WorldWideScience

Sample records for researchers develop method

  1. Is Mixed Methods Research Used in Australian Career Development Research?

    Science.gov (United States)

    Cameron, Roslyn

    2010-01-01

    Mixed methods research has become a substantive and growing methodological force that is growing in popularity within the human and social sciences. This article reports the findings of a study that has systematically reviewed articles from the "Australian Journal of Career Development" from 2004 to 2009. The aim of the study was to…

  2. Development of a Research Methods and Statistics Concept Inventory

    Science.gov (United States)

    Veilleux, Jennifer C.; Chapman, Kate M.

    2017-01-01

    Research methods and statistics are core courses in the undergraduate psychology major. To assess learning outcomes, it would be useful to have a measure that assesses research methods and statistical literacy beyond course grades. In two studies, we developed and provided initial validation results for a research methods and statistical knowledge…

  3. Multidisciplinary Methods in Educational Technology Research and Development

    Science.gov (United States)

    Randolph, Justus J.

    2008-01-01

    Over the past thirty years, there has been much dialogue, and debate, about the conduct of educational technology research and development. In this brief volume, the author helps clarify that dialogue by theoretically and empirically charting the research methods used in the field and provides much practical information on how to conduct…

  4. Research Circles - a method for developing guidance practices

    DEFF Research Database (Denmark)

    2012-01-01

    This video reports on our work with using research circles to improve our understanding of how to provide guidance and counseling to help young people in danger of dropping out of school. The video is based on the paper: Research Circles -- a method for developing guidance practices, and was pres......This video reports on our work with using research circles to improve our understanding of how to provide guidance and counseling to help young people in danger of dropping out of school. The video is based on the paper: Research Circles -- a method for developing guidance practices......, and was presented at the Conference for Social Justice, Prosperity and Sustainable Employment 2012 by assistant professor Helle Merete Nordentoft from DPU (http://edu.au.dk/). The film communicating the research paper was created by Mie Nørgaard...

  5. Improving the Development of Student's Research Questions and Hypotheses in an Introductory Business Research Methods Course

    Science.gov (United States)

    Strangman, Lauria; Knowles, Elizabeth

    2012-01-01

    In an introductory research methods course, students often develop research questions and hypotheses that are vague or confusing, do not contain measurable concepts, and are too narrow in scope or vision. Because of this, the final research projects often fail to provide useful information or address the overall research problem. A Lesson Study…

  6. Research and development of radioactive waste treatment methods

    International Nuclear Information System (INIS)

    Nguyen Thi Nang

    2000-01-01

    The Nuclear Research Institute (NRI) uses the reactor for research, training, isotope production and activation analyses. NRI generates about 150 m 3 of liquid and 5 m 3 of solid wastes every year. The researched methods applied to treatment of radwastes are coagulation-precipitation and two steps ion-exchange for liquid waste and compaction for solid waste are described. (author)

  7. Method of advancing research and development of fast breeder reactors

    International Nuclear Information System (INIS)

    1988-01-01

    In the long term plan of atomic energy development and utilization, fast breeder reactors are to be developed as the main of the future nuclear power generation in Japan, and when their development is advanced, it has been decided to positively aim at building up the plutonium utilization system using FBRs superior to the uranium utilization system using LWRs. Also it has been decided that the development of FBRs requires to exert incessant efforts for a considerable long period under the proper cooperation system of government and people, and as for its concrete development, hereafter the deliberation is to be carried out in succession by the expert subcommittee on FBR development projects of the Atomic Energy Commission. The subcommittee was founded in May, 1986, to deliberate on the long term promotion measures for FBR development, the measures for promoting the research and development, the examination of the basic specification of a demonstration FBR, the measures for promoting international cooperation, and other important matters. As the results of investigation, the situation around the development of FBRs, the fundamentals at the time of promoting the research and development, the subjects of the research and development and so on are reported. (Kako, I.)

  8. Methods of research and marketing in tourism development

    Directory of Open Access Journals (Sweden)

    Vojnović Boško

    2009-01-01

    Full Text Available Within that context, marketing and research are becoming more important for the development of tourist pursuits, all for the purpose of increased demands for the own destinations. The basic question is oriented to the course and factors that are to be explored and analyzed towards needs of the development of tourism. Results achieved through the experiences of many high-developed economies show that those subjects who have applied an appropriate marketing and exploring in due course, achieve better and faster development. .

  9. Open Online Research: Developing Software and Method for Collaborative Interpretation

    Directory of Open Access Journals (Sweden)

    Christian Bröer

    2016-09-01

    Full Text Available Inspired by the potentials of web-based collaboration, in 2014, a group of social scientists, students and information specialists started tinkering with software and methodology for open online collaborative research. The results of their research led to a gathering of academics at the #ethnography Conference Amsterdam 2014, where new material was collected, shared and collaboratively interpreted. Following the conference, they continued to develop software and methodology. In this contribution, we report on the aims, methodology, inspiring examples, caveats and results from testing several prototypes of open online research software. We conclude that open online collaborative interpretation is both feasible and desirable. Dialogue and reflexivity, we hold, are able to transcend separated perspectives and stimulate agreement on a set of distinct interpretations; they simultaneously respect the multiplicity of understandings of social phenomena whilst bringing order into this diversity. URN: http://nbn-resolving.de/urn:nbn:de:0114-fqs160327

  10. New Research Methods Developed for Studying Diabetic Foot Ulceration

    Science.gov (United States)

    1998-01-01

    Dr. Brian Davis, one of the Cleveland Clinic Foundation's researchers, has been investigating the risk factors related to diabetic foot ulceration, a problem that accounts for 20 percent of all hospital admissions for diabetic patients. He had developed a sensor pad to measure the friction and pressure forces under a person's foot when walking. As part of NASA Lewis Research Center's Space Act Agreement with the Cleveland Clinic Foundation, Dr. Davis requested Lewis' assistance in visualizing the data from the sensor pad. As a result, Lewis' Interactive Data Display System (IDDS) was installed at the Cleveland Clinic. This computer graphics program is normally used to visualize the flow of air through aircraft turbine engines, producing color two- and three-dimensional images.

  11. Thermodynamic data development using the solubility method (Joint research)

    International Nuclear Information System (INIS)

    Rai, Dhanpat; Yui, Mikazu

    2013-05-01

    The solubility method is one of the most powerful tools to obtain reliable thermodynamic data for 1) solubility products of discrete solids and double salts, 2) complexation constants for various ligands, 3) development of data in a wide range of pH values, 4) evaluation of data for metals that form very insoluble solids (e.g. tetravalent actinides), 5) determining solubility-controlling solids in different types of wastes and 6) elevated temperatures for redox sensitive systems. This document is focused on describing various aspects of obtaining thermodynamic data using the solubility method. This manuscript deals with various aspects of conducting solubility studies, including selecting the study topic, modeling to define important variables, selecting the range of variables and experimental parameters, anticipating results, general equipment requirements, conducting experiments, and interpreting experimental data. (author)

  12. Combinatorial methods for advanced materials research and development

    Energy Technology Data Exchange (ETDEWEB)

    Cremer, R.; Dondorf, S.; Hauck, M.; Horbach, D.; Kaiser, M.; Krysta, S.; Kyrylov, O.; Muenstermann, E.; Philipps, M.; Reichert, K.; Strauch, G. [Rheinisch-Westfaelische Technische Hochschule Aachen (Germany). Lehrstuhl fuer Theoretische Huettenkunde

    2001-10-01

    The applicability of combinatorial methods in developing advanced materials is illustrated presenting four examples for the deposition and characterization of one- and two-dimensionally laterally graded coatings, which were deposited by means of (reactive) magnetron sputtering and plasma-enhanced chemical vapor deposition. To emphasize the advantages of combinatorial approaches, metastable hard coatings like (Ti,Al)N and (Ti,Al,Hf)N respectively, as well as Ge-Sb-Te based films for rewritable optical data storage were investigated with respect to the relations between structure, composition, and the desired materials properties. (orig.)

  13. Aero-methods and engineering research and development

    Energy Technology Data Exchange (ETDEWEB)

    Peterson, R K

    1979-01-01

    There is presently a sharp, ongoing increase in the volume of work being conducted throughout the country associated with the development of natural gas fields as well as the resulting accelerated development of major gas trunklines. Aero-methods have presently found wide application in the engineering and planning of equipment for such projects. Success has been obtained by the increased quantity and quality of the available engineering information: The ''Giprospetsgaz'' Institute is using aerial photography as the basis for selecting pipeline routes and to more accurately determine the equipment requirements along proposed trunklines such as for compressors, gas transfer stations, electrical power substations, worker settlements, water and transport infrastructure and communications. These requirements are the most important factors in reducing capital operating expenditures. The greatest savings, in economic terms, can be achieved by avoiding sparsely settled or uninhabited areas as much as possible. Similiarly, aerial photography coupled with computer application aids in the solution of engineering problems. Third-generation computers are recommended for this process.

  14. Researchers Develop Method to Identify Sparticles in Big Bang Conditions

    CERN Multimedia

    2008-01-01

    Three Northeastern University researchers have proposed a new approach for the highly anticipated discovery of supersymmetric particles, often called sparticles. The methodology, which was published in the December 21 issue of the Physical Review Letters, is based on identifying the hierarchical mass patterns of sparticles, which are assumed to exist in a new class of particle physics theories beyond the Standard Model.

  15. 75 FR 45627 - Office of Research and Development; Ambient Air Monitoring Reference and Equivalent Methods...

    Science.gov (United States)

    2010-08-03

    ... Research and Development on March 30, 2010. The analytical procedure of this method has been tested in... Protection Agency, Research Triangle Park, North Carolina 27711. Designation of this new equivalent method is... ENVIRONMENTAL PROTECTION AGENCY [FRL-9184-5] Office of Research and Development; Ambient Air...

  16. Development of a method for research in sports policy in Brazil: an approach to method of mixed research

    Directory of Open Access Journals (Sweden)

    Fernando Marinho Mezzadri

    2015-05-01

    Full Text Available This article presents a method of mixed research for the study of Sport public policy in Brazil. To reach the result, the text was divided into two phases. In the first, it presents a conceptual model for the qualitative analysis of Brazilian public policies directed to the sport. This phase will still be divided into two stages. The first is the construction of a theoretical framework for the interpretation of the study on public policies and the other one demonstrates a conceptual methodological contribution based on the sociology of Pierre Bourdieu. In the second phase it is developed an analysis of the quantitative part which aims to interpret the data that were collected in the empirical part of the research. Later, it will be possible to produce a model of assessment, monitoring, and, especially, the improvement of public policies for Brazilian sport.

  17. Four Methods for Completing the Conceptual Development Phase of Applied Theory Building Research in HRD

    Science.gov (United States)

    Storberg-Walker, Julia; Chermack, Thomas J.

    2007-01-01

    The purpose of this article is to describe four methods for completing the conceptual development phase of theory building research for single or multiparadigm research. The four methods selected for this review are (1) Weick's method of "theorizing as disciplined imagination" (1989); (2) Whetten's method of "modeling as theorizing" (2002); (3)…

  18. Learning as Researchers and Teachers: The Development of a Pedagogical Culture for Social Science Research Methods?

    Science.gov (United States)

    Kilburn, Daniel; Nind, Melanie; Wiles, Rose

    2014-01-01

    In light of calls to improve the capacity for social science research within UK higher education, this article explores the possibilities for an emerging pedagogy for research methods. A lack of pedagogical culture in this field has been identified by previous studies. In response, we examine pedagogical literature surrounding approaches for…

  19. 75 FR 9894 - Office of Research and Development; Ambient Air Monitoring Reference and Equivalent Methods...

    Science.gov (United States)

    2010-03-04

    ..., Research Triangle Park, North Carolina 27711. Designation of this new equivalent method is intended to... ENVIRONMENTAL PROTECTION AGENCY [FRL-9121-6] Office of Research and Development; Ambient Air Monitoring Reference and Equivalent Methods: Designation of One New Equivalent Method AGENCY: Environmental...

  20. 76 FR 15974 - Office of Research and Development; Ambient Air Monitoring Reference and Equivalent Methods...

    Science.gov (United States)

    2011-03-22

    ..., Research Triangle Park, North Carolina 27711. Designation of these new equivalent methods is intended to... ENVIRONMENTAL PROTECTION AGENCY [FRL-9285-2] Office of Research and Development; Ambient Air Monitoring Reference and Equivalent Methods: Designation of Four New Equivalent Methods AGENCY: Environmental...

  1. 75 FR 51039 - Office of Research and Development; Ambient Air Monitoring Reference and Equivalent Methods...

    Science.gov (United States)

    2010-08-18

    ..., Research Triangle Park, North Carolina 27711. Designation of these new equivalent methods is intended to... ENVIRONMENTAL PROTECTION AGENCY [FRL-9190-5] Office of Research and Development; Ambient Air Monitoring Reference and Equivalent Methods: Designation of Two New Equivalent Methods AGENCY: Environmental...

  2. Lessons from comparative effectiveness research methods development projects funded under the Recovery Act.

    Science.gov (United States)

    Zurovac, Jelena; Esposito, Dominick

    2014-11-01

    The American Recovery and Reinvestment Act of 2009 (ARRA) directed nearly US$29.2 million to comparative effectiveness research (CER) methods development. To help inform future CER methods investments, we describe the ARRA CER methods projects, identify barriers to this research and discuss the alignment of topics with published methods development priorities. We used several existing resources and held discussions with ARRA CER methods investigators. Although funded projects explored many identified priority topics, investigators noted that much work remains. For example, given the considerable investments in CER data infrastructure, the methods development field can benefit from additional efforts to educate researchers about the availability of new data sources and about how best to apply methods to match their research questions and data.

  3. Recent UK research and the development of high temperature design methods

    International Nuclear Information System (INIS)

    Rose, R.T.; Tomkins, B.; Townley, C.H.A.

    1987-01-01

    The paper outlines recent research and development activities on high temperature design methods and criteria for high temperature components as utilized by liquid metal cooled fast breeder reactors. (orig.)

  4. 75 FR 22126 - Office of Research and Development; Ambient Air Monitoring Reference and Equivalent Methods...

    Science.gov (United States)

    2010-04-27

    ... ENVIRONMENTAL PROTECTION AGENCY [FRL-9142-1] Office of Research and Development; Ambient Air Monitoring Reference and Equivalent Methods: Designation of One New Equivalent Method AGENCY: Environmental Protection Agency. ACTION: Notice of the designation of one new equivalent method for monitoring ambient air...

  5. 76 FR 62402 - Office of Research and Development; Ambient Air Monitoring Reference and Equivalent Methods...

    Science.gov (United States)

    2011-10-07

    ... ENVIRONMENTAL PROTECTION AGENCY [FRL-9476-7] Office of Research and Development; Ambient Air Monitoring Reference and Equivalent Methods; Designation of One New Equivalent Method AGENCY: Environmental Protection Agency. ACTION: Notice of the designation of one new equivalent method for monitoring ambient air...

  6. 75 FR 30022 - Office of Research and Development; Ambient Air Monitoring Reference and Equivalent Methods...

    Science.gov (United States)

    2010-05-28

    ... ENVIRONMENTAL PROTECTION AGENCY [FRL-9156-1] Office of Research and Development; Ambient Air Monitoring Reference and Equivalent Methods: Designation of One New Equivalent Method AGENCY: Environmental Protection Agency. ACTION: Notice of the designation of one new equivalent method for monitoring ambient air...

  7. Using mixed methods to develop and evaluate complex interventions in palliative care research.

    Science.gov (United States)

    Farquhar, Morag C; Ewing, Gail; Booth, Sara

    2011-12-01

    there is increasing interest in combining qualitative and quantitative research methods to provide comprehensiveness and greater knowledge yield. Mixed methods are valuable in the development and evaluation of complex interventions. They are therefore particularly valuable in palliative care research where the majority of interventions are complex, and the identification of outcomes particularly challenging. this paper aims to introduce the role of mixed methods in the development and evaluation of complex interventions in palliative care, and how they may be used in palliative care research. the paper defines mixed methods and outlines why and how mixed methods are used to develop and evaluate complex interventions, with a pragmatic focus on design and data collection issues and data analysis. Useful texts are signposted and illustrative examples provided of mixed method studies in palliative care, including a detailed worked example of the development and evaluation of a complex intervention in palliative care for breathlessness. Key challenges to conducting mixed methods in palliative care research are identified in relation to data collection, data integration in analysis, costs and dissemination and how these might be addressed. the development and evaluation of complex interventions in palliative care benefit from the application of mixed methods. Mixed methods enable better understanding of whether and how an intervention works (or does not work) and inform the design of subsequent studies. However, they can be challenging: mixed method studies in palliative care will benefit from working with agreed protocols, multidisciplinary teams and engaging staff with appropriate skill sets.

  8. Research and Development Program in Reactor Diagnostics and Monitoring with Neutron Noise Methods, Stage 18

    International Nuclear Information System (INIS)

    Pazsit, Imre; Nam, Tran Hoai; Dykin, Victor; Jonsson, Anders

    2013-01-01

    This report constitutes Stage 18 of a long-term research and development program concerning the development of diagnostics and monitoring methods for nuclear reactors. The objective of the research program is to contribute to the strategic research goal of competence and research capacity by building up competence within the Department of Nuclear Engineering at Chalmers University of Technology, regarding reactor physics, reactor dynamics and noise diagnostics. The purpose is also to contribute to the research goal of giving a basis for SSM's supervision by developing methods for identification and localization of perturbations in reactor cores. Results up to Stage 17 were reported in SKI and SSM reports, as listed in the report's summary

  9. Arsenic removal methods for drinking water in the developing countries: technological developments and research needs.

    Science.gov (United States)

    Kabir, Fayzul; Chowdhury, Shakhawat

    2017-11-01

    Arsenic pollution of drinking water is a concern, particularly in the developing countries. Removal of arsenic from drinking water is strongly recommended. Despite the availability of efficient technologies for arsenic removal, the small and rural communities in the developing countries are not capable of employing most of these technologies due to their high cost and technical complexity. There is a need for the "low-cost" and "easy to use" technologies to protect the humans in the arsenic affected developing countries. In this study, arsenic removal technologies were summarized and the low-cost technologies were reviewed. The advantages and disadvantages of these technologies were identified and their scopes of applications and improvements were investigated. The costs were compared in context to the capacity of the low-income populations in the developing countries. Finally, future research directions were proposed to protect the low-income populations in the developing countries.

  10. Developing content standards for teaching research skills using a delphi method

    NARCIS (Netherlands)

    Schaaf, M.F. van der; Stokking, K.M.; Verloop, N.

    2005-01-01

    The increased attention for teacher assessment and current educational reforms ask for procedures to develop adequate content standards. For the development of content standards on teaching research skills, a Delphi method based on stakeholders’ judgments has been designed and tested. In three

  11. The Methodical Approaches to the Research of Informatization of the Global Economic Development

    Directory of Open Access Journals (Sweden)

    Kazakova Nadezhda A.

    2018-03-01

    Full Text Available The article is aimed at researching the identification of global economic development informatization. The complex of issues connected with research of development of informatization of the world countries in the conditions of globalization is considered. The development of informatization in the global economic space, which facilitates opening of new markets for international trade enterprises, international transnational corporations and other organizations, which not only provide exports, but also create production capacities for local producers. The methodical approach which includes three stages together with formation of the input information on the status of informatization of the global economic development of the world countries has been proposed.

  12. Hermeneutic interviewing: an example of its development and use as research method.

    Science.gov (United States)

    Geanellos, R

    1999-06-01

    In a study exploring the practice knowledge of nursing on adolescent mental health units, I chose hermeneutic philosophy to guide the conduct of the research. Immediately, I encountered the problem that hermeneutics is essentially unconcerned with its use as research method. The need for congruence between the study's hermeneutic foundations and the methodological processes of the research, led me to develop a style of hermeneutic interviewing for the purpose of information gathering. I did this using Gadamer's (1979) fundamental principles of: (1) tradition, (2) dialectics of interpretation, and (3) dialectic of question and answer. These principles are examined and discussed. The actualization of hermeneutic interviewing, as a means of information gathering, proved challenging. Using interview excerpts, I demonstrate my use of hermeneutic interviewing as research method, and critique my interviewing skills in relation to the fundamental principles from which this style of interviewing was developed.

  13. A case study on the design and development of minigames for research methods and statistics

    Directory of Open Access Journals (Sweden)

    P. Van Rosmalen

    2014-08-01

    Full Text Available Research methodology involves logical reasoning and critical thinking skills which are core competences in developing a more sophisticated understanding of the world. Acquiring expertise in research methods and statistics is not easy and poses a significant challenge for many students. The subject material is challenging because it is highly abstract and complex and requires the coordination of different but inter-related knowledge and skills that are all necessary to develop a coherent and usable skills base in this area. Additionally, while many students embrace research methods enthusiastically, others find the area dry, abstract and boring. In this paper we discuss the design and the first evaluation of a set of mini-games to practice research methods. Games are considered to be engaging and allow students to test out scenarios which provide concrete examples in a way that they typically only do once they are out in the field. The design of a game is a complex task. First, we describe how we used cognitive task analysis to identify the knowledge and competences required to develop a comprehensive and usable understanding of research methods. Next, we describe the games designed and how 4C-ID, an instructional design model, was used to underpin the games with a sound instructional design basis. Finally, the evaluation approach is discussed and how the findings of the first evaluation phase were used to improve the games.

  14. Research trend in thermally stimulated current method for development of materials and devices in Japan

    Science.gov (United States)

    Iwamoto, Mitsumasa; Taguchi, Dai

    2018-03-01

    Thermally stimulated current (TSC) measurement is widely used in a variety of research fields, i.e., physics, electronics, electrical engineering, chemistry, ceramics, and biology. TSC is short-circuit current that flows owing to the displacement of charges in samples during heating. TSC measurement is very simple, but TSC curves give very important information on charge behaviors. In the 1970s, TSC measurement contributed greatly to the development of electrical insulation engineering, semiconductor device technology, and so forth. Accordingly, the TSC experimental technique and its analytical method advanced. Over the past decades, many new molecules and advanced functional materials have been discovered and developed. Along with this, TSC measurement has attracted much attention in industries and academic laboratories as a way of characterizing newly discovered materials and devices. In this review, we report the latest research trend in the TSC method for the development of materials and devices in Japan.

  15. Interactive and Hands-on Methods for Professional Development of Undergraduate Researchers

    Science.gov (United States)

    Pressley, S. N.; LeBeau, J. E.

    2016-12-01

    Professional development workshops for undergraduate research programs can range from communicating science (i.e. oral, technical writing, poster presentations), applying for fellowships and scholarships, applying to graduate school, and learning about careers, among others. Novel methods of presenting the information on the above topics can result in positive outcomes beyond the obvious of transferring knowledge. Examples of innovative methods to present professional development information include 1) An interactive session on how to write an abstract where students are given an opportunity to draft an abstract from a short technical article, followed by discussion amongst a group of peers, and comparison with the "published" abstract. 2) Using the Process Oriented Guided Inquiry Learning (POGIL) method to evaluate and critique a research poster. 3) Inviting "experts" such as a Fulbright scholar graduate student to present on applying for fellowships and scholarships. These innovative methods of delivery provide more hands-on activities that engage the students, and in some cases (abstract writing) provide practice for the student. The methods also require that students develop team work skills, communicate amongst their peers, and develop networks with their cohort. All of these are essential non-technical skills needed for success in any career. Feedback from students on these sessions are positive and most importantly, the students walk out of the session with a smile on their face saying how much fun it was. Evaluating the impact of these sessions is more challenging and under investigation currently.

  16. Developing a methodology to assess the impact of research grant funding: a mixed methods approach.

    Science.gov (United States)

    Bloch, Carter; Sørensen, Mads P; Graversen, Ebbe K; Schneider, Jesper W; Schmidt, Evanthia Kalpazidou; Aagaard, Kaare; Mejlgaard, Niels

    2014-04-01

    This paper discusses the development of a mixed methods approach to analyse research funding. Research policy has taken on an increasingly prominent role in the broader political scene, where research is seen as a critical factor in maintaining and improving growth, welfare and international competitiveness. This has motivated growing emphasis on the impacts of science funding, and how funding can best be designed to promote socio-economic progress. Meeting these demands for impact assessment involves a number of complex issues that are difficult to fully address in a single study or in the design of a single methodology. However, they point to some general principles that can be explored in methodological design. We draw on a recent evaluation of the impacts of research grant funding, discussing both key issues in developing a methodology for the analysis and subsequent results. The case of research grant funding, involving a complex mix of direct and intermediate effects that contribute to the overall impact of funding on research performance, illustrates the value of a mixed methods approach to provide a more robust and complete analysis of policy impacts. Reflections on the strengths and weaknesses of the methodology are used to examine refinements for future work. Copyright © 2014 Elsevier Ltd. All rights reserved.

  17. Development of Implicit Methods in CFD NASA Ames Research Center 1970's - 1980's

    Science.gov (United States)

    Pulliam, Thomas H.

    2010-01-01

    The focus here is on the early development (mid 1970's-1980's) at NASA Ames Research Center of implicit methods in Computational Fluid Dynamics (CFD). A class of implicit finite difference schemes of the Beam and Warming approximate factorization type will be addressed. The emphasis will be on the Euler equations. A review of material pertinent to the solution of the Euler equations within the framework of implicit methods will be presented. The eigensystem of the equations will be used extensively in developing a framework for various methods applied to the Euler equations. The development and analysis of various aspects of this class of schemes will be given along with the motivations behind many of the choices. Various acceleration and efficiency modifications such as matrix reduction, diagonalization and flux split schemes will be presented.

  18. In situ methods for Li-ion battery research: A review of recent developments

    Science.gov (United States)

    Harks, P. P. R. M. L.; Mulder, F. M.; Notten, P. H. L.

    2015-08-01

    A considerable amount of research is being directed towards improving lithium-ion batteries in order to meet today's market demands. In particular in situ investigations of Li-ion batteries have proven extremely insightful, but require the electrochemical cell to be fully compatible with the conditions of the testing method and are therefore often challenging to execute. Advantageously, in the past few years significant progress has been made with new, more advanced, in situ techniques. Herein, a comprehensive overview of in situ methods for studying Li-ion batteries is given, with the emphasis on new developments and reported experimental highlights.

  19. Research Methods Teaching in Vocational Environments: Developing Critical Engagement with Knowledge?

    Science.gov (United States)

    Gray, C.; Turner, R.; Sutton, C.; Petersen, C.; Stevens, S.; Swain, J.; Esmond, B.; Schofield, C.; Thackeray, D.

    2015-01-01

    Knowledge of research methods is regarded as crucial for the UK economy and workforce. However, research methods teaching is viewed as a challenging area for lecturers and students. The pedagogy of research methods teaching within universities has been noted as underdeveloped, with undergraduate students regularly expressing negative dispositions…

  20. Proposed Project Selection Method for Human Support Research and Technology Development (HSR&TD)

    Science.gov (United States)

    Jones, Harry

    2005-01-01

    The purpose of HSR&TD is to deliver human support technologies to the Exploration Systems Mission Directorate (ESMD) that will be selected for future missions. This requires identifying promising candidate technologies and advancing them in technology readiness until they are acceptable. HSR&TD must select an may of technology development projects, guide them, and either terminate or continue them, so as to maximize the resulting number of usable advanced human support technologies. This paper proposes an effective project scoring methodology to support managing the HSR&TD project portfolio. Researchers strongly disagree as to what are the best technology project selection methods, or even if there are any proven ones. Technology development is risky and outstanding achievements are rare and unpredictable. There is no simple formula for success. Organizations that are satisfied with their project selection approach typically use a mix of financial, strategic, and scoring methods in an open, established, explicit, formal process. This approach helps to build consensus and develop management insight. It encourages better project proposals by clarifying the desired project attributes. We propose a project scoring technique based on a method previously used in a federal laboratory and supported by recent research. Projects are ranked by their perceived relevance, risk, and return - a new 3 R's. Relevance is the degree to which the project objective supports the HSR&TD goal of developing usable advanced human support technologies. Risk is the estimated probability that the project will achieve its specific objective. Return is the reduction in mission life cycle cost obtained if the project is successful. If the project objective technology performs a new function with no current cost, its return is the estimated cash value of performing the new function. The proposed project selection scoring method includes definitions of the criteria, a project evaluation

  1. Mixed methods research.

    Science.gov (United States)

    Halcomb, Elizabeth; Hickman, Louise

    2015-04-08

    Mixed methods research involves the use of qualitative and quantitative data in a single research project. It represents an alternative methodological approach, combining qualitative and quantitative research approaches, which enables nurse researchers to explore complex phenomena in detail. This article provides a practical overview of mixed methods research and its application in nursing, to guide the novice researcher considering a mixed methods research project.

  2. ["Grounded theory" develops medicine. Popular research method for exploring human behavior can discover new connections].

    Science.gov (United States)

    Thulesius, Hans; Barfod, Toke; Ekström, Helene; Håkansson, Anders

    2004-09-30

    Grounded theory (GT) is a popular research method for exploring human behavior. GT was developed by the medical sociologists Glaser and Strauss while they studied dying in hospitals in the 1960s resulting in the book "Awareness of dying". The goal of a GT is to generate conceptual theories by using all types of data but without applying existing theories and hypotheses. GT procedures are mostly inductive as opposed to deductive research where hypotheses are tested. A good GT has a core variable that is a central concept connected to many other concepts explaining the main action in the studied area. A core variable answers the question "What's going on?". Examples of core variables are: "Cutting back after a heart attack"--how people adapt to life after a serious illness; and "Balancing in palliative cancer care"--a process of weighing, shifting, compensating and compromising when treating people with a progressive and incurable illness trajectory.

  3. Next Generation Nuclear Plant Methods Research and Development Technical Program Plan -- PLN-2498

    Energy Technology Data Exchange (ETDEWEB)

    Richard R. Schultz; Abderrafi M. Ougouag; David W. Nigg; Hans D. Gougar; Richard W. Johnson; William K. Terry; Chang H. Oh; Donald W. McEligot; Gary W. Johnsen; Glenn E. McCreery; Woo Y. Yoon; James W. Sterbentz; J. Steve Herring; Temitope A. Taiwo; Thomas Y. C. Wei; William D. Pointer; Won S. Yang; Michael T. Farmer; Hussein S. Khalil; Madeline A. Feltus

    2008-09-01

    One of the great challenges of designing and licensing the Very High Temperature Reactor (VHTR) is to confirm that the intended VHTR analysis tools can be used confidently to make decisions and to assure all that the reactor systems are safe and meet the performance objectives of the Generation IV Program. The research and development (R&D) projects defined in the Next Generation Nuclear Plant (NGNP) Design Methods Development and Validation Program will ensure that the tools used to perform the required calculations and analyses can be trusted. The Methods R&D tasks are designed to ensure that the calculational envelope of the tools used to analyze the VHTR reactor systems encompasses, or is larger than, the operational and transient envelope of the VHTR itself. The Methods R&D focuses on the development of tools to assess the neutronic and thermal fluid behavior of the plant. The fuel behavior and fission product transport models are discussed in the Advanced Gas Reactor (AGR) program plan. Various stress analysis and mechanical design tools will also need to be developed and validated and will ultimately also be included in the Methods R&D Program Plan. The calculational envelope of the neutronics and thermal-fluids software tools intended to be used on the NGNP is defined by the scenarios and phenomena that these tools can calculate with confidence. The software tools can only be used confidently when the results they produce have been shown to be in reasonable agreement with first-principle results, thought-problems, and data that describe the “highly ranked” phenomena inherent in all operational conditions and important accident scenarios for the VHTR.

  4. Methods of removal of tritium from aqueous effluent: a review of international research and development

    International Nuclear Information System (INIS)

    Segal, M.G.

    1988-01-01

    Tritium is formed in thermal nuclear reactors both by neutron activation of elements such as deuterium and lithium and by ternary fission in the fuel. It is a weak beta-emitter with a short half-life, 12.3 years, and its radiological significance in reactor discharges is very low. In heavy-water-cooled and -moderated reactors, such as the CANDU stations, the tritium concentration in the moderator is sufficiently high to cause a potential hazard to operators, and so a major research and development programme has been carried out on processes to remove the tritium. Detritiation of light water has also been the subject of major R and D effort world-wide, because reprocessing operations can generate significant quantities of tritium in liquid waste, and high concentrations of tritium may arise in some aqueous streams in fusion reactors. This Report presents a review of the methods that have been proposed, studied and developed for removal of tritium from light and heavy water: the principles of individual methods are discussed, and the current status of their development is reviewed. (author)

  5. The Value of Developing a Mixed-Methods Program of Research.

    Science.gov (United States)

    Simonovich, Shannon

    2017-07-01

    This article contributes to the discussion of the value of utilizing mixed methodological approaches to conduct nursing research. To this end, the author of this article proposes creating a mixed-methods program of research over time, where both quantitative and qualitative data are collected and analyzed simultaneously, rather than focusing efforts on designing singular mixed-methods studies. A mixed-methods program of research would allow for the best of both worlds: precision through focus on one method at a time, and the benefits of creating a robust understanding of a phenomenon over the trajectory of one's career through examination from various methodological approaches.

  6. Research on teaching methods.

    Science.gov (United States)

    Oermann, M H

    1990-01-01

    Research on teaching methods in nursing education was categorized into studies on media, CAI, and other nontraditional instructional strategies. While the research differed, some generalizations may be made from the findings. Multimedia, whether it is used for individual or group instruction, is at least as effective as traditional instruction (lecture and lecture-discussion) in promoting cognitive learning, retention of knowledge, and performance. Further study is needed to identify variables that may influence learning and retention. While learner attitudes toward mediated instruction tended to be positive, investigators failed to control for the effect of novelty. Control over intervening variables was lacking in the majority of studies as well. Research indicated that CAI is as effective as other teaching methods in terms of knowledge gain and retention. Attitudes toward CAI tended to be favorable, with similar problems in measurement as those evidenced in studies of media. Chang (1986) also recommends that future research examine the impact of computer-video interactive instruction on students, faculty, and settings. Research is needed on experimental teaching methods, strategies for teaching problem solving and clinical judgment, and ways of improving the traditional lecture and discussion. Limited research in these areas makes generalizations impossible. There is a particular need for research on how to teach students the diagnostic reasoning process and encourage critical thinking, both in terms of appropriate teaching methods and the way in which those strategies should be used. It is interesting that few researchers studied lecture and lecture-discussion except as comparable teaching methods for research on other strategies. Additional research questions may be generated on lecture and discussion in relation to promoting concept learning, an understanding of nursing and other theories, transfer of knowledge, and development of cognitive skills. Few

  7. Research and Development Program in Reactor Diagnostics and Monitoring with Neutron Noise Methods, Stage 16

    Energy Technology Data Exchange (ETDEWEB)

    Pazsit, Imre; Dykin, Victor; Jonsson, Anders; Demaziere, Christophe (Chalmers Univ. of Technology, Dept. of Nuclear Engineering, Goeteborg (Sweden))

    2010-12-15

    This report gives an account of the work performed by the Dept. of Nuclear Engineering, Chalmers Univ. of Technology, in the frame of a research contract with the Swedish Radiation Safety Authority (SSM), contract No. SSM 2009/2093. The present report is based on work performed by Imre Pazsit, Victor Dykin, Anders Jonsson and Christophe Demaziere, with Imre Pazsit being the project leader. This report describes the results obtained during Stage 16 of a long-term research and development program concerning the development of diagnostics and monitoring methods for nuclear reactors. The long-term goals are elaborated in more detail in e.g. the Final Reports of Stage 1 and 2 (SKI Report 95:14 and 96:50, Pazsit et al. 1995, 1996). Results up to Stage 15 were reported in (Pazsit et al. 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2003a, 2003b; Demaziere et al, 2004; Sunde et al, 2006; Pazsit et al. 2008, 2009). A brief proposal for the continuation of this program in Stage 17 is also given at the end of the report. The program executed in Stage 16 consists of four parts as follows: - An overview of the present status of experience with BWR stability; - An investigation of the significance of the properties of the noise source for BWR instability; - Study of the dynamics of molten salt systems: construction of the adjoint and calculating the space dependent noise induced by propagating perturbations in the fuel; - A specific study of some novel methods of analysis of non-linear and non-stationary processes

  8. Research and Development Program in Reactor Diagnostics and Monitoring with Neutron Noise Methods, Stage 16

    International Nuclear Information System (INIS)

    Pazsit, Imre; Dykin, Victor; Jonsson, Anders; Demaziere, Christophe

    2010-12-01

    This report gives an account of the work performed by the Dept. of Nuclear Engineering, Chalmers Univ. of Technology, in the frame of a research contract with the Swedish Radiation Safety Authority (SSM), contract No. SSM 2009/2093. The present report is based on work performed by Imre Pazsit, Victor Dykin, Anders Jonsson and Christophe Demaziere, with Imre Pazsit being the project leader. This report describes the results obtained during Stage 16 of a long-term research and development program concerning the development of diagnostics and monitoring methods for nuclear reactors. The long-term goals are elaborated in more detail in e.g. the Final Reports of Stage 1 and 2 (SKI Report 95:14 and 96:50, Pazsit et al. 1995, 1996). Results up to Stage 15 were reported in (Pazsit et al. 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2003a, 2003b; Demaziere et al, 2004; Sunde et al, 2006; Pazsit et al. 2008, 2009). A brief proposal for the continuation of this program in Stage 17 is also given at the end of the report. The program executed in Stage 16 consists of four parts as follows: - An overview of the present status of experience with BWR stability; - An investigation of the significance of the properties of the noise source for BWR instability; - Study of the dynamics of molten salt systems: construction of the adjoint and calculating the space dependent noise induced by propagating perturbations in the fuel; - A specific study of some novel methods of analysis of non-linear and non-stationary processes

  9. Assessing the Development of Educational Research Literacy: The Effect of Courses on Research Methods in Studies of Educational Science

    Science.gov (United States)

    Groß Ophoff, Jana; Schladitz, Sandra; Leuders, Juliane; Leuders, Timo; Wirtz, Markus A.

    2015-01-01

    The ability to purposefully access, reflect, and use evidence from educational research (Educational Research Literacy) is expected of future professionals in educational practice. Based on the presented conceptual framework, a test instrument was developed to assess the different competency aspects: Information Literacy, Statistical Literacy, and…

  10. Consumer Behavior Research Methods

    DEFF Research Database (Denmark)

    Chrysochou, Polymeros

    2017-01-01

    This chapter starts by distinguishing consumer behavior research methods based on the type of data used, being either secondary or primary. Most consumer behavior research studies phenomena that require researchers to enter the field and collect data on their own, and therefore the chapter...... emphasizes the discussion of primary research methods. Based on the nature of the data primary research methods are further distinguished into qualitative and quantitative. The chapter describes the most important and popular qualitative and quantitative methods. It concludes with an overall evaluation...... of the methods and how to improve quality in consumer behavior research methods....

  11. Accelerating what works: using qualitative research methods in developing a change package for a learning collaborative.

    Science.gov (United States)

    Sorensen, Asta V; Bernard, Shulamit L

    2012-02-01

    Learning (quality improvement) collaboratives are effective vehicles for driving coordinated organizational improvements. A central element of a learning collaborative is the change package-a catalogue of strategies, change concepts, and action steps that guide participants in their improvement efforts. Despite a vast literature describing learning collaboratives, little to no information is available on how the guiding strategies, change concepts, and action items are identified and developed to a replicable and actionable format that can be used to make measurable improvements within participating organizations. The process for developing the change package for the Health Resources and Services Administration's (HRSA) Patient Safety and Clinical Pharmacy Services Collaborative entailed environmental scan and identification of leading practices, case studies, interim debriefing meetings, data synthesis, and a technical expert panel meeting. Data synthesis involved end-of-day debriefings, systematic qualitative analyses, and the use of grounded theory and inductive data analysis techniques. This approach allowed systematic identification of innovative patient safety and clinical pharmacy practices that could be adopted in diverse environments. A case study approach enabled the research team to study practices in their natural environments. Use of grounded theory and inductive data analysis techniques enabled identification of strategies, change concepts, and actionable items that might not have been captured using different approaches. Use of systematic processes and qualitative methods in identification and translation of innovative practices can greatly accelerate the diffusion of innovations and practice improvements. This approach is effective whether or not an individual organization is part of a learning collaborative.

  12. The change and development of statistical methods used in research articles in child development 1930-2010.

    Science.gov (United States)

    Køppe, Simo; Dammeyer, Jesper

    2014-09-01

    The evolution of developmental psychology has been characterized by the use of different quantitative and qualitative methods and procedures. But how does the use of methods and procedures change over time? This study explores the change and development of statistical methods used in articles published in Child Development from 1930 to 2010. The methods used in every article in the first issue of every volume were categorized into four categories. Until 1980 relatively simple statistical methods were used. During the last 30 years there has been an explosive use of more advanced statistical methods employed. The absence of statistical methods or use of simple methods had been eliminated.

  13. The Application of a Multiphase Triangulation Approach to Mixed Methods: The Research of an Aspiring School Principal Development Program

    Science.gov (United States)

    Youngs, Howard; Piggot-Irvine, Eileen

    2012-01-01

    Mixed methods research has emerged as a credible alternative to unitary research approaches. The authors show how a combination of a triangulation convergence model with a triangulation multilevel model was used to research an aspiring school principal development pilot program. The multilevel model is used to show the national and regional levels…

  14. Development of high-frame rate neutron radiography and quantitative measurement method for multiphase flow research

    International Nuclear Information System (INIS)

    Mishima, K.; Hibiki, T.

    1998-01-01

    Neutron radiography (NR) is one of the radiographic techniques which makes use of the difference in attenuation characteristics of neutrons in materials. Fluid measurement using the NR technique is a non-intrusive method which enables visualization of dynamic images of multiphase flow of opaque fluids and/or in a metallic duct. To apply the NR technique to multiphase flow research, high frame-rate NR was developed by combining up-to-date technologies for neutron sources, scintillator, high-speed video and image intensifier. This imaging system has several advantages such as a long recording time (up to 21 minutes), high-frame-rate (up to 1000 frames/s) imaging and there is no need for a triggering signal. Visualization studies of air-water two-phase flow in a metallic duct and molten metal-water interaction were performed at recording speeds of 250, 500 and 1000 frames/s. The qualities of the consequent images were sufficient to observe the flow pattern and behavior. It was also demonstrated that some characteristics of two-phase flow could be measured from these images in collaboration with image processing techniques. By utilizing geometrical information extracted from NR images, data on flow regime, bubble rise velocity, and wave height and interfacial area in annular flow were obtained. By utilizing attenuation characteristics of neutrons in materials, measurements of void profile and average void fraction were performed. It was confirmed that this new technique may have significant advantages both in visualizing and measuring high-speed fluid phenomena when other methods, such as an optical method and X-ray radiography, cannot be applied. (author)

  15. Development of Chemical Engineering Course Methods Using Action Research: Case Study

    Science.gov (United States)

    Virkki-Hatakka, Terhi; Tuunila, Ritva; Nurkka, Niina

    2013-01-01

    This paper reports on the systematic development of a teaching methodology for two chemical engineering courses. The aim was to improve the quality of teaching to achieve expected learning outcomes more effectively. The development was carried out over a period of several years based on an action research methodology with data systematically…

  16. The Change and Development of Statistical Methods Used in Research Articles in Child Development 1930-2010

    DEFF Research Database (Denmark)

    Køppe, Simo; Dammeyer, Jesper Herup

    2014-01-01

    The evolution of developmental psychology has been characterized by the use of different quantitative and qualitative methods and procedures. But how does the use of methods and procedures change over time? This study explores the change and Development of statistical methods used in articles...... published in Child Development from 1930 to 2010. The methods used in every article in the first issue of every volume were categorized into four categories. Until 1980 relatively simple statistical methods were used. During the last 30 years there has been an explosive use of more advanced statistical...... methods employed. The absence of statistical methods or use of simplemethods had been eliminated....

  17. Benefits, Challenges, and Dynamism of Positionalities Associated with Mixed Methods Research in Developing Countries: Evidence from Ghana

    Science.gov (United States)

    Teye, Joseph Kofi

    2012-01-01

    Although mixed methods designs have gained visibility in recent years, most of the publications on this methodological strategy have been written by scholars in the developed world. Consequently, the practical challenges associated with mixed methods research in developing countries have not been adequately discussed in the literature. Relying on…

  18. Teaching and learning research methods: towards developing a deeper appreciation of their assumptions

    OpenAIRE

    Mendy, John P.

    2016-01-01

    Quite often the approach adopted by tutors to the teaching and learning of research methodology at undergraduate and, sometimes even at postgraduate level, is to teach students to be able to set a question and to go about trying to answer it in the way of research. This is a pragmatic approach to an important area of scholarship which deserves something more special than what is being provided in frequently used books on research methods (see Easterby-Smith et al 2002; Saunders et al 2012). G...

  19. [Development and effects of emotional intelligence program for undergraduate nursing students: mixed methods research].

    Science.gov (United States)

    Lee, Oi Sun; Gu, Mee Ock

    2014-12-01

    This study was conducted to develop and test the effects of an emotional intelligence program for undergraduate nursing students. The study design was a mixed method research. Participants were 36 nursing students (intervention group: 17, control group: 19). The emotional intelligence program was provided for 4 weeks (8 sessions, 20 hours). Data were collected between August 6 and October 4, 2013. Quantitative data were analyzed using Chi-square, Fisher's exact test, t-test, repeated measure ANOVA, and paired t-test with SPSS/WIN 18.0. Qualitative data were analyzed using content analysis. Quantitative results showed that emotional intelligence, communication skills, resilience, stress coping strategy, and clinical competence were significantly better in the experimental group compared to the control group. According to the qualitative results, the nursing students experienced improvement in emotional intelligence, interpersonal relationships, and empowerment, as well as a reduction in clinical practice stress after participation in the emotional intelligence program. Study findings indicate that the emotional intelligence program for undergraduate nursing students is effective and can be recommended as an intervention for improving the clinical competence of undergraduate students in a nursing curriculum.

  20. Development of simulation code for MOX dissolution using silver-mediated electrochemical method (Contract research)

    Energy Technology Data Exchange (ETDEWEB)

    Kida, Takashi; Umeda, Miki; Sugikawa, Susumu [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment

    2003-03-01

    MOX dissolution using silver-mediated electrochemical method will be employed for the preparation of plutonium nitrate solution in the criticality safety experiments in the Nuclear Fuel Cycle Safety Engineering Research Facility (NUCEF). A simulation code for the MOX dissolution has been developed for the operating support. The present report describes the outline of the simulation code, a comparison with the experimental data and a parameter study on the MOX dissolution. The principle of this code is based on the Zundelevich's model for PuO{sub 2} dissolution using Ag(II). The influence of nitrous acid on the material balance of Ag(II) is taken into consideration and the surface area of MOX powder is evaluated by particle size distribution in this model. The comparison with experimental data was carried out to confirm the validity of this model. It was confirmed that the behavior of MOX dissolution could adequately be simulated using an appropriate MOX dissolution rate constant. It was found from the result of parameter studies that MOX particle size was major governing factor on the dissolution rate. (author)

  1. Wellbeing Research in Developing Countries: Reviewing the Role of Qualitative Methods

    Science.gov (United States)

    Camfield, Laura; Crivello, Gina; Woodhead, Martin

    2009-01-01

    The authors review the contribution of qualitative methods to exploring concepts and experiences of wellbeing among children and adults living in developing countries. They provide examples illustrating the potential of these methods for gaining a holistic and contextual understanding of people's perceptions and experiences. Some of these come…

  2. FODEM: A Multi-Threaded Research and Development Method for Educational Technology

    Science.gov (United States)

    Suhonen, Jarkko; de Villiers, M. Ruth; Sutinen, Erkki

    2012-01-01

    Formative development method (FODEM) is a multithreaded design approach that was originated to support the design and development of various types of educational technology innovations, such as learning tools, and online study programmes. The threaded and agile structure of the approach provides flexibility to the design process. Intensive…

  3. Solar cells elaborated by chemical methods: examples of research and development at CIE-UNAM

    International Nuclear Information System (INIS)

    Rincon, Marina E.

    2008-01-01

    Full text: At the Energy Research Center (CIE-UNAM-Mexico), the major areas of renewable energy research are solar thermal energy, photovoltaic energy, geothermal energy, hydrogen energy, materials for renewable energy, and energy planning. Among the efforts to developed solar cells, both physical and chemical methods are in progress at CIE-UNAM. In this contribution we focus on the advancement in efficiency, stability, and cost, of photovoltaic junctions based on chemically deposited films. Examples of early research are a composite thin film electrode comprised of SnO2/Bi2S3 nanocrystallites (5 nm) prepared by sequential deposition of SnO2 and Bi2S3 films onto an optically transparent electrode; the co-deposition of pyrrole and Bi2S3 nanoparticles on chemically deposited bismuth sulfide substrates to explore new approaches to improve light-collection efficiency in polymer photovoltaics; the sensitization of titanium dioxide coatings by chemically deposited cadmium selenide and bismuthe sulfide thin films. Here the good photostability of the coatings was promising for the use of the sensitized films in photocatalytic as well as photovoltaic applications. More recently, chemically deposited cadmium sulfide thin films have been explored in planar hybrid heterojunctions with chemically synthesized poly 3-octylthiophene, as well as all-chemically deposited photovoltaic structures. Examples of the last are: chemically deposited thin films of CdS (80 nm), Sb2S3 (450 nm), and Ag2Se (150 nm) annealed at 300 C and integrated into a p-i-n structure glass/SnO2:F/n-CdS/Sb2S3/p-AgSbSe2/Ag, showing Voc ∼ 550 mV and Jsc ∼ 2.3 mA/cm2 at 1 kW/m2 (tungsten halogen) intensity. Similarly, chemically deposited SnS (450nm) and CuS (80nm) thin films integrated in a photovoltaic structure SnO2:F/CdS/SnS/CuS/Ag, showing Voc>300 mV and Jsc up to 5 mA/cm2 under 850 W/m2 tungsten halogen illumination. These photovoltaic structures have been found to be stable over a period extending over

  4. Development of a Mixed Methods Investigation of Process and Outcomes of Community-Based Participatory Research

    Science.gov (United States)

    Lucero, Julie; Wallerstein, Nina; Duran, Bonnie; Alegria, Margarita; Greene-Moton, Ella; Israel, Barbara; Kastelic, Sarah; Magarati, Maya; Oetzel, John; Pearson, Cynthia; Schulz, Amy; Villegas, Malia; White Hat, Emily R.

    2018-01-01

    This article describes a mixed methods study of community-based participatory research (CBPR) partnership practices and the links between these practices and changes in health status and disparities outcomes. Directed by a CBPR conceptual model and grounded in indigenous-transformative theory, our nation-wide, cross-site study showcases the value…

  5. Research circles: A method for the development of knowledge and the creation of change in practice

    Directory of Open Access Journals (Sweden)

    Sara Högdin

    2014-12-01

    Full Text Available This article contains a presentation of experiences gained of research circles as a participant-based method for the development of knowledge and the creation of change in practice. The starting point is two international projects whose aim is to develop knowledge about the professional work being done with young people who exhibit violent behavior. In the Swedish sub-studies, research circles are used as a method for developing such knowledge as well as for creating change in practice. The research circle as a method has its theoretical starting point in action research and participant-oriented research. The results of the study illustrate how research circles can contribute to the creation of a knowledge process through the dialogue in the group and the facilitation of reflection over different work approaches in one’s own work, even if it is a method that does not suit everyone. The results also show that the research circle can lead to a change process in the actual work by enhancing transprofessional collaboration and leading to an increase in the participants’ awareness and evaluation of their work with violent children and young people. Este artigo contém uma apresentação de experiências adquiridas com círculos de investigação como método participante capaz de gerar conhecimento e mudança de práticas. Dois projetos internacionais constituem o nosso ponto de partida, cujo objetivo foi o de produzir conhecimento sobre o trabalho profissional que está a ser feito com os jovens que apresentam comportamento violento. Nos sub-estudos suecos, os círculos de investigação são usados como um método para o desenvolvimento de tais conhecimentos, bem como para proporcionar mudança de práticas. O círculo de investigação como método tem o seu ponto de partida teórico na investigação-ação e na investigação participante. Os resultados do estudo demonstram como os círculos de investigação podem contribuir para a cria

  6. Research Methods in Education

    Science.gov (United States)

    Check, Joseph; Schutt, Russell K.

    2011-01-01

    "Research Methods in Education" introduces research methods as an integrated set of techniques for investigating questions about the educational world. This lively, innovative text helps students connect technique and substance, appreciate the value of both qualitative and quantitative methodologies, and make ethical research decisions.…

  7. The National Shipbuilding Research Program. Development of a Quick TBT Analytical Method

    Science.gov (United States)

    2000-08-16

    Development of a Quick TBT Analytical Method 09/25/2000 Page 3 of 38 Executive Summary Concern about the toxic effect of tributyltin have caused the...Antifouling Paints on the Environment Tributyl tin ( TBT ) has been shown to be highly toxic to certain aquatic organisms at concentrations measured in the...paints, developed in the 1960s, contains the organotin tributyltin ( TBT ), which has been proven to cause deformations in oysters and sex changes in

  8. Research and Development Project Selection Methods at the Air Force Wright Aeronautical Laboratories.

    Science.gov (United States)

    1985-09-01

    personal and telephone interviews. Ten individuals from each of the four AFWAL Laboratories were interrviewed. The results illustrated that few of the...680). Aaker and Tyebee. 1978. The authors constructed a model that dealt with the selection of interdependent R&D projects. The model covers three...of this research effort. Scope * The data collection method used in this study consisted of a combination of personal and telephone interviews. The

  9. Cooperative method development

    DEFF Research Database (Denmark)

    Dittrich, Yvonne; Rönkkö, Kari; Eriksson, Jeanette

    2008-01-01

    The development of methods tools and process improvements is best to be based on the understanding of the development practice to be supported. Qualitative research has been proposed as a method for understanding the social and cooperative aspects of software development. However, qualitative...... research is not easily combined with the improvement orientation of an engineering discipline. During the last 6 years, we have applied an approach we call `cooperative method development', which combines qualitative social science fieldwork, with problem-oriented method, technique and process improvement....... The action research based approach focusing on shop floor software development practices allows an understanding of how contextual contingencies influence the deployment and applicability of methods, processes and techniques. This article summarizes the experiences and discusses the further development...

  10. Research Methods Tutorial

    Science.gov (United States)

    Aguilera, Frank J.

    2015-01-01

    A guiding principle for conducting research in technology, science, and engineering, leading to innovation is based on our use of research methodology (both qualitative and qualitative). A brief review of research methodology will be presented with an overview of NASA process in developing aeronautics technologies and other things to consider in research including what is innovation.

  11. Research on assessment methods for urban public transport development in China.

    Science.gov (United States)

    Zou, Linghong; Dai, Hongna; Yao, Enjian; Jiang, Tian; Guo, Hongwei

    2014-01-01

    In recent years, with the rapid increase in urban population, the urban travel demands in Chinese cities have been increasing dramatically. As a result, developing comprehensive urban transport systems becomes an inevitable choice to meet the growing urban travel demands. In urban transport systems, public transport plays the leading role to promote sustainable urban development. This paper aims to establish an assessment index system for the development level of urban public transport consisting of a target layer, a criterion layer, and an index layer. Review on existing literature shows that methods used in evaluating urban public transport structure are dominantly qualitative. To overcome this shortcoming, fuzzy mathematics method is used for describing qualitative issues quantitatively, and AHP (analytic hierarchy process) is used to quantify expert's subjective judgment. The assessment model is established based on the fuzzy AHP. The weight of each index is determined through the AHP and the degree of membership of each index through the fuzzy assessment method to obtain the fuzzy synthetic assessment matrix. Finally, a case study is conducted to verify the rationality and practicability of the assessment system and the proposed assessment method.

  12. Using an Evaluability Assessment To Select Methods for Evaluating State Technology Development Programs: The Case of the Georgia Research Alliance.

    Science.gov (United States)

    Youtie, Jan; Bozeman, Barry; Shapira, Philip

    1999-01-01

    Describes an evaluability assessment of the Georgia Research Alliance (GRA), a technology development program. Presents the steps involved in conducting an evaluability assessment, including development of an understanding of the program and its stakeholders. Analyzes and compares different methods by which the GRA could be evaluated. (SLD)

  13. A Method for Recruiting Participants from Isolated Islands of Small Island Developing States (SIDS) for Survey Research

    Science.gov (United States)

    Moosa, Sheena; Koopman-Boyden, Peggy

    2016-01-01

    Representing isolated small island communities through social survey research continues to be challenging. We examine a locally developed method to reach and recruit older people (65+ years) for a survey on well-being in the small island developing state of Maldives. The use of messengers to recruit participants is examined in the context of these…

  14. New method development in prehistoric stone tool research: evaluating use duration and data analysis protocols.

    Science.gov (United States)

    Evans, Adrian A; Macdonald, Danielle A; Giusca, Claudiu L; Leach, Richard K

    2014-10-01

    Lithic microwear is a research field of prehistoric stone tool (lithic) analysis that has been developed with the aim to identify how stone tools were used. It has been shown that laser scanning confocal microscopy has the potential to be a useful quantitative tool in the study of prehistoric stone tool function. In this paper, two important lines of inquiry are investigated: (1) whether the texture of worn surfaces is constant under varying durations of tool use, and (2) the development of rapid objective data analysis protocols. This study reports on the attempt to further develop these areas of study and results in a better understanding of the complexities underlying the development of flexible analytical algorithms for surface analysis. The results show that when sampling is optimised, surface texture may be linked to contact material type, independent of use duration. Further research is needed to validate this finding and test an expanded range of contact materials. The use of automated analytical protocols has shown promise but is only reliable if sampling location and scale are defined. Results suggest that the sampling protocol reports on the degree of worn surface invasiveness, complicating the ability to investigate duration related textural characterisation. Copyright © 2014. Published by Elsevier Ltd.

  15. Multi-scale computation methods: Their applications in lithium-ion battery research and development

    Science.gov (United States)

    Siqi, Shi; Jian, Gao; Yue, Liu; Yan, Zhao; Qu, Wu; Wangwei, Ju; Chuying, Ouyang; Ruijuan, Xiao

    2016-01-01

    Based upon advances in theoretical algorithms, modeling and simulations, and computer technologies, the rational design of materials, cells, devices, and packs in the field of lithium-ion batteries is being realized incrementally and will at some point trigger a paradigm revolution by combining calculations and experiments linked by a big shared database, enabling accelerated development of the whole industrial chain. Theory and multi-scale modeling and simulation, as supplements to experimental efforts, can help greatly to close some of the current experimental and technological gaps, as well as predict path-independent properties and help to fundamentally understand path-independent performance in multiple spatial and temporal scales. Project supported by the National Natural Science Foundation of China (Grant Nos. 51372228 and 11234013), the National High Technology Research and Development Program of China (Grant No. 2015AA034201), and Shanghai Pujiang Program, China (Grant No. 14PJ1403900).

  16. Research developments in methods to reduce the carbon footprint of the food system: a review.

    Science.gov (United States)

    Xu, Zhongyue; Sun, Da-Wen; Zeng, Xin-An; Liu, Dan; Pu, Hongbin

    2015-01-01

    Global warming is a worldwide issue with its evident impact across a wide range of systems and sectors. It is caused by a number of greenhouse gases (GHGs) emissions, in which food system has made up of a large part. Recently, reduction of GHG emissions has become an urgent issue to be resolved in the food system. Many governments and organizations are making great endeavors to alleviate the adverse effect of this phenomenon. In this review, methods to reduce the carbon footprint within the life cycle of a food system are presented from the technical, consumption behavior and environmental policies perspectives. The whole food system including raw material acquisition, processing, packaging, preservation, transportation, consumption, and disposal are covered. Improving management techniques, and adopting advanced technology and equipment are critical for every stage of a food system. Rational site selection is important to alleviate the influence of land use change. In addition, environmental choices of packaging stage, reduction in refrigeration dependence, and correct waste treatment are essential to reduce the total carbon footprint of the production. However, only technical methods cannot radically reverse the trend of climate change, as consumption behaviors present a great deal of influence over climate change. Appropriate purchase patterns and substitution within food product categories by low carbon products can reduce GHG emissions. Development of methods to calculate the carbon footprint of every kind of food and its processing technology enable people to make environmental choice. Policy can shape and cultivate the new code of consumption and influence the direction of emerging technology and science. From political perspectives, government intervention and carbon offset are common tools, especially for carbon tax and a real or implicit price of carbon. Finally, by mitigating the methodologies described above, the rate and magnitude of climate changes

  17. Synergic development of pharmacokinetics and bioanalytical methods as support of pharmaceutical research.

    Science.gov (United States)

    Marzo, M; Ciccarelli, R; Di Iorio, P; Giuliani, P; Caciagli, F; Marzo, A

    2016-06-01

    The development of pharmacokinetics led this science to achieve a relevant role in the investigation of new chemical entities for therapeutic application, and has allowed a series of new useful realizations of out of patent drugs like prolonged release and delayed release formulations, therapeutic delivery system (TDS) for drugs to be active in systemic circulation avoiding the first pass effect, orodispersible and effervescent formulations, intramuscular and subcutaneous depot formulations acting over a long period, oral inhalatory systems, and drug association at fixed dose. The above applications had pharmacokinetics as protagonist and have required the support from bioanalytical methods to assay drug concentrations, even in pg·mL(-1) of plasma, that really have paralleled the synergic development of pharmacokinetics.The complexity of the above realizations required specific guidelines from the regulatory authorities, mainly the US FDA and EU EMA, which have normalized and, in most cases, simplified the above applications admitting some waivers of in vivo bioequivalence.However, this review highlights some critical points, not yet focused on by operating guidelines, which need to be clarified by regulatory authorities. One of the most relevant issues is about the planning and conducting bioavailability and bioequivalence trials with endogenous substances, that possess own homeostatic equilibria with fluctuations, in some cases with specific rhythms, like melatonin and female sex hormones. The baseline subtraction required by guidelines to define the net contribute to the exogenous absorbed drug in most cases is a non-solvable problem. © The Author(s) 2015.

  18. RESEARCH AND DEVELOPMENT CONTROL METHOD PATHOGENIC PRION INFECTIONS SECONDARY RAW MEAT INDUSTRY

    Directory of Open Access Journals (Sweden)

    A. Y. Prosekov

    2016-01-01

    Full Text Available Highly sensitive and specific method for identification of pathogenic prion protein was developed. It was found that the water-soluble fractions of beef proteins and plasma proteins of farm animals are normal prion proteins in cattle. Aligning gene sequences of pathogenic and normal prion protein of sheep (Ovis aries revealed that the nucleotide sequences of PrPc and PrPsc are identical. Murine monoclonal antibody 15B3 was selected. Synthetic sequence of 194 bps was randomly produced (DNA-tail. The produced sequence and the database sequences have no homologues. Two primer of20 bps were selected for synthesized DNA-tail. The experimental data indicate that by using AGTCAGTCCTTGGCCTCCTT (left and CAGTTTCGATCCTCCTCCAG (right primers the amplification should be performed as follows: pre-denaturation, 95 °C, 60 seconds, 1 cycle; denaturation, 95 °C, 30 seconds, 30 cycles; annealing, 56 °C, 60 seconds, 30 cycles; elongation, 72 °C, 30 seconds, 30 cycles, additional elongation, 1 cycle, 600 seconds. The optimum concentration of reaction mixture components for PCR was established. High specificity of the developed test system and oligonucleotide primers was confirmed by electrophoretic separation of ground beef samples containing  pathogenic prion protein, as well as by comparative analysis of the results of pathogenic prion protein determination. These results were obtained using PCR test system and TeSeE™ ELISA system.

  19. Development of X-ray and ion diagnostic methods for plasma focus research

    International Nuclear Information System (INIS)

    Sadowski, M.

    1986-12-01

    A review of experimental methods used for investigation of X-rays and ion-beams emmited from plasma focus facilities is presented. The research program has been realized at the Institute for Nuclear Studies in Swierk and at the Institut fuer Plasmaforschung in Stuttgart, within the frames of an international co-operation. The studies on ion emission from different PF facilities are reviewed. The application of CN-films with Al-filters and of different ion-pinhole cameras is described. The use of a Thomson mass-spectrometer adopted for plasma studies is presented. The time-resolved measurements combined with a simultaneous mass- and energy-analysis of the ion beams are also described. The most important results of these studies are summarized. Particular attention is also paid to the studies of the X-ray emission. The use of stereoscopic sets of vacuum pinhole cameras with thin Be-filters is described. The application of X-ray pinhole cameras equipped with miniature scintillators for time-resolved measurements is also presented. The most important results of the X-ray emission studies are summarized. 35 refs., 12 figs. (author)

  20. MORECare research methods guidance development: recommendations for ethical issues in palliative and end-of-life care research

    NARCIS (Netherlands)

    Gysels, M.; Evans, C.J.; Lewis, P.; Speck, P.; Benalia, H.; Preston, N.J.; Grande, G.E.; Short, V.; Owen-Jones, E.; Todd, C.J.; Higginson, I.J.

    2013-01-01

    Background: There is little guidance on the particular ethical concerns that research raises with a palliative care population. Aim: To present the process and outcomes of a workshop and consensus exercise on agreed best practice to accommodate ethical issues in research on palliative care. Design:

  1. Development of a method of testing irradiation devices by gamma scanning inside a research nuclear reactor

    International Nuclear Information System (INIS)

    Michel, Francois.

    1975-01-01

    A tridimensional experiment of spectrometry of an irradiation device located inside the reactor Siloe at a place shielded against spurious radiations, is exposed. The automatic scanning system that was developed, makes it possible to fully analyze in about 24 hours, the irradiation device (fuel pin, coolant and structures). The process combined with a 'pre-processing' program allows first partial results to be simultaneously obtained, more refined results being achieved during the next week, using the 'heavy processing'. The irradiation of the device is only interrupted during the compelling duty shutdown of the reactor, the evolution of the device during the successive irradiation cycles being thus followed up without pertubing said evolution. The reproducibility was studied at a local stage for testing the collimation of the detection unit (1% accuracy) and for testing the whole set 'processing measurement and computation' (5% accuracy). The sensitivity has been illustrated by detecting and measuring local singularities inside fuel (pellets), determining the detection efficiency dependence on the radial distribution of fission products and measuring nucleides inside the coolant flow (limiting value 10 -7 ). The accuracy of the method is evaluated at 5% for relative measurement of an experimental device during its in-pile lifetime and as 10% for quantitative absolute measurements [fr

  2. Research methods in information

    CERN Document Server

    Pickard, Alison Jane

    2013-01-01

    The long-awaited 2nd edition of this best-selling research methods handbook is fully updated and includes brand new coverage of online research methods and techniques, mixed methodology and qualitative analysis. There is an entire chapter contributed by Professor Julie McLeod, Sue Childs and Elizabeth Lomas focusing on research data management, applying evidence from the recent JISC funded 'DATUM' project. The first to focus entirely on the needs of the information and communications community, it guides the would-be researcher through the variety of possibilities open to them under the heading "research" and provides students with the confidence to embark on their dissertations. The focus here is on the 'doing' and although the philosophy and theory of research is explored to provide context, this is essentially a practical exploration of the whole research process with each chapter fully supported by examples and exercises tried and tested over a whole teaching career. The book will take readers through eac...

  3. Methods in mummy research

    DEFF Research Database (Denmark)

    Lynnerup, Niels

    2009-01-01

    Mummies are human remains with preservation of non-bony tissue. Many mummy studies focus on the development and application of non-destructive methods for examining mummies, including radiography, CT-scanning with advanced 3-dimensional visualisations, and endoscopic techniques, as well as minima......Mummies are human remains with preservation of non-bony tissue. Many mummy studies focus on the development and application of non-destructive methods for examining mummies, including radiography, CT-scanning with advanced 3-dimensional visualisations, and endoscopic techniques, as well...... as minimally-destructive chemical, physical and biological methods for, e.g., stable isotopes, trace metals and DNA....

  4. Research Methods in Sociolinguistics

    Science.gov (United States)

    Hernández-Campoy, Juan Manuel

    2014-01-01

    The development of Sociolinguistics has been qualitatively and quantitatively outstanding within Linguistic Science since its beginning in the 1950s, with a steady growth in both theoretical and methodological developments as well as in its interdisciplinary directions within the spectrum of language and society. Field methods in sociolinguistic…

  5. Preparatory research to develop an operational method to calibrate airborne sensor data using a network of ground calibration sites

    International Nuclear Information System (INIS)

    Milton, E.J.; Smith, G.M.; Lawless, K.P.

    1996-01-01

    The objective of the research is to develop an operational method to convert airborne spectral radiance data to reflectance using a number of well-characterized ground calibration sites located around the UK. The study is in three phases. First, a pilot study has been conducted at a disused airfield in southern England to test the feasibility of the open-quote empirical line close-quote method of sensor calibration. The second phase is developing methods to predict temporal changes in the bidirectional reflectance of ground calibration sites. The final phase of the project will look at methods to extend such calibrations spatially. This paper presents some results from the first phase of this study. The viability of the empirical line method of correction is shown to depend upon the use of ground targets whose in-band reflectance encompasses that of the targets of interest in the spectral band(s) concerned. The experimental design for the second phase of the study, in which methods to predict temporal trends in the bidirectional reflectance of these sites will be developed, is discussed. Finally, it is planned to develop an automated method of searching through Landsat TM data for the UK to identify a number of candidate ground calibration sites for which the model can be tested. 11 refs., 5 figs., 5 tabs

  6. Ergonomics research methods

    Science.gov (United States)

    Uspenskiy, S. I.; Yermakova, S. V.; Chaynova, L. D.; Mitkin, A. A.; Gushcheva, T. M.; Strelkov, Y. K.; Tsvetkova, N. F.

    1973-01-01

    Various factors used in ergonomic research are given. They are: (1) anthrometric measurement, (2) polyeffector method of assessing the functional state of man, (3) galvanic skin reaction, (4) pneumography, (5) electromyography, (6) electrooculography, and (7) tachestoscopy. A brief summary is given of each factor and includes instrumentation and results.

  7. Developing appropriate methods and indicators for evaluation of research in the social sciences and humanities

    Energy Technology Data Exchange (ETDEWEB)

    Sivertsen, G.; Galleron, I.

    2016-07-01

    As STI ENID 2016 will focus on areas of research which are traditionally treated as ''peripheral'' in bibliometrics because they are inadequately covered or targeted by current international data sources and indicators, one of the major issues that comes to mind is that of SSH research evaluation. Based on a newly accepted COST Action, we propose to organize a roundtable devoted to the analysis of specific problems related to indicator use in SSH research evaluation, and of new, creative uses of metrics for this area. (Author)

  8. Evaluating public involvement in research design and grant development: Using a qualitative document analysis method to analyse an award scheme for researchers.

    Science.gov (United States)

    Baxter, Susan; Muir, Delia; Brereton, Louise; Allmark, Christine; Barber, Rosemary; Harris, Lydia; Hodges, Brian; Khan, Samaira; Baird, Wendy

    2016-01-01

    money was used, including a description of the aims and outcomes of the public involvement activities. The purpose of this study was to analyse the content of these reports. We aimed to find out what researcher views and experiences of public involvement activities were, and what lessons might be learned. Methods We used an innovative method of data analysis, drawing on group participatory approaches, qualitative content analysis, and Framework Analysis to sort and label the content of the reports. We developed a framework of categories and sub-categories (or themes and sub-themes) from this process. Results Twenty five documents were analysed. Four main themes were identified in the data: the added value of public involvement; planning and designing involvement; the role of public members; and valuing public member contributions. Within these themes, sub-themes related to the timing of involvement (prior to the research study/intended during the research study), and also specific benefits of public involvement such as: validating ideas; ensuring appropriate outcomes; ensuring the acceptability of data collection methods/tools and advice regarding research processes. Other sub-themes related to: finding and approaching public members; timing of events; training/support; the format of sessions; setting up public involvement panels: use of public contributors in analysis and interpretation of data; and using public members to assist with dissemination and translation into practice. Conclusions The analysis of reports submitted by researchers following involvement events provides evidence of the value of public involvement during the development of applications for research funding, and details a method for involving members of the public in data analysis which could be of value to other researchers The findings of the analysis indicate recognition amongst researchers of the variety in potential roles for public members in research, and also an acknowledgement of how

  9. Modeling Contextual Effects in Developmental Research: Linking Theory and Method in the Study of Social Development

    Science.gov (United States)

    Ojanen, Tiina; Little, Todd D.

    2010-01-01

    This special section was inspired by the recent increased interest and methodological advances in the assessment of context-specificity in child and adolescent social development. While the effects of groups, situations, and social relationships on cognitive, affective and behavioral development have long been acknowledged in theoretical…

  10. Development of a Self-Rated Mixed Methods Skills Assessment: The NIH Mixed Methods Research Training Program for the Health Sciences

    Science.gov (United States)

    Guetterman, Timothy C.; Creswell, John W.; Wittink, Marsha; Barg, Fran K.; Castro, Felipe G.; Dahlberg, Britt; Watkins, Daphne C.; Deutsch, Charles; Gallo, Joseph J.

    2017-01-01

    Introduction Demand for training in mixed methods is high, with little research on faculty development or assessment in mixed methods. We describe the development of a Self-Rated Mixed Methods Skills Assessment and provide validity evidence. The instrument taps six research domains: “Research question,” “Design/approach,” “Sampling,” “Data collection,” “Analysis,” and “Dissemination.” Respondents are asked to rate their ability to define or explain concepts of mixed methods under each domain, their ability to apply the concepts to problems, and the extent to which they need to improve. Methods We administered the questionnaire to 145 faculty and students using an internet survey. We analyzed descriptive statistics and performance characteristics of the questionnaire using Cronbach’s alpha to assess reliability and an ANOVA that compared a mixed methods experience index with assessment scores to assess criterion-relatedness. Results Internal consistency reliability was high for the total set of items (.95) and adequate (>=.71) for all but one subscale. Consistent with establishing criterion validity, respondents who had more professional experiences with mixed methods (e.g., published a mixed methods paper) rated themselves as more skilled, which was statistically significant across the research domains. Discussion This Self-Rated Mixed Methods Assessment instrument may be a useful tool to assess skills in mixed methods for training programs. It can be applied widely at the graduate and faculty level. For the learner, assessment may lead to enhanced motivation to learn and training focused on self-identified needs. For faculty, the assessment may improve curriculum and course content planning. PMID:28562495

  11. Development of a Self-Rated Mixed Methods Skills Assessment: The National Institutes of Health Mixed Methods Research Training Program for the Health Sciences.

    Science.gov (United States)

    Guetterman, Timothy C; Creswell, John W; Wittink, Marsha; Barg, Fran K; Castro, Felipe G; Dahlberg, Britt; Watkins, Daphne C; Deutsch, Charles; Gallo, Joseph J

    2017-01-01

    Demand for training in mixed methods is high, with little research on faculty development or assessment in mixed methods. We describe the development of a self-rated mixed methods skills assessment and provide validity evidence. The instrument taps six research domains: "Research question," "Design/approach," "Sampling," "Data collection," "Analysis," and "Dissemination." Respondents are asked to rate their ability to define or explain concepts of mixed methods under each domain, their ability to apply the concepts to problems, and the extent to which they need to improve. We administered the questionnaire to 145 faculty and students using an internet survey. We analyzed descriptive statistics and performance characteristics of the questionnaire using the Cronbach alpha to assess reliability and an analysis of variance that compared a mixed methods experience index with assessment scores to assess criterion relatedness. Internal consistency reliability was high for the total set of items (0.95) and adequate (≥0.71) for all but one subscale. Consistent with establishing criterion validity, respondents who had more professional experiences with mixed methods (eg, published a mixed methods article) rated themselves as more skilled, which was statistically significant across the research domains. This self-rated mixed methods assessment instrument may be a useful tool to assess skills in mixed methods for training programs. It can be applied widely at the graduate and faculty level. For the learner, assessment may lead to enhanced motivation to learn and training focused on self-identified needs. For faculty, the assessment may improve curriculum and course content planning.

  12. Research for developing precise tsunami evaluation methods. Probabilistic tsunami hazard analysis/numerical simulation method with dispersion and wave breaking

    International Nuclear Information System (INIS)

    2007-01-01

    The present report introduces main results of investigations on precise tsunami evaluation methods, which were carried out from the viewpoint of safety evaluation for nuclear power facilities and deliberated by the Tsunami Evaluation Subcommittee. A framework for the probabilistic tsunami hazard analysis (PTHA) based on logic tree is proposed and calculation on the Pacific side of northeastern Japan is performed as a case study. Tsunami motions with dispersion and wave breaking were investigated both experimentally and numerically. The numerical simulation method is verified for its practicability by applying to a historical tsunami. Tsunami force is also investigated and formulae of tsunami pressure acting on breakwaters and on building due to inundating tsunami are proposed. (author)

  13. The development of trend and pattern analysis methods for incident data by CEC'S joint research at Ispra

    International Nuclear Information System (INIS)

    Amesz, J.; Kalfsbeek, H.W.

    1990-01-01

    The Abnormal Occurrences Reporting System of the Commission of the European Communities was developed by the Joint Research Centre at Ispra in the period 1982 through 1985. It collects in a unique format all safety relevant events from NPPs as recorded in the participating countries. The system has been set-up with the specific objective of providing an advanced tool for a synoptic analysis of a large number of events, identifying patterns of sequences, trends, multiple dependencies between incident descriptors, precursors to severe incidents, performance indicators etc. This paper gives an overview of the development of trend and pattern analysis techniques of two different types: - event sequence analysis; - statistical methods. Though these methods have been developed and applied in relation with the AORS data, they can be regarded as generic in the sense that they may be applied to any incident reporting system satisfying the necessary criteria as to homogeneity and completeness, for rendering valid results

  14. Research development and teaching of numerical methods at the Atomic Centre of Bariloche, Argentina

    International Nuclear Information System (INIS)

    Pissanetzky, S.; Sarmiento, G.S.

    1981-01-01

    The areas of study of numerical methods, particularly the finite element method, are listed. These include numerical simulation of the thermo-mechanical behaviour of nuclear fuel elements and of the heat transfer in the industrial processing of sheaths for nuclear fuel cladding. Computer programs to support these studies are listed. Two examples of applications of these programs are given. The first is the modelling of high-vacuum annealing furnaces, particularly those used to manufacture zircaloy tubes for reactor sheaths. The second is the modelling of localized thermochemical problems in nuclear fuel elements and other nuclear reactor components. Details of where to obtain further information of work covered in this summary are given. (U.K.)

  15. Engaging Adolescents Through Participatory and Qualitative Research Methods to Develop a Digital Communication Intervention to Reduce Adolescent Obesity.

    Science.gov (United States)

    Livingood, William C; Monticalvo, David; Bernhardt, Jay M; Wells, Kelli T; Harris, Todd; Kee, Kadra; Hayes, Johnathan; George, Donald; Woodhouse, Lynn D

    2017-08-01

    The complexity of the childhood obesity epidemic requires the application of community-based participatory research (CBPR) in a manner that can transcend multiple communities of stakeholders, including youth, the broader community, and the community of health care providers. To (a) describe participatory processes for engaging youth within context of CBPR and broader community, (b) share youth-engaged research findings related to the use of digital communication and implications for adolescent obesity intervention research, and (c) describe and discuss lessons learned from participatory approaches. CBPR principles and qualitative methods were synergistically applied in a predominantly African American part of the city that experiences major obesity-related issues. A Youth Research Advisory Board was developed to deeply engage youth in research that was integrated with other community-based efforts, including an academic-community partnership, a city-wide obesity coalition, and a primary care practice research network. Volunteers from the youth board were trained to apply qualitative methods, including facilitating focus group interviews and analyzing and interpreting data with the goal of informing a primary care provider-based obesity reduction intervention. The primary results of these efforts were the development of critical insights about adolescent use of digital communication and the potential importance of messaging, mobile and computer apps, gaming, wearable technology, and rapid changes in youth communication and use of digital technology in developing adolescent nutrition and physical activity health promotion. The youth led work helped identify key elements for a digital communication intervention that was sensitive and responsive to urban youth. Many valuable lessons were also learned from 3 years of partnerships and collaborations, providing important insights on applying CBPR with minority youth populations.

  16. Original methods of quantitative analysis developed for diverse samples in various research fields. Quantitative analysis at NMCC

    International Nuclear Information System (INIS)

    Sera, Koichiro

    2003-01-01

    Nishina Memorial Cyclotron Center (NMCC) has been opened for nationwide-common utilization of positron nuclear medicine (PET) and PIXE since April 1993. At the present time, nearly 40 subjects of PIXE in various research fields are pursued here, and more than 50,000 samples have been analyzed up to the present. In order to perform quantitative analyses of diverse samples, technical developments in sample preparation, measurement and data analysis have been continuously carried out. Especially, a standard-free method for quantitative analysis'' made it possible to perform analysis of infinitesimal samples, powdered samples and untreated bio samples, which could not be well analyzed quantitatively in the past. The standard-free method'' and a ''powdered internal standard method'' made the process for target preparation quite easier. It has been confirmed that results obtained by these methods show satisfactory accuracy and reproducibility preventing any ambiguity coming from complicated target preparation processes. (author)

  17. Development and improvement of radioactive methods for tribiological researches on elements of tools, machines and devices

    International Nuclear Information System (INIS)

    Ivkovic, B.

    1979-02-01

    Charged particle activation analysis based on the bombardment with 15MeV protons from cyclotron was used to study the friction wearing at the zone of contacts in cutting tools, roller bearings and gear teeth. The radioactivity of resulting isotopes such as Co-56, Co-58, Re-183 serves as a measure of the mass changes on the surface tools. The method is suitable for studying the parameters effecting wearing processes and the role of cutting fluid, and also to envisage the economic factors in production planning

  18. Multi-scale computation methods: Their applications in lithium-ion battery research and development

    International Nuclear Information System (INIS)

    Shi Siqi; Zhao Yan; Wu Qu; Gao Jian; Liu Yue; Ju Wangwei; Ouyang Chuying; Xiao Ruijuan

    2016-01-01

    Based upon advances in theoretical algorithms, modeling and simulations, and computer technologies, the rational design of materials, cells, devices, and packs in the field of lithium-ion batteries is being realized incrementally and will at some point trigger a paradigm revolution by combining calculations and experiments linked by a big shared database, enabling accelerated development of the whole industrial chain. Theory and multi-scale modeling and simulation, as supplements to experimental efforts, can help greatly to close some of the current experimental and technological gaps, as well as predict path-independent properties and help to fundamentally understand path-independent performance in multiple spatial and temporal scales. (topical review)

  19. Directions of development of research methods in the assessment of leaching of heavy metals from mineral waste

    Directory of Open Access Journals (Sweden)

    Król Anna

    2016-01-01

    Full Text Available There are many test methods to assess the level of the release of heavy metals into the environment from mineral waste materials. Leaching methods can be different depending on the leaching time periods, leaching dynamics, sample preparation method or the pH of the elution medium. In Poland, little attention is paid to the research on the relationship between the leaching of particular heavy metals from mineral wastes and changes in environmental conditions, including the pH of the environment. Tests being carried out abroad have started to pay great attention to the pH-dependent impact of the environment and the liquid being in contact with the material on the degree of leaching contaminants from wastes. The solubility of all metals depends on the value of the pH. Authors of the paper will try to prove that Polish methods of waste characterization is incomplete and inconsistent with opinions prevailing in the global literature. The procedure described in the Polish standards are insufficient to determine the actual level of leaching of heavy metals having regard to the impact of multiple external conditions on the level of leaching of heavy metals. Paper will present a directions of development of research methods in the assessment of leaching of heavy metals from mineral waste.

  20. Development of the KBS-3 method. Survey of SKB's research programs and safety assessments, reviews by Government authorities and SKB's international research cooperation

    International Nuclear Information System (INIS)

    2010-11-01

    The purpose of this report is to outline the origin and development over the past 30 years (up to 2009) of the KBS-3 method proposed by the Swedish Nuclear Fuel and Waste Management Co (SKB) for final disposal of spent nuclear fuel. The KBS-3 method is based on three protective barriers. The spent nuclear fuel is encapsulated in impermeable copper canisters. The canisters are placed in crystalline basement rock at a depth of 400-700 metres, embedded in bentonite clay. After disposal the tunnels and rock caverns are sealed. The account does not claim to cover all parts of the extensive technical and scientific research and development work conducted by SKB in form of collecting data, refining methods and increasing process understanding. The report forms part of the background material which SKB has gathered as a basis for future applications regarding permits under the Environmental Code and the Nuclear Activities Act to build and operate facilities for encapsulation and final disposal of spent nuclear fuel. A prominent feature of the industrial development work on the final disposal of spent nuclear fuel has been an openness for a constant input of ideas and opinions from society and public bodies (the Government, national authorities, universities and other institutes of higher education, municipalities and various non-governmental organizations). The presentation sheds light on developments in a number of areas that are of central importance for safety in a KBS-3 repository. In SKB's RDandD Programme 2007, these areas go under the headings rock line, buffer line, canister line, backfilling line and closure line. Furthermore, attention has been given to issues related to the possible retrieval of deposited canisters, variants of KBS-3, deposition technology and safety assessment, as well as a number of interdisciplinary issues. The development of methods for the safety assessment has been an important part of the development of the KBS-3 method. The work with

  1. Methods of promotion of nuclear research and development in the Federal Republic of Germany and international cooperation

    International Nuclear Information System (INIS)

    Lehr, G.

    1987-01-01

    The promotion of nuclear research and development in the Federal Republic of Germany is part of the overall R and D policy and is geared to the long-term energy policy goals. Nuclear energy development has been successfully promoted for more than thirty years, the non-nuclear energy technologies for almost 15 years. As a result of this support for new technologies, energy production has become more efficient and cost-effective and with regard to fossil energy sources also markedly less detrimental to the environment. Nuclear energy research policy is an integral part of energy research policy as a whole, which particularly aims to increasingly promote renewable energy sources, above all photovoltaic and wind energy, the utilization of biomass and geothermal energy as well as the development of various energy storage methods. In addition to some mining projects which aim to reduce coal production costs, promotion in the field of fossil energy sources concentrates above all on power plant engineering and combustion techniques - i.e. environment-oriented technologies. In view of future supply patterns, projects on coal conversion are continued; with present supply and price structures for mineral oil and natural gas, however, commercialization of coal conversion cannot be expected to be launched on a large scale. (J.P.N.)

  2. Research and Development Program in Reactor Diagnostics and Monitoring with Neutron Noise Methods. Stages 14 and 15

    Energy Technology Data Exchange (ETDEWEB)

    Pazsit, Imre; Wihlstrand, Gustav; Tambouratzis, Tatiana; Jonsson, Anders; Dahl, Berit (Chalmers Univ. of Technology, Dept. of Nuclear Engineering, SE-412 96 Goeteborg (Sweden))

    2009-12-15

    This report constitutes Stages 14 and 15 of a long-term research and development program concerning the development of diagnostics and monitoring methods for nuclear reactors. Stage 14 was a full one-year project, whereas Stage 15 consisted of a half-year project. The program executed in Stages 14 and 15 consists of the following three parts: - Study of criticality, neutron kinetics and neutron noise in molten salt reactors (MSR) (Stages 14 and 15); - An overview and introduction to fuzzy logics (Stage 14), and an application to two-phase flow identification (Stage 15) - Preparations for and execution of an IAEA-ICTP workshop on Neutron fluctuations, reactor noise and their applications in nuclear reactors (Stage 14)

  3. Research and Development Program in Reactor Diagnostics and Monitoring with Neutron Noise Methods. Stages 14 and 15

    International Nuclear Information System (INIS)

    Pazsit, Imre; Wihlstrand, Gustav; Tambouratzis, Tatiana; Jonsson, Anders; Dahl, Berit

    2009-12-01

    This report constitutes Stages 14 and 15 of a long-term research and development program concerning the development of diagnostics and monitoring methods for nuclear reactors. Stage 14 was a full one-year project, whereas Stage 15 consisted of a half-year project. The program executed in Stages 14 and 15 consists of the following three parts: - Study of criticality, neutron kinetics and neutron noise in molten salt reactors (MSR) (Stages 14 and 15); - An overview and introduction to fuzzy logics (Stage 14), and an application to two-phase flow identification (Stage 15) - Preparations for and execution of an IAEA-ICTP workshop on Neutron fluctuations, reactor noise and their applications in nuclear reactors (Stage 14)

  4. The construction of airfoil pressure models by the plate method: Achievements, current research, technology development and potential applications

    Science.gov (United States)

    Lawing, P. L.

    1985-01-01

    A method of constructing airfoils by inscribing pressure channels on the face of opposing plates, bonding them together to form one plate with integral channels, and contour machining this plate to form an airfoil model is described. The research and development program to develop the bonding technology is described as well as the construction and testing of an airfoil model. Sample aerodynamic data sets are presented and discussed. Also, work currently under way to produce thin airfoils with camber is presented. Samples of the aft section of a 6 percent airfoil with complete pressure instrumentation including the trailing edge are pictured and described. This technique is particularly useful in fabricating models for transonic cryogenic testing, but it should find application in a wide ange of model construction projects, as well as the fabrication of fuel injectors, space hardware, and other applications requiring advanced bonding technology and intricate fluid passages.

  5. Mixed methods research in music therapy research.

    Science.gov (United States)

    Bradt, Joke; Burns, Debra S; Creswell, John W

    2013-01-01

    Music therapists have an ethical and professional responsibility to provide the highest quality care possible to their patients. Much of the time, high quality care is guided by evidence-based practice standards that integrate the most current, available research in making decisions. Accordingly, music therapists need research that integrates multiple ways of knowing and forms of evidence. Mixed methods research holds great promise for facilitating such integration. At this time, there have not been any methodological articles published on mixed methods research in music therapy. The purpose of this article is to introduce mixed methods research as an approach to address research questions relevant to music therapy practice. This article describes the core characteristics of mixed methods research, considers paradigmatic issues related to this research approach, articulates major challenges in conducting mixed methods research, illustrates four basic designs, and provides criteria for evaluating the quality of mixed methods articles using examples of mixed methods research from the music therapy literature. Mixed methods research offers unique opportunities for strengthening the evidence base in music therapy. Recommendations are provided to ensure rigorous implementation of this research approach.

  6. Mixed methods research for TESOL

    CERN Document Server

    Brown, James; Farr, Fiona

    2014-01-01

    Defining and discussing the relevance of theoretical and practical issues involved in mixed methods research. Covering the basics of research methodology, this textbook shows you how to choose and combine quantitative and qualitative research methods to b

  7. Social Phenomenological Analysis as a Research Method in Art Education: Developing an Empirical Model for Understanding Gallery Talks

    Science.gov (United States)

    Hofmann, Fabian

    2016-01-01

    Social phenomenological analysis is presented as a research method to study gallery talks or guided tours in art museums. The research method is based on the philosophical considerations of Edmund Husserl and sociological/social science concepts put forward by Max Weber and Alfred Schuetz. Its starting point is the everyday lifeworld; the…

  8. Mixed methods for telehealth research.

    Science.gov (United States)

    Caffery, Liam J; Martin-Khan, Melinda; Wade, Victoria

    2017-10-01

    Mixed methods research is important to health services research because the integrated qualitative and quantitative investigation can give a more comprehensive understanding of complex interventions such as telehealth than can a single-method study. Further, mixed methods research is applicable to translational research and program evaluation. Study designs relevant to telehealth research are described and supported by examples. Quality assessment tools, frameworks to assist in the reporting and review of mixed methods research, and related methodologies are also discussed.

  9. Transformative Mixed Methods Research

    Science.gov (United States)

    Mertens, Donna M.

    2010-01-01

    Paradigms serve as metaphysical frameworks that guide researchers in the identification and clarification of their beliefs with regard to ethics, reality, knowledge, and methodology. The transformative paradigm is explained and illustrated as a framework for researchers who place a priority on social justice and the furtherance of human rights.…

  10. Development of groundwater treatment methods using radiation-induced graft polymerization adsorbent at the Mizunami Underground Research Laboratory. Annual report for 2008 fiscal year (Joint research)

    International Nuclear Information System (INIS)

    Iyatomi, Yosuke; Shimada, Akiomi; Ogata, Nobuhisa; Sugihara, Kozo; Hoshina, Hiroyuki; Seko, Noriaki; Kasai, Noboru; Ueki, Yuji; Tamada, Masao

    2011-02-01

    The concentrations of fluorine (7.2-10mg/L) and boron (0.8-1.5mg/L) dissolved in groundwater pumped from the shafts during excavation of the Mizunami Underground Research Laboratory (MIU), Tono Geoscience Center, shall be reduced to levels below the environmental standards for fluorine: 0.8mg/L and boron: 1mg/L. Coagulation and ion exchange methods are being applied for fluorine and boron, respectively, at the operating water treatment facility at the MIU. As well, collaborative research on groundwater treatment started in 2006 between the Environmental and Industrial Materials Research Division, Quantum Beam Science Directorate and the Tono Geoscientific Research Unit, Geological Isolation Research and Development Directorate on a novel method to remove the fluorine and boron. The Quantum Beam Directorate has synthesized fibrous adsorbents with radiation-induced graft polymerization and applied the adsorbents to collect rare metals dissolved in hot springs and sea water. The results of previous testing indicated that the adsorbent was able to remove more than 95% of the boron and fluorine and that performance of adsorbent for boron removal was better than the performance using ion-exchange resin. It was also apparent that the pH of groundwater had an influence on the performance of the adsorbent with respect to boron removal. Therefore we reran the recycling tests using groundwater from the neutralization tank at the groundwater treatment facility were repeated. The results indicated that the performance of the adsorbent using neutral groundwater for boron removal was higher than using uncontrolled groundwater. However the bed volume (BV) with recycled adsorbent decreased compared to first use. It is thought that sulfur added at the groundwater treatment facility was retained by the adsorbent despite elution, and affected the performance such that repeat usage resulted in decreased efficiency. In addition, it is considered that the goals established in the first

  11. The Strategic Fitness Process: A Collaborative Action Research Method for Developing and Understanding Organizational Prototypes and Dynamic Capabilities

    Directory of Open Access Journals (Sweden)

    Michael Beer

    2013-04-01

    Full Text Available Organizations underperform and sometimes fail because their leaders are unable to learn the unvarnished truth from relevant stakeholders about how the design and behavior of the organization is misaligned with its goals and strategy. The Strategic Fitness Process (SFP was designed to enable leaders to overcome organizational silence about the misalignment with the environment and chosen strategy. By enabling an honest, organization-wide and public conversation, senior management teams, working collaboratively with scholar-consultants and organizational members, have access to valid data (the unvarnished truth, can conduct a valid diagnosis, and can develop a valid plan to change the structure, processes, and behavior of an organization while at the same time developing commitment that ensures execution. SFP is also a research method. By applying SFP iteratively to new and challenging situations, scholar-consultants can invent new organizational prototypes as well as learn if a standardized and institutionalized organizational learning process like SFP can enhance dynamic capabilities. The SFP model is illustrated with an application to Hewlett-Packard’s Santa Rosa Systems Division.

  12. Diabetes Knowledge Translation Status in Developing Countries: A Mixed Method Study Among Diabetes Researchers in Case of Iran.

    Science.gov (United States)

    Valinejadi, Ali; Sadoughi, Farahnaz; Salehi, Masoud

    2016-01-01

    Despite considerable investment in research, the existing research evidence is frequently not implemented and/or leads to useless or detrimental care in healthcare. The knowledge-practice gap proposed as one of the main causes of not achieving the treatment goals in diabetes. Iran also is facing a difference between the production and utilization of the knowledge of diabetes. The aim of this study was to assess the status of diabetes knowledge translation (KT) in Iran. This was a survey that executed in 2015 by concurrent mixed methods approach in a descriptive, cross-sectional method. The research population was 65 diabetes researchers from 14 diabetes research centers throughout Iran. The research was carried out via the self-assessment tool for research institutes (SATORI), a valid and reliable tool. Focus group discussions were used to complete this tool. The data were analyzed using quantitative (descriptive method by Excel software) and qualitative approaches (thematic analysis) based on SATORI-extracted seven themes. The mean of scores "the question of research," "knowledge production," "knowledge transfer," "promoting the use of evidence," and all aspects altogether were 2.48, 2.80, 2.18, 2.06, and 2.39, respectively. The themes "research quality and timeliness" and "promoting and evaluating the use of evidence" received the lowest (1.91) and highest mean scores (2.94), respectively. Except for the theme "interaction with research users" with a relatively mediocre scores (2.63), the other areas had scores below the mean. The overall status of diabetes KT in Iran was lower than the ideal situation. There are many challenges that require great interventions at the organizational or macro level. To reinforce diabetes KT in Iran, it should hold a more leading and centralized function in the strategies of the country's diabetes research system.

  13. LIDAR Research & Development Lab

    Data.gov (United States)

    Federal Laboratory Consortium — The LIDAR Research and Development labs are used to investigate and improve LIDAR components such as laser sources, optical signal detectors and optical filters. The...

  14. Photovoltaic research and development

    CSIR Research Space (South Africa)

    Cummings, F

    2009-09-01

    Full Text Available Photovoltaic (PV) is the direct conversion of sunlight into electrical energy through a solar cell. This presentation consists of an introduction to photovoltaics, the South African PV research roadmap, a look at the CSIR PV research and development...

  15. Diabetes knowledge translation status in developing countries: A mixed method study among diabetes researchers in case of Iran

    OpenAIRE

    Ali Valinejadi; Farahnaz Sadoughi; Masoud Salehi

    2016-01-01

    Background: Despite considerable investment in research, the existing research evidence is frequently not implemented and/or leads to useless or detrimental care in healthcare. The knowledge-practice gap proposed as one of the main causes of not achieving the treatment goals in diabetes. Iran also is facing a difference between the production and utilization of the knowledge of diabetes. The aim of this study was to assess the status of diabetes knowledge translation (KT) in Iran. Methods...

  16. Research and development program in reactor diagnostics and monitoring with neutron noise methods. Stage 7. Final report

    International Nuclear Information System (INIS)

    Pazsit, I.; Demaziere, C.; Arzhanov, V.

    2001-08-01

    This report constitutes stage 7 of a long-term research and development program concerning the development of diagnostics and monitoring methods for nuclear reactors. A proposal for the continuation of this program in stage 8 is also given at the end of the report. In stage 6, the basic principles of a 3-D fully coupled neutronic/thermal-hydraulic simulator in the frequency domain were presented. The neutronic model relied on the two-group diffusion approximation, whereas the thermal-hydraulic algorithms relied on the so called 'lumped' model. The key element of this simulator was that only the static data were required which could be obtained from the Studsvik Scandpower CASMO-4/TABLES-3/ SIMULATE-3 code package. The simulator was developed with this underlying idea, which means that the calculation of the static fluxes and the eigenvalue were avoided. Depending on what kind of spatial discretization scheme which is used in the noise simulator to calculate the 'leakage' noise, it is not granted that the system remains critical by using the group constants supplied by SIMULATE. Nevertheless, when the system is critical, the balance equations should be fulfilled in all nodes with respect to the discretization scheme used. In concrete terms, the calculation of the static fluxes and eigenvalue can be avoided if the system is brought back to criticality by modifying the cross-sections so that the balance equations are always fulfilled with the chosen spatial discretization scheme. This approach was used in this study with the finite difference scheme. As pointed out in stage 6, the finite difference scheme is relatively inefficient compared to finite elements or nodal methods, but on the other hand it is rather easy to implement. These two more sophisticated schemes are planned to be investigated at a later stage, but for the time being the simulator relying on the finite difference scheme was improved as much as possible so that a 2-D entirely neutronic model could be

  17. RD and D-Programme 2004. Programme for research, development and demonstration of methods for the management and disposal of nuclear waste, including social science research

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2004-09-01

    SKB (the Swedish Nuclear Fuel and Waste Management Co), which is owned by the companies that operate the Swedish nuclear power plants, has been assigned the task of managing and disposing of the spent nuclear fuel from the reactors. The Nuclear Activities Act requires a programme of comprehensive research and development and other measures that are needed to manage and dispose of nuclear waste in a safe manner and to decommission and dismantle the nuclear power plants. SKB is now presenting RD and D-Programme 2004 in fulfilment of this requirement. The programme describes SKB's plans for the period 2005-2010. The period of immediate concern is 2005-2007. The level of detail for the three subsequent years is naturally lower.The programme provides a basis for designing systems for safe management and disposal of the radioactive waste from the nuclear power plants. SKB's plan is to implement deep disposal of the spent fuel in accordance with the KBS-3 method. In the RD and D-Programme we describe our activities and planning for this line of action and the work that is being conducted on alternative methods. Review of the programme can contribute valuable outside viewpoints. The regulatory authorities and the Government can clarify how they look upon different parts of the programme and stipulate guidelines for the future. Municipalities and other stakeholders can, after studying the programme, offer their viewpoints to SKB, the regulatory authorities or the Government.The goal for the period up to the end of 2008 is to be able to submit permit applications for the encapsulation plant and the deep repository. This RD and D-Programme therefore differs from the preceding ones in that it concentrates on questions relating to technology development for these facilities. The programmes for safety assessment and research on the long-term processes that take place in the deep repository are then linked together with the programmes for technology development. Another new

  18. RD and D-Programme 2004. Programme for research, development and demonstration of methods for the management and disposal of nuclear waste, including social science research

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2004-09-01

    SKB (the Swedish Nuclear Fuel and Waste Management Co), which is owned by the companies that operate the Swedish nuclear power plants, has been assigned the task of managing and disposing of the spent nuclear fuel from the reactors. The Nuclear Activities Act requires a programme of comprehensive research and development and other measures that are needed to manage and dispose of nuclear waste in a safe manner and to decommission and dismantle the nuclear power plants. SKB is now presenting RD and D-Programme 2004 in fulfilment of this requirement. The programme describes SKB's plans for the period 2005-2010. The period of immediate concern is 2005-2007. The level of detail for the three subsequent years is naturally lower.The programme provides a basis for designing systems for safe management and disposal of the radioactive waste from the nuclear power plants. SKB's plan is to implement deep disposal of the spent fuel in accordance with the KBS-3 method. In the RD and D-Programme we describe our activities and planning for this line of action and the work that is being conducted on alternative methods. Review of the programme can contribute valuable outside viewpoints. The regulatory authorities and the Government can clarify how they look upon different parts of the programme and stipulate guidelines for the future. Municipalities and other stakeholders can, after studying the programme, offer their viewpoints to SKB, the regulatory authorities or the Government.The goal for the period up to the end of 2008 is to be able to submit permit applications for the encapsulation plant and the deep repository. This RD and D-Programme therefore differs from the preceding ones in that it concentrates on questions relating to technology development for these facilities. The programmes for safety assessment and research on the long-term processes that take place in the deep repository are then linked together with the programmes for technology development. Another

  19. RD and D-Programme 2004. Programme for research, development and demonstration of methods for the management and disposal of nuclear waste, including social science research

    International Nuclear Information System (INIS)

    2004-09-01

    SKB (the Swedish Nuclear Fuel and Waste Management Co), which is owned by the companies that operate the Swedish nuclear power plants, has been assigned the task of managing and disposing of the spent nuclear fuel from the reactors. The Nuclear Activities Act requires a programme of comprehensive research and development and other measures that are needed to manage and dispose of nuclear waste in a safe manner and to decommission and dismantle the nuclear power plants. SKB is now presenting RD and D-Programme 2004 in fulfilment of this requirement. The programme describes SKB's plans for the period 2005-2010. The period of immediate concern is 2005-2007. The level of detail for the three subsequent years is naturally lower.The programme provides a basis for designing systems for safe management and disposal of the radioactive waste from the nuclear power plants. SKB's plan is to implement deep disposal of the spent fuel in accordance with the KBS-3 method. In the RD and D-Programme we describe our activities and planning for this line of action and the work that is being conducted on alternative methods. Review of the programme can contribute valuable outside viewpoints. The regulatory authorities and the Government can clarify how they look upon different parts of the programme and stipulate guidelines for the future. Municipalities and other stakeholders can, after studying the programme, offer their viewpoints to SKB, the regulatory authorities or the Government.The goal for the period up to the end of 2008 is to be able to submit permit applications for the encapsulation plant and the deep repository. This RD and D-Programme therefore differs from the preceding ones in that it concentrates on questions relating to technology development for these facilities. The programmes for safety assessment and research on the long-term processes that take place in the deep repository are then linked together with the programmes for technology development. Another new

  20. Space biology research development

    Science.gov (United States)

    Bonting, Sjoerd L.

    1993-01-01

    The purpose of the Search for Extraterrestrial Intelligence (SETI) Institute is to conduct and promote research related activities regarding the search for extraterrestrial life, particularly intelligent life. Such research encompasses the broad discipline of 'Life in the Universe', including all scientific and technological aspects of astronomy and the planetary sciences, chemical evolution, the origin of life, biological evolution, and cultural evolution. The primary purpose was to provide funding for the Principal Investigator to collaborate with the personnel of the SETI Institute and the NASA-Ames Research center in order to plan and develop space biology research on and in connection with Space Station Freedom; to promote cooperation with the international partners in the space station; to conduct a study on the use of biosensors in space biology research and life support system operation; and to promote space biology research through the initiation of an annual publication 'Advances in Space Biology and Medicine'.

  1. Consumer research in the early stages of new product development: A critical review of methods and techniques

    NARCIS (Netherlands)

    Kleef, van E.; Trijp, van J.C.M.; Luning, P.A.

    2005-01-01

    Incorporating the `voice of the consumer' in early stages of the new product development process has been identified as a critical success factor for new product development. Yet, this step is often ignored or poorly executed. This may be due to lack of familiarity on which methods are available,

  2. Research and Development Program in Reactor Diagnostics and Monitoring with Neutron Noise Methods. Stage 11 and 12. Final report

    International Nuclear Information System (INIS)

    Sunde, C.; Pazsit, I.; Demaziere, C.; Dahl, O.; Mileshina, L.

    2006-06-01

    This report describes the results obtained during Stage 11 and 12 of a long-term research and development program concerning the development of diagnostics and monitoring methods for nuclear reactors. The long-term goals are elaborated in more detail in e.g. the Final Reports of stage 1 and 2 (SKI Report 95:14 and 96:50). Higher order eigenfunctions and eigenvalues of the diffusion equation, describing a static core, have lost their significance when doing calculations in realistic systems, since there are usually made by nodal methods or other direct numerical techniques. However, there are situations when knowledge of the higher order modes is still useful. Such case is the separation of the global and regional flux oscillations in the case of BWR instability. Another case is the investigation of the stability properties of large inhomogeneous cores, which is usually quantified with the so-called eigenvalue separation, ES=1/k 1 - 1/k 0 where k 0 and k 1 , are the fundamental and first higher order eigenvalues, respectively. Numerical codes used for ICMF calculations usually do not have the option of calculating the higher order eigenvalues and eigenfunctions. In idealised systems, these can be calculated with semi-analytical methods. In order to get insight into the characteristics of the higher order eigenmodes of the neutron flux and the adjoint, these were calculated in a reflected homogeneous system with two-group theory. The adjoint eigenmodes are necessary if an orthogonality property needs to be used, such as the separation of the modes from a flux shape which is a sum of several eigenmodes. At the same time, the so-called numerical noise simulator, developed at the Dept., was extended such that it became suitable for the calculation of the higher order eigenmodes, both direct and adjoint ones. This simulator can treat real inhomogeneous cores, with an input deck compatible with that of SIMULATE. The simulator was used to calculate the eigenfunctions and

  3. Research and Development Program in Reactor Diagnostics and Monitoring with Neutron Noise Methods. Stage 11 and 12. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Sunde, C.; Pazsit, I.; Demaziere, C.; Dahl, O.; Mileshina, L. [Chalmers Univ. of Technology, Goeteborg (Sweden). Dept. of Nuclear Engineering

    2006-06-15

    This report describes the results obtained during Stage 11 and 12 of a long-term research and development program concerning the development of diagnostics and monitoring methods for nuclear reactors. The long-term goals are elaborated in more detail in e.g. the Final Reports of stage 1 and 2 (SKI Report 95:14 and 96:50). Higher order eigenfunctions and eigenvalues of the diffusion equation, describing a static core, have lost their significance when doing calculations in realistic systems, since there are usually made by nodal methods or other direct numerical techniques. However, there are situations when knowledge of the higher order modes is still useful. Such case is the separation of the global and regional flux oscillations in the case of BWR instability. Another case is the investigation of the stability properties of large inhomogeneous cores, which is usually quantified with the so-called eigenvalue separation, ES=1/k{sub 1} - 1/k{sub 0} where k{sub 0} and k{sub 1}, are the fundamental and first higher order eigenvalues, respectively. Numerical codes used for ICMF calculations usually do not have the option of calculating the higher order eigenvalues and eigenfunctions. In idealised systems, these can be calculated with semi-analytical methods. In order to get insight into the characteristics of the higher order eigenmodes of the neutron flux and the adjoint, these were calculated in a reflected homogeneous system with two-group theory. The adjoint eigenmodes are necessary if an orthogonality property needs to be used, such as the separation of the modes from a flux shape which is a sum of several eigenmodes. At the same time, the so-called numerical noise simulator, developed at the Dept., was extended such that it became suitable for the calculation of the higher order eigenmodes, both direct and adjoint ones. This simulator can treat real inhomogeneous cores, with an input deck compatible with that of SIMULATE. The simulator was used to calculate the

  4. Biological Methods and Manual Development

    Science.gov (United States)

    EPA scientists conduct research to develop and evaluate analytical methods for the identification, enumeration, evaluation of aquatic organisms exposed to environmental stressors and to correlate exposures with effects on chemical and biological indicators

  5. Regression methods for medical research

    CERN Document Server

    Tai, Bee Choo

    2013-01-01

    Regression Methods for Medical Research provides medical researchers with the skills they need to critically read and interpret research using more advanced statistical methods. The statistical requirements of interpreting and publishing in medical journals, together with rapid changes in science and technology, increasingly demands an understanding of more complex and sophisticated analytic procedures.The text explains the application of statistical models to a wide variety of practical medical investigative studies and clinical trials. Regression methods are used to appropriately answer the

  6. Tourism research and audio methods

    DEFF Research Database (Denmark)

    Jensen, Martin Trandberg

    2016-01-01

    • Audio methods enriches sensuous tourism ethnographies. • The note suggests five research avenues for future auditory scholarship. • Sensuous tourism research has neglected the role of sounds in embodied tourism experiences.......• Audio methods enriches sensuous tourism ethnographies. • The note suggests five research avenues for future auditory scholarship. • Sensuous tourism research has neglected the role of sounds in embodied tourism experiences....

  7. Nuclear safeguards research and development

    Science.gov (United States)

    Henry, C. N.

    1981-11-01

    The status of a nuclear safeguard research and development program is presented. Topics include nondestructive assay technology development and applications, international safeguards, training courses, technology transfer, analytical chemistry methods for fissionable materials safeguards, the Department of Energy Computer Security Technical Center, and operational security.

  8. Research and development program in reactor diagnostics and monitoring with neutron noise methods. Stage 7. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Pazsit, I.; Demaziere, C.; Arzhanov, V. [Chalmers Univ. of Technology, Goeteborg (Sweden). Department of Reactor Physics; Garis, N.S. [Swedish Nuclear Power Inspectorate, Stockholm (Sweden)

    2001-08-01

    This report constitutes stage 7 of a long-term research and development program concerning the development of diagnostics and monitoring methods for nuclear reactors. A proposal for the continuation of this program in stage 8 is also given at the end of the report. In stage 6, the basic principles of a 3-D fully coupled neutronic/thermal-hydraulic simulator in the frequency domain were presented. The neutronic model relied on the two-group diffusion approximation, whereas the thermal-hydraulic algorithms relied on the so called 'lumped' model. The key element of this simulator was that only the static data were required which could be obtained from the Studsvik Scandpower CASMO-4/TABLES-3/ SIMULATE-3 code package. The simulator was developed with this underlying idea, which means that the calculation of the static fluxes and the eigenvalue were avoided. Depending on what kind of spatial discretization scheme which is used in the noise simulator to calculate the 'leakage' noise, it is not granted that the system remains critical by using the group constants supplied by SIMULATE. Nevertheless, when the system is critical, the balance equations should be fulfilled in all nodes with respect to the discretization scheme used. In concrete terms, the calculation of the static fluxes and eigenvalue can be avoided if the system is brought back to criticality by modifying the cross-sections so that the balance equations are always fulfilled with the chosen spatial discretization scheme. This approach was used in this study with the finite difference scheme. As pointed out in stage 6, the finite difference scheme is relatively inefficient compared to finite elements or nodal methods, but on the other hand it is rather easy to implement. These two more sophisticated schemes are planned to be investigated at a later stage, but for the time being the simulator relying on the finite difference scheme was improved as much as possible so that a 2-D entirely

  9. Research and Development Program in Reactor Diagnostics and Monitoring with Neutron Noise Methods. Stage 10. Final Report

    International Nuclear Information System (INIS)

    Demaziere, C.; Pazsit, I.; Sunde, S.; Wright, J.

    2004-12-01

    This report constitutes Stage 10 of a long-term research and development program concerning the development of diagnostics and monitoring methods for nuclear reactors. The program executed in Stage 10 consists of three parts and the work performed in each part is summarized below. A so-called 2-D 2-group neutron noise simulator was previously developed at the Department of Reactor Physics. This simulator is able to calculate the space-dependence of the neutron noise induced by localised or spatially-distributed absorbers of variable strength or by vibrating absorbers. These calculations are performed in the 2-group diffusion approximation and can treat an arbitrary heterogeneous 2-D system. The goal of the present investigation is to use the simulator for unfolding purposes, i.e. to reconstruct the noise source from the detector readings. This task is particularly challenging since the number of detectors available in a commercial PWR can be very low. In this study, five detectors are assumed to be present and evenly distributed in the core. Furthermore, only localised absorbers of variable strength are considered as perturbations. Numerical simulations were first carried out to verify that the space-dependent local and global components of the neutron noise were overwhelmingly large compared to the point-kinetic term of the neutron noise whose spatial structure does not depend on the position of the perturbation. The significance of the space-dependent global component is that its relaxation length is large enough, so that several neutron detectors can monitor it. Therefore, the neutron noise induced at the position of the detectors is itself a function of the position of the perturbation. Unfolding procedures could thus be considered. Prior to performing any unfolding, the type of the noise source has to be determined, since the algorithms developed in this report are based on the assumption of an absorber of variable strength. Such a noise source can also be

  10. Participatory Methods in Arctic Research

    DEFF Research Database (Denmark)

    Faber, Louise

    2018-01-01

    collection, analysis and conclusions and / or knowledge dissemination. The book aims to collect and share experiences from researchers active in engaging research in the Arctic. The articles reflect on the inclusive methods used in the Arctic research, on the cause and purpose thereof, while the methods......This book is a collection of articles written by researchers at Aalborg University, affiliated with AAU Arctic. The articles are about how the researchers in their respective projects work with stakeholders and citizens in different ways, for example in connection with problem formulation, data...... are exemplified to serve as inspiration for other researchers....

  11. Survey of an evaluation method for research and development projects; Kenkyu kaihatsu project no hyoka shuho ni kansuru chosa

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1997-03-01

    This report describes an interim evaluation method and a concrete evaluation method for projects promoted by the Agency of Industrial Science and Technology, and NEDO. As a result of the survey, a method of highly practical interim evaluation, concrete evaluation items, and evaluation criteria have been proposed by assuming that the projects are evaluated by the project evaluation department independent of the project promotion department. Long-term issues for constructing the evaluation system are also described. It is the most essential for the evaluation to fulfill the function of effective promotion of the following projects. It is also indispensable for the evaluation method and issues proposed in this report to communicate closely to project promoters and researchers, and to reassess the projects continuously. Continuous consideration for the feedback of evaluation process and the improvement of evaluation are significant for the long-term construction of system. 21 refs., 9 figs., 23 tabs.

  12. MATHEMATICAL METHODS AND TOOLS OF TRENDS’ RESEARCH IN THE EVOLUTIONARY DEVELOPMENT OF THE NATURAL AND ECONOMIC PROCESSES

    OpenAIRE

    Kymratova A. M.

    2015-01-01

    The present study was carried out in the view of the fact that there is no more or less complete theory of time series prediction memory to date. This determines the urgency and necessity of the development of new mathematical methods and algorithms to detect possible potential predictability of the series with the memory and the construction of adequate predictive models. Classical methods of forecasting economic time series are based on the mathematical apparatus of econometrics. It is carr...

  13. Development of quantitative structure activity relationship (QSAR) model for disinfection byproduct (DBP) research: A review of methods and resources

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Baiyang, E-mail: poplar_chen@hotmail.com [Harbin Institute of Technology Shenzhen Graduate School, Shenzhen Key Laboratory of Water Resource Utilization and Environmental Pollution Control, Shenzhen 518055 (China); Zhang, Tian [Harbin Institute of Technology Shenzhen Graduate School, Shenzhen Key Laboratory of Water Resource Utilization and Environmental Pollution Control, Shenzhen 518055 (China); Bond, Tom [Department of Civil and Environmental Engineering, Imperial College, London SW7 2AZ (United Kingdom); Gan, Yiqun [Harbin Institute of Technology Shenzhen Graduate School, Shenzhen Key Laboratory of Water Resource Utilization and Environmental Pollution Control, Shenzhen 518055 (China)

    2015-12-15

    Quantitative structure–activity relationship (QSAR) models are tools for linking chemical activities with molecular structures and compositions. Due to the concern about the proliferating number of disinfection byproducts (DBPs) in water and the associated financial and technical burden, researchers have recently begun to develop QSAR models to investigate the toxicity, formation, property, and removal of DBPs. However, there are no standard procedures or best practices regarding how to develop QSAR models, which potentially limit their wide acceptance. In order to facilitate more frequent use of QSAR models in future DBP research, this article reviews the processes required for QSAR model development, summarizes recent trends in QSAR-DBP studies, and shares some important resources for QSAR development (e.g., free databases and QSAR programs). The paper follows the four steps of QSAR model development, i.e., data collection, descriptor filtration, algorithm selection, and model validation; and finishes by highlighting several research needs. Because QSAR models may have an important role in progressing our understanding of DBP issues, it is hoped that this paper will encourage their future use for this application.

  14. Development of quantitative structure activity relationship (QSAR) model for disinfection byproduct (DBP) research: A review of methods and resources

    International Nuclear Information System (INIS)

    Chen, Baiyang; Zhang, Tian; Bond, Tom; Gan, Yiqun

    2015-01-01

    Quantitative structure–activity relationship (QSAR) models are tools for linking chemical activities with molecular structures and compositions. Due to the concern about the proliferating number of disinfection byproducts (DBPs) in water and the associated financial and technical burden, researchers have recently begun to develop QSAR models to investigate the toxicity, formation, property, and removal of DBPs. However, there are no standard procedures or best practices regarding how to develop QSAR models, which potentially limit their wide acceptance. In order to facilitate more frequent use of QSAR models in future DBP research, this article reviews the processes required for QSAR model development, summarizes recent trends in QSAR-DBP studies, and shares some important resources for QSAR development (e.g., free databases and QSAR programs). The paper follows the four steps of QSAR model development, i.e., data collection, descriptor filtration, algorithm selection, and model validation; and finishes by highlighting several research needs. Because QSAR models may have an important role in progressing our understanding of DBP issues, it is hoped that this paper will encourage their future use for this application.

  15. Development of a health education intervention strategy using an implementation research method to control taeniasis and cysticercosis in Burkina Faso.

    Science.gov (United States)

    Ngowi, Helena; Ozbolt, Ivan; Millogo, Athanase; Dermauw, Veronique; Somé, Télesphore; Spicer, Paul; Jervis, Lori L; Ganaba, Rasmané; Gabriel, Sarah; Dorny, Pierre; Carabin, Hélène

    2017-06-01

    Taeniasis and cysticercosis are two diseases caused by Taenia solium, a parasite transmitted between humans and pigs, leading to considerable economic loss and disabilities. Transmission of the parasite is linked to environmental and behavioural factors such as inadequate sanitation and hygiene, poor pig management, and consumption of infected pork. This study used implementation research method to design a health education intervention strategy for reducing T. solium infections in Burkina Faso, a country endemic for the parasite. Eighteen group discussions were conducted with 8-18 participants each in three villages. In addition, structured interviews were conducted among 4 777 participants and 2 244 pig owners, who were selected through cluster random sampling in 60 villages of three provinces of Burkina Faso. Both approaches assessed knowledge and practices related to T. solium. The information obtained was used to develop a community-adapted health education intervention strategy to control taeniasis and cysticercosis in Burkina Faso. The group discussions revealed that participants had a poor quality of life due to the diseases as well as inadequate access to latrines, safe water, and healthcare services. In addition, it was found that pig production was an important economic activity, especially for women. Furthermore, financial and knowledge constraints were important limitations to improved pig management and latrine construction. The survey data also showed that open defecation and drinking unboiled water were common behaviours, enhanced by a lack of knowledge regarding the transmission of the parasite, perceived financial barriers to the implementation of control measures, lack of public sensitization, as well as a lack of self-efficacy towards control of the parasite. Nevertheless, the perceived financial benefits of controlling porcine cysticercosis could be emphasized by an education program that discourages open defecation and encourages drinking safe

  16. Research and development

    Energy Technology Data Exchange (ETDEWEB)

    Harlow, Jr, J G

    1977-09-01

    The need for increased research and development programs to provide technological advances to meet future energy demands, particularly electric power demands, is discussed. It is concluded that the future energy needs of the world can only be supplied through technological improvements. The cost of these technological improvements can be minimized by cooperative, unified research and development programs. The financial support of the energy industry, the equipment manufacturing industry and the consumer will be required to finance these vital developments. The energy problems of the world can be solved by an adequately financed unified R and D effort. The U.S. must assume a major role of leadership in this world-wide effort. (LCL)

  17. Experimental Methods in Media Research

    NARCIS (Netherlands)

    C.W. Handke (Christian); C. Herzog (Christian)

    2017-01-01

    textabstractCausal effects are a prime concern in media policy research, and experimental research designs are widely regarded as the most effective way to identify and gauge causality. Nevertheless, explicit applications of experimental methods are rare in media policy research. This chapter

  18. Research and development of CRIEPI

    International Nuclear Information System (INIS)

    Akita, Shirabe

    2008-01-01

    Central Research Institute of Electric Power Industry (CRIEPI) reported its R and D of nuclear power technologies. The research results of light water reactor aging deterioration contain the estimation method of irradiation embrittlement of pressure vessel, stress corrosion cracking of piping and core internal structure, and pipe thinning. The backend project support researches include transpiration and storage of recycle fuel, the high-level radioactive waste disposal and low-level radioactive waste disposal. Safety of concrete cask storage was confirmed by the falling test, SCC test and vibration test. The researches for the next generation nuclear technologies have developed the pyrochemical reprocessing process for the metal fuel and oxide fuel, and development of metal fuel with U, Pu and Zr. Assist management of development of fast reactor is proceeding. One of researches of radiation safety is on low dose X-ray bystander effect on the diabetes mellitus of model mouse. (S.Y.)

  19. Hydropower research and development

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1997-03-01

    This report is a compilation of information on hydropower research and development (R and D) activities of the Federal government and hydropower industry. The report includes descriptions of on-going and planned R and D activities, 1996 funding, and anticipated future funding. Summary information on R and D projects and funding is classified into eight categories: fish passage, behavior, and response; turbine-related; monitoring tool development; hydrology; water quality; dam safety; operations and maintenance; and water resources management. Several issues in hydropower R and D are briefly discussed: duplication; priorities; coordination; technical/peer review; and technology transfer/commercialization. Project information sheets from contributors are included as an appendix.

  20. Method Engineering: Engineering of Information Systems Development Methods and Tools

    NARCIS (Netherlands)

    Brinkkemper, J.N.; Brinkkemper, Sjaak

    1996-01-01

    This paper proposes the term method engineering for the research field of the construction of information systems development methods and tools. Some research issues in method engineering are identified. One major research topic in method engineering is discussed in depth: situational methods, i.e.

  1. Methods and Methods' Debates within Consumption Research

    DEFF Research Database (Denmark)

    Halkier, Bente

    2017-01-01

    This chapter takes an open look at how researchers are using new topographies, technologies, and technocultural rituals and routines in order to reconceptualize what market actors are and do, and most especially, how they should be studied. We are interested in the latest developments in consumer...... ethnography, as we have experienced and visualized them being practices in our native fields of anthropology, marketing and consumer research, and as it has touched upon industry market researchers and their workings. We do not rehash classic treatments easily available to interested scholars (e.g. Arnould...

  2. Research and Development Program in Reactor Diagnostics and Monitoring with Neutron Noise Methods. Stage 8. Final report

    International Nuclear Information System (INIS)

    Pazsit, I.; Demaziere, C.; Arzhanov, V.

    2003-01-01

    This report constitutes Stage 8 of a long-term research and development program concerning the development of diagnostics and monitoring methods for nuclear reactors. A brief proposal for the continuation of this program in stage 9 is also given at the end of the report. The program executed in Stage 8 consists of three parts and the work performed in each part is summarized below. In Stage 7, an anomaly localisation algorithm was presented and applied to the Forsmark-1 channel instability event. This investigation was carried out with a set of static data that were typical of a generic BWR model, since no data except the Local Power Range Monitors (LPRMs) time signals recorded during the instability event were made accessible to us at that time. In the present Stage, these static data were obtained from Vattenfall Fuel AB, who used the SIMULATE-3 code. The first Section of this report is thus devoted to this anomaly localisation but this time with a relevant set of data, both regarding the static core conditions and regarding the LPRMs time signals. The noise source pointed out by the localisation algorithm was once again found to be very close to an unseated fuel assembly discovered during the fuel outage following the instability event. The localisation procedure relies in fact on the prior calculation of the reactor transfer function, carried out via the neutron noise simulator first presented in Stage 6 and later improved in Stage 7. The neutron noise simulator was also improved in this Stage. More precisely, a 2-D 2- group static core simulator was developed in order to calculate the static flux and the associated eigenvalue with a spatial discretization scheme compatible with the one in use in the neutron noise simulator, i.e. finite differences. It has generally been assumed that the Decay Ratio (DR), a parameter characterizing the stability of BWRs, is a space-independent parameter of the reactor, i.e. it is independent of which LPRM is used in the core to

  3. Photonics Research and Development

    Energy Technology Data Exchange (ETDEWEB)

    Dickson, Elizabeth [UNLV Research Foundation, Las Vegas, NV (United States)

    2010-01-15

    During the period August 2005 through October 2009, the UNLV Research Foundation (UNLVRF), a non-profit affiliate of the University of Nevada, Las Vegas (UNLV), in collaboration with UNLV's Colleges of Science and Engineering; Boston University (BU); Oak Ridge National Laboratory (ORNL); and Sunlight Direct, LLC, has managed and conducted a diverse and comprehensive research and development program focused on light-emitting diode (LED) technologies that provide significantly improved characteristics for lighting and display applications. This final technical report provides detailed information on the nature of the tasks, the results of the research, and the deliverables. It is estimated that about five percent of the energy used in the nation is for lighting homes, buildings and streets, accounting for some 25 percent of the average home's electric bill. However, the figure is significantly higher for the commercial sector. About 60 percent of the electricity for businesses is for lighting. Thus replacement of current lighting with solid-state lighting technology has the potential to significantly reduce this nation's energy consumption by some estimates, possibly as high as 20%. The primary objective of this multi-year R&D project has been to develop and advance lighting technologies to improve national energy conversion efficiencies; reduce heat load; and significantly lower the cost of conventional lighting technologies. The UNLVRF and its partners have specifically focused these talents on (1) improving LED technologies; (2) optimizing hybrid solar lighting, a technology which potentially offers the benefits of blending natural with artificial lighting systems, thus improving energy efficiency; and (3) building a comprehensive academic infrastructure within UNLV which concentrates on photonics R&D. Task researchers have reported impressive progress in (1) the development of quantum dot laser emitting diodes (QDLEDs) which will ultimately improve

  4. The order and priority of research and design method application within an assistive technology new product development process: a summative content analysis of 20 case studies.

    Science.gov (United States)

    Torrens, George Edward

    2018-01-01

    Summative content analysis was used to define methods and heuristics from each case study. The review process was in two parts: (1) A literature review to identify conventional research methods and (2) a summative content analysis of published case studies, based on the identified methods and heuristics to suggest an order and priority of where and when were used. Over 200 research and design methods and design heuristics were identified. From the review of the 20 case studies 42 were identified as being applied. The majority of methods and heuristics were applied in phase two, market choice. There appeared a disparity between the limited numbers of methods frequently used, under 10 within the 20 case studies, when hundreds were available. Implications for Rehabilitation The communication highlights a number of issues that have implication for those involved in assistive technology new product development: •The study defined over 200 well-established research and design methods and design heuristics that are available for use by those who specify and design assistive technology products, which provide a comprehensive reference list for practitioners in the field; •The review within the study suggests only a limited number of research and design methods are regularly used by industrial design focused assistive technology new product developers; and, •Debate is required within the practitioners working in this field to reflect on how a wider range of potentially more effective methods and heuristics may be incorporated into daily working practice.

  5. Research methods courses as a means of developing academic general practice. Fifteen years' experience from Sweden and Denmark.

    Science.gov (United States)

    Håkansson, Anders; Beckman, Anders; Hansson, Eva Ekvall; Merlo, Juan; Månsson, Nils-Ove

    2005-09-01

    Since 1989, the authors have given courses in research methodology, and these courses are now given at six venues in southern Sweden, as well as in Denmark. The course corresponds to half a year's full-time study, with half the time devoted to lectures and studies of literature, while the rest is spent on an individual project under supervision. To enable part-time study, the course extends over 1(1/2) years. In 15 years roughly 1000 people, mainly physicians, have been given training in basic research methods. The course model has been appreciated by clinically active colleagues, who have been able to attend a course and simultaneously work with patients. Among the GPs in the region, one in five has taken this course, and one in five has then gone on to start formal PhD studies. The authors have thus succeeded in their goal of giving basic scientific schooling to many physicians and recruiting some for further research.

  6. e-Learning Business Research Methods

    Science.gov (United States)

    Cowie, Jonathan

    2004-01-01

    This paper outlines the development of a generic Business Research Methods course from a simple name in a box to a full e-Learning web based module. It highlights particular issues surrounding the nature of the discipline and the integration of a large number of cross faculty subject specific research methods courses into a single generic module.…

  7. Report of Research Cooperation Sub-Committee 46 on research and development of methods for inelastic (EPICC: Elastic-PlastIC-Creep) structural analysis

    International Nuclear Information System (INIS)

    Yamada, Yoshiaki

    1977-05-01

    This report succeeds the preceding one on ''Verification and Qualification of Nonlinear Structural Analysis Computer Program''. PNC (Power Reactor and Nuclear Fuel Development Corporation) decided to sponsor an extended research project on inelastic structural analysis for a period spanning September, 1976 to May, 1978. Responding to PNC proposal, RC Sub-Committee 46 was formed in Japan Society of Mechanical Engineers and plunged into the cooperative work from October, 1976. Besides the verification and/or qualification of available general purpose computer programs which were the major objectives of previous contract, the Committee executed the research on the topics categorized into the following three fields of interests: 1. Material data for use in elastic analysis, 2. Inelastic analysis procedure and computer program verification, 3. Design code and processing of computer solutions. This report summarizes the efforts during the first year of the Sub-Committee and consists of three parts each corresponding to the research topics stated above. Part I. Inelastic constitutive equations for materials under high temperature service conditions Part II. EPICC standard benchmark test problem and solutions Part III. Examination of postprocessors and development Although the research is still in the intermediate stage, the features of research being actively under way are 1. Evaluative review and nationwide collection of material data, recommendation of tentative constitutive equations for elastic-plastic and creep analyses of benchmark test problem, 2. Revision and augmentation of EPICC standard benchmark test problem and competitive and/or cooperative execution of solutions, 3. Review of existing prototypical post processors, and development of a processor for piping design. (author)

  8. Ecotribology research developments

    CERN Document Server

    2016-01-01

    This book presents resent research advances in the area of eco-triobology. In the last years, eco-tribology or environmentally friendly tribology has gained increasing importance in sustainable engineering. Environmentally acceptable tribological practices save resources by optimizing product usage and reducing energy. This book covers current developments in all areas covered by the term eco-tribology, including biomimetics surfaces, control of friction and wear, environmental aspects of lubrication and surface modification techniques as well as tribological aspects of green applications, such wind-power turbines or solar panels.

  9. Mixed-Methods Research Methodologies

    Science.gov (United States)

    Terrell, Steven R.

    2012-01-01

    Mixed-Method studies have emerged from the paradigm wars between qualitative and quantitative research approaches to become a widely used mode of inquiry. Depending on choices made across four dimensions, mixed-methods can provide an investigator with many design choices which involve a range of sequential and concurrent strategies. Defining…

  10. Research and development of methods/utilities and rules for managing cooperation for performance improvement in government offices

    Energy Technology Data Exchange (ETDEWEB)

    Kurstedt, H.A.

    1993-03-01

    Purpose is to help managers approach their responsibilities proactively, so that they can anticipate problems and take actions to alleviate or eliminate those problems. Continuous performance improvement, the philosophy behind total quality management, requires working cooperatively to do a little better each day. The most effective tools are working through a closed set of 9 methods: setting expectations, charting, defining indicators and standards, collecting and logging data, converting data to information, organizing and presenting information, reviewing status and progress, self-management, and appraising. In addition, there are 8 rules: focus on what you can do, supply physical evidence of progress, pay attention to detail, inspect (don't expect), review progress routinely and frequently, face ''success/fail'' squarely, communicate crisply, and conduct honest, open appraisals. Scope and plans of the draft research plan (study areas) are described.

  11. Research and development experience

    International Nuclear Information System (INIS)

    Slater, J.B.

    1980-06-01

    In the early 1950s, Atomic Energy of Canada Limited (AECL), in collaboration with Canadian industry and the power utilities, started on the task of developing and establishing the CANDU power reactor system and the necessary industrial infrastructure. While international activity provided a useful background and information to support Canadian activities, there were several unique features of the CANDU reactor which demanded specific programs of research and development work with a physics orientation. The four major areas were basic reactor physics, reactor control, heavy water and tritium monitoring and instruments and, finally, the potential of alternative fuel cycles. These four topics are discussed with the objective of providing an overview of what has been accomplished and what remains to be done. (auth)

  12. Technology research and development

    International Nuclear Information System (INIS)

    Haas, G.M.; Abdov, M.A.; Baker, C.C.; Beuligmann, R.F.

    1985-01-01

    The U.S. Dept. of Energy discusses the new program plan, the parameters of which are a broad scientific and technology knowledge base, an attractive plasma configuration to be determined, and other issues concerning uncertainty as to what constitutes attractive fusion options to be determined in the future, and increased collaboration. Tables show changing directions in magnetic fusion energy, two examples of boundary condition impacts on long-term technology development, and priority classes of the latter. The Argonne National Laboratory comments on the relationship between science, technology and the engineering aspects of the fusion program. UCLA remarks on the role of fusion technology in the fusion program plan, particularly on results from the recent studies of FINESSE. General Dynamics offers commentary on the issues of a reduced budget, and new emphasis on science which creates an image of the program. A table illustrates technology research and development in the program plan from an industrial perspective

  13. Applied research and development of neutron activation analysis - Development of the precise analysis method for plastic materials by the use of NAA

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Kil Yong; Sim, Sang Kwan; Yoon, Yoon Yeol; Chun, Sang Ki [Korea Institute of Geology, Mining and Materials, Taejon (Korea)

    2000-04-01

    The demand for inorganic analysis of plastics has significantly increased in the fields of microelectronic, environmental, nuclear and resource recycling. The difficulties of chemical analysis methods have led to the application of NAA which has great advantages of non-destructivity, freedom from blank, high sensitivity. The goal of the present work is to optimize and to develop the NAA procedures for the inorganic analysis of plastics. Even though NAA has unique advantages, it has two problems for plastics. One is the contamination by metallic utensils during sample treatment and the other is destruction of sample ampule due to pressure build-up by hydrogen and methane gas formed from oxyhydrogenation reaction with neutrons. For the first problem, large plastics were cut to pieces after immersion in liquid nitrogen. And the second problem has been solved by making an aperture on top side of sample ampule. These research results have been applied to analysis of various plastic materials which were used in food, drug containers and toys for children. Moreover, korean irradiation rabbit could be produced by the application of the results and standard reference materials of plastics which were used for the analysis in XRF and ICP could be produced. 36 refs., 6 figs., 37 tabs (Author)

  14. Research tools | IDRC - International Development Research Centre

    International Development Research Centre (IDRC) Digital Library (Canada)

    Through training materials and guides, we aim to build skills and knowledge to enhance the quality of development research. We also offer free access to our database of funded research projects, known as IDRIS+, and our digital library. Our research tools include. Guide to research databases at IDRC: How to access and ...

  15. Changing Research Practices and Research Infrastructure Development

    Science.gov (United States)

    Houghton, John W.

    2005-01-01

    This paper examines changing research practices in the digital environment and draws out implications for the development of research infrastructure. Reviews of the literature, quantitative indicators of research activities and our own field research in Australia suggest that there is a new mode of knowledge production emerging, changing research…

  16. GEM simulation methods development

    International Nuclear Information System (INIS)

    Tikhonov, V.; Veenhof, R.

    2002-01-01

    A review of methods used in the simulation of processes in gas electron multipliers (GEMs) and in the accurate calculation of detector characteristics is presented. Such detector characteristics as effective gas gain, transparency, charge collection and losses have been calculated and optimized for a number of GEM geometries and compared with experiment. A method and a new special program for calculations of detector macro-characteristics such as signal response in a real detector readout structure, and spatial and time resolution of detectors have been developed and used for detector optimization. A detailed development of signal induction on readout electrodes and electronics characteristics are included in the new program. A method for the simulation of charging-up effects in GEM detectors is described. All methods show good agreement with experiment

  17. Development of groundwater treatment method using radiation-induced graft polymerization adsorbent at the Mizunami Underground Research Laboratory. Annual report on 2007 fiscal year (Joint research)

    International Nuclear Information System (INIS)

    Iyatomi, Yosuke; Shimada, Akiomi; Ogata, Nobuhisa; Sugihara, Kozo; Seko, Noriaki; Kasai, Noboru; Hoshina, Hiroyuki; Ueki, Yuji; Tamada, Masao

    2009-11-01

    The concentrations of fluorine (7.2-10mg/L) and boron (0.8-1.5mg/L) dissolved in groundwater pumped from shafts during excavation at the Mizunami Underground Research Laboratory (MIU), Tono Geoscience Centre, must be reduced to the levels below the environmental standards (fluorine:0.8mg/L, boron:1mg/L). Coagulation treatment and ion exchange treatment are applied for fluorine and boron at a current water treatment facility in MIU, respectively. A collaborative research on groundwater treatment for fluorine and boron was started by the Environment and Industrial Materials Research Division, Quantum Beam Science Directorate and the Tono Geoscientific Research Unit, Geological Isolation Research and Development Directorate in 2006. This is because the Quantum Beam Science Directorate has synthesized fibrous adsorbents with radiation-induced graft polymerization and applied them to collect rare metals dissolved in hot springs and sea water. Boron adsorbent synthesized by grafting showed higher removal rate than that of the ion-exchange resin. Additionally, the durability and the repetitive use of the boron adsorbent were evaluated to estimate the capacity of the boron adsorption. Therefore we produced a test equipment to do scale-up test of the adsorbent. Effects of flow rate and the repetitive use on the adsorption capacity of boron were investigated. As a result, it concluded that the adsorption capacity of the boron adsorbent did not change even when the flow rate increased from SV 50h -1 to 100h -1 . In addition, enough durability was confirmed for the repetitive use of the adsorbent. The adsorption capacity of the adsorbent was affected by pH of the groundwater especially in high alkaline range above a pH of 10. (author)

  18. Eltron Research & Development

    Energy Technology Data Exchange (ETDEWEB)

    Evenson, Carl; Mackay, Richard; Faull, John

    2014-03-01

    This topical report covers technical work conducted under contract DE-FC26-05NT42469 between FY06 Q1 through FY14 Q2. The project evolved through several budget periods, budget revisions and continuation applications. This report covers work performed under the “base” program. In 2010 ARRA funding was added to the project. A separate report covering the ARRA portion of the project was submitted to DOE. The original project was focused on research and development for scale-up of hydrogen separation membrane for a FutureGen type power plant. The work included membrane testing and evaluation of metal alloy flat plates vs. tubes and metal membranes vs. cermet membranes. In addition, economic analysis and process modeling was performed. The original project team included CoorsTek, NORAM, and Praxair. In FY10Q2 a continuation application was filed for conducting a scale-up test at Eastman Chemical. In this part of the project a Subscale Engineering Prototype (SEP) membrane skid was designed, fabricated, and operated on a gasified coal slip-stream on Eastman’s site in Kingsport, TN. Following operation, the project was reorganized and a second continuation application with a new statement of work was initiated in FY12Q1. Finally, based on DOE’s decision not to proceed with a Process Development Unit (PDU) field test, a third continuation application and statement of work was initiated in FY13Q1 to close out the project.

  19. Development of partitioning method

    International Nuclear Information System (INIS)

    Kondo, Yasuo; Kubota, Masumitsu; Abe, Tadashi; Nagato, Kotaro.

    1991-09-01

    Spent fuels from nuclear power stations contain many useful elements, which can be utilized as heat and irradiation sources, radioisotope, elemental resource, etc. Their recovery from spent fuel and effective uses have the advantages in not only converting the radioactive waste to beneficial resources but also promoting rationalization of the management and disposal of the radioactive wastes. In present study, published literature related to recovery and utilization of useful elements in spent fuel was mainly surveyed, present states and trends in their research and development were analyzed, and their future prospects were conjectured. Research and development on recovery and utilization of useful elements are being continued mainly in USA, Europe and Japan. A transportable food irradiator with Cs-137 and an electric power source with Sr-90 for remote weather station are typical examples in major past applications. However, research and development on recovery and utilization are not so much active and the future efforts should be expected hereafter. Present study was conducted under the auspices of the Science and Technology Agency of Japan. (author)

  20. Method Engineering: Engineering of Information Systems Development Methods and Tools

    OpenAIRE

    Brinkkemper, J.N.; Brinkkemper, Sjaak

    1996-01-01

    This paper proposes the term method engineering for the research field of the construction of information systems development methods and tools. Some research issues in method engineering are identified. One major research topic in method engineering is discussed in depth: situational methods, i.e. the configuration of a project approach that is tuned to the project at hand. A language and support tool for the engineering of situational methods are discussed.

  1. Behavioral Methods in Consciousness Research

    DEFF Research Database (Denmark)

    that the research literature has expanded greatly, particularly in cognitive neuroscience and cognitive science. Interestingly, this scientific work has made use of a wide variety of different methods without much consensus on how one might in fact measure subjective consciousness. This situation makes...

  2. Developments in Surrogating Methods

    Directory of Open Access Journals (Sweden)

    Hans van Dormolen

    2005-11-01

    Full Text Available In this paper, I would like to talk about the developments in surrogating methods for preservation. My main focus will be on the technical aspects of preservation surrogates. This means that I will tell you something about my job as Quality Manager Microfilming for the Netherlands’ national preservation program, Metamorfoze, which is coordinated by the National Library. I am responsible for the quality of the preservation microfilms, which are produced for Metamorfoze. Firstly, I will elaborate on developments in preservation methods in relation to the following subjects: · Preservation microfilms · Scanning of preservation microfilms · Preservation scanning · Computer Output Microfilm. In the closing paragraphs of this paper, I would like to tell you something about the methylene blue test. This is an important test for long-term storage of preservation microfilms. Also, I will give you a brief report on the Cellulose Acetate Microfilm Conference that was held in the British Library in London, May 2005.

  3. Thermophysical methods in materials research

    International Nuclear Information System (INIS)

    Rohde, M.

    2003-01-01

    Thermophysical properties, namely the thermal conductivity, diffusivity and the heat capacity determine the behavior of every material under heat load. Therefore these properties are important not only for design purposes but also for the development of advanced materials. Within this contribution an overview will be given about measurement techniques for thermophysical properties. Some aspects of materials characterization and process development will be highlighted using selected research results. (orig.)

  4. Using ethnographic methods in software engineering research

    DEFF Research Database (Denmark)

    Sharp, Helen, C.; Dittrich, Yvonne; De Souza, Cleidson

    2010-01-01

    This tutorial provides an overview of the role of ethnography in Software Engineering research. It describes the use of ethnographic methods as a means to provide an in-depth understanding of the socio-technological realities surrounding everyday software development practice. The knowledge gained......-depth discussion of methods for data collection and analysis used in ethnographic studies. It then describes how these methods can be and have been used by software engineering researchers to understand developers' work practices, to inform the development of processes, methods and tools and to evaluate...... can be used to improve processes, methods and tools as well as develop observed industrial practices. The tutorial begins with a brief historical account of ethnography in the fields of Software Engineering, CSCW, Information Systems and other related areas. This sets the stage for a more in...

  5. Engineering research, development and technology

    International Nuclear Information System (INIS)

    1994-05-01

    The mission of the Engineering Research, Development, and Technology Program at Lawrence Livermore National Laboratory (LLNL) is to develop the technical staff, tools, and facilities needed to support current and future LLNL programs. The efforts are guided by a dual-benefit research and development strategy that supports Department of Energy missions, such as national security through nuclear deterrence and economic competitiveness through partnerships with U.S. industry. This annual report, organized by thrust area, describes the activities for the fiscal year 1993. The report provides timely summaries of objectives, methods, and results from nine thrust areas for this fiscal year: Computational Electronics and Electromagnetics; Computational Mechanics; Diagnostics and Microelectronics; Fabrication Technology; Materials Science and Engineering; Power Conversion Technologies; Nondestructive Evaluation; Remote Sensing, Imaging, and Signal Engineering; and Emerging Technologies. Separate abstracts were prepared for 47 papers in this report

  6. International Development Research Centre

    International Development Research Centre (IDRC) Digital Library (Canada)

    ... development. Learn moreArtificial intelligence and human development ... New initiative will match climate knowledge to developing country needs. Aminata Camara ... Shadow Libraries: Access to Knowledge in Global Higher Education.

  7. Development of partitioning method

    International Nuclear Information System (INIS)

    Kubota, Kazuo; Dojiri, Shigeru; Kubota, Masumitsu

    1988-10-01

    The literature survey was carried out on the amount of natural resources, behaviors in reprocessing process and in separation and recovery methods of the platinum group elements and technetium which are contained in spent fuel. The essential results are described below. (1) The platinum group elements, which are contained in spent fuel, are quantitatively limited, compared with total demand for them in Japan. And estimated separation and recovery cost is rather high. In spite of that, development of these techniques is considered to be very important because the supply of these elements is almost from foreign resources in Japan. (2) For recovery of these elements, studies of recovery from undisolved residue and from high level liquid waste (HLLW) also seem to be required. (3) As separation and recovery methods, following techniques are considered to be effective; lead extraction, liquid metal extraction, solvent extraction, ion-exchange, adsorption, precipitation, distillation, electrolysis or their combination. (4) But each of these methods has both advantages and disadvantages. So development of such processes largely depends on future works. (author) 94 refs

  8. An Overview of Models, Methods, and Reagents Developed for Translational Autoimmunity Research in the Common Marmoset (Callithrix jacchus)

    OpenAIRE

    Jagessar, S. Anwar; Vierboom, Michel; Blezer, Erwin L.A.; Bauer, Jan; Hart, Bert A. ‘t; Kap, Yolanda S.

    2013-01-01

    textabstractThe common marmoset (Callithrix jacchus) is a small-bodied Neotropical primate and a useful preclinical animal model for translational research into autoimmune-mediated inflammatory diseases (AIMID), such as rheumatoid arthritis (RA) and multiple sclerosis (MS). The animal model for MS established in marmosets has proven their value for exploratory research into (etio) pathogenic mechanisms and for the evaluation of new therapies that cannot be tested in lower species because of t...

  9. A Design Science Research Methodology for Developing a Computer-Aided Assessment Approach Using Method Marking Concept

    Science.gov (United States)

    Genemo, Hussein; Miah, Shah Jahan; McAndrew, Alasdair

    2016-01-01

    Assessment has been defined as an authentic method that plays an important role in evaluating students' learning attitude in acquiring lifelong knowledge. Traditional methods of assessment including the Computer-Aided Assessment (CAA) for mathematics show limited ability to assess students' full work unless multi-step questions are sub-divided…

  10. Mixed methods research in the development and evaluation of complex interventions in palliative and end-of-life care: report on the MORECare consensus exercise.

    Science.gov (United States)

    Farquhar, Morag; Preston, Nancy; Evans, Catherine J; Grande, Gunn; Short, Vicky; Benalia, Hamid; Higginson, Irene J; Todd, Chris

    2013-12-01

    Complex interventions are common in palliative and end-of-life care. Mixed methods approaches sit well within the multiphase model of complex intervention development and evaluation. Generic mixed methods guidance is useful but additional challenges in the research design and operationalization within palliative and end-of-life care may have an impact on the use of mixed methods. The objective of the study was to develop guidance on the best methods for combining quantitative and qualitative methods for health and social care intervention development and evaluation in palliative and end-of-life care. A one-day workshop was held where experts participated in facilitated groups using Transparent Expert Consultation to generate items for potential recommendations. Agreement and consensus were then sought on nine draft recommendations (DRs) in a follow-up exercise. There was at least moderate agreement with most of the DRs, although consensus was low. Strongest agreement was with DR1 (usefulness of mixed methods to palliative and end-of-life care) and DR5 (importance of attention to respondent burden), and least agreement was with DR2 (use of theoretical perspectives) and DR6 (therapeutic effects of research interviews). Narrative comments enabled recommendation refinement. Two fully endorsed, five partially endorsed, and two refined DRs emerged. The relationship of these nine to six key challenges of palliative and end-of-life care research was analyzed. There is a need for further discussion of these recommendations and their contribution to methodology. The recommendations should be considered when designing and operationalizing mixed methods studies of complex interventions in palliative care, and because they may have wider relevance, should be considered for other applications.

  11. Research and Development of Methods for Estimating Physicochemical Properties of Organic Compounds of Environmental Concern. Part 2.

    Science.gov (United States)

    1981-06-01

    lar orbital considerations. The basis of light scattering in Raman spec- troscopy is the dipole moment induced in the molecule when hit by the...of 6 25-9 APPENDICES SIMPLE LINEAR REGRESSION B-1 Scatter Plot of Twenty-five Observations of Two Variables B-2 B-2 Violation of Regression Assumptions...parachor values com- puted by the Sugden method and the McGowan method, respectively. Example 12-2 Estimate the normal boiling point for nicotine . (1

  12. Research Librarian | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Job Summary The Research Librarian is a key member of a team responsible for the delivery of comprehensive research information services which contribute strategic value to the work of clients. Intermediated search services at the expert level, the development and delivery of orientations, training/coaching, ...

  13. Engaging Adolescents through Participatory and Qualitative Research Methods to Develop a Digital Communication Intervention to Reduce Adolescent Obesity

    Science.gov (United States)

    Livingood, William C.; Monticalvo, David; Bernhardt, Jay M.; Wells, Kelli T.; Harris, Todd; Kee, Kadra; Hayes, Johnathan; George, Donald; Woodhouse, Lynn D.

    2017-01-01

    Background: The complexity of the childhood obesity epidemic requires the application of community-based participatory research (CBPR) in a manner that can transcend multiple communities of stakeholders, including youth, the broader community, and the community of health care providers. Aim: To (a) describe participatory processes for engaging…

  14. An Overview of Models, Methods, and Reagents Developed for Translational Autoimmunity Research in the Common Marmoset (Callithrix jacchus)

    NARCIS (Netherlands)

    Jagessar, S. Anwar; Vierboom, Michel; Blezer, Erwin L. A.; Bauer, Jan; 't Hart, Bert A.; Kap, Yolanda S.

    The common marmoset (Callithrix jacchus) is a small-bodied Neotropical primate and a useful preclinical animal model for translational research into autoimmune-mediated inflammatory diseases (AIMID), such as rheumatoid arthritis (RA) and multiple sclerosis (MS). The animal model for MS established

  15. An overview of models, methods, and reagents developed for translational autoimmunity research in the common marmoset (Callithrix jacchus)

    NARCIS (Netherlands)

    S.A. Jagessar (Anwar); M.P.M. Vierboom (Michel); E. Blezer (Erwin); J. Bauer; B.A. 't Hart (Bert); Y.S. Kap (Yolanda)

    2013-01-01

    textabstractThe common marmoset (Callithrix jacchus) is a small-bodied Neotropical primate and a useful preclinical animal model for translational research into autoimmune-mediated inflammatory diseases (AIMID), such as rheumatoid arthritis (RA) and multiple sclerosis (MS). The animal model for MS

  16. Research and development program in reactor diagnostics and monitoring with neutron noise methods. Stage 6. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Pazsit, I.; Demaziere, C.; Avdic, S.; Dahl, B. [Chalmers Univ. of Technology, Goeteborg (Sweden). Dept. of Reactor Physics

    2000-07-15

    The program executed in Stage 6 consists of three parts and the work performed in each part is summarized below. In Stage 5 experimental and numerical investigations were made of the applicability of using the gradient of the static flux to locate a neutron source in a water tank. The measurements were made with a recently developed very small optical fibre detector, and the supporting calculations done with the Monte Carlo code MCNP. In the present Stage, the work was extended to the investigation of the true neutron current. Based on the same thin fibre detector, a detector capable of measuring the neutron current was constructed. This was achieved by covering one side of the detector with a cadmium cladding. With this detector, laboratory measurements were carried out the same way as with the gradient detector in the previous stage. A neutron source located in a water tank was used and the flux and the current measured in points with varying distance from the source. The direction of the neutron current vector indicates the direction of the source from the measurement point, and the ratio of the absolute value of the current to the flux can be used to estimate the distance to the source. For the latter, values of the same ratio as a function of the source-detector distance must be available from theory or calculations. We have used earlier MCNP calculations of the gradient/flux ratio for this purpose. The results show that it is possible to measure the true neutron current with the detector construction and, by comparing them to MCNP calculations, to determine the distance to the source and thereby also determine the position of the source. In the previous stage, we have developed a numerical finite-difference code which can be used to calculate the dynamic adjoint (i.e. the transfer function) in a heterogeneous 1-D reactor system and in two-group diffusion theory. The purpose in this Stage was to extend the calculations to 2-D and 3-D cases. This was achieved

  17. Research & Development of Materials/Processing Methods for Continuous Fiber Ceramic Composites (CFCC) Phase 2 Final Report.

    Energy Technology Data Exchange (ETDEWEB)

    Szweda, A.

    2001-01-01

    The Department of Energy's Continuous Fiber Ceramic Composites (CFCC) Initiative that begun in 1992 has led the way for Industry, Academia, and Government to carry out a 10 year R&D plan to develop CFCCs for these industrial applications. In Phase II of this program, Dow Corning has led a team of OEM's, composite fabricators, and Government Laboratories to develop polymer derived CFCC materials and processes for selected industrial applications. During this phase, Dow Corning carried extensive process development and representative component demonstration activities on gas turbine components, chemical pump components and heat treatment furnace components.

  18. Applying the Action-Research Method to Develop a Methodology to Reduce the Installation and Maintenance Times of Information Security Management Systems

    Directory of Open Access Journals (Sweden)

    Antonio Santos-Olmo

    2016-07-01

    Full Text Available Society is increasingly dependent on Information Security Management Systems (ISMS, and having these kind of systems has become vital for the development of Small and Medium-Sized Enterprises (SMEs. However, these companies require ISMS that have been adapted to their special features and have been optimized as regards the resources needed to deploy and maintain them, with very low costs and short implementation periods. This paper discusses the different cycles carried out using the ‘Action Research (AR’ method, which have allowed the development of a security management methodology for SMEs that is able to automate processes and reduce the implementation time of the ISMS.

  19. Challenges of the Administrative Consultation Wiki Research Project as a Learning and Competences Development Method for MPA Students

    Science.gov (United States)

    Kovac, Polonca; Stare, Janez

    2015-01-01

    Administrative Consultation Wiki (ACW) is a project run under the auspices of the Faculty of Administration and the Ministry of Public Administration in Slovenia since 2009. A crucial component thereof is the involvement of students of Master of Public Administration (MPA) degree programs to offer them an opportunity to develop competences in…

  20. Thermonuclear research development

    International Nuclear Information System (INIS)

    Velikhov, E.

    1977-01-01

    Tokamak 10, the world's largest thermonuclear facility was commissioned in 1975. Soviet scientists thus achieved enormous success in producing high-temperature plasma and constructing a thermonuclear fusion source. The problems which remain to be solved include finding a method of regenerating the deuterium-tritium fuel mixture and a method of purifying the reacting high-temperature plasma of heavy elements. The project is designed for a more powerful facility, namely the Tokamak 20 whose toroidal chamber will accommodate a current of 5 to 6 MA and whose plasma volume will be 400 m 3 . (Oy)

  1. Thermonuclear research development

    Energy Technology Data Exchange (ETDEWEB)

    Velikhov, E

    1977-04-01

    Tokamak 10, the world's largest thermonuclear facility was commissioned in 1975. Soviet scientists thus achieved enormous success in producing high-temperature plasma and constructing a thermonuclear fusion source. The problems which remain to be solved include finding a method of regenerating the deuterium-tritium fuel mixture and a method of purifying the reacting high-temperature plasma of heavy elements. The project is designed for a more powerful facility, namely the Tokamak 20 whose toroidal chamber will accommodate a current of 5 to 6 MA and whose plasma volume will be 400 m/sup 3/.

  2. Cryogenic Research and Development

    Science.gov (United States)

    1960-09-30

    of right angle illumination (with respect to the camera ) may be illustrated from the fact that the scattering of light from a hydrogen bubble is 10...und Kondensierter Gase bel tiefen Temperaturen, A. Eucken, Verb. deut. Phys. Gesells . 18, 4 (1916) 27. Resonance method of measuring the ratio of the

  3. Studies on application of neutron activation analysis -Applied research on air pollution monitoring and development of analytical method of environmental samples

    International Nuclear Information System (INIS)

    Chung, Yong Sam; Moon, Jong Hwa; Chung, Young Ju; Jeong, Eui Sik; Lee, Sang Mi; Kang, Sang Hun; Cho, Seung Yeon; Kwon, Young Sik; Chung, Sang Wuk; Lee, Kyu Sung; Chun, Ki Hong; Kim, Nak Bae; Lee, Kil Yong; Yoon, Yoon Yeol; Chun, Sang Ki.

    1997-09-01

    This research report is written for results of applied research on air pollution monitoring using instrumental neutron activation analysis. For identification and standardization of analytical method, 24 environmental samples are analyzed quantitatively, and accuracy and precision of this method are measured. Using airborne particulate matter and biomonitor chosen as environmental indicators, trace elemental concentrations of sample collected at urban and rural site monthly are determined ant then the calculation of statistics and the factor analysis are carried out for investigation of emission source. Facilities for NAA are installed in a new HANARO reactor, functional test is performed for routine operation. In addition, unified software code for NAA is developed to improve accuracy, precision and abilities of analytical processes. (author). 103 refs., 61 tabs., 19 figs

  4. Qualitative methods in pharmacy practice research

    DEFF Research Database (Denmark)

    Kaae, Susanne; Traulsen, Janine Marie

    2015-01-01

    Qualitative research within pharmacy practice is concerned with understanding the behavior of actors such as pharmacy staff, pharmacy owners, patients, other healthcare professionals, and politicians to explore various types of existing practices and beliefs in order to improve them. As qualitative...... research attempts to answer the “why” questions, it is useful for describing, in rich detail, complex phenomena that are situated and embedded in local contexts. Typical methods include interviews, observation, document analysis, and netnography. Qualitative research has to live up to a set of rigid...... quality criteria of research conduct to provide trustworthy results that contribute to the further development of the area....

  5. International Development Research Centre

    International Development Research Centre (IDRC) Digital Library (Canada)

    Ann Gregory

    further development of scientific agriculture and technology. Already, however ..... sent, starting in the north, to Galilee and the regions adjoining, Lebanon and Syria, and working my ... the water, grow crops, and flocks of sheep and goats.” He says ... I served in 30 or 40 different countries throughout Asia and Africa, South.

  6. Offshore wind development research.

    Science.gov (United States)

    2014-04-01

    Offshore wind (OSW) development is a new undertaking in the US. This project is a response to : New Jerseys 2011 Energy Master Plan that envisions procuring 22.5% of the states power : originating from renewable sources by 2021. The Offshore Wi...

  7. Social Experiments and Participatory Research as Method

    DEFF Research Database (Denmark)

    Dirckinck-Holmfeld, Lone

    2007-01-01

    Interdisciplinary research with stakeholders and users challenge the research methodologies to be used. These have to provide a shared language for all the participants, to build up trust, and to offer insights into the diverse perspectives of the participants. Further more it challenge ways to d...... practice-based methods where "social experiments with technology" and "dialogue research" are the key-words. ...... to discuss and validate contributions from each others - across different criteria for each discipline, and crosswise different agendas for stakeholders, politicians, practitioners and researchers. Participatory research and social experiments are methodologies which have been developed to cope......Interdisciplinary research with stakeholders and users challenge the research methodologies to be used. These have to provide a shared language for all the participants, to build up trust, and to offer insights into the diverse perspectives of the participants. Further more it challenge ways...

  8. Research and development of asymmetrical heat transfer augmentation method in radial channels of blades for high temperature gas turbines

    Science.gov (United States)

    Shevchenko, I. V.; Rogalev, A. N.; Garanin, I. V.; Vegera, A. N.; Kindra, V. O.

    2017-11-01

    The serpentine-like one and half-pass cooling channel systems are primarily used in blades fabricated by the lost-wax casting process. The heat transfer turbulators like cross-sectional or angled ribs used in channels of the midchord region failed to eliminate the temperature irregularity from the suction and pressure sides, which is reaching 200°C for a first stage blade of the high-pressure turbine for an aircraft engine. This paper presents the results of a numerical and experimental test of an advanced heat transfer augmentation system in radial channels developed for alignment of the temperature field from the suction and pressure sides. A numerical simulation of three-dimensional coolant flow for a wide range of Reynolds numbers was carried out using ANSYS CFX software. Effect of geometrical parameters on the heat removal asymmetry was determined. The test results of a blade with the proposed intensification system conducted in a liquid-metal thermostat confirmed the accuracy of calculations. Based on the experimental data, the dependencies for calculation of heat transfer coefficients to the cooling air in the blade studied were obtained.

  9. Qualitative research methods for medical educators.

    Science.gov (United States)

    Hanson, Janice L; Balmer, Dorene F; Giardino, Angelo P

    2011-01-01

    This paper provides a primer for qualitative research in medical education. Our aim is to equip readers with a basic understanding of qualitative research and prepare them to judge the goodness of fit between qualitative research and their own research questions. We provide an overview of the reasons for choosing a qualitative research approach and potential benefits of using these methods for systematic investigation. We discuss developing qualitative research questions, grounding research in a philosophical framework, and applying rigorous methods of data collection, sampling, and analysis. We also address methods to establish the trustworthiness of a qualitative study and introduce the reader to ethical concerns that warrant special attention when planning qualitative research. We conclude with a worksheet that readers may use for designing a qualitative study. Medical educators ask many questions that carefully designed qualitative research would address effectively. Careful attention to the design of qualitative studies will help to ensure credible answers that will illuminate many of the issues, challenges, and quandaries that arise while doing the work of medical education. Copyright © 2011 Academic Pediatric Association. All rights reserved.

  10. Geological Sequestration Training and Research Program in Capture and Transport: Development of the Most Economical Separation Method for CO2 Capture

    Energy Technology Data Exchange (ETDEWEB)

    Vahdat, Nader

    2013-09-30

    The project provided hands-on training and networking opportunities to undergraduate students in the area of carbon dioxide (CO2) capture and transport, through fundamental research study focused on advanced separation methods that can be applied to the capture of CO2 resulting from the combustion of fossil-fuels for power generation . The project team’s approach to achieve its objectives was to leverage existing Carbon Capture and Storage (CCS) course materials and teaching methods to create and implement an annual CCS short course for the Tuskegee University community; conduct a survey of CO2 separation and capture methods; utilize data to verify and develop computer models for CO2 capture and build CCS networks and hands-on training experiences. The objectives accomplished as a result of this project were: (1) A comprehensive survey of CO2 capture methods was conducted and mathematical models were developed to compare the potential economics of the different methods based on the total cost per year per unit of CO2 avoidance; and (2) Training was provided to introduce the latest CO2 capture technologies and deployment issues to the university community.

  11. Development of an intervention to reduce antibiotic use for childhood coughs in UK primary care using critical synthesis of multi-method research

    Directory of Open Access Journals (Sweden)

    Patricia J. Lucas

    2017-12-01

    Full Text Available Abstract Background Overuse of antibiotics contributes to the global threat of antimicrobial resistance. Antibiotic stewardship interventions address this threat by reducing the use of antibiotics in occasions or doses unlikely to be effective. We aimed to develop an evidence-based, theory-informed, intervention to reduce antibiotic prescriptions in primary care for childhood respiratory tract infections (RTI. This paper describes our methods for doing so. Methods Green and Krueter’s Precede/Proceed logic model was used as a framework to integrate findings from a programme of research including 5 systematic reviews, 3 qualitative studies, and 1 cohort study. The model was populated using a strength of evidence approach, and developed with input from stakeholders including clinicians and parents. Results The synthesis produced a series of evidence-based statements summarizing the quantitative and qualitative evidence for intervention elements most likely to result in changes in clinician behaviour. Current evidence suggests that interventions which reduce clinical uncertainty, reduce clinician/parent miscommunication, elicit parent concerns, make clear delayed or no-antibiotic recommendations, and provide clinicians with alternate treatment actions have the best chance of success. We designed a web-based within-consultation intervention to reduce clinician uncertainty and pressure to prescribe, designed to be used when children with RTI present to a prescribing clinician in primary care. Conclusions We provide a worked example of methods for the development of future complex interventions in primary care, where multiple factors act on multiple actors within a complex system. Our synthesis provided intervention guidance, recommendations for practice, and highlighted evidence gaps, but questions remain about how best to implement these recommendations. The funding structure which enabled a single team of researchers to work on a multi-method

  12. Research Methods in Healthcare Epidemiology: Survey and Qualitative Research.

    Science.gov (United States)

    Safdar, Nasia; Abbo, Lilian M; Knobloch, Mary Jo; Seo, Susan K

    2016-11-01

    Surveys are one of the most frequently employed study designs in healthcare epidemiology research. Generally easier to undertake and less costly than many other study designs, surveys can be invaluable to gain insights into opinions and practices in large samples and may be descriptive and/or be used to test associations. In this context, qualitative research methods may complement this study design either at the survey development phase and/or at the interpretation/extension of results stage. This methods article focuses on key considerations for designing and deploying surveys in healthcare epidemiology and antibiotic stewardship, including identification of whether or not de novo survey development is necessary, ways to optimally lay out and display a survey, denominator measurement, discussion of biases to keep in mind particularly in research using surveys, and the role of qualitative research methods to complement surveys. We review examples of surveys in healthcare epidemiology and antimicrobial stewardship and review the pros and cons of methods used. A checklist is provided to help aid design and deployment of surveys in healthcare epidemiology and antimicrobial stewardship. Infect Control Hosp Epidemiol 2016;1-6.

  13. Creative Research Methods - a reflective online discussion

    Directory of Open Access Journals (Sweden)

    Ruth Leary

    2014-03-01

    Full Text Available In November 2013, the Institute of Advanced Studies (University of Warwick hosted a meeting of interdisciplinary colleagues interested in Creative Research Methods. The aspirations were to kick-start the debate at Warwick and create a platform from which researchers can develop projects that embrace new forms of intellectual enquiry and knowledge production. Following the meeting, several of the attendees agreed to develop some of the discussion points and briefly responded to a number of questions in an online document over a period of a few weeks. This paper is the result of that real space and online collaboration.

  14. Final Report for research grant "Development of Methods for High Specific Activity Labeling of Biomolecules Using Astatine-211 in Different Oxidation States"

    Energy Technology Data Exchange (ETDEWEB)

    Wilbur, D. Scott [Univ. of Washington, Seattle, WA (United States)

    2011-12-14

    The overall objective of this research effort was to develop methods for labeling biomolecules with higher oxidation state species of At-211. This was to be done in an effort to develop reagents that had higher in vivo stability than the present carbon-bonded At-211-labeled compounds. We were unsuccessful in that effort, as none of the approaches studied provided reagents that were stable to in vivo deastatination. However, we gained a lot of information about At-211 in higher oxidation states. The studies proved to be very difficult as small changes in pH and other conditions appeared to change the nature of the species that obtained (by HPLC retention time analyses), with many of the species being unidentifiable. The fact that there are no stable isotopes of astatine, and the chemistry of the nearest halogen iodine is quite different, made it very difficult to interpret results of some experiments. With that said, we believe that a lot of valuable information was obtained from the studies. The research effort evaluated: (1) methods for chemical oxidation of At-211, (2) approaches to chelation of oxidized At-211, and (3) approaches to oxidation of astatophenyl compounds. A major hurdle that had to be surmounted to conduct the research was the development of HPLC conditions to separate and identify the various oxidized species formed. Attempts to develop conditions for separation of iodine and astatine species by normal and reversed-phase TLC and ITLC were not successful. However, we were successful in developing conditions (from a large number of attempts) to separate oxidized forms of iodine ([I-125]iodide, [I-125]iodate and [I-125]periodate) and astatine ([At-211]astatide, [At-211]astatate, [At-211]perastatate, and several unidentified At-211 species). Information on the basic oxidation and characterization of At-211 species is provided under Objective 1. Conditions were developed to obtain new At-211 labeling method where At-211 is chelated with the DOTA and

  15. Qualitative Methods in Mental Health Services Research

    Science.gov (United States)

    Palinkas, Lawrence A.

    2014-01-01

    Qualitative and mixed methods play a prominent role in mental health services research. However, the standards for their use are not always evident, especially for those not trained in such methods. This paper reviews the rationale and common approaches to using qualitative and mixed methods in mental health services and implementation research based on a review of the papers included in this special series along with representative examples from the literature. Qualitative methods are used to provide a “thick description” or depth of understanding to complement breadth of understanding afforded by quantitative methods, elicit the perspective of those being studied, explore issues that have not been well studied, develop conceptual theories or test hypotheses, or evaluate the process of a phenomenon or intervention. Qualitative methods adhere to many of the same principles of scientific rigor as quantitative methods, but often differ with respect to study design, data collection and data analysis strategies. For instance, participants for qualitative studies are usually sampled purposefully rather than at random and the design usually reflects an iterative process alternating between data collection and analysis. The most common techniques for data collection are individual semi-structured interviews, focus groups, document reviews, and participant observation. Strategies for analysis are usually inductive, based on principles of grounded theory or phenomenology. Qualitative methods are also used in combination with quantitative methods in mixed method designs for convergence, complementarity, expansion, development, and sampling. Rigorously applied qualitative methods offer great potential in contributing to the scientific foundation of mental health services research. PMID:25350675

  16. Nuclear methods in environmental and energy research

    Energy Technology Data Exchange (ETDEWEB)

    Vogt, J. R. [ed.

    1977-01-01

    The topics considered in the seven sessions were nuclear methods in atmospheric research; nuclear and atomic methodology; nuclear methods in tracer applications; energy exploration, production, and utilization; nuclear methods in environmental monitoring; nuclear methods in water research; and nuclear methods in biological research. Individual abstracts were prepared for each paper. (JSR)

  17. Laboratory directed research and development

    Energy Technology Data Exchange (ETDEWEB)

    1991-11-15

    The purposes of Argonne's Laboratory Directed Research and Development (LDRD) Program are to encourage the development of novel concepts, enhance the Laboratory's R D capabilities, and further the development of its strategic initiatives. Among the aims of the projects supported by the Program are establishment of engineering proof-of-principle''; development of an instrumental prototype, method, or system; or discovery in fundamental science. Several of these project are closely associated with major strategic thrusts of the Laboratory as described in Argonne's Five Year Institutional Plan, although the scientific implications of the achieved results extend well beyond Laboratory plans and objectives. The projects supported by the Program are distributed across the major programmatic areas at Argonne. Areas of emphasis are (1) advanced accelerator and detector technology, (2) x-ray techniques in biological and physical sciences, (3) advanced reactor technology, (4) materials science, computational science, biological sciences and environmental sciences. Individual reports summarizing the purpose, approach, and results of projects are presented.

  18. Translational Research and Youth Development

    Science.gov (United States)

    Hamilton, Stephen F.

    2015-01-01

    Borrowing the term "translational research" (TR) from medicine, along with some of the ideas and practices that define it, holds promise as a way of linking research more closely to the practice of youth development. However, doing so entails substantial adaptation. TR is more than a new name for applied research. It comprehends the…

  19. Ethiopian Journal of Development Research

    African Journals Online (AJOL)

    Log in or Register to get access to full text downloads. ... The Ethiopian Journal of Development Research (EJDR) is a bi-annual journal devoted to ... It is devoted to the multi-disciplinary study of development problems of Ethiopia in particular ... for Researchers · for Librarians · for Authors · FAQ's · More about AJOL · AJOL's ...

  20. Measurement Method and Empirical Research on the Sustainable Development Capability of a Regional Industrial System Based on Ecological Niche Theory in China

    Directory of Open Access Journals (Sweden)

    Hang Yin

    2014-11-01

    Full Text Available From the analytical view of a recycling economy, the regional system achieves the goal of sustainable development through improving resource utilization efficiency, reducing energy consumption and ameliorating the quality of water and air. The regional economic system’s potential for sustainable development is significantly influenced by regional industrial operational efficiency, which measures the cost of ecology, environment, energy and resources accompanying the economic growth. It is vital for national and regional governments to accelerate harmonious development between products of industrial department, consumption of energy and pollutants discharged. Under the guidance of ecological niche theory and recycling economy theory, the theoretical analysis on efficient relations between regional industrial growth, energy consumption, resources utilization and environmental carrying capacity has been carried out from horizontal and vertical respects. Industrial operational efficiency and the sensitivity coefficient in response to the change of every input and output index can be calculated and critical factors, which restrict sustainable development capability, can be found out so that quantitative references could be provided for administrative decisions. As for the measurement method, a super efficiency mixed data envelopment analysis model, which wipes off self-limited condition and either contains both meeting cone characteristic indexes or not, has been established and applied. Statistics from 1993 to 2012 in China are collected to carry out empirical research. On the basis of further analysis, an adjustment strategy can be constituted to improve the capability for sustainable development.

  1. Research into real-option evaluation method

    International Nuclear Information System (INIS)

    Shiba, Tsuyoshi; Wakamatsu, Hitoshi

    2002-03-01

    As an evaluational method for valuation of a corporation, an investment project, a research and development, or the evaluation technique of an enterprise strategy, a real option analysis attracts attention instead of conventional Discount Cash Flow method. The reason is that it can divert the technique for the option valuation in financial engineering to the decision-making process performed according to change in investment environment. Related references, the analysis tools, the application examples, etc. were investigated about the decision-making technique using real option analysis, and this investigation considered the application method to decision-making of the research and development at Japan Nuclear Cycle Development Institute. Consequently, since the feature is in real option analysis being the evaluation technique on condition of that business conditions and business itself also change, the real option analysis fits for evaluation of a research and development that business conditions were opaque and it turns out that the businesses are highly flexible. Moreover, it turns out that it fits also for evaluation of a capital concentration type investment issue like power plants. (author)

  2. Mixed methods research in mental health nursing.

    Science.gov (United States)

    Kettles, A M; Creswell, J W; Zhang, W

    2011-08-01

    Mixed methods research is becoming more widely used in order to answer research questions and to investigate research problems in mental health and psychiatric nursing. However, two separate literature searches, one in Scotland and one in the USA, revealed that few mental health nursing studies identified mixed methods research in their titles. Many studies used the term 'embedded' but few studies identified in the literature were mixed methods embedded studies. The history, philosophical underpinnings, definition, types of mixed methods research and associated pragmatism are discussed, as well as the need for mixed methods research. Examples of mental health nursing mixed methods research are used to illustrate the different types of mixed methods: convergent parallel, embedded, explanatory and exploratory in their sequential and concurrent combinations. Implementing mixed methods research is also discussed briefly and the problem of identifying mixed methods research in mental and psychiatric nursing are discussed with some possible solutions to the problem proposed. © 2011 Blackwell Publishing.

  3. Tradeoffs in Design Research: Development Oriented Triangulation

    NARCIS (Netherlands)

    Koen van Turnhout; Sabine Craenmehr; Robert Holwerda; Mark Menijn; Jan-Pieter Zwart; René Bakker

    2013-01-01

    The Development Oriented Triangulation (DOT) framework in this paper can spark and focus the debate about mixed-method approaches in HCI. The framework can be used to classify HCI methods, create mixed-method designs, and to align research activities in multidisciplinary projects. The framework is

  4. Mathematics and computational methods development in U.S. department of energy-sponsored research (nuclear energy research initiative and nuclear engineering education research). 4. Development of an Expert System for Generation of an Effective Mesh Distribution for the SN Method

    International Nuclear Information System (INIS)

    Patchimpattapong, Apisit; Haghighat, Alireza

    2001-01-01

    The discrete ordinates (S N ) method is widely used to obtain numerical solutions of the transport equation. The method calls for discretization of spatial, energy, and angular variables. To generate an 'effective' spatial mesh distribution, one has to consider various factors including particle mean free path (mfp), material and source discontinuities, and problem objectives. This becomes more complicated if we consider the effect of numerics such as differencing schemes, parallel processing strategies, and computation resources. As a result, one may often over/under-mesh depending upon limitations on accuracy, computing resources, and time allotted. To overcome the foregoing issues, we are developing an expert system for input preparation of the discrete ordinates (S N ) method. This project is a part of an ongoing project sponsored by Nuclear Engineering Education Research. Our expert system consists of two parts: (a) an algorithm for generation of a mesh distribution for a serial calculation and (b) an algorithm for extension to parallel computing, which accounts for parallelization parameters including granularity, load balancing, parallel algorithms, and possible architectural issues. Thus far, we have developed a stand-alone algorithm for generation of an 'effective' mesh distribution for a serial calculation. The algorithm has been successfully tested with the Parallel Environment Neutral-Particle Transport (PENTRAN) code system. In this paper, we discuss the structure of our algorithm and present its use for simulating the VENUS-3 experimental facility. To date, we have developed and tested part 1 of this system. This part comprises of four steps: creation of a geometric model and coarse meshes, calculation of un-collided flux, selection of differencing schemes, and generation of fine-mesh distribution. For the un-collided flux calculation, we have developed a parallel code called PENFC. It is capable of calculating un-collided and first-collision fluxes

  5. Reliability and risk analysis methods research plan

    International Nuclear Information System (INIS)

    1984-10-01

    This document presents a plan for reliability and risk analysis methods research to be performed mainly by the Reactor Risk Branch (RRB), Division of Risk Analysis and Operations (DRAO), Office of Nuclear Regulatory Research. It includes those activities of other DRAO branches which are very closely related to those of the RRB. Related or interfacing programs of other divisions, offices and organizations are merely indicated. The primary use of this document is envisioned as an NRC working document, covering about a 3-year period, to foster better coordination in reliability and risk analysis methods development between the offices of Nuclear Regulatory Research and Nuclear Reactor Regulation. It will also serve as an information source for contractors and others to more clearly understand the objectives, needs, programmatic activities and interfaces together with the overall logical structure of the program

  6. Provincial resource development research policy

    Energy Technology Data Exchange (ETDEWEB)

    Flock, D L

    1976-01-01

    In Alberta, there is an abundance of oil, natural gas, and coal. But only a small portion of the Alberta oil sands and coal resources are commercially accessible to surface-mining techniques. It is quite apparent that some in-situ technological breakthrough will be required, which will mean a concerted research effort at the provincial level. It is the purpose of this paper to present certain concepts and recommendations for a coordinated provincial resource development research policy for the Province of Alberta. Research as discussed in this paper covers basic and applied research and development. (MCW)

  7. Research and development toward Monju

    International Nuclear Information System (INIS)

    Nakamoto, Koichiro; Ikegami, Tetsuo; Sikakura, Sakae; Iwata, Koji; Yamaguchi, Katsuhisa; Kodaira, Kiyoshi

    1994-01-01

    Power Reactor and Nuclear Fuel Development Corporation aimed at the development of the experimental FBR ''Joyo'' and the prototype FBR ''Monju'', and has promoted the research and development of respective fields of reactor physics, shielding, fuel, safety, sodium technology, machinery and equipment, structural materials, measurement and control by cooperating with Japan Atomic Energy Research Institute, universities, national and public research institutes, electric power and manufacturing companies. Also the promotion of the development by international cooperation has been carried out positively. As for the core and fuel, the Japan-UK joint research ''MOZART project'' for the increase of reactor power output and the heightening of fuel burnup, and the test of MOX fuel, as for machinery, equipment and structure, the rationalization of structural design, the development of steam generator, the test with sodium testing facility, and as for safety, the test on the events related to the core, decay heat removing system and containment system were carried out. (K.I.)

  8. Educational research methods for researching innovations in teaching, learning and assessment: The nursing lecturer as researcher.

    Science.gov (United States)

    Marks-Maran, Diane

    2015-11-01

    The author, who has had previous experience as a nurse researcher, has been engaged in helping nurse lecturers to undertake evaluation research studies into innovations in their teaching, learning and assessment methods. In order to undertake this work successfully, it was important to move from thinking like a nurse researcher to thinking like an educational researcher and developing the role of the nursing lecturer as researcher of their teaching. This article explores the difference between evaluation and evaluation research and argues for the need to use educational research methods when undertaking evaluation research into innovations in teaching, learning and assessment. A new model for educational evaluation research is presented together with two case examples of the model in use. The model has been tested on over 30 research studies into innovations in teaching, learning and assessment over the past 8 years. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. Handbook of Research Methods in Social and Personality Psychology

    Science.gov (United States)

    Reis, Harry T.; Judd, Charles M.

    2000-03-01

    This volume provides an overview of research methods in contemporary social psychology. Coverage includes conceptual issues in research design, methods of research, and statistical approaches. Because the range of research methods available for social psychology have expanded extensively in the past decade, both traditional and innovative methods are presented. The goal is to introduce new and established researchers alike to new methodological developments in the field.

  10. ADDRESSING RESEARCH DESIGN PROBLEM IN MIXED METHODS RESEARCH

    OpenAIRE

    Hamed ALAVI; Patrycja HĄBEK

    2016-01-01

    Alongside other disciplines in social sciences, management researchers use mixed methods research more and more in conduct of their scientific investigations. Mixed methods approach can also be used in the field of production engineering. In comparison with traditional quantitative and qualitative research methods, reasons behind increasing popularity of mixed research method in management science can be traced in different factors. First of all, any particular discipline in management can be...

  11. Development of partitioning method

    International Nuclear Information System (INIS)

    Kobayashi, Tsutomu; Shirahashi, Koichi; Kubota, Masumitsu

    1989-11-01

    Precipitation behavior of elements in a high-level liquid waste (HLW) was studied by using the simulated liquid waste, when the transuranic elements group was precipitated and separated as oxalate from HLW generated from the reprocessing of spent nuclear fuel. The results showed that over 90 % of strontium and barium were precipitated when oxalic acid was directly added to HLW to precipitate the transuranic elements group, and the percentages of these elements precipitated were affected by molybdenum and or zirconium. Therefore, a method of adding oxalic acid into the filtrate was studied after removing previously molybdenum and zirconium as precipitate by denitrating HLW, and it was found that precipitated fractions of strontium and barium could be suppressed about 10 %. Adding oxalic acid under the co-existance of ascorbic acid is effective for quantitative precipitation of neptunium in HLW. In this case, it was found that adding ascorbic acid had little influence on precipitation behavior of the other elements except palladium. (author)

  12. Proteomics in pulmonary research: selected methodical aspects

    Directory of Open Access Journals (Sweden)

    Martin Petrek

    2007-10-01

    Full Text Available Recent years witness rapid expansion of applications of proteomics to clinical research including non-malignant lung disorders. These developments bring along the need for standardisation of proteomic experiments. This paper briefly reviews basic methodical aspects of appliedproteomic studies using SELDI-TOF mass spectrometry platform as example but also emphasizes general aspects of quality assurance in proteomics. Key-words: lung proteome, quality assurance, SELDI-TOF MS

  13. RDandD Programme 2007. Programme for research, development and demonstration of methods for the management and disposal of nuclear waste

    International Nuclear Information System (INIS)

    2007-09-01

    The programme describes in general terms the planned measures and the facilities that are needed for the task, with a focus on the plans for the period 2008-2013. The period of immediate concern is 2008-2010. The level of detail for the three subsequent years is naturally lower. The programme provides a basis for designing systems to manage and dispose of the radioactive waste from the nuclear power plants. SKB intends to dispose of the spent nuclear fuel in accordance with the KBS-3 method. In the RDandD Programme we describe our activities and the planning for it. We also deal with societal research and other methods for disposal of spent nuclear fuel. The planning for low- and intermediate-level waste, as well as for the societal research, is presented in separate parts. The upcoming review of the programme can contribute valuable outside viewpoints. The regulatory authorities and the Government can clarify how they view different parts of the activity. Municipalities and other stakeholders can, after studying the programme, offer their viewpoints to SKB, the regulatory authorities or the Government. The most important milestone during the coming three-year period is to submit applications under the Nuclear Activities Act for the final repository for spent nuclear fuel and under the Environmental Code for the final repository system. RDandD programme 2007 therefore focuses on the technology development that is needed to realize the final repository for spent nuclear fuel. The site investigations in Forsmark and Laxemar will be concluded in 2007. The work of compiling the applications for the final repository is under way. In contrast to the immediately preceding programmes, RDandD Programme 2007 therefore also contains a summary of the site investigation phase and a look ahead at the steps that remain before the final repository can be put into operation. RDandD Programme 2007 consists of six parts: Part I SKB's plan of action; Part II Final repository for spent

  14. RDandD Programme 2007. Programme for research, development and demonstration of methods for the management and disposal of nuclear waste

    Energy Technology Data Exchange (ETDEWEB)

    2007-09-15

    The programme describes in general terms the planned measures and the facilities that are needed for the task, with a focus on the plans for the period 2008-2013. The period of immediate concern is 2008-2010. The level of detail for the three subsequent years is naturally lower. The programme provides a basis for designing systems to manage and dispose of the radioactive waste from the nuclear power plants. SKB intends to dispose of the spent nuclear fuel in accordance with the KBS-3 method. In the RDandD Programme we describe our activities and the planning for it. We also deal with societal research and other methods for disposal of spent nuclear fuel. The planning for low- and intermediate-level waste, as well as for the societal research, is presented in separate parts. The upcoming review of the programme can contribute valuable outside viewpoints. The regulatory authorities and the Government can clarify how they view different parts of the activity. Municipalities and other stakeholders can, after studying the programme, offer their viewpoints to SKB, the regulatory authorities or the Government. The most important milestone during the coming three-year period is to submit applications under the Nuclear Activities Act for the final repository for spent nuclear fuel and under the Environmental Code for the final repository system. RDandD programme 2007 therefore focuses on the technology development that is needed to realize the final repository for spent nuclear fuel. The site investigations in Forsmark and Laxemar will be concluded in 2007. The work of compiling the applications for the final repository is under way. In contrast to the immediately preceding programmes, RDandD Programme 2007 therefore also contains a summary of the site investigation phase and a look ahead at the steps that remain before the final repository can be put into operation. RDandD Programme 2007 consists of six parts: Part I SKB's plan of action; Part II Final repository for spent

  15. RDandD Programme 2007. Programme for research, development and demonstration of methods for the management and disposal of nuclear waste

    Energy Technology Data Exchange (ETDEWEB)

    2007-09-15

    The programme describes in general terms the planned measures and the facilities that are needed for the task, with a focus on the plans for the period 2008-2013. The period of immediate concern is 2008-2010. The level of detail for the three subsequent years is naturally lower. The programme provides a basis for designing systems to manage and dispose of the radioactive waste from the nuclear power plants. SKB intends to dispose of the spent nuclear fuel in accordance with the KBS-3 method. In the RDandD Programme we describe our activities and the planning for it. We also deal with societal research and other methods for disposal of spent nuclear fuel. The planning for low- and intermediate-level waste, as well as for the societal research, is presented in separate parts. The upcoming review of the programme can contribute valuable outside viewpoints. The regulatory authorities and the Government can clarify how they view different parts of the activity. Municipalities and other stakeholders can, after studying the programme, offer their viewpoints to SKB, the regulatory authorities or the Government. The most important milestone during the coming three-year period is to submit applications under the Nuclear Activities Act for the final repository for spent nuclear fuel and under the Environmental Code for the final repository system. RDandD programme 2007 therefore focuses on the technology development that is needed to realize the final repository for spent nuclear fuel. The site investigations in Forsmark and Laxemar will be concluded in 2007. The work of compiling the applications for the final repository is under way. In contrast to the immediately preceding programmes, RDandD Programme 2007 therefore also contains a summary of the site investigation phase and a look ahead at the steps that remain before the final repository can be put into operation. RDandD Programme 2007 consists of six parts: Part I SKB's plan of action; Part II Final repository for

  16. Using a Community-Engaged Research (CEnR) approach to develop and pilot a photo grid method to gain insights into early child health and development in a socio-economic disadvantaged community.

    Science.gov (United States)

    Lowrie, Emma; Tyrrell-Smith, Rachel

    2017-01-01

    This paper reports on the use of a Community-Engaged Research (CEnR) approach to develop a new research tool to involve members of the community in thinking about priorities for early child health and development in a deprived area of the UK. The CEnR approach involves researchers, professionals and members of the public working together during all stages of research and development.Researchers used a phased approach to the development of a Photo Grid tool including reviewing tools which could be used for community engagement, and testing the new tool based on feedback from workshops with local early years professionals and parents of young children.The Photo Grid tool is a flat square grid on which photo cards can be placed. Participants were asked to pace at the top of the grid the photos they considered most important for early child health and development, working down to the less important ones at the bottom. The findings showed that the resulting Photo Grid tool was a useful and successful method of engaging with the local community. The evidence for this is the high numbers of participants who completed a pilot study and who provided feedback on the method. By involving community members throughout the research process, it was possible to develop a method that would be acceptable to the local population, thus decreasing the likelihood of a lack of engagement. The success of the tool is therefore particularly encouraging as it engages "seldom heard voices," such as those with low literacy. The aim of this research was to consult with professionals and parents to develop a new research toolkit (Photo Grid), to understand community assets and priorities in relation to early child health and development in Blackpool, a socio-economic disadvantaged community. A Community-Engaged Research (CEnR) approach was used to consult with community members. This paper describes the process of using a CEnR approach in developing a Photo Grid toolkit. A phased CEnR approach

  17. Nuclear methods in environmental and energy research

    International Nuclear Information System (INIS)

    Vogt, J.R.

    1980-01-01

    A total of 75 papers were presented on nuclear methods for analysis of environmental and biological samples. Sessions were devoted to software and mathematical methods; nuclear methods in atmospheric and water research; nuclear and atomic methodology; nuclear methods in biology and medicine; and nuclear methods in energy research

  18. Nuclear methods in environmental and energy research

    Energy Technology Data Exchange (ETDEWEB)

    Vogt, J R [ed.

    1980-01-01

    A total of 75 papers were presented on nuclear methods for analysis of environmental and biological samples. Sessions were devoted to software and mathematical methods; nuclear methods in atmospheric and water research; nuclear and atomic methodology; nuclear methods in biology and medicine; and nuclear methods in energy research.

  19. Software Development as Music Education Research

    Science.gov (United States)

    Brown, Andrew R.

    2007-01-01

    This paper discusses how software development can be used as a method for music education research. It explains how software development can externalize ideas, stimulate action and reflection, and provide evidence to support the educative value of new software-based experiences. Parallels between the interactive software development process and…

  20. Modelization of physical phenomena in research reactors with the help of new developments in transport methods, and methodology validation with experimental data

    International Nuclear Information System (INIS)

    Rauck, St.

    2000-10-01

    The aim of this work is to develop a scheme for experimental reactors, based on transport equations. This type of reactors is characterized by a small core, a complex, very heterogeneous geometry and a large leakage. The possible insertion of neutron beams in the reflector and the presence of absorbers in the core increase the difficulty of the 3D-geometrical description and the physical modeling of the component parameters of the reactor. The Orphee reactor has been chosen for our study. Physical models (homogenization, collapsing cross section in few groups, albedo multigroup condition) have been developed in the APOLLO2 and CRONOS2 codes to calculate flux and power maps in a 3D-geometry, with different burnup and through transport equations. Comparisons with experimental measurements have shown the interest of taking into account anisotropy, steep flux gradients by using Sn methods, and on the other hand using a 12-group cross section library. The modeling of neutron beams has been done outside the core modeling through Monte Carlo calculations and with the total geometry, including a large thickness of heavy water. Thanks to this calculations, one can evaluate the neutron beams anti-reactivity and determinate the core cycle. We assure these methods more accurate than usual transport-diffusion calculations will be used for the conception of new research reactors. (author)

  1. Research on the recycling industry development model for typical exterior plastic components of end-of-life passenger vehicle based on the SWOT method.

    Science.gov (United States)

    Zhang, Hongshen; Chen, Ming

    2013-11-01

    In-depth studies on the recycling of typical automotive exterior plastic parts are significant and beneficial for environmental protection, energy conservation, and sustainable development of China. In the current study, several methods were used to analyze the recycling industry model for typical exterior parts of passenger vehicles in China. The strengths, weaknesses, opportunities, and challenges of the current recycling industry for typical exterior parts of passenger vehicles were analyzed comprehensively based on the SWOT method. The internal factor evaluation matrix and external factor evaluation matrix were used to evaluate the internal and external factors of the recycling industry. The recycling industry was found to respond well to all the factors and it was found to face good developing opportunities. Then, the cross-link strategies analysis for the typical exterior parts of the passenger car industry of China was conducted based on the SWOT analysis strategies and established SWOT matrix. Finally, based on the aforementioned research, the recycling industry model led by automobile manufacturers was promoted. Copyright © 2013 Elsevier Ltd. All rights reserved.

  2. A Framework for Teaching Software Development Methods

    Science.gov (United States)

    Dubinsky, Yael; Hazzan, Orit

    2005-01-01

    This article presents a study that aims at constructing a teaching framework for software development methods in higher education. The research field is a capstone project-based course, offered by the Technion's Department of Computer Science, in which Extreme Programming is introduced. The research paradigm is an Action Research that involves…

  3. Using mixed methods in health research.

    OpenAIRE

    Tariq, S.; Woodman, J.

    2013-01-01

    Mixed methods research is the use of quantitative and qualitative methods in a single study or series of studies. It is an emergent methodology which is increasingly used by health researchers, especially within health services research. There is a growing literature on the theory, design and critical appraisal of mixed methods research. However, there are few papers that summarize this methodological approach for health practitioners who wish to conduct or critically engage with mixed method...

  4. Cancer Research UK | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Cancer Research UK. Cancer Research UK. https://www.cancerresearchuk.org/. The Economics of Tobacco Control Research Initiative. The Economics of Tobacco Control Research Initiative funds innovative fiscal policy research supporting tobacco control in low and middle-income countries. View more. The Economics ...

  5. Using standardized methods for research on HIV and injecting drug use in developing/transitional countries: case study from the WHO Drug Injection Study Phase II

    Directory of Open Access Journals (Sweden)

    Stimson Gerry V

    2006-03-01

    Full Text Available Abstract Background Successful cross-national research requires methods that are both standardized across sites and adaptable to local conditions. We report on the development and implementation of the methodology underlying the survey component of the WHO Drug Injection Study Phase II – a multi-site study of risk behavior and HIV seroprevalence among Injecting Drug Users (IDUs. Methods Standardized operational guidelines were developed by the Survey Coordinating Center in collaboration with the WHO Project Officer and participating site Investigators. Throughout the duration of the study, survey implementation at the local level was monitored by the Coordinating Center. Surveys were conducted in 12 different cities. Prior rapid assessment conducted in 10 cities provided insight into local context and guided survey implementation. Where possible, subjects were recruited both from drug abuse treatment centers and via street outreach. While emphasis was on IDUs, non-injectors were also recruited in cities with substantial non-injecting use of injectable drugs. A structured interview and HIV counseling/testing were administered. Results Over 5,000 subjects were recruited. Subjects were recruited from both drug treatment and street outreach in 10 cities. Non-injectors were recruited in nine cities. Prior rapid assessment identified suitable recruitment areas, reduced drug users' distrust of survey staff, and revealed site-specific risk behaviors. Centralized survey coordination facilitated local questionnaire modification within a core structure, standardized data collection protocols, uniform database structure, and cross-site analyses. Major site-specific problems included: questionnaire translation difficulties; locating affordable HIV-testing facilities; recruitment from drug treatment due to limited/selective treatment infrastructure; access to specific sub-groups of drug users in the community, particularly females or higher income groups

  6. Participatory design methods in telemedicine research

    DEFF Research Database (Denmark)

    Danbjørg, Dorthe Boe; Clemensen, Jane; Rothmann, Mette Juel

    together with the patients. Participatory design is a research design and methodology that encourages the participation of users in the design process of technological solutions. Therefore, it has a potential for designing technologies that actually reflect the needs of the users, why it is relevant within...... telemedicine. The aim of this presentation is to explain the process and theoretical framework of a PD project; give an example of a project including the applied methods, and to determine its application to telemedicine with focus on the rationale for genuine participation. Theory: Participation implies....... Methods: Key activities of a Participatory Design project comprise methods such as fieldwork; literature reviewing; development and testing, and user activities as workshops. Methods that support telling, making, enacting. For instance telling activities as drivers for participation, where practitioners...

  7. Teaching Qualitative Research Methods Using "Undercover Boss"

    Science.gov (United States)

    Graham, LaKresha; Schuwerk, Tara J.

    2017-01-01

    Course(s): Research Methods, Qualitative Research Methods, Organizational Communication, Business Communication. Objectives: After completing this class exercise, students should be able to identify the major components of a qualitative research study, along with the ethical dilemmas that come with doing qualitative research.

  8. Action Research Methods: Plain and Simple

    Science.gov (United States)

    Klein, Sheri R., Ed.

    2012-01-01

    Among the plethora of action research books on the market, there is no one text exclusively devoted to understanding how to acquire and interpret research data. Action Research Methods provides a balanced overview of the quantitative and qualitative methodologies and methods for conducting action research within a variety of educational…

  9. Fundamental research in developing countries

    International Nuclear Information System (INIS)

    Moravesik, M.J.

    1964-01-01

    Technical assistance is today a widespread activity. Large numbers of persons with special qualifications in the applied sciences go to the developing countries to work on specific research and development projects, as do educationists on Fulbright or other programmes - usually to teach elementary or intermediate courses. But I believe that until now it has been rare for a person primarily interested in fundamental research to go to one of these countries to help build up advanced education and pure research work. Having recently returned from such an assignment, and having found it a most stimulating and enlightening experience, I feel moved to urge strongly upon others who may be in a position to do so that they should seek similar experience themselves. The first step is to show that advanced education and fundamental research are badly needed in the under-developed countries.

  10. Development research: The environmental challenge

    International Nuclear Information System (INIS)

    Winpenny, J.T.

    1991-01-01

    This book represents papers from a 1990 conference 'The environment, Development and Economic Research'. The focus of the book is the environmental and natural resource use problems, though economic development is a strong co-theme. Chapters cover the following topic areas: international issues; macroeconomic policies; natural resource degradation; urban problems; social dimensions; bio-diversity; energy; economic valuation

  11. Addressing Research Design Problem in Mixed Methods Research

    Science.gov (United States)

    Alavi, Hamed; Hąbek, Patrycja

    2016-03-01

    Alongside other disciplines in social sciences, management researchers use mixed methods research more and more in conduct of their scientific investigations. Mixed methods approach can also be used in the field of production engineering. In comparison with traditional quantitative and qualitative research methods, reasons behind increasing popularity of mixed research method in management science can be traced in different factors. First of all, any particular discipline in management can be theoretically related to it. Second is that concurrent approach of mixed research method to inductive and deductive research logic provides researchers with opportunity to generate theory and test hypothesis in one study simultaneously. In addition, it provides a better justification for chosen method of investigation and higher validity for obtained answers to research questions. Despite increasing popularity of mixed research methods among management scholars, there is still need for a comprehensive approach to research design typology and process in mixed research method from the perspective of management science. The authors in this paper try to explain fundamental principles of mixed research method, its typology and different steps in its design process.

  12. The Impact of the 5E Teaching Model on Changes in Neuroscience, Drug Addiction, and Research Methods Knowledge of Science Teachers Attending California's ARISE Professional Development Workshops

    Science.gov (United States)

    Manzo, Rosa D.; Whent, Linda; Liets, Lauren; de la Torre, Adela; Gomez-Camacho, Rosa

    2016-01-01

    This study examined how science teachers' knowledge of research methods, neuroscience and drug addiction changed through their participation in a 5-day summer science institute. The data for this study evolved from a four-year NIH funded science education project called Addiction Research and Investigation for Science Educators (ARISE). Findings…

  13. Nuclear methods in coal research

    International Nuclear Information System (INIS)

    Lyon, W.S.

    1980-01-01

    Nuclear methods, particularly neutron activation analysis (NAA) provide useful information about elemental constituents in coal and fly ash, but often other techniques are required to supplement NAA data. Spark source mass spectrometry and atomic absorption have been studied as methods for determination of certain elements in coal that are not easily measured by NAA. In work concerned with the chemical speciation of elements in fly ash, a number of analytical techniques have been used; these include NAA, chemical etching and separation, optical and electron microscopy and x-ray diffraction

  14. Publications | Page 86 | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Results 851 - 860 of 6372 ... Through books, articles, research publications, and studies, we aim to widen the impact of our investment and advance development research. ... Global pathways to men's caregiving: mixed methods findings from the international men and gender equality survey and the men who care study ...

  15. Statistical methods in personality assessment research.

    Science.gov (United States)

    Schinka, J A; LaLone, L; Broeckel, J A

    1997-06-01

    Emerging models of personality structure and advances in the measurement of personality and psychopathology suggest that research in personality and personality assessment has entered a stage of advanced development, in this article we examine whether researchers in these areas have taken advantage of new and evolving statistical procedures. We conducted a review of articles published in the Journal of Personality, Assessment during the past 5 years. Of the 449 articles that included some form of data analysis, 12.7% used only descriptive statistics, most employed only univariate statistics, and fewer than 10% used multivariate methods of data analysis. We discuss the cost of using limited statistical methods, the possible reasons for the apparent reluctance to employ advanced statistical procedures, and potential solutions to this technical shortcoming.

  16. Research and development program 1985

    International Nuclear Information System (INIS)

    1984-01-01

    In this report the research and development program of the GSI Darmstadt is described. It concerns heavy ion reactions, nuclear structure studies, exotic nuclei, nuclear theory, atomic collisions with heavy ions, atomic spectroscopy, the interaction of heavy ions with matter, atomic theory, biological studies with heavy ions, nuclear track techniques, UNILAC developments, acquisition of experimental data, and the development of new accelerators, ion sources, targets, and detectors. (HSI) [de

  17. Developing the Model of "Pedagogical Art Communication" Using Social Phenomenological Analysis: An Introduction to a Research Method and an Example for Its Outcome

    Science.gov (United States)

    Hofmann, Fabian

    2016-01-01

    Social phenomenological analysis is presented as a research method for museum and art education. After explaining its methodological background, it is shown how this method has been applied in a study of gallery talks or guided tours in art museums: Analyzing the situation by description and interpretation, a model for understanding gallery talks…

  18. Research methods for subgrouping low back pain

    DEFF Research Database (Denmark)

    Kent, Peter; Keating, Jennifer L; Leboeuf-Yde, Charlotte

    2010-01-01

    important distinctions in their treatment needs or prognoses. Due to a proliferation of research methods and variability in how subgrouping results are interpreted, it is timely to open discussion regarding a conceptual framework for the research designs and statistical methods available for subgrouping...... studies (a method framework). The aims of this debate article are: (1) to present a method framework to inform the design and evaluation of subgrouping research in low back pain, (2) to describe method options when investigating prognostic effects or subgroup treatment effects, and (3) to discuss...... the strengths and limitations of research methods suitable for the hypothesis-setting phase of subgroup studies....

  19. Cancer Data and Aboriginal Disparities (CanDAD)—developing an Advanced Cancer Data System for Aboriginal people in South Australia: a mixed methods research protocol

    Science.gov (United States)

    Yerrell, Paul Henry; Roder, David; Cargo, Margaret; Reilly, Rachel; Banham, David; Micklem, Jasmine May; Morey, Kim; Stewart, Harold Bundamurra; Stajic, Janet; Norris, Michael; Brown, Alex

    2016-01-01

    Introduction In Australia, Aboriginal and Torres Strait Islander People carry a greater burden of cancer-related mortality than non-Aboriginal Australians. The Cancer Data and Aboriginal Disparities Project aims to develop and test an integrated, comprehensive cancer monitoring and surveillance system capable of incorporating epidemiological and narrative data to address disparities and advocate for clinical system change. Methods and analysis The Advanced Cancer Data System will integrate routinely collected unit record data from the South Australian Population Cancer Registry and a range of other data sources for a retrospective cohort of indigenous people with cancers diagnosed from 1990 to 2010. A randomly drawn non-Aboriginal cohort will be matched by primary cancer site, sex, age and year at diagnosis. Cross-tabulations and regression analyses will examine the extent to which demographic attributes, cancer stage and survival vary between the cohorts. Narratives from Aboriginal people with cancer, their families, carers and service providers will be collected and analysed using patient pathway mapping and thematic analysis. Statements from the narratives will structure both a concept mapping process of rating, sorting and prioritising issues, focusing on issues of importance and feasibility, and the development of a real-time Aboriginal Cancer Measure of Experience for ongoing linkage with epidemiological data in the Advanced Cancer Data System. Aboriginal Community engagement underpins this Project. Ethics and dissemination The research has been approved by relevant local and national ethics committees. Findings will be disseminated in local and international peer-reviewed journals and conference presentations. In addition, the research will provide data for knowledge translation activities across the partner organisations and feed directly into the Statewide Cancer Control Plan. It will provide a mechanism for monitoring and evaluating the implementation of

  20. Doctoral research on cadastral development

    DEFF Research Database (Denmark)

    Cagdas, Volkan; Stubkjær, Erik

    2009-01-01

    of the countries concerned. The cadastre, however, is the core of both systems as it provides for systematic and official descriptions of land parcels or real property units. The research mentioned often has a development perspective, and in this article we will motivate the introduction of the research domain...... of cadastral development. This research is multi-disciplinary and draws on elements of theories and methodologies from the natural, the social, the behavioral, and the formal sciences. During the last decade or so, doctoral dissertations have come to constitute a substantial part of this research effort...... with a call for a shared terminology and a shared set of concepts which may contribute to further theory building within the cadastral domain. Udgivelsesdato: OCT...

  1. Qualitative Methods in Drug Utilization Research

    DEFF Research Database (Denmark)

    Almarsdóttir, Anna Birna; Bastholm Rahmner, Pia

    2016-01-01

    Qualitative research methods derive from the social sciences. Their use in drug utilization research is increasingly widespread, especially in understanding patient and prescriber perspectives. The main focus in qualitative research is exploration of a given phenomenon in order to get a wider...... understanding of why and how it appears. Qualitative research methods build on various theoretical underpinnings/schools of thought. The same validity and quality criteria cannot be used for both qualitative and quantitative methods....

  2. DESIGNING THE STRATEGIES FOR SOCIO-ECONOMIC DEVELOPMENT OF MUNICIPALITY DISTRICTS ON THE BASIS OF SYNTHESIS METHODS FOR COMPLEX SYSTEMS RESEARCH

    Directory of Open Access Journals (Sweden)

    Sergey N. Isaev

    2014-01-01

    Full Text Available The article presents the results of research work on designing the strategies for socio-economic development for the Sholokhovskiy municipal district of Rostov region and Chusovskoy municipal district of Perm Region, which was made by research team of autonomous nonprofit organization of higher education «Eurasian Open Institute» (EOI during the 2012-2013.

  3. UCLA accelerator research and development

    International Nuclear Information System (INIS)

    Cline, D.B.

    1992-01-01

    This progress report covers work supported by the above DOE grant over the period November 1, 1991 to July 31, 1992. The work is a program of experimental and theoretical studies in advanced particle accelerator research and development for high energy physics applications. The program features research at particle beam facilities in the United States and includes research on novel high power sources, novel focussing systems (e.g. plasma lens), beam monitors, novel high brightness, high current gun systems, and novel flavor factories in particular the φ Factory

  4. Method Development in Forensic Toxicology.

    Science.gov (United States)

    Peters, Frank T; Wissenbach, Dirk K; Busardo, Francesco Paolo; Marchei, Emilia; Pichini, Simona

    2017-01-01

    In the field of forensic toxicology, the quality of analytical methods is of great importance to ensure the reliability of results and to avoid unjustified legal consequences. A key to high quality analytical methods is a thorough method development. The presented article will provide an overview on the process of developing methods for forensic applications. This includes the definition of the method's purpose (e.g. qualitative vs quantitative) and the analytes to be included, choosing an appropriate sample matrix, setting up separation and detection systems as well as establishing a versatile sample preparation. Method development is concluded by an optimization process after which the new method is subject to method validation. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  5. Research and Development Services: Methods Development

    Science.gov (United States)

    1982-07-23

    PROPERTIES Melting Boiling Density Analvte Formula Point (*C) Point (C) (g/ml) ATNBA C7 H307N3 119 -- Source: ESE, 1982. 48 AMD.6/FR/3.15 7/8/82 A UV...Sulfide B. PHYSICAL AND CHEMICAL PROPERTIES Melting Boiling Density Analyte Formula Point (*C) Point (@C) (g/ml) TDGCL C4 H1002 S -10 165 1.1819...Analyte Formula Point Point (g/ml) UDMH C2H8 N2 -58’C 63.9C 0.791 Source: ESE, 1982. 78 AMD.6/FR/3.30 7/8/82 (disalicylhydrazine), which is removed by

  6. Radiation methods in research of ancient monuments

    International Nuclear Information System (INIS)

    Cechak, T.; Gerndt, J.; Kubelik, M.; Musilek, L.; Pavlik, Milan

    2000-01-01

    A 'Laboratory of Quantitative Methods in Monument Research' is being built at the CTU Prague. Its primary orientation is the investigation of historic architecture, although other objects of art can also be investigated. In the first phase, two radiation methods are being established, but it is set up in such a way, that various other methods can readily be added in its future development. The radiation methods chosen for the initial development of the laboratory are: thermoluminescence dating and X-ray fluorescence analysis. The design of the automated TL-reader, built in our laboratories, is adjusted for the purpose of dating of historic brick architecture (which, of course, does not exclude applications for ceramics and other materials). The investigation of renaissance architecture in southern Bohemia and Moravia is under preparation as the first large campaign of this kind in the Czech Republic. Radionuclide X-ray fluorescence analysis has been chosen as the basic analytical method in the laboratory. The possibility of analyses of paintings and fired building materials (bricks, roof tiles) have been investigated. The first results in both the areas are very promising

  7. NGNP Research and Development Status

    Energy Technology Data Exchange (ETDEWEB)

    David A. Petti

    2010-08-01

    At the inception of the Next Generation Nuclear Plant (NGNP) project, experts from the Department of Energy (DOE) national laboratories, gas reactor vendors, and universities collaborated to establish technology research and development (R&D) roadmaps. These roadmaps outlined the testing and computational development activities needed to qualify the materials and validate the modeling and simulation tools to be used in the design and safe operation of the NGNP, a helium-cooled, high temperature gas reactor (HTGR).

  8. Developing Effective Undergraduate Research Experience

    Science.gov (United States)

    Evans, Michael; Ilie, Carolina C.

    2011-03-01

    Undergraduate research is a valuable educational tool for students pursuing a degree in physics, but these experiences can become problematic and ineffective if not handled properly. Undergraduate research should be planned as an immersive learning experience in which the student has the opportunity to develop his/her skills in accordance with their interests. Effective undergraduate research experiences are marked by clear, measurable objectives and frequent student-professor collaboration. These objectives should reflect the long and short-term goals of the individual undergraduates, with a heightened focus on developing research skills for future use. 1. Seymour, E., Hunter, A.-B., Laursen, S. L. and DeAntoni, T. (2004), ``Establishing the benefits of research experiences for undergraduates in the sciences: First findings from a three-year study''. Science Education, 88: 493--534. 2. Behar-Horenstein, Linda S., Johnson, Melissa L. ``Enticing Students to Enter Into Undergraduate Research: The Instrumentality of an Undergraduate Course.'' Journal of College Science Teaching 39.3 (2010): 62-70.

  9. Methods in Lexicography and Dictionary Research | Schierholz ...

    African Journals Online (AJOL)

    Methods are used in every stage of dictionary-making and in every scientific analysis which is carried out in the field of dictionary research. This article presents some general considerations on methods in philosophy of science, gives an overview of many methods used in linguistics, in lexicography, dictionary research as ...

  10. The Delphi Method for Graduate Research

    Science.gov (United States)

    Skulmoski, Gregory J.; Hartman, Francis T.; Krahn, Jennifer

    2007-01-01

    The Delphi method is an attractive method for graduate students completing masters and PhD level research. It is a flexible research technique that has been successfully used in our program at the University of Calgary to explore new concepts within and outside of the information systems body of knowledge. The Delphi method is an iterative process…

  11. Children's Literature in the Undergraduate Course on Communication Research Methods

    Science.gov (United States)

    Brown, Daniel S.

    2010-01-01

    Objective: Students will develop positive attitudes toward communication research by linking new values and principles with the familiar values and principles contained in children's literature. Course: Communication Research Methods.

  12. Suborbital Research and Development Opportunities

    Science.gov (United States)

    Davis, Jeffrey R.

    2011-01-01

    This slide presentation reviews the new strategies for problem solving in the life sciences in the suborbital realm. Topics covered are: an overview of the space life sciences, the strategic initiatives that the Space Life Sciences organization engaged in, and the new business model that these initiatives were developed. Several opportunities for research are also reviewed.

  13. New laser research and development

    International Nuclear Information System (INIS)

    Anon.

    1976-01-01

    New types of lasers must be developed to provide the desired energy per pulse, pulse length, pulse shape, wavelength, and efficiency for laser-fusion applications. This advanced laser research has focused on rare-gas oxides and on Hg 2 excimers

  14. Global research and development budget

    Energy Technology Data Exchange (ETDEWEB)

    Norman, C

    1980-03-01

    The future political and economic relationships between industrial countries and between the industrial and developing countries will be influenced by the investments now being made for research and development (R and D). There is little public understanding of this $150 billion global investment, 25 percent of which is spent on military programs, 15 percent on basic research, and nearly 10 percent on space exploration, while the most-pressing world problems are receiving relatively little attention. A breakdown of geographic distribution of research and a comparison of government expenditures for different areas of R and D reveals a situation that could be corrected. National and corporate priorities need to be revised and political and institutional barriers must give way to new international and cooperative arrangements. 3 tables, 27 references. (DCK)

  15. Using Q Method in Qualitative Research

    Directory of Open Access Journals (Sweden)

    Pnina Shinebourne PhD

    2009-03-01

    Full Text Available In this paper the author outlines the features of Q method and assesses its suitability as a qualitative research method. She discusses the process of using the method and its particular approach to researching the range and diversity of subjective understandings, beliefs, and experiences. Q method is particularly suitable for identifying commonality and diversity and has a powerful capacity for thematic identification and analysis. In the author's view, Q method makes a contribution to expanding the repertoire of qualitative research methods.

  16. Upgrading of analytical method of general sensitivity for feature evaluation of land disposal system. 3. Abstract of report on research entrusted by the Japan Nuclear Cycle Development Institute

    International Nuclear Information System (INIS)

    1999-02-01

    In this research, a method to evaluate features of searching type system was analyzed statistically and deterministically by expanding it to nuclide transport in near-field host rocks. Here was described on abstract of methodology by summarizing fundamental concept on procedure and shadow-model of the feature evaluation based on investigation progress in last fiscal year, details on the nuclide transport in near-field host rocks and analytical method of sensitivity using this research, contents of statistical analysis using the shadow-model of nuclide transport, and summaries of contents and results on the deterministic analysis. (G.K.)

  17. 'Research and development of research information infrastructure'. Achievement report on development of parallel processing software technology for discrete value solving methods; Kenkyu joho kiban kenkyu kaihatsu seika hokokusho. Risanka suchi kaiho no tame no heiretsu shori software gijutsu kaihatsu

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2000-09-01

    Research and development has been performed on a general purpose parallel processing software that can be utilized for value solving methods, such as the finite element method, finite volume method and finite difference method. The achievements of the research and development may be summarized as follows: this parallel platform is parallelized in the concept of the domain division method for the elements (calculation cells), and is applicable to any of the finite element method, finite volume method and finite difference method; a researcher who has developed a program can easily perform the parallelization work to have the parallelizing performance displayed; the platform can be utilized in agreement with several parallel levels that are required by the user; with regard to the parallelization efficiency in large-size problems, it has become possible to execute at an efficiency of higher than 70% for the solver parts by using 32 processors of SR8000 at the computation center of the Agency of Industrial Science and Technology; the rigidity matrix preparing part shows an efficiency close to 100%W; and the developed parallel platform is under continued evaluation at the Machine Technology Research Institute and the Material Engineering Research Institute. (NEDO)

  18. Achievement report on research and development in the Sunshine Project in fiscal 1978. Research and development of hydrogen manufacturing technologies using the thermo-chemical method; 1978 nendo netsukagakuho ni yoru suiso seizo gijutsu no kenkyu kaihatsu seika hokokusho

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1979-05-31

    This paper describes a summary design of an iodine cycle experimenting equipment as one of the achievements in fiscal 1978 on research of hydrogen manufacturing technologies using the thermo-chemical method. The object of the equipment is a reaction to derive Mg(IO{sub 3}){sub 2} and MgI{sub 2} from MgO being the first reaction of the cycle, and iodine. The by-product (Q-phase) is produced according to composition of the aqueous reaction solution. The occurring reaction and composition of the produced materials vary depending on which contact system the reactor type uses, countercurrent flow or concurrent flow. Discussions were given on both types. Hydrogen generation rate of 1 Nm{sup 3}/hr was assumed as the equipment size to derive material balance and heat balance. Furthermore, types considered applicable were selected from different types of the solid-liquid reaction equipment, and summary design and calculation were performed. Process simulation provided a prospect of achieving thermal efficiency that can compete with the electrolytic process. As a study on materials for a magnesium iodate pyrolytic equipment as the second reaction, corrosion tests were carried out in a gas mixture composed of iodine, oxygen and steam. Using 26 kinds of metallic materials as the objects, the tests were executed at 100 and 300 degrees C for 100 hours. Long-term durability tests were also performed on materials judged to have good corrosion resistance. (NEDO)

  19. Classroom Research and Professional Development

    Directory of Open Access Journals (Sweden)

    Omaira Vergara Luján

    2009-04-01

    Full Text Available This article intends to share the experience of a group of teachers in the Classroom Research Seminar of the Teacher Development Program in English carried out at Universidad del Valle, Cali, from January to June, 2007. The seminar was part of a high-level in-service program for teachers of English of a network of private educational institutions. We would like to share the highlights and difficulties of the experience. We will start with the general framework of the program and the concept of professional development that underlies it. Next we will focus on the classroom research seminar, its objectives, methodology and results. Finally we share the voices of some of the participants, who talk about the influence this seminar had on their professional development and daily work.

  20. An Acupuncture Research Protocol Developed from Historical Writings by Mathematical Reflections: A Rational Individualized Acupoint Selection Method for Immediate Pain Relief

    Directory of Open Access Journals (Sweden)

    Sven Schroeder

    2013-01-01

    Full Text Available While balancing yin and yang is one basic principle of Chinese medicine, balancing methods for combination of meridians and acupoints had been described throughout the history of Chinese medicine. We have identified six historical systems for combinations of acupuncture points in historical writings. All of them represent symmetrical combinations which are defined by the steps in the Chinese Clock. Taking the historical systems as a basis, we calculated the possible combinations that fit into these systems they revealed, leading to a total of 19 systems offering new balancing combinations. Merging the data of these 19 systems, there are 7 combinatorial options for every meridian. On the basis of this data, we calculated 4-meridian combinations with an ideal balance pattern, which is given when all meridians balance each other. We identified 5 of these patterns for every meridian, so we end up with 60 patterns for all the 12 meridians but we find multiple overlapping. Finally, 15 distinct patterns remain. By combining this theoretical concept with the Image and Mirror Concept, we developed an acupuncture research protocol. This protocol potentially solves some problems of acupuncture trials because it represents a rational reproducible procedure independent of examiner experience, but the resulting treatment is individualized.

  1. Integrating Research Skills Training into Non--Research Methods Courses

    Science.gov (United States)

    Woolf, Jules

    2014-01-01

    Research skills are a valued commodity by industry and university administrators. Despite the importance placed on these skills students typically dislike taking research method courses where these skills are learned. However, training in research skills does not necessarily have to be confined to these courses. In this study participants at a…

  2. Learning and Teaching Research Methods in Management Education: Development of a Curriculum to Combine Theory and Practice--A Swiss Case

    Science.gov (United States)

    Hoidn, Sabine; Olbert-Bock, Sibylle

    2016-01-01

    Purpose: In the context of the creation of a two-year Master of Science in Business Administration programme to offer a scientifically sound and practice-related management education in Switzerland, a curriculum for learning and teaching research methods had to be designed. Major pedagogic challenges were identified and addressed by curricular…

  3. Teaching Social Science Research Methods to Undergraduate Medical Students: The State of the Art and Opportunities for Practice and Curriculum Development

    Science.gov (United States)

    Forrest, Simon

    2017-01-01

    There is an expectation that medical students in the UK will be able to demonstrate conversancy with social science relevant to medicine and health, including the means by which the relevant bodies of knowledge are generated through the use of social science research methods. This paper explores the structural and pedagogical challenges and…

  4. Research of radioactive waste storage cask/canister materials, spent nuclear fuels and various radioactive waste forms and development of their assessment methods. Final report for Stage 3

    International Nuclear Information System (INIS)

    Dobrev, D.; Balek, V.; Červinka, R.; Večerník, P.; Člupek, M.; Kouřil, M.; Novák, P.; Stoulil, J.; Silber, R.

    2013-08-01

    The main topics treated are: Research and development of methodologies for canister/cask material degradation assessment; Laboratory research of selected materials of canister/cask with radioactive waste; and Research and assessment of canister/cask materials in natural granite rocks. Two additional documents are appended: Corrosion rate determination for samples in compacted bentonite in anaerobic conditions (methodology), and Roll test for corrosion test in an occluded solution at the interface between a radioactive waste disposal canister and the bentonite cover. (P.A.)

  5. Research in Medicine: Essentials for Developing Countries

    Directory of Open Access Journals (Sweden)

    Yusuf YAKUPOGULLARI

    2014-06-01

    Full Text Available (ExtractThe well-being has been the highest topic for humanity throughout the adventure of mankind on the earth. Therefore, extensive efforts have been performed on the science of medicine, and glorious advances have been gained especially in the last two centuries. Research is essential for medicine to develop new therapeutic methods and to monitor the results of the current treatment given to the patient. These are possibly the simplest reasons for investigations in medicine. On the other hand, qualified human resource, research ethics, financial supports, regular data recording and analysis, and publication are important issues for improvement of the medical researches in the developing countries.... 

  6. Application of the Current Knowledge from Research and Development of the Burial Methods and their Impact on Designing or Transforming Contemporary Cemeteries in the Czech Republic

    Directory of Open Access Journals (Sweden)

    Frolíková Palánová Klára

    2017-12-01

    Full Text Available Considerable transformation of the burial method at the turn of the 19th and the 20th centuries is apparent from the existing results of research in the developments of burial and funeral architecture, when after centuries controlled by the church – due to social and political changes – gradual secularisation of the society and subsequent desacralisation of funeral rituals started appearing. This phenomenon, as well as other aspects (e.g. Josephine reforms in 1782 brought about a change in the approach to newly established cemeteries but also the necessity to define areas for new burial methods and constructing new building types of funeral architecture. The position of necropolis is also changing as the society understands it, and its inclusion not only in the organism of towns but also in everyday life of town and municipality citizens. Thus, not only new but mainly original cemeteries are searching for their new position in the society. Studio papers try to react to this situation written by students of the master degree of the specialisation Architecture and civil engineering at the Faculty of Civil Engineering at the VŠB - Technical University in Ostrava, led by prof. Ing. arch. Petr Hrůša, doc. Ing. Martina Peřinková, Ph.D. and Ing. arch. Klára Frolíková Palánová, Ph.D. Students try to view necropolis in an innovative way and give them a new dimension to succeed and become adequate public or semi-public space of cities and municipalities. The contribution represents starting points of possible solutions on case studies, such as transformation of a cemetery in Ostrava on the Hulváky Hill, the design of establishing a new cemetery in open space near the municipality of Velichovky, including the design of a funeral hall, situating a new urn grove in the place of a former cemetery – the current park – a part of which is the design of a new crematorium in Nový Jičín and extension of possibilities for placement of ashes and

  7. RD and D-Programme 2001. Programme for research, development and demonstration of methods for the management and disposal of nuclear waste

    International Nuclear Information System (INIS)

    2001-09-01

    the Aespoe HRL will contain six deposition holes with canisters, and the test will proceed for 20 years. Material and methods for backfilling, closure and sealing of boreholes are also being developed at Aespoe. KBS-3 is the basis, but we will also examine variants of the concept. Such a variant is Medium Long Holes (MLH), whereby the canisters are deposited horizontally. The encapsulation plant where the spent fuel is to be placed in copper canisters, is still on the drawing board. The technology for welding on the copper lid is being developed at the Canister Laboratory in Oskarshamn. The technology for examining the weld joint is also being developed there. Elsewhere, different fabrication methods for the different parts of the canister are being tested. SKB has decided to monitor the development of the two alternatives partitioning and transmutation and deposition in Very Deep Holes. SKB is conducting general studies of decommissioning to ensure that competence exists and that the costs are correctly estimated. The aim during the coming six-year period is to develop methods for dry interim storage of core components, introduce systems for registration of the waste, review the decommissioning logistics, estimate doses in conjunction with decommissioning, and carry out preliminary safety assessments of final disposal. An important element in this work is monitoring of foreign activities. Long-lived waste from decommissioning in the form of reactor internals and core components also have to be disposed of in a final repository. This repository must also accommodate long-lived LILW (low-and intermediate-level waste) from research, industry and medicine. A preliminary design of the repository for long-lived LILW has been studied and a safety assessment has been conducted. The repository does not have to be put into operation for another 45 years

  8. [Internet research methods: advantages and challenges].

    Science.gov (United States)

    Liu, Yi; Tien, Yueh-Hsuan

    2009-12-01

    Compared to traditional research methods, using the Internet to conduct research offers a number of advantages to the researcher, which include increased access to sensitive issues and vulnerable / hidden populations; decreased data entry time requirements; and enhanced data accuracy. However, Internet research also presents certain challenges to the researcher. In this article, the advantages and challenges of Internet research methods are discussed in four principle issue areas: (a) recruitment, (b) data quality, (c) practicality, and (d) ethics. Nursing researchers can overcome problems related to sampling bias and data truthfulness using creative methods; resolve technical problems through collaboration with other disciplines; and protect participant's privacy, confidentiality and data security by maintaining a high level of vigilance. Once such issues have been satisfactorily addressed, the Internet should open a new window for Taiwan nursing research.

  9. Development of Three Methods for Simultaneous Quantitative ...

    African Journals Online (AJOL)

    Development of Three Methods for Simultaneous Quantitative Determination of Chlorpheniramine Maleate and Dexamethasone in the Presence of Parabens in ... Tropical Journal of Pharmaceutical Research ... Results: All the proposed methods were successfully applied to the analysis of raw materials and dosage form.

  10. DDOT MXD+ method development report.

    Science.gov (United States)

    2015-09-01

    Mixed-use development has become increasingly common across the country, including Washington, D.C. : However, a straightforward and empirically validated method for evaluating the traffic impacts of such : projects is still needed. The data presente...

  11. Internationalization of Research and Development

    DEFF Research Database (Denmark)

    Håkanson, Lars

    2014-01-01

    with geographically dispersed and organizationally decentralized R&D. A simple typology of foreign R&D units is presented, emphasizing that the opportunities and challenges vary with the nature of their tasks, which range from technical support and local adaptation of products and processes to product development and......, in some cases, applied and basic research. Managerial systems, procedures, and practices for coordination and control of internationally decentralized R&D are identified, along with mechanisms promoting knowledge management, problem solving, and innovation....

  12. Negotiating a Systems Development Method

    Science.gov (United States)

    Karlsson, Fredrik; Hedström, Karin

    Systems development methods (or methods) are often applied in tailored version to fit the actual situation. Method tailoring is in most the existing literature viewed as either (a) a highly rational process with the method engineer as the driver where the project members are passive information providers or (b) an unstructured process where the systems developer makes individual choices, a selection process without any driver. The purpose of this chapter is to illustrate that important design decisions during method tailoring are made by project members through negotiation. The study has been carried out using the perspective of actor-network theory. Our narratives depict method tailoring as more complex than (a) and (b) show the driver role rotates between the project members, and design decisions are based on influences from several project members. However, these design decisions are not consensus decisions.

  13. Miscellaneous standard methods for Apis mellifera research

    DEFF Research Database (Denmark)

    Human, Hannelie; Brodschneider, Robert; Dietemann, Vincent

    2013-01-01

    A variety of methods are used in honey bee research and differ depending on the level at which the research is conducted. On an individual level, the handling of individual honey bees, including the queen, larvae and pupae are required. There are different methods for the immobilising, killing an...

  14. Optimizing How We Teach Research Methods

    Science.gov (United States)

    Cvancara, Kristen E.

    2017-01-01

    Courses: Research Methods (undergraduate or graduate level). Objective: The aim of this exercise is to optimize the ability for students to integrate an understanding of various methodologies across research paradigms within a 15-week semester, including a review of procedural steps and experiential learning activities to practice each method, a…

  15. Exploring methods in information literacy research

    CERN Document Server

    Lipu, Suzanne; Lloyd, Annemaree

    2007-01-01

    This book provides an overview of approaches to assist researchers and practitioners to explore ways of undertaking research in the information literacy field. The first chapter provides an introductory overview of research by Dr Kirsty Williamson (author of Research Methods for Students, Academics and Professionals: Information Management and Systems) and this sets the scene for the rest of the chapters where each author explores the key aspects of a specific method and explains how it may be applied in practice. The methods covered include those representing qualitative, quantitative and mix

  16. Qualitative versus quantitative methods in psychiatric research.

    Science.gov (United States)

    Razafsha, Mahdi; Behforuzi, Hura; Azari, Hassan; Zhang, Zhiqun; Wang, Kevin K; Kobeissy, Firas H; Gold, Mark S

    2012-01-01

    Qualitative studies are gaining their credibility after a period of being misinterpreted as "not being quantitative." Qualitative method is a broad umbrella term for research methodologies that describe and explain individuals' experiences, behaviors, interactions, and social contexts. In-depth interview, focus groups, and participant observation are among the qualitative methods of inquiry commonly used in psychiatry. Researchers measure the frequency of occurring events using quantitative methods; however, qualitative methods provide a broader understanding and a more thorough reasoning behind the event. Hence, it is considered to be of special importance in psychiatry. Besides hypothesis generation in earlier phases of the research, qualitative methods can be employed in questionnaire design, diagnostic criteria establishment, feasibility studies, as well as studies of attitude and beliefs. Animal models are another area that qualitative methods can be employed, especially when naturalistic observation of animal behavior is important. However, since qualitative results can be researcher's own view, they need to be statistically confirmed, quantitative methods. The tendency to combine both qualitative and quantitative methods as complementary methods has emerged over recent years. By applying both methods of research, scientists can take advantage of interpretative characteristics of qualitative methods as well as experimental dimensions of quantitative methods.

  17. Survey Research: Methods, Issues and the Future

    Science.gov (United States)

    Brewer, Ernest W.; Torrisi-Steele, Geraldine; Wang, Victor C. X.

    2015-01-01

    Survey research is prevalent among many professional fields. Both cost effective and time efficient, this method of research is commonly used for the purposes of gaining insight into the attitudes, thoughts, and opinions of populations. Additionally, because there are several types of survey research designs and data collection instruments, the…

  18. Cooperation in research and development

    International Nuclear Information System (INIS)

    Ramanna, R.

    1977-01-01

    In planning scientific programs for rapid and extensive peaceful applications of atomic energy in any developing country, it is not fully realized that one of the most important inputs is a strong research and development (R and D) base with a well-oriented training program. The paper discusses the various ways in which R and D is required to assist in both indigenous and turnkey projects. The R and D organization should be broad based; i.e., it should have physicists, chemists (particularly specialists in water chemistry), health physicists, and engineers (particularly metallurgists for materials development, study of corrosion problems, etc.). The role of electronic engineers is also very significant from the viewpoint of designing reactor control systems. Another important advantage of having an R and D program is its general technological fallout, which aids the entire industrial structure of the country. The concept of regional cooperation is very important, particularly for atomic energy programs in developing countries that have similar conditions and levels of technological skills. This cooperation can be bilateral or multilateral under the auspices of the International Atomic Energy Agency. Scientists from several countries have been trained in our Center, and we also had a very successful India-Philippines-Agency Project in which scientists from many countries in the region participated in cooperative research programs

  19. Future methods in pharmacy practice research

    DEFF Research Database (Denmark)

    Almarsdottir, A B; Babar, Z U D

    2016-01-01

    research. These are demographics, technology and professional standards. Second, deriving from this, it seeks to predict and forecast the future shifts in use of methodologies. Third, new research areas and availability of data impacting on future methods are discussed. These include the impact of aging...... of the trends for pharmacy practice research methods are discussed. © 2016, Springer International Publishing.......This article describes the current and future practice of pharmacy scenario underpinning and guiding this research and then suggests future directions and strategies for such research. First, it sets the scene by discussing the key drivers which could influence the change in pharmacy practice...

  20. Using observational methods in nursing research.

    Science.gov (United States)

    Salmon, Jenny

    2015-07-08

    Observation is a research data-collection method used generally to capture the activities of participants as well as when and where things are happening in a given setting. It checks description of the phenomena against what the researcher perceives to be fact in a rich experiential context. The method's main strength is that it provides direct access to the social phenomena under consideration. It can be used quantitatively or qualitatively, depending on the research question. Challenges in using observation relate to adopting the role of participant or non-participant researcher as observer. This article discusses some of the complexities involved when nurse researchers seek to collect observational data on social processes in naturalistic settings using unstructured or structured observational methods in qualitative research methodology. A glossary of research terms is provided.

  1. Research methods for English language teachers

    CERN Document Server

    McDonough, Jo

    2014-01-01

    This book offers a lively introduction to the research methods and techniques available to English language teachers who wish to investigate aspects of their own practice. It covers qualitative and quantitative methodology and includes sections on observation, introspection, diary studies, experiments, interviews, questionnaires, numerical techniques and case study research. Each method is illustrated with examples in language teaching contexts, and techniques of data collection and analysis are introduced. The authors focus particularly on research in the classroom, on tests, materials, the

  2. Advanced accelerator research and development

    International Nuclear Information System (INIS)

    Anon.

    1974-01-01

    Research and development on the Positron-Electron Project (PEP), the electron rings, the superconducting accelerator (ESCAR), and the superconductivity program are reported. Efforts relating to the proposed PEP include work on: (1) the injection system; (2) the rf system; (3) the main-ring bend magnets; (4) the magnet power supplies and controls; (5) alignment; (6) radiation and shielding; (7) the vacuum system; and (8) conventional facilities (utilities, etc.). Experimental and theoretical work continued on the development of suitably intense electron rings as vehicles for the collective acceleration of ions. The most difficult problem was found to be the longitudinal (negative mass) instability. Design work was begun for ESCAR (Experimental Superconducting Accelerating Ring), a small proton synchrotron and storage ring using superconducting magnets, which should aid in the design of future large superconducting facilities. Magnet development was largely directed toward the detailed design of the dipole units. A superconducting beam transport line was installed at the Bevatron. (PMA)

  3. Ethnographic Contributions to Method Development

    DEFF Research Database (Denmark)

    Leander, Anna

    2016-01-01

    of IR—Critical Security Studies. Ethnographic research works with what has been termed a “strong” understanding of objectivity. When this understanding is taken seriously, it must lead to a refashioning of the processes of gathering, analyzing, and presenting data in ways that reverse many standard...... of research in the ethnographic tradition. However, it would also require rethinking standard methods instructions and the judgments they inform....... assumptions and instructions pertaining to “sound methods.” Both in the context of observation and in that of justification, working with “strong objectivity” requires a flexibility and willingness to shift research strategies that is at odds with the usual emphasis on stringency, consistency, and carefully...

  4. Developing Online Recruitment and Retention Methods for HIV Prevention Research Among Adolescent Males Who Are Interested in Sex with Males: Interviews with Adolescent Males.

    Science.gov (United States)

    Nelson, Kimberly M; Ramirez, Jaime J; Carey, Michael P

    2017-12-21

    Adolescent males interested in sex with males (AMSM) are an important audience for HIV prevention interventions, but they are difficult to reach due to their age and social stigma. We aim to identify efficient methods to recruit and retain AMSM in online research. Interviews with 14-to-18-year-old AMSM (N=16) were conducted at 2017 Pride events in Boston, MA and Providence, RI. Participants reported that (1) social media platforms are viable recruitment venues; (2) recruitment advertisements should describe the study using colorful/bright pictures, familiar words, and information about compensation; (3) surveys should be recruitment and retention procedures to increase the efficiency of HIV prevention research for this at-risk group. ©Kimberly M Nelson, Jaime J Ramirez, Michael P Carey. Originally published in the Journal of Medical Internet Research (http://www.jmir.org), 21.12.2017.

  5. The Value of Mixed Methods Research: A Mixed Methods Study

    Science.gov (United States)

    McKim, Courtney A.

    2017-01-01

    The purpose of this explanatory mixed methods study was to examine the perceived value of mixed methods research for graduate students. The quantitative phase was an experiment examining the effect of a passage's methodology on students' perceived value. Results indicated students scored the mixed methods passage as more valuable than those who…

  6. CSM research: Methods and application studies

    Science.gov (United States)

    Knight, Norman F., Jr.

    1989-01-01

    Computational mechanics is that discipline of applied science and engineering devoted to the study of physical phenomena by means of computational methods based on mathematical modeling and simulation, utilizing digital computers. The discipline combines theoretical and applied mechanics, approximation theory, numerical analysis, and computer science. Computational mechanics has had a major impact on engineering analysis and design. When applied to structural mechanics, the discipline is referred to herein as computational structural mechanics. Complex structures being considered by NASA for the 1990's include composite primary aircraft structures and the space station. These structures will be much more difficult to analyze than today's structures and necessitate a major upgrade in computerized structural analysis technology. NASA has initiated a research activity in structural analysis called Computational Structural Mechanics (CSM). The broad objective of the CSM activity is to develop advanced structural analysis technology that will exploit modern and emerging computers, such as those with vector and/or parallel processing capabilities. Here, the current research directions for the Methods and Application Studies Team of the Langley CSM activity are described.

  7. Qualitative and quantitative methods in health research

    OpenAIRE

    V?zquez Navarrete, M. Luisa

    2009-01-01

    Introduction Research in the area of health has been traditionally dominated by quantitative research. However, the complexity of ill-health, which is socially constructed by individuals, health personnel and health authorities have motivated the search for other forms to approach knowledge. Aim To discuss the complementarities of qualitative and quantitative research methods in the generation of knowledge. Contents The purpose of quantitative research is to measure the magnitude of an event,...

  8. Advanced Research Reactor Fuel Development

    Energy Technology Data Exchange (ETDEWEB)

    Kim, C. K.; Park, H. D.; Kim, K. H. (and others)

    2006-04-15

    RERTR program for non-proliferation has propelled to develop high-density U-Mo dispersion fuels, reprocessable and available as nuclear fuel for high performance research reactors in the world. As the centrifugal atomization technology, invented in KAERI, is optimum to fabricate high-density U-Mo fuel powders, it has a great possibility to be applied in commercialization if the atomized fuel shows an acceptable in-reactor performance in irradiation test for qualification. In addition, if rod-type U-Mo dispersion fuel is developed for qualification, it is a great possibility to export the HANARO technology and the U-Mo dispersion fuel to the research reactors supplied in foreign countries in future. In this project, reprocessable rod-type U-Mo test fuel was fabricated, and irradiated in HANARO. New U-Mo fuel to suppress the interaction between U-Mo and Al matrix was designed and evaluated for in-reactor irradiation test. The fabrication process of new U-Mo fuel developed, and the irradiation test fuel was fabricated. In-reactor irradiation data for practical use of U-Mo fuel was collected and evaluated. Application plan of atomized U-Mo powder to the commercialization of U-Mo fuel was investigated.

  9. Report on the achievements in fiscal 1999. Technology to use gas hydrate as a resource (Research and development for exploration, research and development on drilling technologies, investigative research on an environment influence evaluation method, and investigative research on a utilization system); 1999 nendo gas hydrate shigenka gijutsu sendo kenkyu kaihatsu seika hokokusho. Tansa nado ni kansuru kenkyu kaihatsu, kussaku gijutsu nado ni kansuru kenkyu kaihatsu, kankyo eikyo hyokaho no chosa kenkyu, riyo system ni kansuru chosa kenkyu

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2000-03-01

    The contents of the research and development performed in the current fiscal year are as follows: (1) research and development for exploration, (2) research and development on drilling technologies, (3) investigative research on an environment influence evaluation method, and (4) investigative research on a utilization system. In Item (1), element analysis data are used to study a method to estimate production environment of hydrate ore beds by using an inorganic ion analyzer and a trace amount element analyzer, the crust thermal flow measuring method is used to discuss a method to analyze the hydrate stability zones together with the data of sea area exploration records, and conceptual design is made on a resource potential evaluation system. In Item (2), experiments and analytical discussions are performed on decomposition control of the gas hydrate solid-liquid interface according to such conditions for the drilling fluid as temperatures and flow rates. Elucidation is given on the initial process of bubble generation for behavior of decomposed gas bubbles. Observation and elucidation are made on two-phase flow behavior of non-Newtonian fluid. In Item (3), conceptual design is carried out on a system to detect elements of shape change in each bed due to fluid movement in a gas hydrate bed and an upper bed. In Item (4), discussions are given on the optimizing conditions for generation and dissociation of gas hydrates. Investigation is made also on a possibility of the transportation and storage system. (NEDO)

  10. Focusing on What Counts: Using Exploratory Focus Groups to Enhance the Development of an Electronic Survey in a Mixed-Methods Research Design

    Science.gov (United States)

    Galliott, Natal'ya; Graham, Linda J.

    2016-01-01

    This paper illustrates the use of exploratory focus groups to inform the development of a survey instrument in a sequential phase mixed-methods study investigating differences in secondary students' career choice capability. Five focus groups were conducted with 23 Year 10 students in the state of New South Wales, Australia. Analysis of the focus…

  11. Development Model for Research Infrastructures

    Science.gov (United States)

    Wächter, Joachim; Hammitzsch, Martin; Kerschke, Dorit; Lauterjung, Jörn

    2015-04-01

    Research infrastructures (RIs) are platforms integrating facilities, resources and services used by the research communities to conduct research and foster innovation. RIs include scientific equipment, e.g., sensor platforms, satellites or other instruments, but also scientific data, sample repositories or archives. E-infrastructures on the other hand provide the technological substratum and middleware to interlink distributed RI components with computing systems and communication networks. The resulting platforms provide the foundation for the design and implementation of RIs and play an increasing role in the advancement and exploitation of knowledge and technology. RIs are regarded as essential to achieve and maintain excellence in research and innovation crucial for the European Research Area (ERA). The implementation of RIs has to be considered as a long-term, complex development process often over a period of 10 or more years. The ongoing construction of Spatial Data Infrastructures (SDIs) provides a good example for the general complexity of infrastructure development processes especially in system-of-systems environments. A set of directives issued by the European Commission provided a framework of guidelines for the implementation processes addressing the relevant content and the encoding of data as well as the standards for service interfaces and the integration of these services into networks. Additionally, a time schedule for the overall construction process has been specified. As a result this process advances with a strong participation of member states and responsible organisations. Today, SDIs provide the operational basis for new digital business processes in both national and local authorities. Currently, the development of integrated RIs in Earth and Environmental Sciences is characterised by the following properties: • A high number of parallel activities on European and national levels with numerous institutes and organisations participating

  12. Taxation of Research and Development

    Directory of Open Access Journals (Sweden)

    Zsuzsanna Szeles

    2016-01-01

    Full Text Available Research and development plays an unquestionably role in terms of long-term growth. According to Eurostat, almost half of all enterprises in the EU-28 reported innovation activity (48.9% during the period 2010-2012. Compared with the period 2008-2010, the share of innovative enterprises decreased by 3.9 percentage points. Among the EU Member States, the highest shares of innovative enterprises during the period 2010–2012 were observed in Germany (66.9 % of all enterprises, and the lowest share was recorded in Romania (20.7%.

  13. Entrepreneurship research in Spain: developments and distinctiveness.

    Science.gov (United States)

    Sánchez, José C; Gutiérrez, Andrea

    2011-08-01

    This article presents a review of research on entrepreneurship in Spain, paying particular attention to its beginnings, nature and main focus of interest. We have developed a database based on the review of 471 works produced between 1977 and 2009, including articles published in national and international journals and dissertations (read in Spain) that allowed us to extract the following results. There is a preference for qualitative methods, conceptual contributions and the entrepreneurial process as the privileged research theme. There is also a strong focus of interest on micro and small enterprises. These characteristics of Spanish research in areas of entrepreneurship can make a distinctive contribution to international research. However, the dissemination of knowledge and inadequate strategies for international publication limit the diffusion of Spanish research in entrepreneurship. Lastly, we discuss the implications for future research.

  14. Using mixed methods in music therapy health care research

    DEFF Research Database (Denmark)

    Bonde, Lars Ole

    2015-01-01

    »Mixed methods« (or »multiple methods») is a fairly new concept in music therapy research. It is inspired by recent methodological developments in social science, covering the interaction of quantitative and qualitative methods in one and the same research study. Mixed methods are not the same...... as the diversity or pluralism of methods advocated by many scholars who are critical towards the principles of evidence-based medicine. This article presents a concrete example of mixed methods in music therapy research: a psycho-social study of music therapy with female cancer survivors. Problems related...

  15. Participatory Research and Development for Sustainable Agriculture ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Participatory Research and Development for Sustainable Agriculture and Natural Resource Management - A Sourcebook Volume 3 : Doing Participatory Research and Development. Couverture du livre Participatory Research and Development for Sustainable Agriculture and Natural Resource Management : A.

  16. Methodology for developing new test methods

    Directory of Open Access Journals (Sweden)

    A. I. Korobko

    2017-06-01

    Full Text Available The paper describes the methodology for developing new test methods and forming solutions for the development of new test methods. The basis of the methodology for developing new test methods is the individual elements of the system and process approaches. They contribute to the development of an effective research strategy for the object, the study of interrelations, the synthesis of an adequate model of the test method. The effectiveness of the developed test method is determined by the correct choice of the set of concepts, their interrelations and mutual influence. This allows you to solve the tasks assigned to achieve the goal. The methodology is based on the use of fuzzy cognitive maps. The question of the choice of the method on the basis of which the model for the formation of solutions is based is considered. The methodology provides for recording a model for a new test method in the form of a finite set of objects. These objects are significant for the test method characteristics. Then a causal relationship is established between the objects. Further, the values of fitness indicators and the observability of the method and metrological tolerance for the indicator are established. The work is aimed at the overall goal of ensuring the quality of tests by improving the methodology for developing the test method.

  17. Software development for research reactors

    International Nuclear Information System (INIS)

    Krohn, J.L.; Feltz, D.E.; Khalil, N.S.

    1986-01-01

    The Texas A and M University Nuclear Science Center, in a program jointly sponsored with the International Atomic Energy Agency, is developing a series of computer software programs of use at research reactor facilities. The programs cover a wide range of topics including activation and shielding calculations, control rod calibrations, power calorimetrics, and fuel inventory including burnup. Many of the programs are modified and improved versions of programs already in use at the NSC that ran on outdated computing equipment. All of the new versions were written in Fortran77 on the NSC's new TI Pro microcomputer and are IBM-compatible. This paper describes the development and translation efforts in preparing the programs for use by other facilities, and gives an overview of the aim of the development effort. A brief description of each program that has been or is to be written is given including the required inputs and the resulting outputs. This paper also addresses the original needs that brought about the development program and the benefits to facility operations that each program provides. The programs discussed are available to interested parties in a hard-copy listing as requested. (author)

  18. Advanced research reactor fuel development

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Chang Kyu; Pak, H. D.; Kim, K. H. [and others

    2000-05-01

    The fabrication technology of the U{sub 3}Si fuel dispersed in aluminum for the localization of HANARO driver fuel has been launches. The increase of production yield of LEU metal, the establishment of measurement method of homogeneity, and electron beam welding process were performed. Irradiation test under normal operation condition, had been carried out and any clues of the fuel assembly breakdown was not detected. The 2nd test fuel assembly has been irradiated at HANARO reactor since 17th June 1999. The quality assurance system has been re-established and the eddy current test technique has been developed. The irradiation test for U{sub 3}Si{sub 2} dispersed fuels at HANARO reactor has been carried out in order to compare the in-pile performance of between the two types of U{sub 3}Si{sub 2} fuels, prepared by both the atomization and comminution processes. KAERI has also conducted all safety-related works such as the design and the fabrication of irradiation rig, the analysis of irradiation behavior, thermal hydraulic characteristics, stress analysis for irradiation rig, and thermal analysis fuel plate, for the mini-plate prepared by international research cooperation being irradiated safely at HANARO. Pressure drop test, vibration test and endurance test were performed. The characterization on powders of U-(5.4 {approx} 10 wt%) Mo alloy depending on Mo content prepared by rotating disk centrifugal atomization process was carried out in order to investigate the phase stability of the atomized U-Mo alloy system. The {gamma}-U phase stability and the thermal compatibility of atomized U-16at.%Mo and U-14at.%Mo-2at.%X(: Ru, Os) dispersion fuel meats at an elevated temperature have been investigated. The volume increases of U-Mo compatibility specimens were almost the same as or smaller than those of U{sub 3}Si{sub 2}. However the atomized alloy fuel exhibited a better irradiation performance than the comminuted alloy. The RERTR-3 irradiation test of nano

  19. Using mixed methods when researching communities.

    Science.gov (United States)

    Ochieng, Bertha M N; Meetoo, Danny

    2015-09-01

    To argue for the use of mixed methods when researching communities. Although research involving minority communities is now advanced, not enough effort has been made to formulate methodological linkages between qualitative and quantitative methods in most studies. For instance, the quantitative approaches used by epidemiologists and others in examining the wellbeing of communities are usually empirical. While the rationale for this is sound, quantitative findings can be expanded with data from in-depth qualitative approaches, such as interviews or observations, which are likely to provide insights into the experiences of people in those communities and their relationships with their wellbeing. Academic databases including The Cochrane Library, MEDLINE, CINAHL, AMED, INTERNURSE, Science Direct, Web of Knowledge and PubMed. An iterative process of identifying eligible literature was carried out by comprehensively searching electronic databases. Using mixed-methods approaches is likely to address any potential drawbacks of individual methods by exploiting the strengths of each at the various stages of research. Combining methods can provide additional ways of looking at a complex problem and improve the understanding of a community's experiences. However, it is important for researchers to use the different methods interactively during their research. The use of qualitative and quantitative methods is likely to enrich our understanding of the interrelationship between wellbeing and the experiences of communities. This should help researchers to explore socio-cultural factors and experiences of health and healthcare practice more effectively.

  20. Research on radiative heat transfer in sodium combustion. Modeling, verification and development a radiative properties measuring method. Report of the JNC cooperative research scheme on the nuclear fuel cycle

    International Nuclear Information System (INIS)

    Li Bingxi; Kudo, Kazuhiko

    2001-05-01

    A quantitative evaluation of a radiative heat transfer is important in sodium combustion because a large amount of aerosol particles, which are produced as a result of the combustion, exists in a combustion region. In this study, a development of radiation model with aerosols and optical property measurement has been carried out for the purpose of evaluating radiative heat transfer based on a optical property, diameter, number density and statistical and spatial distribution of aerosol particles. In 2000 research, one dimensional analysis program of the Monte Carlo method has been developed. This program evaluates a radiative transmission intensity based on an optical property and a statistic and spatial diameter distribution of airborne particles. Using this program, an optical property can be estimated from experimental conditions (e.g. diameter distribution) and results (radiative transmission intensity). As a result of numerical analyses which evaluate an influence of a size parameter (relation between a particle diameter [D] and wavelength [λ] :=πD/λ) on the accuracy evaluation, an optical property can be estimated within 3% accuracy though an angle distribution measurement of radiative transmission intensity is necessary when the size parameter becomes large. (author)

  1. Mixed-methods research in nursing - a critical review.

    Science.gov (United States)

    Bressan, Valentina; Bagnasco, Annamaria; Aleo, Giuseppe; Timmins, Fiona; Barisone, Michela; Bianchi, Monica; Pellegrini, Ramona; Sasso, Loredana

    2017-10-01

    To review the use of mixed-methods research in nursing with a particular focus on the extent to which current practice informs nurse researchers. It also aimed to highlight gaps in current knowledge, understanding and reporting of this type of research. Mixed-methods research is becoming increasingly popular among nurses and healthcare professionals. Emergent findings from this type of research are very useful for nurses in practice. The combination of both quantitative and qualitative methods provides a scientific base for practice but also richness from the qualitative enquiry. However, at the same time mixed-methods research is underdeveloped. This study identified mixed-methods research papers and critically evaluated their usefulness for research practice. To support the analysis, we performed a two-stage search using CINAHL to find papers with titles that included the key term 'mixed method'. An analysis of studies that used mixed-methods research revealed some inconsistencies in application and reporting. Attempts to use two distinct research methods in these studies often meant that one or both aspects had limitations. Overall methods were applied in a less rigorous way. This has implications for providing somewhat limited direction for novice researchers. There is also potential for application of evidence in healthcare practice that limited validity. This study highlights current gaps in knowledge, understanding and reporting of mixed-methods research. While these methods are useful to gain insight into clinical problems nurses lack guidance with this type of research. This study revealed that the guidance provided by current mixed-methods research is inconsistent and incomplete and this compounds the lack of available direction. There is an urgent need to develop robust guidelines for using mixed-methods research so that findings may be critically implemented in practice. © 2016 John Wiley & Sons Ltd.

  2. Carbon sequestration research and development

    Energy Technology Data Exchange (ETDEWEB)

    Reichle, Dave; Houghton, John; Kane, Bob; Ekmann, Jim; and others

    1999-12-31

    Predictions of global energy use in the next century suggest a continued increase in carbon emissions and rising concentrations of carbon dioxide (CO{sub 2}) in the atmosphere unless major changes are made in the way we produce and use energy--in particular, how we manage carbon. For example, the Intergovernmental Panel on Climate Change (IPCC) predicts in its 1995 ''business as usual'' energy scenario that future global emissions of CO{sub 2} to the atmosphere will increase from 7.4 billion tonnes of carbon (GtC) per year in 1997 to approximately 26 GtC/year by 2100. IPCC also projects a doubling of atmospheric CO{sub 2} concentration by the middle of next century and growing rates of increase beyond. Although the effects of increased CO{sub 2} levels on global climate are uncertain, many scientists agree that a doubling of atmospheric CO{sub 2} concentrations could have a variety of serious environmental consequences. The goal of this report is to identify key areas for research and development (R&D) that could lead to an understanding of the potential for future use of carbon sequestration as a major tool for managing carbon emissions. Under the leadership of DOE, researchers from universities, industry, other government agencies, and DOE national laboratories were brought together to develop the technical basis for conceiving a science and technology road map. That effort has resulted in this report, which develops much of the information needed for the road map.

  3. Review Statement and Evaluation of the Swedish Nuclear Fuel and Waste Management Co's RDandD Programme 2004. Programme for Research, Development and Demonstration of Methods for the Management and Disposal of Nuclear Waste, including Social Science Research

    International Nuclear Information System (INIS)

    2005-12-01

    verify the models in time prior to a licence application. Furthermore, the authorities assume that more long-term biosphere issues are being taken into account in SKB's new plan of action. - In its biosphere research, SKB should take into account the possibility of using radionuclide concentrations and flows as complementary safety indicators. - SKB should more clearly explain how it will ensure that studied climate scenarios will shed light on the most important climate-related stresses on the barrier function. - It is justifiable for the research conducted by SKB and Sweden in the area of PandT to maintain its current level so that international developments can be followed and to maintain and develop scientific and technical expertise in areas of importance for nuclear safety. - A clarification of the account of deep boreholes prior to the ultimate choice of a method and prior to licensing under the Environmental Code is needed. A comparison should be made with the KBS-3 method which utilizes safety assessment methodology including simple calculations. - SKB needs to intensify the work on decommissioning issues and in order to present detailed plans and considerations in RDandD Programme 2007. - SKB should investigate the shortest time required for the start of a licensing process for the disposal of decommissioning waste. - In the next RDandD programme, SKB should provide a more detailed description of the programme for long-lived low and intermediate-level waste. - SKB should take into account the viewpoint that long-term interim storage of waste while waiting for the construction of a repository should, as far as possible, be avoided and take this into consideration in its planning. - It is positive that SKB has incorporated social science research into its programme, since the findings from the research should be useful for the stakeholders to apply the research findings in ongoing and future consultation processes for an encapsulation plant and repository

  4. Review Statement and Evaluation of the Swedish Nuclear Fuel and Waste Management Co's RDandD Programme 2004. Programme for Research, Development and Demonstration of Methods for the Management and Disposal of Nuclear Waste, including Social Science Research

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2005-12-15

    verify the models in time prior to a licence application. Furthermore, the authorities assume that more long-term biosphere issues are being taken into account in SKB's new plan of action. - In its biosphere research, SKB should take into account the possibility of using radionuclide concentrations and flows as complementary safety indicators. - SKB should more clearly explain how it will ensure that studied climate scenarios will shed light on the most important climate-related stresses on the barrier function. - It is justifiable for the research conducted by SKB and Sweden in the area of PandT to maintain its current level so that international developments can be followed and to maintain and develop scientific and technical expertise in areas of importance for nuclear safety. - A clarification of the account of deep boreholes prior to the ultimate choice of a method and prior to licensing under the Environmental Code is needed. A comparison should be made with the KBS-3 method which utilizes safety assessment methodology including simple calculations. - SKB needs to intensify the work on decommissioning issues and in order to present detailed plans and considerations in RDandD Programme 2007. - SKB should investigate the shortest time required for the start of a licensing process for the disposal of decommissioning waste. - In the next RDandD programme, SKB should provide a more detailed description of the programme for long-lived low and intermediate-level waste. - SKB should take into account the viewpoint that long-term interim storage of waste while waiting for the construction of a repository should, as far as possible, be avoided and take this into consideration in its planning. - It is positive that SKB has incorporated social science research into its programme, since the findings from the research should be useful for the stakeholders to apply the research findings in ongoing and future consultation processes for an encapsulation plant and repository.

  5. Research Methods in European Union Studies

    DEFF Research Database (Denmark)

    Lynggaard, Kennet; Manners, Ian; Löfgren, Karl

    Research on the European Union over the past few years has been strongly implicated in the crises that currently grip Europe with a failure to ask the pertinent questions as well as a perceived weakness in the methods and evidence used by researchers providing the basis for these allegations....... This volume moves the study of EU research strategies beyond the dichotomies of the past towards a new agenda for research on Europe through a rich diversity of problem-solving based research. This new agenda acknowledges the weaknesses of the past and moves beyond them towards greater openness and awareness...

  6. Phenomenological Research Method, Design and Procedure: A ...

    African Journals Online (AJOL)

    Phenomenological Research Method, Design and Procedure: A Phenomenological Investigation of the Phenomenon of Being-in-Community as Experienced by Two Individuals Who Have Participated in a Community Building Workshop.

  7. Food studies: an introduction to research methods

    National Research Council Canada - National Science Library

    Miller, Jeff; Deutsch, Jonathan

    2009-01-01

    .... Designed for the classroom as well as for the independent scholar, the book details the predominant research methods in the field, provides a series of interactive questions and templates to help...

  8. Infusing Active Learning into the Research Methods Unit

    Science.gov (United States)

    Bluestone, Cheryl

    2007-01-01

    The research methods unit of survey psychology classes introduces important concepts of scientific reasoning and fluency, making it an ideal course in which to deliver enhanced curricula. To increase interest and engagement, the author developed an expanded research methods and statistics module to give students the opportunity to explore…

  9. Mixed Methods in Intervention Research: Theory to Adaptation

    Science.gov (United States)

    Nastasi, Bonnie K.; Hitchcock, John; Sarkar, Sreeroopa; Burkholder, Gary; Varjas, Kristen; Jayasena, Asoka

    2007-01-01

    The purpose of this article is to demonstrate the application of mixed methods research designs to multiyear programmatic research and development projects whose goals include integration of cultural specificity when generating or translating evidence-based practices. The authors propose a set of five mixed methods designs related to different…

  10. Development Of A Method For Measurement Of Total Neutron Cross Sections Based On The Neutron Transmission Method Using A He-3 Counter On Filtered Neutron Beams At Dalat Research Reactor

    International Nuclear Information System (INIS)

    Tran Tuan Anh; Dang Lanh; Nguyen Canh Hai; Nguyen Xuan Hai; Pham Kien; Nguyen Thuy Nham; Pham Ngoc Son; Ho Huu Thang

    2007-01-01

    Determination of total neutron cross sections and average resonance parameters in the energy range from tens keV to hundreds keV is important for fast reactors calculations and designs because this energy range gives the most output of all neutron induced reactions in the spectrum of fast reactors. Besides, the total neutron cross section measurement is also one of the methods for determination of s, p and d-wave neutron strength functions. The purpose of this project is to develop a method for measurement of total neutron cross sections based on the neutron transmission technique using a He-3 counter. The average total neutron cross sections of 238 U were obtained from neutron transmission measurements on filtered neutron beams of 55 keV and 144 keV at the horizontal channel No.4 of the Dalat research reactor. The present results have been compared with the previous measurements, and the evaluated data from ENDF/B-6.8 library. (author)

  11. Why, and how, mixed methods research is undertaken in health services research in England: a mixed methods study

    Science.gov (United States)

    O'Cathain, Alicia; Murphy, Elizabeth; Nicholl, Jon

    2007-01-01

    Background Recently, there has been a surge of international interest in combining qualitative and quantitative methods in a single study – often called mixed methods research. It is timely to consider why and how mixed methods research is used in health services research (HSR). Methods Documentary analysis of proposals and reports of 75 mixed methods studies funded by a research commissioner of HSR in England between 1994 and 2004. Face-to-face semi-structured interviews with 20 researchers sampled from these studies. Results 18% (119/647) of HSR studies were classified as mixed methods research. In the documentation, comprehensiveness was the main driver for using mixed methods research, with researchers wanting to address a wider range of questions than quantitative methods alone would allow. Interviewees elaborated on this, identifying the need for qualitative research to engage with the complexity of health, health care interventions, and the environment in which studies took place. Motivations for adopting a mixed methods approach were not always based on the intrinsic value of mixed methods research for addressing the research question; they could be strategic, for example, to obtain funding. Mixed methods research was used in the context of evaluation, including randomised and non-randomised designs; survey and fieldwork exploratory studies; and instrument development. Studies drew on a limited number of methods – particularly surveys and individual interviews – but used methods in a wide range of roles. Conclusion Mixed methods research is common in HSR in the UK. Its use is driven by pragmatism rather than principle, motivated by the perceived deficit of quantitative methods alone to address the complexity of research in health care, as well as other more strategic gains. Methods are combined in a range of contexts, yet the emerging methodological contributions from HSR to the field of mixed methods research are currently limited to the single

  12. Mixed Methods Research Designs in Counseling Psychology

    Science.gov (United States)

    Hanson, William E.; Creswell, John W.; Clark, Vicki L. Plano; Petska, Kelly S.; Creswell, David J.

    2005-01-01

    With the increased popularity of qualitative research, researchers in counseling psychology are expanding their methodologies to include mixed methods designs. These designs involve the collection, analysis, and integration of quantitative and qualitative data in a single or multiphase study. This article presents an overview of mixed methods…

  13. The Delphi Method in Rehabilitation Counseling Research

    Science.gov (United States)

    Vazquez-Ramos, Robinson; Leahy, Michael; Estrada Hernandez, Noel

    2007-01-01

    Rehabilitation researchers have found in the application of the Delphi method a more sophisticated way of obtaining consensus from experts in the field on certain matters. The application of this research methodology has affected and certainly advanced the body of knowledge of the rehabilitation counseling practice. However, the rehabilitation…

  14. RDandD Programme 2010. Programme for research, development and demonstration of methods for the management and disposal of nuclear waste

    International Nuclear Information System (INIS)

    2010-09-01

    The RD and D programme 2010 gives an account of SKB's plans for research, development and demonstration during the period 2011-2016. SKB's activities are divided into two main areas - the programme for Low and Intermediate Level Waste (the Loma program) and the Nuclear Fuel Program. The RD and D Programme 2010 consists of five parts: Part I: Overall Plan, Part II: Loma program, Part III: Nuclear Fuel Program, Part IV: Research on analysis of long-term safety, Part V: Social Science Research. The 2007 RD and D programme was focused primarily on technology development to realize the final repository for spent nuclear fuel. The actions described were aimed at increasing awareness of long-term safety and to obtain technical data for application under the Nuclear Activities Act for the final repository for spent fuel and under the Environmental Code of the repository system. Many important results from these efforts are reported in this program. An overall account of the results will be given in the Licensing application in early 2011. The authorities' review of RD and D programme in 2007 and completion of the program called for clarification of plans and programs for the final repository for short-lived radioactive waste, SFR, and the final repository for waste, SFL. This RD and D program describes these plans in a more detailed way

  15. RDandD Programme 2010. Programme for research, development and demonstration of methods for the management and disposal of nuclear waste

    Energy Technology Data Exchange (ETDEWEB)

    2010-09-15

    RDandD Programme 2010 presents SKB's plans for research, development and demonstration during the period 2011-2016. SKB's activities are divided into two main areas: the programme for low- and intermediate-level waste (the LILW Programme) and the Nuclear Fuel Programme. Operation of the existing facilities takes place within the Operational Process. RDandD Programme 2010 consists of five parts: Part I Overall plan of action Part II The LILW Programme Part III The Nuclear Fuel Programme Part IV Research for assessment of long-term safety Part V Social science research RDandD Programme 2007 was mainly focused on development of technology to realize the final repository for spent nuclear fuel. The efforts described were aimed at gaining a greater knowledge of long-term safety and compiling technical supporting documentation for applications under the Nuclear Activities Act for the final repository for spent nuclear fuel and under the Environmental Code for the final repository system. Many important results from these efforts are reported in this programme. The integrated account of the results will be presented in applications submitted in early 2011. The regulatory review of RDandD Programme 2007 and its supplement called for clarifications of plans and programmes for the final repository for short-lived radioactive waste, SFR, and the final repository for long-lived waste, SFL. This RDandD Programme describes these plans more clearly

  16. RDandD Programme 2010. Programme for research, development and demonstration of methods for the management and disposal of nuclear waste

    International Nuclear Information System (INIS)

    2010-09-01

    RDandD Programme 2010 presents SKB's plans for research, development and demonstration during the period 2011-2016. SKB's activities are divided into two main areas: the programme for low- and intermediate-level waste (the LILW Programme) and the Nuclear Fuel Programme. Operation of the existing facilities takes place within the Operational Process. RDandD Programme 2010 consists of five parts: Part I Overall plan of action Part II The LILW Programme Part III The Nuclear Fuel Programme Part IV Research for assessment of long-term safety Part V Social science research RDandD Programme 2007 was mainly focused on development of technology to realize the final repository for spent nuclear fuel. The efforts described were aimed at gaining a greater knowledge of long-term safety and compiling technical supporting documentation for applications under the Nuclear Activities Act for the final repository for spent nuclear fuel and under the Environmental Code for the final repository system. Many important results from these efforts are reported in this programme. The integrated account of the results will be presented in applications submitted in early 2011. The regulatory review of RDandD Programme 2007 and its supplement called for clarifications of plans and programmes for the final repository for short-lived radioactive waste, SFR, and the final repository for long-lived waste, SFL. This RDandD Programme describes these plans more clearly

  17. RDandD Programme 2010. Programme for research, development and demonstration of methods for the management and disposal of nuclear waste

    Energy Technology Data Exchange (ETDEWEB)

    2010-09-15

    RDandD Programme 2010 presents SKB's plans for research, development and demonstration during the period 2011-2016. SKB's activities are divided into two main areas: the programme for low- and intermediate-level waste (the LILW Programme) and the Nuclear Fuel Programme. Operation of the existing facilities takes place within the Operational Process. RDandD Programme 2010 consists of five parts: Part I Overall plan of action Part II The LILW Programme Part III The Nuclear Fuel Programme Part IV Research for assessment of long-term safety Part V Social science research RDandD Programme 2007 was mainly focused on development of technology to realize the final repository for spent nuclear fuel. The efforts described were aimed at gaining a greater knowledge of long-term safety and compiling technical supporting documentation for applications under the Nuclear Activities Act for the final repository for spent nuclear fuel and under the Environmental Code for the final repository system. Many important results from these efforts are reported in this programme. The integrated account of the results will be presented in applications submitted in early 2011. The regulatory review of RDandD Programme 2007 and its supplement called for clarifications of plans and programmes for the final repository for short-lived radioactive waste, SFR, and the final repository for long-lived waste, SFL. This RDandD Programme describes these plans more clearly

  18. Approaches to Mixed Methods Dissemination and Implementation Research: Methods, Strengths, Caveats, and Opportunities.

    Science.gov (United States)

    Green, Carla A; Duan, Naihua; Gibbons, Robert D; Hoagwood, Kimberly E; Palinkas, Lawrence A; Wisdom, Jennifer P

    2015-09-01

    Limited translation of research into practice has prompted study of diffusion and implementation, and development of effective methods of encouraging adoption, dissemination and implementation. Mixed methods techniques offer approaches for assessing and addressing processes affecting implementation of evidence-based interventions. We describe common mixed methods approaches used in dissemination and implementation research, discuss strengths and limitations of mixed methods approaches to data collection, and suggest promising methods not yet widely used in implementation research. We review qualitative, quantitative, and hybrid approaches to mixed methods dissemination and implementation studies, and describe methods for integrating multiple methods to increase depth of understanding while improving reliability and validity of findings.

  19. Mapping Mixed Methods Research: Methods, Measures, and Meaning

    Science.gov (United States)

    Wheeldon, J.

    2010-01-01

    This article explores how concept maps and mind maps can be used as data collection tools in mixed methods research to combine the clarity of quantitative counts with the nuance of qualitative reflections. Based on more traditional mixed methods approaches, this article details how the use of pre/post concept maps can be used to design qualitative…

  20. The imagework method in health and social science research.

    Science.gov (United States)

    Edgar, I R

    1999-03-01

    Existing alongside the traditional forms of qualitative social science research, there is a set of potential research methods that derive from experiential groupwork and the humanistic human potential movement and are only slightly used by researchers. Social science research has barely begun to use these powerful strategies that were developed originally for personal and group change but that are potentially applicable to the research domain. This article will locate these methods within the qualitative research domain and propose a novel view of their value. The study of the actual and potential use of one of these methods, imagework, will be the particular focus of this article. References to the use of artwork, sculpting, psychodrama, gestalt, and dreamwork will also be made. The hypothesis underpinning the author's approach is that experiential research methods such as imagework can elicit implicit knowledge and self-identifies of respondents in a way that other methods cannot.

  1. A Review of Research Methods in Children's Technology Design

    DEFF Research Database (Denmark)

    Jensen, Janne Jul; Skov, Mikael B.

    2005-01-01

    Research methods have been objects of discussions for dec-ades and defining research methods is still a quite substan-tial challenge. However, it is important to understand how research methods have been adapted in different disciplines as it potentially informs us on future directions and influ......-ences on the discipline. Inspired by previous studies from other disciplines, we conduct a survey of research methods in paper publications. 105 papers on children's technology design are classified on a two-dimensional matrix on research method and pur-pose. Our results show a strong focus on engineering of products...... as applied research and on evaluation of devel-oped products in the field or in the lab. Also, we find that much research is conducted in natural setting environments with strong focus on field studies....

  2. Students' perspectives of undergraduate research methods ...

    African Journals Online (AJOL)

    Introduction: in this study we used a model of adult learning to explore undergraduate students' views on how to improve the teaching of research methods and biostatistics. Methods: this was a secondary analysis of survey data of 600 undergraduate students from three medical schools in Uganda. The analysis looked at ...

  3. Using Replication Projects in Teaching Research Methods

    Science.gov (United States)

    Standing, Lionel G.; Grenier, Manuel; Lane, Erica A.; Roberts, Meigan S.; Sykes, Sarah J.

    2014-01-01

    It is suggested that replication projects may be valuable in teaching research methods, and also address the current need in psychology for more independent verification of published studies. Their use in an undergraduate methods course is described, involving student teams who performed direct replications of four well-known experiments, yielding…

  4. Co-ordinated research programme on application of stable isotope tracer methods to studies of amino acid, protein, and energy metabolism in malnourished populations of developing countries. Report on the second research co-ordination meeting

    International Nuclear Information System (INIS)

    1996-01-01

    The use of isotopes has revolutionized the field of human nutrition research, but has been of greatest benefit to industrialized countries. The International Atomic Energy Agency is sponsoring programmes using isotopic and related technologies in human nutrition research to address issues that are of priority to developing countries. Scientists participating in the Coordinated Research Programme (CRP) on ''Amino Acid and Protein Metabolism in Malnourished Populations of Developing Countries'' are conducting research on the interaction between infection and amino acid metabolism, particularly the potential diversion of substrates from anabolic pathways to fight infection in marginally nourished children during periods of infections. This topic is of great importance to the nutritional status of children in developing countries, who frequently or chronically have infections and who, as a consequence, may have alterations in nutrient requirements. The CRP has developed and implemented a standardized protocol for measuring leucine oxidation during infection in 8 different countries. The CRP is expected to contribute important new knowledge about interactions between protein utilization, the stresses of unhygienic environments, and infections in marginally nourished people. This information is expected to be applicable to efforts to increase efficient utilization of limited food resources in developing countries. Another highlight of the CRP is that it represents an international team of nutrition scientists who together are building nutritional biology research capabilities in developing countries. Refs, figs, tabs

  5. Co-ordinated research programme on application of stable isotope tracer methods to studies of amino acid, protein, and energy metabolism in malnourished populations of developing countries. Report on the second research co-ordination meeting

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1997-12-31

    The use of isotopes has revolutionized the field of human nutrition research, but has been of greatest benefit to industrialized countries. The International Atomic Energy Agency is sponsoring programmes using isotopic and related technologies in human nutrition research to address issues that are of priority to developing countries. Scientists participating in the Coordinated Research Programme (CRP) on ``Amino Acid and Protein Metabolism in Malnourished Populations of Developing Countries`` are conducting research on the interaction between infection and amino acid metabolism, particularly the potential diversion of substrates from anabolic pathways to fight infection in marginally nourished children during periods of infections. This topic is of great importance to the nutritional status of children in developing countries, who frequently or chronically have infections and who, as a consequence, may have alterations in nutrient requirements. The CRP has developed and implemented a standardized protocol for measuring leucine oxidation during infection in 8 different countries. The CRP is expected to contribute important new knowledge about interactions between protein utilization, the stresses of unhygienic environments, and infections in marginally nourished people. This information is expected to be applicable to efforts to increase efficient utilization of limited food resources in developing countries. Another highlight of the CRP is that it represents an international team of nutrition scientists who together are building nutritional biology research capabilities in developing countries. Refs, figs, tabs.

  6. Unified fuel elements development for research reactors

    International Nuclear Information System (INIS)

    Vatulin, A.; Stetsky, Y.; Dobrikova, I.

    1998-01-01

    Square cross-section rod type fuel elements have been developed for russian pool-type research reactors. new fuel elements can replace the large nomenclature of tubular fuel elements with around, square and hexahedral cross-sections and to solve a problem of enrichment reduction. the fuel assembly designs with rod type fuel elements have been developed. The overall dimensions of existing the assemblies are preserved in this one. the experimental-industrial fabricating process of fuel elements, based on a joint extrusion method has been developed. The fabricating process has been tested in laboratory conditions, 150 experimental fuel element samples of the various sizes were produced. (author)

  7. Research and Development. Annual Report 2000

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2001-07-01

    This report discusses the research and development activities in which NVE has been involved in 2000. These activities fall into three categories: watercourse research, hydrological research and energy related research. The HYDRA research programme, which studied flooding and human intervention, is discussed in particular. The report includes a list of research and development reports that were published in 2000.

  8. Fiscal 2000 achievement report on project for research and development of intelligent infrastructure creation and utilization technologies. Research and development project on high-speed deformation characteristics evaluation methods for metallic materials; 2000 nendo chiteki kiban sose riyo gijutsu kenkyu kaihatsu jigyo. Kinzoku zairyo no kosoku henkei tokusei hyoka hoho no kenkyu kaihatsu jigyo - Gyomu seika hokokusho

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2001-03-01

    Efforts were made to develop methods for evaluating the characteristics of metallic materials experiencing high-speed deformation or impact deformation. The research was conducted by the research WG (working group) consisting of some participants of an international conference convened this fiscal year. The research result revealed that studies in Japan lopsidedly dealt with metallic materials at strain velocity of 10{sup 4}/second or less, such as steel, while many studies overseas dealt with materials other than metals at strain velocity over 10{sup 4}/second. The test and evaluation WG conducted high-speed tension tests for T6-treated aluminum alloys using the split Hopkinson bar method, hydraulic servo method, one bar method, and the sensing-plate method for measuring force, and the results were compared. It was then found that the one bar method produced disturbance more remarkably than the others and that the loading block structure and load rise time influenced the emergence of the peak load. The emergence of a peak load in the Hopkinson bar method or the one bar method had been predicted on the basis of the research conducted by the analysis group. (NEDO)

  9. Research and development of methods and tools for achieving and maintaining consensus processes in the face of change within and among government oversight agencies: Volume 1

    International Nuclear Information System (INIS)

    1992-03-01

    This progress report summarizes our research activities under our consensus grant. In year four of the grant, we continued to capitalize on and benefit from historical events which drove our early emphasis on group process studies. Following our work on various procedures for bringing together groups such as the State and Tribal Government Working Group and the Stakeholders' Forum (both of which provide input to the Five-Year Waste Plan), we continue to observe these groups and collect data. We also began a configuration study involving the complex modeling of DOE's Office of Environmental Restoration and Waste Management (EM). Related to group process studies is the issue of the information requirements for individuals making decisions in consensus groups. Our information studies examined the requirements for decision-related information, frameworks for such information, and the effectiveness of information portrayed for decision making. However, we were able not only to continue studying consensus groups in action and related information issues, but also to focus considerable attention on the fundamental side of our research. The fundamental or basic research conducted in year four included: (1) expanding our literature database; (2) beginning the writing of the literature review summary document and the consensus guide; (3) developing frameworks and models such as the Environmental Trilogy model and a structural equations model of the consensus process; and (4) conducting laboratory studies concerning the effects of the presence of an expert, met expectations, opportunity to express views, incentive structure and conflict type (competitive versus collaborative) on consensus outcomes

  10. Canada Research Chairs | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    aspx. International Research Chairs Initiative. The International Research Chairs Initiative pairs top research talent from universities in Canada with their counterparts in developing countries to address key development challenges. View more

  11. Writing a Mixed Methods Report in Social Work Research

    Science.gov (United States)

    Bronstein, Laura R.; Kovacs, Pamela J.

    2013-01-01

    This article briefly chronicles the development of mixed methods research and its use in social work. We then move onto a discussion of terms and designs, reasons for (and for not) using mixed methods. Drawing upon exemplars, we address how to write up a mixed methods study when (1) the sample is single; single for one part, with a subset for the…

  12. Neutron spectrometric methods for core inventory verification in research reactors

    International Nuclear Information System (INIS)

    Ellinger, A.; Filges, U.; Hansen, W.; Knorr, J.; Schneider, R.

    2002-01-01

    In consequence of the Non-Proliferation Treaty safeguards, inspections are periodically made in nuclear facilities by the IAEA and the EURATOM Safeguards Directorate. The inspection methods are permanently improved. Therefore, the Core Inventory Verification method is being developed as an indirect method for the verification of the core inventory and to check the declared operation of research reactors

  13. The Brazilian Research Consortium on Obsessive-Compulsive Spectrum Disorders: recruitment, assessment instruments, methods for the development of multicenter collaborative studies and preliminary results.

    Science.gov (United States)

    Miguel, Euripedes Constantino; Ferrão, Ygor Arzeno; Rosário, Maria Conceição do; Mathis, Maria Alice de; Torres, Albina Rodrigues; Fontenelle, Leonardo Franklin; Hounie, Ana Gabriela; Shavitt, Roseli Gedanke; Cordioli, Aristides Volpato; Gonzalez, Christina Hojaij; Petribú, Kátia; Diniz, Juliana Belo; Malavazzi, Dante Marino; Torresan, Ricardo C; Raffin, Andréa Litvin; Meyer, Elisabeth; Braga, Daniela T; Borcato, Sonia; Valério, Carolina; Gropo, Luciana N; Prado, Helena da Silva; Perin, Eduardo Alliende; Santos, Sandro Iêgo; Copque, Helen; Borges, Manuela Corrêa; Lopes, Angélica Prazeres; Silva, Elenita D da

    2008-09-01

    To describe the recruitment of patients, assessment instruments, implementation, methods and preliminary results of The Brazilian Research Consortium on Obsessive-Compulsive Spectrum Disorders, which includes seven university sites. This cross-sectional study included a comprehensive clinical assessment including semi-structured interviews (sociodemographic data, medical and psychiatric history, disease course and comorbid psychiatric diagnoses), and instruments to assess obsessive-compulsive (Yale-Brown Obsessive-Compulsive Scale and Dimensional Yale-Brown Obsessive-Compulsive Scale), depressive (Beck Depression Inventory) and anxious (Beck Anxiety Inventory) symptoms, sensory phenomena (Universidade de São Paulo Sensory Phenomena Scale), insight (Brown Assessment Beliefs Scale), tics (Yale Global Tics Severity Scale) and quality of life (Medical Outcome Quality of Life Scale Short-form-36 and Social Assessment Scale). The raters' training consisted of watching at least five videotaped interviews and interviewing five patients with an expert researcher before interviewing patients alone. The reliability between all leaders for the most important instruments (Structured Clinical Interview for DSM-IV, Dimensional Yale-Brown Obsessive-Compulsive Scale, Universidade de São Paulo Sensory Phenomena Scale) was measured after six complete interviews. Inter-rater reliability was 96%. By March 2008, 630 obsessive-compulsive disorder patients had been systematically evaluated. Mean age (+/-SE) was 34.7 (+/-0.51), 56.3% were female, and 84.6% Caucasian. The most prevalent obsessive compulsive symptom dimensions were symmetry and contamination. The most common comorbidities were major depression, generalized anxiety and social anxiety disorder. The most common DSM-IV impulsive control disorder was skin picking. The sample was composed mainly by Caucasian individuals, unmarried, with some kind of occupational activity, mean age of 35 years, onset of obsessive

  14. Research and development of methods/utilities and rules for managing cooperation for performance improvement in government offices. Second Technical progress report, September 1, 1992--January 31, 1993

    Energy Technology Data Exchange (ETDEWEB)

    Kurstedt, H.A.

    1993-03-01

    Purpose is to help managers approach their responsibilities proactively, so that they can anticipate problems and take actions to alleviate or eliminate those problems. Continuous performance improvement, the philosophy behind total quality management, requires working cooperatively to do a little better each day. The most effective tools are working through a closed set of 9 methods: setting expectations, charting, defining indicators and standards, collecting and logging data, converting data to information, organizing and presenting information, reviewing status and progress, self-management, and appraising. In addition, there are 8 rules: focus on what you can do, supply physical evidence of progress, pay attention to detail, inspect (don`t expect), review progress routinely and frequently, face ``success/fail`` squarely, communicate crisply, and conduct honest, open appraisals. Scope and plans of the draft research plan (study areas) are described.

  15. The TIMSS Videotape Classroom Study: Methods and Findings from an Exploratory Research Project on Eighth-Grade Mathematics Instruction in Germany, Japan, and the United States. A Research and Development Report.

    Science.gov (United States)

    Stigler, James W.; Gonzales, Patrick; Kwanaka, Takako; Knoll, Steffen; Serrano, Ana

    This report presents the methods and preliminary findings of the Videotape Classroom Study, a video study of eighth-grade mathematics lessons in Germany, Japan, and the United States. This exploratory research project is part of the Third International Mathematics and Science Study (TIMSS). The study included 231 eighth-grade mathematics…

  16. Research Engagement for School Development

    Science.gov (United States)

    Wilkins, Raphael

    2011-01-01

    This thought-provoking book examines the new and growing phenomenon of the "research-engaged school"--schools that not only encourage their staff to carry out their own research, but also use published research to inform practice and improve the quality of education. The author draws upon his scholarship and practice in local authorities, schools…

  17. The Challenges of Developing Research Resources for Leading Vietnamese Universities

    Science.gov (United States)

    Nguyen, Thi Lan Huong

    2013-01-01

    This paper examines the challenges of developing research resources for leading Vietnamese universities. The first part of the paper presents the background to the study, including literature review on the challenges to research resources development, and describes the research questions and research methods. The next part provides empirical…

  18. Qualitative and Mixed Methods Social Media Research

    OpenAIRE

    Chareen L. Snelson

    2016-01-01

    Social media technologies have attracted substantial attention among many types of users including researchers who have published studies for several years. This article presents an overview of trends in qualitative and mixed methods social media research literature published from 2007 through 2013. A collection of 229 qualitative studies were identified through a systematic literature review process. A subset of 55 of these articles report studies involving a combination of qualitative and q...

  19. Qualitative and Mixed Methods Social Media Research

    Directory of Open Access Journals (Sweden)

    Chareen L. Snelson

    2016-02-01

    Full Text Available Social media technologies have attracted substantial attention among many types of users including researchers who have published studies for several years. This article presents an overview of trends in qualitative and mixed methods social media research literature published from 2007 through 2013. A collection of 229 qualitative studies were identified through a systematic literature review process. A subset of 55 of these articles report studies involving a combination of qualitative and quantitative methods. Articles were reviewed, analyzed, and coded through a qualitative content analysis approach. Overall trends are presented with respect to the entire collection of articles followed by an analysis of mixed methods research approaches identified in the subset of 55 studies. The most commonly used research approaches involved collecting data from people through interview, focus group, and survey methodologies. Content analysis was the second most commonly used approach whereby researchers use Facebook posts, Tweets (Twitter posts, YouTube videos, or other social media content as a data source. Many of the studies involving combinations of quantitative and qualitative data followed a design resembling Creswell and Plano Clark’s basic mixed methods typology (e.g., convergent parallel, explanatory sequential, and exploratory sequential.

  20. [Application and Integration of Qualitative and Quantitative Research Methods in Intervention Studies in Rehabilitation Research].

    Science.gov (United States)

    Wirtz, M A; Strohmer, J

    2016-06-01

    In order to develop and evaluate interventions in rehabilitation research a wide range of empirical research methods may be adopted. Qualitative research methods emphasize the relevance of an open research focus and a natural proximity to research objects. Accordingly, using qualitative methods special benefits may arise if researchers strive to identify and organize unknown information aspects (inductive purpose). Particularly, quantitative research methods require a high degree of standardization and transparency of the research process. Furthermore, a clear definition of efficacy and effectiveness exists (deductive purpose). These paradigmatic approaches are characterized by almost opposite key characteristics, application standards, purposes and quality criteria. Hence, specific aspects have to be regarded if researchers aim to select or combine those approaches in order to ensure an optimal gain in knowledge. © Georg Thieme Verlag KG Stuttgart · New York.

  1. Research and development of methods and tools for achieving and maintaining consensus processes in the face of change within and among government oversight agencies: Volume 1

    Energy Technology Data Exchange (ETDEWEB)

    1992-03-01

    This progress report summarizes our research activities under our consensus grant. In year four of the grant, we continued to capitalize on and benefit from historical events which drove our early emphasis on group process studies. Following our work on various procedures for bringing together groups such as the State and Tribal Government Working Group and the Stakeholders' Forum (both of which provide input to the Five-Year Waste Plan), we continue to observe these groups and collect data. We also began a configuration study involving the complex modeling of DOE's Office of Environmental Restoration and Waste Management (EM). Related to group process studies is the issue of the information requirements for individuals making decisions in consensus groups. Our information studies examined the requirements for decision-related information, frameworks for such information, and the effectiveness of information portrayed for decision making. However, we were able not only to continue studying consensus groups in action and related information issues, but also to focus considerable attention on the fundamental side of our research. The fundamental or basic research conducted in year four included: (1) expanding our literature database; (2) beginning the writing of the literature review summary document and the consensus guide; (3) developing frameworks and models such as the Environmental Trilogy model and a structural equations model of the consensus process; and (4) conducting laboratory studies concerning the effects of the presence of an expert, met expectations, opportunity to express views, incentive structure and conflict type (competitive versus collaborative) on consensus outcomes.

  2. Research and development and industrial informatization

    International Nuclear Information System (INIS)

    1995-08-01

    This book deals with research and development and industrial informatization with development of technology international trend, the present conditions of scientific technology in the major nations, politics of technical development and trend, process of national research and development, research for industrial research and development, strengthen cooperation for scientific technology among nations, current situation and development of technology by field such as energy, software and system, and technology for industrial informatization.

  3. Historical Development of Origins Research

    Science.gov (United States)

    Lazcano, Antonio

    2010-01-01

    Following the publication of the Origin of Species in 1859, many naturalists adopted the idea that living organisms were the historical outcome of gradual transformation of lifeless matter. These views soon merged with the developments of biochemistry and cell biology and led to proposals in which the origin of protoplasm was equated with the origin of life. The heterotrophic origin of life proposed by Oparin and Haldane in the 1920s was part of this tradition, which Oparin enriched by transforming the discussion of the emergence of the first cells into a workable multidisciplinary research program. On the other hand, the scientific trend toward understanding biological phenomena at the molecular level led authors like Troland, Muller, and others to propose that single molecules or viruses represented primordial living systems. The contrast between these opposing views on the origin of life represents not only contrasting views of the nature of life itself, but also major ideological discussions that reached a surprising intensity in the years following Stanley Miller’s seminal result which showed the ease with which organic compounds of biochemical significance could be synthesized under putative primitive conditions. In fact, during the years following the Miller experiment, attempts to understand the origin of life were strongly influenced by research on DNA replication and protein biosynthesis, and, in socio-political terms, by the atmosphere created by Cold War tensions. The catalytic versatility of RNA molecules clearly merits a critical reappraisal of Muller’s viewpoint. However, the discovery of ribozymes does not imply that autocatalytic nucleic acid molecules ready to be used as primordial genes were floating in the primitive oceans, or that the RNA world emerged completely assembled from simple precursors present in the prebiotic soup. The evidence supporting the presence of a wide range of organic molecules on the primitive Earth, including membrane

  4. Cancer Data and Aboriginal Disparities (CanDAD)-developing an Advanced Cancer Data System for Aboriginal people in South Australia: a mixed methods research protocol.

    Science.gov (United States)

    Yerrell, Paul Henry; Roder, David; Cargo, Margaret; Reilly, Rachel; Banham, David; Micklem, Jasmine May; Morey, Kim; Stewart, Harold Bundamurra; Stajic, Janet; Norris, Michael; Brown, Alex

    2016-12-23

    In Australia, Aboriginal and Torres Strait Islander People carry a greater burden of cancer-related mortality than non-Aboriginal Australians. The Cancer Data and Aboriginal Disparities Project aims to develop and test an integrated, comprehensive cancer monitoring and surveillance system capable of incorporating epidemiological and narrative data to address disparities and advocate for clinical system change. The Advanced Cancer Data System will integrate routinely collected unit record data from the South Australian Population Cancer Registry and a range of other data sources for a retrospective cohort of indigenous people with cancers diagnosed from 1990 to 2010. A randomly drawn non-Aboriginal cohort will be matched by primary cancer site, sex, age and year at diagnosis. Cross-tabulations and regression analyses will examine the extent to which demographic attributes, cancer stage and survival vary between the cohorts. Narratives from Aboriginal people with cancer, their families, carers and service providers will be collected and analysed using patient pathway mapping and thematic analysis. Statements from the narratives will structure both a concept mapping process of rating, sorting and prioritising issues, focusing on issues of importance and feasibility, and the development of a real-time Aboriginal Cancer Measure of Experience for ongoing linkage with epidemiological data in the Advanced Cancer Data System. Aboriginal Community engagement underpins this Project. The research has been approved by relevant local and national ethics committees. Findings will be disseminated in local and international peer-reviewed journals and conference presentations. In addition, the research will provide data for knowledge translation activities across the partner organisations and feed directly into the Statewide Cancer Control Plan. It will provide a mechanism for monitoring and evaluating the implementation of the recommendations in these documents. Published by the

  5. Mixed Methods Designs for Sports Medicine Research.

    Science.gov (United States)

    Kay, Melissa C; Kucera, Kristen L

    2018-07-01

    Mixed methods research is a relatively new approach in the field of sports medicine, where the benefits of qualitative and quantitative research are combined while offsetting the other's flaws. Despite its known and successful use in other populations, it has been used minimally in sports medicine, including studies of the clinician perspective, concussion, and patient outcomes. Therefore, there is a need for this approach to be applied in other topic areas not easily addressed by one type of research approach in isolation, such as the retirement from sport, effects of and return from injury, and catastrophic injury. Copyright © 2018 Elsevier Inc. All rights reserved.

  6. Qualitative methods in radiography research: a proposed framework

    International Nuclear Information System (INIS)

    Adams, J.; Smith, T.

    2003-01-01

    Introduction: While radiography is currently developing a research base, which is important in terms of professional development and informing practice and policy issues in the field, the amount of research published by radiographers remains limited. However, a range of qualitative methods offer further opportunities for radiography research. Purpose: This paper briefly introduces a number of key qualitative methods (qualitative interviews, focus groups, observational methods, diary methods and document/text analysis) and sketches one possible framework for future qualitative work in radiography research. The framework focuses upon three areas for study: intra-professional issues; inter-professional issues; and clinical practice, patient and health delivery issues. While the paper outlines broad areas for future focus rather than providing a detailed protocol for how individual pieces of research should be conducted, a few research questions have been chosen and examples of possible qualitative methods required to answer such questions are outlined for each area. Conclusion: Given the challenges and opportunities currently facing the development of a research base within radiography, the outline of key qualitative methods and broad areas suitable for their application is offered as a useful tool for those within the profession looking to embark upon or enhance their research career

  7. FY 1974 Report on results of Sunshine Project. Research and development of methods for wide-area thermal structure exploitation; 1974 nendo koiki netsu kozo chosaho no kenkyu kaihatsu seika hokokusho

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1975-05-28

    The project of (research and development of methods for wide-area thermal structure exploitation) is to pursue (1) development of heat flow rate analyzers, and researches on the methods for measurement/analysis of heat flow rates, (2) researches on geological thermometers with the cores collected from test bores as the samples, (3) observation/analysis of microearthquakes, and application of the results to the geothermal structure exploitation, and (4) development, on a trial basis, small, light air drilling machines. The method for clearly elucidating thermal structures has not been well established. Therefore, a test bore was drilled to measure temperature and collect the core samples in the wide-area geothermal district at Kita Yahata-daira as the model district, for measurement of heat flows, and analysis of the cores to estimate temperature at which they are formed. Microearthquakes, which frequently occur in geothermal areas, are also observed for extended periods. This project of (research and development of methods for wide-area thermal structure exploitation) is aimed at, based on the above efforts, to estimate/elucidate depth of thermal sources by the geological, geophysical and geochemical studies, relationships between geological structures and high-temperature zones, geothermal propagation structures, and geothermal reserves. This report summarizes the R and D results in the initial year of the 6-year plan. (NEDO)

  8. A CTSA Agenda to Advance Methods for Comparative Effectiveness Research

    Science.gov (United States)

    Helfand, Mark; Tunis, Sean; Whitlock, Evelyn P.; Pauker, Stephen G.; Basu, Anirban; Chilingerian, Jon; Harrell Jr., Frank E.; Meltzer, David O.; Montori, Victor M.; Shepard, Donald S.; Kent, David M.

    2011-01-01

    Abstract Clinical research needs to be more useful to patients, clinicians, and other decision makers. To meet this need, more research should focus on patient‐centered outcomes, compare viable alternatives, and be responsive to individual patients’ preferences, needs, pathobiology, settings, and values. These features, which make comparative effectiveness research (CER) fundamentally patient‐centered, challenge researchers to adopt or develop methods that improve the timeliness, relevance, and practical application of clinical studies. In this paper, we describe 10 priority areas that address 3 critical needs for research on patient‐centered outcomes (PCOR): (1) developing and testing trustworthy methods to identify and prioritize important questions for research; (2) improving the design, conduct, and analysis of clinical research studies; and (3) linking the process and outcomes of actual practice to priorities for research on patient‐centered outcomes. We argue that the National Institutes of Health, through its clinical and translational research program, should accelerate the development and refinement of methods for CER by linking a program of methods research to the broader portfolio of large, prospective clinical and health system studies it supports. Insights generated by this work should be of enormous value to PCORI and to the broad range of organizations that will be funding and implementing CER. Clin Trans Sci 2011; Volume 4: 188–198 PMID:21707950

  9. Nuclear methods in national development

    International Nuclear Information System (INIS)

    1993-01-01

    This volume of the proceedings of the First National Conference on Nuclear Methods held at Kongo Conference Hotel Zaria from 2-4 September 1993, contains the full text of about 30 technical papers and speeches of invited dignitaries presented at the conference. The technical papers are original or review articles containing results and experiences in nuclear and related analytical techniques. Topics treated include neutron generator operation and control, nuclear data, application of nuclear techniques in environment, geochemistry, medicine, biology, agriculture, material science and industries. General topics in nuclear laboratory organization and research experiences were also covered. The papers were fully discussed during the conference and authors were requested to make changes in the manuscripts where necessary. However, they were further edited. The organizing committee wishes to thank all authors for their presentation and cooperation in submitting their manuscripts promptly and the participants for their excellent contribution during the conference

  10. Nuclear physics methods in materials research

    International Nuclear Information System (INIS)

    1980-01-01

    The brochure contains the abstracts of the papers presented at the 7th EPS meeting 1980 in Darmstadt. The main subjects were: a) Neutron scattering and Moessbauer effect in materials research, b) ion implantation in micrometallurgy, c) applications of nuclear reactions and radioisotopes in research on solids, d) recent developments in activation analysis and e) pions, positrons, and heavy ions applied in solid state physics. (RW) [de

  11. Web Developer | IDRC - International Development Research Centre

    International Development Research Centre (IDRC) Digital Library (Canada)

    Primary Duties or Responsibilities Web Development Leads all technical web ... design, and maintain the corporate website and any other internet properties IDRC ... and testing site for use by members of the website and social media team.

  12. Phenomenography: A Missed Method in Medical Research

    Directory of Open Access Journals (Sweden)

    Assarroudi Abdolghader

    2016-09-01

    Full Text Available Research is an approach with which human beings can attempt to answer questions and discover the unknowns. Research methodology is something that is determined by the researcher’s attitude toward the universe as well as by the question he is trying to answer. Some essential questions regarding the research process are: “What is the nature of reality?”, “What is the nature of the relationship between the scholar and the subject of interest?”, and “How can one understand the subject, and what are the methods?”. Research approaches can be categorized as quantitative and qualitative. In the former, measurement, prediction, and control are the bases, while in the latter, exploring, describing, and explaining the phenomena are fundamental. Among qualitative research methods, phenomenography is one of the newest methods. However, in spite of proving to be useful in various disciplines, it has yet to become popular, and many scholars mistake it for phenomenology. The focus of phenomenography is on what is known as the second-order perspective and the different ways that people can experience the same phenomenon, while phenomenology primarily emphasizes the first-order perspective and the similar essences that are derived from various experiences. This article aims to provide a better understanding of phenomenography through explaining it and comparing it with phenomenology in order to facilitate its proper and timely application in medical studies.

  13. Achievement report on research and development of medical and welfare equipment technology. Optical tomographic imaging method; Iryo fukushi kiki gijutsu kenkyu kaihatsu seika hokokusho. Hikari danso imaging system

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1999-11-01

    The aim is to develop a method of processing oxygen concentration distribution in human organs into an image by computed tomography using near infrared rays capable of transmitting through living tissues. Since the photoabsorption spectra of hemoglobin etc. in blood vary according to the degree of their oxidation, an oxygen concentration level is determined by measuring the magnitude of the variation. In the imaging method named in the title, the object is irradiated with picosecond-level near infrared pulses from all directions successively, the pulses after transmission through the object are measured at all directions at a picosecond-level time resolution, and the distribution of pulse scattering and absorption characteristics are subjected to algorithmic calculation, the outcome is converted into oxygen concentration levels, and an image is obtained. A 64-channel time resolution measurement system is constructed, and is applied to living tissue models (phantoms) and animals, and an image is obtained and evaluated. On the basis of the result, a patient is examined for clinical evaluation, and an image reflecting the distribution of variations in hemoglobin oxygen concentration is obtained for the head of the adult patient. A spatial resolution of 1cm is achieved in case of a phantom 10cm in diameter. In the case of 64 channels, measurement takes approximately 20 minutes and mapping image data measurement takes approximately 7 minutes. (NEDO)

  14. What we do | Page 76 | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Results 751 - 760 of 1736 ... IDRC funds research in developing countries to create lasting change on a large scale. ... Topic(s): Research Methods, Partnership, Higher Education ... Capacity Building, Human Rights, Policy Making, Social Justice.

  15. RD and D-Programme 2001. Programme for research, development and demonstration of methods for the management and disposal of nuclear waste

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2001-09-01

    heterogeneity of the rock in the best manner and to serve as a basis for selecting suitable rock for location of deposition tunnels and holes. The chemistry of the groundwater at repository depth has been thoroughly studied, and SKB has developed practical methods for investigating a future site. Microbial processes are a relatively new field that we are continuing to investigate. Matrix diffusion describes how dissolved radionuclides penetrate into the micro fractures in the rock, thereby retarding the migration of radionuclides along large water-bearing fractures in the rock. Diffusion in micro fractures has been thoroughly investigated, but its relationship with the water flow and the geometry of the system of major fractures in the rock needs to be further studied. Postglacial land uplift and climatic variations are examples of processes that influence the evolution of the biosphere in the long term. Knowledge of the mechanisms for transfer of radionuclides between different parts of the biosphere has improved, and the models will be based on this new knowledge. Examples of ecosystems that are studied and dealt with in the models are forest, mireland and sediment. Permafrost is an example of a climatic state that will be more closely investigated, and a project aimed at this is currently planned. Another example is the glacial state. Material analogues occupy a prominent position in the upcoming programme. Typical material analogues are natural deposits of copper or bentonite, but concrete will also be investigated. Specimens of old concrete will be examined, as well as sites where cement minerals occur naturally. The different steps in building the repository, emplacing the canisters and the buffer, and backfilling and closure are tested on Aespoe. Site investigation methods are also developed there. Full-scale tests are being performed at the Aespoe HRL of drilling of deposition holes, emplacement of canisters and bentonite, and backfilling. The Prototype Repository in

  16. Research and development program, fiscal year 1966

    Energy Technology Data Exchange (ETDEWEB)

    1964-04-01

    The biomedical program of the Laboratory of Nuclear Medicine and Radiation Biology for FY 1966 is conducted within the scope of the following categories: Somatic Effects of Radiation; Combating Detrimental Effects of Radiation; Molecular and Cellular Level Studies; Environmental Radiation Studies; Radiological and Health Physics and Instrumentation; Chemical Toxicity; Cancer Research; and Selected Beneficial Applications. The overall objectives of the Laboratory within these areas of the Biology and Medicine program may be summarized as follows: (1) investigation of the effects of ionizing radiation on living organisms and systems of biological significance; (2) investigation of the dynamic aspects of physiological and biochemical processes in man, animals and plants and how these processes are modified by radiation and related pathological states; (3) the assessment and study of the immediate and long term consequences of the operation or detonation of nuclear devices on the fauna, and flora in man's environment and on man; (4) the development of methods of minimizing or preventing the detrimental effects of ionizing radiation; (5) research in, and development of, beneficial uses of ionizing radiation and radioactive substances in medicine and biology; (6) research in the development of new and more efficient radiation detection devices; (7) research, including field studies, as mutually agreed upon by the Commission and the University, in connection with the conduct of weapon tests and biomedical and civil effects experiments at such tests conducted at continental and overseas test sites; and (8) the conduct of training and educational activities in the biological and medical aspects of radiation and related fields.

  17. Defense Nanotechnology Research and Development Program

    National Research Council Canada - National Science Library

    2007-01-01

    ...), Army Research Office (ARO) and the Air Force Office of Scientific Research (AFOSR)initiated numerous research and development programs focusing on advancing science and technology below one micron in size...

  18. Achievement report for fiscal 1997 on the research and development to lead to gas hydrate using technology. Research and development on exploration, research and development on drilling technologies, survey and research on a method to evaluate environmental impact, and survey and research on a utilization system; 1997 nendo gas haidoreto shigenka gijutsu sendo kenkyu kaihatsu seika hokokusho. Tansanado ni kansuru kenkyu kaihatsu, kussaku gijutsu ni kansuru kenkyu kaihatsu, kankyo eikyo hyokaho no chosa kenkyu, riyo system ni kansuru chosa kenkyu

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1998-09-01

    The present study is intended to analyze comprehensively geophysical, geological and geochemical data, and establish a technology to estimate distribution of gas hydrate (GH) in sea areas around Japan. It is also intended to develop a high-accuracy resource amount calculating method utilizing the result of excavation of GH planned in the future. In order to achieve these goals, the following activities are performed: (1) study on a method to estimate production environment of GH deposits, (2) development of a method to estimate GH stability areas by using the crust thermal flow measuring method, and (3) study on estimation of GH distribution and wide-area potential. For the study (1), an inorganic element analyzer was introduced, and calibration of devices was performed in fiscal 1997. A survey was carried out on literatures related to distribution of inorganic elements and process of GH deposit production. In the study (2), design and trial fabrication were executed on a high-accuracy crust thermal flow measuring device, capable of long-term continuous observation. In the study (3), re-processing focusing on BSR was implemented by using the latest computer and analysis software on the data in which BSR has been confirmed in the surveys done in the past on sea areas around Japan. (NEDO)

  19. Journal of Agricultural Research and Development

    African Journals Online (AJOL)

    The Journal of Agricultural Research and Development aims at publishing research reports, short communications, Critical Reviews in Agricultural Economics and Farm Management, Agronomy, Forestry, Animal Science, Food Technology, Soil Science, Home Economics, Agricultural Extension, Rural development, ...

  20. Publications | Page 11 | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Results 101 - 110 of 6389 ... IDRC works with developing-country researchers and ... impact of our investment and advance development research. ... on a daily basis to her family in Huallhua, a tiny farming community in Peru's Andes Mountains.

  1. [Baseflow separation methods in hydrological process research: a review].

    Science.gov (United States)

    Xu, Lei-Lei; Liu, Jing-Lin; Jin, Chang-Jie; Wang, An-Zhi; Guan, De-Xin; Wu, Jia-Bing; Yuan, Feng-Hui

    2011-11-01

    Baseflow separation research is regarded as one of the most important and difficult issues in hydrology and ecohydrology, but lacked of unified standards in the concepts and methods. This paper introduced the theories of baseflow separation based on the definitions of baseflow components, and analyzed the development course of different baseflow separation methods. Among the methods developed, graph separation method is simple and applicable but arbitrary, balance method accords with hydrological mechanism but is difficult in application, whereas time series separation method and isotopic method can overcome the subjective and arbitrary defects caused by graph separation method, and thus can obtain the baseflow procedure quickly and efficiently. In recent years, hydrological modeling, digital filtering, and isotopic method are the main methods used for baseflow separation.

  2. Mixed methods research: a design for emergency care research?

    Science.gov (United States)

    Cooper, Simon; Porter, Jo; Endacott, Ruth

    2011-08-01

    This paper follows previous publications on generic qualitative approaches, qualitative designs and action research in emergency care by this group of authors. Contemporary views on mixed methods approaches are considered, with a particular focus on the design choice and the amalgamation of qualitative and quantitative data emphasising the timing of data collection for each approach, their relative 'weight' and how they will be mixed. Mixed methods studies in emergency care are reviewed before the variety of methodological approaches and best practice considerations are presented. The use of mixed methods in clinical studies is increasing, aiming to answer questions such as 'how many' and 'why' in the same study, and as such are an important and useful approach to many key questions in emergency care.

  3. Creating and supporting a mixed methods health services research team.

    Science.gov (United States)

    Bowers, Barbara; Cohen, Lauren W; Elliot, Amy E; Grabowski, David C; Fishman, Nancy W; Sharkey, Siobhan S; Zimmerman, Sheryl; Horn, Susan D; Kemper, Peter

    2013-12-01

    To use the experience from a health services research evaluation to provide guidance in team development for mixed methods research. The Research Initiative Valuing Eldercare (THRIVE) team was organized by the Robert Wood Johnson Foundation to evaluate The Green House nursing home culture change program. This article describes the development of the research team and provides insights into how funders might engage with mixed methods research teams to maximize the value of the team. Like many mixed methods collaborations, the THRIVE team consisted of researchers from diverse disciplines, embracing diverse methodologies, and operating under a framework of nonhierarchical, shared leadership that required new collaborations, engagement, and commitment in the context of finite resources. Strategies to overcome these potential obstacles and achieve success included implementation of a Coordinating Center, dedicated time for planning and collaborating across researchers and methodologies, funded support for in-person meetings, and creative optimization of resources. Challenges are inevitably present in the formation and operation of effective mixed methods research teams. However, funders and research teams can implement strategies to promote success. © Health Research and Educational Trust.

  4. Ethiopian Journal of Development Research: Advanced Search

    African Journals Online (AJOL)

    PROMOTING ACCESS TO AFRICAN RESEARCH ... Ethiopian Journal of Development Research: Advanced Search ... containing either term; e.g., education OR research; Use parentheses to create more complex queries; ... Ethiopian Journal of Business and Economics (The), Ethiopian Journal of Development Research ...

  5. Institutional research and development, FY 1987

    Energy Technology Data Exchange (ETDEWEB)

    Struble, G.L.; Lawler, G.M.; Crawford, R.B.; Kirvel, R.D.; Peck, T.M.; Prono, J.K.; Strack, B.S. (eds.)

    1987-01-01

    The Institutional Research and Development program at Lawrence Livermore National Laboratory fosters exploratory work to advance science and technology, disciplinary research to develop innovative solutions to problems in various scientific fields, and long-term interdisciplinary research in support of defense and energy missions. This annual report describes research funded under this program for FY87. (DWL)

  6. Institutional research and development, FY 1987

    International Nuclear Information System (INIS)

    Struble, G.L.; Lawler, G.M.; Crawford, R.B.; Kirvel, R.D.; Peck, T.M.; Prono, J.K.; Strack, B.S.

    1987-01-01

    The Institutional Research and Development program at Lawrence Livermore National Laboratory fosters exploratory work to advance science and technology, disciplinary research to develop innovative solutions to problems in various scientific fields, and long-term interdisciplinary research in support of defense and energy missions. This annual report describes research funded under this program for FY87

  7. Laboratory Directed Research and Development Program

    Energy Technology Data Exchange (ETDEWEB)

    Ogeka, G.J.

    1991-12-01

    Today, new ideas and opportunities, fostering the advancement of technology, are occurring at an ever-increasing rate. It, therefore, seems appropriate that a vehicle be available which fosters the development of these new ideas and technologies, promotes the early exploration and exploitation of creative and innovative concepts, and which develops new fundable'' R D projects and programs. At Brookhaven National Laboratory (BNL), one such method is through its Laboratory Directed Research and Development (LDRD) Program. This discretionary research and development tool is critical in maintaining the scientific excellence and vitality of the Laboratory. Additionally, it is a means to stimulate the scientific community, fostering new science and technology ideas, which is the major factor achieving and maintaining staff excellence, and a means to address national needs, with the overall mission of the Department of Energy (DOE) and the Brookhaven National Laboratory. The Project Summaries with their accomplishments described in this report reflect the above. Aside from leading to new fundable or promising programs and producing especially noteworthy research, they have resulted in numerous publications in various professional and scientific journals, and presentations at meetings and forums.

  8. Research and development and management of technology

    International Nuclear Information System (INIS)

    Kim, Yeong Gil

    1989-04-01

    This book mentions current state of affairs on research and development and prospect : activity of business, field like information and materials, energy and resource, public welfare, general industry technology. It introduces policy on promotion of research and development such as propel of special research and development business, propel strategy for 10 priority tasks, reinforcement of basic research, promotion of information industry and propel for technical development of business.

  9. Contaminated land and ground water: trends in the development of biological methods for remediation research; Altlasten und Grundwasser - Trends in der Entwicklung der biologischen Methoden in der Sanierungsforschung

    Energy Technology Data Exchange (ETDEWEB)

    Stottmeister, U [UFZ - Umweltforschungszentrum Leipzig-Halle GmbH, Leipzig (Germany). Sektion Sanierungsforschung

    1998-11-01

    Future developments in environmental biotechnology and in situ-remediation processes need the understanding and the influencing of the interaction between all components of a biological biocoenosis, especially in biofilm. Better performances concerning the elimination of contaminants could be made possible by the balanced addition of both additional electron acceptors and cosubstrates, in which the studies of the physiological interaction must be studied. The application of physical methods like radio waves are able to support the microbiological processes. The understanding of the interaction between biotic and abiotic processes in contaminated sites is incomplete at the present time. Ecotechnical processes must decrease the time demand of the natural attenuation and remove inhibitions. Phytoremediation is promising; the understanding of the root - microorganism interaction is the basis of new applications. (orig.) [Deutsch] Die zukuenftigen Entwicklungen der Umweltbiotechnologie und der in situ-Sanierungsverfahren sollten durch das Erkennen und die Beeinflussung des Wechselspiels von Biozoenosen insbesondere in Biofilmen bestimmt werden. Leistungssteigerungen des Schadstoffabbaus sind moeglich durch die bilanzierte Zugabe zusaetzlicher Elektronenakzeptoren oder von Kosubstraten, deren physiologische Wirkungsweise erkannt werden muss. Physikalische Massnahmen wie z.B. die Radiowellenanwendung koennen mikrobiologische Prozesse unterstuetzen. Das Wechselspiel biotischer und abiotischer Prozesse in Altlasten ist erst unvollstaendig verstanden. Oekotechnische Prozesse muessen die natuerliche Selbstreinigung beschleunigen oder Inhibitionen aufheben. Die vielversprechenden Methoden der Phytoremediation werden neue Anwendungsgebiete finden, wenn die Wurzelraum-Mikroorganismen-Wechselwirkung verstanden wird. (orig.)

  10. Development of safety assessment method for human intrusion scenario in Japan. Part 1. Drilling scenario database for safety assessment of geological disposal (Contract research)

    International Nuclear Information System (INIS)

    Nagasawa, Hirokazu; Takeda, Seiji; Kimura, Hideo; Sasaki, Toshihisa

    2010-11-01

    In deep geological disposal or intermediate depth disposal, human intrusion, i.e. accidental excavation or drilling into the disposal site, may make a direct or an indirect effect on the disposal system. Safety assessment method for the human intrusion scenario, that is, the evaluation code of radiological effect from the human intrusion and the data to examine the reduction of the probability of the human intrusion occurring, is essential for the future safety regulation. Assuming that drilling action into the disposal site leads to the human proximity to the radioactive waste or the damage to the barrier system (drilling scenario), we have collected both the data on borehole drilling implemented in Japan and information on actual situation of drilling activities. Based on the data and information, we provide concrete exposure scenarios associated with borehole drilling in the vicinity of the repository and model for estimating the frequency on borehole reaching the depth of repository. The frequency is characterized with the relation to objective of excavation, geographical features, and region in Japan etc. We have developed an assembly of the information mentioned above as database, including the model parameters used in the code to assess radiation dose for drilling scenario. (author)

  11. Ethiopian Journal of Development Research

    African Journals Online (AJOL)

    This research investigated whether non-farm income diversification increases overall income equality and decreases poverty in rural Ethiopia or not. It used a four-wave panel data from the Ethiopian Rural Household Survey over the period 1994-2009. The impacts of non-farm income on inequality and poverty were ...

  12. Materials Processing Research and Development

    Science.gov (United States)

    2010-08-01

    2 2.1.4 The Origins of Microstexture in Duplex Ti Alloys...Controlled Growth and Coarsening ....... 14 2.11 PUBLISHED RESEARCH ON FRICTION STIR WELDING OF SC-MODIFIED AL-ZN-MG-CU EXTRUDED PLATES...14 2.11.1 Friction Stir Welding of Sc

  13. Participatory methods in pediatric participatory research: a systematic review.

    Science.gov (United States)

    Haijes, Hanneke A; van Thiel, Ghislaine J M W

    2016-05-01

    Meaningful child participation in medical research is seen as important. In order to facilitate further development of participatory research, we performed a systematic literature study to describe and assess the available knowledge on participatory methods in pediatric research. A search was executed in five databases: PubMed, CINAHL, PsycINFO, Scopus, and Cochrane. After careful screening of relevant papers, finally 24 documents were included in our analysis. Literature on participatory methods in pediatric research appears generally to be descriptive, whereby high-quality evidence is lacking. Overall, five groups of participatory methods for children could be distinguished: observational, verbal, written, visual, and active methods. The choice for one of these methods should be based on the child's age, on social and demographic characteristics, and on the research objectives. To date, these methods are still solely used for obtaining data, yet they are suitable for conducting meaningful participation. This may result in a successful partnership between children and researchers. Researchers conducting participatory research with children can use this systematic review in order to weigh the current knowledge about the participatory methods presented.

  14. 10 best resources on ... mixed methods research in health systems.

    Science.gov (United States)

    Ozawa, Sachiko; Pongpirul, Krit

    2014-05-01

    Mixed methods research has become increasingly popular in health systems. Qualitative approaches are often used to explain quantitative results and help to develop interventions or survey instruments. Mixed methods research is especially important in low- and middle-income country (LMIC) settings, where understanding social, economic and cultural contexts are essential to assess health systems performance. To provide researchers and programme managers with a guide to mixed methods research in health systems, we review the best resources with a focus on LMICs. We selected 10 best resources (eight peer-reviewed articles and two textbooks) based on their importance and frequency of use (number of citations), comprehensiveness of content, usefulness to readers and relevance to health systems research in resource-limited contexts. We start with an overview on mixed methods research and discuss resources that are useful for a better understanding of the design and conduct of mixed methods research. To illustrate its practical applications, we provide examples from various countries (China, Vietnam, Kenya, Tanzania, Zambia and India) across different health topics (tuberculosis, malaria, HIV testing and healthcare costs). We conclude with some toolkits which suggest what to do when mixed methods findings conflict and provide guidelines for evaluating the quality of mixed methods research.

  15. Experimental methods of shock wave research

    CERN Document Server

    Seiler, Friedrich

    2016-01-01

    This comprehensive and carefully edited volume presents a variety of experimental methods used in Shock Waves research. In 14 self contained chapters this 9th volume of the “Shock Wave Science and Technology Reference Library” presents the experimental methods used in Shock Tubes, Shock Tunnels and Expansion Tubes facilities. Also described is their set-up and operation. The uses of an arc heated wind tunnel and a gun tunnel are also contained in this volume. Whenever possible, in addition to the technical description some typical scientific results obtained using such facilities are described. Additionally, this authoritative book includes techniques for measuring physical properties of blast waves and laser generated shock waves. Information about active shock wave laboratories at different locations around the world that are not described in the chapters herein is given in the Appendix, making this book useful for every researcher involved in shock/blast wave phenomena.

  16. [Mixed methods research in public health: issues and illustration].

    Science.gov (United States)

    Guével, Marie-Renée; Pommier, Jeanine

    2012-01-01

    For many years, researchers in a range of fields have combined quantitative and qualitative methods. However, the combined use of quantitative and qualitative methods has only recently been conceptualized and defined as mixed methods research. Some authors have described the emerging field as a third methodological tradition (in addition to the qualitative and quantitative traditions). Mixed methods research combines different perspectives and facilitates the study of complex interventions or programs, particularly in public health, an area where interdisciplinarity is critical. However, the existing literature is primarily in English. By contrast, the literature in French remains limited. The purpose of this paper is to present the emergence of mixed methods research for francophone public health specialists. A literature review was conducted to identify the main characteristics of mixed methods research. The results provide an overall picture of the mixed methods approach through its history, definitions, and applications, and highlight the tools developed to clarify the approach (typologies) and to implement it (integration of results and quality standards). The tools highlighted in the literature review are illustrated by a study conducted in France. Mixed methods research opens new possibilities for examining complex research questions and provides relevant and promising opportunities for addressing current public health issues in France.

  17. Biosensing International Research and Development

    CERN Document Server

    Schultz, Jerome; Mrksich, Milan

    2006-01-01

    The goal of this book is to disseminate information on the worldwide status and trends in biosensing R&D to government decisionmakers and the research community. The contributors critically analyze and compare biosensing research in the United States with that being pursued in Japan, Europe and other major industrialized countries. Biosensing includes systems that incorporate a variety of means, including electrical, electronic, and photonic devices; biological materials (e.g., tissue, enzymes, nucleic acids, etc.); and chemical analysis to produce detectable signals for the monitoring or identification of biological phenomena. In a broader sense, the study of biosensing includes any approach to detection of biological elements and the associated software or computer identification technologies (e.g., imaging) that identify biological characteristics. Biosensing is finding a growing number of applications in a wide variety of areas, including biomedicine, food production and processing, and detection of b...

  18. Ethnographic Contributions to Method Development

    DEFF Research Database (Denmark)

    Leander, Anna

    2014-01-01

    Program paper title: The Reversal of Value Neutrality: Research Ethics in Critical Approaches to Security......Program paper title: The Reversal of Value Neutrality: Research Ethics in Critical Approaches to Security...

  19. Research reactor developments in Australia

    International Nuclear Information System (INIS)

    Godfrey, Robert

    1998-01-01

    The Australian Nuclear Science and Technology Organization (ANSTO) operates the 10 MW research reactor, HIFAR, at the Lucas Heights site approximately 30 kilometres south of Sydney. Although recent reviews and inspections have confirmed that HIFAR operates safely by an adequate margin and has minimal impact, it was concluded that the reactor design and age places limitations on its operation and utilization, and that HIFAR is approaching the end of its economic life. In September 1997, a decision was made by the Australian Government to found ANSTO for the construction of a replacement research on the existing Lucas Heights site, subject to the requisite environmental assessment process. A draft EIS has been prepared and is currently undergoing public review. A design specification is in preparation, and a research reactor vendor pre-qualification process has been initiated. Spent fuel shipments have been made to Dounreay and to the Savannah River Site, and discussions are continuing regarding the disposition of the existing spent fuel and that arising form HIFAR's remaining operation. (author)

  20. Research and Development in ENSA

    International Nuclear Information System (INIS)

    2006-01-01

    We conceive R and D as a whole of creative works undertaken in a systematic way to increase our knowledge and conceive new applications for our productive processes. Advanced technology is developed and applied in ENSA by different departments. Coordination is done by the Technology Division. The development of new applications for the different metallurgical processes are mainly carried out by the Welding and Metallurgy Laboratories Development for process Automation and Robotization are carried out by the Automation department in close collaboration with the Welding, Engineering, Quality and Production departments, as appropriate. The upgrading of Machines and Installations is carried out by Engineering and Production. We believe in Innovation as an ongoing Strategy for our competitiveness. (Author)

  1. Qualitative Descriptive Methods in Health Science Research.

    Science.gov (United States)

    Colorafi, Karen Jiggins; Evans, Bronwynne

    2016-07-01

    The purpose of this methodology paper is to describe an approach to qualitative design known as qualitative descriptive that is well suited to junior health sciences researchers because it can be used with a variety of theoretical approaches, sampling techniques, and data collection strategies. It is often difficult for junior qualitative researchers to pull together the tools and resources they need to embark on a high-quality qualitative research study and to manage the volumes of data they collect during qualitative studies. This paper seeks to pull together much needed resources and provide an overview of methods. A step-by-step guide to planning a qualitative descriptive study and analyzing the data is provided, utilizing exemplars from the authors' research. This paper presents steps to conducting a qualitative descriptive study under the following headings: describing the qualitative descriptive approach, designing a qualitative descriptive study, steps to data analysis, and ensuring rigor of findings. The qualitative descriptive approach results in a summary in everyday, factual language that facilitates understanding of a selected phenomenon across disciplines of health science researchers. © The Author(s) 2016.

  2. Research method of nuclear patent information

    International Nuclear Information System (INIS)

    Mo Dan; Gao An'na; Sun Chenglin; Wang Lei; You Xinfeng

    2010-01-01

    When faced with a huge amount of nuclear patent information, the key to effective research include: (1) Choose convenient way to search, quick access to nuclear technology related patents; (2) To overcome the language barrier, analysis the technical content of patent information; (3) Organize the publication date of retrieved patent documents, analysis the status and trends of nuclear technology development; (4) Research the patented technology of main applicants; (5) Always pay attention to the legal status of patent information, free use the invalid patents, at the same time avoid the patent infringement. Summary, patent information is important to obtain the latest technical information source, and the research work of patent information is a comprehensive understanding and mastery way for advanced nuclear technology. (authors)

  3. IDRC - International Development Research Centre |

    International Development Research Centre (IDRC) Digital Library (Canada)

    Learn moreArtificial intelligence and human development ... Our experts share insights on the issues and approaches challenging the international ... Shadow Libraries: Access to Knowledge in Global Higher Education · Book cover: ... Social Theories of Urban Violence in the Global South: Towards Safe and Inclusive Cities.

  4. Nuclear physics methods in materials research

    International Nuclear Information System (INIS)

    Bethge, K.; Baumann, H.; Jex, H.; Rauch, F.

    1980-01-01

    Proceedings of the seventh divisional conference of the Nuclear Physics Division held at Darmstadt, Germany, from 23rd through 26th of September, 1980. The scope of this conference was defined as follows: i) to inform solid state physicists and materials scientists about the application of nuclear physics methods; ii) to show to nuclear physicists open questions and problems in solid state physics and materials science to which their methods can be applied. According to the intentions of the conference, the various nuclear physics methods utilized in solid state physics and materials science and especially new developments were reviewed by invited speakers. Detailed aspects of the methods and typical examples extending over a wide range of applications were presented as contributions in poster sessions. The Proceedings contain all the invited papers and about 90% of the contributed papers. (orig./RW)

  5. Research and development on groundwater dating. Part 11. The proposal of separation method of chloride and sulfate ion for accurate measurement of 36Cl/Cl

    International Nuclear Information System (INIS)

    Nakata, Kotaro; Hasegawa, Takuma

    2010-01-01

    36 Cl is one of the most powerful tools to estimate the residence time of groundwater about 300-1800 thousand years. AMS(Accelerator Mass Spectroscopy) can provide accurate estimation of 36 Cl. However, estimation of 36 Cl by AMS is usually disturbed by isobar such as 36 S. Thus, separation of Cl (usually Cl - form in groundwater) and S (usually SO 4 -2 form in groundwater) is required for accurate estimation of 36 Cl. In previous studies, a methodology (BaSO 4 Method) that uses the difference in solubility between BaSO 4 and BaCl 2 , had been applied as pretreatment method for 36 Cl estimation by AMS. However BaSO 4 Method has following disadvantages; (1) Cl and SO 4 can not be separated completely, (2) accuracy of separation depends on the skills of operator, (3) it takes a long time for treatment, (4) it can not be applied to dilute solutions. Therefore, new methodology that can overcome disadvantages of BaSO 4 method is required for more accurate estimation of 36 Cl. In this study, Column Method based on column chromatography was investigated for pretreatment method for 36 Cl estimation by AMS to separate Cl and SO 4 ions. The conditions for Column Method were determined and adjusted so that Cl and SO 4 ions were separated completely and sufficient amount of Cl for 36 Cl estimation can be treated. The results of AMS measurement showed Column Method can remove SO 4 from Cl more effectively comparing with BaSO 4 method. Furthermore, Column Method was found to have following advantages over BaSO 4 Method; (1) dependence of accuracy of separation on the skills of operator is quite low, (2) treatment can be done within 6 h, (3) it can be applied to dilute solutions. (author)

  6. 2010-11 Research Portfolio: Research & Development Division

    Science.gov (United States)

    Educational Testing Service, 2010

    2010-01-01

    This document describes the breadth of the research that the ETS (Educational Testing Service) Research & Development division is conducting in 2010. This portfolio will be updated in early 2011 to reflect changes to existing projects and new projects that were added after this document was completed. The research described in this portfolio falls…

  7. Energy storage research and development

    Energy Technology Data Exchange (ETDEWEB)

    None, None

    2008-01-01

    In 2007, US consumers experienced the highest sustained gasoline prices in recent history, in real terms, including those seen in the early 1980s1. Partially as a result of the $3/gallon gasoline prices, sales of hybrid electric vehicles (HEVs) increased almost 60% in 20072, and several automakers announced plans to develop plug-in hybrid electric vehicles (PHEVs)3. However, total sales of HEVs remained in the 2-3 percent range of all vehicle sales. An important step for continued HEV market penetration, as well as electrifying the nation's personal transportation, is the development of cost effective, long lasting, and abuse tolerant Li-ion batteries.

  8. Advances in Statistical Methods for Substance Abuse Prevention Research

    Science.gov (United States)

    MacKinnon, David P.; Lockwood, Chondra M.

    2010-01-01

    The paper describes advances in statistical methods for prevention research with a particular focus on substance abuse prevention. Standard analysis methods are extended to the typical research designs and characteristics of the data collected in prevention research. Prevention research often includes longitudinal measurement, clustering of data in units such as schools or clinics, missing data, and categorical as well as continuous outcome variables. Statistical methods to handle these features of prevention data are outlined. Developments in mediation, moderation, and implementation analysis allow for the extraction of more detailed information from a prevention study. Advancements in the interpretation of prevention research results include more widespread calculation of effect size and statistical power, the use of confidence intervals as well as hypothesis testing, detailed causal analysis of research findings, and meta-analysis. The increased availability of statistical software has contributed greatly to the use of new methods in prevention research. It is likely that the Internet will continue to stimulate the development and application of new methods. PMID:12940467

  9. Research on geochemical exploration in geotherm development

    International Nuclear Information System (INIS)

    Hirowatari, Kazuo; Imaizumi, Yukio; Koga, Akito; Iwanaga, Tatsuto.

    1987-01-01

    The decisive factor of geotherm development is to improve the exploration techniques. By effectively carrying out the selection of promising development spots and the decision of well drilling positions, the geotherm development exceeding existing energy sources becomes feasible. There have been many problems in conventional geotherm exploration such as the high cost and long work period, therefore, it was decided to advance the research on geochemical exploration techniques which are relatively simple and can be carried out with low cost. When the techniques of geochemistry are used, for example, in the case that there are hot springs or fumaroles, the temperature, origin, properties and so on of underground hot water reservoirs can be estimated from their chemical composition. The method of examining the mercury concentration in soil and soil air has been in practical use in the geothermal districts where the ground surface symptom lacks. This time, the method of investigation using radon, thoron and gamma ray as the exploration indices was newly studied. The index compositions for geochemical exploration, new exploration index compositions, the method of measurement, the basic investigation and on-the-spot investigation are reported. (Kako, I.)

  10. Research and Development from the bottom up

    DEFF Research Database (Denmark)

    Brem, Alexander; Wolfram, P.

    2014-01-01

    and ecological context or the growing interest of developed market firms in approaches from emerging markets. Hence, the presented framework supports further research in new paradigms for research and development (R&D) in developed market firms (DMFs), particularly in relation to emerging markets. This framework...... enables scholars to compare concepts from developed and emerging markets, to address studies specifically by using consistent terms, and to advance research into the concepts according their characterization....

  11. Mixed methods in psychotherapy research: A review of method(ology) integration in psychotherapy science.

    Science.gov (United States)

    Bartholomew, Theodore T; Lockard, Allison J

    2018-06-13

    Mixed methods can foster depth and breadth in psychological research. However, its use remains in development in psychotherapy research. Our purpose was to review the use of mixed methods in psychotherapy research. Thirty-one studies were identified via the PRISMA systematic review method. Using Creswell & Plano Clark's typologies to identify design characteristics, we assessed each study for rigor and how each used mixed methods. Key features of mixed methods designs and these common patterns were identified: (a) integration of clients' perceptions via mixing; (b) understanding group psychotherapy; (c) integrating methods with cases and small samples; (d) analyzing clinical data as qualitative data; and (e) exploring cultural identities in psychotherapy through mixed methods. The review is discussed with respect to the value of integrating multiple data in single studies to enhance psychotherapy research. © 2018 Wiley Periodicals, Inc.

  12. Reusable launch vehicle development research

    Science.gov (United States)

    1995-01-01

    NASA has generated a program approach for a SSTO reusable launch vehicle technology (RLV) development which includes a follow-on to the Ballistic Missile Defense Organization's (BMDO) successful DC-X program, the DC-XA (Advanced). Also, a separate sub-scale flight demonstrator, designated the X-33, will be built and flight tested along with numerous ground based technologies programs. For this to be a successful effort, a balance between technical, schedule, and budgetary risks must be attained. The adoption of BMDO's 'fast track' management practices will be a key element in the eventual success of NASA's effort.

  13. Nigerian Educational Research For Sustainable Development ...

    African Journals Online (AJOL)

    Education and research controls the development of any nation because no nation can rise above the products of its educational system. However, a number of problems face our educational and national development in general. The solution to such problem lies in research . educational research for sustainable ...

  14. Publications | Page 87 | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Results 861 - 870 of 6381 ... IDRC works with developing-country researchers and institutions to build local capacity through funding, knowledge sharing, and training. Through books, articles, research publications, and studies, we aim to widen the impact of our investment and advance development research. We share the ...

  15. Publications | Page 17 | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Results 161 - 170 of 6379 ... IDRC works with developing-country researchers and institutions to build local capacity through funding, knowledge sharing, and training. Through books, articles, research publications, and studies, we aim to widen the impact of our investment and advance development research. We share the ...

  16. Publications | Page 22 | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Results 211 - 220 of 2177 ... IDRC works with developing-country researchers and institutions to build local capacity through funding, knowledge sharing, and training. Through books, articles, research publications, and studies, we aim to widen the impact of our investment and advance development research. We share the ...

  17. Participatory Research and Development for Sustainable Agriculture ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    It is crucial, for example, that local stakeholders provide input to the process. Participatory research and ... Participatory Research and Development for Sustainable Agriculture and Natural Resource Management - A Sourcebook Volume 2: Enabling Participatory Research and Development. Book cover Participatory ...

  18. Publications | Page 4 | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Results 31 - 40 of 6375 ... IDRC works with developing-country researchers and institutions to build local capacity through funding, knowledge sharing, and training. Through books, articles, research publications, and studies, we aim to widen the impact of our investment and advance development research. We share the ...

  19. Publications | Page 31 | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Results 301 - 310 of 6388 ... IDRC works with developing-country researchers and institutions to build local capacity through funding, knowledge sharing, and training. Through books, articles, research publications, and studies, we aim to widen the impact of our investment and advance development research. We share the ...

  20. Publications | Page 36 | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Results 351 - 360 of 6341 ... IDRC works with developing-country researchers and institutions to build local capacity through funding, knowledge sharing, and training. Through books, articles, research publications, and studies, we aim to widen the impact of our investment and advance development research. We share the ...

  1. Publications | Page 29 | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Results 281 - 290 of 6341 ... IDRC works with developing-country researchers and institutions to build local capacity through funding, knowledge sharing, and training. Through books, articles, research publications, and studies, we aim to widen the impact of our investment and advance development research. We share the ...

  2. Publications | Page 85 | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Results 841 - 850 of 6381 ... IDRC works with developing-country researchers and institutions to build local capacity through funding, knowledge sharing, and training. Through books, articles, research publications, and studies, we aim to widen the impact of our investment and advance development research. We share the ...

  3. Publications | Page 82 | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Results 811 - 820 of 6372 ... IDRC works with developing-country researchers and institutions to build local capacity through funding, knowledge sharing, and training. Through books, articles, research publications, and studies, we aim to widen the impact of our investment and advance development research. We share the ...

  4. Publications | Page 56 | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Results 551 - 560 of 6381 ... IDRC works with developing-country researchers and institutions to build local capacity through funding, knowledge sharing, and training. Through books, articles, research publications, and studies, we aim to widen the impact of our investment and advance development research. We share the ...

  5. View all initiatives | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    The International Research Chairs Initiative pairs top research talent from universities in Canada with their counterparts in developing countries to address key development challenges. We fund researchers driving global change. Careers · Contact Us · Subscribe · Unsubscribe · Site map. Follow us; Facebook · Twitter ...

  6. Publications | Page 22 | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Results 211 - 220 of 6379 ... IDRC works with developing-country researchers and institutions to build local capacity through funding, knowledge sharing, and training. Through books, articles, research publications, and studies, we aim to widen the impact of our investment and advance development research. We share the ...

  7. Publications | Page 26 | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Results 251 - 260 of 6378 ... IDRC works with developing-country researchers and institutions to build local capacity through funding, knowledge sharing, and training. Through books, articles, research publications, and studies, we aim to widen the impact of our investment and advance development research. We share the ...

  8. Recent developments in blood cell labeling research

    Energy Technology Data Exchange (ETDEWEB)

    Srivastava, S.C.; Straub, R.F.; Meinken, G.E.

    1988-09-07

    A number of recent developments in research on blood cell labeling techniques are presented. The discussion relates to three specific areas: (1) a new in vitro method for red blood cell labeling with /sup 99m/Tc; (2) a method for labeling leukocytes and platelets with /sup 99m/Tc; and (3) the use of monoclonal antibody technique for platelet labeling. The advantages and the pitfalls of these techniques are examined in the light of available mechanistic information. Problems that remain to be resolved are reviewed. An assessment is made of the progress as well as prospects in blood cell labeling methodology including that using the monoclonal antibody approach. 37 refs., 4 figs.

  9. Recent developments in blood cell labeling research

    International Nuclear Information System (INIS)

    Srivastava, S.C.; Straub, R.F.; Meinken, G.E.

    1988-01-01

    A number of recent developments in research on blood cell labeling techniques are presented. The discussion relates to three specific areas: (1) a new in vitro method for red blood cell labeling with /sup 99m/Tc; (2) a method for labeling leukocytes and platelets with /sup 99m/Tc; and (3) the use of monoclonal antibody technique for platelet labeling. The advantages and the pitfalls of these techniques are examined in the light of available mechanistic information. Problems that remain to be resolved are reviewed. An assessment is made of the progress as well as prospects in blood cell labeling methodology including that using the monoclonal antibody approach. 37 refs., 4 figs

  10. Participatory action as a research method with public health nurses.

    Science.gov (United States)

    Cusack, Cheryl; Cohen, Benita; Mignone, Javier; Chartier, Mariette J; Lutfiyya, Zana

    2018-02-28

    This article explores and describes participatory action research (PAR) as a preferred method in addressing nursing practice issues. This is the first study that used PAR with public health nurses (PHNs) in Canada to develop a professional practice model. Participatory action research is a sub-category of action research that incorporates feminist and critical theory with foundations in the field of social psychology. For nurses, critical analysis of long-established beliefs and practices through PAR contributes to emancipatory knowledge regarding the impact of traditional hierarchies on their practice. This study used participatory action, a non-traditional but systematic research method, which assisted participants to develop a solution to a long-standing organizational issue. The stages of generating concerns, participatory action, acting on concerns, reflection and evaluation were implemented from 2012 - 2013 in an urban Canadian city, to develop a professional practice model for PHNs. Four sub-themes specific to PAR are discussed. These are "participatory action research engaged PHNs in development of a professional practice model;" "the participatory action research cycles of "Look, Think, Act" expanded participants' views;" "participatory action research increased awareness of organizational barriers;" and "participatory action research promoted individual empowerment and system transformation." This study resulted in individual and system change that may not have been possible without the use of PAR. The focus was engagement of participants and recognition of their lived experience, which facilitated PHNs' empowerment, leadership and consciousness-raising. © 2018 The Authors. Journal of Advanced Nursing Published by John Wiley & Sons Ltd.

  11. Qualitative research methods in renal medicine: an introduction.

    Science.gov (United States)

    Bristowe, Katherine; Selman, Lucy; Murtagh, Fliss E M

    2015-09-01

    Qualitative methodologies are becoming increasingly widely used in health research. However, within some specialties, including renal medicine, qualitative approaches remain under-represented in the high-impact factor journals. Qualitative research can be undertaken: (i) as a stand-alone research method, addressing specific research questions; (ii) as part of a mixed methods approach alongside quantitative approaches or (iii) embedded in clinical trials, or during the development of complex interventions. The aim of this paper is to introduce qualitative research, including the rationale for choosing qualitative approaches, and guidance for ensuring quality when undertaking and reporting qualitative research. In addition, we introduce types of qualitative data (observation, interviews and focus groups) as well as some of the most commonly encountered methodological approaches (case studies, ethnography, phenomenology, grounded theory, thematic analysis, framework analysis and content analysis). © The Author 2015. Published by Oxford University Press on behalf of ERA-EDTA. All rights reserved.

  12. Publications | Page 79 | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Results 781 - 790 of 6372 ... Through books, articles, research publications, and studies, we aim to widen the impact of our investment and advance development research. We share the results of our funded research, and offer free training materials to guide researchers and institutions. Want more? Explore outputs from more ...

  13. Research Skills Development in Higher Education Students

    Science.gov (United States)

    Bergamini, Tiziana Priede; Navarro, Cristina Lopez-Cozar

    2014-01-01

    This case study presents the development of a research project in a third-year undergraduate course, Family Business Administration. The research project aimed at promoting research skills in students. The authors formed working groups of no more than six students, and each group had to select an original research topic after conducting a…

  14. Research and Development Conference CIEE Program 1992

    Energy Technology Data Exchange (ETDEWEB)

    1992-11-01

    CIEE`s second annual Research and Development Conference will introduce you to some of the results achieved to date through CIEE-sponsored multiyear research performed in three programs: Building Energy Efficiency, Air Quality Impacts of Energy Efficiency, and End-Use Resource Planning. Results from scoping studies, Director`s discretionary research, and exploratory research will also be featured in this report.

  15. Adapting biomarker technologies to adverse outcome pathways (AOPs) research: current thoughts on using in vivo discovery for developing in vitro target methods

    Science.gov (United States)

    Adverse outcome pathways (AOP) research is a relatively new concept in human systems biology for assessing the molecular level linkage from an initiating (chemical) event that could lead to a disease state. Although most implementations of AOPs are based on liquids analyses, the...

  16. Research on condensed matter and atomic physics using major experimental facilities and devices: Physics, chemistry, biology. Reports on results. Vol. 3. 4. Chemistry. 5. Biology. 6. Development of methods and instruments

    International Nuclear Information System (INIS)

    1993-01-01

    This report in three volumes substantiates the contents of the programme survey published in September 1989. The progress reports cover the following research areas: Vol. I, (1). Atomic and molecular physics - free atoms, molecules, macromolecules, clusters, matrix-isolated atoms and molecules. (2) Physics and chemistry of surfaces and interfaces - epitaxy, surface structure, adsorption, electrical, magnetic, and optical properties, thin films, synthetic layer structure. Vol. II, (3). Solid-state physics, and materials science -structural research, lattice dynamics, magnetic structure and dynamics, electronic states; load; spin and pulse density fluctuations; diffusion and internal motion, defects, unordered systems and liquids. Vol. III, (4). Chemistry - bonding and structure, kinetics and reaction mechanisms, polymer research, analysis and synthesis. (5). Biology, - structure and dynamics of biological macromolecules, membrane and cell biology. (6) Development of methods and instruments - neutron sources, synchrotron sources, special accelerators, research with interlinked systems and devices. (orig.) [de

  17. Data Mining and Machine Learning Methods for Dementia Research.

    Science.gov (United States)

    Li, Rui

    2018-01-01

    Patient data in clinical research often includes large amounts of structured information, such as neuroimaging data, neuropsychological test results, and demographic variables. Given the various sources of information, we can develop computerized methods that can be a great help to clinicians to discover hidden patterns in the data. The computerized methods often employ data mining and machine learning algorithms, lending themselves as the computer-aided diagnosis (CAD) tool that assists clinicians in making diagnostic decisions. In this chapter, we review state-of-the-art methods used in dementia research, and briefly introduce some recently proposed algorithms subsequently.

  18. Publications | Page 25 | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Results 241 - 250 of 6341 ... Journal articles. Papers. Reports. Research in Action. Studies ... Half a year later, on. ... Over the past two decades, the International Development Research Centre (IDRC) has established and subsequently devolved ...

  19. Participatory Research and Development for Sustainable Agriculture ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Participatory research and development (PR&D) offers such an inclusive model. ... PR&D concepts and practices for practitioners, researchers, and academic. ... Call for new OWSD Fellowships for Early Career Women Scientists now open.

  20. Publications | Page 21 | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Results 201 - 210 of 6387 ... Through books, articles, research publications, and studies, we aim to widen the ... Development Research Centre (IDRC), the project uses evidence to enhance the ... Greening South America, one business at a time.

  1. Research and Development Information System (RDIS)

    Data.gov (United States)

    Department of Veterans Affairs — The Research and Development Information System (RDIS) is the Veterans Affairs Central Office budgetary and project data repository for managing the VA Research and...

  2. Publications | Page 62 | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Results 611 - 620 of 6341 ... IDRC works with developing-country researchers and institutions to build ... America, and Australia and to determine knowledge gaps for future research. ... health and rights framework for population and health policy, ...

  3. Journal of Agricultural Research and Development

    African Journals Online (AJOL)

    The Journal of Agricultural Research and Development aims at publishing research reports, short communications, Critical Reviews in Agricultural Economics and Farm ... Response of Sesamum radiatum Schum vegetable and seed yield to ...

  4. Research Award: Innovation for Inclusive Development program

    International Development Research Centre (IDRC) Digital Library (Canada)

    IDRC CRDI

    2011-09-12

    Sep 12, 2011 ... students, as well as recent graduates, to enhance their research skills ... experience in development research. ... enable greater understanding of how innovation in the informal ... Innovation and women in the informal sector.

  5. IPMC microgripper research and development

    International Nuclear Information System (INIS)

    Lumia, R; Shahinpoor, M

    2008-01-01

    Described are the state of the art on designing and developing a microgripper using ionic polymer metal composites (IPMCs), an electroactive material, as an actuator to grasp and manipulate micro-sized flexible and rigid objects and yet also serve as a sensor for position feedback control. IPMCs, as a material, are compliant and can work in both wet and dry environments. This makes it ideally suited for both industrial operations, e.g., building microsystems from MEMS components, as well as for a variety of bio-micromanipulation tasks, e.g., bacterium and cell handling. We derive a theoretical force model for the microgripper. The model estimates that an IPMC finger of dimensions 5mm x lmm x 0.2mm exerts a force of 85 μN when grasping a solder ball of 15mg. We experimentally measure the load carrying capacity of the IPMC microgripper. Furthermore, we show empirically that the relationship between load carry capability and the length of microgripper fingers is linear. Experiments with three different microgripper finger shapes show that load carrying performance is related to the area of the finger rather than the shape. This implies that manufacturing ease favours microgrippers with tapered fingers. Finally, we show how flexible objects (hydrogel crystals in this case) are grasped with this IPMC microgripper.

  6. Development of snow water equivalent survey methods using airborne gamma measurements. Research progress, January 1975--September 1975 and suggested directions for future work

    International Nuclear Information System (INIS)

    Fritzsche, A.; Jupiter, C.

    1975-01-01

    This is a summary of the progress made during the period March 1975 through September 1975 on EG and G's support of the National Oceanic and Atmospheric Administration for development of airborne techniques for measurement of the water equivalent of snow and soil moisture. The work included a series of snow and soil moisture surveys and development of a new detector and data acquisition system. The status of this work is summarized here together with a review of plans for the immediate future

  7. Agricultural extension, research, and development for increased ...

    African Journals Online (AJOL)

    The challenges of food security and agricultural development in South Africa cannot simply be solved by limiting extension and research development to the public sector. However, if shortcomings arise in the public sector while addressing extension, research and development, the potential involvement of the private sector ...

  8. Anindya Chatterjee | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Dr Anindya Chatterjee is Regional Director, Asia, based in New Delhi, India. He has provided leadership in research, research management, policy, and program development in the area of global health and development. Dr Chatterjee formerly worked internationally with United Nations development agencies, and ...

  9. Karlsruhe Nuclear Research Center. Research and development program 1992

    International Nuclear Information System (INIS)

    1991-01-01

    The KfK R and D activities are classified by ten point-of-main-effort projects: 1) low-pollution/low-waste methods, 2) environmental energy and mass transfers, 3) nuclear fusion, 4) nuclear saftey research, 5) radioactive waste management, 6) superconduction, 7) microtechnics, 8) materials handling, 9) materials and interfaces, 10) basic physical research. (orig.) [de

  10. Research on new methods in transport theory

    International Nuclear Information System (INIS)

    Stefanovicj, D.

    1975-01-01

    Neutron transport theory is the basis for development of reactor theory and reactor calculational methods. It has to be acknowledged that recent applications of these disciplines have influenced considerably the development of power reactor concepts and technology. However, these achievements were implemented in a rather heuristic way, since the satisfaction of design demands were of utmost importance. Often this kind of approach turns out to be very restrictive and not even adequate for rather typical reactor applications. Many aspects and techniques of reactor theory and calculations ought to be reevaluated and/or reformulated on the more sound physical and mathematical foundations. At the same time, new reactor concepts and operational demands give rise to more sophisticated and complex design requirements. These new requirements can be met only by the development of new design techniques, which in the case of reactor neutronic calculation lead directly to the advanced transport theory methods. In addition, the rapid development of computer technology opens new opportunities for applications of advanced transport theory in practical calculations

  11. Development of a research evaluation protocol for NSD research portfolios

    International Nuclear Information System (INIS)

    Gould, J.

    1999-01-01

    This report is concerned with developing and describing a research evaluation protocol for use by the Nuclear Safety Directorate (NSD), in evaluating their various programmes of research; or aspects of those programmes. The Health and Safety Executive (HSE) has been involved with research evaluation for some considerable time and NSD, as part of HSE, wishes to develop a protocol which, while it meets their needs, is also fully compatible with other HSE approaches. It is intended that the methodology developed by this project will be used for evaluation of the Probabilistic Safety Assessment Portfolio (as a separate project). The usefulness of the methodology will be reviewed in the light of this experience

  12. Current research and development at the Nuclear Research Center Karlsruhe

    International Nuclear Information System (INIS)

    Kuesters, H.

    1982-01-01

    The Nuclear Research Center Karlsruhe (KfK) is funded to 90% by the Federal Republic of Germany and to 10% by the State of Baden-Wuerttemberg. Since its foundation in 1956 the main objective of the Center is research and development (R and D) in the aera of the nuclear technology and about 2/3 of the research capacity is now devoted to this field. Since 1960 a major activity of KfK is R and D work for the design of fast breeder reactors, including material research, physics, and safety investigations; a prototype of 300 MWe is under construction now in the lower Rhine Valley. For enrichment of 235 U fissile material KfK developed the separation nozzle process; its technical application is realized within an international contract between the Federal Republic of Germany and Brazil. Within the frame of the European Programme on fusion technology KfK develops and tests superconducting magnets for toroidal fusion systems; a smaller activity deals with research on inertial confinement fusion. A broad research programme is carried through for safety investigations of nuclear installations, especially for PWRs; this activity is supplemented by research and development in the field of nuclear materials' safeguards. Development of fast reactors has to initiate research for the reprocessing of spent fuel and waste disposal. In the pilot plant WAK spent fuel from LKWs is reprocessed; research especially tries e.g. to improve the PUREX-process by electrochemical means, vitrification of high active waste is another main activity. First studies are being performed now to clarify the necessary development for reprocessing fast reactor fuel. About 1/3 of the research capacity of KfK deals with fundamental research in nuclear physics, solid state physics, biology and studies on the impact of technology on environment. Promising new technologies as e.g. the replacement of gasoline by hydrogen cells as vehicle propulsion are investigated. (orig.)

  13. Mobility Research and Development (Briefing charts)

    Science.gov (United States)

    2016-03-17

    Mobility Research & Development Dr. Paramsothy Jayakumar, STE, Analytics Tank Automotive Research, Development and Engineering Center Research...Mobility Model (NRMM) • Dr. M. G. Bekker of TARDEC is the “Father of Terrain-Vehicle Systems ” • NRMM was developed in 1960-70 by TARDEC and ERDC...Blocks: Scaled Experiments Particle Image Velocimetry Pressure – Sinkage Test Direct Shear Test Simulations Single Wheel Test Plate width = 50 mm

  14. Applications of mixed-methods methodology in clinical pharmacy research.

    Science.gov (United States)

    Hadi, Muhammad Abdul; Closs, S José

    2016-06-01

    Introduction Mixed-methods methodology, as the name suggests refers to mixing of elements of both qualitative and quantitative methodologies in a single study. In the past decade, mixed-methods methodology has gained popularity among healthcare researchers as it promises to bring together the strengths of both qualitative and quantitative approaches. Methodology A number of mixed-methods designs are available in the literature and the four most commonly used designs in healthcare research are: the convergent parallel design, the embedded design, the exploratory design, and the explanatory design. Each has its own unique advantages, challenges and procedures and selection of a particular design should be guided by the research question. Guidance on designing, conducting and reporting mixed-methods research is available in the literature, so it is advisable to adhere to this to ensure methodological rigour. When to use it is best suited when the research questions require: triangulating findings from different methodologies to explain a single phenomenon; clarifying the results of one method using another method; informing the design of one method based on the findings of another method, development of a scale/questionnaire and answering different research questions within a single study. Two case studies have been presented to illustrate possible applications of mixed-methods methodology. Limitations Possessing the necessary knowledge and skills to undertake qualitative and quantitative data collection, analysis, interpretation and integration remains the biggest challenge for researchers conducting mixed-methods studies. Sequential study designs are often time consuming, being in two (or more) phases whereas concurrent study designs may require more than one data collector to collect both qualitative and quantitative data at the same time.

  15. Development of Radiometric and Allied Analytical Methods and Strategies to Strengthen National Residue Control Programmes for Antibiotic and Anthelmintic Veterinary Drug Residues. Final Report of a Coordinated Research Project

    International Nuclear Information System (INIS)

    2016-08-01

    Awareness of food safety is rising among consumers, and many importing countries implement food control regulations to guarantee the quality and safety of imported foods for their consumers. Many developing countries have also taken steps to put in place control systems that encourage responsible use of veterinary medicines to combat possible drug resistance, control drug residues and ensure compliance with international and national standards. However, these countries still require the necessary know-how and skills to protect local consumers and to access international markets. One significant constraint is the capacity of laboratory services to generate surveillance data using reliable and cost effective analytical methods validated to national and international standards. The IAEA coordinated research project (CRP) on the Development of Radiometric and Allied Analytical Methods to Strengthen National Residue Control Programmes for Antibiotic and Anthelmintic Veterinary Drug Residues was initiated in 2009 to conduct work on robust nuclear and related technologies suitable for the screening and confirmatory analysis of residues of veterinary medicines, including antimicrobials and anthelmintics commonly used in animal production, with public health and trade significance. The CRP also explored mechanisms to enhance networking among research institutions involved in research on pharmacologically active veterinary drug residues in food (primarily) and environmental samples. The project was implemented by the Joint FAO/IAEA Division of Nuclear Techniques in Food and Agriculture between 2009 and 2014 and involved eleven research contracts and one technical contract, five research agreements and one institution. The CRP was a continuation of the CRP on the Development of Strategies for the Effective Monitoring of Veterinary Drug Residues in Livestock and Livestock Products in Developing Countries and the key findings are also summarized in this publication.

  16. Principles, Methods of Participatory Research: Proposal for Draft Animal Power

    Directory of Open Access Journals (Sweden)

    E. Chia

    2004-03-01

    Full Text Available The meeting of researchers, who question themselves on the efficiency of their actions when they accompany stakeholders during change processes, provides the opportunity to ponder on the research methods to develop when working together with the stakeholders: participative research, research-action, research-intervention… The author proposes to present the research-action approach as new. If the three phases of research-action are important, the negotiation phase is essential, because it enables contract formalization among partners (ethical aspect, development of a common language, and formalization of structuring efforts between researchers with various specialties and stakeholders. In the research-action approach, the managing set-ups (scientific committees… play a major role: they guarantee at the same time a solution to problems, production, and the legitimacy of the scientific knowledge produced. In conclusion, the author suggests ways to develop research-action in the field of animal traction in order to conceive new socio-technical and organizational innovations that will make the use of this technique easier.

  17. METHODS TO DEVELOP A TOROIDAL SURFACE

    Directory of Open Access Journals (Sweden)

    DANAILA Ligia

    2017-05-01

    Full Text Available The paper work presents two practical methods to draw the development of a surface unable to be developed applying classical methods of Descriptive Geometry, the toroidal surface, frequently met in technical practice. The described methods are approximate ones; the development is obtained with the help of points. The accuracy of the methods is given by the number of points used when drawing. As for any other approximate method, when practically manufactured the development may need to be adjusted on site.

  18. Creative Approaches to Teaching Graduate Research Methods Workshops

    OpenAIRE

    Peter Reilly

    2017-01-01

    Engagement and deeper learning were enhanced by developing several innovative teaching strategies delivered in Research Methods workshops to Graduate Business Students.  Focusing primarily on students adopting a creative approach to formulating a valid research question for undertaking a dissertation successfully. These techniques are applicable to most subject domains to ensure student engagement.  Addressing the various multiple intelligences and learning styles existing within groups while...

  19. Supercompressibility factor program. A new calculation method for real gas factors developed by the American Gas Association/Gas Research Institute

    Energy Technology Data Exchange (ETDEWEB)

    Luebbe, D.

    1987-07-01

    The innovative US calculation method for natural gas real gas factors is applicable to great pressure and temperature ranges and does not involve any restrictions as to the quality of natural gas. The results obtained for natural gas coming from Northern Germany or for imported natural gas are well consistent with actual measuring results. The model can therefore be applied as a rule for computing in a new technical recommendation and determine real gas factors whenever they are relevant to trading. The respective calculations must be preceded by a complete analysis characterizing the quality of gases. However, the new method allows for the alternative calculation of real gas factors on the basis of a small number of easily measurable factors (for example H/sub 0/, d, CO/sub 2/). This quality seams to be all the more attractive as it allows for an automatic translation of parametric sets at changing gas qualities which for the first time can manage without an expensive online gas chromatography or density translators, respectively.

  20. Cuba | IDRC - International Development Research Centre

    International Development Research Centre (IDRC) Digital Library (Canada)

    Researchers developed a way for community members to track mosquito ... government, and business, they bring concrete and innovative development ideas to ... areas such as maternal and child health, and sustainable water management.

  1. Biomedical engineering for health research and development.

    Science.gov (United States)

    Zhang, X-Y

    2015-01-01

    Biomedical engineering is a new area of research in medicine and biology, providing new concepts and designs for the diagnosis, treatment and prevention of various diseases. There are several types of biomedical engineering, such as tissue, genetic, neural and stem cells, as well as chemical and clinical engineering for health care. Many electronic and magnetic methods and equipments are used for the biomedical engineering such as Computed Tomography (CT) scans, Magnetic Resonance Imaging (MRI) scans, Electroencephalography (EEG), Ultrasound and regenerative medicine and stem cell cultures, preparations of artificial cells and organs, such as pancreas, urinary bladders, liver cells, and fibroblasts cells of foreskin and others. The principle of tissue engineering is described with various types of cells used for tissue engineering purposes. The use of several medical devices and bionics are mentioned with scaffold, cells and tissue cultures and various materials are used for biomedical engineering. The use of biomedical engineering methods is very important for the human health, and research and development of diseases. The bioreactors and preparations of artificial cells or tissues and organs are described here.

  2. Safeguards technology research and development at CIAE

    International Nuclear Information System (INIS)

    Yang Qun

    2001-01-01

    Full text: China Institute of Atomic Energy (CIAE) is a multi-disciplinary institute under the leadership of China National Nuclear Corporation (CNNC). The Laboratory of Technical Research for Nuclear Safeguards was established at CIAE in 1991 to develop safeguards technology and to provide technical assistance to competent authorities for nuclear material management and control, which became one of the key laboratories approved by CNNC in 1993. The main research works for safeguards at CIAE include: nuclear material control and accounting, facilities license review and assessment, domestic inspection, NDA and DA analysis, physical protection and technical training. Research and development of equipment and technique for safeguards has been continuing at CIAE. A variety of NDA equipment that has different resolution and analysis capability has been developed. Method of NDA measurement has been investigated for nuclear material with different characteristics. Mathematics method such as Monte Carlo simulation is applied in NDA. Advanced destructive analysis (DA) instrument is installed at laboratory of CIAE, such as TIMS, ICP-MS and electronic chemistry analyzing system. The high accuracy results of element analysis and isotopic analysis for nuclear material can be obtained. It is possible to measure the types and quantities of nuclear material in a given area by means of NDA and DA. Physical protection system has also been developed. It consists of access control and management, various alarm (including perimeter alarm, intrusion alarms, fire alarms), video and audio monitors, intercommunication set and central console. The system can meet technical requirement for safeguards of first rank. Nuclear material accounting is an important aspect of safeguards research at CIAE. The computer software related to material accounting has been developed. It is the important task for scientists at CIAE to design and review nuclear accounting systems in various facilities. For

  3. Distributed Research Project Scheduling Based on Multi-Agent Methods

    Directory of Open Access Journals (Sweden)

    Constanta Nicoleta Bodea

    2011-01-01

    Full Text Available Different project planning and scheduling approaches have been developed. The Operational Research (OR provides two major planning techniques: CPM (Critical Path Method and PERT (Program Evaluation and Review Technique. Due to projects complexity and difficulty to use classical methods, new approaches were developed. Artificial Intelligence (AI initially promoted the automatic planner concept, but model-based planning and scheduling methods emerged later on. The paper adresses the project scheduling optimization problem, when projects are seen as Complex Adaptive Systems (CAS. Taken into consideration two different approaches for project scheduling optimization: TCPSP (Time- Constrained Project Scheduling and RCPSP (Resource-Constrained Project Scheduling, the paper focuses on a multiagent implementation in MATLAB for TCSP. Using the research project as a case study, the paper includes a comparison between two multi-agent methods: Genetic Algorithm (GA and Ant Colony Algorithm (ACO.

  4. Research methods to develop Measures of Effectiveness of the United States Coast Guard`s Vessel Inspection and Boarding Program. Volume 2, Main report

    Energy Technology Data Exchange (ETDEWEB)

    Wheeler, T.; Cox, R. [Sandia National Labs., Albuquerque, NM (United States); Gawande, K. [New Mexico Univ., Albuquerque, NM (United States). Dept. of Economics; Stone, R.; Waisel, L.; Wallace, W.A. [Rensselaer Polytechnic Inst., Troy, New York (United States). Dept. of Decision Sciences and Engineering Systems

    1995-04-01

    The primary objective of this study is to provide Measures of Effectiveness (MOEs) of the US Coast Guard Marine Inspection and Boarding Program based on objective scientific methods. A secondary objective of the study is to provide USCG management with a methodologically and theoretically sound aid to effective policy decision-making. The MOEs constructed in this study are specific to the Marine Inspection and Boarding Program, but the methodology of the study is based on sound theoretical principles that are probably applicable to a range of USCG activities. Hence the methodology applied equally to other important USCG programs and can be similarly used to measure their effectiveness and as an aid to decision-making.

  5. The Documentary Method in Intercultural Research Scenarios

    Directory of Open Access Journals (Sweden)

    Henrike Evers

    2009-01-01

    Full Text Available The documentary method appears to be especially suitable for preventing possible ethnocentrisms in the interpretation of data in reconstructive research, as well as for precluding concessions with a statistic and normative cultural concept. As an illustration of this thesis, this article presents a study—undertaken at the Bremen University of Applied Sciences—in which the effects of an intercultural contact programme between international students and German families are analysed. Special emphasis is placed on the question of the students' emotional and cognitive changes, called educational processes ("Bildung" in the educational science. The theoretical and methodological background of the study and exemplary results are presented. URN: urn:nbn:de:0114-fqs0901478

  6. Research and development of evaluation system for photovoltaic power generation system. Research and survey on test and evaluation method for BOS component devices; Taiyoko hatsuden system hyoka gijutsu no kenkyu kaihatsu. Shuhen gijutsu hyoka system no kenkyu kaihatsu

    Energy Technology Data Exchange (ETDEWEB)

    Tatsuta, M [New Energy and Industrial Technology Development Organization, Tokyo (Japan)

    1994-12-01

    This paper reports the study results on R and D of the evaluation method for BOS component devices in fiscal 1994. (1) On the study on requirements of BOS component devices for practical use, the study results on storage battery, inverter, protective device for system interconnection, and effective use means for storage battery were summarized. On the future device technology, it was clarified that the following value added technologies are promising: simple design of inverter circuit, cost reduction by common specification and mass production, and stabilization of voltage and compensation of momentary peak load by combining inverter with small-capacity storage batteries. (2) On the study on the performance test method for BOS component devices, basic characteristic (capacity, efficiency) test, PSOC charge/discharge cycle test, and accelerated life cycle test were performed for 4 kinds of new storage batteries developed by NEDO. The whole characteristic test results satisfied specifications, and long-term cycle test is in promotion for all new storage batteries. 3 figs., 4 tabs.

  7. Structured methods for customer-oriented innovation research

    DEFF Research Database (Denmark)

    Scholderer, Joachim

    customers might have told them if they had only properly been asked beforehand. In the following, a short introduction will be given to structured research methods that are relatively easy to use and can help product developers prioritise their efforts and assess the market potential of innovative concepts....

  8. Reliability and Validity of the Research Methods Skills Assessment

    Science.gov (United States)

    Smith, Tamarah; Smith, Samantha

    2018-01-01

    The Research Methods Skills Assessment (RMSA) was created to measure psychology majors' statistics knowledge and skills. The American Psychological Association's Guidelines for the Undergraduate Major in Psychology (APA, 2007, 2013) served as a framework for development. Results from a Rasch analysis with data from n = 330 undergraduates showed…

  9. What we do | Page 90 | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Results 891 - 900 of 1605 ... IDRC funds research in developing countries to create lasting ... Regions and countries ... --Faroe Islands, --Finland, --France, --Germany, --Gibraltar .... Carbon Market and Integrated Waste Solutions : a Case Study of Indonesia ... Topic(s): RESEARCH NETWORKS, RESEARCH METHODS, ...

  10. What we do | Page 90 | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Results 891 - 900 of 1605 ... IDRC funds research in developing countries to create lasting ... Urban agriculture ... Carbon Market and Integrated Waste Solutions : a Case Study of Indonesia ... Region(s): Asia, China, Far East Asia, India, South and Central Asia ... Topic(s): RESEARCH NETWORKS, RESEARCH METHODS, ...

  11. METHOD OF HISTORICAL RESEARCH OF PRESCHOOL EDUCATION IN RUSSIA

    OpenAIRE

    Y. S. Rubinchik

    2015-01-01

    The article suggests a methodology of historical research of preschool education. The analysis of theoretical and methodical provisions for the education of preschool children. Discusses the importance of the achievements of the Soviet system of preschool upbringing and education. Shows the principles, directions, methods and conditions for their implementation when working with children of preschool age. Discusses the state of childhood in modern Russia, problems of development of preschool ...

  12. Scenario development methods and practice

    International Nuclear Information System (INIS)

    2001-01-01

    The safe management of radioactive waste is an essential aspect of all nuclear power programmes. Although a general consensus has been reached in OECD countries on the use of geological repositories for the disposal of high-level radioactive waste, analysis of the long-term safety of these repositories, using performance assessment and other tools, is required prior to implementation. The initial stage in developing a repository safety assessment is the identification of all factors that may be relevant to the long-term safety of the repository and their combination to form scenarios. This must be done in a systematic and transparent way in order to assure the regulatory authorities that nothing important has been forgotten. Scenario development has become the general term used to describe the collection and organisation of the scientific and technical information necessary to assess the long-term performance or safety of radioactive waste disposal systems. This includes the identification of the relevant features, events and processes (FEPs), the synthesis of broad models of scientific understanding, and the selection of cases to be calculated. Scenario development provides the overall framework in which the cases and their calculated consequences can be discussed, including biases or shortcomings due to omissions or lack of knowledge. The NEA Workshop on Scenario Development was organised in Madrid, in May 1999, with the objective of reviewing developments in scenario methodologies and applications in safety assessments since 1992. The outcome of this workshop is the subject of this book. It is a review of developments in scenario methodologies based on a large body of practical experience in safety assessments. It will be of interest to radioactive waste management experts as well as to other specialists involved in the development of scenario methodologies. (author)

  13. Publications | Page 42 | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Results 411 - 420 of 6382 ... Through books, articles, research publications, and studies, we aim to widen the impact of our investment and advance development research. We share the results of our funded ... Evaluation in the Extreme: Research, Impact and Politics in Violently Divided Societies. Over the past two decades, ...

  14. Publications | Page 76 | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Results 751 - 760 of 6335 ... IDRC works with developing-country researchers and institutions to build local capacity through funding, knowledge sharing, and training. Through books, articles, research ... Caribbean health : diversity in local food production to combat obesity (restricted access). Led by researchers from McGill ...

  15. Gender | Page 230 | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    For research results to improve people's lives, they must reach decision-makers who can use them to develop more effective policies and practices. About 20% of IDRC's project funding in the past year — and the past decade — went to research that aimed to influence policies. To help IDRC-supported research results ...

  16. Managing Research Libraries in Developing Economy | Ahmed ...

    African Journals Online (AJOL)

    This paper discusses managing research libraries in developing economy. The concepts of special libraries, funding of research libraries, the need for training and retraining of library staff and resources sharing networking were highlighted. The paper recommends that research Institutes need to re-order their priorities ...

  17. Research and development of methods and technologies for CO2 capture in fossil fuel power plants and storage in geological formations in the Czech Republic. Substage E2.1: Methods of and technologies for post-combustion CO2 capture from the flue gas. Substage E2.3: Selection of a chemical absorption based method for post-combustion CO2 capture. Revision 0

    International Nuclear Information System (INIS)

    Vavrova, Jana

    2010-12-01

    The following topics are described: Overview of CO 2 capture methods; Overview of absorption technologies (Amine technologies; Ammonia technologies); and the Research & Development stage (Absorption processes, chemical/carbonate loop; Membranes). (P.A.)

  18. Social Media and Mentoring in Biomedical Research Faculty Development

    Science.gov (United States)

    Teruya, Stacey Alan; Bazargan-Hejazi, Shahrzad

    2014-01-01

    Purpose: To determine how effective and collegial mentoring in biomedical research faculty development may be implemented and facilitated through social media. Method: The authors reviewed the literature for objectives, concerns, and limitations of career development for junior research faculty. They tabularized these as developmental goals, and…

  19. Research in Review. Malnutrition and Children's Development.

    Science.gov (United States)

    Stevens, Joseph H., Jr.; Baxter, Delia H.

    1981-01-01

    Indicates how various degrees of malnutrition affect children's development. Reviews research conducted in several developing countries and the United States, and describes the nutritional status of children in the United States. Implications for nutrition programs, research and policy formation are pointed out. (Author/RH)

  20. Program Leader | IDRC - International Development Research Centre

    International Development Research Centre (IDRC) Digital Library (Canada)

    Leads in the identification of the overall development research ... Ensures that a regional perspective is brought to bear on program planning at the PI and ... The incumbent is the manager of the Program Initiative program and team and as such: ... projects between Canadian and developing country researchers; and; When ...

  1. Publications | Page 50 | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Results 491 - 500 of 6341 ... Through books, articles, research publications, and studies, we aim to widen the impact of our investment and advance development research. ... ​Does the unequal distribution of technological resources and available data sets threaten the developing world's participation in the open data ...

  2. Particle Detectors: Research and Development at CERN

    International Nuclear Information System (INIS)

    Fabjan, C. W.

    2008-01-01

    Over the past 15 years a worldwide Detector R and D Programme has made the LHC experiments possible. These experiments operate at a new level of event rate and detection capabilities. Based on these advances, Detector R and D is continuing at CERN in close collaboration with University and Research Institutes. Several main directions are being pursued for solid-state and gaseous tracking devices, advanced crystal and noble liquid calorimetry, particle identification methods, and advanced signal-processing techniques. This effort is directed towards experiments at even higher collision rates at the LHC, the requirements for the next generation of linear electron-positron colliders and for applications outside particle physics, such as medical diagnostics instrumentation. We shall illustrate this challenging, stimulating and creative programme with examples and show how these developments are taking place in close collaboration between CERN and institutions around the globe

  3. Developing Scoring Algorithms (Earlier Methods)

    Science.gov (United States)

    We developed scoring procedures to convert screener responses to estimates of individual dietary intake for fruits and vegetables, dairy, added sugars, whole grains, fiber, and calcium using the What We Eat in America 24-hour dietary recall data from the 2003-2006 NHANES.

  4. Taxonomic Dimensions for Studying Situational Method Development

    NARCIS (Netherlands)

    Aydin, Mehmet N.; Harmsen, Frank; van Hillegersberg, Jos; Ralyté, Jolita; Brinkkemper, Sjaak; Henderson-Sellers, Brian

    2007-01-01

    This paper is concerned with fragmented literature on situational method development, which is one of fundamental topics related to information systems development (ISD) methods. As the topic has attracted many scholars from various and possibly complementary schools of thought, different

  5. Research and Development Conference CIEE Program 1992

    Energy Technology Data Exchange (ETDEWEB)

    1992-01-01

    CIEE's second annual Research and Development Conference will introduce you to some of the results achieved to date through CIEE-sponsored multiyear research performed in three programs: Building Energy Efficiency, Air Quality Impacts of Energy Efficiency, and End-Use Resource Planning. Results from scoping studies, Director's discretionary research, and exploratory research will also be featured in this report.

  6. Karlsruhe Nuclear Research Center. Research and development programme 1989

    International Nuclear Information System (INIS)

    1988-01-01

    The R and D activities of the KfK are classified in 10 main research activities: 1) Project fast breeder; 2) separation nozzle method; 3) project nuclear fusion; 4) project reprocessing and waste processing; 5) ultimate storage; 6) environment and safety; 7) solid-state and materials research; 8) nuclear and elementary particle physics; 9) microtechnics e.g. X-ray lithography; 10) materials handling. (HP) [de

  7. Developments in geophysical exploration methods

    CERN Document Server

    1982-01-01

    One of the themes in current geophysical development is the bringing together of the results of observations made on the surface and those made in the subsurface. Several benefits result from this association. The detailed geological knowledge obtained in the subsurface can be extrapolated for short distances with more confidence when the geologi­ cal detail has been related to well-integrated subsurface and surface geophysical data. This is of value when assessing the characteristics of a partially developed petroleum reservoir. Interpretation of geophysical data is generally improved by the experience of seeing the surface and subsurface geophysical expression of a known geological configuration. On the theoretical side, the understanding of the geophysical processes themselves is furthered by the study of the phenomena in depth. As an example, the study of the progress of seismic wave trains downwards and upwards within the earth has proved most instructive. This set of original papers deals with some of ...

  8. Reactor kinetics methods development. Final report

    International Nuclear Information System (INIS)

    Hansen, K.F.; Henry, A.F.

    1978-01-01

    This report is a qualitative summary of research conducted at MIT from 1967 to 1977 in the area of reactor kinetics methods. The objectives of the research were to find methods of integration of various mathematical models of nuclear reactor transients. From the beginning the work was aimed at numerical integration methods. Specific areas of research, discussed in more detail following, included: integration of multigroup diffusion theory models by finite difference and finite element methods; response matrix and nodal methods; coarse-mesh homogenization; and special treatment of boundary conditions

  9. New Product Development and Business Strategy of Research and Development

    International Nuclear Information System (INIS)

    Lee, Sun Cheol

    1998-05-01

    The contents of this book are new product development strategy of the top business, commercialization and new product development, development case analysis and framework of new product development, investigation strategy for idea of new product development, case analysis of research as development and goal of new product development, case analysis and planning and management for new product development, innovative item development and technical management against confusion, the map for determination procedure of development, strategy of market and goods and development strategy cases in leading company.

  10. Innovative Methods and Applications in Mucoadhesion Research

    DEFF Research Database (Denmark)

    Mackie, Alan; Goycoolea, Francisco M.; Menchicchi, Bianca

    2017-01-01

    The present review is aimed at elucidating relatively new aspects of mucoadhesion/mucus interaction and related phenomena that emerged from a Mucoadhesion workshop held in Munster on 2–3 September 2015 as a satellite event of the ICCC 13th—EUCHIS 12th. After a brief outline of the new issues......, the focus is on mucus description, purification, and mucus/mucin characterization, all steps that are pivotal to the understanding of mucus related phenomena and the choice of the correct mucosal model for in vitro and ex vivo experiments, alternative bio/mucomimetic materials are also presented....... Then a selection of preparative techniques and testing methods are described (at molecular as well as micro and macroscale) that may support the pharmaceutical development of mucus interactive systems and assist formulators in the scale-up and industrialization steps. Recent applications of mucoadhesive systems...

  11. Development of the Learning Health System Researcher Core Competencies.

    Science.gov (United States)

    Forrest, Christopher B; Chesley, Francis D; Tregear, Michelle L; Mistry, Kamila B

    2017-08-04

    To develop core competencies for learning health system (LHS) researchers to guide the development of training programs. Data were obtained from literature review, expert interviews, a modified Delphi process, and consensus development meetings. The competencies were developed from August to December 2016 using qualitative methods. The literature review formed the basis for the initial draft of a competency domain framework. Key informant semi-structured interviews, a modified Delphi survey, and three expert panel (n = 19 members) consensus development meetings produced the final set of competencies. The iterative development process yielded seven competency domains: (1) systems science; (2) research questions and standards of scientific evidence; (3) research methods; (4) informatics; (5) ethics of research and implementation in health systems; (6) improvement and implementation science; and (7) engagement, leadership, and research management. A total of 33 core competencies were prioritized across these seven domains. The real-world milieu of LHS research, the embeddedness of the researcher within the health system, and engagement of stakeholders are distinguishing characteristics of this emerging field. The LHS researcher core competencies can be used to guide the development of learning objectives, evaluation methods, and curricula for training programs. © Health Research and Educational Trust.

  12. A narrative method for consciousness research

    Science.gov (United States)

    Díaz, José-Luis

    2013-01-01

    Some types of first-person narrations of mental processes that constitute phenomenological accounts and texts, such as internal monolog statements, epitomize the best expressions and representations of human consciousness available and therefore may be used to model phenomenological streams of consciousness. The type of autonomous monolog in which an author or narrator declares actual mental processes in a think aloud manner seems particularly suitable for modeling streams of consciousness. A narrative method to extract and depict conscious processes, operations, contents, and states from an acceptable phenomenological text would require three subsequent steps: operational criteria for producing and/or selecting a phenomenological text, a system for detecting text items that are indicative of conscious contents and processes, and a procedure for representing such items in formal dynamic system devices such as Petri nets. The requirements and restrictions of each of these steps are presented, analyzed, and applied to phenomenological texts in the following manner: (1) the relevance of introspective language and narrative analyses to consciousness research and the idea that specific narratives are of paramount interest for such investigation is justified; (2) some of the obstacles and constraints to attain plausible consciousness inferences from narrative texts and the methodological requirements to extract and depict items relevant to consciousness contents and operations from a suitable phenomenological text are examined; (3) a preliminary exercise of the proposed method is used to analyze and chart a classical interior monolog excerpted from James Joyce’s Ulysses, a masterpiece of the stream-of-consciousness literary technique and, finally, (4) an inter-subjective evaluation for inter-observer agreement of mental attributions of another phenomenological text (an excerpt from the Intimate Journal of Miguel de Unamuno) is presented using some mathematical tools

  13. A narrative method for consciousness research

    Directory of Open Access Journals (Sweden)

    José-Luis eDíaz

    2013-11-01

    Full Text Available Some types of first person narrations of mental processes that constitute phenomenological parliaments and texts, such as internal monologue statements, epitomize the best expressions and representations of human consciousness available and therefore may be used to model phenomenological streams of consciousness. The type of autonomous monologue in which an author or narrator declares actual mental processes in a think aloud manner seems particularly suitable for modeling streams of consciousness. A narrative method to extract and depict conscious processes, operations, contents, and states from an acceptable phenomenological text would require three subsequent steps: operational criteria for producing and/or selecting a phenomenological text, a system for detecting text items that are indicative of conscious contents and processes, and a procedure for representing such items in formal dynamic system devices such as Petri nets. The requirements and restrictions of each of these steps are presented, analyzed, and applied to phenomenological texts in the following manner: (1 The relevance of introspective language and narrative analyses to consciousness research and the idea that specific narratives are of paramount interest for such investigation is justified; (2 Some of the obstacles and constraints to attain plausible consciousness inferences from narrative texts and the methodological requirements to extract and depict items relevant to consciousness contents and operations from a suitable phenomenological text are examined; (3 A preliminary exercise of the proposed method is used to analyze and chart a classical interior monologue excerpted from James Joyce’s Ulysses, a masterpiece of the stream-of-consciousness literary technique and, finally, an inter-subjective evaluation for inter-observer agreement of mental attributions of another phenomenological text (an excerpt from the Intimate Journal of Miguel de Unamuno is presented using some

  14. A narrative method for consciousness research.

    Science.gov (United States)

    Díaz, José-Luis

    2013-01-01

    Some types of first-person narrations of mental processes that constitute phenomenological accounts and texts, such as internal monolog statements, epitomize the best expressions and representations of human consciousness available and therefore may be used to model phenomenological streams of consciousness. The type of autonomous monolog in which an author or narrator declares actual mental processes in a think aloud manner seems particularly suitable for modeling streams of consciousness. A narrative method to extract and depict conscious processes, operations, contents, and states from an acceptable phenomenological text would require three subsequent steps: operational criteria for producing and/or selecting a phenomenological text, a system for detecting text items that are indicative of conscious contents and processes, and a procedure for representing such items in formal dynamic system devices such as Petri nets. The requirements and restrictions of each of these steps are presented, analyzed, and applied to phenomenological texts in the following manner: (1) the relevance of introspective language and narrative analyses to consciousness research and the idea that specific narratives are of paramount interest for such investigation is justified; (2) some of the obstacles and constraints to attain plausible consciousness inferences from narrative texts and the methodological requirements to extract and depict items relevant to consciousness contents and operations from a suitable phenomenological text are examined; (3) a preliminary exercise of the proposed method is used to analyze and chart a classical interior monolog excerpted from James Joyce's Ulysses, a masterpiece of the stream-of-consciousness literary technique and, finally, (4) an inter-subjective evaluation for inter-observer agreement of mental attributions of another phenomenological text (an excerpt from the Intimate Journal of Miguel de Unamuno) is presented using some mathematical tools.

  15. A method for Effect Modifier Assessment in ergonomic intervention research – The EMA method

    DEFF Research Database (Denmark)

    Edwards, Kasper; Winkel, Jørgen

    2016-01-01

    Introduction: Ergonomic intervention research includes studies in which researchers arrange (or follow) changes in working conditions to determine the effects in risk factors and/or health. Often this research takes place at workplaces and not in a controlled environment of a laboratory. The effe......Introduction: Ergonomic intervention research includes studies in which researchers arrange (or follow) changes in working conditions to determine the effects in risk factors and/or health. Often this research takes place at workplaces and not in a controlled environment of a laboratory...... of the literature revealed lack of or poor consideration of effect modifiers in ergonomic intervention research. We present a method that has been developed over the course of several years parallel to intervention studies in healthcare. Material and methods: The EMA method is a type of group interview including 3...... sources. Conclusion: The EMA method seems to offer a feasible procedure to obtain significant knowledge on potential effect modifiers in ergonomic intervention research. However, further development and validation is suggested....

  16. Research and Design of Rootkit Detection Method

    Science.gov (United States)

    Liu, Leian; Yin, Zuanxing; Shen, Yuli; Lin, Haitao; Wang, Hongjiang

    Rootkit is one of the most important issues of network communication systems, which is related to the security and privacy of Internet users. Because of the existence of the back door of the operating system, a hacker can use rootkit to attack and invade other people's computers and thus he can capture passwords and message traffic to and from these computers easily. With the development of the rootkit technology, its applications are more and more extensive and it becomes increasingly difficult to detect it. In addition, for various reasons such as trade secrets, being difficult to be developed, and so on, the rootkit detection technology information and effective tools are still relatively scarce. In this paper, based on the in-depth analysis of the rootkit detection technology, a new kind of the rootkit detection structure is designed and a new method (software), X-Anti, is proposed. Test results show that software designed based on structure proposed is much more efficient than any other rootkit detection software.

  17. Advances in research methods for information systems research data mining, data envelopment analysis, value focused thinking

    CERN Document Server

    Osei-Bryson, Kweku-Muata

    2013-01-01

    Advances in social science research methodologies and data analytic methods are changing the way research in information systems is conducted. New developments in statistical software technologies for data mining (DM) such as regression splines or decision tree induction can be used to assist researchers in systematic post-positivist theory testing and development. Established management science techniques like data envelopment analysis (DEA), and value focused thinking (VFT) can be used in combination with traditional statistical analysis and data mining techniques to more effectively explore

  18. Demystifying Mixed Methods Research Design: A Review of the Literature

    OpenAIRE

    Gail D. Caruth

    2013-01-01

    Mixed methods research evolved in response to the observed limitations of both quantitative and qualitative designs and is a more complex method. The purpose of this paper was to examine mixed methods research in an attempt to demystify the design thereby allowing those less familiar with its design an opportunity to utilize it in future research. A review of the literature revealed that it has been gaining acceptance among researchers, researchers have begun using mixed methods research, it ...

  19. ASPECTS REGARDING NEUROMARKETING SPECIFIC RESEARCH METHODS

    Directory of Open Access Journals (Sweden)

    MIRELA-CRISTINA VOICU

    2012-05-01

    Full Text Available Information is one of the most important resources that a company must posses. Some informations are hidden deep in the black box - the mind of the consumer. Neuromarketing helps us find what is inside of the black box without troubling the consumer with questions that he doesn’t want to answer or that he can’t answer. Today because of an extensive research in mapping cortical and subcortical activity in association with behaviors and thoughts, the confidence in neurological data is growing. Thanks to discoveries in perceptual sciences we can identify the parts of the brain that are responsible for the phenomena that we experience daily. For all those interested in information obtained through neuromarketing techniques it becomes evident that there are corresponding neural substrates of consumer decision making process and these substrates can be observed, measured, and possibly manipulated. The following paper reveals some important aspects of the use of neuromarketing in studying consumer behavior by presenting the concepts, methods and techniques used under this sophisticated name, the limitations and advantages of using neuromarketing techniques and the importance of this type of information in decision making process at a company level.

  20. Exploring Reticence in Research Methods: The Experience of Studying Psychological Research Methods in Higher Education

    Science.gov (United States)

    Kingsley, Barbara E.; Robertson, Julia M.

    2017-01-01

    As a fundamental element of any psychology degree, the teaching and learning of research methods is repeatedly brought into sharp focus, and it is often regarded as a real challenge by undergraduate students. The reasons for this are complex, but frequently attributed to an aversion of maths. To gain a more detailed understanding of students'…

  1. Peter Taylor | IDRC - International Development Research Centre

    International Development Research Centre (IDRC) Digital Library (Canada)

    He leads a multidisciplinary team that strengthens policy research capacity in developing countries on issues of economic policy, governance, and health systems. Peter has more than 30 years of experience in international development, including positions at the Institute of Development Studies, UK; Helvetas Vietnam; ...

  2. View all initiatives | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    The Open Data for Development program's global network will facilitate and scale innovative approaches to open data to ensure benefits reach citizens in developing countries. Combining research and action to address scaling and sustainability of open data for development initiatives is key to the network's success.

  3. Qualitative research methods: key features and insights gained from use in infection prevention research.

    Science.gov (United States)

    Forman, Jane; Creswell, John W; Damschroder, Laura; Kowalski, Christine P; Krein, Sarah L

    2008-12-01

    Infection control professionals and hospital epidemiologists are accustomed to using quantitative research. Although quantitative studies are extremely important in the field of infection control and prevention, often they cannot help us explain why certain factors affect the use of infection control practices and identify the underlying mechanisms through which they do so. Qualitative research methods, which use open-ended techniques, such as interviews, to collect data and nonstatistical techniques to analyze it, provide detailed, diverse insights of individuals, useful quotes that bring a realism to applied research, and information about how different health care settings operate. Qualitative research can illuminate the processes underlying statistical correlations, inform the development of interventions, and show how interventions work to produce observed outcomes. This article describes the key features of qualitative research and the advantages that such features add to existing quantitative research approaches in the study of infection control. We address the goal of qualitative research, the nature of the research process, sampling, data collection and analysis, validity, generalizability of findings, and presentation of findings. Health services researchers are increasingly using qualitative methods to address practical problems by uncovering interacting influences in complex health care environments. Qualitative research methods, applied with expertise and rigor, can contribute important insights to infection prevention efforts.

  4. Developing teachers through research: reflections on method

    African Journals Online (AJOL)

    Erna Kinsey

    was decided upon as the best means of reflecting teachers' under- standing of ... Through the use of language (communication) people critically under- stand a ... strategies and assessment exercises without looking at them as part of a whole ...

  5. Qualitative methods: a research approach worth considering

    African Journals Online (AJOL)

    Qualitative research forms part of the classical cycle of research. ... putting aside any preconceived ideas and “intuiting”- focusing on the ... that is, no new information is obtained. ... and communication with the scientific community are adhered.

  6. Validity in Mixed Methods Research in Education: The Application of Habermas' Critical Theory

    Science.gov (United States)

    Long, Haiying

    2017-01-01

    Mixed methods approach has developed into the third methodological movement in educational research. Validity in mixed methods research as an important issue, however, has not been examined as extensively as that of quantitative and qualitative research. Additionally, the previous discussions of validity in mixed methods research focus on research…

  7. Using gender research in development: food security in practice

    OpenAIRE

    Quisumbing, Agnes R.; McClafferty, Bonnie

    2006-01-01

    Metadata only record This guide presents research from several countries in IFPRI's research program on gender and intrahousehold relations, using quantitative and qualitative methods. It examines the implications of these issues in the success of development initiatives and suggestions for integrating gender research in projects and policy. The guide is divided into the following sections: the importance of using gender and intrahousehold research to inform projects and policies; gender a...

  8. Informatics methods to enable sharing of quantitative imaging research data.

    Science.gov (United States)

    Levy, Mia A; Freymann, John B; Kirby, Justin S; Fedorov, Andriy; Fennessy, Fiona M; Eschrich, Steven A; Berglund, Anders E; Fenstermacher, David A; Tan, Yongqiang; Guo, Xiaotao; Casavant, Thomas L; Brown, Bartley J; Braun, Terry A; Dekker, Andre; Roelofs, Erik; Mountz, James M; Boada, Fernando; Laymon, Charles; Oborski, Matt; Rubin, Daniel L

    2012-11-01

    The National Cancer Institute Quantitative Research Network (QIN) is a collaborative research network whose goal is to share data, algorithms and research tools to accelerate quantitative imaging research. A challenge is the variability in tools and analysis platforms used in quantitative imaging. Our goal was to understand the extent of this variation and to develop an approach to enable sharing data and to promote reuse of quantitative imaging data in the community. We performed a survey of the current tools in use by the QIN member sites for representation and storage of their QIN research data including images, image meta-data and clinical data. We identified existing systems and standards for data sharing and their gaps for the QIN use case. We then proposed a system architecture to enable data sharing and collaborative experimentation within the QIN. There are a variety of tools currently used by each QIN institution. We developed a general information system architecture to support the QIN goals. We also describe the remaining architecture gaps we are developing to enable members to share research images and image meta-data across the network. As a research network, the QIN will stimulate quantitative imaging research by pooling data, algorithms and research tools. However, there are gaps in current functional requirements that will need to be met by future informatics development. Special attention must be given to the technical requirements needed to translate these methods into the clinical research workflow to enable validation and qualification of these novel imaging biomarkers. Copyright © 2012 Elsevier Inc. All rights reserved.

  9. "Reading" Mixed Methods Research: Contexts for Criticism

    Science.gov (United States)

    Freshwater, Dawn

    2007-01-01

    Health and social care researchers, in their haste to "belong" to academia, have adopted the system of mixed methodology research, overestimating its ability to reveal the truth and occasionally imprisoning their thought in one system. In this article, some of the assumptions underpinning mixed methodology research and its discourse are subjected…

  10. Research and Development Costs in Retail Trade

    Directory of Open Access Journals (Sweden)

    Radojko LUKIC

    2016-12-01

    Full Text Available Research and development expenses are crucial business performance factors for all enterprises, including trading companies. The size and structure of these expenses depend largely on the nature of a company’s activities. Due to such importance and specificity, the research focus of this article is on R&D expenses in trading companies with particular emphasis on retail companies. Their share in the sales revenue of trading companies is increasingly important and determined by many factors, such as innovation, size, location, product categories, and others. Due to varying intensity of influence of these and other factors, research and development expenses in commercial companies differ among countries, trade types (wholesale, retail, wholesale and retail, retail formats (store types and product categories. Understanding the factors of these differences is important for efficient management of research and development costs in trade, particularly retail companies. They are the focus of research in this work.

  11. Fast Charging Electric Vehicle Research & Development Project

    Energy Technology Data Exchange (ETDEWEB)

    Heny, Michael

    2014-03-31

    The research and development project supported the engineering, design and implementation of on-road Electric Vehicle (“EV”) charging technologies. It included development of potential solutions for DC fast chargers (“DCFC”) capable of converting high voltage AC power to the DC power required by EVs. Additional development evaluated solutions related to the packaging of power electronic components and enclosure design, as well as for the design and evaluation of EV charging stations. Research compared different charging technologies to identify optimum applications in a municipal fleet. This project collected EV usage data and generated a report demonstrating that EVs, when supported by adequate charging infrastructure, are capable of replacing traditional internal combustion vehicles in many municipal applications. The project’s period of performance has demonstrated various methods of incorporating EVs into a municipal environment, and has identified three general categories for EV applications: Short Commute: Defined as EVs performing in limited duration, routine commutes. - Long Commute: Defined as tasks that require EVs to operate in longer daily mileage patterns. - Critical Needs: Defined as the need for EVs to be ready at every moment for indefinite periods. Together, the City of Charlottesville, VA (the “City”) and Aker Wade Power Technologies, LLC (“Aker Wade”) concluded that the EV has a viable position in many municipal fleets but with limited recommendation for use in Critical Needs applications such as Police fleets. The report also documented that, compared to internal combustion vehicles, BEVs have lower vehicle-related greenhouse gas (“GHG”) emissions and contribute to a reduction of air pollution in urban areas. The enhanced integration of EVs in a municipal fleet can result in reduced demand for imported oil and reduced municipal operating costs. The conclusions indicated in the project’s Engineering Report (see Attachment

  12. Laboratory Directed Research and Development Program

    International Nuclear Information System (INIS)

    Ogeka, G.J.; Romano, A.J.

    1992-12-01

    This report briefly discusses the following research: Advances in Geoexploration; Transvenous Coronary Angiography with Synchrotron X-Rays; Borehole Measurements of Global Warming; Molecular Ecology: Development of Field Methods for Microbial Growth Rate and Activity Measurements; A New Malaria Enzyme - A Potential Source for a New Diagnostic Test for Malaria and a Target for a New Antimalarial Drug; Basic Studies on Thoron and Thoron Precursors; Cloning of the cDNA for a Human Serine/Threonine Protein Kinase that is Activated Specifically by Double-Stranded DNA; Development of an Ultra-Fast Laser System for Accelerator Applications; Cluster Impact Fusion; Effect of a Bacterial Spore Protein on Mutagenesis; Structure and Function of Adenovirus Penton Base Protein; High Resolution Fast X-Ray Detector; Coherent Synchrotron Radiation Longitudinal Bunch Shape Monitor; High Grain Harmonic Generation Experiment; BNL Maglev Studies; Structural Investigations of Pt-Based Catalysts; Studies on the Cellular Toxicity of Cocaine and Cocaethylene; Human Melanocyte Transformation; Exploratory Applications of X-Ray Microscopy; Determination of the Higher Ordered Structure of Eukaryotic Chromosomes; Uranium Neutron Capture Therapy; Tunneling Microscopy Studies of Nanoscale Structures; Nuclear Techiques for Study of Biological Channels; RF Sources for Accelerator Physics; Induction and Repair of Double-Strand Breaks in the DNA of Human Lymphocytes; and An EBIS Source of High Charge State Ions up to Uranium

  13. Laboratory Directed Research and Development Program

    Energy Technology Data Exchange (ETDEWEB)

    Ogeka, G.J.; Romano, A.J.

    1992-12-01

    This report briefly discusses the following research: Advances in Geoexploration; Transvenous Coronary Angiography with Synchrotron X-Rays; Borehole Measurements of Global Warming; Molecular Ecology: Development of Field Methods for Microbial Growth Rate and Activity Measurements; A New Malaria Enzyme - A Potential Source for a New Diagnostic Test for Malaria and a Target for a New Antimalarial Drug; Basic Studies on Thoron and Thoron Precursors; Cloning of the cDNA for a Human Serine/Threonine Protein Kinase that is Activated Specifically by Double-Stranded DNA; Development of an Ultra-Fast Laser System for Accelerator Applications; Cluster Impact Fusion; Effect of a Bacterial Spore Protein on Mutagenesis; Structure and Function of Adenovirus Penton Base Protein; High Resolution Fast X-Ray Detector; Coherent Synchrotron Radiation Longitudinal Bunch Shape Monitor; High Grain Harmonic Generation Experiment; BNL Maglev Studies; Structural Investigations of Pt-Based Catalysts; Studies on the Cellular Toxicity of Cocaine and Cocaethylene; Human Melanocyte Transformation; Exploratory Applications of X-Ray Microscopy; Determination of the Higher Ordered Structure of Eukaryotic Chromosomes; Uranium Neutron Capture Therapy; Tunneling Microscopy Studies of Nanoscale Structures; Nuclear Techiques for Study of Biological Channels; RF Sources for Accelerator Physics; Induction and Repair of Double-Strand Breaks in the DNA of Human Lymphocytes; and An EBIS Source of High Charge State Ions up to Uranium.

  14. Laos | IDRC - International Development Research Centre

    International Development Research Centre (IDRC) Digital Library (Canada)

    As a result, local university researchers studied the effects of a new protected forest ... city of Luang Prabang, which introduced Internet services to rural people. ... the Government of Laos improve trade negotiations; leaders develop sound ...

  15. Publications | Page 75 | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Results 741 - 750 of 6346 ... IDRC works with developing-country researchers and institutions to ... Improving the Nutrition and Health of CARICOM Populations : final ... policy and an unfavorable legal and regulatory environment, which in turn ...

  16. Publications | Page 28 | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Results 271 - 280 of 6341 ... IDRC works with developing-country researchers and ... food and nutrition security for low- and middle-income households in Kenya and Uganda. ... of the work IDRC's Rural Poverty and Environment program has ...

  17. Gender | Page 229 | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    . ... Building Businesses with Small Producers présente les constatations et une analyse ... Researchers identified the regions in Southeast Asia most vulnerable to ... asked why some children in developing countries are not being vaccinated.

  18. Guatemala | IDRC - International Development Research Centre

    International Development Research Centre (IDRC) Digital Library (Canada)

    Our early work in Guatemala targeted farming efficiency, access to water, ... Researchers also developed a low-cost coffee drying machine powered by coffee ... National Campaign for Inter-ethnic Dialogue, a public education campaign that ...

  19. Publications | Page 6 | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Results 51 - 60 of 7327 ... IDRC works with developing-country researchers and institutions to build local ... Mobile phones, Internet, and gender in Myanmar ... India believe music can offer clues about the ability of the brain to transfer learning.

  20. Problems of scientific research in developing countries

    International Nuclear Information System (INIS)

    Vose, P.B.; Cervellini, A.

    1983-01-01

    The paper gives a general consideration of the problems encountered in the scientific research by the developing countries. Possible optimizations in the long term as well as short term strategies are pointed out