WorldWideScience

Sample records for researchers develop method

  1. Information Systems Development as a Research Method

    Directory of Open Access Journals (Sweden)

    Helen Hasan

    2003-11-01

    Full Text Available This paper takes the stance that some cases of information systems development can be considered knowledge creating activities, and, in those cases, information systems development can be a legitimate research method. In these cases not only is knowledge created about the development process itself but also a deeper understanding emerges about the organisational problem that the system is designed to solve. The paper begins with a brief overview of research in the design sciences and a comparison of research methods that are concerned with the design, and use, of information systems. This is followed by an assessment of the way systems development as a research method deals with the scientific research processes of data collection, analysis, synthesis and display. A case study, where the systems development research method was use, is described to illustrate the method and give the reader a better understanding of the approach.

  2. Research methods for formal consensus development.

    Science.gov (United States)

    James, Daphne; Warren-Forward, Helen

    2015-01-01

    This paper reviews three research methods for developing consensus. Consensus statements and guidelines are increasingly used to clarify and standardise practice, and inform health policy, when relevant and rigorous evidence is lacking. Clinicians need to evaluate the quality of practice guidelines to determine whether to incorporate them into clinical practice or reject them. Formal methods of developing consensus provide a scientific method that uses expert panel members to evaluate current evidence and expert opinions to produce consensus statements for clinical problems. Online search for relevant literature was conducted in Medline and CINAHL. A literature review of consensus, consensus development and research methods papers published in English in peer-reviewed journals. The three methods of developing consensus discussed are the Delphi technique, nominal group technique and the consensus development conference. The techniques and their respective advantages are described, and examples from the literature are provided. The three methods are compared and a flowchart to assist researchers selecting an appropriate method is included. Online resources with information on the development and evaluation of clinical guidelines are reviewed. This paper will help researchers to select an appropriate research method for developing consensus statements and guidelines. When developing consensus guidelines for clinical practice, researchers should use a formal research method to ensure rigour and credibility.

  3. Is Mixed Methods Research Used in Australian Career Development Research?

    Science.gov (United States)

    Cameron, Roslyn

    2010-01-01

    Mixed methods research has become a substantive and growing methodological force that is growing in popularity within the human and social sciences. This article reports the findings of a study that has systematically reviewed articles from the "Australian Journal of Career Development" from 2004 to 2009. The aim of the study was to…

  4. Is Mixed Methods Research Used in Australian Career Development Research?

    Science.gov (United States)

    Cameron, Roslyn

    2010-01-01

    Mixed methods research has become a substantive and growing methodological force that is growing in popularity within the human and social sciences. This article reports the findings of a study that has systematically reviewed articles from the "Australian Journal of Career Development" from 2004 to 2009. The aim of the study was to…

  5. Development of a Research Methods and Statistics Concept Inventory

    Science.gov (United States)

    Veilleux, Jennifer C.; Chapman, Kate M.

    2017-01-01

    Research methods and statistics are core courses in the undergraduate psychology major. To assess learning outcomes, it would be useful to have a measure that assesses research methods and statistical literacy beyond course grades. In two studies, we developed and provided initial validation results for a research methods and statistical knowledge…

  6. EPA Scientists Develop Research Methods for Studying Mold Fact Sheet

    Science.gov (United States)

    In 2002, U.S. Environmental Protection Agency researchers developed a DNA-based Mold Specific Quantitative Polymerase Chain Reaction method (MSQPCR) for identifying and quantifying over 100 common molds and fungi.

  7. Multidisciplinary Methods in Educational Technology Research and Development

    Science.gov (United States)

    Randolph, Justus J.

    2008-01-01

    Over the past thirty years, there has been much dialogue, and debate, about the conduct of educational technology research and development. In this brief volume, the author helps clarify that dialogue by theoretically and empirically charting the research methods used in the field and provides much practical information on how to conduct…

  8. Research Circles - a method for developing guidance practices

    DEFF Research Database (Denmark)

    2012-01-01

    This video reports on our work with using research circles to improve our understanding of how to provide guidance and counseling to help young people in danger of dropping out of school. The video is based on the paper: Research Circles -- a method for developing guidance practices......, and was presented at the Conference for Social Justice, Prosperity and Sustainable Employment 2012 by assistant professor Helle Merete Nordentoft from DPU (http://edu.au.dk/). The film communicating the research paper was created by Mie Nørgaard...

  9. Methods of research and marketing in tourism development

    Directory of Open Access Journals (Sweden)

    Vojnović Boško

    2009-01-01

    Full Text Available Within that context, marketing and research are becoming more important for the development of tourist pursuits, all for the purpose of increased demands for the own destinations. The basic question is oriented to the course and factors that are to be explored and analyzed towards needs of the development of tourism. Results achieved through the experiences of many high-developed economies show that those subjects who have applied an appropriate marketing and exploring in due course, achieve better and faster development. .

  10. Exploring the Application of Community Development Methods on Water Research in Developing Countries

    Science.gov (United States)

    Crane, P. E.

    2012-12-01

    In research and community development focused on water in developing countries, there is a common focus on issues of water quantity and quality. In the best circumstances both are innovative - bringing understanding and solutions to resource poor regions that is appropriate to their unique situations. But the underlying methods and measures for success often differ significantly. Applying critical aspects of community development methods to water research in developing countries could increase the probability of identifying innovative and sustainable solutions. This is examined through two case studies: the first identifies common methods across community development projects in six African countries, and the second examines water quality research performed in Benin, West Africa through the lens of these methods. The first case study is taken from observations gathered between 2008 and 2012 of community development projects focused on water quantity and quality in six sub-Saharan African countries implemented through different non-governmental organizations. These projects took place in rural and peri-urban regions where public utilities were few to none, instance of diarrheal disease was high, and most adults had received little formal education. The water projects included drilling of boreholes, building of rain water tanks, oasis rehabilitation, spring protection, and household biosand filters. All solutions were implemented with hygiene and sanitation components. Although these projects occurred in a wide array of cultural, geographical and climatic regions, the most successful projects shared methods of implementation. These methods are: high levels of stakeholder participation, environmental and cultural adaptation of process and product, and implementation over an extended length of time. The second case study focuses on water quality research performed in Benin, West Africa from 2003 to 2008. This research combined laboratory and statistical analyses with

  11. New Research Methods Developed for Studying Diabetic Foot Ulceration

    Science.gov (United States)

    1998-01-01

    Dr. Brian Davis, one of the Cleveland Clinic Foundation's researchers, has been investigating the risk factors related to diabetic foot ulceration, a problem that accounts for 20 percent of all hospital admissions for diabetic patients. He had developed a sensor pad to measure the friction and pressure forces under a person's foot when walking. As part of NASA Lewis Research Center's Space Act Agreement with the Cleveland Clinic Foundation, Dr. Davis requested Lewis' assistance in visualizing the data from the sensor pad. As a result, Lewis' Interactive Data Display System (IDDS) was installed at the Cleveland Clinic. This computer graphics program is normally used to visualize the flow of air through aircraft turbine engines, producing color two- and three-dimensional images.

  12. Defence Research and Development Canada: Suffield research on nuclear methods for detection of buried bulk explosives

    Science.gov (United States)

    McFee, John E.; Faust, Anthony A.

    2011-06-01

    Defence R&D Canada - Suffield has conducted research and development on nuclear methods for detection of bulk explosives since 1994. Initial efforts were directed at confirmation of the presence of bulk explosives in land mines and improvised explosive devices (IEDs). In close collaboration with a few key Canadian companies, methods suitable for vehicle-mounted or fixed position applications and those suitable for person- or small robotportable roles have been studied. Vehicle-mounted systems mainly employ detection of characteristic radiation, whereas person-portable systems use imaging of back scattered radiation intensity distributions. Two key design tenets have been reduction of personnel shielding by the use of teleoperation and custom design of sensors to address the particular problem, rather than adapting an existing sensor to a problem. This is shown in a number of recent research examples. Among vehicle-mounted systems, recent research to improve the thermal neutron analysis (TNA) sensors, which were put into service with the Canadian Forces in 2002, are discussed. Research on fast neutron analysis (FNA) and associated particle imaging (API), which can augment or replace TNA, depending on the application, are described. Monoenergetic gamma ray induced photoneutron spectroscopy is a novel method which has a number of potential advantages and disadvantages over TNA and FNA. Sources, detectors and geometries have been identified and modelling studies have suggested feasibility. Among person-portable systems, research on neutron backscatter imaging and X-ray coded aperture backscatter imaging are discussed.

  13. Researchers Develop Method to Identify Sparticles in Big Bang Conditions

    CERN Multimedia

    2008-01-01

    Three Northeastern University researchers have proposed a new approach for the highly anticipated discovery of supersymmetric particles, often called sparticles. The methodology, which was published in the December 21 issue of the Physical Review Letters, is based on identifying the hierarchical mass patterns of sparticles, which are assumed to exist in a new class of particle physics theories beyond the Standard Model.

  14. Current Development in Elderly Comprehensive Assessment and Research Methods

    Directory of Open Access Journals (Sweden)

    Shantong Jiang

    2016-01-01

    Full Text Available Comprehensive geriatric assessment (CGA is a core and an essential part of the comprehensive care of the aging population. CGA uses specific tools to summarize elderly status in several domains that may influence the general health and outcomes of diseases of elderly patients, including assessment of medical, physical, psychological, mental, nutritional, cognitive, social, economic, and environmental status. Here, in this paper, we review different assessment tools used in elderly patients with chronic diseases. The development of comprehensive assessment tools and single assessment tools specially used in a dimension of CGA was discussed. CGA provides substantial insight into the comprehensive management of elderly patients. Developing concise and effective assessment instruments is helpful to carry out CGA widely to create a higher clinical value.

  15. Development of a method for research in sports policy in Brazil: an approach to method of mixed research

    Directory of Open Access Journals (Sweden)

    Fernando Marinho Mezzadri

    2015-05-01

    Full Text Available This article presents a method of mixed research for the study of Sport public policy in Brazil. To reach the result, the text was divided into two phases. In the first, it presents a conceptual model for the qualitative analysis of Brazilian public policies directed to the sport. This phase will still be divided into two stages. The first is the construction of a theoretical framework for the interpretation of the study on public policies and the other one demonstrates a conceptual methodological contribution based on the sociology of Pierre Bourdieu. In the second phase it is developed an analysis of the quantitative part which aims to interpret the data that were collected in the empirical part of the research. Later, it will be possible to produce a model of assessment, monitoring, and, especially, the improvement of public policies for Brazilian sport.

  16. Learning as Researchers and Teachers: The Development of a Pedagogical Culture for Social Science Research Methods?

    Science.gov (United States)

    Kilburn, Daniel; Nind, Melanie; Wiles, Rose

    2014-01-01

    In light of calls to improve the capacity for social science research within UK higher education, this article explores the possibilities for an emerging pedagogy for research methods. A lack of pedagogical culture in this field has been identified by previous studies. In response, we examine pedagogical literature surrounding approaches for…

  17. Learning as Researchers and Teachers: The Development of a Pedagogical Culture for Social Science Research Methods?

    Science.gov (United States)

    Kilburn, Daniel; Nind, Melanie; Wiles, Rose

    2014-01-01

    In light of calls to improve the capacity for social science research within UK higher education, this article explores the possibilities for an emerging pedagogy for research methods. A lack of pedagogical culture in this field has been identified by previous studies. In response, we examine pedagogical literature surrounding approaches for…

  18. Research Methods

    Science.gov (United States)

    1992-01-01

    ADDRESS(ES) 8. PERFORMING ORGANIZATION Navy Personnel Research and Development Center REPORT NUMBER San Diego, California 92152-6800 BK -92-05 9. SPONSORING...other interneurons , IN2, which inhibit the ganglion cell. By preferentially stimulating the suround, green light covering the receptive field lowers

  19. 76 FR 62402 - Office of Research and Development; Ambient Air Monitoring Reference and Equivalent Methods...

    Science.gov (United States)

    2011-10-07

    ... AGENCY Office of Research and Development; Ambient Air Monitoring Reference and Equivalent Methods; Designation of One New Equivalent Method AGENCY: Environmental Protection Agency. ACTION: Notice of the..., Research Triangle Park, North Carolina 27711. Designation of this new equivalent method is intended...

  20. Lessons from comparative effectiveness research methods development projects funded under the Recovery Act.

    Science.gov (United States)

    Zurovac, Jelena; Esposito, Dominick

    2014-11-01

    The American Recovery and Reinvestment Act of 2009 (ARRA) directed nearly US$29.2 million to comparative effectiveness research (CER) methods development. To help inform future CER methods investments, we describe the ARRA CER methods projects, identify barriers to this research and discuss the alignment of topics with published methods development priorities. We used several existing resources and held discussions with ARRA CER methods investigators. Although funded projects explored many identified priority topics, investigators noted that much work remains. For example, given the considerable investments in CER data infrastructure, the methods development field can benefit from additional efforts to educate researchers about the availability of new data sources and about how best to apply methods to match their research questions and data.

  1. 75 FR 45627 - Office of Research and Development; Ambient Air Monitoring Reference and Equivalent Methods...

    Science.gov (United States)

    2010-08-03

    ... AGENCY Office of Research and Development; Ambient Air Monitoring Reference and Equivalent Methods: Designation of One New Equivalent Method AGENCY: Environmental Protection Agency. ACTION: Notice of the designation of one new equivalent method for monitoring ambient air quality. SUMMARY: Notice is hereby...

  2. 75 FR 30022 - Office of Research and Development; Ambient Air Monitoring Reference and Equivalent Methods...

    Science.gov (United States)

    2010-05-28

    ... AGENCY Office of Research and Development; Ambient Air Monitoring Reference and Equivalent Methods: Designation of One New Equivalent Method AGENCY: Environmental Protection Agency. ACTION: Notice of the designation of one new equivalent method for monitoring ambient air quality. SUMMARY: Notice is hereby...

  3. 76 FR 15974 - Office of Research and Development; Ambient Air Monitoring Reference and Equivalent Methods...

    Science.gov (United States)

    2011-03-22

    ... AGENCY Office of Research and Development; Ambient Air Monitoring Reference and Equivalent Methods: Designation of Four New Equivalent Methods AGENCY: Environmental Protection Agency. ACTION: Notice of the designation of four new equivalent methods for monitoring ambient air quality. SUMMARY: Notice is hereby...

  4. 75 FR 9894 - Office of Research and Development; Ambient Air Monitoring Reference and Equivalent Methods...

    Science.gov (United States)

    2010-03-04

    ... AGENCY Office of Research and Development; Ambient Air Monitoring Reference and Equivalent Methods: Designation of One New Equivalent Method AGENCY: Environmental Protection Agency. ACTION: Notice of the designation of one new equivalent method for monitoring ambient air quality. SUMMARY: Notice is hereby...

  5. 75 FR 22126 - Office of Research and Development; Ambient Air Monitoring Reference and Equivalent Methods...

    Science.gov (United States)

    2010-04-27

    ... AGENCY Office of Research and Development; Ambient Air Monitoring Reference and Equivalent Methods: Designation of One New Equivalent Method AGENCY: Environmental Protection Agency. ACTION: Notice of the designation of one new equivalent method for monitoring ambient air quality. SUMMARY: Notice is hereby...

  6. Using mixed methods to develop and evaluate complex interventions in palliative care research.

    Science.gov (United States)

    Farquhar, Morag C; Ewing, Gail; Booth, Sara

    2011-12-01

    there is increasing interest in combining qualitative and quantitative research methods to provide comprehensiveness and greater knowledge yield. Mixed methods are valuable in the development and evaluation of complex interventions. They are therefore particularly valuable in palliative care research where the majority of interventions are complex, and the identification of outcomes particularly challenging. this paper aims to introduce the role of mixed methods in the development and evaluation of complex interventions in palliative care, and how they may be used in palliative care research. the paper defines mixed methods and outlines why and how mixed methods are used to develop and evaluate complex interventions, with a pragmatic focus on design and data collection issues and data analysis. Useful texts are signposted and illustrative examples provided of mixed method studies in palliative care, including a detailed worked example of the development and evaluation of a complex intervention in palliative care for breathlessness. Key challenges to conducting mixed methods in palliative care research are identified in relation to data collection, data integration in analysis, costs and dissemination and how these might be addressed. the development and evaluation of complex interventions in palliative care benefit from the application of mixed methods. Mixed methods enable better understanding of whether and how an intervention works (or does not work) and inform the design of subsequent studies. However, they can be challenging: mixed method studies in palliative care will benefit from working with agreed protocols, multidisciplinary teams and engaging staff with appropriate skill sets.

  7. Development of a qualitative exploratory case study research method to explore sustained delivery of cognitive services.

    Science.gov (United States)

    Kaae, Susanne; Søndergaard, Birthe; Haugbølle, Lotte Stig; Traulsen, Janine Morgall

    2010-02-01

    To develop, apply and evaluate a new research method to establish relationships between structural and process elements of the provision of cognitive services. In-depth knowledge about how local organisational structural elements of community pharmacies shape the implementation process of cognitive services is needed to develop targeted quality assurance systems to ensure that the services are continuously provided to the patients who need them. The first publicly reimbursed cognitive service in Denmark, the Inhaler Technique Assessment Service (ITAS) is used as the case. The research method was developed at the Faculty of Pharmaceutical Sciences at the University of Copenhagen and later applied to seven community pharmacies geographically spread around Denmark. A pilot study as well as a subsequent literature review was conducted to determine which structure-process elements to focus on in the research method as well as to select appropriate theories and methods. The developed research method was a qualitative exploratory multi-case study, that was based on method triangulation of field observations, semi-structured interviews, group interviews as well as collection of documentary material. The three main themes of the research method were: the administration of tasks, leadership style and professional values. We integrated the organisational theories of Mintzberg, Bolman and Deal as well as Sørensen to support and clarify the data collection process and analyses. A cross-case analysis and an exploratory contextual analysis relating the leadership style of the pharmacy owner to the ITAS provision were applied to the collected data. The developed qualitative exploratory multi-case study research method was satisfactory with regard to achieving nuanced and in-depth results of some relationships between structural and process elements of provision of cognitive services. The research method can be considered an important supplement to the existing literature on the

  8. Developing content standards for teaching research skills using a delphi method

    NARCIS (Netherlands)

    Schaaf, M.F. van der; Stokking, K.M.; Verloop, N.

    2008-01-01

    The increased attention for teacher assessment and current educational reforms ask for procedures to develop adequate content standards. For the development of content standards on teaching research skills, a Delphi method based on stakeholders’ judgments has been designed and tested. In three round

  9. A case study on the design and development of minigames for research methods and statistics

    Directory of Open Access Journals (Sweden)

    P. Van Rosmalen

    2014-08-01

    Full Text Available Research methodology involves logical reasoning and critical thinking skills which are core competences in developing a more sophisticated understanding of the world. Acquiring expertise in research methods and statistics is not easy and poses a significant challenge for many students. The subject material is challenging because it is highly abstract and complex and requires the coordination of different but inter-related knowledge and skills that are all necessary to develop a coherent and usable skills base in this area. Additionally, while many students embrace research methods enthusiastically, others find the area dry, abstract and boring. In this paper we discuss the design and the first evaluation of a set of mini-games to practice research methods. Games are considered to be engaging and allow students to test out scenarios which provide concrete examples in a way that they typically only do once they are out in the field. The design of a game is a complex task. First, we describe how we used cognitive task analysis to identify the knowledge and competences required to develop a comprehensive and usable understanding of research methods. Next, we describe the games designed and how 4C-ID, an instructional design model, was used to underpin the games with a sound instructional design basis. Finally, the evaluation approach is discussed and how the findings of the first evaluation phase were used to improve the games.

  10. Developing a checklist for research proposals to help describe health service interventions in UK research programmes: a mixed methods study.

    Science.gov (United States)

    Dorling, Hannah; White, Donna; Turner, Sheila; Campbell, Kevin; Lamont, Tara

    2014-03-04

    One of the most common reasons for rejecting research proposals in the National Institute for Health Research (NIHR) Health Services and Delivery Research (HS&DR) Programme is the failure to adequately specify the intervention or context in research proposals. Examples of failed research proposals include projects to assess integrated care models, use of generic caseworkers, or new specialist nurse services. These are all important service developments which need evaluation, but the lack of clarity about the intervention and context prevented these research proposals from obtaining funding. The purpose of the research presented herein was to develop a checklist, with key service intervention and contextual features, for use by applicants to the NIHR HS&DR Programme to potentially enhance the quality of research proposals. The study used mixed methods to identify the need for and develop and test a checklist. Firstly, this included assessing existing checklists in peer-reviewed literature relevant to organisational health research. Building on existing work, a new checklist was piloted. Two reviewers used a small sample (n = 16) of research proposals to independently assess the relevance of the checklist to the proposal and the degree of overlap or gaps between the constructs. The next two stages externally validated the revised checklist by collecting qualitative feedback from researchers and experts in the field. The initial checklist was developed from existing checklists which included domains of intervention and context. The constructs and background to each were developed through review of existing literature. Eight researchers provided feedback on the checklist, which was generally positive. This iterative process resulted in changes to the checklist, collapsing two constructs and providing more prompts for others; the final checklist includes six constructs. Features relating to intervention and context should be well described to increase the quality of

  11. Research and development of fringe projection-based methods in 3D shape reconstruction

    Institute of Scientific and Technical Information of China (English)

    WU Lu-shen; PENG Qing-jin

    2006-01-01

    This paper discusses current research and development of fringe projection-based techniques. A system based on Fourier transform profilometry (FTP) is proposed for three-dimensional (3D) shape recovery. The system improves the method of phase unwrapping to gain accurate 3D shapes of objects. The method uses a region-growing algorithm for the path prediction guided by the quality map to increase the recovering accuracy and provides a fast and simple tool for 3D shape recovery. The shape measurement and data recovery are integrated to offer a new method of 3D modelling. Examples are presented to verify the feasibility of the proposed method.

  12. Developing a methodology to assess the impact of research grant funding: a mixed methods approach.

    Science.gov (United States)

    Bloch, Carter; Sørensen, Mads P; Graversen, Ebbe K; Schneider, Jesper W; Schmidt, Evanthia Kalpazidou; Aagaard, Kaare; Mejlgaard, Niels

    2014-04-01

    This paper discusses the development of a mixed methods approach to analyse research funding. Research policy has taken on an increasingly prominent role in the broader political scene, where research is seen as a critical factor in maintaining and improving growth, welfare and international competitiveness. This has motivated growing emphasis on the impacts of science funding, and how funding can best be designed to promote socio-economic progress. Meeting these demands for impact assessment involves a number of complex issues that are difficult to fully address in a single study or in the design of a single methodology. However, they point to some general principles that can be explored in methodological design. We draw on a recent evaluation of the impacts of research grant funding, discussing both key issues in developing a methodology for the analysis and subsequent results. The case of research grant funding, involving a complex mix of direct and intermediate effects that contribute to the overall impact of funding on research performance, illustrates the value of a mixed methods approach to provide a more robust and complete analysis of policy impacts. Reflections on the strengths and weaknesses of the methodology are used to examine refinements for future work.

  13. Interactive and Hands-on Methods for Professional Development of Undergraduate Researchers

    Science.gov (United States)

    Pressley, S. N.; LeBeau, J. E.

    2016-12-01

    Professional development workshops for undergraduate research programs can range from communicating science (i.e. oral, technical writing, poster presentations), applying for fellowships and scholarships, applying to graduate school, and learning about careers, among others. Novel methods of presenting the information on the above topics can result in positive outcomes beyond the obvious of transferring knowledge. Examples of innovative methods to present professional development information include 1) An interactive session on how to write an abstract where students are given an opportunity to draft an abstract from a short technical article, followed by discussion amongst a group of peers, and comparison with the "published" abstract. 2) Using the Process Oriented Guided Inquiry Learning (POGIL) method to evaluate and critique a research poster. 3) Inviting "experts" such as a Fulbright scholar graduate student to present on applying for fellowships and scholarships. These innovative methods of delivery provide more hands-on activities that engage the students, and in some cases (abstract writing) provide practice for the student. The methods also require that students develop team work skills, communicate amongst their peers, and develop networks with their cohort. All of these are essential non-technical skills needed for success in any career. Feedback from students on these sessions are positive and most importantly, the students walk out of the session with a smile on their face saying how much fun it was. Evaluating the impact of these sessions is more challenging and under investigation currently.

  14. Development of Implicit Methods in CFD NASA Ames Research Center 1970's - 1980's

    Science.gov (United States)

    Pulliam, Thomas H.

    2010-01-01

    The focus here is on the early development (mid 1970's-1980's) at NASA Ames Research Center of implicit methods in Computational Fluid Dynamics (CFD). A class of implicit finite difference schemes of the Beam and Warming approximate factorization type will be addressed. The emphasis will be on the Euler equations. A review of material pertinent to the solution of the Euler equations within the framework of implicit methods will be presented. The eigensystem of the equations will be used extensively in developing a framework for various methods applied to the Euler equations. The development and analysis of various aspects of this class of schemes will be given along with the motivations behind many of the choices. Various acceleration and efficiency modifications such as matrix reduction, diagonalization and flux split schemes will be presented.

  15. Formative research methods for designing culturally appropriate, integrated child nutrition and development interventions: an overview.

    Science.gov (United States)

    Bentley, Margaret E; Johnson, Susan L; Wasser, Heather; Creed-Kanashiro, Hilary; Shroff, Monal; Fernandez Rao, Sylvia; Cunningham, Melissa

    2014-01-01

    Nutritional and developmental insults in the first few years of life have profound public health implications, including substantial contributions to neonatal, infant, and early childhood morbidity and mortality, as well as longer term effects on cognitive development, school achievement, and worker productivity. Optimal development that can lead to the attainment of an individual's fullest potential, therefore, requires a combination of genetic capacity, adequate nutrition, psychosocial stimulation, and safe, clean physical environments. Researchers and policymakers have called for integrated child nutrition and development interventions for more than 20 years, yet there are only a handful of efficacy trials and even fewer examples of integrated interventions that have been taken to scale. While a critical component in the design of such interventions is formative research, there is a dearth of information in both the literature and policy arenas to guide this phase of the process. To move the field forward, this paper first provides an overview of formative research methods with a focus on qualitative inquiry, a description of the critical domains to be assessed (infant and young child feeding, responsive feeding, and child development), and currently available resources. Application of these methods is provided through a real-world case study--the design of an integrated nutrition and child development efficacy trial in Andhra Pradesh, India. Recommendations for next steps are discussed, the most important of which is the need for a comprehensive set of formative guidelines for designing locally tailored, culturally appropriate, integrated interventions.

  16. In situ methods for Li-ion battery research: A review of recent developments

    Science.gov (United States)

    Harks, P. P. R. M. L.; Mulder, F. M.; Notten, P. H. L.

    2015-08-01

    A considerable amount of research is being directed towards improving lithium-ion batteries in order to meet today's market demands. In particular in situ investigations of Li-ion batteries have proven extremely insightful, but require the electrochemical cell to be fully compatible with the conditions of the testing method and are therefore often challenging to execute. Advantageously, in the past few years significant progress has been made with new, more advanced, in situ techniques. Herein, a comprehensive overview of in situ methods for studying Li-ion batteries is given, with the emphasis on new developments and reported experimental highlights.

  17. Research Methods Teaching in Vocational Environments: Developing Critical Engagement with Knowledge?

    Science.gov (United States)

    Gray, C.; Turner, R.; Sutton, C.; Petersen, C.; Stevens, S.; Swain, J.; Esmond, B.; Schofield, C.; Thackeray, D.

    2015-01-01

    Knowledge of research methods is regarded as crucial for the UK economy and workforce. However, research methods teaching is viewed as a challenging area for lecturers and students. The pedagogy of research methods teaching within universities has been noted as underdeveloped, with undergraduate students regularly expressing negative dispositions…

  18. Research Methods Teaching in Vocational Environments: Developing Critical Engagement with Knowledge?

    Science.gov (United States)

    Gray, C.; Turner, R.; Sutton, C.; Petersen, C.; Stevens, S.; Swain, J.; Esmond, B.; Schofield, C.; Thackeray, D.

    2015-01-01

    Knowledge of research methods is regarded as crucial for the UK economy and workforce. However, research methods teaching is viewed as a challenging area for lecturers and students. The pedagogy of research methods teaching within universities has been noted as underdeveloped, with undergraduate students regularly expressing negative dispositions…

  19. Proposed Project Selection Method for Human Support Research and Technology Development (HSR&TD)

    Science.gov (United States)

    Jones, Harry

    2005-01-01

    The purpose of HSR&TD is to deliver human support technologies to the Exploration Systems Mission Directorate (ESMD) that will be selected for future missions. This requires identifying promising candidate technologies and advancing them in technology readiness until they are acceptable. HSR&TD must select an may of technology development projects, guide them, and either terminate or continue them, so as to maximize the resulting number of usable advanced human support technologies. This paper proposes an effective project scoring methodology to support managing the HSR&TD project portfolio. Researchers strongly disagree as to what are the best technology project selection methods, or even if there are any proven ones. Technology development is risky and outstanding achievements are rare and unpredictable. There is no simple formula for success. Organizations that are satisfied with their project selection approach typically use a mix of financial, strategic, and scoring methods in an open, established, explicit, formal process. This approach helps to build consensus and develop management insight. It encourages better project proposals by clarifying the desired project attributes. We propose a project scoring technique based on a method previously used in a federal laboratory and supported by recent research. Projects are ranked by their perceived relevance, risk, and return - a new 3 R's. Relevance is the degree to which the project objective supports the HSR&TD goal of developing usable advanced human support technologies. Risk is the estimated probability that the project will achieve its specific objective. Return is the reduction in mission life cycle cost obtained if the project is successful. If the project objective technology performs a new function with no current cost, its return is the estimated cash value of performing the new function. The proposed project selection scoring method includes definitions of the criteria, a project evaluation

  20. Mixed methods research.

    Science.gov (United States)

    Halcomb, Elizabeth; Hickman, Louise

    2015-04-08

    Mixed methods research involves the use of qualitative and quantitative data in a single research project. It represents an alternative methodological approach, combining qualitative and quantitative research approaches, which enables nurse researchers to explore complex phenomena in detail. This article provides a practical overview of mixed methods research and its application in nursing, to guide the novice researcher considering a mixed methods research project.

  1. Developing a method for comparing the elite sport systems and policies of nations: a mixed research methods approach

    NARCIS (Netherlands)

    de Bosscher, Veerle; Shibli, Simon; van Bottenburg, M.|info:eu-repo/dai/nl/114979189; de Knop, P.; Truyens, Jasper

    2010-01-01

    This article aims to make a contribution to comparative sport research and details a method for comparing nations’ elite sport systems less descriptively by measuring and comparing determinants of national competitiveness quantitatively. A mixed methods exploratory sequential design is used,

  2. Next Generation Nuclear Plant Methods Research and Development Technical Program Plan -- PLN-2498

    Energy Technology Data Exchange (ETDEWEB)

    Richard R. Schultz; Abderrafi M. Ougouag; David W. Nigg; Hans D. Gougar; Richard W. Johnson; William K. Terry; Chang H. Oh; Donald W. McEligot; Gary W. Johnsen; Glenn E. McCreery; Woo Y. Yoon; James W. Sterbentz; J. Steve Herring; Temitope A. Taiwo; Thomas Y. C. Wei; William D. Pointer; Won S. Yang; Michael T. Farmer; Hussein S. Khalil; Madeline A. Feltus

    2008-09-01

    One of the great challenges of designing and licensing the Very High Temperature Reactor (VHTR) is to confirm that the intended VHTR analysis tools can be used confidently to make decisions and to assure all that the reactor systems are safe and meet the performance objectives of the Generation IV Program. The research and development (R&D) projects defined in the Next Generation Nuclear Plant (NGNP) Design Methods Development and Validation Program will ensure that the tools used to perform the required calculations and analyses can be trusted. The Methods R&D tasks are designed to ensure that the calculational envelope of the tools used to analyze the VHTR reactor systems encompasses, or is larger than, the operational and transient envelope of the VHTR itself. The Methods R&D focuses on the development of tools to assess the neutronic and thermal fluid behavior of the plant. The fuel behavior and fission product transport models are discussed in the Advanced Gas Reactor (AGR) program plan. Various stress analysis and mechanical design tools will also need to be developed and validated and will ultimately also be included in the Methods R&D Program Plan. The calculational envelope of the neutronics and thermal-fluids software tools intended to be used on the NGNP is defined by the scenarios and phenomena that these tools can calculate with confidence. The software tools can only be used confidently when the results they produce have been shown to be in reasonable agreement with first-principle results, thought-problems, and data that describe the “highly ranked” phenomena inherent in all operational conditions and important accident scenarios for the VHTR.

  3. Developing Investigative Entry Points: Exploring the Use of Quantitative Methods in English Education Research

    Science.gov (United States)

    McGraner, Kristin L.; Robbins, Daniel

    2010-01-01

    Although many research questions in English education demand the use of qualitative methods, this paper will briefly explore how English education researchers and doctoral students may use statistics and quantitative methods to inform, complement, and/or deepen their inquiries. First, the authors will provide a general overview of the survey areas…

  4. Development of a Local Entomological Database for Education and Research using Simulation (Virtual Methods

    Directory of Open Access Journals (Sweden)

    Emad I. Khater

    2014-01-01

    Full Text Available Bioinformatics has been regarded as one of the rapidly-evolving fields with enormous impact on the history of life and biomedical sciences. It is an interdisciplinary science that integrates life sciences, mathematics and computer science in order to extract meaningful biological insights from large data sets of raw DNA and protein sequences. Our objective was the development of an entomogenomics database (provisionally named EntomDB for education and research in entomology (entomology is the science of insects. This DB includes DNA/protein sequence data selected from genomes of major insect models of importance in biology and biomedical research. EntomDB will represent a customized easy, interactive and self-learning resource tool for beginner users in poor-resource settings. This will enable the users to learn basic skills in bioinformatics and genomics, needlessly to search through the numerous databases currently available on the World-Wide Web with their complex interfaces and contents. EntomDB will help students and young researchers in studying the primary structure, splicing, and translation and predict function of different genes by using simple simulation methods. It is also designed to be adaptable to work off-line, in case no internet connection is available. EntomDB is primarily designed for entomology discipline; however, it can easily be adapted for other disciplines in life and biomedical sciences. EntomDB will have important educational and developmental outcomes in promoting bioinformatics learning in the developing world and provide affordable first-level training for advanced degree and research levels.

  5. The Value of Developing a Mixed-Methods Program of Research.

    Science.gov (United States)

    Simonovich, Shannon

    2017-07-01

    This article contributes to the discussion of the value of utilizing mixed methodological approaches to conduct nursing research. To this end, the author of this article proposes creating a mixed-methods program of research over time, where both quantitative and qualitative data are collected and analyzed simultaneously, rather than focusing efforts on designing singular mixed-methods studies. A mixed-methods program of research would allow for the best of both worlds: precision through focus on one method at a time, and the benefits of creating a robust understanding of a phenomenon over the trajectory of one's career through examination from various methodological approaches.

  6. Developing and refining the methods for a ‘one-stop shop’ for research evidence about health systems

    OpenAIRE

    Lavis, John N.; Wilson, Michael G; Moat, Kaelan A; Hammill, Amanda C; Boyko, Jennifer A; Grimshaw, Jeremy M; Flottorp, Signe

    2015-01-01

    Background: Policymakers, stakeholders and researchers have not been able to find research evidence about health systems using an easily understood taxonomy of topics, know when they have conducted a comprehensive search of the many types of research evidence relevant to them, or rapidly identify decision-relevant information in their search results. Methods: To address these gaps, we developed an approach to building a ‘one-stop shop’ for research evidence about health systems. We developed ...

  7. Exploring "Halaqah" as Research Method: A Tentative Approach to Developing Islamic Research Principles within a Critical "Indigenous" Framework

    Science.gov (United States)

    Ahmed, Farah

    2014-01-01

    This paper explores a traditional Islamic pedagogy known as "halaqah" as a potentially useful authentic research method and contributes to discourses about critical and indigenous research methodologies through an analysis of Islamization of Knowledge and other "critical indigenous" movements amongst Muslims. Islamic research…

  8. Exploring "Halaqah" as Research Method: A Tentative Approach to Developing Islamic Research Principles within a Critical "Indigenous" Framework

    Science.gov (United States)

    Ahmed, Farah

    2014-01-01

    This paper explores a traditional Islamic pedagogy known as "halaqah" as a potentially useful authentic research method and contributes to discourses about critical and indigenous research methodologies through an analysis of Islamization of Knowledge and other "critical indigenous" movements amongst Muslims. Islamic research…

  9. The Application of a Multiphase Triangulation Approach to Mixed Methods: The Research of an Aspiring School Principal Development Program

    Science.gov (United States)

    Youngs, Howard; Piggot-Irvine, Eileen

    2012-01-01

    Mixed methods research has emerged as a credible alternative to unitary research approaches. The authors show how a combination of a triangulation convergence model with a triangulation multilevel model was used to research an aspiring school principal development pilot program. The multilevel model is used to show the national and regional levels…

  10. The Application of a Multiphase Triangulation Approach to Mixed Methods: The Research of an Aspiring School Principal Development Program

    Science.gov (United States)

    Youngs, Howard; Piggot-Irvine, Eileen

    2012-01-01

    Mixed methods research has emerged as a credible alternative to unitary research approaches. The authors show how a combination of a triangulation convergence model with a triangulation multilevel model was used to research an aspiring school principal development pilot program. The multilevel model is used to show the national and regional levels…

  11. RESEARCH TOWARDS DEVELOPING METHODS FOR SELECTED PHARMACEUTICAL AND PERSONAL CARE PRODUCTS (PPCPS) ADAPTED FOR BIOSOLIDS

    Science.gov (United States)

    Development, standardization, and validation of analytical methods provides state-of-the-sciencetechniques to evaluate the presence, or absence, of select PPCPs in biosolids. This researchprovides the approaches, methods, and tools to assess the exposures and redu...

  12. Assessing the Development of Educational Research Literacy: The Effect of Courses on Research Methods in Studies of Educational Science

    Science.gov (United States)

    Groß Ophoff, Jana; Schladitz, Sandra; Leuders, Juliane; Leuders, Timo; Wirtz, Markus A.

    2015-01-01

    The ability to purposefully access, reflect, and use evidence from educational research (Educational Research Literacy) is expected of future professionals in educational practice. Based on the presented conceptual framework, a test instrument was developed to assess the different competency aspects: Information Literacy, Statistical Literacy, and…

  13. MORECare research methods guidance development: recommendations for ethical issues in palliative and end-of-life care research.

    Science.gov (United States)

    Gysels, Marjolein; Evans, Catherine J; Lewis, Penney; Speck, Peter; Benalia, Hamid; Preston, Nancy J; Grande, Gunn E; Short, Vicky; Owen-Jones, Eleanor; Todd, Chris J; Higginson, Irene J

    2013-12-01

    There is little guidance on the particular ethical concerns that research raises with a palliative care population. To present the process and outcomes of a workshop and consensus exercise on agreed best practice to accommodate ethical issues in research on palliative care. Consultation workshop using the MORECare Transparent Expert Consultation approach. Prior to workshops, participants were sent overviews of ethical issues in palliative care. Following the workshop, nominal group techniques were used to produce candidate recommendations. These were rated online by participating experts. Descriptive statistics were used to analyse agreement and consensus. Narrative comments were collated. Experts in ethical issues and palliative care research were invited to the Cicely Saunders Institute in London. They included senior researchers, service providers, commissioners, researchers, members of ethics committees and policy makers. The workshop comprised 28 participants. A total of 16 recommendations were developed. There was high agreement on the issue of research participation and high to moderate agreement on applications to research ethics committees. The recommendations on obtaining and maintaining consent from patients and families were the most contentious. Nine recommendations were refined on the basis of the comments from the online consultation. The culture surrounding palliative care research needs to change by fostering collaborative approaches between all those involved in the research process. Changes to the legal framework governing the research process are required to enhance the ethical conduct of research in palliative care. The recommendations are relevant to all areas of research involving vulnerable adults.

  14. The Development of a Self-Guided, Library-Based Materials and Methods Manual for Social Work Research.

    Science.gov (United States)

    Doelker, Richard E., Jr.; Toifel, Peggy

    1984-01-01

    This paper outlines process of developing self-guided, library-based materials and methods manual to complement social work research course taught at graduate and undergraduate levels. Selection of topic for research, identification of library reference resources, and development of reference material bibliography are covered. Formative evaluation…

  15. Accelerating what works: using qualitative research methods in developing a change package for a learning collaborative.

    Science.gov (United States)

    Sorensen, Asta V; Bernard, Shulamit L

    2012-02-01

    Learning (quality improvement) collaboratives are effective vehicles for driving coordinated organizational improvements. A central element of a learning collaborative is the change package-a catalogue of strategies, change concepts, and action steps that guide participants in their improvement efforts. Despite a vast literature describing learning collaboratives, little to no information is available on how the guiding strategies, change concepts, and action items are identified and developed to a replicable and actionable format that can be used to make measurable improvements within participating organizations. The process for developing the change package for the Health Resources and Services Administration's (HRSA) Patient Safety and Clinical Pharmacy Services Collaborative entailed environmental scan and identification of leading practices, case studies, interim debriefing meetings, data synthesis, and a technical expert panel meeting. Data synthesis involved end-of-day debriefings, systematic qualitative analyses, and the use of grounded theory and inductive data analysis techniques. This approach allowed systematic identification of innovative patient safety and clinical pharmacy practices that could be adopted in diverse environments. A case study approach enabled the research team to study practices in their natural environments. Use of grounded theory and inductive data analysis techniques enabled identification of strategies, change concepts, and actionable items that might not have been captured using different approaches. Use of systematic processes and qualitative methods in identification and translation of innovative practices can greatly accelerate the diffusion of innovations and practice improvements. This approach is effective whether or not an individual organization is part of a learning collaborative.

  16. Research circles: A method for the development of knowledge and the creation of change in practice

    Directory of Open Access Journals (Sweden)

    Sara Högdin

    2014-12-01

    Full Text Available This article contains a presentation of experiences gained of research circles as a participant-based method for the development of knowledge and the creation of change in practice. The starting point is two international projects whose aim is to develop knowledge about the professional work being done with young people who exhibit violent behavior. In the Swedish sub-studies, research circles are used as a method for developing such knowledge as well as for creating change in practice. The research circle as a method has its theoretical starting point in action research and participant-oriented research. The results of the study illustrate how research circles can contribute to the creation of a knowledge process through the dialogue in the group and the facilitation of reflection over different work approaches in one’s own work, even if it is a method that does not suit everyone. The results also show that the research circle can lead to a change process in the actual work by enhancing transprofessional collaboration and leading to an increase in the participants’ awareness and evaluation of their work with violent children and young people. Este artigo contém uma apresentação de experiências adquiridas com círculos de investigação como método participante capaz de gerar conhecimento e mudança de práticas. Dois projetos internacionais constituem o nosso ponto de partida, cujo objetivo foi o de produzir conhecimento sobre o trabalho profissional que está a ser feito com os jovens que apresentam comportamento violento. Nos sub-estudos suecos, os círculos de investigação são usados como um método para o desenvolvimento de tais conhecimentos, bem como para proporcionar mudança de práticas. O círculo de investigação como método tem o seu ponto de partida teórico na investigação-ação e na investigação participante. Os resultados do estudo demonstram como os círculos de investigação podem contribuir para a cria

  17. Development of a research method to measure insoluble and soluble starch in sugarcane factory and refinery products

    Science.gov (United States)

    A rapid, quantitative research method using microwave-assisted probe ultrasonication was developed to facilitate the determination of total insoluble, and soluble starch in various sugar factory and refinery products. Several variables that affect starch solubilization were evaluated: 1) conductiv...

  18. Benefits, Challenges, and Dynamism of Positionalities Associated with Mixed Methods Research in Developing Countries: Evidence from Ghana

    Science.gov (United States)

    Teye, Joseph Kofi

    2012-01-01

    Although mixed methods designs have gained visibility in recent years, most of the publications on this methodological strategy have been written by scholars in the developed world. Consequently, the practical challenges associated with mixed methods research in developing countries have not been adequately discussed in the literature. Relying on…

  19. A Drama Textbook with Sociodrama Method: Research and Development in Linguistic Education Study Program in Central Java

    Directory of Open Access Journals (Sweden)

    Evy Tri Widyahening

    2013-05-01

    Full Text Available This research was aimed to determine: (1 the quality of drama textbook which is used in Study Program of Language Education in Private Universities in Central Java; (2 how the development of drama textbook with sociodrama method; (3 the effectiveness of drama textbook with sociodrama method which have been developed by sociodrama.

  20. A Drama Textbook with Sociodrama Method: Research and Development in Linguistic Education Study Program in Central Java

    OpenAIRE

    Evy Tri Widyahening

    2013-01-01

    This research was aimed to determine: (1) the quality of drama textbook which is used in Study Program of Language Education in Private Universities in Central Java; (2) how the development of drama textbook with sociodrama method; (3) the effectiveness of drama textbook with sociodrama method which have been developed by sociodrama.

  1. Benefits, Challenges, and Dynamism of Positionalities Associated with Mixed Methods Research in Developing Countries: Evidence from Ghana

    Science.gov (United States)

    Teye, Joseph Kofi

    2012-01-01

    Although mixed methods designs have gained visibility in recent years, most of the publications on this methodological strategy have been written by scholars in the developed world. Consequently, the practical challenges associated with mixed methods research in developing countries have not been adequately discussed in the literature. Relying on…

  2. Development of Chemical Engineering Course Methods Using Action Research: Case Study

    Science.gov (United States)

    Virkki-Hatakka, Terhi; Tuunila, Ritva; Nurkka, Niina

    2013-01-01

    This paper reports on the systematic development of a teaching methodology for two chemical engineering courses. The aim was to improve the quality of teaching to achieve expected learning outcomes more effectively. The development was carried out over a period of several years based on an action research methodology with data systematically…

  3. The change and development of statistical methods used in research articles in child development 1930-2010.

    Science.gov (United States)

    Køppe, Simo; Dammeyer, Jesper

    2014-09-01

    The evolution of developmental psychology has been characterized by the use of different quantitative and qualitative methods and procedures. But how does the use of methods and procedures change over time? This study explores the change and development of statistical methods used in articles published in Child Development from 1930 to 2010. The methods used in every article in the first issue of every volume were categorized into four categories. Until 1980 relatively simple statistical methods were used. During the last 30 years there has been an explosive use of more advanced statistical methods employed. The absence of statistical methods or use of simple methods had been eliminated.

  4. Consumer Behavior Research Methods

    DEFF Research Database (Denmark)

    Chrysochou, Polymeros

    2017-01-01

    emphasizes the discussion of primary research methods. Based on the nature of the data primary research methods are further distinguished into qualitative and quantitative. The chapter describes the most important and popular qualitative and quantitative methods. It concludes with an overall evaluation......This chapter starts by distinguishing consumer behavior research methods based on the type of data used, being either secondary or primary. Most consumer behavior research studies phenomena that require researchers to enter the field and collect data on their own, and therefore the chapter...... of the methods and how to improve quality in consumer behavior research methods....

  5. Cooperative method development

    DEFF Research Database (Denmark)

    Dittrich, Yvonne; Rönkkö, Kari; Eriksson, Jeanette;

    2008-01-01

    research is not easily combined with the improvement orientation of an engineering discipline. During the last 6 years, we have applied an approach we call `cooperative method development', which combines qualitative social science fieldwork, with problem-oriented method, technique and process improvement....... The action research based approach focusing on shop floor software development practices allows an understanding of how contextual contingencies influence the deployment and applicability of methods, processes and techniques. This article summarizes the experiences and discusses the further development......The development of methods tools and process improvements is best to be based on the understanding of the development practice to be supported. Qualitative research has been proposed as a method for understanding the social and cooperative aspects of software development. However, qualitative...

  6. [Development and effects of emotional intelligence program for undergraduate nursing students: mixed methods research].

    Science.gov (United States)

    Lee, Oi Sun; Gu, Mee Ock

    2014-12-01

    This study was conducted to develop and test the effects of an emotional intelligence program for undergraduate nursing students. The study design was a mixed method research. Participants were 36 nursing students (intervention group: 17, control group: 19). The emotional intelligence program was provided for 4 weeks (8 sessions, 20 hours). Data were collected between August 6 and October 4, 2013. Quantitative data were analyzed using Chi-square, Fisher's exact test, t-test, repeated measure ANOVA, and paired t-test with SPSS/WIN 18.0. Qualitative data were analyzed using content analysis. Quantitative results showed that emotional intelligence, communication skills, resilience, stress coping strategy, and clinical competence were significantly better in the experimental group compared to the control group. According to the qualitative results, the nursing students experienced improvement in emotional intelligence, interpersonal relationships, and empowerment, as well as a reduction in clinical practice stress after participation in the emotional intelligence program. Study findings indicate that the emotional intelligence program for undergraduate nursing students is effective and can be recommended as an intervention for improving the clinical competence of undergraduate students in a nursing curriculum.

  7. Development of simulation code for MOX dissolution using silver-mediated electrochemical method (Contract research)

    Energy Technology Data Exchange (ETDEWEB)

    Kida, Takashi; Umeda, Miki; Sugikawa, Susumu [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment

    2003-03-01

    MOX dissolution using silver-mediated electrochemical method will be employed for the preparation of plutonium nitrate solution in the criticality safety experiments in the Nuclear Fuel Cycle Safety Engineering Research Facility (NUCEF). A simulation code for the MOX dissolution has been developed for the operating support. The present report describes the outline of the simulation code, a comparison with the experimental data and a parameter study on the MOX dissolution. The principle of this code is based on the Zundelevich's model for PuO{sub 2} dissolution using Ag(II). The influence of nitrous acid on the material balance of Ag(II) is taken into consideration and the surface area of MOX powder is evaluated by particle size distribution in this model. The comparison with experimental data was carried out to confirm the validity of this model. It was confirmed that the behavior of MOX dissolution could adequately be simulated using an appropriate MOX dissolution rate constant. It was found from the result of parameter studies that MOX particle size was major governing factor on the dissolution rate. (author)

  8. Recursive Frame Analysis: Reflections on the Development of a Qualitative Research Method

    Science.gov (United States)

    Keeney, Hillary; Keeney, Bradford

    2012-01-01

    The origin of recursive frame analysis (RFA) is revisited and discussed as a postmodern alternative to modernist therapeutic models and research methods that foster hegemony of a preferred therapeutic metaphor, narrative, or strategy. It encourages improvisational performance while enabling a means of scoring the change and movement of the…

  9. Graduate and research team develops new method for making optical fibers

    OpenAIRE

    Gilbert, Karen

    2006-01-01

    Nitin Goel, a graduate of the College of Engineering at Virginia Tech, along with a team of researchers, has discovered a new way to make optical fibers with compound glass cores. Called"core-suction," the method is ideal for producing the non-linear fibers required for fiber lasers, Raman amplifiers, and continuum generation.

  10. Wellbeing Research in Developing Countries: Reviewing the Role of Qualitative Methods

    Science.gov (United States)

    Camfield, Laura; Crivello, Gina; Woodhead, Martin

    2009-01-01

    The authors review the contribution of qualitative methods to exploring concepts and experiences of wellbeing among children and adults living in developing countries. They provide examples illustrating the potential of these methods for gaining a holistic and contextual understanding of people's perceptions and experiences. Some of these come…

  11. Wellbeing Research in Developing Countries: Reviewing the Role of Qualitative Methods

    Science.gov (United States)

    Camfield, Laura; Crivello, Gina; Woodhead, Martin

    2009-01-01

    The authors review the contribution of qualitative methods to exploring concepts and experiences of wellbeing among children and adults living in developing countries. They provide examples illustrating the potential of these methods for gaining a holistic and contextual understanding of people's perceptions and experiences. Some of these come…

  12. FODEM: A Multi-Threaded Research and Development Method for Educational Technology

    Science.gov (United States)

    Suhonen, Jarkko; de Villiers, M. Ruth; Sutinen, Erkki

    2012-01-01

    Formative development method (FODEM) is a multithreaded design approach that was originated to support the design and development of various types of educational technology innovations, such as learning tools, and online study programmes. The threaded and agile structure of the approach provides flexibility to the design process. Intensive…

  13. A case study on the design and development of mini-games for research methods and statistics

    NARCIS (Netherlands)

    Van Rosmalen, Peter; Boyle, Elizabeth; Van der Baaren, John; Kärki, Anne; Del Blanco Aguado, Ángel

    2014-01-01

    Research methodology involves logical reasoning and critical thinking skills which are core competences in developing a more sophisticated understanding of the world. Acquiring expertise in research methods and statistics is not easy and poses a significant challenge for many students. The subject m

  14. The Change and Development of Statistical Methods Used in Research Articles in Child Development 1930-2010

    DEFF Research Database (Denmark)

    Køppe, Simo; Dammeyer, Jesper Herup

    2014-01-01

    The evolution of developmental psychology has been characterized by the use of different quantitative and qualitative methods and procedures. But how does the use of methods and procedures change over time? This study explores the change and Development of statistical methods used in articles...... published in Child Development from 1930 to 2010. The methods used in every article in the first issue of every volume were categorized into four categories. Until 1980 relatively simple statistical methods were used. During the last 30 years there has been an explosive use of more advanced statistical...

  15. A Method for Recruiting Participants from Isolated Islands of Small Island Developing States (SIDS) for Survey Research

    Science.gov (United States)

    Moosa, Sheena; Koopman-Boyden, Peggy

    2016-01-01

    Representing isolated small island communities through social survey research continues to be challenging. We examine a locally developed method to reach and recruit older people (65+ years) for a survey on well-being in the small island developing state of Maldives. The use of messengers to recruit participants is examined in the context of these…

  16. Research Methods in Education

    Science.gov (United States)

    Check, Joseph; Schutt, Russell K.

    2011-01-01

    "Research Methods in Education" introduces research methods as an integrated set of techniques for investigating questions about the educational world. This lively, innovative text helps students connect technique and substance, appreciate the value of both qualitative and quantitative methodologies, and make ethical research decisions.…

  17. Research Methods in Education

    Science.gov (United States)

    Check, Joseph; Schutt, Russell K.

    2011-01-01

    "Research Methods in Education" introduces research methods as an integrated set of techniques for investigating questions about the educational world. This lively, innovative text helps students connect technique and substance, appreciate the value of both qualitative and quantitative methodologies, and make ethical research decisions.…

  18. Research on the statistics index system and evaluation method of high and new technology industry development

    Institute of Scientific and Technical Information of China (English)

    李晓东; 张霞

    2004-01-01

    During the evolution of the global economic, high and new technology industry has become the maindriver to impel the global economy growth via technological advancement, and the main means to guarantee the sustainable development of the global economy. In the view of China's situation, this article analyzes the experiences of OECD in high and new technology industry and gives a statistics index system along with the evaluation method to estimate the development of high and new technology industry.

  19. A method for addressing research gaps in HTA, developed whilst evaluating robotic-assisted surgery: a proposal

    Directory of Open Access Journals (Sweden)

    Ballini Luciana

    2010-09-01

    Full Text Available Abstract Background When evaluating health technologies with insufficient scientific evidence, only innovative potentials can be assessed. A Regional policy initiative linking the governance of health innovations to the development of clinical research has been launched by the Region of Emilia Romagna Healthcare Authority. This program, aimed at enhancing the research capacity of health organizations, encourages the development of adoption plans that combine use in clinical practice along with experimental use producing better knowledge. Following the launch of this program we developed and propose a method that, by evaluating and ranking scientific uncertainty, identifies the moment (during the stages of the technology's development where it would be sensible to invest in research resources and capacity to further its evaluation. The method was developed and tested during a research project evaluating robotic surgery. Methods A multidisciplinary panel carried out a 5-step evaluation process: 1 definition of the technology's evidence profile and of all relevant clinical outcomes; 2 systematic review of scientific literature and outline of the uncertainty profile differentiating research results into steady, plausible, uncertain and unknown results; 3 definition of the acceptable level of uncertainty for investing research resources; 4 analysis of local context; 5 identification of clinical indications with promising clinical return. Results Outputs for each step of the evaluation process are: 1 evidence profile of the technology and systematic review; 2 uncertainty profile for each clinical indication; 3 exclusion of clinical indications not fulfilling the criteria of maximum acceptable risk; 4 mapping of local context; 5 recommendations for research. Outputs of the evaluation process for robotic surgery are described in the paper. Conclusions This method attempts to rank levels of uncertainty in order to distinguish promising from hazardous

  20. Research Methods Tutorial

    Science.gov (United States)

    Aguilera, Frank J.

    2015-01-01

    A guiding principle for conducting research in technology, science, and engineering, leading to innovation is based on our use of research methodology (both qualitative and quantitative). A brief review of research methodology will be presented with an overview of NASA process in developing aeronautics technologies and other things to consider in research including what is innovation.

  1. Research Methods Tutorial

    Science.gov (United States)

    Aguilera, Frank J.

    2015-01-01

    A guiding principle for conducting research in technology, science, and engineering, leading to innovation is based on our use of research methodology (both qualitative and qualitative). A brief review of research methodology will be presented with an overview of NASA process in developing aeronautics technologies and other things to consider in research including what is innovation.

  2. Research on assessment methods for urban public transport development in China.

    Science.gov (United States)

    Zou, Linghong; Dai, Hongna; Yao, Enjian; Jiang, Tian; Guo, Hongwei

    2014-01-01

    In recent years, with the rapid increase in urban population, the urban travel demands in Chinese cities have been increasing dramatically. As a result, developing comprehensive urban transport systems becomes an inevitable choice to meet the growing urban travel demands. In urban transport systems, public transport plays the leading role to promote sustainable urban development. This paper aims to establish an assessment index system for the development level of urban public transport consisting of a target layer, a criterion layer, and an index layer. Review on existing literature shows that methods used in evaluating urban public transport structure are dominantly qualitative. To overcome this shortcoming, fuzzy mathematics method is used for describing qualitative issues quantitatively, and AHP (analytic hierarchy process) is used to quantify expert's subjective judgment. The assessment model is established based on the fuzzy AHP. The weight of each index is determined through the AHP and the degree of membership of each index through the fuzzy assessment method to obtain the fuzzy synthetic assessment matrix. Finally, a case study is conducted to verify the rationality and practicability of the assessment system and the proposed assessment method.

  3. Research on Assessment Methods for Urban Public Transport Development in China

    Directory of Open Access Journals (Sweden)

    Linghong Zou

    2014-01-01

    Full Text Available In recent years, with the rapid increase in urban population, the urban travel demands in Chinese cities have been increasing dramatically. As a result, developing comprehensive urban transport systems becomes an inevitable choice to meet the growing urban travel demands. In urban transport systems, public transport plays the leading role to promote sustainable urban development. This paper aims to establish an assessment index system for the development level of urban public transport consisting of a target layer, a criterion layer, and an index layer. Review on existing literature shows that methods used in evaluating urban public transport structure are dominantly qualitative. To overcome this shortcoming, fuzzy mathematics method is used for describing qualitative issues quantitatively, and AHP (analytic hierarchy process is used to quantify expert’s subjective judgment. The assessment model is established based on the fuzzy AHP. The weight of each index is determined through the AHP and the degree of membership of each index through the fuzzy assessment method to obtain the fuzzy synthetic assessment matrix. Finally, a case study is conducted to verify the rationality and practicability of the assessment system and the proposed assessment method.

  4. Phenomenographic Research Method

    Directory of Open Access Journals (Sweden)

    Erdem ÇEKMEZ

    2012-12-01

    Full Text Available Phenomenography, an approach to educational research, emerged from the studies carried out by Ference Marton and his colleagues at the University of Göteborg, Sweden, in the early 1970s. Phenomenography is the empirical study of the different ways in which people experience, perceive, apprehend, understand, conceptualize various phenomena in the world around them. Not only this method has been used much in educational researches in Turkey, but also the books about research methods do not provide detailed information about this method in details. This study explains the aim, characteristics, historical background and how to ensure the generalization, validity and reliability of phenomenographic research outcomes, besides mentions to the studies in which phenomenographic research method was used. In addition, the differences and similarities between this method and methods similar to phenomenology are explained.

  5. THE ACTION RESEARCH METHOD

    Directory of Open Access Journals (Sweden)

    Petre GEORGIEVSKI

    1999-05-01

    Full Text Available The effort in this work to elaborate an action research method as a central research problem considering the recent contemporary sociological and educa­tional literature. The author begins with the statement that the method is a complex notion, composed of three main components: approach to the research problem, data gathering procedures and data analysis procedures. This point of view is further applied and elaborated in the author's text, emphasizing the action research characteristics: interruption with the positive tradition in social research and the divided of the objective and subjective, application of the qualitative data. The sub­stantial difference between the action research in regard with the other kinds of research, is not only in getting to new knowledge's, but also in problem solving or a change in the situation in a concrete social context.

  6. The World through Glass: Developing Novel Methods with Wearable Computing for Urban Videographic Research

    Science.gov (United States)

    Paterson, Mark; Glass, Michael R.

    2015-01-01

    Google Glass was deployed in an Urban Studies field course to gather videographic data for team-based student research projects. We evaluate the potential for wearable computing technology such as Glass, in combination with other mobile computing devices, to enhance reflexive research skills, and videography in particular, during field research.…

  7. The World through Glass: Developing Novel Methods with Wearable Computing for Urban Videographic Research

    Science.gov (United States)

    Paterson, Mark; Glass, Michael R.

    2015-01-01

    Google Glass was deployed in an Urban Studies field course to gather videographic data for team-based student research projects. We evaluate the potential for wearable computing technology such as Glass, in combination with other mobile computing devices, to enhance reflexive research skills, and videography in particular, during field research.…

  8. Theory Emergence in IS Research: The Grounded Theory Method Applied : 10. JAIS Theory Development Workshop

    NARCIS (Netherlands)

    Olbrich, Sebastian; Mueller, Benjamin; Niederman, Fred

    2011-01-01

    Where IS research aims at theory building and testing, the vast bulk of theory is borrowed from reference disciplines. While this provides some momentum for research output, it also tends to shift the focus of research away from direct observation of central, core IS issues. The purpose of this pape

  9. Research developments in methods to reduce the carbon footprint of the food system: a review.

    Science.gov (United States)

    Xu, Zhongyue; Sun, Da-Wen; Zeng, Xin-An; Liu, Dan; Pu, Hongbin

    2015-01-01

    Global warming is a worldwide issue with its evident impact across a wide range of systems and sectors. It is caused by a number of greenhouse gases (GHGs) emissions, in which food system has made up of a large part. Recently, reduction of GHG emissions has become an urgent issue to be resolved in the food system. Many governments and organizations are making great endeavors to alleviate the adverse effect of this phenomenon. In this review, methods to reduce the carbon footprint within the life cycle of a food system are presented from the technical, consumption behavior and environmental policies perspectives. The whole food system including raw material acquisition, processing, packaging, preservation, transportation, consumption, and disposal are covered. Improving management techniques, and adopting advanced technology and equipment are critical for every stage of a food system. Rational site selection is important to alleviate the influence of land use change. In addition, environmental choices of packaging stage, reduction in refrigeration dependence, and correct waste treatment are essential to reduce the total carbon footprint of the production. However, only technical methods cannot radically reverse the trend of climate change, as consumption behaviors present a great deal of influence over climate change. Appropriate purchase patterns and substitution within food product categories by low carbon products can reduce GHG emissions. Development of methods to calculate the carbon footprint of every kind of food and its processing technology enable people to make environmental choice. Policy can shape and cultivate the new code of consumption and influence the direction of emerging technology and science. From political perspectives, government intervention and carbon offset are common tools, especially for carbon tax and a real or implicit price of carbon. Finally, by mitigating the methodologies described above, the rate and magnitude of climate changes

  10. RESEARCH AND DEVELOPMENT CONTROL METHOD PATHOGENIC PRION INFECTIONS SECONDARY RAW MEAT INDUSTRY

    Directory of Open Access Journals (Sweden)

    A. Y. Prosekov

    2016-01-01

    Full Text Available Highly sensitive and specific method for identification of pathogenic prion protein was developed. It was found that the water-soluble fractions of beef proteins and plasma proteins of farm animals are normal prion proteins in cattle. Aligning gene sequences of pathogenic and normal prion protein of sheep (Ovis aries revealed that the nucleotide sequences of PrPc and PrPsc are identical. Murine monoclonal antibody 15B3 was selected. Synthetic sequence of 194 bps was randomly produced (DNA-tail. The produced sequence and the database sequences have no homologues. Two primer of20 bps were selected for synthesized DNA-tail. The experimental data indicate that by using AGTCAGTCCTTGGCCTCCTT (left and CAGTTTCGATCCTCCTCCAG (right primers the amplification should be performed as follows: pre-denaturation, 95 °C, 60 seconds, 1 cycle; denaturation, 95 °C, 30 seconds, 30 cycles; annealing, 56 °C, 60 seconds, 30 cycles; elongation, 72 °C, 30 seconds, 30 cycles, additional elongation, 1 cycle, 600 seconds. The optimum concentration of reaction mixture components for PCR was established. High specificity of the developed test system and oligonucleotide primers was confirmed by electrophoretic separation of ground beef samples containing  pathogenic prion protein, as well as by comparative analysis of the results of pathogenic prion protein determination. These results were obtained using PCR test system and TeSeE™ ELISA system.

  11. Validation of the Benefit Forecasting Method: Organization Development Program to Increase Health Organization Membership. Training and Development Research Center, Project Number Eleven.

    Science.gov (United States)

    Sleezer, Catherine M.; And Others

    This project is the sixth in a series of studies designed to validate the Training and Development Benefit Forecasting Method (BFM) sponsored by the Training and Development Research Center (TDRC) at the University of Minnesota. The purpose of this study was to validate the BFM's ability to forecast the benefits of an organization development…

  12. Engaging Adolescents Through Participatory and Qualitative Research Methods to Develop a Digital Communication Intervention to Reduce Adolescent Obesity.

    Science.gov (United States)

    Livingood, William C; Monticalvo, David; Bernhardt, Jay M; Wells, Kelli T; Harris, Todd; Kee, Kadra; Hayes, Johnathan; George, Donald; Woodhouse, Lynn D

    2016-11-02

    Background The complexity of the childhood obesity epidemic requires the application of community-based participatory research (CBPR) in a manner that can transcend multiple communities of stakeholders, including youth, the broader community, and the community of health care providers. Aim To (a) describe participatory processes for engaging youth within context of CBPR and broader community, (b) share youth-engaged research findings related to the use of digital communication and implications for adolescent obesity intervention research, and (c) describe and discuss lessons learned from participatory approaches. Method CBPR principles and qualitative methods were synergistically applied in a predominantly African American part of the city that experiences major obesity-related issues. A Youth Research Advisory Board was developed to deeply engage youth in research that was integrated with other community-based efforts, including an academic-community partnership, a city-wide obesity coalition, and a primary care practice research network. Volunteers from the youth board were trained to apply qualitative methods, including facilitating focus group interviews and analyzing and interpreting data with the goal of informing a primary care provider-based obesity reduction intervention. Results The primary results of these efforts were the development of critical insights about adolescent use of digital communication and the potential importance of messaging, mobile and computer apps, gaming, wearable technology, and rapid changes in youth communication and use of digital technology in developing adolescent nutrition and physical activity health promotion. Conclusions The youth led work helped identify key elements for a digital communication intervention that was sensitive and responsive to urban youth. Many valuable lessons were also learned from 3 years of partnerships and collaborations, providing important insights on applying CBPR with minority youth populations.

  13. The development and application of k -standardization method of neutron activation analysis at Es-Salam research reactor

    Energy Technology Data Exchange (ETDEWEB)

    Alghem, L. [Departement d' Analyse par Activation Neutronique, CRNB, BP 180, Ain Oussera 17200, W Djelfa (Algeria)]. E-mail: lylia_25@hotmail.com; Ramdhane, M. [Departement de physique, Universite Mentouri de Constantine (Algeria); Khaled, S. [Departement d' Analyse par Activation Neutronique, CRNB, BP 180, Ain Oussera 17200, W Djelfa (Algeria); Akhal, T. [Departement d' Analyse par Activation Neutronique, CRNB, BP 180, Ain Oussera 17200, W Djelfa (Algeria)

    2006-01-01

    In recent years the k -NAA method has been applied and developed at the 15 MW Es-Salam research reactor, which includes: (1) the detection efficiency calibration of {gamma}-spectrometer used in k -NAA (2) the determination of reactor neutron spectrum parameters such as {alpha} and f factors in the irradiation channel, and (3) the validation of the developed k -NAA procedure by analysing SRM, namely AIEA-Soil7 and CRM, namely IGGE-GSV4. The analysis results obtained by k -NAA with 27 elements of Soil-7 standard and 14 elements of GSV-4 standard were compared with certified values. The analysis results showed that the deviations between experimental and certified values were mostly less than 10%. The k -NAA procedure established at Es-Salam research reactor has been regarded as a reliable standardization method of NAA and as available for practical applications.

  14. Research methods in information

    CERN Document Server

    Pickard, Alison Jane

    2013-01-01

    The long-awaited 2nd edition of this best-selling research methods handbook is fully updated and includes brand new coverage of online research methods and techniques, mixed methodology and qualitative analysis. There is an entire chapter contributed by Professor Julie McLeod, Sue Childs and Elizabeth Lomas focusing on research data management, applying evidence from the recent JISC funded 'DATUM' project. The first to focus entirely on the needs of the information and communications community, it guides the would-be researcher through the variety of possibilities open to them under the heading "research" and provides students with the confidence to embark on their dissertations. The focus here is on the 'doing' and although the philosophy and theory of research is explored to provide context, this is essentially a practical exploration of the whole research process with each chapter fully supported by examples and exercises tried and tested over a whole teaching career. The book will take readers through eac...

  15. 75 FR 51039 - Office of Research and Development; Ambient Air Monitoring Reference and Equivalent Methods...

    Science.gov (United States)

    2010-08-18

    ...: Designation of Two New Equivalent Methods AGENCY: Environmental Protection Agency. ACTION: Notice of the designation of two new equivalent methods for monitoring ambient air quality. SUMMARY: Notice is hereby given that the Environmental Protection Agency (EPA) has designated, in accordance with 40 CFR Part 53, two...

  16. Development of a Self-Rated Mixed Methods Skills Assessment: The National Institutes of Health Mixed Methods Research Training Program for the Health Sciences.

    Science.gov (United States)

    Guetterman, Timothy C; Creswell, John W; Wittink, Marsha; Barg, Fran K; Castro, Felipe G; Dahlberg, Britt; Watkins, Daphne C; Deutsch, Charles; Gallo, Joseph J

    2017-01-01

    Demand for training in mixed methods is high, with little research on faculty development or assessment in mixed methods. We describe the development of a self-rated mixed methods skills assessment and provide validity evidence. The instrument taps six research domains: "Research question," "Design/approach," "Sampling," "Data collection," "Analysis," and "Dissemination." Respondents are asked to rate their ability to define or explain concepts of mixed methods under each domain, their ability to apply the concepts to problems, and the extent to which they need to improve. We administered the questionnaire to 145 faculty and students using an internet survey. We analyzed descriptive statistics and performance characteristics of the questionnaire using the Cronbach alpha to assess reliability and an analysis of variance that compared a mixed methods experience index with assessment scores to assess criterion relatedness. Internal consistency reliability was high for the total set of items (0.95) and adequate (≥0.71) for all but one subscale. Consistent with establishing criterion validity, respondents who had more professional experiences with mixed methods (eg, published a mixed methods article) rated themselves as more skilled, which was statistically significant across the research domains. This self-rated mixed methods assessment instrument may be a useful tool to assess skills in mixed methods for training programs. It can be applied widely at the graduate and faculty level. For the learner, assessment may lead to enhanced motivation to learn and training focused on self-identified needs. For faculty, the assessment may improve curriculum and course content planning.

  17. Ergonomics research methods

    Science.gov (United States)

    Uspenskiy, S. I.; Yermakova, S. V.; Chaynova, L. D.; Mitkin, A. A.; Gushcheva, T. M.; Strelkov, Y. K.; Tsvetkova, N. F.

    1973-01-01

    Various factors used in ergonomic research are given. They are: (1) anthrometric measurement, (2) polyeffector method of assessing the functional state of man, (3) galvanic skin reaction, (4) pneumography, (5) electromyography, (6) electrooculography, and (7) tachestoscopy. A brief summary is given of each factor and includes instrumentation and results.

  18. Research Methods in Sociolinguistics

    Science.gov (United States)

    Hernández-Campoy, Juan Manuel

    2014-01-01

    The development of Sociolinguistics has been qualitatively and quantitatively outstanding within Linguistic Science since its beginning in the 1950s, with a steady growth in both theoretical and methodological developments as well as in its interdisciplinary directions within the spectrum of language and society. Field methods in sociolinguistic…

  19. Research Methods in Sociolinguistics

    Science.gov (United States)

    Hernández-Campoy, Juan Manuel

    2014-01-01

    The development of Sociolinguistics has been qualitatively and quantitatively outstanding within Linguistic Science since its beginning in the 1950s, with a steady growth in both theoretical and methodological developments as well as in its interdisciplinary directions within the spectrum of language and society. Field methods in sociolinguistic…

  20. Method selection in adaptation research

    NARCIS (Netherlands)

    Werners, Saskia Elisabeth; Loon-Steensma, van Jantsje Mintsje; Oost, Albert Peter

    2016-01-01

    Many methods are available to support adaptation planning. Yet there is little guidance on their selection. A recently developed diagnostic framework offers a structured set of criteria to choose research methods for specific adaptation questions. It has been derived from science-driven cases mos

  1. Methods in mummy research

    DEFF Research Database (Denmark)

    Lynnerup, Niels

    2009-01-01

    Mummies are human remains with preservation of non-bony tissue. Many mummy studies focus on the development and application of non-destructive methods for examining mummies, including radiography, CT-scanning with advanced 3-dimensional visualisations, and endoscopic techniques, as well as minima......Mummies are human remains with preservation of non-bony tissue. Many mummy studies focus on the development and application of non-destructive methods for examining mummies, including radiography, CT-scanning with advanced 3-dimensional visualisations, and endoscopic techniques, as well...... as minimally-destructive chemical, physical and biological methods for, e.g., stable isotopes, trace metals and DNA....

  2. MIXED METHOD RESEARCH

    Directory of Open Access Journals (Sweden)

    Masrizal Masrizal

    2012-03-01

    Full Text Available Mixed Method Research adalah metode penelitian yang diaplikasikan bila peneliti memiliki pertanyaan yang perlu diuji dari segi outcomes dan prosesnya, serta menyangkut kombinasi antara metode kuantitatif dan kualitatif dalam satu penelitian. Karena berfokus pada outcomes dan proses, maka desain MMR biasa digunakan dalam penelitian evaluasi program. Namun sekarang, MMR sudah sering digunakan untuk ilmu-ilmu sosial, seperti: konseling, psikologi social manajemen, dan pengorganisasian perilaku.

  3. MIXED METHOD RESEARCH

    OpenAIRE

    Masrizal Masrizal

    2012-01-01

    Mixed Method Research adalah metode penelitian yang diaplikasikan bila peneliti memiliki pertanyaan yang perlu diuji dari segi outcomes dan prosesnya, serta menyangkut kombinasi antara metode kuantitatif dan kualitatif dalam satu penelitian. Karena berfokus pada outcomes dan proses, maka desain MMR biasa digunakan dalam penelitian evaluasi program. Namun sekarang, MMR sudah sering digunakan untuk ilmu-ilmu sosial, seperti: konseling, psikologi social manajemen, dan pengorganisasian perilaku.

  4. Social Phenomenological Analysis as a Research Method in Art Education: Developing an Empirical Model for Understanding Gallery Talks

    Science.gov (United States)

    Hofmann, Fabian

    2016-01-01

    Social phenomenological analysis is presented as a research method to study gallery talks or guided tours in art museums. The research method is based on the philosophical considerations of Edmund Husserl and sociological/social science concepts put forward by Max Weber and Alfred Schuetz. Its starting point is the everyday lifeworld; the…

  5. Mixed methods research for TESOL

    CERN Document Server

    Brown, James; Farr, Fiona

    2014-01-01

    Defining and discussing the relevance of theoretical and practical issues involved in mixed methods research. Covering the basics of research methodology, this textbook shows you how to choose and combine quantitative and qualitative research methods to b

  6. SKUTHI: Developing a tablet-based survey technology and its application in teaching research methods in social sciences

    Directory of Open Access Journals (Sweden)

    Ridvan Peshkopia

    2014-08-01

    Full Text Available Digital tablets and smartphones are increasingly becoming part of the daily life of people and a must in professional developments in so many disciplines. The dependence on internet availability of current tabled-based technologies prevents successful public polling in areas where there is no internet connection. In order to overcome those restrictions we have developed the Skuthi platform for android tablets and smartphones. Skuthi allows the selection of convenient samples on android tablets independent to internet connection. Moreover, Skuthi enables probability samples by polling the public via cellphones by using a random digit dealing (RDD technique, and also filling the questionnaire on the same smartphone from where the interviewer is calling. The multifunctional potentials of Skuthi offer opportunities for its successful application in both developed and developing countries in a wide variety of survey setting. We are implementing Skuthi as a medium of public polling with students from our Research Methods courses as part of their fieldwork requirement for the course. The ability of today’s students to navigate smartphones and digital tablets facilitates such an application and produces enjoyable and productive learning experiences.

  7. Ecoregional research for development

    NARCIS (Netherlands)

    Bouma, J.; Stoorvogel, J.J.; Quiroz, R.; Staal, S.; Herrero, M.; Immerzeel, W.; Roetter, R.P.; Bosch, van den H.; Sterk, G.; Rabbinge, R.; Chater, S.

    2007-01-01

    This chapter focuses on the subject of ecoregional research for development. The character of international agricultural research has changed profoundly in the last decades of the twentieth century. This can be illustrated by developments within the Consultative Group on International Agricultural

  8. Mixed methods research in music therapy research.

    Science.gov (United States)

    Bradt, Joke; Burns, Debra S; Creswell, John W

    2013-01-01

    Music therapists have an ethical and professional responsibility to provide the highest quality care possible to their patients. Much of the time, high quality care is guided by evidence-based practice standards that integrate the most current, available research in making decisions. Accordingly, music therapists need research that integrates multiple ways of knowing and forms of evidence. Mixed methods research holds great promise for facilitating such integration. At this time, there have not been any methodological articles published on mixed methods research in music therapy. The purpose of this article is to introduce mixed methods research as an approach to address research questions relevant to music therapy practice. This article describes the core characteristics of mixed methods research, considers paradigmatic issues related to this research approach, articulates major challenges in conducting mixed methods research, illustrates four basic designs, and provides criteria for evaluating the quality of mixed methods articles using examples of mixed methods research from the music therapy literature. Mixed methods research offers unique opportunities for strengthening the evidence base in music therapy. Recommendations are provided to ensure rigorous implementation of this research approach.

  9. Mixed methods research for the novice researcher.

    Science.gov (United States)

    Giddings, Lynne S; Grant, Barbara M

    2006-10-01

    Mixed methods research is becoming increasingly popular in the health and social science disciplines. The aim of this article is to give an overview of the varieties of mixed methods designs. We begin by situating mixed methods research in the context of a paradigmatic framework which assists a researcher in making decisions concerning the design of their study. Although the most commonly used mixed methods designs are underpinned by positivist/postpositivist assumptions, the combination of qualitative and quantitative methods can be used within any research paradigm.

  10. Mixed Method Research: An Overview

    Directory of Open Access Journals (Sweden)

    Dewan Mahboob HOSSAIN

    2012-12-01

    Full Text Available This article gives a general overview of mixed method research. In mixed method, the researchers combine both qualitative and quantitative approaches in a single research project. The article first attempts to define mixed method research. Then it gives a comparison of qualitative and quantitative approaches. It also introduces the well-known controversy among the researchers: which of these approaches is superior? By explaining this controversy, the article identifies the need for mixed method research. Lastly, the article describes the process of mixed method research.

  11. The DST method for solar domestic hot water systems - Research and development for ISO and CEN standards

    NARCIS (Netherlands)

    Visser, H.; Ree, B.G.C. van der

    1996-01-01

    The Dynamic System Test (DST) method for performance characterization of solar domestic hot water (SDHW) systems has been the subject of international research for a number of years. At present, several countries are using the method and it is being standardized on international and European levels.

  12. The Strategic Fitness Process: A Collaborative Action Research Method for Developing and Understanding Organizational Prototypes and Dynamic Capabilities

    Directory of Open Access Journals (Sweden)

    Michael Beer

    2013-04-01

    Full Text Available Organizations underperform and sometimes fail because their leaders are unable to learn the unvarnished truth from relevant stakeholders about how the design and behavior of the organization is misaligned with its goals and strategy. The Strategic Fitness Process (SFP was designed to enable leaders to overcome organizational silence about the misalignment with the environment and chosen strategy. By enabling an honest, organization-wide and public conversation, senior management teams, working collaboratively with scholar-consultants and organizational members, have access to valid data (the unvarnished truth, can conduct a valid diagnosis, and can develop a valid plan to change the structure, processes, and behavior of an organization while at the same time developing commitment that ensures execution. SFP is also a research method. By applying SFP iteratively to new and challenging situations, scholar-consultants can invent new organizational prototypes as well as learn if a standardized and institutionalized organizational learning process like SFP can enhance dynamic capabilities. The SFP model is illustrated with an application to Hewlett-Packard’s Santa Rosa Systems Division.

  13. LIDAR Research & Development Lab

    Data.gov (United States)

    Federal Laboratory Consortium — The LIDAR Research and Development labs are used to investigate and improve LIDAR components such as laser sources, optical signal detectors and optical filters. The...

  14. Transformative Mixed Methods Research

    Science.gov (United States)

    Mertens, Donna M.

    2010-01-01

    Paradigms serve as metaphysical frameworks that guide researchers in the identification and clarification of their beliefs with regard to ethics, reality, knowledge, and methodology. The transformative paradigm is explained and illustrated as a framework for researchers who place a priority on social justice and the furtherance of human rights.…

  15. Transformative Mixed Methods Research

    Science.gov (United States)

    Mertens, Donna M.

    2010-01-01

    Paradigms serve as metaphysical frameworks that guide researchers in the identification and clarification of their beliefs with regard to ethics, reality, knowledge, and methodology. The transformative paradigm is explained and illustrated as a framework for researchers who place a priority on social justice and the furtherance of human rights.…

  16. Mixed Method Research: An Overview

    OpenAIRE

    Hossain, Dewan Mahboob

    2012-01-01

    This article gives a general overview of mixed method research. In mixed method, the researchers combine both qualitative and quantitative approaches in a single research project. The article first attempts to define mixed method research. Then it gives a comparison of qualitative and quantitative approaches. It also introduces the well-known controversy among the researchers: which of these approaches is superior? By explaining this controversy, the article identifies the need for mixed meth...

  17. Mixed Method Research: An Overview

    OpenAIRE

    Hossain, Dewan Mahboob

    2012-01-01

    This article gives a general overview of mixed method research. In mixed method, the researchers combine both qualitative and quantitative approaches in a single research project. The article first attempts to define mixed method research. Then it gives a comparison of qualitative and quantitative approaches. It also introduces the well-known controversy among the researchers: which of these approaches is superior? By explaining this controversy, the article identifies the need for mixed meth...

  18. Space biology research development

    Science.gov (United States)

    Bonting, Sjoerd L.

    1993-01-01

    The purpose of the Search for Extraterrestrial Intelligence (SETI) Institute is to conduct and promote research related activities regarding the search for extraterrestrial life, particularly intelligent life. Such research encompasses the broad discipline of 'Life in the Universe', including all scientific and technological aspects of astronomy and the planetary sciences, chemical evolution, the origin of life, biological evolution, and cultural evolution. The primary purpose was to provide funding for the Principal Investigator to collaborate with the personnel of the SETI Institute and the NASA-Ames Research center in order to plan and develop space biology research on and in connection with Space Station Freedom; to promote cooperation with the international partners in the space station; to conduct a study on the use of biosensors in space biology research and life support system operation; and to promote space biology research through the initiation of an annual publication 'Advances in Space Biology and Medicine'.

  19. A Research into the Evaluation Target System and Comprehensive Evaluation Method About the Science and Technology Development of Provinces

    Institute of Scientific and Technical Information of China (English)

    WU Ci-sheng; WANG Min; LI Xing-guo

    2001-01-01

    Based on the systematic theory and the system analytic method, this thesis expounds manifestly the evaluation target system and comprehensive evaluation method about the science and technology development of provinces (cities and districts). By putting it into practice of provinces (cities and districts) science and technology development, this set of target system and method may fully reflect the impact on the social development. The acceleration of transferring the extensive economy to the intensive one in province (cities and districts) and the relation of coordinated growth of science and technology, economy, society are of momentous current significance.

  20. 2008 Research Portfolio: Research & Development Division

    Science.gov (United States)

    Educational Testing Service, 2008

    2008-01-01

    This document describes the breadth of the research being conducted in 2008 by the Research and Development Division at Educational Testing Service (ETS). The research described falls into three large categories: (1) Research supported by the ETS research allocation; (2) Research funded by testing programs at ETS; and (3) Research funded by…

  1. Teaching Sociological Research Methods to Medical Students.

    Science.gov (United States)

    Gregory, Stanford W.; O'Toole, Richard

    1987-01-01

    Reports the development of a three-course eight-week summer program for medical students. One course covers research methods and the other two involve research practicums in public health and medical sociology. (JDH)

  2. RD and D-Programme 2004. Programme for research, development and demonstration of methods for the management and disposal of nuclear waste, including social science research

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2004-09-01

    SKB (the Swedish Nuclear Fuel and Waste Management Co), which is owned by the companies that operate the Swedish nuclear power plants, has been assigned the task of managing and disposing of the spent nuclear fuel from the reactors. The Nuclear Activities Act requires a programme of comprehensive research and development and other measures that are needed to manage and dispose of nuclear waste in a safe manner and to decommission and dismantle the nuclear power plants. SKB is now presenting RD and D-Programme 2004 in fulfilment of this requirement. The programme describes SKB's plans for the period 2005-2010. The period of immediate concern is 2005-2007. The level of detail for the three subsequent years is naturally lower.The programme provides a basis for designing systems for safe management and disposal of the radioactive waste from the nuclear power plants. SKB's plan is to implement deep disposal of the spent fuel in accordance with the KBS-3 method. In the RD and D-Programme we describe our activities and planning for this line of action and the work that is being conducted on alternative methods. Review of the programme can contribute valuable outside viewpoints. The regulatory authorities and the Government can clarify how they look upon different parts of the programme and stipulate guidelines for the future. Municipalities and other stakeholders can, after studying the programme, offer their viewpoints to SKB, the regulatory authorities or the Government.The goal for the period up to the end of 2008 is to be able to submit permit applications for the encapsulation plant and the deep repository. This RD and D-Programme therefore differs from the preceding ones in that it concentrates on questions relating to technology development for these facilities. The programmes for safety assessment and research on the long-term processes that take place in the deep repository are then linked together with the programmes for technology development. Another

  3. Consumer research in the early stages of new product development: A critical review of methods and techniques

    NARCIS (Netherlands)

    Kleef, van E.; Trijp, van J.C.M.; Luning, P.A.

    2005-01-01

    Incorporating the `voice of the consumer' in early stages of the new product development process has been identified as a critical success factor for new product development. Yet, this step is often ignored or poorly executed. This may be due to lack of familiarity on which methods are available, th

  4. Research and Development Program in Reactor Diagnostics and Monitoring with Neutron Noise Methods. Stage 11 and 12. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Sunde, C.; Pazsit, I.; Demaziere, C.; Dahl, O.; Mileshina, L. [Chalmers Univ. of Technology, Goeteborg (Sweden). Dept. of Nuclear Engineering

    2006-06-15

    This report describes the results obtained during Stage 11 and 12 of a long-term research and development program concerning the development of diagnostics and monitoring methods for nuclear reactors. The long-term goals are elaborated in more detail in e.g. the Final Reports of stage 1 and 2 (SKI Report 95:14 and 96:50). Higher order eigenfunctions and eigenvalues of the diffusion equation, describing a static core, have lost their significance when doing calculations in realistic systems, since there are usually made by nodal methods or other direct numerical techniques. However, there are situations when knowledge of the higher order modes is still useful. Such case is the separation of the global and regional flux oscillations in the case of BWR instability. Another case is the investigation of the stability properties of large inhomogeneous cores, which is usually quantified with the so-called eigenvalue separation, ES=1/k{sub 1} - 1/k{sub 0} where k{sub 0} and k{sub 1}, are the fundamental and first higher order eigenvalues, respectively. Numerical codes used for ICMF calculations usually do not have the option of calculating the higher order eigenvalues and eigenfunctions. In idealised systems, these can be calculated with semi-analytical methods. In order to get insight into the characteristics of the higher order eigenmodes of the neutron flux and the adjoint, these were calculated in a reflected homogeneous system with two-group theory. The adjoint eigenmodes are necessary if an orthogonality property needs to be used, such as the separation of the modes from a flux shape which is a sum of several eigenmodes. At the same time, the so-called numerical noise simulator, developed at the Dept., was extended such that it became suitable for the calculation of the higher order eigenmodes, both direct and adjoint ones. This simulator can treat real inhomogeneous cores, with an input deck compatible with that of SIMULATE. The simulator was used to calculate the

  5. Method Engineering: Engineering of Information Systems Development Methods and Tools

    NARCIS (Netherlands)

    Brinkkemper, J.N.; Brinkkemper, Sjaak

    1996-01-01

    This paper proposes the term method engineering for the research field of the construction of information systems development methods and tools. Some research issues in method engineering are identified. One major research topic in method engineering is discussed in depth: situational methods, i.e.

  6. Development of quantitative structure activity relationship (QSAR) model for disinfection byproduct (DBP) research: A review of methods and resources

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Baiyang, E-mail: poplar_chen@hotmail.com [Harbin Institute of Technology Shenzhen Graduate School, Shenzhen Key Laboratory of Water Resource Utilization and Environmental Pollution Control, Shenzhen 518055 (China); Zhang, Tian [Harbin Institute of Technology Shenzhen Graduate School, Shenzhen Key Laboratory of Water Resource Utilization and Environmental Pollution Control, Shenzhen 518055 (China); Bond, Tom [Department of Civil and Environmental Engineering, Imperial College, London SW7 2AZ (United Kingdom); Gan, Yiqun [Harbin Institute of Technology Shenzhen Graduate School, Shenzhen Key Laboratory of Water Resource Utilization and Environmental Pollution Control, Shenzhen 518055 (China)

    2015-12-15

    Quantitative structure–activity relationship (QSAR) models are tools for linking chemical activities with molecular structures and compositions. Due to the concern about the proliferating number of disinfection byproducts (DBPs) in water and the associated financial and technical burden, researchers have recently begun to develop QSAR models to investigate the toxicity, formation, property, and removal of DBPs. However, there are no standard procedures or best practices regarding how to develop QSAR models, which potentially limit their wide acceptance. In order to facilitate more frequent use of QSAR models in future DBP research, this article reviews the processes required for QSAR model development, summarizes recent trends in QSAR-DBP studies, and shares some important resources for QSAR development (e.g., free databases and QSAR programs). The paper follows the four steps of QSAR model development, i.e., data collection, descriptor filtration, algorithm selection, and model validation; and finishes by highlighting several research needs. Because QSAR models may have an important role in progressing our understanding of DBP issues, it is hoped that this paper will encourage their future use for this application.

  7. Development of quantitative structure activity relationship (QSAR) model for disinfection byproduct (DBP) research: A review of methods and resources.

    Science.gov (United States)

    Chen, Baiyang; Zhang, Tian; Bond, Tom; Gan, Yiqun

    2015-12-15

    Quantitative structure-activity relationship (QSAR) models are tools for linking chemical activities with molecular structures and compositions. Due to the concern about the proliferating number of disinfection byproducts (DBPs) in water and the associated financial and technical burden, researchers have recently begun to develop QSAR models to investigate the toxicity, formation, property, and removal of DBPs. However, there are no standard procedures or best practices regarding how to develop QSAR models, which potentially limit their wide acceptance. In order to facilitate more frequent use of QSAR models in future DBP research, this article reviews the processes required for QSAR model development, summarizes recent trends in QSAR-DBP studies, and shares some important resources for QSAR development (e.g., free databases and QSAR programs). The paper follows the four steps of QSAR model development, i.e., data collection, descriptor filtration, algorithm selection, and model validation; and finishes by highlighting several research needs. Because QSAR models may have an important role in progressing our understanding of DBP issues, it is hoped that this paper will encourage their future use for this application.

  8. Research and development program in reactor diagnostics and monitoring with neutron noise methods. Stage 7. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Pazsit, I.; Demaziere, C.; Arzhanov, V. [Chalmers Univ. of Technology, Goeteborg (Sweden). Department of Reactor Physics; Garis, N.S. [Swedish Nuclear Power Inspectorate, Stockholm (Sweden)

    2001-08-01

    This report constitutes stage 7 of a long-term research and development program concerning the development of diagnostics and monitoring methods for nuclear reactors. A proposal for the continuation of this program in stage 8 is also given at the end of the report. In stage 6, the basic principles of a 3-D fully coupled neutronic/thermal-hydraulic simulator in the frequency domain were presented. The neutronic model relied on the two-group diffusion approximation, whereas the thermal-hydraulic algorithms relied on the so called 'lumped' model. The key element of this simulator was that only the static data were required which could be obtained from the Studsvik Scandpower CASMO-4/TABLES-3/ SIMULATE-3 code package. The simulator was developed with this underlying idea, which means that the calculation of the static fluxes and the eigenvalue were avoided. Depending on what kind of spatial discretization scheme which is used in the noise simulator to calculate the 'leakage' noise, it is not granted that the system remains critical by using the group constants supplied by SIMULATE. Nevertheless, when the system is critical, the balance equations should be fulfilled in all nodes with respect to the discretization scheme used. In concrete terms, the calculation of the static fluxes and eigenvalue can be avoided if the system is brought back to criticality by modifying the cross-sections so that the balance equations are always fulfilled with the chosen spatial discretization scheme. This approach was used in this study with the finite difference scheme. As pointed out in stage 6, the finite difference scheme is relatively inefficient compared to finite elements or nodal methods, but on the other hand it is rather easy to implement. These two more sophisticated schemes are planned to be investigated at a later stage, but for the time being the simulator relying on the finite difference scheme was improved as much as possible so that a 2-D entirely

  9. Accelerator mass spectrometry in pharmaceutical research and development--a new ultrasensitive analytical method for isotope measurement.

    Science.gov (United States)

    Garner, R C

    2000-09-01

    Accelerator mass spectrometry (AMS) permits the measurement of elemental isotopes at the individual atom level. The main application of AMS in drug discovery and development will be in the analysis of 14-carbon (14C). The principle behind AMS is the separation of individual positively charged atoms through mass, charge and momentum differences. In order to obtain the high-energy charge state required for separation, negative atoms are accelerated through a high voltage field (up to 10 million volts) generated by a tandem Van de Graaff accelerator. In the middle of the accelerator, the outer valency electrons are stripped from the atom and the resulting charged species are separated and counted. For 14C, AMS counts the number of individual atoms rather than measuring radioactive decays. The result is that AMS is up to one million times more sensitive than decay counting. Radioactivity levels as low 0.0001 dpm can be detected using AMS. The exquisite sensitivity of AMS analysis means that much lower amounts of 14C can be used than for conventional counting methods. This makes it easier to use 14C for in vitro, preclinical and clinical research programmes. As 14C poses both a biological and environmental hazard, AMS permits much lower doses to be used. Human drug mass balance studies have been conducted with doses of 50 nanoCuries and below. Radioactive HPLC metabolite profiles of plasma extracts from subjects given nanoCurie doses of 14C-labelled drug have been obtained by injecting as little as 0.25 dpm onto an HPLC column. In studies of biologics, biosynthetically 14C-labelled recombinant protein has been produced with a specific radioactivity sufficient to conduct human clinical studies with AMS analysis. For one human recombinant protein an increase in sensitivity of 2,000-fold over ELISA was obtained with AMS measurement. AMS is an enabling technology that should prove of value in increasing human and environmental safety as well as allowing new research

  10. Tourism research and audio methods

    DEFF Research Database (Denmark)

    Jensen, Martin Trandberg

    2016-01-01

    • Audio methods enriches sensuous tourism ethnographies. • The note suggests five research avenues for future auditory scholarship. • Sensuous tourism research has neglected the role of sounds in embodied tourism experiences.......• Audio methods enriches sensuous tourism ethnographies. • The note suggests five research avenues for future auditory scholarship. • Sensuous tourism research has neglected the role of sounds in embodied tourism experiences....

  11. Regression methods for medical research

    CERN Document Server

    Tai, Bee Choo

    2013-01-01

    Regression Methods for Medical Research provides medical researchers with the skills they need to critically read and interpret research using more advanced statistical methods. The statistical requirements of interpreting and publishing in medical journals, together with rapid changes in science and technology, increasingly demands an understanding of more complex and sophisticated analytic procedures.The text explains the application of statistical models to a wide variety of practical medical investigative studies and clinical trials. Regression methods are used to appropriately answer the

  12. Overview of models, methods, and reagents developed for translational autoimmunity research in the common marmoset (Callithrix jacchus).

    Science.gov (United States)

    Jagessar, S Anwar; Vierboom, Michel; Blezer, Erwin L A; Bauer, Jan; Hart, Bert A 't; Kap, Yolanda S

    2013-01-01

    The common marmoset (Callithrix jacchus) is a small-bodied Neotropical primate and a useful preclinical animal model for translational research into autoimmune-mediated inflammatory diseases (AIMID), such as rheumatoid arthritis (RA) and multiple sclerosis (MS). The animal model for MS established in marmosets has proven their value for exploratory research into (etio) pathogenic mechanisms and for the evaluation of new therapies that cannot be tested in lower species because of their specificity for humans. Effective usage of the marmoset in preclinical immunological research has been hampered by the limited availability of blood for immunological studies and of reagents for profiling of cellular and humoral immune reactions. In this paper, we give a concise overview of the procedures and reagents that were developed over the years in our laboratory in marmoset models of the above-mentioned diseases.

  13. The development of methods for predicting and measuring distribution patterns of aerial sprays. [Langley Vortex Research Facility

    Science.gov (United States)

    Ormsbee, A. I.; Bragg, M. B.; Maughmer, M. D.

    1981-01-01

    A set of relationships used to scale small sized dispersion studies to full size results are experimentally verified and, with some qualifications, basic deposition patterns are presented. In the process of validating these scaling laws, the basic experimental techniques used in conducting such studies both with and without an operational propeller were developed. The procedures that evolved are outlined in some detail. The envelope of test conditions that can be accommodated in the Langley Vortex Research Facility, which were developed theoretically, are verified using a series of vortex trajectory experiments that help to define the limitations due to wall interference effects for models of different sizes.

  14. From Soap Opera to Research Methods Teaching: Developing an Interactive Website/DVD to Teach Research in Health and Social Care

    Science.gov (United States)

    Sabey, Abigail; Horrocks, Sue

    2011-01-01

    Research methods modules have become a core component of a range of nursing and allied health professional educational programmes both at pre-qualifying, undergraduate level and at post-qualifying and Masters' level, in keeping with requirements of professional bodies. These courses are offered both on a full time basis and part time for qualified…

  15. Mixed methods in gerontological research.

    Science.gov (United States)

    Happ, Mary Beth

    2009-04-01

    This article distinguishes between parallel and integrated mixed methods research approaches. Barriers to integrated mixed methods approaches in gerontological research are discussed and critiqued. The author presents examples of mixed methods gerontological research to highlight approaches to data integration at the levels of data analysis, interpretation, and research reporting. As a summary of the methodological literature, four basic levels of mixed methods data combination are proposed. Opportunities for mixing qualitative and quantitative data are explored using contemporary examples from published studies. Data transformation and visual display, judiciously applied, are proposed as pathways to fuller mixed methods data integration and analysis. Finally, practical strategies for mixing qualitative and quantitative data types are explicated, as gerontological research moves beyond parallel mixed methods approaches to achieve data integration.

  16. Hydropower research and development

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1997-03-01

    This report is a compilation of information on hydropower research and development (R and D) activities of the Federal government and hydropower industry. The report includes descriptions of on-going and planned R and D activities, 1996 funding, and anticipated future funding. Summary information on R and D projects and funding is classified into eight categories: fish passage, behavior, and response; turbine-related; monitoring tool development; hydrology; water quality; dam safety; operations and maintenance; and water resources management. Several issues in hydropower R and D are briefly discussed: duplication; priorities; coordination; technical/peer review; and technology transfer/commercialization. Project information sheets from contributors are included as an appendix.

  17. Hydropower research and development

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1997-03-01

    This report is a compilation of information on hydropower research and development (R and D) activities of the Federal government and hydropower industry. The report includes descriptions of on-going and planned R and D activities, 1996 funding, and anticipated future funding. Summary information on R and D projects and funding is classified into eight categories: fish passage, behavior, and response; turbine-related; monitoring tool development; hydrology; water quality; dam safety; operations and maintenance; and water resources management. Several issues in hydropower R and D are briefly discussed: duplication; priorities; coordination; technical/peer review; and technology transfer/commercialization. Project information sheets from contributors are included as an appendix.

  18. Development of Solar Research

    Science.gov (United States)

    Wittmann, Axel D.; Wolfschmidt, Gudrun; Duerbeck, Hilmar W.

    Originally based on a workshop on “Development of Solar Research”, held in Freiburg/Breisgau, this book contains articles on megalithic structures, the Nebra sky-disk, ancient sun cults, the observation of sunspots, the photography of the sun during eclipses, eclipse maps and expeditions, solar telescopes, solar physics during the Nazi era, archives of solar observations, scientific ballooning for solar research, site-testing on the Canary Islands, as well as on international cooperation.

  19. The order and priority of research and design method application within an assistive technology new product development process: a summative content analysis of 20 case studies.

    Science.gov (United States)

    Torrens, George Edward

    2017-03-12

    Summative content analysis was used to define methods and heuristics from each case study. The review process was in two parts: (1) A literature review to identify conventional research methods and (2) a summative content analysis of published case studies, based on the identified methods and heuristics to suggest an order and priority of where and when were used. Over 200 research and design methods and design heuristics were identified. From the review of the 20 case studies 42 were identified as being applied. The majority of methods and heuristics were applied in phase two, market choice. There appeared a disparity between the limited numbers of methods frequently used, under 10 within the 20 case studies, when hundreds were available. Implications for Rehabilitation The communication highlights a number of issues that have implication for those involved in assistive technology new product development: •The study defined over 200 well-established research and design methods and design heuristics that are available for use by those who specify and design assistive technology products, which provide a comprehensive reference list for practitioners in the field; •The review within the study suggests only a limited number of research and design methods are regularly used by industrial design focused assistive technology new product developers; and, •Debate is required within the practitioners working in this field to reflect on how a wider range of potentially more effective methods and heuristics may be incorporated into daily working practice.

  20. Photonics Research and Development

    Energy Technology Data Exchange (ETDEWEB)

    Dickson, Elizabeth [UNLV Research Foundation, Las Vegas, NV (United States)

    2010-01-15

    During the period August 2005 through October 2009, the UNLV Research Foundation (UNLVRF), a non-profit affiliate of the University of Nevada, Las Vegas (UNLV), in collaboration with UNLV's Colleges of Science and Engineering; Boston University (BU); Oak Ridge National Laboratory (ORNL); and Sunlight Direct, LLC, has managed and conducted a diverse and comprehensive research and development program focused on light-emitting diode (LED) technologies that provide significantly improved characteristics for lighting and display applications. This final technical report provides detailed information on the nature of the tasks, the results of the research, and the deliverables. It is estimated that about five percent of the energy used in the nation is for lighting homes, buildings and streets, accounting for some 25 percent of the average home's electric bill. However, the figure is significantly higher for the commercial sector. About 60 percent of the electricity for businesses is for lighting. Thus replacement of current lighting with solid-state lighting technology has the potential to significantly reduce this nation's energy consumption by some estimates, possibly as high as 20%. The primary objective of this multi-year R&D project has been to develop and advance lighting technologies to improve national energy conversion efficiencies; reduce heat load; and significantly lower the cost of conventional lighting technologies. The UNLVRF and its partners have specifically focused these talents on (1) improving LED technologies; (2) optimizing hybrid solar lighting, a technology which potentially offers the benefits of blending natural with artificial lighting systems, thus improving energy efficiency; and (3) building a comprehensive academic infrastructure within UNLV which concentrates on photonics R&D. Task researchers have reported impressive progress in (1) the development of quantum dot laser emitting diodes (QDLEDs) which will ultimately improve

  1. Qualitative Research: Methods and Methodology

    OpenAIRE

    Gabb, Jacqui

    2016-01-01

    This entry provides an overview of qualitative LGBTQ research. It begins by mapping out the qualities and character of studies that use this approach with particular attention to psycho-social research. It then highlights how reflexivity, the iterative process of self-identity making, has informed qualitative research, influencing both understandings of sexualities and also the underlying methodologies and research methods used. Finally, it considers how “the everyday” and a practices approac...

  2. "Phenomenology" and qualitative research methods.

    Science.gov (United States)

    Nakayama, Y

    1994-01-01

    Phenomenology is generally based on phenomenological tradition from Husserl to Heidegger and Merleau-Ponty. As philosophical stances provide the assumptions in research methods, different philosophical stances produce different methods. However, the term "phenomenology" is used in various ways without the definition being given, such as phenomenological approach, phenomenological method, phenomenological research, etc. The term "phenomenology" is sometimes used as a paradigm and it is sometimes even viewed as synonymous with qualitative methods. As a result, the term "phenomenology" leads to conceptual confusions in qualitative research methods. The purpose of this paper is to examine the term "phenomenology" and explore philosophical assumptions, and discuss the relationship between philosophical stance and phenomenology as a qualitative research method in nursing.

  3. e-Learning Business Research Methods

    Science.gov (United States)

    Cowie, Jonathan

    2004-01-01

    This paper outlines the development of a generic Business Research Methods course from a simple name in a box to a full e-Learning web based module. It highlights particular issues surrounding the nature of the discipline and the integration of a large number of cross faculty subject specific research methods courses into a single generic module.…

  4. Ecotribology research developments

    CERN Document Server

    2016-01-01

    This book presents resent research advances in the area of eco-triobology. In the last years, eco-tribology or environmentally friendly tribology has gained increasing importance in sustainable engineering. Environmentally acceptable tribological practices save resources by optimizing product usage and reducing energy. This book covers current developments in all areas covered by the term eco-tribology, including biomimetics surfaces, control of friction and wear, environmental aspects of lubrication and surface modification techniques as well as tribological aspects of green applications, such wind-power turbines or solar panels.

  5. Research methods with disabled populations.

    Science.gov (United States)

    Eckhardt, Elizabeth; Anastas, Jeane

    2006-01-01

    Although social work and related fields need more research involving people with disabilities, such studies can pose special challenges due to lack of understanding of disability issues, the disempowerment and invisibility of many who are disabled, and communication barriers. This article discusses ways of eliminating bias and maintaining ethical safeguards when designing and conducting research on people with disabilities. Participatory action research, which engages those studied in the design and conduct of research, is discussed as a model, as is the use of qualitative methods. Recent methodological innovations in survey research with deaf populations are also described and illustrated.

  6. Research and development of methods/utilities and rules for managing cooperation for performance improvement in government offices

    Energy Technology Data Exchange (ETDEWEB)

    Kurstedt, H.A.

    1993-03-01

    Purpose is to help managers approach their responsibilities proactively, so that they can anticipate problems and take actions to alleviate or eliminate those problems. Continuous performance improvement, the philosophy behind total quality management, requires working cooperatively to do a little better each day. The most effective tools are working through a closed set of 9 methods: setting expectations, charting, defining indicators and standards, collecting and logging data, converting data to information, organizing and presenting information, reviewing status and progress, self-management, and appraising. In addition, there are 8 rules: focus on what you can do, supply physical evidence of progress, pay attention to detail, inspect (don't expect), review progress routinely and frequently, face ''success/fail'' squarely, communicate crisply, and conduct honest, open appraisals. Scope and plans of the draft research plan (study areas) are described.

  7. Expounding the Place of Legal Doctrinal Methods in Legal-Interdisciplinary Research : Experiences with Studying the Practice of Independent Accountability Mechanisms at Multilateral Development Banks

    NARCIS (Netherlands)

    A. Naudé Fourie (Andria)

    2015-01-01

    textabstractThere is a distinct place for legal doctrinal methods in legal- interdisciplinary research methodologies, but there is value to be had in expounding that place – in developing a deeper understanding, for instance, of what legal doctrinal analysis has to offer, wherein lies its limitation

  8. CSM parallel structural methods research

    Science.gov (United States)

    Storaasli, Olaf O.

    1989-01-01

    Parallel structural methods, research team activities, advanced architecture computers for parallel computational structural mechanics (CSM) research, the FLEX/32 multicomputer, a parallel structural analyses testbed, blade-stiffened aluminum panel with a circular cutout and the dynamic characteristics of a 60 meter, 54-bay, 3-longeron deployable truss beam are among the topics discussed.

  9. Phenomenological Research Methods for Counseling Psychology

    Science.gov (United States)

    Wertz, Frederick J.

    2005-01-01

    This article familiarizes counseling psychologists with qualitative research methods in psychology developed in the tradition of European phenomenology. A brief history includes some of Edmund Husserl's basic methods and concepts, the adoption of existential-phenomenology among psychologists, and the development and formalization of qualitative…

  10. Phenomenological Research Methods for Counseling Psychology

    Science.gov (United States)

    Wertz, Frederick J.

    2005-01-01

    This article familiarizes counseling psychologists with qualitative research methods in psychology developed in the tradition of European phenomenology. A brief history includes some of Edmund Husserl's basic methods and concepts, the adoption of existential-phenomenology among psychologists, and the development and formalization of qualitative…

  11. [Qualitative methods in psychiatric research].

    Science.gov (United States)

    Sikorski, Claudia; Glaesmer, Heide

    2011-01-01

    This article addresses the usage of qualitative methods in psychiatric research and presents the qualitative approach in more detail. Recent original empirical work of a German psychiatric journal was systematically reviewed. Methods used to collect and analyse the information are detailed. One third of the articles used a solely qualitative research design. One further article applied a combination of quantitative and qualitative approaches. Three kinds of the qualitative interviews were used (in depth, narrative and problem-focussed interview). Additionally, focus groups (group discussions) and qualitative content analysis were applied by studies. Qualitative approaches are an integral part of psychiatric research. Further work should assure to use adequate sampling strategies.

  12. Developments in Surrogating Methods

    Directory of Open Access Journals (Sweden)

    Hans van Dormolen

    2005-11-01

    Full Text Available In this paper, I would like to talk about the developments in surrogating methods for preservation. My main focus will be on the technical aspects of preservation surrogates. This means that I will tell you something about my job as Quality Manager Microfilming for the Netherlands’ national preservation program, Metamorfoze, which is coordinated by the National Library. I am responsible for the quality of the preservation microfilms, which are produced for Metamorfoze. Firstly, I will elaborate on developments in preservation methods in relation to the following subjects: · Preservation microfilms · Scanning of preservation microfilms · Preservation scanning · Computer Output Microfilm. In the closing paragraphs of this paper, I would like to tell you something about the methylene blue test. This is an important test for long-term storage of preservation microfilms. Also, I will give you a brief report on the Cellulose Acetate Microfilm Conference that was held in the British Library in London, May 2005.

  13. Qualitative research as methodical hermeneutics.

    Science.gov (United States)

    Rennie, David L

    2012-09-01

    The proportion of publications of qualitative research in mainstream psychology journals is small. Thus, in terms of this important criterion, despite its recent rapid growth, qualitative research is marginalized in psychology. The author suggests that contributing to this situation is the lack of a coherent and unifying methodology of qualitative research methods that elucidates their credibility. He groups the many qualitative research methods into 3 main kinds, then applies to them 4 propositions offered as such a methodology: (1) Qualitative research is hermeneutical, entailing application of the method of the hermeneutic circle to text about experience and/or action. (2) Implicit in the use of the hermeneutic circle method is the activity of educing and articulating the meaning of text, an activity that modifies and interacts with C. S. Peirce's (1965, 1966) logical operations of abduction, theorematic deduction, and induction. (3) The cycling of these 4 moments enables demonstration, achieved rhetorically, of the validity of the understandings resulting from the exegesis of the text under study. (4) This demonstrative rhetoric is enhanced when researchers disclose reflexively those aspects of their perspectives they judge to have most relevant bearing on their understandings. The author compares abduction as formulated here with other recent uptakes of it. As an installment on the generality of the methodology, he explores its fit with the descriptive phenomenological psychological method, conversation analysis, and thematic analysis.

  14. Mixed-Methods Research Methodologies

    Science.gov (United States)

    Terrell, Steven R.

    2012-01-01

    Mixed-Method studies have emerged from the paradigm wars between qualitative and quantitative research approaches to become a widely used mode of inquiry. Depending on choices made across four dimensions, mixed-methods can provide an investigator with many design choices which involve a range of sequential and concurrent strategies. Defining…

  15. Behavioral Methods in Consciousness Research

    DEFF Research Database (Denmark)

    that the research literature has expanded greatly, particularly in cognitive neuroscience and cognitive science. Interestingly, this scientific work has made use of a wide variety of different methods without much consensus on how one might in fact measure subjective consciousness. This situation makes...... it potentially impossible to compare and contrast experimental findings, and difficult to show that consciousness research is a discipline going in a particular direction or has a particular focus. This book provides an overview of methods and approaches for studying consciousness. It aims to make progress...... giving concrete tools for how to investigate consciousness in combination with theoretical discussions of possibilities and limitations of each method...

  16. Eltron Research & Development

    Energy Technology Data Exchange (ETDEWEB)

    Evenson, Carl; Mackay, Richard; Faull, John

    2014-03-01

    This topical report covers technical work conducted under contract DE-FC26-05NT42469 between FY06 Q1 through FY14 Q2. The project evolved through several budget periods, budget revisions and continuation applications. This report covers work performed under the “base” program. In 2010 ARRA funding was added to the project. A separate report covering the ARRA portion of the project was submitted to DOE. The original project was focused on research and development for scale-up of hydrogen separation membrane for a FutureGen type power plant. The work included membrane testing and evaluation of metal alloy flat plates vs. tubes and metal membranes vs. cermet membranes. In addition, economic analysis and process modeling was performed. The original project team included CoorsTek, NORAM, and Praxair. In FY10Q2 a continuation application was filed for conducting a scale-up test at Eastman Chemical. In this part of the project a Subscale Engineering Prototype (SEP) membrane skid was designed, fabricated, and operated on a gasified coal slip-stream on Eastman’s site in Kingsport, TN. Following operation, the project was reorganized and a second continuation application with a new statement of work was initiated in FY12Q1. Finally, based on DOE’s decision not to proceed with a Process Development Unit (PDU) field test, a third continuation application and statement of work was initiated in FY13Q1 to close out the project.

  17. Quantitative vs qualitative research methods.

    Science.gov (United States)

    Lakshman, M; Sinha, L; Biswas, M; Charles, M; Arora, N K

    2000-05-01

    Quantitative methods have been widely used because of the fact that things that can be measured or counted gain scientific credibility over the unmeasurable. But the extent of biological abnormality, severity, consequences and the impact of illness cannot be satisfactorily captured and answered by the quantitative research alone. In such situations qualitative methods take a holistic perspective preserving the complexities of human behavior by addressing the "why" and "how" questions. In this paper an attempt has been made to highlight the strengths and weaknesses of both the methods and also that a balanced mix of both qualitative as well as quantitative methods yield the most valid and reliable results.

  18. Development Research in/on Educational Development

    OpenAIRE

    Plomp, T

    2000-01-01

    In the practice of education, much design and development activities are taking place: curriculum development, instructional design, multimedia design, textbook development, etc. However, there is not much knowledge about how to design and develop, neither about criteria for the outcomes of design and development activities. Development research is a problem oriented, interdisciplinary research approach aimed at reducing uncertainty of design decisions, generating concrete recommendations for...

  19. Mixed methods research in the development and evaluation of complex interventions in palliative and end-of-life care: report on the MORECare consensus exercise.

    Science.gov (United States)

    Farquhar, Morag; Preston, Nancy; Evans, Catherine J; Grande, Gunn; Short, Vicky; Benalia, Hamid; Higginson, Irene J; Todd, Chris

    2013-12-01

    Complex interventions are common in palliative and end-of-life care. Mixed methods approaches sit well within the multiphase model of complex intervention development and evaluation. Generic mixed methods guidance is useful but additional challenges in the research design and operationalization within palliative and end-of-life care may have an impact on the use of mixed methods. The objective of the study was to develop guidance on the best methods for combining quantitative and qualitative methods for health and social care intervention development and evaluation in palliative and end-of-life care. A one-day workshop was held where experts participated in facilitated groups using Transparent Expert Consultation to generate items for potential recommendations. Agreement and consensus were then sought on nine draft recommendations (DRs) in a follow-up exercise. There was at least moderate agreement with most of the DRs, although consensus was low. Strongest agreement was with DR1 (usefulness of mixed methods to palliative and end-of-life care) and DR5 (importance of attention to respondent burden), and least agreement was with DR2 (use of theoretical perspectives) and DR6 (therapeutic effects of research interviews). Narrative comments enabled recommendation refinement. Two fully endorsed, five partially endorsed, and two refined DRs emerged. The relationship of these nine to six key challenges of palliative and end-of-life care research was analyzed. There is a need for further discussion of these recommendations and their contribution to methodology. The recommendations should be considered when designing and operationalizing mixed methods studies of complex interventions in palliative care, and because they may have wider relevance, should be considered for other applications.

  20. Doctoral research on cadastral development

    DEFF Research Database (Denmark)

    Cagdas, Volkan; Stubkjær, Erik

    2009-01-01

    . The article focuses on the methodological aspect of doctoral research by analyzing ten doctoral dissertations. Our analysis is based on a taxonomy of methodological elements and aims at identifying commonalities and differences among the dissertations in the use of concepts and methods. Having completed......The multitude of rights in land and the recording of these rights are addressed by a number of studies, yet a recognized paradigm for such studies seems missing. Rights in land are recorded and managed through either cadastral systems or land administration systems depending on the legal system...... of cadastral development. This research is multi-disciplinary and draws on elements of theories and methodologies from the natural, the social, the behavioral, and the formal sciences. During the last decade or so, doctoral dissertations have come to constitute a substantial part of this research effort...

  1. Using ethnographic methods in software engineering research

    DEFF Research Database (Denmark)

    Sharp, Helen, C.; Dittrich, Yvonne; De Souza, Cleidson

    2010-01-01

    This tutorial provides an overview of the role of ethnography in Software Engineering research. It describes the use of ethnographic methods as a means to provide an in-depth understanding of the socio-technological realities surrounding everyday software development practice. The knowledge gained...... can be used to improve processes, methods and tools as well as develop observed industrial practices. The tutorial begins with a brief historical account of ethnography in the fields of Software Engineering, CSCW, Information Systems and other related areas. This sets the stage for a more in......-depth discussion of methods for data collection and analysis used in ethnographic studies. It then describes how these methods can be and have been used by software engineering researchers to understand developers' work practices, to inform the development of processes, methods and tools and to evaluate...

  2. Using ethnographic methods in software engineering research

    DEFF Research Database (Denmark)

    Sharp, Helen, C.; Dittrich, Yvonne; De Souza, Cleidson

    2010-01-01

    This tutorial provides an overview of the role of ethnography in Software Engineering research. It describes the use of ethnographic methods as a means to provide an in-depth understanding of the socio-technological realities surrounding everyday software development practice. The knowledge gained......-depth discussion of methods for data collection and analysis used in ethnographic studies. It then describes how these methods can be and have been used by software engineering researchers to understand developers' work practices, to inform the development of processes, methods and tools and to evaluate...... can be used to improve processes, methods and tools as well as develop observed industrial practices. The tutorial begins with a brief historical account of ethnography in the fields of Software Engineering, CSCW, Information Systems and other related areas. This sets the stage for a more in...

  3. Radionuclide Operational Research & Development

    Science.gov (United States)

    2000-09-01

    DoD/DOE Seismic Research Symposium: Planning for Verification of and Compliance with the Comprehensive Nuclear-Test-Ban Treaty (CTBT) held in New...message sent via a socket connection). Version 1.0 of the RASA Authentication Software has been tested on the two RASA stations at Hanford (USX01...No. 1 (1999) 109-122, (ARSA). Harris, et al. (1999), Proceedings of 21st Seismic Research Symposium: Technologies for Monitoring the

  4. A Design Science Research Methodology for Developing a Computer-Aided Assessment Approach Using Method Marking Concept

    Science.gov (United States)

    Genemo, Hussein; Miah, Shah Jahan; McAndrew, Alasdair

    2016-01-01

    Assessment has been defined as an authentic method that plays an important role in evaluating students' learning attitude in acquiring lifelong knowledge. Traditional methods of assessment including the Computer-Aided Assessment (CAA) for mathematics show limited ability to assess students' full work unless multi-step questions are sub-divided…

  5. High-temperature fatigue in metals - A brief review of life prediction methods developed at the Lewis Research Center of NASA

    Science.gov (United States)

    Halford, G. R.

    1983-01-01

    The presentation focuses primarily on the progress we at NASA Lewis Research Center have made. The understanding of the phenomenological processes of high temperature fatigue of metals for the purpose of calculating lives of turbine engine hot section components is discussed. Improved understanding resulted in the development of accurate and physically correct life prediction methods such as Strain-Range partitioning for calculating creep fatigue interactions and the Double Linear Damage Rule for predicting potentially severe interactions between high and low cycle fatigue. Examples of other life prediction methods are also discussed. Previously announced in STAR as A83-12159

  6. An overview of models, methods, and reagents developed for translational autoimmunity research in the common marmoset (Callithrix jacchus)

    NARCIS (Netherlands)

    S.A. Jagessar (Anwar); M.P.M. Vierboom (Michel); E. Blezer (Erwin); J. Bauer; B.A. 't Hart (Bert); Y.S. Kap (Yolanda)

    2013-01-01

    textabstractThe common marmoset (Callithrix jacchus) is a small-bodied Neotropical primate and a useful preclinical animal model for translational research into autoimmune-mediated inflammatory diseases (AIMID), such as rheumatoid arthritis (RA) and multiple sclerosis (MS). The animal model for MS e

  7. An Overview of Models, Methods, and Reagents Developed for Translational Autoimmunity Research in the Common Marmoset (Callithrix jacchus)

    NARCIS (Netherlands)

    Jagessar, S. Anwar; Vierboom, Michel; Blezer, Erwin L. A.; Bauer, Jan; 't Hart, Bert A.; Kap, Yolanda S.

    2013-01-01

    The common marmoset (Callithrix jacchus) is a small-bodied Neotropical primate and a useful preclinical animal model for translational research into autoimmune-mediated inflammatory diseases (AIMID), such as rheumatoid arthritis (RA) and multiple sclerosis (MS). The animal model for MS established i

  8. Engaging Adolescents through Participatory and Qualitative Research Methods to Develop a Digital Communication Intervention to Reduce Adolescent Obesity

    Science.gov (United States)

    Livingood, William C.; Monticalvo, David; Bernhardt, Jay M.; Wells, Kelli T.; Harris, Todd; Kee, Kadra; Hayes, Johnathan; George, Donald; Woodhouse, Lynn D.

    2017-01-01

    Background: The complexity of the childhood obesity epidemic requires the application of community-based participatory research (CBPR) in a manner that can transcend multiple communities of stakeholders, including youth, the broader community, and the community of health care providers. Aim: To (a) describe participatory processes for engaging…

  9. Diabetes knowledge translation status in developing countries: A mixed method study among diabetes researchers in case of Iran

    Directory of Open Access Journals (Sweden)

    Ali Valinejadi

    2016-01-01

    Conclusions: The overall status of diabetes KT in Iran was lower than the ideal situation. There are many challenges that require great interventions at the organizational or macro level. To reinforce diabetes KT in Iran, it should hold a more leading and centralized function in the strategies of the country′s diabetes research system.

  10. Validation of the Training Benefit Forecasting Method: Geometric Dimension & Tolerance Training. Training and Development Research Center: Project Number Two.

    Science.gov (United States)

    Geroy, Gary D.

    The validity of the University of Minnesota Skills Training Cost-Benefit Forecasting Model (STCBFM) in a corporate setting was studied. Research and related literature suggested that a model for forecasting the economic benefits of training should include facility to identify and summarize costs and provide an assessment of the value of the…

  11. e-LITE: A Concurrent Engineering Method Dedicated to E-learning Training Development for the Enhancement of Research Project Results%e-LITE: A Concurrent Engineering Method Dedicated to E-learning Training Development for the Enhancement of Research Project Results

    Institute of Scientific and Technical Information of China (English)

    AKIF J-Ch; DANG T-N; DUCQ Y; GAUTHIER P

    2012-01-01

    Scientific research projects aim to produce new knowledge generally in domains of high specialization. Some of these projects have goals of improving the performance of companies. In this case, the issues of the capitalization and transfer of scientific knowledge and its rapid transformation into professional skills are directly addressed. However, there is no method to derive e-learning teaching material from project results. So, this paper presents the e-LITE Method and its application to the ISTA3 project to support the process of developing a e-learning training. This application has allowed us to highlight the contributions of the method that promotes better knowledge sharing between partners of a research project and the development and transfer of research results to the professional world. So, after the presentation of the method, an application to the ISTA3 project will be presented.

  12. Applying the Action-Research Method to Develop a Methodology to Reduce the Installation and Maintenance Times of Information Security Management Systems

    Directory of Open Access Journals (Sweden)

    Antonio Santos-Olmo

    2016-07-01

    Full Text Available Society is increasingly dependent on Information Security Management Systems (ISMS, and having these kind of systems has become vital for the development of Small and Medium-Sized Enterprises (SMEs. However, these companies require ISMS that have been adapted to their special features and have been optimized as regards the resources needed to deploy and maintain them, with very low costs and short implementation periods. This paper discusses the different cycles carried out using the ‘Action Research (AR’ method, which have allowed the development of a security management methodology for SMEs that is able to automate processes and reduce the implementation time of the ISMS.

  13. Designing a mixed methods study in pediatric oncology nursing research.

    Science.gov (United States)

    Wilkins, Krista; Woodgate, Roberta

    2008-01-01

    Despite the appeal of discovering the different strengths of various research methods, mixed methods research remains elusive in pediatric oncology nursing research. If pediatric oncology nurses are to succeed in mixing quantitative and qualitative methods, they need practical guidelines for managing the complex data and analyses of mixed methods research. This article discusses mixed methods terminology, designs, and key design features. Specific areas addressed include the myths about mixed methods research, types of mixed method research designs, steps involved in developing a mixed method research study, and the benefits and challenges of using mixed methods designs in pediatric oncology research. Examples of recent research studies that have combined quantitative and qualitative research methods are provided. The term mixed methods research is used throughout this article to reflect the use of both quantitative and qualitative methods within one study rather than the use of these methods in separate studies concerning the same research problem.

  14. Research & Development of Materials/Processing Methods for Continuous Fiber Ceramic Composites (CFCC) Phase 2 Final Report.

    Energy Technology Data Exchange (ETDEWEB)

    Szweda, A.

    2001-01-01

    The Department of Energy's Continuous Fiber Ceramic Composites (CFCC) Initiative that begun in 1992 has led the way for Industry, Academia, and Government to carry out a 10 year R&D plan to develop CFCCs for these industrial applications. In Phase II of this program, Dow Corning has led a team of OEM's, composite fabricators, and Government Laboratories to develop polymer derived CFCC materials and processes for selected industrial applications. During this phase, Dow Corning carried extensive process development and representative component demonstration activities on gas turbine components, chemical pump components and heat treatment furnace components.

  15. Studies on application of neutron activation analysis -Applied research on air pollution monitoring and development of analytical method of environmental samples

    Energy Technology Data Exchange (ETDEWEB)

    Chung, Yong Sam; Moon, Jong Hwa; Chung, Young Ju; Jeong, Eui Sik; Lee, Sang Mi; Kang, Sang Hun; Cho, Seung Yeon; Kwon, Young Sik; Chung, Sang Wuk; Lee, Kyu Sung; Chun, Ki Hong; Kim, Nak Bae; Lee, Kil Yong; Yoon, Yoon Yeol; Chun, Sang Ki

    1997-09-01

    This research report is written for results of applied research on air pollution monitoring using instrumental neutron activation analysis. For identification and standardization of analytical method, 24 environmental samples are analyzed quantitatively, and accuracy and precision of this method are measured. Using airborne particulate matter and biomonitor chosen as environmental indicators, trace elemental concentrations of sample collected at urban and rural site monthly are determined ant then the calculation of statistics and the factor analysis are carried out for investigation of emission source. Facilities for NAA are installed in a new HANARO reactor, functional test is performed for routine operation. In addition, unified software code for NAA is developed to improve accuracy, precision and abilities of analytical processes. (author). 103 refs., 61 tabs., 19 figs.

  16. Validation of the Training Benefit Forecasting Method: Recreational Vehicle Service Training. Training and Development Research Center: Project Number Six.

    Science.gov (United States)

    Swanson, Richard A.; Geroy, Gary D.

    The validity of the Training Benefit Forecasting Method (TBFM) in a recreational vehicle service training setting was studied. Cost-benefit issues were associated with the Onan Service School change from a field-based Recreational Vehicle Generator Set training program to a customer-delivered self-instructional training program. Actual costs and…

  17. Validation of the Training Benefit Forecasting Method: Grammar and Punctuation Training. Training and Development Research Center: Project Number Three.

    Science.gov (United States)

    Heidary, Farhood; And Others

    The validity of the Training Benefit Forecasting Method (TBFM) was studied in a Grammar and Punctuation Program conducted at Onan Corporation. The target population was composed of 10 workers who handled the document production in the organization's word processing center. Based on information gathered from the course instructor, participants, and…

  18. Qualitative Research Methods in Education and Educational Technology. Research Methods for Educational Technology

    Science.gov (United States)

    Willis, Jerry W.

    2008-01-01

    "Qualitative Research Methods in Education and Educational Technology" was written for students and scholars interested in exploring the many qualitative methods developed over the last 50 years in the social sciences. The book does not stop, however, at the boundaries of the social sciences. Social scientists now consume and use research methods…

  19. Qualitative methods in pharmacy practice research

    DEFF Research Database (Denmark)

    Kaae, Susanne; Traulsen, Janine Marie

    2015-01-01

    Qualitative research within pharmacy practice is concerned with understanding the behavior of actors such as pharmacy staff, pharmacy owners, patients, other healthcare professionals, and politicians to explore various types of existing practices and beliefs in order to improve them. As qualitative...... research attempts to answer the “why” questions, it is useful for describing, in rich detail, complex phenomena that are situated and embedded in local contexts. Typical methods include interviews, observation, document analysis, and netnography. Qualitative research has to live up to a set of rigid...... quality criteria of research conduct to provide trustworthy results that contribute to the further development of the area....

  20. Labels discover physics: the development of new labelling methods as a promising research field for applied physics

    CERN Document Server

    Sparavigna, Amelia

    2008-01-01

    Labels and tags are accompanying us in almost each moment of our life and everywhere we are going, in the form of electronic keys or money, or simply as labels on products we are buying in shops and markets. The label diffusion, rapidly increasing for logistic reasons in the actual global market, carries huge amount of information but it is demanding security and anti-fraud systems. The first crucial point, for the consumer and producer safety, is to ensure the authenticity of the labelled products with systems against counterfeiting and piracy. Recent anti-fraud techniques are based on a sophisticated use of physical effects, from holograms till magnetic resonance or tunnel transitions between atomic sublevels. In this paper we will discuss labels and anti-fraud technologies as a new and very promising research field for applied physics.

  1. Social Experiments and Participatory Research as Method

    DEFF Research Database (Denmark)

    Dirckinck-Holmfeld, Lone

    2007-01-01

    Interdisciplinary research with stakeholders and users challenge the research methodologies to be used. These have to provide a shared language for all the participants, to build up trust, and to offer insights into the diverse perspectives of the participants. Further more it challenge ways to d...... practice-based methods where "social experiments with technology" and "dialogue research" are the key-words. ......Interdisciplinary research with stakeholders and users challenge the research methodologies to be used. These have to provide a shared language for all the participants, to build up trust, and to offer insights into the diverse perspectives of the participants. Further more it challenge ways...... to discuss and validate contributions from each others - across different criteria for each discipline, and crosswise different agendas for stakeholders, politicians, practitioners and researchers. Participatory research and social experiments are methodologies which have been developed to cope...

  2. 杂交玉米研究中的自交系选育技术%Methods and Ways of Developing Inbred Lines in Hybrid Maize Research

    Institute of Scientific and Technical Information of China (English)

    杨峻芸; 谭静

    2001-01-01

    杂交玉米研究中,自交系选育是一个十分重要的环节。完成自交系选育,可以有多种不同的方法和途径,本文介绍了几种重要的选育方法,可供玉米育种工作者参考。%Development of inbred lines is very important in hybrid maize research.There are a lot of methods and ways to develop inbred lines.In this article,the authors introduced some methods and ways which are useful to breeders in their studies.

  3. Ethnographic Contributions to Method Development

    DEFF Research Database (Denmark)

    Leander, Anna

    2016-01-01

    of IR—Critical Security Studies. Ethnographic research works with what has been termed a “strong” understanding of objectivity. When this understanding is taken seriously, it must lead to a refashioning of the processes of gathering, analyzing, and presenting data in ways that reverse many standard......Contrary to common assumptions, there is much to be learned about methods from constructivist/post-structuralist approaches to International Relations (IR) broadly speaking. This article develops this point by unpacking the contributions of one specific method—ethnography—as used in one subfield...

  4. Qualitative research methods for medical educators.

    Science.gov (United States)

    Hanson, Janice L; Balmer, Dorene F; Giardino, Angelo P

    2011-01-01

    This paper provides a primer for qualitative research in medical education. Our aim is to equip readers with a basic understanding of qualitative research and prepare them to judge the goodness of fit between qualitative research and their own research questions. We provide an overview of the reasons for choosing a qualitative research approach and potential benefits of using these methods for systematic investigation. We discuss developing qualitative research questions, grounding research in a philosophical framework, and applying rigorous methods of data collection, sampling, and analysis. We also address methods to establish the trustworthiness of a qualitative study and introduce the reader to ethical concerns that warrant special attention when planning qualitative research. We conclude with a worksheet that readers may use for designing a qualitative study. Medical educators ask many questions that carefully designed qualitative research would address effectively. Careful attention to the design of qualitative studies will help to ensure credible answers that will illuminate many of the issues, challenges, and quandaries that arise while doing the work of medical education. Copyright © 2011 Academic Pediatric Association. All rights reserved.

  5. Funding Research Software Development

    Science.gov (United States)

    Momcheva, Ivelina G.

    2017-01-01

    Astronomical software is used by each and every member of our scientific community. Purpose-build software is becoming ever more critical as we enter the regime of large datasets and simulations of increasing complexity. However, financial investments in building, maintaining and renovating the software infrastructure have been uneven. In this talk I will summarize past and current funding sources for astronomical software development, discuss other models of funding and introduce a new initiative for supporting community software at STScI. The purpose of this talk is to prompt discussion about how we allocate resources to this vital infrastructure.

  6. Geological Sequestration Training and Research Program in Capture and Transport: Development of the Most Economical Separation Method for CO2 Capture

    Energy Technology Data Exchange (ETDEWEB)

    Vahdat, Nader

    2013-09-30

    The project provided hands-on training and networking opportunities to undergraduate students in the area of carbon dioxide (CO2) capture and transport, through fundamental research study focused on advanced separation methods that can be applied to the capture of CO2 resulting from the combustion of fossil-fuels for power generation . The project team’s approach to achieve its objectives was to leverage existing Carbon Capture and Storage (CCS) course materials and teaching methods to create and implement an annual CCS short course for the Tuskegee University community; conduct a survey of CO2 separation and capture methods; utilize data to verify and develop computer models for CO2 capture and build CCS networks and hands-on training experiences. The objectives accomplished as a result of this project were: (1) A comprehensive survey of CO2 capture methods was conducted and mathematical models were developed to compare the potential economics of the different methods based on the total cost per year per unit of CO2 avoidance; and (2) Training was provided to introduce the latest CO2 capture technologies and deployment issues to the university community.

  7. Translational Research and Youth Development

    Science.gov (United States)

    Hamilton, Stephen F.

    2015-01-01

    Borrowing the term "translational research" (TR) from medicine, along with some of the ideas and practices that define it, holds promise as a way of linking research more closely to the practice of youth development. However, doing so entails substantial adaptation. TR is more than a new name for applied research. It comprehends the…

  8. Translational Research and Youth Development

    Science.gov (United States)

    Hamilton, Stephen F.

    2015-01-01

    Borrowing the term "translational research" (TR) from medicine, along with some of the ideas and practices that define it, holds promise as a way of linking research more closely to the practice of youth development. However, doing so entails substantial adaptation. TR is more than a new name for applied research. It comprehends the…

  9. [Methodology, method, and quality of qualitative research].

    Science.gov (United States)

    Frommer, Jörg; Rennie, David L

    2006-05-01

    Over the last ten years qualitative research approaches have been increasingly recognized and applied to the fields of psychotherapy and psychosomatic medicine in German-speaking countries, although this development has lagged behind what has occurred at the same time in English-speaking countries. In the former, especially, a misunderstanding prevails that qualitative research methods are at best preliminary to real science. This misunderstanding has roots in the philosophy of science and the sociology of knowledge. It comes from the lack of recognition that the human sciences, unlike the natural sciences, entail a double rather than single hermeneutic and that qualitative research methods are logically coherent ways of working systematically and rigorously with this double hermeneutic. Indeed, this nature of qualitative research is generally not well understood by many qualitative researchers themselves. In this article, the need for qualitative research is shown and its methodology is seen as an integration of method and hermeneutics, or methodical hermeneutics, which in turn is distinguished from alternative qualitative research methodologies. The article closes with considerations of quality criteria and publication standards.

  10. Final Report for research grant "Development of Methods for High Specific Activity Labeling of Biomolecules Using Astatine-211 in Different Oxidation States"

    Energy Technology Data Exchange (ETDEWEB)

    Wilbur, D., Scott

    2011-12-14

    The overall objective of this research effort was to develop methods for labeling biomolecules with higher oxidation state species of At-211. This was to be done in an effort to develop reagents that had higher in vivo stability than the present carbon-bonded At-211-labeled compounds. We were unsuccessful in that effort, as none of the approaches studied provided reagents that were stable to in vivo deastatination. However, we gained a lot of information about At-211 in higher oxidation states. The studies proved to be very difficult as small changes in pH and other conditions appeared to change the nature of the species that obtained (by HPLC retention time analyses), with many of the species being unidentifiable. The fact that there are no stable isotopes of astatine, and the chemistry of the nearest halogen iodine is quite different, made it very difficult to interpret results of some experiments. With that said, we believe that a lot of valuable information was obtained from the studies. The research effort evaluated: (1) methods for chemical oxidation of At-211, (2) approaches to chelation of oxidized At-211, and (3) approaches to oxidation of astatophenyl compounds. A major hurdle that had to be surmounted to conduct the research was the development of HPLC conditions to separate and identify the various oxidized species formed. Attempts to develop conditions for separation of iodine and astatine species by normal and reversed-phase TLC and ITLC were not successful. However, we were successful in developing conditions (from a large number of attempts) to separate oxidized forms of iodine ([I-125]iodide, [I-125]iodate and [I-125]periodate) and astatine ([At-211]astatide, [At-211]astatate, [At-211]perastatate, and several unidentified At-211 species). Information on the basic oxidation and characterization of At-211 species is provided under Objective 1. Conditions were developed to obtain new At-211 labeling method where At-211 is chelated with the DOTA and

  11. Developments in the Nursing Research

    OpenAIRE

    2008-01-01

    Technological and social changes as well as changes in health and demographic developments have modified considerably the role of nursing and made nursing research more and more essential. Nursing research aims at developing knowledge that guides and supports the whole field of nursing practice in order to improve the quality of nursing care and thereby improves the status of the profession. Like nursing itself, nursing research began with Florence Nightingale in her hospital reforms first in...

  12. Laboratory directed research and development

    Energy Technology Data Exchange (ETDEWEB)

    1991-11-15

    The purposes of Argonne's Laboratory Directed Research and Development (LDRD) Program are to encourage the development of novel concepts, enhance the Laboratory's R D capabilities, and further the development of its strategic initiatives. Among the aims of the projects supported by the Program are establishment of engineering proof-of-principle''; development of an instrumental prototype, method, or system; or discovery in fundamental science. Several of these project are closely associated with major strategic thrusts of the Laboratory as described in Argonne's Five Year Institutional Plan, although the scientific implications of the achieved results extend well beyond Laboratory plans and objectives. The projects supported by the Program are distributed across the major programmatic areas at Argonne. Areas of emphasis are (1) advanced accelerator and detector technology, (2) x-ray techniques in biological and physical sciences, (3) advanced reactor technology, (4) materials science, computational science, biological sciences and environmental sciences. Individual reports summarizing the purpose, approach, and results of projects are presented.

  13. Latest Research Development of Physical Rehabilitation Training Methods%体能康复训练方法的最新研究进展

    Institute of Scientific and Technical Information of China (English)

    檀志宗; 李男

    2011-01-01

    By the method of literature study, the paper discusses the development, functional mechanism and research status of some new methods of physical rehabilitation, such as hydrotherapy, Pilates and suspension exercise training. It makes some suggestions on the application of physical rehabilitation in competitive sports.%通过文献资料法,就体能康复发展中的若干新方法(如水疗、普拉提训练和悬吊训练)的发展历史,作用机制和研究现状进行分析和探讨,对这些体能康复方法在竞技体育中的应用提出思考和建议。

  14. Participatory Research for a Radical Community Development.

    Science.gov (United States)

    Mulenga, Derek C.

    1994-01-01

    Critically examines community development assumptions through historical analysis and mapping of political discourse. Using the methods of Foucault, Said, and Gramsci, demonstrates how participatory research, concerned with releasing people's knowledge through transformation, can expose and resist dominant discourses. (SK)

  15. Methods used for research regarding iteration in instructional design

    NARCIS (Netherlands)

    Verstegen, D.M.L.

    2004-01-01

    This paper focuses on the search for suitable research methods for research regarding iteration in instructional design. More specifically my research concerned the question how instructional designers can be supported during an iterative design process. Although instructional design and development

  16. Creative Research Methods - a reflective online discussion

    Directory of Open Access Journals (Sweden)

    Ruth Leary

    2014-03-01

    Full Text Available In November 2013, the Institute of Advanced Studies (University of Warwick hosted a meeting of interdisciplinary colleagues interested in Creative Research Methods. The aspirations were to kick-start the debate at Warwick and create a platform from which researchers can develop projects that embrace new forms of intellectual enquiry and knowledge production. Following the meeting, several of the attendees agreed to develop some of the discussion points and briefly responded to a number of questions in an online document over a period of a few weeks. This paper is the result of that real space and online collaboration.

  17. Social Media as a Research Method

    DEFF Research Database (Denmark)

    Wills, Tarrin Jon

    2016-01-01

    methodologies using similar interfaces to those of social media platforms. It then discusses some research tools developed by the author as a way of facilitating the interaction between researchers and primary sources using digital methods. Although much more limited than social media tools, it shows a way...... with some delay from the wide-scale adoption of the same technologies in other areas of society. This delay allows for a prediction about what technologies may be adopted in the near future in DH. In particular, the rise of social media in recent years provides a potential model for future DH research......, particularly as it differs greatly from previous technologies in its capacity to engage end-users in digital methods. This paper argues that the techniques by which users interact with data in social media, particularly categorisation and semantic tagging, can be applied to a broad range of humanities research...

  18. Reframing research on faculty development.

    Science.gov (United States)

    O'Sullivan, Patricia S; Irby, David M

    2011-04-01

    Research on faculty development has focused primarily on individual participants and has produced relatively little generalizable knowledge that can guide faculty development programs. In this article, the authors examine how current research on faculty development in medical education can be enriched by research in related fields such as teacher education, quality improvement, continuing medical education, and workplace learning. As a result of this analysis, the authors revise the old model for conceptualizing faculty development (preferably called professional development). This expanded model calls for research on educational process and outcomes focused on two communities of practice: the community created among participants in faculty development programs and the communities of teaching practice in the workplace (classroom or clinic) where teaching actually occurs. For the faculty development community, the key components are the participants, program, content, facilitator, and context in which the program occurs and in which the faculty teach. For the workplace community, associated components include relationships and networks of association in that environment, the organization and culture of the setting, the teaching tasks and activities, and the mentoring available to the members of that academic and/or clinical community of teaching practice. This expanded model of faculty development generates a new set of research questions, which are described along with six recommendations for enhancing research, including establishment of a national center for research in health professions education.

  19. Tradeoffs in Design Research: Development Oriented Triangulation

    NARCIS (Netherlands)

    Turnhout, Koen van; Craenmehr, Sabine; Holwerda, Robert; Menijn, Mark; Zwart, Jan-Pieter; Bakker, René

    2013-01-01

    The Development Oriented Triangulation (DOT) framework in this paper can spark and focus the debate about mixed-method approaches in HCI. The framework can be used to classify HCI methods, create mixed-method designs, and to align research activities in multidisciplinary projects. The framework is g

  20. Tradeoffs in Design Research: Development Oriented Triangulation

    NARCIS (Netherlands)

    Jan-Pieter Zwart; René Bakker; Robert Holwerda; Mark Menijn; Koen van Turnhout; Sabine Craenmehr

    2013-01-01

    The Development Oriented Triangulation (DOT) framework in this paper can spark and focus the debate about mixed-method approaches in HCI. The framework can be used to classify HCI methods, create mixed-method designs, and to align research activities in multidisciplinary projects. The framework is

  1. Nuclear methods in environmental and energy research

    Energy Technology Data Exchange (ETDEWEB)

    Vogt, J. R. [ed.

    1977-01-01

    The topics considered in the seven sessions were nuclear methods in atmospheric research; nuclear and atomic methodology; nuclear methods in tracer applications; energy exploration, production, and utilization; nuclear methods in environmental monitoring; nuclear methods in water research; and nuclear methods in biological research. Individual abstracts were prepared for each paper. (JSR)

  2. Qualitative Methods in Mental Health Services Research

    Science.gov (United States)

    Palinkas, Lawrence A.

    2014-01-01

    Qualitative and mixed methods play a prominent role in mental health services research. However, the standards for their use are not always evident, especially for those not trained in such methods. This paper reviews the rationale and common approaches to using qualitative and mixed methods in mental health services and implementation research based on a review of the papers included in this special series along with representative examples from the literature. Qualitative methods are used to provide a “thick description” or depth of understanding to complement breadth of understanding afforded by quantitative methods, elicit the perspective of those being studied, explore issues that have not been well studied, develop conceptual theories or test hypotheses, or evaluate the process of a phenomenon or intervention. Qualitative methods adhere to many of the same principles of scientific rigor as quantitative methods, but often differ with respect to study design, data collection and data analysis strategies. For instance, participants for qualitative studies are usually sampled purposefully rather than at random and the design usually reflects an iterative process alternating between data collection and analysis. The most common techniques for data collection are individual semi-structured interviews, focus groups, document reviews, and participant observation. Strategies for analysis are usually inductive, based on principles of grounded theory or phenomenology. Qualitative methods are also used in combination with quantitative methods in mixed method designs for convergence, complementarity, expansion, development, and sampling. Rigorously applied qualitative methods offer great potential in contributing to the scientific foundation of mental health services research. PMID:25350675

  3. Handbook of Research Methods in Social and Personality Psychology

    Science.gov (United States)

    Reis, Harry T.; Judd, Charles M.

    2000-03-01

    This volume provides an overview of research methods in contemporary social psychology. Coverage includes conceptual issues in research design, methods of research, and statistical approaches. Because the range of research methods available for social psychology have expanded extensively in the past decade, both traditional and innovative methods are presented. The goal is to introduce new and established researchers alike to new methodological developments in the field.

  4. Computational structural mechanics methods research using an evolving framework

    Science.gov (United States)

    Knight, N. F., Jr.; Lotts, C. G.; Gillian, R. E.

    1990-01-01

    Advanced structural analysis and computational methods that exploit high-performance computers are being developed in a computational structural mechanics research activity sponsored by the NASA Langley Research Center. These new methods are developed in an evolving framework and applied to representative complex structural analysis problems from the aerospace industry. An overview of the methods development environment is presented, and methods research areas are described. Selected application studies are also summarized.

  5. Software Development as Music Education Research

    Science.gov (United States)

    Brown, Andrew R.

    2007-01-01

    This paper discusses how software development can be used as a method for music education research. It explains how software development can externalize ideas, stimulate action and reflection, and provide evidence to support the educative value of new software-based experiences. Parallels between the interactive software development process and…

  6. Educational research methods for researching innovations in teaching, learning and assessment: The nursing lecturer as researcher.

    Science.gov (United States)

    Marks-Maran, Diane

    2015-11-01

    The author, who has had previous experience as a nurse researcher, has been engaged in helping nurse lecturers to undertake evaluation research studies into innovations in their teaching, learning and assessment methods. In order to undertake this work successfully, it was important to move from thinking like a nurse researcher to thinking like an educational researcher and developing the role of the nursing lecturer as researcher of their teaching. This article explores the difference between evaluation and evaluation research and argues for the need to use educational research methods when undertaking evaluation research into innovations in teaching, learning and assessment. A new model for educational evaluation research is presented together with two case examples of the model in use. The model has been tested on over 30 research studies into innovations in teaching, learning and assessment over the past 8 years. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. RDandD Programme 2007. Programme for research, development and demonstration of methods for the management and disposal of nuclear waste

    Energy Technology Data Exchange (ETDEWEB)

    2007-09-15

    The programme describes in general terms the planned measures and the facilities that are needed for the task, with a focus on the plans for the period 2008-2013. The period of immediate concern is 2008-2010. The level of detail for the three subsequent years is naturally lower. The programme provides a basis for designing systems to manage and dispose of the radioactive waste from the nuclear power plants. SKB intends to dispose of the spent nuclear fuel in accordance with the KBS-3 method. In the RDandD Programme we describe our activities and the planning for it. We also deal with societal research and other methods for disposal of spent nuclear fuel. The planning for low- and intermediate-level waste, as well as for the societal research, is presented in separate parts. The upcoming review of the programme can contribute valuable outside viewpoints. The regulatory authorities and the Government can clarify how they view different parts of the activity. Municipalities and other stakeholders can, after studying the programme, offer their viewpoints to SKB, the regulatory authorities or the Government. The most important milestone during the coming three-year period is to submit applications under the Nuclear Activities Act for the final repository for spent nuclear fuel and under the Environmental Code for the final repository system. RDandD programme 2007 therefore focuses on the technology development that is needed to realize the final repository for spent nuclear fuel. The site investigations in Forsmark and Laxemar will be concluded in 2007. The work of compiling the applications for the final repository is under way. In contrast to the immediately preceding programmes, RDandD Programme 2007 therefore also contains a summary of the site investigation phase and a look ahead at the steps that remain before the final repository can be put into operation. RDandD Programme 2007 consists of six parts: Part I SKB's plan of action; Part II Final repository for

  8. A Mixed-Methods Inquiry into Science Teachers' Perceptions of the Effects of Professional Development Experiences on Implementation of Research-Based Instructional Practices

    Science.gov (United States)

    Felton, Norma D.

    This was a modified integrated mixed methods study of teachers' perceptions of factors that influence transfer of research-based teaching strategies into classroom practice. Participants were made up of 66 respondents to a researcher made survey, "Survey of Teacher Attitudes toward Change and Classroom Implementation of Research--Based Strategies". Respondents were divided into two groups based on participation in Louisiana Systemic Initiatives Programs (LaSIP): LaSIP, N= 39 and Non-LaSIP, N= 27. Answers to five research questions were based on analysis of quantitative data from a survey, recorded on a five-point Likert scale and qualitative data from analyses of transcripts of three personal interviews, two focus group discussions and five short-answer questions on the survey. SPSS software version 9 and Atlas.ti version 7 were used in quantitative and qualitative analyses, respectively. Concurrent quantitative and qualitative strands of data were integrated throughout the study. Findings from quantitative data included the following: (1) Teacher perceptions of features of the LaSIP were predictive of reported frequency of use of research-based teaching strategies (RBTS); (2) Reported frequency of use of RBTS was not significantly different in LaSIP versus Non-LaSIP teachers, except in reported use of alternative assessments. (3) Both LaSIP and Non-LaSIP teachers indicated that implementation of RBTS increased student achievement (4) LaSIP teachers identified factors such as opportunity to collaborate with colleagues, time to acquire content knowledge, practice with material and supplies and modeling of RBTS as features of the LaSIP that positively influenced classroom implementation. (5) Perceived barriers to implementation of RBTS included lack of equipment and lack of teacher input into planning of professional development. Analyses of qualitative data supported many of the findings due to quantitative analyses. Additionally, qualitative data provided more in

  9. Mixed methods research in mental health nursing.

    Science.gov (United States)

    Kettles, A M; Creswell, J W; Zhang, W

    2011-08-01

    Mixed methods research is becoming more widely used in order to answer research questions and to investigate research problems in mental health and psychiatric nursing. However, two separate literature searches, one in Scotland and one in the USA, revealed that few mental health nursing studies identified mixed methods research in their titles. Many studies used the term 'embedded' but few studies identified in the literature were mixed methods embedded studies. The history, philosophical underpinnings, definition, types of mixed methods research and associated pragmatism are discussed, as well as the need for mixed methods research. Examples of mental health nursing mixed methods research are used to illustrate the different types of mixed methods: convergent parallel, embedded, explanatory and exploratory in their sequential and concurrent combinations. Implementing mixed methods research is also discussed briefly and the problem of identifying mixed methods research in mental and psychiatric nursing are discussed with some possible solutions to the problem proposed. © 2011 Blackwell Publishing.

  10. Research on the recycling industry development model for typical exterior plastic components of end-of-life passenger vehicle based on the SWOT method.

    Science.gov (United States)

    Zhang, Hongshen; Chen, Ming

    2013-11-01

    In-depth studies on the recycling of typical automotive exterior plastic parts are significant and beneficial for environmental protection, energy conservation, and sustainable development of China. In the current study, several methods were used to analyze the recycling industry model for typical exterior parts of passenger vehicles in China. The strengths, weaknesses, opportunities, and challenges of the current recycling industry for typical exterior parts of passenger vehicles were analyzed comprehensively based on the SWOT method. The internal factor evaluation matrix and external factor evaluation matrix were used to evaluate the internal and external factors of the recycling industry. The recycling industry was found to respond well to all the factors and it was found to face good developing opportunities. Then, the cross-link strategies analysis for the typical exterior parts of the passenger car industry of China was conducted based on the SWOT analysis strategies and established SWOT matrix. Finally, based on the aforementioned research, the recycling industry model led by automobile manufacturers was promoted.

  11. The Use of In Situ X-ray Imaging Methods in the Research and Development of Magnesium-Based Grain-Refined and Nanocomposite Materials

    Science.gov (United States)

    Sillekens, W. H.; Casari, D.; Mirihanage, W. U.; Terzi, S.; Mathiesen, R. H.; Salvo, L.; Daudin, R.; Lhuissier, P.; Guo, E.; Lee, P. D.

    2016-12-01

    Metallurgists have an ever-increasing suite of analytical techniques at their disposition. Among these techniques are the in situ methods, being those approaches that are designed to actually study events that occur in the material during for instance solidification, (thermo)-mechanical working or heat treatment. As such they are a powerful tool in unraveling the mechanisms behind these processes, supplementary to ex situ methods that instead analyze the materials before and after their processing. In this paper, case studies are presented of how in situ imaging methods—and more specifically micro-focus x-ray radiography and synchrotron x-ray tomography—are used in the research and development of magnesium-based grain-refined and nanocomposite materials. These results are drawn from the EC collaborative research project ExoMet (www.exomet-project.eu). The first example concerns the solidification of a Mg-Nd-Gd alloy with Zr addition to assess the role of zirconium content and cooling rate in crystal nucleation and growth. The second example concerns the solidification of a Mg-Zn-Al alloy and its SiC-containing nanocomposite material to reveal the influence of particle addition on microstructural development. The third example concerns the (partial) melting-solidification of Elektron21/AlN and Elektron21/Y2O3 nanocomposite materials to study such effects as particle pushing/engulfment and agglomeration during repeated processing. Such studies firstly visualize and by that confirm what is known or assumed. Secondly, they advance science by monitoring and quantifying phenomena as they evolve during processing and by that contribute toward a better understanding of the physics at play.

  12. Applying the Scientific Method of Cybersecurity Research

    Energy Technology Data Exchange (ETDEWEB)

    Tardiff, Mark F.; Bonheyo, George T.; Cort, Katherine A.; Edgar, Thomas W.; Hess, Nancy J.; Hutton, William J.; Miller, Erin A.; Nowak, Kathleen E.; Oehmen, Christopher S.; Purvine, Emilie AH; Schenter, Gregory K.; Whitney, Paul D.

    2016-09-15

    The cyber environment has rapidly evolved from a curiosity to an essential component of the contemporary world. As the cyber environment has expanded and become more complex, so have the nature of adversaries and styles of attacks. Today, cyber incidents are an expected part of life. As a result, cybersecurity research emerged to address adversarial attacks interfering with or preventing normal cyber activities. Historical response to cybersecurity attacks is heavily skewed to tactical responses with an emphasis on rapid recovery. While threat mitigation is important and can be time critical, a knowledge gap exists with respect to developing the science of cybersecurity. Such a science will enable the development and testing of theories that lead to understanding the broad sweep of cyber threats and the ability to assess trade-offs in sustaining network missions while mitigating attacks. The Asymmetric Resilient Cybersecurity Initiative at Pacific Northwest National Laboratory is a multi-year, multi-million dollar investment to develop approaches for shifting the advantage to the defender and sustaining the operability of systems under attack. The initiative established a Science Council to focus attention on the research process for cybersecurity. The Council shares science practices, critiques research plans, and aids in documenting and reporting reproducible research results. The Council members represent ecology, economics, statistics, physics, computational chemistry, microbiology and genetics, and geochemistry. This paper reports the initial work of the Science Council to implement the scientific method in cybersecurity research. The second section describes the scientific method. The third section in this paper discusses scientific practices for cybersecurity research. Section four describes initial impacts of applying the science practices to cybersecurity research.

  13. Mixed Methods Research as Third Methodological Movement:

    OpenAIRE

    Ahmad Mohammadpour; Rasoul Sadeghi; Mehdi Rezaei

    2010-01-01

    AbstractMixed Method Research is considered as the latest methodological orientation in social and behavioralsciences and sociology which has been developed following a long period of intra-paradigm controversiesbetween quantitative and qualitative approaches. Based on pragmatist perspective, the mixed methodresearch, while emphasizing on paradigm convergence, seeks to combine both quantitative and qualitativemethodologies in a single study which takes three forms containing of concurrent, se...

  14. ADDRESSING RESEARCH DESIGN PROBLEM IN MIXED METHODS RESEARCH

    OpenAIRE

    Hamed ALAVI; Patrycja HĄBEK

    2016-01-01

    Alongside other disciplines in social sciences, management researchers use mixed methods research more and more in conduct of their scientific investigations. Mixed methods approach can also be used in the field of production engineering. In comparison with traditional quantitative and qualitative research methods, reasons behind increasing popularity of mixed research method in management science can be traced in different factors. First of all, any particular discipline in management can be...

  15. Mixed Methods Research: A Research Paradigm Whose Time Has Come

    Science.gov (United States)

    Johnson, R. Burke; Onwuegbuzie, Anthony J.

    2004-01-01

    The purposes of this article are to position mixed methods research ("mixed research" is a synonym) as the natural complement to traditional qualitative and quantitative research, to present pragmatism as offering an attractive philosophical partner for mixed methods research, and to provide a framework for designing and conducting mixed methods…

  16. Mixed Methods Research: A Research Paradigm Whose Time Has Come

    Science.gov (United States)

    Johnson, R. Burke; Onwuegbuzie, Anthony J.

    2004-01-01

    The purposes of this article are to position mixed methods research ("mixed research" is a synonym) as the natural complement to traditional qualitative and quantitative research, to present pragmatism as offering an attractive philosophical partner for mixed methods research, and to provide a framework for designing and conducting mixed methods…

  17. Cloud Based Development Issues: A Methodical Analysis

    Directory of Open Access Journals (Sweden)

    Sukhpal Singh

    2012-11-01

    Full Text Available Cloud based development is a challenging task for various software engineering projects, especifically for those which demand extraordinary quality, reusability and security along with general architecture. In this paper we present a report on a methodical analysis of cloud based development problems published in major computer science and software engineering journals and conferences organized by various researchers. Research papers were collected from different scholarly databases using search engines within a particular period of time. A total of 89 research papers were analyzed in this methodical study and we categorized into four classes according to the problems addressed by them. The majority of the research papers focused on quality (24 papers associated with cloud based development and 16 papers focused on analysis and design. By considering the areas focused by existing authors and their gaps, untouched areas of cloud based development can be discovered for future research works.

  18. Research on the Dynamic Evaluation Method of Sustainable Development in Mining Area%矿区可持续发展动态评价方法研究

    Institute of Scientific and Technical Information of China (English)

    张金山; 乔大良

    2011-01-01

    Based on the actual development of China's mining background and relevant research results at home and abroad, the paper discusses a number of complex issues in the sustainable development in mining areas. The mining system consists of five sub-systems including resources, environment, economy, population and the technology, and the complex relationship of positive feedback and negative feedback exist in each sub-system and the internal elements of sub-system.Then, the simulation model of the complex system and the assisted prediction model for mining area are established, which proposes a new method for dynamic evaluation of sustainable development in mining area.%依据我国矿区发展的实际背景和国内外的相关研究成果,对矿区可持续发展中的若干复杂问题进行深入研究和探讨.矿区系统由资源、环境、经济、人口和科技5个子系统组成,各子系统之间及系统内部要素之间存在着复杂的正反馈和负反馈关系.建立了矿区复杂系统仿真模型及其辅助预测模型,提出了矿区可持续发展动态评价的新方法.

  19. The Impact of the 5E Teaching Model on Changes in Neuroscience, Drug Addiction, and Research Methods Knowledge of Science Teachers Attending California's ARISE Professional Development Workshops

    Science.gov (United States)

    Manzo, Rosa D.; Whent, Linda; Liets, Lauren; de la Torre, Adela; Gomez-Camacho, Rosa

    2016-01-01

    This study examined how science teachers' knowledge of research methods, neuroscience and drug addiction changed through their participation in a 5-day summer science institute. The data for this study evolved from a four-year NIH funded science education project called Addiction Research and Investigation for Science Educators (ARISE). Findings…

  20. Methods of marketing research in banking

    OpenAIRE

    Kraevskiy, B.; Makukhina, Ya.

    2017-01-01

    The paper considers the nature of marketing research in banking activities, the main directions of marketing research in the banking sector, identified tasks that can be solved based on the methods of marketing research

  1. Methods of marketing research in banking

    OpenAIRE

    Kraevskiy, B.; Makukhina, Ya.

    2017-01-01

    The paper considers the nature of marketing research in banking activities, the main directions of marketing research in the banking sector, identified tasks that can be solved based on the methods of marketing research

  2. Comparison of initial perturbation methods for the mesoscale ensemble prediction system of the Meteorological Research Institute for the WWRP Beijing 2008 Olympics Research and Development Project (B08RDP)

    Science.gov (United States)

    Saito, Kazuo; Hara, Masahiro; Kunii, Masaru; Seko, Hiromu; Yamaguchi, Munehiko

    2011-05-01

    Different initial perturbation methods for the mesoscale ensemble prediction were compared by the Meteorological Research Institute (MRI) as a part of the intercomparison of mesoscale ensemble prediction systems (EPSs) of the World Weather Research Programme (WWRP) Beijing 2008 Olympics Research and Development Project (B08RDP). Five initial perturbation methods for mesoscale ensemble prediction were developed for B08RDP and compared at MRI: (1) a downscaling method of the Japan Meteorological Agency (JMA)'s operational one-week EPS (WEP), (2) a targeted global model singular vector (GSV) method, (3) a mesoscale model singular vector (MSV) method based on the adjoint model of the JMA non-hydrostatic model (NHM), (4) a mesoscale breeding growing mode (MBD) method based on the NHM forecast and (5) a local ensemble transform (LET) method based on the local ensemble transform Kalman filter (LETKF) using NHM. These perturbation methods were applied to the preliminary experiments of the B08RDP Tier-1 mesoscale ensemble prediction with a horizontal resolution of 15 km. To make the comparison easier, the same horizontal resolution (40 km) was employed for the three mesoscale model-based initial perturbation methods (MSV, MBD and LET). The GSV method completely outperformed the WEP method, confirming the advantage of targeting in mesoscale EPS. The GSV method generally performed well with regard to root mean square errors of the ensemble mean, large growth rates of ensemble spreads throughout the 36-h forecast period, and high detection rates and high Brier skill scores (BSSs) for weak rains. On the other hand, the mesoscale model-based initial perturbation methods showed good detection rates and BSSs for intense rains. The MSV method showed a rapid growth in the ensemble spread of precipitation up to a forecast time of 6 h, which suggests suitability of the mesoscale SV for short-range EPSs, but the initial large growth of the perturbation did not last long. The

  3. Nuclear methods in environmental and energy research

    Energy Technology Data Exchange (ETDEWEB)

    Vogt, J R [ed.

    1980-01-01

    A total of 75 papers were presented on nuclear methods for analysis of environmental and biological samples. Sessions were devoted to software and mathematical methods; nuclear methods in atmospheric and water research; nuclear and atomic methodology; nuclear methods in biology and medicine; and nuclear methods in energy research.

  4. DESIGNING THE STRATEGIES FOR SOCIO-ECONOMIC DEVELOPMENT OF MUNICIPALITY DISTRICTS ON THE BASIS OF SYNTHESIS METHODS FOR COMPLEX SYSTEMS RESEARCH

    Directory of Open Access Journals (Sweden)

    Sergey N. Isaev

    2014-01-01

    Full Text Available The article presents the results of research work on designing the strategies for socio-economic development for the Sholokhovskiy municipal district of Rostov region and Chusovskoy municipal district of Perm Region, which was made by research team of autonomous nonprofit organization of higher education «Eurasian Open Institute» (EOI during the 2012-2013.

  5. Action Research Methods: Plain and Simple

    Science.gov (United States)

    Klein, Sheri R., Ed.

    2012-01-01

    Among the plethora of action research books on the market, there is no one text exclusively devoted to understanding how to acquire and interpret research data. Action Research Methods provides a balanced overview of the quantitative and qualitative methodologies and methods for conducting action research within a variety of educational…

  6. Action Research Methods: Plain and Simple

    Science.gov (United States)

    Klein, Sheri R., Ed.

    2012-01-01

    Among the plethora of action research books on the market, there is no one text exclusively devoted to understanding how to acquire and interpret research data. Action Research Methods provides a balanced overview of the quantitative and qualitative methodologies and methods for conducting action research within a variety of educational…

  7. Using Qualitative Research Methods in Higher Education

    Science.gov (United States)

    Savenye, Wilhelmina C.; Robinson, Rhonda S.

    2005-01-01

    Researchers investigating issues related to computing in higher education are increasingly using qualitative research methods to conduct their investigations. However, they may have little training or experience in qualitative research. The purpose of this paper is to introduce researchers to the appropriate use of qualitative methods. It begins…

  8. Internationalization of Research and Development

    DEFF Research Database (Denmark)

    Håkanson, Lars

    2014-01-01

    This chapter outlines historical and recent trends in the internationalization of research and development (R&D) in multinational corporations (MNCs). It discusses the motives and driving forces that lead firms to perform R&D in foreign locations and the managerial and policy issues associated......, in some cases, applied and basic research. Managerial systems, procedures, and practices for coordination and control of internationally decentralized R&D are identified, along with mechanisms promoting knowledge management, problem solving, and innovation....

  9. Shooting Back and "Looking for Life" in the USA and Haiti: "Seeing" the Ethics of Visual Research Methods through a Development Lens

    Science.gov (United States)

    Zenkov, Kristien; Ewaida, Marriam; Lynch, Megan R.; Bell, Athene; Harmon, James; Pellegrino, Anthony; Sell, Corey

    2014-01-01

    Relying on a critical pedagogy framework and youth participatory action research (YPAR) and visual sociology methods, the authors of this article--teachers, teacher educators, and community activists--have worked with photo elicitation methods and young adults in the USA and Haiti to document youths' impressions of the purposes of, supports for,…

  10. Shooting Back and "Looking for Life" in the USA and Haiti: "Seeing" the Ethics of Visual Research Methods through a Development Lens

    Science.gov (United States)

    Zenkov, Kristien; Ewaida, Marriam; Lynch, Megan R.; Bell, Athene; Harmon, James; Pellegrino, Anthony; Sell, Corey

    2014-01-01

    Relying on a critical pedagogy framework and youth participatory action research (YPAR) and visual sociology methods, the authors of this article--teachers, teacher educators, and community activists--have worked with photo elicitation methods and young adults in the USA and Haiti to document youths' impressions of the purposes of, supports…

  11. Participatory design methods in telemedicine research

    DEFF Research Database (Denmark)

    Danbjørg, Dorthe Boe; Clemensen, Jane; Rothmann, Mette Juel

    together with the patients. Participatory design is a research design and methodology that encourages the participation of users in the design process of technological solutions. Therefore, it has a potential for designing technologies that actually reflect the needs of the users, why it is relevant within...... telemedicine. The aim of this presentation is to explain the process and theoretical framework of a PD project; give an example of a project including the applied methods, and to determine its application to telemedicine with focus on the rationale for genuine participation. Theory: Participation implies....... Methods: Key activities of a Participatory Design project comprise methods such as fieldwork; literature reviewing; development and testing, and user activities as workshops. Methods that support telling, making, enacting. For instance telling activities as drivers for participation, where practitioners...

  12. ADDRESSING RESEARCH DESIGN PROBLEM IN MIXED METHODS RESEARCH

    Directory of Open Access Journals (Sweden)

    Hamed ALAVI

    2016-01-01

    Full Text Available Alongside other disciplines in social sciences, management researchers use mixed methods research more and more in conduct of their scientific investigations. Mixed methods approach can also be used in the field of production engineering. In comparison with traditional quantitative and qualitative research methods, reasons behind increasing popularity of mixed research method in management science can be traced in different factors. First of all, any particular discipline in management can be theoretically related to it. Second is that concurrent approach of mixed research method to inductive and deductive research logic provides researchers with opportunity to generate theory and test hypothesis in one study simultaneously. In addition, it provides a better justification for chosen method of investigation and higher validity for obtained answers to research questions. Despite increasing popularity of mixed research methods among management scholars, there is still need for a comprehensive approach to research design typology and process in mixed research method from the perspective of management science. The authors in this paper try to explain fundamental principles of mixed research method, its typology and different steps in its design process.

  13. Professional development workshops for physics education research

    Science.gov (United States)

    Sayre, Eleanor C.; Franklin, Scott V.; Kustusch, Mary Bridget

    2017-01-01

    Physics education research holds the promise of satisfying expectations of both scholarship, which is increasing at teaching-centric institutions, and teaching effectiveness, a concern at all institutions. Additionally, junior physics education researchers seek more diverse training in research methods and theories. Emerging education researchers need support as they develop their research programs and expand their theoretical and methodological expertise, and they benefit from the guidance of knowledgable peers and near-peers. Our two-part professional development model combines intensive in-person workshops with long-term remote activities. During a two-week in-person workshop, emerging and established education researchers work closely together to develop research questions, learn appropriate analytic techniques, and collect a corpus of data appropriate to their research questions. Afterwards, they meet biweekly in a distributed, mentored research group to share analyses and develop their ideas into publishable papers. In this talk, we discuss this model for professional development and show results from one three-year implementation in the IMPRESS program at the Rochester Institute of Technology. Partially funded by the PERTG of the AAPT.

  14. NGNP Research and Development Status

    Energy Technology Data Exchange (ETDEWEB)

    David A. Petti

    2010-08-01

    At the inception of the Next Generation Nuclear Plant (NGNP) project, experts from the Department of Energy (DOE) national laboratories, gas reactor vendors, and universities collaborated to establish technology research and development (R&D) roadmaps. These roadmaps outlined the testing and computational development activities needed to qualify the materials and validate the modeling and simulation tools to be used in the design and safe operation of the NGNP, a helium-cooled, high temperature gas reactor (HTGR).

  15. Children's Literature in the Undergraduate Course on Communication Research Methods

    Science.gov (United States)

    Brown, Daniel S.

    2010-01-01

    Objective: Students will develop positive attitudes toward communication research by linking new values and principles with the familiar values and principles contained in children's literature. Course: Communication Research Methods.

  16. Children's Literature in the Undergraduate Course on Communication Research Methods

    Science.gov (United States)

    Brown, Daniel S.

    2010-01-01

    Objective: Students will develop positive attitudes toward communication research by linking new values and principles with the familiar values and principles contained in children's literature. Course: Communication Research Methods.

  17. Research Facility Development at CAS

    Institute of Scientific and Technical Information of China (English)

    Tian Dongsheng; Miao Yougui; Zhang Hongsong

    2005-01-01

    @@ This article gives an introductory account on the development of research facilities at the CAS over the past six years since the initiation of the Knowledge Innovation Program in 1998 and during the period of the national 10th Five-year Plan in particular. In addition, it expounds the key points for the future work at the CAS in this regard.

  18. Suborbital Research and Development Opportunities

    Science.gov (United States)

    Davis, Jeffrey R.

    2011-01-01

    This slide presentation reviews the new strategies for problem solving in the life sciences in the suborbital realm. Topics covered are: an overview of the space life sciences, the strategic initiatives that the Space Life Sciences organization engaged in, and the new business model that these initiatives were developed. Several opportunities for research are also reviewed.

  19. Using mixed methods in health research

    OpenAIRE

    Tariq, Shema; Woodman, Jenny

    2013-01-01

    Summary Mixed methods research is the use of quantitative and qualitative methods in a single study or series of studies. It is an emergent methodology which is increasingly used by health researchers, especially within health services research. There is a growing literature on the theory, design and critical appraisal of mixed methods research. However, there are few papers that summarize this methodological approach for health practitioners who wish to conduct or critically engage with mixe...

  20. Qualitative Methods in Drug Utilization Research

    DEFF Research Database (Denmark)

    Almarsdóttir, Anna Birna; Bastholm Rahmner, Pia

    2016-01-01

    Qualitative research methods derive from the social sciences. Their use in drug utilization research is increasingly widespread, especially in understanding patient and prescriber perspectives. The main focus in qualitative research is exploration of a given phenomenon in order to get a wider...... understanding of why and how it appears. Qualitative research methods build on various theoretical underpinnings/schools of thought. The same validity and quality criteria cannot be used for both qualitative and quantitative methods....

  1. Research Methods in European Union Studies

    DEFF Research Database (Denmark)

    Research methods and designs from the social sciences and beyond can, and should, be applied in research directed at EU affairs. The purpose of this edited collection is twofold: (1) to provide a state-of-the-art examination of social science research methods in EU studies and (2) to provide...... innovative guidelines to the advancement of more inclusive and empirically sensitive research methods in EU studies....

  2. Research methods for subgrouping low back pain

    DEFF Research Database (Denmark)

    Kent, Peter; Keating, Jennifer L; Leboeuf-Yde, Charlotte

    2010-01-01

    important distinctions in their treatment needs or prognoses. Due to a proliferation of research methods and variability in how subgrouping results are interpreted, it is timely to open discussion regarding a conceptual framework for the research designs and statistical methods available for subgrouping...... studies (a method framework). The aims of this debate article are: (1) to present a method framework to inform the design and evaluation of subgrouping research in low back pain, (2) to describe method options when investigating prognostic effects or subgroup treatment effects, and (3) to discuss...... the strengths and limitations of research methods suitable for the hypothesis-setting phase of subgroup studies....

  3. Research and Development Services: Methods Development. Appendices

    Science.gov (United States)

    1982-07-23

    day. One analyst can perform approximately eight extractions in an 8-hour day. 2. CHEMISTRY A. ALTERNATE NOMENCLATURE AND CHEMICAL ABSTRACT SERVICE...AMD.3/HXH20.2 10/6/81 2. CHEMISTRY A. ALTERNATE NOMENCLATURE AND CHEMICAL ABSTRACT SERVICE (CAS) REGISTRY NUMBER CAS Registry Analyte Alternate...One analyst can perform approximately eight extractions in an 8-hour day.L 2. CHEMISTRY A. ALTERNATE NOMENCLATURE AND CHEMICAL ABSTRACT SERVICE (CAB

  4. Decomposition methods in turbulence research

    Directory of Open Access Journals (Sweden)

    Uruba Václav

    2012-04-01

    Full Text Available Nowadays we have the dynamical velocity vector field of turbulent flow at our disposal coming thanks advances of either mathematical simulation (DNS or of experiment (time-resolved PIV. Unfortunately there is no standard method for analysis of such data describing complicated extended dynamical systems, which is characterized by excessive number of degrees of freedom. An overview of candidate methods convenient to spatiotemporal analysis for such systems is to be presented. Special attention will be paid to energetic methods including Proper Orthogonal Decomposition (POD in regular and snapshot variants as well as the Bi-Orthogonal Decomposition (BOD for joint space-time analysis. Then, stability analysis using Principal Oscillation Patterns (POPs will be introduced. Finally, the Independent Component Analysis (ICA method will be proposed for detection of coherent structures in turbulent flow-field defined by time-dependent velocity vector field. Principle and some practical aspects of the methods are to be shown. Special attention is to be paid to physical interpretation of outputs of the methods listed above.

  5. Development of Trusted Computing Research

    Institute of Scientific and Technical Information of China (English)

    ZHANG Huanguo; LUO Jie; JIN Gang; ZHU Zhiqiang; YU Fajiang; YAN Fei

    2006-01-01

    Trusted computing is the new trend of information security today. This paper surveys the theory and technology of trusted computing. The development history of trusted computing, and the development of trusted computing in China are introduced in this paper,and then it analyzes some problems of trusted computing at present which are delay in theory research, some key technologies to be developed and lack of trusted software system. Some fields are worthy to be explored on are pointed out including key technology, basic theory and application in trusted computing.

  6. Software Development Cost Estimation Methods

    Directory of Open Access Journals (Sweden)

    Bogdan Stepien

    2003-01-01

    Full Text Available Early estimation of project size and completion time is essential for successful project planning and tracking. Multiple methods have been proposed to estimate software size and cost parameters. Suitability of the estimation methods depends on many factors like software application domain, product complexity, availability of historical data, team expertise etc. Most common and widely used estimation techniques are described and analyzed. Current research trends in software estimation cost are also presented.

  7. An Acupuncture Research Protocol Developed from Historical Writings by Mathematical Reflections: A Rational Individualized Acupoint Selection Method for Immediate Pain Relief

    Directory of Open Access Journals (Sweden)

    Sven Schroeder

    2013-01-01

    Full Text Available While balancing yin and yang is one basic principle of Chinese medicine, balancing methods for combination of meridians and acupoints had been described throughout the history of Chinese medicine. We have identified six historical systems for combinations of acupuncture points in historical writings. All of them represent symmetrical combinations which are defined by the steps in the Chinese Clock. Taking the historical systems as a basis, we calculated the possible combinations that fit into these systems they revealed, leading to a total of 19 systems offering new balancing combinations. Merging the data of these 19 systems, there are 7 combinatorial options for every meridian. On the basis of this data, we calculated 4-meridian combinations with an ideal balance pattern, which is given when all meridians balance each other. We identified 5 of these patterns for every meridian, so we end up with 60 patterns for all the 12 meridians but we find multiple overlapping. Finally, 15 distinct patterns remain. By combining this theoretical concept with the Image and Mirror Concept, we developed an acupuncture research protocol. This protocol potentially solves some problems of acupuncture trials because it represents a rational reproducible procedure independent of examiner experience, but the resulting treatment is individualized.

  8. Fundamental Research and Developing Countries

    CERN Document Server

    Narison, Stéphan

    2002-01-01

    In the first part of this report, I discuss the sociological role of fundamental research in Developing Countries (DC) and how to realize this program. In the second part, I give a brief and elementary introduction to the field of high-energy physics (HEP), accessible to a large audience not necessary physicists. The aim of this report is to make politicians and financial backers aware on the long-term usefulness of fundamental research in DC and on the possible globalisation of HEP and, in general, of science.

  9. Using mixed methods in health research

    Science.gov (United States)

    Woodman, Jenny

    2013-01-01

    Summary Mixed methods research is the use of quantitative and qualitative methods in a single study or series of studies. It is an emergent methodology which is increasingly used by health researchers, especially within health services research. There is a growing literature on the theory, design and critical appraisal of mixed methods research. However, there are few papers that summarize this methodological approach for health practitioners who wish to conduct or critically engage with mixed methods studies. The objective of this paper is to provide an accessible introduction to mixed methods for clinicians and researchers unfamiliar with this approach. We present a synthesis of key methodological literature on mixed methods research, with examples from our own work and that of others, to illustrate the practical applications of this approach within health research. We summarize definitions of mixed methods research, the value of this approach, key aspects of study design and analysis, and discuss the potential challenges of combining quantitative and qualitative methods and data. One of the key challenges within mixed methods research is the successful integration of quantitative and qualitative data during analysis and interpretation. However, the integration of different types of data can generate insights into a research question, resulting in enriched understanding of complex health research problems. PMID:23885291

  10. Using mixed methods in health research.

    Science.gov (United States)

    Tariq, Shema; Woodman, Jenny

    2013-06-01

    Mixed methods research is the use of quantitative and qualitative methods in a single study or series of studies. It is an emergent methodology which is increasingly used by health researchers, especially within health services research. There is a growing literature on the theory, design and critical appraisal of mixed methods research. However, there are few papers that summarize this methodological approach for health practitioners who wish to conduct or critically engage with mixed methods studies. The objective of this paper is to provide an accessible introduction to mixed methods for clinicians and researchers unfamiliar with this approach. We present a synthesis of key methodological literature on mixed methods research, with examples from our own work and that of others, to illustrate the practical applications of this approach within health research. We summarize definitions of mixed methods research, the value of this approach, key aspects of study design and analysis, and discuss the potential challenges of combining quantitative and qualitative methods and data. One of the key challenges within mixed methods research is the successful integration of quantitative and qualitative data during analysis and interpretation. However, the integration of different types of data can generate insights into a research question, resulting in enriched understanding of complex health research problems.

  11. Development of research discourses: a conceptual map.

    Science.gov (United States)

    Freshwater, Dawn; Cahill, Jane

    2016-09-01

    The aim of this study was to discuss: (1) how methodologies are constructed and perpetuated in the context of research paradigms; (2) what exactly constitutes a paradigm; (3) how the proposed conceptual map of discourse development provides a new and original method for understanding knowledge production. In nursing research, methodologies are constructed by several external and internal contextually driven influences. Our focus is on how two methodological paradigms - evidence-based practice and mixed methods - continue to impact and be impacted by patterns of knowledge production. Discussion paper. This discussion is based on our own experiences and supported by literature and theory using examples from the two paradigms to illustrate how discourses are developed, perpetuated and deconstructed and how these have specific impacts on qualitative nursing research. The conceptual map should be used to cultivate an awareness in practitioners, researchers and policy makers of how discourses surrounding research evidence and research practices are generated. This level of awareness will facilitate critical reflection on how certain practices assume dominance, potentially leading to hegemony in nursing research, practice and scholarship. This research offers a critical examination of the meaning of paradigms and a meta-perspective on the production and practice of methodologies using a conceptual map of discourse development as a heuristic device. We anticipate that these examples will encourage debate and discussion on how methodologies and paradigms are perpetuated in academia and the impact this has on nursing knowledge. © 2016 John Wiley & Sons Ltd.

  12. Research Methods in Interlanguage Pragmatics.

    Science.gov (United States)

    Kasper, Gabriele; Dahl, Merete

    1991-01-01

    A review of data collection methods used in 39 studies of interlanguage pragmatics, focusing on the validity of different types of data resulting from discourse completion, role play, observation of authentic speech, and multiple approaches, concludes that caution is needed in determining the true validity of the collected data. (72 references)…

  13. RESEARCH METHODS OF LOCATIVE ELEMENT

    Directory of Open Access Journals (Sweden)

    SULAYMANOVA N.J.

    2012-01-01

    Full Text Available The article is devoted to the methods of investigation of locative elements. Sentence analysis with locative elements is taken according to the results of component analysis in the system of contradicting – opposition. More over the article is full of examples related to the description of various syntactic units.

  14. Multiple Methods: Research Methods in Education Projects at NSF

    Science.gov (United States)

    Suter, Larry E.

    2005-01-01

    Projects on science and mathematics education research supported by the National Science Foundation (US government) rarely employ a single method of study. Studies of educational practices that use experimental design are very rare. The most common research method is the case study method and the second most common is some form of experimental…

  15. Negotiating a Systems Development Method

    Science.gov (United States)

    Karlsson, Fredrik; Hedström, Karin

    Systems development methods (or methods) are often applied in tailored version to fit the actual situation. Method tailoring is in most the existing literature viewed as either (a) a highly rational process with the method engineer as the driver where the project members are passive information providers or (b) an unstructured process where the systems developer makes individual choices, a selection process without any driver. The purpose of this chapter is to illustrate that important design decisions during method tailoring are made by project members through negotiation. The study has been carried out using the perspective of actor-network theory. Our narratives depict method tailoring as more complex than (a) and (b) show the driver role rotates between the project members, and design decisions are based on influences from several project members. However, these design decisions are not consensus decisions.

  16. Recommendations for Culturally Sensitive Research Methods

    Science.gov (United States)

    Awad, Germine H.; Patall, Erika A.; Rackley, Kadie R.; Reilly, Erin D.

    2016-01-01

    As the US continues to diversify, methods for accurately assessing human behavior must evolve. This paper offers multicultural research considerations at several stages of the research process for psychological research and consultation. Implications regarding the comparative research framework are discussed and suggestions are offered on how to…

  17. Recommendations for Culturally Sensitive Research Methods

    Science.gov (United States)

    Awad, Germine H.; Patall, Erika A.; Rackley, Kadie R.; Reilly, Erin D.

    2016-01-01

    As the US continues to diversify, methods for accurately assessing human behavior must evolve. This paper offers multicultural research considerations at several stages of the research process for psychological research and consultation. Implications regarding the comparative research framework are discussed and suggestions are offered on how to…

  18. Research Dilemmas: Paradigms, Methods and Methodology

    Science.gov (United States)

    Mackenzie, Noella; Knipe, Sally

    2006-01-01

    In this article the authors discuss issues faced by early career researchers, including the dichotomy, which many research textbooks and journal articles create and perpetuate between qualitative and quantitative research methodology despite considerable literature to support the use of mixed methods. The authors review current research literature…

  19. Learning and Teaching Research Methods in Management Education: Development of a Curriculum to Combine Theory and Practice--A Swiss Case

    Science.gov (United States)

    Hoidn, Sabine; Olbert-Bock, Sibylle

    2016-01-01

    Purpose: In the context of the creation of a two-year Master of Science in Business Administration programme to offer a scientifically sound and practice-related management education in Switzerland, a curriculum for learning and teaching research methods had to be designed. Major pedagogic challenges were identified and addressed by curricular…

  20. Learning and Teaching Research Methods in Management Education: Development of a Curriculum to Combine Theory and Practice--A Swiss Case

    Science.gov (United States)

    Hoidn, Sabine; Olbert-Bock, Sibylle

    2016-01-01

    Purpose: In the context of the creation of a two-year Master of Science in Business Administration programme to offer a scientifically sound and practice-related management education in Switzerland, a curriculum for learning and teaching research methods had to be designed. Major pedagogic challenges were identified and addressed by curricular…

  1. The Delphi Method for Graduate Research

    Science.gov (United States)

    Skulmoski, Gregory J.; Hartman, Francis T.; Krahn, Jennifer

    2007-01-01

    The Delphi method is an attractive method for graduate students completing masters and PhD level research. It is a flexible research technique that has been successfully used in our program at the University of Calgary to explore new concepts within and outside of the information systems body of knowledge. The Delphi method is an iterative process…

  2. Internationalization of Research and Development

    DEFF Research Database (Denmark)

    Håkanson, Lars

    2014-01-01

    This chapter outlines historical and recent trends in the internationalization of research and development (R&D) in multinational corporations (MNCs). It discusses the motives and driving forces that lead firms to perform R&D in foreign locations and the managerial and policy issues associated...... with geographically dispersed and organizationally decentralized R&D. A simple typology of foreign R&D units is presented, emphasizing that the opportunities and challenges vary with the nature of their tasks, which range from technical support and local adaptation of products and processes to product development and......, in some cases, applied and basic research. Managerial systems, procedures, and practices for coordination and control of internationally decentralized R&D are identified, along with mechanisms promoting knowledge management, problem solving, and innovation....

  3. Research and development serving society

    Energy Technology Data Exchange (ETDEWEB)

    1981-01-01

    In the F. R. of Germany we can look back to a successful development of r and d in industry, science and private as well as public research institutions. After it had become necessary to fill the 'technological gap', and to bridge over the distance towards other industrial countries more and more technologies and problem fields were developed apart from nuclear engineering and space research like electronics, communication engineering, transport and traffic, non-nuclear energy generation, environment research, health research, bioengineering and the humanization of work. The success and the activities of the past are considerable but so are the challenges of the future. In view of the undiminished worldwide population growth we shall have to reckon with an increased demand for energy and raw materials. That is why it is more important than ever to handle all resources of the world more economically, and with more care. The promotion of technologies which can diminish on dependence on raw materials and energy, reduce the ecological burdens and improve the living and working conditions shall remain the main objective of the BMFT. This brochure policy and the promotion tasks which are performed by the Bundesministerium fuer Forschung und Technologie.

  4. [Pharmaceutical technology: development and research].

    Science.gov (United States)

    Traisnel, M

    1994-06-01

    Production of pharmaceutics cannot be compared to the manufacture of consumer goods: pharmaceutical manufacturing is the study and bulk manufacture of the ingredients from which medicines are made, and is concerned with the mixing, preparing, packing, of the ingredients into a dosage form for the patient, in according to the good manufacturing practices (GMP). Development and manufacture are not discrete activities but links in a single chain of activity. Research and development, pharmaceutical training, regulatory requirements: these concepts are present with three ways: bioavailability, targeting and compliance.

  5. [Framework analysis method in qualitative research].

    Science.gov (United States)

    Liao, Xing; Liu, Jian-ping; Robison, Nicola; Xie, Ya-ming

    2014-05-01

    In recent years a number of qualitative research methods have gained popularity within the health care arena. Despite this popularity, different qualitative analysis methods pose many challenges to most researchers. The present paper responds to the needs expressed by recent Chinese medicine researches. The present paper is mainly focused on the concepts, nature, application of framework analysis, especially on how to use it, in such a way to assist the newcomer of Chinese medicine researchers to engage with the methodology.

  6. Power Control Method for Research Reactor

    Energy Technology Data Exchange (ETDEWEB)

    Baang, Dane; Suh, Yongsuk; Park, Cheol [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2015-05-15

    Considering safety-oriented design concept and other control environment, we developed a simple controller that provides limiting function of power change- rate as well as fine tracking performance. The design result has been well-proven via simulation and actual application to a TRIGA-II type research reactor. The proposed controller is designed to track the PDM(Power Demand) from operator input as long as maintaining the power change rate lower than a certain value for stable reactor operation. A power control method for a TRIGA-II type research reactor has been designed, simulated, and applied to actual reactor. The control performance during commissioning test shows that the proposed controller provides fine control performance for various changes in reference values (PDM), even though there is large measurement noise from neutron detectors. The overshoot at low power level is acceptable in a sense of reactor operation.

  7. Qualitative research methods in Software Engineering

    Directory of Open Access Journals (Sweden)

    Patrick Anya

    2014-12-01

    Full Text Available In the investigation of Software Engineering coexist two different research methods: 1 the quantitative that try to measure and analyze the casual relationship between the variables in a frame with free values, and 2 the qualitative that examine the creation process of meanings from which is generated new theorems or improve. Apply this methods separately in the research in software engineer makes evident that obtain results are incomplete and so is difficult to choose definitively wit which of them embark in a specific research. To approach this problem, in this article are described the quantitative methods as research methods to this engineer, and described its benefits and difficulties.

  8. Entrepreneurship research in Spain: developments and distinctiveness.

    Science.gov (United States)

    Sánchez, José C; Gutiérrez, Andrea

    2011-08-01

    This article presents a review of research on entrepreneurship in Spain, paying particular attention to its beginnings, nature and main focus of interest. We have developed a database based on the review of 471 works produced between 1977 and 2009, including articles published in national and international journals and dissertations (read in Spain) that allowed us to extract the following results. There is a preference for qualitative methods, conceptual contributions and the entrepreneurial process as the privileged research theme. There is also a strong focus of interest on micro and small enterprises. These characteristics of Spanish research in areas of entrepreneurship can make a distinctive contribution to international research. However, the dissemination of knowledge and inadequate strategies for international publication limit the diffusion of Spanish research in entrepreneurship. Lastly, we discuss the implications for future research.

  9. Center Independent Research & Developments: JPL IRAD Program

    Data.gov (United States)

    National Aeronautics and Space Administration — Innovative projects are sought in the areas of basic research, fundamental research, applied research, development and systems and other concept formulation studies....

  10. Integrating Research Skills Training into Non--Research Methods Courses

    Science.gov (United States)

    Woolf, Jules

    2014-01-01

    Research skills are a valued commodity by industry and university administrators. Despite the importance placed on these skills students typically dislike taking research method courses where these skills are learned. However, training in research skills does not necessarily have to be confined to these courses. In this study participants at a…

  11. Advances in structure research by diffraction methods

    CERN Document Server

    Hoppe, W

    1974-01-01

    Advances in Structure Research by Diffraction Methods: Volume 5 presents discussions on application of diffraction methods in structure research. The book provides the aspects of structure research using various diffraction methods. The text contains 2 chapters. Chapter 1 reviews the general theory and experimental methods used in the study of all types of amorphous solid, by both X-ray and neutron diffraction, and the detailed bibliography of work on inorganic glasses. The second chapter discusses electron diffraction, one of the major methods of determining the structures of molecules in the

  12. Approaches to Mixed Methods Dissemination and Implementation Research: Methods, Strengths, Caveats, and Opportunities

    OpenAIRE

    Green, Carla A.; Duan, Naihua; Gibbons, Robert D.; Hoagwood, Kimberly E; Palinkas, Lawrence A.; Wisdom, Jennifer P.

    2015-01-01

    Limited translation of research into practice has prompted study of diffusion and implementation, and development of effective methods of encouraging adoption, dissemination and implementation. Mixed methods techniques offer approaches for assessing and addressing processes affecting implementation of evidence-based interventions. We describe common mixed methods approaches used in dissemination and implementation research, discuss strengths and limitations of mixed methods approaches to data...

  13. Business model in research-development activity

    Directory of Open Access Journals (Sweden)

    Koszałka Jerzy

    2016-09-01

    Full Text Available The partners and allies of business practice in the processes of modernization of the economy are scientific-research institutions, such as scientific institutes, research-development units and universities. A market on which companies can look for the solutions they need and scientific-research institutions can look for inspiration, partners and capital is being formed. The market provides conditions for operation, development and implementation of developed solutions. Taking into consideration the complexity of market, technical, legal, financial, or intellectual property protection issues, research-development units are more and more frequently unable to function efficiently without a clear and unequivocal definition of goals, methods and conditions of activity. Their market offer has to take into consideration not just scientific-research, or methodological aspects. Taking into consideration continuously growing demands of the clients and pressure of the competition, scientific-research institutions have to pay attention also to market, information, personnel, or financial aspects typical of strictly commercial ventures. What may support a comprehensive preparation and implementation of scientific-research activities under market conditions are tools successfully used in trade and economy, such as business models. These issues are the basis of deliberations contained in this work.

  14. Development of unconventional forming methods

    Directory of Open Access Journals (Sweden)

    S. Rusz

    2012-10-01

    Full Text Available Purpose: Paper presents results of progress ECAP processing method for UFG structure reached (gained.The properties and microstructure are influenced by technological factors during application ECAP method.Design/methodology/approach: Summary of methods studied on Department of technology at Machining faculty of VŠB-TU Ostrava through of co-operation with Institute of Engineering Materials and Biomaterials, Silesian University of Technology is presented.Findings: Achievement of ultra-fine grained structure in initial material leads to substantial increase of plasticity and makes it possible to form materials in conditions of „superplastic state“. Achievement of the required structure depends namely of the tool geometry, number of passes through the matrix, obtained deformation magnitude and strain rate, process temperature and lubrication conditions. High deformation at comparatively low homologous temperatures is an efficient method of production of ultra-fine grained solid materials.The new technologies, which use severe plastic deformation, comprise namely these techniques: High Pressure Torsion, Equal Channel Angular Pressing = ECAP, Cyclic Channel Die Compression = CCDC, Cyclic Extrusion Compression = CEC, Continuous Extrusion Forming = CONFORM, Accumulative Roll Bonding, Constrained Groove Pressing.Research limitations/implications: Achieved hardness and microstructure characteristics will be determined by new research.Practical implications: The results may be utilized for a relation between structure and properties of the investigated materials in future process of manufacturing.Originality/value: These results contribute to complex evaluation of properties new metals after application unconventional forming methods. The results of this paper are determined for research workers deal by the process severe plastic deformation.

  15. Development Model for Research Infrastructures

    Science.gov (United States)

    Wächter, Joachim; Hammitzsch, Martin; Kerschke, Dorit; Lauterjung, Jörn

    2015-04-01

    Research infrastructures (RIs) are platforms integrating facilities, resources and services used by the research communities to conduct research and foster innovation. RIs include scientific equipment, e.g., sensor platforms, satellites or other instruments, but also scientific data, sample repositories or archives. E-infrastructures on the other hand provide the technological substratum and middleware to interlink distributed RI components with computing systems and communication networks. The resulting platforms provide the foundation for the design and implementation of RIs and play an increasing role in the advancement and exploitation of knowledge and technology. RIs are regarded as essential to achieve and maintain excellence in research and innovation crucial for the European Research Area (ERA). The implementation of RIs has to be considered as a long-term, complex development process often over a period of 10 or more years. The ongoing construction of Spatial Data Infrastructures (SDIs) provides a good example for the general complexity of infrastructure development processes especially in system-of-systems environments. A set of directives issued by the European Commission provided a framework of guidelines for the implementation processes addressing the relevant content and the encoding of data as well as the standards for service interfaces and the integration of these services into networks. Additionally, a time schedule for the overall construction process has been specified. As a result this process advances with a strong participation of member states and responsible organisations. Today, SDIs provide the operational basis for new digital business processes in both national and local authorities. Currently, the development of integrated RIs in Earth and Environmental Sciences is characterised by the following properties: • A high number of parallel activities on European and national levels with numerous institutes and organisations participating

  16. Miscellaneous standard methods for Apis mellifera research

    NARCIS (Netherlands)

    Human, H.; Brodschneider, R.; Dietemann, V.; Dively, G.; Ellis, J.D.; Forsgren, E.; Fries, I.; Hatjina, F.; Hu, F.L.; Jaffe, R.; Jensen, A.B.; Kohler, A.; Magyar, J.P.; Ouml; zkyrym, A.; Pirk, C.W.W.; Rose, R.; Strauss, U.; Tanner, G.; Tarpy, D.R.; Steen, van der J.J.M.; Vaudo, A.; Vejsnaes, F.; Wilde, de J.; Williams, G.R.; Zheng, H.Q.

    2013-01-01

    A variety of methods are used in honey bee research and differ depending on the level at which the research is conducted. On an individual level, the handling of individual honey bees, including the queen, larvae and pupae are required. There are different methods for the immobilising, killing and s

  17. Exploring methods in information literacy research

    CERN Document Server

    Lipu, Suzanne; Lloyd, Annemaree

    2007-01-01

    This book provides an overview of approaches to assist researchers and practitioners to explore ways of undertaking research in the information literacy field. The first chapter provides an introductory overview of research by Dr Kirsty Williamson (author of Research Methods for Students, Academics and Professionals: Information Management and Systems) and this sets the scene for the rest of the chapters where each author explores the key aspects of a specific method and explains how it may be applied in practice. The methods covered include those representing qualitative, quantitative and mix

  18. Future methods in pharmacy practice research

    DEFF Research Database (Denmark)

    Almarsdottir, A B; Babar, Z U D

    2016-01-01

    This article describes the current and future practice of pharmacy scenario underpinning and guiding this research and then suggests future directions and strategies for such research. First, it sets the scene by discussing the key drivers which could influence the change in pharmacy practice...... of the trends for pharmacy practice research methods are discussed. © 2016, Springer International Publishing....... research. These are demographics, technology and professional standards. Second, deriving from this, it seeks to predict and forecast the future shifts in use of methodologies. Third, new research areas and availability of data impacting on future methods are discussed. These include the impact of aging...

  19. Autoethnography as an Accessible Method of Research

    Directory of Open Access Journals (Sweden)

    Patrycja Polczyk

    2012-11-01

    Full Text Available Reflecting on my own experiences as a researcher with a disability who lives and works in Poland, I examine methodological issues critical to conducting qualitative research. I argue that autoethnography is a viable method for researchers who must overcome physical and/or cultural obstacles associated with a disability. I also maintain that autoethnography as well as its usefulness as a research method is inherently situated within the sociocultural conditions in which research is being conducted. Concluding, I imply that further studies are necessary for people with disabilities to re-gain voice and articulate their experiences.

  20. Mapping Methods Metadata for Research Data

    Directory of Open Access Journals (Sweden)

    Tiffany Chao

    2015-02-01

    Full Text Available Understanding the methods and processes implemented by data producers to generate research data is essential for fostering data reuse. Yet, producing the metadata that describes these methods remains a time-intensive activity that data producers do not readily undertake. In particular, researchers in the long tail of science often lack the financial support or tools for metadata generation, thereby limiting future access and reuse of data produced. The present study investigates research journal publications as a potential source for identifying descriptive metadata about methods for research data. Initial results indicate that journal articles provide rich descriptive content that can be sufficiently mapped to existing metadata standards with methods-related elements, resulting in a mapping of the data production process for a study. This research has implications for enhancing the generation of robust metadata to support the curation of research data for new inquiry and innovation.

  1. Research on Negotiating Agent Development

    Institute of Scientific and Technical Information of China (English)

    WEI Ding-guo; PENG Hong

    2004-01-01

    The paper presents a flexible and effective method of development of negotiating agents.A strategy specification, which is specified by a state chart and defeasible rules, can be dynamically inserted into an agent shell incorporating a state chart interpreter and a defeasible logic inference engine, in order to yield a desirable agent.The set of desirable criteria and rules is required to be justified with different context of the application.

  2. Using observational methods in nursing research.

    Science.gov (United States)

    Salmon, Jenny

    2015-07-08

    Observation is a research data-collection method used generally to capture the activities of participants as well as when and where things are happening in a given setting. It checks description of the phenomena against what the researcher perceives to be fact in a rich experiential context. The method's main strength is that it provides direct access to the social phenomena under consideration. It can be used quantitatively or qualitatively, depending on the research question. Challenges in using observation relate to adopting the role of participant or non-participant researcher as observer. This article discusses some of the complexities involved when nurse researchers seek to collect observational data on social processes in naturalistic settings using unstructured or structured observational methods in qualitative research methodology. A glossary of research terms is provided.

  3. Research methods for English language teachers

    CERN Document Server

    McDonough, Jo

    2014-01-01

    This book offers a lively introduction to the research methods and techniques available to English language teachers who wish to investigate aspects of their own practice. It covers qualitative and quantitative methodology and includes sections on observation, introspection, diary studies, experiments, interviews, questionnaires, numerical techniques and case study research. Each method is illustrated with examples in language teaching contexts, and techniques of data collection and analysis are introduced. The authors focus particularly on research in the classroom, on tests, materials, the

  4. Mixed method designs in implementation research.

    Science.gov (United States)

    Palinkas, Lawrence A; Aarons, Gregory A; Horwitz, Sarah; Chamberlain, Patricia; Hurlburt, Michael; Landsverk, John

    2011-01-01

    This paper describes the application of mixed method designs in implementation research in 22 mental health services research studies published in peer-reviewed journals over the last 5 years. Our analyses revealed 7 different structural arrangements of qualitative and quantitative methods, 5 different functions of mixed methods, and 3 different ways of linking quantitative and qualitative data together. Complexity of design was associated with number of aims or objectives, study context, and phase of implementation examined. The findings provide suggestions for the use of mixed method designs in implementation research.

  5. Qualitative versus quantitative methods in psychiatric research.

    Science.gov (United States)

    Razafsha, Mahdi; Behforuzi, Hura; Azari, Hassan; Zhang, Zhiqun; Wang, Kevin K; Kobeissy, Firas H; Gold, Mark S

    2012-01-01

    Qualitative studies are gaining their credibility after a period of being misinterpreted as "not being quantitative." Qualitative method is a broad umbrella term for research methodologies that describe and explain individuals' experiences, behaviors, interactions, and social contexts. In-depth interview, focus groups, and participant observation are among the qualitative methods of inquiry commonly used in psychiatry. Researchers measure the frequency of occurring events using quantitative methods; however, qualitative methods provide a broader understanding and a more thorough reasoning behind the event. Hence, it is considered to be of special importance in psychiatry. Besides hypothesis generation in earlier phases of the research, qualitative methods can be employed in questionnaire design, diagnostic criteria establishment, feasibility studies, as well as studies of attitude and beliefs. Animal models are another area that qualitative methods can be employed, especially when naturalistic observation of animal behavior is important. However, since qualitative results can be researcher's own view, they need to be statistically confirmed, quantitative methods. The tendency to combine both qualitative and quantitative methods as complementary methods has emerged over recent years. By applying both methods of research, scientists can take advantage of interpretative characteristics of qualitative methods as well as experimental dimensions of quantitative methods.

  6. Focusing on What Counts: Using Exploratory Focus Groups to Enhance the Development of an Electronic Survey in a Mixed-Methods Research Design

    Science.gov (United States)

    Galliott, Natal'ya; Graham, Linda J.

    2016-01-01

    This paper illustrates the use of exploratory focus groups to inform the development of a survey instrument in a sequential phase mixed-methods study investigating differences in secondary students' career choice capability. Five focus groups were conducted with 23 Year 10 students in the state of New South Wales, Australia. Analysis of the focus…

  7. Focusing on What Counts: Using Exploratory Focus Groups to Enhance the Development of an Electronic Survey in a Mixed-Methods Research Design

    Science.gov (United States)

    Galliott, Natal'ya; Graham, Linda J.

    2016-01-01

    This paper illustrates the use of exploratory focus groups to inform the development of a survey instrument in a sequential phase mixed-methods study investigating differences in secondary students' career choice capability. Five focus groups were conducted with 23 Year 10 students in the state of New South Wales, Australia. Analysis of the focus…

  8. Feminist research: definitions, methodology, methods and evaluation.

    Science.gov (United States)

    Webb, C

    1993-03-01

    The literature relating to feminist research both within and beyond nursing is reviewed in this paper. Feminist research is located within a post-positivist paradigm, and various definitions are considered. The distinctive methodological approach of feminist research is discussed, and interviewing and ethnography are evaluated as suitable methods for use in feminist research. Oakley's (1981) paper on interviewing women is subjected to criticism. A final section examines attempts by three sets of writers to propose evaluation criteria for feminist research. The review concludes that a number of paradoxes and dilemmas in feminist research have yet to be resolved.

  9. Research and Development. Annual Report 2000

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2001-07-01

    This report discusses the research and development activities in which NVE has been involved in 2000. These activities fall into three categories: watercourse research, hydrological research and energy related research. The HYDRA research programme, which studied flooding and human intervention, is discussed in particular. The report includes a list of research and development reports that were published in 2000.

  10. Using mixed methods in music therapy health care research

    DEFF Research Database (Denmark)

    Bonde, Lars Ole

    2015-01-01

    »Mixed methods« (or »multiple methods») is a fairly new concept in music therapy research. It is inspired by recent methodological developments in social science, covering the interaction of quantitative and qualitative methods in one and the same research study. Mixed methods are not the same...... as the diversity or pluralism of methods advocated by many scholars who are critical towards the principles of evidence-based medicine. This article presents a concrete example of mixed methods in music therapy research: a psycho-social study of music therapy with female cancer survivors. Problems related...

  11. Mixed Method Designs in Implementation Research

    OpenAIRE

    Palinkas, Lawrence A; Aarons, Gregory A.; Horwitz, Sarah; Chamberlain, Patricia; Hurlburt, Michael; Landsverk, John

    2010-01-01

    This paper describes the application of mixed method designs in implementation research in 22 mental health services research studies published in peer-reviewed journals over the last 5 years. Our analyses revealed 7 different structural arrangements of qualitative and quantitative methods, 5 different functions of mixed methods, and 3 different ways of linking quantitative and qualitative data together. Complexity of design was associated with number of aims or objectives, study context, and...

  12. CSM research: Methods and application studies

    Science.gov (United States)

    Knight, Norman F., Jr.

    1989-01-01

    Computational mechanics is that discipline of applied science and engineering devoted to the study of physical phenomena by means of computational methods based on mathematical modeling and simulation, utilizing digital computers. The discipline combines theoretical and applied mechanics, approximation theory, numerical analysis, and computer science. Computational mechanics has had a major impact on engineering analysis and design. When applied to structural mechanics, the discipline is referred to herein as computational structural mechanics. Complex structures being considered by NASA for the 1990's include composite primary aircraft structures and the space station. These structures will be much more difficult to analyze than today's structures and necessitate a major upgrade in computerized structural analysis technology. NASA has initiated a research activity in structural analysis called Computational Structural Mechanics (CSM). The broad objective of the CSM activity is to develop advanced structural analysis technology that will exploit modern and emerging computers, such as those with vector and/or parallel processing capabilities. Here, the current research directions for the Methods and Application Studies Team of the Langley CSM activity are described.

  13. Mixed-methods research in nursing - a critical review.

    Science.gov (United States)

    Bressan, Valentina; Bagnasco, Annamaria; Aleo, Giuseppe; Timmins, Fiona; Barisone, Michela; Bianchi, Monica; Pellegrini, Ramona; Sasso, Loredana

    2017-10-01

    To review the use of mixed-methods research in nursing with a particular focus on the extent to which current practice informs nurse researchers. It also aimed to highlight gaps in current knowledge, understanding and reporting of this type of research. Mixed-methods research is becoming increasingly popular among nurses and healthcare professionals. Emergent findings from this type of research are very useful for nurses in practice. The combination of both quantitative and qualitative methods provides a scientific base for practice but also richness from the qualitative enquiry. However, at the same time mixed-methods research is underdeveloped. This study identified mixed-methods research papers and critically evaluated their usefulness for research practice. To support the analysis, we performed a two-stage search using CINAHL to find papers with titles that included the key term 'mixed method'. An analysis of studies that used mixed-methods research revealed some inconsistencies in application and reporting. Attempts to use two distinct research methods in these studies often meant that one or both aspects had limitations. Overall methods were applied in a less rigorous way. This has implications for providing somewhat limited direction for novice researchers. There is also potential for application of evidence in healthcare practice that limited validity. This study highlights current gaps in knowledge, understanding and reporting of mixed-methods research. While these methods are useful to gain insight into clinical problems nurses lack guidance with this type of research. This study revealed that the guidance provided by current mixed-methods research is inconsistent and incomplete and this compounds the lack of available direction. There is an urgent need to develop robust guidelines for using mixed-methods research so that findings may be critically implemented in practice. © 2016 John Wiley & Sons Ltd.

  14. Advanced research reactor fuel development

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Chang Kyu; Pak, H. D.; Kim, K. H. [and others

    2000-05-01

    The fabrication technology of the U{sub 3}Si fuel dispersed in aluminum for the localization of HANARO driver fuel has been launches. The increase of production yield of LEU metal, the establishment of measurement method of homogeneity, and electron beam welding process were performed. Irradiation test under normal operation condition, had been carried out and any clues of the fuel assembly breakdown was not detected. The 2nd test fuel assembly has been irradiated at HANARO reactor since 17th June 1999. The quality assurance system has been re-established and the eddy current test technique has been developed. The irradiation test for U{sub 3}Si{sub 2} dispersed fuels at HANARO reactor has been carried out in order to compare the in-pile performance of between the two types of U{sub 3}Si{sub 2} fuels, prepared by both the atomization and comminution processes. KAERI has also conducted all safety-related works such as the design and the fabrication of irradiation rig, the analysis of irradiation behavior, thermal hydraulic characteristics, stress analysis for irradiation rig, and thermal analysis fuel plate, for the mini-plate prepared by international research cooperation being irradiated safely at HANARO. Pressure drop test, vibration test and endurance test were performed. The characterization on powders of U-(5.4 {approx} 10 wt%) Mo alloy depending on Mo content prepared by rotating disk centrifugal atomization process was carried out in order to investigate the phase stability of the atomized U-Mo alloy system. The {gamma}-U phase stability and the thermal compatibility of atomized U-16at.%Mo and U-14at.%Mo-2at.%X(: Ru, Os) dispersion fuel meats at an elevated temperature have been investigated. The volume increases of U-Mo compatibility specimens were almost the same as or smaller than those of U{sub 3}Si{sub 2}. However the atomized alloy fuel exhibited a better irradiation performance than the comminuted alloy. The RERTR-3 irradiation test of nano

  15. The Value of Mixed Methods Research: A Mixed Methods Study

    Science.gov (United States)

    McKim, Courtney A.

    2017-01-01

    The purpose of this explanatory mixed methods study was to examine the perceived value of mixed methods research for graduate students. The quantitative phase was an experiment examining the effect of a passage's methodology on students' perceived value. Results indicated students scored the mixed methods passage as more valuable than those who…

  16. Carbon sequestration research and development

    Energy Technology Data Exchange (ETDEWEB)

    Reichle, Dave; Houghton, John; Kane, Bob; Ekmann, Jim; and others

    1999-12-31

    Predictions of global energy use in the next century suggest a continued increase in carbon emissions and rising concentrations of carbon dioxide (CO{sub 2}) in the atmosphere unless major changes are made in the way we produce and use energy--in particular, how we manage carbon. For example, the Intergovernmental Panel on Climate Change (IPCC) predicts in its 1995 ''business as usual'' energy scenario that future global emissions of CO{sub 2} to the atmosphere will increase from 7.4 billion tonnes of carbon (GtC) per year in 1997 to approximately 26 GtC/year by 2100. IPCC also projects a doubling of atmospheric CO{sub 2} concentration by the middle of next century and growing rates of increase beyond. Although the effects of increased CO{sub 2} levels on global climate are uncertain, many scientists agree that a doubling of atmospheric CO{sub 2} concentrations could have a variety of serious environmental consequences. The goal of this report is to identify key areas for research and development (R&D) that could lead to an understanding of the potential for future use of carbon sequestration as a major tool for managing carbon emissions. Under the leadership of DOE, researchers from universities, industry, other government agencies, and DOE national laboratories were brought together to develop the technical basis for conceiving a science and technology road map. That effort has resulted in this report, which develops much of the information needed for the road map.

  17. Healthy ageing, narrative method and research ethics.

    Science.gov (United States)

    Sarvimäki, Anneli

    2015-08-01

    The purpose of this article is to describe research and teaching activities related to healthy ageing, narrative methods and research ethics at the Nordic School of Public Health NHV during 1999 - 2012. Healthy ageing was conceived in terms of The World Health Organization's (WHO) model of active ageing and of quality of life defined as a sense of well-being, meaning and value. Qualitative research on ageing and health conducted at NHV showed how elderly people themselves experience health and what they perceive to be health promoting. Narrative method was one the qualitative methods used in research at NHV. By adopting holistic and categorical content analysis the life stories of elderly Finnish migrants, the stories of home-dwelling persons about falls, and working persons' stories of alcohol use were studied. The courses on research ethics took their point of departure in a model that describes the role of scientific, economic, aesthetic and ethical values in research.

  18. Pictorial Analysis in Research on Education: Method and Concepts

    Science.gov (United States)

    Skareus, Eva

    2009-01-01

    Pictures are rarely used as the principal research material in research on the teaching profession. This article presents the central analytical concepts and method development of such a study. The research material consisted of pictures that art student teachers created from a given theme: Who are you as a teacher? The theoretical frame combines…

  19. Infusing Active Learning into the Research Methods Unit

    Science.gov (United States)

    Bluestone, Cheryl

    2007-01-01

    The research methods unit of survey psychology classes introduces important concepts of scientific reasoning and fluency, making it an ideal course in which to deliver enhanced curricula. To increase interest and engagement, the author developed an expanded research methods and statistics module to give students the opportunity to explore…

  20. Critical Realism and Empirical Research Methods in Education

    Science.gov (United States)

    Scott, David

    2005-01-01

    In the light of recent writings of Richard Pring, and in relation to the application of empirical research methods in education, this paper offers a corrective to a neo-realist viewpoint and develops a critical realist perspective. The argument is made that the deployment of empirical research methods needs to be underpinned by a meta-theory…

  1. RDandD Programme 2010. Programme for research, development and demonstration of methods for the management and disposal of nuclear waste

    Energy Technology Data Exchange (ETDEWEB)

    2010-09-15

    RDandD Programme 2010 presents SKB's plans for research, development and demonstration during the period 2011-2016. SKB's activities are divided into two main areas: the programme for low- and intermediate-level waste (the LILW Programme) and the Nuclear Fuel Programme. Operation of the existing facilities takes place within the Operational Process. RDandD Programme 2010 consists of five parts: Part I Overall plan of action Part II The LILW Programme Part III The Nuclear Fuel Programme Part IV Research for assessment of long-term safety Part V Social science research RDandD Programme 2007 was mainly focused on development of technology to realize the final repository for spent nuclear fuel. The efforts described were aimed at gaining a greater knowledge of long-term safety and compiling technical supporting documentation for applications under the Nuclear Activities Act for the final repository for spent nuclear fuel and under the Environmental Code for the final repository system. Many important results from these efforts are reported in this programme. The integrated account of the results will be presented in applications submitted in early 2011. The regulatory review of RDandD Programme 2007 and its supplement called for clarifications of plans and programmes for the final repository for short-lived radioactive waste, SFR, and the final repository for long-lived waste, SFL. This RDandD Programme describes these plans more clearly

  2. The Challenges of Developing Research Resources for Leading Vietnamese Universities

    Science.gov (United States)

    Nguyen, Thi Lan Huong

    2013-01-01

    This paper examines the challenges of developing research resources for leading Vietnamese universities. The first part of the paper presents the background to the study, including literature review on the challenges to research resources development, and describes the research questions and research methods. The next part provides empirical…

  3. Why, and how, mixed methods research is undertaken in health services research in England: a mixed methods study

    Science.gov (United States)

    O'Cathain, Alicia; Murphy, Elizabeth; Nicholl, Jon

    2007-01-01

    Background Recently, there has been a surge of international interest in combining qualitative and quantitative methods in a single study – often called mixed methods research. It is timely to consider why and how mixed methods research is used in health services research (HSR). Methods Documentary analysis of proposals and reports of 75 mixed methods studies funded by a research commissioner of HSR in England between 1994 and 2004. Face-to-face semi-structured interviews with 20 researchers sampled from these studies. Results 18% (119/647) of HSR studies were classified as mixed methods research. In the documentation, comprehensiveness was the main driver for using mixed methods research, with researchers wanting to address a wider range of questions than quantitative methods alone would allow. Interviewees elaborated on this, identifying the need for qualitative research to engage with the complexity of health, health care interventions, and the environment in which studies took place. Motivations for adopting a mixed methods approach were not always based on the intrinsic value of mixed methods research for addressing the research question; they could be strategic, for example, to obtain funding. Mixed methods research was used in the context of evaluation, including randomised and non-randomised designs; survey and fieldwork exploratory studies; and instrument development. Studies drew on a limited number of methods – particularly surveys and individual interviews – but used methods in a wide range of roles. Conclusion Mixed methods research is common in HSR in the UK. Its use is driven by pragmatism rather than principle, motivated by the perceived deficit of quantitative methods alone to address the complexity of research in health care, as well as other more strategic gains. Methods are combined in a range of contexts, yet the emerging methodological contributions from HSR to the field of mixed methods research are currently limited to the single

  4. A Review of Research Methods in Children's Technology Design

    DEFF Research Database (Denmark)

    Jensen, Janne Jul; Skov, Mikael B.

    2005-01-01

    Research methods have been objects of discussions for dec-ades and defining research methods is still a quite substan-tial challenge. However, it is important to understand how research methods have been adapted in different disciplines as it potentially informs us on future directions and influ......-ences on the discipline. Inspired by previous studies from other disciplines, we conduct a survey of research methods in paper publications. 105 papers on children's technology design are classified on a two-dimensional matrix on research method and pur-pose. Our results show a strong focus on engineering of products...... as applied research and on evaluation of devel-oped products in the field or in the lab. Also, we find that much research is conducted in natural setting environments with strong focus on field studies....

  5. Reality Research Methods: An Innovative Teaching Strategy for Generation Y

    Science.gov (United States)

    van Eeden-Moorefield, Brad; Walsh, Christine

    2010-01-01

    Those who teach research methods courses may struggle to engage students who are anxious or apprehensive about taking the course. Thus, it becomes the obligation of the instructor to develop innovative approaches so that students overcome their apprehension, learn the material, and, it is hoped, develop a passion for research. The authors present…

  6. Evolution of Research Methods for Probing and Understanding Metacognition

    Science.gov (United States)

    Anderson, David; Nashon, Samson M.; Thomas, Gregory P.

    2009-01-01

    This paper reports on the development, self-critique and evolution of research methods for interpreting and understanding students' metacognition that were developed through the Metacognition and Reflective Inquiry (MRI) collaborative study. The MRI collaborative was a multi-year, multi-case, research study that investigated the elusive nature and…

  7. Developing a research skill set.

    Science.gov (United States)

    You, Y Nancy; Bednarski, Brian

    2014-06-01

    The recent decades have witnessed a significant expansion in the diversity of career paths within academic surgery. Although the skills for providing exemplary surgical care and for maintaining a strong work ethic are the foundations of an academic surgeon, deliberate career planning and organized acquisition of research skills contribute to the success of an academic career. In this article, we identify a set of core academic skills and propose a framework for acquiring them. We also describe specific career paths within academic surgery and provide an overview of the opportunities for acquiring specific skill sets. The development of an academic career is challenging, and firm knowledge of the personal motivations will sustain and endure the time needed for acquiring the needed skills.

  8. Dynamic management of sustainable development methods for large technical systems

    CERN Document Server

    Krishans, Zigurds; Merkuryev, Yuri; Oleinikova, Irina

    2014-01-01

    Dynamic Management of Sustainable Development presents a concise summary of the authors' research in dynamic methods analysis of technical systems development. The text illustrates mathematical methods, with a focus on practical realization and applications.

  9. Approaches to Mixed Methods Dissemination and Implementation Research: Methods, Strengths, Caveats, and Opportunities.

    Science.gov (United States)

    Green, Carla A; Duan, Naihua; Gibbons, Robert D; Hoagwood, Kimberly E; Palinkas, Lawrence A; Wisdom, Jennifer P

    2015-09-01

    Limited translation of research into practice has prompted study of diffusion and implementation, and development of effective methods of encouraging adoption, dissemination and implementation. Mixed methods techniques offer approaches for assessing and addressing processes affecting implementation of evidence-based interventions. We describe common mixed methods approaches used in dissemination and implementation research, discuss strengths and limitations of mixed methods approaches to data collection, and suggest promising methods not yet widely used in implementation research. We review qualitative, quantitative, and hybrid approaches to mixed methods dissemination and implementation studies, and describe methods for integrating multiple methods to increase depth of understanding while improving reliability and validity of findings.

  10. Space Radiation Transport Methods Development

    Science.gov (United States)

    Wilson, J.; Tripathi, R.; Qualls, G.; Cucinotta, F.; Prael, R.; Norbury, J.

    Early space radiation shield code development relied on Monte Carlo methods for proton, neutron and pion transport and made important contributions to the space program. More recently Monte Carlo code LAHET has been upgraded to include high-energy multiple-charged light ions for GCR simulations and continues to be expanded in capability. To compensate for low computational efficiency, Monte Carlo methods have resorted to restricted one-dimensional problems leading to imperfect representations of appropriate boundary conditions. Even so, intensive computational requirements resulted and shield evaluation was made near the end of the design process and resolving shielding issues usually had a negative impact on the design. We evaluate the implications of these common one-dimensional assumptions on the evaluation of the Shuttle internal radiation field. Improved spacecraft shield design requires early entry of radiation constraints into the design process to maximize performance and minimize costs. As a result, we have been investigating high-speed computational procedures to allow shield analysis from the preliminary design concepts to the final design. In particular, we will discuss the progress towards a full three-dimensional and computationally efficient deterministic code for which the current HZETRN evaluates the lowest order asymptotic term. HZETRN is the first deterministic solution to the Boltzmann equation allowing field mapping within the International Space Station (ISS) in tens of minutes using standard Finite Element Method (FEM) geometry common to engineering design practice enabling development of integrated multidisciplinary design optimization methods. A single ray trace in ISS FEM geometry requires 14 milliseconds and severely limits application of Monte Carlo methods to such engineering models. A potential means of improving the Monte Carlo efficiency in coupling to spacecraft geometry is given in terms of reconfigurable computing and could be

  11. Using mixed methods when researching communities.

    Science.gov (United States)

    Ochieng, Bertha M N; Meetoo, Danny

    2015-09-01

    To argue for the use of mixed methods when researching communities. Although research involving minority communities is now advanced, not enough effort has been made to formulate methodological linkages between qualitative and quantitative methods in most studies. For instance, the quantitative approaches used by epidemiologists and others in examining the wellbeing of communities are usually empirical. While the rationale for this is sound, quantitative findings can be expanded with data from in-depth qualitative approaches, such as interviews or observations, which are likely to provide insights into the experiences of people in those communities and their relationships with their wellbeing. Academic databases including The Cochrane Library, MEDLINE, CINAHL, AMED, INTERNURSE, Science Direct, Web of Knowledge and PubMed. An iterative process of identifying eligible literature was carried out by comprehensively searching electronic databases. Using mixed-methods approaches is likely to address any potential drawbacks of individual methods by exploiting the strengths of each at the various stages of research. Combining methods can provide additional ways of looking at a complex problem and improve the understanding of a community's experiences. However, it is important for researchers to use the different methods interactively during their research. The use of qualitative and quantitative methods is likely to enrich our understanding of the interrelationship between wellbeing and the experiences of communities. This should help researchers to explore socio-cultural factors and experiences of health and healthcare practice more effectively.

  12. Methods, goals and educational design research

    NARCIS (Netherlands)

    McKenney, Susan

    2014-01-01

    McKenney, S. (2013). Methods, goals and educational design research. Invited panel presentation at the annual meeting of the European Association for Practitioner Resaerch on Improving Learning. November 27-29, Biel/Bienne, Switzerland.

  13. Methods, goals and educational design research

    NARCIS (Netherlands)

    McKenney, Susan

    2014-01-01

    McKenney, S. (2013). Methods, goals and educational design research. Invited panel presentation at the annual meeting of the European Association for Practitioner Resaerch on Improving Learning. November 27-29, Biel/Bienne, Switzerland.

  14. Mixed Methods Research Designs in Counseling Psychology

    Science.gov (United States)

    Hanson, William E.; Creswell, John W.; Clark, Vicki L. Plano; Petska, Kelly S.; Creswell, David J.

    2005-01-01

    With the increased popularity of qualitative research, researchers in counseling psychology are expanding their methodologies to include mixed methods designs. These designs involve the collection, analysis, and integration of quantitative and qualitative data in a single or multiphase study. This article presents an overview of mixed methods…

  15. Mixed Methods Research Designs in Counseling Psychology

    Science.gov (United States)

    Hanson, William E.; Creswell, John W.; Clark, Vicki L. Plano; Petska, Kelly S.; Creswell, David J.

    2005-01-01

    With the increased popularity of qualitative research, researchers in counseling psychology are expanding their methodologies to include mixed methods designs. These designs involve the collection, analysis, and integration of quantitative and qualitative data in a single or multiphase study. This article presents an overview of mixed methods…

  16. The Delphi Method in Rehabilitation Counseling Research

    Science.gov (United States)

    Vazquez-Ramos, Robinson; Leahy, Michael; Estrada Hernandez, Noel

    2007-01-01

    Rehabilitation researchers have found in the application of the Delphi method a more sophisticated way of obtaining consensus from experts in the field on certain matters. The application of this research methodology has affected and certainly advanced the body of knowledge of the rehabilitation counseling practice. However, the rehabilitation…

  17. Global/local methods research using the CSM testbed

    Science.gov (United States)

    Knight, Norman F., Jr.; Ransom, Jonathan B.; Griffin, O. Hayden, Jr.; Thompson, Danniella M.

    1990-01-01

    Research activities in global/local stress analysis are described including both two- and three-dimensional analysis methods. These methods are being developed within a common structural analysis framework. Representative structural analysis problems are presented to demonstrate the global/local methodologies being developed.

  18. Mapping Mixed Methods Research: Methods, Measures, and Meaning

    Science.gov (United States)

    Wheeldon, J.

    2010-01-01

    This article explores how concept maps and mind maps can be used as data collection tools in mixed methods research to combine the clarity of quantitative counts with the nuance of qualitative reflections. Based on more traditional mixed methods approaches, this article details how the use of pre/post concept maps can be used to design qualitative…

  19. Mapping Mixed Methods Research: Methods, Measures, and Meaning

    Science.gov (United States)

    Wheeldon, J.

    2010-01-01

    This article explores how concept maps and mind maps can be used as data collection tools in mixed methods research to combine the clarity of quantitative counts with the nuance of qualitative reflections. Based on more traditional mixed methods approaches, this article details how the use of pre/post concept maps can be used to design qualitative…

  20. E-Government Service Research Development: A Literature Review

    OpenAIRE

    M. Mahmudul Hasan

    2015-01-01

    Electronic service in the domain of e-Government has been gaining research attention over past two decades. This paper reports on a literature review of the published e-Government service research and provides an analysis of the research development in terms of research themes, regional context, research perspective, data analysis method, and research approach. The results of this analysis can serve the e-Government research communities as a means of understanding the e-Government service res...

  1. Identification of research activities for the dairy sector development ...

    African Journals Online (AJOL)

    Mo

    phase, which is the research support of the development process, could then be implemented with all the ... The research activities on milk production improvement in the South .... lean on statistical methods as cluster analysis or hierarchical.

  2. Research and development of methods/utilities and rules for managing cooperation for performance improvement in government offices. Second Technical progress report, September 1, 1992--January 31, 1993

    Energy Technology Data Exchange (ETDEWEB)

    Kurstedt, H.A.

    1993-03-01

    Purpose is to help managers approach their responsibilities proactively, so that they can anticipate problems and take actions to alleviate or eliminate those problems. Continuous performance improvement, the philosophy behind total quality management, requires working cooperatively to do a little better each day. The most effective tools are working through a closed set of 9 methods: setting expectations, charting, defining indicators and standards, collecting and logging data, converting data to information, organizing and presenting information, reviewing status and progress, self-management, and appraising. In addition, there are 8 rules: focus on what you can do, supply physical evidence of progress, pay attention to detail, inspect (don`t expect), review progress routinely and frequently, face ``success/fail`` squarely, communicate crisply, and conduct honest, open appraisals. Scope and plans of the draft research plan (study areas) are described.

  3. [Application and Integration of Qualitative and Quantitative Research Methods in Intervention Studies in Rehabilitation Research].

    Science.gov (United States)

    Wirtz, M A; Strohmer, J

    2016-06-01

    In order to develop and evaluate interventions in rehabilitation research a wide range of empirical research methods may be adopted. Qualitative research methods emphasize the relevance of an open research focus and a natural proximity to research objects. Accordingly, using qualitative methods special benefits may arise if researchers strive to identify and organize unknown information aspects (inductive purpose). Particularly, quantitative research methods require a high degree of standardization and transparency of the research process. Furthermore, a clear definition of efficacy and effectiveness exists (deductive purpose). These paradigmatic approaches are characterized by almost opposite key characteristics, application standards, purposes and quality criteria. Hence, specific aspects have to be regarded if researchers aim to select or combine those approaches in order to ensure an optimal gain in knowledge. © Georg Thieme Verlag KG Stuttgart · New York.

  4. Writing a Mixed Methods Report in Social Work Research

    Science.gov (United States)

    Bronstein, Laura R.; Kovacs, Pamela J.

    2013-01-01

    This article briefly chronicles the development of mixed methods research and its use in social work. We then move onto a discussion of terms and designs, reasons for (and for not) using mixed methods. Drawing upon exemplars, we address how to write up a mixed methods study when (1) the sample is single; single for one part, with a subset for the…

  5. Writing a Mixed Methods Report in Social Work Research

    Science.gov (United States)

    Bronstein, Laura R.; Kovacs, Pamela J.

    2013-01-01

    This article briefly chronicles the development of mixed methods research and its use in social work. We then move onto a discussion of terms and designs, reasons for (and for not) using mixed methods. Drawing upon exemplars, we address how to write up a mixed methods study when (1) the sample is single; single for one part, with a subset for the…

  6. Neutron spectrometric methods for core inventory verification in research reactors

    CERN Document Server

    Ellinger, A; Hansen, W; Knorr, J; Schneider, R

    2002-01-01

    In consequence of the Non-Proliferation Treaty safeguards, inspections are periodically made in nuclear facilities by the IAEA and the EURATOM Safeguards Directorate. The inspection methods are permanently improved. Therefore, the Core Inventory Verification method is being developed as an indirect method for the verification of the core inventory and to check the declared operation of research reactors.

  7. Toward a goodwill ethics of online research methods

    Directory of Open Access Journals (Sweden)

    Brittany Kelley

    2016-09-01

    Full Text Available As more academic work (teaching, research, and publishing moves online, we acafans face ever more challenges regarding how academia and online communities can and should interact. Since academia enjoys a position of power, while fan communities are often highly marginalized, I argue that, as acafans, we have a special responsibility to the fan communities we engage with and study. Fulfilling this responsibility means using what I call a goodwill ethics heuristic approach to online research methods, which requires us to balance the concerns of fans with those of scholarly development. In order to trace what this goodwill heuristic approach to online research methods might look like, I start by examining ethical values of research methods as they are defined by the Belmont Report. I then revisit the methods of previous fan studies. I add to these methods an extended set of ethical values as they have been described by prominent scholars in a range of fields using human subjects research. Finally, I discuss my own online fannish profile, focusing on my self-positioning and how it has been crucial in developing a goodwill ethics approach in my own research. Ultimately, I argue that all online research should use a goodwill ethics heuristic approach, and that such an approach is chiefly characterized by researchers' willingness to abdicate their expert status where necessary; ongoing negotiations between researchers and participants; and researchers' taking sufficient time to establish both an emic perspective of the community or site being researched and relationships with participants.

  8. Dialectical Inquiry: A Structured Qualitative Research Method

    Science.gov (United States)

    Berniker, Eli; McNabb, David E.

    2006-01-01

    This paper presents Dialectical Inquiry (DI) as a structured qualitative research method for studying participant models of organizational processes. The method is applied to rich secondary anecdotal data on technology transfer, gathered by subject-matter experts in a large firm. DI assumes that the imposition of a dialectical structure will…

  9. Research on BOM based composable modeling method

    NARCIS (Netherlands)

    Zhang, M.; He, Q.; Gong, J.

    2013-01-01

    Composable modeling method has been a research hotpot in the area of Modeling and Simulation for a long time. In order to increase the reuse and interoperability of BOM based model, this paper put forward a composable modeling method based on BOM, studied on the basic theory of composable modeling m

  10. A "Handy" Way to Introduce Research Methods.

    Science.gov (United States)

    Johnson, David E.

    1996-01-01

    Provides an exercise for introducing research methods to undergraduates. The students view a graph revealing that left-handed people are underrepresented in older age groups. Small group discussions attempt to explain this phenomenon. A follow-up class discussion focuses on the different approaches and methods available for interpreting the data.…

  11. A "Handy" Way to Introduce Research Methods.

    Science.gov (United States)

    Johnson, David E.

    1996-01-01

    Provides an exercise for introducing research methods to undergraduates. The students view a graph revealing that left-handed people are underrepresented in older age groups. Small group discussions attempt to explain this phenomenon. A follow-up class discussion focuses on the different approaches and methods available for interpreting the data.…

  12. Using Replication Projects in Teaching Research Methods

    Science.gov (United States)

    Standing, Lionel G.; Grenier, Manuel; Lane, Erica A.; Roberts, Meigan S.; Sykes, Sarah J.

    2014-01-01

    It is suggested that replication projects may be valuable in teaching research methods, and also address the current need in psychology for more independent verification of published studies. Their use in an undergraduate methods course is described, involving student teams who performed direct replications of four well-known experiments, yielding…

  13. Research and development of methods and tools for achieving and maintaining consensus processes in the face of change within and among government oversight agencies: Volume 1

    Energy Technology Data Exchange (ETDEWEB)

    1992-03-01

    This progress report summarizes our research activities under our consensus grant. In year four of the grant, we continued to capitalize on and benefit from historical events which drove our early emphasis on group process studies. Following our work on various procedures for bringing together groups such as the State and Tribal Government Working Group and the Stakeholders' Forum (both of which provide input to the Five-Year Waste Plan), we continue to observe these groups and collect data. We also began a configuration study involving the complex modeling of DOE's Office of Environmental Restoration and Waste Management (EM). Related to group process studies is the issue of the information requirements for individuals making decisions in consensus groups. Our information studies examined the requirements for decision-related information, frameworks for such information, and the effectiveness of information portrayed for decision making. However, we were able not only to continue studying consensus groups in action and related information issues, but also to focus considerable attention on the fundamental side of our research. The fundamental or basic research conducted in year four included: (1) expanding our literature database; (2) beginning the writing of the literature review summary document and the consensus guide; (3) developing frameworks and models such as the Environmental Trilogy model and a structural equations model of the consensus process; and (4) conducting laboratory studies concerning the effects of the presence of an expert, met expectations, opportunity to express views, incentive structure and conflict type (competitive versus collaborative) on consensus outcomes.

  14. Miscellaneous standard methods for Apis mellifera research

    DEFF Research Database (Denmark)

    Human, Hannelie; Brodschneider, Robert; Dietemann, Vincent

    2013-01-01

    A variety of methods are used in honey bee research and differ depending on the level at which the research is conducted. On an individual level, the handling of individual honey bees, including the queen, larvae and pupae are required. There are different methods for the immobilising, killing......, microinjection is often used. A method that is used by both researchers and beekeepers is the marking of queens that serves not only to help to locate her during her life, but also enables the dating of queens. Creating multiple queen colonies allows the beekeeper to maintain spare queens, increase brood......, estimation of population density is essential to evaluate the health status and using beelines help to locate wild colonies. These methods, described in this paper, are especially valuable when investigating the effects of pesticide applications, environmental pollution and diseases on colony survival....

  15. Historical development of origins research.

    Science.gov (United States)

    Lazcano, Antonio

    2010-11-01

    Following the publication of the Origin of Species in 1859, many naturalists adopted the idea that living organisms were the historical outcome of gradual transformation of lifeless matter. These views soon merged with the developments of biochemistry and cell biology and led to proposals in which the origin of protoplasm was equated with the origin of life. The heterotrophic origin of life proposed by Oparin and Haldane in the 1920s was part of this tradition, which Oparin enriched by transforming the discussion of the emergence of the first cells into a workable multidisciplinary research program. On the other hand, the scientific trend toward understanding biological phenomena at the molecular level led authors like Troland, Muller, and others to propose that single molecules or viruses represented primordial living systems. The contrast between these opposing views on the origin of life represents not only contrasting views of the nature of life itself, but also major ideological discussions that reached a surprising intensity in the years following Stanley Miller's seminal result which showed the ease with which organic compounds of biochemical significance could be synthesized under putative primitive conditions. In fact, during the years following the Miller experiment, attempts to understand the origin of life were strongly influenced by research on DNA replication and protein biosynthesis, and, in socio-political terms, by the atmosphere created by Cold War tensions. The catalytic versatility of RNA molecules clearly merits a critical reappraisal of Muller's viewpoint. However, the discovery of ribozymes does not imply that autocatalytic nucleic acid molecules ready to be used as primordial genes were floating in the primitive oceans, or that the RNA world emerged completely assembled from simple precursors present in the prebiotic soup. The evidence supporting the presence of a wide range of organic molecules on the primitive Earth, including membrane

  16. Evolution of Research Methods for Probing and Understanding Metacognition

    Science.gov (United States)

    Anderson, David; Nashon, Samson M.; Thomas, Gregory P.

    2009-03-01

    This paper reports on the development, self-critique and evolution of research methods for interpreting and understanding students’ metacognition that were developed through the Metacognition and Reflective Inquiry (MRI) collaborative study. The MRI collaborative was a multi-year, multi-case, research study that investigated the elusive nature and character of high school students’ metacognition across formal and informal science learning contexts. The study’s research design comprised a series of integrated, layered, interpretive case studies which were conducted in a hermeneutic fashion over a 3 year period. The implementation of each case study provided an opportunity for the researchers to reflect critically on the research methods used to elucidate metacognition and hence refine the individual and collective capacity, responsiveness and fruitfulness of the methods used. This paper discusses the evolution of these methods and the lessons that the entire study provides for the conceptualization of other qualitative-interpretivist studies.

  17. Research on Development Strategy of YO Company Based on SWOT Analysis Method%基于SWOT分析法的YO公司发展战略研究

    Institute of Scientific and Technical Information of China (English)

    李连璋

    2016-01-01

    为应对当前企业经营者高度重视战略管理,且决策模式多为命令式和愿景式使得员工主动参与程度不高的问题。低价格、低成本、多种类的原始竞争手段已不能满足现代社会的多元化需求。依据SWOT分析方法,结合YO建筑公司实际,对公司发展战略从多维度研究,从产品定价策略、营销渠道、企业文化、人力资源管理、财务等方面提出了YO公司发展战略优化方法,通过案例验证发展战略可行。%Current business operators attach great importance to the strategic management, however, its decision model is imperative and visionary, making employees not willing to participate. Low price, low cost, many kinds of primitive means of competition can not meet the diverse needs of modern society. For this, based on the SWOT analysis method, combining the reality of YO construction company, this paper studies the company development strategy from multi-dimensions, and proposes the development strategy optimization method for YO company.

  18. Social Psychology: research methods and techniques

    Directory of Open Access Journals (Sweden)

    Marcos Emanoel Pereira

    2013-03-01

    Full Text Available The objective of this paper is to identify the research methods adopted by researchers in the field of Social Psychology, differentiating them by considerations derived from the four epistemic dimensions. Our starting point was a study conducted to identify the theoretical references and research methods used by educators and researchers in the field of social psychology. The results presented here refer to data, obtained in the years 2011 and 2012, relating to 545 social psychologists and professors of social psychology, of which 157 responded in Portuguese and 388 in Spanish. The average age of participants was 41.5 years (standard deviation = 11.4; minimum = 21 years; maximum = 78, being 54% female and 43% male. The participants originated from 19 countries, with Spain (158, Brazil (149, Mexico (64, and Argentina (45 the most frequent. Based on the results, we sought to classify and subsequently to estimate the frequency of use of the methods, considering them based on the distribution of the researchers from two geographic regions, Latin America and the Iberian Peninsula. Since geographical distribution did not provide a consistent criterion for differentiating between methods, we tried to understand the differences by considering ultimately the theoretical approach embraced by the researcher.

  19. A CTSA agenda to advance methods for comparative effectiveness research.

    Science.gov (United States)

    Helfand, Mark; Tunis, Sean; Whitlock, Evelyn P; Pauker, Stephen G; Basu, Anirban; Chilingerian, Jon; Harrell, Frank E; Meltzer, David O; Montori, Victor M; Shepard, Donald S; Kent, David M

    2011-06-01

    Clinical research needs to be more useful to patients, clinicians, and other decision makers. To meet this need, more research should focus on patient-centered outcomes, compare viable alternatives, and be responsive to individual patients' preferences, needs, pathobiology, settings, and values. These features, which make comparative effectiveness research (CER) fundamentally patient-centered, challenge researchers to adopt or develop methods that improve the timeliness, relevance, and practical application of clinical studies. In this paper, we describe 10 priority areas that address 3 critical needs for research on patient-centered outcomes (PCOR): (1) developing and testing trustworthy methods to identify and prioritize important questions for research; (2) improving the design, conduct, and analysis of clinical research studies; and (3) linking the process and outcomes of actual practice to priorities for research on patient-centered outcomes. We argue that the National Institutes of Health, through its clinical and translational research program, should accelerate the development and refinement of methods for CER by linking a program of methods research to the broader portfolio of large, prospective clinical and health system studies it supports. Insights generated by this work should be of enormous value to PCORI and to the broad range of organizations that will be funding and implementing CER.

  20. Research on Negotiation Method for Cooperative Product Development%协同产品开发中的协商方法研究

    Institute of Scientific and Technical Information of China (English)

    曹健; 张申生

    2001-01-01

    Conflict can not be avoided in cooperative product design process. In order to ensure the success of product development process, some method must be adopted to resolve the conflict effectively. According to the characters of the cooperative product design process, the negotiation model and negotiation process organizing methods are put out to support cooperative product design. Flexible index modeling, scheme evaluating and revising, problem restructuring methods are discussed. All of these can provide a useful way to resolve the conflict arising in the cooperative product design process.%协同产品开发过程中的冲突是不可避免的,为了使产品开发过程取得成功,必须采取相应的方法来消除冲突。本文从协同产品开发过程的特点出发,提出了支持协同产品开发的协商模型和协商过程组织方法。为了使协商过程有效进行,文中研究了指标柔性建模、方案评判和修改、问题重构等协商技术,从而为消除协同产品开发过程中产生的冲突提供了有力手段。

  1. Institutional research and development, FY 1987

    Energy Technology Data Exchange (ETDEWEB)

    Struble, G.L.; Lawler, G.M.; Crawford, R.B.; Kirvel, R.D.; Peck, T.M.; Prono, J.K.; Strack, B.S. (eds.)

    1987-01-01

    The Institutional Research and Development program at Lawrence Livermore National Laboratory fosters exploratory work to advance science and technology, disciplinary research to develop innovative solutions to problems in various scientific fields, and long-term interdisciplinary research in support of defense and energy missions. This annual report describes research funded under this program for FY87. (DWL)

  2. Research development of early diagnostic methods of diabetic nephropathy%糖尿病肾病的早期诊断方法研究进展

    Institute of Scientific and Technical Information of China (English)

    孙慧博; 高伟; 刘继军

    2011-01-01

    糖尿病肾病是糖尿病常见的微血管并发症之一.常规尿检查不易早期发现,一旦发生临床糖尿病肾病,尚缺乏有效方法控制其发展,大多数患者数年后转为慢性肾功能衰竭,威胁着糖尿病患者的生命.因此早期诊断可以早期干预、延缓糖尿病肾病的发展.目前认为,在早期糖尿病肾病诊断中临床指标有尿微量白蛋白、尿N-乙酰-β-D氨基葡萄糖苷酶、β2-微球蛋白等.%Diabetic nephropathy is one of the most common microvascular complications of diabetes. Early detection with the conventional urine test is unlikely. In the event of clinical diabetic nephropathy, there is still a lack of effective methods to control its development. Most patients are developped into chronic renal failure a few years later, threatening lives of patients with diabetes. Therefore, early diagnosis can intervene and delay the development of diabetic nephropathy. Currently considered clinical indicators in the early diagnosis of diabetic nephropathy include urinary microalbumin, urinary N-acetyl-P-fl-glucosaminidase, P2-microglobulin and so on.

  3. ARK methods: some recent developments

    Science.gov (United States)

    Moir, Nicolette

    2005-03-01

    Almost Runge-Kutta methods are a sub-class of the family of methods known as general linear methods, used for solving ordinary differential equations. They combine many of the favourable properties of traditional Runge-Kutta methods with some additional advantages. We will introduce these methods, concentrating on methods of order four, and present some recent results.

  4. Research and development program, fiscal year 1966

    Energy Technology Data Exchange (ETDEWEB)

    1964-04-01

    The biomedical program of the Laboratory of Nuclear Medicine and Radiation Biology for FY 1966 is conducted within the scope of the following categories: Somatic Effects of Radiation; Combating Detrimental Effects of Radiation; Molecular and Cellular Level Studies; Environmental Radiation Studies; Radiological and Health Physics and Instrumentation; Chemical Toxicity; Cancer Research; and Selected Beneficial Applications. The overall objectives of the Laboratory within these areas of the Biology and Medicine program may be summarized as follows: (1) investigation of the effects of ionizing radiation on living organisms and systems of biological significance; (2) investigation of the dynamic aspects of physiological and biochemical processes in man, animals and plants and how these processes are modified by radiation and related pathological states; (3) the assessment and study of the immediate and long term consequences of the operation or detonation of nuclear devices on the fauna, and flora in man's environment and on man; (4) the development of methods of minimizing or preventing the detrimental effects of ionizing radiation; (5) research in, and development of, beneficial uses of ionizing radiation and radioactive substances in medicine and biology; (6) research in the development of new and more efficient radiation detection devices; (7) research, including field studies, as mutually agreed upon by the Commission and the University, in connection with the conduct of weapon tests and biomedical and civil effects experiments at such tests conducted at continental and overseas test sites; and (8) the conduct of training and educational activities in the biological and medical aspects of radiation and related fields.

  5. Ethnographic Contributions to Method Development

    DEFF Research Database (Denmark)

    Leander, Anna

    2014-01-01

    Program paper title: The Reversal of Value Neutrality: Research Ethics in Critical Approaches to Security......Program paper title: The Reversal of Value Neutrality: Research Ethics in Critical Approaches to Security...

  6. Qualitative and Mixed Methods Social Media Research

    OpenAIRE

    Chareen L. Snelson

    2016-01-01

    Social media technologies have attracted substantial attention among many types of users including researchers who have published studies for several years. This article presents an overview of trends in qualitative and mixed methods social media research literature published from 2007 through 2013. A collection of 229 qualitative studies were identified through a systematic literature review process. A subset of 55 of these articles report studies involving a combination of qualitative and q...

  7. Federal Research and Development Funding: FY2017

    Science.gov (United States)

    2017-01-27

    the spectrum auction proceeds in FY2015 to help industry and public safety organizations conduct research and develop new standards, technologies...Detection Office (DNDO) DNDO is the DHS organization responsible for nuclear detection research, development , testing, evaluation, acquisition, and...Federal Research and Development Funding: FY2017 John F. Sargent Jr., Coordinator Specialist in Science and Technology Policy Robert Esworthy

  8. Qualitative and Mixed Methods Social Media Research

    Directory of Open Access Journals (Sweden)

    Chareen L. Snelson

    2016-02-01

    Full Text Available Social media technologies have attracted substantial attention among many types of users including researchers who have published studies for several years. This article presents an overview of trends in qualitative and mixed methods social media research literature published from 2007 through 2013. A collection of 229 qualitative studies were identified through a systematic literature review process. A subset of 55 of these articles report studies involving a combination of qualitative and quantitative methods. Articles were reviewed, analyzed, and coded through a qualitative content analysis approach. Overall trends are presented with respect to the entire collection of articles followed by an analysis of mixed methods research approaches identified in the subset of 55 studies. The most commonly used research approaches involved collecting data from people through interview, focus group, and survey methodologies. Content analysis was the second most commonly used approach whereby researchers use Facebook posts, Tweets (Twitter posts, YouTube videos, or other social media content as a data source. Many of the studies involving combinations of quantitative and qualitative data followed a design resembling Creswell and Plano Clark’s basic mixed methods typology (e.g., convergent parallel, explanatory sequential, and exploratory sequential.

  9. DESIGN METHODS OF HUMAN DEVELOPMENT MANAGEMENT SYSTEM

    Directory of Open Access Journals (Sweden)

    Stanislav E. Elkin

    2017-09-01

    Full Text Available The article discusses the concept of "human development" and the schematic diagram of the organizational design of regional management systems in relation to human development. Management as an organizational process in the study is considered as part of all social subsystems, specifies regularities of development and formation of new structures and functions. In the study applied the following methods: allocation of levels of models, techniques of domination, the allocation phases of the operation, the construction of generalized indicators, etc. As a result of research design problems of systems management human development revealed that the primary means of successful adaptation of organizations to changing conditions is an effective mechanism for management of human capacity, which will provide the best in current economic terms the end results that allows you to apply the concept of "innovation potential" in relation to the process of human development.

  10. Laboratory Directed Research and Development Program

    Energy Technology Data Exchange (ETDEWEB)

    Ogeka, G.J.

    1991-12-01

    Today, new ideas and opportunities, fostering the advancement of technology, are occurring at an ever-increasing rate. It, therefore, seems appropriate that a vehicle be available which fosters the development of these new ideas and technologies, promotes the early exploration and exploitation of creative and innovative concepts, and which develops new fundable'' R D projects and programs. At Brookhaven National Laboratory (BNL), one such method is through its Laboratory Directed Research and Development (LDRD) Program. This discretionary research and development tool is critical in maintaining the scientific excellence and vitality of the Laboratory. Additionally, it is a means to stimulate the scientific community, fostering new science and technology ideas, which is the major factor achieving and maintaining staff excellence, and a means to address national needs, with the overall mission of the Department of Energy (DOE) and the Brookhaven National Laboratory. The Project Summaries with their accomplishments described in this report reflect the above. Aside from leading to new fundable or promising programs and producing especially noteworthy research, they have resulted in numerous publications in various professional and scientific journals, and presentations at meetings and forums.

  11. Using Empirical Article Analysis to Assess Research Methods Courses

    Science.gov (United States)

    Bachiochi, Peter; Everton, Wendi; Evans, Melanie; Fugere, Madeleine; Escoto, Carlos; Letterman, Margaret; Leszczynski, Jennifer

    2011-01-01

    Developing students who can apply their knowledge of empirical research is a key outcome of the undergraduate psychology major. This learning outcome was assessed in two research methods courses by having students read and analyze a condensed empirical journal article. At the start and end of the semester, students in multiple sections of an…

  12. Using Empirical Article Analysis to Assess Research Methods Courses

    Science.gov (United States)

    Bachiochi, Peter; Everton, Wendi; Evans, Melanie; Fugere, Madeleine; Escoto, Carlos; Letterman, Margaret; Leszczynski, Jennifer

    2011-01-01

    Developing students who can apply their knowledge of empirical research is a key outcome of the undergraduate psychology major. This learning outcome was assessed in two research methods courses by having students read and analyze a condensed empirical journal article. At the start and end of the semester, students in multiple sections of an…

  13. Advances in structure research by diffraction methods

    CERN Document Server

    Brill, R

    1970-01-01

    Advances in Structure Research by Diffraction Methods reviews advances in the use of diffraction methods in structure research. Topics covered include the dynamical theory of X-ray diffraction, with emphasis on Ewald waves in theory and experiment; dynamical theory of electron diffraction; small angle scattering; and molecular packing. This book is comprised of four chapters and begins with an overview of the dynamical theory of X-ray diffraction, especially in terms of how it explains all the absorption and propagation properties of X-rays at the Bragg setting in a perfect crystal. The next

  14. DEVELOPING SOFTWARE FOR CORPUS RESEARCH

    Directory of Open Access Journals (Sweden)

    Oliver Mason

    2008-06-01

    Full Text Available Despite the central role of the computer in corpus research, programming is generally not seen as a core skill within corpus linguistics. As a consequence, limitations in software for text and corpus analysis slow down the progress of research while analysts often have to rely on third party software or even manual data analysis if no suitable software is available. Apart from software itself, data formats are also of great importance for text processing. But again, many practitioners are not very aware of the options available to them, and thus idiosyncratic text formats often make sharing of resources difficult if not impossible. This article discusses some issues relating to both data and processing which should aid researchers to become more aware of the choices available to them when it comes to using computers in linguistic research. It also describes an easy way towards automating some common text processing tasks that can easily be acquired without knowledge of actual computer programming.

  15. Achievement report on research and development of medical and welfare equipment technology. Optical tomographic imaging method; Iryo fukushi kiki gijutsu kenkyu kaihatsu seika hokokusho. Hikari danso imaging system

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1999-11-01

    The aim is to develop a method of processing oxygen concentration distribution in human organs into an image by computed tomography using near infrared rays capable of transmitting through living tissues. Since the photoabsorption spectra of hemoglobin etc. in blood vary according to the degree of their oxidation, an oxygen concentration level is determined by measuring the magnitude of the variation. In the imaging method named in the title, the object is irradiated with picosecond-level near infrared pulses from all directions successively, the pulses after transmission through the object are measured at all directions at a picosecond-level time resolution, and the distribution of pulse scattering and absorption characteristics are subjected to algorithmic calculation, the outcome is converted into oxygen concentration levels, and an image is obtained. A 64-channel time resolution measurement system is constructed, and is applied to living tissue models (phantoms) and animals, and an image is obtained and evaluated. On the basis of the result, a patient is examined for clinical evaluation, and an image reflecting the distribution of variations in hemoglobin oxygen concentration is obtained for the head of the adult patient. A spatial resolution of 1cm is achieved in case of a phantom 10cm in diameter. In the case of 64 channels, measurement takes approximately 20 minutes and mapping image data measurement takes approximately 7 minutes. (NEDO)

  16. 型号产品研制风险管理方法研究%Research on the Risk Management Methods of Model Product Development

    Institute of Scientific and Technical Information of China (English)

    钟海波; 陈明晖

    2016-01-01

    目前型号研制中风险管理不系统、不全面,远未起到规避缓解风险的作用,究其原因主要是对风险管理的内涵不理解、缺乏有效管理手段。本文就是针对上述问题,通过对项目风险内涵及主要活动阐述,结合工作的实际,总结出一套项目风险管理的方法,以期作为型号研制风险管理的参考。%At present, the risk management in the development of models is not systematic and comprehensive, and it can't play the role of risk aversion. The main reason is that the connotation of risk management is not understood and the effective management tools are lack. Aimed at the above problems, this paper expounds the connotation and main activities of project risk. Combined with the actual work, a set of project risk management methods is summed up to provide references for the risk management of the model development.

  17. Creating and supporting a mixed methods health services research team.

    Science.gov (United States)

    Bowers, Barbara; Cohen, Lauren W; Elliot, Amy E; Grabowski, David C; Fishman, Nancy W; Sharkey, Siobhan S; Zimmerman, Sheryl; Horn, Susan D; Kemper, Peter

    2013-12-01

    To use the experience from a health services research evaluation to provide guidance in team development for mixed methods research. The Research Initiative Valuing Eldercare (THRIVE) team was organized by the Robert Wood Johnson Foundation to evaluate The Green House nursing home culture change program. This article describes the development of the research team and provides insights into how funders might engage with mixed methods research teams to maximize the value of the team. Like many mixed methods collaborations, the THRIVE team consisted of researchers from diverse disciplines, embracing diverse methodologies, and operating under a framework of nonhierarchical, shared leadership that required new collaborations, engagement, and commitment in the context of finite resources. Strategies to overcome these potential obstacles and achieve success included implementation of a Coordinating Center, dedicated time for planning and collaborating across researchers and methodologies, funded support for in-person meetings, and creative optimization of resources. Challenges are inevitably present in the formation and operation of effective mixed methods research teams. However, funders and research teams can implement strategies to promote success. © Health Research and Educational Trust.

  18. Phenomenography: A Missed Method in Medical Research

    Directory of Open Access Journals (Sweden)

    Assarroudi Abdolghader

    2016-09-01

    Full Text Available Research is an approach with which human beings can attempt to answer questions and discover the unknowns. Research methodology is something that is determined by the researcher’s attitude toward the universe as well as by the question he is trying to answer. Some essential questions regarding the research process are: “What is the nature of reality?”, “What is the nature of the relationship between the scholar and the subject of interest?”, and “How can one understand the subject, and what are the methods?”. Research approaches can be categorized as quantitative and qualitative. In the former, measurement, prediction, and control are the bases, while in the latter, exploring, describing, and explaining the phenomena are fundamental. Among qualitative research methods, phenomenography is one of the newest methods. However, in spite of proving to be useful in various disciplines, it has yet to become popular, and many scholars mistake it for phenomenology. The focus of phenomenography is on what is known as the second-order perspective and the different ways that people can experience the same phenomenon, while phenomenology primarily emphasizes the first-order perspective and the similar essences that are derived from various experiences. This article aims to provide a better understanding of phenomenography through explaining it and comparing it with phenomenology in order to facilitate its proper and timely application in medical studies.

  19. RD and D-Programme 2001. Programme for research, development and demonstration of methods for the management and disposal of nuclear waste

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2001-09-01

    heterogeneity of the rock in the best manner and to serve as a basis for selecting suitable rock for location of deposition tunnels and holes. The chemistry of the groundwater at repository depth has been thoroughly studied, and SKB has developed practical methods for investigating a future site. Microbial processes are a relatively new field that we are continuing to investigate. Matrix diffusion describes how dissolved radionuclides penetrate into the micro fractures in the rock, thereby retarding the migration of radionuclides along large water-bearing fractures in the rock. Diffusion in micro fractures has been thoroughly investigated, but its relationship with the water flow and the geometry of the system of major fractures in the rock needs to be further studied. Postglacial land uplift and climatic variations are examples of processes that influence the evolution of the biosphere in the long term. Knowledge of the mechanisms for transfer of radionuclides between different parts of the biosphere has improved, and the models will be based on this new knowledge. Examples of ecosystems that are studied and dealt with in the models are forest, mireland and sediment. Permafrost is an example of a climatic state that will be more closely investigated, and a project aimed at this is currently planned. Another example is the glacial state. Material analogues occupy a prominent position in the upcoming programme. Typical material analogues are natural deposits of copper or bentonite, but concrete will also be investigated. Specimens of old concrete will be examined, as well as sites where cement minerals occur naturally. The different steps in building the repository, emplacing the canisters and the buffer, and backfilling and closure are tested on Aespoe. Site investigation methods are also developed there. Full-scale tests are being performed at the Aespoe HRL of drilling of deposition holes, emplacement of canisters and bentonite, and backfilling. The Prototype Repository in

  20. Miscellaneous standard methods for Apis mellifera research

    DEFF Research Database (Denmark)

    Human, Hannelie; Brodschneider, Robert; Dietemann, Vincent;

    2013-01-01

    , microinjection is often used. A method that is used by both researchers and beekeepers is the marking of queens that serves not only to help to locate her during her life, but also enables the dating of queens. Creating multiple queen colonies allows the beekeeper to maintain spare queens, increase brood...

  1. Using Experimental Methods in Higher Education Research

    Science.gov (United States)

    Ross, Steven M.; Morrison, Gary R.; Lowther, Deborah L.

    2005-01-01

    Experimental methods have been used extensively for many years to conduct research in education and psychology. However, applications of experiments to investigate technology and other instructional innovations in higher education settings have been relatively limited. The present paper examines ways in which experiments can be used productively…

  2. Sprint methods for web archive research

    NARCIS (Netherlands)

    Huurdeman, H.C.; Ben David, A.; Samar, T.

    2013-01-01

    Web archives provide access to snapshots of the Web of the past, and could be valuable for research purposes. However, access to these archives is often limited, both in terms of data availability, and interfaces to this data. This paper explores new methods to overcome these limitations. It present

  3. Environmental Social Sciences: Methods and Research Design

    OpenAIRE

    Jeremy Spoon

    2012-01-01

    Review of Environmental Social Sciences: Methods and Research Design. Ismael Vaccaro, Eric Alden Smith, and Shankar Aswani, eds. 2010. Cambridge University Press, Cambridge. Pp. 396, 41 b/w illustrations, 20 tables. US$49.99 (paperback). ISBN 9780521125710.

  4. Higher Education Research Methodology-Literature Method

    Science.gov (United States)

    Lin, Guijuan

    2009-01-01

    Starting by a brief introduction of literature method, this paper raises the question of how to choose representative research literatures. For this question, Professor Hongcai Wang points out the root of this problem and the strategies to resolve it and provides the ways to choose representative literatures. Through analyzing and summarizing,…

  5. Relevant Research on Audio-Tutorial Methods

    Science.gov (United States)

    Novak, Joseph D.

    1970-01-01

    Reviews two aspects of research related to audio-tutorial instructional methods. First, the learning theory of David P. Ausebel is summarized and applied to instructional procedures. Secondly, learning time for attainment of concept and knowledge levels is discussed. Concludes that studies are needed on designs based on Ausebel's theory,…

  6. 10 best resources on ... mixed methods research in health systems.

    Science.gov (United States)

    Ozawa, Sachiko; Pongpirul, Krit

    2014-05-01

    Mixed methods research has become increasingly popular in health systems. Qualitative approaches are often used to explain quantitative results and help to develop interventions or survey instruments. Mixed methods research is especially important in low- and middle-income country (LMIC) settings, where understanding social, economic and cultural contexts are essential to assess health systems performance. To provide researchers and programme managers with a guide to mixed methods research in health systems, we review the best resources with a focus on LMICs. We selected 10 best resources (eight peer-reviewed articles and two textbooks) based on their importance and frequency of use (number of citations), comprehensiveness of content, usefulness to readers and relevance to health systems research in resource-limited contexts. We start with an overview on mixed methods research and discuss resources that are useful for a better understanding of the design and conduct of mixed methods research. To illustrate its practical applications, we provide examples from various countries (China, Vietnam, Kenya, Tanzania, Zambia and India) across different health topics (tuberculosis, malaria, HIV testing and healthcare costs). We conclude with some toolkits which suggest what to do when mixed methods findings conflict and provide guidelines for evaluating the quality of mixed methods research.

  7. Combinatorial materials research applied to the development of new surface coatings X: a high-throughput electrochemical impedance spectroscopy method for screening organic coatings for corrosion inhibition.

    Science.gov (United States)

    He, Jie; Bahr, James; Chisholm, Bret J; Li, Jun; Chen, Zhigang; Balbyshev, Séva N; Bonitz, Verena; Bierwagen, Gordon P

    2008-01-01

    The objective of the study was to develop a high-throughput electrochemical impedance spectroscopy (HT-EIS) method for rapid and quantitative evaluation of corrosion protective coatings. A 12-element, spatially addressable electrochemical platform was designed, fabricated, and validated. This platform was interfaced to a commercial EIS instrument through an automated electronic switching unit. The HT-EIS system enables four parallel EIS measurements to be run simultaneously, which significantly reduces characterization time compared to that of serial EIS measurements using a multiplexer. The performance of the HT-EIS system was validated using a series of model systems, including a Randles equivalent circuit, an electrochemical reaction (Ti/K4FeCN6, K3FeCN6), a highly uniform polymer film, and several polymer coatings. The results of the validation studies showed that the HT-EIS system enables a major reduction in characterization time and provides high quality data comparable to data obtained with conventional, single-cell EIS measurement systems.

  8. Research and Development from the bottom up

    DEFF Research Database (Denmark)

    Brem, Alexander; Wolfram, P.

    2014-01-01

    and ecological context or the growing interest of developed market firms in approaches from emerging markets. Hence, the presented framework supports further research in new paradigms for research and development (R&D) in developed market firms (DMFs), particularly in relation to emerging markets. This framework...... enables scholars to compare concepts from developed and emerging markets, to address studies specifically by using consistent terms, and to advance research into the concepts according their characterization....

  9. Justifying knowledge, justifying method, taking action: epistemologies, methodologies, and methods in qualitative research.

    Science.gov (United States)

    Carter, Stacy M; Little, Miles

    2007-12-01

    In this article, the authors clarify a framework for qualitative research, in particular for evaluating its quality, founded on epistemology, methodology, and method. They define these elements and discuss their respective contributions and interrelationships. Epistemology determines and is made visible through method, particularly in the participant- researcher relationship, measures of research quality, and form, voice, and representation in analysis and writing. Epistemology guides methodological choices and is axiological. Methodology shapes and is shaped by research objectives, questions, and study design. Methodologies can prescribe choices of method, resonate with particular academic disciplines, and encourage or discourage the use and/or development of theory. Method is constrained by and makes visible methodological and epistemic choices. If we define good quality qualitative research as research that attends to all three elements and demonstrates internal consistency between them, standardized checklists can be transcended and innovation and diversity in qualitative research practice facilitated.

  10. [Mixed methods research in public health: issues and illustration].

    Science.gov (United States)

    Guével, Marie-Renée; Pommier, Jeanine

    2012-01-01

    For many years, researchers in a range of fields have combined quantitative and qualitative methods. However, the combined use of quantitative and qualitative methods has only recently been conceptualized and defined as mixed methods research. Some authors have described the emerging field as a third methodological tradition (in addition to the qualitative and quantitative traditions). Mixed methods research combines different perspectives and facilitates the study of complex interventions or programs, particularly in public health, an area where interdisciplinarity is critical. However, the existing literature is primarily in English. By contrast, the literature in French remains limited. The purpose of this paper is to present the emergence of mixed methods research for francophone public health specialists. A literature review was conducted to identify the main characteristics of mixed methods research. The results provide an overall picture of the mixed methods approach through its history, definitions, and applications, and highlight the tools developed to clarify the approach (typologies) and to implement it (integration of results and quality standards). The tools highlighted in the literature review are illustrated by a study conducted in France. Mixed methods research opens new possibilities for examining complex research questions and provides relevant and promising opportunities for addressing current public health issues in France.

  11. 2010-11 Research Portfolio: Research & Development Division

    Science.gov (United States)

    Educational Testing Service, 2010

    2010-01-01

    This document describes the breadth of the research that the ETS (Educational Testing Service) Research & Development division is conducting in 2010. This portfolio will be updated in early 2011 to reflect changes to existing projects and new projects that were added after this document was completed. The research described in this portfolio falls…

  12. Research Skills Development in Higher Education Students

    Science.gov (United States)

    Bergamini, Tiziana Priede; Navarro, Cristina Lopez-Cozar

    2014-01-01

    This case study presents the development of a research project in a third-year undergraduate course, Family Business Administration. The research project aimed at promoting research skills in students. The authors formed working groups of no more than six students, and each group had to select an original research topic after conducting a…

  13. Teacher Professional Development Approach:Action Research

    Institute of Scientific and Technical Information of China (English)

    LIU Yang

    2013-01-01

    Theory and practice, researchers and practitioners are usually isolated in traditional education research, so much so that the research results can not solve the problems that teachers encounter in their teaching practice. As a new mode, action research provides a bridge linking theory and teaching practice as well as a way to promote teacher development.

  14. Biosensing International Research and Development

    CERN Document Server

    Schultz, Jerome; Mrksich, Milan

    2006-01-01

    The goal of this book is to disseminate information on the worldwide status and trends in biosensing R&D to government decisionmakers and the research community. The contributors critically analyze and compare biosensing research in the United States with that being pursued in Japan, Europe and other major industrialized countries. Biosensing includes systems that incorporate a variety of means, including electrical, electronic, and photonic devices; biological materials (e.g., tissue, enzymes, nucleic acids, etc.); and chemical analysis to produce detectable signals for the monitoring or identification of biological phenomena. In a broader sense, the study of biosensing includes any approach to detection of biological elements and the associated software or computer identification technologies (e.g., imaging) that identify biological characteristics. Biosensing is finding a growing number of applications in a wide variety of areas, including biomedicine, food production and processing, and detection of b...

  15. Developing a Research Skill Set

    OpenAIRE

    You, Y. Nancy; Bednarski, Brian

    2014-01-01

    The recent decades have witnessed a significant expansion in the diversity of career paths within academic surgery. Although the skills for providing exemplary surgical care and for maintaining a strong work ethic are the foundations of an academic surgeon, deliberate career planning and organized acquisition of research skills contribute to the success of an academic career. In this article, we identify a set of core academic skills and propose a framework for acquiring them. We also describ...

  16. [DEVELOPMENT RESEARCH OF BIOLOGICAL DRESSING].

    Science.gov (United States)

    Zhang, Jinfeng; Hao, Jianbo; Zhang, Jinpeng; Luo, Bo; Liu, Peng

    2015-02-01

    To review the research progress of modern biological dressings. The related literature at home and abroad was reviewed, analyzed, and summarized in the progress of biological dressing situation and various types of biological dressing research. Compared with the traditional dressing, the biological dressing can greatly promote wound healing. Biological dressings are mainly divided into the natural materials, artificial synthetic materials, and drug loaded dressings. The natural material dressings are mainly the alginate dressing, this kind of dressing can promote wound healing, which has been confirmed by a large number of studies. The artificial synthetic materials include film dressings, liquid, water colloids, gels, and foam, each has its own advantages and disadvantages, which can be chosen according to need. The drug dressing can play the role of drug loading, and further promote the wound healing; using microcapsule technology to construct the dressing and choosing Chinese medicine as drugs is the research direction of load. The experiment and clinical application of biological dressing are many types, clinical application prospect is wide, but each has its own advantages and disadvantages, further study is needed to improve its efficacy.

  17. PMARC - PANEL METHOD AMES RESEARCH CENTER

    Science.gov (United States)

    Ashby, D. L.

    1994-01-01

    Panel methods are moderate cost tools for solving a wide range of engineering problems. PMARC (Panel Method Ames Research Center) is a potential flow panel code that numerically predicts flow fields around complex three-dimensional geometries. PMARC's predecessor was a panel code named VSAERO which was developed for NASA by Analytical Methods, Inc. PMARC is a new program with many additional subroutines and a well-documented code suitable for powered-lift aerodynamic predictions. The program's open architecture facilitates modifications or additions of new features. Another improvement is the adjustable size code which allows for an optimum match between the computer hardware available to the user and the size of the problem being solved. PMARC can be resized (the maximum number of panels can be changed) in a matter of minutes. Several other state-of-the-art PMARC features include internal flow modeling for ducts and wind tunnel test sections, simple jet plume modeling essential for the analysis and design of powered-lift aircraft, and a time-stepping wake model which allows the study of both steady and unsteady motions. PMARC is a low-order panel method, which means the singularities are distributed with constant strength over each panel. In many cases low-order methods can provide nearly the same accuracy as higher order methods (where the singularities are allowed to vary linearly or quadratically over each panel). Low-order methods have the advantage of a shorter computation time and do not require exact matching between panels. The flow problem is solved by assuming that the body is at rest in a moving flow field. The body is modeled as a closed surface which divides space into two regions -- one region contains the flow field of interest and the other contains a fictitious flow. External flow problems, such as a wing in a uniform stream, have the external region as the flow field of interest and the internal flow as the fictitious flow. This arrangement is

  18. Research and Development Information System (RDIS)

    Data.gov (United States)

    Department of Veterans Affairs — The Research and Development Information System (RDIS) is the Veterans Affairs Central Office budgetary and project data repository for managing the VA Research and...

  19. Development of Space Environment Research in China

    Institute of Scientific and Technical Information of China (English)

    GONG Jiancun; XUE Bingsen; HUANG Jianguo; SHI Liqin

    2006-01-01

    Abstract This paper presents the recent research progress on space environment in China. The space environment here includes space environment models, forecast methodology and space environment effects on spacecrafts. Finally the development trends of China's space environment research are discussed.

  20. Recent developments in photorespiration research.

    Science.gov (United States)

    Bauwe, Hermann

    2010-04-01

    Photorespiration is the light-dependent release of CO(2) initiated by Rubisco (ribulose-1,5-bisphosphate carboxylase/oxygenase) during oxygenic photosynthesis. It occurs during the biochemical reactions of the photorespiratory C(2) cycle, which is an ancillary metabolic process that allows photosynthesis to occur in oxygen-containing environments. Recent research has identified the genes for many plant photorespiratory enzymes, allowing precise functional analyses by reverse genetics. Similar studies with cyanobacteria disclosed the evolutionary origin of photorespiratory metabolism in these ancestors of plastids.

  1. Mixed methods research: a design for emergency care research?

    Science.gov (United States)

    Cooper, Simon; Porter, Jo; Endacott, Ruth

    2011-08-01

    This paper follows previous publications on generic qualitative approaches, qualitative designs and action research in emergency care by this group of authors. Contemporary views on mixed methods approaches are considered, with a particular focus on the design choice and the amalgamation of qualitative and quantitative data emphasising the timing of data collection for each approach, their relative 'weight' and how they will be mixed. Mixed methods studies in emergency care are reviewed before the variety of methodological approaches and best practice considerations are presented. The use of mixed methods in clinical studies is increasing, aiming to answer questions such as 'how many' and 'why' in the same study, and as such are an important and useful approach to many key questions in emergency care.

  2. Recent developments in blood cell labeling research

    Energy Technology Data Exchange (ETDEWEB)

    Srivastava, S.C.; Straub, R.F.; Meinken, G.E.

    1988-09-07

    A number of recent developments in research on blood cell labeling techniques are presented. The discussion relates to three specific areas: (1) a new in vitro method for red blood cell labeling with /sup 99m/Tc; (2) a method for labeling leukocytes and platelets with /sup 99m/Tc; and (3) the use of monoclonal antibody technique for platelet labeling. The advantages and the pitfalls of these techniques are examined in the light of available mechanistic information. Problems that remain to be resolved are reviewed. An assessment is made of the progress as well as prospects in blood cell labeling methodology including that using the monoclonal antibody approach. 37 refs., 4 figs.

  3. Laboratory Learning in a Research Methods Course

    Directory of Open Access Journals (Sweden)

    Sarah Knapp

    2016-03-01

    Full Text Available Laboratory-based learning is increasingly considered to be an integral component of undergraduate education. However, students do not always perceive the value of laboratory learning in the college classroom. The current research sought to create an effective laboratory learning environment within a research methods course and to assess students’ perceptions of this approach at the end of one semester. This article reports the findings for two studies; in Study 1, a survey was given to 17 criminal justice, health care management and advocacy, and psychology students. In a subsequent semester, challenges from Study 1 were addressed, and the same survey (i.e., Study 2 was given to 20 criminal justice and psychology majors. Across both samples, students’ responses to the laboratory learning paradigm were generally positive, yet concerns and challenges were identified. Future research should attempt to address these concerns and to assess objective student outcomes, such as grades in the course.

  4. Experimental methods of shock wave research

    CERN Document Server

    Seiler, Friedrich

    2016-01-01

    This comprehensive and carefully edited volume presents a variety of experimental methods used in Shock Waves research. In 14 self contained chapters this 9th volume of the “Shock Wave Science and Technology Reference Library” presents the experimental methods used in Shock Tubes, Shock Tunnels and Expansion Tubes facilities. Also described is their set-up and operation. The uses of an arc heated wind tunnel and a gun tunnel are also contained in this volume. Whenever possible, in addition to the technical description some typical scientific results obtained using such facilities are described. Additionally, this authoritative book includes techniques for measuring physical properties of blast waves and laser generated shock waves. Information about active shock wave laboratories at different locations around the world that are not described in the chapters herein is given in the Appendix, making this book useful for every researcher involved in shock/blast wave phenomena.

  5. Research of the heliostat cleaning method

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Xiliang; Liu, Xiaobin [Himin Solar Energy Group Co., Ltd, Dezhou City (China); Wang, Zhifeng [CAS, Beijing (China). Inst. of Electrical Engineering

    2008-07-01

    Heliostat is the core component of Solar Power Tower system. It can straightly affect the efficiency of whole system. Because the heliostats run outside, and are discovered in the air, dust and dirt accumulates gradually on the surface of reflector. Then, it will gradually decrease the reflectivity of mirror so that reduce the whole efficiency. The article analyzed environment factors, and researched selecting availably cleaning method of heliostat for different conditions. (orig.)

  6. Faculty development in medical education research.

    Science.gov (United States)

    LaMantia, Joseph; Hamstra, Stanley J; Martin, Daniel R; Searle, Nancy; Love, Jeffrey; Castaneda, Jill; Aziz-Bose, Rahela; Smith, Michael; Griswold-Therodorson, Sharon; Leuck, JoAnna

    2012-12-01

    This 2012 Academic Emergency Medicine consensus conference breakout session was devoted to the task of identifying the history and current state of faculty development in education research in emergency medicine (EM). The participants set a future agenda for successful faculty development in education research. A number of education research and content experts collaborated during the session. This article summarizes existing academic and medical literature, expert opinions, and audience consensus to report our agreement and findings related to the promotion of faculty development.

  7. Qualitative research methods in renal medicine: an introduction.

    Science.gov (United States)

    Bristowe, Katherine; Selman, Lucy; Murtagh, Fliss E M

    2015-09-01

    Qualitative methodologies are becoming increasingly widely used in health research. However, within some specialties, including renal medicine, qualitative approaches remain under-represented in the high-impact factor journals. Qualitative research can be undertaken: (i) as a stand-alone research method, addressing specific research questions; (ii) as part of a mixed methods approach alongside quantitative approaches or (iii) embedded in clinical trials, or during the development of complex interventions. The aim of this paper is to introduce qualitative research, including the rationale for choosing qualitative approaches, and guidance for ensuring quality when undertaking and reporting qualitative research. In addition, we introduce types of qualitative data (observation, interviews and focus groups) as well as some of the most commonly encountered methodological approaches (case studies, ethnography, phenomenology, grounded theory, thematic analysis, framework analysis and content analysis).

  8. Energy storage research and development

    Energy Technology Data Exchange (ETDEWEB)

    None, None

    2008-01-01

    In 2007, US consumers experienced the highest sustained gasoline prices in recent history, in real terms, including those seen in the early 1980s1. Partially as a result of the $3/gallon gasoline prices, sales of hybrid electric vehicles (HEVs) increased almost 60% in 20072, and several automakers announced plans to develop plug-in hybrid electric vehicles (PHEVs)3. However, total sales of HEVs remained in the 2-3 percent range of all vehicle sales. An important step for continued HEV market penetration, as well as electrifying the nation's personal transportation, is the development of cost effective, long lasting, and abuse tolerant Li-ion batteries.

  9. [Research and development of artificial retina material].

    Science.gov (United States)

    Hu, Ning; Yang, Jun; Peng, Chenglin; Wang, Xing; Zhang, Sijie; Zhang, Ying; Zheng, Erxin

    2008-04-01

    The application of artificial retina was introduced. The principal characteristics of artificial retina material were reviewed in particular. Moreover, the recent research development and application prospect were discussed.

  10. Qualitative Descriptive Methods in Health Science Research.

    Science.gov (United States)

    Colorafi, Karen Jiggins; Evans, Bronwynne

    2016-07-01

    The purpose of this methodology paper is to describe an approach to qualitative design known as qualitative descriptive that is well suited to junior health sciences researchers because it can be used with a variety of theoretical approaches, sampling techniques, and data collection strategies. It is often difficult for junior qualitative researchers to pull together the tools and resources they need to embark on a high-quality qualitative research study and to manage the volumes of data they collect during qualitative studies. This paper seeks to pull together much needed resources and provide an overview of methods. A step-by-step guide to planning a qualitative descriptive study and analyzing the data is provided, utilizing exemplars from the authors' research. This paper presents steps to conducting a qualitative descriptive study under the following headings: describing the qualitative descriptive approach, designing a qualitative descriptive study, steps to data analysis, and ensuring rigor of findings. The qualitative descriptive approach results in a summary in everyday, factual language that facilitates understanding of a selected phenomenon across disciplines of health science researchers. © The Author(s) 2016.

  11. Subject to Form: Research Interviews, Performative Subjectivity, Professional Development

    Science.gov (United States)

    Sarigianides, Sophia Tatiana

    2010-01-01

    In this dissertation, I analyze teacher, literacy coach and researcher subjectivities in a five-year study of on-site professional development with middle-grade Language Arts teachers in a school designated by its district and state as severely underperforming. Interested in the role of research interviews as both research method and cultural…

  12. RD and D-Programme 2001. Programme for research, development and demonstration of methods for the management and disposal of nuclear waste

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2001-09-01

    heterogeneity of the rock in the best manner and to serve as a basis for selecting suitable rock for location of deposition tunnels and holes. The chemistry of the groundwater at repository depth has been thoroughly studied, and SKB has developed practical methods for investigating a future site. Microbial processes are a relatively new field that we are continuing to investigate. Matrix diffusion describes how dissolved radionuclides penetrate into the micro fractures in the rock, thereby retarding the migration of radionuclides along large water-bearing fractures in the rock. Diffusion in micro fractures has been thoroughly investigated, but its relationship with the water flow and the geometry of the system of major fractures in the rock needs to be further studied. Postglacial land uplift and climatic variations are examples of processes that influence the evolution of the biosphere in the long term. Knowledge of the mechanisms for transfer of radionuclides between different parts of the biosphere has improved, and the models will be based on this new knowledge. Examples of ecosystems that are studied and dealt with in the models are forest, mireland and sediment. Permafrost is an example of a climatic state that will be more closely investigated, and a project aimed at this is currently planned. Another example is the glacial state. Material analogues occupy a prominent position in the upcoming programme. Typical material analogues are natural deposits of copper or bentonite, but concrete will also be investigated. Specimens of old concrete will be examined, as well as sites where cement minerals occur naturally. The different steps in building the repository, emplacing the canisters and the buffer, and backfilling and closure are tested on Aespoe. Site investigation methods are also developed there. Full-scale tests are being performed at the Aespoe HRL of drilling of deposition holes, emplacement of canisters and bentonite, and backfilling. The Prototype Repository in

  13. METHODS TO DEVELOP A TOROIDAL SURFACE

    Directory of Open Access Journals (Sweden)

    DANAILA Ligia

    2017-05-01

    Full Text Available The paper work presents two practical methods to draw the development of a surface unable to be developed applying classical methods of Descriptive Geometry, the toroidal surface, frequently met in technical practice. The described methods are approximate ones; the development is obtained with the help of points. The accuracy of the methods is given by the number of points used when drawing. As for any other approximate method, when practically manufactured the development may need to be adjusted on site.

  14. Social Media and Mentoring in Biomedical Research Faculty Development

    Science.gov (United States)

    Teruya, Stacey Alan; Bazargan-Hejazi, Shahrzad

    2014-01-01

    Purpose: To determine how effective and collegial mentoring in biomedical research faculty development may be implemented and facilitated through social media. Method: The authors reviewed the literature for objectives, concerns, and limitations of career development for junior research faculty. They tabularized these as developmental goals, and…

  15. Social Media and Mentoring in Biomedical Research Faculty Development

    Science.gov (United States)

    Teruya, Stacey Alan; Bazargan-Hejazi, Shahrzad

    2014-01-01

    Purpose: To determine how effective and collegial mentoring in biomedical research faculty development may be implemented and facilitated through social media. Method: The authors reviewed the literature for objectives, concerns, and limitations of career development for junior research faculty. They tabularized these as developmental goals, and…

  16. Codes & standards research, development & demonstration Roadmap

    Energy Technology Data Exchange (ETDEWEB)

    None, None

    2008-07-22

    This Roadmap is a guide to the Research, Development & Demonstration activities that will provide data required for SDOs to develop performance-based codes and standards for a commercial hydrogen fueled transportation sector in the U.S.

  17. Research on polarization imaging information parsing method

    Science.gov (United States)

    Yuan, Hongwu; Zhou, Pucheng; Wang, Xiaolong

    2016-11-01

    Polarization information parsing plays an important role in polarization imaging detection. This paper focus on the polarization information parsing method: Firstly, the general process of polarization information parsing is given, mainly including polarization image preprocessing, multiple polarization parameters calculation, polarization image fusion and polarization image tracking, etc.; And then the research achievements of the polarization information parsing method are presented, in terms of polarization image preprocessing, the polarization image registration method based on the maximum mutual information is designed. The experiment shows that this method can improve the precision of registration and be satisfied the need of polarization information parsing; In terms of multiple polarization parameters calculation, based on the omnidirectional polarization inversion model is built, a variety of polarization parameter images are obtained and the precision of inversion is to be improve obviously; In terms of polarization image fusion , using fuzzy integral and sparse representation, the multiple polarization parameters adaptive optimal fusion method is given, and the targets detection in complex scene is completed by using the clustering image segmentation algorithm based on fractal characters; In polarization image tracking, the average displacement polarization image characteristics of auxiliary particle filtering fusion tracking algorithm is put forward to achieve the smooth tracking of moving targets. Finally, the polarization information parsing method is applied to the polarization imaging detection of typical targets such as the camouflage target, the fog and latent fingerprints.

  18. Research and Evaluation in Curriculum Development.

    Science.gov (United States)

    Vogel, Paul G.; Carmichael, Donald L.

    Research and evaluation are crucial elements of the curriculum development process. Educational research properly includes "basic- nonevaluative" and "applied-evaluative research." Each species should be judged relative to its purpose and the degree to which systematic investigation occurs through the application of the…

  19. Method Of Predicting Size Of Software Under Development

    Science.gov (United States)

    Hihn, Jairus M.; Murthy, Subramanyam K.

    1994-01-01

    Method of estimating size and complexity of large computer program under development based on metric called "function mass." Simplification of Demarco's "function bang" metric. Size of completed program usually expressed in terms of number of lines of code (SLOC), shown in previous research to be highly correlated with amount of development effort and therefore important predictor of development cost. Proposed method of estimating ultimate size of program is intermediate product of continuing research on estimation of size and structured analysis of developmental software.

  20. IPMC microgripper research and development

    Energy Technology Data Exchange (ETDEWEB)

    Lumia, R [Department of Mechanical Engineering, University of New Mexico, MSC01-1150, Albuquerque, NM 87131 (United States); Shahinpoor, M [Department of Mechanical Engineering, University of Maine, Orono, Maine 04469 (United States)], E-mail: lumia@unm.edu, E-mail: mohsen.shahinpoor@umit.maine.edu

    2008-08-15

    Described are the state of the art on designing and developing a microgripper using ionic polymer metal composites (IPMCs), an electroactive material, as an actuator to grasp and manipulate micro-sized flexible and rigid objects and yet also serve as a sensor for position feedback control. IPMCs, as a material, are compliant and can work in both wet and dry environments. This makes it ideally suited for both industrial operations, e.g., building microsystems from MEMS components, as well as for a variety of bio-micromanipulation tasks, e.g., bacterium and cell handling. We derive a theoretical force model for the microgripper. The model estimates that an IPMC finger of dimensions 5mm x lmm x 0.2mm exerts a force of 85 {mu}N when grasping a solder ball of 15mg. We experimentally measure the load carrying capacity of the IPMC microgripper. Furthermore, we show empirically that the relationship between load carry capability and the length of microgripper fingers is linear. Experiments with three different microgripper finger shapes show that load carrying performance is related to the area of the finger rather than the shape. This implies that manufacturing ease favours microgrippers with tapered fingers. Finally, we show how flexible objects (hydrogel crystals in this case) are grasped with this IPMC microgripper.

  1. Rainfall Simulation: methods, research questions and challenges

    Science.gov (United States)

    Ries, J. B.; Iserloh, T.

    2012-04-01

    In erosion research, rainfall simulations are used for the improvement of process knowledge as well as in the field for the assessment of overland flow generation, infiltration, and erosion rates. In all these fields of research, rainfall experiments have become an indispensable part of the research methods. In this context, small portable rainfall simulators with small test-plot sizes of one square-meter or even less, and devices of low weight and water consumption are in demand. Accordingly, devices with manageable technical effort like nozzle-type simulators seem to prevail against larger simulators. The reasons are obvious: lower costs and less time consumption needed for mounting enable a higher repetition rate. Regarding the high number of research questions, of different fields of application, and not least also due to the great technical creativity of our research staff, a large number of different experimental setups is available. Each of the devices produces a different rainfall, leading to different kinetic energy amounts influencing the soil surface and accordingly, producing different erosion results. Hence, important questions contain the definition, the comparability, the measurement and the simulation of natural rainfall and the problem of comparability in general. Another important discussion topic will be the finding of an agreement on an appropriate calibration method for the simulated rainfalls, in order to enable a comparison of the results of different rainfall simulator set-ups. In most of the publications, only the following "nice" sentence can be read: "Our rainfall simulator generates a rainfall spectrum that is similar to natural rainfall!". The most substantial and critical properties of a simulated rainfall are the drop-size distribution, the fall velocities of the drops, and the spatial distribution of the rainfall on the plot-area. In a comparison of the most important methods, the Laser Distrometer turned out to be the most up

  2. Future of federal research and development

    Energy Technology Data Exchange (ETDEWEB)

    Goldman, D.T.

    1995-12-31

    This paper very briefly describes factors affecting federal funding for research and development. Historical, political, and economic aspects of funding are outlined. Projections of future funding is provided in general terms. The potential of the national laboratories for continued research and development contributions is described.

  3. European Youth Research: Development, Debates, Demands

    Science.gov (United States)

    Chisholm, Lynne

    2006-01-01

    This chapter presents the development of European youth research as a distinctive field of study. It draws attention to the sociopolitical context in which the field has emerged, outlines the key dimensions of the field's agenda, reports on significant facets of theory and research development to date, and briefly considers the field's…

  4. Standard methods for fungal brood disease research

    DEFF Research Database (Denmark)

    Jensen, Annette Bruun; Aronstein, Kathrine; Manuel Flores, Jose

    2013-01-01

    Chalkbrood and stonebrood are two fungal diseases associated with honey bee brood. Chalkbrood, caused by Ascosphaera apis, is a common and widespread disease that can result in severe reduction of emerging worker bees and thus overall colony productivity. Stonebrood is caused by Aspergillus spp. ...... interactions. We give guidelines on the preferred methods used in current research and the application of molecular techniques. We have added photographs, drawings and illustrations to assist bee-extension personnel and bee scientists in the control of these two diseases....... tissues upon inhalation by humans. In the current chapter we describe the honey bee disease symptoms of these fungal pathogens. In addition, we provide research methodologies and protocols for isolating and culturing, in vivo and in vitro assays that are commonly used to study these host pathogen...

  5. Developing Scoring Algorithms (Earlier Methods)

    Science.gov (United States)

    We developed scoring procedures to convert screener responses to estimates of individual dietary intake for fruits and vegetables, dairy, added sugars, whole grains, fiber, and calcium using the What We Eat in America 24-hour dietary recall data from the 2003-2006 NHANES.

  6. Research and development of Cordyceps in Taiwan

    Directory of Open Access Journals (Sweden)

    Ching-Peng Chiu

    2016-12-01

    Full Text Available Cordyceps is treasured entomopathogenic fungi that have been used as antitumor, immunomodulating, antioxidant, and pro-sexual agent. Cordyceps, also called DongChongXiaCao in Chinese, Yartsa Gunbu (Tibetan, means winter worm-summer grass. Natural Cordyceps sinensis with parasitic hosts is difficult to be collected and the recent findings on its potential pharmacological functions, resulted in skyrocketing prices. Therefore, finding a mass-production method or an alternative for C. sinensis products is a top-priority task. In this review, we describe current status of Cordyceps research and its recent developments in Taiwan. The content and pharmacological activities of four major industrial species of Cordyceps (C. sinensis, Cordyceps militaris, Cordyceps cicadae and Cordyceps sobolifera used in Taiwan, were reviewed. Moreover, we highlighted the effect of using different methods of fermentation and production on the morphology and chemical content of Cordyceps sp. Finally, we summarized the bottle-necks and challenges facing Cordyceps research as well as we proposed future road map for Cordyceps industry in Taiwan.

  7. Biomedical engineering for health research and development.

    Science.gov (United States)

    Zhang, X-Y

    2015-01-01

    Biomedical engineering is a new area of research in medicine and biology, providing new concepts and designs for the diagnosis, treatment and prevention of various diseases. There are several types of biomedical engineering, such as tissue, genetic, neural and stem cells, as well as chemical and clinical engineering for health care. Many electronic and magnetic methods and equipments are used for the biomedical engineering such as Computed Tomography (CT) scans, Magnetic Resonance Imaging (MRI) scans, Electroencephalography (EEG), Ultrasound and regenerative medicine and stem cell cultures, preparations of artificial cells and organs, such as pancreas, urinary bladders, liver cells, and fibroblasts cells of foreskin and others. The principle of tissue engineering is described with various types of cells used for tissue engineering purposes. The use of several medical devices and bionics are mentioned with scaffold, cells and tissue cultures and various materials are used for biomedical engineering. The use of biomedical engineering methods is very important for the human health, and research and development of diseases. The bioreactors and preparations of artificial cells or tissues and organs are described here.

  8. Applications of mixed-methods methodology in clinical pharmacy research.

    Science.gov (United States)

    Hadi, Muhammad Abdul; Closs, S José

    2016-06-01

    Introduction Mixed-methods methodology, as the name suggests refers to mixing of elements of both qualitative and quantitative methodologies in a single study. In the past decade, mixed-methods methodology has gained popularity among healthcare researchers as it promises to bring together the strengths of both qualitative and quantitative approaches. Methodology A number of mixed-methods designs are available in the literature and the four most commonly used designs in healthcare research are: the convergent parallel design, the embedded design, the exploratory design, and the explanatory design. Each has its own unique advantages, challenges and procedures and selection of a particular design should be guided by the research question. Guidance on designing, conducting and reporting mixed-methods research is available in the literature, so it is advisable to adhere to this to ensure methodological rigour. When to use it is best suited when the research questions require: triangulating findings from different methodologies to explain a single phenomenon; clarifying the results of one method using another method; informing the design of one method based on the findings of another method, development of a scale/questionnaire and answering different research questions within a single study. Two case studies have been presented to illustrate possible applications of mixed-methods methodology. Limitations Possessing the necessary knowledge and skills to undertake qualitative and quantitative data collection, analysis, interpretation and integration remains the biggest challenge for researchers conducting mixed-methods studies. Sequential study designs are often time consuming, being in two (or more) phases whereas concurrent study designs may require more than one data collector to collect both qualitative and quantitative data at the same time.

  9. Developing and executing an effective research plan.

    Science.gov (United States)

    Weber, Robert J; Cobaugh, Daniel J

    2008-11-01

    Practical approaches to successful implementation of practice-based research are examined. In order to successfully complete a research project, its scope must be clearly defined. The research question and the specific aims or objectives should guide the study. For practice-based research, the clinical setting is the most likely source to find important research questions. The research idea should be realistic and relevant to the interests of the investigators and the organization and its patients. Once the lead investigator has developed a research idea, a comprehensive literature review should be performed. The aims of the project should be new, relevant, concise, and feasible. The researchers must budget adequate time to carefully consider, develop, and seek input on the research question and objectives using the principles of project management. Identifying a group of individuals that can work together to ensure successful completion of the proposed research should be one of the first steps in developing the research plan. Dividing work tasks can alleviate workload for individual members of the research team. The development of a timeline to help guide the execution of the research project plan is critical. Steps that can be especially time-consuming include obtaining financial support, garnering support from key stakeholders, and getting institutional review board consent. One of the primary goals of conducting research is to share the knowledge that has been gained through presentations at national and international conferences and publications in peer-reviewed biomedical journals. Practice-based research presents numerous challenges, especially for new investigators. Integration of the principles of project management into research planning can lead to more efficient study execution and higher-quality results.

  10. Development of the Learning Health System Researcher Core Competencies.

    Science.gov (United States)

    Forrest, Christopher B; Chesley, Francis D; Tregear, Michelle L; Mistry, Kamila B

    2017-08-04

    To develop core competencies for learning health system (LHS) researchers to guide the development of training programs. Data were obtained from literature review, expert interviews, a modified Delphi process, and consensus development meetings. The competencies were developed from August to December 2016 using qualitative methods. The literature review formed the basis for the initial draft of a competency domain framework. Key informant semi-structured interviews, a modified Delphi survey, and three expert panel (n = 19 members) consensus development meetings produced the final set of competencies. The iterative development process yielded seven competency domains: (1) systems science; (2) research questions and standards of scientific evidence; (3) research methods; (4) informatics; (5) ethics of research and implementation in health systems; (6) improvement and implementation science; and (7) engagement, leadership, and research management. A total of 33 core competencies were prioritized across these seven domains. The real-world milieu of LHS research, the embeddedness of the researcher within the health system, and engagement of stakeholders are distinguishing characteristics of this emerging field. The LHS researcher core competencies can be used to guide the development of learning objectives, evaluation methods, and curricula for training programs. © Health Research and Educational Trust.

  11. Developments in geophysical exploration methods

    CERN Document Server

    1982-01-01

    One of the themes in current geophysical development is the bringing together of the results of observations made on the surface and those made in the subsurface. Several benefits result from this association. The detailed geological knowledge obtained in the subsurface can be extrapolated for short distances with more confidence when the geologi­ cal detail has been related to well-integrated subsurface and surface geophysical data. This is of value when assessing the characteristics of a partially developed petroleum reservoir. Interpretation of geophysical data is generally improved by the experience of seeing the surface and subsurface geophysical expression of a known geological configuration. On the theoretical side, the understanding of the geophysical processes themselves is furthered by the study of the phenomena in depth. As an example, the study of the progress of seismic wave trains downwards and upwards within the earth has proved most instructive. This set of original papers deals with some of ...

  12. The Use of In Situ X-ray Imaging Methods in the Research and Development of Magnesium-Based Grain-Refined and Nanocomposite Materials

    Science.gov (United States)

    Sillekens, W. H.; Casari, D.; Mirihanage, W. U.; Terzi, S.; Mathiesen, R. H.; Salvo, L.; Daudin, R.; Lhuissier, P.; Guo, E.; Lee, P. D.

    2016-10-01

    The aim of the present study is to investigate the effect of microwave energy on the structural and electrical properties of yttria-stabilized zirconia (YSZ) electrolyte for solid oxide fuel cells (SOFC). Five different compositions of Zr1-x Y x O2-x/2 (x = 0.06-0.14) were prepared by a co-precipitation method and were then sintered by microwave as well as conventional heating at 1400°C for 20 min and 240 min, respectively. The structural and electrical properties of the samples sintered by both the methods were compared. The x-ray diffraction (XRD) results revealed that YSZ samples sintered by both methods had either a tetragonal crystal structure or a cubic structure depending on its composition. Almost the same degree of densification as well as conductivity of same order was found from impedance analysis for both microwave- and conventionally sintered YSZ products, which showed that microwave sintering is the better alternative for material processing in terms of saving energy and time without compromising the product quality.

  13. [Development of metallomics research on environmental toxicology].

    Science.gov (United States)

    Ogra, Yasumitsu

    2015-01-01

    Metallomics is newly coined terms and defined as a comprehensive analysis of the entirety of metal and metalloid species within a cell or tissue type. Then, metallome is defined as the entire category of metalloproteins and any other metal-containing biomolecules. Metallomics and research on metallome require analytical techniques that can provide information on the identification and quantification of metal/metalloid-containing biomolecules. This concept has been called speciation, and the acquisition of data according to the concept is performed using hyphenated techniques involving both separation and detection methods. In this review, the author intends to present several applications of complementary use of HPLC-inductively coupled plasma mass spectrometry (ICP-MS) and HPLC-electrospray ionization tandem mass spectrometry for identification of unknown selenium-containing metabolites, and also to present a newly developed technique, capillary LC-ICP-MS to be used for the analysis of metal-binding proteins.

  14. Advanced Waveform Research Methods for Geress Recordings

    Science.gov (United States)

    1993-04-15

    24 2.6 Pre-Amplifier and A/D-Converter 24 2.7 Seismometer Generator Constant 25 2.8 Shaking Table Experiments 27 2.9 Electrical Excitation 29 2.10...January 1992- December 1992 Michael L. Jost 1.1 General The German Experimental Seismic System (GERESS) is a cooperative research program of Southern...hen Messung am GERESS Array im November 1992, BGR internal report GoldenK P., E. T. Herrin, and C. Hayward (1991). Development of an intelligent

  15. Methods of synthesizing qualitative research studies for health technology assessment.

    Science.gov (United States)

    Ring, Nicola; Jepson, Ruth; Ritchie, Karen

    2011-10-01

    Synthesizing qualitative research is an important means of ensuring the needs, preferences, and experiences of patients are taken into account by service providers and policy makers, but the range of methods available can appear confusing. This study presents the methods for synthesizing qualitative research most used in health research to-date and, specifically those with a potential role in health technology assessment. To identify reviews conducted using the eight main methods for synthesizing qualitative studies, nine electronic databases were searched using key terms including meta-ethnography and synthesis. A summary table groups the identified reviews by their use of the eight methods, highlighting the methods used most generally and specifically in relation to health technology assessment topics. Although there is debate about how best to identify and quality appraise qualitative research for synthesis, 107 reviews were identified using one of the eight main methods. Four methods (meta-ethnography, meta-study, meta-summary, and thematic synthesis) have been most widely used and have a role within health technology assessment. Meta-ethnography is the leading method for synthesizing qualitative health research. Thematic synthesis is also useful for integrating qualitative and quantitative findings. Four other methods (critical interpretive synthesis, grounded theory synthesis, meta-interpretation, and cross-case analysis) have been under-used in health research and their potential in health technology assessments is currently under-developed. Synthesizing individual qualitative studies has becoming increasingly common in recent years. Although this is still an emerging research discipline such an approach is one means of promoting the patient-centeredness of health technology assessments.

  16. Using gender research in development: Food security in practice

    OpenAIRE

    2006-01-01

    Metadata only record This guide presents research from several countries in IFPRI's research program on gender and intrahousehold relations, using quantitative and qualitative methods. It examines the implications of these issues in the success of development initiatives and suggestions for integrating gender research in projects and policy. The guide is divided into the following sections: the importance of using gender and intrahousehold research to inform projects and policies; gender a...

  17. New Methods in Genomic Research of Plants

    Institute of Scientific and Technical Information of China (English)

    STEWART J M; KANTARTZI S K; AVILA C A

    2008-01-01

    @@ Association mapping (as opposed to population mapping) is becoming more important in establishing associations between a phenotype and a genotype.The major advantage of association mapping,which depends on novel statistical methods,lies in the ability to use a collection of germplasm directly rather than taking the time and expense of developing a mapping population.Another advantage of association mapping is that the linkage disequilibrium values give a stronger LOD value,hence weak QTLs are more evident.

  18. Structured methods for customer-oriented innovation research

    DEFF Research Database (Denmark)

    Scholderer, Joachim

    customers might have told them if they had only properly been asked beforehand. In the following, a short introduction will be given to structured research methods that are relatively easy to use and can help product developers prioritise their efforts and assess the market potential of innovative concepts....

  19. Structured methods for customer-oriented innovation research

    DEFF Research Database (Denmark)

    Scholderer, Joachim

    customers might have told them if they had only properly been asked beforehand. In the following, a short introduction will be given to structured research methods that are relatively easy to use and can help product developers prioritise their efforts and assess the market potential of innovative concepts....

  20. Distributed Research Project Scheduling Based on Multi-Agent Methods

    Directory of Open Access Journals (Sweden)

    Constanta Nicoleta Bodea

    2011-01-01

    Full Text Available Different project planning and scheduling approaches have been developed. The Operational Research (OR provides two major planning techniques: CPM (Critical Path Method and PERT (Program Evaluation and Review Technique. Due to projects complexity and difficulty to use classical methods, new approaches were developed. Artificial Intelligence (AI initially promoted the automatic planner concept, but model-based planning and scheduling methods emerged later on. The paper adresses the project scheduling optimization problem, when projects are seen as Complex Adaptive Systems (CAS. Taken into consideration two different approaches for project scheduling optimization: TCPSP (Time- Constrained Project Scheduling and RCPSP (Resource-Constrained Project Scheduling, the paper focuses on a multiagent implementation in MATLAB for TCSP. Using the research project as a case study, the paper includes a comparison between two multi-agent methods: Genetic Algorithm (GA and Ant Colony Algorithm (ACO.

  1. Conservatism Research: Historical Development and Future Prospects

    Institute of Scientific and Technical Information of China (English)

    Sudipta Basu

    2009-01-01

    <正>1.Introduction and Summary Over the last decade,there has been much empirical research on Chinese accounting conservatism.This research started with Ball,Robin and Wu(2000)that was one o the first papers to apply modern research methods to Chinese data.In this paper,survey the early research on conservatism to provide the background and context for discussion of my dissertation paper,Basu(1997).I describe some lessons I have learn from the unexpected success of my dissertation,review recent Chinese research on

  2. Managing safety in a research and development environment

    Energy Technology Data Exchange (ETDEWEB)

    Cummings, G.E.

    1995-12-22

    A method for managing safety in a research and development environment is described which involves both the subject matter experts and the researchers in development of safety policy and implementation planning. This method has been used effectively at LLNL to maximize safety benefits while minimizing the costs of the safety program and aggravation to the researcher. A product of this effort is the establishment of an effective safety culture as the line organizations work with the subject matter experts to develop and implement the safety program.

  3. Research methods to develop Measures of Effectiveness of the United States Coast Guard`s Vessel Inspection and Boarding Program. Volume 2, Main report

    Energy Technology Data Exchange (ETDEWEB)

    Wheeler, T.; Cox, R. [Sandia National Labs., Albuquerque, NM (United States); Gawande, K. [New Mexico Univ., Albuquerque, NM (United States). Dept. of Economics; Stone, R.; Waisel, L.; Wallace, W.A. [Rensselaer Polytechnic Inst., Troy, New York (United States). Dept. of Decision Sciences and Engineering Systems

    1995-04-01

    The primary objective of this study is to provide Measures of Effectiveness (MOEs) of the US Coast Guard Marine Inspection and Boarding Program based on objective scientific methods. A secondary objective of the study is to provide USCG management with a methodologically and theoretically sound aid to effective policy decision-making. The MOEs constructed in this study are specific to the Marine Inspection and Boarding Program, but the methodology of the study is based on sound theoretical principles that are probably applicable to a range of USCG activities. Hence the methodology applied equally to other important USCG programs and can be similarly used to measure their effectiveness and as an aid to decision-making.

  4. Systematic review of methods for evaluating healthcare research economic impact

    Directory of Open Access Journals (Sweden)

    Majdzadeh Reza

    2010-03-01

    Full Text Available Abstract Background The economic benefits of healthcare research require study so that appropriate resources can be allocated to this research, particularly in developing countries. As a first step, we performed a systematic review to identify the methods used to assess the economic impact of healthcare research, and the outcomes. Method An electronic search was conducted in relevant databases using a combination of specific keywords. In addition, 21 relevant Web sites were identified. Results The initial search yielded 8,416 articles. After studying titles, abstracts, and full texts, 18 articles were included in the analysis. Eleven other reports were found on Web sites. We found that the outcomes assessed as healthcare research payback included direct cost-savings, cost reductions in healthcare delivery systems, benefits from commercial advancement, and outcomes associated with improved health status. Two methods were used to study healthcare research payback: macro-economic studies, which examine the relationship between research studies and economic outcome at the aggregated level, and case studies, which examine specific research projects to assess economic impact. Conclusions Our study shows that different methods and outcomes can be used to assess the economic impacts of healthcare research. There is no unique methodological approach for the economic evaluation of such research. In our systematic search we found no research that had evaluated the economic return of research in low and middle income countries. We therefore recommend a consensus on practical guidelines at international level on the basis of more comprehensive methodologies (such as Canadian Academic of Health Science and payback frameworks in order to build capacity, arrange for necessary informative infrastructures and promote necessary skills for economic evaluation studies.

  5. Research and development of evaluation system for photovoltaic power generation system. Research and survey on test and evaluation method for BOS component devices; Taiyoko hatsuden system hyoka gijutsu no kenkyu kaihatsu. Shuhen gijutsu hyoka system no kenkyu kaihatsu

    Energy Technology Data Exchange (ETDEWEB)

    Tatsuta, M. [New Energy and Industrial Technology Development Organization, Tokyo (Japan)

    1994-12-01

    This paper reports the study results on R and D of the evaluation method for BOS component devices in fiscal 1994. (1) On the study on requirements of BOS component devices for practical use, the study results on storage battery, inverter, protective device for system interconnection, and effective use means for storage battery were summarized. On the future device technology, it was clarified that the following value added technologies are promising: simple design of inverter circuit, cost reduction by common specification and mass production, and stabilization of voltage and compensation of momentary peak load by combining inverter with small-capacity storage batteries. (2) On the study on the performance test method for BOS component devices, basic characteristic (capacity, efficiency) test, PSOC charge/discharge cycle test, and accelerated life cycle test were performed for 4 kinds of new storage batteries developed by NEDO. The whole characteristic test results satisfied specifications, and long-term cycle test is in promotion for all new storage batteries. 3 figs., 4 tabs.

  6. Research and Development in the Muslim Society

    Directory of Open Access Journals (Sweden)

    Hikmatullah Babu Sahib

    2005-06-01

    Full Text Available Abstract: Despite clear-cut exhortation from the Qur’ān and Sunnah, Muslims are not showing much interest in R&D. Many Muslims are finding comfort in simply importing foreign goods and solutions to enrich their lives. Data analyses show that the Muslim world is far behind other countries in terms of research and development. There exists some misunderstanding in the Muslim mind on the meaning and role of research and development. There is a need for sustained research in all aspects of the society for it to develop as envisaged by Islam.

  7. Research of thermal processes in the soil during the development of oil fields in the Far North by the compression method with heating

    Science.gov (United States)

    Filimonov, A. S.; Tarasov, V. A.; Komkov, M. A.; Moiseev, V. A.; Timofeev, M. P.; Boyarskaya, R. V.

    2016-12-01

    In this paper, the hazard of adverse heat effect on permafrost soil as a result of viscous oil production in the Far North is studied with the method of thermocompression supply of superheated water steam to the oil-bearing layer. It is found that, due to the divergent nature of heat transfer and convective complex movement of air in the space between the tubing and the casing, the temperature of the latter in the area of load-bearing elements heated to 130°C is about 70°C. The heterogeneity of the temperature field is leveled up to 4-5% at a distance of 400-420 mm from the axis of the tubing. The thickness of the melting layer of ground ice within 90 days of operation of the tubing depends on the percentage of water-filled pores in the soil. With the minimum (10%) percentage of water-filled pores in the soil layer, the thickness of the ground ice melting layer for 90 days of operation of the tubing does not exceed 2.6 m.

  8. Validity in Mixed Methods Research in Education: The Application of Habermas' Critical Theory

    Science.gov (United States)

    Long, Haiying

    2017-01-01

    Mixed methods approach has developed into the third methodological movement in educational research. Validity in mixed methods research as an important issue, however, has not been examined as extensively as that of quantitative and qualitative research. Additionally, the previous discussions of validity in mixed methods research focus on research…

  9. Validity in Mixed Methods Research in Education: The Application of Habermas' Critical Theory

    Science.gov (United States)

    Long, Haiying

    2017-01-01

    Mixed methods approach has developed into the third methodological movement in educational research. Validity in mixed methods research as an important issue, however, has not been examined as extensively as that of quantitative and qualitative research. Additionally, the previous discussions of validity in mixed methods research focus on research…

  10. Employing Design and Development Research (DDR): Approaches in the Design and Development of Online Arabic Vocabulary Learning Games Prototype

    Science.gov (United States)

    Sahrir, Muhammad Sabri; Alias, Nor Aziah; Ismail, Zawawi; Osman, Nurulhuda

    2012-01-01

    The design and development research, first proposed by Brown and Collins in the 1990s, is currently among the well-known methods in educational research to test theory and validate its practicality. The method is also known as developmental research, design research, design-based research, formative research and design-cased and possesses…

  11. Research on the Method of Enterprise Developing Network Advertisement%企业开展网络广告的方法研究

    Institute of Scientific and Technical Information of China (English)

    张春明

    2015-01-01

    Network advertising is a kind of network marketing method,which has a good purpose,and has a good purpose.It is easy to interact with the internet.It can be achieved in the short term.Network advertising can increase brand awareness and customer loyalty,track and analyze customer interest and its change trend,for the website bring trafifc,sales places bring customers,for the products of other brands of the same company to carry out cross selling,provide and improve customer service function etc..In the process of network advertising,through the process of target determination,the budget,the form and the form of information expression,the choice of media,as well as the beneift analysis and detection.%网络广告是一种发展较为成熟的网络营销方法,具有目的性强、针对性好,便于交互,可以在短期内取得效果明显.网络广告具有增加品牌认知和顾客忠诚、跟踪分析顾客的兴趣及其变化趋势、为网站带来访问量、为销售场所带来顾客、为同一公司其他品牌的产品开展交叉销售、提供和改善顾客服务等功能.在网络广告投放的过程中经历目标确定、预算确定、形式及信息表现形式、媒体的选择,以及取得的效益分析与检测.

  12. Digital Mock-up Technology in Product Development and Research

    Institute of Scientific and Technical Information of China (English)

    CHEN Xu; ZHANG Pandeng; YANG Cheng; XU Zhongming

    2006-01-01

    After introducing the present status of digital mock-up (DMU) technology in product development and research, the modeling and its key technologies in product design are described. The architecture of digital design platform system for main DMU model is developed. Based on the architecture, a method of skeleton design has been applied to the development of digital design system.

  13. The Present Situation and Development Research of Recreation Ecology

    Institute of Scientific and Technical Information of China (English)

    Quan; ZHOU; Guoqin; HUANG; Qiguo; ZHAO

    2013-01-01

    With the continuous development of society,the problem of the tourism also appears more outstanding.The article analyzed the relationship between ecotourism and recreation ecology on the basis of the understanding and researching,and put recreation ecology forward a deeper level of request.How to develop the tourism,including ecotourism,is the problem to be solved.Five research methods about recreation ecology were introduced,namely the field survey method,the positioning method,the ecological simulation method,the modern information technology method and the tourism evaluation and planning method,from the point of view of research methods to elaborate the present situation of recreation ecology at home and abroad.The relationship of recreation ecology and landscape ecology,landscape architecture,biological statistics and the potential were discussed at the end of the article.

  14. Research and Development Costs in Retail Trade

    Directory of Open Access Journals (Sweden)

    Radojko LUKIC

    2016-12-01

    Full Text Available Research and development expenses are crucial business performance factors for all enterprises, including trading companies. The size and structure of these expenses depend largely on the nature of a company’s activities. Due to such importance and specificity, the research focus of this article is on R&D expenses in trading companies with particular emphasis on retail companies. Their share in the sales revenue of trading companies is increasingly important and determined by many factors, such as innovation, size, location, product categories, and others. Due to varying intensity of influence of these and other factors, research and development expenses in commercial companies differ among countries, trade types (wholesale, retail, wholesale and retail, retail formats (store types and product categories. Understanding the factors of these differences is important for efficient management of research and development costs in trade, particularly retail companies. They are the focus of research in this work.

  15. Methods for researching intercultural communication in globalized complex societies

    DEFF Research Database (Denmark)

    Jensen, Iben; Andreasen, Lars Birch

    2014-01-01

    The field of intercultural communication research is challenged theoretically as well as methodologically by global changes such as migration, global mobility, mass media, tourism, etc. According to these changes cultures can no longer be seen as national entities, and cultural identity can...... are not capable of addressing these new realities, research in intercultural communication will have a tendency to reproduce ‘old’ assumptions. The aim of this chapter is to discuss four criteria for developing methods that are relevant to intercultural communication research in complex globalized societies...... no longer be taken for granted as related to a single ethnic group. Thus, in globalized complex societies, knowledge of ‘the other’ no longer primarily comes from business guides or international literature, but is an integrated part of everyday experiences. If the methods we use in intercultural research...

  16. Review article: medical education research: an overview of methods.

    Science.gov (United States)

    Boet, Sylvain; Sharma, Saroo; Goldman, Joanne; Reeves, Scott

    2012-02-01

    This article provides clinician-teachers with an overview of the process necessary to move from an initial idea to the conceptualization and implementation of an empirical study in the field of medical education. This article will allow clinician-teachers to become familiar with educational research methodology in order to a) critically appraise education research studies and apply evidence-based education more effectively to their practice and b) initiate or collaborate in medical education research. This review uses relevant articles published in the fields of medicine, education, psychology, and sociology before October 2011. The focus of the majority of research in medical education has been on reporting outcomes related to participants. There has been less assessment of patient care outcomes, resulting in informing evidence-based education to only a limited extent. This article explains the process necessary to develop a focused and relevant education research question and emphasizes the importance of theory in medical education research. It describes a range of methodologies, including quantitative, qualitative, and mixed methods, and concludes with a discussion of dissemination of research findings. A majority of studies currently use quantitative methods. This article highlights how further use of qualitative methods can provide insight into the nuances and complexities of learning and teaching processes. Research in medical education requires several successive steps, from formulating the correct research question to deciding the method for dissemination. Each approach has advantages and disadvantages and should be chosen according to the question being asked and the specific goal of the study. Well-conducted education research should allow progression towards the important goal of using evidence-based education in our teaching and institutions.

  17. The Documentary Method in Intercultural Research Scenarios

    Directory of Open Access Journals (Sweden)

    Henrike Evers

    2009-01-01

    Full Text Available The documentary method appears to be especially suitable for preventing possible ethnocentrisms in the interpretation of data in reconstructive research, as well as for precluding concessions with a statistic and normative cultural concept. As an illustration of this thesis, this article presents a study—undertaken at the Bremen University of Applied Sciences—in which the effects of an intercultural contact programme between international students and German families are analysed. Special emphasis is placed on the question of the students' emotional and cognitive changes, called educational processes ("Bildung" in the educational science. The theoretical and methodological background of the study and exemplary results are presented. URN: urn:nbn:de:0114-fqs0901478

  18. A method for Effect Modifier Assessment in ergonomic intervention research – The EMA method

    DEFF Research Database (Denmark)

    Edwards, Kasper; Winkel, Jørgen

    2016-01-01

    of the literature revealed lack of or poor consideration of effect modifiers in ergonomic intervention research. We present a method that has been developed over the course of several years parallel to intervention studies in healthcare. Material and methods: The EMA method is a type of group interview including 3...... intervention(s) or other causes (“the effect modifiers”) and their impact on the work environment. Following the workshop, events are entered into a database and reassessed by triangulation based on scientific evidence, researcher knowledge, reading the transcribed audio recorded workshop and other local...... sources. Conclusion: The EMA method seems to offer a feasible procedure to obtain significant knowledge on potential effect modifiers in ergonomic intervention research. However, further development and validation is suggested....

  19. Developing Action Research for Developing Teachers in Kosovo

    Directory of Open Access Journals (Sweden)

    Eda Vula

    2015-10-01

    Full Text Available This study explores the perception of student teachers on their role as researchers and the impact of action research in their professional development. The study involves the master level student teachers of the Faculty of Education at the University of Prishtina in Kosovo. Qualitative data collected through reflective writing, open-ended questionnaires and research reports developed by student teachers were analyzed through the inductive method. The study suggests that teacher research has a major impact not only on the improvement of teaching practices and increasing student achievement, but also on increasing the collaboration among peers and fostering a new culture where teachers assume their responsibilities to apply action research in their own classrooms as a tool for classroom transformation. Teacher education and school context are crucial in this matter and the need arises to avoid viewing the development of teacher research as an isolated activity.Keywords: Action research, professional development, student teacher, environmentÖzBu araştırma, öğrenci öğretmenlerin araştırmacı rollerini algılamalarını ve profesyonel gelişimlerinde eylem araştırmaların etkisini incelemektedir. Araştırma, Priştine Üniversitesi Eğitim Fakültesi’nde yüksek lisans düzeyinde olan öğrenci öğretmenleri kapsamaktadır. Öğrenciler tarafından yapılan yansıtıcı yazılar, açık uçlu soru formları ve araştırma raporlarından toplanan nitel veriler tümevarım yöntemi aracılığıyla incelenmiştir. Araştırma, öğretmen araştırmalarının, sadece öğretim uygulamalarının geliştirilmesine ve öğrenci başarısının yükseltilmesine değil, aynı zamanda yaşıtlar arası işbirliğini arttırma ve öğretmenlerin sınıfı dönüştürme aracı olarak kendi sınıflarında eylem araştırmasını uygulama sorumluluğunu yeni bir kültür olarak teşvik etmeye önemli bir etkisinin olduğunu ortaya koymaktad

  20. Standard methods for fungal brood disease research.

    Science.gov (United States)

    Jensen, Annette Bruun; Aronstein, Kathrine; Flores, José Manuel; Vojvodic, Svjetlana; Palacio, María Alejandra; Spivak, Marla

    2013-01-01

    Chalkbrood and stonebrood are two fungal diseases associated with honey bee brood. Chalkbrood, caused by Ascosphaera apis, is a common and widespread disease that can result in severe reduction of emerging worker bees and thus overall colony productivity. Stonebrood is caused by Aspergillus spp. that are rarely observed, so the impact on colony health is not very well understood. A major concern with the presence of Aspergillus in honey bees is the production of airborne conidia, which can lead to allergic bronchopulmonary aspergillosis, pulmonary aspergilloma, or even invasive aspergillosis in lung tissues upon inhalation by humans. In the current chapter we describe the honey bee disease symptoms of these fungal pathogens. In addition, we provide research methodologies and protocols for isolating and culturing, in vivo and in vitro assays that are commonly used to study these host pathogen interactions. We give guidelines on the preferred methods used in current research and the application of molecular techniques. We have added photographs, drawings and illustrations to assist bee-extension personnel and bee scientists in the control of these two diseases.

  1. Researchers Develop Potential Oral Treatment for Hemophilia

    Science.gov (United States)

    ... 162798.html Researchers Develop Potential Oral Treatment for Hemophilia Currently, genetic bleeding disorder is treated with injections ... THURSDAY, Dec. 29, 2016 (HealthDay News) -- People with hemophilia have to endure painful injections every few days ...

  2. Entrepreneurial skill development: Participatory action research ...

    African Journals Online (AJOL)

    BlignautAS

    Entrepreneurial skill development: Participatory action research approach in a rural community. Entrepreneurial ..... business skills and a practical baking section with the aim to equip the ..... velopment Strategy: Leadership Pack. Pretoria. Gov-.

  3. Journal of Research in National Development

    African Journals Online (AJOL)

    The Journal of Research in National Development aims to encourage ... the Nigerian workforce system: announcing the arrival of crude oil in the nation's economy ... The freedom of information act and the practice of journalism in Nigeria: an ...

  4. Advances in research methods for information systems research data mining, data envelopment analysis, value focused thinking

    CERN Document Server

    Osei-Bryson, Kweku-Muata

    2013-01-01

    Advances in social science research methodologies and data analytic methods are changing the way research in information systems is conducted. New developments in statistical software technologies for data mining (DM) such as regression splines or decision tree induction can be used to assist researchers in systematic post-positivist theory testing and development. Established management science techniques like data envelopment analysis (DEA), and value focused thinking (VFT) can be used in combination with traditional statistical analysis and data mining techniques to more effectively explore

  5. Advancing Administrative Supports for Research Development

    Science.gov (United States)

    Briar-Lawson, Katharine; Korr, Wynne; White, Barbara; Vroom, Phyllis; Zabora, James; Middleton, Jane; Shank, Barbara; Schatz, Mona

    2008-01-01

    Research administrative supports must parallel and reinforce faculty initiatives in research grant procurement. This article features several types of developments that draw on presentations at the National Association of Deans and Directors of Schools of Social Work meetings. Key changes in social work programs are addressed, including the…

  6. Developing Research Skills across the Undergraduate Curriculum

    Science.gov (United States)

    Gray, Simon; Coates, Lee; Fraser, Ann; Pierce, Pam

    2015-01-01

    This chapter describes consortial efforts within the Great Lakes Colleges Association to share expertise and programming to build research skills throughout the undergraduate curriculum. Strategies to scaffold research skill development are provided from Allegheny College, Kalamazoo College, and The College of Wooster.

  7. Developing Research Skills across the Undergraduate Curriculum

    Science.gov (United States)

    Gray, Simon; Coates, Lee; Fraser, Ann; Pierce, Pam

    2015-01-01

    This chapter describes consortial efforts within the Great Lakes Colleges Association to share expertise and programming to build research skills throughout the undergraduate curriculum. Strategies to scaffold research skill development are provided from Allegheny College, Kalamazoo College, and The College of Wooster.

  8. Radiometric Method for the Research on Geomechanical Parameters of Rocks

    Science.gov (United States)

    Bonczyk, Michał; Wysocka, Małgorzata; Bukowska, Mirosława; Michalik, Bogusław; Prusek, Stanisław; Wadas, Mariusz

    2017-03-01

    Tests aimed to verify whether there is a correlation between the basic parameters characterizing the mechanical properties of rocks with the properties of ionizing radiation scattered by rocks were performed as part of the research. The positive correlation between the two examined properties would provide the basis for the development of a new method of rock testing using radiation sources or devices generating ionizing radiation. The method could be applied to carry out research in underground boreholes to determine the mechanical properties of the rock mass in situ. The study allowed the verification of the adopted assumptions for the proposed method. The verification was based on the correlation analysis of absorption coefficients of the ionizing radiation of rocks from the Upper Silesian Coal Basin with the results of the research on mechanical and physical properties.

  9. The Use of Mixed Methods for Therapeutic Massage Research

    Science.gov (United States)

    Porcino, Antony Joseph; Verhoef, Marja J.

    2010-01-01

    Mixed methods research is the integration of quantitative and qualitative components in a research project. Whether you are reading or designing a mixed methods research project, it is important to be familiar with both qualitative and quantitative research methods and the specific purposes for which they are brought together in a study: triangulation, complementarity, expansion, initiation, or development. In addition, decisions need to be made about the sequencing and the priority or importance of each qualitative and quantitative component relative to the other components, and the point or points at which the various qualitative and quantitative components will be integrated. Mixed methods research is increasingly being recognized for its ability to bring multiple points of view to a research project, taking advantage of the strengths of each of the quantitative and qualitative components to explain or resolve complex phenomena or results. This ability becomes critical when complex healing systems such as therapeutic massage are being studied. Complex healing systems may have multiple physiologic effects, often reflected in changes throughout the patient’s body. Additionally, the patient’s experience of the treatment may be an important outcome. PMID:21589698

  10. Using Mixed Methods to Facilitate Complex, Multiphased Health Research

    Directory of Open Access Journals (Sweden)

    Tina Strudsholm

    2016-02-01

    Full Text Available From conceptualization to application and evaluation, research is conducted in a context of increasing complexity of disciplines, goals, communities, and partnerships. Researchers often are challenged to demonstrate the rigor of their methods and results to audiences with diverse backgrounds and disciplinary expertise. This article illustrates the benefits of using mixed methods approaches in research designed to address issues in complex research projects. It outlines the implementation of a private, public, and academic partnership, where scientific merit of methods and results was a critical foundation to the development of public policy. The overall goal of the Public Health Leadership Competencies Project (the Project was to identify public health leadership competencies that could apply to public health practice across the country. This research demonstrates how mixed methods research in public health might be of perceived benefit to complex projects. The Project included challenges and opportunities through multiple phases of data collection and participation of members from each of the seven disciplines in public health (i.e., public health dentists, physicians, dietitians, and nurses, as well as epidemiologists, health promoters, and environmental health inspectors. The discussion addresses challenges of a national project, the complex organizational framework within which we were directed to work, and the lessons associated with using multiple sources of data.

  11. Qualitative research methods: key features and insights gained from use in infection prevention research.

    Science.gov (United States)

    Forman, Jane; Creswell, John W; Damschroder, Laura; Kowalski, Christine P; Krein, Sarah L

    2008-12-01

    Infection control professionals and hospital epidemiologists are accustomed to using quantitative research. Although quantitative studies are extremely important in the field of infection control and prevention, often they cannot help us explain why certain factors affect the use of infection control practices and identify the underlying mechanisms through which they do so. Qualitative research methods, which use open-ended techniques, such as interviews, to collect data and nonstatistical techniques to analyze it, provide detailed, diverse insights of individuals, useful quotes that bring a realism to applied research, and information about how different health care settings operate. Qualitative research can illuminate the processes underlying statistical correlations, inform the development of interventions, and show how interventions work to produce observed outcomes. This article describes the key features of qualitative research and the advantages that such features add to existing quantitative research approaches in the study of infection control. We address the goal of qualitative research, the nature of the research process, sampling, data collection and analysis, validity, generalizability of findings, and presentation of findings. Health services researchers are increasingly using qualitative methods to address practical problems by uncovering interacting influences in complex health care environments. Qualitative research methods, applied with expertise and rigor, can contribute important insights to infection prevention efforts.

  12. 78 FR 28630 - Pfizer Therapeutic Research, Pfizer Worldwide Research & Development Division, Formerly Known as...

    Science.gov (United States)

    2013-05-15

    ... Employment and Training Administration Pfizer Therapeutic Research, Pfizer Worldwide Research & Development... Therapeutic Research, Pfizer Worldwide Research & Development Division, Comparative Medicine Department... Research, Pfizer Worldwide Research & Development Division, formerly known as Warner Lambert Company...

  13. Informatics methods to enable sharing of quantitative imaging research data.

    Science.gov (United States)

    Levy, Mia A; Freymann, John B; Kirby, Justin S; Fedorov, Andriy; Fennessy, Fiona M; Eschrich, Steven A; Berglund, Anders E; Fenstermacher, David A; Tan, Yongqiang; Guo, Xiaotao; Casavant, Thomas L; Brown, Bartley J; Braun, Terry A; Dekker, Andre; Roelofs, Erik; Mountz, James M; Boada, Fernando; Laymon, Charles; Oborski, Matt; Rubin, Daniel L

    2012-11-01

    The National Cancer Institute Quantitative Research Network (QIN) is a collaborative research network whose goal is to share data, algorithms and research tools to accelerate quantitative imaging research. A challenge is the variability in tools and analysis platforms used in quantitative imaging. Our goal was to understand the extent of this variation and to develop an approach to enable sharing data and to promote reuse of quantitative imaging data in the community. We performed a survey of the current tools in use by the QIN member sites for representation and storage of their QIN research data including images, image meta-data and clinical data. We identified existing systems and standards for data sharing and their gaps for the QIN use case. We then proposed a system architecture to enable data sharing and collaborative experimentation within the QIN. There are a variety of tools currently used by each QIN institution. We developed a general information system architecture to support the QIN goals. We also describe the remaining architecture gaps we are developing to enable members to share research images and image meta-data across the network. As a research network, the QIN will stimulate quantitative imaging research by pooling data, algorithms and research tools. However, there are gaps in current functional requirements that will need to be met by future informatics development. Special attention must be given to the technical requirements needed to translate these methods into the clinical research workflow to enable validation and qualification of these novel imaging biomarkers. Copyright © 2012 Elsevier Inc. All rights reserved.

  14. Recent developments of atmospheric research in Ukraine

    Science.gov (United States)

    Milinevsky, G. P.; Danylevsky, V. O.; Grytsai, A. V.; Evtushevsky, O. M.; Kravchenko, V. O., Bovchaliuk, A. P.; Bovchaliuk, V. P.; Sosonkin, M. G.; Goloub, Ph.; Savitska, L. Y.; Udodov, E. V.; Voytenko, V. P.

    2012-11-01

    In recent years the Joint Laboratory of Atmospheric Optics and Aerosols of Ukraine has been carrying out atmospheric research in cooperation with international program of climate change studies. Our current research is aimed at studying aerosol and ozone in the Earth's atmosphere, because these constituents have a substantial influence on climate. In Ukraine, atmospheric aerosol remote sensing in the PHOTONS/AERONET network has been carried out since 2006 in Sevastopol and 2008 in Kyiv. For this research, sunphotometers CIMEL CE318 have been used. A mobile AERONET station has been developed, which consists of CE318N and portable Microtops II sunphotometers, as well as two self-designed experimental portable sunphotometer models and an ozonometer for aerosol and ozone study. The team's findings on aerosol spectral optical thickness, as well as optical and physical properties of aerosol particles (single-scattering albedo, distribution of particles by sizes, Ångström exponent), are discussed in the paper. In 2010, upon the establishment of the new regional atmospheric research station Nr.498 Kyiv-Goloseyev, the team commenced with measurements of the total column density and vertical distribution of ozone, using the Dobson D040 spectrophotometer, in the framework of the Global Atmosphere Watch Program of WMO. The station has also been equipped with a Vaisala automatic weather station, a surface ozone 49i analyzer, and an experimental complex for monitoring secondary space rays. The aerosol and ozone measurements have been continuously submitted to data centres of AERONET (http://aeronet.gsfc.nasa.gov/) and WMO (www.woudc.org/data/). For aerosol and ozone research, the data from satellite sources (POLDER, MODIS, OMI, and SCIAMACHY) have also been analysed. The work on a proposal to design, build, and launch the space radiometer/polarimeter for global monitoring of atmospheric aerosols has commenced recently. This instrument should have the capability of

  15. Fast Charging Electric Vehicle Research & Development Project

    Energy Technology Data Exchange (ETDEWEB)

    Heny, Michael

    2014-03-31

    The research and development project supported the engineering, design and implementation of on-road Electric Vehicle (“EV”) charging technologies. It included development of potential solutions for DC fast chargers (“DCFC”) capable of converting high voltage AC power to the DC power required by EVs. Additional development evaluated solutions related to the packaging of power electronic components and enclosure design, as well as for the design and evaluation of EV charging stations. Research compared different charging technologies to identify optimum applications in a municipal fleet. This project collected EV usage data and generated a report demonstrating that EVs, when supported by adequate charging infrastructure, are capable of replacing traditional internal combustion vehicles in many municipal applications. The project’s period of performance has demonstrated various methods of incorporating EVs into a municipal environment, and has identified three general categories for EV applications: - Short Commute: Defined as EVs performing in limited duration, routine commutes. - Long Commute: Defined as tasks that require EVs to operate in longer daily mileage patterns. - Critical Needs: Defined as the need for EVs to be ready at every moment for indefinite periods. Together, the City of Charlottesville, VA (the “City”) and Aker Wade Power Technologies, LLC (“Aker Wade”) concluded that the EV has a viable position in many municipal fleets but with limited recommendation for use in Critical Needs applications such as Police fleets. The report also documented that, compared to internal combustion vehicles, BEVs have lower vehicle-related greenhouse gas (“GHG”) emissions and contribute to a reduction of air pollution in urban areas. The enhanced integration of EVs in a municipal fleet can result in reduced demand for imported oil and reduced municipal operating costs. The conclusions indicated in the project’s Engineering Report (see

  16. Fast Charging Electric Vehicle Research & Development Project

    Energy Technology Data Exchange (ETDEWEB)

    Heny, Michael

    2014-03-31

    The research and development project supported the engineering, design and implementation of on-road Electric Vehicle (“EV”) charging technologies. It included development of potential solutions for DC fast chargers (“DCFC”) capable of converting high voltage AC power to the DC power required by EVs. Additional development evaluated solutions related to the packaging of power electronic components and enclosure design, as well as for the design and evaluation of EV charging stations. Research compared different charging technologies to identify optimum applications in a municipal fleet. This project collected EV usage data and generated a report demonstrating that EVs, when supported by adequate charging infrastructure, are capable of replacing traditional internal combustion vehicles in many municipal applications. The project’s period of performance has demonstrated various methods of incorporating EVs into a municipal environment, and has identified three general categories for EV applications: Short Commute: Defined as EVs performing in limited duration, routine commutes. - Long Commute: Defined as tasks that require EVs to operate in longer daily mileage patterns. - Critical Needs: Defined as the need for EVs to be ready at every moment for indefinite periods. Together, the City of Charlottesville, VA (the “City”) and Aker Wade Power Technologies, LLC (“Aker Wade”) concluded that the EV has a viable position in many municipal fleets but with limited recommendation for use in Critical Needs applications such as Police fleets. The report also documented that, compared to internal combustion vehicles, BEVs have lower vehicle-related greenhouse gas (“GHG”) emissions and contribute to a reduction of air pollution in urban areas. The enhanced integration of EVs in a municipal fleet can result in reduced demand for imported oil and reduced municipal operating costs. The conclusions indicated in the project’s Engineering Report (see Attachment

  17. Prioritizing pesticide compounds for analytical methods development

    Science.gov (United States)

    Norman, Julia E.; Kuivila, Kathryn; Nowell, Lisa H.

    2012-01-01

    The U.S. Geological Survey (USGS) has a periodic need to re-evaluate pesticide compounds in terms of priorities for inclusion in monitoring and studies and, thus, must also assess the current analytical capabilities for pesticide detection. To meet this need, a strategy has been developed to prioritize pesticides and degradates for analytical methods development. Screening procedures were developed to separately prioritize pesticide compounds in water and sediment. The procedures evaluate pesticide compounds in existing USGS analytical methods for water and sediment and compounds for which recent agricultural-use information was available. Measured occurrence (detection frequency and concentrations) in water and sediment, predicted concentrations in water and predicted likelihood of occurrence in sediment, potential toxicity to aquatic life or humans, and priorities of other agencies or organizations, regulatory or otherwise, were considered. Several existing strategies for prioritizing chemicals for various purposes were reviewed, including those that identify and prioritize persistent, bioaccumulative, and toxic compounds, and those that determine candidates for future regulation of drinking-water contaminants. The systematic procedures developed and used in this study rely on concepts common to many previously established strategies. The evaluation of pesticide compounds resulted in the classification of compounds into three groups: Tier 1 for high priority compounds, Tier 2 for moderate priority compounds, and Tier 3 for low priority compounds. For water, a total of 247 pesticide compounds were classified as Tier 1 and, thus, are high priority for inclusion in analytical methods for monitoring and studies. Of these, about three-quarters are included in some USGS analytical method; however, many of these compounds are included on research methods that are expensive and for which there are few data on environmental samples. The remaining quarter of Tier 1

  18. Laboratory Directed Research and Development Program

    Energy Technology Data Exchange (ETDEWEB)

    Ogeka, G.J.; Romano, A.J.

    1992-12-01

    This report briefly discusses the following research: Advances in Geoexploration; Transvenous Coronary Angiography with Synchrotron X-Rays; Borehole Measurements of Global Warming; Molecular Ecology: Development of Field Methods for Microbial Growth Rate and Activity Measurements; A New Malaria Enzyme - A Potential Source for a New Diagnostic Test for Malaria and a Target for a New Antimalarial Drug; Basic Studies on Thoron and Thoron Precursors; Cloning of the cDNA for a Human Serine/Threonine Protein Kinase that is Activated Specifically by Double-Stranded DNA; Development of an Ultra-Fast Laser System for Accelerator Applications; Cluster Impact Fusion; Effect of a Bacterial Spore Protein on Mutagenesis; Structure and Function of Adenovirus Penton Base Protein; High Resolution Fast X-Ray Detector; Coherent Synchrotron Radiation Longitudinal Bunch Shape Monitor; High Grain Harmonic Generation Experiment; BNL Maglev Studies; Structural Investigations of Pt-Based Catalysts; Studies on the Cellular Toxicity of Cocaine and Cocaethylene; Human Melanocyte Transformation; Exploratory Applications of X-Ray Microscopy; Determination of the Higher Ordered Structure of Eukaryotic Chromosomes; Uranium Neutron Capture Therapy; Tunneling Microscopy Studies of Nanoscale Structures; Nuclear Techiques for Study of Biological Channels; RF Sources for Accelerator Physics; Induction and Repair of Double-Strand Breaks in the DNA of Human Lymphocytes; and An EBIS Source of High Charge State Ions up to Uranium.

  19. When Academics Integrate Research Skill Development in the Curriculum

    Science.gov (United States)

    Willison, J. W.

    2012-01-01

    This study considered outcomes when 27 academics explicitly developed and assessed student research skills in 28 regular (non-research methods) semester-length courses. These courses ranged from small (n = 17) to medium-large (n = 222) and included those from first year to masters in business, engineering, health science, humanities and science,…

  20. Research and Development in the Muslim Society

    OpenAIRE

    Hikmatullah Babu Sahib

    2005-01-01

    Abstract: Despite clear-cut exhortation from the Qur’ān and Sunnah, Muslims are not showing much interest in R&D. Many Muslims are finding comfort in simply importing foreign goods and solutions to enrich their lives. Data analyses show that the Muslim world is far behind other countries in terms of research and development. There exists some misunderstanding in the Muslim mind on the meaning and role of research and development. There is a need for sustained research in all aspects of the so...

  1. Research data collection methods: from paper to tablet computers.

    Science.gov (United States)

    Wilcox, Adam B; Gallagher, Kathleen D; Boden-Albala, Bernadette; Bakken, Suzanne R

    2012-07-01

    Primary data collection is a critical activity in clinical research. Even with significant advances in technical capabilities, clear benefits of use, and even user preferences for using electronic systems for collecting primary data, paper-based data collection is still common in clinical research settings. However, with recent developments in both clinical research and tablet computer technology, the comparative advantages and disadvantages of data collection methods should be determined. To describe case studies using multiple methods of data collection, including next-generation tablets, and consider their various advantages and disadvantages. We reviewed 5 modern case studies using primary data collection, using methods ranging from paper to next-generation tablet computers. We performed semistructured telephone interviews with each project, which considered factors relevant to data collection. We address specific issues with workflow, implementation and security for these different methods, and identify differences in implementation that led to different technology considerations for each case study. There remain multiple methods for primary data collection, each with its own strengths and weaknesses. Two recent methods are electronic health record templates and next-generation tablet computers. Electronic health record templates can link data directly to medical records, but are notably difficult to use. Current tablet computers are substantially different from previous technologies with regard to user familiarity and software cost. The use of cloud-based storage for tablet computers, however, creates a specific challenge for clinical research that must be considered but can be overcome.

  2. Moral counselling: a method in development.

    Science.gov (United States)

    de Groot, Jack; Leget, Carlo

    2011-01-01

    This article describes a method of moral counselling developed in the Radboud University Medical Centre Nijmegen (The Netherlands). The authors apply insights of Paul Ricoeur to the non-directive counselling method of Carl Rogers in their work of coaching patients with moral problems in health care. The developed method was shared with other health care professionals in a training course. Experiences in the course and further practice led to further improvement of the method.

  3. Operational research(ers) in development: Growing a new ...

    African Journals Online (AJOL)

    Africa by critically evaluating a Masters program in Operational Research in Development ... specifically with the training of OR practitioners who possess the skills needed ... perspective rather than providing a complete review of the field. .... plemented, either because some sector of participants who are key to success will.

  4. Early Brain Development Research Review and Update

    Science.gov (United States)

    Schiller, Pam

    2010-01-01

    Thanks to imaging technology used in neurobiology, people have access to useful and critical information regarding the development of the human brain. This information allows them to become much more effective in helping children in their early development. In fact, when people base their practices on the findings from medical science research,…

  5. Children's Vocational Development: A Research Rationale

    Science.gov (United States)

    Porfeli, Erik J.; Hartung, Paul J.; Vondracek, Fred W.

    2008-01-01

    Vocational development research and interventions have focused primarily on adolescents and young adults. The lack of attention to career development antecedents in children has led to a serious neglect of this period of life when the foundation is laid for career choices and outcomes in later life. A harmful by-product is the frequent preclusion…

  6. Early Brain Development Research Review and Update

    Science.gov (United States)

    Schiller, Pam

    2010-01-01

    Thanks to imaging technology used in neurobiology, people have access to useful and critical information regarding the development of the human brain. This information allows them to become much more effective in helping children in their early development. In fact, when people base their practices on the findings from medical science research,…

  7. Second Language Writing Development: A Research Agenda

    Science.gov (United States)

    Polio, Charlene

    2017-01-01

    In 1998, Wolfe-Quintero, Inagaki & Kim published a monograph describing measures used in assessing writing development. Despite more recent research on linguistic development (e.g., Bulté & Housen 2012; Verspoor, Schmid & Xu 2012; Connor-Linton & Polio 2014), the volume is still a valuable resource and good starting point for…

  8. [Landscape classification: research progress and development trend].

    Science.gov (United States)

    Liang, Fa-Chao; Liu, Li-Ming

    2011-06-01

    Landscape classification is the basis of the researches on landscape structure, process, and function, and also, the prerequisite for landscape evaluation, planning, protection, and management, directly affecting the precision and practicability of landscape research. This paper reviewed the research progress on the landscape classification system, theory, and methodology, and summarized the key problems and deficiencies of current researches. Some major landscape classification systems, e. g. , LANMAP and MUFIC, were introduced and discussed. It was suggested that a qualitative and quantitative comprehensive classification based on the ideology of functional structure shape and on the integral consideration of landscape classification utility, landscape function, landscape structure, physiogeographical factors, and human disturbance intensity should be the major research directions in the future. The integration of mapping, 3S technology, quantitative mathematics modeling, computer artificial intelligence, and professional knowledge to enhance the precision of landscape classification would be the key issues and the development trend in the researches of landscape classification.

  9. Resource recovery: research development and demonstration plan

    Energy Technology Data Exchange (ETDEWEB)

    Scaramelli, A B

    1979-10-01

    Implementation of resource recovery is being retarded by technological uncertainties and institutional impediments. Development and commercialization of new competitive technologies are not proceeding rapidly because a structured development program for the industry is lacking. The US Department of Energy (DOE) has recognized these problems, and as part of its overall program in energy recovery from urban waste, it is developing a near- and longer-term research, development, and demonstration (RD and D) program to accelerate commercialization of promising resource recovery technologies. The MITRE Corporation was contracted to develop a near-term RD and D Plan for resource recovery which identifies actions which should be taken over the next three years to accelerate commercialization of existing and developing technologies. The research needs presented in this Plan exist in the industry today. The resolution, however, is not necessarily the sole responsibility of DOE, but rather calls for a combination of public and private sector efforts. An individual research program is presented for each resource recovery technology. A program consists of a combination of bench-, pilot-, demonstration-, and full-scale process and equipment evaluations as well as qualitative and quantitative studies. Each research program is tailored to alleviate the problems of a technology such that their resolution will accelerate the rate at which the technology advances toward commercial readiness and realizes commercial implementation. All the research needs identified are actions which should be taken in the next three years to advance the field of resource recovery.

  10. Developing research skills in medical students: AMEE Guide No. 69.

    Science.gov (United States)

    Laidlaw, Anita; Aiton, Jim; Struthers, Julie; Guild, Simon

    2012-01-01

    This Guide has been written to provide guidance for individuals involved in curriculum design who wish to develop research skills and foster the attributes in medical undergraduates that help develop research. The Guide will provoke debate on an important subject, and although written specifically with undergraduate medical education in mind, we hope that it will be of interest to all those involved with other health professionals' education. Initially, the Guide describes why research skills and its related attributes are important to those pursuing a medical career. It also explores the reasons why research skills and an ethos of research should be instilled into professionals of the future. The Guide also tries to define what these skills and attributes should be for medical students and lays out the case for providing opportunities to develop research expertise in the undergraduate curriculum. Potential methods to encourage the development of research-related attributes are explored as are some suggestions as to how research skills could be taught and assessed within already busy curricula. This publication also discusses the real and potential barriers to developing research skills in undergraduate students, and suggests strategies to overcome or circumvent these. Whilst we anticipate that this Guide will appeal to all levels of expertise in terms of student research, we hope that, through the use of case studies, we will provide practical advice to those currently developing this area within their curriculum.

  11. Developing Ethics and Standards in Action Research

    Directory of Open Access Journals (Sweden)

    Ben Boog

    2008-12-01

    Full Text Available In a globalizing world, what role can social science research – particularly action research – play in order to address the risks of exclusion, poverty, social and physical insecurity and environmental deprivation? More specifically, how can this type of research be conducted in a participatory, responsible, transparent and scientific way? In other words: what about the ethics and standards in action research? This was the main focus of the World Congress on Action Research and Action Learning (August 2006 organized by the University of Groningen and the Higher Education Group of the Northern Netherlands. We begin by discussing the core characteristics of action research with reference to theory and practice. Reflection and action are key constituents of the process through the enactment of action research. The middle section draws upon the research findings presented at the congress and published in a book [B. Boog, J. Preece, M. Slagter and J. Zeelen (Eds. (2008 Towards Quality Improvement of Action Research. Developing Ethics and Standards, Rotterdam/Taipei: Sense Publishers]. Citing authors who contributed chapters to the book mentioned above, we analyze four important subthemes: ‘participation, power and rapport’; ‘quality of research and quality management’; ‘learning to solve your own problems in complex responsive social systems, and ‘heuristics (rules of thumb for action research practice’. Finally, we comment on possible quality improvements for action research. Our remarks relate to the problems of implementing the concept of participation, the ambition of action research to contribute to both knowledge production and social change and the need for systematic reconstruction (scientific validation of action research.

  12. SELECTED OUTCOMES OF RESEARCH OF DIGITAL COMPETENCY DEVELOPMENT ON ELEMENTARY SCHOOLS

    National Research Council Canada - National Science Library

    RAMBOUSEK, Vladimír; FUGLÍK, Viktor; ŠTÍPEK, Jiří

    2015-01-01

    ... and the development of digital competencies in educational activities, which were used as complementary research methods within the research project focused on a complex issue of curricular, process...

  13. Developing, testing, and sustaining rehabilitation interventions via participatory action research.

    Science.gov (United States)

    Ehde, Dawn M; Wegener, Stephen T; Williams, Rhonda M; Ephraim, Patti L; Stevenson, Jennifer E; Isenberg, Patricia J; MacKenzie, Ellen J

    2013-01-01

    Few published intervention studies in the rehabilitation literature have included consumers in the research process other than as study participants. This lack of consumer involvement in intervention research may contribute to the challenges encountered developing, translating, disseminating, and sustaining evidence-based rehabilitation interventions in clinical practice. The overall objective of this article is to promote the integration of participatory action research (PAR) into rehabilitation intervention research as a mechanism for addressing these gaps. First, we outline essential components of a PAR model across 5 key phases of intervention research, specifically: agenda setting, methods, implementation, diffusion/dissemination, and sustainability. Second, we describe the use of PAR in rehabilitation intervention research within each of these phases by reviewing relevant literature and by providing an illustrative research example from a randomized controlled trial that integrated PAR throughout the research process. Finally, we conclude with a discussion of 5 specific recommendations for promoting the integration of PAR into rehabilitation intervention research.

  14. A narrative method for consciousness research.

    Science.gov (United States)

    Díaz, José-Luis

    2013-01-01

    Some types of first-person narrations of mental processes that constitute phenomenological accounts and texts, such as internal monolog statements, epitomize the best expressions and representations of human consciousness available and therefore may be used to model phenomenological streams of consciousness. The type of autonomous monolog in which an author or narrator declares actual mental processes in a think aloud manner seems particularly suitable for modeling streams of consciousness. A narrative method to extract and depict conscious processes, operations, contents, and states from an acceptable phenomenological text would require three subsequent steps: operational criteria for producing and/or selecting a phenomenological text, a system for detecting text items that are indicative of conscious contents and processes, and a procedure for representing such items in formal dynamic system devices such as Petri nets. The requirements and restrictions of each of these steps are presented, analyzed, and applied to phenomenological texts in the following manner: (1) the relevance of introspective language and narrative analyses to consciousness research and the idea that specific narratives are of paramount interest for such investigation is justified; (2) some of the obstacles and constraints to attain plausible consciousness inferences from narrative texts and the methodological requirements to extract and depict items relevant to consciousness contents and operations from a suitable phenomenological text are examined; (3) a preliminary exercise of the proposed method is used to analyze and chart a classical interior monolog excerpted from James Joyce's Ulysses, a masterpiece of the stream-of-consciousness literary technique and, finally, (4) an inter-subjective evaluation for inter-observer agreement of mental attributions of another phenomenological text (an excerpt from the Intimate Journal of Miguel de Unamuno) is presented using some mathematical tools.

  15. A narrative method for consciousness research

    Directory of Open Access Journals (Sweden)

    José-Luis eDíaz

    2013-11-01

    Full Text Available Some types of first person narrations of mental processes that constitute phenomenological parliaments and texts, such as internal monologue statements, epitomize the best expressions and representations of human consciousness available and therefore may be used to model phenomenological streams of consciousness. The type of autonomous monologue in which an author or narrator declares actual mental processes in a think aloud manner seems particularly suitable for modeling streams of consciousness. A narrative method to extract and depict conscious processes, operations, contents, and states from an acceptable phenomenological text would require three subsequent steps: operational criteria for producing and/or selecting a phenomenological text, a system for detecting text items that are indicative of conscious contents and processes, and a procedure for representing such items in formal dynamic system devices such as Petri nets. The requirements and restrictions of each of these steps are presented, analyzed, and applied to phenomenological texts in the following manner: (1 The relevance of introspective language and narrative analyses to consciousness research and the idea that specific narratives are of paramount interest for such investigation is justified; (2 Some of the obstacles and constraints to attain plausible consciousness inferences from narrative texts and the methodological requirements to extract and depict items relevant to consciousness contents and operations from a suitable phenomenological text are examined; (3 A preliminary exercise of the proposed method is used to analyze and chart a classical interior monologue excerpted from James Joyce’s Ulysses, a masterpiece of the stream-of-consciousness literary technique and, finally, an inter-subjective evaluation for inter-observer agreement of mental attributions of another phenomenological text (an excerpt from the Intimate Journal of Miguel de Unamuno is presented using some

  16. Developing a qualitative research culture in university psychology departments

    OpenAIRE

    Frost, Nollaig; Barry, Richard

    2010-01-01

    We are academics in the Department of Psychology, Middlesex University. Nollaig’s research is primarily qualitative and Richard’s primarily quantitative. We form part of a team responsible for developing and delivering Research Methods modules to students at undergraduate and postgraduate level. In this paper, we draw on our experiences and those of colleagues to discuss some challenges (and possible solutions) to changing the research culture in a psychology department.

  17. Designing, Teaching, and Evaluating Two Complementary Mixed Methods Research Courses

    Science.gov (United States)

    Christ, Thomas W.

    2009-01-01

    Teaching mixed methods research is difficult. This longitudinal explanatory study examined how two classes were designed, taught, and evaluated. Curriculum, Research, and Teaching (EDCS-606) and Mixed Methods Research (EDCS-780) used a research proposal generation process to highlight the importance of the purpose, research question and…

  18. Designing, Teaching, and Evaluating Two Complementary Mixed Methods Research Courses

    Science.gov (United States)

    Christ, Thomas W.

    2009-01-01

    Teaching mixed methods research is difficult. This longitudinal explanatory study examined how two classes were designed, taught, and evaluated. Curriculum, Research, and Teaching (EDCS-606) and Mixed Methods Research (EDCS-780) used a research proposal generation process to highlight the importance of the purpose, research question and…

  19. Evaluation method research on prestressed concrete bridges

    Institute of Scientific and Technical Information of China (English)

    HUANG Qiao; LIN Yang-zi; REN Yuan

    2008-01-01

    Considering the construction features of prestressed concrete bridge, the comprehensive evaluation method about the bridge damage conditions are studied. Particular attentions are paid on establishing a multi-level evaluation model for damaged prestressed concrete bridge, and the evaluation indices of the model as well as the rating standards are defined in the model. A normal relative function about the evaluation indices of each element is developed to calculate the relative degree, and for each element which is no sub-level elements. When evaluating the elements in sub-item level or index level of the model, the weights of elements that are pertained to one element are adopted, taking account of their deterioration degree. At the same time, the dam-age conditions of bridge are characterized by relative degree, element evaluation scale and structural technology mark of bridge ,so it agrees with Code for Maintenance of Highway Bridges and Culvers.

  20. Qualitative methods: a research approach worth considering

    African Journals Online (AJOL)

    and collects data about it to describe it-this is qualitative research. With enough ... Purposive sampling or judgmental sampling is utilised by the researcher. ... Data collection involves interviews, observation and field notes as well as document ...

  1. ASPECTS REGARDING NEUROMARKETING SPECIFIC RESEARCH METHODS

    Directory of Open Access Journals (Sweden)

    MIRELA-CRISTINA VOICU

    2012-05-01

    Full Text Available Information is one of the most important resources that a company must posses. Some informations are hidden deep in the black box - the mind of the consumer. Neuromarketing helps us find what is inside of the black box without troubling the consumer with questions that he doesn’t want to answer or that he can’t answer. Today because of an extensive research in mapping cortical and subcortical activity in association with behaviors and thoughts, the confidence in neurological data is growing. Thanks to discoveries in perceptual sciences we can identify the parts of the brain that are responsible for the phenomena that we experience daily. For all those interested in information obtained through neuromarketing techniques it becomes evident that there are corresponding neural substrates of consumer decision making process and these substrates can be observed, measured, and possibly manipulated. The following paper reveals some important aspects of the use of neuromarketing in studying consumer behavior by presenting the concepts, methods and techniques used under this sophisticated name, the limitations and advantages of using neuromarketing techniques and the importance of this type of information in decision making process at a company level.

  2. Mixed Methods in Nursing Research : An Overview and Practical Examples

    OpenAIRE

    2014-01-01

    Mixed methods research methodologies are increasingly applied in nursing research to strengthen the depth and breadth of understanding of nursing phenomena. This article describes the background and benefits of using mixed methods research methodologies, and provides two examples of nursing research that used mixed methods. Mixed methods research produces several benefits. The examples provided demonstrate specific benefits in the creation of a culturally congruent picture of chronic pain man...

  3. "Reading" Mixed Methods Research: Contexts for Criticism

    Science.gov (United States)

    Freshwater, Dawn

    2007-01-01

    Health and social care researchers, in their haste to "belong" to academia, have adopted the system of mixed methodology research, overestimating its ability to reveal the truth and occasionally imprisoning their thought in one system. In this article, some of the assumptions underpinning mixed methodology research and its discourse are subjected…

  4. "Reading" Mixed Methods Research: Contexts for Criticism

    Science.gov (United States)

    Freshwater, Dawn

    2007-01-01

    Health and social care researchers, in their haste to "belong" to academia, have adopted the system of mixed methodology research, overestimating its ability to reveal the truth and occasionally imprisoning their thought in one system. In this article, some of the assumptions underpinning mixed methodology research and its discourse are subjected…

  5. Current Developments in Nuclear Density Functional Methods

    CERN Document Server

    Dobaczewski, J

    2010-01-01

    Density functional theory (DFT) became a universal approach to compute ground-state and excited configurations of many-electron systems held together by an external one-body potential in condensed-matter, atomic, and molecular physics. At present, the DFT strategy is also intensely studied and applied in the area of nuclear structure. The nuclear DFT, a natural extension of the self-consistent mean-field theory, is a tool of choice for computations of ground-state properties and low-lying excitations of medium-mass and heavy nuclei. Over the past thirty-odd years, a lot of experience was accumulated in implementing, adjusting, and using the density-functional methods in nuclei. This research direction is still extremely actively pursued. In particular, current developments concentrate on (i) attempts to improve the performance and precision delivered by the nuclear density-functional methods, (ii) derivations of density functionals from first principles rooted in the low-energy chromodynamics and effective th...

  6. Twelve tips for getting started using mixed methods in medical education research.

    Science.gov (United States)

    Lavelle, Ellen; Vuk, Jasna; Barber, Carolyn

    2013-04-01

    Mixed methods research, which is gaining popularity in medical education, provides a new and comprehensive approach for addressing teaching, learning, and evaluation issues in the field. The aim of this article is to provide medical education researchers with 12 tips, based on consideration of current literature in the health professions and in educational research, for conducting and disseminating mixed methods research. Engaging in mixed methods research requires consideration of several major components: the mixed methods paradigm, types of problems, mixed method designs, collaboration, and developing or extending theory. Mixed methods is an ideal tool for addressing a full range of problems in medical education to include development of theory and improving practice.

  7. Assessing Autonomous Learning in Research Methods Courses: Implementing the Student-Driven Research Project

    Science.gov (United States)

    Vandiver, Donna M.; Walsh, Jeffrey A.

    2010-01-01

    As empirical assessments of teaching strategies increase in many disciplines and across many different courses, a paucity of such assessment seems to exist in courses devoted to social science research methods. This lack of assessment and evaluation impedes progress in developing successful teaching pedagogy. The teaching-learning issue addressed…

  8. Consensus of recommendations guiding comparative effectiveness research methods.

    Science.gov (United States)

    Morton, Jacob B; McConeghy, Robert; Heinrich, Kirstin; Gatto, Nicolle M; Caffrey, Aisling R

    2016-12-01

    Because of an increasing demand for quality comparative effectiveness research (CER), methods guidance documents have been published, such as those from the Agency for Healthcare Research and Quality (AHRQ) and the Patient-Centered Outcomes Research Institute (PCORI). Our objective was to identify CER methods guidance documents and compare them to produce a summary of important recommendations which could serve as a consensus of CER method recommendations. We conducted a systematic literature review to identify CER methods guidance documents published through 2014. Identified documents were analyzed for methods guidance recommendations. Individual recommendations were categorized to determine the degree of overlap. We identified nine methods guidance documents, which contained a total of 312 recommendations, 97% of which were present in two or more documents. All nine documents recommended transparency and adaptation for relevant stakeholders in the interpretation and dissemination of results. Other frequently shared CER methods recommendations included: study design and operational definitions should be developed a priori and allow for replication (n = 8 documents); focus on areas with gaps in current clinical knowledge that are relevant to decision-makers (n = 7); validity of measures, instruments, and data should be assessed and discussed (n = 7); outcomes, including benefits and harms, should be clinically meaningful, and objectively measured (n = 7). Assessment for and strategies to minimize bias (n = 6 documents), confounding (n = 6), and heterogeneity (n = 4) were also commonly shared recommendations between documents. We offer a field-consensus guide based on nine CER methods guidance documents that will aid researchers in designing CER studies and applying CER methods. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  9. Mixed-Method Nursing Research: "A Public and Its Problems?" A Commentary on French Nursing Research.

    Science.gov (United States)

    Dupin, Cécile Marie; Debout, Christophe; Rothan-Tondeur, Monique

    2014-02-01

    Nursing in France is undergoing a transition. In 2009, the preregistration nursing education program was reformed in line with the European Bologna Process, bringing nursing education to the universities. In 2010, the French Programme Hospitalier de Recherche Infirmière, the first national French nursing research funding program, was launched by the French Health Ministry. Of the 149 French research proposals submitted by registered nurses in 2010 and 2011, 13 were mixed-method proposals. The registered nurse principal investigator argued for a complementary use of qualitative and quantitative methods. These trends highlight major issues regarding mixed-method and nursing research. We can reasonably assume that mixed-method research has a broad appeal for nurse scholars, particularly for the exploration of complex phenomena related to nursing. Moreover, the recent movement in the domain of nursing education and research experienced in France highlights the need for dedicated research education in the development of nursing research capacity. © The Author(s) 2014 Reprints and permissions:]br]sagepub.co.uk/journalsPermissions.nav.

  10. Federal Support for Research and Development

    Science.gov (United States)

    2007-06-01

    credit lowers the tax bill of firms that increase their spending for research and development. In general, the credit is designed to apply to...Martin Buxton , Steve Hanney, and Teri Jones, “Estimating the Economic Value to Societies of the Impact of Health Research: A Critical Review...2007). a. Examples of other types of support include that provided for veterans under the GI Bill and tuition paid by the Department of Defense for

  11. Present status of research and development on underground disposal

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1994-11-01

    Power Reactor and Nuclear Fuel Development Corporation published the technical report `Research and development of the formation disposal of high level radioactive waste` 1991 in 1992, summarizing the results of the research and development of the formation disposal which have been advanced by dividing into three parts, that is, the investigation and research of geological environment conditions, the research and development of disposal technologies, and the research on the performance evaluation. Based on the subjects pointed out during the process of making the technical report, the results of evaluation by the state, and the opinions of those concerned, the efforts are exerted toward the second summarization expected in about 2000. By informing the present state of the research and development, in order to accept the criticism and advice, this book was published. The way of thinking and the method of advancing of the research and development of formation disposal, the present state of the research on geological environment conditions, disposal technologies and the performance evaluation are described. Also the present state of the research on stratum science in Tono and Kamaishi mines and others is reported. (K.I.).

  12. Maturity Models Development in IS Research

    DEFF Research Database (Denmark)

    Lasrado, Lester Allan; Vatrapu, Ravi; Andersen, Kim Normann

    2015-01-01

    Maturity models are widespread in IS research and in particular, IT practitioner communities. However, theoretically sound, methodologically rigorous and empirically validated maturity models are quite rare. This literature review paper focuses on the challenges faced during the development...... literature reveals that researchers have primarily focused on developing new maturity models pertaining to domain-specific problems and/or new enterprise technologies. We find rampant re-use of the design structure of widely adopted models such as Nolan’s Stage of Growth Model, Crosby’s Grid, and Capability...... Maturity Model (CMM). Only recently have there been some research efforts to standardize maturity model development. We also identify three dominant views of maturity models and provide guidelines for various approaches of constructing maturity models with a standard vocabulary. We finally propose using...

  13. Collaborative Engineering for Research and Development

    Science.gov (United States)

    Davis, Jose M.; Keys, L. Ken; Chen, Injazz J.

    2004-01-01

    Research and development (R&D) organizations are being required to be relevant, to be more application-oriented, and to be partners in the strategic management of the business while meeting the same challenges as the rest of the organization, namely: (1) reduced time to market; (2) reduced cost; (3) improved quality; (4) increased reliability; and (5) increased focus on customer needs. Recent advances in computer technology and the Internet have created a new paradigm of collaborative engineering or collaborative product development (CPD), from which new types of relationships among researchers and their partners have emerged. Research into the applicability and benefits of CPD in a low/no production, R&D, and/or government environment is limited. In addition, the supply chain management (SCM) aspects of these relationships have not been studied. This paper presents research conducted at the NASA Glenn Research Center (GRC) investigating the applicability of CPD and SCM in an R&D organization. The study concentrates on the management and implementation of space research activities at GRC. Results indicate that although the organization is engaged in collaborative relationships that incorporate aspects of SCM, a number of areas, such as development of trust and information sharing merit special attention.

  14. Research Dynamics of the Classification Methods of Remote Sensing Images

    Institute of Scientific and Technical Information of China (English)

    Yan; ZHANG; Baoguo; WU; Dong; WANG

    2013-01-01

    As the key technology of extracting remote sensing information,the classification of remote sensing images has always been the research focus in the field of remote sensing. The paper introduces the classification process and system of remote sensing images. According to the recent research status of domestic and international remote sensing classification methods,the new study dynamics of remote sensing classification,such as artificial neural networks,support vector machine,active learning and ensemble multi-classifiers,were introduced,providing references for the automatic and intelligent development of remote sensing images classification.

  15. Home economics in development through action research

    DEFF Research Database (Denmark)

    Benn, Jette

    2010-01-01

    This research study aimed at describing and developing home economics education through an action research approach in 2 schools and classes grade 6. The study went through 3 phases, an explorative phase with preliminary observations, interviews and discussions with teachers and pupils. Next...... in discursive phase changes have been implemented and conducted in accordance with findings. Third phase the explicative phase results were translated into text books for pupil's grade 4 to7 and to a teachers' guide. The subject is analysed theoretical through a model of the subject and research field. Findings...

  16. Research and development for ethylbenzene production

    Energy Technology Data Exchange (ETDEWEB)

    Xue, Mingwei; Sun, Hongmin; Shen, Zhenhao; Zhang, Bin; Yang, Weimin [SINOPEC Shanghai Research Institute of Petrochemical Technology (China); Huan, Mingyao

    2013-11-01

    Ethylbenzene (EB) is important raw material for the production of styrene. Now, EB is mainly produced by the alkylation of benzene with ethylene catalyzed by zeolite in vapour phase or liquid phase. Shanghai Research Institute of Petrochemical Technology (SRIPT) began to research the catalysts for the production of ethylbenezene in 1993. With near 20 years work, three series of catalysts for the alkylation of benzene with pure ethylene, dilute ethylene and ethanol are in commerical in China. This paper mainly introduced the research and development of SRIPT for the EB production. (orig.)

  17. MODERN METHODS OF EVALUATING THE PRODUCTIVITY OF THE RESEARCH ACTIVITY

    Directory of Open Access Journals (Sweden)

    Romanov D. A.

    2015-04-01

    Full Text Available The purpose of the research is development of the new methods of diagnostic the research activities productivity. It is known, that for the evaluation the productivity of a scientist we usually use a well-known index of Hirsch, the introduction of which in 2005 was a significant step forward compared with application of this index as the ratio of the number of references to works of scientist and publications themselves. At the same time even h-index as an indicator is not flawless, the main flaw is weak differential ability: a number of links to the most cited publications of the scientific worker does not matter after reaching a certain threshold. It is necessary to develop a method of estimating the productivity of scientific worker, which preserves dignities of h-index and removes its shortcomings. This will allow evaluating the productivity of research activities more objectively. Methodological bases of the research: a systematic approach (considering the science as a social institution in close connection with the society as a whole, a metasystem approach (considering the results of the scientific activities as a metasystem, i.e. the system with relatively independent components, probabilistic and statistical approach (considering the research activities as the random process, a synergistic approach (considering science like a self-organized system qualimetric approach (considering the productivity of scientific activity as latent variables that reflect a variety of criteria

  18. How composition methods are developed and validated.

    Science.gov (United States)

    Rogers, Hilary A

    2013-09-04

    Method validation is a critical prerequisite to performing analytical methods in the laboratory. A given analytical method is validated for a specific matrix or matrices. If the matrix to be tested is not included in the original scope of method validation, a validation must be performed to determine if the method is applicable to that particular matrix. A number of organizations, such as AOAC and ISO, publish peer-reviewed methods for cross-industry matrices, whereas others, such as AOCS and AACC, are focused on specific industry segments (fats/oils and cereal grains). When no validated method is available for the analyte of interest, method development and validation must first be performed to ensure that correct identification and quantification of the analyte are being observed and measured. Development of a new method requires an understanding of the chemistry and properties of the analyte to be tested, as well as the various types of instrumentation currently available. Method development and improvement is a continuous process, as technology advances and new instrumentation and techniques become available. This paper addresses some of the decisions related to method development but will primarily focus on validation as it applies to compositional testing of foods, crops, and commodities, the factors that determine method selection, and how extensive the validation need be.

  19. Geodemographic regional system research: information provision and methodical bases

    Directory of Open Access Journals (Sweden)

    Катерина Сегіда

    2017-09-01

    Full Text Available The most reasonable and prudent method to consider the region’s population as a regional geodemographic system and its features lies in its inseparable connection with the general process of regional soсiogeosystem’s development that takes into account many factors including regional development, which influence the geodemographic processes in the region. Geodemographic system is treated as a functional component in soсigeosystem at the heart of social and geographical concepts. Geodemographic system of the region is based on five methodological approaches: geographical, systemic, synergistic, historical and informational. The authors elucidate methodological features of geodemographic study of the region from the perspective of human geography. These methodological approaches to study basic techniques and application features are disclosed in the content. Among the scientific methods we consider probabilistic and statistical methods, methods of organizing, summarizing, comparing, system analysis, modeling. Among specific methods are mapping method, IFV modeling, development trajectory modeling, component analysis of the initial vector, other methods of multivariate analysis and GIS technology. The special research methods of geodemographic system include a system of techniques to study the characteristics of population distribution in the territory, and a number of demographic and geodemographic methods and techniques to establish the demographic characteristics of the territories. The geodemographic software research system of the region is presented; the list of statistical indicators for information database is mentioned. The demographic index groups to characterize the system, including vital factors of speed, intensity of demographic processes, reproduction and structural factors are defined. The key demographic factors and coefficients are presented both in absolute,and relative units. Database features to implement social and

  20. Cooperative research and development agreements at METC

    Energy Technology Data Exchange (ETDEWEB)

    Ludlow, J.C.; Jarr, L.A.; Anderson, R.J.

    1995-06-01

    The Federal Technology Transfer Act of 1986 (P.L. 99-502) provided a new mechanism for joint research between private parties and the Morgantown Energy Technology Center (METC). Joint projects under this law are called Cooperative Research And Development Agreements (CRADAs) and are simply agreements between METC and the private sector to work together on a mutually beneficial project. Of primary interest to METC is the development and deployment of: (1) clean, efficient power generation technologies, (2) technologies for the characterization and exploitation of the Nation`s natural gas resource, and (3) environmental remediation technologies.