; Qian, Wenbin; Qin, Jia-Jia; Quagliani, Renato; Quintana, Boris; Rachwal, Bartlomiej; Rademacker, Jonas; Rama, Matteo; Ramos Pernas, Miguel; Rangel, Murilo; Raniuk, Iurii; Ratnikov, Fedor; Raven, Gerhard; Ravonel Salzgeber, Melody; Reboud, Meril; Redi, Federico; Reichert, Stefanie; dos Reis, Alberto; Remon Alepuz, Clara; Renaudin, Victor; Ricciardi, Stefania; Richards, Sophie; Rihl, Mariana; Rinnert, Kurt; Robbe, Patrick; Robert, Arnaud; Rodrigues, Ana Barbara; Rodrigues, Eduardo; Rodriguez Lopez, Jairo Alexis; Rogozhnikov, Alexey; Roiser, Stefan; Rollings, Alexandra Paige; Romanovskiy, Vladimir; Romero Vidal, Antonio; Rotondo, Marcello; Rudolph, Matthew Scott; Ruf, Thomas; Ruiz Valls, Pablo; Ruiz Vidal, Joan; Saborido Silva, Juan Jose; Sadykhov, Elnur; Sagidova, Naylya; Saitta, Biagio; Salustino Guimaraes, Valdir; Sanchez Mayordomo, Carlos; Sanmartin Sedes, Brais; Santacesaria, Roberta; Santamarina Rios, Cibran; Santimaria, Marco; Santovetti, Emanuele; Sarpis, Gediminas; Sarti, Alessio; Satriano, Celestina; Satta, Alessia; Saunders, Daniel Martin; Savrina, Darya; Schael, Stefan; Schellenberg, Margarete; Schiller, Manuel; Schindler, Heinrich; Schmelling, Michael; Schmelzer, Timon; Schmidt, Burkhard; Schneider, Olivier; Schopper, Andreas; Schreiner, HF; Schubiger, Maxime; Schune, Marie Helene; Schwemmer, Rainer; Sciascia, Barbara; Sciubba, Adalberto; Semennikov, Alexander; Sepulveda, Eduardo Enrique; Sergi, Antonino; Serra, Nicola; Serrano, Justine; Sestini, Lorenzo; Seyfert, Paul; Shapkin, Mikhail; Shapoval, Illya; Shcheglov, Yury; Shears, Tara; Shekhtman, Lev; Shevchenko, Vladimir; Siddi, Benedetto Gianluca; Silva Coutinho, Rafael; Silva de Oliveira, Luiz Gustavo; Simi, Gabriele; Simone, Saverio; Sirendi, Marek; Skidmore, Nicola; Skwarnicki, Tomasz; Smith, Iwan Thomas; Smith, Jackson; Smith, Mark; Soares Lavra, Lais; Sokoloff, Michael; Soler, Paul; Souza De Paula, Bruno; Spaan, Bernhard; Spradlin, Patrick; Sridharan, Srikanth; Stagni, Federico; Stahl, Marian; Stahl, Sascha; Stefko, Pavol; Stefkova, Slavomira; Steinkamp, Olaf; Stemmle, Simon; Stenyakin, Oleg; Stepanova, Margarita; Stevens, Holger; Stone, Sheldon; Storaci, Barbara; Stracka, Simone; Stramaglia, Maria Elena; Straticiuc, Mihai; Straumann, Ulrich; Sun, Jiayin; Sun, Liang; Swientek, Krzysztof; Syropoulos, Vasileios; Szumlak, Tomasz; Szymanski, Maciej Pawel; T'Jampens, Stephane; Tayduganov, Andrey; Tekampe, Tobias; Tellarini, Giulia; Teubert, Frederic; Thomas, Eric; van Tilburg, Jeroen; Tilley, Matthew James; Tisserand, Vincent; Tobin, Mark; Tolk, Siim; Tomassetti, Luca; Tonelli, Diego; Tourinho Jadallah Aoude, Rafael; Tournefier, Edwige; Traill, Murdo; Tran, Minh Tâm; Tresch, Marco; Trisovic, Ana; Tsaregorodtsev, Andrei; Tsopelas, Panagiotis; Tully, Alison; Tuning, Niels; Ukleja, Artur; Usachov, Andrii; Ustyuzhanin, Andrey; Uwer, Ulrich; Vacca, Claudia; Vagner, Alexander; Vagnoni, Vincenzo; Valassi, Andrea; Valat, Sebastien; Valenti, Giovanni; Vazquez Gomez, Ricardo; Vazquez Regueiro, Pablo; Vecchi, Stefania; van Veghel, Maarten; Velthuis, Jaap; Veltri, Michele; Veneziano, Giovanni; Venkateswaran, Aravindhan; Verlage, Tobias Anton; Vernet, Maxime; Vesterinen, Mika; Viana Barbosa, Joao Vitor; Vieira, Daniel; Vieites Diaz, Maria; Viemann, Harald; Vilasis-Cardona, Xavier; Vitti, Marcela; Volkov, Vladimir; Vollhardt, Achim; Voneki, Balazs; Vorobyev, Alexey; Vorobyev, Vitaly; Voß, Christian; de Vries, Jacco; Vázquez Sierra, Carlos; Waldi, Roland; Walsh, John; Wang, Jianchun; Wang, Yilong; Ward, David; Wark, Heather Mckenzie; Watson, Nigel; Websdale, David; Weiden, Andreas; Weisser, Constantin; Whitehead, Mark; Wicht, Jean; Wilkinson, Guy; Wilkinson, Michael; Williams, Mark Richard James; Williams, Mike; Williams, Timothy; Wilson, Fergus; Wimberley, Jack; Winn, Michael Andreas; Wishahi, Julian; Wislicki, Wojciech; Witek, Mariusz; Wormser, Guy; Wotton, Stephen; Wyllie, Kenneth; Xie, Yuehong; Xu, Menglin; Xu, Qingnian; Xu, Zehua; Xu, Zhirui; Yang, Zhenwei; Yang, Zishuo; Yao, Yuezhe; Yin, Hang; Yu, Jiesheng; Yuan, Xuhao; Yushchenko, Oleg; Zarebski, Kristian Alexander; Zavertyaev, Mikhail; Zhang, Liming; Zhang, Yanxi; Zhelezov, Alexey; Zheng, Yangheng; Zhu, Xianglei; Zhukov, Valery; Zonneveld, Jennifer Brigitta; Zucchelli, Stefano

    2018-01-01

    Amplitude models are constructed to describe the resonance structure of ${D^{0}\\to K^{-}\\pi^{+}\\pi^{+}\\pi^{-}}$ and ${D^{0} \\to K^{+}\\pi^{-}\\pi^{-}\\pi^{+}}$ decays using $pp$ collision data collected at centre-of-mass energies of 7 and 8 TeV with the LHCb experiment, corresponding to an integrated luminosity of $3.0\\mathrm{fb}^{-1}$. The largest contributions to both decay amplitudes are found to come from axial resonances, with decay modes $D^{0} \\to a_1(1260)^{+} K^{-}$ and $D^{0} \\to K_1(1270/1400)^{+} \\pi^{-}$ being prominent in ${D^{0}\\to K^{-}\\pi^{+}\\pi^{+}\\pi^{-}}$ and $D^{0}\\to K^{+}\\pi^{-}\\pi^{-}\\pi^{+}$, respectively. Precise measurements of the lineshape parameters and couplings of the $a_1(1260)^{+}$, $K_1(1270)^{-}$ and $K(1460)^{-}$ resonances are made, and a quasi model-independent study of the $K(1460)^{-}$ resonance is performed. The coherence factor of the decays is calculated from the amplitude models to be $R_{K3\\pi} = 0.459\\pm 0.010\\,(\\mathrm{stat}) \\pm 0.012\\,(\\mathrm{syst}) \\pm 0.020\\,(...

  6. Measurement of the Branching Fraction and Decay Rate Asymmetry of B to D_pi+ pi- pi0 K-

    Energy Technology Data Exchange (ETDEWEB)

    Aubert, B.; Barate, R.; Boutigny, D.; Couderc, F.; Karyotakis, Y.; Lees, J.P.; Poireau, V.; Tisserand, V.; Zghiche, A.; /Annecy, LAPP; Grauges, E.; /Barcelona, IFAE; Palano, A.; Pappagallo, M.; Pompili, A.; /Bari U. /INFN, Bari; Chen, J.C.; Qi, N.D.; Rong, G.; Wang, P.; Zhu, Y.S.; /Beijing, Inst. High Energy Phys.; Eigen, G.; Ofte, I.; Stugu, B.

    2005-06-10

    The authors report the observation of the decay B{sup -} {yields} D{sub {pi}{sup +}{pi}{sup -}{pi}{sup 0}}K{sup -}, where D{sub {pi}{sup +}{pi}{sup -}{pi}{sup 0}} indicates a neutral D meson detected in the final state {pi}{sup +}{pi}{sup -}{pi}{sup 0}, excluding K{sub S}{sup 0}{pi}{sup 0}. This doubly Cabibbo-suppressed decay chain can be used to measure the CKM phase {gamma}. Using about 229 million e{sup +}e{sup -} {yields} B{bar B} events recorded by the BABAR experiment at the PEP-II e{sup +}e{sup -} storage ring, they measure the branching fraction {Beta}(B{sup -} {yields} D{sub {pi}{sup +}{pi}{sup -}{pi}{sup 0}K{sup -}}) = (5.5 {+-} 1.0 (stat.) {+-} 0.7 (syst.)) x 10{sup -6} and the decay rate asymmetry A = -0.02 {+-} 0.16 (stat.) {+-} 0.03 (syst.) for the full decay chain.

  7. Radiative corrections to the charged pion-pair production process {pi}{sup -}{gamma} {yields} {pi}{sup +}{pi}{sup -}{pi}{sup -} at low energies

    Energy Technology Data Exchange (ETDEWEB)

    Kaiser, N.; Petschauer, S. [Technische Universitaet Muenchen, Physik-Department T39, Garching (Germany)

    2013-12-15

    We calculate the one-photon loop radiative corrections to the charged pion-pair production process {pi}{sup -}{gamma} {yields} {pi}{sup +}{pi}{sup -}{pi}{sup -}. In the low-energy region this reaction is governed by the chiral pion-pion interaction. The pertinent set of 42 irreducible photon-loop diagrams is calculated by using the package FeynCalc. Electromagnetic counterterms with two independent low-energy constants k{sub 1} and k{sub 2} are included in order to remove the ultraviolet divergences generated by the photon loops. Infrared finiteness of the virtual radiative corrections is achieved by including soft photon radiation below an energy cut-off {Lambda}. The purely electromagnetic interaction of the charged pions mediated by one-photon exchange is also taken into account. The radiative corrections to the total cross section (in the isospin limit) vary between +10% close to threshold and about -1% at a center-of-mass energy of 7m{sub {pi}}. The largest contribution comes from the simple one-photon exchange. Radiative corrections to the {pi}{sup +}{pi}{sup -} and {pi}{sup -}{pi}{sup -} mass spectra are studied as well. The Coulomb singularity of the final-state interaction produces a kink in the dipion mass spectra. The virtual radiative corrections to elastic {pi}{sup -}{pi}{sup -} scattering are derived additionally. (orig.)

  8. Oryza sativa L.

    African Journals Online (AJOL)

    Jane

    2011-07-11

    Jul 11, 2011 ... Disease resistance in plants is a desirable economic trait. Many disease ... in BRGA-1(blast resistant gene analogue-1), putative retro-elements and putative retro-transposons proteins in ... with approximately 150 described in the Colombia ecotype of .... molecular basis of NBS2-Pi9 in broad-spectrum blast.

  9. Introgression of ivermectin resistance genes into a susceptible Haemonchus contortus strain by multiple backcrossing.

    Directory of Open Access Journals (Sweden)

    Elizabeth Redman

    2012-02-01

    Full Text Available Anthelmintic drug resistance in livestock parasites is already widespread and in recent years there has been an increasing level of anthelmintic drug selection pressure applied to parasitic nematode populations in humans leading to concerns regarding the emergence of resistance. However, most parasitic nematodes, particularly those of humans, are difficult experimental subjects making mechanistic studies of drug resistance extremely difficult. The small ruminant parasitic nematode Haemonchus contortus is a more amenable model system to study many aspects of parasite biology and investigate the basic mechanisms and genetics of anthelmintic drug resistance. Here we report the successful introgression of ivermectin resistance genes from two independent ivermectin resistant strains, MHco4(WRS and MHco10(CAVR, into the susceptible genome reference strain MHco3(ISE using a backcrossing approach. A panel of microsatellite markers were used to monitor the procedure. We demonstrated that after four rounds of backcrossing, worms that were phenotypically resistant to ivermectin had a similar genetic background to the susceptible reference strain based on the bulk genotyping with 18 microsatellite loci and individual genotyping with a sub-panel of 9 microsatellite loci. In addition, a single marker, Hcms8a20, showed evidence of genetic linkage to an ivermectin resistance-conferring locus providing a starting point for more detailed studies of this genomic region to identify the causal mutation(s. This work presents a novel genetic approach to study anthelmintic resistance and provides a "proof-of-concept" of the use of forward genetics in an important model strongylid parasite of relevance to human hookworms. The resulting strains provide valuable resources for candidate gene studies, whole genome approaches and for further genetic analysis to identify ivermectin resistance loci.

  10. Herbicide resistance-endowing ACCase gene mutations in hexaploid wild oat (Avena fatua): insights into resistance evolution in a hexaploid species

    Science.gov (United States)

    Yu, Q; Ahmad-Hamdani, M S; Han, H; Christoffers, M J; Powles, S B

    2013-01-01

    Many herbicide-resistant weed species are polyploids, but far too little about the evolution of resistance mutations in polyploids is understood. Hexaploid wild oat (Avena fatua) is a global crop weed and many populations have evolved herbicide resistance. We studied plastidic acetyl-coenzyme A carboxylase (ACCase)-inhibiting herbicide resistance in hexaploid wild oat and revealed that resistant individuals can express one, two or three different plastidic ACCase gene resistance mutations (Ile-1781-Leu, Asp-2078-Gly and Cys-2088-Arg). Using ACCase resistance mutations as molecular markers, combined with genetic, molecular and biochemical approaches, we found in individual resistant wild-oat plants that (1) up to three unlinked ACCase gene loci assort independently following Mendelian laws for disomic inheritance, (2) all three of these homoeologous ACCase genes were transcribed, with each able to carry its own mutation and (3) in a hexaploid background, each individual ACCase resistance mutation confers relatively low-level herbicide resistance, in contrast to high-level resistance conferred by the same mutations in unrelated diploid weed species of the Poaceae (grass) family. Low resistance conferred by individual ACCase resistance mutations is likely due to a dilution effect by susceptible ACCase expressed by homoeologs in hexaploid wild oat and/or differential expression of homoeologous ACCase gene copies. Thus, polyploidy in hexaploid wild oat may slow resistance evolution. Evidence of coexisting non-target-site resistance mechanisms among wild-oat populations was also revealed. In all, these results demonstrate that herbicide resistance and its evolution can be more complex in hexaploid wild oat than in unrelated diploid grass weeds. Our data provide a starting point for the daunting task of understanding resistance evolution in polyploids. PMID:23047200

  11. Patient survival and tumor characteristics associated with CHEK2:p.I157T - findings from the Breast Cancer Association Consortium.

    Science.gov (United States)

    Muranen, Taru A; Blomqvist, Carl; Dörk, Thilo; Jakubowska, Anna; Heikkilä, Päivi; Fagerholm, Rainer; Greco, Dario; Aittomäki, Kristiina; Bojesen, Stig E; Shah, Mitul; Dunning, Alison M; Rhenius, Valerie; Hall, Per; Czene, Kamila; Brand, Judith S; Darabi, Hatef; Chang-Claude, Jenny; Rudolph, Anja; Nordestgaard, Børge G; Couch, Fergus J; Hart, Steven N; Figueroa, Jonine; García-Closas, Montserrat; Fasching, Peter A; Beckmann, Matthias W; Li, Jingmei; Liu, Jianjun; Andrulis, Irene L; Winqvist, Robert; Pylkäs, Katri; Mannermaa, Arto; Kataja, Vesa; Lindblom, Annika; Margolin, Sara; Lubinski, Jan; Dubrowinskaja, Natalia; Bolla, Manjeet K; Dennis, Joe; Michailidou, Kyriaki; Wang, Qin; Easton, Douglas F; Pharoah, Paul D P; Schmidt, Marjanka K; Nevanlinna, Heli

    2016-10-03

    P.I157T is a CHEK2 missense mutation associated with a modest increase in breast cancer risk. Previously, another CHEK2 mutation, the protein truncating c.1100delC has been associated with poor prognosis of breast cancer patients. Here, we have investigated patient survival and characteristics of breast tumors of germ line p.I157T carriers. We included in the analyses 26,801 European female breast cancer patients from 15 studies participating in the Breast Cancer Association Consortium. We analyzed the association between p.I157T and the clinico-pathological breast cancer characteristics by comparing the p.I157T carrier tumors to non-carrier and c.1100delC carrier tumors. Similarly, we investigated the p.I157T associated risk of early death, breast cancer-associated death, distant metastasis, locoregional relapse and second breast cancer using Cox proportional hazards models. Additionally, we explored the p.I157T-associated genomic gene expression profile using data from breast tumors of 183 Finnish female breast cancer patients (ten p.I157T carriers) (GEO: GSE24450). Differential gene expression analysis was performed using a moderated t test. Functional enrichment was investigated using the DAVID functional annotation tool and gene set enrichment analysis (GSEA). The tumors were classified into molecular subtypes according to the St Gallen 2013 criteria and the PAM50 gene expression signature. P.I157T was not associated with increased risk of early death, breast cancer-associated death or distant metastasis relapse, and there was a significant difference in prognosis associated with the two CHEK2 mutations, p.I157T and c.1100delC. Furthermore, p.I157T was associated with lobular histological type and clinico-pathological markers of good prognosis, such as ER and PR expression, low TP53 expression and low grade. Gene expression analysis suggested luminal A to be the most common subtype for p.I157T carriers and CDH1 (cadherin 1) target genes to be significantly

  12. Role of G-protein-coupled receptor-related genes in insecticide resistance of the mosquito, Culex quinquefasciatus.

    Science.gov (United States)

    Li, Ting; Liu, Lena; Zhang, Lee; Liu, Nannan

    2014-09-29

    G-protein-coupled receptors regulate signal transduction pathways and play diverse and pivotal roles in the physiology of insects, however, the precise function of GPCRs in insecticide resistance remains unclear. Using quantitative RT-PCR and functional genomic methods, we, for the first time, explored the function of GPCRs and GPCR-related genes in insecticide resistance of mosquitoes, Culex quinquefasciatus. A comparison of the expression of 115 GPCR-related genes at a whole genome level between resistant and susceptible Culex mosquitoes identified one and three GPCR-related genes that were up-regulated in highly resistant Culex mosquito strains, HAmCq(G8) and MAmCq(G6), respectively. To characterize the function of these up-regulated GPCR-related genes in resistance, the up-regulated GPCR-related genes were knockdown in HAmCq(G8) and MAmCq(G6) using RNAi technique. Knockdown of these four GPCR-related genes not only decreased resistance of the mosquitoes to permethrin but also repressed the expression of four insecticide resistance-related P450 genes, suggesting the role of GPCR-related genes in resistance is involved in the regulation of resistance P450 gene expression. This results help in understanding of molecular regulation of resistance development in Cx. quinquefasciatus.

  13. Genome Comparison of Erythromycin Resistant Campylobacter from Turkeys Identifies Hosts and Pathways for Horizontal Spread of erm(B Genes

    Directory of Open Access Journals (Sweden)

    Diego Florez-Cuadrado

    2017-11-01

    Full Text Available Pathogens in the genus Campylobacter are the most common cause of food-borne bacterial gastro-enteritis. Campylobacteriosis, caused principally by Campylobacter jejuni and Campylobacter coli, is transmitted to humans by food of animal origin, especially poultry. As for many pathogens, antimicrobial resistance in Campylobacter is increasing at an alarming rate. Erythromycin prescription is the treatment of choice for clinical cases requiring antimicrobial therapy but this is compromised by mobility of the erythromycin resistance gene erm(B between strains. Here, we evaluate resistance to six antimicrobials in 170 Campylobacter isolates (133 C. coli and 37 C. jejuni from turkeys. Erythromycin resistant isolates (n = 85; 81 C. coli and 4 C. jejuni were screened for the presence of the erm(B gene, that has not previously been identified in isolates from turkeys. The genomes of two positive C. coli isolates were sequenced and in both isolates the erm(B gene clustered with resistance determinants against aminoglycosides plus tetracycline, including aad9, aadE, aph(2″-IIIa, aph(3′-IIIa, and tet(O genes. Comparative genomic analysis identified identical erm(B sequences among Campylobacter from turkeys, Streptococcus suis from pigs and Enterococcus faecium and Clostridium difficile from humans. This is consistent with multiple horizontal transfer events among different bacterial species colonizing turkeys. This example highlights the potential for dissemination of antimicrobial resistance across bacterial species boundaries which may compromise their effectiveness in antimicrobial therapy.

  14. Prevalence of sulfonamide resistance genes in bacterial isolates from manured agricultural soils and pig slurry in the United Kingdom.

    Science.gov (United States)

    Byrne-Bailey, K G; Gaze, W H; Kay, P; Boxall, A B A; Hawkey, P M; Wellington, E M H

    2009-02-01

    The prevalences of three sulfonamide resistance genes, sul1, sul2, and sul3 and sulfachloropyridazine (SCP) resistance were determined in bacteria isolated from manured agricultural clay soils and slurry samples in the United Kingdom over a 2-year period. Slurry from tylosin-fed pigs amended with SCP and oxytetracycline was used for manuring. Isolates positive for sul genes were further screened for the presence of class 1 and 2 integrons. Phenotypic resistance to SCP was significantly higher in isolates from pig slurry and postapplication soil than in those from preapplication soil. Of 531 isolates, 23% carried sul1, 18% sul2, and 9% sul3 only. Two percent of isolates contained all three sul genes. Class 1 and class 2 integrons were identified in 5% and 11.7%, respectively, of sul-positive isolates. In previous reports, sul1 was linked to class 1 integrons, but in this study only 8% of sul1-positive isolates carried the intI1 gene. Sulfonamide-resistant pathogens, including Shigella flexneri, Aerococcus spp., and Acinetobacter baumannii, were identified in slurry-amended soil and soil leachate, suggesting a potential environmental reservoir. Sulfonamide resistance in Psychrobacter, Enterococcus, and Bacillus spp. is reported for the first time, and this study also provides the first description of the genotypes sul1, sul2, and sul3 outside the Enterobacteriaceae and in the soil environment.

  15. Prevalence of Sulfonamide Resistance Genes in Bacterial Isolates from Manured Agricultural Soils and Pig Slurry in the United Kingdom▿

    Science.gov (United States)

    Byrne-Bailey, K. G.; Gaze, W. H.; Kay, P.; Boxall, A. B. A.; Hawkey, P. M.; Wellington, E. M. H.

    2009-01-01

    The prevalences of three sulfonamide resistance genes, sul1, sul2, and sul3 and sulfachloropyridazine (SCP) resistance were determined in bacteria isolated from manured agricultural clay soils and slurry samples in the United Kingdom over a 2-year period. Slurry from tylosin-fed pigs amended with SCP and oxytetracycline was used for manuring. Isolates positive for sul genes were further screened for the presence of class 1 and 2 integrons. Phenotypic resistance to SCP was significantly higher in isolates from pig slurry and postapplication soil than in those from preapplication soil. Of 531 isolates, 23% carried sul1, 18% sul2, and 9% sul3 only. Two percent of isolates contained all three sul genes. Class 1 and class 2 integrons were identified in 5% and 11.7%, respectively, of sul-positive isolates. In previous reports, sul1 was linked to class 1 integrons, but in this study only 8% of sul1-positive isolates carried the intI1 gene. Sulfonamide-resistant pathogens, including Shigella flexneri, Aerococcus spp., and Acinetobacter baumannii, were identified in slurry-amended soil and soil leachate, suggesting a potential environmental reservoir. Sulfonamide resistance in Psychrobacter, Enterococcus, and Bacillus spp. is reported for the first time, and this study also provides the first description of the genotypes sul1, sul2, and sul3 outside the Enterobacteriaceae and in the soil environment. PMID:19064898

  16. Functional and gene expression analysis of hTERT overexpressed endothelial cells

    Directory of Open Access Journals (Sweden)

    Haruna Takano

    2008-09-01

    Full Text Available Haruna Takano1, Satoshi Murasawa1,2, Takayuki Asahara1,2,31Institute of Biomedical Research and Innovation, Kobe, Japan; 2RIKEN Center for Developmental Biology, Kobe 650-0047, Japan; 3Tokai University of School of Medicine, Tokai, JapanAbstract: Telomerase dysfunction contributes to cellular senescence. Recent advances indicate the importance of senescence in maintaining vascular cell function in vitro. Human telomerase reverse transcriptase (hTERT overexpression is thought to lead to resistance to apoptosis and oxidative stress. However, the mechanism in endothelial lineage cells is unclear. We tried to generate an immortal endothelial cell line from human umbilical vein endothelial cells using a no-virus system and examine the functional mechanisms of hTERT overexpressed endothelial cell senescence in vitro. High levels of hTERT genes and endothelial cell-specific markers were expressed during long-term culture. Also, angiogenic responses were observed in hTERT overexpressed endothelial cell. These cells showed a delay in senescence and appeared more resistant to stressed conditions. PI3K/Akt-related gene levels were enhanced in hTERT overexpressed endothelial cells. An up-regulated PI3K/Akt pathway caused by hTERT overexpression might contribute to anti-apoptosis and survival effects in endothelial lineage cells.Keywords: endothelial, telomerase, senescence, oxidative stress, anti-apoptosis, PI3K/Akt pathway

  17. Discovery and characterization of two new stem rust resistance genes in Aegilops sharonensis.

    Science.gov (United States)

    Yu, Guotai; Champouret, Nicolas; Steuernagel, Burkhard; Olivera, Pablo D; Simmons, Jamie; Williams, Cole; Johnson, Ryan; Moscou, Matthew J; Hernández-Pinzón, Inmaculada; Green, Phon; Sela, Hanan; Millet, Eitan; Jones, Jonathan D G; Ward, Eric R; Steffenson, Brian J; Wulff, Brande B H

    2017-06-01

    We identified two novel wheat stem rust resistance genes, Sr-1644-1Sh and Sr-1644-5Sh in Aegilops sharonensis that are effective against widely virulent African races of the wheat stem rust pathogen. Stem rust is one of the most important diseases of wheat in the world. When single stem rust resistance (Sr) genes are deployed in wheat, they are often rapidly overcome by the pathogen. To this end, we initiated a search for novel sources of resistance in diverse wheat relatives and identified the wild goatgrass species Aegilops sharonesis (Sharon goatgrass) as a rich reservoir of resistance to wheat stem rust. The objectives of this study were to discover and map novel Sr genes in Ae. sharonensis and to explore the possibility of identifying new Sr genes by genome-wide association study (GWAS). We developed two biparental populations between resistant and susceptible accessions of Ae. sharonensis and performed QTL and linkage analysis. In an F 6 recombinant inbred line and an F 2 population, two genes were identified that mapped to the short arm of chromosome 1S sh , designated as Sr-1644-1Sh, and the long arm of chromosome 5S sh , designated as Sr-1644-5Sh. The gene Sr-1644-1Sh confers a high level of resistance to race TTKSK (a member of the Ug99 race group), while the gene Sr-1644-5Sh conditions strong resistance to TRTTF, another widely virulent race found in Yemen. Additionally, GWAS was conducted on 125 diverse Ae. sharonensis accessions for stem rust resistance. The gene Sr-1644-1Sh was detected by GWAS, while Sr-1644-5Sh was not detected, indicating that the effectiveness of GWAS might be affected by marker density, population structure, low allele frequency and other factors.

  18. Antimicrobial resistance and detection of the mecA gene besides enterotoxin-encoding genes among coagulase-negative Staphylococci isolated from clam meat of Anomalocardia brasiliana.

    Science.gov (United States)

    Batista, Jacqueline Ellen Camelo; Ferreira, Ewerton Lucena; Nascimento, Danielle Cristina de Oliveira; Ventura, Roberta Ferreira; de Oliveira, Wagner Luis Mendes; Leal, Nilma Cintra; Lima-Filho, José Vitor

    2013-12-01

    The marine clam Anomalocardia brasiliana is a candidate as a sentinel animal to monitor the contamination levels of coliforms in shellfish-harvesting areas of Brazil's northeastern region. The aim of the present study was to search enterotoxin-encoding genes plus the mecA gene among coagulase-negative staphylococci (CNS) isolates from shellfish meats of A. brasiliana. The specimen clam (n=48; 40 clams per sample) was collected during low tide in the bay area of Mangue Seco from April through June 2009, and random samples of chilled and frozen shelled clam meat (n=33; 250 g per sample) were obtained from retail shops from January through March 2012. Seventy-nine CNS isolates were identified, including Staphylococcus xylosus, S. cohnii spp. urealyticus, S. sciuri, and S. lentus. A high percentage of isolates resistant to erythromycin (58.5%), penicillin (51.2%), and tetracycline (43.9%), and the fluoroquinolones levofloxacin (39%) and ciprofloxacin (34.1%) were recorded from those environmental samples. Isolates from retail shops were particularly resistant to oxacillin (55.3%) and penicillin (36.8%). All CNS resistant to oxacillin and/or cefoxitin were positive for the presence of the mecA gene, but phenotypically susceptible to vancomycin. Also, the enterotoxin-encoding genes seg and seh were detected through multiplex-polymerase chain reaction in 77.7% and 88.8% of the isolates from environmental samples, versus 90.5% and 100% of the isolates from retail shops, respectively. The data reveal the risk to public health due to consuming raw or undercooked shellfish containing enterotoxigenic plus methicillin-resistant CNS.

  19. A gene expression signature of RAS pathway dependence predicts response to PI3K and RAS pathway inhibitors and expands the population of RAS pathway activated tumors.

    Science.gov (United States)

    Loboda, Andrey; Nebozhyn, Michael; Klinghoffer, Rich; Frazier, Jason; Chastain, Michael; Arthur, William; Roberts, Brian; Zhang, Theresa; Chenard, Melissa; Haines, Brian; Andersen, Jannik; Nagashima, Kumiko; Paweletz, Cloud; Lynch, Bethany; Feldman, Igor; Dai, Hongyue; Huang, Pearl; Watters, James

    2010-06-30

    Hyperactivation of the Ras signaling pathway is a driver of many cancers, and RAS pathway activation can predict response to targeted therapies. Therefore, optimal methods for measuring Ras pathway activation are critical. The main focus of our work was to develop a gene expression signature that is predictive of RAS pathway dependence. We used the coherent expression of RAS pathway-related genes across multiple datasets to derive a RAS pathway gene expression signature and generate RAS pathway activation scores in pre-clinical cancer models and human tumors. We then related this signature to KRAS mutation status and drug response data in pre-clinical and clinical datasets. The RAS signature score is predictive of KRAS mutation status in lung tumors and cell lines with high (> 90%) sensitivity but relatively low (50%) specificity due to samples that have apparent RAS pathway activation in the absence of a KRAS mutation. In lung and breast cancer cell line panels, the RAS pathway signature score correlates with pMEK and pERK expression, and predicts resistance to AKT inhibition and sensitivity to MEK inhibition within both KRAS mutant and KRAS wild-type groups. The RAS pathway signature is upregulated in breast cancer cell lines that have acquired resistance to AKT inhibition, and is downregulated by inhibition of MEK. In lung cancer cell lines knockdown of KRAS using siRNA demonstrates that the RAS pathway signature is a better measure of dependence on RAS compared to KRAS mutation status. In human tumors, the RAS pathway signature is elevated in ER negative breast tumors and lung adenocarcinomas, and predicts resistance to cetuximab in metastatic colorectal cancer. These data demonstrate that the RAS pathway signature is superior to KRAS mutation status for the prediction of dependence on RAS signaling, can predict response to PI3K and RAS pathway inhibitors, and is likely to have the most clinical utility in lung and breast tumors.

  20. A gene expression signature of RAS pathway dependence predicts response to PI3K and RAS pathway inhibitors and expands the population of RAS pathway activated tumors

    Directory of Open Access Journals (Sweden)

    Paweletz Cloud

    2010-06-01

    Full Text Available Abstract Background Hyperactivation of the Ras signaling pathway is a driver of many cancers, and RAS pathway activation can predict response to targeted therapies. Therefore, optimal methods for measuring Ras pathway activation are critical. The main focus of our work was to develop a gene expression signature that is predictive of RAS pathway dependence. Methods We used the coherent expression of RAS pathway-related genes across multiple datasets to derive a RAS pathway gene expression signature and generate RAS pathway activation scores in pre-clinical cancer models and human tumors. We then related this signature to KRAS mutation status and drug response data in pre-clinical and clinical datasets. Results The RAS signature score is predictive of KRAS mutation status in lung tumors and cell lines with high (> 90% sensitivity but relatively low (50% specificity due to samples that have apparent RAS pathway activation in the absence of a KRAS mutation. In lung and breast cancer cell line panels, the RAS pathway signature score correlates with pMEK and pERK expression, and predicts resistance to AKT inhibition and sensitivity to MEK inhibition within both KRAS mutant and KRAS wild-type groups. The RAS pathway signature is upregulated in breast cancer cell lines that have acquired resistance to AKT inhibition, and is downregulated by inhibition of MEK. In lung cancer cell lines knockdown of KRAS using siRNA demonstrates that the RAS pathway signature is a better measure of dependence on RAS compared to KRAS mutation status. In human tumors, the RAS pathway signature is elevated in ER negative breast tumors and lung adenocarcinomas, and predicts resistance to cetuximab in metastatic colorectal cancer. Conclusions These data demonstrate that the RAS pathway signature is superior to KRAS mutation status for the prediction of dependence on RAS signaling, can predict response to PI3K and RAS pathway inhibitors, and is likely to have the most clinical

  1. Identification of leaf rust resistant gene Lr10 in Pakistani wheat ...

    African Journals Online (AJOL)

    Leaf (brown) rust is the major disease of wheat in Pakistan and other countries. The disease is more effectively controlled when several rust resistance genes are pyramided into a single line. Molecular survey was conducted to screen 25 Pakistan wheat germplasm for the presence of leaf rust resistance gene Lr10 using ...

  2. Identification of a novel gene in ROD9 island of Salmonella Enteritidis involved in the alteration of virulence-associated genes expression.

    Science.gov (United States)

    Das, Susmita; Ray, Shilpa; Ryan, Daniel; Sahu, Bikash; Suar, Mrutyunjay

    2018-01-01

    Salmonella enterica subsp. I serovar Enteritidis (S. Enteritidis), one of the causative agents for non-typhoidal gastrointestinal diseases in humans is an intracellular bacterium and mechanism for its invasion into host cells is critical to cause infection. The virulence of the pathogen is explained by the expression of genes located on its pathogenicity islands, mostly encoded under SPI-1 and SPI-2. However, S. Typhimurium SL1344, despite sharing ∼98% of its genome with S. Enteritidis P125109, lacks few regions of differences (ROD) that are hypothesized to impart virulence potential to S. Enteritidis. In this study, we created different mutants in the ROD9 island of S. Enteritidis, also referred as SPI-19 and identified a novel locus, SEN1005, encoding a hypothetical protein that is involved in its pathogenesis. ΔSEN1005 displayed significantly reduced entry into cultured epithelial cells as well as uptake by macrophages and failed to cause acute colitis in C57BL/6 mice at day 3 post-infection (p.i.). Additionally, the global transcriptome analysis revealed a highly repressed SPI-1 and other down-regulated genes responsible for flagellar assembly, chemotaxis and motility in the mutant which correlated with decreased invasion and abated inflammation as compared to the wild-type. Therefore, our findings revealed that ΔSEN1005 was attenuated in vitro as well as in vivo and we propose this hypothetical protein to play a role in altering the expression of genes involved in Salmonella virulence.

  3. Isolation, structure elucidation and anticancer activity from Brevibacillus brevis EGS 9 that combats Multi Drug Resistant actinobacteria.

    Science.gov (United States)

    Arumugam, T; Senthil Kumar, P; Hemavathy, R V; Swetha, V; Karishma Sri, R

    2018-02-01

    Actinobacteria is the most widely distributed organism in the mangrove environment and produce a large amount of secondary metabolites. A new environmental actinobacterial stain exhibited strong antimicrobial activity against vancomycin and methicillin resistant actinobacteria. The active producer strain was found to be as Brevibacillus brevis EGS9, which was confirmed by its morphological, biochemical characteristics and 16S rRNA gene sequencing. It was deposited in NCBI GeneBank database and received with an accession number of KX388147. Brevibacillus brevis EGS9 was cultivated by submerged fermentation to produce antimicrobial compounds. The anti-proliferative agent was extracted from Brevibacillus brevis EGS9 with ethyl acetate. The bioactive metabolites of mangrove actinobacteria was identified by Liquid chromatography with mass spectrometry analysis. The result of the present investigation revealed that actinobacteria isolated from mangroves are potent source of anticancer activity. The strain of Brevibacillus brevis EGS9 exhibited a potential in vitro anticancer activity. The present research concluded that the actinobacteria isolated from mangrove soil sediment are valuable in discovery of novel species. Copyright © 2017. Published by Elsevier Ltd.

  4. In Silico Assigned Resistance Genes Confer Bifidobacterium with Partial Resistance to Aminoglycosides but Not to Β-Lactams

    Science.gov (United States)

    Fouhy, Fiona; O’Connell Motherway, Mary; Fitzgerald, Gerald F.; Ross, R. Paul; Stanton, Catherine; van Sinderen, Douwe; Cotter, Paul D.

    2013-01-01

    Bifidobacteria have received significant attention due to their contribution to human gut health and the use of specific strains as probiotics. It is thus not surprising that there has also been significant interest with respect to their antibiotic resistance profile. Numerous culture-based studies have demonstrated that bifidobacteria are resistant to the majority of aminoglycosides, but are sensitive to β-lactams. However, limited research exists with respect to the genetic basis for the resistance of bifidobacteria to aminoglycosides. Here we performed an in-depth in silico analysis of putative Bifidobacterium-encoded aminoglycoside resistance proteins and β-lactamases and assess the contribution of these proteins to antibiotic resistance. The in silico-based screen detected putative aminoglycoside and β-lactam resistance proteins across the Bifidobacterium genus. Laboratory-based investigations of a number of representative bifidobacteria strains confirmed that despite containing putative β-lactamases, these strains were sensitive to β-lactams. In contrast, all strains were resistant to the aminoglycosides tested. To assess the contribution of genes encoding putative aminoglycoside resistance proteins in Bifidobacterium sp. two genes, namely Bbr_0651 and Bbr_1586, were targeted for insertional inactivation in B. breve UCC2003. As compared to the wild-type, the UCC2003 insertion mutant strains exhibited decreased resistance to gentamycin, kanamycin and streptomycin. This study highlights the associated risks of relying on the in silico assignment of gene function. Although several putative β-lactam resistance proteins are located in bifidobacteria, their presence does not coincide with resistance to these antibiotics. In contrast however, this approach has resulted in the identification of two loci that contribute to the aminoglycoside resistance of B. breve UCC2003 and, potentially, many other bifidobacteria. PMID:24324818

  5. In silico assigned resistance genes confer Bifidobacterium with partial resistance to aminoglycosides but not to β-lactams.

    Directory of Open Access Journals (Sweden)

    Fiona Fouhy

    Full Text Available Bifidobacteria have received significant attention due to their contribution to human gut health and the use of specific strains as probiotics. It is thus not surprising that there has also been significant interest with respect to their antibiotic resistance profile. Numerous culture-based studies have demonstrated that bifidobacteria are resistant to the majority of aminoglycosides, but are sensitive to β-lactams. However, limited research exists with respect to the genetic basis for the resistance of bifidobacteria to aminoglycosides. Here we performed an in-depth in silico analysis of putative Bifidobacterium-encoded aminoglycoside resistance proteins and β-lactamases and assess the contribution of these proteins to antibiotic resistance. The in silico-based screen detected putative aminoglycoside and β-lactam resistance proteins across the Bifidobacterium genus. Laboratory-based investigations of a number of representative bifidobacteria strains confirmed that despite containing putative β-lactamases, these strains were sensitive to β-lactams. In contrast, all strains were resistant to the aminoglycosides tested. To assess the contribution of genes encoding putative aminoglycoside resistance proteins in Bifidobacterium sp. two genes, namely Bbr_0651 and Bbr_1586, were targeted for insertional inactivation in B. breve UCC2003. As compared to the wild-type, the UCC2003 insertion mutant strains exhibited decreased resistance to gentamycin, kanamycin and streptomycin. This study highlights the associated risks of relying on the in silico assignment of gene function. Although several putative β-lactam resistance proteins are located in bifidobacteria, their presence does not coincide with resistance to these antibiotics. In contrast however, this approach has resulted in the identification of two loci that contribute to the aminoglycoside resistance of B. breve UCC2003 and, potentially, many other bifidobacteria.

  6. Bacterial metal resistance genes and metal bioavailability in contaminated sediments

    International Nuclear Information System (INIS)

    Roosa, Stéphanie; Wattiez, Ruddy; Prygiel, Emilie; Lesven, Ludovic; Billon, Gabriel; Gillan, David C.

    2014-01-01

    In bacteria a metal may be defined as bioavailable if it crosses the cytoplasmic membrane to reach the cytoplasm. Once inside the cell, specific metal resistance systems may be triggered. In this research, specific metal resistance genes were used to estimate metal bioavailability in sediment microbial communities. Gene levels were measured by quantitative PCR and correlated to metals in sediments using five different protocols to estimate dissolved, particle-adsorbed and occluded metals. The best correlations were obtained with czcA (a Cd/Zn/Co efflux pump) and Cd/Zn adsorbed or occluded in particles. Only adsorbed Co was correlated to czcA levels. We concluded that the measurement of czcA gene levels by quantitative PCR is a promising tool which may complement the classical approaches used to estimate Cd/Zn/Co bioavailability in sediment compartments. - Highlights: • Metal resistance genes were used to estimate metal bioavailability in sediments. • Gene levels were correlated to metals using 5 different metal extraction protocols. • CzcA gene levels determined by quantitative PCR is a promising tool for Cd/Zn/Co. - Capsule Bacterial czcA is a potential biomarker of Cd, Zn and Co bioavailability in aquatic sediments as shown by quantitative PCR and sequential metal extraction

  7. Characterizing the pathotype structure of barley powdery mildew and effectiveness of resistance genes to this pathogen in Kazakhstan.

    Science.gov (United States)

    Rsaliyev, Aralbek; Pahratdinova, Zhazira; Rsaliyev, Shynbolat

    2017-11-14

    Powdery mildew of barley is a wind-borne and obligate biotrophic pathogen, which ranks among the most widespread barley pathogens worldwide. However, purposeful research towards studying the structure of the barley powdery mildew populations, of their virulence and of effectiveness of certain resistance genes against the infection was not conducted in Kazakhstan till present time. This paper is the first to describe characteristics of the pathotype structure of Blumeria graminis f.sp. hordei (Bgh) population and effectiveness of resistance genes in two regions of barley cultivation in the republic. One hundred and seven isolates of Bgh were obtained from seven populations occurring on cultivated barley at two geographically locations in Kazakhstan during 2015 and 2016. Their virulence frequency was determined on 17 differential lines Pallas. All isolates were virulent on the resistance gene Mla8 and avirulent for the resistance genes Mla9, Mla1 + MlaAl2, Mla6 + Mla14, Mla13 + MlRu3, Mla7 + MlNo3, Mla10 + MlDu2, Mla13 + MlRu3 and Mlo-5. The frequencies of isolates overcoming the genes Mla3, Mla22, Mlat Mlg + MlCP and Mla12 + MlEm2 were 0.0-33.33%, and frequencies of isolates overcoming the genes Mlra, Mlk, MlLa and Mlh ranged from 10.0 to 78.6%. Based on reactions of differential lines possessing the genes Mla22, Mlra, Mlk, Mlat, MlLa and Mlh, pathotypes were identified. In total, 23 pathotypes with virulence complexity ranging from 1 to 6 were identified. During both years in all populations of South Kazakhstan and Zhambyl regions pathotypes 24 and 64 mainly prevailed. Obtained data suggest that low similarity of populations Bgh in Kazakhstan to European, African, Australian and South-East Asian populations. The present study provides a foundation for future studies on the pathogenic variability within of Bgh populations in Kazakhstan and addresses the knowledge gap on the virulence structure of Bgh in Central Asia. Complete effectiveness of the

  8. Identification and expression analysis of cobia (Rachycentron canadum) Toll-like receptor 9 gene.

    Science.gov (United States)

    Byadgi, Omkar; Puteri, Dinda; Lee, Yan-Horn; Lee, Jai-Wei; Cheng, Ta-Chih

    2014-02-01

    Cobia culture is hindered by bacterial infection (Photobacterium damselae subsp. piscicida) and in order to study the effect of P. damselae subsp. piscicida challenge and CpG ODN stimulation on cobia Toll like receptor 9 (RCTLR9), we used PCR to clone RCTLR9 gene and qRT-PCR to quantify gene expression. The results indicated that RCTLR9 cDNA contains 3141 bp. It encodes 1047 amino acids containing 16 typical structures of leucine-rich repeats (LRRs) including an LRRTYP, LRRCT and a motif involved in PAMP binding was identified at position 240-253 amino acid. Broad expression of RCTLR9 was found in larval, juvenile and adult stages irrespective of the tissues. In larval stage, RCTLR9 mRNA expression decreased at 5 d and then increased at 10 dph. At juvenile stage cobia, the expression was significantly high (p Cobia challenged with P. damselae subsp. piscicida showed significant increase in RCTLR9 expression at 24 h post challenge in intestine, spleen and liver, while in kidney the expression was peak at 12 h and later it decreased at 24 h. The highest expression was 40 fold increase in spleen and the lowest expression was ∼3.6 fold increase in liver. Cobia stimulated with CpG oligonucleotides showed that the induction of these genes was CpG ODN type and time dependent. In spleen and liver, CpG ODNs 1668 and 2006 injected group showed high expression of RCTLR9, IL-1β, chemokine CC compared to other groups. Meanwhile, CpG ODN 2006 has induced high expression of IgM. The CpG ODNs 2395 have induced significant high expression of Mx in spleen and liver. These results demonstrates the potential of using CpG ODN to enhance cobia resistance to P. damselae subsp. piscicida infection and use as an adjuvant in vaccine development. Copyright © 2013 Elsevier Ltd. All rights reserved.

  9. The LBP Gene and Its Association with Resistance to Aeromonas hydrophila in Tilapia

    Directory of Open Access Journals (Sweden)

    Gui Hong Fu

    2014-12-01

    Full Text Available Resistance to pathogens is important for the sustainability and profitability of food fish production. In immune-related genes, the lipopolysaccharide-binding protein (LBP gene is an important mediator of the inflammatory reaction. We analyzed the cDNA and genomic structure of the LBP gene in tilapia. The full-length cDNA (1901 bp of the gene contained a 1416 bp open reading frame, encoding 471 amino acid residues. Its genomic sequence was 5577 bp, comprising 15 exons and 14 introns. Under normal conditions, the gene was constitutively expressed in all examined tissues. The highest expression was detected in intestine and kidney. We examined the responses of the gene to challenges with two bacterial pathogens Streptcoccus agalactiae and Aeromonas hydrophila. The gene was significantly upregulated in kidney and spleen post-infection with S. agalactiae and A. hydrophila, respectively. However, the expression profiles of the gene after the challenge with the two pathogens were different. Furthermore, we identified three SNPs in the gene. There were significant associations (p < 0.05 of two of the three SNPs with the resistance to A. hydrophila, but not with the resistance to S. agalactiae or growth performance. These results suggest that the LBP gene is involved in the acute-phase immunologic response to the bacterial infections, and the responses to the two bacterial pathogens are different. The two SNPs associated with the resistance to A. hydrophila may be useful in the selection of tilapia resistant to A. hydrophila.

  10. Relationship between Psidium species (Myrtaceae) by resistance gene analog markers: focus on nematode resistance.

    Science.gov (United States)

    Noia, L R; Tuler, A C; Ferreira, A; Ferreira, M F S

    2017-03-16

    Guava (Psidium guajava L.) crop is severely affected by the nematode Meloidogyne enterolobii. Native Psidium species have been reported as sources of resistance against this nematode. Knowledge on the molecular relationship between Psidium species based on plant resistance gene analogs (RGA) can be useful in the genetic breeding of guava for resistance to M. enterolobii. In this study, RGA markers from conserved domains, and structural features of plant R genes, were employed to characterize Psidium species and establish genetic proximity, with a focus on nematode resistance. SSR markers were also applied owing to their neutral nature, thus differing from RGA markers. For this, species reported as sources of resistance to M. enterolobii, such as P. cattleianum and P. friedrichsthalianum, as well as species occurring in the Atlantic Rainforest and susceptible genotypes, were investigated. In 10 evaluated Psidium species, high interspecific genetic variability was verified through RGA and SSR markers, with intraspecific variation in P. guajava higher with SSR, as was expected. Resistant species were clustered by RGA markers, and differential amplicons among genotypes resistant and susceptible to M. enterolobii were identified. Knowledge on the molecular relationships between Psidium species constitutes useful information for breeding of the guava tree, providing direction for hybridization and material for rootstocks. Additionally, the genetic relationship between native species, which have been little studied, and P. guajava were estimated by RGAs, which were confirmed as important markers for genetic diversity related to pathogen resistance.

  11. Genetics and mapping of a new leaf rust resistance gene in Triticum ...

    Indian Academy of Sciences (India)

    Genetic analysis in F1, F2 and F2.3 families at the seedling stage revealed that leaf rust resistance in Selection G12 is conditioned by a single incompletely dominant gene. The leaf rust resistance gene was mapped to chromosome 3BL with SSR markers Xgwm114 and Xgwm547 flanking the gene at a distance of 28.3 cM ...

  12. CRISPR-Cas9 gene editing

    NARCIS (Netherlands)

    Oude Blenke, Erik; Evers, Martijn J.W.; Mastrobattista, Enrico; Oost, van der John

    2016-01-01

    The CRISPR-Cas9 gene editing system has taken the biomedical science field by storm, initiating rumors about future Nobel Prizes and heating up a fierce patent war, but also making significant scientific impact. The Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR), together with

  13. Molecular Analysis and Expression of bap Gene in Biofilm-Forming Multi-Drug-Resistant Acinetobacter baumannii

    Directory of Open Access Journals (Sweden)

    Omid Azizi

    2016-10-01

    Full Text Available Background: Acinetobacter baumannii is commonly resistant to nearly all antibiotics due to presence of antibiotic resistance genes and biofilm formation. In this study we determined the presence of certain antibiotic-resistance genes associated with biofilm production and the influence of low iron concentration on expression of the biofilm-associated protein gene (bap in development of biofilm among multi-drug-resistant A. baumannii (MDRAB. Methods: Sixty-five MDRAB isolates from clinical samples were collected. Molecular typing was carried out by random amplified polymorphism DNA polymerase chain reaction (RAPD-PCR. Biofilm formation was assayed by the microtiter method. Results: The sequence of bap was determined and deposited in the GenBank database (accession no. KR080550.1. Expression of bap in the presence of low iron was analyzed by relative quantitative real time PCR (rqRT-PCR. Nearly half of the isolates belonged to RAPD-types A and B remaining were either small clusters or singleton. The results of biofilm formation revealed that 23 (35.4%, 18 (27.7%, 13 (20%, and 11 (16.9% of the isolates had strong, moderate, weak, and no biofilm activities, respectively. ompA and csuE genes were detected in all, while bap and blaPER-1 were detected in 43 (66% and 42 (64% of the isolates that showed strong and moderate biofilm activities (p ≤ 0.05, respectively. Analysis of bap expression by rqRT-PCR revealed five isolates with four-fold bap overexpression in the presence of low iron concentration (20 μM. Conclusion: The results suggest that bap overexpression may influence biofilm formation in presence of low iron concentration.

  14. Discovery of a seventh Rpp soybean rust resistance locus in soybean accession PI 605823

    Science.gov (United States)

    Soybean rust, caused by the obligate biotrophic fungal pathogen Phakopsora pachyrhizi Syd. & Syd, is a disease threat to soybean production in regions of the world with mild winters. Host plant resistance to P. pachyrhizi conditioned by Rpp genes has been found in numerous soybean accessions, and at...

  15. Nuclear translocation of glutathione S-transferase {pi} is mediated by a non-classical localization signal

    Energy Technology Data Exchange (ETDEWEB)

    Kawakatsu, Miho [Department of Stem Cell Biology, Atomic Bomb Disease Institute, Nagasaki University Graduate School of Biomedical Sciences, Nagasaki 852-8523 (Japan); Goto, Shinji, E-mail: sgoto@nagasaki-u.ac.jp [Department of Stem Cell Biology, Atomic Bomb Disease Institute, Nagasaki University Graduate School of Biomedical Sciences, Nagasaki 852-8523 (Japan); Yoshida, Takako; Urata, Yoshishige; Li, Tao-Sheng [Department of Stem Cell Biology, Atomic Bomb Disease Institute, Nagasaki University Graduate School of Biomedical Sciences, Nagasaki 852-8523 (Japan)

    2011-08-12

    Highlights: {yields} Nuclear translocation of GST{pi} is abrogated by the deletion of the last 16 amino acid residues in the carboxy-terminal region, indicating that residues 195-208 of GST{pi} are required for nuclear translocation. {yields} The lack of a contiguous stretch of positively charged amino acid residues within the carboxy-terminal region of GST{pi}, suggests that the nuclear translocation of GST{pi} is mediated by a non-classical nuclear localization signal. {yields} An in vitro transport assay shows that the nuclear translocation of GST{pi} is dependent on cytosolic factors and ATP. -- Abstract: Glutathione S-transferase {pi} (GST{pi}), a member of the GST family of multifunctional enzymes, is highly expressed in human placenta and involved in the protection of cellular components against electrophilic compounds or oxidative stress. We have recently found that GST{pi} is expressed in the cytoplasm, mitochondria, and nucleus in some cancer cells, and that the nuclear expression of GST{pi} appears to correlate with resistance to anti-cancer drugs. Although the mitochondrial targeting signal of GST{pi} was previously identified in the amino-terminal region, the mechanism of nuclear translocation remains completely unknown. In this study, we find that the region of GST{pi}195-208 is critical for nuclear translocation, which is mediated by a novel and non-classical nuclear localization signal. In addition, using an in vitro transport assay, we demonstrate that the nuclear translocation of GST{pi} depends on the cytosolic extract and ATP. Although further experiments are needed to understand in depth the precise mechanism of nuclear translocation of GST{pi}, our results may help to establish more efficient anti-cancer therapy, especially with respect to resistance to anti-cancer drugs.

  16. Bioinformatics Analysis of NBS-LRR Encoding Resistance Genes in Setaria italica.

    Science.gov (United States)

    Zhao, Yan; Weng, Qiaoyun; Song, Jinhui; Ma, Hailian; Yuan, Jincheng; Dong, Zhiping; Liu, Yinghui

    2016-06-01

    In plants, resistance (R) genes are involved in pathogen recognition and subsequent activation of innate immune responses. The nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes family forms the largest R-gene family among plant genomes and play an important role in plant disease resistance. In this paper, comprehensive analysis of NBS-encoding genes is performed in the whole Setaria italica genome. A total of 96 NBS-LRR genes are identified, and comprehensive overview of the NBS-LRR genes is undertaken, including phylogenetic analysis, chromosome locations, conserved motifs of proteins, and gene expression. Based on the domain, these genes are divided into two groups and distributed in all Setaria italica chromosomes. Most NBS-LRR genes are located at the distal tip of the long arms of the chromosomes. Setaria italica NBS-LRR proteins share at least one nucleotide-biding domain and one leucine-rich repeat domain. Our results also show the duplication of NBS-LRR genes in Setaria italica is related to their gene structure.

  17. Integrated Metabolo-Transcriptomics Reveals Fusarium Head Blight Candidate Resistance Genes in Wheat QTL-Fhb2.

    Directory of Open Access Journals (Sweden)

    Dhananjay Dhokane

    Full Text Available Fusarium head blight (FHB caused by Fusarium graminearum not only causes severe losses in yield, but also reduces quality of wheat grain by accumulating mycotoxins. Breeding for host plant resistance is considered as the best strategy to manage FHB. Resistance in wheat to FHB is quantitative in nature, involving cumulative effects of many genes governing resistance. The poor understanding of genetics and lack of precise phenotyping has hindered the development of FHB resistant cultivars. Though more than 100 QTLs imparting FHB resistance have been reported, none discovered the specific genes localized within the QTL region, nor the underlying mechanisms of resistance.In our study recombinant inbred lines (RILs carrying resistant (R-RIL and susceptible (S-RIL alleles of QTL-Fhb2 were subjected to metabolome and transcriptome profiling to discover the candidate genes. Metabolome profiling detected a higher abundance of metabolites belonging to phenylpropanoid, lignin, glycerophospholipid, flavonoid, fatty acid, and terpenoid biosynthetic pathways in R-RIL than in S-RIL. Transcriptome analysis revealed up-regulation of several receptor kinases, transcription factors, signaling, mycotoxin detoxification and resistance related genes. The dissection of QTL-Fhb2 using flanking marker sequences, integrating metabolomic and transcriptomic datasets, identified 4-Coumarate: CoA ligase (4CL, callose synthase (CS, basic Helix Loop Helix (bHLH041 transcription factor, glutathione S-transferase (GST, ABC transporter-4 (ABC4 and cinnamyl alcohol dehydrogenase (CAD as putative resistance genes localized within the QTL-Fhb2 region.Some of the identified genes within the QTL region are associated with structural resistance through cell wall reinforcement, reducing the spread of pathogen through rachis within a spike and few other genes that detoxify DON, the virulence factor, thus eventually reducing disease severity. In conclusion, we report that the wheat

  18. The influence of the stem cell marker ALDH and the EGFR-PI3 kinase act signaling pathway on the radiation resistance of human tumor cell lines

    International Nuclear Information System (INIS)

    Mihatsch, Julia

    2014-01-01

    Cancer is the second leading cause of death in industriated nations. Besides surgery and chemotherapy, radiotherapy (RT) is an important approach by which about 60% of patients are treated. The response of these patients to RT is very heterogenous. On the one hand, there are patients with tumors which are radiosensitive and can be cured, but on the other hand patients bear tumors which are quite resistant to radiotherapy. A Radioresistant phenotype of tumor cells causes treatment failure consequently leading to a limited response to radiotherapy. It is proposed, that radiotherapy outcome mainly depends on the potential of radiation on controlling growth, proliferation and survival of a specific population of tumor cells called cancer stem cells (CSCs) or tumor-initiating cells. Based on experimental studies so far reported it is assumed that the population of CSC varies in tumors from different entities and is relatively low compared to the tumor bulk cells in general. According to the CSC hypothesis, it might be concluded that the differential response of tumors to radiotherapy depends on CSC populations, since these supposedly slow replicating cells are able to initiate a tumor, to self renew indefinitely and to generate the differentiated progeny of a tumor. Besides the role of cancer stem cells in radiotherapy response, ionizing radiation (IR) activates the epidermal growth factor receptor (EGFR) and its downstream signaling pathways such as phosphoinositide 3-kinase (PI3K)/Akt, mitogen-activated protein kinase (MAPK) and Janus kinase/Signal Transducer and Activator of Transcription (JAK/STAT) pathways. Among these pathways, PI3K/Akt is one of the most important pathways involved in post-irradiation survival: Activation of Akt results in activation of DNA-dependent protein kinase, catalytic subunit (DNA-PKcs). DNA-PKcs is a core enzyme involved in repair of IR-induced DNA-double strand breaks (DNA-DSB) through non-homologous end joining (NHEJ). The aim of the

  19. Members of the genera Paenibacillus and Rhodococcus harbor genes homologous to enterococcal glycopeptide resistance genes vanA and vanB

    DEFF Research Database (Denmark)

    Guardabassi, L.; Christensen, H.; Hasman, Henrik

    2004-01-01

    Genes homologous to enterococcal glycopeptide resistance genes vanA and vanB were found in glycopeptide-resistant Paenibacillus and Rhodococcus strains from soil. The putative D-Ala:D-Lac ligase genes in Paenibacillus thiaminolyticus PT-2B1 and Paenibacillus apiarius PA-B2B were closely related...

  20. Correlation Between qacE and qacE∆1 Efflux Pump Genes, Antibiotic and Disinfectant Resistant Among Clinical Isolates of E.coli.

    Science.gov (United States)

    Shafaati, Maryam; Boroumand, Mohammadali; Nowroozi, Jamileh; Amiri, Pouya; Kazemian, Hossein

    2016-01-01

    Antiseptics and disinfectants have been used widely in hospitals and other health care settings to control the growth of microorganisms. However, some disinfectant resistant strains were reported. The objectives of our study were to evaluate correlation between the efflux pump genes, drugs and disinfectant resistant among clinical isolates of E.coli. A total of 102 of E. coli strains were isolated from urine sample of hospitalized patients. The antibiotic susceptibility was carried out by disc diffusion method. Didecyl di-methyl ammonium chloride (DDDMAC) was used as Quaternary ammonium compound (QAC) disinfectant which was used in Heart Center Hospital. PCR reaction was carried out for detection of qacE and qac∆E efflux pump genes. Almost all the strains had higher resistance to ampicillin, ciproflaxacin, cotrimaxazole and cephalothin. Totally 49% (n: 50) of strains were produced ESBL. Almost all the strains have MIC value between 0.00195 to 0.0078 mg/l for DDDMAC. Correlation between presence of qacE and qac∆E genes and antibiotic resistance was perceived. Presence of qacE and qac∆E genes among strains that have high disinfectant MIC value were 96.9% and 93.7% respectively. In addition, 98% of ESBL producing strains harbored qacE gene and 94% of ESBL producing strains harbored qac∆E gene. Our study indicated that there was a strong correlation between presence of qacE and qac∆E genes with resistance to some antibiotics and growth in media which contain high concentration of disinfectant. In conclusion, other mechanisms also play important role in resistant to antimicrobial agents but the role of efflux pumps in resistant to antimicrobial agents should not be neglected. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  1. Remapping of the stripe rust resistance gene Yr10 in common wheat.

    Science.gov (United States)

    Yuan, Cuiling; Wu, Jingzheng; Yan, Baiqiang; Hao, Qunqun; Zhang, Chaozhong; Lyu, Bo; Ni, Fei; Caplan, Allan; Wu, Jiajie; Fu, Daolin

    2018-02-23

    Yr10 is an important gene to control wheat stripe rust, and the search for Yr10 needs to be continued. Wheat stripe rust or yellow rust is a devastating fungal disease caused by Puccinia striiformis f. sp. tritici (Pst). Host disease resistance offers a primary source for controlling wheat stripe rust. The stripe rust resistance gene Yr10 confers the race-specific resistance to most tested Pst races in China including CYR29. Early studies proposed that Yr10 was a nucleotide-binding site, leucine-rich repeat gene archived as GenBank accession AF149112 (hereafter designated the Yr10 candidate gene or Yr10 CG ). In this study, we revealed that 15 Chinese wheat cultivars positive for Yr10 CG are susceptible to CYR29. We then expressed the Yr10 CG cDNA in the common wheat 'Bobwhite'. The Yr10 CG -cDNA positive transgenic plants were also susceptible to CYR29. Thus, it is highly unlikely that Yr10 CG corresponds to the Yr10 resistance gene. Using the Yr10 donor 'Moro' and the Pst-susceptible wheat 'Huixianhong', we generated two F 3 populations that displayed a single Mendelian segregation on the Yr10 gene, and used them to remap the Yr10 gene. Six markers were placed in the Yr10 region, with the Yr10 CG gene now mapping about 1.2-cM proximal to the Yr10 locus and the Xsdauw79 marker is completely linked to the Yr10 locus. Apparently, the Yr10 gene has not yet been identified. Fine mapping and positional cloning of Yr10 is important for gene pyramiding for stripe rust resistance in wheat.

  2. Emerging quinolones resistant transfer genes among gram-negative bacteria, isolated from faeces of HIV/AIDS patients attending some Clinics and Hospitals in the City of Benin, Edo State, Nigeria

    Directory of Open Access Journals (Sweden)

    Enabulele IO

    2006-12-01

    Full Text Available A survey of 1431 gram-negative bacilli from June 2001 to September 2005 were obtained from the faeces of 920 HIV/AIDS patients attending some Clinics and Hospitals in Benin City, Nigeria, were screened for quinolones resistance gene. The HIV/AIDS patients CD4 cells range was ≤14/mm3 ≥800/mm3 of blood. Out of the 1431 isolates, 343 (23.9% were resistance to quinolones with a MIC ≥4μg/ml for norfloxacin, ciprofloxacin and pefloxacin while a MIC of ≥32 µg/ml for nalidixic acid. The screened isolates include Pseudomonas aeruginosa 64(18.7%, E coli 92(26.8%, Klebsiella pneumoniae 53(15.4%, Salmonella typhi 39(11.4%, Shigella dysenteriae 36(10.5%, Proteus mirabilis 34(9.9% and Serratia marcescens 25(7.3%. The average resistance of the isolates to the various quinolones ranged from 42.7% to 66.7%. Klebsiella were the most resistant isolates with a mean resistance of 66.7% while Proteus were the less resistant isolates with a mean resistance of 42.7%. Most isolates were resistant to Nalidixic acid followed by norfloxacin while the less resistant were to the pefloxacin. The frequency of qnr genes transfer to EJRifr as recipient ranged from 2 x 10-2 to 6 x 10-6 with an average of 2 plasmids per cell. The molecular weight of the plasmids ranged from <2.9kbp to <5.5 kbp. This indicated that plasmids allowed the movement of genetic materials including qnr resistant genes between bacteria species and genera in Benin City, Nigeria.

  3. Cloning and characterization of NBS-LRR resistance gene ...

    African Journals Online (AJOL)

    biotech

    2013-07-03

    Jul 3, 2013 ... Rose using degernate primers designed from the conserved motifs of different plant resistance genes. A total of 40 sequences were hit with various R genes, of which 20 .... absorption ratio OD260 nm/OD280 nm between 1.80 and ..... status and outlook for small-holders agriculture in C S Gold and B.

  4. Metastatic function of BMP-2 in gastric cancer cells: The role of PI3K/AKT, MAPK, the NF-{kappa}B pathway, and MMP-9 expression

    Energy Technology Data Exchange (ETDEWEB)

    Kang, Myoung Hee [Graduate School of Medicine, Korea University College of Medicine, Korea University, Seoul 136-705 (Korea, Republic of); Oh, Sang Cheul [Division of Oncology/Hematology, Department of Internal Medicine, Korea University College of Medicine, Korea University, Seoul 136-705 (Korea, Republic of); Lee, Hyun Joo [Department of Pathology, Korea University College of Medicine, Korea University, Seoul 136-705 (Korea, Republic of); Kang, Han Na; Kim, Jung Lim [Graduate School of Medicine, Korea University College of Medicine, Korea University, Seoul 136-705 (Korea, Republic of); Kim, Jun Suk [Division of Oncology/Hematology, Department of Internal Medicine, Korea University College of Medicine, Korea University, Seoul 136-705 (Korea, Republic of); Yoo, Young A., E-mail: ydanbi@korea.ac.kr [Brain Korea 21 Program for Biomedical Science, Korea University College of Medicine, Korea University, Seoul 136-705 (Korea, Republic of)

    2011-07-15

    Bone morphogenetic proteins (BMPs) have been implicated in tumorigenesis and metastatic progression in various types of cancer cells, but the role and cellular mechanism in the invasive phenotype of gastric cancer cells is not known. Herein, we determined the roles of phosphoinositide 3-kinase (PI3K)/AKT, extracellular signal-regulated protein kinase (ERK), nuclear factor (NF)-{kappa}B, and matrix metalloproteinase (MMP) expression in BMP-2-mediated metastatic function in gastric cancer. We found that stimulation of BMP-2 in gastric cancer cells enhanced the phosphorylation of AKT and ERK. Accompanying activation of AKT and ERK kinase, BMP-2 also enhanced phosphorylation/degradation of I{kappa}B{alpha} and the nuclear translocation/activation of NF-{kappa}B. Interestingly, blockade of PI3K/AKT and ERK signaling using LY294002 and PD98059, respectively, significantly inhibited BMP-2-induced motility and invasiveness in association with the activation of NF-{kappa}B. Furthermore, BMP-2-induced MMP-9 expression and enzymatic activity was also significantly blocked by treatment with PI3K/AKT, ERK, or NF-{kappa}B inhibitors. Immunohistochemistry staining of 178 gastric tumor biopsies indicated that expression of BMP-2 and MMP-9 had a significant positive correlation with lymph node metastasis and a poor prognosis. These results indicate that the BMP-2 signaling pathway enhances tumor metastasis in gastric cancer by sequential activation of the PI3K/AKT or MAPK pathway followed by the induction of NF-{kappa}B and MMP-9 activity, indicating that BMP-2 has the potential to be a therapeutic molecular target to decrease metastasis.

  5. PCR detection of oxytetracycline resistance genes otr(A) and otr(B) in tetracycline-resistant streptomycete isolates from diverse habitats

    NARCIS (Netherlands)

    Nikolakopoulou, T; Egan, S; van Overbeek, L; Guillaume, G; Heuer, H; Wellington, EMH; van Elsas, JD; Collard, JM; Smalla, K; Karagouni, A

    2005-01-01

    A range of European habitats was screened by PCR for detection of the oxytetracycline resistance genes otr(A) and otr(B), found in the oxytetracycline-producing strain Streptomyces rimosus. Primers were developed to detect these otr genes in tetracycline-resistant (Tc-R) streptomycete isolates from

  6. Identification and mapping of two powdery mildew resistance genes in Triticum boeoticum L.

    Science.gov (United States)

    Chhuneja, Parveen; Kumar, Krishan; Stirnweis, Daniel; Hurni, Severine; Keller, Beat; Dhaliwal, Harcharan S; Singh, Kuldeep

    2012-04-01

    Powdery mildew (PM) caused by Blumeria graminis f. sp. tritici (Bgt), is one of the important foliar diseases of wheat that can cause serious yield losses. Breeding for cultivars with diverse resources of resistance is the most promising approach for combating this disease. The diploid A genome progenitor species of wheat are an important resource for new variability for disease resistance genes. An accession of Triticum boeoticum (A(b)A(b)) showed resistance against a number of Bgt isolates, when tested using detached leaf segments. Inheritance studies in a recombinant inbred line population (RIL), developed from crosses of PM resistant T. boeoticum acc. pau5088 with a PM susceptible T. monococcum acc. pau14087, indicated the presence of two powdery mildew resistance genes in T. boeoticum acc. pau5088. Analysis of powdery mildew infection and molecular marker data of the RIL population revealed that both powdery mildew resistance genes are located on the long arm of chromosome 7A. Mapping was conducted using an integrated linkage map of 7A consisting of SSR, RFLP, STS, and DArT markers. These powdery mildew resistance genes are tentatively designated as PmTb7A.1 and PmTb7A.2. The PmTb7A.2 is closely linked to STS markers MAG2185 and MAG1759 derived from RFLP probes which are linked to powdery mildew resistance gene Pm1. This indicated that PmTb7A.2 might be allelic to Pm1. The PmTb7A.1, flanked by a DArT marker wPt4553 and an SSR marker Xcfa2019 in a 4.3 cM interval, maps proximal to PmT7A.2. PmTb7A.1 is putatively a new powdery mildew resistance gene. The powdery mildew resistance genes from T. boeoticum are currently being transferred to cultivated wheat background through marker-assisted backcrossing, using T. durum as bridging species.

  7. Search for the suppressed decays $B^{+}\\rightarrow K^{+}K^{+}\\pi^{-}$ and $B^{+}\\rightarrow \\pi^{+}\\pi^{+}K^{-}$

    CERN Document Server

    Aaij, Roel; Adinolfi, Marco; Ajaltouni, Ziad; Akar, Simon; Albrecht, Johannes; Alessio, Federico; Alexander, Michael; Ali, Suvayu; Alkhazov, Georgy; Alvarez Cartelle, Paula; Alves Jr, Antonio Augusto; Amato, Sandra; Amerio, Silvia; Amhis, Yasmine; An, Liupan; Anderlini, Lucio; Andreassi, Guido; Andreotti, Mirco; Andrews, Jason; Appleby, Robert; Aquines Gutierrez, Osvaldo; Archilli, Flavio; d'Argent, Philippe; Arnau Romeu, Joan; Artamonov, Alexander; Artuso, Marina; Aslanides, Elie; Auriemma, Giulio; Baalouch, Marouen; Babuschkin, Igor; Bachmann, Sebastian; Back, John; Badalov, Alexey; Baesso, Clarissa; Baldini, Wander; Barlow, Roger; Barschel, Colin; Barsuk, Sergey; Barter, William; Batozskaya, Varvara; Batsukh, Baasansuren; Battista, Vincenzo; Bay, Aurelio; Beaucourt, Leo; Beddow, John; Bedeschi, Franco; Bediaga, Ignacio; Bel, Lennaert; Bellee, Violaine; Belloli, Nicoletta; Belous, Konstantin; Belyaev, Ivan; Ben-Haim, Eli; Bencivenni, Giovanni; Benson, Sean; Benton, Jack; Berezhnoy, Alexander; Bernet, Roland; Bertolin, Alessandro; Betti, Federico; Bettler, Marc-Olivier; van Beuzekom, Martinus; Bezshyiko, Iaroslava; Bifani, Simone; Billoir, Pierre; Bird, Thomas; Birnkraut, Alex; Bitadze, Alexander; Bizzeti, Andrea; Blake, Thomas; Blanc, Frederic; Blouw, Johan; Blusk, Steven; Bocci, Valerio; Boettcher, Thomas; Bondar, Alexander; Bondar, Nikolay; Bonivento, Walter; Borgheresi, Alessio; Borghi, Silvia; Borisyak, Maxim; Borsato, Martino; Bossu, Francesco; Boubdir, Meriem; Bowcock, Themistocles; Bowen, Espen Eie; Bozzi, Concezio; Braun, Svende; Britsch, Markward; Britton, Thomas; Brodzicka, Jolanta; Buchanan, Emma; Burr, Christopher; Bursche, Albert; Buytaert, Jan; Cadeddu, Sandro; Calabrese, Roberto; Calvi, Marta; Calvo Gomez, Miriam; Camboni, Alessandro; Campana, Pierluigi; Campora Perez, Daniel; Campora Perez, Daniel Hugo; Capriotti, Lorenzo; Carbone, Angelo; Carboni, Giovanni; Cardinale, Roberta; Cardini, Alessandro; Carniti, Paolo; Carson, Laurence; Carvalho Akiba, Kazuyoshi; Casse, Gianluigi; Cassina, Lorenzo; Castillo Garcia, Lucia; Cattaneo, Marco; Cauet, Christophe; Cavallero, Giovanni; Cenci, Riccardo; Charles, Matthew; Charpentier, Philippe; Chatzikonstantinidis, Georgios; Chefdeville, Maximilien; Chen, Shanzhen; Cheung, Shu-Faye; Chobanova, Veronika; Chrzaszcz, Marcin; Cid Vidal, Xabier; Ciezarek, Gregory; Clarke, Peter; Clemencic, Marco; Cliff, Harry; Closier, Joel; Coco, Victor; Cogan, Julien; Cogneras, Eric; Cogoni, Violetta; Cojocariu, Lucian; Collazuol, Gianmaria; Collins, Paula; Comerma-Montells, Albert; Contu, Andrea; Cook, Andrew; Coquereau, Samuel; Corti, Gloria; Corvo, Marco; Costa Sobral, Cayo Mar; Couturier, Benjamin; Cowan, Greig; Craik, Daniel Charles; Crocombe, Andrew; Cruz Torres, Melissa Maria; Cunliffe, Samuel; Currie, Robert; D'Ambrosio, Carmelo; Dall'Occo, Elena; Dalseno, Jeremy; David, Pieter; Davis, Adam; De Aguiar Francisco, Oscar; De Bruyn, Kristof; De Capua, Stefano; De Cian, Michel; De Miranda, Jussara; De Paula, Leandro; De Serio, Marilisa; De Simone, Patrizia; Dean, Cameron Thomas; Decamp, Daniel; Deckenhoff, Mirko; Del Buono, Luigi; Demmer, Moritz; Derkach, Denis; Deschamps, Olivier; Dettori, Francesco; Dey, Biplab; Di Canto, Angelo; Dijkstra, Hans; Dordei, Francesca; Dorigo, Mirco; Dosil Su{á}rez, Alvaro; Dovbnya, Anatoliy; Dreimanis, Karlis; Dufour, Laurent; Dujany, Giulio; Dungs, Kevin; Durante, Paolo; Dzhelyadin, Rustem; Dziurda, Agnieszka; Dzyuba, Alexey; D{é}l{é}age, Nicolas; Easo, Sajan; Ebert, Marcus; Egede, Ulrik; Egorychev, Victor; Eidelman, Semen; Eisenhardt, Stephan; Eitschberger, Ulrich; Ekelhof, Robert; Eklund, Lars; Elsasser, Christian; Ely, Scott; Esen, Sevda; Evans, Hannah Mary; Evans, Timothy; Falabella, Antonio; Farley, Nathanael; Farry, Stephen; Fay, Robert; Fazzini, Davide; Ferguson, Dianne; Fernandez Albor, Victor; Fernandez Prieto, Antonio; Ferrari, Fabio; Ferreira Rodrigues, Fernando; Ferro-Luzzi, Massimiliano; Filippov, Sergey; Fini, Rosa Anna; Fiore, Marco; Fiorini, Massimiliano; Firlej, Miroslaw; Fitzpatrick, Conor; Fiutowski, Tomasz; Fleuret, Frederic; Fohl, Klaus; Fontana, Marianna; Fontanelli, Flavio; Forshaw, Dean Charles; Forty, Roger; Franco Lima, Vinicius; Frank, Markus; Frei, Christoph; Fu, Jinlin; Furfaro, Emiliano; F{ä}rber, Christian; Gallas Torreira, Abraham; Galli, Domenico; Gallorini, Stefano; Gambetta, Silvia; Gandelman, Miriam; Gandini, Paolo; Gao, Yuanning; Garcia Martin, Luis Miguel; Garc{í}a Pardi{ñ}as, Juli{á}n; Garra Tico, Jordi; Garrido, Lluis; Garsed, Philip John; Gascon, David; Gaspar, Clara; Gavardi, Laura; Gazzoni, Giulio; Gerick, David; Gersabeck, Evelina; Gersabeck, Marco; Gershon, Timothy; Ghez, Philippe; Gian{ì}, Sebastiana; Gibson, Valerie; Girard, Olivier G{ö}ran; Giubega, Lavinia-Helena; Gizdov, Konstantin; Gligorov, V.V.; Golubkov, Dmitry; Golutvin, Andrey; Gomes, Alvaro; Gorelov, Igor Vladimirovich; Gotti, Claudio; Grabalosa G{á}ndara, Marc; Graciani Diaz, Ricardo; Granado Cardoso, Luis Alberto; Graugés, Eugeni; Graverini, Elena; Graziani, Giacomo; Grecu, Alexandru; Griffith, Peter; Grillo, Lucia; Gruberg Cazon, Barak Raimond; Gr{ü}nberg, Oliver; Gushchin, Evgeny; Guz, Yury; Gys, Thierry; G{ö}bel, Carla; Hadavizadeh, Thomas; Hadjivasiliou, Christos; Haefeli, Guido; Haen, Christophe; Haines, Susan; Hall, Samuel; Hamilton, Brian; Han, Xiaoxue; Hansmann-Menzemer, Stephanie; Harnew, Neville; Harnew, Samuel; Harrison, Jonathan; Hatch, Mark; He, Jibo; Head, Timothy; Heister, Arno; Hennessy, Karol; Henrard, Pierre; Henry, Louis; Hernando Morata, Jose Angel; van Herwijnen, Eric; Heß, Miriam; Hicheur, Adl{è}ne; Hill, Donal; Hombach, Christoph; Hulsbergen, Wouter; Humair, Thibaud; Hushchyn, Mikhail; Hussain, Nazim; Hutchcroft, David; Idzik, Marek; Ilten, Philip; Jacobsson, Richard; Jaeger, Andreas; Jalocha, Pawel; Jans, Eddy; Jawahery, Abolhassan; John, Malcolm; Johnson, Daniel; Jones, Christopher; Joram, Christian; Jost, Beat; Jurik, Nathan; Kandybei, Sergii; Kanso, Walaa; Karacson, Matthias; Kariuki, James Mwangi; Karodia, Sarah; Kecke, Matthieu; Kelsey, Matthew; Kenyon, Ian; Kenzie, Matthew; Ketel, Tjeerd; Khairullin, Egor; Khanji, Basem; Khurewathanakul, Chitsanu; Kirn, Thomas; Klaver, Suzanne; Klimaszewski, Konrad; Koliiev, Serhii; Kolpin, Michael; Komarov, Ilya; Koopman, Rose; Koppenburg, Patrick; Kozachuk, Anastasiia; Kozeiha, Mohamad; Kravchuk, Leonid; Kreplin, Katharina; Kreps, Michal; Krokovny, Pavel; Kruse, Florian; Krzemien, Wojciech; Kucewicz, Wojciech; Kucharczyk, Marcin; Kudryavtsev, Vasily; Kuonen, Axel Kevin; Kurek, Krzysztof; Kvaratskheliya, Tengiz; Lacarrere, Daniel; Lafferty, George; Lai, Adriano; Lambert, Dean; Lanfranchi, Gaia; Langenbruch, Christoph; Langhans, Benedikt; Latham, Thomas; Lazzeroni, Cristina; Le Gac, Renaud; van Leerdam, Jeroen; Lees, Jean-Pierre; Leflat, Alexander; Lefran{ç}ois, Jacques; Lef{è}vre, Regis; Lemaitre, Florian; Lemos Cid, Edgar; Leroy, Olivier; Lesiak, Tadeusz; Leverington, Blake; Li, Yiming; Likhomanenko, Tatiana; Lindner, Rolf; Linn, Christian; Lionetto, Federica; Liu, Bo; Liu, Xuesong; Loh, David; Longstaff, Iain; Lopes, Jose; Lucchesi, Donatella; Lucio Martinez, Miriam; Luo, Haofei; Lupato, Anna; Luppi, Eleonora; Lupton, Oliver; Lusiani, Alberto; Lyu, Xiao-Rui; Machefert, Frederic; Maciuc, Florin; Maev, Oleg; Maguire, Kevin; Malde, Sneha; Malinin, Alexander; Maltsev, Timofei; Manca, Giulia; Mancinelli, Giampiero; Manning, Peter Michael; Maratas, Jan; Marchand, Jean Fran{ç}ois; Marconi, Umberto; Marin Benito, Carla; Marino, Pietro; Marks, J{ö}rg; Martellotti, Giuseppe; Martin, Morgan; Martinelli, Maurizio; Martinez Santos, Diego; Martinez Vidal, Fernando; Martins Tostes, Danielle; Massacrier, Laure Marie; Massafferri, Andr{é}; Matev, Rosen; Mathad, Abhijit; Mathe, Zoltan; Matteuzzi, Clara; Mauri, Andrea; Maurin, Brice; Mazurov, Alexander; McCann, Michael; McCarthy, James; McNab, Andrew; McNulty, Ronan; Meadows, Brian; Meier, Frank; Meissner, Marco; Melnychuk, Dmytro; Merk, Marcel; Merli, Andrea; Michielin, Emanuele; Milanes, Diego Alejandro; Minard, Marie-Noelle; Mitzel, Dominik Stefan; Mogini, Andrea; Molina Rodriguez, Josue; Monroy, Ignacio Alberto; Monteil, Stephane; Morandin, Mauro; Morawski, Piotr; Mord{à}, Alessandro; Morello, Michael Joseph; Moron, Jakub; Morris, Adam Benjamin; Mountain, Raymond; Muheim, Franz; Mulder, Mick; Mussini, Manuel; M{ü}ller, Dominik; M{ü}ller, Janine; M{ü}ller, Katharina; M{ü}ller, Vanessa; Naik, Paras; Nakada, Tatsuya; Nandakumar, Raja; Nandi, Anita; Nasteva, Irina; Needham, Matthew; Neri, Nicola; Neubert, Sebastian; Neufeld, Niko; Neuner, Max; Nguyen, Anh Duc; Nguyen-Mau, Chung; Nieswand, Simon; Niet, Ramon; Nikitin, Nikolay; Nikodem, Thomas; Novoselov, Alexey; O'Hanlon, Daniel Patrick; Oblakowska-Mucha, Agnieszka; Obraztsov, Vladimir; Ogilvy, Stephen; Oldeman, Rudolf; Onderwater, Gerco; Otalora Goicochea, Juan Martin; Otto, Adam; Owen, Patrick; Oyanguren, Maria Aranzazu; Pais, Preema Rennee; Palano, Antimo; Palombo, Fernando; Palutan, Matteo; Panman, Jacob; Papanestis, Antonios; Pappagallo, Marco; Pappalardo, Luciano; Pappenheimer, Cheryl; Parker, William; Parkes, Christopher; Passaleva, Giovanni; Pastore, Alessandra; Patel, Girish; Patel, Mitesh; Patrignani, Claudia; Pearce, Alex; Pellegrino, Antonio; Penso, Gianni; Pepe Altarelli, Monica; Perazzini, Stefano; Perret, Pascal; Pescatore, Luca; Petridis, Konstantinos; Petrolini, Alessandro; Petrov, Aleksandr; Petruzzo, Marco; Picatoste Olloqui, Eduardo; Pietrzyk, Boleslaw; Pikies, Malgorzata; Pinci, Davide; Pistone, Alessandro; Piucci, Alessio; Playfer, Stephen; Plo Casasus, Maximo; Poikela, Tuomas; Polci, Francesco; Poluektov, Anton; Polyakov, Ivan; Polycarpo, Erica; Pomery, Gabriela Johanna; Popov, Alexander; Popov, Dmitry; Popovici, Bogdan; Potterat, C{é}dric; Price, Eugenia; Price, Joseph David; Prisciandaro, Jessica; Pritchard, Adrian; Prouve, Claire; Pugatch, Valery; Puig Navarro, Albert; Punzi, Giovanni; Qian, Wenbin; Quagliani, Renato; Rachwal, Bartolomiej; Rademacker, Jonas; Rama, Matteo; Ramos Pernas, Miguel; Rangel, Murilo; Raniuk, Iurii; Raven, Gerhard; Redi, Federico; Reichert, Stefanie; dos Reis, Alberto; Remon Alepuz, Clara; Renaudin, Victor; Ricciardi, Stefania; Richards, Sophie; Rihl, Mariana; Rinnert, Kurt; Rives Molina, Vicente; Robbe, Patrick; Rodrigues, Ana Barbara; Rodrigues, Eduardo; Rodriguez Lopez, Jairo Alexis; Rodriguez Perez, Pablo; Rogozhnikov, Alexey; Roiser, Stefan; Romanovskiy, Vladimir; Romero Vidal, Antonio; Ronayne, John William; Rotondo, Marcello; Rudolph, Matthew Scott; Ruf, Thomas; Ruiz Valls, Pablo; Saborido Silva, Juan Jose; Sadykhov, Elnur; Sagidova, Naylya; Saitta, Biagio; Salustino Guimaraes, Valdir; Sanchez Mayordomo, Carlos; Sanmartin Sedes, Brais; Santacesaria, Roberta; Santamarina Rios, Cibran; Santimaria, Marco; Santovetti, Emanuele; Sarti, Alessio; Satriano, Celestina; Satta, Alessia; Saunders, Daniel Martin; Savrina, Darya; Schael, Stefan; Schellenberg, Margarete; Schiller, Manuel; Schindler, Heinrich; Schlupp, Maximilian; Schmelling, Michael; Schmelzer, Timon; Schmidt, Burkhard; Schneider, Olivier; Schopper, Andreas; Schubert, Konstantin; Schubiger, Maxime; Schune, Marie Helene; Schwemmer, Rainer; Sciascia, Barbara; Sciubba, Adalberto; Semennikov, Alexander; Sergi, Antonino; Serra, Nicola; Serrano, Justine; Sestini, Lorenzo; Seyfert, Paul; Shapkin, Mikhail; Shapoval, Illya; Shcheglov, Yury; Shears, Tara; Shekhtman, Lev; Shevchenko, Vladimir; Shires, Alexander; Siddi, Benedetto Gianluca; Silva Coutinho, Rafael; Silva de Oliveira, Luiz Gustavo; Simi, Gabriele; Simone, Saverio; Sirendi, Marek; Skidmore, Nicola; Skwarnicki, Tomasz; Smith, Eluned; Smith, Iwan Thomas; Smith, Jackson; Smith, Mark; Snoek, Hella; Sokoloff, Michael; Soler, Paul; Souza, Daniel; Souza De Paula, Bruno; Spaan, Bernhard; Spradlin, Patrick; Sridharan, Srikanth; Stagni, Federico; Stahl, Marian; Stahl, Sascha; Stefko, Pavol; Stefkova, Slavorima; Steinkamp, Olaf; Stemmle, Simon; Stenyakin, Oleg; Stevenson, Scott; Stoica, Sabin; Stone, Sheldon; Storaci, Barbara; Stracka, Simone; Straticiuc, Mihai; Straumann, Ulrich; Sun, Liang; Sutcliffe, William; Swientek, Krzysztof; Syropoulos, Vasileios; Szczekowski, Marek; Szumlak, Tomasz; T'Jampens, Stephane; Tayduganov, Andrey; Tekampe, Tobias; Tellarini, Giulia; Teubert, Frederic; Thomas, Christopher; Thomas, Eric; van Tilburg, Jeroen; Tisserand, Vincent; Tobin, Mark; Tolk, Siim; Tomassetti, Luca; Tonelli, Diego; Topp-Joergensen, Stig; Toriello, Francis; Tournefier, Edwige; Tourneur, Stephane; Trabelsi, Karim; Traill, Murdo; Tran, Minh T{â}m; Tresch, Marco; Trisovic, Ana; Tsaregorodtsev, Andrei; Tsopelas, Panagiotis; Tully, Alison; Tuning, Niels; Ukleja, Artur; Ustyuzhanin, Andrey; Uwer, Ulrich; Vacca, Claudia; Vagnoni, Vincenzo; Valat, Sebastien; Valenti, Giovanni; Vallier, Alexis; Vazquez Gomez, Ricardo; Vazquez Regueiro, Pablo; Vecchi, Stefania; van Veghel, Maarten; Velthuis, Jaap; Veltri, Michele; Veneziano, Giovanni; Venkateswaran, Aravindhan; Vernet, Maxime; Vesterinen, Mika; Viaud, Benoit; Vieira, Daniel; Vieites Diaz, Maria; Vilasis-Cardona, Xavier; Volkov, Vladimir; Vollhardt, Achim; Voneki, Balazs; Voong, David; Vorobyev, Alexey; Vorobyev, Vitaly; Voß, Christian; de Vries, Jacco; V{á}zquez Sierra, Carlos; Waldi, Roland; Wallace, Charlotte; Wallace, Ronan; Walsh, John; Wang, Jianchun; Ward, David; Wark, Heather Mckenzie; Watson, Nigel; Websdale, David; Weiden, Andreas; Whitehead, Mark; Wicht, Jean; Wilkinson, Guy; Wilkinson, Michael; Williams, Mark Richard James; Williams, Matthew; Williams, Mike; Williams, Timothy; Wilson, Fergus; Wimberley, Jack; Wishahi, Julian; Wislicki, Wojciech; Witek, Mariusz; Wormser, Guy; Wotton, Stephen; Wraight, Kenneth; Wright, Simon; Wyllie, Kenneth; Xie, Yuehong; Xing, Zhou; Xu, Zhirui; Yang, Zhenwei; Yin, Hang; Yu, Jiesheng; Yuan, Xuhao; Yushchenko, Oleg; Zangoli, Maria; Zarebski, Kristian Alexander; Zavertyaev, Mikhail; Zhang, Liming; Zhang, Yanxi; Zhang, Yu; Zhelezov, Alexey; Zheng, Yangheng; Zhokhov, Anatoly; Zhu, Xianglei; Zhukov, Valery; Zucchelli, Stefano

    2017-02-10

    A search is made for the highly-suppressed B meson decays $B^{+}\\rightarrow K^{+}K^{+}\\pi^{-}$ and $B^{+}\\rightarrow \\pi^{+}\\pi^{+}K^{-}$ using a data sample corresponding to an integrated luminosity of 3.0 $fb^{-1}$ collected by the LHCb experiment in proton-proton collisions at centre-of-mass energies of 7 and 8 TeV. No evidence is found for the decays, and upper limits at 90\\% confidence level are determined to be $\\mathcal{B}(B^{+}\\rightarrow K^{+}K^{+}\\pi^{-}) < 1.1\\times 10^{-8}$ and $\\mathcal{B}(B^{+}\\rightarrow \\pi^{+}\\pi^{+}K^{-}) < 4.6\\times 10^{-8}$.

  8. Measurement of the Branching Ratio Lambda_c+ -> p pi+ pi-

    Energy Technology Data Exchange (ETDEWEB)

    Lopez-Hinojosa, Guillermo; /San Luis Potosi U.

    2008-03-01

    The confirmation of the Cabibbo-suppressed charm baryon decay mode {Lambda}{sub c}{sup +} {yields} p{pi}{sup +}{pi}{sup -} is reported. All data analyzed are from SELEX, a fixed target experiment at Fermilab that took data during 1996 and 1997, mainly with a 600 GeV/c {Sigma}{sup -} beam. The branching ratio of the Cabibbo-suppressed decay mode {Lambda}{sub c}{sup +} {yields} p{pi}{sup +}{pi}{sup -} relative to the Cabibbo-favored mode {Lambda}{sub c}{sup +} {yields} pK{sup -}{pi}{sup +} is measured to be: {Gamma}({Lambda}{sub c}{sup +} {yields} p{pi}{sup +}{pi}{sup -})/{Gamma}({Lambda}{sub c}{sup +} {yields} pK{sup -}{pi}{sup +}) = 0.103 {+-} 0.022.

  9. Evolution by Pervasive Gene Fusion in Antibiotic Resistance and Antibiotic Synthesizing Genes

    Directory of Open Access Journals (Sweden)

    Orla Coleman

    2015-03-01

    Full Text Available Phylogenetic (tree-based approaches to understanding evolutionary history are unable to incorporate convergent evolutionary events where two genes merge into one. In this study, as exemplars of what can be achieved when a tree is not assumed a priori, we have analysed the evolutionary histories of polyketide synthase genes and antibiotic resistance genes and have shown that their history is replete with convergent events as well as divergent events. We demonstrate that the overall histories of these genes more closely resembles the remodelling that might be seen with the children’s toy Lego, than the standard model of the phylogenetic tree. This work demonstrates further that genes can act as public goods, available for re-use and incorporation into other genetic goods.

  10. Genetics and mapping of a new anthracnose resistance locus in Andean common bean Paloma.

    Science.gov (United States)

    de Lima Castro, Sandra Aparecida; Gonçalves-Vidigal, Maria Celeste; Gilio, Thiago Alexandre Santana; Lacanallo, Giselly Figueiredo; Valentini, Giseli; da Silva Ramos Martins, Vanusa; Song, Qijian; Galván, Marta Zulema; Hurtado-Gonzales, Oscar P; Pastor-Corrales, Marcial Antonio

    2017-04-18

    The Andean cultivar Paloma is resistant to Mesoamerican and Andean races of Colletotrichum lindemuthianum, the fungal pathogen that causes the destructive anthracnose disease in common bean. Remarkably, Paloma is resistant to Mesoamerican races 2047 and 3481, which are among the most virulent races of the anthracnose pathogen. Most genes conferring anthracnose resistance in common bean are overcome by these races. The genetic mapping and the relationship between the resistant Co-Pa gene of Paloma and previously characterized anthracnose resistance genes can be a great contribution for breeding programs. The inheritance of resistance studies for Paloma was performed in F 2 population from the cross Paloma (resistant) × Cornell 49-242 (susceptible) inoculated with race 2047, and in F 2 and F 2:3 generations from the cross Paloma (resistant) × PI 207262 (susceptible) inoculated with race 3481. The results of these studies demonstrated that a single dominant gene confers the resistance in Paloma. Allelism tests performed with multiple races of C. lindemuthianum showed that the resistance gene in Paloma, provisionally named Co-Pa, is independent from the anthracnose resistance genes Co-1, Co-2, Co-3, Co-4, Co-5, Co-6, Co-12, Co-13, Co-14, Co-15 and Co-16. Bulk segregant analysis using the SNP chip BARCBean6K_3 positioned the approximate location of Co-Pa in the lower arm of chromosome Pv01. Further mapping analysis located the Co-Pa gene at a 390 kb region of Pv01 flanked by SNP markers SS82 and SS83 at a distance of 1.3 and 2.1 cM, respectively. The results presented here showed that Paloma cultivar has a new dominant gene conferring resistance to anthracnose, which is independent from those genes previously described. The linkage between the Co-Pa gene and the SS82 and SS83 SNP markers will be extremely important for marker-assisted introgression of the gene into elite cultivars in order to enhance resistance.

  11. Molecular mapping and genetic analysis of a rice brown planthopper (Nilaparvata lugens Stål) resistance gene.

    Science.gov (United States)

    Yang, Haiyuan; Ren, Xiang; Weng, Qingmei; Zhu, Lili; He, Guangcun

    2002-01-01

    The brown planthopper (BPH), Nilaparvata lugens Stål, is a serious insect pest of rice (Oryza saliva L.). We have determined the chromosomal location of a BPH resistance gene in rice using SSR and RFLP techniques. A rice line 'B14', derived from the wild rice Oryza latifolia, showed high resistance to BPH. For tagging the resistance gene in 'B14X', an F2 population and a recombinant inbred (RI) population from a cross between Taichung Native 1 and 'B14' were developed and evaluated for BPH resistance. The results showed that a single dominant gene controlled the resistance of 'B14' to BPH. Bulked segregant SSR analysis was employed for identification of DNA markers linked to the resistance gene. From the survey of 302 SSR primer pairs, three SSR (RM335, RM261, RM185) markers linked to the resistance gene were identified. The closest SSR marker RM261 was linked to the resistance gene at a distance of 1.8 cM. Regions surrounding the resistance gene and the SSR markers were examined with additional RFLP markers on chromosome 4 to define the location of the resistance gene. Linkage of RFLP markers C820, R288, C946 with the resistance gene further confirmed its location on the short arm of chromosome 4. Closely linked DNA markers will facilitate selection for resistant lines in breeding programs and provide the basis for map-based cloning of this resistance gene.

  12. Upgraded DIRAC spectrometer at CERN PS for the investigation of pi pi and pi K atoms

    Czech Academy of Sciences Publication Activity Database

    Adeva, B.; Benelli, A.; Čechák, T.; Doškářová, P.; Hons, Zdeněk; Klusoň, J.; Lednický, Richard; Martinčík, J.; Průša, P.; Smolík, J.; Trojek, T.; Urban, T.; Vrba, T.

    2016-01-01

    Roč. 839, DEC (2016), s. 52-85 ISSN 0168-9002 R&D Projects: GA MŠk(CZ) LG13031 Institutional support: RVO:61389005 ; RVO:68378271 Keywords : upgraded DIRAC spectrometer * CERN PS * pi pi and pi K atoms * Life-time measurement * long-lived excited states of pi pi atoms Subject RIV: BG - Nuclear, Atomic and Molecular Physics, Colliders; BF - Elementary Particles and High Energy Physics (FZU-D) Impact factor: 1.362, year: 2016

  13. Antimicrobial resistance and resistance gene determinants in clinical Escherichia coli from different animal species in Switzerland.

    Science.gov (United States)

    Lanz, Roland; Kuhnert, Peter; Boerlin, Patrick

    2003-01-02

    Antimicrobial susceptibility testing was performed on a total of 581 clinical Escherichia coli isolates from diarrhea and edema disease in pigs, from acute mastitis in dairy cattle, from urinary tract infections in dogs and cats, and from septicemia in laying hens collected in Switzerland between 1999 and 2001. Among the 16 antimicrobial agents tested, resistance was most frequent for sulfonamides, tetracycline, and streptomycin. Isolates from swine presented significantly more resistance than those from the other animal species. The distribution of the resistance determinants for sulfonamides, tetracycline, and streptomycin was assessed by hybridization and PCR in resistant isolates. Significant differences in the distribution of resistance determinants for tetracycline (tetA, tetB) and sulfonamides (sulII) were observed between the isolates from swine and those from the other species. Resistance to sulfonamides could not be explained by known resistance mechanisms in more than a quarter of the sulfonamide-resistant and sulfonamide-intermediate isolates from swine, dogs and cats. This finding suggests that one or several new resistance mechanisms for sulfonamides may be widespread among E. coli isolates from these animal species. The integrase gene (intI) from class I integrons was detected in a large proportion of resistant isolates in association with the sulI and aadA genes, thus demonstrating the importance of integrons in the epidemiology of resistance in clinical E. coli isolates from animals.

  14. Test of the Zweig rule in. pi. /sup -/p interactions at 19 GeV/c

    Energy Technology Data Exchange (ETDEWEB)

    Woodworth, P L; Treille, D; Thompson, A S; Strub, R; Sonderegger, P; Palazzi-Cerrina, C; Mitaroff, W A; French, B R [European Organization for Nuclear Research, Geneva (Switzerland); Kumar, R [Glasgow Univ. (UK). Dept. of Natural Philosophy; Kenyon, I R [Birmingham Univ. (UK). Dept. of Physics

    1976-10-25

    Phi production has been observed in ..pi../sup -/p interactions at 19 GeV/c with (44+-10) events in the final state phi..pi../sup +/..pi../sup -/..pi../sup -/p and (45+-9) events in phiK/sup +/K/sup -/..pi../sup -/p. The production ratios phi..pi../sup +/..pi../sup -/..pi../sup -/p/..omega pi../sup +/..pi../sup -/..pi../sup -/p approximately 0.005 and phiK/sup +/K/sup -/..pi../sup -/p/rho/sup 0/K/sup +/K/sup -/..pi../sup -/p approximately 0.45 agree with Zweig-rule expectations.

  15. Identification and verification of potential piRNAs from domesticated yak testis.

    Science.gov (United States)

    Gong, Jishang; Zhang, Quanwei; Wang, Qi; Ma, Youji; Du, Jiaxiang; Zhang, Yong; Zhao, Xingxu

    2018-02-01

    PIWI-interacting RNAs (piRNA) are small non-coding RNA molecules expressed in animal germ cells that interact with PIWI family proteins to form RNA-protein complexes involved in epigenetic and post-transcriptional gene silencing of retrotransposons and other genetic elements in germ line cells, including reproductive stem cell self-sustainment, differentiation, meiosis and spermatogenesis. In the present study, we performed high-throughput sequencing of piRNAs in testis samples from yaks in different stages of sexual maturity. Deep sequencing of the small RNAs (18-40 nt in length) yielded 4,900,538 unique reads from a total of 53,035,635 reads. We identified yak small RNAs (18-30 nt) and performed functional characterization. Yak small RNAs showed a bimodal length distribution, with two peaks at 22 nt and >28 nt. More than 80% of the 3,106,033 putative piRNAs were mapped to 4637 piRNA-producing genomic clusters using RPKM. 6388 candidate piRNAs were identified from clean reads and the annotations were compared with the yak reference genome repeat region. Integrated network analysis suggested that some differentially expressed genes were involved in spermatogenesis through ECM-receptor interaction and PI3K-Akt signaling pathways. Our data provide novel insights into the molecular expression and regulation similarities and diversities in spermatogenesis and testicular development in yaks at different stages of sexual maturity. © 2018 The authors.

  16. Impact of colistin sulfate treatment of broilers on the presence of resistant bacteria and resistance genes in stored or composted manure.

    Science.gov (United States)

    Le Devendec, Laetitia; Mourand, Gwenaelle; Bougeard, Stéphanie; Léaustic, Julien; Jouy, Eric; Keita, Alassane; Couet, William; Rousset, Nathalie; Kempf, Isabelle

    2016-10-15

    The application of manure may result in contamination of the environment with antimicrobials, antimicrobial-resistant bacteria, resistance genes and plasmids. The aim of this study was to investigate the impact of the administration of colistin and of manure management on (i) the presence of colistin-resistant Escherichia coli, Klebsiella pneumoniae and Pseudomonas aeruginosa and (ii) the prevalence of various antimicrobial resistance genes in feces and in composted or stored manure. One flock of chickens was treated with colistin at the recommended dosage and a second flock was kept as an untreated control. Samples of feces, litter and stored or composted manure from both flocks were collected for isolation and determination of the colistin-susceptibility of E. coli, K. pneumoniae and P. aeruginosa and quantification of genes coding for resistance to different antimicrobials. The persistence of plasmids in stored or composted manure from colistin-treated broilers was also evaluated by plasmid capturing experiments. Results revealed that colistin administration to chickens had no apparent impact on the antimicrobial resistance of the dominant Enterobacteriaceae and P. aeruginosa populations in the chicken gut. Composting stimulated an apparently limited decrease in genes coding for resistance to different antimicrobial families. Importantly, it was shown that even after six weeks of composting or storage, plasmids carrying antimicrobial resistance genes could still be transferred to a recipient E. coli. In conclusion, composting is insufficient to completely eliminate the risk of spreading antimicrobial resistance through chicken manure. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. Inverse gene-for-gene interactions contribute additively to tan spot susceptibility in wheat.

    Science.gov (United States)

    Liu, Zhaohui; Zurn, Jason D; Kariyawasam, Gayan; Faris, Justin D; Shi, Gongjun; Hansen, Jana; Rasmussen, Jack B; Acevedo, Maricelis

    2017-06-01

    Tan spot susceptibility is conferred by multiple interactions of necrotrophic effector and host sensitivity genes. Tan spot of wheat, caused by Pyrenophora tritici-repentis, is an important disease in almost all wheat-growing areas of the world. The disease system is known to involve at least three fungal-produced necrotrophic effectors (NEs) that interact with the corresponding host sensitivity (S) genes in an inverse gene-for-gene manner to induce disease. However, it is unknown if the effects of these NE-S gene interactions contribute additively to the development of tan spot. In this work, we conducted disease evaluations using different races and quantitative trait loci (QTL) analysis in a wheat recombinant inbred line (RIL) population derived from a cross between two susceptible genotypes, LMPG-6 and PI 626573. The two parental lines each harbored a single known NE sensitivity gene with LMPG-6 having the Ptr ToxC sensitivity gene Tsc1 and PI 626573 having the Ptr ToxA sensitivity gene Tsn1. Transgressive segregation was observed in the population for all races. QTL mapping revealed that both loci (Tsn1 and Tsc1) were significantly associated with susceptibility to race 1 isolates, which produce both Ptr ToxA and Ptr ToxC, and the two genes contributed additively to tan spot susceptibility. For isolates of races 2 and 3, which produce only Ptr ToxA and Ptr ToxC, only Tsn1 and Tsc1 were associated with tan spot susceptibility, respectively. This work clearly demonstrates that tan spot susceptibility in this population is due primarily to two NE-S interactions. Breeders should remove both sensitivity genes from wheat lines to obtain high levels of tan spot resistance.

  18. Inactivation Effect of Antibiotic-Resistant Gene Using Chlorine Disinfection

    Directory of Open Access Journals (Sweden)

    Takashi Furukawa

    2017-07-01

    Full Text Available The aim of this study was to elucidate the inactivation effects on the antibiotic-resistance gene (vanA of vancomycin-resistant enterococci (VRE using chlorination, a disinfection method widely used in various water treatment facilities. Suspensions of VRE were prepared by adding VRE to phosphate-buffered saline, or the sterilized secondary effluent of a wastewater treatment plant. The inactivation experiments were carried out at several chlorine concentrations and stirring time. Enterococci concentration and presence of vanA were determined. The enterococci concentration decreased as chlorine concentrations and stirring times increased, with more than 7.0 log reduction occurring under the following conditions: 40 min stirring at 0.5 mg Cl2/L, 20 min stirring at 1.0 mg Cl2/L, and 3 min stirring at 3.0 mg Cl2/L. In the inactivation experiment using VRE suspended in secondary effluent, the culturable enterococci required much higher chlorine concentration and longer treatment time for complete disinfection than the cases of suspension of VRE. However, vanA was detected in all chlorinated suspensions of VRE, even in samples where no enterococcal colonies were present on the medium agar plate. The chlorine disinfection was not able to destroy antibiotic-resistance genes, though it can inactivate and decrease bacterial counts of antibiotic-resistant bacteria (ARB. Therefore, it was suggested that remaining ARB and/or antibiotic-resistance gene in inactivated bacterial cells after chlorine disinfection tank could be discharged into water environments.

  19. Search for the rare decay B to pi l+ l-

    Energy Technology Data Exchange (ETDEWEB)

    Aubert, B.

    2007-03-16

    The authors have performed a search for the flavor-changing neutral-current decays B {yields} {pi}{ell}{sup +}{ell}{sup -}, where {ell}{sup +}{ell}{sup -} is either e{sup +}e{sup -} or {mu}{sup +}{mu}{sup -}, using a sample of 230 million {Upsilon}(4S) {yields} B{bar B} decays collected with the BABAR detector. They observe no evidence of a signal and measure the upper limit on the isospin-averaged branching fraction to be {Beta}(B {yields} {pi}{ell}{sup +}{ell}{sup -}) < 9.1 x 10{sup -8} at 90% confidence level. They also search for the lepton-flavor-violating decays B {yields} {pi}e{sup {+-}} {mu}{sup {-+}} and measure an upper limit on the isospin-averaged branching fraction of {Beta}(B {yields} {pi}e{sup {+-}} {mu}{sup {-+}}) < 9.2 x 10{sup -8} at 90% confidence level.

  20. Systematic Analysis and Comparison of Nucleotide-Binding Site Disease Resistance Genes in a Diploid Cotton Gossypium raimondii

    Science.gov (United States)

    Wei, Hengling; Li, Wei; Sun, Xiwei; Zhu, Shuijin; Zhu, Jun

    2013-01-01

    Plant disease resistance genes are a key component of defending plants from a range of pathogens. The majority of these resistance genes belong to the super-family that harbors a Nucleotide-binding site (NBS). A number of studies have focused on NBS-encoding genes in disease resistant breeding programs for diverse plants. However, little information has been reported with an emphasis on systematic analysis and comparison of NBS-encoding genes in cotton. To fill this gap of knowledge, in this study, we identified and investigated the NBS-encoding resistance genes in cotton using the whole genome sequence information of Gossypium raimondii. Totally, 355 NBS-encoding resistance genes were identified. Analyses of the conserved motifs and structural diversity showed that the most two distinct features for these genes are the high proportion of non-regular NBS genes and the high diversity of N-termini domains. Analyses of the physical locations and duplications of NBS-encoding genes showed that gene duplication of disease resistance genes could play an important role in cotton by leading to an increase in the functional diversity of the cotton NBS-encoding genes. Analyses of phylogenetic comparisons indicated that, in cotton, the NBS-encoding genes with TIR domain not only have their own evolution pattern different from those of genes without TIR domain, but also have their own species-specific pattern that differs from those of TIR genes in other plants. Analyses of the correlation between disease resistance QTL and NBS-encoding resistance genes showed that there could be more than half of the disease resistance QTL associated to the NBS-encoding genes in cotton, which agrees with previous studies establishing that more than half of plant resistance genes are NBS-encoding genes. PMID:23936305